Datasets:

hatakeyama-llm-team

/

PMC

like 0

In flowering plants, the development of male reproductive organs is controlled precisely to achieve successful fertilization and reproduction. Despite the increasing knowledge of genes that contribute to anther development, the regulatory mechanisms controlling this process are still unclear.aborted microspores (ams) and found that 1,368 genes were differentially expressed in ams compared to wild type anthers, affecting metabolism, transportation, ubiquitination and stress response. Moreover, the lack of significant enrichment of potential AMS binding sites (E-box) in the promoters of differentially expressed genes suggests both direct and indirect regulation for AMS-dependent regulation of anther transcriptome involving other transcription factors. Combining ams transcriptome profiles with those of two other sterile mutants, spl/nzz and ems1/exs, expression of 3,058 genes were altered in at least one mutant. Our investigation of expression patterns of major transcription factor families, such as bHLH, MYB and MADS, suggested that some closely related homologs of known anther developmental genes might also have similar functions. Additionally, comparison of expression levels of genes in different organs suggested that anther-preferential genes could play important roles in anther development.In this study, we analyzed the transcriptome profiles of early anthers of sterile mutants ams anther transcriptome and its comparison with those of spl/nzz and ems1/exs anthers uncovered overlapping and distinct sets of regulated genes, including those encoding transcription factors and other proteins. These results support an expanded regulatory network for early anther development, providing a series of hypotheses for future experimentation.Analysis of In flowering plants, male reproductive organs are called stamens, each of which consists of a filament and an anther . Cells iSPOROCYTELESS (SPL)/NOZZLE (NZZ) gene is one of the earliest genes that regulate anther cell fate determination [SPL/NZZ is activated by AG, a C function gene in the ABC model [SPL/NZZ is expressed as early as anther stage 2-5 and a mutation in SPL/NZZ leads to the failure of differentiation of parietal and sporogenous cells, and consequentially blocks the formation of anther wall and microsporocytes [Previous studies indicated that early anther development depends on transcriptional regulation and cell-cell communication ,7-9. Themination ,11. SPL/BC model -14. SPL/orocytes ,16.EXCESS MALE SPOROCYTES1 (EMS1) and TAPETUM DETERMINANT1 (TPD1) are also essential for male fertility with a later expression peak at stage 5 [ems1 and tpd1 mutants, anthers produce more microsporocytes at the expense of the tapetum, indicating that communication between adjacent cell layers determines the cell fate of archesporial cell progenies in order to form normal anther wall [EMS1 and TPD1, other cell-cell communication-related genes are also involved in anther development, such as SOMATIC EMBRYOGENESIS RECEPTORLIKE KINASES1/2 (SERK1/2), and RECEPTORLIKE PROTEIN KINASE2 (RPK2) [ stage 5 . EMS1 is stage 5 ,18,19. Iher wall . Besides2 (RPK2) ,21.DYSFUNCTIONAL TAPETUM1 (DYT1) and AMS, encoding two bHLH transcription factors, are required for tapetal functions at subsequent stages [dyt1, tapetum cells harbor enlarged vacuoles and reduced cytoplasm. The dyt1 meiocytes have comparatively thin callose walls, cannot complete cytokinesis and finally collapse. RNA in situ hybridization experiments showed that DYT1 reaches its peak expression at anther stage 5 to 6 [AMS functions near the time of meiosis, slightly later than that of DYT1. In the ams mutant, the microsporocytes can complete meiosis but the tapetum cells prematurely collapse and microspores are degraded before the first pollen mitosis [Upon the formation of the anther lobes, t stages ,23. In de 5 to 6 . AMS fun mitosis ,16,24-28Arabidopsis whose male reproductive organs are quite tiny [SPL, EMS1 and AMS have important functions at different stages of anther development, although they have temporal overlap of expression [However, due to the functional redundancy of members of many gene families, the subtleties of the phenotypes of single-gene mutants, and possible early phenotypes that obscure anther function, forward genetics has limitations in uncovering anther gene functions . Expressite tiny ,33,36. Tpression ,17,22,23pression -39.ams mutants and wild-type Arabidopsis, even though it is time consuming and technically difficult to dissect developing anthers, because we wanted to identify the genes affected by the ams mutation that might be too diluted to detect using RNAs from whole-inflorescences. The ams transcriptome data and comparison with previous data from spl and ems1 anthers [Arabidopsis, we identified genes that function during early anther stage around meiosis. We found that many transcription factor genes were preferentially expressed during early anther development, such as bHLH, MYB, and MADS. Closely related homologs were hypothesized to have either redundant or divergent functions according to phylogenic studies [To obtain more information on transcriptomes near the stage of meiosis, we collected anthers at stage 4 to 7 from anthers provide studies -42. Moreams mutant plants for Affymatrix ATH1 microarray analysis. We included three biological replicates for each genotype and the results are highly reproducible through the formation of microspores, our samples from early stage anthers allowed an examination of the early AMS function in regulating transcriptome and sensitive detection of expression shifts without dilution by other floral tissues, resulting in the identification of additional 1,278 genes (478 down- and 800 up-regulated in the ams anthers) with differential expression between wild-type and ams anthers in vivo . In ordes Figure &3B. We ams mutant anther, morphologically and transcriptomically [ams inflorescence showed reduced expression of genes predicted to be involved in metabolism, such as lipid synthesis-related genes [ams anther, consistent with morphological defects.Both somatic and reproductive cells were evidently affected in the omically ,35. Specams anthers whereas starch and sucrose related genes were increased if the expression in the anther is: 1) significantly higher than those in any other tissue with FDR < 0.05 is significantly higher than its percentage in the whole genome (1%) compared with whole genome data (5%) Figure . The sta) Figure . The rese genome % . 1,813 and 802 genes were identified as differentially expressed in spl and ems1, respectively, contributing to a total of 3,058 genes that were differentially expressed by 2-fold or more between the wild-type anther and one or more of the spl, ems1 and ams mutant anthers is larger than those in spl and ems1 , consistent with previous knowledge of dynamic metabolism in tapetum cells. In addition, genes encoding transcription factors and DNA binding proteins are enriched in categories with both up-and down-regulated genes in the spl mutant, suggesting that SPL control anther development at least in part by regulating genes encoding transcription factors. Furthermore, the ams mutant showed reduced expression of many genes encoding structural proteins, which mainly contribute to cell structural integrity, suggesting that AMS might activate these genes to promote maturation of tapetum cells.Because the three mutants showed related but distinct phenotypes, we speculate that the functions of genes differentially expressed in these mutants might differ from each other. Thus we applied GO categorization of molecular function to genes up- or down-regulated in each mutant and bHLH89/At1g06170, were also identified in this category [Besides, several genes encoding putative transcription factors were found within this subset Table . A-P gencategory ,32,35. Tcategory . Our datAMS is significantly reduced in spl, therefore we assumed that genes down-regulated in ams should have similar reduction in spl. Interestingly, we found that 56 genes showed opposite expression changes in spl and in ams compared with wild type anther, and even larger proportion only differentially expressed in ams controls petal formation and was activated in the spl anther [In addition, some bHLH genes with known functions in other organs showed increased expression in the l anther ,69, suggArabidopsis, because they were first identified as flower homeotic genes that determine floral organ and meristem identities [APETALA2 (AP2), majority of genes involved in the ABCDE model belong to the MADS family [APETALA1 (AP1) is an A function gene controlling the first and second whorls and no expression shift was observed [APETALA3 (AP3) and PISTILLATA (PI) are both B function genes, essential for the formation of petals and stamens [PI is an anther-preferential gene, but its expression level did not change in any mutant while AP3 was obviously up-regulated in spl, suggesting that AP3 is regulated more tightly than PI during anther development . AG, the C class gene controlling both stamen and carpel identities, shared similar expression patterns in the anther with AP3 [AG in anther development after the specification of stamen identity [spl and ems1 slightly. FUL involved in fruit development [spl and ems1 mutants, suggesting negative roles of SPL and EMS1 in whorl 4. AGL80, important for central cell and endosperm formation in female gametophytes [Beside the ABCDE genes, some other MADS genes were also expressed in the anther -79 were elopment was up-rtophytes , was alsArabidopsis transcription factor family, MYB genes play important roles in controlling many cellular processes, such as secondary metabolism, morphogenesis, and signal transduction . The mutants of spl, ems1 are of L er background as described [ams mutant is of Columbia background. We select 21-28 day old plant to collect anther at 4-7 stage as described previously [All the plants in this study were grown in soil under long day condition (16 h light/8 h dark) at constant 22°C. The wild-type in this paper refers to ecotype Landsberg escribed , while teviously .Following the Affymetrix GeneChip Expression Analysis Overview described on the website , cRNA waT-test based on previous study [Normalization was applied using Bioconductor package in R by RMA , and allus study .Arabidopsis were normalized together and converted to logarithms base 2 values. We defined genes as anther-specific if they met these criteria: 1) the expression in anther is significantly higher than in any other tissue with FDR < 0.05; 2) gene is present in anther but absent in any other tissues. We used two alternative methods to define whether a gene is present in a tissue. One of the methods was using the Affymetrix' MAS5 algorithm. This method uses a comparison of hybridization intensity with wild-type oligo set vs mismatched oligo set; sometimes similar levels of hybridization to both sets can actually be real expression, yet such results would lead to "absent" calls. Therefore, we also used a second method to define "presence", by using a threshold of 50 for expression value, previously determined on basis of analysis of variation among samples of the same tissue [Similar data processing was performed with the microarray results from different organs. The microarray data from all organs in wild-type e tissue ,43. BothFor the anther-preferential genes, we used the criteria that the expression in anther is 1) present using both MAS and/or 50 cutoff; 2) significantly higher than in any other tissue with FDR < 0.05; 3) at least 2 fold more compared with any other tissues. The reproductive-preferential genes required the expression present and significantly higher in anther than only the vegetative organs using FDR < 0.05 and 2-fold changes.Hierarchical clustering of co-expressed genes was performed by MeV 4.6 . We usedams against the numbers of their putative AMS binding sites using minitab [cis-regulatory binding site was conducted by perl [Possible promoter sequences of all genes on the microarray chip (1 kb upstream of the start codon) were obtained from TAIR website. The number of common bHLH binding site (E-box) was then counted. We then plotted the fold-changes of gene expression in minitab . The ide by perl . The bin by perl .To test the reliability of our microarray hybridizations, six genes and one reference were studied using Quantitative Real-Time PCR. RNA extraction and Real-Time experiments followed the protocols described previously . TriplicAMS: Aborted microspores; AG: Agamous; AP2/ERF: APETALA2/ethylene response factor domain-containing transcription factor; bHLH: Basic helix-loop-helix; bZIP: Basic-leucine zipper; CCR1: Cinnamoyl coa reductase1; DYT1: Dysfunctional tapetum1; EMS1: Excess male sporocytes1; EPS1: Enhanced pseudomonas susceptibilty; EXO: Exocytosis; GO: Gene ontology consortium; MADS: MCM1-agamous-deficiens-SRF; MYB: Myeloblastosis-like gene; NAC: NAM/ATAF1/2/CUC2; RD22: Responsive to dessication22; PI: Pistillata; RPK2: Receptor-like protein kinase2; SEC: Secretion; SERK1/2: Somatic embryogenesis receptor-like kinases1/2; SNARE: Soluble NSF attachment protein receptor; SPL/NZZ: Sporocyteless/nozzle; TAIR: The arabidopsis information resource web site; TIR-NBS-LRR: Toll interleukine 1receptor-nucleotide binding site-leucine rich repeat domain;TPD1: Tapetum determinant1; VAM3: Vacuolar morphology; VSP1: Vegetative storage protein.HM designed and supervised the research; BF performed tissue collection and RNA isolation; XM performed data analysis; XM and HM wrote the manuscript drafts; XM, BF and HM edited the manuscript; all authors approved the manuscript.ams anther replicatesFigure S1. Correlation coefficients between signal intensities from wild-type and the . Pearson's correlation coefficients were larger than 0.96 between pair of the biological replicates from the ams and wild type anther, indicating that the results were highly reproducible. ams. Figures S2 & S3. GO annotation of genes up- and down-regulated in GO categorization of genes differentially expressed in the ams mutant compared with wild type. The enriched groups were shown in different color with P-value provided. ams compared with wild typeFigures S4-S11. The genes involved in different metabolic pathways that were activated or repressed in . Red color represents genes activated while green color represents genes repressed in ams compared with wild type. The overview of metabolism activities was shown in supplemental figure 4. Figure Figure S12. Real-time PCR results consistent with microarray data. Six genes were verified using real-time PCR. The bars in blue represent the real-time RT-PCR results while red the microarray results. All the numbers shown in this figure are the fold changes of expression intensities in other tissues compared with anther. "infl" is the abbreviation of inflorescence.Click here for fileams mutantGenes differentially expressed in anther and inflorescences from the . This additional file contains information about genes differentially expressed in the ams anther and inflorescences compared with wild type. Column sequence, abbreviation and the version of annotation are as those used as in table Click here for fileGO categorization of different clusters based on expression pattern. This additional file contains information about numbers of genes in each GO category. The enriched categories were highlighted in red color.Click here for fileams mutant with putative function in exocytosis, transportation, ubiquitination and stress reactionGenes differentially expressed in the . This additional file contains information about genes involved in different pathways with elevated expression levels in ams.Click here for fileGenes defined as specifically or preferentially expressed in early anther or preferentially expressed in reproductive tissue. This additional file contains information about genes preferentially expressed in only anther or reproductive tissues compared with roots, stems, leaves, siliques.Click here for fileGenes expressed in stamen, early anther and pollen. This additional file contains information about the expression levels of gene in different organs.Click here for filesplGenes differentially expressed in , ems1 or/and the ams mutants. This additional file contains information about the expression levels of gene differentially expressed in the three mutants.Click here for fileMADSExpression pattern of , MYB, bHLH, WRKY, bZIP, AP2/ERF and NAC families. This additional file contains information about the expression levels of different gene families.Click here for file

Low serum level of complement component 4 (C4) that occurs in mixed cryoglobulinemia (MC) may be due to in vivo or ex vivo activation of complement by the classical pathway. Potential activators include monoclonal IgM rheumatoid factor (RF), IgG antibodies, and the complexing of the two in the cold, perhaps modulated by the rheology and stoichiometry of cryocomplexes in specific microcirculations. There is also the potential for activation of complement by the alternative and lectin pathways, particularly in the setting of chronic infection and immune stimulation caused by hepatitis C virus (HCV). Engagement of C1q and interaction with specific cell surface receptors serve to localize immune complexes (ICs) to the sites of pathology, notably the cutaneous and glomerular microcirculations. Defective or saturated clearance of ICs by CR1and/or Fc receptors may explain persistence in the circulation. The phlogistic potential of cryoprecipitable ICs depends upon the cleavage of complement components to generate fragments with anaphylatoxin or leukocyte mobilizing activity, and the assembly of the membrane attack complex (C5b-9) on cell surfaces. A research agenda would include further characterization of the effector arm of complement activation in MC, and elucidation of activation mechanisms due to virus and viral antigens in HCV infection. Mixed cryoglobulins (MCs) are cold-precipitable rheumatoid factors (RFs) that are easily identifiable and characterized by immunofixation of cryoprecipitate obtained from serum carefully collected from blood kept at and allowed to clot at core body temperature, and then cooled to 4°C . Type 2 The complement system comprises 30 serum and cell-surface proteins tightly regulated to respond to activators by three independent pathways , evolved primarily to recognize and destroy pathogenic microorganisms . Tempera2 domain of IgG, and/or to the CH3 or CH4 domains of IgM may occur in MC [Rheumatoid factors are IgM antibodies with specificity largely for the Fc portion of IgG; potential triggers to mRF production include (a) direct infection by virus, (b) chronic antigenic stimulation by ICs, (c) stimulation in the form of repetitively arranged epitopes on viral particles, or (d) molecular mimicry. Early studies suggested additional reactivities of MC IgM with idiotypic determinants in the F(ab')2 of MC IgG, possibly reflecting the fact that in MC the IgG is reactive with viral antigens , some ofur in MC . RFs in ur in MC . Direct ur in MC , but hasur in MC . By contur in MC ; elevatiMC formation provides a fertile substrate for in vitro and, by extension, potential for in vivo, complement activation. Both IgG and IgM may be recognized by the globular heads of C1q, which has been identified as a constituent of cryoprecipitates in some studies. Although binding of C1q to monomeric IgG in cryocomplexes might be anticipated to be offset by more effective binding to IgM, this could be mitigated by clustering of IgG in the ICs, complex formation of IgG with viral antigens, and increased representation of the IgG3 subclass, which is known to be most effective for CP activation , 6. An a50 and hemolytic C4 with normal hemolytic C5-C9 is seen at 4°C, with normal values being obtained in EDTA-treated plasma and in serum kept at 37°C. First described as an in vitro phenomena in occasional sera [In sera manifesting CDAC, a similar profile of low CHnal sera , it was nal sera , 23. CDAEarly studies of mixed cryoglobulins associated with severe RA provided the first indication that as much as one quarter to one-third of the cryoprecipitable material was nonimmunoglobulin . In HCV-The ability of cryoaggregates to generate vasoactive substances and proinflammatory mediators to produce tissue lesions is suggested by elevated levels of complement fragments with anaphylatoxin activity C3a, C5a) in serum, as well as the ability of isolated cryoproteins to activate basophils, cause platelet aggregation, and interact with kallikrein-kinin in vitro . In addia in seru C1q binding has been used as an assay for the identification of both cryoprecipitable and noncryoprecipitable ICs in the sera of patients with MC . DefectiThe detection of HCV core antigen in cryoprecipitates has been linked to the presence of unencapsulated nucleocapsid particles as a constituent of MCs . A recepThe MAC is dependent on the cleavage of C5 into C5a and C5b leading to the assembly of C6–9 and lytic activity targeting membranes at the site of tissue pathology. Relatively little information has been accumulated to implicate terminal complement activation and the generation of MAC in tissue lesions associated with extrahepatic HCV infection.The low level of C4 characteristic of some sera from patients with type 2 MC may be due to activation and cleavage, clearance abnormalities, or reduced synthesis. Activation may proceed via the CP, AP, or MBL pathways, masked by the increased synthesis of this APR due to the inflammation of liver damage and/or IC disease. Activation may be consequent to the IgM RF and/or IgG fractions of type 2 MC, complex formation, and other constituents of cryoprecipitates, including HCV viral antigens, viral RNA, and CRP. Cryoglobulin formation provides a marker for the persistence of ICs in the circulation of affected individuals, as well as for the development of occlusive and/or inflammatory vasculopathy, particularly in the skin. Persistence of ICs may result from defective or saturated clearance mechanisms involving complement (CR1 and other), immunoglobulin Fc (RIIa and other), and/or C1q (gC1qR and other) receptors. Tissue damage due to complement activation requires the generation of fragments with anaphylatoxin and leukocytosis mobilizing (C3d and C3e) activity, and the engagement of their specific receptors; it is reflected in footprints for the assembly of the MAC complex at sites of tissue injury. Lastly, polymorphisms of proteins that tightly regulate the complement system might be interrogated to determine the environmental and genetic determinants of complement abnormalities characteristic for type 2 MC , 40.

Electrohysterography (EHG) is a noninvasive technique for monitoring uterine electrical activity. However, the presence of artifacts in the EHG signal may give rise to erroneous interpretations and make it difficult to extract useful information from these recordings. The aim of this work was to develop an automatic system of segmenting EHG recordings that distinguishes between uterine contractions and artifacts. Firstly, the segmentation is performed using an algorithm that generates the TOCO-like signal derived from the EHG and detects windows with significant changes in amplitude. After that, these segments are classified in two groups: artifacted and nonartifacted signals. To develop a classifier, a total of eleven spectral, temporal, and nonlinear features were calculated from EHG signal windows from 12 women in the first stage of labor that had previously been classified by experts. The combination of characteristics that led to the highest degree of accuracy in detecting artifacts was then determined. The results showed that it is possible to obtain automatic detection of motion artifacts in segmented EHG recordings with a precision of 92.2% using only seven features. The proposed algorithm and classifier together compose a useful tool for analyzing EHG signals and would help to promote clinical applications of this technique. This not only leads to delivery but may also increase the risk of intrapartum infection is the bipolar signal PSD obtained from the periodogram with a Hamming window and fj0 and fj1 are the abovementioned lower and upper limits of the frequency band considered . y ranges . Given tTemporal Parameters. As previously mentioned, EHG signals containing artifacts often present sudden large amplitude variations. This can be characterized by means of parameters such as standard deviation (σx); relative amplitude (RA); kurtosis (κ); normalized maximum derivative in relation to standard deviation of the baseline (MDbs); normalized maximum derivative in relation to standard deviation of the signal under study (MDx); and the ratio between the RMS value of the segment of the signal under study and the RMS of the baseline extracted from the same channel and the same recording (RRMS):xi is the ith sample of the bipolar EHG signal, N is the number of samples in the window length, σx is the standard deviation of the signal under study, and σbs is the standard deviation of the baseline extracted from the same channel of the same recording session.Nonlinear Parameters. The presence of artifacts in an EHG signal may affect the signal non-linearity properties, such as regularity or complexity of finite length time series which can be measured by the sample entropy (En). This nonlinear technique seems to be an appropriate quantitative tool to measure the variability of underlying physiological mechanisms. It has been shown to discriminate between EHG signals of term and preterm deliveries [m = 3 and a pattern matches margin r = 0.15 to obtain the parameter sample entropy. In addition time reversibility of the surrogate time series (Tr) was calculated. Probabilistic properties of artifacted signals are expected to be more susceptible with respect to time reversal than non-artifacted signals. The difference between the time reversibility of the original data and the surrogates was quantified as the measurement of signal non-linearity. For this the z score value was computed:Trorg is the time reversibility of the original data, Trsurr denotes the time reversibility for the 100 computations of the surrogate time series, and σTrsurr is the standard deviation. The definition of the signal time reversibility and the method for generating surrogate time series is described in previous works [liveries , and it liveries . We estaus works .An important aspect in the design of a classifier is the selection of the features involved in it. The use of a single or a limited number of these could adversely affect the classifier accuracy due to lack of information. On the other hand, too many features could also give rise to an excess of information and over-training of data, which would also affect the classifier performance . We opteIn the present study, linear (LDA) and quadratic discriminant analysis (QDA); and support vector machine (SVM) classifier using RBF kernel was implemented. In order to determine the generalization capacity of the new data classifiers, in a first stage signals from ten patients were used (392 nonartifacted contractions and 253 artifacted segments). Specifically, two-fold cross-validation was used, with 50% of the data being used for training and 50% for validation . In the E3). By contrast, even though differences were found in the spectral content in the 0.1–0.3 Hz (E1) and 0.3–1 Hz (E2) frequency ranges in both groups, the distribution of these two features is completely overlapping. In the temporal parameters, the presence of artifacts is also associated with a significant rise in the values of parameters RA, κ, MDbs, and MDx. On the other hand, even though the standard deviation of the signal (σx) and the RRMS feature in EHG signals with artifacts tends to be higher than in signals with no artifacts, the distribution of these parameters shows considerable overlapping between both groups. As expected, the signals containing artifacts present a higher degree of nonlinear behavior as evidenced by the higher time reversibility z-score value, although the sample entropy in both groups is completely overlapping.E3, RA, κ, MDbs, and MDx features for the three classifiers. The sequential forward feature selection algorithm provided a set of 7 features as the best combination of features for both QDA and SVM, 5 of them being common for both classifiers which provide complementary information among them. E3, RA, κ, MDbs, MDx, En, and Tr. The optimal combination of specific features for LDA and SVM provided similar results to those shown in Another example of the application of the algorithm designed to automatically segment and classify EHG recordings is shown in Motion artifacts detection is a common problem in bioelectrical signal analysis and is extremely challenging as their characteristics show an extremely large variability depending on the specific source, making it hard to distinguish between target signal and artifacts. Although previous works have been made in this respect , 34–36, Concerning the TOCO-like generation from EHG recording, various methods that have been proposed in the literature were implemented and compared: RMS-based approach , 29 and Moreover, in this work it has been shown that the signal features of artifacted-EHG segments differ significantly from the non-artifacted ones. Artifacted EHG segments are associated with a rise in relative amplitude, maximum derivative, and kurtosis value. These observations agree with other authors that analyzed noninvasive recordings of other myoelectric signals , 37. MotE3, MDbs, and MDx ranged from 76.0% to 87.6%.In the present work, the ability of the different single features for discriminating the target signal and motion artifacted signal was further analyzed. Our experimental results are in partial agreement with another study on the analysis of parameters for detecting artifacts in surface electrogastrogram recordings . In thish2 [On the other hand, various classifying techniques to distinguish the EHG signal segments with and without artifacts were compared. As it could be expected, the two nonlinear methods provided superior classifier accuracy than LDA which may be due to the fact that the features' distribution for artifacted signal and non-artifacted signal was highly overlapped. Regarding SVM and QDA, they yielded similar results for the training and validation data set. Theoretically, the SVM should provide lower generalization error ; howeverh2 that havWith respect to the motion artifacts detection in bioelectrical recording, manual identification by experts based on previous knowledge about both the target signal and motion artifacts has been often used , 34. OthFinally it should be noticeable that EHG recording is not only contaminated by motion artifacts but also by a set of physiological interferences, such as fetal and maternal ECG activity and respiration. Regarding the possible effects of such interferences in the proposed algorithm, ECG interference is partially cancelled in bipolar EHG recording, its energy content is mostly distributed over 1 Hz, and it is almost constant throughout the recording sessions. Therefore the proposed algorithm would not be very sensitive to this interference. Nevertheless, several techniques have been proposed for removing ECG from EHG recordings and could be used prior to applying the presented method , 41–43. With respect to the potential use of EHG recordings and the proposed method in everyday clinical practice, although clinical staff is not accustomed to EHG recordings for monitoring uterine contraction, they are familiar to other bioelectrical recordings such as electrocardiogram or electroencephalogram. Therefore we consider that the progressive implementation of these methods would not be distressing. It would undoubtedly require a training period for the clinical staff to adapt to and learn about the electrode arrangement for the recording and electrode and bioamplifier wiring and handling. In this context, the TOCO-like signal generation with which clinicians are accustomed will also facilitate the introduction of this technique in clinical practice. Moreover the proposed algorithms do not require a high computational cost, and, from the user point of view, the application could be considered to work on real-time. The proposed method would greatly facilitate the task of segmenting recording sessions and evaluating uterine contractions based on the EHG recording. After having correctly identified the contractions, delivery room staff could be provided with relevant information on their efficiency, such as duration, frequency, signal amplitude, dominant frequency of the EHG signal, and the energy distribution in the spectral domain, among others , 22, 30.E3, RA, κ, MDbs, MDx, sample entropy, and surrogate time reversibility. The proposed classifier, based on QDA with these features, can be used for the automatic detection of artifacts in the EHG recording, reaching a classification accuracy of 92.2%. This classifier, jointly with the proposed TOCO-like signal generation and analysis algorithms, provide a tool for the automatic detection and segmentation of uterine contractions, distinguishing them from possible artifacts. This technique could therefore be a valuable aid to the analysis of surface EHG recordings and could be used by clinical staff to extract additional information from the habitually used TOCO recordings.The experimental results show that the most important features for detecting artifacts in EHG signals are

Hymenolepis.The WHO recently produced updated guidelines for managers of helminth control programmes, specifically targeting soil-transmitted helminthiasis (STH) and schistosomiasis in school-age children Hymenolepis infecting man, namely H. nana and H. diminuta, are ubiquitous and H. nana is by far the most common of the two parasites. H. nana infections are considered to be the most prevalent human cestodiasis in the world H. nana indicate that in some communities this infection can reach prevalence as high as 21% in children compared to adults H. nana infection by quantifying the role of individual and household factors and the physical environment in H. nana infection; quantify the role of H. nana infection on morbidity outcomes such as anaemia, diarrhoea, abdominal pain, and growth; quantify the geographical variation in H. nana infection prevalence in children aged ≤15 years; generate the first high-resolution H. nana infection map; and compare this map with a preexisting S. haematobium map for the region In order to test our proposition, we have analysed data from a parasitic disease survey of 2,168 children aged ≤15 years, including 1,098 girls and 1,070 boys in the Dande municipality in Northern Angola. Previous analysis of this dataset revealed that children were at significantly increased risk of H. nana transmission is known to be facilitated by contact with environments contaminated with human faeces, use of inadequate drinking sources, the absence of proper sanitation and ineffective treatment of excreta or waste, deficient personal hygiene, and the presence of another infected person in the household H. nana infection. The irrigation canals are a legacy of the sugar plantation industry set up in the 1950s and surround the provincial capital of Caxito and neighbouring communities. While the sugar mill is no longer in production, the irrigation canals are used by the population for their daily necessities including clothes washing, recreation, and in some instances as a source of drinking water H. nana infection in children due to a deterioration of the general hygiene situation of the household, which increases faecal-oral transmission of H. nanaH. nana infection in that the risk is increased in households with more rooms probably due to the resulting lower hygiene score. This finding is also consistent with the view that hymenolepiasis is more often seen as clusters within a family H. nana infection in that households that reported not washing their vegetables were at increased risk of infection compared to those that do wash their vegetables. This finding is corroborated by a recent study reporting isolation of H. nana eggs from raw vegetables H. nana prevalence in children aged <5 years was lower compared to children aged ≥5–15 years, our results suggest an association between H. nana infection and previous history of abdominal pain, and H. nana and T. trichiura coinfections to acute malnutrition in children aged <5 years. We did not see an independent effect of T. trichiura infection on morbidity. The effect on morbidity identified in this study is consistent with the known pathophysiology of H. nana and T. trichiura worms, which are known to cause inflammation, bleeding, and dysentery through mucosal injury and local, humoral, and cellular responses to infection H. nana and T. trichiura coinfections are also associated with previous history of abdominal pain and acute malnutrition is a reasonable argument to advocate the delivery of PZQ to the communities with the aim of reducing helminth-associated morbidity in the study area. While albendazole may be made available to this population due to the high endemicity of STHs (<30%), the high spatial heterogeneity of S. haematobium endemicity in the area means that PZQ will not be made available to all communities on an annual basis H. nana, which should be the focus of interventions even in areas of low endemicity.While H. nana infection is likely to be highly geographically variable. Modern geographical risk prediction methods using model-based geostatistics (MBG) provide an extensive set of spatial modeling tools for assessing the geographical overlap of multiple parasite infections and are being used as control tools for targeting helminth interventions H. nana infection showed an area of high H. nana risk associated with more populated areas near and around Caxito and a large cluster predicted to the commune of Mabubas that is unrelated to the endemicity of schistosomiasis do not completely overlap with areas of high H. nana prevalence of infection may pose an import gap in PZQ delivery needs to eliminate emerging adult worms and to eradicate the infection The prevalence of hymenolepiasis in a community can be a useful indicator of the degree of faecal contamination of an environment and/or the level of hygiene practice. Because WASH coverage in sub-Saharan Africa shows considerable regional disparities somiasis . The facry needs . FurtherH. nana infection is an important contributor to infection-associated morbidity, particularly in children aged <5 years, and that the delivery of PZQ to control schistosomiasis and hymenolepiasis should take into consideration their coendemicity. If delivery of PZQ is based solely on schistosomiasis endemicity thresholds, areas in need of PZQ to treat H. nana infections will be reached at very low frequencies or not at all. However, it remains to be demonstrated whether targeting of communities for PZQ distribution on the basis of H. nana disease burden is likely to be cost-effective, and further economic analysis needs to be conducted. To improve visibility and enhance advocacy for the control of hymenolepiasis, it may be warranted to include this infection in the list of neglected tropical diseases.The results highlight the need for WASH improvements to be delivered to communities concomitantly with anthelminth therapy if resources are available. The impact of autoinfection is unlikely to change unless WASH interventions are put in place. More importantly, in this study we show for the first time that Text S1Technical information.(DOC)Click here for additional data file.

There was an error in Figure 5. The correct version of the figures is available here:

Targeting the stages of the malaria parasites responsible for transmission from the human host to the mosquito vector is a key pharmacological strategy for malaria control. Research efforts to identify compounds that are active against these stages have significantly increased in recent years. However, at present, only two drugs are available, namely primaquine and artesunate, which reportedly act on late stage gametocytes.Azadirachta indica and Guiera senegalensis against the early vector stages of Plasmodium falciparum, using field isolates. In an ex vivo assay gametocytaemic blood was supplemented with the plant extracts and offered to Anopheles coluzzii females by membrane feeding. Transmission blocking activity was evaluated by assessing oocyst prevalence and density on the mosquito midguts.In this study, we assessed the antiplasmodial effects of 5 extracts obtained from the neem tree 95 12.0 - 79.0; p < 10-4) and in oocyst density of 90.5% , while the ethanol extract from the same plant part did not exhibit any activity. No evidence of transmission blocking activity was found using G. senegalensis ethyl acetate extract from stem galls.Initial screening of the 5 plant extracts at 250 ppm revealed transmission blocking activity in two neem preparations. Up to a concentration of 70 ppm the commercial extract NeemAzal® completely blocked transmission and at 60 ppm mosquitoes of 4 out of 5 replicate groups remained uninfected. Mosquitoes fed on the ethyl acetate phase of neem leaves at 250 ppm showed a reduction in oocyst prevalence of 59.0% (CIThe results of this study highlight the potential of antimalarial plants for the discovery of novel transmission blocking molecules, and open up the potential of developing standardized transmission blocking herbal formulations as malaria control tools to complement currently used antimalarial drugs and combination treatments. Thanks to the advancements of knowledge and to a significant expansion of financial resources supporting malaria programmes, the burden of the disease has been significantly reduced over the last decade. An estimated 274 million cases and 1.1 million deaths have been averted and 50 countries with ongoing malaria transmission are on track to reduce the incidence of malaria cases by 75% by 2015 [Moreover the progress achieved remains under threat from the development of artemisinin resistant parasites, which have already been detected in 4 countries of the South East Asia Region . The likThis scenario calls for the acceleration of the discovery of novel antiplasmodial molecules and the design and development of new combination drugs tailored to the pharmacological needs of malaria control . Combination drugs including molecules effective against transmissible stages of the parasite have a key role to play both as a resistance containment strategy and to equip countries entering the malaria elimination phase with the required tools. Current ACTs based on artemisinin compounds which are active on asexual blood stages as well as gametocytes have been shown to have a beneficial impact on transmission -5 despitFrom a parasitologist’s perspective, there are several arguments to support focusing on the early sporogonic stages developing in the midgut lumen of the mosquito host. First, transition from the vertebrate to the phylogenetically completely different mosquito host is an extremely critical phase in the parasite’s life cycle. This may well explain why even without the introduction of an intervention the yield of the sexual process is so low. In rodent plasmodia it has been estimated that, from 500 macrogametocytes counted in the vertebrate host, only one goes through the whole process and develops into an oocyst on the midgut wall . After bOn this background it is not surprising that a large number of schizonticidal drugs designed to target asexual erythrocytic forms were found to display activity, and in some cases multi-stage effects, against the various transmissible Plasmodium stages . For exaArtemisia annua, prompted us to explore plants frequently used as anti-malarial remedies for possible transmission blocking effects. Among the plant species investigated, extracts from Azadirachta indica and Guiera senegalensis revealed in vivo transmission blocking activity and/or in vitro inhibitory effects on the early sporogonic development of P. berghei. The Azadirachta indica extract, NeemAzal®, tested in vitro at 6.5 μg/ml resulted in a 65.8% inhibition of early sporogonic stage development and a Guiera senegalensis ethylacetate fraction of galls tested at 50 ug/ml showed a 66% to 88% inhibitory activity (unpublished results). In particular, NeemAzal® a commercial methanol extract from seed kernels of A. indica rich in Azadirachtin A, showed prominent effects, completely inhibiting mosquito infection when administered intraperitoneally at a dosage of 50 mg/kg to gametocytaemic mice [Learning the lesson from ACTs, i.e. the successful development of highly effective artemisinin based combination drugs starting from the medicinal plant mic mice ,14.P. falciparum gametocytes from naturally infected humans and Anopheles coluzzii mosquitoes from colonies established in 2008 were used. Female mosquitoes were membrane fed with blood supplemented with plant extracts. In order to explore which compounds are likely to be responsible for transmission blocking activity, chemically characterized extracts prepared with various solvents from different plant parts were tested.The present study was undertaken to assess the activity of these plants on the transmissible stages of the human malaria parasite under field-like conditions. P. falciparum entomological inoculation rate of 300–500 infective bites per person per year. Parasite prevalence and densities are strongly seasonal, with the transmission season peaking in September and lasting from approximately June to October. Gametocyte-positive blood samples for the direct membrane feeding assay (DMFA) were obtained from children, residents of the Dandé, Soumousso and Bama villages, situated at 40–55 km distance from Bobo-Dioulasso town.The study was conducted in the Bobo Dioulasso area (Burkina Faso) from May to October 2011. Malaria transmission is hyperendemic in the area, with an estimated A total of 2160 children aged 5 – 11 years participated at 18 screening events organized from May to October 2011. For each event, groups of 120 children were invited to present at the village health center early in the morning. Every child was clinically examined for the presence of chronic diseases, acute infections other than malaria and signs of severe malaria. Finger-prick blood was collected and used for the preparation of thick smears. Information on anti-malarial drugs taken during the preceding 2 weeks as well as presence of hypersensitivity to anti-malarial drugs was recorded.Plasmodium parasites. Asexual parasite and gametocyte numbers were calculated per 200 and 1000 leukocytes respectively. Gametocytemia and parasitemia were then expressed as number of gametocytes or total number of parasites per microliter (μL) of blood, assuming leukocyte counts of 8000/μL of blood.Thick smears were stained with Giemsa and examined in the laboratory on the same day. On each slide 100 fields were screened for the presence of P. falciparum gametocytemia ≥ 56 gametocytes/μL, parasitemia ≤ 1000 parasites/μL and negative for other Plasmodium species were selected as blood donors for the direct membrane feeding assay (DMFA) scheduled for the following day.Asymptomatic children with All children with confirmed malaria infection obtained treatment with the combination of artesunate (4 mg/kg body weight)/amodiaquine (10 mg/kg body weight), once daily for 3 days according to the guidelines of the National Malaria Control Programme. Children selected as gametocyte donors for the DMFA were treated the following morning after venous blood collection at the laboratory, those not recruited for the study were given the treatment the same evening by the village health workers.A. indica A. Juss., Meliaceae) and G. senegalensis J. F. Gmel (Combretaceae), previously found to interfere with the sporogonic development of the rodent parasite P. berghei in Anopheles stephensi mosquitoes have been selected for this study [Neem NeemAzal® (NA), a commercial methanol extract from neem seed kernels containing azadirachtin A 34%, other azadirachtins (azadirachtin B to K) 16%, salannins 4% and nimbins 2% .ii) two extracts of neem leaves collected in the Oubritenga Province, Burkina Faso, namely: a) total EtOH extract (NLE); b) EtOAc phase of the EtOH extract (NLA) obtained by partitioning NLE between water and EtOAc. The leaves contained limonoids, with gedunin as a major member of this class, but were devoid of azadirachtin. After partitioning, limonoids were concentrated in NLA.iii) EtOAc phase of the total ethanol extract of neem fruits collected in the Oubritenga Province, Burkina Faso (NFA). This plant fraction has been subjected to detailed phytochemical analysis and 10 triterpenoid derivatives have been identified. The most abundant limonoids were azadirone and azadiradione accounting for 70% of the total components. The gedunin content was estimated at 3%, azadirachtin was not present at detectable amounts .G. senegalensis stem galls, collected in the Bobo-Dioulasso area, Burkina Faso (GS).iv) EtOAc extract of A. indica and G. senegalensis had been collected in the central region of Burkina Faso in June 2008. Plants were identified by Prof. Jeanne Millogo, professor of botanics at the Life Science Unit (University of Ouagadougou) and voucher specimen N°2 NFE (A. indica), N°1 GSE have been deposited in the Laboratory of Ecology at the University of Ouagadougou. Extracts were prepared and chemically characterized [Leaves and fruits of cterized -15 at thAll extracts were initially screened at the high dosage of 250 ppm to allow any possible transmission blocking effects to be detected even by compounds present at low concentrations. Extracts found active were then tested at decreasing doses.P. falciparum gametocyte field isolates was assessed on An. coluzzii mosquitoes, using a colony established in 2008 from field collected mosquitoes. For the membrane feeding assays, 4–5 day old females, kept without sucrose solution for 24 hours before the experimental infection, were used.The transmission blocking efficacy of the plant extracts on Approximately 8 mL of gametocytaemic blood was collected from each selected child by venous puncture using heparinized tubes. Care was taken to keep the blood tubes constantly at 37°C to avoid gametocyte activation leading to precocious gamete formation. Volumes of 10 – 35 μL of experimental extracts, dissolved in sterile distilled water for injection were added to 1 mL blood aliquots to obtain the desired final extract concentrations. Equal amounts of sterilized distilled water for injection were added to the control blood samples. Extract supplements and control blood mixtures were transferred to membrane feeders and 50 mosquito females per feeder were allowed to take blood for 30 to 60 minutes. Fed mosquitoes were separated from the unfed specimens and kept on a 10% sucrose diet. On day 7 after membrane feeding, midguts were dissected from all surviving females, stained with 1% mercurochrome in PBS and the presence and number of oocysts recorded for each mosquito. The transmission blocking activity of the plant extracts was estimated by determining both oocyst prevalence and oocyst density. For each test extract and concentration, two to five independent replicates were performed and prevalence and density values calculated for the treatment and control groups.Generalized linear mixed models were used to compare mosquito infection in control and treatment groups and estimate intervention efficacy . DiffereThe study was approved by the ethical committee of the Centre Muraz and filed under the registration number N/Ref. 003-2009/CE-CM. Parents or guardians provided written informed consent before children were enrolled into the blood collection protocol.A. indica extracts and the G. senegalensis extract was investigated in a series of 31 membrane feeding experiments using P. falciparum gametocyte-positive blood from 18 different donors. Gametocyte densities varied among the experimental blood samples from 56 (threshold for inclusion) to 1760 sexual forms per microliter of blood; two thirds of the samples (12/18) displayed gametocyte densities between 96 and 416 (Table 95 65.7-74.7) and oocyst densities between 1.4 and 151.6 and oocyst density by 90.5% . The mean percentage inhibition for each experiment compared to its control from the four independent replicates was respectively 96.0% (CI95 94.0 - 98.0), 87.0% (CI95 83.0 - 99.6), 70.0% (CI95 66.0 - 85.0) and 91.0% (CI95 89.0 - 95.0). The neem fruit EtOAc extract showed inconsistent results: in two experiments using blood with relatively low gametocytemia (120 and 88 gametocytes/μL) oocyst prevalence and density were reduced by 58.54% and 65.83% in treated mosquitoes compared to controls. The third replicate experiment however, performed with a blood sample rich in gametocytes (416 gametocytes/μL) yielded numerous oocysts in both, treated and control mosquitoes of the treatment group were found positive for oocyst as compared to 81.6% (CI95 65.16-98.04) of control mosquitoes, corresponding to a reduction of 79.9% oocysts was recorded, 99.06% less than on control midguts group with respect to the control groups . However, analysis of oocyst densities still evidenced a reduction of 52.69% were found to contain components with transmission blocking activity against P. falciparum field isolates in our vector infection experiments conducted in Burkina Faso. Of the different A. indica extracts examined, NeemAzal®, an azadirachtin-enriched preparation of neem seeds showed prominent inhibitory activity on parasite development in the vector. When added at a concentration of 60 ppm to gametocytaemic blood from P. falciparum infected donors and membrane fed to An. coluzzii females, oocyst development was completely suppressed in four out of five independent replicates. At 50 ppm, oocyst prevalence was reduced by 80% and density by 99% and at 20 ppm, a 53% decrease in oocyst density was still observed.Extracts from P. falciparum field isolate membrane feeding assay developed at IRSS in Bobo-Dioulasso. These results establish the transmission blocking activity of NeemAzal® against the human parasite P. falciparum, and are in excellent agreement with the previously reported activity in the murine parasite model P. berghei and An. stephensi mosquitoes [Despite considerable variation of gametocyte density between replicates, consistent dose dependent results were obtained, substantiating the specificity of the NeemAzal® action and providing support for the robustness of the squitoes .A. indica) is a popular medicinal plant used in various Asian and African countries for the cure of various ailments and illnesses caused by infectious agents, including malaria. More frequently leaves, but also fruits, seeds and the bark are employed for the preparation of traditional remedies [in vitro growth of P. falciparum asexual blood stages [P. falciparum and P. berghei microgametocytes in vitro, the initial phase of sporogonic development in the vector [P. berghei in An. stephensi mosquitoes when fed on gametocytemic mice previously treated with NeemAzal® at an azadirachtin concentration of 50 mg/kg body weight [in vivo. In addition, post-zygotic forms from NeemAzal® treated mosquitoes displayed evident morphological alterations and no mature ookinetes could be detected at the 50 mg/kg dosage, indicating that NeemAzal® action is targeted to the early sporogonic stages developing in the midgut lumen. This assumption was further supported by the observation that NeemAzal®, when blood fed to already infected mosquitoes did not interfere with oocyst development [The neem tree was higher to 5000 mg/kg body weight in rat [Several studies report that azadirachtin and other limonoids present in neem extracts are active on mosquitoes ,27. Explwer eggs . This rewer eggs . In addit in rat .P. falciparum field isolates was also displayed by the EtOAc fraction from neem leaves (NLA). Added at 250 ppm to blood from gametocytaemic donors and membrane fed to An. coluzzii mosquitoes, NLA reduced oocyst prevalence by 59% and oocyst intensity by 90%. Since this extract does not contain detectable levels of azadirachtin, this activity must be attributed to the presence of other neem components. Gedunin, which is abundant in NLA might be involved. This molecule, previously reported to possess gametocytocidal activity in vitro[In this study, a transmission blocking activity on in vitro, certainin vitro screening for anti-blood stage activity using a P. falciparum chloroquine sensitive (D10) and resistant (W2) strain revealed prominent in vitro schizontocidal activity of the EtOAc neem fruit extract. IC50 values of 1.31- 3.35 μg/mL were found. Similar values were observed for the isolated molecules azadirone, gedunin and neemfruitin A [in vivo activity of neem fruits has been demonstrated: mice treated at a daily oral dosage of 200 mg/kg crude extract over 9 days and exposed to infectious mosquito bites on day 3 of treatment displayed parasitaemia levels reduced by 45% [The examined EtOAc extract from neem fruits did not show consistent transmission blocking inhibitory effects at 250 ppm initial screening dose. Detailed phytochemical analysis of this plant fraction allowed the isolation of 10 triterpenoid derivatives including the identification of two new limonoid molecules named neemfruitins A and B . Since truitin A . Given truitin A . In addid by 45% .G. senegalensis, the second anti-malarial plant selected for this study, did not display transmission blocking activity. It has been included in this study since remedies based on the galls of this plant are frequently used in the Bobo-Dioulasso area for the treatment of fevers and similarly to neem, G. senegalensis contains abundant terpenoids and phenolic compounds [Stem gall ethyl acetate extract from vonoids) .P. falciparum isolates in An. coluzzii mosquitoes. The results strongly suggest azadirachtin to be an important compound, but the results also provide evidence for the presence of at least one other molecule with transmission blocking activity. Screening many purified molecules would have not been practical in this study because of logistical and ethical limitations . However, by focusing on a small panel of extracts with different limonoid content profiles it was possible to deduce useful information on the transmission blocking activity of single constituent molecules.In conclusion, this study confirmed activity of limonoid-rich medicinal plant extracts on the sporogonic development of Considering the anti-plasmodial activity of neem limonoids on different life cycle stages of the parasite these compounds hold promise for the design of new, effective, multi-stage combination medicines. As an example, herbal medicines designed as preventive-transmission blocking formulations, if used by entire communities, may reduce incidence of malaria cases and decrease the intensity of transmission. Studies aimed at assessing bioavailability of pure azadirachtin and azadirachtin rich preparations have been initiated in order to validate the feasibility of the approach.I declare that no competing interests existed for the authors or the institute before, during and after preparing and submitting this paper for review.RSY participated in study design, carried out the experiments, performed the statistical analysis, and drafted the manuscript; LL participated in study design; RKO, DFA, FAY and KBY participated in the execution of the experiments; TSC: conducted the statistical analysis; RSY, GL and OTS participated and helped with plant extraction and partitioning; LCG, AC and GKC participated in study design and helped with manuscript revision; JBO and AH coordinated the work, participated in study design and critically revised the manuscript. All the authors read and approved the final manuscript.

FOXO1 might be a target gene for miR-582-5p and its 3′UTR contains potential binding sites for miR-582-5p. To determine whether miR-582-5p could influence FOXO1 expression, miR-582-5p mimics or negative control of microRNA mimics were transfected into THP-1 cells. RT-PCR and western blot analysis showed that the miR-582-5p could suppress both FOXO1 mRNA and protein expression. Co-transfection of miR-582-5p and FOXO1 3′UTR-luciferase reporter vector into cells demonstrated that significant decrease in luciferase activity was only found in reporter vector that contained a wild type sequence of FOXO1 3′UTR, suggesting that miR-582-5p could directly target FOXO1. In conclusion, miR-582-5p inhibited apoptosis of monocytes by down-regulating FOXO1 expression and might play an important role in regulating anti-M. tuberculosis directed immune responses.Macrophage apoptosis is a host innate defense mechanism against tuberculosis (TB). In this study, we found that percentage of apoptotic cells in peripheral blood monocytes from patients with active TB was lower than that from healthy controls (p<0.001). To understand whether microRNAs can modulate apoptosis of monocytes, we investigated differentially expressed microRNAs in patients with active TB. miR-582-5p was mainly expressed in monocytes and was upregulated in patients with active TB. The apoptotic percentage of THP-1 cells transfected with miR-582-5p mimics was significantly lower than those transfected with negative control of microRNA mimics (p<0.001), suggesting that miR-582-5p could inhibit apoptosis of monocytes. To our knowledge, the role of miR-582-5p in regulating apoptosis of monocytes has not been reported so far. Systematic bioinformatics analysis indicated that Mycobacterium tuberculosis is the etiological agent of TB and it most often infects lungs but can also affect most parts of our body Tuberculosis (TB) is the second most common cause of death from an infectious disease after AIDS M. tuberculosis first encounters host innate immune defense, such as alveolar macrophages M. tuberculosis is able to circumvent the macrophage killing machinery by blocking the fusion of mycobacterial phagosome with lysosome and replicates within macrophages M. tuberculosis strain inhibits macrophage apoptosis and induces necrosis to spread the infection, while attenuated M. tuberculosis strain induces apoptosis, suggesting that macrophage apoptosis is a host innate defense mechanism against TB M. tuberculosis replication During lung infection, Patients with active TB have increased frequency of peripheral blood monocytes compared with healthy controls, and effective anti-TB chemotherapy can reverse the change microRNAs are endogenous regulatory RNA molecules that may regulate as much as 1/3 of encoding genes The study protocols were approved by the Ethics Committee of Beijing 309 Hospital (#20110311) and informed written consent was obtained from all participants.One hundred and nine patients with active pulmonary TB were recruited from the TB Clinical Center of the Institute of Tuberculosis, 309 hospital, Beijing, China . They weNinety-nine healthy controls were recruited randomly from individuals underwent regular health check-up, with following inclusion criteria: (1) no fever, cough or other signs of active TB; (2) with normal physical examination result and normal radiography; (3) without HIV infection .Blood samples for purification of peripheral blood mononuclear cells (PBMCs) were drawn at 7 to 8 am from patients with active TB and healthy controls. PBMCs were purified by density gradient centrifugation using Ficoll-Paque within 6 hrs of blood collection. Anti-human CD3 and CD33 magnet beads were used to separate primary human monocytes according to manufacturer' s instructions 2 atmosphere at 37°C.Human monocytic cell line THP-1 (TIB-202) and human embryonic kidney 293T cells (CRL-11268) were obtained from the American Type Culture Collection . Primary monocytes and THP-1 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 µg/ml streptomycin and 2 mmol/L glutamine. HEK-293T cells were cultured in Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 µg/ml streptomycin and 2 mmol/L glutamine. All cells were incubated in 5% COFor surface staining, PBMCs from TB patients and controls were stained with PE-CF594-labeled anti-human CD3 mAb , FITC--labeled anti-human CD14 mAb or PE-Cy5-labeled anti-human CD33 mAb for 30 min at 4°C. Appropriate isotype-matched control antibodies were used to determine background levels of staining. At least 100,000 events were collected and analyzed with Beckman CXP software on a FC-500 Flow Cytometer .microRNAs were extracted by using a miRVana™ miRNA isolation kit and cDNA synthesis were performed with TaqMan® microRNA reverse transcription kit (Applied Biosystems) according to manufacturer's protocols. TaqMan® microRNA assay for miR-582-5p and TaqMan® universal PCR master mix (Applied Biosystems) were used for specific amplification and identification of miR-582-5p. Real-time RT-PCR was performed by using iQ5™ instrument with following conditions: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C for 10 s and 56°C for 30 s. The relative amount of microRNAs was normalized against U6 snRNA , and the fold change for the miR-582-5p was calculated by the 2-ΔΔCt method.FOXO1, the following primers were used: FOXO1 forward (5′-GGATGGCATGTTCATTGAGCG-3′) and FOXO1 reserve, (5′-ACTGCTTCTCTCAGTTCCTGC-3′). The expression levels were normalized by housekeeping gene GAPDH with following primer pair: GAPDH forward (5′-CCGCATCTTCTTTTGCGTCG-3′) and reserve (5′-TTCCCGTTCTCAGCCTTGAC-3′). Real-time RT-PCR was performed at following condition: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C for 10 s and 60°C for 30 s. The relative amounts of mRNA were calculated by the 2-ΔΔCt method.For detection of mRNA expression of FOXO1 siRNA and negative control of siRNA were mixed with 100 µl Amaxa nucleofector solution and transfected into 2×106 cells by electroporation using Nucleofector II instrument (Lonza). A control plasmid pmaxGFP® (Lonza) which encodes EGFP was used to determine transfection efficacy. After transfection, the cells were allowed to recover for 6 hrs at 37°C and fresh RPMI 1640 medium was changed thereafter. The cells were cultured for additional 24 h in a 5% CO2 atmosphere at 37°C.For transient transfection, 100 nmol/L of synthesized oligonucleotides, including miR-582-5p mimics and negative control of mimics (mimics NC) (both are from Ambion), 6 cells/ml, and were incubated with annexin V-FITC and PI for 15 min. The cells were analyzed with Beckman CXP software on a FC-500 Flow Cytometer (Beckman Coulter) within 1 hr of cell collection. At least 20,000 cells were counted in each assay.Annexin V apoptosis detection kit I was used to determine apoptosis of the cells. In brief, cells transfected with miR-582-5p mimics or mimics NC were resuspended in 100 µl binding buffer, at a density of 1×102 atmosphere at 37°C for 24 hrs. The cells were collected and stained with PE/Cy7-labeled anti-human CD14 mAb and Annexin V apoptosis detection kit. Apoptotic rate of monocytes was determined by flow cytometric analysis.For induced apoptosis assay of primary monocytes, PBMCs from patients with active TB and healthy controls were cultured in RPMI 1640 medium (Invitrogen) supplemented with 2% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin and 2 mmol/L glutamine in a 5% COhttp://www.targetscan.org/) and miRanda (http://www.microrna.org/). To investigate the biological processes that correlated with miR-582-5p expression, predicted target genes of miR-582-5p were projected to Gene Ontology analysis (http://david.abcc.ncifcrf.gov).The target genes of miR-582-5p were predicted using microRNA analysis software TargetScan and AAGCTTTGCTGTGCACCTGTTCTCTT (reverse primer). The restriction sites SpeI and HindIII were included in the primers to facilitate cloning. The amplified products were inserted into pMIR-report vector (Ambion) and the resulting vector was designated pMIR-FOXO1-3′UTR-wt.A DNA fragment of FOXO1 3′UTR mutation oligos were synthesized as following: CTAGTTTTCTTTAGCCTGTAGCAACCTACCCTAAAATTCCTATCATTATGTA-3′5′- (sense) and 5′ AGCTTACATAATGATAGGAATTTTAGGGTAGGTTGCTACAGGCTAAAGAAAA-3′ (antisense). The mutated bases in the potential target sequence of miR-582-5p were indicated in the box, and restriction sites SpeI and HindIII were included in the oligos. The complementary oligos were annealed and inserted into pMIR-report vector, and the resulting vector was designated pMIR-FOXO1-3′UTR-mut.The 4 cells per well) 24 h before transfection. 100 ng pMIR-FOXO1-3′UTR-wt or pMIR-FOXO1-3′UTR-mut was co-transfected with 50 nmol/L miR-582-5p mimics or mimics NC (Ambion) into 293T cells by using Lipofectamine 2000 (Invitrogen). Cells lysates were prepared with Passive Lysis Buffer 24 h after transfection, and luciferase activities were measured by using the Dual Luciferase Reported Assay Kit (Promega) on a luminometer.For luciferase assay, HEK-293T cells were seeded onto 96-well plates and the protein concentration was determined using the BCA protein assay kit . Twenty microgram total protein were electrophoresed on a 10% (w/v) SDS-PAGE gel (Bio-Rad) and transferred onto a PVDF membrane . After blocking with 5% (w/v) BSA, membranes were probed with the primary antibody against FOXO1 and then incubated with horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology). The membranes were developed with western blotting luminol reagent (Santa Cruz Biotechnology). Data were normalized to the housekeeping protein β-actin (Santa Cruz Biotechnology).p<0.05.All statistical analyses were performed using the Graphpad Prism 5.0 software package. Data were shown as mean±SD or median . For comparison between two groups, a two-tailed unpaired t-test or Mann-Whitney test were used. Differences were considered significant at a level of + monocytes compared with healthy controls which predicted that 1157 genes could be targeted by miR-582-5p, and some of the genes are related to cell proliferation and apoptosis .p<0.001). These data suggested that miR-582-5p could inhibit apoptosis of monocytes.To investigate whether miR-582-5p can influence apoptosis of monocytes, miR-582-5p mimics or negative control of microRNA mimics were transfected into human monocytic cell line THP-1 cells. The reason to use THP-1 cell line instead of primary monocytes was due to low transfection efficiency of fresh human monocytes. As shown in FOXO1 might be a target gene of miR-582-5p and its 3′UTR contains potential binding sites for miR-582-5p were significantly lower than those transfected with negative control siRNA (13.1%±1.4%) (p<0.01).Next, siRNA-mediated FOXO1 silencing was performed to investigate the influence of FOXO1 on apoptosis of monocytes. As shown in Taken together, these results indicated that miR-582-5p could inhibit apoptosis of monocytes by directly down-regulating FOXO1.M. tuberculosis and host determine the outcome of TB M. tuberculosis infection can modulate apoptosis of monocytes, which might play roles in host immunity against TB and augmented circulating monocytes in TB patients Interactions between Many studies have shown that microRNAs play a crucial role in regulation cellular proliferation and apoptosis, and they might have great potential in cancer treatment FOXO1 is a transcription factor of Forkhead box O (FoxO) family that involves in diverse functions of cellular processes FOXO1 contains potential binding sites for miR-582-5p and might be one of its target genes. The relationship between miR-582-5p and FOXO1 has not been reported before. Our study demonstrated that miR-582-5p can directly target 3′UTR of FOXO1 to inhibit apoptosis of monocytes. The observation indicates that miR-582-5p inhibits apoptosis of monocytes by targeting FOXO1.Through systematic bioinformatics analysis, we found that 3′UTR of FOXO1 was a target gene of miR-582-5p, which participated in regulation of monocyte apoptosis.In summary, miR-582-5p was upregulated in monocytes from patients with active TB and could inhibit apoptosis of monocytes.

The Six-minute walk (6MW) and Timed-Up-and-Go (TUG) are short walk tests commonly used to evaluate functional recovery after total knee arthroplasty (TKA). However, little is known about walking capacity of TKA recipients over extended periods typical of everyday living and whether these short walk tests actually predict longer, more functional distances. Further, short walk tests only correlate moderately with patient-reported outcomes. The overarching aims of this study were to compare the performance of TKA recipients in an extended walk test to healthy age-matched controls and to determine the utility of this extended walk test as a research tool to evaluate longer term functional mobility in TKA recipients.The mobility of 32 TKA recipients one year post-surgery and 43 healthy age-matched controls were assessed using the TUG, 6MW and 30-minute walk (30MW) tests. The latter test was repeated one week later. Self-reported function was measured using the WOMAC Index and a physical activity questionnaire.30MW distance was significantly shorter amongst TKA recipients . Test-retest repeatability was high . Amongst TKA recipients, the 30MW distance correlated strongly with the shorter tests . Multiple regression modeling found 6MW distance to be the only significant predictor (P < 0.001) of 30MW distance, explaining 96% of the variability. The TUG test models were moderate predictors of WOMAC function (55%) and physical activity (36%) and were stronger predictors than 6MW and 30 MW tests.Though TKA recipients are able to walk for 30 minutes one year post-surgery, their performance falls significantly short of age-matched norms. The 30MW test is strongly predicted by 6MW test performance, thus providing strong construct validity for the use of the 6MW test in the TKA population. Neither a short nor long walk test is a strong predictor of patient-reported function after TKA. Maximizing functional mobility is a key goal of rehabilitation after total knee arthroplasty (TKA) surgery. The Timed-Up-and-Go (TUG) and Six-minute walk (6MW) tests are commonly used to evaluate functional recovery after TKA -9 as theThe use of extended walk tests has been investigated in other populations. In a study of the two-, six-and 12-minute walk tests in patients following stroke, the 12-minute walk test was observed to be the most responsive to change . FurtherTo date, there has been no examination of the utility of a walking test beyond six minutes in the TKA population. The overarching aim of this study was to determine the utility of an extended walk test as a research tool to evaluate longer-term functional mobility in TKA recipients. The specific aims of the study were multiple: 1) to assess the performance and repeatability of the extended test in TKA recipients one year after surgery and in healthy age-matched controls; 2) to examine the correlations between the extended walk test and both the TUG and 6MW tests amongst the TKA cohort; 3) to determine the predictors of performance of the extended walk test amongst the TKA cohort; and finally, 4) to examine which of the walk tests best predicts self-reported function and physical activity. The main hypotheses to be addressed were that: TKA recipients one year post-surgery will perform significantly worse than age-matched healthy controls in an extended walk test; the shorter walk tests will not predict performance in the longer walk test, and; the longer walk test will be a stronger predictor of self-reported function and physical activity than the shorter walk tests.Prior to undertaking the definitive study, a pilot survey of patients awaiting knee and hip replacement was performed to determine a time parameter for an extended walk test which may be functionally relevant for this patient group. Sixty-four consecutive individuals attending the pre-operative joint replacement education class at a public hospital completed a written survey comprising close-ended questions about current and expected 1-year walk times. At the time of the survey, 52% of participants reported a maximum walking duration of 10 minutes or less before they had to stop due to their leg symptoms. As anticipated, participants expected to be able to walk much further 1-year post surgery; 86% of participants expected to be able to walk 25 minutes non-stop, and over 50% expected to be able to walk 50 minutes non-stop one year post-surgery. From these data, we reasoned that a 30-minute walk (30MW) test was in accordance with patient expectations for functional mobility one year after TKA.A convenience sample of a minimum of 60 subjects was planned for this study. The sample size was a compromise between gathering sufficient data for repeatability and cross-sectional analyses based on what is known from previous timed mobility trials in TKA and elderly populations n=22 to 51) 1 5,11,1,17, and , and 17,For the TKA cohort, patients who underwent TKA 12 to 18 months prior were identified from an existing hospital database and a random sample was selected using a computer-generated sequence. The selected individuals were contacted and screened via a telephone interview. Eligible patients were invited to participate. To improve generalizability, patients with other co-morbidities and other musculoskeletal pain were not excluded, as patients who undergo TKA commonly present with multiple co-morbidities and other joint disease . HoweverHealthy control volunteers were recruited from the community through flyers placed in hospital grounds and through word-of-mouth. To allow comparison with a genuinely healthy population of this age group, volunteers were excluded if they had acute or chronic respiratory, cardiac, neurological and musculoskeletal disorders involving significant mobility impairment. Eligibility was determined via telephone interview.All participants who provided written, informed consent were enrolled into the trial. The protocol and consent forms were reviewed and approved by the South Western Sydney Local Health District Human Research Ethics Committee. The characteristics of the participants including age, gender. height, and body mass index (BMI) are summarized in Table Testing took place at three outdoor sites for the convenience of the participants. An outdoor setting was used to simulate normal functional walking conditions. Well demarcated, level, paved, concrete or bitumen footpaths devoid of obstacles were chosen. Participants were tested under dry conditions with ambient temperature between 13 to 24 degrees Celsius. Time of testing was constant for each participant. Participants were instructed to wear supportive footwear and comfortable clothing.TM or F6TM, Polar Electro Oy, Finland) at the commencement of the testing session. As with other studies evaluating 6MW tests . Supplementary analysis revealed that the 30MW distance covered by the TKA cohort remained significantly lower than the age-matched group when TKA recipients with other conditions impairing mobility (n=13) were removed.All control subjects and 12 TKA recipients performed a repeat test. TKA recipients were reluctant to perform a second test as they found the test to be difficult. For participants who performed a second test, excellent repeatability was observed in the distance walked as denoted by the very high ICCs obtained for both groups Table . Effort 2 of 0.96.Scatter plots of 30MW distance versus TUG and 30MW distance versus 6MW distance for TKA patients are shown in Figure The significant predictor variables for self-reported function (WOMAC) and reported weekly duration of physical activity using multiple regression modes are shown in Table This study deepens our understanding of walking ability of individuals one year after TKA surgery. The prevailing norm in this area is to use short duration walk tests to evaluate functional mobility after surgery ,2,6-8. IWe observed that the 30-minute walking capacity of TKA recipients at one year after surgery remains significantly inferior to their healthy counterparts. Given the similar effort observed during the 30MW test between TKA recipients and controls and the subjective reporting by participants, the inferior performance is likely explained by the presence of a prosthetic joint and pain in the index joint, as well as other factors shown to influence recovery such as the presence of significant co-morbidities , severe The observed residual impairment in mobility amongst our TKA cohort is further supported by comparisons between their 6MW test performance with published standard values of healthy elderly populations. Using the reference equation published by Troosters et al. , our heaThe near-perfect correlation between the 6MW and 30MW tests and the high predictability of 30MW distance by 6MW distance were unexpected. This is because participants were instructed to walk as far as possible but safely, and as such we expected that some participants would not be able to maintain the same speed in both tests, presuming a comparatively poor fitness level in the cohort. We observed that the healthy cohort walked faster in the longer test. This may be due to less frequent deceleration and turning associated with the longer lap in the 30MW test. In contrast, the walking speeds of TKA recipients were identical in both tests. The gain in walk speed associated with a longer track was not seen in the TKA cohort, suggesting that the 30MW test was indeed more fatiguing for this cohort. For some participants, the overall walk speed was reduced as a result of the rests taken during the 30MW test and these people demonstrated the slowest speeds in the 6MW test. For those who did not rest, there was a trend for a slightly faster speed but this did not quite reach statistical significance. Consequently, whilst fatigue likely did become a factor in the longer test, its effects were small, and those most affected were those who performed worst in the 6MW test anyway. Thus the prediction of the 30MWD and 6MWD was high. The knowledge that a strong correlation exists between the 6MW and 30MW tests is useful both in clinical practice and research, as it means that the 6MW test is a suitable tool to evaluate interventions aimed at improving longer duration ambulation; specifically, the 6MW test will predict how far a TKA recipient can walk over 30 minutes with acceptable accuracy.All three walk tests moderately predicted self-reported function. The 6MW and 30MW tests produced similar models for reasons described above, with TUG producing the strongest model. A possible explanation for the latter is that, unlike the 30MW and 6MW tests, TUG performance is a combination of walking ability, lower limb strength and balance owing to the sit-to-stand component, and is based on activities similar to items included in the WOMAC questionnaire. Others have found similar, modest relationships between measured ambulation and self-reported function. Rossi et al. found moPhysical activity levels reported by the TKA cohort were significantly lower than the control group. The average time spent performing physical activities by TKA recipients (202 minutes) was also lower than reported in a similarly aged population-based sample (255 minutes) using the same survey , whilst By virtue of our design, this study also describes for the first time the spatio-temporal gait characteristics of TKA recipients under natural environmental conditions, as gait analysis in this population has mostly been conducted from snap-shots created under laboratory conditions . Whilst A limitation to the study is that the results are limited to the TKA population one year post-surgery. A minor limitation of the study is the sample size of the TKA cohort as it necessarily restricted the number of variables included in the regression modeling. A larger sample would have allowed the inclusion of other potential predictors, such as age and co-morbidity which are known predictors of the shorter walk tests -43. ThisThe 30MW test highlights the persistent subnormal mobility seen in this cohort, its utility, however, is lacking as it does not provide greater predictive value for patient-reported outcomes than the shorter walk tests and the test appears particularly arduous. As the 30 MW test is almost completely predicted by the 6MW test, this study demonstrates that the 6MW test is a robust measure of functional mobility in long-term recovery amongst TKA recipients. Our findings reinforce the use of performance-based tests such as the 6MW and TUG tests together with self-report outcomes to evaluate recovery of functional mobility.6MW: Six-minute walk; 30MW: 30-minute walk; BMI: Body mass index; HR: Heart Rate; ICC: Intra-class correlation coefficient; TKA: Total knee arthroplasty; TUG: Timed-Up-and-Go; WOMAC: Western Ontario and McMaster Universities Osteoarthritis Index.The authors declare that they have no competing interests.VK contributed to the conception and design of the study; acquisition, analysis and interpretation of data; and drafting of the manuscript. JN contributed to the conception and design of the study; acquisition, analysis and interpretation of data; and drafting the manuscript. IH contributed to the conception and design of the study; interpretation of data; and revision of the manuscript. JC contributed to the conception and design of the study; analysis and interpretation of data; and revision of the manuscript. AY contributed to the analysis and interpretation of data; and revision of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2474/14/145/prepub

Fever is one of the most suggestive symptoms for infectious disease pathology, although it is neither specific nor sensitive. Reoccurrence of fever during the course of hospital admission generally suggests that the diagnosed infection might not be controlled and that medical management should be revised. However, other concurrent illnesses can also be responsible for fever; for this reason, a complete interdisciplinary medical investigation should be performed.We present the case of a 48 year-old patient, smoker, moderate alcohol consumer, with grade 2 obesity, arterial hypertension, COPD and hepatic steatosis.Enterococcus and Klebsiella XDR. A diagnosis of endocarditis and sepsis with multiple organ dysfunction syndrome was established. He received treatment with meropenem, colistin, linezolid, followed by tigecycline.He was admitted to the intensive care unit of our Infectious Disease Clinic for fever and chills; blood cultures positive for Enterococcus spp and Klebsiella spp, antibiotic therapy was continued and the patient presented favorable clinical evolution.The patient’s medical history is positive for an invasive procedure the day before fever onset: post-extractional ridge preservation with bone substitute of bovine origin. After consult with the dental surgeon, the alveolar addition material was extracted and sent to the laboratory for culture – results came out positive for Transesophageal echocardiography revealed a hyperechoic immobile image of 3/4 mm on the aortic left coronary cusp, compatible with an old vegetation.Over the course of hospitalization, the patient developed abdominal pain, and fever reappeared. Abdominal CT scans were suggestive of hydropneumoperitoneum through possible digestive perforation and the patient was transferred to a surgery department where he was diagnosed with parieto-sigmoid and intermesenterico-sigmoido-jejunal abscess due to infection of sigmoid diverticula. After abscess drainage and lavage, fever persisted, and he was transferred to our Clinic, where antibiotic therapy was continued and the patient presented favorable clinical evolution.Fever of recent onset in a patient with existing, but undiagnosed comorbidities can be tricky to manage. It is important to try to differentiate the etiology of recurrent feverish episodes. Although the simplest explanation is oftentimes the best, different concurrent pathologies can sometimes justify the same sign or symptom, as was the case with this patient, where the second course of fever did not signal an issue in the management of endocarditis, but rather the development of a complication of a pre-existing pathology that had not been yet diagnosed: sigmoid diverticula.

No general systemic activation of the extracutaneous pigmentary system in response to viral infections with affinity to the heart was observed.It is widely accepted that melanin formation may play an immunologic role in invertebrates and ectothermic vertebrates. In farmed Atlantic salmon, cardiomyopathy syndrome (CMS) is a common viral disease associated with severe cardiac inflammation that may be accompanied by heavy melanisation of the heart. By the use of histology, laser capture microdissection and transcription analysis of tyrosinase genes, we here show that this melanisation is linked to Salmo salar L.). The piscine myocarditis virus (PMCV) is the proposed causative agent [Cardiomyopathy syndrome (CMS) is a severe disease that affects farmed Atlantic salmon ,9 and pade novo synthesis. A secondary aim was to reveal if such melanisation could be part of a general systemic response to common viral infections of Atlantic salmon.The aim of this study was to investigate if the melanin deposits in the CMS-associated lesions of the hearts were due to Four different production farms of Atlantic salmon were diagnosed with CMS outbreaks by the Norwegian Veterinary Institute. PMCV was detected in all four locations. Formalin fixed paraffin embedded (FFPE) samples from heart and kidney, stained with haematoxylin and eosin (H&E), were included in this study. Histological classification was based on the presence of endocarditis, mononuclear myocarditis, degeneration and necrosis , and thede novo melanin synthesis, samples of pigmented cardiac tissue were analysed for the expression of genes confined to melanin-synthesizing cells. Six individuals with severe atrial melanisation were subjected to laser capture microdissection (LCMD). FFPE-sections, 5 μm thick, were mounted on membrane slides , dewaxed and counterstained with RNase-free haematoxylin. Sections of pigmented cell accumulations were micro dissected as described previously [A (EF1AA) [To address possible eviously as descr (EF1AA) .t-test, p < 0.05). These results made us able to pinpoint the transcription of the tyrosinase gene family to the pigmented cells, hence strongly suggesting de novo melanin production by melanomacrophages.The procedure of microdissection enabled us to compare the relative transcription levels of the tyrosinase gene family in the pigmented lesions of diseased fish with respective areas of inflammation without pigmentation. The relative transcription of both Tyr and Dct was significantly up-regulated in inflamed areas containing accumulations of melanomacrophages compared to non-pigmented parts of the inflammatory lesion within the same sample Figure , . Hence, evidence for a systemic activation of the extracutaneous pigmentary system as a direct response to the viral infections or the cardiac inflammation could not be observed. However, in the experimental study of CMS (PMCV-positive fish co-infected by IPNV and PRV) there was a tendency towards an up-regulation of the transcription of tyrosinase, yet only statistically significant in the kidney at 24 wpc through their antioxidative properties . ROS canper se. Taking the present data into account, we suggest that melanin production in chronically inflamed cardiac lesions of CMS-diseased fish serve as a protective mechanism against oxidation during cell necrosis followed by repair by scarring in tissue too damaged to be restored.Melanin and melanogenesis have been considered to be related to innate immunity in a range of species ,27,28 anCMS: Cardiomyopathy syndrome; PMCV: Piscine myocarditis virus; HSMI: Heart and skeletal muscle inflammation; PRV: Piscine reovirus; PD: Pancreas disease; SPDV: Salmon pancreas disease virus; ISA: Infectious salmon anaemia; ISAV: Infectious salmon anaemia virus; FFPE: Formalin fixed paraffin embedded; LCMD: Laser capture microdissection; RT-qPCR: Quantitative real-time reverse transcriptase polymerase chain reaction; Tyr: Tyrosinase; Dct: Dopachrome tautomerase.The authors declare that they have no competing interests.HL designed the study, performed experiments, interpreted results and wrote the manuscript. LA provided the ISA- and PD-material, interpreted results and edited the manuscript. CF provided the CMS-material from the infection trial, performed histology, interpreted results and co-wrote the manuscript. MA provided the CMS-material from the field outbreak and performed histology. TT provided the CMS-material from the infection trial. ER provided the PD- and HSMI-material. KF provided ISA-material. EOK supervised the study, interpreted results and edited the manuscript. All authors read and commented on the manuscript.

Introduction. The verbal, eye, and motor components of Glasgow coma scale (GCS) may be influenced by poisoned patients' behavior in an attempted suicide. So, the values of admission GCS and its components for outcomes prediction in mixed drugs poisoning were investigated. Materials and Methods. A followup study data was performed on patients with mixed drugs poisoning. Outcomes were recorded as without complications and with complications. Discrimination was evaluated by calculating the area under the receiver operating characteristic curves (AUC). Results. There was a significant difference between the mean value of each component of GCS as well as the total GCS between patients with and without complication. Discrimination was best for GCS (AUC: 0.933 ± 0.020) and verbal (0.932 ± 0.021), followed by motor (0.911 ± 0.025), then eye (0.89 ± 0.028). Conclusions. Admission GCS and its components seem to be valuable in outcome prediction of patients with mixed drug poisoning. Glasgow coma scale (GCS) first appeared in 1974 in reports by Graham Teasdale and Bryan J. Jennet, both professors of neurosurgery at the University of Glasgow , for theThis is a prospective followup study which conducted at the Poisoning Emergency Department of Noor University Medical Center, a main referral center of Isfahan Province, Iran. The centre is facilitated, staffed, and designed exclusively for the management of poisoned patients in our hospital. One hundred fifty two patients with mixed drugs poisoning (MDP) were hospitalized in the centre and followed over time to measure the final outcome. Patients transferred from elsewhere and patients admitted after the first 24 hours of ingestion were excluded. Having 152 patients, we would be able to estimate 95% confidence interval for mean GCS scores with 0.4 effect size. The project was approved by the Institutional Ethics Committee of Isfahan University of Medical Sciences (IUMS) . n (%) where appropriate. Two-tailed paired t-test was performed to compare mean scores at the baseline and after the treatment. Logistic regression was applied to calculate odds ratio (OR) with 95% confidence interval (CI) to show how predictive is the subset of GCS . For each outcome measure and combination of GCS components, we identified the optimal cutoff point. The area under the curve (AUC) and its standard error were calculated to measure the prognostic information provided by each combination of GCS components. AUCs between 0.7 and 0.8 were classified as “acceptable” and between 0.8 and 0.9 as “excellent” discrimination [P value less than .05 was considered as statistically significant results.For all patients, routine biochemical tests were measured, and usual treatments were continued. Trained medical staff prospectively recorded demographic data and clinical readings of patients. The composite GCS, including eye, motor, and verbal components were measured on admission. GCS was determined based on three components: eyes , verbal , and motor . All othmination . Data wen = 54) than women (n = 98). The mean age was 24.89 ± 0.65 years, ranged from 14 to 56 years. Patients were admitted to the hospital early in the course of ingestion (161.99 ± 6.65 minutes). The most frequently used drugs were benzodiazepines, pain relief medications, and antidepressants drugs were studied. There were more men (ts drugs .Our findings indicated that 130 patients (85.5%) survived without complications, 20 patients (13.2%) survived with complications, and two patients died (1.3%) . The lenP < .0001) . PatientFor eye, verbal, and motor variables, and the area under ROC curve, sensitivity and specificity at the best cutoff point were determined and compared with GCS. Discrimination was excellent for GCS as well as all components including motor, eye, and verbal. There were no statistically significant differences among all components in terms of area under ROC curve . Logistic regression results indicated that the chance of complications is 44 times higher for patients with motor score less than five in comparison with normal motor score. It also showed that patients with a verbal score equal or less than three had 90 times the risk of complications compared with those with verbal score four. With respect to eye component, the chance of complications is 52 times higher for patients with eye score less than two in comparison with normal eye score (score ≥ 3) .In this study, the value of GCS and its components in predicting outcome of patients with MDP were investigated. Our findings show the mean value of each component as well as total GCS in patients with MDP was strongly related with outcomes. Patients without complications had greater mean values than patients with complications. The prognosis in patients presenting with poisoning depends on the level of consciousness on admission .Although rapid changes in the level of consciousness in poisoning cases may raise a question on the role of admission GCS in predicting outcome, we showed that admission GCS as well as its components can be validated for poisoned patients with mixed drugs ingestion. Applicability of GCS in outcome prediction of different poisoning has been evaluated previously. GCS has been shown to be an effective clinical parameter that helps clinicians to predict the outcome of organophosphate poisoning cases in the initial assessment –17. GCS Our results showed patients with GCS equal or less than 10 had higher chance of getting complications in comparison with patients with GCS score more than 10. Unverir et al. demonstrated that antidepressant-poisoned patients with GCS scores of 8 or less were intubated more frequently . GCS lesVariability in agreement between physicians when measuring the GCS is another concern that may limit its clinical usefulness , 26. TheIn conclusion, our results show admission GCS and its components seem to be valuable prognostic tools in acute mixed drug poisoning. Findings on the predictive ability of GCS score and its components can help clinicians to better identify patients who may develop complications.There are also some limitations in our study. Our results may not be extrapolated to other institutions. It is a single-centre study, which may not be representative of all patients. GCS measured at the time of admission may not reflect completely unforeseen events that may be major determinants of outcome. A sequential evaluation of GCS may yield greater accuracy . The overall number of our patients with complications or death was relatively small which may be affected power of prediction of complications by GCS scores. Given the listed most common agents of poisoning employed by the study population , it is likely that mortality and serious complications were negligible. Also, most of the previous studies have only included patients admitted to an intensive care unit. In contrast, our study included all poisoned patients presenting to the poisoning emergency department, which makes the results more generalizable.In our hospital there is not a toxicology lab; therefore, the toxicological screening was not carried out to confirm different kind of toxic agents. The diagnosis was based on history and clinical evaluation and summary records which had been confirmed by our poisoning emergency department specialists. Although “mixed drugs” toxicity has been taken, but any single agent may alter the outcome should also be considered.Lack of measuring intensity of treatment may be affected the rate of complications.Therefore, we suggest performing a larger prospective study of poisoned patients, comparing complication or death prediction of GCS scores and its components which measured over time.

The best method to deliver intraperitoneal chemotherapy (IPC) for peritoneal carcinomatosis from ovarian cancer is not well defined. The aim of this study was to assess the ability of hyperthermia and adrenaline to enhance the intratumoral accumulation of cisplatin in a rat model of peritoneal carcinomatosis.in vivo and in vitro (cytotoxicity on human ovarian cancer cells).Four groups of 5 BDIX rats with ovarian peritoneal carcinomatosis underwent IPC with 30 mg/l of cisplatin according to the following conditions: normothermia at 37° for 1 or 2 hours, hyperthermia at 42°C for 1 hour or normothermia at 37°C for 2 hours with 2 mg/l adrenaline. Tissue platinum content was measured by atomic absorption spectroscopy. The effect of hyperthermia, adrenaline and the duration of exposure to the drug was measured In vitro, hyperthermia and longer exposure enhanced the accumulation and the cytotoxic effect of cisplatin on cancer cells. In vivo, only the 2 hours treatment with adrenaline resulted in increased platinum concentrations. The rats treated with adrenaline showed significantly lower concentrations of cisplatin in extra peritoneal tissues than those treated with hyperthermia.Adrenaline is more effective than hyperthermia in order to enhance the intratumoral concentration of cisplatin in rats with peritoneal carcinomatosis from ovarian origin. It may also decrease the systemic absorption of the drug. Despite recent improvements, the prognosis of patients with peritoneal carcinomatosis from digestive or ovarian origin treated with systemic chemotherapy remains poor ,2. IntraIn previous papers, we reported that intraperitoneal adrenaline increased platinum uptake in rat peritoneal tumor nodules by a factor of 2 to 3 -19. AdreFemale inbred BDIX strain rats, 3 months old, weighing 200-250 g, were bred in constant conditions of temperature, hygrometry and exposure to artificial light. Experimental protocols followed the "Guidelines on the protection of experimental animals" published by the Council of the European Community (1986). The Burgundy's University Animal Care and Use Committee approved all of the procedures.A previously described rat model of peritoneal carcinomatosis was used. We previously reported the likeness of this rat model to human ovarian carcinomatosis in terms of peritoneal extension and chemo sensitivity to cisplatin . The DHD6 cells in each rat). The size of the peritoneal tumor nodules depended upon time.The cells were detached from the culture flask using trypsin and EDTA and centrifuged in the presence of complete culture medium with fetal bovine serum to inhibit trypsin. The PROb cells were suspended in 3 ml of serum-free Ham's F10 medium and then injected into the peritoneum of anesthetized rats , or 37°C for 1 hour (control cells).The PROb rat colon cancer cell line and the three human ovarian cancer cell lines were incubated In vitro cytotoxicity of cisplatin on cancer cells was determined using a quantitative clonogenic assay. Cells (5 × 104/well) were seeded and cultivated in 96-well tissue culture plates for 72 hours until confluence. Cell incubation with cisplatin was performed in serum-free Ham culture medium at 37°C or 42°C. After rinsing, the cells were trypsinized and seeded again in 24-well tissue culture plates. After 6 days of culture, the cells were washed with phosphate buffered saline, fixed with pure ethanol for 10 min, and then stained with 1% crystal violet in distilled water. After flushing the excess dye with water, the remaining dye was eluted with 33% acetic acid. The optical density (OD) was read on an automatic photometer at a wavelength of 540 nm. Cell survival was determined as the ratio of OD in treated wells to OD in control wells × 100. Experiments were done twice in triplicate.The rats were treated 21 days after intraperitoneal cell inoculation. Laparotomy was performed in anaesthetized rats to check the presence of a peritoneal carcinomatosis . At day 21 after cell injection, the tumor nodules were confluent in the epiploic area and extended partly to the peritoneum wall, including nodules in the area of the diaphragm. The abdomen was then closed in such a way as to make it watertight. Twenty rats were distributed into 4 groups of treatment (5 rats per group), which are presented in Table first group(control group) received 30 mg/l of intraperitoneal cisplatin in 50 ml of saline solution (9 g/l NaCl) at 37°C. The second groupreceived HIPEC for 1 hour at 42°C with 30 mg/l of cisplatin. After laparotomy, an electronic thermal probe was placed in the epiploic area, an inward catheter above the right liver, and an outward catheter in the left splenic area. After watertight abdomen closure, a closed circuit was established by an electric pump at a flow rate of 15 ml/min. Total volume of the circuit was 500 ml of saline solution which was pre-heated to 37°C. Starting time was defined as the moment the temperature reached 41.5°C and 30 mg/l cisplatin was added. The temperature was kept constant at 42°C for 1 hour in the peritoneal cavity by immersing an intermediate reservoir and about 1 meter of the circuit tubing in a thermostat-regulated bath at an average temperature of 48°C. The third grouphad a 2 hours treatment with 30 mg/l of cisplatin and 2 mg/l of intraperitoneal adrenaline: after 1 hour the abdomen was open to empty the peritoneal cavity and a second identical bath was then performed for 1 additional hour. A previous experiment showed that 1 hour of treatment with 2 mg/ml adrenaline at 37°C did not increase the platinum content in peritoneal nodules and, thus, such a group was not planned in this study (unpublished data). The fourth groupunderwent the same treatment as the third group, but without adrenaline. All animals from the 4 groups were kept anesthetized, lying on the back, for the entire duration of the treatment, using repeated IM ketamine and xylazine injections as necessary.The At the end of treatment, the rats were sacrificed; the abdominal cavity was opened and abundantly washed with water. Epiploic tumor nodules (200 mg), the left diaphragm, a piece of the muscle lining the abdominal cavity measuring 5 × 5 × 1 mm thick, parietal thoracic muscle (200 mg) in order to reflect the extra-abdominal tissues, half of the left kidney, and about 200 mg of the anterior edge of the liver were sampled and kept at -80°C until the platinum assay.The comparison of groups 1 and 2 should assess the effect of hyperthermia; that of groups 3 and 4 should assess the effect of adrenaline; and that of groups 1 and 4 should assess the effect of the duration of IPC. A 2-hour HIPEC was impossible due to intolerance of the animals.The total concentration of platinum was measured by atomic absorption spectrometry (AAS). Cultured cells were washed twice after cisplatin incubation, then trypsinised and counted. Cell pellets were frozen at - 80°C until AAS assay. After weighing, the frozen rat tissues were digested in a microwave digester . Platinum concentration was measured after dilution in distilled water, using a Zeeman atomic absorption spectrometer . Platinum is 65.01% of the molecular mass of cisplatin; to convert platinum concentrations into cisplatin concentrations, the first must be multiplied by 1.54.Because of the small sample size, nonparametric tests were used to analyze the concentrations of platinum and the operative time. The Kruskal-Wallis test was performed to detect global statistically significant differences in the extent of platinum accumulation in the organs and tumors between the four groups. When a significant difference was found the Mann-Whitney test was used for 2 × 2 comparisons between groups. A two-tailed P value of\0.05 was considered significant for all tests. Data collection and statistical calculations were performed by SPSS (version 10.0) software .A temperature of 42°C was toxic by itself. In comparison with the basal level, the number of residual adherent cells in the wells was reduced after 1 hour incubation at 42°C . This was not the case after 2 hours of treatment with cisplatin with or without adrenaline at 37°C. Cellular platinum concentration was increased by hyperthermia in all cells in a mean time of 15.5 minutes (range 4-21 minutes) with variations of less than 0.5°C along the procedure. Temperature was dependent on the flow rate and was unstable at a flow of less than 15 ml/min.Tolerance to HIPEC was poor. Only 3 out of 5 rats survived until the end of the experiment. The others presented an abnormal respiratory rhythm at about 45 minutes and died before the end. This precluded the performance of a 2-hour HIPEC. In contrast, all of the animals that were treated at 37°C, for either 1 or 2 hours, with or without adrenaline, were alive and well at the end of the experiment.Platinum concentrations in rat organs and peritoneal nodules were measured according to the different treatments Figure . RegardiOut of the peritoneal cavity (kidney and thoracic muscle), the accumulation of platinum was lower in group 3 than in groups 1 (control) and 4 (HIPEC) .The present study reports the greater uptake of platinum in peritoneal nodules and in peritoneum lining muscle when adrenaline was used in combination with cisplatin, as compared to HIPEC. This underlines the interest of adrenaline to increase the tissue concentration of chemotherapy and the fact that the best method to deliver of IPC remains to be defined ,17,21.The rats treated with adrenaline (group 3) received this treatment for 2 hours, as compared to those undergoing HIPEC (group 2) during only 1 hour. A 1-hour adrenaline group was not performed because a previous unpublished experiment found no significant difference after this treatment as compared to the control group. A 2-hour HIPEC was impossible due to intolerance of the animals to such a procedure. It could be argued that the longer exposure explains the higher tissue uptake of cisplatin. However, group 4 had a 2 hours IPC and did not achieved significantly better concentrations than group 1 (1 hour IPC); the difference was close to significance (p = 0.06), but it can not explain a 3-fold increase in concentration. The effect of time probably exists, but is small. This is consistent with the results of a previous pharmacokinetic study which showed that most of the uptake happens at the beginning of IPC, when the gradient of concentrations is higher: a twice 1-hour bath (as done in the present study) with a newly prepared identical solution was more effective than a 2-hour bath . SimilarAdrenaline also increased the drug content in the muscle of the abdominal wall. We observed a ratio of 5 to 17 in drug uptake between an abdominal muscle and a distant thoracic muscle. This reflects the pharmacological advantage of IPC to obtain high local drug concentrations in the abdominal wall, peritoneum and muscle lining, all of which are possibly infiltrated by malignant cells in peritoneal carcinomatosis. In previous studies we used a higher concentration of adrenaline (5 or 10 mg/L) ,19. In tDespite their longer exposure, rats treated with adrenaline showed lower extraperitoneal concentrations of platinum than both, the control and the HIPEC groups. This is probably explained by the vasoconstrictor effect of adrenaline which prevented the systemic diffusion, and thus, the potential toxicity of cisplatin. At the opposite, HIPEC has been shown to increase systemic absorption of chemotherapy drugs due to heat-induced vasodilatation .in vitro as in vivo [In vitro, the thermal enhanced ratio (TER) after 1 hour exposure at 42°C compared to 37°C ranged from 1.5 to 2.1, depending on the cell line. The TER was lower than that found in other studies [Our results confirmed the well-known enhancing effect of hyperthermia on the platinum uptake, as well in vivo -28. In vctively) ,27. The In vitro experiments on cancer cell lines alone cannot predict the in vivo effect of temperature or adrenaline. Tumor tissue penetration is the limiting factor for the activity of the chemotherapeutic agents [c agents . It has c agents ,30,31. Dc agents . This coc agents . An explc agents .in vitro (Figure In contrast with heat, adrenaline at a concentration of 2 mg/l for 2 hour achieved a 2 to 3-fold increase in platinum content in the peritoneal tumor nodules. Such an increase boosts the cytotoxic effect of cisplatin Experimental data show that adrenaline is more effective and better tolerated than hyperthermia in order to enhance the penetration of cisplatin. It also minimizes the systemic absorption of cisplatin. Hyperthermia was not well tolerated in this rat model, but it is in humans. Future clinical trials performing IPC with cisplatin for ovarian carcinoma should compare the effectiveness of adrenaline and hyperthermia in order to improve the effect of intraperitoneal chemotherapy.The authors declare that they have no competing interests.in vivo experiments. SL and HT carried out the in vitro experiments. BC participated in the design of the study and performed the statistical analysis. POD, FG and PR conceived the study, and participated in its design and coordination. All authors read and approved the final manuscript.OF, FR and DD carried out the

Conus venoms are rich sources of biologically active peptides that act specifically on ionic channels and metabotropic receptors present at the neuromuscular junction, efficiently paralyzing the prey. Each species of Conus may have 50 to 200 uncharacterized bioactive peptides with pharmacological interest. Conus regius is a vermivorous species that inhabits Northeastern Brazilian tropical waters. In this work, we characterized one peptide with activity on neuronal acetylcholine receptor (nAChR). Crude venom was purified by reverse-phase HPLC and selected fractions were screened and sequenced by mass spectrometry, MALDI-ToF, and ESI-Q-ToF, respectively. A new peptide was identified, bearing two disulfide bridges. The novel 2,701 Da peptide belongs to the cysteine framework I, corresponding to the cysteine pattern CC-C-C. The biological activity of the purified peptide was tested by intracranial injection in mice, and it was observed that high concentrations induced hyperactivity in the animals, whereas lower doses caused breathing difficulty. The activity of this peptide was assayed in patch-clamp experiments, on nAChR-rich cells, in whole-cell configuration. The peptide blocked slow rise-time neuronal receptors, probably α3β4 and/or α3β4α5 subtype. According to the nomenclature, the new peptide was designated as α-RgIB. Conus genus may produce from 50 up to 200 biologically active molecules that can be injected in the prey to capture or be employed as defense and/or escape mechanisms to deter competitors. The peptide toxins, called conopeptides, are composed of 10–40 amino acids and are abundant in the venom. Peptides presenting a rigid structure due to more than one disulfide bridges are common, being called conotoxins. These peptides act specifically on ionic channels and/or neuromuscular receptors [Marine mollusks from Conotoxins are classified according to three schemes: the similarities between the endoplasmatic reticulum signal sequence of the conotoxin precursors (gene superfamilies), the cysteine patterns of conotoxin mature peptide regions (cysteine frameworks), and the specificities to pharmacological targets , 4.α, which acts on neuronal acetylcholine receptor, have been found in the A, D, L, M, and S gene superfamilies [Conopeptides of the pharmacological family families , 6. α-conotoxins are peptides with 12 to 16 amino acid residues and two disulfide bridges, presenting the pattern CC-C-C. These peptides are competitive antagonists of the nicotinic acetylcholine receptors (nAChR) and display high selectivity by subtypes of this receptor [α-conotoxins significantly decrease the amplitude of the motor end plate postsynaptic potentials in vertebrates, paralyzing the prey [Typically, receptor , 7–9. Afthe prey .Conus regius is a vermivorous species that inhabits rock and coral deep waters of Florida (USA), Central America, and the Northeast and East coast of Brazil, including Fernando de Noronha archipelago [In the Brazilian tropical coast, there are approximately 18 species of cone snails . Conus rhipelago .Conus regius venom, belonging to the α-conotoxins family. This peptide blocks the neuronal acetylcholine receptors on PC12 cells, which comprise α3β4 and/or α3β4α5 subtypes receptors, probably target of the peptide. In this work we described a novel peptide from All the employed reagents were of analytical grade and were purchased from Sigma Co , unless otherwise stated. C. regius were collected at Fernando de Noronha Archipelago, Pernambuco, Brazil. The Brazilian Environmental Agency (IBAMA—Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis) license numbers were 030/2000 and 087/2001, and the process number was 02001, 000775/00-00. Venom was extracted from the specimens as previously described [Specimens of escribed . The cruVoucher material is deposited in the malacological collection of Zoology Museum of University of São Paulo, São Paulo, Brazil.μm, C18, 300 Å, 250 × 20 mm) in a two-solvent system: (A) trifluoroacetic acid (TFA)/H2O (1 : 1000) and (B) TFA/Acetonitrile (ACN)/H2O (1 : 900 : 100). The sample was eluted at a constant flow rate of 8 mL·min−1 with a 0 to 60% gradient of solvent B over 60 min. The HPLC column eluates were monitored by a Shimadzu SPD-10A detector scanning 220 nm. A reversed-phase binary HPLC system was used for sample fractionation. The lyophilized crude venom powder was solubilized into 0.1% trifluoroacetic acid (TFA) and aliquots were loaded in a Shim-pack Prep-ODS C18 column , in a 19 to 21% B gradient over 20 min, at a constant flow rate of 8 mL·min−1. A subsequent purification step was still necessary to obtain the peptide. This purification was conducted in a Merck C18 column (300 × 4.6 mm), in an isocratic elution at 35% B (TFA/methanol/H2O 1 : 900 : 100) at a constant flow rate of 1 mL·min−1.For Molecular mass analyses of the peaks and the peptides were performed on a micro-LC-MS Ettan coupled in a Q-ToF Ultima API and/or by MALDI-TOF mass spectrometry on a Ettan MALDI-ToF/Pro System .μRPC C2/C18 ST 1.0/150 column , with two solvents: (A) formic acid (FA)/H2O (1 : 1000) and (B) FA/ACN/H2O (1 : 900 : 100). The sample was eluted at a constant flow rate of 50 μL·min−1 with a 5 to 65% gradient of solvent B over 60 min. Q-Tof operated under positive ionization mode. For MALDI-TOF analyses, a-cyano-4-hydroxycinnamic acid was used as matrix. The analysis in the micro-LC-MS Ettan was performed in a μL·min−1 by a Hamilton infusion pump, or directly injected using a Rheodyne 7010 sample loop coupled to a LC-10A VP Shimadzu pump operating at 20 μL·min−1 constant flow rate. The instrument control and data acquisition were conducted by MassLynx 4.0 data system and experiments were performed by scanning a mass-to-charge ratio (m/z) of 50–1800 using a scan time of 2 s applied during the whole chromatographic process. The mass spectra corresponding to each signal from the total ion current (TIC) chromatogram were averaged, allowing an accurate molecular mass determination. External calibration of the mass scale was performed with NaI. For the MS/MS analysis, collision energy ranged from 18 to 45 and the precursor ions were selected under a 1-m/z window. Mass spectrometric “de novo” peptide sequencing was carried out in positive ionization mode on a Q-TOF Ultima API fitted with an electrospray ion source . Briefly, the amounts of previously lyophilized peptide were dissolved in 50 mM ammonium acetate, reduced with 50 mM DTT, alkylated by 150 mM iodoacetamide, and hydrolyzed by 25 nM trypsin, according to slight modifications of Westermeier and Naven . The reaα-RgIB was determined in Swiss Webster mice (5.5 to 7 g body weight) by observation of the behavioral disorders after intracranial injection [The biological activity of njection of the p3H1 cells, mouse myocytes which express nicotinic acetylcholine receptors, were acquired by ATCC (CRL-1443) and maintained in culture according to Sine and Taylor [BCd Taylor to electd Taylor .2, 2.38 mM CaCl2, and 10 mM glucose (pH 7.4). A recording electrode was filled with intracellular solution containing 25 mM HEPES, 141 mM KCl, 10 mM NaCl, 2 mM MgCl2, and 1 mM EGTA (pH 7.4). Experiments were carried out at room temperature (20–24°C).Individual cells were subjected to a patch-clamp, at a whole cell configuration, according to Hamill et al. and Urli3H1 cells and −70 mV for PC12 cells, holding potential using an Axon Axopatch amplifier . Data were recorded and digitized by Clampex 8.2 software and plots were made using Origin 7.0 software . Throughout the experiment, the membrane potential was clamped at a −60 mV for BCμM) was incubated on cells, and then another dose of the agonist was incubated [Control currents were performed with 1.5 mM carbamylcholine, using the cell-flow technique . After tncubated . α-RgIB, as well as three PDB deposited 3D solution structures, was created by I-TASSER [When data fitting was performed, results were presented as the calculated value ± standard deviation (SD). Otherwise, data correspond to the mean of three individual experiments. Peptide sequence alignment was performed using ClustalW software . The 3D I-TASSER , 24.C. regius was fractionated by RP-HPLC, as shown in The crude venom from After cysteine bridge reduction and alkylation, the reaction product was digested with trypsin. The obtained peptides were submitted to MS/MS analyses and ionsα-RgIB, according to the guidelines for conotoxins nomenclature ConoServer and has been assigned the following UNIPROT accession number: C0HJA8 [The peptide sequence was determined to be TWEECCKNPGCRNNHVDRCRGQV. This sequence has 4 cysteine residues with pattern CC-C-C, typical from conotoxins of framework I . This pe: C0HJA8 , 6, 26. α-conotoxins available at UniProt . Based on this large alignment, a phylogeny was constructed and the peptide sequences present at the branch containing α-RgIB were realigned mutants, a conotoxin that specifically and potently blocks the α9α10 nAChR [α-RgIB N- and C-terminal extensions and longer interbridge peptide sequence, the model and the structures are tridimensionally related, for example, a C-shaped structure, held by the Cys-bridges.A sequence alignment was performed with all ealigned . ClustalI-TASSER , 24, as 10 nAChR . In spitin vivo biological activity of the peptide was assessed by means of intracranial injection in Swiss Webster mice. Following 1 nmol injection, the animals displayed a hyperactive behavior, defecating and urinating all the time, which was not observed for the control group that received saline solution. Auditory stimuli, for example, a hand-clap or hitting the cage, also triggered the hyperactive behavior. Interestingly, the lower doses (0.1 and 0.5 nmol), caused the animals to have difficulty in breathing. Although the peptide promoted behavioral disorders, it was not lethal to the animals.The 3H1 cells, which express the acetylcholine muscle type receptors on the surface, and PC12, which terminally differentiate in neurons and express nicotinic neuronal receptors [Whole-cell voltage clamp measurement was used to verify the ion currents on acetylcholine receptors. BCeceptors were seleceptors , for it μM α-RgIB was not able to induce any change in the ion currents on BC3H1 cells (data not shown), as well as a higher dose (30 μM) of the peptide. d-tubocurarine (a classic nicotinic receptor antagonist) was used as a positive control and successfully to block this channel (data not shown).10 α-RgIB is able to block the ion current by 40%, compared to cells stimulated with carbamylcholine , the cysteine patterns of conotoxin mature peptide regions (cysteine frameworks), and the specificities to pharmacological targets , 4.α-Rg-IB because the peptide acts on neuronal acetylcholine receptors (“α”), was extracted from a Conus regius specimen (“Rg”), displays a cysteine framework I—CC-C-C (“I”), and was the second peptide discovered with both being from C. regius with a cysteine framework I (“B”) [This new peptide was termed I (“B”) . α-RgIA was the first α-conotoxin described from C. regius, acting on neuronal nicotinic receptors. This peptide has been thoroughly characterized in terms of its primary and three-dimensional structures [α9α10 nAChR [α-RgIA and α-RgIB come from the same animal, belong to the same toxin family, and possess similar biological effects; however, their amino acid sequences differ. α-RgIB and its closest phylogenetic relatives , besides α-RgIA, which was not considered to be similar (according to MEGA5), but was manually inserted in the figure for the benefit of sequence comparison. α-RgIA is shorter, both in the N- and C-terminal flanking regions, as well as in the inter-Cys-bridge region. Nevertheless, in a considerably small universe of possibilities , α-RgIA and α-RgIB bare considerable similarities: the Pro, at the 13th aligned position, and the charged residues at the 17th and 18th aligned positions. It is noteworthy to mention that, in spite of the phylogenetic analyses, all conotoxins listed in α-RgIA and α-RgIB) come from other Conus species: C. leopardus , C. litteratus (Q2I2R6), C. pulicarius and C. geographus (P01519). Moreover, only P01519 has been detected at the protein level and has been characterized as active on the muscular nicotinic receptors [ructures , as well10 nAChR , 31. α-Receptors . α-RgIA, the following toxins have been isolated from C. regius: P85009; P85010; P85011; P85012; and P85013, all α-conotoxin-like peptides belonging to superfamily A; P85016; P85017; P85018; P85019; P85020; P85021 and P85022, all belonging to the M-superfamily of conotoxins [1 superfamily ; and Rgα-RgIB and the conopeptides described until the present moment; therefore, the identification of a proper 3D structure to serve as a template for homology modeling is deprecated. Instead, a structure was predicted by using I-TASSER server [α-RgIA, α-RgIB model assumed the same basic shape as the NMR determined structures of the α-RgIA mutants, available at the PDB database [There is no high level of homology between R server , 24. Fidatabase . α-RgIB and thoroughly analyzing our data, we could not rule out the possibility that one of the glutamic acid (Glu) residues of this novel conotoxin would be a gamma-carboxyglutamic acid residue (Gla). Our suspicions arouse from the slightly higher deviation between the theoretical and calculated molecular mass values for A and B ions (C. regius conotoxins (α-RgIB included) will clarify this matter.Regarding the rather unique amino acid sequence of d B ions , that coα-conotoxins bind to nicotinic acetylcholine receptors. The subgroup α3/5 of α-conotoxins, from piscivorous Conus, has the motif CCX3CX5C and can cause paralysis of the prey by the binding on muscle nicotinic receptors. Another subgroup, α4/3, that present the motif CCX4CX3C, bind on neuronal nicotinic receptors. The main subgroup of α-conotoxins is α4/7, with motif CCX4CX7C. These peptides bind in all classes of nicotinic receptors: muscular , homomeric neuronal , and heteromeric neuronal (α-conotoxins MII and AuIB) [nd AuIB) .α or heteromeric α and β subunits assembled from a family of 12 distinct neuronal nicotinic subunits [α2, α3, and α4 with β2 and β4 results in a functional receptor, as well α7, α8, and α9 homomeric receptors [α3, α5, α7, β2, and β4 subunits of neuronal nicotinic receptors, the same pattern found by Sargent [α-Rg-IB affinity by the PC12 nicotinic receptors, there are still other neuronal nicotinic receptors that may be higher affinity targets for these toxins that were not explored in the present work. Neuronal nicotinic acetylcholine receptors (nAChRs) belong to the pentameric superfamily of Cys-loop ligand gated ionic channels. They are composed of either homomeric ; β2–β4) . The comeceptors , 41. In Sargent in PC12 Conus aulicus, which is also an α-conotoxin, blocks the α3β4 receptors; however, the currents can be recovered after the toxin washing [α-RgIB is probably due to the irreversible action of the peptide on the receptor. Successive applications of the agonist (carbamolycholine), in control experiments, did not cause recovery of the ion currents on slow rise-time receptors (data not shown). Besides the irreversible action, the peptide may also be able to prolong the desensitization time of the receptor, since the repeated CBC administration on α-RgIB-treated PC12 cells was not able to recover the initial current, which is either caused by the irreversible binding of a low affinity toxin or the prolonging of the desensitization time of the receptor (or both).AuIB, from washing . In our α3, α7, and β2 subunits of nAChR are correlated to fast rise-time receptors. The slow desensitization is a characteristic of α3β4 receptor, while α3β2 receptor is from fast desensitization [α3β2, α3β2α5, and α7 subunits, while slow desensitization receptors are formed by subunits α3β4 and α3β4α5. α-RgIB was able to inhibit the currents elicited by carbamolycholine on PC12 cells, mainly on the slow desensitization component, which comprise, in our model, α3β4 and α3β4α5 receptors. Sudweeks and Yakel showed ttization . The fasω-conotoxin GVIA causes trembling on the mice, which indicates an action on calcium ionic channels [α-nicotinic acetylcholine receptor (nAChR) is associated to attention-deficit/hyperactivity disorder [α-RgIB-treated hyperactive mice.The intracranial injection assay was performed to investigate whether there would be any direct activity of the toxin in the central nervous system (CNS), once peptides can promote behavioral alterations by acting on receptors and ionic channels on CNS. These alterations can indicate activities on specific ionic channels. For example, channels . The α-ndisorder which coConus regius and, by means of a combination of biochemical, structural and pharmacological assays were able to classify this peptide in the α-family and named it α-RgIB. There are still several peptides to be explored in the C. regius venom, as our previous qualitative investigations have shown [α-RgIB.In conclusion, we have isolated a novel conotoxin from ve shown and the α-conotoxins, one explanatory table with the toxin description and organism of origin and the resulting molecular phylogenetic tree built (by MEGA) on the alignment data. This tree branches provide a better visualization of the possible phylogenetic relations among the toxins. This tree served to locate the branch in which α-RgIB sits. The closest phylogenetic relatives were than reanalyzed for homology and presented in the main text. Moreover, this material also presents the expression profile of the nicotinic receptors detected in the employed cell cultures, which is important for proper pharmacological characterization.The accompanying figures and tables provide information that subside the results presented in the main text. These data consist of one CLUSTALW alignment of all deposited Click here for additional data file.

These predicted damping torques satisfied the specified damping torque of 475 N·m at 1.5 A and showed errors of less than 5% when compared to experimental measurements from the MR damper manufactured by the proposed design. The current study could play an important role in improving the performance of rotary type MR dampers.We designed and validated a rotary magnetorheological (MR) damper with a specified damping torque capacity, an unsaturated magnetic flux density (MFD), and a high magnetic field intensity (MFI) for unmanned vehicle suspension systems. In this study, for the rotary type MR damper to have these satisfactory performances, the roles of the sealing location and the cover case curvature of the MR damper were investigated by using the detailed 3D finite element model to reflect asymmetrical shapes and sealing components. The current study also optimized the damper cover case curvature based on the MFD, the MFI, and the weight of the MR damper components. The damping torques, which were computed using the characteristic equation of the MR fluid and the MFI of the MR damper, were 239.2, 436.95, and 576.78 N Unmanned vehicles for combat can run and petrol automatically to defend against enemy attack and intrusion. Unmanned vehicles can drive at a speed of 50 km/h, although on the off-road, and have approximately a weight of 1 ton with various machine guns and sensors to attack and detect enemies as well as to navigate a path . TherefoA damper is a major component of a vehicle suspension system that provides comfort and steering controllability of the vehicle . AlthougThe facts that a rotary MR damper (a rotary damper with an MR fluid) has a simple structure with a fast response speed driven by electronic control circuits , 18, 19 Unlike related studies in the literature, the present study attempted to investigate the effect of sealing locations and cover case curvatures on the performance of a rotary type MR damper, thus optimizing these design parameters. Moreover, the asymmetric nature of the MR damper used in the study requires that a detailed 3D FE model needs to be generated and that the damping torque needs to be calculated individually from the upper and lower surfaces between the disk and MR fluid. Therefore, the first objective of this study is to investigate the sealing location and the optimized cover case curvature of a rotary type MR damper which could maximize the magnetic field intensity (MFI) as well as to minimize the weight of the MR damper with the magnetic flux density (MFD) lower than the saturation limit. The second objective is to determine if the damping torque capacity of the proposed MR damper design would be suitable for unmanned vehicle suspension systems and further to validate it through comparisons of the analytical predictions and experimental measurements of the damping torque capacity for the proposed optimal design.The main issues in the design of a rotary MR damper are to reduce the size and weight of its components to allow installation within a limited space and to determine the optimal dimensions of the components such that the MR fluid has the maximum magnetic field strength. Reducing the size and weight of a rotary MR damper decreases the required driving energy of an MR damper-installed system with a corresponding increase in the efficiency of the system. In addition, optimization of the component dimensions contributes to maximizing the damping torque capacity of an MR damper. The proposed rotary MR damper is required to produce a damping torque of more than 475 N·m using 400 coil turns and an input current of 1.5 A at a rotating speed of 10 RPM. Our detailed design procedure is shown in Using ANSYS commercial finite element (FE) analysis software , we constructed a three dimensional (3D) magnetostatic finite element model based on an initial design of the rotary MR damper , 18, 27.The damping torque of the proposed rotary MR damper was computed using the characteristic equation of the MR fluid and the MFI of the rotary MR damper. When the MR damper could not achieve the required damping torque capacity, further changes in the design were made. For the final design of the rotary MR damper, the damping torque was experimentally measured to validate the design procedure and the accuracy of our analytical methods.Damping torque is generated by changes in friction between the rotating disk and MR fluid due to changes in the magnetically dependent viscosity of the MR fluid . The magTo achieve the desired damping torque capacity, the rotary MR damper is composed of single or multiple rotating disks connected to a rotating shaft, coils that generate a magnetic field, a sealed case to prevent the MR fluid from leaking outside by enclosing the coils, and various sealing rings . The casTtotal) of the rotary MR damper is given byTvis is the torque due to the viscosity of the MR fluid itself without applied current and Tyd is the torque due to increased viscosity with the increasing magnetic field strength of the MR fluid by the applied current.The total damping torque (η) of 0.250 Pa·s . Th. Th32]. In the magnetostatic FE analysis, 400 coil turns and an electric current of 1.5 A were modeled in the coil region . The magA magnetostatic FE analysis of the initial rotary MR damper design (Model A), as described above, resulted in a maximum MFD value of 1.66 T near the coil case of the upper cover case. The sealing area of the flange also showed a high MFD value of 1.62 T . At an aR) of the upper cover case was selected to be a design parameter, and the corresponding 3D model was constructed to 15 mm (Model C) in order to increase the cross-section of the saturated region and thereby decrease the MFD. Although Model B overcame the sealing area saturation problem of the MFD, the MFD value near the outer surface of the MR damper cover case (~1.7 T) was still saturated, as shown in structed . The gent, 1.6 T . Moreove = 16 mm . However = 16 mm . Based oThe magnetostatic FE analysis of Model C, obtained using the same electric current and boundary conditions as Model A and B, exhibited a maximum MFD value of 1.57 T in the middle of the cover and flange . This vaR = 25 mm (Model B) to R = 15 mm (Model C), the average MFI value increased by 22,800 mA/mm. Thus, the damping torque of Model C was expected to be higher than that of Model B.The damping torque capacity of the rotary MR damper was determined from the MFI magnitude on the contact plane between the MR fluid and the disk . To calculate the damping torque of the MR damper, the MFI values of the upper and lower contact lines between the MR fluid and the disk were extracted from Models B and C and plotThe MFI values were different between the upper and lower lines although at the same curvature size of the damper cover. Because previous investigators have generally designed MR dampers with symmetrical shapes between the upper and lower sides, both extracted MFI values at the upper and lower lines are equal to each other, and thus either one of the two MFI values calculated at the upper and lower lines can be used. In this study, however, the asymmetry in the MR damper against the horizontal plane led to two different MFI values between the upper and lower lines, and the use of both different MFI values enhanced the accuracy of the damping torque evaluation in the present study. There was a tendency for the MFI of the upper to be higher than that of the lower with decreasing damper curvature size as well as both MFI values of the upper and lower to increase with increasing distances from the center axis.The damping torques of the rotary MR damper calculated using both MFI values of the upper and lower contact region and the The damping torque was experimentally measured by changing the current using the custom-built testing apparatus shown in Using magnetostatic 3D FE analysis and the MR fluid characteristic equation, we successfully designed a rotary MR damper with a specified damping torque capacity and unsaturated magnetic flux density (MFD) for unmanned vehicle suspension systems. The present study revealed the effect of the sealing location and the cover case curvature on the performance of the rotary type MR damper and optimized the curvature of the MR damper cover case. The small cross-sectional area of the sealing region in the flange, due to the narrow gap between the rotation disk and the sealing ring, resulted in the saturated MFD. This saturated sealing region MFD was reduced below the saturation limit of the material by locating the disk and MR fluid positions in the middle of the coil and by increasing the gap between the MR fluid and the sealing point. Moreover, the MFD was very sensitive to the curvature of the MR damper cover case, and the saturated MFD in the radial region between the coil case and the MR damper cover could be addressed by adjusting the curvature of the damper cover case. This curvature was further optimized by considering the MFD, the magnetic field intensity (MFI), and the weight of the MR damper components.The damping torque of the rotary MR damper was predicted using the MFI of the MR damper and the characteristic equation of the MR fluid, with errors of less than 5% when compared to experimental measurements from the rotary MR damper, which was manufactured by our proposed design, using a custom-made testing apparatus. Here, the accuracy of the analytically predicted damping torque was improved due to the use of both MFI values of the asymmetric upper and lower contact areas between the MR fluid and disk as well as the use of the much detailed 3D MR damper model on FE analysis. The results of the present study could play an important role in the design of rotary MR dampers by reducing product development time and cost while maintaining a high level of performance.

Information about the identity and the location of perceptual objects can be automatically integrated in perception and working memory (WM). Contrasting results in visual and auditory WM studies indicate that the characteristics of feature-to-location binding can vary according to the sensory modality of the input. The present study provides first evidence of binding between “what” and “where” information in WM for haptic stimuli. In an old-new recognition task, blindfolded participants were presented in their peripersonal space with sequences of three haptic stimuli varying in texture and location. They were then required to judge if a single probe stimulus was previously included in the sequence. Recall was measured both in a condition in which both texture and location were relevant for the task (Experiment 1) and in two conditions where only one feature had to be recalled (Experiment 2). Results showed that when both features were task-relevant, even if the association of location and texture was neither necessary nor required to perform the task, participants exhibited a recall advantage in conditions in which the location and the texture of the target probe was kept unaltered between encoding and recall. By contrast, when only one feature was task-relevant, the concurrent feature did not influence the recall of the target feature. We conclude that attention to feature binding is not necessary for the emergence of feature integration in haptic WM. For binding to take place, however, it is necessary to encode and maintain in memory both the identity and the location of items. The functional and anatomical independence of the so-called “what” and “where” streams of processing has been repeatedly demonstrated in perception in different modalities Separate mechanisms have been shown to exist in humans for processing the Converging evidence of feature-to-location binding, however, demonstrates that “what” and “where” information can be also associated through mechanisms of binding in perception The association in memory between different dimensions of the stimulus is not necessarily bi-directional. Findings about non-mutual influences of one feature on the other show that, in some conditions, the encoding of a feature implicates the encoding of a second feature, but the encoding of the second feature does not implicate the encoding of the first The few studies that approached feature-to-location binding in haptics did not directly deal with working memory, but aimed instead at testing “what” versus “where” interference effects in perceptual tasks. For example, Purdy, Lederman and Klatzky The two abovementioned haptic studies show evidence of independent processing of spatial and identity information. The identity-location dissociability in the tactile domain contrasts with evidence of the automaticity of feature-to-location binding in visual In this study, we conducted two experiments aimed at directly testing whether the texture and the location of haptically explored objects are maintained in an integrated or in an independent fashion in WM. In Experiment 1, we associated location and texture in a conjunct condition where both features were relevant for the task. The main focus of Experiment 1 was to test whether an advantage in recognition would be observed for the intact probes over the recombined ones, consistent with a hypothesis of association in WM of the identity and the location of the tactile stimuli. In Experiment 2, we tested location and texture in two separate tasks. The second experiment required recognition judgments that were focused on either the identity or the location of the tactile items. These conditions allowed us to test whether the influences of the unattended feature - either the identity or the location - on the target feature are symmetric or asymmetric and whether identity-location binding takes place even when it is not necessary to memorize both features.We used a modification of the experimental paradigm proposed by Prabhakaran and collaborators 1L1, T2L2, T3L3. The learning phase was followed by a test phase in which a single probe stimulus was presented for immediate recall. The task required indicating whether both the texture and the location of the probe stimulus were presented in the learning phase. The following probe conditions were tested: an old texture in its original location (e.g. T2L2), an old texture in the location of another old texture (e.g. T2L3), a new texture in the location of an old texture (e.g. TnewL2), an old texture in a new location (e.g. T2Lnew) and a new texture in a new location (e.g. TnewLnew). The critical comparison was between intact probes (e.g. T2L2), where the association of the features is preserved between one of the stimuli of the learning sequence and the probe stimulus, and recombined probes (e.g. T2L1), where both a texture and a location used in the learning sequence were re-presented in the probe stimulus, though in a new combination. Since the task did not require associating texture and location, we reasoned that, if the two features were encoded independently, participants should show equivalent proficiency in responding to intact and recombined probes. Otherwise, if texture and location were integrated into multi-featured representations in WM, then intact probes should be recognized with greater ease than recombined probes. This is because an intact probe would match precisely the multi-featured representation of one of the learned stimuli, whereas a recombined probe would provide only a partial match to the representations of two learned stimuli.Participants were presented in a learning phase with different stimuli varying in texture (T) and location (L): for example TOur research involved healthy human participants in non-clinical behavioral testing. The experiments were conducted in agreement with the ethics and safety guidelines of Utrecht University, which are based on the Declaration of Helsinki. A written informed consent was obtained from all participants. Under the advice of the WMO Advisory Committee of the Faculty of Social and Behavioral Sciences at Utrecht University, we decided not to submit our study for approval to the Medical Review Committee (METC) of the Utrecht Medical Center (UMC), as an explicit approval was not necessary for studies of this kind.Twenty right-handed students of Utrecht University (mean age: 24.8 (SD = 4.0), 14 females) participated in the experiment in exchange for course credits or a small amount of money. All participants self-reported normal hearing, normal touch and normal or corrected-to-normal visual acuity.Two sets of 12 flat wooden squares of 10×10 cm were used. To the top of each square a specific material was attached which, when touched, was distinguishable from the others by its texture. Textures were selected from a set of 124 stimuli used in a previous study An arc-shaped exploration space subtending an angle of 160 degrees was arranged on a table in front of the blindfolded participant . Each trial included a learning phase and a probe phase. In the learning phase, the experimenter took three items from a set of twelve different textures and placed them in three of ten possible positions in the exploration space. The selection of textures, of positions and of their combination was quasi-random; in order to avoid confusion of items and positions belonging to different trials, a constraint was applied to the randomization process of stimuli and position that assured that textures and positions used in one trial could not be used in the following one. The list of positions and textures to be used in each trial of a block was displayed in a computer screen. The list of position-texture pairings was also used by the experimenter to record the participant’s responses in a digital file.new texture – new location where neither the texture nor the location of the probe were not included in the learned sequence, old texture – new location and new texture – old location in which either the texture or the location were new while the other feature remained unchanged between learning and probe phase. The amount of time to produce a response was unconstrained. Although participants were not forced to answer within a specific time limit, they tended to respond with comparable delays, which were typically in the range of 3 to 5 seconds from the first contact with the probe texture.In the learning phase, when verbally prompted, participants moved from one of the extreme positions – either the leftmost or the rightmost in the exploration space – towards the other extreme position until they found the first of the three stimuli in the learning sequence. They could feel its texture by rubbing one or more fingers over the surface of the square. Although exploration time was not fixed, participants were instructed to explore the texture rapidly. After exploration of the first texture they proceeded along the exploration space in the same direction they started, seeking a new texture to explore. Participants were not allowed to go back and re-explore previously touched textures. The experiment was divided into two sessions. In the first session, half of the participants started their exploration from the rightmost position proceeding leftward and the other half started from the leftmost position proceeding rightward. The direction of exploration was reversed in the second session. During exploration, participants performed an articulatory suppression procedure by sub-vocalizing the word ‘cola’ in order to prevent verbal recoding and rehearsal. When all the three textures had been explored, participants returned to the waiting position. Subsequently, in the probe phase, a single probe texture was placed in one of the ten positions of the exploration space. The experimenter was trained to remove the three textures used in the learning phase and to place the probe texture on the target position from the exploration space as rapidly as possible, but without interfering with any movement of the participant during exploration. As soon as the participant reached the resting position after the learning phase exploration, the probe texture had already been placed in the correct position and the participant could be immediately prompted to start the probe phase. This way, the delay between learning and probe phases was always equivalent for all trials and for all participants. In the probe phase, the single texture present in the exploration space might or might not have been already explored in the previous display. The position might or might not have been used in the learning phase. Participants haptically rescanned the exploration space with the same direction of exploration used for the learning sequence until they found the probe square. For each trial, one of the probe types shown in After responding, participants replaced their middle finger in the resting position waiting for the next trial. Eighteen trials per probe type were presented in two sessions of 45 trials. In order to attenuate the effects of learning, different sets of stimuli were used in the first and in second sessions. The experiment lasted about 1 hour and 30 minutes.d' was calculated according to the following formula: d' = ZH – ZFA where H is HITS (proportion of ‘yes’ responses when both the texture and the location of the probe were present in the learning sequence), FA is FALSE ALARMS (proportion of ‘yes’ responses when either the probe texture or the probe location or both were not presented in the learning sequence) and the function Zp, with p ∈ , is the inverse of the cumulative Gaussian distribution. The criterion was calculated as follows: C = −0.5[ZH+ZFA]. In addition to the signal detection analysis, two separate Analyses of Variance (ANOVA) with respectively positive and negative probe types as single factors were performed on the percentages of correct responses. The choice to separate the analyses of positive and negative probes was led by different reasons. First: we reckoned that positive and negative probes inform about different aspects of our theoretical questions. In fact, data from positive probes tell us whether or not recall is easier for intact than for recombined probes. Data from negative probes, instead, inform us about the relative weight of identity and location in the correct rejection of a negative probe. Second: by splitting the analysis we did not lose information about sensitivity as we already obtain a measure of sensitivity from the SDT analysis. Third: a previous study which we wanted to compare to ours The proportion of correct ‘yes’ and ‘no’ responses were calculated and signal detection theory (SDT) was employed to calculate sensitivity and the presence of a bias in the response (i.e. criterion). d' was 1.34, suggesting that participants were rather sensitive to variations in the probe stimuli. Moreover, the value of the criterion C was 0.03, which was not significantly different from zero: t(19) = 0.55, p = 0.59. This indicated that there was neither a bias toward a liberal approach nor a bias toward a conservative approach .Concerning SDT, the overall F = 13, p = 0.0019, ηp2 = 0.41. The ANOVA with negative probe types indicated a significant effect of probe type F = 27, p<0.001, ηp2 = 0.75. Pairwise comparisons specified that the new texture – new location probe condition (83% correct) was significantly more accurate than the old texture - new-location probe condition (66% correct) (p<0.001). The new texture – new location probe condition was also significantly more accurate than the new texture – old location probe condition (70% correct) (p<0.001). Finally, no significant difference between the old texture – new location probe and the new texture – old location probe condition was found (p = 0.64).Accuracy in all probe conditions is summarized in 2 = 1.63, p = .44.In order to test the presence of serial position effects, we compared the frequency of correct recalls of intact probes which were previously explored in the learning phase as first (81% of correct responses), as second (84% of correct responses) or as third item (79% of correct responses) in the learning phase sequence. The Chi Square analysis indicated that the percentage of correct responses did not differ as a function of the serial position in which the probe was presented in the learning phase, χIn Experiment 1, participants were presented with three stimuli varying in texture and location followed by a single probe stimulus. They were required to indicate whether the texture as well as the location of the probe stimulus had been presented in the learning sequence. Concerning general distinguishability, SDT analysis showed that participants were highly accurate in recalling textures and locations and did not show any response bias. Concerning feature binding, we compared accuracy in intact and recombined probes. In intact probes, both the texture and the location of one of the stimuli of the learning sequence were also presented in the probe stimulus. In recombined probes, the texture of one of the stimuli of the learning sequence and the location of another stimulus of the same list were recombined in the probe stimulus. Results indicated that, even if the combination texture and location was not relevant for the task, intact probes were recognized more accurately than recombined probes. This finding supports the hypothesis of an automatic integration of texture information and spatial location in WM representation and it is consistent with earlier evidence of feature-to-location binding in visual We also compared the accuracy in three different types of negative probes. Probes in which neither texture nor location were previously presented in the learning sequence were correctly rejected more often than probes in which only texture or only location were new. Importantly, the result of this comparison between negative probe conditions indicates that the relative weight of spatial and texture information is comparable and, therefore, that both location and texture equally contribute to memory recall. In sum, Experiment 1 revealed that when memory of both features is needed for an accurate response, item location and texture are represented in an integrated fashion in haptic WM.Finally, we tested whether the serial order of the item during encoding influenced accuracy of recall. We did not find any difference in the recall performance for probes that were previously encoded either as the first, second or third item during the learning phase. We can therefore exclude the presence of serial order effects in the memory representation of brief (3 items) sequences of tactile items.Since in Experiment 1 memory of both features was required to formulate a correct response, it was not possible to isolate the separate contributions of texture and location to the combined response. More importantly, it was also not possible to determine if texture-location binding takes place automatically even when it is not necessary to memorize both features. In order to clarify this issue, in Experiment 2 we investigated binding effects when only one of the two features was relevant for the memory task. Specifically, we used the same five probe conditions of Experiment 1 in two tasks in which memory for location and memory for texture were tested separately.Twenty right-handed students of Utrecht University (mean age: 22.6 (SD = 2.5), 14 females) participated in the experiment in exchange for course credits or a small amount of money. All participants self-reported normal hearing, touch and normal or corrected to normal visual acuity. Informed consent was obtained from all participants. None of the participants of Experiment 2 had taken part in Experiment 1.Stimuli and apparatus were the same as the ones used in Experiment 1.intact and recombined, in which both the texture and the location of the probe were included in the learning sequence, required always a ‘yes’ response, irrespective of the task. One probe type, new texture – new location, where both the texture and the location of the probe were not included in the learning sequence, required always a ‘no’ response irrespective of the task. Two probe types required a ‘yes’ response in one task and a ‘no’ response in the other task: new location – old texture and old location – new texture . Each participant completed 4 sessions of 30 trials for a total duration of 1 hour and 45 minutes, including breaks between sessions.The main difference with Experiment 1 was the presence of two distinct and independent tasks for location and for texture discrimination. Four sessions of 30 trials each were performed with 12 trials per probe type. In two blocks, participants were required to memorize and recall only the position of the stimuli, whereas in the other two blocks, they were told to attend to the textures of the stimuli only. Two directions of exploration (from left to right and from right to left) were required in both tasks. The order of presentation of the two tasks (texture and location) and the direction of exploration (from right to left and from left to right) were counterbalanced between participants. Analogously to Experiment 1, an articulatory suppression task was required during exploration. Supplementary tasks were added during the learning phase to guarantee the perceptual processing of the task-irrelevant dimension. Specifically, in the location blocks, participants were required to say aloud “rough” or “smooth” according to their perception of each item along the dimension roughness/smoothness. Analogously, when performing the texture blocks, participants judged the location of each item, saying aloud “right” or “left” according to the position of the item with respect to their midsagittal plane. This way, we were sure that the information about the task-irrelevant feature was perceptually processed, although not necessarily maintained in WM. Two probe types, d' and the criterion for both the texture and the location tasks. We ran two repeated-measures ANOVAs to measure the influence of the task on the d-prime and on the criterion, respectively. Regarding the role of the probe conditions, we conducted separate ANOVA analyses for the location task and for the texture task, as well as for positive and negative probes.Concerning SDT analysis, analogously to Experiment 1, we calculated d' = 1.49) and location (d' = 1.54) tasks, indicated that participants were comparably sensitive to variations in the texture and in the location of the stimuli: F = 0.079, p = 0.22, pη2 = 0.009. Concerning the response bias, one-sample t-tests indicated that the criterion in the texture task (C = 0.17) and in the location task (C = 0.13) were both significantly different from zero: t (19) = 2.6, p = 0.016 for the texture task and t (19) = 2.4, p = 0.029 for the location task. These criterion values indicate a bias towards a positive response, namely the tendency to produce ‘yes’ responses, which is often termed a “liberal approach”. The ANOVA between criteria of the location and of the texture task were not significantly different: F = 0.25, p = 0.37, ηp2 = 0.013.The ANOVA between d-primes of the texture  = 0.58, p = 0.57, ηp2 = 0.060. Also, no difference was found in the comparison of the two negative probe conditions, i.e., new texture - new location (75% correct) and old texture – new location (79% correct): F = 1.1, p = 0.31, ηp2 = 0.055. Analogously, in the texture task, the comparison between the three different positive probe conditions, i.e., intact (84% correct responses), recombined (81% correct) and old texture – new location (81% correct responses) showed no difference between conditions, F = 0.67, p = 0.52, ηp2 = 0.069. Also, no difference was found between the two texture negative probes, i.e., new texture – new location (70% correct) and new texture – old location (71% correct): F = 0.012, p = 0.91 ηp2 = 0.001.Results about accuracy in the different conditions of the location and the texture tasks are shown in F = 1.1, p = 0.39, ηp2 = 0.22, no effect of task F = 3.29, p = 0.08, ηp2 = 0.15, but a significant interaction between eccentricity and task: F  = 3.3, p = 0.023, ηp2 = 0.172. The post-hoc analysis indicated that participants in the location task only were more accurate (p = 0.04) in the extreme positions (1 and 10) than in the positions next to the extreme positions (2 and 9). A comparison was also made between recall accuracy of probe items located in position 1 and probe items in position 10, which are the most dissimilar in terms of movement and positioning of hand, arm and torso during exploration. Paired-samples t-tests indicated no difference between the two conditions, neither in the location task t(19) = 0.8, p = 0.43 nor in the texture task t(19) = −0.31, p = 0.76.We performed additional analyses in order to measure the influence of intervening factors, like the position of the probe item along the exploration arch and the direction of exploration. Specifically, we wanted to verify whether certain positions along the exploration arch would be easier to recall and whether lateralization could influence item representation in WM. An ANOVA with probe location eccentricity and task as factors showed no effect of probe location, F = 2.4, p = 0.1, ηp2 = 0.11, no effect of task  = 0.14, p = 0.28, ηp2 = 0.007) and no interaction between direction and task F  = 0.076, p = 0.21, ηp2 = 0.004.Concerning the influence of the direction of exploration, a two-factors ANOVA with the direction of exploration and task showed no effect of direction: In Experiment 2, where the spatial and the identity tasks were separated, accuracy in the recall of both the location and the texture of items did not vary as a function of the probe type. This result indicates that when one of the two features is task-irrelevant, the representation of the two features is not necessarily integrated in WM. This lack of integration is not caused by a lack of processing, since participants were forced to process the task-irrelevant feature in supplementary tasks during encoding. We interpret this result as evidence that information can be discharged from WM maintenance when it is not relevant for the task. Notably, previous studies in other sensory modalities have found that variations in the task-irrelevant dimension can affect the recall of the target dimension. For example, Maybery and colleagues  = 2.2, p = 0.15), p2η = 0.10) and between the conjunction and in the texture condition  = 0.86, p = 0.37), p2η = 0.043). If binding would cause an impairment of sensitivity, we would expect a worse performance in the conjunction condition than in the single-feature conditions. This was not the case, since we did not find any negative effect of binding on sensitivity. We interpret this result as further proof of the automaticity of binding between texture and location in haptics.In order to verify whether the simultaneous encoding of the two features impairs sensitivity to variation in a single feature, we ran two between-subjects ANOVAs comparing d-prime in the conjunction task (Experiment 1) to d-prime in the location-only task and in the texture task, respectively (Experiment 2). Notably, results indicated no difference between In Experiment 1, we showed that the accuracy in the conjunct recall of texture and location of a sequence of haptically explored items varies as a function of the probe type. More specifically, even if the combination of texture and location was not relevant for the task, intact probes were recognized more accurately than recombined probes. We interpreted this data as evidence of binding between spatial and texture information in WM, as already observed in vision Concerning the automaticity of binding, a cross-experiment comparison indicated that the sensitivity to variations in both location and texture is analogous to sensitivity to variation in either location or texture. Since binding does not have any negative effect on sensitivity, it appears that the integration of features is effortless and does not imply an increased cognitive load.Which are the neural mechanisms subserving feature integration in working memory in haptics? As far as we know, there are no studies focusing on the neural mechanisms of “what” and “where” integration in haptics. However, previous research in the visual domain suggested a crucial role for the prefrontal cortex for the integration of spatial and non-spatial information Finally, no effects of the contingent aspects of exploration, such as the direction of the exploration and the position of the items in space, suggest the intervention of recoding mechanisms, from an egocentric representation during exploration to an allocentric representation in maintenance and recall.The present study is the first study to provide evidence of binding between “what” and “where” information in WM for haptic stimuli. We investigated whether the representation of location and texture of tactile items is integrated in a conjunct representation both in a condition in which each is relevant for the task and in a condition where only the location or only the texture must be maintained in memory for future recall. When both features were task-relevant, results indicated that, even if the association of location and texture is neither necessary nor required to perform the task, participants integrate the two features in a single memory representation. By contrast, when only one feature is relevant for memory recall, results indicate that the task-irrelevant feature is not able to influence the recall of the target feature. Considering the combined result of the two experiments, we conclude that attention to the association between features is not necessary for the emergence of feature-to-location binding in haptic WM. For binding to take place, however, it is necessary to encode and maintain in memory both the identity and the location of items.

Neuroimaging data revealed a frame by response interaction, showing an increase of neural activity in the right rolandic operculum/insular cortex, the anterior cingulate, among other regions, for accepting the frame “I take” vs. rejecting, as compared to accepting the frame “I give you” vs. rejecting. In addition, the left occipito-temporal junction was activated for “I take” vs. “I give you” for offer 5, corresponding to the equal offer made unpleasant by the presence of the frame “I take,” where is the proposer that takes the money. Our data extend the current understanding of the neural substrates of social decision making, by disentangling the structures sensitive to the way in which the information is formulated , in terms of gain or loss.It has now become widely accepted that economic decisions are influenced by cognitive and emotional processes. In the present study, we aimed at disentangling the neural mechanisms associated with the way in which the information is formulated, i.e., framing effect, in terms of gain or loss, which influences people's decisions. Participants played a fMRI version of the Ultimatum Game (UG) where we manipulated bids through two different frames: the expression “I give you” ( Cross-field research in experimental economics and cognitive psychology has clearly demonstrated how both the cognitive and emotional processes may influence economical decision-making , two players are asked to divide a given amount of money: the proponent must decide how this money should be divided, while the responder may accept or reject the offer. If the responder accepts the offer, both players receive the agreed amount, but if the responder rejects, neither of them gets anything. What has been observed is that when participants play as responders, they tend to reject about 5 of bids below the 2–3 of the total when the offer was framed as a loss rather than as a gain, and a higher rate of rejection under the loss than the gain frame with mid-value offers (3 out of 10€). Accordingly, in the present study we hypothesized that the frame “I take” might elicit stronger bodily responses because it might be interpreted more negatively.In a previous psychophysiological study vs. gain (“I give you”) frame in emotional areas such as the amygdala and anterior insula.A total of 17 males right-handed , middle [3€], and fair [5€] . Stimuli were projected through a VisuaStim Goggles system (Resonance Technology). Subjects responded by pressing the corresponding keys of an MRI-compatible response device .For each experimental trial a fixation point (500 ms) was presented, followed by the offer , after which a 2 s display indicated that the response (“accept”/”reject”) could be made (“decision slide”). Trials were intermixed by inter-trial intervals ranging randomly from 3060 to 6720 ms with an incremental step of 60 ms. Instructions emphasized that the participants should press the selected key when the decision slide appeared on the screen.N = 20 trials): subjects were told that, in order to acquire familiarity with the structure of the task, they had to play some fake trials on a computer outside the scanner, being informed that the offers were not real, and the subject was told that they wouldn't have been calculated in the final payoff. The offers could take any amount.Each experimental session included 62 randomized trials, including 54 experimental trials [3 × 2 × 9 repetitions], yielding a total of 27 offers for each frame condition and 8 trials of no interest (2 offers with gain 2€ and 2 offers with gain 4€), were included for each frame condition in order to represent the full range of offers the hypothetical proposers would make, while keeping reasonable the total number of trials sequence of the whole brain. EPI volumes for the main experiment contained 30 transverse axial slices and were preceded by 5 dummy scans that allowed the MR signal to reach a steady state. After functional neuroimaging, high-resolution anatomical images were acquired using a T1-weighted 3-D magnetization-prepared, rapid acquisition gradient fast filed echo (T1W 3D TFE SENSE) pulse sequence lasting 8.8 min.A 3.0-T Philips Achieva whole-body scanner was used to acquire T1-weighted anatomical images and functional images using a SENSE-Head-8 channel head coil and a custom-built head restrainer to minimize head movements. Functional images were obtained using a T2http://www.ubuntu.com/) using MATLAB r2007b and SPM5 . Dummy scans were discarded before further image processing. Preprocessing included spatial realignment of the images to the reference volume of the time series, segmentation producing the parameter file used for normalization of functional data to a standard EPI template of the Montreal Neurological Institute template provided by SPM5, re-sampling to a voxel size of 2 × 2 × 2 mm, and spatial smoothing with a 6-mm FWHM Gaussian kernel to meet the statistical requirements of the General Linear Model and to compensate for residual macro-anatomical variations across subjects. We performed a whole brain random effects analysis closely following the model previously used by some of us = 3.37, p = 0.089, n.s.; resp type, F = 1.012, p = 0.33, n.s.; frame × resp type interaction, F = 0.01, p = 0.90, n.s.], thus cells were comparable between conditions. On the first-level analysis, we modeled as the regressors of main interest the response types (accept/reject) and the frames “I take” and “I give you” and their temporal derivative. We also included the motor response as a further regressor of no interest In addition, to correct for motion artifacts, subject-specific realignment parameters were modeled as covariates of no interest. Low-frequency signal drifts were filtered using a cut-off period of 128 s. At the single subject level, specific effects were assessed by applying appropriate linear contrasts to the parameter estimates of the experimental conditions resulting in t-statistics for each voxel. For the second-level random effects analyses, contrast images obtained from individual participants were entered into a one-sample t-test to create a SPM{T}, indicative of significant activations specific for this contrast at the group level. We used a threshold of p < 0.05, corrected for multiple comparisons at the cluster level [using family-wise error (FWE)], with a height threshold at the voxel level of p < 0.001, uncorrected. The anatomical localization of the functional imaging results was performed using the SPM Anatomy toolbox .SPSS for Windows (version 14.0) was used for performing a repeated measure ANOVA with within-subject factors type of “frame” and “gain” on the subjects' rejection rates and response times (RTs) data. All At the debriefing, all participants reported that they believe the offers came from genuine humans.F = 23.91, p < 0.001, with significantly less rejections for gain 5€ vs. 1€ , and for 5€ vs. 3€ compared with 3€ vs. 1€ = 0.35, p = 0.56] and the frame × gain interaction were not significant.We found a significant main effect of gain, F = 0.93, p = 0.76, n.s., η2 = 0.0022; gain, F = 41.5 p < 0.001 η2 = 0.679, with significantly less rejections for gain 5€ vs. 1€ , and for 5€ vs. 3€ compared with 3€ vs. 1€ ; frame × gain, F = 0.94, p = 0.40, n.s. η2 = 0.0201].Identical effects were found also when we removed from the analysis four participants who never rejected an offer, because it was necessary that all the subjects considered had rejections in both the frames in order to perform an ANOVA without empty cells factors. Irrespective of frame, unfair (1€) gain [vs. middle gain (3€)], differentially activated the anterior cingulate cortex (ACC). Furthermore, fair (5€) gain [vs. middle gain (3€)], differentially activated (i) the left superior parietal lobe (Area 7a), extending to the precuneus, (ii) the middle cingulate cortex.For the fair (5€) gain, the frame “I take” (vs. “I give you”) differentially activated the left occipito-temporal junction and the middle temporal gyrus focusing on money the respondent would receive if she/he agreed with the proponent, and the expression “I take” (loss) focusing on the money that would be removed from the respondent in the event that she/he accepted the offer. Behaviorally, unfair offers were equally often rejected in both conditions. This is different from what was found in the study by Sarlo et al. the offers presented in the frame “I take,” as compared to the frame “I give you.” We reasoned that in the loss frame one should be more prone to reject with respect to the gain frame; it follows that when participants accept in the loss frame they deviate more from their “expected” response, even though this interpretation is speculative, as we cannot provide behavioral evidence to support the expectancy hypothesis. Accordingly, the operculo-insular cortex might signal this deviation from participants' own expected behavior. It has been proposed that the equal treatment is a default social norm, and its violation is signaled by the anterior insula or the proposer along with the responder (“I give you”), thus modulating the activity of mechanisms of self-other distinction that are associated with posterior insula and rolandic operculum was significantly activated independent of the frame in which offers were formulated, i.e., “I give you” or “I take” by gain 5€ as compared to 3€, thus for equal offers. In addition, the left area 7a was significantly activated by the frame by decision interaction, in which the responder takes but this time the player accepts. When you accept in the loss frame you deviate more from your “expected” response. It is not only the insula signaling this deviation from your own expected behavior, but also area 7, which has been related to egocentric (body- and body part-centered) coordinates coding . Our coordinates of the left occipito-temporal junction cluster are in the proximity to previously reported locations of extrastriate body area (EBA) in human brain (Arzy et al., We found that the right calcarine gyrus and the right cuneus were significantly activated by the frame by decision interaction, in which the responder takes but this time the player accepts. We can exclude that this activation is related to visual processing of the stimuli since it is a product of the interaction term. Rather, we suggest that in this condition there is an increase of implicit visual imaginary processes, as described above, which triggers an increase of activation in areas related to visual imagery of scenes and characters (Kosslyn et al., To conclude, we argue that areas involved in imaginary task were found activated by our version of the UG, mainly in the frame by decision interaction, in which the responder takes and the player accepts. This condition corresponds to a loss frame, and here participants deviate from their “expected” response. Thus, deviation from participants' own expected behavior are signaled not only by the posterior insula/rolandic operculum but also trigger an increase of activation in areas related to mental imagery. Our findings extend the current understanding of the neural substrate of social decision making, by disentangling the structures sensitive to the way in which the information is formulated, i.e., framing effect, in terms of gain or loss, which influences people's decisions.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Translational Neurodegeneration would like to thank all our reviewers who have contributed to the journal in Volume 2 (2013).The editors of William BrooksAustraliaHuaibin CaiUnited States of AmericaMeghan CampbellUnited States of AmericaPiu ChanChinaHonglei ChenUnited States of AmericaQi ChengChinaEmilio CiusaniItalyJianqing DingChinaYiru FangChinaSerge GauthierCanadaCheng-Xin GongUnited States of AmericaHaigang GuUnited States of AmericaMarwan HarizUnited KingdomMaria Trinidad HerreroSpainYue HuangAustraliaNancy IpChinaKurt JellingerAustriaZun-JI KeChinaFuzhong LiUnited States of AmericaJun LiuChinaWeiguo LiuChinaXuebin LiuChinaXiao-Guang LuoChinaGuozhao MaChinaJianfang MaChinaKangmu MaUnited States of AmericaJan MarcussonSwedenIan McKeithUnited KingdomM Maral MouradianUnited States of AmericaElizabeth Sajdel-SulkowskaUnited States of AmericaYuan ShenChinaHideto ShinnoJapanFlorindo StellaBrazilBomin SunChinaEK TanSloveniaBeisha TangChinaGang WangChinaHonglin WangChinaJian WangChinaJianzhi WangChinaNing WangChinaFrances WeaverUnited States of AmericaHoward WormanUnited States of AmericaRuey-Meei WuTaiwanZhi-Ying WuChinaKun XiaChinaChen XianwenChinaQin XiaoChinaShifu XiaoChinaTao XieUnited States of AmericaZhongcong XieUnited States of AmericaZhen YanUnited States of AmericaJingya ZhangUnited States of AmericaJialin ZhengUnited States of AmericaJiawei ZhouChinaXiongwei ZhuUnited States of America

There is no hydrogen bonding or π–π stacking in the crystal structure.In the title compound, C Å b = 8.1587 (4) Å c = 16.1487 (8) Å α = 100.404 (1)°β = 95.897 (1)°γ = 96.490 (1)°V = 1000.85 (9) Å3 Z = 2 Kα radiationMo −1 μ = 0.32 mmT = 173 K 0.46 × 0.30 × 0.28 mm Bruker SMART 1000 CCD diffractometerSADABS; Sheldrick, 2004T min = 0.868, T max = 0.917Absorption correction: multi-scan (7798 measured reflections3857 independent reflectionsI > 2σ(I)3268 reflections with R int = 0.018 R[F 2 > 2σ(F 2)] = 0.036 wR(F 2) = 0.122 S = 1.15 3857 reflections256 parametersH-atom parameters constrainedmax = 0.33 e Å−3 Δρmin = −0.31 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536810042601/ng5049sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536810042601/ng5049Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Tea is believed to be beneficial for health, and the effects of the fermentation process on its contributions to apoptosis and cell cycle arrest of gastric cancer cells have not been completely investigated. In this study, the chemical components in green tea, black tea and pu-erh tea aqueous extracts were analyzed and compared. The polysaccharide and caffeine levels were substantially higher in the fermented black tea and pu-erh tea, while the polyphenol level was higher in the unfermented green tea. Hence, a treatment of tea aqueous extract and the components, which are emerging as promising anticancer agents, were pursued to determine whether this treatment could lead to enhance apoptosis and cell cycle arrest. In the human gastric cancer cell line SGC-7901, the cell viability and flow cytometry analysis for apoptotic cells indicated effects in a dose-dependent inhibition manner for the three tea treatment groups. The apoptosis rates were found to be elevated after 48 h of treatment with 31.2, 125, and 500 μg/mL of green tea extract, the higher catechins content may be involved in the mechanism. Cell cycle was arrested in S phase in the fermented black tea and pu-erh tea, and the populations were significantly decreased in G2/M phases, possibly due to the oxidation of tea polyphenols, which causes an increase of theabrownins. CCC-HEL-1 normal cells were not sensitive to tea extract. These findings suggest that the fermentation process causes changes of the compounds which might be involved in the changes of cell proliferation inhibition, apoptosis induction and cell cycle arrest. Generdiseases ,8. Thesediseases .Catechins, which comprise epigallocatechin-3-gallate (EGCG), epigallocatechin (EGC), epicatechin-3-gallate (ECG), and epicatechin (EC), are members of the four main tea phenolic compounds. Catechins have attracted significant attention recently . The manThe possible cancer preventive activity of tea has received much attention in recent years. The inhibitory activities of tea and tea constituents against carcinogenesis have been demonstrated in many animal models –18. Gast2.2.1.2.2.Because the samples of tea extract have been obtained from the same locations, the origins and manufacturing processes of these tea samples are similar. Therefore, we decided to study the effect of the fermentation process on the levels of these constituents. In this study, the fermentation processes are carried out by tea-making experts in the China Academy of Pu-erh Tea Research. The resulting tea products are classified according to the degree of fermentation as unfermented tea (green tea), fully fermented tea (black tea) and post-fermented tea (pu-erh tea). The active ingredients, including tea polyphenol, polysaccharides and caffeine in green tea, black tea and pu-erh tea were analyzed and compared in our study . It seem2.3.50) value of SGC-7901 cells at 48 h was 335.9, 511.5, 658.1 μg/mL, respectively. The cell viability of the two groups that underwent fermentation process was relatively higher than the green tea treatment. It was noted that green tea had more inhibitory effect than black tea and pu-erh tea on cell growth.The human gastric cancer cells SGC-7901 and CCC-HEL-1 normal cells were treated with various concentrations of tea extract and their main compounds for 48 h, which induced a significant decrease in MTT reduction. The cell viability was expressed as MTT conversion rate. In SGC-7901 cells, green tea, black tea and pu-erh tea extract could inhibit the growth of gastric cancer cells in a dose dependent manner . There w50 value of catechins, theabrownins and caffeine on SGC-7901 cells at 48 h was 99.1, 522.0, 808.5 μg/mL, respectively. Samples at the concentration of 15.6–500 μg/mL on cell viability was depicted and the late stage of apoptosis (upper-right) in SGC-7901 and CCC-HEL-1 cells were investigated. We examined the concentration-dependence of the samples on apoptosis in SGC-7901 cells. As demonstrated, treatment with tea extracts for 48 h induced early and late stage apoptosis . Resultsin vivo inhibition of tumorigenesis.The results from apoptotic analysis for the CCC-HEL-1 normal cells showed that the percentage of early apoptosis after treatment 500 μg/mL green tea, black tea and pu-erh tea was 4.99 ± 0.98%, 4.19 ± 0.36% and 5.08 ± 0.73%. 250 μg/mL catechins and theabrownins induced slight apoptosis , newborn calf serum, and 3-- 2, 5-diphenyltetrazoliunbromide (MTT) were purchased from GIBCO BRL .Trypsin, penicillin, streptomycin and all other chemicals employed in this study were of analytical grade and were purchased from Sigma Chemical Co. . Catechins, theabrownins and caffeine were provided by China Academy of Pu-erh Tea Research . Fluorescein isothiocyanate-conjugated annexin V (Annexin V-FITC) and propidium iodide (PI) Apoptosis Detection Kits was purchased from BD Biosciences . Propidium iodide (PI) for cell cycle analysis was from Calbiochem .3.2.The tea leaves of green tea, black tea and pu-erh tea were collected from plants grown in the Yunnan Highlands of China. Green tea leaves were collected and heated, dried at <60 °C and molded to make unfermented tea. To make fermented black tea and post fermented pu-erh tea, the tea leaves were dampened and fermented, then dried at <60 °C and packed. Green tea, black tea and pu-erh tea were extracted three times by placing in boiling distilled water for 10 min each time. The solution was collected, lyophilized to obtain the aqueous extract.3.3.2 = 0.9957. Caffeine was quantitated using the lead subacetate method [2 = 0.9997.Determination of polyphenol content was performed under the guidelines of national standards using the ferrous tartrate method ,28. Briee method . A stand3.4.2.Catechins, theabrownins, caffeine, green tea, black tea and pu-erh tea extract were dissolved in complete DMEM, the pH value adjusted to 7.2 and sterilized through a 0.2 μm filter to the desired working solutions . Human gastric cancer cell line SGC-7901 was provided by the Cell Bank of Shanghai Institute of Cell Biology, Chinese Academy of Sciences . Human primary embryo liver-derived cells CCC-HEL-1 was obtained from cell center of the Chinese Academy of Medical Sciences and Peking Union Medical College. Cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS), 100 mg/mL streptomycin and 100 units/mL penicillin at 37 °C in a humidified incubator in an atmosphere of 5% CO4 cells/well) for 24 h incubation, cell viability was evaluated using MTT assay as described previously [50 (cytotoxic concentration for 50% cell death) was determined from the dose-response curve.SGC-7901 and CCC-HEL-1 cells were seeded in 96-well plates (1 × 10eviously . In brie3.5.5 cells/well) for 24 h incubation and treated with various drugs at the indicated concentrations for 48 h. Apoptosis of cells was evaluated by measuring the exposure of phosphatidylserine on the cell membranes using Apoptosis Detection Kits. Cell pellets were resuspended in a staining solution containing PI and Annexin V-FITC for 15 min at room temperature in the dark. The cells were assessed by FACS equipped with the Cell Quest software . Cell cycle analysis was undertaken by flow cytometric analysis after propidium iodide (PI) staining. Briefly, cells in suspension with and without drugs were fixed with ethanol at 4 °C for 24 h and then stained with 50 μg/mL of PI, 100 μg/mL RNase A in a PBS solution. After staining, the population of cells in each cell cycle phase was determined using the ModFit software .SGC-7901 and CCC-HEL-1 cells were seeded in 6-well plates . Statistical analyses were evaluated using Student’s t-test. Analysis of variances and pairwise comparisons were examined by ANOVA single-factor test at the P < 0.05 confidence level.4.Although the anti-carcinogenic activities of tea have been demonstrated in many studies, epidemiological evidence for a protective role of tea consumption against cancer in human populations is weak. These inconsistencies may be due to the insufficient intake of tea. Therefore, to understand the chemopreventive effect of tea, higher amounts may have to be consumed. A second possible reason for the discrepancy between human epidemiological studies and experiments is that the human population is not homogenous in genetic makeup and life style, and the results are influenced by many confounding factors ,32. Somein vitro cytotoxicity of EGCG have shown its greater toxicity to cancer than to normal cells and have suggested that EGCG, the most abundant polyphenolic in green tea, was the prime agent mediating the chemopreventive properties of green tea [in vivo studies showing green and black tea extracts inhibit tumorigenesis in animal model systems, are suggestive of the potential protective role of teas against human cancers [The use of tea, as a cancer chemopreventive agent has been appreciated in the last twenty years. It has now been suggested that tea polyphenols potently induce apoptotic cell death and cell cycle arrest in tumor cells but not in their normal cell counterparts and affect several biological pathways. As supporting evidence, various animal studies have revealed that treatment with tea inhibits tumor incidence and multiplicity in different organ sites such as skin, lung, liver, stomach, mammary gland, and colon ,34. Severeen tea . Such fi cancers . The can cancers .5.The data acquired from chemical components and flow cytometric analysis in this study gave us clues to the key molecules that contribute to apoptosis and cell cycle in gastric cancer. We found that catechins, the main tea phenolic compounds, could induce early apoptosis of gastric cancer cell lines SGC-7901 higher, and during the fermentation process the content of phenolic compounds reduced. In addition, cell cycle results showed that the proportion of G2/M phase cells decreased with the fermentation process, which may be due to the oxidation of tea polyphenols, and increase of theabrownins. In addition, our investigation showed that tea extract and their constituents have lower cytotoxicity to normal CCC-HEL-1 cells. Induction of early apoptosis occurred only in SGC-7901 cancer cells, but not in CCC-HEL-1 normal cells. Cell cycle was not affected with the high concentration treatment in this study. Although further studies are required to elucidate the molecular mechanisms, these results suggest that tea extract and their constituents could be a candidate agent for the therapy of gastric cancer.

Because decision-making in situations of potential conflict hinges on assessing many features of the self and the foe, this process can be facilitated by summarizing diverse attributes in a single heuristic representation. Physical size and strength are evolutionarily ancient determinants of victory in conflict, and their relevance is reinforced during development. Accordingly, size and muscularity constitute ready dimensions for a summary representation of relative formidability, a perspective paralleled by the notion that social power is represented using envisioned relative size. Physical incapacitation constitutes a significant tactical disadvantage, hence temporary incapacitation should increase the envisioned size and strength of an antagonist. In Study 1, being bound to a chair increased men’s estimates of the size of an angry man and decreased estimates of their own height. Fight, flee, or parley? Successfully navigating antagonistic social interactions hinges on assessing one’s strategic assets and liabilities relative to those of one’s opponent. Importantly, physical capabilities are an elementary consideration in this regard. Here, we explore how temporary physical handicaps affect able-bodied men’s conceptualizations of prospective adversaries.To determine the optimal course of action in situations of potential agonistic conflict, individuals must estimate the likelihood of victory or defeat, and the costs likely to be incurred therein. In calculating such probabilities, actors have to assess many attributes that the parties bring to the interaction. Because these attributes are diverse, decision-making can be facilitated by compiling assessments of the relevant features into a single representation, a summary that can then readily be consulted. Physical size and strength have been fundamental determinants of the outcomes of violent conflicts throughout our species’ evolutionary history, a pattern recapitulated in experience during development. Physical size and strength thus provide readily available dimensions for such a summary representation. Based on this logic, Fessler, Holbrook, and Snyder While the above work focuses on decision making in agonistic situations, complementary evidence has been presented by investigators exploring the use of conceptual metaphors in reasoning about social hierarchy. Specifically, drawing on observations that the vertical dimension is used to represent hierarchical relationships e.g., , Yap, MaAt the most elementary level, in the absence of other factors, the actor’s ability to respond effectively to threatening situations hinges on physical attributes. Strength is not the only consideration in this regard, as even strong individuals may be handicapped by burdens or injuries. If the actor’s representation of a prospective antagonist summarizes the assets and liabilities that the two parties bring to a conflict, such a conceptualization should therefore be affected by any temporary incapacitation that the actor suffers at the time of assessment. Hence, if size and strength constitute the dimensions of a summary representation of relative formidability, then being incapacitated should lead actors to increase their conceptualizations of a given foe in these regards. This prediction can also be framed in the language of social hierarchy: to the extent that one’s social power is conceptualized in terms of bodily attributes, such that possession of power affects perceptions of the size of others relative to oneself, then physical incapacitation – which reduces social power – should lead actors to perceive a target individual as larger. In our successful tests of this prediction, we experimentally manipulated physical incapacitation in two studies. Because men engage in far more violence than do women Both studies reported here were examined and approved by the University of California, Los Angeles Institutional Review Board. Following the exact protocol approved by the Institutional Review Board, in each study, participants were first presented with a written information sheet describing the study procedures, any potential risks or discomforts, the identity and contact information of the first author, and compensation; participants then indicated their consent to participate. The protocol approved by the Institutional Review Board dictated that, in order to ensure participant anonymity, consent was given orally, rather in writing, with anonymous identification numbers being assigned to each participant in order to document this procedure.SD = 6.69). The ethnicity of the sample was 40.4% White, 25.5% East Asian, 10.6% Latino, 8.5% Black, 4.3% South Asian, 4.3% Middle Eastern, and 6.4% other or mixed ethnicities.Fifty-one male undergraduates at the University of California, Los Angeles were recruited to participate in a study, advertised as concerning links between physical disability and visual perception, in exchange for $8. Data were screened prior to analysis for overt suspicion regarding the hypothesis or frivolous responses. There were no such concerns, but technical problems led to incomplete data for 5 participants, leaving a final sample of 46 men, with a mean age of 22.9 years and minor nerve damage to the fingers (the control condition). In the impaired condition, participants were strapped tightly to a wooden chair using six nylon webbing straps attached just above the ankles, on the lower forearms, and at the elbows; the chair itself was anchored in place using 136 kilograms of weights. Care was taken not to cause pain or impair circulation, and the hands were free to move at the wrist. A numeric response pad was positioned adjacent to the chair, within the participant’s reach. After being fastened to the chair, participants were asked to attempt to move; the straps were then tightened as needed. This step ensured both that participants were truly incapacitated and that they were cognizant of the extent of their incapacitation. In the control condition, participants were seated in the same chair and used the same response pad, but were unrestrained; consonant with the framing of the study as concerning physical disabilities, small metal caps were attached to the fingertips of the dominant hand, ostensibly to simulate minor peripheral nerve damage. Once the participant had been readied, the research assistant moved behind a privacy screen, remaining in the room.http://www.socsci.ru.nl:8180/RaFD2/RaFD?p=faq; accessed March 3, 2013).Participants completed parallel tasks in each condition, beginning with one of two versions of a computerized survey, presented in counterbalanced order across conditions. The surveys were projected on a 113 cm by 71 cm monitor positioned 168 cm away, directly in front of the chair. The surveys included relative formidability measures interspersed among filler visual judgment measures intended to reduce demand characteristics. In the formidability measure, participants were shown images of angry White male faces (one per survey) and asked to estimate the individual’s i) height in feet and inches, ii) overall size using a 6-point array, and iii) muscularity using a 6-point array see . The angThe self-height estimation task was administered next, while the participant was still seated in the same location. The privacy screen, chair, and an 8-foot (2.5-meter) stadiometer were located such that participants could see only the unmarked side of the monochromatic stadiometer, located 380 cm away in front of a blank white wall; the stadiometer’s units of measure were visible only to the research assistant. While remaining behind the privacy screen, using a laser pointer, and beginning at the base of the stadiometer, the research assistant moved a point of light upwards at a rate of 10 centimeters per second. Participants were instructed to say “Stop” at the precise moment when the laser dot reached the level that they believed matched their standing height.Not worried at all, 7 = Very worried). As an exploratory measure of the contribution of social power to estimations of the targets’ physical formidability and of participants’ own height, self-perceived status was assessed using the MacArthur Scale of Subjective Social Status Individuals differ in a variety of traits affecting their ability to win physical conflicts. Such differences are plausibly reflected in people’s subjective concerns regarding the possibility of being criminally victimized Finally, participants were questioned for suspicion about the purpose of the study. Although several participants speculated that the study involved visual bias related to incapacitation, none evinced suspicion that such bias concerned inflating the physical attributes of the target males. Participants were then thanked, paid, and debriefed.Preliminary MANOVAs revealed no significant effects of order of condition or survey version on estimations of the height, size, or muscularity of the angry male targets, or on estimates of participant’s own height.M = 70.92 inches, SD = 2.55) than in the control condition , F = 6.02, p<.02, η2p = .12. The target was also estimated to be larger using the silhouette array in the impaired condition than in the control condition , F = 11.37, p<.01, η2p = .20. The target was estimated to be slightly more muscular in the impaired condition than in the control condition , but this difference was not significant, p = .21.As predicted, angry male targets were estimated to be taller in the impaired condition  = .27, p<.08. There were no significant correlations between perceived social status and the difference scores for estimated height, size, or muscularity, ps >.3.To assess whether fear of crime positively correlated with perceptions of the targets as more formidable in the impaired condition, difference scores were calculated subtracting the height, size, and muscularity of the target estimations made while in the control condition from those made while restrained. Although all correlations were in the predicted positive direction, there were no significant correlations between subjective fear of crime and difference scores for height or size, M = 64.13 inches, SD = 6.17) than in the control condition . A repeated measures ANOVA confirmed that the effect of impairment condition on estimations of self-height was significant, F = 11.56, p = .001, η2p = .21.Consistent with predictions, participants assessed their own height as shorter in the impaired condition (r(45) = .35, p = .02.To assess whether fear of crime correlated with perceptions of oneself as shorter when restrained, difference scores were calculated subtracting the self-height estimation made when restrained from that made when unrestrained. As predicted, subjective fear of crime predicted estimations of one’s own height as shorter when restrained versus unrestrained, r(45) = .27, p<.08. A follow-up test indicated that this was driven by a correlation between status and own height in the unrestrained condition, r(45) = .25, p<.1; there was no correlation in the impaired condition, p>.65. The positive trend in the control condition is consistent with prior findings that enhanced perceptions of social power inflate estimates of own height In a marginal trend, self-perceived social status was positively correlated with the difference between estimations of own height when restrained versus unrestrained, Consonant with our thesis that physical incapacitation should alter the conceptualized relative formidability of a potential antagonist, we found that restraining U.S. male undergraduate students’ arms and legs led them to envision an unfamiliar angry man as larger. Similarly, in keeping with prior work showing that relative power affects assessments of one’s own size, this manipulation substantially decreased participants’ visual assessments of their own height. However, despite these positive results, the predicted influence of physical restraints on participants’ conceptualization of a prospective foe as more muscular was not significant.Importantly, this laboratory study was notably divorced from the sorts of everyday contexts in which the psychology at issue could be expected to operate. Having one’s arms and legs bound to an immobile chair is an extreme instantiation of the sort of incapacitation that able-bodied people would normally experience periodically. Correspondingly, both the oddness of the experience and the anxiety that may have attended it could have affected participants’ responses in unknown ways. To address these limitations, we ran a second study, conducted in public areas, in which participants were asked to engage in a simple and relatively familiar balance task in order to induce the experience of partial incapacitation.Postural instability can result from fatigue SD = 8.02). The ethnicity of the sample was 53.3% White, 22.2% Asian, 8.9% Latino, 4.4% Black, 2.2% Middle Eastern, and 8.9% other or mixed ethnicities.Ninety-eight adult men were recruited in public areas on or near the University of California, Los Angeles campus in exchange for $3. The study was presented as testing links between motor skills and visual skills. Data were screened prior to analysis for overt suspicion, frivolous or incomplete responses, and perception of the balance task as unchallenging. One individual evinced suspicion, one gave frivolous responses , six provided incomplete data, and 45 individuals rated the balance board task as unchallenging, leaving a final sample of 45 men, with a mean age of 24.7 years to estimate the individual’s height, overall size, and muscularity using the same measures as in Study 1. The two versions of the survey were presented in counterbalanced order.Extremely easy; 9 = Extremely difficult). Finally, participants were questioned for suspicion. Although several speculated that the study might involve visual bias related to being off-balance, only one evinced suspicion that such bias concerned inflating the physical attributes of the pictured angry males; this participant’s responses were removed prior to analysis.After completing both surveys, participants answered demographic questions and the fear of crime measure (α = .91) used in Study 1. Self-perceived social power was not assessed, as the design included neither estimations of personal height nor a manipulation likely to moderate social power. As a manipulation check, the subjective difficulty of balancing on the board was reported using a 9-point scale rated the balancing task as less than minimally difficult . As individuals responding in this fashion likely did not undergo the experience of extensive postural instability that our manipulation was intended to induce, our principal analyses exclude these participants, encompassing only those participants who rated the balancing task as at least minimally difficult. Following presentation of our principal analyses, we also present exploratory analyses of the complete sample.p>.3. However, there was a main effect of survey sequence , p<.04, with significant effects of survey sequence on estimates of height and muscularity, ps <.04. The survey sequence was therefore controlled for in subsequent analyses of height and muscularity estimates.Preliminary MANOVAs revealed no significant main effect of order of condition on estimations of the height, size, or muscularity of the angry male targets, M = 70.34 inches, SD = 2.78) than in the control condition , F = 4.16, p<.05, η2p = .09. Likewise, the target was estimated to be larger using the silhouette array in the balance board condition than in the control condition , F = 4.33, p<.05, η2p = .09. Lastly, the target was also estimated to be more muscular in the balance board condition than in the control condition , F = 4.81, p<.04, η2p = .10. Difference scores between estimates of height, size, and muscularity made between conditions were calculated, then correlated with fear of crime ratings; fear of crime did not correlate with any of these scores, ps >.18.As predicted, the target was estimated to be taller in the balance board condition , we correlated the difficulty ratings with the difference scores for estimated height, size, and muscularity between conditions. Unexpectedly, task difficulty did not correlate with any of these difference scores, ps >.5. This evident absence of moderation contrasts with the striking lack of effect of condition observed among the portion of the sample that did not rate the balance task as minimally difficult or above. It is possible that, below this threshold, the finer gradations in our self-reported difficulty measure did not closely track the extent to which the manipulation influenced perceived relative formidability. Seeking to more precisely identify the floor in self-reported difficulty below which the manipulation had no effect on perceived relative formidability, we next assessed the effect of condition on all participants whose difficulty scores were greater than one standard deviation below the mean, a subsample (N = 65) composed of those who rated the task as a 4 or above on our 9-point scale. Indeed, in this enlarged sample, the target was estimated to be taller in the balance board condition than in the control condition , F = 4.83, p<.04, η2p = .07. Likewise, in a nonsignificant trend, the target was estimated to be larger in the balance board condition than in the control condition , F = 3.21, p<.08, η2p = .05. However, although the angry male targets were also estimated to be slightly more muscular in the balance board condition than in the control condition , this difference was not significant, p>.4. In sum, the overall pattern suggests that the null effects of condition observed in the half of the sample who rated the balance task as unchallenging were driven by the participants who rated the task as relatively easy, with modest evidence of an influence of the manipulation among those who rated the task as less easy, and, as expected, the most pronounced evidence of an influence of the manipulation among those participants who reported the task to be difficult.To explore the influence of task difficulty on formidability estimation, we repeated the above tests on the half of the sample composed of participants who did not rate the balance task as minimally difficult or above. Consistent with predictions, there were no significant effects of condition for any of the three bodily estimations, Study 2 replicated the key results of Study 1 using a more mundane manipulation of physical incapacitation, conducted in a public setting rather than a laboratory, and absent the overt priming of physical infirmity involved in the framing of Study 1. For those participants who found standing on a balance board to be challenging, a potential antagonist was estimated to be more physically formidable when the participant was handicapped by postural instability than when such estimates were provided with the benefit of firm footing. Similar, albeit reduced, effects were evident among participants who found the task to be less challenging; as expected, these effects were absent among those who found the task to be relatively easy . Our measures of the estimated height and overall size of a potential antagonist revealed the predicted effects of incapacitation in both studies; additionally, in Study 2, we also found a significant effect of incapacitation on estimates of the muscularity of the target, a pattern discernable as a nonsignificant trend in Study 1. Fear of crime again did not correlate with estimates of target formidability, suggesting that this self-reported subjective attribute may have limited applicability in such investigations.In two studies, using very different means of inducing temporary physical incapacitation, we found that this state led participants to increase their conceptualizations of the physical formidability of potential antagonists; correspondingly, Study 1 also revealed that incapacitation led participants to conceptualize themselves as smaller.Our results are largely redundant across differing manipulations. Nevertheless, our findings are subject to sampling limitations, as we studied only young men in and around one Southern Californian university. At the least, it will be important in future studies to examine the effects of incapacitation among women; ideally, future studies will also expand beyond Western university contexts. Likewise, because we sought to maximize the likelihood that participants would perceive the individual being evaluated as a potential antagonist, we employed only angry male faces as target stimuli; in the future, it will be important to examine the full extent of the phenomena explored here by varying both the emotions expressed by the target and the target’s sex.Our investigations focus on how the mind summarizes assessments of relative formidability using the dimensions of size and muscularity. Although we are concerned with cognitive representations in the mind of the perceiver, size and muscularity are also morphological attributes of the target individual, features that are subject to inspection. We therefore presented participants with intentionally underspecified stimuli so that, rather than reflecting their perceptual accuracy or attention to the details of the stimuli, their estimations of the bodily characteristics of the target individual would instead reveal their representations of relative formidability. Indeed, ceteris paribus, we expect perceptual accuracy to be unaffected by factors affecting relative formidability, as, regardless of whether the ensuing decision is to fight or flee, the effectiveness of subsequent action hinges on such accuracy, hence natural selection can be expected to disfavor diminished accuracy Our findings are potentially explicable in terms of both the narrower view that the conceptualized size and strength of an antagonist summarizes relative formidability and the broader view that size is used to represent social power. The two theoretical frameworks outlined above, though highlighting distinct functional computations regarding, respectively, combat and social position, are rendered complementary by an evolutionary approach to the psychology of power. In nonhuman animals, power stems from dominance – the ability to achieve goals through force or the threat thereof. However, in many human groups, power stems not from dominance, but from either prestige or formal office: rather than using physical force to achieve their goals, people rely on the social status awarded them by others

Small cigar smoking among young adult cigarette smokers may be attributed to their exposure to its advertisements and promotions. We examined the association between exposure to a celebrity music artist's endorsement of a specific brand of small cigars and young adult cigarette smokers' susceptibility to smoking that brand. Venue-based sampling procedures were used to select and survey a random sample of 121 young adult cigarette smokers, aged 18–35. Fourteen percent reported exposure to the artist's endorsement of the small cigar and 45.4% reported an intention to smoke the product in the future. The odds of small cigar smoking susceptibility increased threefold for those who reported exposure to the endorsement compared to those not exposed . Past 30-day small cigar use and past 30-day cigar use were also associated with susceptibility to smoke a small cigar. An association between young adult cigarette smokers' exposure to the music artist's small cigar endorsement and their susceptibility to smoke small cigars was found. This association underscores the importance of monitoring small cigar promotions geared toward young people and their impact on small cigar product smoking. In the United States (USA), cigarette consumption has steadily declined during the past decade. However, sales of cigars, particularly little cigars and cigarillos, have markedly increased. Of the three types of cigar products available in the USA, trend data from 1993 to 2006 suggest that the sales of large cigars decreased from 37% to 47%, while the sales of cigarillos increased from 25% to 32% and little cigars increased from 37% to 47% [Small cigar smoking has become increasingly popular among young adults, aged 18–35. Over 65% of young adults have heard about small cigars are tradIn 2012, a celebrity hip-hop music artist, Calvin Broadus Jr., also known as Snoop Dogg, announced his launching of a new brand line of cigarillo products, called Executive Branch. Several widely circulated music magazines and press releases reported that Snoop Dogg planned to “unveil” the new product during his upcoming performances at the 2012 Coachella Music and Arts Festival in Indio, California. The music festival mainly attracts an international audience of adults aged 35 and younger , 11. A rn = 238) posted on the festival's webpage (http://www.coachella.com), 31.5% were aged 25–29 years, 29.8% were aged 20–24 years, and 12.2% were aged 30–34 years old. Venue-based sampling procedures [Eligible participants were young adults, aged 18–35, who attended the Coachella festival and reported smoking at least one cigarette in the past 30 days. Approximately 85,000 concertgoers attended the festival per day over a three-day period . AccordiTo construct our sampling frame, the study team (K.S. and N.P.) utilized ethnographic sampling techniques to survey the area and identify locations within the festival where young adult smokers would gather or pass through. We identified three locations within the venue that fit this criterion: two “beer gardens” where festival attendees purchased and consumed alcoholic beverages and a smoking lounge. Each location was restricted to individuals aged 18 and older. Within the smoking lounge, we implemented area-based sampling and approached each individual for inclusion into the survey. For the two “beer gardens,” we identified young adults who were smoking cigarettes and randomly selected them by systematically intercepting every third cigarette smoking attendee that crossed a predetermined point. The two study team members collected data from attendees over a two-day period from festival open to close. Upon interception, each team member approached festival attendees, gave them a short description about the study, and obtained verbal consent. If the attendee refused, the study team member noted their refusal and continued the process with the next random participant. Festival attendees who appeared to be visibly impaired by alcohol or other substances were not approached. The study team determined the eligibility status of festival attendees that were intercepted and who were willing to participate using a brief screener that verified the attendant's age and cigarette smoking status. Attendees who did not meet the eligibility criteria were not surveyed.Over the two-day data collection period, a total of 275 participants were approached. Of those 126 (45.8%) refusals were noted and 6 (2.2%) participants did not meet study eligibility criteria. Data were lost for 22 respondents due to a synchronization error between the server and the device and could not be retrieved. Thus survey responses were collected and retained for 121 young adults. The majority of the 121 respondents were male (55.4%) and between the ages of 18 and 30 years old (88.0%). Regarding race/ethnicity, most respondents were white (75.2%) and lived in a country outside of the USA (52.4%). Overall, 70% reported past 30-day nonmentholated cigarette smoking, while 36.4% smoked menthol cigarettes. http://www.isurveysoft.com), and were uploaded to the handheld device (iPod touch 5th generation). The brief survey consisted of 21 items including demographic information, smoking history and current tobacco use, and exposure to small cigar advertisements. Survey items were entered in a survey software app, iSurveySoft , mentholated cigarettes , cigars, and small cigars . The response categories for each included “yes” or “no”. Brand names were provided for each tobacco product to help respondents better recognize the tobacco product . Respond Respondents were asked two questions: (1) if they intended to smoke Executive Branch small cigars and (2) if they intended to smoke any other small cigar in the future. Response categories for both questions were “yes” or “no.”We assessed festival attendees' exposure to (1) the Snoop Dogg's advertisements of the Executive Branch small cigars and (2) other advertisements for other small cigar products . Brand names were provided to assist the respondents with recall. Response categories for both questions were “yes” or “no.” If a respondent reported exposure to the product, they were asked to recall where they had seen the advertisement. Response categories included in a newspaper, in a magazine, on the Internet, on social media sites , and other. Urge to smoke Executive Branch small cigars was assessed by asking respondents how much they wanted to smoke the product after exposure to Snoop Dogg's advertisement. The urge to smoke variable is similar to the one used by Sargent and colleagues . A four-Respondent demographics, smoking-related behaviors, advertising exposure, and urge to smoke variables were explored using descriptive statistics. We assessed the prevalence of the past 30-day small cigar smoking among our sample of young adult cigarette smokers. To understand the demographic and tobacco use characteristics of small cigar users in our sample, we conducted descriptive analyses comparing survey responses from those young adult cigarette smokers who reported past 30-day use of small cigars to those who did not report use. Descriptive statistics were also used to assess exposure to small cigar advertisements (celebrity-endorsed and other) and the urge to smoke small cigars after viewing the ads. Bivariate and multivariate logistic regression analyses were conducted to assess the associations between small cigar smokers and nonusers and the demographic, smoking-related, exposure, and urge to smoke variables. The dependent variable for the bivariate and multivariate analysis was small cigar smoking.P = 0.001). Notably, over half of the small cigar smokers in our sample lived in a country outside of the United States.Of the 121 young adult cigarette smokers in our sample, 25.6% reported smoking small cigars at least once in the past 30 days. N = 31) in our sample reported concomitant use of other tobacco products. Over two-thirds (71.0%) of small cigar smokers reported smoking nonmentholated cigarettes in the past 30 days, while one-third (32.3%) reported using mentholated cigarettes. Small cigar smokers also reported current cigar smoking, with 19.4% reporting smoking cigars at least once in the past 30 days. Small cigar smokers reportedly saw these advertisements on the Internet, while 27.8% reported seeing them on social media sites, such as Facebook or Instagram. Of the respondents who were exposed to the Executive Branch advertisements, 82.4% said seeing the advertisement made them want to try the product.Approximately 60.2% of our respondents had been exposed to other small cigars advertisements. Respondents reported seeing advertisements for the other small cigars in magazines (35.1%), on the Internet (23.0%), in convenience stores or bodegas (12.4%), in smoke shops (6.6%), and on social media sites (5.4%). Over half of respondents (55.1%) wanted to try the small cigars after being exposed to the advertisements. P = 0.02) and small cigar smoking were significantly associated with an intention to smoke Executive Branch small cigars. Exposure to Snoop Dogg's advertisements was marginally associated with intention to smoke Executive Branch small cigars (P = 0.08). Given the exploratory nature of our study, variables from the bivariate analysis that were significant at P < 0.10 were included in the multivariate analysis. Forty-five percent (45.4%) of 121 young adult cigarette smokers in our sample reported an intention to smoke Executive Branch small cigars in the future; of these, 40.9% were current small cigar smokers. Bivariate and multivariate logistic regression analyses were conducted to assess whether the demographic and smoking-related variables and the exposure to Snoop Dogg's Executive Branch small cigar advertisements were associated with susceptibility to smoke the product in the future. Though demographic variables were not associated with susceptibility, bivariate analyses found that past 30-day cigar , cigar , and small cigar smoking were significantly associated and exposure to other small cigar advertisements (P = 0.06) was marginally associated with the susceptibility to smoke other small cigars. Over half (53.7%) of our respondents intended to smoke other small cigars in the future; 41.5% were already current small cigar smokers. Bivariate analyses found that past 30-day cigarette (Small cigar smoking is a growing public health concern among young adults, particularly for those with a history of tobacco use. Among our sample of young adult cigarette smokers, over 25% concurrently smoked small cigars in the past 30 days. Our finding is consistent with that of prior studies , 7. ConcOur preliminary findings suggest that exposure to small cigar advertisements may explain, in part, young adults' awareness of small cigars. Over 60% of our respondents reported exposure to other small cigar advertisements, and 14% reported exposure to Snoop Dogg's Executive Branch small cigar advertisement. Although traditional outlets such as magazines and convenience stores were also sources of advertisement exposure, respondents reported exposure to small cigar advertisements on the Internet, particularly on social media sites. This is consistent with growing body of evidence that has found protobacco images and references –29, in p We have little evidence to support the claim that the tobacco industry paid for or supported the hip-hop artist's endorsement of this small cigar product. However, the Federal Trade Commission Report of 1999 documented the cigar industry's payments to celebrities for their endorsements, appearances, and cigar product placements. It is well documented that cigarette smoking has been promoted through rap and hip-hop music , 31 and Exposure to the hip-hop artist's small cigar advertisements appeared to influence small cigar smoking susceptibility among the young adult cigarette smokers in our sample. Those who reported exposure to the artist's Executive Branch small cigar advertisements were three times more likely to intend to smoke these small cigars in the future. Notably, over 40% of those who reported an intention to use the Executive Branch small cigars were already past 30-day small cigar smokers. Although not previously documented for music entertainment, our findings are consistent with studies that found an association between exposure to prosmoking depictions in films and smoking behavior among adolescents . Future An important limitation of this study is its generalizability, as the survey sample largely consisted of a sample of young adult festival attendees in the United States. Findings from this study may not generalize to other young adult populations. While we broadly assessed other small cigars, this study specifically examined exposure to Snoop Dogg's advertisements and promotions of Executive Branch small cigars. As such, our findings may not generalize to other small cigar brands. We used brand-specific items to estimate small cigar use among our respondents. Though these items may estimate small cigar use more accurately , their uOur study documented young adult smokers' exposure to a celebrity hip-hop artist's advertising of Executive Branch small cigars. We also provided preliminary evidence of an association between exposure to a celebrity artist's small cigar promotion and susceptibility to smoke the brand-specific small cigar. Our findings indicate that celebrity endorsement is a potentially important source of marketing small cigar products to young adults and should be monitored.

The prevalence of cocaine adulterated with levamisole-induced vasculitis is increasing and physicians should be aware of this unique entity. There have been many reports of cutaneous vasculitis syndrome caused by cocaine which is contaminated with levamisole. Levamisole was used as an antihelminth drug and later was rescinded from use in humans due to adverse effects. Through this paper, we will report a 39-year-old crack cocaine user who presented with purpuric rash and skin necrosis of his ear lobes. Levamisole-induced vasculitis syndrome was suspected. A urine toxicology screen was positive for cocaine, opiates, and marijuana. Blood work revealed positive titres of ANA and p-ANCA, as well as anti-cardiolipin antibody. Biopsy taken from the left ear showed focal acute inflammation, chronic inflammation with thrombus formation, and extravasated blood cells. Treatment was primarily supportive with wound care. Levamisole, which was first developed as an antihelminth agent in the 1960s . In this Staphylococcus aureus (MRSA) infection presented with painful lesions on his right hand, left foot, and bilateral ears. Onset was three days prior to presentation where he started to have a constant burning sensation, most severely on the superior aspect of his ears. He had last smoked cracked cocaine one day prior to presentation and he was snorting it the day before.A 39-year-old man with past medical history of cocaine abuse, gout, attention deficit hyperactivity disorder, and hand cellulitis secondary to methicillin-resistantOn admission, the patient was afebrile, with blood pressure of 125/83 mmHg and heart rate of 110 beats per minute. On examination, the blisters on the dorsum of the right hand were new, although there was still an open wound from hand cellulitis secondary to MRSA infection 4 years ago on the dorsum of the second metacarpophalangeal joint. There was also a dry, closed, and scaly lesion on the left foot, as well as black necrotic bilateral auricular lesions with 1-2 mm blisters noted on both ears . The tonReview of systems was negative for fever, chills, cough, hemoptysis, hematuria, Raynaud's phenomenon, alopecia, and oral or nasal ulcers. The patient had a history of necrotic lesions. They started 2 years ago, while at work he noticed dark patches on his cheeks and nose that would not wash off and were painful to touch. Over the next few hours, the patches spread bilaterally over the buccal area and the lower aspect of the nose. At that time he complained of fever, chills, myalgia, and joint pain. He was hospitalized and diagnosed with having septic vasculitis secondary to MRSA and was treated with vancomycin.On this admission, laboratory testing showed a white count of 15.4 k/µL, hemoglobin of 14.9 g/dL, hematocrit of 41.9%, and platelet count of 208,000 k/µL. Basal metabolic profile, liver function tests, and haptoglobin were normal. Antinuclear antibody (ANA) and perinuclear-antineutrophil cytoplasmic antibody (p-ANCA) were weakly positive at a 1 : 40 titer and 1.1 U , respectively. IGM cardiolipin antibody was positive at 19 U . Antiphospholipid antibodies, complement level, HIV antibodies' titers, hepatitis panel, cytoplasmic antineutrophil cytoplasmic antibodies (c-ANCA), beta-2 glycoprotein, and blood and urine cultures were all negative. A urine toxicology screen was positive for cocaine, opiates, and marijuana. Biopsy taken from the superior aspect of the left ear showed focal acute inflammation of the surface epidermis, with foci of mild perivascular acute and chronic inflammation with thrombus formation and foci showing extravasated red blood cells. Burn and infectious disease services were consulted and recommended supportive wound care with bacitracin cream. The patient improved and was discharged few days later.Cocaine is the most commonly reported illicit drug in the emergency department in the United States . There aLevamisole was first identified as a cocaine adulterant in the USA in 2003 and now it is found in around 70% of the cocaine seized in the United States as an adulterant . The reaAlthough cocaine contaminated with levamisole was previously reported to be associated with neutropenia or agranulocytosis , 14, ourAnother characteristic of the vasculitis related to levamisole is the association of autoantibodies production especially ANCA, anticardiolipin, and lupus anticoagulant antibodies . PreviouThe diagnosis of cocaine/levamisole-induced cutaneous vasculitis relies on the history, clinical findings and a positive urine toxicology test with a 2-3-day window as well as the detection of levamisole both serum and urine using gas chromatography and mass spectrometry with a short half life of 5.6 hours .The approach to treat these patients differs between the reported cases. Steroids were used in some cases with unclear benefit. However, most of the cases were treated supportively with a self-limited course. Cocaine/levamisole should be withdrawn from all the patients. Extensive skin involvement and necrosis will need treatment in special burn unit as well as debridement, skin grafts, and reconstructive procedures.The number of cases of cocaine contaminated with levamisole-induced vasculitis is increased rapidly. This diagnosis should be suspected in any patient who presents with purpuric rash or skin necrosis and associated neutropenia, agranulocytosis, or positive ANCA or anticardiolipin antibody.

Chronic heart failure (CHF) is one of the most important public health concerns in the industrialized world having increasing incidence and prevalence. Although there are several studies describing the prevalence of heart failure with reduced ejection fraction (HFREF) and heart failure with normal ejection fraction (HFNEF) in selected populations, there are few data regarding the prevalence and the determinants of symptomatic heart failure in the general population.Cross-sectional data of a population-based German sample were analyzed to determine the prevalence and determinants of chronic SHF and HFNEF defined according to the European Society of Cardiology using symptoms, echocardiography and serum NT-proBNP. Prevalence was age-standardized to the German population as of December 31st, 2005.The overall age-standardized prevalence of symptomatic CHF was 7.7% (95%CI 6.0–9.8) for men and 9.0% (95%CI 7.0–11.5) for women. The prevalence of CHF strongly increased with age from 3.0% among 45–54- year-old subjects to 22.0% among 75–83- year-old subjects. Symptomatic HFREF could be shown in 48% (n = 78), symptomatic HFNEF in 52% (n = 85) of subjects with CHF. The age-standardized prevalence of HFREF was 3.8 % (95%CI 2.4–5.8) for women and 4.6 % (95%CI 3.6–6.3) for men. The age-standardized prevalence of HFNEF for women and men was 5.1 % (95%CI 3.8–7.0) and 3.0 % (95%CI 2.1–4.5), respectively. Persons with CHF were more likely to have hypertension or to have had a previous myocardial infarction .The prevalence of symptomatic CHF appears high in this population compared with other studies. While more women were affected by HFNEF than men, more male subjects suffered from HFREF. The high prevalence of symptomatic CHF seems likely to be mainly due to the high prevalence of cardiovascular risk factors in this population. Chronic heart failure (CHF) is one of the most important health concerns in the industrialized world. Whereas survival with CHF has improved over the last decades, its prevalence and incidence are steadily increasing European Society of Cardiology (ESC), heart failure is defined as a syndrome that consists of symptoms or signs typical of heart failure, such as shortness of breath or raised jugular venous pressure, and objective evidence of a structural or functional abnormality of the heart at rest, e.g., in an echocardiogram. According to the The objective evidence of normal systolic LV function accompanied by an impaired diastolic function in about one third of patients with clinical signs of heart failure led to the differentiation between heart failure with reduced ejection fraction (HFREF) and heart failure with normal ejection fraction (HFNEF) Systolic dysfunction is primarily considered as reduced contraction ability of the heart muscle resulting in a decreased ejection fraction. In contrast, diastolic dysfunction is characterized by a disturbed relaxation and dilatation of the left ventricle after the contraction. The filling of the ventricles is slow or incomplete unless atrial blood pressure rises, but the ejection fraction is preserved. Although cardiac structure and function differ substantially in systolic and diastolic dysfunction, the clinical signs and symptoms are nearly the same Despite a wide variation in the reported prevalence of chronic heart failure, published data suggest that the prevalence has been steadily increasing over the past decades Many attempts have been made to describe the burden of CHF in the population. Although there are several studies estimating the prevalence of HFREF and HFNEF in selected populations CArdiovascular Risk Factors, Living and Ageing in Halle Study (CARLA Study), conducted between December 2002 and January 2006 in Halle in Saxony-Anhalt. The CARLA Study is a German population-based prospective cohort study. Details of the study design and methods have been described elsewhere To determine the prevalence of overall CHF we used cross-sectional data from the baseline examination of the The study was approved by the Ethics Committee of the Medical Faculty of the Martin-Luther-University Halle-Wittenberg and by the State Data Privacy Commissioner of Saxony-Anhalt and conforms with the principles outlined in the Declaration of Helsinki The diagnosis of CHF was based on (a) self-reported symptoms suggestive of heart failure in combination with (b) an increase of the NT-proBNP serum concentration above 220 pg/ml and (c) on the evidence of systolic or diastolic dysfunction using echocardiographic parameters according to the recommendation of the ESC 2 in male subjects and less than 3.7 cm/m2 in female subjects The echocardiographic parameters LV ejection fraction (LVEF) and LV diameter index (LVDI) were used to determine the left ventricular systolic function. According to the recommendation of the ESC, systolic function was considered as normal or mildly reduced if LVEF was greater than 0.5 and LVDI was less than 3.8 cm/mor LVDI ≥3.8 cm/m2 for males and ≥3.7 for females) were classified as having heart failure with reduced ejection fraction (HFREF). Those subjects with self-reported symptoms suggestive of heart failure, an elevated NT-proBNP (>220 pg/ml), and a reduced diastolic function (according to the above mentioned echocardiographic criteria) but a normal or only mildly reduced LV systolic function were classified as having heart failure with normal ejection fraction (HFNEF) (see All subjects with self-reported symptoms and a reduced LV systolic function (LVEF ≤50% NEF) see .Hypertension was defined as mean systolic blood pressure (SBP) ≥140 mmHg, and/or mean diastolic BP ≥90 mmHg, and/or use of antihypertensive medication according to the anatomic therapeutic chemical classification system . Blood pressure measurement was performed in sitting position after a 5-minute resting phase using the OMRON HEM-705CP device. The average of the second and third of three measurements was used for further analyses. Prevalent myocardial infarction (MI) was defined as self-reported physician-diagnosed MI and/or definite MI by Minnesota code of the 10-second ECG ® procedure PROC GENMOD using the binomial distribution and the log link All statistical analyses were performed using the Statistical Analysis Software . Prevalences were directly age-standardized to the German standard population as of December 31st, 2005. The corresponding confidence intervals were calculated according to the recommendations of Fay and Feuer 2 or more).The study population of the CARLA Study comprises 812 women and 967 men aged 45–83 years at baseline with a mean age (SD) of 63.8 (9.9) and 64.9 (10.2) years, respectively. The baseline characteristics of this population are shown in Symptomatic CHF was diagnosed in 163 subjects (86 men and 77 women) resulting in an age-standardized prevalence of 8.3% (95%CI 7.0–9.8) in the total study group and 7.7% (95%CI 6.1–9.8) in men and 9.0% (95%CI 7.0–11.5) in women, respectively. The overall age-standardized prevalence of symptomatic HFREF and symptomatic HFNEF was 4.2% (95%CI 3.3–5.5) and 4.0% (95%CI 3.2–5.1), respectively. Overall, the prevalence of CHF did not differ between men and women. However, whereas more men were affected by symptomatic HFREF for male vs. female subjects 1.5 (95%CI 0.9–2.4)), more women were affected by symptomatic HFNEF, see . Of all The prevalence of symptomatic CHF strongly increased with age from 3.0% among 45–54- year-old subjects to 22.0% among 75–83- year-old subjects. While men showed a lower LVEF than women (0.62% (SD 0.09) vs. 0.65% (SD 0.08)) women showed a higher NT-proBNP serum concentration (median 65.5 pg/ml (IQR 33.5–140.7) vs. 92.5 pg/ml (IQR 51.7–158.3)). Subjects with HFNEF showed the highest LVMI (mean 184.0 g/m2 (SD 51.9)). Subjects with HFNEF showed the highest NT-proBNP serum concentration (median 424.5 pg/ml (IQR 279.5–808.4)) followed by subjects with HFREF (259.3 pg/ml (IQR 86.2–846.1)). As Among the prevalent cardiovascular diseases and risk factors that were analyzed as determinants of CHF, hypertension was the strongest determinant of CHF. The age- and sex-adjusted prevalence ratio (PR) for subjects with hypertension vs. subjects without hypertension was 3.4 (95%CI 1.6–7.3). For subjects with CHD versus subjects without CHD the age- and sex-adjusted PR was 2.3 (95%CI 1.6–3.1). The CARLA Study was initiated to investigate the prevalence and incidence of cardiovascular diseases and their determinants in an elderly general population. One of the main goals of this investigation was to describe the burden of CHF, as it is one of the most important public health concerns.As the data suggest, the study population can be described as a high-risk population with a high prevalence of cardiovascular risk factors such as hypertension, obesity, low physical activity, or high proportion of smokers. This is in accordance with other investigations comparing the prevalence of cardiovascular risk factors among different regions in Germany The results of the CARLA Study showed a high prevalence of symptomatic heart failure compared to other studies, for the examined population aged 45 years and over In the present study, women, especially in the higher age-groups, were more likely to suffer from heart failure than men. This fact is also in accordance with the data from above mentioned studies We found a strong correlation of CHF with age with a noticeable increase in CHF prevalence after the age of 70. The age-specific increase of CHF was similar in subjects with HFNEF compared to those with SHF. However, we observed a stronger age-specific increase of HFNEF as well as SHF in women compared with men.2 or more reported such complaints. While the age-standardized prevalence of COPD was quite similar between the sexes, we could observe a higher prevalence of obesity among women. This might be one possible explanation for the noticeably higher prevalence of symptoms suggestive of CHF among women.Self-reported symptoms suggestive of CHF were very common in the examined population, with an age-standardized prevalence of 44% in men and almost 67% in women. These symptoms were only self-reported during the standardized interview, and not verified by a clinical examination. This raises the question, whether the high prevalence of self-reported symptoms might have contributed to the high prevalence of chronic heart failure in the studied population. According our data, the relation between symptomatic heart failure and asymptomatic heart failure is very comparable to that in previous studies The differentiation between COPD and CHF is complicated by the overlap of signs and symptoms. Furthermore, the accuracy of the echocardiography can be decreased due to hyperinflated lungs. However, the diagnosis HFNEF should be considered in subjects with COPD when abnormal LV mass or left atrial enlargement exist The aetiology of heart failure, especially of SHF, is fairly well understood. However, there is a lack of information on the aetiology of HFNEF and there is a need to understand the underlying pathophysiology of HFNEF, in order to provide effective treatment and improve outcomes for subjects with HFNEF. Up to now, there is no pharmacologic therapy which has shown to be effective in improving outcomes in patients with HFNEF. Trials like the I-PRESERVE-trial did not show any benefit to the patients The results of this study may be considered representative for the general population aged 45 to 85 years since a random sample from the population registry of the city of Halle had been selected, and a high participation rate could be achieved. However, lower participation rates among subjects too ill to attend the 4-hour examination resulted in a moderate selection bias towards a healthier population. Unfortunately, we do not have any information on chronic heart failure from subjects who refused to participate in the study. However, non-respondents reported a higher prevalence of cardiovascular diseases and adverse risk factors than study participants The main strengths of our study are the representative sample and the highly standardized assessment of the data in agreement with other German and international studies. For the definition of heart failure, we were able to include information on symptoms, biomarker NT-proBNP, and echocardiographic parameters. The use of natriuretic peptides is recommended in addition to clinical information to detect diastolic dysfunction especially in high-risk populations In summary, we found a higher prevalence of overall HF in this elderly population compared with previous population-based studies, which is primarily due to the higher prevalence of HFNEF, since the prevalence of systolic dysfunction is within the range of these population-based studies except for the highest age-groups. Our results underline the need for further elucidation of determinants of diastolic dysfunction and its progression to HFNEF in order to develop the prevention strategies that are needed to address the heart failure epidemic in the ageing population. Therefore, it will be important to assess what proportion of subjects with preclinical diastolic dysfunction have developed diastolic heart failure during the 4-year follow-up of the CARLA Study that has recently been completed To our knowledge, this is the first investigation in Germany describing the prevalence of symptomatic CHF among the general population and, in addition, the first study in Europe to describe the prevalence of symptomatic HFNEF.

P < 0.01) in these three lines. Among the identified proteins, prostate stem cell antigen (PSCA) was upregulated and eukaryotic elongation factor 1 alpha (EEF1α) was downregulated in the HPV+ cell lines. Immunofluorescence and western blotting analyses confirmed these results. Moreover, PSCA and EEF1α were differentially expressed in two clinical series of 50 HPV+ and 50 HPV− oral cavity carcinomas. Thus, our study reveals for the first time that PSCA and EEF1α are associated with the HPV-status, suggesting that these proteins could be involved in HPV-associated carcinogenesis.Human papillomavirus (HPV) was recently recognized as a new risk factor for head and neck squamous cell carcinoma. For oropharyngeal cancers, an HPV+ status is associated with better prognosis in a subgroup of nonsmokers and nondrinkers. However, HPV infection is also involved in the biology of head and neck carcinoma (HNC) in patients with a history of tobacco use and/or alcohol consumption. Thus, the involvement of HPV infection in HN carcinogenesis remains unclear, and further studies are needed to identify and analyze HPV-specific pathways that are involved in this process. Using a quantitative proteomics-based approach, we compared the protein expression profiles of two HPV+ HNC cell lines and one HPV− HNC cell line. We identified 155 proteins that are differentially expressed ( Head and neck cancers (HNCs) constitute a heterogeneous group of tumors that often arise in the oral cavity, oropharynx, hypopharynx, and larynx. HNC is the sixth most common cancer, with as many as 466,831 new cases diagnosed in men in 2008 [Although the relationship between HPV infection and patient prognosis seems clear in oropharyngeal carcinoma, this relationship is less evident in the other anatomical sites affected by HNC, such as the oral cavity, larynx, and hypopharynx. The meta-analysis performed by Ragin and Taioli, which examined the relationship between HPV and overall survival, did not show any differences between HPV+ and HPV− patients with cancers at nonoropharyngeal sites . RecentlProteomic analysis represents a promising approach for identifying HPV-related signaling pathways. However, a paucity of literature exists regarding the biology of HPV-mediated head and neck tumors. A small number of proteomic studies have been conducted, and these investigations have identified HPV-specific protein candidates in HNC. Additional proteins with altered expression levels were previously identified using 2D electrophoresis followed by mass spectrometry. S100A8, a calcium-binding protein, is a powerful biomarker of HPV18 infection in oral SCC patients and is iHere, we used a quantitative proteomic-based approach to visualize major changes in protein expression between HPV+ and HPV− HNSCC cell lines. Among these proteins, we selected two candidates to validate our proteomic approach and studied their involvement in the carcinogenesis of HPV+ head and neck cancers. To this end, we performed immunohistochemistry on two clinical series to support our results. In summary, this study aimed to establish a proteomic signature of HPV infection in head and neck cancer in order to better understand the mechanisms by which HPV drives head and neck carcinogenesis.2 atmosphere. The FaDU and 93VU-147T cell lines were grown in Dulbecco's Modified Eagle Medium supplemented with 10% FBS, 2% L-glutamine, and 1% penicillin/streptomycin at 37°C in a humidified 95% air-5% CO2 atmosphere. The culture medium was changed three times each week, and the cells were passaged when they reached 90% confluence. The cell lines used in this study, which were derived from head and neck squamous cell carcinomas, are described in For total protein extraction, cells were washed twice in cold PBS and centrifuged, and the cell pellets were stored at −80°C. Protein extraction was performed using 6 M guanidinium chloride . The solution was then ultrasonicated for 3 × 10 sec and incubated for 20 min at room temperature. The supernatant was recovered by centrifugation , and the protein concentration was determined according to the Bradford method, using bovine gamma-globulin as a standard.The proteins were reduced, and their cysteines were alkylated using an ICPL kit (SERVA). The proteins were recovered via acetone precipitation and digested into peptides using trypsin at an enzyme/substrate ratio of 1 : 50 overnight at 37°C. The next day, trypsin digestion was stopped by adding 0.1% formic acid.μg) were separated on a 25 cm C18 column using a linear gradient (5–35% over 120 min) of acetonitrile (ACN) in water containing 0.1% formic acid at a flow rate of 300 nL min−1. To obtain the highest possible retention time stability, which is required for label-free quantification, the column was equilibrated with a 10× volume of 5% ACN before each injection. Mass spectra (MS) were acquired across 400–1500 m/z in high-resolution mode with a 500 msec accumulation time. The precursor selection parameters were as follows: intensity threshold 200 cps, 50 precursors maximum per cycle, 50 msec accumulation time, and 15 sec exclusion after one spectrum. These parameters led to a duty cycle of 3 sec per cycle, ensuring that high-quality extracted ion chromatograms (XICs) were obtained for peptide quantification.Protein identification and quantification were performed using a label-free strategy on an UHPLC-HRMS platform (Eksigent 2D Ultra and AB SCIEX TripleTOF 5600). The peptides was used to conduct a database search against the UniProt Trembl database (09/30/2011 version), which was restricted to P value lower than 0.05 across the 3 biological replicates analyzed were taken into account for metabolic characterization. Fold changes were assessed using Student's t-test. Finally, proteins identified with 1 peptide were validated manually.For peptide quantification, PeakView was used to construct XICs for the top 5 peptides of each protein identified with an FDR lower than 1%. Only unmodified and unshared peptides were used for quantification. Peptides were also excluded if their identification confidence was below 0.99, as determined by ProteinPilot. A retention time window of 2 min and a mass tolerance of 0.015 m/z were used. The calculated XICs were exported into MarkerView, and they were normalized based on the summed area of the entire run. Only proteins presenting a fold change higher/lower than 1.5/0.6 with a 5 cells/well in 12-well plates containing sterile round glass coverslips and grown at 37°C and 5% CO2 for 5 days. The cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min. The fixed cells were rinsed with PBS, permeabilized with 0.1% Triton X-100 in PBS for 15 min and blocked with 0.05% casein for 20 min. Then, the cells were treated overnight with primary antibodies against PSCA and EEF1α (anti-EEF1A1 rabbit antibody (N-term), Abgent, Huissen, The Netherlands), which were diluted 1 : 50 in blocking solution. The next day, the cells were washed with PBS containing 0.1% Triton X-100 and incubated with Alexa Fluor 488-conjugated anti-rabbit IgG for 1 h. The cells were washed with PBS containing 0.1% Triton X-100 for 15 min, rinsed with distilled water for 10 min and mounted with Vectashield Mounting Medium containing DAPI (Vector Laboratories). The cells were observed by confocal microscopy using an Olympus FV1000D laser scanning inverted microscope . The exposure time of each photo was 27.59 s/frame, pictures were captured at 1600 pix/1600 pix, and the pixel time was 10.0 μs/pix. The background noise was adjusted in the same manner and to the same level for each picture. Each picture was analyzed semiquantitatively.Cells were seeded at a density of 5 × 10μL 20× reducing agent (Fermentas) were added to each protein extract, and the sample volume was brought to 20 μL with deionized water. The samples were heated at 95°C for 5 min, and 30 μg of proteins was separated on 4–20% Mini Protean Gels . After electrophoresis, the proteins were electrotransferred onto nitrocellulose membranes . Nonspecific binding sites were blocked by incubation with PBS containing 5% nonfat milk at room temperature for 1 h. Immunodetection was performed overnight at 4°C using anti-EEF1α (anti-EEF1A1 rabbit antibody (N-term), Abgent, Huissen, The Netherlands) and anti-PSCA antibodies, which were diluted 1 : 100 in PBS containing 2% nonfat milk. The membrane was washed three times with PBS and incubated for 1 h at room temperature with HRP-conjugated goat anti-rabbit IgG , which was diluted in PBS containing 2% nonfat milk. The bound peroxidase was detected using the SuperSignal West Femto kit (Roche), and the bands were visualized by exposing the membranes to photosensitive film .Proteins were extracted from cells using BugBuster Protein extraction reagent , and the protein concentrations of the extracts were determined using a Bio-Rad protein assay . Four microliters 4× LDS sample buffer and 1 We examined 100 formalin-fixed, paraffin-embedded oral SCC specimens obtained from patients who underwent radical curative surgery between January 2004 and December 2008 at Saint Pieter's Hospital (Brussels) or the EpiCURA Center (Baudour). The tumors were classified according to the TNM classification of the International Union Against Cancer. β-globin levels were assessed using real-time quantitative PCR to verify the quality of the DNA in the samples and measure the amount of input DNA.HPV detection and typing of paraffin-embedded tissues were performed as described in our previous work . DNA extμm thick sections mounted on silane-coated glass sides. The paraffin-embedded tissue specimens were deparaffinized in toluene, soaked in ethanol, and then soaked in PBS. They were pretreated in a pressure cooker (11 min for PSCA and 6 min for EEF1α) in a 10% citrate buffer solution (for EEF1α) or a 10% EDTA solution (for PSCA) to unmask the antigens. Then, the sections were incubated in 0.06% hydrogen peroxide for 5 min to block endogenous peroxidase activity, rinsed in PBS, blocked with Protein Block , and incubated at 4°C overnight with rabbit anti-PSCA or anti-EEF1α . The next day, the tissues were incubated with Post Blocking Antibody for 15 min, followed by PowerVision for 30 min. The slides were washed with PBS between incubation steps. Finally, the localization of the antibody/antigen complex was visualized by staining with DAB , and the sections were counterstained with Luxol Fast Blue and mounted with a synthetic medium. To exclude antigen-independent staining, controls, for which the incubation step with the primary antibody was omitted, were examined. In all cases, these controls were negative.All tumors samples were fixed for 24 h in 10% buffered formaldehyde, dehydrated, and embedded in paraffin. Immunohistochemistry was performed on 5 α immunoreactivities in all tumor areas using an optical microscope . The mean intensity (MI) was defined as follows: 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). The percentage of immunopositive cells was categorized as follows: 0 (0% positive cells), 1 (1–25%), 2 (26–75%), and 3 (76–100%). Statistical analysis was performed using the Mann-Whitney test to compare the MI and LI values between the HPV+ and HPV− samples.Two independent investigators, who were blinded to the clinical details of the patients, assessed PSCA and EEF1Protein profiling using label-free quantification was conducted to identify proteins whose expression was altered by HPV infection. To elucidate the specific effects of HPV in head and neck carcinogenesis and identify potential candidates, we compared the differential patterns of protein expression between one HPV− cell line (FaDU) and two HPV+ cell lines (93VU-147T and UPCI-SCC90). Proteins extracts were analyzed in triplicate for each cell line using tandem mass spectrometry.For this analysis, we were interested in proteins that had increased or decreased expression levels and are clinically relevant.P values of <0.01; 56 of these were downregulated, and 99 were upregulated (α (EEF1α) (Accession number: Q6IPS9) expression was four fold higher in the HPV− cells than the HPV+ cell lines. Its upregulation was recently reported to be associated with increased cell proliferation and oncogenic transformation.Analysis of the three cancer cell lines identified 2221 proteins, among which 155 were differentially expressed between the HPV− and HPV+ cells with significant egulated . Two intα by immunocytochemistry in six head and neck cancer cell lines: 3 HPV+ cell lines and 3 HPV− cell lines . The results of the immunofluorescence analysis of PSCA in all cell lines are presented in To confirm our mass spectrometry results, we studied the expression of PSCA and EEF1α between HPV+ and HPV− cell lines. EEF1α was primarily nuclear, but it was also diffuse throughout the cytoplasm. We also noted a marked difference in the expression of this protein in both cell populations (HPV+ and HPV−). In fact, as expected, confocal microscopy examination of EEF1α revealed an increase in the intensity of the immunofluorescence signal in the HPV− cells in terms of the labeling index (LI), which corresponds to the percentage of immunopositive cells.Among the 50 HPV+ cases, qRT-PCR targeting 18 HPV subtypes revealed that 100% of the cases were infected by HPV-16, with two coinfections, HPV-53 and HPV-39. After confirming our results α expression in the same clinical series (50 HPV+ OSCCs versus 50 HPV− OSCCs). EEF1α was localized in both the nucleus and cytoplasm, but significantly stronger staining intensity was observed in the nucleus values between the HPV+ and HPV− tumors was calculated using a nonparametric Mann-Whitney test (P = 0.03) .Recent advances have been made in our understanding of the relationship between head and neck carcinogenesis and HPV. Strong evidence indicates that HPV+ HNSCC comprise a subclass of tumors with a different biology and different clinical properties and that affects specific demographic populations. HPV+ tumors occur in a younger age group, originate more frequently in the oropharynx, and have a lower T stage compared to HPV− tumors . At the Despite the progress made in the field of HPV-related HNSCC, a paucity of literature exists with respect to studies investigating the biology of HPV infection in head and neck carcinogenesis. Disease predictors are important from both the clinical and molecular perspectives. Current HNSCC treatments are frequently associated with adverse side effects, and 50% of HNSCC patients die within two years of their initial diagnosis because two-thirds of patients have advanced cancer (stage III or IV) at diagnosis , 20. TheOver the past decade, technological advances have been made in the field of proteomics, leading to the identification of specific proteins that are differentially expressed in tumor and control specimens. Mass spectrometry is undoubtedly the most powerful technology for proteomics. The most current mass spectrometers present high resolving power and mass accuracy, allowing for the detection and quantification of thousands of proteins. Thus, clinical proteomics is a powerful diagnostic and prognostic technology. However, advances in the proteomics field have resulted in publications describing numerous potential cancer markers that must be clinically validated prior to the development of a diagnostic test.P values of <0.01. The strength of our study lies in the clinical validation of our potential candidates. Indeed, there is a limitation in using cultured cells rather than clinical specimens, as the proteomes of cells grown in vitro may not accurately reflect those of in vivo cancer cells. However, if the selected protein candidates are further investigated by immunohistochemistry (IHC) using patient tissue samples, the proteomic analysis of cultured cells is entirely valid for the identification of putative candidates. Ye et al. identified 40 differentially expressed proteins between three paired oral SCC cell lines with different metastatic potentials. They were able to confirm their results by IHC and, consequently, identified superoxide dismutase 2 (SOD2) as a predictive marker for the diagnosis of metastasis [In our study, we used liquid chromatography coupled to electrospray ionization tandem mass spectrometry to analyze tryptic peptides from three cell lines (2 HPV+ and 1 HPV−). This technology allowed us to identify and quantify 2221 proteins, among which 155 were differentially expressed between the HPV− and HPV+ cells with significant Similarly, we validated several of the differentially expressed proteins between the HPV− and HPV+ populations in our study using three different methods. Immunocytochemistry and western blotting confirmed our mass spectrometry results, and IHC also demonstrated those statistically significant differences in 50 HPV+ and 50 HPV− oral SCC specimens. In fact, HPV+ oral carcinomas overexpressed prostate stem cell antigen (PSCA) compared to HPV− oral carcinomas. PSCA was discovered fifteen years ago. It is a glycosylphosphatidylinositol (GPI)-anchored cell surface protein belonging to the Thy-1/Ly-6 family . PSCA waPSCA seems to be involved in cell growth regulation and to play some roles in signal transduction. Other members of the Ly-6 superfamily are involved in cell adhesion, cell migration, and the regulation of T lymphocyte regulation –30. PSCAα, was overexpressed in the HPV− cell line. EEF1α is a GTP-binding protein that interacts with aminoacyl-tRNA to recruit and deliver it to the A site of the ribosome during the elongation phase of protein translation. In addition to its role in protein translation, EEF1α is involved in cell migration, cell morphology, protein synthesis, actin cytoskeleton organization, and the modulation of apoptosis sensitivity [α has been defined as a putative oncogene [α expression is associated with increased cell proliferation, oncogenic transformation, and delayed cell senescence [Our second candidate protein, EEF1sitivity , 34. Dueoncogene . This proncogene . In contnescence –39. EEF1nescence . Severalnescence , 41.α in head and neck carcinogenesis caused by viral infection, and their functions remain to be elucidated. This study will aid in our understanding of the mechanisms used by HPV to promote the development of head and neck cancers. In conclusion, PSCA and EEF1 meet several criteria, suggesting that they are involved in the biology of HPV-related HNSCC; however, further studies should be conducted to confirm our observations in a larger clinical series. Moreover, it will be interesting to perform functional experiments to understand the signaling pathways disrupted by HPV infection. By silencing several proteins, we plan to study the impact of gene extinction on cell proliferation, migration, invasion, and apoptosis to better understand the mechanisms used by HPV to drive carcinogenesis.To date, no clinical studies have demonstrated the involvement of PSCA or EEF1

Huntington’s disease (HD) is an autosomal dominant disorder caused by an expanded CAG repeat on the short arm of chromosome 4 resulting in cognitive decline, motor dysfunction, and death, typically occurring 15 to 20 years after the onset of motor symptoms. Neuropathologically, HD is characterized by a specific loss of medium spiny neurons in the caudate and the putamen, as well as subsequent neuronal loss in the cerebral cortex. The transgenic R6/2 mouse model of HD carries the N-terminal fragment of the human HD gene (145 to 155 repeats) and rapidly develops some of the behavioral characteristics that are analogous to the human form of the disease. Mesenchymal stem cells (MSCs) have shown the ability to slow the onset of behavioral and neuropathological deficits following intrastriatal transplantation in rodent models of HD. Use of MSCs derived from umbilical cord (UC) offers an attractive strategy for transplantation as these cells are isolated from a noncontroversial and inexhaustible source and can be harvested at a low cost. Because UC MSCs represent an intermediate link between adult and embryonic tissue, they may hold more pluripotent properties than adult stem cells derived from other sources.Mesenchymal stem cells, isolated from the UC of day 15 gestation pups, were transplanted intrastriatally into 5-week-old R6/2 mice at either a low-passage (3 to 8) or high-passage (40 to 50). Mice were tested behaviorally for 6 weeks using the rotarod task, the Morris water maze, and the limb-clasping response. Following behavioral testing, tissue sections were analyzed for UC MSC survival, the immune response to the transplanted cells, and neuropathological changes.Following transplantation of UC MSCs, R6/2 mice did not display a reduction in motor deficits but there appeared to be transient sparing in a spatial memory task when compared to untreated R6/2 mice. However, R6/2 mice receiving either low- or high-passage UC MSCs displayed significantly less neuropathological deficits, relative to untreated R6/2 mice.The results from this study demonstrate that UC MSCs hold promise for reducing the neuropathological deficits observed in the R6/2 rodent model of HD. Huntington’s disease (HD) is an autosomal dominant disorder caused by an expanded and unstable CAG trinucleotide repeat that causes a progressive degeneration of neurons, primarily in the putamen, caudate nucleus and cerebral cortex. The underlying pathology of HD is initiated when the gene that codes for the huntingtin (HTT) protein, located on the short arm of chromosome 4, contains an increased number of CAG repeats . Adult oThe R6/2 mouse model of HD expresses the N-terminal portion of human htt, containing a highly expanded CAG repeat 145 to 155), and develops progressive neurological phenotypes resembling HD . At birt5 to 155,Mesenchymal stem cells (MSC) are multipotent cells derived from adult tissue that are readily available and easily accessed. Previous studies have shown that MSCs can suppress the immune response following transplantation and provide functional efficacy in rodent models of HD. As such, MSCs hold considerable promise as a source for an effective cell therapy -7. HowevAs observed previously , transplThe umbilical-cord (UC) is an attractive source of MSCs, as they represent an intermediate link between adult and embryonic tissue, and can be isolated from a noncontroversial source and can be harvested at a low cost ,10. HumaUC stem cells hold advantages over other types of adult stem cells, as it has been shown that UCs do not require human leukocyte antigen (HLA) matching ,14. Furtin vitro, when exposed to the differentiation signals [With this potential for pluripotency, many researchers have explored the use of UC MSCs as a cell replacement therapy in neurodegenerative disorders. Several groups have reported that human UC MSCs express neuronal precursor markers and can differentiate into mature neurons signals ,17-21. I signals . Several signals -25.in vivo following intra-striatal transplantation. UC MSCs may offer an exciting avenue for transplantation therapies if they are able to exert beneficial factors similar to bone-marrow MSCs, while possessing the ability to differentiate into neuronal lineages.The current study tested the efficacy of UC MSCs in the R6/2 mouse model of HD. It was hypothesized that MSCs isolated from the UC would possess the ability to differentiate into neuronal lineages in vitro passaging is required, and passaging cells has been shown to alter the properties of these cells [In order to expand stem cells, specifically MSCs, in sufficient numbers for transplantation, se cells . Our prese cells .in vitro alters the functional outcome following transplantation. Behavioral and histological analyses were performed to examine the efficacy of both low-passage (P3 to 8) and high-passage (P40 to 50) UC MSCs transplanted into the striata of R6/2 mice.The goals of the present experiment were to test: (1) the efficacy of UC MSCs in the R6/2 transgenic mouse model of HD; and (2) how passaging of MSCs 2 flask containing 15 mL of MSC medium.The extraction of UC MSCs was performed from day 15 gestation pups of wild-type . Briefly, the placenta was discarded from the distal end of the umbilical cord and the fetus and held above a sterile Petri dish with sterilized forceps. The cells were then pushed out of the umbilical cord using a separate set of sterile forceps. The UC was then diluted in 10 mL MSC medium with 10% fetal bovine serum , 10% horse serum , and 5 mg/mL streptomycin and 5 UI/mL penicillin ) and collected in a 15 mL Falcon tube and centrifuged at 1,500 rpm for seven minutes at 4°C. The cells were then counted and plated in a 75 cm2, UC MSCs were allowed to attach and non-adherent cells or debris was removed and replaced with fresh MSC medium. When the UC MSCs reached 85% confluency, the cells were passaged. Briefly, the culture medium was aspirated, 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA) solution (Sigma) was added for five minutes to detach the cells, then the trypsin was deactivated with 2 mL of FBS. The trypsin/EDTA solution and FBS containing the cells was collected and centrifuged at 1,500 rpm for seven minutes at 4°C. The supernatant was removed and the pellet was then re-suspended, counted and replated at a density of 8,000 cells/cm2 in a new 75 cm2 flask with fresh MSC media.Following incubation for 48 hours at 37°C, 5% COThe low-passage and the high-passage MSCs were analyzed by immunocytochemistry (ICC) and by flow cytometry. Briefly, for ICC, UC MSCs were plated into six-well plates containing poly-L-ornithine coated glass coverslips and cultured in MSC medium. At 80% confluency, the cells were fixed with 4% paraformaldehyde in 0.1 M PBS at 4°C for ten minutes. To block non-specific binding sites, the coverslips were incubated for one hour at room temperature with 10% normal goat serum (Sigma). Following blocking, the coverslips were incubated in primary antibodies overnight at 4°C. Primary antibodies included CD45 and SCA-1 . After 24 hours, the coverslips were then rinsed and incubated for one hour at room temperature with the appropriately conjugated secondary antibodies. The secondary antibodies included AlexaFluor488 and AlexaFluor594 . The coverslips were then rinsed and incubated in Hoechst 33358 for five minutes at room temperature to visualize cell DNA and then mounted onto glass slides using Fluoromount (Sigma). Slides were imaged at 20x using a Zeiss Axiovert 200 M inverted fluorescent microscope.Flow cytometry analysis followed previously published protocols . BrieflyRNA isolation was performed from UC MSC cell cultures using a Qiagen RNeasy system . All procedures followed the manufacturer’s guidelines. Briefly, two million cells were isolated following passaging and stored at −80°C in 200 μL Trizol (Sigma). Then, 300 μL of buffer RLT was added to the cell pellet and transferred into a gDNA Eliminator tube and centrifuged at 8,000 × g for one minute, at which point 350 μL of 70% ethanol was added to the flow-through and mixed thoroughly. All contents of the flow-through were then added to an RNeasy spin column and centrifuged at 8,000 × g for 30 seconds. The flow-through was discarded, 700 μL of RW1 buffer was added to the RNeasy spin column, and the column was centrifuged at 8,000 × g for 30 seconds. The flow-through was again discarded, and 500 μL of RPE buffer was added to the RNeasy spin column and the column was centrifuged at 8,000 × g for 30 seconds. The RNeasy spin column was placed in a new collection tube, 30 μL of RNase-free water was added to the spin column, and the column was centrifuged at 8,000 × g for one minute. Purified RNA, in the collection tube, was analyzed using a NanoDrop2000 spectrophotometer and was stored at −20°C until used for cDNA synthesis. A QuantiTect Reverse Transcription Kit (Qiagen) was used for cDNA synthesis following the manufacturer’s guidelines. Briefly, RNA was incubated at 42°C for two minutes in a genomic DNA elimination buffer. The solution was transferred to a reverse-transcription master mix and incubated at 42°C for 30 minutes and then at 95°C for three minutes to inactivate the reverse transcriptase. The cDNA was stored at −20°C until used in quantitative PCR experiments. Primer used for quantitative PCR was brain-derived neurotrophic factor (BDNF). All values were normalized to the housekeeping gene GAPDH and to a reference sample of tail-tip fibroblasts. Sequences are shown in Table ad libitum access to food and water. The mice were randomly assigned to one of the following four groups, with the exception of having the groups balanced by gender and genotype: (1) sham-operated WT mice ; (2) sham-operated R6/2 mice; (3) R6/2 mice transplanted with low-passage UC MSCs ; and (4) R6/2 mice transplanted with high-passage UC MSCs .All procedures were carried out under the approval of Central Michigan University Animal Care and Use Committee. Male and female R6/2 and WT mice, were housed at 22°C under a 12 hour light/12 hour dark reverse light cycle (lights on at 0900) with 2. The heads of the mice were shaved and cleaned using chlorehexadine . Lidocaine gel was placed on the tip of the ear bars prior to placing the mouse in the stereotaxic apparatus. The mice were then placed in the stereotaxic device and the anesthesia was maintained with isoflurane gas and O2 for the duration of the surgery. A midline incision was made on the scalp and the skin was retracted, exposing bregma. Two burr holes (0.5 mm) were placed directly over the neostriatum . Prior to transplantation, MSCs at either low passage (P3 to 8) or high passage (P40 to 50) were pre-labeled with Hoechst 33358 and resuspended at a density of 200,000 cells per microliter in HBSS. The cells were loaded into a 10 μL Hamilton microsyringe and bilaterally transplanted at a constant rate of 0.33 μL/minute for three minutes. Following the first injection, the syringe was left in place for three minutes, raised 1 mm, and injected a second time, for a total injection volume of 2 μL containing approximately 400,000 cells per hemisphere. After a second three-minute wait period, the microsyringe was withdrawn at a steady rate over a three-minute period. The same procedure was then followed on the opposite hemisphere, the burr holes were sealed with bone wax, and the wound was closed using sterile wound clips . The mice were then placed in a recovery cage until fully mobile, at which point, they were returned to their homecage.At five weeks of age, mice were anesthetized with isoflurane gas and OAll mice were tested for baseline behavior at five weeks of age, prior to cell transplantation. Following a one-week resting period after transplantation, the mice were tested weekly for six weeks, on all behavioral tasks, except for the Morris Water Maze (MWM), for which testing started at two weeks post-transplantation. The rotarod task was conducted to assess motor coordination. The mice were required to maintain their balance on a 3-cm diameter rotating rod for 60 seconds. The rotarod was set at a constant speed of 10 rpm and each mouse was given three trials per day. If the mouse was incapable of remaining on the rotarod for the full 60 seconds, they fell onto a foam pad placed below the apparatus.The mice also had their limb-clasping response recorded, which involved suspending them by their tails from a height of 50 cm for 30 seconds. A limb-clasping response was defined as the withdrawal of any limb to the torso for more than one second. Each testing session consisted of three trials, with a clasping score ranging from 0 to 4 . The limb-clasping response scores were averaged for each testing session for each animal.The MWM was used to assess cognitive function through spatial memory. Briefly, the MWM is a 142 cm diameter tank filled with opaque water (30.5 cm deep water mixed with non-toxic white paint). A platform (14 cm diameter) was placed just below (approximately 1 cm) the surface of the water. Prior to the baseline testing week, each mouse was given a cued trial, where the platform was placed in the center of the MWM with a visible flag attached 15 cm overhead. The mice were given four training trials from four starting locations which shaped them to swim to the escape platform and to ensure that their visual acuity and swimming ability were intact. During each weekly testing period, the location of the hidden platform was altered between the Northwest and Northeast quadrant (with the platform in the center of these quadrants). During baseline and the subsequent testing days, the mice were placed facing the wall of the tank on the center line at the tank’s Southern-most point and given sixty seconds to find the hidden platform. Following a successful trial, the mice were left on the platform for five seconds, removed from the tank, dried, and given a forty-five second inter-trial interval. Mice who did not locate the hidden platform within 60 seconds were guided by hand to the platform and allowed to rest on the platform for five seconds. Mice were given five trials per testing session. The swim speed, distance travelled and latency to escape were tracked and recorded using Viewpoint VideoTrack version 1.75. Measures recorded included latency to find the platform, distance swum, swim speed and the probability of finding the escape platform .At the conclusion of behavioral testing, when the mice were 11.5 weeks old, they were deeply anesthetized and overdosed with sodium pentobarbital (delivered i.p.) and transcardially perfused with 0.1 M PBS, followed by 4% paraformaldehyde (diluted in 0.1 M PBS at pH 7.4) to fix the tissue of the animal. The brains were then rapidly removed, suspended in 4% paraformaldehyde for 24 hours at 4°C and then transferred to 30% sucrose in 0.1 M PBS for 48 hours at 4°C. The brains were then flash frozen, using methylbutane and stored at −80°C until they were processed. Coronal sections were cut on a cryostat at 30 μm and were mounted on positive charged microscope slides . The tissue was labeled, using previously established free-floating fluorescent staining protocols using an-diaminobenzidine dissolved in 20 mL of phosphate-buffer for four hours at room temperature. The tissue was then transferred to deionized H2O, mounted onto positively charged glass slides and coverslipped using Depex . CYO labelled tissue was scanned using Nikon ScanPro.Cytochrome oxidase (CYO) histology was used to provide a terminal measure of metabolic activity in the tissue and these sections were also used for subsequent morphological analyses. Briefly, tissue designated for CYO analysis was submersed in a solution of 800 mg of sucrose (Sigma), 4 mg of cytochrome C (Sigma) and 1 mg of 3, 3'All images were analyzed using ImageJ . Briefly, images of the transplanted cells were captured from five sections of each animal, starting at 0.5 mm anterior to bregma and two sections, approximately 200 μm apart, anterior and posterior to the transplant site. Average intensity of the label, counts of positively labeled cells, as well as percent of co-localization between the transplanted MSCs and NeuN or GFAP, were analyzed in all groups. Densitometric measures of CYO and GFAP were analyzed from images taken in the striatum and the average intensities were normalized to the corpus callosum. Cells were counted as positive if they showed: (1) antibody immunoreactivity within the cell body; (2) the nucleus of that cell was within the counting frame without touching the exclusion lines; and (3) the nucleus of that cell was in focus. For total brain area, five sections were traced using ImageJ and the total area was calculated.post hoc tests were performed.All statistical analyses were performed using SPSS v16 with an alpha level equal to 0.05. All behavioral data were analyzed using a repeated measures analysis of variance (ANOVA) to measure changes between genotypes and treatments across weeks. Histological data were analyzed using a multivariate ANOVA. When appropriate, Tukey’s Honestly Significant Difference (Tukey’s HSD) Measures of ICC for both low- and high-passage UC MSCs showed positive expression of SCA1, a marker of mouse MSCs Figure , contrast(4) = 21.488, P <0.001), with low-passaged cells displaying a significantly higher expression of the mRNA for BDNF  = 13.575, P <0.01)  = 5.286, P <0.001). Tukey’s HSD analysis revealed significant differences between R6/2 and WT mice starting at six weeks of age and remaining for all testing weeks. Transplantation of low-passage UC MSCs did not confer significant motor benefits, as these animals were similar to R6/2 control mice at all time points. However, significant differences were observed between R6/2 and high-passage UCB MSC mice at 10 weeks of age.In the rotarod task, a repeated-measures ANOVA revealed significant between-group differences for the latency to fall  = 4.806, P <0.01) having a higher probability of finding the hidden platform than untreated R6/2 mice. It is important to note that the R6/2 mice did not display motor deficits in swimming ability and their swim speeds were similar to WT mice throughout all testing periods. However, their ability to locate the hidden platform within the 60-second trial period was significantly different than WT mice, and this deficit was mitigated somewhat by the UC MSC transplants.Given the high-degree of variability on measures of latency to find the platform and in the distance swum, the probability of finding the hidden platform was used for these analyses. In the MWM task, a repeated-measures ANOVA revealed significant differences between groups for the probability of correctly finding the hidden platform  = 8.259, P <0.001), and a significant interaction was observed between weeks and group  = 4.845, P <0.001) = 4.414, P <0.01) = 7.846, P <0.001) Figure A and B. t-test revealed a significant difference in the number of surviving UC MSCs between the low- and high-passaged groups at six weeks following transplantation (t(55) = 3.104, P <0.05)  = 2.265, P >0.05) Figure B. It was5)Figure C. These in vivo following transplantation. This is in contrast to what has been previously reported following transplantation of UC MSCs in the brain [In contrast to what was hypothesized, little to no co-localization of the transplanted UC MSCs with the mature neuronal marker NeuN was revealed, suggesting that these cells did not differentiate into mature neurons he brain -25, but he brain ,27,29,30in vitro, this alone was not able to provide significant behavioral sparing, suggesting that the transient reduction in behavioral deficits following transplantation of UC MSCs is not solely due to BDNF expression but likely due to a release of several trophic factors and immunomodulating cytokines [The four main findings of this study were: (1) transplantation of UC MSCs into the striata of R6/2 mice provided transient behavioral sparing compared to mice that did not receive stem cell transplants; (2) transplantation of high-passage UC MSCs resulted in a significant reduction in neuropathology, albeit providing only transient behavioral sparing; (3) the number of times the cells were passaged significantly altered the number of surviving cells and the astrocyte activation to the transplant 6.5 weeks following the transplant; and 4) while the UC MSCs did express the mRNA for BDNF ytokines .Data from this study demonstrate that transplantation of UC MSCs, while providing transient behavioral sparing, did not provide robust reductions of deficits to the extent of those previously observed in our lab following transplantations of bone-marrow-derived MSCs ,29,30. TWhile long-term behavioral sparing was not observed following intrastriatal UC MSC transplantation in these mice, significant reductions in neuropathology, in terms of preserved optical densitometric measures of CYO labeling in the striatum of R6/2 mice that received either low- or high-passaged UC MSCs. In addition, mice that received high-passaged UC MSCs also did not show overall brain atrophy when compared to untreated R6/2 mice. The trend for reduced neuropathological deficits observed in the high-passaged group, relative to the low-passaged group may, in part, be due to the number of surviving cells, as well as a reduced immune response to those cells. It was observed that there were significantly more surviving cells in the high-passaged group and that there was an increase in the optical densitometric measures of GFAP in the low-passaged group, when compared to the high-passaged group, suggesting that the low-passaged group may be subjected to a greater immune response, resulting in fewer surviving cells.in vitro. This suggests that the mechanism underlying MSC-mediated recovery is not solely dependent on BDNF, but probably involves a host of other trophic and immunomodulatory factors. Surprisingly, mRNA expression of BDNF in UC MSCs are in contrast to what was previously observed in our study with bone-marrow MSCs, whereby murine MSCs that have been maintained in culture for more than 40 passages had higher expression of BDNF mRNA than those that had been maintained in culture for less than eight passages. While it has been suggested that deficits in BDNF production play a causal role in the progression of HD [Because our results suggested that high-passaged UC MSCs tend to provide greater behavioral and neuropathological sparing than low-passaged UC MSCs, we were surprised that the low-passaged UC MSCs displayed a higher expression of mRNA for BDNF on of HD and the on of HD ,8,27,29.in vivo following intrastriatal transplantation. While we were unable to discern umbilical cord blood from Wharton’s jelly during cell isolation, the cells isolated did display characteristics of MSCs and were able to confer modest behavioral and anatomical sparing.A main goal of utilizing MSCs isolated from the UC was that these cells may possess greater levels of pluripotency than other adult MSCs, due to their intermediate developmental status between the fetus and the adult. However, in our lab, MSCs isolated from the UC, while displaying typical MSC morphology and protein expression, did not express markers of pluripotency and were unable to differentiate into neuronal phenotypes The results from this study demonstrate that UC MSCs may hold significant therapeutic value for reducing the neuropathological changes observed in the R6/2 rodent model of HD. While the cells cultured in our standard MSC medium did not express markers of pluripotency, changing the protocols for cell extraction from the umbilical cord ,20 or exANOVA: Analysis of variance; BDNF: Brain-derived neurotrophic factor; CYO: Cytochrome oxidase; EDTA: Ethylenediaminetetraacetic acid; FBS: Fetal bovine serum; GFAP: Glial fibrillary acid protein; HBSS: Hank’s balanced salt solution; HD: Huntington’s disease; HLA: Human leukocyte antigen; HSD: Honestly significant difference; HTT: Huntingtin; ICC: Immunocytochemistry; MHC: Major histological complex; MSC: Mesenchymal stem cell; MWM: Morris water maze; NeuN: Neuronal nuclei; PBS: Phosphate-buffered saline; PCR: Polymerase chain reaction; SSEA4: Stage specific embryonic antigen 4; UC: Umbilical-cord; WT: Wild-type.The authors declare that they have no competing interests.KF conducted behavioral testing, histological and RT-PCR analysis, performed statistical analysis, participated in the design of the study and drafted the manuscript. JR conducted behavioral testing, histological analysis, participated in the design of the study and coordination and helped to draft the manuscript. AC conducted histological and RT-PCR analysis and helped to draft the manuscript. KD conducted behavioral testing and histological analysis. MB conducted behavioral testing, histological analysis and participated in the design of the study. AB conducted behavioral testing and histological analysis. SC conducted behavioral testing and histological analysis. SL conducted behavioral testing and helped to draft the manuscript. CS participated in genotyping the animals. LL participated in the design and coordination and helped to draft the manuscript. GD conceived of the study, and participated in the design and coordination and performed the final proof of the manuscript. All authors read and approved the final manuscript.

A simple, sensitive, and reproducible reversed-phase high-performance liquid chromatography (RP-HPLC) method, coupled with a photodiode array detector, was developed for the determination of rupatadine (RUPA) and its related substances in pharmaceutical dosage forms. Chromatographic separation was achieved on the Hypersil BDS column with a mobile phase containing a gradient mixture of a buffer (acetate buffer pH-6.0) and solvent (methanol). The eluted compounds were monitored at 264 nm for the related substances and assay, the flow rate was 1.0 mL/min, and the column oven temperature was maintained at 50°C. The developed method separated RUPA from its four known and three unknown impurities within 15.0 min. Rupatadine was subjected to the stress conditions of oxidative, acid, base, hydrolytic, thermal, and photolytic degradation. Rupatadine was found to degrade significantly under oxidative stress conditions, and degrade slightly under acid, base, hydrolytic, thermal, and photolytic stress conditions. All impurities were well-resolved from each other and from the main peak, showing the stability-indicating power of the method. The developed method was validated as per the International Conference on Harmonization (ICH) guidelines. The developed and validated RP-HPLC method is LC-MS compatible and can be explored for the identification of eluted unknown impurities of RUPA. H-benzo[b]pyridine (2E)-but-2-enedioate. RUPAF discovery, pre-clinical, and clinical development was performed by J. Uriach y Cia, S. A. piperidin-4-ylidene}-6,11-dihydro-5al. for each of the stressed samples was calculated. The results from the forced degradation study are given in Forced degradation studies were performed by the stress conditions, acid hydrolysis (0.1N HCl at 70°C for 24h), base hydrolysis (0.1N NaOH at 70°C for 24h), oxidation (5% HThe system precision of the related substance method was verified by injecting six replicate injections of a standard solution containing RUPA (5 μg/mL). The % RSD (related standard deviation) of the peak area was calculated for RUPA (system precision). The method precision experiments were conducted in six individual preparations of the RUPA sample (1000 μg/mL) and the RSD (%) for the area percentage of Imp-B was calculated. Precision of the assay method was evaluated by performing six (n=6) independent assays of the RUPA tablet at the 100 μg/mL level against a qualified working standard. The RSD (%) of the six results was calculated. The intermediate precision of the assay and RS method was evaluated by different analysts, with different instruments, and on different days. The RSD (%) of the peak area of RUPA in system precision was within 1.0% . The RSDThe accuracy of an analytical procedure expresses the closeness of agreement between the true value and the observed value. The accuracy of the assay method for RUPA was evaluated in triplicate (n=3) at the three concentrations of 50, 100, and 150 μg/mL of the drug product, and the recovery was calculated for each added concentration. For impurity-B, the recovery was determined in triplicate (n=3) for 0.16, 2.0, 5.0, and 7.5 μg/mL of the analyte concentration (1000 μg/mL) of the drug product, and the recovery of the impurities was calculated. The amount recovered was within ± 1.5 % (for the assay) and ± 5.0 % (for related substances) of the amount added, which indicates that there is no interference due to excipients present in the pharmaceutical dosage forms. It was confirmed from results that the method is highly accurate and 6.y-intercepts of the calibration curve were determined to 7.5 μg/mL of the normal analyte concentration (5 μg/mL). For the RUPA assay, the response function was determined by preparing standard solutions at seven different concentration levels ranging from 50 to 150 μg/mL . The correlation coefficients, slopes, and termined . The cortermined –6. μg/mL toThe LOD and LOQ for RUPA and its impurity were determined at a signal-to-noise ratio of 3:1 and 10:1, respectively, by injecting a series of dilute solutions with known concentrations. A precision study was also carried out at the LOQ level by injecting six (n=6) individual preparations and calculating the % RSD of the area for Imp-B and RUPA. The determined limit of detection, limit of quantification, precision at LOQ, and accuracy at the LOQ level for RUPA and Imp-B are presented in To determine the robustness of the method, the experimental conditions were deliberately changed. The resolution of RUPA and imp-B was evaluated. The effect of change in flow rate ± 0.1mL/min (0.9 and 1.1 mL/min), column oven temperature ± 5°C (45 and 55°C), mobile phase pH ± 0.2 units (5.8 and 6.2 pH), and wavelength ± 2.0 (262 nm and 266 nm) were studied. During the study, other chromatographic conditions were kept the same as per the experimental section. In all of the deliberately varied chromatographic conditions, all analytes were adequately resolved, and the order of elution remained unchanged. The robustness study obtained results which are presented in Drug stability in pharmaceutical formulations is a function of the storage conditions and chemical properties of the drug and its impurities. The conditions used in the stability experiments should reflect situations likely to be encountered during actual sample handling and analysis. Stability data is required to show that the concentration and purity of the analyte in the sample at the time of analysis corresponds to the concentration and purity of the analyte at the time of sampling. RUPA (1000 μg/mL)-spiked solution (with 5 μg/mL of Imp-B) was prepared in the diluent by leaving the test solutions at room temperature. The spiked solution was re-analyzed at 24h and 48h time intervals, and the assay and related substances were determinate for the compounds and compared against the fresh sample. The sample solution did not show any appreciable change in the assay and related substances value when stored at ambient temperature up to 48h; the data are presented in ®, Milford, MA, USA). All other chemicals used were of analytical grade.The Rupatadine fumarate (100.9% w/w) working standard, Impurity-A (94.97% w/w), Impurity-B (99.74% w/w), Impurity-C (92.76% w/w), Impurity-D (87.22% w/w), placebo, and Rupatadine tablets were provided by Cadila Pharmaceutical Ltd., Ahmedabad, India. HPLC grade glacial acetic acid and methanol were obtained from J. T. Baker . AR grade ammonium acetate and sodium hydroxide were obtained from Merck Ltd. . A 0.45 μm PVDF membrane filter and PVDF syringe filters were purchased from Pall Life Science Limited (India). 0.45 μm PVDF syringe filters were purchased from Millipore (India). High purity water was generated using the Milli-Q Plus water purification system was used for the specificity study. Photo stability studies were carried out in a photostability chamber . Thermal stability studies were performed in a dry air oven .™ system , consisting of a binary solvent manager, sample manager, and PDA (photodiode array) detector. System control, data collection, and data processing were accomplished using Waters Empower™-2 chromatography data software. The chromatographic condition was optimized using the Hypersil BDS C8, column. The mobile phase-A consisted of an acetate buffer and was filtered through a 0.45 μm nylon membrane filter. Methanol was used as the mobile phase-B. A mixture of methanol and water in a 50:50 ratio was used as a diluent. The final selected and optimized conditions were as follows: injection volume 20 μL, gradient in diluent to obtain a solution containing 1000 μg/mL of RUPA (for related substances) and 100 μg/mL (for the assay). It was then filtered through a 0.45 μm Nylon syringe filter and the filtrate was collected after discarding the first few milliliters.in vitro dissolutions of pharmaceutical products, where the sample load is higher and the high throughput is essential for faster delivery of results.The rapid, gradient RP-HPLC method was developed for the quantitative and related substances analysis of Rupatadine in pharmaceutical formulation. Satisfactory results were obtained from the validation of the method. The run time (15 min) enabled rapid determination of RUPA. This method exhibited an excellent performance in terms of sensitivity and speed. This stability-indicating method can be applied for the routine analysis of production samples and to check the stability of Rupatadine in the bulk drug and formulation. Moreover, it can be applied for the determination of the assay, blend uniformity, content uniformity, and

SPAtially Referenced Regressions On Watershed attributes (SPARROW) models were developed to estimate nutrient inputs [total nitrogen (TN) and total phosphorus (TP)] to the northwestern part of the Gulf of Mexico from streams in the South-Central United States (U.S.). This area included drainages of the Lower Mississippi, Arkansas-White-Red, and Texas-Gulf hydrologic regions. The models were standardized to reflect nutrient sources and stream conditions during 2002. Model predictions of nutrient loads (mass per time) and yields (mass per area per time) generally were greatest in streams in the eastern part of the region and along reaches near the Texas and Louisiana shoreline. The Mississippi River and Atchafalaya River watersheds, which drain nearly two-thirds of the conterminous U.S., delivered the largest nutrient loads to the Gulf of Mexico, as expected. However, the three largest delivered TN yields were from the Trinity River/Galveston Bay, Calcasieu River, and Aransas River watersheds, while the three largest delivered TP yields were from the Calcasieu River, Mermentau River, and Trinity River/Galveston Bay watersheds. Model output indicated that the three largest sources of nitrogen from the region were atmospheric deposition (42%), commercial fertilizer (20%), and livestock manure . The three largest sources of phosphorus were commercial fertilizer (28%), urban runoff (23%), and livestock manure . A goal by 2015 . Water rIt is reasonable to expect that if the majority of the overall nutrient load from the MARB delivered to the Gulf originates from the Upper Mississippi River drainage area, then this part of the MARB would also be prioritized with respect to mitigation activities. For example, the Mississippi River Basin Healthy Watersheds Initiative (MRBI) of the U.S. Department of Agriculture, Natural Resources Conservation Service (USDA-NRCS), was established in 2010 to redirect existing USDA funding to the 12 states identified as top contributors to the overall nutrient load from the MARB to the Gulf . Forty-oa, low DO, and diminished estuary flushing capacity. Similarly, Although hypoxia along the inner continental shelf of the Gulf is of national significance, other nutrient-related issues such as localized hypoxia and harmful algal blooms in bays and estuaries along the coasts of Louisiana and Texas in the northwestern Gulf are also becoming more prevalent. Based on work by SPAtially Referenced Regressions On Watershed attributes (SPARROW) models were developed to assess the sources and delivery of TN and TP from streams in the South-Central United States (U.S.). This area includes the Lower Mississippi, Arkansas-White-Red, and Texas-Gulf hydrologic regions , but the load estimates from a bay or estuarine watershed may not be relevant to hypoxia on the inner continental shelf of the northern Gulf of Mexico. For ease of use, however, the estimates of TN and TP are summarized graphically for the major watersheds of the LMTG region, and it is inferred that each drains to the northwestern Gulf of Mexico. The watersheds and their associated names are identified according to the NOAA Coastal Assessment Framework NOAA, 2 for centSPARROW models use a hybrid statistical and process-based approach that relates nutrient loads (or mass) to upstream sources, landscape characteristics that influence nutrient transport, and instream loss were estimated using a software package called Fluxmaster, which uses an adjusted maximum likelihood approach as described in 2. In comparison, the national model developed by 2 and only 68 were located within the LMTG region.Total nitrogen and TP concentration data used to estimate loads were acquired from the USGS, USEPA, and databases from the states of Mississippi, Louisiana, Oklahoma, Texas, Arkansas, and Kansas. TN and TP concentration data from the various federal, state, and local databases were assumed to be of similar quality although sampling protocols and quality assurance procedures likely differed. Sites selected for model calibration were screened using criteria related to the type and amount of water-quality data available at each site. Selected sites were then matched with nearby streamflow gaging stations, and mean daily flow data used for load estimation were acquired from USGS and selected U.S. Army Corps of Engineers (USACE) gaging stations. Flow record was considered usable for load estimation if inclusive of the 2002 base year. A complete description of the screening and collocation process is available in the Supporting Information as well as in Selection of source, land-to-water delivery, and loss terms (independent variables) considered for LMTG SPARROW models was guided by: (1) review of terms selected for the national SPARROW model , and (2)K-factor from the Universal Soil Loss Equation).Land-to-water delivery terms considered for both models were precipitation (average for 2002 and 30-year average), soil permeability, channel slope, overland flow in excess of infiltration, overland flow in excess of saturation, drainage density, surficial geology classifications, bedrock geology classifications, hydrologic landscape regions, groundwater recharge, and estimated area of irrigated agricultural lands. Land-to-water delivery terms considered only for the TP model were estimated area of dams not included in the eRF1_2 reach network, average clay content, average silt content, and soil erodibility factor , (2) streams with flows >1.4 and ≤28 m3/s , and (3) streams with flows >28 m3/s. Loss in reservoirs was also modeled as a first-order decay process, and expressed as an apparent settling velocity (or mass transfer coefficient) in units of length per time. Reservoir loss is estimated as a function of the ratio of outflow discharge and surface area of the reservoir, and it represents the net effect of processes that remove nutrients from the water column to reservoir sediments and processes that add nutrients back to the water column , and 90th percentile confidence limits are presented in this article for each model. Confidence limits for the coefficients were computed using a t-distribution with N− k degrees of freedom, where N is the number of monitoring locations, and k is the number of coefficients estimated in the model. The robustness of the coefficients of the final TN and TP models were examined using nonparametric resampled bootstrapping procedures with 200 iterations. The bootstrapping procedures produce a mean value for the coefficients in each model , and the coefficients were evaluated for statistical significance. The final calibrated SPARROW models were selected based on assessment of significance level (α = 0.05) and interpretability of each source, land-to-water delivery, and loss term. Model coefficients, their standard errors and significance levels (R2), and magnitude and spatial distribution of residuals. A residual is an expression of the difference between the measured loads used for calibration and the model-estimated loads. For this article, residuals are standardized to have zero mean and unit variance and are referred to as studentized residuals , (3) lowest residual magnitudes, and (4) residuals with the lowest degree of spatial bias based on visual inspection of mapped residuals.Model performance, or goodness of fit, was evaluated on the basis of root mean square error, coefficients of determination , yield (mass per unit area per time), concentration (mass per unit water volume), and source-share contributions (percentage of the load for each source). Stream load and yield were reported for three spatial domains: (1) total drainage area upstream of an individual reach outlet, (2) the incremental reach drainage area, which is mass delivered to the downstream end of an individual reach exclusively from sources in the catchment that drain directly to the reach without passing through another reach , and (3) the amount of mass delivered from an incremental or total drainage area from an individual reach to a downstream water body, for example, estuary, reservoir. Their corresponding metrics are hereafter referred to as the “total,”“incremental,” and “delivered” load or yield, respectively. These metrics provide management-relevant information about the sources and fate of nutrients from local to regional spatial scales. The delivered load or yield was calculated by multiplying the total or incremental value of a stream reach by the SPARROW estimate of the “delivery fraction,” which quantifies the proportion of the nutrient load that is delivered to downstream waters without any removal by natural attenuation processes. . These estimates describe the cumulative mass generated in a watershed from all stream reaches that terminate at the watershed outlet. The accumulated delivered load and yield estimates were produced for these watersheds using a parametric bootstrapping approach with 200 model iterations, so the estimates include corresponding standard errors and 90th percentile confidence limits. More details are available in the Supporting Information describing computations used to accumulate delivered loads and yields by watershed.3/s and streams with average streamflows >1.4 and ≤28 m3/s; and one reservoir loss term. All final terms in the TN model were highly significant (p < 0.01).Source, land-to-water delivery, and loss terms for the final TN and TP SPARROW models for the LMTG region are presented in K-factor); one instream loss term, which was for streams with average streamflows ≤1.4 m3/s; and one reservoir loss term. Nearly all final terms in the TP model were significant (p ≤ 0.05).The final TP model included six source terms, which were industrial and municipal point sources, urban runoff from residential land-use classes, fertilizer applied to crops, livestock manure from confined and unconfined animal feeding operations (combined term), sediment from in-channel erosion, and background sources; three land-to-water delivery terms, which were overland flow in excess of infiltration, 30-year average precipitation, and soil erodibility factor and the background source term in the TP model (difference in the coefficients from the two methods was about 34%).R2 values were 0.92 and 0.88, and the yield R2 values were 0.86 and 0.80 for the TN and TP models, respectively, indicating that the assembled set of predictor variables used for the TN model explained variability in observed loads slightly better than did the predictor variables used in the TP model. Model uncertainty associated with load predictions for any given reach was lower for the TN model than the TP model as indicated by the root mean square errors, which were 0.55 and 0.74, respectively.Studentized residuals of the TN and TP models for the LMTG region are plotted in 2) for the land-use variables. Source coefficients account for losses (or gains) in the delivery of mass to all stream reaches throughout the model domain. Spatially variable land-to-water delivery factors such as climate and infiltration may account for additional gains or losses in delivery of mass to streams in areas where those variables affect loading.The present application of SPARROW includes nonconservative transport and mass-balance constraints. Given a specification of nutrient sources, the model estimates nutrient delivery from these sources to streams in relation to the land-to-water delivery terms specified in the model, which in the case of the LMTG models, included climate, infiltration excess overland flow, and soil erodibility (TP model only). Coefficients estimated for each source are expressed as either a percentage (fraction) for the mass variables delivered to the streams, or a unit area load to streams (kg/kmUrban sources for both LMTG models included point sources and urban runoff. Point source loads were input as a mass (in kg) to both models and response variables were expressed in the same units. Model coefficients for point sources were expected to be near 1 (dimensionless), which infers that 100% of the input is delivered to the stream, as it is assumed that point sources discharge directly to receiving streams and their loads are unaffected by land-to-water delivery factors. However, coefficients for point sources in both the TN and TP models were >1 , indicat2) expressed as a summation of land area for low, medium, high, and open space developed land-use categories from the 2001 NLCD. Developed land, therefore, serves as a surrogate measure of various diffuse urban sources in the model. These sources may include nutrient runoff from impervious surfaces and inflows from surface and groundwaters in urbanized catchments related to such sources as fertilizers, septic systems, sewage collection system leaks, sewage collection system overflows and bypasses, combined sewer overflows (where they exist), and atmospheric deposition from vehicle emissions. The model coefficient for urban runoff, expressed as kg/km2/year, from the TN model is about six times higher than the coefficient from the TP model and the effects of some farm management practices . Nutrient mineralization and immobilization rates in cultivated soils are assumed to be approximately in equilibrium. Nutrients associated with livestock manure reflect contributions from the excreted wastes of Coefficients for agricultural sources represent the net mean fraction of the source delivered from the land surface to the stream given the effect of land-to-water delivery losses specified in each model relevant to conditions in the LMTG region. For example, the coefficient for N from fertilizer applied to crops is 0.061 in the TN model . In generegional atmospheric N sources, given that NADP wet-deposition estimates generally reflect regional N emissions from both agricultural and industrial stationary sources sites as a surrogate for wet plus dry inorganic N deposition. LMTG-TN model estimates of atmospheric N deposition delivered to streams is expected to account for additional contributions from dry N deposition forms because regional patterns of wet and dry deposition are generally correlated over large areas of the U.S. ( sources indicatiAbout 22% (0.216 kg/kg) of N from atmospheric deposition onto the land surface was delivered to streams in the LMTG region on average; again, setting aside the effects of spatially variable land-to-water delivery terms . The atm3/s and streams with mean daily flows >1.4 m3/s. The final model included stream length only for streams with mean daily flows >1.4 m3/s indicating that streams with smaller flows were less capable of producing and transporting large amounts of sediment from in-channel erosion. P contribution from in-channel erosion was about 0.03 kg/m of stream length on average for the LMTG region (Stream length (or stream channel) was found to be a significant source of sediment in a recent national application of the SPARROW model . Stream G region . Because2/year of P are delivered to streams in the LMTG region from these background sources , wetlands (woody and emergent herbaceous), scrub, and barren. Each of these categories was considered a separate source term in previous model runs, but some were not statistically significant. To account for all sources of P in the LMTG region, these land-use categories were combined into a single background source term as presented here, which was statistically significant in the final LMTG-TP model. On average, about 2 kg/km sources . By compp-values <0.01 as shown in Land-to-water delivery variables common to both models were precipitation and overland flow in excess of infiltration, which were highly significant in both models database and were relatively consistent with other regional and national SPARROW models . For the final LMTG-TP model, the only instream P loss term that was included was for stream reaches with mean daily flows ≤1.4 m3/s, and for these stream reaches, the P loss rate was 0.25 day−1 (3/s) was used for both the stream length term as a source (sediment from in-channel erosion) and here as a stream loss term. For stream reaches with mean daily flows >1.4 m3/s, stream length was an important source and loss was minimal. These results imply that, for streams whose mean daily flows are >1.4 m3/s, P bound to sediment continues to be transported downstream with minimal loss even with settling and re-suspension phases considered. The loss of P in reservoirs in the LMTG region was 8.67 m/year as were used for the TN model. However, for all preliminary runs of the TP model, coefficients of instream loss of P for stream reaches with mean daily flows >1.4 m25 day−1 . It shou7 m/year , which iIncremental and delivered incremental TN and TP yields based on LMTG model output indicated that streams in the eastern part of the LMTG region and streams along the coast delivered more TN and TP than other locations . Reasons2/year, respectively, indicating that while a higher percentage of P generated in LMTG catchments was delivered to the Gulf, yields from N sources were at least an order of magnitude greater than yields from P sources.On average, model results indicated that more of the P load (about 59%) generated from catchments in the LMTG region was delivered to the Gulf of Mexico than N load (about 48% as shown in Model output indicated that the largest source contributions of N to LMTG streams were atmospheric deposition (42%), commercial fertilizer (20%), and livestock manure from unconfined animal feeding operations (17%) . The larIf all agricultural sources were considered, contributions presented here for the LMTG region (43% for TN and 51% for TP as shown in p > 0.05). For example, in the TN model, atmospheric deposition was the dominant source. However, there were no background sources of N that were considered in the TN model or were statistically significant . The atmospheric deposition term could, therefore, also be representing N from background sources. Another example related to the TN model is that N from crop fixation was not accounted for as a specific source. Datasets that adequately describe N fixation for the LMTG region were unavailable. Fixation as a source of N could be indirectly related to other terms such as atmospheric deposition and spreading of manure. Therefore, it was likely that several of the source coefficients in the TN model indirectly accounted for N from crop fixation. With respect to the TP model, commercially applied fertilizer was the primary source of P for northwestern Mississippi, an area dominated with row crop agriculture in the Lake Borgne and Barataria Bay watersheds. The Trinity River/Galveston Bay and Nueces River/Corpus Christi Bay watersheds were highly influenced by urban activities as the combined point source and urban runoff contributions totaled more than 50% of the delivered load. In contrast, the Colorado River/Matagorda Bay and Aransas River watersheds were affected by agricultural activities as the combined fertilizer and livestock manure contributions totaled nearly 60% or more of the delivered load, respectively. With respect to TP source contributions, the Trinity River/Galveston Bay, Nueces River/Corpus Christi Bay, and Lower Laguna Madre watersheds were highly influenced by urban activities as the combined point source and urban runoff contributions totaled more than 60% of the delivered load. In contrast, the Colorado River/Matagorda Bay, Aransas River, and Upper Laguna Madre watersheds were affected by agricultural activities as the combined fertilizer and livestock manure contributions totaled more than 60% of the delivered load. Although statistically significant as sources in the TP model, the combined P contribution from in-channel erosion (sediment) and from background land-use classifications did not total more than 11% of the delivered load for any of the 15 watersheds in the LMTG region.Results from the SPARROW models can help resource managers in the LMTG region address critical questions concerning nutrient issues in local watersheds. For example, LMTG model output for the Trinity River/Galveston Bay watershed indicated that pockets of elevated delivered incremental TN and TP yields were located in the upper part of the watershed and near the watershed outlet in close proximity of the cities of Dallas/Ft. Worth and Houston, respectively .Combined urban sources (point sources and urban runoff) were the primary source contributions in this watershed and accounted for about 73% of the TN load and about 80% of the TP load delivered to the outlet of the watershed based on LMTG model output . The impThe effect of reservoirs on nutrient loads entering Galveston Bay has also been a focus of previous work. Lake Livingston, located on the Trinity River about 175 km above Galveston Bay, was constructed in 1971 for water supply purposes and is cMuch of the focus of nutrient loading to Galveston Bay has centered on the Trinity River due to the fact that it accounts for about 70% of the total Galveston Bay watershed. However, model output indicated an area of elevated TN and TP yield in the western part of the watershed, which includes the San Jacinto River and City of Houston and yields (mass per unit area of catchment) from streams that drain to the northwestern part of the Gulf of Mexico from the Lower Mississippi, Arkansas-White-Red, and Texas-Gulf (LMTG) region. Load estimates standardized to the 2002 base year from 344 sampled sites for the TN model and from 442 sampled sites for the TP model were used for calibration. Streams in the eastern part of the region and streams along the coast delivered more N and P than other locations in the LMTG region, a consequence of shorter travel times and distances, higher inputs from sources, rainfall patterns, and less instream loss of nutrients . The Mississippi River and Atchafalaya River/Terrebonne Bay watersheds, which drain nearly two-thirds of the conterminous U.S. land area, delivered the largest loads of TN and TP to the Gulf of Mexico, as expected, but yields from other watersheds in the LMTG region were as high or higher than those in these two watersheds. The highest delivered TN yields were from the Trinity River/Galveston Bay, Calcasieu River, and Aransas River watersheds, while the highest delivered TP yields were from the Calcasieu River, Mermentau River, and Trinity River/Galveston Bay watersheds.Simulations made with the LMTG SPARROW models developed here allow for relative watershed-to-watershed comparison of nutrient yields and sources, and results can be scaled to address local watershed issues as well as broader concerns such as the influence of LMTG streams on Gulf hypoxia. Delivered incremental yields and primary sources as identified from LMTG model output, such as those presented for the Trinity River/Galveston Bay watershed, provide a complete picture to assess the origin of elevated nutrient loads and yields and to identify the primary sources of nutrients within those areas. Such information is useful to water resource managers in nutrient criteria and total maximum daily load development, as well as nutrient reduction strategies to protect downstream sea grass beds and other aquatic resources in bays and estuaries along the Louisiana and Texas coasts.It should be noted that uncertainty increases in load estimates and source allocations, especially at very small scales or for very small tributaries, due to limitations in the datasets used to complete model calibration and predictions. The LMTG SPARROW models could be improved by using a more refined digital stream reach network, which would allow for better source and land-to-water delineations, use of more monitoring stations for calibration, and better estimates of nutrient transport and decay. LMTG models also could be improved by using updated datasets such as confirmation of precise tributary locations and load estimates for municipal and industrial point sources.

MCHR1. The variations constitute two main haplotypes . Both SNPs affect CpG dinucleotides, whereby each haplotype contains a potential methylation site at one of the two SNP positions. In addition, 15 CpGs in close vicinity of these SNPs constitute a weak CpG island. Here, we studied whether DNA methylation in this sequence context may contribute to population- and age-specific effects of MCHR1 alleles in obesity.Melanin-concentrating hormone receptor 1 (MCHR1) plays a significant role in regulation of energy balance, food intake, physical activity and body weight in humans and rodents. Several association studies for human obesity showed contrary results concerning the SNPs rs133072 (G/A) and rs133073 (T/C), which localize to the first exon of MCHR1 encompassing rs133072 and rs133073 and the CpG island in blood samples of 49 individuals by bisulfite sequencing. The AC haplotype shows a significantly higher methylation level than the GT haplotype. This allele-specific methylation is age-dependent. In young individuals (20–30 years) the difference in DNA methylation between haplotypes is significant; whereas in individuals older than 60 years it is not detectable. Interestingly, the GT allele shows a decrease in methylation status with increasing BMI, whereas the methylation of the AC allele is not associated with this phenotype. Heterozygous lymphoblastoid cell lines show the same pattern of allele-specific DNA methylation. The cell line, which exhibits the highest difference in methylation levels between both haplotypes, also shows allele-specific transcription of MCHR1, which can be abolished by treatment with the DNA methylase inhibitor 5-aza-2′-deoxycytidine.We analyzed DNA methylation of a 315 bp region of MCHR1 is allele-specific, age-dependent, BMI-associated and affects transcription. Conceivably, this epigenetic regulation contributes to the age- and/or population specific effects reported for MCHR1 in several human obesity studies.We show that DNA methylation at DNA methylation is an essential epigenetic modification of the genome, and is involved in many cellular processes like transcription, X chromosome inactivation, genomic imprinting and chromosome stability cisDifferent DNA methylation levels of alleles of a given gene within one cell have been observed in imprinted regions on a parent-of-origin basis MLH1 and BRCA1Allele-specific expression (ASE) is a widespread phenomenon in human cells MCHR1 protein-coding region of exon 1 were published and show inconsistent results or no association at all vs. obese individuals, but not statistically significant th percentile) and obese adults (BMI>40) the G allele of rs133072 was associated with obesity/BMI (P = 0.044) compared to adult controls in vitroMelanin-concentrating hormone receptor 1 (MCHR1) plays a significant role in regulation of energy balance, food intake and body weight in humans and rodents NDUFB6, a gene associated with the risk of type 2 diabetes mellitus, in human skeletal muscle MCHR1These contrasting results suggest that SNP-dependent epigenetic variations may influence the association with obesity. The role of genotype-dependent DNA methylation in gene silencing/expression has previously been shown for the respiratory chain component MCHR1. They are in tight linkage and form two major haplotypes, GT and AC MCHR1 is age-dependent, which means the difference in methylation status between haplotypes is significant in young (20–30 y) but abolished in old individuals. Interestingly, the methylation status of the GT haplotype decreases with increasing BMI, whereas the AC haplotype shows no association in methylation status with BMI. In a MCHR1 heterozygous lymphoblastoid cell line (LCL), which shows ASM, ASE could be abolished by treatment with the methylation inhibitor 5-aza-2′-deoxycytidine (AzadC).SNPs rs133072 and rs133073 are located in the first exon of vs. expected CpG ratio of 0.64. The CpG island is embedded in the coding portion of MCHR1 exon 1 and is located about 300 bp downstream of the putative MCHR1 TSS (The SNPs rs133072 (G/A) and rs133073 (T/C) form each a CpG, if allele G or C is present, respectively. Based on sequences of chimpanzee (CGSC 2.1/panTro2) and rhesus macaque (MGSC Merged 1.0/rheMac3), these alleles represent the ancestral state. In the vicinity of these SNPs there are 15 additional CpGs, which form a CpG island according to criteria put forward by Gardiner-Garden and Frommer _005297) .MCHR1 SNPs rs133072 and rs133073 in 93 DNA samples of individuals aged between 21 and 78 years. All homozygous individuals showed only two haplotypes, GT and AC. In heterozygous individuals, all individuals who were heterozygous at rs133072 were also heterozygous at rs133073. For further analyses PCR products of 18 heterozygotes were cloned and sequenced, which allowed determination of haplotypes. Also here, only GT and AC haplotypes were found. Therefore and because of the previously reported tight linkage of these SNPs P = 0.468, Chi-square test). For subsequent methylation analyses only unrelated Caucasian individuals were used.We initially genotyped the MCHR1 methylation in blood of 49 individuals, including 18 individuals homozygous for GT, 13 individuals homozygous for AC and 18 heterozygotes after bisulfite treatment by cloning and sequencing. We analyzed on average 41 clones per individual. The average clone number for the GT allele is 29 and for the AC allele 31 (nind = 31). The methylation intensity of the GT allele was significantly lower than that of the AC allele .MCHR1 methylation intensity varies over age, we further selected from the 49 individuals three age classes: young (20–30 years), intermediate (40–50 years) and old (>60 years), comprised of 23, 10 and 12 individuals, respectively. Genotypes of rs133072 in the age classes are distributed as follows: young (GG/GA/AA: 8/9/6), intermediate (4/3/3) and old (5/5/2). Again, in young individuals the methylation level of the GT allele was significantly lower compared to the AC allele , but show a decrease in methylation status with advancing age for both alleles, with a higher slope for the higher methylated AC allele. No gender difference was observed within the different age classes (data not shown).To test whether vs. BMI. The methylation status of the GT allele (nind = 29) is negatively correlated with BMI , whereas for the AC allele (nind = 26) we did not detect a difference in methylation with respect to increasing BMI , we analyzed the methylation status MCHR1 methylation and mRNA expression, we studied three EBV transformed LCLs: GM12760, GM12864 and C0913, which are heterozygous at rs133072 and rs133073. At ten time points within 63 passages DNA methylation was stable in all three cell lines . To check if the observed allele-specific transcription is not due to a different number of allele copies in these LCLs, we measured allelic status in genomic DNA by pyrosequencing. All three LCLs have equal copies of both alleles did not show ASE in a study of lymphoblastoid cell lines MCHR1MCHR1 is age-dependent. The AC allele was significantly more methylated than the GT allele in individuals of young (20–30 years) in contrast to those of intermediate (40–50 years) and old (>60 years) age. Both alleles showed a decrease in methylation intensity with increasing age but with a smaller slope for the GT in comparison to the AC allele. It was previously shown that DNA methylation varies over age Here, we report the methylation analysis of a CpG island in the first exon of MCHR1 in LCL C0913 is reflected in a skewed mRNA transcription rate: the highly methylated AC allele has a three times lower expression than the lowly methylated GT allele. Further, global suppression of DNA methylation by AzadC supplementation leads to an elevated total MCHR1 mRNA expression and abolishes ASE. The analyzed MCHR1 CpG island is located 300 bp downstream of the putative MCHR1 TSS. Although the island is weak and not located in the promoter region our results suggest that DNA methylation of this MCHR1 CpG island has an impact on gene expression.ASE is a widespread phenomenon in the human transcriptome Mchr1−/−) mice have a significantly elevated energy expenditure and show hyperactivity and resistance to diet-induced obesity MCHR1 may mediate suppression of gene transcription and thus cause a reduction of orexigenic effects of receptor ligands. That implies that the association of MCHR1 and human obesity may be mediated epigenetically. Previously, a significant association of the A allele of rs133072 with obesity in a German study group comprising mainly adolescents could not be confirmed in other German, Danish, French and American study samples of older age MCHR1 associated with the A allele of rs133072 – suggests a protective effect of the A allele Mchr1-deficient . For a further 60 individuals DNA isolated from blood was obtained from the popgen biobank 3 and 75 cm3 BD Falcon™ flasks at 37°C and 5% CO2 in a total amount of 10 ml and 30 ml, respectively. Cells were grown to a density of 1×106 cells/ml and split in a ratio of 1∶3.The B-lymphocyte, EBV transformed cell lines (LCL) GM12760 and GM12864 and cell line C0913 were purchased from The Coriell Institute for Medical Research and ECACC , respectively. Cell lines GM12760 and GM12864 are from male donors of the CEPH project, which comprises donors from Utah residents with ancestry from western and northern Europe (HapMap project). The donor of C0913 is an UK Caucasian female of unknown age. Cell lines were cultured in RPMI 1640 with GIBCO GlutaMAX™ with 15% Fetal Bovine Serum “GOLD” and 1.5% PenStrep in 25 cmDNA isolation from blood and cell lines was performed using the DNeasy Blood & Tissue Kit from Qiagen according to the manufacturer's protocol.MCHR1 SNPs rs133072 and rs133073 a nested PCR approach was used. Primers used in the first PCR were: M_Gt.1F 5′-GGAGATCCCTTTCCTGATGG-3′ and M_Gt.1R 5′-CCATCGCACCAGTGAGAGGC-3′. First PCR was performed in a volume of 25 µl. Cycling conditions were: 96°C for 5 min, 30 cycles at 95°C for 1 min, 59°C for 30 s, 72°C for 1 min 30 s and a final elongation step at 72°C for 10 min. In the second PCR, primers M_Gt.2F 5′-TGCAGGCATTCAGAAGTGG-3′ and M_Gt.2R 5′-CAAAGGTCTCATCCTGCTC-3′ were used. The PCR was done in a volume of 25 µl; conditions were 95°C for 2 min, 30 cycles at 95°C for 1 min, 56°C for 30 s, 72°C for 1 min and a final elongation step at 72°C for 10 min. Genotyping was performed by sequencing using BigDye Terminator v3.1 Sequencing Standard Kit and primers M_Gt.2F and M_Gt.3R 5′-CCTCAGAGCAAAGCAGACC-3′. Sequencing reactions were electrophoresed on ABI 3730×l automated sequencers. Base calling was performed using phred For genotyping of E. coli were transformed according to the manufacturer's protocol. Single clones were sequenced using M13 primers as described. The methylation intensity for each individual was calculated by dividing the number of methylated sites in all clones by the number of possible methylation sites.A minimum of 200 ng DNA was treated with sodium bisulfite to convert unmethylated cytosines to uracil using the Methylation Gold Kit . Bisulfite specific PCR (BSP) was performed using at least 10 ng of bisulfite treated DNA in 25 µl for 95°C for 30 s, 35 cycles at 60°c for 30 s, 72°C for 25 s, 95°C for 30 s and a final elongation step at 72°C for 5 min. BSP products were resolved on 1.5% agarose gels, purified using the Double Pure Kit and eluted in 12 µl HPLC water. Amplicons were cloned into pCR2.1 . Further, MCHR1, the BSP product is 315 bp and contains 15 CpGs and SNPs rs133072 and rs133073. Primers for BSP were: M_BSP.1F 5′-TGTTTAGGTGATGTTAGTGGGAGTT-3′, M_BSP.1R 5′-ACTCCCAATCAACTCACCTAC-3′.For 7 cells with Qiagen RNeasy Mini Kit (Qiagen). Reverse transcription was done using Omniscript™ RT Kit (Qiagen). Prior to further analysis, MCHR1 cDNA was amplified using primers M_Gt.1F and M_Gt.1R as described above. PCR was performed in a volume of 25 µl. Cycling conditions were: 96°C for 5 min, 30 cycles at 95°C for 1 min, 59°C for 30 s, 72°C for 1 min 30 s and a final elongation step at 72°C for 10 min. For pyrosequencing biotinylated PCR products were needed. For this purpose, we carried out eight PCRs with one biotinylated and one unlabeled primer by mixing 20 µl of PCR product with 6 µl streptavidin Sepharose™ suspension, 10 µl water, and 40 µl 1×binding buffer, followed by shaking at room temperature for at least 10 min. To remove unbiotinylated DNA strand, samples were sequentially washed with 70% ethanol and 0.5 M NaOH using the PyroMark Vacuum PrepTool (Biotage). Immobilized single stranded DNA was then washed with 1× washing buffer for 10 s, transferred to 40 µl 1×annealing buffer plus 4 µl target-specific sequencing primer (10 pmol/µl in water), and kept at 80°C for 10 min. After equilibration to room temperature, sequencing was performed using sequencing primers and the 5 cells/ml in a total volume of 6 ml per well. A single dose of 5 µM of AzadC was added to one well, while three wells were used as untreated controls. Cells were harvested after 96 hours; incubation medium was not changed. The experiment was repeated once.Lymphoblastoid cells were counted and set at an initial concentration of 1×10MCHR1 were normalized to Ct values of the housekeeping gene GAPDH . For amplification, primers qM.F 5′-CCAGGCTACGGAGGAAGAC-3′ and qM.R 5′-GAGGTGATCCTGCCGAAGT-3′ were used for MCHR1 and qG.F 5′-AACAGCGACACCCACTCCTC-3′ and qG.R 5′-GGAGGGGAGATTCAGTGTGGT-3′ for GAPDH. PCR conditions were 95°C for 2 min, 45 cycles at 95°C for 20 s, 59°C for 30 s, 72°C for 20 s and 80°C for 15 s following by melting curve analysis with 95°C for 30 s and a 0.5°C ramp starting from 75°C to 100°C.Real-time PCR was performed with the iCycler iQ detection system . PCR reactions were performed in 50 µl volume using GoScript® qPCR Master Mix following manufactory's protocol. All reactions were performed in triplicates and negative controls were always included. The cycle threshold (Ct) values were normalized to the Ct value which represented the lowest expression level. Fold changes describe the difference in expression level between untreated and treated LCL C0913. Ct values of To detect CpG islands 2 kb up-and downstream of the putative TSS, the program CpG island searcher was used χ2) test in EXCEL .Hardy-Weinberg disequilibrium was tested using Chi square (http://www.urogene.org/methprimer) http://frodo.wi.mit.edu/primer3/), respectively.For primer design on bisulfite treated DNA, we used the MethPrimer software . Statistical analysis was performed using the t-test for normally distributed data. If the Normality Test (Shapiro-Wilk-test) failed, the non-parametric Mann-Whitney-test was used. To compare absolute clone counts for three different methylation levels , we performed a Chi square test, which was done in SigmaPlot®. To test, if the differences in allele-specific gene expression between the three LCLs do not occur by chance, we performed Kruskal-Wallis One Way ANOVA using SigmaPlot®. A value of Figure S1Allele-specific DNA methylation at MCHR1 in three LCLs. DNA methylation levels of GT and AC alleles at ten single passages in the three analyzed heterozygous LCLs: A: GM12760, B: GM12864, C: C0913. The passage numbers were counted when cells were split after thawing of the immortalized LCLs. White circles display the methylation level of the AC allele; black circles show methylation level of the GT allele.(TIF)Click here for additional data file.Figure S2GT allele frequency in genomic DNA of LCLs. GT allele frequencies of the three LCLs in genomic DNA were obtained by pyrosequencing. The measurements were performed in a similar approach as for expression analysis of three LCLs (see LCLs see . We used(TIF)Click here for additional data file.Figure S3Fold changes in total expression of MCHR1 following AzadC treatment. To check if global suppression of DNA methylation leads to an elevated MCHR1 expression, we measured fold changes in gene expression by quantitative real time PCR. Following AzadC treatment, total expression of MCHR1 changed about 645-fold.(TIF)Click here for additional data file.Table S1Pyrosequencing primer names and sequences.(DOC)Click here for additional data file.Table S2Pyrosequencing PCR.(DOC)Click here for additional data file.

Clin Chem Lab Med 2006;44:883–887]. These patterns were used to construct a simplistic model of the ovulatory cycle without the conventional "positive feedback" phenomenon. The model is based on few well-established relations:When hormones during the ovulatory cycle are shown in phase plane graphs, reported FSH and estrogen values form a specific pattern that resembles the leaning “&" symbol, while LH and progesterone (Pg) values form a "boomerang" shape. Graphs in this paper were made using data reported by Stricker et al. [hypothalamic GnRH secretion is increased under estrogen exposure during two weeks that start before the ovulatory surge and lasts till lutheolysis.the pituitary GnRH receptors are so prone to downregulation through ligand binding that this must be important for their function.in several estrogen target tissue progesterone receptor (PgR) expression depends on previous estrogen binding to functional estrogen receptors (ER), while Pg binding to the expressed PgRs reduces both ER and PgR expression.Some key features of the presented model are here listed:High GnRH secretion induced by the recovered estrogen exposure starts in the late follicular phase and lasts till lutheolysis. The LH and FSH surges start due to combination of accumulated pituitary GnRH receptors and increased GnRH secretion. The surges quickly end due to partial downregulation of the pituitary GnRH receptors (64% reduction of the follicular phase pituitary GnRH receptors is needed to explain the reported LH drop after the surge). A strong increase in the lutheal Pg blood level, despite modest decline in LH levels, is explained as delayed expression of pituitary PgRs. Postponed pituitary PgRs expression enforces a negative feedback loop between Pg levels and LH secretions not before the mid lutheal phase.Lutheolysis is explained as a consequence of Pg binding to hypothalamic and pituitary PgRs that reduces local ER expression. When hypothalamic sensitivity to estrogen is diminished due to lack of local ERs, hypothalamus switches back to the low GnRH secretion rate, leading to low secretion of gonadotropins and to lutheolysis. During low GnRH secretion rates, previously downregulated pituitary GnRH receptors recover to normal levels and thus allow the next cycle.Possible implications of the presented model on several topics related to reproductive physiology are shortly discussed with some evolutionary aspects including the emergence of menopause. When presenting the complex dynamic of involved hormones, graphs often show time series data within an idealized 28 day ovulatory cycle, similar to Figure Perfect timing of several hormone actions during the ovulatory cycle is essential for complex process of follicular growth, ovulation, and maintenance of When explaining the sequence of events during the ovulatory cycle, most physiological textbooks are similar in description of two important phases of the ovulatory cycle: the ovulatory surge of gonadotropins (FSH & LH) and lutheolysis.Positive feedback of estrogens, progestins, and activins on the hypothalamic-pituitary axis is involved in the induction of this LH surge… the accelerated rate of increase in estradiol levels in the preovulatory phase sensitizes the gonadotrophs in the anterior pituitary to GnRH pulses… also modulate hypothalamic neuronal activity and induce a GnRH surge…the powerful positive feedback action of estradiol induces the midcycle surge of LH and, to a lesser extent, FSH.. Just before ovulation, the rise in estradiol secretion becomes more rapid and, by a positive feedback effect on the anterior pituitary, triggers a surge in LH, which causes ovulation. Also occurring just before ovulation is a smaller FSH surge that is triggered by a rise in progesterone as well as activin… Estradiol secretion by the dominant follicle increases rapidly near the end of the late follicular phase. This dramatic rise in circulating estradiol exerts positive feedback on the anterior pituitary and sensitizes it to GnRH. The net effect of a rising estradiol level is induction of the LH surge….The LH surge appears to terminate in part as a result of rising levels of progesterone, via negative feedback, and in part as a result of loss of the positive feedback that is derived from estradiol. Depletion of gonadotropin stores in the anterior pituitary gland may also contribute to termination of the LH surge.” (1).Often, more attention is payed to the mechanism of ovulation induction that happens after several days of raising estrogen blood levels in the late follicular phase. Then an almost paradoxical surge of gonadotropins, often described as the “positive feedback”, leads to the follicle rupture. In Boron & Boulpaep this pheLH secretion is held in check by the negative feedback effect of the rising plasma estrogen level. At 36 to 48 hours before ovulation, the estrogen feedback effect becomes positive, and this initiates the burst of LH secretion (LH surge) that produces ovulation…a moderate, constant level of circulating estrogen exerts a negative feedback effect on LH secretion, whereas during the cycle, an elevated estrogen level exerts a positive feedback effect and stimulates LH secretion…” [Similar approaches can be found in other textbooks: “ …retion…” .The high levels of progesterone, estrogens, and inhibins maximally suppress the hypothalamic-pituitary system. The result is that FSH and LH levels fall. As LH levels fall, the target of LH, the corpus luteum, rapidly diminishes its production of estrogen and progestins… the fall in estrogen and progestin levels diminishes the feedback inhibition on the hypothalamic-pituitary system, and gonadotropin secretion rises once again, thus beginning the next menstrual cycle.”Often it is much less said about lutheolysis. In Boron & Boulpaep it is co&" symbol, while Figure Here presented model of the ovulatory cycle is an attempt to interpret both gonadotropin surges and lutheolysis without using the positive feedback phenomenon. The model is based on phase plane graphs of gonadotropins with estrogen and progesterone during a typical ovulatory cycle. This approach was first applied on digitalized values of FSH, LH, estrogen (E) and progesterone (Pg) during a typical 28-day ovulatory cycle, as reported by Chabbert Buffet et al. . After tSeveral assumptions were needed for the here proposed interpretation of complex phase plane patterns in Figures GnRH action is peculiar in two aspects ,2. FirstSeveral mediators are modulating the GnRH secretion. The pineal gland as a biorhythm regulator probably has some role in initiating puberty, but the body fat reserve seems more important in human reproduction. Information about the body fat reserve is probably mediated through leptin secretion from adipose tissue, particularly from the abdominal fat . Only suThe rhythm of GnRH secretion depends on hypothalamic action of sex hormone action, as shown in Table In males after the puberty onset, stable GnRH secretion lasts for decades Table . InteracIf we take gonadotropins more closely, the regulation of LH secretion seems simple. In men, it depends on testosterone action on the pituitary and on the previously mentioned combined testosterone/estrogen exposure that modulates hypothalamic GnRH secretion. In women it seems mainly regulated by progesterone exposure, although during the follicular phase it is regulated through GnRH actions with FSH.FSH regulation is more complex. In men, beside the combined testosterone/estrogen modulation of hypothalamic GnRH secretion, FSH is regulated on the pituitary level by inhibin secreted from Sertoli cells ,2. In woEstrogen binds to the pool of sex hormone binding globulin ,2 and th“…the monthly cycle of folliculogenesis actually begins from the primary-follicle stage 2 to 3 days before onset of the menses of the previous cycle. At this time, FSH levels begin to increase because of decreasing inhibin concentrations, thus inducing folliculogenesis, which is completed in the next cycle.”.inhibin A is secreted during the lutheal phase when it reduces FSH secretion and thusactivin is probably another fine-tuning modulator of the FSH secretion.Regular shifting between the low and the high mode of GnRH secretion each two weeks in ovulating women resembles the puberty onset in several aspects Table . AlthougSeveral mediators are involved in puberty initiation when GnRH secretion increases in both genders, particularly leptin and kisspeptin . Since pFrom breast cancer studies -19, it iBased on reports on various estrogen and progesterone target tissues , the pool of estrogen binding proteins slowly releases estrogen accumulated from the previous cycle. In the next days, levels of inhibin, E and Pg are low, allowing FSH to rise. Early estrogen secretion cannot suppress the FSH secretion since most of the new estrogen is caught by the almost empty pool of sex hormone binding globulin (SHBG). Excess FSH secretion that might lead to multiple ovulations is prevented by inhibin.On the day −7, new follicles start producing more estrogen and inhibin B. From the day −6 to −2, due to estrogen secretion from the dominant follicle, estrogen rapidly rises. Despite expected suppression, FSH is only slightly reduced, showing absence of the negative feedback of FSH with estrogen. A possible interpretation is that secreted estrogen binds to the unsaturated pool of plasma binding proteins. Inhibin B is probably important in preventing multiple ovulation due to inhibition of FSH secretion.Between the day −3 and −1, estrogen action in the hypothalamus is strong enough to switch the GnRH secretion rhythm to a more intense level that forces rapid rises of FSH and LH secretions during one or two days, peaking on the day 0. The FSH peak is limited by pituitary exposure to estrogen and inhibin A & B through the negative feedback. The LH surge seems limited only by the GnRH action, since Pg level in the blood is low and the pituitary PgRs are still scarce. Expression of PgR was low due to low estrogen exposure during the previous week. The LH surge can be used as a measure of increased GnRH secretion since, median LH values reported by Stricker et al. are 5.8 Intensified GnRH secretion rapidly downregulates the pituitary GnRH receptors and this reduction in pituitary GnRH sensitivity diminish both gonadotropin surges. Based on median values reported by Stricker et al. , the LH In short, ovulatory surges are here not explained by the “positive” feedback. Instead of that, the low GnRH secretion during the follicular phase allows the pituitary GnRHRs to accumulate. When the GnRH secretion is qualitatively increased, due to estrogen exposure, temporary gonadotropin surges happen. They last until the GnRHR downregulation returns the gonadotropin secretion under the negative feedback control. So, instead of mysterious “positive feedback”, here presented model proposes serial hormonal actions:Early follicular phase:low estrogen exposure increases pool of hypothalamic ERslow GnRH secretion increases pool of pituitary GnRHRsLate follicular phasehypothalamus detects estrogen secretion and changes GnRH secretion to the high rateOvulatory surgessurges of gonadotropins last until pituitary GhRHRs are downregulatedthe FSH surge is shaped by estrogen and inhibin negative feedbackthe LH surge is maximal since pituitary is insensitive to low progesterone exposure due to low pituitary PgR expressionThe dominant follicle ruptures and subsequent local bleeding interrupts estrogen production. In the first postovulatory day (day +1), beside FSH and LH that fail due to downregulation of pituitary GnRH receptors, estrogen levels also fall due to interrupted ovarian secretion, but this fall is buffered by liberating some of SHBG bound estrogen.For FSH secretion, a new balance between GnRH secretion, pituitary GnRH sensitivity on one and estrogen (and inhibin A) exposure on the other side is reached on the day +3. Between days +3 and +9, a negative feedback between FSH and estrogen is established, during which increased estrogen secretion reduces the FSH secretion.Delayed estrogen action on pituitary and hypothalamic levels (started on days −7 to −2) leads to the delayed PgR expression and results in the lack of clear negative feedback between LH and progesterone. It is evident between days +1 and +4, when progesterone level strongly rise, despite slowly decreasing LH levels. On the day +5 to +9, the negative feedback of LH and progesterone steps in, LH drops due to progesterone action. Pg levels peak on day +7 and after that both Pg and LH decline.On the day +10, a small drop of FSH is followed by a huge drop of estrogen on the next day, showing that the hypothalamic switch to the low GnRH secretion rate has just happened. Lutheolysis happens on days +11 to +14. LH secretion hits the bottom on the day +11, and progesterone drops almost to the nonexistent levels at the cycle end. Simultaneously reduced estrogen (and probably inhibin A) levels allow some increase in FSH secretion, despite low GnRH secretion rates, suggesting initial recovery of pituitary GnRH receptors.The presented simplified ovulatory cycle model is possibly related to several topics in reproductive physiology.When considering possible roles of androgens in women, androgens on the pituitary level act twice: via androgen receptors, androgens regulate the LH secretion, but also and after being locally transformed to E1, they indirectly regulate the FSH secretion. So, increased extragonadal androgen exposure can block follicle maturation and prevent ovulation by suppressing FSH and LH surges, and thus can lead to polycystic ovaries.Several entities seem linked to the role of adrenal steroids in women:Anorexia nervosa. Low gonadotropin levels are reported in this disorder [disorder . It is pdisorder in whichMenopause. In menopausal women, adrenal androgens are converted to estrone in the adipose tissue. Postmenopausal estrogen action is to low to to suppress the FSH secretion, or to enhance the hypothalamic GnRH secretion. Since GnRH secretion remains low, pituitary GnRH receptors accumulate and thus increase the pituitary sensitivity to GnRH. Despite low GnRH secretion rate, due to increased pituitary sensitivity LH and FSH blood values are increased to the menopausal range. Beside that, low estrogen exposure of various target tissues lead to an increased ER and diminished PgR expression, making them more vulneable to estrogen related neoplasms, due to unopposed easrogen actions on them.It is well recognized that the “male” hypothalamus is not able to generate ovulatory FSH and LH surges. Here presented interpretation proposes that the “female” hypothalamus is programed to act in two distinct modes of GnRH secretion. The low secretion period lasts from lutheolysis (day +10), till the late follicular phase (day-2), while the high rate period starts from the preovulatory phase (day −1) to lutheolysis (day +9). This two-mode mechanism allows increased pituitary sensitivity to GnRH on the day 0, responsible for the ovulatory surge. On the other hand, lutheolysis is caused by reduced hypothalamic sensitivity to estrogen that develops at the end of the lutheal phase, due to several days of progesterone exposure that diminishes both ER and PgR expression.This interpretation also relies on the available pool of sex hormone binding globulin (SHBG). Presence of a large SHBG pool would postpone ovulation since estrogen secretion first saturates SHBG before exerting a decisive action on the hypothalamic level. This agrees with reports that SHBG synthesis in liver is augmented by estrogen and reduced by androgens, so in males a small and stable SHBG pool is expected, while in women the SHBG availability depends on estrogen action in the previous cycle.Anastrosole, an aromatase inhibitor used in the treatment of ER positive breast cancer, is also used to control gynecomastia in boys and in hExtremely obese male patients often have hypogonadism with low gonadotropin levels and anasspecies might suggest that we have evolved somewhere near the equator, where the lack of seasons could make the pineal gland control unimportant in our reproduction. Without seasonal estrous type reproduction, the probability of pregnancy declined sharply in our ancestors, leading to regular ovulatory cycling and frequent intercourses unrelated to ovulations. This evolutionary pressure for frequent ovulations forced our species to develop regular 28-day ovulatory cycles, probably as short as possible to allow pregnancy. The result is that reproduction of our species started to depend on the ability of our female ancestors to have regular ovulations and intercourses whenever it was energetically feasible.Potential evolutionary survival advantages of interactions proposed in the described ovulatory cycle model are here briefly outlined. Since in many mammals daytime light exposure initiates estrous cycles in which ovulation is directly linked to the intercourse, conception and pregnancy are almost inevitable. The lack of seasonal reproduction in our In other words, it became unavoidable to our female ancestors to reproduce only during periods of normal food availability . We can With normal food availability, the whole system recovers. If no pregnancy has occurred within the optimal time frame of the lutheal phase, the lutheal progesterone secretion turns down both ER and PgR expression and leads to lutheolysis and further cycles.A separate evolutionary issue is the presence of several regulators of FSH secretion in women. From the evolutionary perspective each mediator of FSH secretion during the ovulatory cycle has to have some survival advantage for our ancestors, otherwise it would probably be lost during evolution.It seems plausible that mediators of FSH secretion function as optimizer of continuos cycling. For instance, to many primordial follicles are recruited in each ovulatory cycle, the ovarian reserves can be quickly depleted. If we are considering some 500.000 primordial follicles at the puberty age, a normal woman would spend some 1000 follicles in each cycle. So, the primordial follicle recruitment has to be limited to allow more ovulations. This is a potential role of inhibin A that tunes down the FSH secretion in the lutheal phase and thus spare some primordial follicles from activation. The other issue is that if more than one follicle matures, this might lead to dangerous multiple pregnancies that result in risky delivery of immature babies. Evolutionary response was the inhibin B action that tunes down the FSH secretion in the follicular phase and thus allows mainly single pregnancies.An interesting consequence of this interpretation is that menopause might not be caused by the advantageous role of postmenopausal women in the care of their grandchildren, as proposed by G.C. Williams . The maispecies, needs to be explained within the frames of female reproductive physiology. Further, the increased importance of postmenopausal women in family life of our ancestors should be considered a consequence of physiology and not the cause.Due to these remarks, the menopause, as a strict gender specific feature of our Here proposed interpretation is that the ovarian pool of primordial follicles was optimized in our ancestors to allow sufficient chances of reproduction despite continuous ovarian activity. When sufficient reproductive probability was once achieved, there was no need for further enlargements of the primordial follicle pool in ovaries. After the average lifespan of our ancestors has become prolonged, the menopause has emerged because of normal depletion of ovarian reserves of primordial follicles.The author declares that he has no competing interests

Although we describe the most outstanding features of flavoprotein monooxygenases, we mainly focus on enzymes that were cloned, expressed and used for biocatalysis during the last years.External flavoprotein monooxygenases comprise a group of flavin-dependent oxidoreductases that catalyze the insertion of one atom of molecular oxygen into an organic substrate and the second atom is reduced to water. These enzymes are involved in a great number of metabolic pathways both in prokaryotes and eukaryotes. Flavoprotein monooxygenases have attracted the attention of researchers for several decades and the advent of recombinant DNA technology caused a great progress in the field. These enzymes are subjected to detailed biochemical and structural characterization and some of them are also regarded as appealing oxidative biocatalysts for the production of fine chemicals and valuable intermediates toward active pharmaceutical ingredients due to their high chemo-, stereo-, and regioselectivity. Here, we review the most representative reactions catalyzed both These enzymes are classified as external (EC 1.14.13) and internal monooxygenases (EC 1.13.12). External monooxygenases rely on reduced coenzymes in the form of NADPH or NADH as sources of reducing power for the flavin, whereas in internal monooxygenases the flavin is reduced by the substrate itself. Besides, there are flavin-dependent enzymes that are able to catalyze hydroxylations of organic compounds. In this case, the flavin is required to oxidize the substrate via a reaction in which the oxygen atom comes from water while O2 serves to recycle the flavin is a model Type I BVMO that has been studied in-depth. It showed to be a robust biocatalyst, as expressed in E. coli from a pET-22b derived vector, able to catalyze selective oxygenation of a broad variety of ketones in desymmetrizations reactions, regiodivergent oxidations and kinetic resolutions technology, a fine control of the bioprocess and a proper aeration. This bioconversion was scaled-up to pilot-plant scale (200 L) and 4.5 g/L of lactone were produced have a very broad substrate acceptance profile and the ability to convert some bulky ketones not accepted by other BVMOs is another cycloketone-converting BVMO, which can display enantiodivergent transformations with respect to the CHMO group. E. coli cells overexpressing the gene coding for CPMO were used as biocatalysts to oxidize an oxo-bridged ketone in order to obtain a heterobicyclic lactone, a key intermediate in formal total syntheses of various natural products containing a tetrahydrofuran structural motif such as trans-kumausyne, goniofufurone analogs and showdomycin . These chiral lactones were key intermediates toward (+) and (−) non-natural carba-C-nucleosides in high optical purity Table . Its codPseudomonas stutzeri WM88. The pamO gene was cloned into a pBAD-derived plasmid between an N-terminal Tat-dependent signal sequence of the endogenous E. coli protein TorA and a C-terminal Myc epitope/His-tag. The Tat-PAMO protein was functionally expressed in the periplasm of E. coli cells and this system was used together with the PTDH-based regeneration system for biotransformations. Just recently, this analysis was extended to the screening of a library of PAMO mutants, which resulted in the isolation of a quadruple mutant with the same thermostability as the wild-type enzyme but with an extended substrate scope . Its gene was cloned in 2006 and initial assays detected activity toward large ring ketones (C11-C13), substituted cyclohexanones , which was used as a case study to show the potentials of a new tool for chiral catalysts assessment gene from the same bacteria was identified and cloned individually or in tandem with the respective 2,5-, or 3,6-DKCMO-coding genes. Pairs DKCMO-Fred were able to convert bicyclic ketones with enantiomeric specificity in recombinant whole-cell systems from Candida boidinii and 3,6-diketocamphane 1,6-monooxygenase ) that participate in the camphor-degrading metabolic route in Stenotrophomonas maltophilia (SMFMO) to catalyze some Baeyer-Villiger oxidations as well as sulfoxidations and to use both NADH and NADPH. The codon-optimized synthetic gene was cloned and SMFMO was produced in E. coli, purified and its crystal structure elucidated. Just recently, Riebel et al. -bicyclo[3.2.0]hept-2-en-6-one and methyl phenyl sulfide (thioanisole). These results were further extended by in-depth screening in whole-cell systems and a NADH-flavin oxidoreductase (StyB). The genes coding for this enzyme (StyAB) were identified, cloned and expressed in E. coli -epoxides with excellent e.e. In Rhodococcus opacus 1CP, a self-sufficient styrene monooxygenase was reported that harbors in the same polypeptide chain a monooxygenase and a NADH-flavin oxidoreductase (StyA2B) -8-oxabicyclo[3.2.1]oct-6-en-3-one was catalyzed by CHMOXantho, representing the first report of a BVMO involved in this conversion from Mycobacterium tuberculosis was evaluated in several aqueous-organic media aromatic sulfides and alkyl butyl sulfides were also oxidized to the corresponding sulfoxides, showing moderate to very good enantioselectivity mediate the FAD-dependent oxidation of amines using NADPH as electron donor in the presence of molecular oxygen. Typical representatives are L-ornithine hydroxylases and L-lysine hydroxylases.Pseudomonas aeruginosa, L-ornithine hydroxylase catalyzes the hydroxylation of the side chain amine of L-ornithine to produce the corresponding hydroxylamine, the initial step in the biosynthesis of the siderophore pyoverdine. After further modifications the hydroxylamine produces a hydroxymate functional group that is able to chelate ferric ions. The gene coding for L-ornithine hydroxylase (PvdA) from P. aeruginosa PAO1 was cloned and overexpressed in E. coli as a His-tagged fusion that finally enters the β-ketoadipate pathway. The genes encoding the PHBH from P. aeruginosa and P. fluorescens were cloned and expressed in E. coli more than 20 years ago and a 3-hydroxybenzoate hydroxylase (mobA) from the moderate halophyte Chromohalobacter sp. HS-2 were cloned and overexpressed in E. coli was cloned and subjected to directed evolution by error-prone PCR. With only a single point mutation, the enzyme able to hydroxylate phenolic acids was transformed into an enzyme that can also act on phenol are classified as class A of flavoprotein monooxygenases, they are encoded by a single gene and contain tightly bound FAD to the sole dinucleotide binding domain present in these enzymes. They depend on NADPH or NADH as electron donors for flavin reduction. Prototype enzymes are PHBH from Suemori, . RecentlPseudomonas alcaligenes NCIMB 9867 P25X and from Polaromonas naphthalenivorans CJ2 were reported in 2005 and 2007, respectively from o-diphenol compounds, 4-hydroxyphenylacetate 3-hydroxylases (HPAH) are attractive biocatalysts and the whole-cell system was used for the biotransformation of 4-substituted halophenols to the corresponding catechols in shake- flasks and in a 5 L bioreactor (Brondani et al., Some Type I BVMOs have also the ability to oxidize boron-containing compounds (Branchaud and Walsh, de-novo design of enzymes allow the expansion of the range of biocatalysts available and the development of tailored enzymes. Innovations on solvent or reaction medium engineering have also a huge impact on the biocatalytic outcome. Immobilization methods, strain improvement by metabolic engineering, and scale-up procedures under fine bioprocess control are further valuable tools for the development of a successful biocatalytic process for the industry.Biocatalysis is an environmentally friendly strategy for the elaboration of fine chemicals, natural products or other biologically active compounds. During the last decades enormous efforts have been done to satisfy the demands of biocatalysts for organic synthesis. However, multidisciplinary and coordinate work is still required to enlarge the repertoire of accessible reactions and compounds. The development of recombinant biocatalysts for organic synthesis and industrial applications involves multiple steps beginning from sequence selection up to bioprocess improvement Figure . Aiming The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

C. elegans mitochondrial (Mit) mutants have disrupted mitochondrial electron transport chain function, yet, surprisingly, they are often long-lived, a property that has offered unique insights into the molecular mechanisms of aging. In this study, we examine the phenotypic consequences of reducing the expression of the respiratory chain complex assembly factors sft-1 (homologous to human SURF1) and oxa-1 (homologous to human OXA1) by RNA interference (RNAi). Mutations in human SURF1 are associated with Leigh syndrome, a neurodegenerative condition of the brain caused by cytochrome oxidase (COX) deficiency. Both SURF1 and OXA1 are integral proteins of the inner mitochondrial membrane, functioning in the COX assembly pathway.C. elegans is associated with increased longevity, but the mechanism by which lifespan is extended is different in each case. sft-1(RNAi) animals display lifespan extension that is dependent on the daf-16 insulin-like signaling pathway, and associated with sensitivity to oxidative stress. oxa-1(RNAi) animals, in contrast, exhibit increased longevity that is at least partially independent of daf-16, and associated with a reduced developmental rate and increased resistance to oxidative stress.RNAi of both of these genes in This study further delineates the consequences of mitochondrial dysfunction within a whole organism that will ultimately help provide new models for human mitochondrial-associated diseases. The difference in phenotype observed upon down-regulation of these two COX assembly factors, as well as phenotypic differences between these factors and other respiratory chain components analyzed thus far, illustrates the complex inter-relationships that exist among energy metabolism, reproduction and aging even in this simplest of metazoan model organisms. Defects in mitochondrial function are implicated in a wide range of human diseases, affecting both development and the maintenance of normal structure and function . The comC. elegans is an established model organism for the study of pathogenesis of human mitochondrial diseases, exploiting the remarkable degree of evolutionary homology between both nuclear-encoded and mtDNA-encoded components of complexes of the respiratory chain, as well as associated assembly factors , lrs-2 mutants , and nuo-1 and atp-2 mutants, containing defects in mitochondrial proteins affecting complexes I and V, respectively, all display an increased lifespan [One of the most striking findings is that different mitochondrial defects, which result in comparable levels of impairment of energy generation, can have opposite effects on lifespan. For example, mutation in the lifespan . Likewislifespan -13. Furtlifespan ,12,14,15gas-1(fc210), has a shortened lifespan [mev-1(kn1) and the complex III subunit mutant ucr-2.3(pk732)[In contrast, the complex I subunit mutant lifespan , as has .3(pk732),17. Thus.3(pk732)). For ex.3(pk732). Further.3(pk732)-22 and i.3(pk732)), or by .3(pk732). Thus, isft-1 and oxa-1 genes. Targeted silencing of these C. elegans genes by RNA interference (RNAi) produces model deficiencies of these proteins in a tractable system, where the phenotypic consequences can be easily defined. The gene sft-1 is the C. elegans ortholog of the human SURF1 gene. Mutations in SURF1 result in a systemic cytochrome oxidase deficiency; however, the mutant phenotype is restricted to the brain. Patients typically present with Leigh syndrome, a subacute neurodegenerative condition with characteristic necrotic lesions of the basal ganglia and brain stem [SURF1 gene product is an integral protein of the inner mitochondrial membrane, part of a 250 kDa complex which appears to act early in the COX assembly pathway [In this study, we compare the consequences of the deficiency of two mitochondrial respiratory chain assembly factors, the protein products of the ain stem ,25. The pathway . PatientOXA1 and C. elegans oxa-1 genes encode the protein OXA1, a ubiquitous component of the inner mitochondrial membrane that inserts mitochondrially synthesized cytochrome oxidase subunits COX1, COX2 and COX3 into the inner membrane co-translationally, via binding of its C-terminal domain to the mitochondrial ribosome [The human ribosome . Human Osft-1 and oxa-1 knockdown in C. elegans are quite different. The overall result of knockdown of either gene is increased lifespan, but the mechanism by which prolonged lifespan is conferred, in terms of resistance to oxidative stress and dependence on the DAF-16/FoxO insulin-like signaling pathway component, are different, suggesting that distinct molecular pathways are involved.Although both SURF1/SFT-1 and OXA-1 are components of the inner mitochondrial membrane that function in the assembly of respiratory chain complexes, the consequences of sft-1 (gene H06I04.2) and oxa-1 (gene C01A2.3) were identified as the closest C. elegans homologues of human SURF1 and OXA1L, respectively. sft-1 and SURF1 both contain a Surfeit Locus 1 domain of approximately 300 amino acids, displaying 34.1% identity (53.8% similarity). In C. elegans, sft-1 is represented by the single deletion allele ok2277. Human and C. elegans oxa1 genes both contain a 60 kDa inner membrane protein domain of approximately 200 amino acids, displaying 21% identity (43% similarity). RNAi of sft-1 or oxa-1 leads to significantly reduced gene expression and consequent reduction in cytochrome oxidase activity as assayed in whole animals in the case of sft-1 RNAi . In subsequent experiments, RNAi by injection was utilized as the more reliable method of choice.sft-1(RNAi) animals developed at the same rate as WT N2 controls and did not exhibit embryonic lethality to any significant level, suggesting that the reduction in brood size is a consequence of reduced germ cell production. A similar reduction in brood size was noted for the F1 progeny of worms injected with sft-1 dsRNA as for the injected mothers themselves. F2 progeny of injected mothers, as expected, had normal brood sizes (data not shown). The brood size of sft-1(RNAi) animals could be increased if F1 progeny from sft-1 RNAi injected worms (at the L4 stage) were mated with WT males (data not shown), suggesting that defects in spermatogenesis are partly responsible for the lower brood size. However, supplying WT sperm did not restore brood sizes to normal, indicating that knockdown of sft-1 leads to defects in both sperm and oocyte production.oxa-1 RNAi resulted in a high proportion of embryonic lethality animals, 0% of hatchlings reached L4 by 48 or 72 hours, and typically only 50% of hatchlings reached L4 (or at least some aspects of L4) after 96 hours). F1 progeny of oxa-1(RNAi) animals produced almost no progeny of their own.sft-1(RNAi) worms show an extended lifespan compared with the WT control worms (n = 95) and 15.1 ± 0.5 days for N2 control (n = 79), with 50% survival at days 19 and 15, respectively and maximal lifespans of 27 days for sft-1(RNAi) animals and 23 days for WT worms, the lifespan was extended even further with a mean of 19.3 ± 0.8 days (n = 88), a maximum of 31 days and 50% survival at Day 20 animals given the developmental delay. It is possible that further developmental delay could contribute to the lifespan extension, although given that oxa-1(RNAi) animals, on average, took twice as long to reach adulthood, the delay from L4 to adulthood would only be expected to contribute to lifespan extension by a maximum of one day, and observed lifespan extension was much more pronounced than this.Cumulative survival curves of the F1 offspring of injected l Figure A. Mean ldaf-16 insulin-like signaling pathway, RNAi of sft-1 and oxa-1 by injection was performed in a daf-16(m26) mutant background, which has previously been shown to suppress the lifespan extension of both daf-2(e1370) and age-1(hx546) mutants [daf-16(m26) mutant background, sft-1 RNAi resulted in mean and maximum lifespans of 13.5 ± 0.4 days (n = 92) and 21 days respectively, very similar to daf-16 controls (13.6 ± 0.4 days (n = 92), maximum 19 days) worms is dependent upon the daf-16 pathway, and that sft-1 may operate upstream of daf-16 to regulate longevity.To ascertain whether the lifespan extension was dependent on the mutants ,29. In aoxa-1 RNAi in a daf-16 mutant background, however, a different result was obtained. In this case, lifespan was still extended following oxa-1 knockdown, with a mean lifespan of 17.9 ± 0.7 days (n = 84) and maximum lifespan of 31 days, not statistically different to the data obtained when oxa-1 RNAi is performed in a wild type background animals and daf-16; oxa-1(RNAi) animals are compared, and that the 50% survival point is reduced from 20 to 17 days, respectively. This may suggest a somewhat complex interaction between oxa-1 and daf-16, or that suppression is incomplete with the daf-16 allele used in this analysis, and caution needs to be exercised in the interpretation of this result. What is clear, however, is that the two knock-downs produce different phenotypes in terms of embryonic lethality, brood size and developmental delay, and respond somewhat differently to perturbations in the daf-16 pathway, with sft-1 showing complete dependence on functioning daf-16 for lifespan extension, and the oxa-1(RNAi) phenotype being at least partially daf-16-independent.In the case of C. elegans in RNAi feeding experiments may affect the phenotypic outcome, with lower doses of particular dsRNAs causing lifespan extension while higher doses shorten lifespan [sft-1 and oxa-1, the phenotypic outcome is unlikely to be dose-dependent (at least in terms of different doses resulting in opposite phenotypes).It has previously been reported that, in the case of genes involved in mitochondrial function, the dose of dsRNA delivered to lifespan . It is wsft-1(RNAi) and oxa-1(RNAi) worms were subjected to oxidative stress treatment with the herbicide paraquat. This causes oxidative stress by a metabolically catalyzed reaction resulting in depletion of NADPH and production of ROS, primarily superoxide anions [To investigate whether the lifespan extension was associated with resistance to oxidative stress, e anions .sft-1(RNAi) worms was not significantly different from the N2 controls at either 10 or 25 mM paraquat animals to 10 mM paraquat of 61.3 ± 2 hours (n = 36), compared to 65 ± 3.1 hours for WT controls (n = 29). Similarly, exposure to 25 mM paraquat resulted in a mean survival time of 35.4 ± 1.5 hours for sft-1(RNAi) animals (n = 36) compared with 33.8 ± 1.3 hours for WT controls (n = 35) worms were much more resistant to paraquat than the control worms at both concentrations animals and, therefore, the time it takes for them to reach L4 , we used three-day-old progeny of oxa-1 dsRNA injected hermaphrodites, and size-matched WT controls (L1s), to control for the possibility that animal size could have an effect on paraquat sensitivity that could complicate our results. In this case, exposure to 10 mM paraquat resulted in a mean survival time of 58.4 ± 1.9 hours for WT (n = 38) and 100.1 ± 1.9 hours for oxa-1(RNAi) animals (n = 42). Increasing the concentration of paraquat to 25 mM gave similar results, with a mean survival time of 35.9 ± 1.2 hours for WT (n = 39) and 49.7 ± 1.9 hours for oxa-1(RNAi) animals (n = 48) animals used for this experiment, it is difficult to categorically state what developmental stage they were at. They were size-matched to L1 control WT animals, but may have been more advanced in terms of certain aspects of development, which could be uncoupled when oxa-1 is knocked down and overall growth slows. In any case, however, it is noteworthy that WT animals did not appear to display any size-dependent resistance to paraquat , indicating that animal size differences are unlikely to be confounding our data.The resistance to oxidative stress of the t Figure A, with moxa-1::gfp fusion construct is shown in Figure oxa-1::gfp is expressed at high levels throughout the animal. oxa-1::gfp expression is widely distributed, showing a punctate mitochondrial network pattern, and is particularly prominent in pharyngeal and body wall muscle .The expression pattern of a translational e Figure . Mitochod Figure B. Embryosft-1 gene appears to be contained within a large operon, CEOP3088, making the construction of reporter constructs problematic, as it is difficult to predict where the important regulatory elements will be and the required constructs are likely to be very large (CEOP3088 covers some 40 Kb). Recent analysis suggests that sft-1 is part of a “hybrid” operon, however, containing intercistronic promoter/enhancer elements required for tissue-specific gene expression [sft-1 (>1.5 Kb), we made a translational reporter construct in which this region was used to drive sft-1::gfp, which would be expected to report on at least part of the sft-1 expression pattern. The expression pattern obtained with this construct is shown in Additional file sft-1::GFP is expressed at a very low level throughout the worm with higher levels of expression in a region of body wall muscle adjacent to the pharyngeal bulb animals could reflect some mitochondrial “threshold effect” in which the threshold for mitochondrial function is surpassed in some embryos, leading to catastrophic mitochondrial damage and the inability to invoke compensatory pathways.Cytochrome oxidase deficiency generated by RNAi of oxa-1 correlates with phenotypic observations of oxa-1 homologues in other organisms. Inactivation of both OXA1 genes in S. pombe is lethal [S. cerevisiae is viable, but is unable to respire and can only grow on fermentable carbon sources [N. crassa, human and S. pombe homologues can rescue S. cerevisiae oxa1 null mutants [Oxa1 ablate the function of the cytochrome oxidase complex and greatly reduce levels of Complex III and F0F1ATPase [oxa-1 RNAi phenotype seen in C. elegans. Consistent with this, no OXA1 deficient patients have been identified and this condition may thus be embryonic lethal in humans.The embryonic lethality and slow growth of viable progeny observed with RNAi of s lethal , whereas sources . The fun mutants . In yeasF1ATPase . OverallF1ATPase ) and thiSURF1 deficient patients, on the other hand, usually survive into early childhood with a progressive neurodegenerative disease. In contrast to the human SURF1 deficient phenotype, no abnormal neuromuscular function was observed in sft-1(RNAi) worms, despite detailed observations of movement and pharyngeal pumping rates (data not shown). A possible caveat to this conclusion, however, is that RNAi in C. elegans is known to be relatively ineffective in the nervous system, thus neuronal phenotypes may have been masked in our experiments. It is also possible that the lack of a neuromuscular phenotype in the sft-1 deficient worms may simply reflect overall energy requirements and the level of energy generation in different tissues. Previous studies of metabolic activity in C. elegans, as monitored by oxygen consumption, indicate that only a small proportion of total energy expenditure is on movement and the greatest single energetic demand is for reproduction [nuo-1 gene) and the F1F0 ATP synthase (atp-2 gene) also show a marked abnormality in gonadal development [oduction . There ioduction . Reflectelopment .sft-1(RNAi) worms was attributed to a failure of both oogenesis and spermatogenesis, as unfertilized oocytes were not observed at a significant level and WT sperm was only able to partially restore the brood size. Consistent with the hypothesis that decreased energy generating capacity in sft-1(RNAi) worms due to COX deficiency may account for the reproductive failure, we observed high levels of COX activity in the germ line of WT animals. sft-1::gfp was not observed in the germline, but a likely explanation for this is the phenomenon of gene silencing that is often triggered by transgene expression in the germline [Decreased fecundity of germline .sft-1(RNAi) and oxa-1(RNAi) worms can be described as having Mit phenotypes . Knockdown of either gene resulted in a significantly extended lifespan (particularly in the case of oxa-1) in at least two independent experiments, while only the oxa-1(RNAi) worms were resistant to oxidative stress induced by treatment with paraquat. The relationship between mitochondrial function and lifespan in C. elegans is complex, although most observations support two contributory mechanisms, nutritional restriction and damage due to ROS. Many different observations link nutritional/energetic status and lifespan in a wide range of different species. Food deprivation, either environmental or genetically determined and mutns [nuo-1) or indio-1[clk-1) in mitosft-1(RNAi) animals on daf-16 for lifespan extension, suggesting that sft-1 may act upstream of daf-16 to regulate longevity, is noteworthy, putting sft-1 knockdown in a different phenotypic category from most other Mit phenotypes. The FoxO-like forkhead/winged helix transcription factor DAF-16 is thought to be a master regulator of aging, integrating metabolic signals, stress signals as well as reproductive signals from the germline to modulate longevity [sft-1(RNAi) animals on daf-16 reflects the relative importance of reduced fecundity in promoting longevity when sft-1 expression is reduced.In nearly all cases examined thus far, lifespan extension in Mit mutants has been shown to act independently of the insulin/IGF signaling pathway . Therefoongevity . PerhapsC. elegans is based on the accumulation of damage due to ROS, although recent analyses suggest a rather complex relationship between oxidative stress and aging, and one that can be experimentally uncoupled. The oxidative damage model is not independent of the rate of living model as the major site for the formation of ROS is the mitochondrion and production is related to the level of metabolic activity. Some Mit mutants , in common with IGF/insulin signaling pathway mutants daf-2 and age-1, show increased lifespan and resistance to oxidative stress [oxa-1, as presented here, appears to fall into this category. By contrast, gas-1, nuo-1 and mev-1 mutations confer reduced lifespan associated with a hypersensitivity to free radicals [The second model for the determination of lifespan in e stress , reviewee stress . oxa-1, radicals ,42,43, rradicals . Resistaclk-1 and sod-2 display a hypersensitivity to oxidative stress but are also long-lived [per se is not always a primary cause of aging. Indeed, it has been suggested that ROS generated inappropriately in some mitochondrial mutants might actually extend lifespan by signaling various adaptive responses [On the other hand, mutants such as ng-lived ,22, suggesponses ,44. Thisesponses . Intriguoxa-1(RNAi) worms, in contrast to those analyzed in the Lee study, exhibit marked resistance to paraquat. This suggests that it is very difficult to generalize about the effects of mitochondrial dysfunction, even within the group of mutants/RNAi-treated worms that display both prolonged lifespan and heightened stress resistance. Furthermore, a recent study has found that pathways of lifespan extension can differ depending on whether RNAi or mutation for the same gene is used to reduce gene function [sft-1 or oxa-1 were not analyzed here, but these would form an interesting subject for future analysis.“Oxidative stress resistance” is rather an umbrella term, as different Mit mutants display different sensitivities to a spectrum of oxidative stresses. For example, in one study of 10 different mutant/RNAi strains, most of the long-lived worms with compromised mitochondria displayed marked resistance to hydrogen peroxide, yet were not resistant (or even displayed increased sensitivity) to paraquat . The autfunction . Mutatioper se does not cause lifespan extension [gei-7, which encodes the main glyoxylate shunt enzyme in C. elegans. gei-7 mutation was found to suppress the enhanced longevity of clk-1 mutants [cyc-1 Mit mutants [It has been previously suggested that long-lived Mit mutants utilize a novel metabolism, and that longevity in these animals may be dependent on this altered metabolic state. For example, it has been proposed, albeit using a limited number of mutants, that long-lived Mit mutants up-regulate fermentative malate dismutation, where fumarate is terminally reduced at complex II to succinate, generating fewer radical species overall . This isxtension . Recent mutants and has mutants .C. elegans Mit mutants. For example, a partial deficiency of Mclk1, the mouse clk-1 ortholog, increases average lifespan by 30% [Surf1 in mice has been recently demonstrated [Surf1 knockdown in the central nervous system of Drosophila melanogaster has also been shown to induce longevity [sft-1 in regulating lifespan is likely to be widely conserved, and it will be very interesting to discover the extent to which precise mechanisms of lifespan extension are conserved between disparate species. For example, it would be interesting to examine whether lifespan extension in sft-1 knockdown animals is dependent on gei-7 and thus a shift to the glyoxylate pathway. It is not clear, however, how such metabolic restructuring might proceed in other organisms where this alternative pathway is not thought to operate.Strikingly, mitochondrial respiratory complex dysfunction models being developed in other systems display many of the same features as n by 30% . Even monstrated , and simongevity . This susft-1 and oxa-1 influence longevity through distinct molecular pathways, despite the fact that both genes encode factors required for COX assembly.Whatever the precise mechanisms, it is clear that sft-1 or oxa-1 by RNAi results in increased longevity; however, distinct molecular mechanisms appear to operate in each case, and analysis of these two genes illustrate the principle that it is not possible to draw simple conclusions about the relationships between mitochondrial energetics, longevity, stress resistance and insulin-like signaling. Further analysis of COX deficiency and generation of worms with defects in other mitochondrial enzyme complexes will be required to further delineate the organismal consequences of mitochondrial dysfunction that will help provide new models for human mitochondrial-associated diseases. For the present, analysis of the effects of reducing expression of sft-1 and oxa-1, both of which encode proteins required for the assembly of respiratory complexes, illustrates the diversity of phenotypic outcomes that can result from mitochondrial dysfunction and the complex inter-relationships that exist between energy metabolism, reproduction and aging even in this simplest of metazoan model organisms.We have clearly shown that knockdown of daf-16(m26) mutant (provided by the Caenorhabditis Genetics Center). C. elegans strains were maintained and handled on nematode growth media (NGM) agar with E. coli OP50 as their food source [Experiments were performed with the wild-type (WT) Bristol strain N2 and d source . Microscd source .http://blast.ncbi.nlm.nih.gov). C. elegans protein sequences were retrieved from Wormbase (http://www.wormbase.org) and human protein sequences from the Ensembl database (http://www.ensembl.org). Sequences were analyzed using Pairwise alignment in Bioedit (http://www.mbio.ncsu.edu/bioedit/bioedit.html).Homologs were identified by BLAST analysis (sft-1 (C. elegans gene H06I04.2) and oxa-1 (C01A2.3) and including T7 or T3 RNA polymerase promoter sites were designed. These amplified fragments of 679 bp and 515 bp were from genomic DNA, respectively.PCR primers specific for sft-1 F primer 5’ ATTAACCCTCACTAAAGTTATTTTGAAGC 3’ JH1;sft-1 R primer 5’AATACGACTCACTATAGGTGACGGGGAATTC 3’ JH2oxa-1 F primer 5’ATTAACCCTCACTAAAGACATTCCCTGGTGGGTTACA 3’ JH5.oxa-1 R primer 5’AATACGACTCACTATAGACGCATAATTGGTGGCATTT 3’ JH6dsRNA was synthesized directly from PCR products as previously described and injedaf-16(m26)) hermaphrodites were picked onto IPTG plates which had been seeded with the relevant bacterial RNAi feeding clones as previously described [oxa-1 feeding clone in the feeding RNAi bacterial strain HT115 was from the Ahringer Lab RNAi feeding library [sft-1 feeding clone was made by inserting a PCR fragment corresponding to 400 bp of sft-1 exonic sequence (amplified from fosmid H06104) into the L4440 RNAi feeding vector, using enzymes XbaI and HindIIII. This was electroporated into E. coli strain HT115 before feeding to worms.L3 N2 (or escribed . The oxa library . The sftsft-1(RNAi) worms and six plates of progeny from oxa-1(RNAi) worms and equivalent N2 controls. Transcript levels of a non-target gene, eft-2, were measured as a control for the specificity of the RNAi. The RT reaction was primed using oligo(dT) primers. RNA was extracted using a hot phenol protocol [Reduction of the target transcripts following RNAi treatment was confirmed by gene-specific RT-PCR using the Superscript III RT system (Life Technologies (Invitrogen Division). Renfrew, Paisley, UK) with RNA from 20 L4 progeny from protocol and purisft-1, oxa-1and eft-2 RT-PCR primers were designed and amplified 220 bp, 164 bp and 350 bp fragments, respectively. Twenty-five cycles of PCR were used in each case.Specific sft-1 F primer 5’ GAAAGGGCGACTGAATCAAA 3’ JH7sft-1 R primer 5’ GTGTCCTCCATGACTGCTCA 3’ JH8oxa-1 F primer 5’ GCACTTCCATTCATCTCTGC 3’ JH9oxa-1 R primer 5’ CATAGACCCGTAGCAAATTGTG 3’ JH10eft-2 F primer 5’ GCGTATCAAGCCAGTTCTTT 3’ JH19eft-2 R primer 5’ CTGCTCCACTTCTTGGTCTT 3’ JH20sft-1 or oxa-1. Control groups were injected with TE buffer only. . For the brood size counts, L4 animals were picked singly onto individual 55 mm NGM plates seeded with OP50 bacteria (or HT115 transformed with the relevant feeding RNAi clone or empty vector control), and transferred to fresh seeded plates every 24 hours until egg laying had stopped. Counting of unhatched eggs and live progeny was performed on plates from which the mother had been moved the previous day and individual plate counts totaled in order to derive a complete brood size for each animal. All plates were kept at 20°C.Brood sizes were assessed using 20 synchronized L4 worms each injected with dsRNA corresponding to et al. [3). A total of 50 mixed-stage animals were picked into 50 μl of M9 buffer in an Eppendorf tube (in duplicate) . The worms were allowed to settle and the M9 buffer was carefully removed. A total of 1 ml of freshly prepared COX stain was added to the worms and gently mixed. Worms were incubated with the stain for 4 h at 20°C. NaN3 was added to one of the duplicate tubes to a final concentration of 1 mM. The COX stain was removed and the worms gently rinsed with PBS twice. Tubes were spun at 6,000 rpm for 8 secs to gently sediment the worms between rinses. The worms were then placed on a slide and allowed to air dry (approximately 30 minutes). They were subsequently mounted for microscopy by adding a coverslip coated with Aquatex and samples photographed using identical settings and exposure times. Experiments were repeated at least three times.COX activity was assayed in cells of intact worms by the oxidation of diaminobenzidine in the presence of cytochrome c in a protocol adapted from Seligman et al. . The spesft-1 or oxa-1, or fed on the appropriate feeding RNAi bacteria) per experiment. Single L4 worms were picked onto individual wells of 12-well NGM plates seeded with OP50 bacteria, and transferred daily to a fresh seeded well until the end of egg laying. Animals were checked for viability every day by recording their response to mechanical stimulus. Worms that did not respond to five gentle prods with a platinum wire were scored as dead and the date of death recorded. All lifespan assays were performed at 20°C, with three biological replicates.Lifespan assays were performed using 20 to 50 worms for each strain .Oxidative stress sensitivity assays were performed using 50 worms for each strain or oxa-1(RNAi) worms and size-matched N2 controls were picked onto 30 mm NGM plates containing final concentrations of 0, 10 or 25 mM paraquat ). Survival was assessed at regular intervals over the course of 100 hours by response to mechanical stimulus as described above. Animals that escaped from the plate and thus could not be accounted for were excluded from the analysis. All plates were kept at 20°C.sft-1 and oxa-1 translational GFP fusion constructs were made using the PCR fusion method [sft-1 ORF (H06I04.2) and 3,204 bp of upstream sequence was amplified from fosmid H06I04 using Expand Long Template polymerase and primers JH13 and JH15. JH15 includes a tag complementary to sequence at the 5’ end of GFP.n method . An 8,12sft-1 F primer 5’GTAAGCTGGAATCGGCAAAG 3’ JH13sft-1 R primer 5’ CGACCTGCAGGCATGCAAGCTCCACATGAGCATTGTGAC 3’ JH15.oxa-1 ORF (C01A2.3) and 3,770 bp of upstream sequence was amplified from fosmid I6F08, using Expand Long polymerase and primers JH16 and JH18. JH18 includes a tag complementary to sequence at the 5’ end of GFP.A 6,870 bp fragment containing the oxa-1 F primer 5’ CGTCTCTCCCATCCAGCTT 3’ JH16oxa-1 R primer 5’ CGACCTGCAGGCATGCAAGCATGAAGCATCACGTTGTCG 3’ JH18To fuse the gene specific PCR products to the GFP reporter, 0.5 μL of each PCR product and 0.5 μL of gel purified GFP PCR product were added to the Expand Long Buffer 3 system reaction mix to form the template for the sewing reaction. A second forward nested primer and GFP specific reverse primer (gfp c2) were used to amplify the full-length gene-GFP fused PCR product. These products were gel purified using the SYBR-RED gel purification system.sft-1 nested forward primer: 5’GTGTATGCAAATGCGACGAG 3’ JH14oxa-1 nested forward primer 5’CGTCTCTCCCATCCAGCTT 3’ JH17ppdgfp primer 5’GCTTGCATGCCTGCAGGTCG3’gfp c1 primer 5’AAGGGCCCGTACGGCCGACTAGTAGG3’gfp c2 primer 5’AAACAGTTATGTTTGGTATATTGGG3’sft-1::gfp construct is pAW317 and the oxa-1::gfp construct is pAW318.The purified PCR products were cloned into the TOPO XL vector using the TOPO XL cloning kit (Invitrogen) and shown to contain the correct inserts by restriction digest and sequencing. The rol-6- transformation marker pCes1943. Rol progeny were picked and stable lines selected for analysis. The sft-1::gfp transgenic strain described in this study is AW240 (ouEx608 (pAW317 + rol-6-)) and the oxa-1::gfp transgenic strain is AW241 (ouEx609 (pAW318 + rol-6-)).GFP reporter constructs were injected into the syncytial gonad of young adult hermaphrodite worms at a concentration of approximately 20 ng/μL as described along wiL4 stage N2 and AW241 worms were transferred to seeded NGM plates with 2 μg/ml Mitotracker Red spread on the surface and stored in the dark. L4 progeny from these animals were picked, washed in M9 for one hour and mounted for fluorescence microscopy as described above.COX: Cytochrome oxidase; MIT: Mitochondrial; NGM: Nematode growth media; PBS: Phosphate-buffered saline; ROS`: Reactive oxygen species.The authors declare that they have no competing interests.SM, JH, CB and PA carried out the brood size, life span and oxidative stress assays. RB and CD performed the COX staining experiments, and SM, JH and RB constructed and analyzed the GFP expression patterns. GB and AW conceived of the study, participated in its design and coordination, and wrote the manuscript. All authors read and approved the final manuscript.Lifespan extension in sft-1(RNAi) and oxa-1(RNAi) worms displays differential dependence on the insulin-like signalling pathway. A: Combined dataset for three separate experiments. Analytical values for lifespan experiments are shown, including mean and median adult lifespan, maximum adult lifespan and the sample size (n) for each strain and experimental condition. Statistical tests (Log-Rank tests using OASIS software [oxa-1(RNAi) and sft-1(RNAi) animals have a significantly increased mean lifespan compared with the wild type N2 strain . daf-16(m26); oxa-1(RNAi) animals have a significantly increased lifespan compared with daf-16 alone (p< 1 x 10-10), but the difference is not significant when compared with oxa-1 alone (p = 0.09). daf-16(m26); sft-1(RNAi) animals do not have a significantly different lifespan from daf-16 alone (P = 0.75) but these animals have a significantly decreased lifespan compared with sft-1(RNAi) alone (P < 1 x 10-10). B: Individual datasets for the three separate experiments. Mean, median and maximum lifespans are shown. Log-Rank tests were carried out using the lifespan of each worm in the entire population. * denotes the significance (P) value compared to N2 worms, ** denotes the P-value compared to daf-16(m26) worms. oxa-1(RNAi) animals had a significant lifespan extension compared to control animals in all three biological replicates which was at least partially independent of daf-16. sft-1(RNAi) animals had a significant lifespan extension compared to control animals in two out of three biological replicates . In all cases, the lifespan extension was dependent on daf-16 mutant background).software ) were caClick here for fileSensitivity of sft-1(RNAi) animals to oxidative stress. Analytical values for survival following exposure to different concentrations of paraquat are shown, including mean and median survival (in hours), standard error of the mean (SEM), maximum survival and the sample size (n) for each strain and experimental condition. Statistical tests (t-tests) were carried out using the survival time of each worm in the population. sft-1(RNAi) animals do not have a significantly different mean survival time compared with N2 controls after exposure to either 10 mM or 25 mM paraquat .Click here for fileResistance of oxa-1(RNAi) animals to oxidative stress. Analytical values for survival following exposure to different concentrations of paraquat are shown, including mean and median survival (in hours), standard error of the mean (SEM), maximum survival and the sample size (n) for each strain and experimental condition. Statistical tests (t-tests) were carried out using the survival time of each worm in the population. oxa-1(RNAi) animals displayed a significantly increased mean survival time compared with N2 controls following exposure to either 10 mM or 25 mM paraquat .Click here for filesft-1::gfp expression pattern. A, B: Transgenic strain AW240 (ouEx608 (pAW317 + rol-6-)), where pAW317 is a translational GFP fusion of sft-1 driven by the intercistronic promoter. sft-1::gfp is expressed at a very low level throughout the worm, but is concentrated in particular tissues. Left hand images, DIC only, right hand images, DIC and GFP merged. A: sft-1::gfp expression in muscle surrounding the pharynx (white arrow). B: sft-1::gfp expression in the uterus (white arrowheads). Scale bar, 100 μm. Anterior is to the left in all images.Click here for file

T cells are known to participate in the response to tumor cells and react with cytotoxicity and cytokine release. At the same time tumors established versatile mechanisms for silencing the immune responses. The interplay is far from being completely understood. In this study we show contacts between tumor cells and lymphocytes revealing novel characteristics in the interaction of T cells and cancer cells in a way not previously described.+ T cells and murine B cells – which could not be detected after incubation of lymphocytes with healthy cells. The interaction was a direct one, not requiring the presence of accessory cells, but independent of cytotoxicity and TCR engagement.Experiments are based on the usage of a hydrophilic fluorescent dye that occurs free in the cytosol and thus transfer of fluorescent cytosol from one cell to the other can be observed using flow cytometry. Tumor cells from cell lines of different origin or primary hepatocellular carcinoma (HCC) cells were incubated with lymphocytes from human and mice. This exposure provoked a contact dependent uptake of tumor derived cytosol by lymphocytes – even in CD4in vitro results were confirmed in vivo using a murine acute lymphoblastic leukemia (ALL) model. The arrest of tumor proliferation resulted in a significant prolonged survival of challenged mice. Electron microscopy disclosed 100-200nm large gaps in the cell membranes of connected cells which separated viable and revealed astonishing outcome. While the lymphocytes were induced to proliferate in a long term fashion, the tumor cells underwent a temporary break in cell division. The The reported cell-cell contacts reveal new characteristics i.e. the enabling of cytosol flow between the cells including biological active proteins that influence the cell cycle and biological behaviour of the recipient cells. This adds a completely new aspect in tumor induced immunology. CMFDA initially is a non-fluorescent molecule able to pass the cell membrane. In viable cells CMFDA is cleaved into the fluorescent, strongly hydrophilic form building a bulky water sheath. This averts its release through the intact cell membrane of viable cells. CMFDA can be used as a marker for viability since in case of cytotoxic lysis, labeled cells become non-fluorescent because of loss of CMFDA-containing cytosol . An analnt cells 1A. + and 7% of CD8+ T cells among bulk PBMCs became green fluorescent (2), a reagent that induces exocytosis of lytic granules thymidine incorporation using a β-counter .To evaluate the outcome of exposure of lymphocytes to tumor cells, 2x105 human lymphocytes for 4h. The ratio of cells co-cultured was difficult to evaluate since the number of adherent cells could hardly be determined. However, titration of cell numbers revealed the appropriate number of cells used for analysis. After incubation cultures were supplemented with 4% paraformaldehyd in PBS for 2h at RT. Medium was discarded and cells were air-dried over night. Samples were fixed with 1:1 mixture of aceton-methanol for 10 min, dried again and stained for CD4 using purified mouse-anti human antibody for 30 min. Samples were then washed with PBS supplemented with 1% BSA and subsequently incubated with Cy3 conjugated goat-anti-mouse Ig (BD Bioscience) and the nuclear dye DAPI for another 30 min. Cells were embedded using Mowiol solution (17% Mowiol in Tris/glycerin buffer) and analyzed using AxioImagerM1 (Zeiss) and AxioVision 4.6 software (Zeiss).CMFDA labeled tumor cells cultured in Chamber Slides were exposed to 5x10Murine spleen, lymph node and bone-morrow cells were isolated from individual mice. To obtain single-cell suspensions, organs were minced through a 70µm nylon mesh and washed with PBS supplemented with 2% FCS. Red blood cells were lysed in both, bone-marrow cell and splenocyte suspensions. The prepared cells were incubated for 30 min at 4°C with an appropriate combination of different monoclonal antibodies as follows: anti-CD3, anti-CD4, anti-CD8, anti-CD25, anti-NKG2D . Dead cells were excluded according to their light-scattering characteristics. All acquisitions were done with a LSRII SORP (BD Biosciences) interfaced to the DIVA software.+ T cells were washed and resuspended in 200µl RPMI medium and transferred to a microtiter plate. 100µg/milliliter luciferin was added to the culture. After 15 min incubation the culture plate was placed in the IVIS chamber and luminescence was analyzed using Living Image Software . Human bulk PBMCs were incubated with CMFDA-labeled luciferase-transgenic L23 cells as described above. After 4h cells were incubated with PE-conjugated anti-CD4 antibodies and T cells which remained negative for green fluorescence were separated from those which revealed cytosol uptake by FACS cell sorting. Isolated CD4The Kaplan-Meier plots for survival were assessed. Survival data were analyzed using the Log-rank (Mantel-Cox) Test, all other data were analyzed with the unpaired Student’s 2-tailed T-test using the GraphPad Prism version 5.00 for Windows, San Diego California, USA: *, difference significant with p≤0.05; **, p≤0.001; ***, p≤0.001; a p-value of less than 0.05 was considered significant. Figure S1A: Scale of magnification in scanning electron microscopy show the double sized tumor cells in comparison to lymphocytes. This enables a separated analysis in flow cytometry because of specifiable identification of lymphocytes and tumor cells in the forward-sideward-scatter (FSC/SSC) leading to weak contamination of tumor cells in the gate of lymphocytes. B: Representative FSC/SSC dot blot of the experiments shown in Figure1 after 4 hours of incubation in Eppendorf tubes. The populations of lymphocytes and tumor cells are still separately detectable. (TIF)Click here for additional data file.Figure S2A: Cytotoxic activity of purified NK cells assessed by JAM test [39]. L23 cells were labeled with 5µCi 3H thymidin for 16 hours and exposed to different numbers of NK cells for 4 hours. In this test, the reduction of cpm is linear to lysis of target cells since cytolysis induced DNA fragmentation which resulted in small DNA sections that are not withholded in the filter membrane for radioactive analysis. NK cells revealed pronounced cytotoxicity against L23 cells. B: 2x106 human PBMCs were incubated with 2x106 CMFDA-labeled L23 cells for 4 h, subsequently stained for NK cell marker NKp46 and analyzed in flow cytometry. The exposure of lymphocytes to L23 cells remained NK cells unaffected. (TIF)Click here for additional data file.Figure S34 T cells sorted in non-fluorescent (CMFDA-) and fluorescent (CMFDA+) CD4+ T cells after 5 days culture without any additional stimulation.A: Proliferation analysis of 5x10 Cells were sorted after 4 h incubation of bulk PBMCs to CMFDA-labeled L23 cells. B: Preincubation of PBMC with OKT3 led to TCR internalization which could be followed by staining with mAb against TCR. C: Assessment of cytosol incorporation after treatment of PBMC with 0,3µg/ml OKT3 for 1 hour at 37°C which rather increased the effect than abolished the exchange of cytosol. D: PBMC were exposed to CMFDA-labeled L23 cells untreated or treated with blocking MHC II antibodies. L23 cells were incubated 30 min on ice before culture with PBMC. Cells were washed and subsequently added to the lymphocytes. E: PBMCs were activated prior exposure to tumor cells specifically with 2x103 irradiated L23 cells or unspecific using 100Uml IL-2 for 3 days. Afterwards naive and activated PBMCs were incubated with labeled L23 for 4 h. The activation state did not affect the interaction with L23 cells and transfer of cytosol. (TIF)Click here for additional data file.Figure S46 purified mouse CD4+ T cells were incubated with 2x106 cells of the murine B lymphoma cell line BM185 for 4 h and prepared for EM.A: 2x10 Scanning (i and ii) and transmission (iii) EM revealed contacts between T cells and tumor cells which caused polarization of the lymphocytes but which were not as intense as could be observed with human T cells and L23 cells. B: Just like the human lymphocytes incubated with porcine tumor cells, the populations of splenocytes from BALB/c mice and the BALB/c derived BM185 are distinguishable in the FSC/SSC thus, the populations can be analyzed separately for the uptake of fluorescent cytosol. (TIF)Click here for additional data file.Figure S5invitro.Splenocytes derived from Balb/c and 6.5 mice were exposed to equal numbers of CMFDA-labeled BM185 wt or HA-expressing transgeneic BM185 for 4 h About 20% of CD4+ T cells derived from 6.5 mice express a TCR specific for HA. The uptake of fluorescence was indeed higher with BM185-HA but this accounts for splenocytes from BALB/c as well.(TIF)Click here for additional data file.

Preparatory steps such as seasoning, marination, and cooking may induce changes in meat which affects the ability of the stomach to adequately digest it. This may result in peptide chains reaching the colon intact where resident bacteria ferment them resulting in the formation of putative carcinogenic phenolic by-products.In this study, we set out to determine whether peptic digestion of beef myofibrils was influenced by prior marination.Cubes of sirloin stewing steak were marinated in balsamic vinegar or left untreated at 4°C overnight. Samples were oven cooked and myofibrils were extracted. Myofibrils were subject to proteolytic digestion with pepsin and digestion products analysed spectrophotometrically and with gel electrophoresis.Both marination in balsamic vinegar and cooking significantly reduced the yield of myofibrils from shop-purchased beef (P<0.05). Digestion progressed in all samples as a function of time (P<0.01), varying depending on prior treatment. Marination induced resistance to the digestive effect of pepsin during the early to mid-phase of digestion, and we identified a protein band of ∼150 kDa which was protected from peptic digestion in samples which had been marinated and cooked, but not in any other groups.Pre-treatment of meat prior to cooking may influence specific peptides such that they become more resistant to the digestive actions of pepsin. Meat is cooked prior to consumption to eliminate pathogenic microorganisms and to enhance its palatability. In addition, tenderisation via mechanical disruption or marination is carried out in order to aid digestion , 2. MariInterest in the digestibility of meat and processes which might influence this partly stem from the association between the products of bacterial fermentation within the colon and risk of colorectal cancer. High intakes of red meat and poor digestion of meat are positively associated with elevated risk of colonic cancer –10. ThisWhilst previous work has focussed on the mechanisms by which proteolysis might be inhibited by prior meat treatment, here we attempt to clarify changes in the distribution of digestion products as a result of pre-treatment. We examined the impact of marination on the digestibility of shop purchased beef and the nature of the digestion products generated by pepsin digestion. We carried out this study in order to determine if prior marination might influence the type of digestion products which pass from the stomach into the small intestine.Sirloin stewing steak was purchased from a local supermarket and cut into small cubes weighing approximately 5 g. Samples were either marinated in balsamic vinegar at a ratio of approximately 2 ml/g meat overnight (∼16 h) at 4°C prior to cooking or left covered and unmarinated at 4°C. Also, samples were either snap frozen and stored at −20°C or wrapped in silver foil and cooked in an oven at 100°C for 30 min. All samples were snap frozen and stored at −20°C for subsequent analysis. Storage at −20°C was limited to a maximum of 48 h. Experimental groups included unmarinated and uncooked (UMUC), unmarinated and cooked (UMC), marinated and uncooked (MUC), or marinated and cooked (MC) samples.2, 0.5 mM DTT, pH 7.5) and homogenised using a bench-top homogeniser . Homogenates were spun at 3000 rpm for 5 min and the supernatant was carefully discarded. A further 10 ml of fresh ice-cold buffer A was then added to each of the pellets and the process was repeated. This was repeated once more before pellets were finally re-suspended in 10 ml ice cold buffer A. The concentration of myofibrillar proteins was assessed by measuring the absorbance of myofibril solution at A280 ηm (absorbance of 1 mg/ml myosin at A280 ηm=0.56) and samples were diluted to 5 mg/ml with buffer A.Myofibril preparation was adapted from Sante-Lhoutellier et al. . BrieflyMyofibrils (2 mg) were digested with pepsin (10 mg/ml in 33 mM glycine buffer pH 1.8) at a final concentration of 5 mg/ml; and incubated at 37°C for 60 min (n=3/group). Thus, all subsequent digestion protocols were conducted using myofibrils resuspended in a buffer A/glycine buffer at a ratio of 1:1. Aliquots were removed at 0 and 60 min and the reaction terminated by heating to 100°C for 5 min. Samples were examined by separation with sodium dodecyl sulphate poly acrylamide gel electrophoresis (SDS PAGE). Gels were stained with Coomassie blue and de-stained with 10% acetic acid over 2 days.Myofibrils were prepared from meat samples (n=5/group) as described, resuspended at a concentration of 5 mg/ml and digested with pepsin at 37°C for 60 min. Samples were taken at 0, 20, 40, and 60 min of digestion, the reactions were stopped by the addition of 30% trichloroacetic acid solution . Samples were centrifuged at 12,500 g for 3 min and the absorbance of the supernatant determined at 280 ηm.Statistical analyses were carried out using SPSS version 16 . The effect of digestion time on the digestibility after cooking and the presence of hydrolysed peptides were tested with a repeated measures analysis, whilst measures of myofibril yield were assessed using a two-way analysis of variance.The process of marination did not appear to impact greatly on the appearance of cooked samples; however, overnight marination significantly reduced the yield of myofibrils in both cooked and uncooked samples P<0.01; . CookingExamination of the ability of pepsin to digest marinated and/or cooked beef samples revealed a marination dependent alteration of proteolysis. All samples showed a significant influence of pepsin over time P<0.01; , howeverIn order to better understand the consequences of prior marination and/or cooking on peptic digestion of beef, we further examined the products of digestion using gel electrophoresis. We found little soluble myosin heavy chain from myofibril preps of unmarinated meat B. DigestIn unmarinated samples, peptic digestion generated a global reduction in all visible protein bands A and 3C In this study, we examined the influence of prior marination on the ability of pepsin to digest beef myofibrils. We found that marination impacted upon the rate of digestion and at least one of the targets of pepsin. The ability to thoroughly fragment consumed meat within the stomach has importance within the context of gastrointestinal cancer, in particular colon cancer . PartialGastric digestion in humans generally takes 1–2 h for smalWe found that the yield of myofibrils was reduced in samples which had been subject to marination . This waThe apparent resistance of a specific protein species to digestion in samples which had been cooked after prior marination suggests that the process of cooking enabled the formation of alternative compounds within the meat which would otherwise not have formed. For example, carbohydrate side chains may have been added via the Maillard reaction to nucleTo sum up, we have shown that myofibrils isolated from beef samples subject to an acidic marinade prior to cooking are made more resistant to peptic digestion and that such resistance may be peptide specific. Future work will aim to identify affected proteins and determine their potential contribution towards the production of tumourigenic compounds within the colon.

Testicular microlithiasis (TM) is a rare pathology characterized by localized or diffuse intratesticular foci of calcification. Its incidence in the pediatric population ranges from 1.1% to 4.2%.The aetiology and the natural course of incidentally detected TM remain unclear.To report three cases of TM in boys who complained of gynecomastia and bilateral testicular enlargement.Case 1) A 9.4-year-old boy presented with bilateral testicular enlargement accompanied by other pubertal signs. His bone age was 11 years and serum levels of LH and FSH after GnRH stimulation were within pubertal limits. Scrotal ultrasonography (US) showed TM in both testes. He revealed early puberty and no malignant evolution. Case 2) A 9.4-year-old boy with Down syndrome presented with bilateral testicular enlargement and accelerated growth velocity. His bone age was 11 years and serum levels of LH and FSH after GnRH stimulation were within pubertal limits. He had TM at US in both testes. He underwent right orchiopexy. He also revealed early puberty and no malignant change. Case 3) A 11-year-old boy complained of gynecomastia without other findings of puberty. His bone age was 11 years. He also had TM at US in both testes. No focal testicular lesion or malignancy developed during the review period.Our report underline the usefulness of scrotal US for finding an occult TM in a patient with gynecomastia without other findings of puberty. In addition, TM may be predictive factor for early puberty evolution, but a large number of patients with a longer follow-up period may be needed to accurately discern the possible association between TM and precocious puberty.

The acute GLP-1 releasing activity of olive leaf extract (OLE), glutamine (GLN), alpha casein (ACAS), beta casein (BCAS) and chlorogenic acid (CGA) were assessed in STC-1 cells and C57BL/6 mice. All compounds except ACAS significantly increased acute in vitro GLP-1 secretion . Oral gavage of OLE and GLN modestly increased plasma GLP-1 concentrations , but did not lower glycaemic excursions. OLE and GLN are potent stimulators of GLP-1 secretion both in vitro and in vivo and chronic studies should assess their suitability as nutritional therapies for type 2 diabetes.Glucagon-like peptide-1 (GLP-1) is an intestinal hormone with well-established glucose-lowering activity. The Glutami in vivo , 4. Chlo in vivo . Similar in vivo . In thisin vivo studies. OLE, GLN, BCAS and CGA significantly increased GLP-1 secretion 66%, 236%, 180% and 386%, respectively exhibited significantly higher circulating levels of GLP-1, as well as GIP and insulin, but it is as yet unclear whether GLN improves glycaemic control . Here, win vitro , 10. Casecretion . This stecretion ; furtherecretion . We alsoin vivo studies only indicate modest rises in plasma GLP-1 concentrations for OLE and GLN. Therefore, the amount of GLP-1 released by these putative GLP-1 secretagogues is perhaps not sufficient to counteract a rapid rise in glucose levels following an oral glucose challenge. In can be concluded that the potential benefits of these GLP-1 secretagogues are not likely to be realised over an acute period, and chronic studies in diabetic animal models should be undertaken to assess their usefulness as nutritional therapies for type 2 diabetes.Other studies have demonstrated that continued consumption of natural putative GLP-1 secretagogues over a prolonged period improves hyperglycaemia associated with diabetes , 14. Thi2 humidified atmosphere at 37°C. Cells underwent passage upon reaching 80–90% confluence and were used between passage numbers 15–50.OLE was prepared by dichloromethane extraction of powdered olive leaves (Olea europoaea) as previously described . Briefly6 cells (n=6) were seeded into 12 well plates and incubated for 18h at 37°C. Media was removed, the cells were washed with HEPES buffer and then underwent 60 min pre-incubation with buffer . Buffer was aspirated off and cells were incubated for 3h with 400μl of vehicle or OLE (1mg/ml), GLN (40 mM), ACAS (1 mg/ml), BCAS (1 mg/ml), and CGA (40 mM). The responsiveness of cells was verified by conducting test incubations with a mixture of fatty acids as a positive control (data not shown). After the test period 350μl of the incubation solution was removed to a separate tube, placed on ice and centrifuged to remove any cellular debris. The supernatant was collected and stored at −80°C prior to analysis by GLP-1 radioimmunoassay. For cellular GLP-1 content STC-1 cells (1.5 × 106) were seeded into 6 well plates and cultured overnight at 37°C in a humidified atmosphere of 5% CO2. Media was removed and fresh media or secretagogue supplemented media was added. Media was removed and replaced with fresh supplemented media every 24h until an incubation period of 72h was reached. Media was then removed, cells were washed and GLP-1 was extracted by the addition of acid/ethanol (1.5% HCl (v/v): 75% ethanol (v/v): 23.5% H2O (v/v)) and incubated overnight at 4°C. Acid/ethanol solutions were removed, centrifuged to remove cellular debris, and the ethanol evaporated off using a SpeedVac sample concentrator . Samples were reconstituted in buffer prior to radioimmunoassay. GLP-1 was measured using an in-house fully optimised radioimmunoassay which used a GLP-1(7–36)amide standard curve and employed anti-rabbit IgG Sac-Cel , and a polyclonal rabbit antibody with no cross-reactivity for glucagon or GIP.For acute GLP-1 secretion approximately 2×10OGTT studies involved 16h-fasted C57BL/6 mice receiving oral gavage of glucose (18 mmol/kg), or glucose in combination with OLE (100mg/kg), GLN (1g/kg), BCAS (0.5 g/kg), or CGA (5 mg/kg). For studies measuring plasma GLP-1, mice were sacrificed in a carbon dioxide atmosphere 30 min post-administration and blood samples taken by cardiac puncture using a heparinised syringe. Blood was centrifuged for 30 seconds at 13000g (IEC Micromax RF) and plasma stored at −80˚C prior to analysis.

It has been suggested that a higher procedure volume is associated with less complications after hip arthroplasty. In order to investigate the incidence of serious negative outcomes and a possible association with procedure volume, we performed a retrospective nationwide cohort study on total hip replacements in all Dutch hospitals.All total hip replacements that were identified as primary intervention in all general and university medical centers between January 1, 2002 and October 1, 2004 were included. Primary endpoints of follow-up were mortality and complications during admission, and re-admission within 3 months due to complications. Variables that were assessed as potential risk factor were age, sex, duration of (preoperative) admission, specific diagnosis, acute/non-planned admission, co-morbidity, and hospital procedure volume.Age, sex, and comorbidity were associated with complications and mortality. Additionally, acute admission was a risk factor for mortality but not for complications. There was no linear trend indicating that decreasing volume led to an increasing number of complications, and no statistically sginificant effect for mortality was found.After adjustment for several risk factors, we found that the hospitals performing most hip procedures every year had fewer complications during index admission, but that they did not have a lower mortality than groups performing fewer procedures. The lack of a linear trend may be explained by the fact that almost all Dutch hospitals perform a high number of hip arthroplasties each year. Approximately 20,000 total hip replacements are performed in Dutch general and university hospitals each year . It is eMost studies have been performed in the United States, and due to differences in healthcare systems, it is not clear whether these results can be generalized to other countries. The aim of our retrospective nationwide cohort study was to gain insight into the incidence and risk of several serious complications of hip arthroplasty, both during the index hospitalization period and within the first 3 months after surgery. In addition, we assessed the importance of risk factors for complications such as the experience of the hospital, expressed as the number of interventions performed annually and corrected for several patient-related factors such as age, sex, co-morbidity, and diagnosis.Data were retrieved from a nationwide computer database of hospital discharge records, with complete coverage of all admissions in all general and university hospitals in the Netherlands (which has 16 million inhabitants). None of these hospitals is private. The university hospitals are owned by the government and the general hospitals are independent foundations, financed by public money. Private clinics did not perform THAs. The database includes (among other information) basic patient characteristics, date of admission and discharge, the main intervention (coded), the medical specialist (coded), and the main and secondary diagnoses at discharge, based on the ICD-9-CM coding system . Characteristics of hospitalizations are registered by treating medical specialists or residents and coded by professional code clerks on the basis of hospital discharge letters. For every admission, one main diagnosis or diagnosis at discharge (mandatory) and up to 9 secondary diagnoses are registered. The coding is independent of reimbursement of the hospital or specialist. In addition, hospitals remain anonymous with the use of unique codes, instead of name and address data. All diagnoses are submitted in the same format, mostly electronically.All patients admitted for a first total hip arthroplasty between January 1, 2002 and October 1, 2004 were included in this nationwide cohort study . This was the most recent dataset available, with sufficient power due to the large number of records. Each cohort member was followed only once from the day of the hip arthroplasty until the earliest of one of the following events: death during index admission, a complication, or end of the follow-up time of 3 months, whichever came first. Patients with an ICD-9 code indicating certain non-fatal complications related to the implant, such as mechanical loosening, dislocation, or infection of the implant during the index hospitalization were excluded since these complications may have been related to an earlier intervention and not to the index intervention that was performed during the study period. All interventions with codes indicating removal or revision of hip implants were excluded from the database, except when such removals or revisions occurred within 3 months after the index operation, as they may have indicated a complication.In the total population, we identified 82,582 admissions for hemiarthroplasty and total hip arthroplasty in the period 2002–2004. After exclusion of patients who were admitted in 2001 but discharged in 2002, admissions later than September 30, 2004 to ensure at least 3 months of follow-up, patients discharged with codes indicating a complication from an earlier procedure, and patients with certain types of malignancies, fractures, and hemiarthroplasties, the study cohort consisted of 50,080 admissions for primary total hip arthroplasty.In the Netherlands, most patients with a hip fracture have a hemiarthroplasty procedure, while patients with osteoarthrosis receive a total hip replacement. Patients with a fracture are clinically different from patients with osteoarthrosis. Thus, we excluded patients with fractures from the study cohort. Additionally, patients with osteoarthrosis or another diagnosis that was not fracture were excluded if they had hemiarthroplasty see .We assessed the proportion of deaths and complications that occurred during the index hospitalization and the proportion of re-admissions as a result of a selected set of potential complications within 3 months of the index hospitalization. We searched the original database records over the period of April 1, 2002 to January 1, 2005 for admitted patients with the same date of birth, sex, postal code of their home address, and hospital identification code, as we found that almost all patients were re-admitted to the same hospital. Complications were identified based on the ICD-9 codes of the main discharge diagnoses and on literature . As compDuring the study period, the Netherlands had 88 general hospitals and 8 university medical centers. 2 of the 96 hospitals only performed hemiarthroplasties; therefore, 94 hospitals remained in the study. Some hospitals have more than one location, but for the purpose of our research they were considered as one organization. The Netherlands is a densely populated country with a relatively old population. The average number of hip procedures per hospital may therefore be higher than in other countries. Only 13 hospitals performed less than 100 total hip arthroplasties annually during the study period. When hemiarthroplasties and fractures were also considered, this number was even lower.We divided the hospitals into 5 volume groups based on the mean number of total hip arthroplasties performed per year. The lowest volume group performed less than 100 procedures a year and the highest volume group performed more than 400 procedures a year. The number of patients in each of these groups see and 4 isOur data did not allow us to distinguish between individual surgeons. Orthopedic surgeons performed almost all of the total hip replacements (99.9%).As covariables, the following variables were considered for inclusion in the models: age and sex, surgical procedure volume per hospital, and co-morbidity in the year prior to the intervention that was severe enough for hospitalization and diagnosis. In order to assess co-morbidity a year before surgery, we searched the original database records over the period January 1, 2001 to January 1, 2005 for admitted patients who had the same date of birth, sex, and postal code. We classified co-morbidity according to the Charlson co-morbidity index as adaptWe performed validation of procedures, complications, and mortality in a sample of our study material by linking it to the Rotterdam Study, a prospective population-based cohort study of chronic diseases in the elderly who live in the Ommoord district of the city of Rotterdam , 2009.By matching according to date of birth, sex, and postal code of the home address, we identified 68 patients from the study cohort in the Rotterdam Study. These 68 patients had been admitted to 3 hospitals in Rotterdam and surrounding area. For 40 patients, the original file including the original discharge letter was available for review. For 17 other patients, information from their general practitioner could be accessed digitally, and no information was available for the other 11 patients.Of all the procedures, diagnoses, and complications, 91% (CI: 84–99), 90% (CI: 82–97), and 80% (CI: 45–115), respectively, were confirmed. The remainder was missing and could not be judged. However, no procedures, diagnoses, or complications were false-positive.Descriptive analyses were conducted using SPSS software version 15.0. Statistical comparison of means and proportions consisted of independent samples t-tests (Student's), and chi-square tests. Because the precise delay between hip arthroplasty and complications during the index hospitalization was not available in the database, we used logistic regression analysis with the first occurrence of a complication as endpoint instead of a Cox proportional hazards model. Covariables that were considered as risk factors in the literature were tested in a univariable logistic regression analysis in order to obtain crude odds ratios. The final multivariable models were fitted by backward elimination regression based on the maximum likelihood ratio . The effApproximately half of the patients were older than 70 years, with a mean age of 69 years (SD 11), and about 70% were women. The median duration of admission was 9 days, with a median preoperative stay of 1 day. Most patients were admitted with a diagnosis of osteoarthritis (97%) and 7% had one or more co-morbidities. About 1% (n = 504) of the admissions were not planned. Most of these patients had osteoarthritis as the main diagnosis, 9.5% (n = 48) had other bone defects such as aseptic bone necrosis and malunion/nonunion of fracture, and another 9.5% (n = 48) had a variety of other diagnoses; 11 of the patients of this group had osteoarthritis as secondary diagnosis. The reason for these admissions being acute/unplanned was not mentioned. The mortality rate during the index admission was 0.2% (n = 114), and 2.2% of the patients had one or more complications. Including re-admissions during the 3 months after surgery, 5.8% of the patients had a complication—either during the index admission or after re-admission for that reason .Almost 9% of the patients were re-admitted at least once within 3 months of surgery. About 40% were re-admitted with a complication of the procedure, most of which involved a mechanical complication of the device or an infection . The second and third re-admissions within the same time frame showed a similar picture . Of thesAge, male sex, co-morbidity, and diagnosis (aseptic bone necrosis and other) were statistically significantly associated with both endpoints. Hospital volume appeared to be associated with complications during the index admission, as all lower-volume groups had higher odds ratios than the high-volume group. However, it did not show the linear trend that would have been expected. For re-admissions due to complications, this association was not apparent.In this study we found that during the index admission for total hip replacement, the percentage of complications was 2.2%. Almost 9% of the patients in the study cohort who were admitted between January 1, 2002 and October 1, 2004 for THA were re-admitted for any cause at least once within 3 months of surgery. However, 40% of these re-admissions were due to a complication that could be related to the implantation. Altogether, approximately 6% of the cohort of patients studied experienced a complication during index admission and/or within 3 months after the implantation. Acute admission appeared to be a risk factor for complications during index admission in the unadjusted analysis, but it was not selected as a risk factor in the final model. This may have been caused by adjustment for co-morbidity and diagnosis, variables that may confound the effect of acute admission.The mortality during admission was 0.2% for patients with a total hip replacement. A complication during index hospitalization was strongly associated with mortality. However, as might be expected, mortality could not be entirely related to the intervention, since age, co-morbidity, and acute admission (i.e. trauma) were also associated with it. The high-volume group had a higher risk of mortality than 3 of the lower-volume groups. This may be explained by the fact that complicated total hip replacements are usually referred to high-volume centers. However, we did not find that higher hospital volume was associated with lower mortality, as found in previous studies . FurtherIn the past decade, several studies have been performed on the incidence of complications following surgery and the effect of hospital and surgical procedure volume . Many ofAlthough hospital groups performing a lower number of THRs were more strongly associated with complications during the index admission than the highest-volume group, our study did not show a trend towards a lower proportion of complications when the number of interventions per hospital increased. Furthermore, there was no association between volume groups and re-admissions within 3 months. As the average number of hip arthroplasties per hospital was high in our study, this may have removed the potential difference between high-volume and low-volume hospitals. However, as in another study that did not find an effect of hospital volume on outcome , and accFinally, there may have been residual confounding caused by factors that could not be adjusted for in our analysis, such as type of prosthesis used, facilities in the operating room, and so on.As far as we know, our study is the first nationwide study in which all primary total hip replacements have been included, and involves a high average number of hip procedures per hospital in a densely populated country. Also, validation of a sample showed that the quality of the registry is good. Furthermore, it is unlikely that there was selection bias, since Dutch inhabitants in need of hip arthroplasty are generally admitted to a Dutch hospital. Information bias due to knowledge of the research question was also unlikely, as the admissions were registered prospectively. However, false-negative misclassification of cases could be an issue because we only had access to data about mortality during hospitalization. Although a median length of stay of 9 days is rather long for this type of procedure, it is still likely that some mortality related to the procedure occurred after discharge. Additionally, although trained code clerks register hospital admissions, mistakes in coding and deviations between employees and hospitals cannot be excluded. However, given the high concordance between registered determinants and complications and medical records in our validation sample, we think that this is unlikely.At least one additional diagnosis was mentioned in only 25% of the admissions. Possible complications may not have been registered because such registration is optional and only registration of the main diagnosis is mandatory. This may have led to underestimation of the number of complications.In conclusion, in contrast with results from USA hospitals, volume does not fully explain the differences in mortality and complications between hospitals in the Netherlands. This might be explained in part by the fact that the average number of hip arthroplasties per hospital is high. This might mean that under such circumstances, other determinants become more important in explaining differences—such as volume per surgeon or technical considerations such as type of prosthesis, surgical technique, use of cement, conditions in the operating rooms, or patient related factors. Other options that may be interesting for further investigation are (1) the degree of orthopedic specialization of hospitals, as an association between this parameter and favorable outcome has been shown in a recent study , and (2)

Pregnancy anemia remains as a public health problem, since the official reports in the 70’s. To guide the treatment of iron-deficiency anemia in pregnancy, the haemoglobin concentration is the most used test in spite of its low accuracy, and serum ferritin is the most reliable test, although its cutoff point remains an issue.n 278) was calculated to estimate sensitivity of 90% and 80% of specificity with relative error of 10% and power of 95%. This study has a prospective design with a before-after intervention of 80 mg of daily oral iron during 90 days and will be analyzed as a delayed-type cross-sectional study. Women at the second trimester of pregnancy are being evaluated with clinical and laboratorial examinations at the enrollment and monthly. The ‘responsiveness to therapeutic test with oral iron’ (gold-standard) was defined to an increase of at least 0.55 Z-score in haemoglobin after 4 weeks of treatment and a total dose of 1200 mg of iron. At the study conclusion, sensitivities, specificities, predictive values, likelihood ratios and areas under the ROC (Receiver Operating Characteristic) curves of serum ferritin and erythrocyte indices will be tested. The compliance and adverse effects are considered confounding variables, since they are the main obstacles for the iron-therapy responsiveness.The aim of this protocol is to verify the accuracy of erythrocyte indices and serum ferritin (studied tests) for the diagnosis of functional iron-deficiency in pregnancy using the iron-therapy responsiveness as the gold-standard. This is an ongoing phase III accuracy study initiated in August 2011 and to be concluded in April 2013. The subjects are anemic pregnant women (haemoglobin concentration < 11.0 g/dL) attended at a low-risk prenatal care center in the Northeast of Brazil. The sample size (This study protocol shows a new approach on iron-deficiency anemia in pregnancy from a functional point of view that could bring some insights about the diagnostic misclassifications arising from the dynamic physiologic changes during the gestational cycle.U1111-1123-2605.WHO International Clinical Trials Registry Platform Iron-deficiency anemia is recognized as the nutritional deficiency of highest prevalence in the world, reaching all continents and geo-economic blocks ,2. This Apart of the concerning issues to the implementation degree and quality of the programs to control anemia, the main limiting factor of the effectiveness and efficacy of the interventions with iron supplements would be the poor compliance to therapy, which can achieve figures up to 70% at pregnancy ,12 and iproxy of iron deficiency and widely recommended as a criterion for the indication of iron-therapy in pregnant women, particularly in location with few resources [The haemoglobin concentration (Hb) has been considered as a esources . The Hb esources ,21,22. Tesources . Indeed,esources ; and somesources -29. Thusversus 30% in the erythrocyte mass [In fact, the cross-sectional and longitudinal assessment of the haematological profile during pregnancy is troublesome due to increased iron requirements beside the haemodilution, a physiological phenomenon in which occur an increase of 50% in the plasma volume yte mass ,21. Thisyte mass ,30-32, wyte mass . Based oyte mass . An alteyte mass . The seryte mass -27, but yte mass .These observations indicate that the accurate diagnosis of iron-deficiency anemia during pregnancy is problematic. The current diagnostic criteria with steady cutoff points based on Gaussian definition of normality does not reflect the functional conceptions of the anemia and of the iron deficiency at pregnancy, respectively, as the status of insufficient circulating haemoglobin for oxygen transport required by gestational metabolism and as the inadequate iron supply to achieve this demand . So, theStarting from the assumptions that erythrocyte indices have low accuracy for the diagnosis of iron deficiency in pregnant women in accuracy phase II studies -29, the In the absence of a gold standard to define functionally iron deficiency in pregnancy, was established as the reference standard the haematological response to oral iron-therapy, which is considered a reliable and low-cost alternative for the confirmation of anemia due to iron deficiency . In thisTaking into account that adverse effects and poor therapeutic compliance are the main limiting of intake of an effective dose of iron they were pre-established as confounding variables. Whereas the physiological fluctuation of Hb at each gestational week is a factor which can be bias the evaluation of the haematological response to iron-therapy , the preThe aim of this study is to describe and to compare, at the practice setting of prenatal care, the pragmatic utility of serum ferritin and each single test on erythrogram to discriminate iron-sufficient from iron-deficient pregnant women who will benefit from iron therapy to achieve the improvement of their anemia.primary objective of this study is to analyze the accuracy of Hb and other erythrocyte indices and of serum ferritin (studied tests) to predict the ‘responsiveness to therapeutic test with oral iron’ (gold-standard test) in pregnant women pre-classified as anemic (Hb < 11.0 g/dL).The secondary objectives are proposed to compare the results of evaluation of the ‘responsiveness to therapeutic test with oral iron’ using absolute values and Z-scores of Hb; and to describe the frequency of the therapeutic compliance and gastrointestinal adverse effects, as well as their association with the dose of iron intake and with the therapeutic response.As a This study deals with a diagnostic validation of the pre-treatment values of erythrocyte indices and serum ferritin (studied tests) in relation to the gold standard ‘responsiveness to therapeutic test with oral iron’ in women with low-risk singleton pregnancy. The design is classified as phase III as these tests already have been used in clinical practice and will be evaluated in anemic pregnant women , i.e., aThe protocol is registered as a single-arm clinical trial in the Brazilian Clinical Trials Registry (REBEC) at the Ministry of Health of Brazil and in the WHO International Clinical Trials Registry Platform (U1111-1123-2605).Instituto de Medicina Integral Prof Fernando Figueira (IMIP) at a large urban center in the Northeast of Brazil. IMIP is a regional tertiary hospital with reference in maternal-child health which serves primarily for high-risk pregnant women; however, around 600 low-risk pregnant women are attended monthly. Data collection was initiated in August 2011 in a pilot study phase in which was concluded in October 2011. The conclusion of this study is scheduled for April 2013.This study is set in the prenatal care center of The participants are 18-35 years old women with a low-risk singleton pregnancy. The inclusion criteria are Hb values ≥ 7.0 and < 11.0 g/dL and the gestational age between 12 and 32 weeks. Pregnant women are being excluded if they have a history of hypersensitivity or intolerance to ferrous sulfate, mental deficits or disorders that cannot correctly follow the prescription; tobacco, alcohol or other drugs use; prior diagnosis of another cause of anemia; or at the time of inclusion present active infectious disease .0) with a structured questionnaire and the anthropometric variables measurement (weight and height). At this moment, the prescription for the drug intervention proceeds under the proper guidance and then the pregnant woman is guided to perform the initial laboratory tests .The recruitment procedure is a consecutive series of patients whose prenatal routine exams show anemia Hb < 11.0 g/dL) and encounters all other eligibility criteria calibrated daily, and are complemented with a microscopic reading of smears stained with a panoptic dye to morphologically study of the cells. The reticulocyte count is performed by a manual method by reading of smears stained with brilliant cresyl blue dye. The serum ferritin is measured by chemiluminescence immunoassay in blood sample collected in dry tube, using the same kit and following the calibration according to the international standards of WHO.n 23) were performed by the laboratory of the institution. After the conclusion of the pilot study (October 2011), for operational reasons, the laboratorial analysis service was outsourced to an external laboratory. Both laboratories have governmental certification and follow standardized operational norms.All non-laboratorial variables are obtained using a standardized form developed specifically for the research. The laboratory data are recovered directly by a computerized system of results generated electronically by the automated equipment of biological analysis. The laboratory tests of the pilot study (0) and at the two monthly revaluations . The pregnant women are oriented at each consultation to ingest the medication with a glass of drinking water, 30 minutes before a meal, and to preserve the non-consumed pills in the blisters. The safety profile for the use of ferrous sulfate at pregnancy is satisfactory; there were no reports of fetal damage or severe maternal adverse events [The treatment consists of two daily doses of 109 mg of ferrous sulfate in the form of pills with 40 mg of elemental iron . Three blisters with 20 pills are given at the enrollment , and information about gastrointestinal symptoms and therapeutic compliance is collected by the standardized form, such a venous blood sample to obtain Hb is prompted. Pregnant women who present drug intolerance, severe anemia (Hb < 7.0 g/dL) or Hb values drop more than 1.0 g/dL during the follow-up are referred to an individualized conduct. Those who present Hb > 11.0 g/dL before 90 days of the overall follow-up will begin to use supplemental doses of oral iron (40 mg/daily).The prescribed treatment provides a follow-up period of 90 days. The follow-up is stopped before this period in case of evolution to high-risk pregnancy, genital bleeding, childbirth delivery, drop out of treatment, use of another type of iron supplement, drug intolerance, cure or aggravation of anemia. The participants are evaluated monthly ; haematocrit < 32.0% (suggested for the 2nd trimester of pregnancy); mean corpuscular volume (MCV) < 81.0 fL; mean corpuscular haemoglobin (MCH) < 26.0 pg; mean corpuscular haemoglobin concentration (MCHC) < 32.0 g/dL; red blood cells distribution width (RDW) > 14.0%; reticulocyte count < 1.0%; serum ferritin < 12.0 ng/mL [The initial values of the erythrocyte indices and serum ferritin will be tested as predictors of presence of the functional iron deficiency at the following cutoff points suggested by WHO and Centers for Disease Control and Prevention (CDC) on pregnant or childbearing age women (when there is no specific report for pregnant women): red blood cells count < 3.8 10.0 ng/mL ,22.The final diagnosis of iron deficiency will be set individually on the basis of the presence (case) or absence (non-case) of the ‘responsiveness to therapeutic test with oral iron’, starting from assumptions that, in the case of iron deficiency in pregnancy, a functional definition would be more appropriate and the To measure this outcome, the physiological variability of Hb throughout the pregnancy was taken into consideration, because it distorts the interpretation of longitudinal trends of Hb absolute values . Thus, oIt was determined as a final diagnosis of functional iron deficiency the partial therapeutic responsiveness by increase of at least 0.55 Hb Z-score after a minimum of 4 weeks treatment and an intake of at least 1200 mg of elemental iron as a total dose, based on the following assumptions:– An increase of 1 g/dL on the Hb after 30 to 60 days of oral iron therapy is a reliable indicator of iron deficiency in individuals or populations [– The haematological improvement depends on the total dose of iron intake considering that the dose of 1200 mg of elemental iron is responsible for most of the effect on the Hb values .– The standard deviation of the Hb distribution in populations of pregnant women is 0.9 g/dL, independently of gestational age .status of a pregnant woman.– By mathematics definition, 1 Z-score corresponds to 1 SD, that is, equal to 0.9 g/dL of Hb at pregnancy. Therefore, the difference of 0.55 SD between the post and pre-treatment Hb Z-scores represents a relative increase of 0.5 g/dL (0.55 × 0.9 g/dL) in the Hb et al. (2002) [Treatment compliance and adverse effects are being evaluated every 30 days and recorded in the pregnant women´s individual form with a goal to reduce losses and ensure the intake of the effective total dose of iron with minimal symptomatic discomfort for the pregnant women. Women who do not achieve the minimum adherence will not be evaluated for the ‘responsiveness to therapeutic test with oral iron’. The frequency of the good adherence to the treatment will be reported as an intake at least 75% of the prescribed monthly pills, according to pregnant women’s information and pill counting. This percentage was determined on the basis of the proportion of the monthly treatment prescribed that corresponds to the total monthly dose of 1800 mg of elemental iron, which is considered responsible for almost the entire effect in Hb levels according to Ekström . (2002) .According to pregnant women´s information the presence of the adverse effects was defined as the appearance of the following symptoms after the beginning of the intervention: abdominal pain/abdominal cramps, diarrhea (increasing number of evacuations or reduction of the stools consistency), constipation (reducing number of evacuations or hardening of stools), nausea, vomiting and heartburn (epygastric burning or heartburn) . The womco-variables are being collected for the sample characterization: age, city of residence, education level, socioeconomic class (economic classification criteria Brazil 2010) [et al. standard) [The following il 2010) , maritaltandard) , number The sample size (43 cases and 97 non-cases) was calculated to estimate 90% of sensitivity and 80% of specificity, with relative error of 10% and the power of 95%. Considering cure rates of 50% and 30% of losses or poor adherence to treatment ,41, 278 The data are being released with dual input and processed in the EPIINFO3.4.2 program. The analytical design is as a delayed-type cross-sectional study, where at the end of the follow-up, the measured tests at time-zero (predictive variables) will be compared with the final diagnosis of the target-disease (outcome variable) to determine estimates of accuracy . Thus, aDuring the period of the pilot study 106 anemic pregnant women were identified, which 39 fulfilled the eligibility criteria with the acceptance of 100% to participate in the research. The loss percentage was 41% due to dropout (9), gestational risk (5) and drug intolerance (2). Low therapeutic adherence (intake of less than 75% of pills) was observed in 30.4% (7/23) and the most incidents of adverse effects were nausea (25.8%), heartburn (21.5%) and constipation (17.2%).An interim analysis of collected data will be performed on 186 pregnant women enrolled until August 2012, whose follow-ups were completed in November 2012, to verify the number of cases and non-cases and estimate the additional time necessary to achieve the sample size.This protocol follows the Ethical Principles for Medical Research Involving Human Subjects of the Declaration of Helsinki and the 196/96 resolution from the National Health Council of Brazil. This study has the ethical approval for the human experimentation by IMIP Research Ethics Committee under the number 2050–10. The participants are duly informed about the research explained by the team and are enrolled in the study after having assigned the written informed consent form.Pregnant women nutritional status in the state of Pernambuco: methodological, epidemiological aspects and implications in pre-natal care’.This trial was funded by the National Council for Scientific and Technological Development (CNPq) of Brazilian Government as a nested study to the cross-sectional multicenter survey ‘Pregnancy is a period marked by singularities in the physiology of the body fluids and erythropoiesis, so both haemodilution and iron deficiency leads to anemia and this discrimination becomes difficult ,34,37. TIn the absence of a gold standard, the haematological response to oral iron was adopted as the reference standard in order to define iron deficiency in pregnancy under the functional point of view. This approach aims to evaluate the pragmatic usefulness of erythrogram and serum ferritin to identify pregnant women who would benefit from iron therapy to achieve the improvement of their anemia, which should be the theoretical purpose of the current guideline in recommending iron-therapy for all pregnant women with Hb < 11.0 g/dL ,33. Thuset al. (2000) were the only one to apply the Hb Z-scores among 23 clinical trials reviewed in the most recent meta-analysis [An important issue addressed in the protocol method is the physiologic fluctuation of the Hb absolute values which could bias the therapeutic efficacy measurements during the follow-up trial period -29. Beatanalysis ,42.“the prevalence of iron deficiency anemia in a population is statistical rather than physiological concept” [In addition to these methodological questions, this study found its own operational limitations of the routine at a prenatal service in our location, particularly regarding to the patients’ return for clinical follow-up and the effective performance of laboratorial exams. The excessive loss rate of the pilot study was overcome with strategies which have strengthened the follow-up and the laboratory analyzes. The percentage of adverse effects agreed with the literature, signaling the continuance of the study in order to ensure the effective dose of iron intake and the safety standard of the medication -17. At tThe authors declare that they have no any financial competing interests as well as other potential conflicts of interest related to this study.CCB, MCB and MB conceived and designed this protocol. CCB, DFF, CET and DBS are carrying out the acquisition of data. CCB is performing the study coordination. All authors read, critically revised and approved this manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2393/13/13/prepub

Klebsiella pneumoniae infections, commonly acquired in hospitals, has drawn great concern. It has been shown that the K1 and K2 capsular serotypes are the most detrimental strains, particularly to those with diabetes. The K1 cps (capsular polysaccharide) locus in the NTUH-2044 strain of the pyogenic liver abscess (PLA) K. pneumoniae has been identified recently, but little is known about the functions of the genes therein. Here we report characterization of a group of cps genes and their roles in the pathogenesis of K1 K. pneumoniae. By sequential gene deletion, the cps gene cluster was first re-delimited between genes galF and ugd, which serve as up- and down-stream ends, respectively. Eight gene products were characterized in vitro and in vivo to be involved in the syntheses of UDP-glucose, UDP-glucuronic acid and GDP-fucose building units. Twelve genes were identified as virulence factors based on the observation that their deletion mutants became avirulent or lost K1 antigenicity. Furthermore, deletion of kp3706, kp3709 or kp3712 , which are all involved in fucose biosynthesis, led to a broad range of transcriptional suppression for 52 upstream genes. The genes suppressed include those coding for unknown regulatory membrane proteins and six multidrug efflux system proteins, as well as proteins required for the K1 CPS biosynthesis. In support of the suppression of multidrug efflux genes, we showed that these three mutants became more sensitive to antibiotics. Taken together, the results suggest that kp3706, kp3709 or kp3712 genes are strongly related to the pathogenesis of K. pneumoniae K1.The growing number of Klebsiella pneumoniae is an opportunistic pathogen of the Enterobacteriaceae and usually causes pneumonia or urinary tract infections Klebsiella spp., especially the so-called extended-spectrum beta lactamase (ESBL) and Klebsiella pneumoniae carbapenemase (KPC) subtypes, has draw much attention in recent years Bacterial pathogenicity has been shown to be due to different causes, including the structures of capsular polysaccharides , lipopolysaccharide , secreted toxins, drug resistance, and genetics K. pneumoniae is complex acidic polysaccharide consisting of repeating units of 3–6 sugars. The type of sugars seems to correlate with the virulence, and 78 capsule types have been identified K. pneumoniae strains have been found to cause primary pyogenic liver abscess (PLA) S)-pyruvate appendix differing from a commonly seen 4,6-(R)-pyruvate in CPS repeat units The CPS of magA (mucoviscosity associated gene A) in the cps locus of NTUH-K2044, a PLA-causing serotype K1 strain from National Taiwan University Hospital galF (kp3726) to ugd (kp3701) was further identified genetically as the K1 cps cluster , ptf, wzc, wzb, and wza in the proposed cps locus (ugd and Δgmd. Based on both anti K1 serum test by double immunodiffusion assay (gnd and ΔwcaH) lost the K1 serotype and mucoviscosity while remaining O1 serotype positive , the pyruvyltransferase gene (Δptf or Δ3715), or the mucoviscosity associated gene was sufficient to cause a significant decrease in the virulence of the NTUH-K2044 strain .Since the deletion mutants make little or no CPS, they are expected to lose pathogenicity also. Animal inoculation experiments were performed for three mutants as examples. As shown in These results taken together have verified the functions of individual genes and proteins. Even though the CPS itself can be considered as a virulence factor, our results suggested that the individual genes or proteins responsible for CPS synthesis can also be considered as virulence factors, and thus are potential targets for designing inhibitors against the pathogen. We further examined the properties of the deletion mutants as described below.wcaI and galF, most of the genes in the cps gene cluster, were found completely silenced in d3706, d3709 and d3712 (Table S4). To estimate the scopes of the gene silencing effect, genes upstream of the cps locus were also examined and found to be silenced up to kp3767 in these three mutants . The total region influenced by the effect was about 70 Kb, including 15 of the 20 cps genes and 37 upstream genes (and Table S5). Interestingly, the functions of these three genes are all related to the fucose residue of the trisaccharide repeat unit - WcaI (KP3706) is likely the fucosyl transferase, WcaG (KP3709) is responsible for GDP-fucose synthesis, and Atf (KP3712) is for fucose acetylation.We first examined the deletion mutants at the transcriptional level by Q-PCR. Surprisingly, expressions for genes between nd d3712 Table 3,, right 3 lanes). This result suggests that the silencing effect is caused by changes at the level of genomic DNA, not simply due to protein expression. (b) The effect of gene silencing was observed from fucose-related metabolites. Analyses of cell fluids extract showed that GDP-Fuc were hardly detectable in these three mutants, while clearly present in two control mutants d3705 and d3715 . This result supports the silencing effect since only KP3709 is involved in GDP-fucose biosynthesis; the functions of KP3706 and KP3712 occur after formation of GDP-fucose and their deletion should not have affected the production of GDP-fucose if there were no silencing effect.That the broad gene silencing effect is novel and real is further supported by three experimental approaches: (a) Complementation experiments with plasmids carrying the deleted gene restored only the expression of the deleted gene, not the other silenced genes regulators of capsule synthesis (rcs) cps gene cluster; (ii) the transcriptional antiterminator rfaH wzb/wzcrmpA2, which is a transcriptional activator and its absence would only lower the capsule production Several other known regulatory mechanisms are related to the Table S6) and at the stationary phase of the growth (Table S7). The results indicate that these factors did not affect the broad gene silencing effect observed for the three deletion mutants.Small RNA (sRNA) is specifically used to represent bacterial non-coding RNA. Since it has been suggested that sRNA cps locus affected by the gene silencing effect include many regulators and multidrug efflux genes (from kp3742 to kp3747) ( and Table S5). Since multidrug efflux pumps are known to contribute to drug resistance in Gram-negative bacteria uge or d3699, a slow-growing mutant, was used as a positive control as Uge is involved in the biosynthesis of LPS). Then we examined the effects of various antibiotics on the growth rates of these strains. Two of the antibiotics tested, zeocin (a member of the bleomycin/phleomycin family of antibiotics known to bind and cleave DNA) but had limited effect against wild-type and the other mutants. In contrast, tetracycline, sulfamethoxazole, ciprofloxacin, and geneticin, which are classified as members of tetracyclines, sulfonamides, quinolones, and aminoglycosides antibiotics, respectively, did not show specific effects on the three mutants (S4D).To test whether the broad gene silencing effect is related to the pathogenicity of the NTUH-K2044 strain, we examined possible functions of the silenced genes. Importantly, the 37 genes upstream of the kp3742 (yegM) deletion mutant was constructed. The inhibition assays showed that the growth of the ΔyegM strain was inhibited by zeocin and H. pylori on the adhesion pathogenesis and escape of host surveillance There has been growing evidence that fucose K. pneumoniae add to the emerging evidence that fucose In summary, our results on the CPS of the NTUH-K2044 strain of the PLA K. pneumoniae strains were collected at National Taiwan University Hospital (NTUH) Bacterial strains and plasmids used in this study are listed in K. pneumoniae strains were determined as previously described K. pneumoniae inoculation consisting of 102–106 mid-logarithmic growth phase CFUs were diluted in 100 µl normal saline and injected intraperitoneally 50 was calculated using the method established by Reed and Muench The serum resistances of Table S8 and cloned into a pGEM-T easy vector. The deletion fragment was generated by inverse PCR using primers listed in Table S8. The deletion fragments described above were cloned into a NotI site of a pKO3-Km plasmid separately The deletion mutants were generated using a modified pKO3-Km vector that contained a temperature-sensitive origin of replication and markers for positive and negative selection for chromosomal integration and excision wcaG, wcaI, and atf genes were amplified by PCR using primers (Table S1) and cloned into a pGEM-T Easy-Km plasmid The K. pneumoniae was determined by a string test as previously described The mucoviscosity of magA deletion mutant.Capsule and lipopolysaccharide were purified as previously described Table S9.1 µg of extracted RNA was reverse transcribed into cDNA in 20 µl reaction as the manufacturer protocol . 20 µl of cDNAs were then diluted into 1 ml. 5 µl of diluted cDNA samples were added into the Q-PCR reaction plate, and also the 10 µl of reaction solution. The analysis of Q-PCR result is that each gene was first normalized with 23S RNA. Each gene in each strain was then normalized with wild-type to obtain the relative gene expression pattern. The primers used for Q-PCR are listed in uge, ugd, manB, manC, gnd, wcaH, wcaG, gmd, and galF) were cloned from NTUH K-2044 genomic DNA into pET28a (his-tagged). Proteins were over-expressed in E. coli. BL21 star (DE3). His-tagged protein purification was followed by PROBOND manufacturer's protocol. Purified proteins were concentrated to 1 mg/ml then 10 µl of protein together with 10 µl of 10 mM substrates (in the figure legend) were added in reaction buffer, 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2 in final 100 µl solution. The reaction solution was extracted by chloroform to remove the proteins, then analyzed by HPLC with ammonium formate gradient.Genes , followed by addition of a mixture chloroform/methanol (1∶2) and vortexing for 10–15 min. The mixture was then centrifuged at 4000 rpm for 15 min, the pellet was removed and mixed with chloroform and ddH2O (1∶1), and centrifuged again. The upper phase containing soluble components were collected and dried under air. It was redissolved in distilled water and further purified by Amicon filter (YM-10 cut-off), and the filtrate was collected and monitored by anion exchange HPLC using ammonium formate. The peaks were identified by comparing the retention times and MS with known standards.For isolation of soluble fractions containing sugar nucleotide/nucleotides from 600 = 0.005 in LB broth with desired antibiotics. The growth curve was plotted by measuring OD600 periodically.NTUH-K2044 and knock-out strains were grown in LB broth at 37°C. For growth curves, log phase cultures were diluted to ODResults S1Characterization of enzymes for the synthesis of UDP-glucose (UDP-Glc), UDP-glucuronic acid (UDP-GlcA), UDP-galacturonic acid , GDP-mannose (GDP-Man) and GDP-fucose (GDP-Fuc).(DOC)Click here for additional data file.Figure S1HPLC traces.A, Ugd (KP3701) reaction buffers containing: (a) UDP-glucose+NAD+, (b) UDP-glucose+KP3701, (c) NAD++KP3701 (d) UDP-glucose+NAD++KP3701. B, Uge (KP3699) reaction buffers containing: (a) UDP-glucuronate+Mg2+, (b) UDP-glucuronate+Mg2++KP3699.(EPS)Click here for additional data file.Figure S2HPLC traces.A, ManC (KP3703) reaction buffers containing: (a) mannose-1-phosphate+GTP+Mg2+, (b) mannose-1-phosphate+Mg2++KP3703, (c) GTP+Mg2++KP3703, (d) mannose-1-phosphate+GTP+Mg2++KP3703, (e) GDP-mannose standard. B, ManB (KP3702) and ManC (KP3703) reaction buffers containing: (a) mannose-6- phosphate+GTP+Mg2++KP3702, (b) mannose-1-phosphate+GTP+Mg2++KP3702, (c) mannose-6-phosphate+GTP+Mg2++KP3703, (d) mannose-6-phosphate+GTP+Mg2++KP3702+KP3703. C, Gmd (KP3711) reaction buffers containing: (a) GDP+Mg2+ (b) GDP-mannose+Mg2+, (c) GDP-mannose+Mg2++KP3711. D, WcaG and Gmd reaction buffers containing: (a) GDP-mannose+NADPH+KP3711+KP3709, (b) GDP-mannose and NADP+ standard, (c) GDP-fucose standard. E, WcaH (KP3708) reaction buffers containing: (a) GDP+Mg2+, (b) GDP-mannose+Mg2+, (c) GDP-mannose+Mg2++KP3708. F, Gnd (KP3704) reaction buffers containing: (a) NADP+, (b) gluconate-6-phosphate+NADP+, (c) gluconate-6-P+NADP++KP3704.(EPS)Click here for additional data file.Figure S3Verification of GDP-fucose in by mass spectrometry obtained on a LTQ mass spectrometer. The peak at 588.1 is GDP-fucose, which is clearly present in Δ3715, minimally detectable in Δ3712, and absent in Δ3709.(EPS)Click here for additional data file.Figure S4Growth curves of wild type and mutants in the presence of antibiotics.A, tetracycline (0.5 µg/ml). B, sulfamethoxazole (500 µg/ml). C, ciprofloxacin (0.025 µg/ml). D, geneticin (12.5 µg/ml).(EPS)Click here for additional data file.Table S1Kinetic parameters for KP3701 (UgD) and KP3704 (Gnd).(EPS)Click here for additional data file.Table S2The enzyme specificity test for ManC (KP3703).(EPS)Click here for additional data file.Table S3The enzyme specificity test for GalF (KP3726).(EPS)Click here for additional data file.Table S4Q-PCR results of non-silencing effect mutants.(EPS)Click here for additional data file.Table S5Gene annotation of NTUH K2044 from kp3689 to kp3769.(EPS)Click here for additional data file.Table S6Gene expression results of mutants strains at different temperature growth condition.(EPS)Click here for additional data file.Table S7Gene expression results of mutants strains at stationary phase (OD600: 2.0).(EPS)Click here for additional data file.Table S8Primers used for cloning the KO construct and complement plasmid.(EPS)Click here for additional data file.Table S9Primers used for quantitative PCR.(EPS)Click here for additional data file.

Background:β2-Glycoprotein I (β2GPI) is an abundant plasma protein that is closely linked to blood clotting, as it interacts with various protein and cellular components of the coagulation system. However, the role of β2GPI in thrombus formation is unknown. We have recently shown that β2GPI is susceptible to reduction by the thiol oxidoreductases thioredoxin-1 and protein disulfide isomerase, and that reduction of β2GPI can take place on the platelet surface. Methods:β2GPI, reduced by thioredoxin-1, was labeled with the selective sulfhydryl probe Na-biocytin and subjected to mass spectrometry to identify the specific cysteines involved in the thiol exchange reaction. Binding assays were used to examine the affinity of reduced β2GPI for von Willebrand factor (VWF) and the effect of reduced β2GPI on glycoprotein (GP)Ibα binding to VWF. Platelet adhesion to ristocetin-activated VWF was studied in the presence of reduced β2GPI. Results: We demonstrate that the Cys288–Cys326 disulfide in domain V of β2GPI is the predominant disulfide reduced by thioredoxin-1. Reduced β2GPI in vitro displays increased binding to VWF that is dependent on disulfide bond formation. β2GPI reduced by thioredoxin-1, in comparison with non-reduced β2GPI, leads to increased binding of GPIbα to VWF and increased platelet adhesion to activated VWF. Conclusions: Given the importance of thiol oxidoreductases in thrombus formation, we provide preliminary evidence that the thiol-dependent interaction of β2GPI with VWF may contribute to the redox regulation of platelet adhesion. The reaction was terminated by addition of 2 m NaOH, and absorbance was read at 405 nm.The method is based on that reported by Lahav et al. . Washed spss 17.0 statistics software was used for the analysis of data. Data were analyzed by anova followed by Dunnett’s correction for multiple comparisons. A P-value of < 0.05 was considered to be statistically significant.The 2GPI treated with TRX-1/TRX-R/NADPH/MPB (see Tables S1 and S2 for a full list of peptides for each sample). As a number of cysteines were found to be biotinylated in β2GPI, the MBP/iodoacetamide-labeled peptide ratio was used to determine the cysteine target of reduced TRX-1. As shown in Table S3, Cys326 is by far the most heavily modified cysteine in the protein.Mass spectrometry showed biotinylation of nβNine of the 11 disulfides in β2GPI have a spiral configuration , the most common configuration and one associated with structural disulfides . The Cys2GPI reduced by TRX-1 shows increased binding to immobilized VWF. Given the importance of thiol linkage in VWF multimerization [2GPI [2GPI are involved in its interaction with VWF. We applied β2GPI reduced by TRX-1/TRX-R/NADPH to VWF-coated ELISA plates, and detected the amount of β2GPI bound to VWF with the mAb 4B2E7. The binding of β2GPI treated with TRX-1/TRX-R/NADPH to immobilized VWF was increased 3.5-fold when compared with untreated β2GPI begins to exceed the amount of antibody, the dose–response curve will plateau and, with further increase, may, paradoxically, become negatively sloped. In some cases, this phenomenon has also been attributed to the coating density of the capture antibody (the capture protein in this case being VWF).βrization and its on [2GPI , we proced β2GPI . Non-redt 0.8 μm and decr2GPI to immobilized VWF was abrogated when the thiol-reactive molecule MPB was added to reduced β2GPI (reduced by TRX-1/TRX-R/NADPH) before addition to VWF-coated wells. This indicated that the binding of reduced β2GPI to VWF was dependent on disulfide bond formation between the two molecules, which was prevented in the presence of MPB (The increased binding of reduced βe of MPB .2GPI) decreased the binding of β2GPI treated with TRX-1/TRX-R/NADPH to immobilized VWF, and the binding was comparable to that of untreated β2GPI increased the binding of GPIba to immobilized VWF in comparison with untreated β2GPI or BSA treated with TRX-1/TRX-R/NADPH as control protein to immobilized (reduced or non-reduced) βsolution .2GPI’s reducing agent, TRX-1, can be found in platelets. Both TRX-1 and TRX-R were detected in platelet lysates of resting and thrombin-activated platelets. TRX-1 was also detected in the releasates from resting and thrombin-activated platelets . Platelet adhesion was partially inhibited by addition of the TRX-R inhibitor DNCB, supporting the notion that reduction of β2GPI by TRX-1 was partially responsible for the adhesion of the platelets .The VWF–platelet GPIbα receptor interaction is important for the initial step of platelet adhesion. Ristocetin promotes VWF binding to GPIbα in solution. We demonstrated that ristocetin-activated VWF had a greater affinity for reduced β2GPI , so we tlatelets . In thislatelets . Represe2GPI reduced by TRX-1 demonstrates thiol-dependent increased binding to VWF and platelet adhesion to activated VWF. TRX-1 is ubiquitously expressed and is secreted to the cell surface [2GPI is partially reduced on the platelet surface by TRX-1/TRX-R/NADPH [2GPI being attributed to domain V including phospholipid [In the current study, we have shown that β surface . TRX-1 i surface and rele-R/NADPH . We now pholipid and GPIbpholipid ,5, and Fpholipid . The fif2GPI has been shown to bind both with GPIba and VWF [et al. [2GPI bound to the A1 domain of VWF with low affinity and inhibited platelet adhesion to immobilized VWF. However, when free thiols are introduced into β2GPI by TRX-1, the binding affinity for VWF increases significantly and promotes adhesion of GPIbα and platelets to activated VWF. The GPIba–VWF interaction is crucial for hemostasis. Disulfide exchange may be an important feature of platelet tethering to exposed VWF, as shear has been shown to promote disulfide formation between VWF subunits and VWF binding to platelets [2GPI, which could be a modifier of disulfide reactions of VWF and/or GPIbα.It is interesting that β and VWF –5. Hulst [et al. showed tlatelets . Furtherlatelets . Platele2GPI have been shown with various components of the coagulation and fibrinolysis system in vitro, often with conflicting results and interpretations. Although β2GPI deficiency does not lead to gross hemostatic abnormalities, we believe that reduction of circulating β2GPI can promote thrombus formation under specific conditions. This idea is supported by the facts that β2GPI−/− mice have impaired thrombin generation [2GPI inhibits thrombin inactivation by heparin cofactor II [2GPI is predominantly in the reduced form in vivo [in vivo reduced β2GPI supports platelet adhesion, a function not apparent in in vitro studies, where the purified protein has been significantly oxidized. The design of in vivo studies would delineate the role of reduced vs. non-reduced β2GPI in platelet adhesion.Multiple interactions of βneration and thatactor II . Our lab in vivo . Hence, 2GPI in the circulation may be relevant to disease development. There are a number of publications addressing the relationship of β2GPI levels to thrombotic and atherothrombotic disease, some in the context of antiphospholipid syndrome. In a review by Inanc et al. [2GPI was not associated with thrombotic risk. High levels of circulating β2GPI have been reported to decrease the risk of myocardial infarction in elderly men [2GPI in the circulation may be more important than the total levels of circulating β2GPI.The presence of the reduced form of βc et al. , the leverly men . With re2GPI can be involved in thiol exchange reactions with TRX-1 is of considerable importance, given β2GPI’s high concentration in plasma makes it easily available for reactions where thiols are needed. There is increased scientific interest in the role of thiol-acting enzymes such as PDI in thrombus formation. PDI has been shown in vivo to be required for thrombus formation [IIbβ3 or GPIba. The demonstration that β2GPI is a substrate of TRX-1 and PDI has implications for a role of β2GPI in thrombus formation. Our results also provide considerable insight into the participation of extracellular TRX-1 in the regulation of platelet adhesion.The finding for the first time that βormation and tissormation . Inhibit

In this work, we introduce an algorithm to compute the derivatives of physical observables along the constrained subspace when flexible constraints are imposed on the system . The presented scheme is exact, it does not contain any tunable parameter, and it only requires the calculation and inversion of a sub-block of the Hessian matrix of second derivatives of the function through which the constraints are defined. We also present a practical application to the case in which the sought observables are the Euclidean coordinates of complex molecular systems, and the function whose minimization defines the flexible constraints is the potential energy. Finally, and in order to validate the method, which, as far as we are aware, is the first of its kind in the literature, we compare it to the natural and straightforward finite-differences approach in a toy system and in three molecules of biological relevance: methanol, N-methyl-acetamide and a tri-glycine peptide. When a given quantity related to the system under study is constrained, it is not allowed to depend explicitly on time (or on any other parameter that describes the evolution of the system in the problem at hand). Instead, a constrained quantity is either set to a constant value (hard or rigid constraints) or to a function of the rest of degrees of freedom ; in such a way that, if it depends on time, it does so through the latter and not in an explicit manner.In the theoretical and computational modeling of physical systems, including but not limited to condensed-matter materials reaction coordinates), in order to be able to compute free energy profiles along them that would take an unfeasibly long time if we used an unconstrained simulation. Probably the most common application of the idea of constraints, and the one that will be mainly discussed in this work, appears when we fix the fastest, hardest degrees of freedom of molecular systems, such as bond lengths or bond angles, in order to allow for larger time-steps in MD simulations The imposition of constraints is useful in a wide variety of contexts in the fields of computational physics and chemistry: For example, we can use constraints to maintain an exact symmetry of the equations of motion; like in Car-Parrinello molecular dynamics (MD) whole space, constrained subspace, In any of these cases the imposition of constraints can be described in the following way: If the state of the system is parameterized by a given set of coordinates regular. Moreover, this independence condition allows, in the vicinity of each point parametrically byunconstrained and they parameterize constrained and their value is determined at each point of flexiblehard, and all the calculations are considerably simplified. In this work, we tackle the general, more involved, flexible case.The condition of these constraints being independent amounts to asking the set of some of the original coordinates at each regular point of same subset of coordinates Of course, even if flexible and hard sub-types is multiple in the literature. The first sub-type is called flexible in refs. elastic in soft in hard in refs. constrained in holonomic in rigid in fully constrained in elastic, holonomic or fully constrained), and, in any case, so many names for such simple concepts is detrimental to understanding in the field.It is also worth mentioning at this point that, not only from the physical point of view all the constraints dealt with in this work are just holonomic constraints, but also the wording used to refer to the two flexiblestiffrigidThe situation is further complicated by the fact that, when studying the statistical mechanics of constrained systems, one can think about two different models for calculating the equilibrium probability density, whose names often collide with the ones used for defining the type of constraints applied. On the one hand, one can implement the constraints by the use of very steep potentials around the constrained subspace; a model sometimes called stiff or the rigid model, with either flexible or hard constraints, hence making any interference between the two sets of words undesirable. The wording chosen is this work is, on the one hand, fairly common, and on the other hand, non-misleading.It is worth remarking that the two types of constraints and the two types of statistical mechanics models can be independently combined; one can have either the restriction to Now, if we take any physical observable The derivatives of this observable along In the case of hard constraints, i.e., when the functions If the constraints are assumed to be flexible, it is common in the literature of molecular modeling to define these functions In this work, we present a parameter-free, exact algorithm (up to machine precision) to calculate the derivatives As we mentioned in the In order to calculate the derivatives along The starting point is eq. (5) in the As we mentioned, the expression of If we assume that we have available some method to check that the order of the stationary point is the appropriate one , we can write a set of equations which are equivalent to eq. (7), and which (implicitly) define the functions Now, we can take the derivative of this expression with respect to a given unconstrained coordinate It is worth mentioning that similar equations to the ones above can be found in classical mechanics anytime that local coordinates are used fixed in the molecule. This problem has been faced by our group when trying to calculate the correcting terms associated with mass-metric tensor determinants that appear in the equilibrium probability density when flexible constraints are imposed atoms. The three Euclidean coordinates of atom In such a case, the system of interest is a set of curvilinear coordinates , denoted by Apart from the Euclidean coordinates, one can also use a given set of proper change of coordinates, i.e., that the Jacobian matrixWe will additionally assume that, for the points of interest, this is a fixed in the system to perform some of the calculations. To this end, we select three atoms in such a way that Now, we define a particular FoR axis see . The posexternal coordinates, internal coordinates and determine the positions of the atoms in the FoR fixed in the system internal subspace or conformational space, denoted by external subspace, denoted by Although the aforementioned curvilinear coordinates The position, Although general constraints affecting all the coordinates unconstrained internal coordinates and parameterize the internal constrained subspace, denoted by constrained coordinates in the unconstrained coordinates of the system, Under the common assumptions in the In this situation, the constraints in eq. (16) are equivalent toFinally, if these constraints are used, together with (16), the Euclidean position of any atom in the constrained case may be parameterized with the set of all unconstrained coordinates, In order to calculate the derivatives along geometrical [or kinematical] objects, i.e., they do not depend of the potential energy). We now turn to the derivation of an explicit algorithm for finding them and thus completing the calculation that is the objective of this section.Now, the derivatives In the supplementary material of ref. In non-redundant internal coordinates schemes, whether they are defined as in ref. bond length, and denoted by Normally, the first of the three internal coordinates used to position atom will move and It is clear that, if we now change a given bond length bond angleThe second internal coordinate, after and see .Now, the reasoning is the same as in the case of the derivative with respect to If we now look at Rodrigues’ rotation formulaThe result, However, notice that, in order to define a rotation, it is not enough to specify the angle The fixed point for the rotation we are interested in can be chosen to be Then, keeping the terms up to first order in dihedral angleprincipal and phase dihedral angles, respectively The third and last internal coordinate that is usually defined to position atom Regarding the derivative of the ‘primed’ position of atom tor see . The fixdo not belong to itself moved and it was used to position In order to decide whether or not atom whether or not there can be atoms that are also used to position what happens when we change the internal coordinates associated to them.The answers to these two questions depend on the particular scheme used to define the internal coordinates, and we will tackle them referring to the SASMIC scheme The first case, in The second case, in In principle, any change in the internal coordinates of atom For example, it is easy to see that, in the case depicted in In the situation shown in In summary, only changes in bond lengths associated to atoms tom see can affeFinally, the outline of the algorithm for calculating the sought derivatives Calculate the chain Calculate the derivatives Calculate the geometric derivatives Plug all the calculated quantities into eq. (19) et voilà.In this section, we compare the finite-differences approach see to the nTo these two ends, we have applied the more specific algorithm introduced in the previous section for the calculation of the derivatives of the Euclidean coordinates of molecular systems to the three biological species in For methanol and NMA, due to the small dimensionality of their constrained subspaces, the working sets of conformations have been generated by systematically scanning their unconstrained internal coordinates at finite steps. For methanol, we produced 19 conformations, in which the central dihedral, At each one of these conformations, defined by the value of the unconstrained internal coordinates In order to find the partial derivatives On the other hand, to calculate the derivatives In order to compare the two methods, we turn first to the smallest system: methanol. In er 5 see with resTo track the source of this difference, we can take a look at eq. (8), which gives the derivative The numerical derivatives appearing in this expression that are related to the three constrained coordinates associated to atom 5 are shown in identity of the minima is altered, thus introducing potentially larger errors. In As we noticed in bond see , presentTo sum up, the finite-differences method contains two sources of error which the new method does not present: one at small values of In The graphics in vely see . We obseAll in all, we see that the need to tune for the optimal Also, and more importantly (since the failure of finite differences was indeed predictable) the good coincidence between the newly introduced, somewhat more involved method and the straightforward finite-differences scheme for the smallest system and in some intermediate range of values of Finally, despite what we discussed in the The toy system is a 2-dimensional one, with positions ergy see :(36)If we take a large enough Now, if we perform a ‘molecular dynamics’ of this system, then we may need at some point to compute the derivative with respect to For finite differences: Choose a displaced value of the unconstrained coordinate For the new method: Calculate the objects in eq. (11), perform the required inversion to find The particularization of eq. (5) to this simple case isIn this section, for illustrative purposes, we have chosen a simple observable We have calculated In summary, in this work, we have introduced a new, exact, parameter-free method for computing the derivatives of physical observables in systems with flexible constraints. The new algorithm has been numerically validated in small molecules against its most natural alternative, finite differences. In doing so, numerous pitfalls of the latter method have been demonstrated, all arising from the fact that it contains a tunable parameter that has to be optimally adjusted in each particular problem at hand. In a number of numerical experiments, we have shown that the finite-differences approach contains two unavoidable sources of error that are not present in the new method: On the one hand, the finite number of significant figures used to represent, in computers, the values of the optimized coordinates, together with the fact that these constrained coordinates are typically very stiff, make the changes in this quantities often unobservable or at least badly resolved, thus rendering the finite-differences derivatives unreliable for small values of the displacement parameter

Recent studies suggest that the combination of caffeine-containing drinks together with alcohol might reduce the subjective feelings of alcohol intoxication—the so-called “masking effect”. In this study, we aimed to review the effects of alcohol in combination with caffeine or energy drink with special focus on the “masking effect”. Fifty-two healthy male volunteers were analysed concerning breath alcohol concentration and subjective sensations of intoxication using a 18 item Visual Analogue Scale in a randomised, double-blinded, controlled, four treatments cross-over trial after consumption of (A) placebo, (B) alcohol (vodka 37.5 % at a dose of 46.5 g ethanol), (C) alcohol in combination with caffeine at a dose of 80 mg and (D) alcohol in combination with energy drink at a dose of 250 ml (one can). Primary variables were headache, weakness, salivation and motor coordination. Out of four primary variables, weakness and motor coordination showed a statistically significant difference between alcohol and non-alcohol group, out of 14 secondary variables, five more variables also showed significant differences due mainly to contrasts with the non-alcohol group. In none of these end points, could a statistically significant effect be found for the additional ingestion of energy drink or caffeine on the subjective feelings of alcohol intoxication. This within-subjects study does not confirm the presence of a “masking effect” when combining caffeine or energy drink with alcohol. Since the publication of this study, several methodological flaws of this study have been discussed, in particular the statistical analysis, and the interpretation of the results are not undisputed , body weight between 68 and 85 kg (77.0 ± 3.8) and at least 12–14 years of formal education. All volunteers were in good general health as determined by medical history and screening investigations. All were taking no regular medication and had no history of psychiatric disorders.Fifty-two healthy male volunteers participated in the study. Their age was 20–26 years (24.4 ± 1.5), with body mass indices between 21 and 25 kg/mFurther inclusion criteria were: Moderate alcohol consumption (less than 190.4 g/week) according to the Daily Drink questionnaire .Four mixtures listed below were consumed orally within 10–20 min, on one occasion each in a randomised order. Volunteers wore a nose clip to optimise blinding. As far as possible all investigational products were identical in appearance and taste, differing only in the absence/presence of alcohol, caffeine and energy drink. The final volume of the mixtures was 500 ml for each treatment. The caffeine, alcohol and energy drink doses were chosen as used by Ferreira et al. because they were within the range of doses usually ingested on a single occasion consisted of (carbonated) water (250 ml), artificial fruit juice [21 g/l prepared with (carbonated) water].The comparator B was a mixture of 46.5 g ethanol (in form of vodka 37.5 vol %) (carbonated) water (250 ml), artificial fruit juice [21 g/l prepared with (carbonated) water].The comparator C was a mixture of 46.5 g ethanol (in form of vodka 37.5 vol %), caffeine , (carbonated) water (250 ml), artificial fruit juice [21 g/l prepared with (carbonated) water].The comparator D was a mixture of 46.5 g ethanol (in form of vodka 37.5 vol %), Red Bull Energy Drink , artificial fruit juice [21 g/l prepared with (carbonated) water].This was evaluated through a visual analogue scale (VAS) of somatic symptoms was required the night before testing and controlled via questionnaire on test days. No alcohol during a period of at least 72 h prior to each test dose was allowed. On the test days, the consumption of at least two and no more than four caffeine-containing drinks was controlled via questionnaire. On every treatment day, the volunteers were instructed to arrive fasting 15 min before the beginning of the treatment administration, which started around midday. A standard meal of 1,000 kcal was given 45 min before treatment. Sugar-free fluid was allowed until 1 h before treatment, no further fluids were allowed until 2.5 h after dosing. We used a double blind procedure throughout the experiment.Supine and standing vital signs were evaluated before (in triplicate) and 60 and 150 min after the treatments.This was determined by using a breath analyzer before and 15, 30, 60, 90, 120 and 150 min after the treatments. The alcohol dose used aimed for a mean breath alcohol concentration of 0.05 % similar to that of Ferreira et al. .To check for differences between the four treatment groups mixed models were applied to consider the special data structure of the cross-over design. A restricted maximum likelihood (REML) method was used. The primary variables were the symptoms headache, weakness, salivation and motor coordination, as they yielded statistically significant differences in Ferreira’s study. To adjust for multiple comparisons a Bonferroni correction was applied for the four primary variables resulting in a local significance level of 0.05/4 = 0.0125 for each single primary variable.In a first step the data of all four treatment groups were used. As the descriptive plots partially revealed considerable differences between the alcohol groups and the non-alcohol group, a further analysis was performed using only the three treatment groups that included alcohol.In each of the models, the 20 min pre-treatment values of the respective treatment day were included as baseline values. The following measurements at 30, 90 and 120 min post-treatment were treated as autoregressive. We assumed, that due to the long wash-out period between the treatments no carry-over effect could occur, but in order to account for possible habituation effects the number of the visit was included in the model. Therefore, the fixed effects included in the model were baseline, treatment, number of the visit, time of measurement, and the interaction between treatment and time of measurement. A random influence of each patient was included in the model.Mean breath alcohol concentrations at 15, 30, 60, 90, 120 and 150 min after the treatments were 0.059, 0.059, 0.053, 0.047, 0.041 and 0.035 %,respectively; there was no difference within the alcohol groups.The statistical significance of the regression coefficients of the mixed models for all four primary variables is presented in Table For the variables, weakness and motor coordination, a statistically significant difference between all four treatment groups was observed; in neither of these variables a statistically significant influence of the treatment could be revealed in the sub-analysis of the three groups with alcohol. This indicates that differences between the four treatment groups in weakness and motor coordination were mainly driven due to the linear values recorded for the non-alcohol group see Fig. a, b.Fig.The time of measurement was significant for salivation, motor coordination and the three-group analysis of weakness, but no treatment–time interaction could be shown for any of the four primary variables. The number of the visit reflecting treatment order had no significant influence on any of the models.Eleven of the 14 secondary variables showed an uncorrected significance level of less than 0.05 %. Out of these, five revealed significant differences between the four treatment groups when corrected for multiple testing . Ferreira et al. showed a significant difference in the parameters Tiredness, Dizziness*, Alterations in Sight*, Alterations in Walking*, Alterations in Speech* between alcoholic and non-alcoholic drinks. We also found a similar difference between alcoholic and non-alcoholic drinks for these parameters, in four out of the five, even after correction for multiple testing (only Tiredness lost significance after correction for multiple testing).For the other seven parameters, the two studies were not in agreement: regarding the parameters Tremor, Perspiration, Tachycardia, Breathing Difficulty, Agitation*, and Alterations in Hearing Ferreira et al. could not find a significant difference between all groups. In contrast, in our study we found a significant difference between the alcoholic and non-alcoholic drinks, which, however, was lost after correction for multiple testing for all parameters except Agitation.As also demonstrated in Table http://cot.food.gov.uk/pdfs/tox201210.pdf) that the masking effect of energy drinks cannot be confirmed by currently available data.In conclusion, although testing twice the number of participants at the lower dose of alcohol, rendering our design more sensitive to the detection of such effects, this within-subjects study failed to reproduce results from Ferreira’s publication in 2006 with regards to a so-called “masking effect” when combining caffeine or energy drink with alcohol compared to alcohol-only consumption. As we did not perform objective measures in this study, our results do not allow conclusions regarding other parameters such as motor coordination and visual reaction time. These results thus add to other evidence reviewed by the UK Committee on Toxicity (http://

Caesarean section (CS) has short and long-term health effects for both the woman and her baby. One of the greatest contributors to the CS rate is elective repeat CS. Vaginal birth after caesarean (VBAC) is an option for many women; despite this the proportion of women attempting VBAC remains low. Potentially the relationship that women have with their healthcare professional may have a major influence on the uptake of VBAC. Models of service delivery, which enable an individual approach to care, may make a difference to the uptake of VBAC. Midwifery continuity of care could be an effective model to encourage and support women to choose VBAC.A randomised, controlled trial will be undertaken. Eligible pregnant women, whose most recent previous birth was by lower-segment CS, will be randomly allocated 1:1 to an intervention group or control group. The intervention provides midwifery continuity of care to women through pregnancy, labour, birth and early postnatal care. The control group will receive standard hospital care from different midwives through pregnancy, labour, birth and early postnatal care. Both groups will receive an obstetric consultation during pregnancy and at any other time if required. Clinical care will follow the same guidelines in both groups.This study will determine whether midwifery continuity of care influences the decision to attempt a VBAC and impacts on mode of birth, maternal experiences with care and the health of the neonate. Outcomes from this study might influence the way maternity care is provided to this group of women and thus impact on the CS rate. This information will provide high level evidence to policy makers, health service managers and practitioners who are working towards addressing the increased rate of CS.ACTRN12611001214921This trial is registered with the Australian New Zealand Clinical Trials Registry (ANZCTR): The rate of caesarean section (CS) in Australia has increased over the past decade and is now well above many similar countries ,2. One oConcerns about a high CS rate centre around growing evidence of increasing maternal morbidity associated with such operations for women, such as increased blood loss, blood clots, abdominal organ injury, need for hysterectomy and longer hospital stays -6. RepeaAs an alternative, women who have had a previous lower-segment CS, and an uncomplicated pregnancy, can be offered to attempt a vaginal birth after CS (VBAC) . HoweverThe best available international evidence suggests that VBAC does not increase the risk of hysterectomy or maternal mortality . NeonataWhereas no studies have examined the effects of midwifery continuity of care, some research has examined what influences women to choose VBAC. One study from the USA showed that the major influences were the woman’s sense of control in the decision-making process and the clinician’s encouragement of VBAC . WhereasMidwifery continuity of care allows women to develop a relationship with the same caregivers throughout pregnancy, birth, and the postnatal period. Women have a midwife caring for them during labour and birth whom they have met before and feel that they know, and this trusting relationship increases their confidence ,27. WomeMidwifery continuity of care per se has been widely studied. A systematic review in the Cochrane Library examining midwifery continuity of care included 11 trials . Women who had midwife-led models of care were less likely to use regional analgesia or have an instrumental birth , and were more likely not to use intrapartum analgesia/anaesthesia , experience spontaneous vaginal birth , feel in control during labour and childbirth , and initiate breastfeeding . Three tIn preliminary work for this trial, we reviewed the outcomes of a midwifery continuity of care program at one NSW hospital and compared the VBAC rate in the program with the rates in the area health service (AHS) in which the hospital is situated. The rate of attempted VBAC was 62.5% in the midwifery continuity of care program compared with 27% for the AHS and the vaginal birth rate was considerably higher in the program . There was no increase in adverse outcomes for mothers or babies, although the total numbers in this evaluation were small (n = 377) (unpublished data). These data, although from a small number of women, provide some evidence to support the hypothesis to be tested in this trial, that is, that midwifery continuity of care will increase the proportion of women who attempt VBAC, increasing the overall rate of vaginal birth and reducing the CS rate.The study uses a two arm, un-blinded randomised controlled design, to compare the outcomes for women who had midwifery continuity of care compared with those who had standard maternity care.The primary aim is to determine whether midwifery continuity of care for women with a previous CS increases the proportion of women who attempt vaginal birth in their current pregnancy. The primary hypothesis is that women with a previous CS, who are eligible for a vaginal birth and receive midwifery continuity of care, will be 50% more likely to choose to attempt a vaginal birth in their current pregnancy than similar women receiving standard care.The secondary aims are to determine whether midwifery continuity of care increases the proportion of women experiencing a vaginal birth, and affects neonatal health or the emotional outcomes for women; and to explore the differences in women’s experiences of care and the decision making processes between the groups.All eligible women booking maternity care at two study sites in Australia will be invited to participate.Our study of VBAC in NSW showed tThe data informing the sample size calculations are drawn from a published cross-sectional study using population-based data from NSW ,31 and dWomen allocated to the intervention group will receive midwifery continuity of care from a small group of midwives. The midwWomen allocated to the control group will receive the current model of public maternity care at the two study sites. Antenatal care is provided by antenatal staff (midwives and obstetricians). Staff in the Birth Unit provides labour and birth care and midwives in the postnatal ward provide postnatal care. Women are also offered midwifery visits at home following discharge from hospital . All these care providers are different people.● Most recent birth was by lower-segment CS● No more than one previous CS● Considered low risk, other than a history of one previous CS● No other previous uterine incision● No previous uterine rupture● No contraindications for vaginal birth at the time of enrolment● English proficiency (spoken and written)● Public patient● No known preference for a certain model of care, such as: GP-shared care or midwifery continuity of care● Women who reside outside the hospital postnatal home-visiting zone● Women who specifically request an ERCS at booking in● Women with BMI > 35Women telephone the booking office to book for maternity care and receive an appointment for their first/booking-in visit. The women will be initially screened by the booking clerk for eligibility into the trial according to the eligibility criteria. An information pack about the study is posted to all eligible women. At the first/booking-in visit, the research assistant (RA) approaches each eligible woman and asks if she received the information and whether she is interested in participating. If the woman agrees, the consent form is signed and the woman is registered as a trial participant and the remote telephone allocation service at the university is contacted for random allocation.Randomisation will be on a 1:1 basis. Allocation concealment will be assured by using a remote telephone allocation service through the university research department. The RA will telephone the university to provide the woman’s initials, medical record number and date of birth. The clerk at the university campus will allocate women based on a randomization schedule developed independently from the RA. The midwife will be informed of the group to which the woman has been allocated and will receive her study number, which will be recorded in the Trial Register and Log Book. If allocated to standard care, the woman will be advised of her next clinic appointment. If allocated to midwifery continuity of care, she will be advised that the continuity of care midwives will contact her with a suitable appointment time.The majority of clinical data required for the study are routinely collected and available in hospital records. The RA will collect these data and 5% of the records will be double checked by one of the CIs to verify their accuracy and consistency.● Age● Parity● Previous pregnancy outcomes● Socio-economic status ● Past medical, surgical and obstetric risk factors● Complications during pregnancy● Planned mode of birth prior to labour/CS● Syntocinon augmentation● Artificial rupture of membranes● Immersion in water for pain relief● Epidural or spinal anaesthesia● General anaesthetic● Mode of birth● Uterine rupture or scar dehiscence● Major postpartum haemorrhage > 1000 mL and/or requiring operative procedure and/or blood transfusion● Length of hospital stay● Readmission Admission to ICU/HDU● Maternal death (within 42 days)● Apgar score < 7 at 5 min● Admissions to neonatal unit within 48 hours of birth for at least 48 hours with feeding difficulties or respiratory distress● Readmission to hospital● Breastfeeding within 1 hour of birth● Skin to skin contact within one hour of birth● Mode of feeding at 6 weeks● Stillbirth and neonatal death (within first 28 days)Two questionnaires have been developed for administration at 36 weeks gestation (during pregnancy) and at 6–8 weeks post-partum (after the birth). These will enable women to report on their experiences with the model of care, their planned mode of birth (VBAC or CS) and the factors influencing the mode of birth choice. Distress and anxiety will be assessed using the Depression Anxiety Stress Scale (DASS 21) and EdinThe postnatal questionnaire includes questions about their labour and birth experiences and satisfaction with their decisions. With permission, we have adapted questions about the experience of care from surveys used to assess satisfaction in the COSMOS Study which examined the impact of caseload midwifery care on low risk women in Melbourne, Australia .Both questionnaires were piloted with pregnant and postpartum women. Completion of each took approximately 20 minutes and they were reported to be understandable to the average adult reader.The questionnaires have been professionally designed and printed. The women will be posted the questionnaires with a self-addressed envelope with a reply-paid stamp. The RA will contact participants to inform them that the questionnaire has been posted. The questionnaires will be linked to the participant by attaching the study code (documented in the log book) to the inside of the front cover of each booklet.2 tests and continuous data will be analysed with t-tests . Ranked or Likert-scale data will be analysed using cumulative odds ratios. Logistic regression and multiple linear regressions will be used if necessary to adjust for any other confounding variables.The analysis will be by ‘intention to treat’, including withdrawals and losses to follow-up. Randomisation should ensure that the groups are similar or equivalent in their baseline characteristics; additional multivariate analysis will be used if baseline differences are noted between the two groups. The relative risks of the primary outcomes will be calculated. Secondary outcome measures of categorical data will be analysed with χIt is not possible to blind participants to the model of care they receive, but outcome assessments will be blinded.A multidisciplinary data-monitoring group has appointed at the outset of the study to monitor the safety of the trial particularly examining differences between the groups that may be larger than expected and assessing any serious adverse effects that may occur. After 50% of the women have enrolled, a difference of at least three standard deviations in the interim analysis of a major endpoint will be needed to justify stopping the trial.All paperwork, documentation, internet and audiotaped data will be treated with confidentiality. The log books required on–site are kept in the office of the booking clerk. This office is staffed during business hours, and is only used by one staff member. The door is locked when the room is empty. Hard copies of client details and study matters are kept in a filing cabinet within the locked area at the university.Human Research Ethics Committee (HREC) approval for all current sites has been provided by the North Sydney Central Coast HREC, according to the single site HREC approval for multicentre clinical trials guidelines. Research governance approval has been provided by the Research Governance Office at each site.A Data and Adverse Event Monitoring Committee will assess the safety and serious adverse events and will be blinded to the assigned group. Serious adverse events will be given a Severity Assessment Code consistent with incident monitoring in NSW and reviThe CIs may terminate this study prematurely, either in its entirety or either of the sites, for reasonable causes . If this occurs, the site investigator will provide written notice to the CIs of the intended termination.One of the greatest contributors to the overall CS rate is women having elective repeat CS. In this study, we will test the effects of midwifery continuity of care (where women have the same midwives through pregnancy and during labour and birth) on rates of vaginal birth and other outcomes in women with a prior CS. This will be the first Australian and international randomised controlled trial of midwifery continuity of care that focuses on women who have had a previous CS. High level evidence on midwifery continuity of care shows that these models increase women’s sense of control over decision making hence thPregnancy, birthing and early parenthood are profoundly important life experiences that directly affect almost 300,000 families in Australia each year. An increasing CS rate is of national and international concern. The Editor of the prestigious journal Birth wrote in 2007 “reducing the caesarean birth rate worldwide is a complex and difficult task that must be tackled on many fronts using multiple strategies” . A key fThis will be the first national and international trial that has tested midwifery continuity of care as an intervention to increase vaginal birth rates in women who have had a previous CS. Although a number of studies have focused on interventions that improve the rates of attempted and/or successful VBAC, they have not been able to demonstrate their effectiveness. This study will provide this evidence that can be used to improve maternal outcomes while maintaining the safety of Australian mothers and babies.The authors declare they have no competing interests.CH, MF and DD hypothesized the link between midwifery continuity of care and VBAC uptake and designed the randomised controlled trial and contributed to drafts of the paper. KB and JB project manage the trial and contributed to the drafts of the paper. JA provided input into the design of the qualitative aspects of the trial and contributed to drafts of the paper. AP provided input into the design of the trial and contributed to drafts of the paper. All authors read and approved the final manuscript.Caroline Homer, Maralyn Foureur, Deborah Davis, Jon Adams, Alison Porteous.Christine Roberts, Alison Shorten, Jennifer Fenwick.Caroline Homer (Chair), Maralyn Foureur, Jenny Bell, Tracey Worrel, Lyndall Mollart, Kylie Normandale, Marian Bullard, Alison Porteous, Jane Knox, Bernadette Leiser, Mutayyab Shah, Angela Monger, Julie-Anne Olaisen.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2393/13/140/prepub

Mecodema. Constrained stratigraphic information (emergence of the Chatham Islands) and a substitution rate for Coleoptera were separately used to calibrate Bayesian relaxed molecular clock date estimates for diversification of Mecodema. The inferred timings indicate radiation of these beetles no earlier than the mid-Miocene with most divergences being younger, dating to the Plio-Pleistocene. A shallow age for the radiation along with a complex spatial distribution of these taxa involving many instances of sympatry implicates recent ecological speciation rather than a simplistic allopatric model. This emphasises the youthful and dynamic nature of New Zealand evolution that will be further elucidated with detailed ecological and population genetic analyses.New Zealand biodiversity has often been viewed as Gondwanan in origin and age, but it is increasingly apparent from molecular studies that diversification, and in many cases origination of lineages, postdate the break-up of Gondwanaland. Relatively few studies of New Zealand animal species radiations have as yet been reported, and here we consider the species-rich genus of carabid beetles, Sphenodon), a supposed Gondwanan element and recent colonists Biologists have long been perplexed with New Zealand's biotic composition which cannot be classed as typically oceanic or continental An initial emphasis by phylogeographers on the origin of New Zealand lineages (stem groups) tended to undervalue the greater evolutionary significance of crown groups in the assembly of the New Zealand biota. Increasingly, molecular studies are revealing the story of diversification in a wide variety of New Zealand animals and plants carabid beetles (tribe Broscini). This endemic genus of large, flightless beetles constitutes a prominent species radiation in New Zealand and presents a good opportunity to explore species level diversification. We utilise the fact that the genus is represented on the Chatham Islands, which are located approximately 850 km east of the South Island, New Zealand in the Pacific Ocean. Geological evidence for the formation of this archipelago within the last 4 Myr is compelling Mecodema. Furthermore a substitution rate for Coleoptera In this study we examine the phylogenetic relationships and timing of radiation of Mecodema belongs to the tribe Broscini (Carabidae). Broscini has a worldwide distribution but has its main diversity in the southern hemisphere (subfamily Nothobroscinae) http://www.landcareresearch.co.nz/research/biosystematics/invertebrates/carabid/carabidlist) Mecodema is especially species-rich. Adult Mecodema beetles are relatively slow-moving, nocturnal, flightless (with fused elytra), generally active throughout the year, and usually scarce Mecodema is a diverse genus with species distributed throughout the New Zealand mainland from alpine to coastal habitats. In contrast, there is a single species on the Chatham Islands. The same species occurs in southeast New Zealand near Dunedin. Although M. alternans may be better treated as a species complex The genus Mecodema representing 35 described species, and 4 undescribed species of the 66 recognized Mecodema species (after http://www.landcareresearch.co.nz/research/biosystematics/invertebrates/carabid/carabidlist), see Oregus , Diglymma , Brullea antarctica , Metaglymma , and Bountya insularis ; plus one representative of Broscini from Australia, Chylnus ater are documented as being present in both main islands of New Zealand In total our sampling comprised 113 specimens, with 88 s, 1868) . As many Zealand . MecodemFresh specimens were obtained in accordance with Department of Conservation collection permits and preserved in 95% ethanol after hand collection in the field. These specimens are in interim storage with unique voucher numbers as part of the Phoenix Collection, Massey University, Palmerston North. Additional taxa were loaned from relevant collections fragment was amplified for 24 specimens in this study and the remaining 89 COI sequences were drawn from GenBank (JN JN409817–JN409904), see Mecodema-specific COI primers were designed using the program Oligo4 to generate a series of short (∼130–200 bp) overlapping fragments and aligned using Se-Al v2.0a11 Polymerase chain reactions were performed in 10 µl volumes and the amplified products then checked on a 1% agarose gel and purified using SAP/EXO1 digest (USB Corporation). Purified PCR products were sequenced using standard protocols for the ABI Prism BigDye Terminator Ready Reaction Kit and run on an ABI Prism 377 automated sequencer (Applied Biosystems). Sequence identity was confirmed by comparison with published data, checked for nucleotide ambiguities in Sequencher 4.2 as it was not possible to gain sequences for outgroup taxa outside of New Zealand for all the employed species and sequence availability in GenBank within Broscini was also very poor. Although Oregus and Diglymma represent two of the New Zealand Nothobroscina genera considered closest to MecodemaMetaglymma and Brullea, exist. MrBayes 3.1.2 To test whether Mecodema group in New Zealand we employed all four genes with a subset of 50 taxa (44 ingroup and 6 outgroup samples). The outgroup sampling was chosen after consideration of the results from the prior outgroup analyses. All taxa with data missing for no more than one of four genes were included in the phylogenetic analysis . Lower values for 16S compared to COI and COII reflect the comparatively low proportion of variable sites in this gene (16.9%).Three widely used mitochondrial gene regions were employed to gauge the scale of genetic diversity among the Mecodema and 6 outgroup taxa , suggesting their concatenation was appropriate. The GTR+I+Γ model of nucleotide substitution was identified as the best fitting model by the hLRT and the AIC as implemented in Modeltest 3.5 The alignment of data from four gene regions comprising 50 specimens sampled across New Zealand was 789 bp long and had an overall A-T bias of 73%. ma clade . The othadiation . The relMecodema radiation. For the given dataset of 113 taxa the ROOT was estimated at a maximum age of 13.42 Myr with the stratigraphic calibration of 4 Myr. However, using the rate of molecular evolution proposed from independent data for COI in Coleoptera Accommodating a relaxed molecular clock approach we calculated divergence times by first using BEAST with a stratigraphic calibration and set priors for the NODE of 4 Myr , followed by use of a substitution rate estimated for COI in Coleoptera Mecodema radiation appeared to be geologically young, with estimates of many clade origins less than 5 Myr. There was little spatial correlation within the COI dataset even at a broad scale such as between the two islands. Instead we noted multiple instances of North Island/South Island (NI/SI) splits within the phylogram were younger than 5 Myr. The results estimated based on the substitution rate of Coleoptera Mecodema clades within the last 1 Myr ), implying additional niche competition Mecodema might well be the product of intense selection yielding adaptive radiation. A striking example is that of Metaglymma , which by virtue of its distinct morphology was classified in a separate genus, but is probably better treated as an ecologically specialized Mecodema. Metaglymma may, along with the coastal monotypic Brullea, be included in Mecodema following further morphological and genetic investigation. The close relationship between these three genera, compared to the two other mainland New Zealand outgroup genera Diglymma and Oregus, is consistent with the degree of morphological differences among them In this study we explored the pattern and depth of species diversity in the beetle genus Molecular dating with appropriate calibrations provides an empirical approach to estimate timing of past speciation events and phylogeography Substitution rates of mitochondrial genes differ greatly among genes and lineages and therefore the use of a general invertebrate divergence rates would be inappropriate for this study. Bayesian relaxed clock methods on the other hand allow rates to vary among lineages although accuracy might still be influenced greatly by the setting of priors. In this study the inferred mitochondrial divergence times based on the fast COI rate obtained for Coleoptera Mecodema crown group is unlikely to have started before the mid to late Miocene, with most lineage formation most likely in the Pliocene and Pleistocene. This relatively shallow radiation is therefore consistent with the timing of radiations inferred for other New Zealand invertebrates . The inference from this is that net diversification (comprising species origination and species extinction) within this genus has been strongly influenced by recent geophysical processes, such as mountain building in the Pliocene, habitat shifting and land formation in the Pleistocene. On a broad scale, and considering the relationships within inferred . All of Mecodema, Metaglymma and the Diglymma/Oregus sister clade are consistent with the notion that colonisation has for the most part been northwards.The splits between sister taxa currently occupying either North or South Island range in estimated age using stratigraphy from 6.39 Myr to 1.60 Myr . This suM. costellum, M. crenicolle, M. strictum in north east South Island). Some localised species might have arisen via allopatry on past islands, for example M. n. sp. in eastern central North Island . The existence of these indicates speciation since land became available and we note a mismatch between estimated lineage age using Chatham stratigraphy and estimates of land age. For example the split within North Island and South Island M. crenicolle/crenaticolle complex is estimated at 2.87 Myr. This predates evidence for land in southern North Island by more than 1 Myr, and predates by at least 1.5 Myr the most substantial period of land connection between North Island and South Island in the late Pleistocene. This type of mismatch between dates derived from genetics and those from geology might result from lineages evolving before the extant species they yielded arrived where they occur today as species ranges do change over time. In North Island, New Zealand, molecular studies showing this type of range expansion include tree weta Mecodema, range shift after lineage origination would require lineage splitting, persistence of two lineages at a source location, expansion of at least one lineage and extinction of that lineage at the source. An alternative and simpler explanation is that the molecular rates inferred for these data by Chatham stratigraphic calibration are underestimated, which has thus yielded over estimation of lineage age. Such an inference is supported by the much younger times yielded by calibration with the Coleoptera COI rate The current sampling is not complete in terms of living species or populations. Additional sampling is most likely to reduce the inferred age of formation of species lineages (by dividing existing branches), which could increase the number of inferred dispersal events. Alternatively, detailed population sampling could indicate taxonomic revision is required, and this might lead to slightly older inferred ages of named species. Nevertheless, a number of observations can be made: Geographically proximate species are rarely sister taxa (e.g. Mecodema alternans lineage arrived there. In all likelihood the age estimates from stratigraphic calibration can be considered maximal. Using this approach, we can infer a rate of molecular evolution for Mecodema COI of 0.0059 subst/site/myrs/l Mecodema radiation is supported as even younger than we are currently able to demonstrate, with a larger proportion of speciation since the late Pliocene.It is not possible to determine using the present data when, after emergence of the Chatham Islands, the Mecodema in New Zealand, the more important evolutionary feature of this beetle, with respect to the assembly of the native biota, is diversification of the crown group. Evidently, a few million years have been sufficient for the evolution of a complex ecosystem comprising not simply allopatric subunits but an array of sympatric species with distinct ecologies; for this to happen a long geological history was not required. While it has been predicted that intense phylogeographic structuring and speciation dating to the Plio-Pleistocene might be observed more frequently in naturally subdivided alpine conditions than in lowland forests Mecodema speciation appears to provide an example where diversification has proceeded across space and into diverse habitats, from coast to above the tree line. Future work on the detailed ecology of these species will be instrumental in demonstrating the population genetic and ecological mechanisms of diversification (e.g. The fact that this genus and other large flightless insects are present on the Chatham Islands ion e.g. .Mecodema is one taxon group that will provide helpful insight, and it is already evident that Mecodema is an impressive example of recent species radiation in the New Zealand fauna. In recent years, synthesis of phylogenetic, ecological and taxonomic evidence has indicated that the biology of New Zealand is primarily the story of recent adaptation and speciation Increasingly, the fields of species phylogenetics and population phylogeography are merging as it becomes easier to generate appropriate DNA data, and the focus in taxonomy is shifted towards an evolutionary paradigm (e.g.

Generalized estimating equation analysis revealed that compared to group 1, hepatitis B virus (HBV) DNA levels were 1.203 and 0.443 Log10 IU/mL higher in groups 2 and 3, respectively. Overall, a significant reduction in viral load (−0.060 Log10 IU/mL) was observed for each additional month of treatment. Adefovir + telbivudine treatment resulted in a significant reduction in HBV DNA levels. Moreover, telbivudine treatment resulted in a significant reduction in viral load (−0.050 Log10 IU/mL) compared to lamivudine treatment after the emergence of lamivudine resistance.We evaluated second-line salvage therapy with adefovir + telbivudine (group 1), adefovir followed by adefovir + telbivudine (group 2), or lamivudine + adefovir followed by adefovir + telbivudine (group 3) in hepatitis B patients with an inadequate virologic response to lamivudine treatment. Simple linear regression analysis showed that for each additional month of treatment, the most significant reduction in viral load occurred in group 1 (HBV DNA [LogThe online version of this article (doi:10.1007/s00705-013-1786-4) contains supplementary material, which is available to authorized users. Chronic hepatitis B virus (HBV) infection is a cause of significant mortality and morbidity worldwide. According to a WHO report published in 2008, two billion people were infected with the virus, and 350 million of these suffered from chronic HBV infection . HBV DNALamivudine (LAM) is often considered to be the drug of choice for HBV patients due to its antiviral potency. However, a major disadvantage associated with conventional LAM monotherapy is the development of resistance , 5. The LAM-induced resistance results from mutations in the HBV Pol gene, primarily rtM204I and rtM204V. Secondary mutations include rtL180M, and rtV173L . The addThe main objective of this prospective study was to determine the efficacy of a combination treatment of LdT and ADV in patients with LAM-resistant HBV compared with either ADV monotherapy or LAM and ADV combination therapy. In addition, the ability of LdT to prevent ADV resistance in patients treated with a combination of both drugs was determined. HBV DNA levels were used for comparisons, as they are fairly accurate indicators of the extent of infection. With the results obtained from this study, we aimed to demonstrate that a combination of LdT and ADV treatment as opposed to the conventional therapy of ADV alone or LAM and ADV combination therapy for patients with LAM-resistant infections may be a better therapeutic option.10 after initial suppression of HBV DNA) during LAM treatment. The study subjects with LAM resistance were divided into three groups according to our inclusion criteria rather than using a randomized method. The study subjects with LAM-resistant HBV were divided into three groups. Group 1 included patients receiving ADV and LdT combination therapy after LAM resistance (n=11) after the study initiated in June 2007. These patients did not have LAM resistance until the initiation of this study. Group 2 included patients who received ADV monotherapy for LAM resistance before this study. They then received LdT and adefovir combination therapy after this study was initiated if they were found to show an inadequate response to ADV monotherapy (HBV DNA ≥ 200 IU/mL after 12 months of therapy) (n=9). Group 3 included patients who received a combination of LAM and ADV for LAM resistance before this study was initiated and then switched to LdT and ADV combination therapy after this study was initiated due to an inadequate virological response (HBV DNA ≥ 200 IU/mL after 6 months of therapy) (n=10). The drug information is a follows: telbivudine (Novartis Pharma Stein AG), 600 mg once daily; lamivudine (GlaxoSmithKline), 100 mg once daily; and adefovir (GlaxoSmithKline), 10 mg once daily.Patients were recruited from the Chang Gung Memorial Hospital, Kaohsiung, Taiwan, in June 2007. The research was conducted in accordance with the Declaration of Helsinki and institutional standards and was granted ethical approval by the institute review board from Chang Gung Memorial Hospital (No. 100-2658B). Written informed consent for participation in the study was obtained from participants. All patients were subjected to second-line salvage therapy following virologic resistance to initial LAM therapy. All patients had virologic breakthrough was checked every six months for HBeAg-negative patients and every three months for HBeAg-positive patients. Serial HBV DNA levels were assessed at baseline (before either mono or combination ADV treatment) and every six months after ADV treatment. The YMDD motif region in the DNA polymerase gene was sequenced at baseline, at the time of biochemical and/or virologic breakthrough, or every six months. The end point of study was when HBV DNA became undetectable or when new resistance emerged after LdT plus adefovir therapy. The end date of the follow-up was 30 June 2012.The presence of hepatitis B surface antigen (HBsAg), HBeAg, and anti-HCV (hepatitis C virus) was assessed using commercial assay kits . All of the patients were anti-HCV negative. The HBV DNA levels were quantified using a Cobas Amplicor HBV monitor kit with a lower detection limit of 200 copies/mL. Dilution was performed if HBV DNA levels exceeded 106 copies/mL. Serum HBeAg levels were measured using a microparticle enzyme immunoassay . The AxSYM assay results were based on the ratio of the sample (S) to the cutoff (Co) for each sample and control. HBeAg-positive and anti-HBe-positive findings were defined using S/Co ratios, in accordance with the manufacturer’s instructions (Abbott). Polymerase chain reaction and sequencing the HBV DNA polymerase gene mutations were done using nested PCR and direct sequencing as described previously . The senData were analyzed using simple regression analysis with the HBV DNA level as the dependent variable and treatment duration as the independent variable. Subsequently, semi-parametric generalized estimating equation (GEE) analysis was performed in order to determine the factors influencing the outcome of combination therapy as well as the outcomes of individual treatments and their duration. The HBV DNA level was the dependent variable, while the combination of drugs, usage of LdT, and treatment duration were independent variables. Pre-treatment HBV DNA levels were used as adjustment factors. A p-value of 0.05 (two-tailed) was considered statistically significant.The generalized estimating equation is used to estimate the parameters of a generalized linear model with a possible unknown correlation between outcomes, especially for repeated measurements , 14. In The final analyses were performed on data collected from 30 patients . The mean ages of the patients were 49, 57, and 43 years in groups 1, 2, and 3, respectively. There were 6 males and 5 females in group 1, 6 males and 3 females in group 2, and 6 males and 4 females in group 3. There was no significant age difference among three groups. The average duration of first-line LAM therapy is reported in Table The HBV DNA levels of 30 chronic hepatitis B patients were analyzed. Before the second-line salvage therapy, all of the patients had received lamivudine therapy, and resistance and virologic breakthrough had occurred. The average HBV DNA concentration was 5.40 (Log10 IU/ml) in group 1, 6.72 (Log10 IU/ml) in group 2, and 6.26 (Log10 IU/ml) in group 3. The durations of prior LAM treatment were not significantly different, as indicated.To evaluate the correlation of different treatments with reductions in HBV DNA levels, we used HBV DNA Log10 IU/ml) as the dependent variable and treatment duration as the independent variable. Table 0 IU/ml a10 HBV DNA level for group 2 and group 3 before LdT treatment is 3.58 (SD=1.41), and that is after 1.98 (SD=1.14) LdT treatment . This means the HBV DNA levels were reduced after combination treatment with LdT. After taking into account the dependence of repeated observation, the average reduction of log10 HBV DNA levels is -1.18 .To evaluate the correlation of different treatments with reductions in HBV DNA levels using more-accurate adjustments, we performed GEE analysis. The dependent variable was the HBV DNA level (Log10 IU/ml), and the independent variables were (1) combination of drugs, (2) usage of LdT, and 3) treatment duration for each drug. The adjustment factor was HBV DNA (Log10 IU/ml) before ADV treatment. Overall, a reduction of 0.06 (Log10 IU/ml) in HBV DNA concentration , and one patient in group 2 had the rtA181V and rtN236T mutations before LdT add-on therapy (due to ADV monotherapy) (Table Twenty-four patients (80 %) with raised baseline levels of ALT showed ALT normalization during treatment, at rates of 29/30 (96 %), 100 %, and 100 % after 1, 2, and 3 years, respectively. Among the 6 patients with normal ALT levels at baseline, none had an elevated ALT level during treatment. Overall, one patient in Group 2 had a virologic breakthrough during ADV monotherapy. Six of 15 patients (40 %) lost HBeAg, and 3 (20 %) seroconverted to antibody to hepatitis B e antigen after ADV-based treatment. None of these patients cleared serum hepatitis B surface antigen with antiviral therapy.No significant adverse events were reported during the course of the study. Most patients had normal renal function during treatment. ALT and creatinine kinase levels remained under control in all patients.The selection of an appropriate treatment strategy is critical for patients with chronic hepatitis B. The management of patients with HBV infection should involve treatment that consistently reduces viral load and prevents the development of mutations that result in drug resistance. Long-term LAM monotherapy is known to favor an increase in mutations by 20 % within the first year and by 70 % in the first five years of therapy , 15–17. Both LdT and LAM are L-nucleoside analogues. Global trials of LdT have demonstrated a better virologic suppression, better HBeAg loss and seroconversion, less treatment failure, and less viral resistance and virologic breakthrough than is observed with LAM after 2 years of therapy , 11. LdTThis prospective study was conducted to determine the efficacy of combination therapy with ADV and LdT as second-line salvage therapy for patients with LAM-resistant HBV infections. A positive correlation exists between the HBV DNA levels and the cumulative occurrence of hepatocellular carcinoma . Hence, Other antivirals such as entecavir carry the risk of inducing secondary mutations when administered in combination with ADV as long-term therapy in patients with LAM-resistant strains. However, there was no evidence of new mutations leading to ADV resistance following administration of ADV and LdT as combination treatment in this study. This result could be of considerable consequence for HBV therapy, as mutated strains replicate more aggressively in the presence of antivirals as a part of their survival and escape strategy , 32.The main objective of this prospective study was to determine the efficacy of a combination treatment of LdT and ADV in patients with LAM-resistant HBV infections compared with either ADV monotherapy or LAM and ADV combination therapy. We used a prospective repeated measurement design to evaluate the efficacy of HBV viral reduction. Patients were followed up every month with a clinical assessment as well as liver and renal biochemical tests. In addition, hepatitis B markers were checked every six or three months for HBeAg-negative and positive patients, respectively. Importantly, since the HBV DNA levels change over time and the two measurements of HBV DNA levels in the same patient are interdependent, repeated measures analysis was performed using a generalized estimating equations (GEEs) method to adjust for this. Tables , 4, 5. TIn conclusion, in patients with LAM-resistant HBV infections, combined ADV and LdT therapy reduced the risk of genotypic resistance to ADV, preventing virologic and clinical breakthrough during a 2- to 3-year period. Although the patient numbers are relatively small in this study, the data provide vital insights into the administration of LdT in countering the drawbacks of existing HBV treatments. These results suggest a novel treatment approach that warrants further confirmatory analysis in a randomized controlled trial.Supplementary material 1 (DOCX 86 kb)Below is the link to the electronic supplementary material.

Arabidopsis thaliana 392 gene models were predicted to be peroxisome-targeted. The predictions were extensively tested in vivo, resulting in a high experimental verification rate of Arabidopsis proteins previously not known to be peroxisomal.High-accuracy prediction tools are essential in the post-genomic era to define organellar proteomes in their full complexity. We recently applied a discriminative machine learning approach to predict plant proteins carrying peroxisome targeting signals (PTS) type 1 from genome sequences. For in vivo subcellular targeting analysis, three novel PTS1 tripeptides and two novel tripeptide residues (Q at position −3 and D at pos. -2) were identified. To understand why, among many Arabidopsis proteins carrying the same C-terminal tripeptides, these proteins were specifically predicted as peroxisomal, the residues upstream of the PTS1 tripeptide were computationally permuted and the changes in prediction scores were analyzed. The newly identified Arabidopsis proteins were found to contain four to five amino acid residues of high predicted targeting enhancing properties at position −4 to −12 in front of the non-canonical PTS1 tripeptide. The identity of the predicted targeting enhancing residues was unexpectedly diverse, comprising besides basic residues also proline, hydroxylated , hydrophobic , and even acidic residues.In this study, we experimentally validated the predictions in greater depth by focusing on the most challenging Arabidopsis proteins with unknown non-canonical PTS1 tripeptides and prediction scores close to the threshold. By Our computational and experimental analyses demonstrate that the plant PTS1 tripeptide motif is more diverse than previously thought, including an increasing number of non-canonical sequences and allowed residues. Specific targeting enhancing elements can be predicted for particular sequences of interest and are far more diverse in amino acid composition and positioning than previously assumed. Machine learning methods become indispensable to predict which specific proteins, among numerous candidate proteins carrying the same non-canonical PTS1 tripeptide, contain sufficient enhancer elements in terms of number, positioning and total strength to cause peroxisome targeting. Revealing the subcellular localization of unknown proteins is of major importance for inferring protein function. Major progress has been made in the past few years in experimental proteomics technology. As a result, many novel organellar proteins have been identified and their physiological functions have been defined at the molecular level. Despite this success, these experimental methods are limited in protein identification capabilities by several parameters, for instance, by technological sensitivity and organelle purity, and to major plant tissues and organs. This holds true particularly for small and fragile organelles such as peroxisomes that can only be isolated in sufficient purity and quantity from a few plant species, generally only from one tissue type per organism and only from organisms raised under optimal growth conditions. As a result, most low-abundance proteins of peroxisomes have remained unidentified to date. Complementary to experimental proteome research, protein targeting prediction from genome sequences has emerged as a central and essential tool in the post-genomic era to define organellar proteomes and to understand metabolic and regulatory networks -4.Peroxisomes are small, ubiquitous eukaryotic organelles that mediate a wide range of oxidative metabolic activities. Classical physiological functions of plant peroxisomes are lipid metabolism, photorespiration, and hormone biosynthesis . AddiSoluble matrix proteins of peroxisomes are imported directly from the cytosol . Apart fArabidopsis leaf peroxisomes and identified more than 90 putative novel peroxisomal proteins, including many long-awaited low-abundance and regulatory proteins . For the QRL > sequence, for instance, this analysis shows that four residues are close to prediction score maximum , indicating that these four residues contribute significantly to peroxisome targeting by the weak non-canonical PTS1 tripeptide QRL>. By contrast, R (pos. -9), even though also a basic residue and principally implicated in serving as a targeting enhancing element, is not predicted to be important for peroxisome targeting of the QRL > sequence.To quantify which upstream positions had been most optimized in terms of predicted targeting enhancing elements in the three Arabidopsis proteins of interest, we expressed the PWM prediction score s of a mutated residue r at position sLikewise, for the SQM > sequence, five residues are predicted to contribute most to peroxisome targeting, primarily S (pos. -6), E (pos. -7), and Q (pos. -8) followed by N (pos. -10), and T (pos. -12). For the SDL > sequence, predominantly four residues are predicted to enhance peroxisome targeting, with two optimal residues , followed by A (pos. -10) and S (pos. -11). Interestingly, the two proline residues at pos. -6 and −8 are predicted to enhance peroxisome targeting to a considerably lower extent as compared to the neighboring P (pos. -7).In summary, these permutation analyses of specific single Arabidopsis proteins of interest carrying functional non-canonical PTS1 domains demonstrate that (i) four to five residues positioned between pos. -4 to −12 appear to have been optimized to enable peroxisome targeting, (ii) their exact positioning appears flexible, and (iii) not only basic residues and proline, but also hydroxylated , hydrophobic , and even acidic residues are predicted to be able to enhance peroxisome targeting. Taken together, the experimental and computational data demonstrate that the plant PTS1 motif is more relaxed and that targeting enhancing elements are more diverse and complex than previously assumed. The models allow identification of predicted targeting enhancing and inhibitory elements for specific sequences of interest and their optimization by site-directed mutagenesis.in vivo analyses [RKNMSLH GETFPQCYD][LMIVYF]>), leading to twelve (pos. -3), 16 (pos. -2), and six (pos. -1) allowed aa residues in plant PTS1 tripeptides , a GTP-binding protein and paralog of RDH3 The functional PTS1 domain terminating with SDL > belongs to the cytosolic Ser/Thr protein kinase CONSTITUTIVE TRIPLE RESPONSE 1 , which is an important negative regulator of the ethylene signal transduction pathway regulating plant growth and development was one of the few residues that could also not be confirmed for one positive example sequence [When the full-length cDNA of HSP70T-2 (RKM>) was cloned to the C-terminal end of the reporter protein, the reporter fusion remained cytosolic as well (data not shown). Alternative expression systems including stable Arabidopsis lines might be needed to conclusively investigate whether the two predicted proteins are cytosolic sequence . It is iOur PWM algorithm combines the C-terminal PTS1 tripeptide and the upstream region (up to 12-aa residues) into a single prediction model. Peroxisome targeting by weak non-canonical PTS1s essentially depends on the presence of targeting enhancing elements in the upstream region. These elements, however, had only been vaguely defined until now. It has been reported for a few sequences that basic residues enhance peroxisome targeting, primarily if located at pos. -4 . Except Our computational and experimental analyses demonstrate that the plant PTS1 tripeptide motif is more diverse than previously thought and includes many non-canonical sequences. Specific targeting enhancing elements can be predicted for particular sequences of interest and are far more diverse in aa identity and positioning than previously assumed. Machine learning methods become indispensable to predict which proteins, among proteins carrying the same PTS1 tripeptide, contain sufficient enhancer elements for peroxisome targeting.For validation of the PTS1 domains that were predicted by the PWM model, the C-terminal 10 residues of Arabidopsis cDNAs were fused to the C terminus of EYFP by PCR using an extended reverse primer and DsRed . The images were captured using a Hamamatsu Orca ER 1394 cooled CCD camera. Standard image acquisition and analysis was performed using Volocity II software (Improvision) and Photoshop.In order to analyze the influence of single aa point mutations on the peroxisome targeting prediction of a sequence, we generated all possible sequences of length 14 by replacing one single residue at a particular position within the 11-aa upstream region of the PTS1 tripeptide by each of the 19 other aa. For the resulting 11 × 19 = 209 permuted sequences we evaluated the prediction score using the PWM prediction model of size 14 described in . The disThe absolute optimization potential of a particular position, i.e. the possibility to enhance peroxisome targeting by a directed residue mutation, is calculated by subtracting the score of the original sequence from that of the maximum position-specific permutation score. The relative optimization potential can then be expressed by dividing the absolute potential by the score range associated with a position. Finally, the total optimization potential associated with a sequence corresponds to the sum of position-specific absolute potentials.The authors declare no competing interests.in vivo subcellular targeting analysis of four and one reporter fusion construct, respectively. TL performed the permutation analysis. SR selected the sequences for experimental analysis, coordinated the project, and wrote the manuscript. All authors read and approved the final manuscript.GC and ARAK carried out subcloning and General PWM score matrix.Click here for fileOligonucleotide primers used for cDNA subcloning. The reverse primers are sorted alphabetically according to the construct name. The XbaI sites in the reverse primers are underlined. One forward primer was used for EYFP amplification and introduced a 5’-NcoI site into the PCR products (5’-AAGTCCATG GTGAGCAAGGGCGAGGA-3’). (DOC 58 kb)Click here for file

Highly emotional events in daily life can be preserved in memory and such memory is generally referred to as emotional memory. Some reports have demonstrated that emotional memory is also found in patients with Alzheimer's disease (AD). However, to our knowledge, there have been no reports about how long memory retention for emotional events can continue in patients with AD. In this paper, we present two patients with AD who lost an immediate family member during followup and retained the memory over a long period despite progression of the AD. The study of emotional memory in patients with Alzheimer's disease (AD) takes two general paths. The first involves the use of photographs, words, and stories to investigate delayed recognition memory for emotional stimuli in an experimental setting. Several such studies have found emotional enhancement effects in AD –3, but tIn this paper, we present two patients with AD who lost an immediate family member during followup and retained memory of the event over a long period despite progression of the AD. Both patients' families provided verbal informed consent to publish the cases, with due consideration given to protecting the patients' identities.Case 1 was a 75-year-old woman who visited our hospital with her son due to her insistence that her bag had been stolen, but for around two years she had often misplaced her bag or purse. She had no history of psychiatric disorders.At the initial visit, no abnormal findings were found on routine blood tests, hematochemistry, or electroencephalography. Magnetic resonance imaging (MRI) of the brain showed no cerebrovascular damage, organic change, or striking atrophy. Her mini-mental state examination (MMSE) score waCase 2 was a 65-year-old woman who visited our hospital with her husband because she had developed feelings of anxiety and sleep disturbance after visiting her mother in hospital. She had become unable to cook, make telephone calls, and shop without assistance for two years. She had no history of psychiatric disorders.At the initial visit, there were no abnormal findings on routine blood tests or hematochemistry. Brain MRI showed no cerebrovascular damage, organic change, or striking atrophy. Her MMSE score was 18 . We gave a diagnosis of AD, FAST stage 4 (mild dementia). She was given donepezil 5 mg/day and returned for follow-up visits with her husband around once a month. Feelings of anxiety and sleep disturbance showed improvement at the two-month follow-up visit.123I-IMP brain single photon emission computed tomography showed symmetrical decreased cerebral blood flow in bilateral temporal and parietal lobes. She was judged to be at FAST stage 6.4 and donepezil was increased to 10 mg/day. Five years after the first visit, she often experienced nocturnal delirium after nontypical events such as dental treatment. Four months later (64 months after first visit), she was admitted to a special nursing home for the elderly. Ten days before admission, her MMSE score was 5 and she verbally expressed the same feeling as when her mother had died.Twenty months after the first visit, her mother died. Eighteen days later, she said “I miss my mother. I want someone to be around me.” Like Case 1, she could not accurately remember factual knowledge about the funeral and Buddhist services she attended. Her diagnosis was FAST stage 4 (mild dementia) at this time. Three years after the first visit, she very often forgot to turn off taps and electrical equipment, and medication noncompliance was suspected. Six months later, brain MRI showed no cerebrovascular damage or organic change but did show enlargement of both lateral ventricles. In the two cases presented, we noted four interesting findings. First, emotional memory was found to be intact at FAST stages 4 (mild) and 5 (moderate) in our two patients with AD. They expressed feelings of desolation and loneliness at 20 days and 18 days, respectively, after their immediate family member had passed away even though they often forgot notable life events that had taken place just a few days earlier. In general, AD is a slowly progressive disease caused by atrophy of the medial temporal lobe including the amygdala, which is thought to play a crucial role in emotional memory [Second, marked emotional arousal was effective for retaining memory of their immediate family member dying but not for retaining factual knowledge about the funeral or Buddhist services. This is consistent with the finding reported for patients with AD that experienced the great Hanshin-Awaji earthquake mentioned above .EmotionaThird, emotional arousal was caused by an extreme negative event. In Case 1, before the son's death, it had not been triggered by overseas travel, which can be considered to be positive in terms of emotional valence. This suggests that negative real-life events that cause psychological distress, such as losing a family member, might easily produce greater emotional enhancement effects than positive events in patients with AD.Lastly, we know from experience that a favorable environment is helpful in managing patients with AD. Both of our patients retained memory of their family member's death even at FAST stage 6 (moderately severe dementia), indicating that patients with AD may retain memory for highly negative events over a long period even with disease progression.In conclusion, these two cases suggest that patients with AD may preserve the ability to store negative events for long periods, until at least FAST stage 5. These findings indicate that memory of experiences in an unfavorable care environment, such as an abusive one, may be retained in the memory of patients with AD. More reports of cases are needed to clarify the nature of emotional memory in AD.

It can be concluded that (1) by 2020, China should develop at least 47 million medium/heavy hybrid cars to prevent the growth of vehicle fuel consumption; (2) China should take the more stringent vehicle emission standard V over 2017–2021 to hold back the growth of exhaust emissions; (3) developing new energy vehicles is the most effective measure to ease the pressure brought by auto industry.In the recent years, China's auto industry develops rapidly, thus bringing a series of burdens to society and environment. This paper uses Logistic model to simulate the future trend of China's vehicle population and finds that China's auto industry would come into high speed development time during 2020–2050. Moreover, this paper predicts vehicles' fuel consumption and exhaust emissions (CO, HC, NO During the past decade, China's automotive industry has experienced a dramatically growth. Since 2009 China had become the largest vehicle producer and consumer. Auto industry has become a pillar industry in China's national economy and played an increasingly important role in economic development, employment promotion and domestic demand stimulation.In recent years, the auto industry in developed countries has tended saturated state, with a slow growth even a negative growth in vehicle population. However, compared with developed countries, the per capita car ownership in China is very low and auto industry is still in a rapid increasing period. By the end of 2008, China's vehicle population was 51 million, just ranked 3rd after America and Japan , and by In fact, the crude oil consumption in China had reached 383.845 million tons in 2009, with average annual growth rate of 6.5% from 1990s, which is 4 times greater than the world growth rate (1.5%) over the same period. One of the major drivers of this increase in China's oil consumption is the rapid growth of the transportation sector in general and motor vehicles in particular [Concerning the rapid development of the auto industry in China, scholars in the recent years have begun to keen to study a series of environmental issues associated with auto industry, analyzing the status, and predicting the future development. For example, Yan and Crookes set two Meanwhile, the study in this field is also hot around the world. Dargay and Gately analyzedx, and PM). This paper aims to make up the defects in research, by predicting and evaluating the growth of auto industry in China during the next few decades, including vehicle population, fuel consumption, and vehicle exhaust emissions.However, the current literature focus little on quantification of specific implementation effects of auto industry policies. Additionally, the concentration on vehicle emissions is much more on GHG , 7–13 whThe change of vehicle population should be traced back to the combined actions of inner needs and external environmental restrictions, which could be properly described by Logistic equation. Logistic equation is a model to describe the trend of dependent variable over time. It can properly reflect the market expansion of new products and showAs stated above, the total number of vehicles in China has been considerable. However, from the perspective of per capita car ownership, the auto industry in China is just at the primary phase, comparing with developed countries and even the world average level . Thus, tCompared with other similar prediction models, for example, the Gompertz model , 20, theFt = Nt/Nm,  Nt represents vehicle population at moment t, Nm is the maximum based on the market, and a is the instantaneous rate of increase, a constant. While (1 − Ft) > 0, the vehicle population increases; while (1 − Ft) < 0, it decreases; while (1 − Ft) = 0, it remains stable.The differential form of Logistic model can be expressed as (1)dFtdtb is a constant. Equation , a), which makes vehicle population tend to the maximum Nm.Solving by separFt=11+e−(Take the logarithm of :(3)ln⁡FFt/(1 − Ft), with t, constitutes a linear relationship. Hence, estimating a maximum population value Nm based on the actual situation of our country, then figuring out ln⁡Ft/(1 − Ft), we can get the model parameters (a and b).It can be concluded from that ln⁡Nm. In 2008, Americans owned 0.82 cars per capita, while this value ranged from 0.54 to 0.69 in some other developed countries, such as Japan, Germany, Italy, Britain, France, and Spain. The auto industries had developed to a mature period in these countries above, even showing a negative growth since 2007 in the US, Japan, and Germany. Moreover, while the population density in the US (32 people per km2) was low, the value in Italy (196 people per km2) and France (113 people per km2) was closer to that in China (138 people per km2). Thus, this paper assumed that the per capita car ownership in China would be 0.6 when reaching the maximum. Suppose that Chinese population would keep around 1.4 billion in the next few decades, so Nm was calculated to be 840 million.This paper consulted the per capita car ownership data and popua and b) by by and shownd b) by . The orind b) by :(4)ln⁡FR2 of will be twice than that in 2011 (121.31 million m3). In Scenario B, the fuel consumption will achieve the largest in 2022 (185.10 million m3) and then begin to decline. The accumulative fuel consumptions from 2011 to 2025 will have been 2.3 billion tons and 1.9 billion tons, respectively. However, the Chinese oil reserve was only 2.95 billion tons in 2009. According to the developing trend in Scenario A, the oil reserve in China would be depleted out before 2030 without relying on oil import.In Scenario A, the fuel consumption in China will increase year by year in the next 15 years, with no trend to slow down. In 2022, the fuel consumption (239.07 million mPlanning"), which detailed goals of energy saving and new energy vehicles in China. In Planning, there are two stage goals on the market share of new energy vehicles: (1) up to 2015, the number of pure electric vehicles (PEVs) and plug-in hybrid electric vehicles (PHEVs) should outnumber 0.5 million, and medium/heavy hybrid cars should reach one million; (2) up till 2020, the number of PEVs and PHEVs should reach 5 million, and medium/heavy hybrid cars should popularize on a large scale.In July 2012, China has officially released Energy Saving and New Energy Vehicles Industry Development Planning (2012–2020) [x, and PM) in excess of 50%, while vehicles produced after Standard III, which made up 25.4% of the total, only discharged 4% of the four pollutants.Since 2000, when Motor Vehicles Emission Standard I implemented, China has implemented 4 emission standards, as shown in t (2010) , the redx, and PM) in vehicle emissions, the paper intends to figure out the annual vehicle exhaust emissions by:Mt,k is the emissions of pollutant k in year t, 104t; mi,k is the annual emissions of pollutant k per car performing Standard i [The vehicle life cycle is 15 years, the maximum prescribed years ind (1997) . That isMotor Vehicle Rejection Standard (1997) [The vehicle life cycle is 11 years, which is calculated according to d (1997) and the The prediction curves of China's four major pollutants in vehicle emissions under two scenarios are shown in Figures It can be concluded that prior to these two time points , the current implementation of emission standards would continue to play a role in the next 5–10 years, and then the increase in vehicle population would surpass the constraint function of Standard IV, resulting in the regrowth of pollutant emissions. Thus, to ensure the exhaust emissions growth, China should take the more stringent emission standard V at least in 2017–2021.t, about 1/100 of that of vehicles before Standard I. If only implementing emission standard VI, rather than taking other measures, it would achieve little success, comparing the rapid growth of vehicle population. Therefore, to further control vehicle exhaust emissions, China should actively develop new energy vehicles, on the basis of continuing to strengthen phased emission standards.Further analysing the two scenarios and evaluating the effectiveness of emission standard V, we make two assumptions: firstly, Standard V was 60% lower on the basis of Standard IV, referring the reduction effects of Standard I to Standard IV; secondly, Standard V would be implemented after the time points of lowest emissions . The prediction curves are shown in Figures In this paper, we developed a prediction of vehicle population in China in the next few decades, based on Logistic model, by using a statistical data set over the period of 1978–2008. Given the per capita car ownership and population density of developed countries, we assumed that per capita would own 0.6 cars when entering the saturation state. We predicted that the total number of China's vehicles would be approximately 15 times higher in 2050 than in 2008, increasing to more than 750 million vehicles . It also3 in 2022 would display roughly consistent changing trends under the two settings and reach the lowest points, respectively, in 2021 and in 2017 , exhaust emissions prediction for China's vehicles up to 2029 was developed in this paper, on the basis of vehicle emission standards for different phrases. We projected that the four pollutants (CO, HC, NO Figures and 7. T Figures and 9. Finally, our results suggest that the future strong growth in China's vehicle population will bring huge burdens on fuel demand and exhaust emissions. China should actively develop new energy vehicles, which is the most effective measure to ease the pressure on fuel demand and exhaust emissions brought by auto industry.

Recent evidence suggests that the lipid-lowering agent atorvastatin is also apotent immunomodulator. The aim of this study was to investigate thepossible effect of atorvastatin on the decline of residual beta cellfunction in recent-onset type 1 diabetes.The randomised placebo-controlled Diabetes and Atorvastatin (DIATOR) Trialincluded 89 patients with newly diagnosed type 1 diabetes and isletautoantibodies , in 12 centres inGermany. Patients received placebo or 80 mg/d atorvastatin for 18 months. Asprimary outcome stimulated serum C-peptide levels were determined 90 minafter a standardized liquid mixed meal. An intent-to-treat analysis wasperformed. Fasting and stimulated C-peptide levels were not significantlydifferent between groups at 18 months. However, median fasting serumC-peptide levels dropped from baseline to 12 and 18 months in the placebogroup versus anonsignificant decline in the atorvastatin group . Median stimulated C-peptide concentrations declined betweenbaseline and 12 months followed by a major loss by month 18 inthe placebo group but notin the atorvastatin group . Median levels of totalcholesterol and C-reactive protein decreased in the atorvastatin group only(p<0.001 and p = 0.04). Metabolic control wassimilar between groups.Atorvastatin treatment did not significantly preserve beta cell functionalthough there may have been a slower decline of beta-cell function whichmerits further study.NCT00974740ClinicalTrials.gov Immunosuppressive treatment of recent onset type 1 diabetes has been shown to slowthe decline of residual beta cell function Atorvastatin showed beneficial effects in patients with rheumatoid arthritis The possible beneficial effect of statin therapy on the beta cell destructive processin pancreatic islets has been analysed in animal models, with inconsistent results.In the multiple low-dose streptozotocin models in CD-1 mice, administration ofsimvastatin delayed or protected from the development of insulin-deficient diabetesIn view of the disease modifying activity of statins in two human immune-mediateddiseases we initiated the DIATOR (Diabetes and Atorvastatin) Trial investigating theeffects of treatment with atorvastatin in the course of recent-onset type 1diabetes.During the years 2004–2006 eighty-nine of the 105 patients with recent-onsettype 1 diabetes screened were identified as eligible. Despite an extension of therecruitment period and of the number of participating centers the goal of 160patients was not reached. The decision to stop screening was made by the StudyCommittee based on the low recruitment rate of the last 12 months, while still beingblinded for patient allocation to treatment groups. After randomization two patientsin the placebo group were excluded because of not having met the inclusion criteriaof at least one islet autoantibody, leaving 87 patients for the intent-to-treatanalysis. In total, 78% of patients completed the visit at 12 months and72% the final visit at 18 months although there was a 50%difference for fasting and a 48% difference for stimulated C-peptide. Thecourse of C-peptide secretion over the study period is depicted in In the atorvastatin group median baseline concentrations of total cholesterol(4.04 mmol/l), LDL-cholesterol (2.51 mmol/l) and triglyceride (0.75 mmol/l)decreased by 3 months and remained at low levels throughout the treatment period(Changes in immune parameters were determined by comparing serum concentrations atbaseline and 3 months. Median plasma CRP concentrations decreased slightly inthe atorvastatin (from 0.95 (IQR 2.01) to 0.73 mg/l (1.03),p = 0.03, but not in the placebo group (from 0.88 (1.59) to0.78 mg/l (1.31)). No significant changes were observed in either group formedian plasma concentrations of the soluble adhesion molecules sICAM-1 andE-selectin, or serum concentrations of cytokines IFNγ, IL-6, IL-18 cytokineantagonist IL-1ra, chemokines eotaxin, IP-10, MCP-4, MIP-1β, MDC, IL-8 andTARC (data not shown). Median concentrations of MCP-1 decreased significantly inthe placebo group butnot in the atorvastatin group .). The only differencebetween groups was a 11% higher concentration of IL-1ra at 3 months withatorvastatin treatment (p = 0.02).Mean HbA1c levels decreased from baseline to 6 months in both study groups and stayed at a lower level throughout the treatment period in theatorvastatin group (6.8% at 18 months), while under placebo treatmentmean values increased and were no more different from baseline at 18 months (Dose reductions (from 80 mg/d to 40 mg/d) due to adverse effects occurred for1–1.7 years in 3 cases: 1 case of myalgia and myopathia (atorvastatin), 1of arthralgia (placebo) and 1 of increased CPK serum levels (atorvastatin).Medication was temporarily discontinued in 7 cases because of symptoms lastingbetween 1 and 28 days Permanent discontinuation of atorvastatin occurredin three persons, after temporary treatment halt because of intestinal cramps,because of mildly elevated hepatic enzyme levels or because of neurologicalsymptoms. In the atorvastatin group, 18 patients (39.1%) reported 64adverse events vs. 15 patients (34.9%) with 31 adverse events in theplacebo group. In the atorvastatin group 9 of the 64 adverse events in 7patients were rated as “possibly” or “probably” relatedto medication, vs. 4 of the 28 adverse events in 4 placebo patients (differencenot significant). Five events in 4 patients of the atorvastatin group and 3events in 3 patients of the placebo group were classified as severe adverseevents; none was classified as “possibly” or “probably”related to medication. All patients recovered or were stabilized. CPK levelswere elevated in 16 patients of the atorvastatin and in 6 patients of theplacebo group. However, in most cases these elevations were of mild character(maximum 405 U/l in the atorvastatin vs. 321 U/l in the placebo group) andcritical serum levels of >10 times of the upper normal range (i.e. >2000U/l) were never observed.The trial did not find a significant effect of atorvastatin treatment with regard tothe primary endpoint, i.e. the comparison of stimulated C-peptide concentrationsbetween groups at 18 months. Also, the two groups did not differ significantly withregard to fasting C-peptide levels. In both cases, median C-peptide concentrationswere around 50% higher in the atorvastatin than the placebo group at 18months, but this difference failed to be significant because of an unexpectedlylarge range or standard deviation of C-peptide concentrations measured, in bothgroups. In this regard, a major limitation of the trial is that the actual number ofpatients recruited was lower than foreseen in the study protocol .As secondary analysis we compared median C-peptide concentrations over the studyperiod within a group. There was a significant deterioration of residual beta cellfunction in the placebo group but not the atorvastatin group. In the placebo group,median fasting C-peptide concentrations decreased from baseline by 32% at 12months and by 41% at 18 months (p<0.001), whereas there was no significantchange in the atorvastatin group. Median stimulated C-peptide concentrationsdecreased mildly in both groups by 12 months . At 18 months medianC-peptide concentrations had further decreased (p = 0.046),total decrease by 46% of baseline, whereas there was no further deteriorationin the atorvastatin group, total decrease by 19%.These differences were not reflected by lower insulin doses in the atorvastatingroup. Rather, there was a more rapid increase of insulin dosing leading tosignificantly higher insulin doses at 12 months although not at 18 months. Sometypes of statins have been reported to increase or decrease insulin resistance but aconsistent effect was not noted for atorvastatin in a recent meta-analysis Since beta cell function is affected by the concentration of glucose at the start ofthe test, the study protocol requested that no mixed meal test should be performedif fasting blood glucose was outside 4–11 mmol/l. However, even in thisconcentration range, ambient glucose may affect the outcome of beta cell functiontests, as suggest by the recent international workshop comparing the liquid mixedmeal with the glucagon assay As expected, regular intake of atorvastatin caused a decrease of total andLDL-cholesterol levels in serum, a decrease of triglyceride levels and a smallincrease of HDL-cholesterol levels. Median concentrations of CRP were low atbaseline, but were further lowered by statin treatment. All of these effects areconsequences of inhibiting the synthesis of mevalonate from acetyl coenzyme A byhydroxyl-3-methylglutaryl-coenzyme A reductase. This is a rate limiting step incholesterol synthesis, and the mevalonate pathway gives rise to a number ofcompounds such as farnesyl or geranylgeranyl pyrophosphate which can modify severaltranscription factors controlling cell growth, endothelial activity and immune geneexpression Atorvastatin was generally well tolerated. Dose reductions or temporarydiscontinuation of treatment were reported in 8 cases, in three cases treatment waspermanently discontinued. Elevation of CPK levels were observed more often in theatorvastatin than in the placebo group (35 vs 14%) but did not reach criticallevels of >2000 U/l.In summary, we report that treatment with atorvastatin over 18 months was safe andwell tolerated in adult patients with recent-onset type 1 diabetes. At 18 months,the atorvastatin group did not exhibit significantly higher fasting or stimulatedC-peptide concentrations than the placebo group. Secondary analyses of the course ofC-peptide secretion within groups found some preservation of fasting and stimulatedserum C-peptide concentrations in the atorvastatin but not the placebo group. Acomparison with results from the ongoing trial of atorvastatin in children andadolescents with type 1 diabetes will help to judge the potential of this treatment modality.The study was conducted in accordance with the Declaration of Helsinki, andapproval by the ethics committees of the Ärztekammer Nordrhein wasobtained. All patients provided written informed consent prior to study entry.The protocol for this trial and supporting CONSORT checklist are available assupporting information; see In participating centers throughout Germany (n = 12),patients with newly diagnosed type 1 diabetes were screened for eligibility. Inaccordance with current guidelines this new treatment modality was first triedin adult patients. Inclusion criteria were insulin requiring diabetes for twoweeks to 3 months, tested positive for at least one islet autoantibody (toglutamic acid decarboxylase (GAD) 65, to insulinoma-associated antigen (IA)-2 orislet cell antibodies (ICA)), age 18–39 years. Female patients were to usecontraceptive methods. Major exclusion criteria were concomitant other diseases,use of anti-inflammatory, antihypertensive, lipid-lowering or antidiabetic drugsother than insulin, a serum creatine phosphokinase (CPK) level >5 times theupper limit of normal, a serum LDL-cholesterol level >150 mg/dl or any otherconditions considered relevant by the investigator. All patients were ofCaucasian ethnicity.The study was a Phase I trial conducted as randomized, double-blind,placebo-controlled, outpatient, parallel group study. Patients were assigned totreatment with either atorvastatin or placebo for a period of 18 months in aone-to-one manner using a computer-generated randomization list, withstratification for participating centers. The starting atorvastatin dose was 40mg/d or a matching number of placebo tablets. After 4 weeks, the dose wasincreased to 80 mg/d or matching placebo. Counts of unused tablets wereperformed and did not indicate a lack of compliance, defined by >20%of tablets returned on two consecutive visits. During the study, theinvestigators were advised to reduce the dose to 40 mg/d in case of side-effects. Insulin treatment was continued throughout the study with arecommended treatment goal of HbA1c below 6.5% from 3 months on.Patients attended visits at 0, 3, 6, 12 and 18 months, without food intake forthe preceding 10 hours. Primary outcome was stimulated C-peptide secretion,assessed as serum C-peptide concentrations after a standardised liquid mixedmeal , 6 ml per kg body weightwith a maximum of 360 ml) which was performed at months 0, 12 and 18. Patientshad to refrain from alcohol intake and unaccustomed strenuous physical activityfor 48 hours prior to the test. In the morning, a capillary blood glucosemeasurement was done and the test was performed if fasting blood glucose was≥4 mmol/l and ≤11.1 mmol/l. The test was performed in the morning between7 and 10 a.m. The patient should not have taken any short-acting insulin atleast 6 hours prior to the test. A first blood sample was drawn five minutes, asecond one immediately before the liquid meal was taken in . The test meal had to be ingested within 5 minutes.Another blood sample was drawn after 90 min, following the guideline of theDiabetes Control and Complications Trial C-reactive protein (CRP) concentrations were determined by an immunonephelometricassay Based on data on C-peptide levels from patient files of the German DiabetesCenter it was calculated that for the primary endpoint 80 patients per groupwould allow to recognize a 20% difference between study groups in medianstimulated serum C-peptide levels at 18 months with a type 1 error of<1%, power 95%. For the actual number of patients recruited,the p-value was <0.05, power 80%. All patients who received at leastone dose of study treatment were included in the safety analysis. Thestatistical evaluation was performed by usingvalidated software (SAS Version 9.2). Tests for normal distribution wereperformed by Kolmogorov-Smirnov. Values with (log-)normal distribution are givenas mean/SD, comparisons between groups were made with unpaired t-test or ANOVA,or by paired t-test within groups; F-test was used to check whether or notvariances were equal and appropriate tests were used: pooled variance test ifvariances were equal, Satterthwaite test if variances were unequal. Comparisonsbetween groups included all patients, for comparisons within a group only thosepatients could be included where baseline and later data were available. Valueswithout normal distribution are given as median and interquartile range Dichotomous/categorical variables are given as proportions(Fisher's exact or Chi-square test). Missing data were not substituted.Exploratory analyses were performed for patient subgroups below or above medianage, BMI, stimulated or fasting C-peptide at baseline.Checklist S1(DOC)Click here for additional data file.Protocol S1(PDF)Click here for additional data file.

Over the years, a number of reports have revealed that Ty1 integration occurs in a 1-kb window upstream of Pol III-transcribed genes with an approximate 80-bp periodicity between each integration hotspot and that this targeting requires active Pol III transcription at the site of integration. However, the molecular bases of Ty1 targeting are still not understood.The publications by Baller et al. and Mularoni et al. in the April issue of Genome Res. report the first high-throughput sequencing analysis of Ty1 de novo insertion events. Their observations converge to the same conclusion, that Ty1 targets a specific surface of the nucleosome at he H2A/H2B interface.This discovery is important, and should help identifying factor(s) involved in Ty1 targeting. Recent data on transposable elements and retroviruses integration site choice obtained by large-scale analyses indicate that transcription and chromatin structure play an important role in this process. The studies reported in this commentary add a new evidence of the importance of chromatin in integration selectivity that should be of interest for everyone interested in transposable elements integration. S. cerevisiae. They have a central role in shaping genomes, and have been shown to be a powerful force of evolution and to play a positive role in long-term adaptation. However, they can also be deleterious in the short-term, since their integration into the host genome can inactivate or deregulate gene expression or even induce large chromosomal rearrangements by homologous recombination of distant copies. LTR-retrotransposons are structurally and functionally related to retroviruses but their life cycle is exclusively intracellular since they do not encode an envelope glycoprotein. They replicate by reverse transcribing their RNA into cDNA, which is ultimately integrated into the host genome by the element-encoded integrase (IN). The non-random distribution of LTR-retrotransposons and retroviruses into genomes suggests that these elements actively select their integration sites .S. cerevisiae have led to better understand the molecular bases of their targeted integration and integration in coding sequences and transcription units (rad6Δ). RTT109 and HOS2 encode histone-modifying enzymes, while RRM3 encodes a helicase and RAD6 an ubiquitin-conjugating enzyme.Both studies used a deep-sequencing approach to get insights into Ty1 integration selectivity. To discriminate s Figure , and thiSNR6, RPR1, SNR52, SCR1 and the repeated locus RDN5 received insertions as well. However, two class III loci of unknown function, RNA170 and ZOD1, were not targeted, probably because the Pol III transcription machinery was not efficiently recruited at these loci. Insertions in Pol II-transcribed genes were rare, representing about 5% of total events. Most of them occurred near a Pol III gene, with a strong preference for the region closest to the class III gene. Considering ORFs which are more distant to tRNA genes (~5 kb), the few recovered insertions occurred at the gene 5' end. Although insertions into mitochondrial sequences (mtDNA) were reported by Mularoni et al., they were not detected by Baller et al., probably because of a smaller dataset size or because those insertions did not confer histidine prototrophy and were, consequently, not selected for sequencing. Mularoni et al. suggest that these insertions might come from shattered mitochondria and could occur in the nucleus or even in the cytoplasm.Both reports describe the same general insertion profile pattern in wild-type cells. Independently of cell ploidy, a vast majority (~90%) of insertions were observed as predicted in the 5' region of class III genes. However, Ty1 did not target class III genes equally. All but two tRNA genes, tE(UUC)C and tI(AAU)L1, received many insertions. Other class III genes, such as The novel and most striking observation of both studies is that Ty1 integration is positively correlated with nucleosome occupancy. An important role for chromatin in the selection process of insertion sites was already suspected after the discovery of an intriguing periodicity of ~80 bp between each integration hotspots that relied on the ATP-dependent chromatin remodeling factor Isw2 . By comphos2Δ and rtt109Δ mutant strains analyzed by Baller et al., the pattern of Ty1 insertion events was not significantly different from that in wild-type cells. In contrast, integration events in verified ORFs increased significantly in rrm3Δ and rad6Δ mutant strains , although the integration pattern upstream of tRNA genes was unmodified, leading to the conclusion that the determining factors for specific nucleosomal targeting upstream of class III genes were not affected in these mutants.In . pombe Tf1 has been shown to be strongly biased for Pol II promoters with a clear preference for stress-induced promoters [in vitro evidences on Ty3 integration at Pol III sites [et al. and Baller et al. reveal that Ty1 integration upstream of class III genes is strongly correlated with the chromatin structure at these loci and preferentially targets a specific nucleosomal DNA segment. Interestingly, the preference for nucleosome-rich regions is not a conserved feature of retroelements since it has been shown that elements such as Ty5 and Hermes (when expressed in yeast) prefer nucleosome-free regions [High-throughput sequencing of insertion events has provided a saturated profile of target activity for several retrotransposons and contributed to better understand their integration preferences. For example, integration of the LTR retrotransposon of Sromoters , and anoII sites . A high-II sites ). The re regions ,17.Although these two studies clearly contribute to better understanding of Ty1 targeting, they do not characterize whether a specific nucleosomal DNA conformation, a specific histone modification, or a nucleosome-bound factor enriched at sites of Pol III transcription, determine Ty1 preferred target sites, nor do they elucidate the role of RNA polymerase III and its co-factors in Ty1 targeting. Thus, further work is required to completely decipher the molecular bases of Ty1 targeting.H2A: Histone protein H2A; H2B: Histone protein H2B; His+: Histidine prototrophy; HIV-1: Human Immunodeficience Virus 1; IN: Integrase; LTR: Long Terminal Repeat; ORF: Open Reading Frame; Pol III: RNA Polymerase III; Ty: Transposon in yeast.The authors declare that they have no competing interests.AB-N, wrote the manuscript PL, supervised the final manuscript. All authors read and approved the final manuscript.

II complex, [Pb2(C2Cl3O2)2(NO3)2(C12H8N2)2]n, the 1,10-phenanthroline ligand is chelating, the nitrate anion chelates one PbII ion and simultaneously bridges a neighbouring PbII ion via the third O atom, and the trichloro­acetate anion is bidentate, bridging two PbII ions. The coordination geometry is based on a penta­gonal–bipramidal geometry defined by an N2O5 donor set with no obvious stereochemical role for the lead-bound lone pair of electrons. The coordination polymer has a zigzag topology along [010] and comprises alternating eight-membered {PbONO}2 and {PbOCO}2 rings.In the title Pb II structures, see: Davidovich et al. 2(NO3)2(C12H8N2)2] = 0.017wR(F2) = 0.038S = 0.993899 reflections235 parametersH-atom parameters constrainedmax = 0.84 e Å−3Δρmin = −0.97 e Å−3ΔρCrysAlis PRO used to solve structure: SHELXS97 global, I. DOI: 10.1107/S1600536812003595/hg5168Isup2.hklStructure factors: contains datablock(s) I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

The dihedral angle between the benzene ring and the mean plane of the piperazin-1-ium ring is 51.22 (6)°. In the crystal, N—H⋯Cl hydrogen bonds link the mol­ecules into chains propagating in [100]. Weak C—H⋯π inter­actions also ocur.In the title mol­ecular salt, C Å b = 11.2821 (3) Å c = 12.4256 (3) Å V = 1143.53 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.30 mmT = 296 K 0.54 × 0.33 × 0.23 mm Bruker APEX DUO CCD diffractometerSADABS; Bruker, 2009)T min = 0.854, T max = 0.936Absorption correction: multi-scan (8246 measured reflections4871 independent reflectionsI > 2σ(I)4172 reflections with R int = 0.016 R[F 2 > 2σ(F 2)] = 0.032 wR(F 2) = 0.092 S = 0.95 4871 reflections128 parametersH-atom parameters constrainedmax = 0.23 e Å−3 Δρmin = −0.19 e Å−3 ΔρAbsolute structure: Flack 1983, 1943 FrFlack parameter: 0.02 (4) APEX2 SAINT SAINT SHELXTL global, I. DOI: 10.1107/S1600536811044394/hb6474Isup2.hkl Structure factors: contains datablock(s) I. DOI: 10.1107/S1600536811044394/hb6474Isup3.cml Supplementary material file. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

In the crystal, the sulfanyl H atoms form inter­molecular hydrogen bonds with the O atoms, connecting the mol­ecules into zigzag chains along the c axis. The two aromatic rings exhibit a small interplanar angle of 16.03 (9)°.In the title compound, C Åb = 22.7530 (14) Åc = 8.0966 (5) Åβ = 118.787 (1)°V = 1284.36 (14) Å3Z = 4Kα radiationMo −1μ = 0.40 mmT = 150 K0.49 × 0.12 × 0.08 mmBruker SMART APEXII diffractometerSADABS; Sheldrick, 2003Tmin = 0.828, Tmax = 0.969Absorption correction: multi-scan (14799 measured reflections3196 independent reflectionsI > 2σ2577 reflections with Rint = 0.029R[F2 > 2σ(F2)] = 0.038wR(F2) = 0.108S = 1.073196 reflections172 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.54 e Å−3Δρmin = −0.24 e Å−3ΔρAPEX2 used to solve structure: SHELXTL I, global. DOI: 10.1107/S1600536812029765/ds2201Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S1600536812029765/ds2201Isup3.cmlSupplementary material file. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

Leishmania parasite species, for which available therapeutic arsenal is scarce and unsatisfactory. Pentavalent antimonials (SbV) are currently the first-line pharmacologic therapy for leishmaniasis worldwide, but resistance to these compounds is increasingly reported. Alkyl-lysophospoholipid analogs (ALPs) constitute a family of compounds with antileishmanial activity, and one of its members, miltefosine, has been approved as the first oral treatment for visceral and cutaneous leishmaniasis. However, its clinical use can be challenged by less impressive efficiency in patients infected with some Leishmania species, including L. braziliensis and L. mexicana, and by proneness to develop drug resistance in vitro.The leishmaniases are a complex of neglected tropical diseases caused by more than 20 Leishmania spp., as assessed by proliferation and flow cytometry assays. Effective antileishmanial ALP concentrations were dependent on both the parasite species and their development stage. Edelfosine accumulated in and killed intracellular Leishmania parasites within macrophages. In vivo antileishmanial activity was demonstrated following oral treatment with edelfosine of mice and hamsters infected with L. major, L. panamensis or L. braziliensis, without any significant side-effect. Edelfosine also killed SbV-resistant Leishmania parasites in in vitro and in vivo assays, and required longer incubation times than miltefosine to generate drug resistance.We found that ALPs ranked edelfosine>perifosine>miltefosine>erucylphosphocholine for their antileishmanial activity and capacity to promote apoptosis-like parasitic cell death in promastigote and amastigote forms of distinct Leishmania spp., and it is less prone to lead to drug resistance development than miltefosine. Edelfosine is effective in killing Leishmania in culture and within macrophages, as well as in animal models infected with different Leishmania spp. and SbV-resistant parasites. Our results indicate that edelfosine is a promising orally administered antileishmanial drug for clinical evaluation.Our data reveal that edelfosine is the most potent ALP in killing different in vitro and in vivo evidence for the antileishmanial activity of the ether phospholipid edelfosine, being effective against a wide number of Leishmania spp. causing cutaneous, mucocutaneous and visceral leishmaniasis. Our experimental mouse and hamster models demonstrated not only a significant antileishmanial activity of edelfosine oral administration against different wild-type Leishmania spp., but also against parasites resistant to pentavalent antimonials, which constitute the first line of treatment worldwide. In addition, edelfosine exerted a higher antileishmanial activity and a lower proneness to generate drug resistance than miltefosine, the first drug against leishmaniasis that can be administered orally. These data, together with our previous findings, showing an anti-inflammatory action and a very low toxicity profile, suggest that edelfosine is a promising orally administered drug for leishmaniasis, thus warranting clinical evaluation.Leishmaniasis represents a major international health problem, has a high morbidity and mortality rate, and is classified as an emerging and uncontrolled disease by the World Health Organization. The migration of population from endemic to nonendemic areas, and tourist activities in endemic regions are spreading the disease to new areas. Unfortunately, treatment of leishmaniasis is far from satisfactory, with only a few drugs available that show significant side-effects. Here, we show The impact of the leishmaniases on human health has been grossly underestimated for many years, and this complex of diseases has been classified by the World Health Organization (WHO) as one of the most neglected tropical diseases Leishmania species and distinct endemic regional variations, even within the same country. Resistance is now common in India, and rates of resistance have been shown to be higher than 60% in parts of the state of Bihar, in north-east India Leishmania drug The chemotherapy currently available for the leishmaniases is far from satisfactory and presents several problems, including toxicity, many adverse side-effects, high costs and development of drug resistance L. donovani; 94% cure) L. panamensis; >90% cure) L. braziliensis, which comprise more than 60% of cutaneous leishmaniasis in Colombia L. braziliensis of 75% L. guyanensis of 71% L. braziliensis in Bolivia L. braziliensis infection, and 60% for L. mexicana infection) in Guatemala L. tropica in Afghanistan in vitro generation of resistance to miltefosine Miltefosine (Impavido) is a new oral agent that has shown high cure rates in visceral leishmaniasis in India is a promising antitumor ether lipid drug in vitro antiparasitic activity against different species of Leishmania parasites Leishmania activity Leishmania parasites remains to be fully elucidated, there are some reports showing that the ability of this compound to promote an apoptosis-like cell death is critical for its leishmanicidal activity in vitro and in vivo study, investigating the putative anti-Leishmania traits of edelfosine, as compared to other ALPs, using different Leishmania species as well as mouse and hamster experimental models.Edelfosine and the European Union (European Directive 2010/63/EU) guidelines on animal experimentation for the protection and humane use of laboratory animals, and were conducted at the accredited Animal Experimentation Facility of the University of Salamanca (Register number: PAE/SA/001). Procedures were approved by the Ethics Committee of the University of Salamanca .O-octadecyl-2-O-methyl-rac-glycero-3-phosphocholine) was from INKEYSA and Apointech . Miltefosine (hexadecylphosphocholine) was from Calbiochem . Perifosine -phosphate) and erucylphosphocholine ((13Z)-docos-13-en-1-yl 2-(trimethylammonio)ethyl phosphate) were from Zentaris . Stock sterile solutions of the distinct ALPs (2 mM) were prepared in RPMI-1640 culture medium , supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin as previously described Edelfosine (1-Leishmania strains were used in this study: L. amazonensis (MHOM/Br/73/LV78), L. braziliensis (MHOM/CO/88/UA301), L. donovani (MHOM/IN/80/DD8), L. infantum (MCAN/ES/96/BCN150), L. major LV39 (MRHO/SU/59/P), L. mexicana (MHOM/MX/95/NAN1), and L. panamensis (MHOM/CO/87/UA140).The following Leishmania promastigotes were grown in RPMI-1640 culture medium, supplemented with 10% FBS, 2 mM glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin at 26°C. Promastigotes were treated with the indicated compounds during their logarithmic growth phase (1.5×106 parasites/ml) at 26°C. Late stationary promastigotes were obtained after incubation of the parasites for 5–6 days with starting inocula of 1×106 parasites/ml. Leishmania axenic amastigotes were obtained at pH 5.0 in Schneider's culture medium following a stepped temperature increase to 30, 31 and 32°C, except for L. infantum amastigotes, which were exposed to 34, 36 and 37°C, as previously described 6 cells/ml for promastigotes, and 2×106 cells/ml for axenic amastigotes), and plated (100 µl/well) in 96-well flat-bottomed microtiter plates at 26°C, in the absence and in the presence of different concentrations of the indicated ALPs. After 72-h incubation at 26°C, IC50 values, defined as the drug concentration causing 50% inhibition in cell proliferation with respect to untreated controls, were determined for each compound. Measurements were done in triplicate, and each experiment was repeated four times.The antileishmanial activity in promastigotes and axenic amastigotes was determined by using the XTT -3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) cell proliferation kit as previously described Leishmania spp. promastigotes or axenic amastigotes were treated in the absence and in the presence of the indicated concentrations of ALPs for different incubation times. Then, parasites were pelleted by centrifugation (1000× g) for 5 min, and analyzed for apoptosis-like DNA breakdown by flow cytometry following a protocol previously described 0/G1 region (hypodiploidy) in cell cycle analysis One and a half million 2, was infected overnight at the exponential growth phase (3×105 cells/ml) with stationary-phase L. panamensis promastigotes, at a macropage/promastigote ratio of 1/10 in complete RPMI-1640 culture medium. Non-internalized promastigotes were removed by 2–3 successive washes with PBS. Then, uninfected and L. panamensis-infected J774 macrophages were incubated for 1 h with 10 µM of the fluorescent edelfosine analog all-(E)-1-O--2-O-methyl-rac-glycero-3-phosphocholine (PTE-ET) L. panamensis in the darkness for 6 h. Samples were fixed with 1% formaldehyde, and analyzed with a Zeiss Axioplan 2 fluorescence microscope (40× magnification).The mouse macrophage-like cell line J774, grown in RPMI-1640 culture medium, supplemented with 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 µg/ml streptomycin, at 37°C in humidified 95% air and 5% COL. panamensis promastigotes as above. The number of intracellular viable parasites was assessed by incubating infected cells with RPMI-1640 medium containing 0.008% SDS to gently disrupt macrophage plasma membrane, followed by addition of RPMI-1640 culture medium containing 20% FBS to stop further lysis. Samples were then sequentially diluted in 96-well plates containing biphasic Novy-MacNeal-Nicolle (NNN) medium. Plates were incubated at 26°C for 20 days, and examined weekly under an inverted Nikon TS-100 microscope to evaluate the presence of viable motile promastigotes. The reciprocal of the highest dilution found positive for parasite growth was considered to be the concentration of parasites.J774 cells were infected with 6 cells/well in 24-well culture plates , and let them adhere for 2 h at 37°C in 5% CO2. Non-adhering cells were removed by gentle washing with complete RPMI-1640 culture medium. Adherent J774 cells were incubated in the absence (negative control), or in the presence of 10 µg/ml lipopolysaccharide or of different concentrations of edelfosine. After 18-h incubation at 37°C in 5% CO2, supernatants were collected, centrifuged at 500× g for 10 min, and stored at −80°C until analysis. NO release was indirectly measured using a colorimetric assay based on the Griess reaction. Triplicate 100-µl aliquots of cell culture supernatants were incubated with 50 µl of freshly prepared Griess reagent for 15 min at room temperature, and then absorbance of the azo-chromophore was measured at 550 nm. Nitrite concentration was determined by using sodium nitrite as a standard. All samples were assayed against a blank comprising complete RPMI-1640 culture medium incubated for 18 h on the same plates as the samples, but in the absence of cells. All reagents were purchased from Sigma. Results were expressed in nanomoles of nitrite per 106 macrophages.Macrophage-like J774 cells were plated in complete RPMI-1640 culture medium at a concentration of 1×10Mesocricetus auratus) (about 120 g) , kept in a pathogen-free facility and handled according to institutional guidelines, complying with the Spanish legislation under a 12/12-h light/dark cycle at a temperature of 22°C, received a standard diet and water ad libitum. Mice were inoculated s.c. into their left hind footpad with 2×106 infective stationary-phase promastigotes, whereas hamsters, previously anesthetized with inhaled Forane, were inoculated intradermally in the nose with 1×106 stationary-phase promastigotes in a volume of 50 µl PBS. When inflamation was evident , animals were randomly assigned into cohorts of 7 animals each, receiving a daily oral administration (through a feeding needle) of edelfosine , or an equal volume of vehicle (water). In mice, the footpad thickness was measured with calipers every week, and compared with the uninfected right hind footpad to obtain the net increase in footpad swelling. In hamsters, nose swelling was measured with calipers every week, and compared with the nose size before inoculation and treatment. Evolution index of the lesion was calculated as size of the lesion during treatment (mm)/size of the lesion before treatment. Animal body weight and any sign of morbidity were monitored. Drug treatment lasted for 28 days, and animals were killed following institutional guidelines, 24 h after the last drug administration.Six-week-old female BALB/c mice (18–20 g) and four-week-old male Syrian golden hamsters , which corresponded to its IC50 value, previously assessed by the XTT technique. Drug-containing culture medium was changed every 4–6 days, depending on parasite growth, and parasites were washed with PBS, analyzed by XTT assay, and resuspended again at 2×106 parasites/ml. This procedure was repeated until parasite viability in the presence of the drug was over 80%. Then, after achieving this viability rate, this process was repeated three times, with increasing concentrations of SbV, up to reaching a final concentration of 37 mg/ml. The volume of drug solution used in each passage was controlled not to exceed 10% of the total volume of culture medium.Parasites cultured in Schneider's culture medium supplemented with 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin at 26°C for 5 days, were washed twice with PBS, and centrifuged at 1000× in vitro-generated SbV-resistant (SbV-R) L. panamensis parasites, growing in the presence of 37 mg/ml SbV, as well as with wild-type susceptible L. panamensis, followed by treatment with Glucantime. Hamsters were divided into two groups, eight animals infected with the resistant strain and eight animals infected with the susceptible strain. Each group was inoculated intradermally on the nose with 1×106 stationary-phase promastigotes in a volume of 50 µl PBS. These animals were previously anesthetized with ketamine (50 mg/ml) and xylazine (5 mg/kg) intraperitoneally. About six weeks after infection, lesions were evident in both animal groups, and animals were treated daily with 40 mg/kg Glucantime, intramuscularly using a 27-gauge needle, for ten days. Evolution of the lesions and drug efficacy were monitored as above.The level of SbV resistance was further assessed by infection of golden hamsters with the above Leishmania strains were generated as indicated above for SbV-resistant parasites. Drugs were initially incubated at their corresponding IC50 values, and then drug concentration was gradually increased. Parasites were considered resistant when they could grow at a drug concentration of 30 µM.ALP-resistant t test. A P-value of <0.05 was considered statistically significant.Data are shown as mean ± SD. Between-group statistical differences were assessed using the Mann-Whitney or the Student's Leishmania spp. promastigotes with IC50 values in the range of low micromolar concentration (∼2–9 µM) in most cases . L. brazs tested . Erucylpstigotes . In geneLeishmania amastigotes. Following an axenic amastigote drug screening, we found that edelfosine and perifosine behaved as the most potent ALPs in the inhibition of proliferation of distinct Leishmania spp. amastigotes , with L. panamensis amastigotes being rather resistant for the inhibition of cell growth in all the Leishmania spp. amastigotes analyzed . Erucylpanalyzed . Surprisesistant , with doterparts , whereaser 14 µM . In genetrations .Leishmania spp. proliferation at distinct rates. We next analyzed whether these agents, used at the pharmacologically relevant concentration of 10 µM, were able to induce an apoptotic-like cell death in Leishmania spp. promastigotes by determining DNA fragmentation by flow cytometry. Parasites displaying a sub-G0/G1 hypodiploid DNA content represent cells that undergo DNA breakdown and an apoptotic-like cell death Leishmania spp. tested of the three ALPs, assessed by XTT assays and L. braziliensis (sug-genus Viannia) promastigotes with XTT IC50 values of 6.4 and 18.3 µM, respectively after 24 h incubation with 10 and 20 µM edelfosine, respectively).A comparative dose-response analysis showed that edelfosine was more potent than miltefosine in inducing apoptosis-like cell death in stigotes , edelfos figures . The celor 10 µM , whereasor 10 µM . InteresLeishmania parasites use macrophages as their main host cell in mammalian infection, we next analyzed the localization of edelfosine in Leishmania-infected macrophages. To this aim, we used the fluorescent edelfosine analog all-(E)-1-O--2-O-methyl-rac-glycero-3-phosphocholine (PTE-ET), which has been previously used as a bona fide compound to analyze the subcellular localization of edelfosine in cancer cells 50 = 40.7±7.1 µM, assessed by XTT assays), and therefore it was used as a host cell line for Leishmania infection. Edelfosine (10 µM) was unable to induce apoptosis in J774 cells following 24 h incubation (<2% apoptosis), and caused less than 15% apoptosis after 48 h incubation. This is in stark contrast to the high sensitivity of other monocyte-like cell lines to edelfosine, such as human U937 cells L. panamensis parasites, an intense blue fluorescence was detected in the intracellular parasites (Leishmania amastigotes are shown in L. major (data not shown). These data suggest that edelfosine accumulates in intracellular Leishmania parasites inside macrophages, in a similar way as PTE-ET, to exert its anti-parasite action regardless drug treatment is before or after infection.Because L. panamensis by examining the parasitic burden of macrophages through limiting dilution assays We also found that edelfosine efficiently killed J774 macrophage-residing n assays . The cyt6 J774 cells after 18 h incubation), unlike cell incubation with 10 µg/ml LPS (100 nmol nitrites/106 J774 cells after 18 h incubation). Likewise, edelfosine treatment failed to prompt NO synthesis in mouse bone marrow-derived macrophages and rat alveolar macrophages (data not shown). These data suggest that the killing effect of edelfosine on macrophage-residing Leishmania parasites does not depend on NO generation.Some anti-parasite drugs are suggested to promote their action through the generation of nitric oxide (NO) in vivo antileishmanial activity of edelfosine in BALB/c mice infected subcutaneously in the footpad with 2×106 infective stationary-phase L. major promastigotes. In agreement with previous estimates L. major-infected BALB/c mice with edelfosine was slightly more effective than with miltefosine, although differences were not statistically significant (data not shown). The dose of edelfosine used in our assays was similar to the dose used for miltefosine in mouse models, ranging from 2.5 to 25 mg/kg of body weight/day given orally, and being 20 mg/kg/day the most widely used dose for in vivo murine experiments in vivo murine studies.We next examined the L. panamensis and L. braziliensis were inoculated in the nose of golden hamsters, as animal models for cutaneous and mucocutaneous leishmaniasis, since the above Leishmania species can cause both cutaneous and mucocutaneous disease L. panamensis for wild type L. panamensis promastigotes. Because of the different susceptibility to SbV shown by certain Leishmania spp., depending on their promastigote or amastigote stage, SbV resistance of L. panamensis promastigotes was further evaluated by in vivo experiments in a hamster model. Two groups of eight hamsters each were inoculated in the nose with wild type and SbV-resistant L. panamensis promastigotes, and then, after a 6-week post-infection period, when nose swelling was clearly detected, hamsters were injected intramuscularly with 40 mg/kg body weight Glucantime (SbV), on a daily basis for 4 weeks. As shown in L. panamensis, but increased in animals infected with SbV-resistant L. panamensis. In addition, macrophages infected with Leishmania amastigotes were readily observed in smears from the nose of SbV-resistant L. panamensis-infected hamsters, but not from wild type L. panamensis-infected animals, treated with SbV . These results indicate that the generated SbV-resistant L. panamensis strain was highly resistant to pentavalent antimonial treatment both in vitro and in vivo.Cutaneous leishmaniasis is the most common form of leishmaniasis and is endemic in many tropical and subtropical countries with SbV . Moreovein vitro the activity of the four ALPs edelfosine, miltefosine, perifosine and erucylphosphocholine against both wild type and SbV-resistant L. panamensis promastigotes by XTT assays. We found that all ALPs were effective in inhibiting proliferation of SbV-resistant L. panamensis promastigotes showing similar IC50 values to those found against wild type L. panamensis for 4 weeks led to a dramatic decrease in the evolution index, parasitic burden and local inflammation , which has been approved as the first oral drug active against visceral leishmaniasis Our results show the Leishmania spp. causing cutaneous, mucocutaneous and visceral leishmaniasis. Edelfosine was able to kill parasites in both promastigote and amastigote forms through an apoptosis-like process that involved DNA degradation, as assessed by an increase in the percentage of cells with a hypodiploid DNA content. Leishmania parasites infect macrophages wherein they reside and replicate in a fusion competent vacuole (parasitophorous vacuole). Interestingly, edelfosine efficiently killed intracellular parasite amastigotes inside macrophages, without affecting the host cells. This killing activity on intracellular parasites seems to be mainly due to a direct action of the drug on the parasite, as edelfosine was unable to induce NO generation in macrophages, while a fluorescent edelfosine analog accumulated in the intracellular parasites within macrophages.Here, we have found that edelfosine shows an outstanding activity against a wide number of in vivo assays using mouse and hamster animal models infected with L. major, L. panamensis or L. braziliensis. To our knowledge this is the first study using hamsters as animal models for the in vivo evaluation of ALPs against cutaneous leishmaniasis. In addition, both in vitro and in vivo evidence showed that edelfosine was very effective against SbV-resistant Leishmania parasites. This is of importance as pentavalent antimonials Glucantime and Pentostam are being used in the treatment of leishmaniasis for over more than six decades, and still they are the first line drugs of choice and the traditional treatment worldwide. However, resistance to pentavalent antimonials is emerging as a result of their widespread use. A stark example of SbV resistance is well documented in Bihar (India), which houses approximately 90% of Indias's cases of visceral leishmaniasis, representing about 50% of the world's cases, and where resistance ended the usefulness of SbV more than a decade ago Our data also reveal a remarkable antileishmanial activity of edelfosine in several in vitro. We have found here that generation of drug resistance required longer incubation times of Leishmania spp. with edelfosine than with miltefosine. Furthermore, whereas miltefosine generated drug resistance in L. donovani following a 40-day treatment, no resistance to edelfosine was detected after 100-day incubation.A major potential drawback in the use of miltefosine could be the relatively rapid generation of drug resistance L. braziliensisL. braziliensis-infected hamsters. In addition, edelfosine offers a number of additional advantages as compared to miltefosine, such as the fact that edelfosine shows a potent anti-inflammatory action Leishmania parasites enter first neutrophils through the regulation of granule fusion processes that prevents any deleterious action on the parasite Leishmania parasites use polymorphonuclear neutrophils as intermediate hosts before their ultimate delivery to macrophages, following engulfment of parasite-infected neutrophils, and in this way Leishmania can escape the host immune system It is worthwhile to note that miltefosine treatment has been reported to be unsatisfactory against infections caused by A serious drawback of miltefosine is its teratogenic effects The studies reported here provide compelling evidence for the potent antileishmanial activity of edelfosine, which together with the low toxicity profile displayed by this ether lipid and its anti-inflammatory activity, warrants further clinical evaluation as a possible alternative treatment against leishmaniasis.

Fatigue is one of the most frequent symptoms in multiple sclerosis (MS), and recent studies have described a relationship between the sensorimotor cortex and its afferent and efferent pathways as a substrate of fatigue. The objectives of this study were to assess the neural correlates of fatigue in MS through gray matter (GM) and white matter (WM) atrophy, and resting state functional connectivity (rs-FC) of the sensorimotor network (SMN). Eighteen healthy controls (HCs) and 60 relapsing-remitting patients were assessed with the Fatigue Severity Scale (FSS). Patients were classified as fatigued (F) or nonfatigued (NF). We investigated GM and WM atrophy using voxel-based morphometry, and rs-FC changes with a seed-based method and independent component analysis (ICA). F patients showed extended GM and WM atrophy focused on areas related to the SMN. High FSS scores were associated with reductions of WM in the supplementary motor area. Seed analysis of GM atrophy in the SMN showed that HCs presented increased rs-FC between the primary motor and somatosensory cortices while patients with high FSS scores were associated with decreased rs-FC between the supplementary motor area and associative somatosensory cortex. ICA results showed that NF patients presented higher rs-FC in the primary motor cortex compared to HCs and in the premotor cortex compared to F patients. Atrophy reduced functional connectivity in SMN pathways and MS patients consequently experienced high levels of fatigue. On the contrary, NF patients experienced high synchronization in this network that could be interpreted as a compensatory mechanism to reduce fatigue sensation. Fatigue is defined as an overwhelming sense of tiredness, lack of energy, or exhaustion . It is oMagnetic resonance imaging (MRI) studies have contributed to describe possible factors related to this disabling symptom. Although initial studies yielded conflicting results ,6, recenWe hypothesized that variability in the organization and activity of motor networks could be related to the fatigue symptoms observed in MS patients. To test this hypothesis, we applied VBM and connectivity analyses on the RSNs trying to: 1) observe possible differences between fatigued (F) and nonfatigued (NF) patients compared to healthy controls (HCs) in GM and white matter (WM) volume, and their possible relationship with scores on an assessment of fatigue; 2) evaluate if the relationship between structural damage in motor areas and functional connectivity alterations within the SMN may account for fatigue; and 3) discern possible differences among the three groups of the study in intrinsic resting-state functional connectivity (rs-FC) of the SMN. N = 32), whereas those with an FSS score of less than 4 were considered NF (N = 28). We recruited 60 relapsing-remitting MS patients diagnosed according to the McDonald criteria and 18 HApproval was received from the local ethical standards committee on human experimentation of Universitat Jaume I and Hospital General and written informed consent was obtained from all subjects. The fMRI session consisted of resting-state data acquired on a 1.5 T scanner . A total of 270 volumes were recorded over 9 minutes using a gradient-echo T2*-weighted echo-planar imaging sequence . Participants were instructed to keep their eyes closed, stay motionless and relaxed without falling asleep, and think of nothing in particular. Prior to the functional sequences, a sagittal high-resolution three-dimensional (3D) T1-weighted sequence was acquired .GM and WM volumes, and intracranial volume (ICV) for every participant were obtained from 3D T1 images using the unified segmentation approach of Statistical Parametric Mapping (SPM) 8 software . In all patients, T1-hypointense lesions were manually identified and were semiautomated painted as regions of interest (ROIs) with the Jim software using the T1 sagittal images converted to axial. We used the T1 acquired images as previously described by Ceccarelli et al., (2012) to be moAfter this, we used Lesion Filling tool of the F3. The study-specific GM and WM templates were then created by the aligned images from all patients and controls. The procedure began with the generation of an original template, computing the average of all aligned data, followed by the first iteration of the registration for each participant in turn. Thus, a new template was created and the second iteration began. After six iterations, the template was generated, which was the average of the DARTEL registered data. During iterations, all images were warped to the template, yielding a series of flow fields and parameterized deformations, which were employed in the modulation step. Since this was processed in native space, it was necessary to transform all the normalized, modulated data into Montreal Neurological Institute (MNI) space. After the space transformation, all these images were smoothed using an isotropic Gaussian kernel with 8-mm full width at half maximum.Then images were reoriented along the anterior-posterior commissure. Optimized VBM was performed on the 3D lesion filled images using Diffeomorphic Anatomical Registration Through Exponential Lie Algebra (DARTEL) included in SPM v.8.The reoriented images were segmented into GM, WM, and cerebrospinal fluid images in native space, and then generated by a rigid transformation. The resolution of the aligned images was specified as 1.5 x 1.5 x 1.5 mmThe distribution of brain atrophy and differences among groups were assessed using an ANCOVA for GM and WM, including age, gender, and ICV as nuisance covariates. Finally, linear regression analyses were used to assess the relationship between WM and GM atrophy and FSS scores in all MS patients as a whole but also in F and NF patients separately.p < .05) determined by Monte Carlo simulations conducted with the AlphaSim utility in REST software (http://www.restfmri.net/), implementing a voxel-wise threshold of p < .001 in combination with a cluster-size criterion of 132 voxels for GM and 146 voxels for WM [ For all analyses, we used a family-wise error correction for multiple comparisons at the cluster level to show the differences in rs-FC of the network associated with the SMN. Both methods required specific preprocessing that is described in the supplementary material.We tested the relationship between GM atrophy and rs-FC using regions of interest obtained in the VBM results in areas that we considered part of the sensorimotor cortex that includes the bilateral supplementary motor area (SMA), lateral primary motor cortex (PMC), and bilateral thalamus (see VBM results and seed-based Rs-FC results). After preprocessing, these regions of interest were resliced to the same normalization space of rs-fMRI data for subsequent rs-FC analysis. We computed voxel-wise rs-FC maps to disentangle the networks evoked by the seed regions. This method allowed us to study the rs-FC (Pearson’s correlation) of the seed region with all other voxels in the whole brain for each participant. Individual r-maps were normalized to z-maps using Fisher’s Z transformation. A one-sample t-test for each region was performed by entering the z-maps to detect brain areas showing significant rs-FC across participants and to obtain functional connectivity maps for each group (see seed-based Rs-FC results). To examine the changes in rs-FC between groups we performed a between-subjects ANOVA. Finally, we examined a possible relationship between rs-FC and FSS scores using a regression analysis. To avoid a possible confounding effect due to excessive head motion , we calc Intrinsic activity measured with rs-fMRI is organized in a limited number of RSNs and this finding has been replicable across studies ,32. To op < .05) determined by whole-brain Monte Carlo simulations conducted with AlphaSim implemented in REST . All rs-FC results were presented using family-wise error corrected for multiple comparisons at the cluster level , different areas of the bilateral temporal and occipital lobes, the right precuneus, and bilateral thalamus see . CompareIn comparison to the HC group, WM structural changes in NF patients achieved statistical significance in several WM areas of the bilateral frontal lobe, right middle cingulate gyrus, bilateral posterior cingulate gyrus, bilateral temporal and occipital lobes, around the left thalamus, and bilateral corpus callosum see . CompareThe regression analysis showed that high FSS scores were associated to reduced WM volumes in the left SMA (MNI -11 -20 50 r=-.41) see We selected four regions of interest within sensorimotor brain areas that differed between the F group and controls in the VBM analyses see and we ur = -.39; see Seed regression analysis within MS patients using FSS scores as a covariate of interest showed that higher FSS scores were associated with lower rs-FC between the bilateral SMA (MNI 8 -21 48) and bilateral PMC showed tIt is important to note that previous studies have suggested that fatigue in MS patients is also related to structural abnormalities of the basal ganglia and thalamus as well as their extensive interconnections with other brain areas ,39. SimiThere is a possible limitation in our study that might be worth considering here, which is the fact that F patients displayed higher EDSS scores than NF patients. However, we do not think that physical disability might account for the fatigue differences found between both MS patients subgroups. This conclusion is based in the fact that we did not find any correlation between FSS and EDSS scores in any of these subroups of MS patients. Future studies should be addressed to observe a possible association between sensoriomotor alterations and fatigue in a wider sample of MS with different EDSS scores. In summary, the present results are unprecedented in showing a relationship between fatigue and rs-FC changes related to atrophy. We observed that reduced rs-FC also extended to other areas of the SMN where no differences in atrophy were observed between F and NF patients but that might be responsible for poor integration of the sensory and motor pathways. Fatigue sensation seems to be related to decreased synchronization between the right precentral gyrus and PMC as well as between the left precentral gyrus and premotor cortex. Interestingly, enhanced rs-FC in this network was observed in MS patients reporting low levels of fatigue. This enhanced connectivity may act as a compensatory and adaptive functional change necessary to maintain “normal” vigor sensation in some MS patients. Material S1Resting state networks (RSN) analysis.(DOC)Click here for additional data file.Figure S1Spatial maps of eight resting state networks (RSNs) construct using independent component analysis (ICA).(TIFF)Click here for additional data file.Table S1Areas showing differences in gray matter volume (GM) between groups according to fatigue. Results are presented at corrected multiple comparisons , k=132. Abbreviations: NF non fatigued patients, F fatigued patients, HC healthy controls, R right, L left, Supplementary motor area (SMA); Primary motor cortex (PMC).(PDF)Click here for additional data file.Table S2Areas showing differences in white matter volume (WM) in between groups according to fatigue. Results are presented at corrected multiple comparisons , k=146. Abbreviations: NF non fatigued patients, F fatigued patients, HC healthy controls, R right, L left; Supplementary motor area (SMA).(PDF)Click here for additional data file.Table S3Anatomical regions of Sensorimotor Network (SMN) identified on three groups using Independent Component Analysis (ICA). Corrected at FWE p < 0.05. Abbreviations: HC = healthy controls; NF = non fatigued; F = fatigued; R = right; L = left; BA = Brodmann Area.(PDF)Click here for additional data file.

Objective(s): A growing interest has recently been attracted towards the identification of plant-based medications including those with protective effects against cognitive impairment. Sesamol has shown promising antioxidant and neuroprotective effects, therefore, we aimed to evaluate its therapeutic potential in epilepsy which is commonly associated with oxidative stress and cognitive impairment. Materials and Methods: Male Wistar rats received pentylenetetrazole (PTZ) once every other day until the development of kindling, i.e., the occurrence of stage 5 of seizures for three consecutive trials. After the completion of kindling procedure, behavioural tests including elevated plus maze and passive avoidance were performed in order to assess learning and memory. Oxidative stress was assessed by estimation of lipid peroxidation and reduced glutathione. The effects of pretreatment with sesamol against PTZ-induced seizures, cognitiveimpairment and oxidativestress were investigated.Results: 32.45 ± 1.86 days after treatment with PTZ, kindling was developed that was associated with myoclonic jerks and generalized tonic-clonic seizures. Moreover, PTZ kindling induced a remarkable cognitive impairment and oxidative stress. Sesamol (30 mg/kg) significantly delayed the development of kindling and prevented seizure-induced cognitive impairment and oxidative stress. Conclusion: Sesamol exerts ameliorative effects in the experimental model of epilepsy. This phytochemical may be considered as a beneficial adjuvant for antiepileptic drugs. Sesamum indicum, Linn, Pedaliaceae), is a traditionally used health supplement which exerts antioxidant, anti-inflammatory, immunomod-ulatory, neuroptotective, anti-aging, chemopreve-ntive, and antidepressant effects -induced kindling, a widely used experimental model for the development of seizure and estim-ation of the effectiveness of antiepileptic drugs. During kindling epileptogenesis, the brain is repeatedly stimulated that initially lowers the seizure threshold leading to the occurrence of seizures . The graAnimals ad libitum, however, animals were deprived of food 12 hr before the behavioural assessment. Experimental proced-ures were approved by the local Ethics Committee. Male Wistar rats weighing 250-280 g from our institution’s laboratory animal centre were randomly assigned and housed three per cage under standard laboratory conditions with a 12-hr light/dark cycle. Food pellets and water were available Treatments ontrol groupsreceived the corresponding vehicle solutions (n=6/group). Injections were performed between 9:00 a.m. and 10:00 a.m. and the injection volume was 1 ml/kg. PTZ was dissolved in 0.9% saline and injected intraperitoneally (IP) at dose of 30 mg/kg once every alternate day (48±2 hr) until the development of stage 5 of seizures for three consecutive trials n=6/gro, 23 30 mPTZ kindlingAfter each injection of PTZ, animals were observed for 30 min in order to assess the seizure activity using the following scale; stage 0: no response, stage 1: hyperactivity, vibrissae twitching, stage 2: head nodding, head clonus and myoclonic jerks, stage 3: unilateral forelimb clonus, stage 4: rearing and bilateral forelimb clonus, stage 5: generalized tonic-clonic seizure (GTCS) and loss of writing reflex . AnimalsBehavioural testsAfter the completion of kindling procedure, behavioural tests were performed (n=6/group). Only one rat was tested at a time.Elevated plus-maze test Spatial learning was evaluated using the elevated plus-maze test as previously described , 26. ThePassive avoidance testA one-trial, step-through, light-dark passive avoidance apparatus was used for the evaluation of emotional memory based on the contextual fear conditioning learning , 28. TheBiochemical testsFollowing the behavioural tests, animals were killed by decapitation and their brains were quickly removed, rinsed with ice-cold saline and stored at -70 ° C for further analysis. Just before the evaluation of oxidative stress, brain tissue samples were thawed and 10% (w/v) homogenates were prepared by ice-cold 0.1 M phosphate buffer (pH 7.4). Aliquots of homogenates were used to assess lipid peroxidation and reduced glutathione. Evaluation of lipid peroxidation Malondialdehyde (MDA) content was determined as previously described . MDA, anMeasurement of reduced glutathioneReduced glutathione (GSH) was measured as previously described . BrieflyStatistical analysispost hoc test was used for the analysis of behavioural and biochemical data. Results are expressed as mean ± SEM . The level of signify-cance was set at P<0.05.The Kolmogorov-Smirnov test was used to verify normal distribution of the experimental data. Repeated measures ANOVA was applied to evaluate the development of seizures in the course of kindl-ing. One-way ANOVA followed by Tukey’s The effect of sesamol on the development of kindlingP<0.05), while, the lower dos-es were ineffective (P>0.05). Pretreatment with 30 mg/kg sesamol significantly reduced the seizure scores .PTZ induced kindling after 32.45 ± 1.86 days . Sesamolffective , P>0.05.The effect of sesamol on the number of myoclonic jerks in kindled ratsP<0.01). The number of myoclonic jerks in PTZ group (The effect of sesamol on the duration of GTCS in PTZ groupP<0.05).Pretreatment with 30 mg/kg sesamol signify-cantly reduced the duration of GTCS as compared to PTZ group , P<0.05.The effect of sesamol on PTZ-induced cognitive impairment using elevated plus-maze P>0.05), while, retention transfer latency was remarkably elevated in PTZ group as compared to the control group (P<0.001). Following the pretreatment with sesamol (30 mg/kg), the retention transfer latency was significantly reduced as compared to PTZ group and the groups pretreated with 10 and 20 mg/kg sesamol (P<0.001) and remained at control level (P>0.05). In the initial transfer latency, there was no significant difference between the groups , P>0.05,ol group , P<0.001 sesamol , P<0.001ol level , P>0.05.The effect of sesamol on PTZ-induced cognitive impairment using passive avoidance test P>0.05), The mean initial latency did not significantly differ between the groups , P>0.05,P<0.001). Following the pretreatment with 30 mg/kg sesamol, the retention latency was significantly increased as compared with PTZ group and the groups pretreated with 10 and 20 mg/kg sesamol (P<0.001) and remained at control level (P>0.05).however, the retention latency was remarkably reduced in PTZ group as compared to the control group , P<0.001 sesamol , P<0.001ol level , P>0.05.The effect of sesamol on brain MDA level in kindled ratsP<0.001). This, was prevented by the pretreatment with 30 mg/kg sesamol (P<0.001 vs PTZ group and the groups pretreated with 10 and 20 mg/kg sesamol). PTZ kindling resulted in a significant enhance-ment of brain MDA level as compared to the vehicle group , P<0.001The effect of sesamol on brain GSH content in kindled ratsP<0.01). GSH level remained significantly lower than vehicle groups following the pretreat-ment with 10 or 20 mg/kg sesamol . GSH content remained at control level following the pretreatment with 30 mg/kg sesamol (P>0.05) and was significa-ntly higher than PTZ group (P<0.05) and the groups pretreated with 10 and 20 mg/kg sesamol .In PTZ-treated rats, brain GSH content was significantly lower as compared to the vehicle group , P<0.01. sesamol , P>0.05 TZ group , P<0.05 In recent years, herbal medicines including those exerting antioxidant and neuroptotective effects have become the focus of intense research. Sesamol is a traditionally used health supplement which ex-erts various cellular effects including antioxidant and neuroprotective effects and has multiple biological targets -14. In tmitochondrial dysfunctionand lipid pero-xidation , exerts high superoxide and NO scavenging activities (As shown in xidation , 33, exetivities and thertivities , 35. Thememory loss or dysfunction. Therefore, the limbic system may be considered as a potential target for the therapeutic action of sesamol. In addi-tion, the increased activity of glutamatergic transm-ission and formation of free radicals play a pivotal role in memory loss (As previously reported, kindled seizures result in neuronal damage in the limbic system including the hippocampus and amygdala that mayory loss , 38, henGSH by scavengingof free radicals, plays a pivotal role in the protection of cells against oxidative damage (As shown in e damage , therefoe damage , demonstSesamol exerts ameliorative effects against seizures, cognitive impairment and oxidative stress in the experimental model of epilepsy. These findings represent sesamol as a beneficial adjuvant for antiepileptic drugs.

Drosophila melanogaster and in human. Although our method does not predict whether the targeted mRNA is degraded and/or its translation to protein inhibited, our quantitative estimates generally track experimentally supported results, indicating that this approach can be used to predict whether an interaction occurs at specified concentrations. Our approach offers a more-quantitative understanding of post-translational regulation in different cell types, tissues, and developmental conditions.MicroRNAs (miRNAs) suppress gene expression by forming a duplex with a target messenger RNA (mRNA), blocking translation or initiating cleavage. Computational approaches have proven valuable for predicting which mRNAs can be targeted by a given miRNA, but currently available prediction methods do not address the extent of duplex formation under physiological conditions. Some miRNAs can at low concentrations bind to target mRNAs, whereas others are unlikely to bind within a physiologically relevant concentration range. Here we present a novel approach in which we find potential target sites on mRNA that minimize the calculated free energy of duplex formation, compute the free energy change involved in unfolding these sites, and use these energies to estimate the extent of duplex formation at specified initial concentrations of both species. We compare our predictions to experimentally confirmed miRNA-mRNA interactions (and non-interactions) in MicroRNAs (miRNAs) are small RNA molecules that regulate post-transcriptional gene expression by binding messenger RNAs (mRNAs), blocking their role in translation or marking them for degradation. To date, computational methods for predicting mRNA targets have assumed an all-or-nothing mode of miRNA-mRNA interaction. Here we introduce a computational approach that predicts the degree of interaction, taking into account initial miRNA and mRNA concentrations. Using this approach, we can predict whether specified interactions are likely to be functionally relevant within physiologically relevant concentration ranges. On this basis we develop a new method that can estimate the quantitative extent of the interactions. We calculate the equilibrium concentrations of the unbound miRNA, unbound mRNA, and miRNA-mRNA duplex from the initial concentrations of the interacting species and free energies of the interactions.Drosophila melanogaster miRNA-mRNA interactions that have been experimentally tested , and to a set of experimentally supported miRNA-mRNA interactions in human. First, we compare the ability of our method to predict target sites as assessed by sensitivity and specificity, to other methods under the same initial concentrations. Then we test the ability of our method to estimate the degree of interaction at the same initial miRNA concentrations used for experimental confirmation. We show that our method can predict target sites at specified concentrations with high accuracy, and that our quantitative estimates generally correlate with experimental results. We also show that some miRNAs can at low concentrations bind to target mRNAs, whereas others are unlikely to bind within a physiologically relevant concentration range.We apply our method to a set of Our method consists of three independent components. First we search for potential target sites by predicted free energy of the miRNA-mRNA duplex, rank these results by energy score, and filter this list requiring presence of a seed match. Second, for each identified potential target site, we compute the thermodynamic parameters described in the two-step model i.e. the net free energy change is zero. If an interaction occurs between the miRNA and mRNA, the change will be always negative.Instead of the free energy change , with most present in <100 copies but a few exceeding 1000 copies ell) see .Drosophila melanogaster reported by Kertesz et al.Drosophila have been examined experimentally using reporter vectors, usually with the full-length in vivo efficiency has been assessed against target structures that are, broadly, similar to those of the native mRNAs. We computed structural energies by folding entire mRNAs where possible; for longer mRNAs it was computationally feasible to fold only the We applied our model to the set of 190 experimentally tested miRNA-mRNA interactions in gion see .Here we assume an initial concentration of 1 y miRNAs . Of 88 my miRNAs ; based oe.g. a miRNA) or non-functional (unable to be bound), Kertesz et al.Since potential sites on an mRNA are usually predicted as either functional , human target sites have often been experimentally confirmed by inserting into the reporter vector only the site under investigation, together with short flanking sequences; therefore the energetics of the native mRNA structure has probably not been properly captured in these experiments. Hence, we selected for comparison 147 target sites for which further functional evidence is available. These sites were manually collected based onThe predicted interactions vary substantially, in extent and properties, among this set of miRNA-mRNA pairs. As shown in i.e. greater reduction of the level of unbound mRNA) than at equal concentrations (1∶1). The differences occur mostly at the highly efficient target sites, where mRNA concentrations are reduced by more than 50%. Target sites with more-moderate efficiency, where the estimated mRNA reduction is Until this point we have assumed equal concentrations for both miRNA and mRNA; however, as described earlier, their concentrations are unlikely to be equal. Therefore, we compared the effect of interactions of different initial concentrations of miRNA and mRNA, focusing on situations in which the concentration of miRNA is tenfold greater than that of the mRNA. As shown in 000∶1000 reduces 000∶1000 . The totFor some of these experimentally confirmed miRNA-mRNA interactions, we predicted that a single miRNA binds to more than one target site on the Among the experimentally supported targets described above in human, miRNA concentrations used for experimental confirmation were reported for 41; one target was confirmed using two different miRNA concentrations . These cIf we require that the predicted mRNA concentration be reduced by at least 20% for the interaction to be considered functionally relevant (the same minimum requirement used in the confirmation experiments: For the remaining 35 sites (36 interactions with unique miRNA concentrations) we recovered, the predicted degree of mRNA reduction generally tracks experimental results, with many successfully predicted target sites falling within (or very close to) eduction . In caseIn vitro confirmation experiments are normally carried out in triplicate, and the degree of mRNA reduction of each repeated experiment can vary Since total mRNA concentrations are rarely reported, we set all mRNA concentrations to equal the corresponding miRNA concentrations and examined miRNA-to-mRNA concentration ratios up to 10∶1. As shown in the previous section, in this range our predictions are robust, as assessed by percent recall. As our approach is based on thermodynamic principles, we anticipate its continued applicability under a broader range of physiologically relevant conditions.in vitro confirmation experiments. Our method estimates the extent to which an mRNA is bound, but cannot predict the outcome of this binding, i.e. whether the bound mRNA may or may not be degraded or its translation inhibited.Although mRNA destabilization is the major contributor to the repression of target-gene activity As shown above, using the benchmark criteria, the predictive power of our method is similar to those of other methods. We compared the target sites predicted by our method and by miRanda (13–77%) . miRandaPITA, like our method, incorporates site accessibility into its searching mechanism, but the predictions of PITAtop include only conserved sites. Overlap between our method and PITAtop is not different from that with other methods compared here. PITA assesses site accessibility; however, the set of PITA targets contains the target sites with positive free-energy changes .We also compared the miRNA targets predicted by five computational methods (including our own) with those identified by Hafner and colleagues approach , show a PAR-CLIP predicts many fewer targets than does any of the computational methods discussed here, with overlap ranging from 1.71–1.87% to 1.31% (our method) to 0.87% (miRanda) of the computationally generated predictions. miRanda recovers the largest proportion of PAR-CLIP targets (50%) from 974 predictions; PicTar, PITAtop and TargetScan 29–45% from 566–864 predictions; and our method 20% from 393 predictions. As miRNAs in the PAR-CLIP dataset are highly expressed in HEK293 cells, their concentrations may be greater than our default 1 t nt 2–7 . AlthougDrosophila miRNA targets, where positive as well as negative experimental results are available. We predicted these targets with 0.73 sensitivity and 0.62 specificity. By these measures the predictive power of our method is similar to that of these other, widely used methods. Next we applied our method to experimentally confirmed targets in human, and showed that we can achieve similar sensitivity (72%). Then we demonstrated how our method can predict targets at different miRNA concentrations. Using the subset of experimentally suported targets for which total miRNA concentrations are available, we predicted 69% of targets correctly at the specified concentrations and mRNA reduction (requiring >20% reduction). We also showed that our quantitative estimates generally correlated with experimental results; most estimates fall within (or very close to) We have developed a computational model that can provide quantitative estimates of RNA-RNA interaction as a function of the concentrations of the interacting species, and have applied our model to predict miRNA-mRNA interactions. Few target sites have been reported with the concentration of total miRNA used in the experiments, necessarily limiting the evaluation of our method. Except as otherwise indicated, we have based our predictions on 1 Both known and unknown factors affect miRNA-mRNA interactions and make quantitative estimation difficult. One factor that directly affects the interactions is the cooperative effects of multiple target sites. A target mRNA bound simultaneously by more than one miRNA may show greater repression than one bound at a single site. However, reports suggest that cooperative effects occur only on target sites that are physically proximate, Another factor that may affect the interactions is the self-folded structure of mature miRNA. Since miRNAs are short, the secondary structures of most mature miRNAs are unstable. However a small number of miRNAs can fold into stable structures (hairpins), or can form a homo-dimer duplex with each other Our results indicate that absolute concentration of miRNAs can be important for regulation. It has been reported that the concentration of a miRNA must exceed a threshold in order for a target mRNA to be suppressed a priori thresholds.Some interactions are robust and can regulate the target mRNAs at low concentrations; other interactions are predicted to be concentration-sensitive within the expected range of physiologically relevant concentrations, while yet others are predicted not to occur at all within physiologically likely concentrations. Computational approaches have proven valuable for predicting which mRNAs can be targeted by a given miRNA; however, although other methods predict which mRNAs can be targeted, they do not capture the sensitivity of the predicted interaction to concentrations of reactants. Incorporating concentration into thermodynamically based miRNA target prediction thus can provide finer-grained prediction while avoiding the artificiality of www.sanger.ac.uk/software/Rfam), and NCBI RefSeq mRNA sequences (mrnaRefseq.txt) were obtained from UCSC (hgdownload.cse.ucsc.edu/downloads.html). mRNAs were mapped to gene annotations using the refFlat files also from UCSC, and the rna.gbff files downloaded from NCBI (ftp.ncbi.nih.gov/refseq).miRNA sequences were obtained from miRBase release 14.0 e.g. miRNA or siRNA) and an entire mRNA has been modelled as a competition between all folded states of the mRNA with or without hybridization of the short RNA to a particular location of the mRNA. The free energy of the folded states of the mRNA in the absence of hybridization is denoted by The interaction between a short RNA and T is the temperature in K.If S (Short) and T (Target) denote the short RNA (miRNA) and the target mRNA, respectively, then [S] and [T] denote their equilibrium concentrations respectively, and [ST] the equilibrium concentration of the hybridized molecular species. Also, and [T], a numerically stable formula for [S] is given byWe also can compute the potential energy of a short RNA in its equilibrium state free energy of the system at equilibrium state may be counted as mismatches by FASTH. We allowed one GU pair in the seed region, as is commonly done for fly We used the FASTH program For any energetically suboptimal duplex to be considered, we requirie it to have a free energy (We used the hybrid-ss-min program (free energy minimization) from UNAFold i.e. if an energy-minimization method with a nearest-neighbor energy model is used to compute the hybridization energy between the two RNA species, then the same method should be used to compute the folding energies; in particular, the fixed-energy model and the nearest-neighbor energy model shold not be mixed. Different models produce different hybridization or folding energies for the same site. Since we compute energy change from multiple free energy values, each free energy has to be obtained using a consistent underlying rule, as otherwise the value of the free energy change is unreliable.The preliminary determination of likely targets, and the more-intensive computations of mRNA folding energies described above, may be accomplished by using different approaches, including partition functions or free energy minimization. Partition functions yield likely target sites through the computation of stochastic samples. Free energy methods do the equivalent by selecting hybridizations that can occur within any prescribed free energy increment from the minimum. While it has been said that the predictions of secondary structures of large RNAs such as mRNAs are poor Although here we have used FASTH The software Ensemble_calc computes the equilibrium concentrations of miRNA, mRNA and miRNA-mRNA in molar concentrations, and the net free energy change . Both the UNAFold and Ensemble_Calc can be downloaded from We estimated the molar concentration of miRNA and mRNA species from the number of RNA copies expressed in a single cell as follows. Given that typical animal cells are 10–30 Table S1Drosophila melanogaster) with initial concentrations of 1 µM for both miRNA and mRNA. The selected target sites shown in List of our predictions on experimentally tested targets in fly ((0.08 MB XLS)Click here for additional data file.Table S2List of our predictions on experimentally supported targets in human with initial concentrations of 1 µM for both miRNA and mRNA. The selected targets sites shown in (0.08 MB XLS)Click here for additional data file.Table S3List of our predictions on experimentally supported targets in human with specified initial concentrations. The predictions are made with the same initial miRNA concentration used in each experiment. The targets that are not predicted by our method using the same concentration but predicted with 1 µM concentration are indicated in light blue, and the sites that are not predicted with 1 µM concentrations are indicated in blue. The miRNA, mRNA, and miRNA-mRNA duplex are normalized equilibrium concentrations.(0.03 MB XLS)Click here for additional data file.Table S4Comparison with other target prediction methods. Our predictions are constructed using the target sites that achieved a >30% mRNA reduction with the initial concentrations of 1 µM for both miRNA and mRNA. Each target consists of a unique (non- redundant) interaction (miRNA-mRNA).(0.04 MB DOC)Click here for additional data file.Table S5List of target sites used for the comparison with other methods. The list contains multiple target sites, if any, for each interaction (miRNA-mRNA).(5.55 MB TXT)Click here for additional data file.Table S6Degree of overlap between PAR-CLIP prediction sets and those of other methods including ours.(0.05 MB DOC)Click here for additional data file.Text S1Description of material for supplemental tables, including additional references.(0.05 MB DOC)Click here for additional data file.

We generated a transgenic mouse with a selective overexpression of CREMα in T cells and introduced a Fas -/- phenotype into the CREMα transgenic mice. CREMα transgenic Fas -/- mice developed a severe lymphadenopathy and splenomegaly as early as 8 weeks of age, while the wildytpe Fas -/- mice did not at this early age. Lymphadenopathy and splenomegaly is paralleled by a massive expansion of pathogenic CD3+CD4-CD8- double negative T cells. Furthermore T cells of CREMα transgenic Fas -/- mice show an enhanced production of IL-21 and IL-17, which are hallmark cytokines of highly inflammatory Th17 cells. Vice versa percentages of regulatory T cells are reduced. The enhanced occurrence of aberrant and inflammatory T cells further leads to increased B cell activation, increased anti-DNA antibody titers and finally shortened life expectation of these mice.The transcription factor cAMP response element modulator (CREM) is a widely expressed transcriptional repressor which is important for the termination of the T cell immune response. CREMα is overexpressed in SLE (Systemic lupus erythematosus) T cells and is supposed to be a key player in orchestrating the transcriptional program of SLE T cells by targeting T cell-relevant genes. To explore the relevance of CREMα Our experiments are the proof of principle for a critical amplifying role of CREMα in autoimmune prone conditions like SLE.

Mental distress is becoming a common health problem among university students. There is limited information in this regard in Ethiopia. This study was aimed to determine the prevalence and associated factors of mental distress among students in Adama University.A cross-sectional study was conducted in March2011. Four hundred and thirteen students were participated in the study. Simple random sampling technique was applied to select the study participants. Self-Reporting Questionnaire-20(SRQ-20) was used to assess the mental distress. Respondents who had a score of eleven and above on the SRQ-20 were considered as mentally distressed.The prevalence of mental distress was 21.6%. Family history of mental illness , frequent conflicts with fellows , Khat (Catha Edulis) chewing and not attending religious program regularly were factors associated with mental distress. Being in second year of their education less likely associated with mental distress.About one fifth of the students were found to be mentally distressed. Designing prevention sand treatments programs addressing the identified factors is important. Mental distress is a mental health problem which manifests with different levels of depressive, anxiety, panic or somatic symptoms.It also presents with confused emotions, hallucination and related symptoms without actually being ill in a medical sense , 2. ThisSignificant proportion of the world population is affected by mental distress of which tertiary education students are the once –8. StudiVarious factors were reported to be associated with the development of mental distress among university students. Separation from pre-existing social support, frustration with academic challenges, social problems, and threats due to high expectations from parents; teachers were reported attributes of mental distress which could present variably in different contexts –18.In Ethiopia, mental disorders was reported to account for 11% of the total burden of diseases . Though This study was a cross-sectional survey conducted among undergraduate students of Adama University; Eastern Ethiopia. It was carried out from March 7-30; 2011. During the study period, the university had more than nine thousand regular undergraduate students of whom twenty percent were females. The study sample size was determined by a single population proportion formula with the assumptions of 95% level of confidence, 5% margin of error, prevalence of metal distress 49% which was taken from previous study conducted in the country [A self-administered structured questionnaire was used to collect the data. The questionnaire was derived from different literatures that included the socio-demographic characteristics, history of substance use, social issues related questions and questions addressing mental distress called Self-Reporting Questionnaire-20(SRQ-20). The questionnaire was first prepared in English and then translated to Amharic for data collection. The level of mental distress was measured using SRQ-20 items , which had been used previously for screening of common mental problems , 24. TheThe data were entered into Epi-Info version 3.5.3 and transferred to SPSS (V16.0) for analysis. For testing the statistical significance, odds ratio with 95% Confidence Level was calculated for each independent variable against the dependent variable using the bivariate logistic regression. Multivariable logistic regression analysis was performed for those variable shown p-value of less than or equal to 0.05 in the bivariate analysis to control for the confounders and identify the independent factors. A p-value less than or equal 0.05 was used to declare the presence statistical significance.Ethical clearance was obtained from the Institutional Research Ethics Review Committee (IRERC) of University of Gonder. A letter introducing the objective of the study, and maintaining the confidentiality was attached as the cover page of the questionnaire. Participants were consented for participation in the study. The right to refuse was clearly stated in the letter if the respondent is not volunteer to participate in the study.Four hundred and thirteen respondents were studied which resulted in a repose rate of 97.3%. Respondents’ age ranges from 18 to 26 years, with a mean of 20.9 ± 1.5(SD) and (80.9%) were within 20-25 years. About 88% were males and most were Orthodox in their religion. A majority were in their second year and beyond in their education (90.0%) . One hunSuicidal ideation one month before the study was 0.9%. The distribution of SRQ-20 showed a mean score of 5.87 ± 4.82 ranging between 0 and 19 . The preDifferent factors associated with mental distress were identified. A higher level of mental distress was reported among students who have had conflicts with their fellow son different personal and social issues (OR 95% CI=2.26 (1.10 - 4.85)). Reported family history of mental illness was significantly associated with mental distress (OR with 95% CI=2.30 (1.10 - 4.81)) and those who had history of Khat chewing were more likely mentally distressed . Being in second years of education was found to be a protective factors and mental distress was low among those regular religious programs attenders, irrespective of what their religion .About one fifth 21.6%) of the study participants were mentally distressed. This finding is lower than what were reported from Malaysia, Spain, United Kingdom, Singapore, USA and Australia where a prevalence of 30%-57% of mental distresses were reported , 27–28. .6% of thThe likelihood of mental distress was higher among ever Khat chewer. This built on what was reported by Damena and his colleagues where Khat chewing was found to be significant predictor of mental distress . This isReligious teachings and advises help in stress management and as well facilitate the development of adaptive behaviors of individual's life , 32–35. In the study, parent marital condition, ethnicity, and gender of the respondents were not significantly associated with mental distress and similar findings were also reported , 21. ThoThis study was not without limitations. Reports for some of the questions were past history or encounters which are prone to recall bias. Variables like Khat chewing and other substances are by nature a sensitive issue and social desirability bias is unavoidable.About one fifth (21.6%) of the university students had mental distress. The likelihood of having mental distress were higher among students who had family history of mental illness, never attended religious programs, frequent conflicts with their fellows and chew khat. Designing preventions and treatments programs tailored to the contexts is essential.

Familial Mediterranean fever (FMF) and Crohn’s disease (CD) are autoinflammatory disorders, associated with genes (MEFV and NOD2/CARD15), encoding for regulatory proteins, important in innate immunity, apoptosis, cytokine processing and inflammation. While mutations in the MEFV gene were shown to modify CD, the role of NOD2/CARD 15 gene mutations in the FMF disease phenotype was never studied before.The cohort consisted of 103 consecutive children with FMF, followed in a single referral center. NOD2/CARD15 genotypes were analyzed in all patients and 299 ethnically matched unaffected controls. Demographic data, clinical characteristics and disease course of FMF patients with and without NOD2/CARD 15 mutation were compared.A single NOD2/CARD 15 mutation was detected in 10 (9.7%) FMF patients and 26 (8.7%) of controls. No homozygotes or compound heterozygotes were discovered in the 2 groups. FMF patients carrying a NOD2/CARD 15 mutation had higher rate of erysipelas-like erythema and acute scrotum attacks and a trend for higher rate of colchicine resistence and a more severe disease as compared to patients without mutations.NOD2/CARD 15 mutations are not associated with a susceptibility to develop FMF, yet the presence of these mutations in FMF patients appears to be associated with a trend to a more severe disease.

Ecklonia kurome Okamura, and their chemical structures were determined by spectroscopic method. The isolated yield of the total of 974-A and 974-B was approximately 4% (w/w) from the polyphenol powder. In 974-A, the carbon at the C2′ position in the A ring of phlorofucofuroeckol-A forms a C–C bond with the carbon at the C2″ position of the C ring of triphloretol-B, while in 974-B, phlorofucofuroeckol-B and triphloretol-B form a C–C bond in the same manner as in 974-A. These structures were supported by high resolution-MS/MS data. To evaluate the antioxidant activities, the 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay and intracellular radical scavenging assay, using 2′,7′-dichlorofluorescin diacetate (DCFH-DA), were performed for 974-A, 974-B, and four known phlorotannins. The results of the DPPH assay showed that the IC50 values of 974-A, 974-B, phlorofucofuroeckol-A, and dieckol were significantly smaller than those of phlorofucofuroeckol-B, phloroglucinol, α-tocopherol, and ascorbic acid. Furthermore, the DCFH-DA assay suggested that 974-A, 974-B, and dieckol reduce intracellular reactive oxygen species most strongly among the tested compounds.Two novel phlorotannins with a molecular weight of 974, temporarily named 974-A and 974-B, were isolated from the polyphenol powder prepared from the edible marine brown alga Based on the means of linkage, phlorotannins can be classified into four subclasses: phlorotannins with an ether linkage , with a phenyl linkage (fucols), with an ether and a phenyl linkage (fucophlorethols), and with a dibenzodioxin linkage −) at m/z 973 was detected using electrospray ionization mass spectrometry (ESI-MS) in high intensity. Phlorotannins, the oligomers and polymers of phloroglucinol ,3, antimrmalols) , antiallrmalols) , antitumrmalols) , and tyrrmalols) . Recentl-Ay mice . E. kuro dieckol , 8, 8,8′a et al. ,12,13. R1) and 974-B (2) of which molecular weights are 974 from the crude polyphenol powder prepared from E. kurome. Although two phlorotannins with the same molecular weight (974) have recently been reported from Ecklonia cava radical scavenging activity, and by intracellular radical scavenging activity using 2′,7′-dichlorofluorescin diacetate (DCFH-DA), and compared with those of reported phlorotannins, phlorofucofuroeckol-A , phlorofucofuroeckol-B , and one set of meta-coupling 2H doublet signal and 1H triplet signal [δ 5.87 /δ 5.91 ] (based on 1H–1H COSY correlations) were observed. The chemical shifts of the three singlet signals of 1 were close to those of 3 which were assigned to H3, H9 and H13 by comparison with previously reported NMR data of 3 in (CD3)2SO , and these signals in 3 were assigned to H2′/H6′ and H4′ in the A ring, or H2″/H6″ and H4″ in the E ring . Based on these data, 1was presumed to contain the structural moiety of 3. 13C NMR signals of 1 were assigned on basis of 1JC,H and 2,3,4JC,H correlations shown on their HSQC and HMBC spectra . Thus, the remaining part of 1 from 3 moiety was suggested to be composed of three aromatic rings based on the molecular formula of 1.0 °C See . Althoug 1 and 2 . In the als of 3 . The lar1 was indicated to have 16 hydroxyl groups in the molecules as described above, a phenyl linkage should be present in the remaining part of 1 from 3. The characteristic 13C signals observed at δ 102.4 and δ 102.6 in 1 were presumed to form a C–C bond between them. One set of 1H triplet 1H NMR signal at δ 5.91 (J = 2.06 Hz) coupling with 2H doublet signal at δ 5.96 (J = 2.06 Hz) assigned to the protons in the A or E rings in 3 was not shown in 1. These data suggested that the part composed by the additional three aromatic rings should be connected to the A or E rings of 3 by phenyl linkage in 1.Since 1 from 3 was suggested to have the structural feature of triphlorethol-B (6) and 2.6 ppm (13C), respectively, as shown in 1 was suggested to have the structure whereby the carbon at the C2 position of the A or E rings of 3 forms a C–C bond with the carbon at the C2 position of the C ring (C2″) of 6. The possibility that the C4 position, instead of the C2 position, in the A or E rings in 1 forms a C–C bond with the F ring in 1 can be ruled out for the following reason: A or E rings would be symmetric in this case, but the rings which form the C–C bond (A and F rings) in 1 were suggested to be asymmetrically substituted by the NMR data of A and F rings showing six 13C signals at the different chemical shifts and two doublet 1H signals at the different chemical shifts coupling with each other (see The remaining part of ol-B (6) , a repor , Table 1rotannin which co3) moiety is connected to the C ring of triphlorethol-B (6), in 1. In CD3OD, the assignment of NMR signals corresponding to those in the A and E rings in 3 are interchangeable with each other due to their similar substitutive features, because NOE was not observed between the protons in the different rings. However, these signals were distinguished and assigned in (CD3)2SO in a previously published paper −m/z 601, 741 and 973 in ESI-MS spectra, indicating the presence of 1, 2, 3, 4, and 8. This fraction was concentrated using rotary evaporator , divided into three portions, and each portion was applied to another reversed phase column, a Mightysil RP-18 GPII , equilibrated with formic acid/methanol/water at 30 °C. Elution of phlorotannins with the same solvent was monitored by a Hitachi diode array detector L-7455 and ESI-MS analysis. Dieckol (8) (5 mg), 974-B (2) (9 mg) and 974-A (1) (6 mg) were mainly eluted in 90–100 mL, 105–120 mL and 130–140 mL fractions, respectively, in almost pure forms. Further, PFF-B (4) (1 mg) and PFF-A (3) (4 mg) were mainly eluted in 140–150 mL and 155–165 mL, respectively . 1, 2, 3, 4, and 8 were obtained as light brown powder. 3 −m/z 973.1069, calcd for C48H29O23 973.1100, Δ −3.1 mmu, 2: [M − H]−m/z 973.1062, calcd for C48H29O23 973.1100, Δ −3.8 mmu (see This crude polyphenol powder (500 mg) dissolved in 0.9 mL of water/methanol was subjected to reversed phase liquid chromatography on a Cosmosil 75C mmu see .2 (2.2 mg) in the mixture of acetic anhydride (300 μL) and dehydrated pyridine (600 μL) was allowed to stand for 18.5 h at room temperature [2 gas and dissolved in acetonitrile. The solution was subjected to reversed phase HPLC purification on a Mightysil RP-18 GP II (4.6 i.d. × 250 mm) equilibrated with formic acid/acetonitrile/water at 30 °C. Then, acethylated 974-B (2a) was eluted with acid/acetonitrile/water . Elution was monitored by a Hitachi diode array detector L-7455. Acethylated 974-B (2a): HR-FAB-MS . Acethylation for 1 was simplified as follows. 1 (10 μg) was acethylated in the mixture of acetic anhydride (30 μL) and dehydrated pyridine (60 μL) as described above. Then, the mixture was partitioned between ethyl acetate and water. A part of the ethyl acetate layer was applied to HR-ESI-TOF MS in flow injection mode : .perature of purified 1 (2 ng) and 2 (2 ng) were applied to the spectrometer using an autosampler (Shimadzu SIL-30AC) and an LC-pump (Shimadzu LC-30AD).HR-ESI-MS/MS (negative) spectra of mode see with met1, 2, 3, 4, and 8 were isolated from E. kurome as described above, and quantified by weighting after completely drying under low pressure, and also by 1H NMR using the ratio of the integration values of 1H signals of the compounds and the signal of CHD2OD [et al. [et al. [1–4, 7, 8, and DL-α-tocopherol in ethanol, and L-ascorbic acid in water) was mixed with 95 μL of the 1:1 (v/v) mixture of 0.4 mM ethanolic solution of DPPH and 100 mM aqueous MES (sodium 2-(N-morpholino)ethanesulfonate) buffer (pH 6.0) in a well using a plate mixer for 1 min. After incubation for 30 min at 37 °C in the dark, absorbance of each well was measured at 540 nm setting the reference at 650 nm using a microplate reader . Absorbance was measured at 540 nm instead of 517 nm just for the instrumental reason of our microplate reader. It was confirmed that statistic difference was not detected between the IC50 values of α-tocopherol determined at 540 nm and that at 510 nm (only 510 nm filter was available for this test). The final concentrations of the compounds were at the range of 0.5–500 μM. The radical scavenging activity of the samples was calculated as a ratio of remaining free radical of DPPH according to Asample/Acontrol, where Acontrol is the absorbance of DPPH incubated without test compound, and Asample is the absorbance of DPPH incubated with test compound. All experiments were carried out in triplicate, with each concentration tripled, except for α-tocopherol (five times) and 4 (four times). The IC50 values, obtained using Hill plots from three independent experiments, were statistically compared among all the tested compounds by a one-way ANOVA, followed by the Tukey-Kramer test for multiple comparisons.f CHD2OD . DPPH ra [et al. , and Kim [et al. with modet al. [2 and 37 °C. The cells were inoculated at density of 5 × 104 cells/well and differentiated into macrophage-like phenotypes by incubation with 40 nM of phorbol-12-myristate-13-acetate (PMA) for 48–72 h [2O2 in HBSS was added to cells. All these steps were performed under dark condition. The formation of 2′,7′-dichlorofluorescein (DCF) from DCFH-DA, due to deacetylation by intracellular esterase and oxidation in the presence of ROS, was read after 2.5 h incubation in the dark at the excitation wavelength (Ex) of 485 nm and the emission wavelength (Em) of 540 nm using a fluorescence microplate reader . As the control, the cells were only treated with H2O2, and not treated with antioxidant. Six wells were measured for each compound, and the experiments were tripled. The fluorescent intensity was statistically compared among tested compounds by a one-way ANOVA, followed by the Turkey-Kramer test for multiple comparisons.The cellular radical scavenging activities of phlorotannins were estimated by the method using DCFH-DA by following the report by Li et al. with mod 48–72 h in micro2 and 37 °C. Cytotoxic effects were evaluated using WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5--2H-tetrazolium, monosodium salt) assay [4 cells/100 μL/well into 96-well plates and differentiated into macrophage-like phenotypes by incubation with 40 nM of PMA containing medium [1, 2, 3, 4, 7, and 8, and 0.1% ethanol (v/v) for 24 h. P388 and Neuro2A were inoculated at density of 2.5 × 104 cells/100 μL/well into 96-well plates and treated with 15 μM of 1 or 2 and 0.25% of DMSO (v/v). After a 24-h incubation, 5 μL of WST-8 was added to the cells and then further incubated for 2.5 h. The absorbance at 450 nm was measured, setting the reference at 655 nm, using a microplate reader . For control, the cells were also incubated in a medium containing 0.1% ethanol (THP-1) or 0.25% of DMSO (P388 and Neuro2A) in the absence of phlorotannins.THP-1 see, , P388 (mt) assay . THP-1 cg medium for 72 hEcklonia kurome, and their structures were determined mainly by NMR analysis and supported by HR-MS/MS data. They showed DPPH radical scavenging activities as potent as dieckol and phlorofucofuroeckol-A, and more potent than phlorofucofuroeckol-B, phloroglucinol, α-tocopherol, and ascorbic acid. They also showed significantly higher intracellular radical scavenging activity than phlorofucofuroeckol-A, phlorofucofuroeckol-B, and quercetin using DCFH-DA dye. The viability of three tumor cell lines was not affected by 974-A and 974-B at the minimum of 15 μM, indicating their potency as natural antioxidants.Two novel phlorotannins (molecular weight 974) temporarily named 974-A and 974-B, were isolated from the edible brown alga

In Japan, the Research Committee on Intractable Vasculitides, supported by the Ministry of Health, Labour and Welfare, has been promoting basic and clinical research on vasculitis since 1972. The present Research Committee on Intractable Vasculitides comprises 4 subcommittees under the direction of a Principal Investigator: Basic and Pathological Research Subcommittee, Clinical Research Subcommittee of Small and Medium-sized Vessel Vasculitis, Clinical Research Subcommittee of Large-sized Vessel Vasculitis, and International Cooperation Research Subcommittee. Since 2008, 9 nationwide clinical studies for vasculitis have been conducted and 8 clinical and basic studies are in progress. The Research Committee on Intractable Vasculitides, supported by the Ministry of Health, Labour and Welfare of Japan, has conducted and promoted basic and clinical research on vasculitis since 1972. We study 9 diseases: Takayasu arteritis, temporal arteritis, polyarteritis nodosa, Buerger disease, microscopic polyangiitis, granulomatosis with polyangiitis, eosinophilic granulomatosis with polyangiitis, antiphospholipid syndrome, and rheumatoid vasculitis. Experts from several fields including nephrology, rheumatology, pulmonology, dermatology, cardiology, vascular surgery, pathology, epidemiology, and otorhinolaryngology work cooperatively. The present Research Committee on Intractable Vasculitides comprises 4 subcommittees under the direction of a Principal Investigator (Hirofumi Makino):Basic and Pathological Research Subcommittee of Vasculitis Syndrome (Yasunori Okada), Clinical Research Subcommittee of Small and Medium-sized Vessel Vasculitis Syndrome (Yoshihiro Arimura), Clinical Research Subcommittee of Large-sized Vessel Vasculitis Syndrome (Kazuo Tanemoto), and International Cooperation Research Subcommittee of Vasculitis Syndrome patients and a naTo describe the current treatment status and evaluate the effectiveness of these treatments for Japanese patients with all types of antineutrophil cytoplasmic antibodies (ANCA)-associated vasculitides (AAV), we conducted a nationwide prospective cohort study of remission induction therapy in Japanese patients with AAV (RemIT-JAV). Twenty-two university hospitals and referring hospitals participated in this study; consecutive patients newly diagnosed with AAV were enrolled from April 2009 to December 2010. The criteria of primary systemic vasculitis proposed by the European Medicines Agency (EMEA) algorithm was employed for enrollment [Based on our retrospective study elucidating the risk factors for relapse in patients with myeloperoxidase (MPO)-ANCA positive MPA , we are After RemIT-JAV, we conducted a nationwide, prospective cohort study of remission induction therapy in Japanese patients with ANCA-associated vasculitides and rapidly progressive glomerulonephritis (RemIT-JAV-RPGN) (UMIN000005136) including 47 university hospitals and referring hospitals. Enrollment of consecutive patients newly diagnosed with AAV began in April 2011 and will continue till December 2013. The primary and some secondary outcome measures are the same as those in RemIT-JAV, but pathological analysis of renal involvement and radiological analysis of pulmonary involvement will be added. Further, biological samples will be collected and offered to the Basic and Pathological Research Subcommittee for Research for identifying candidate biomarkers.We also conducted a nationwide Japanese prospective observational study on the current state and efficacy of therapeutics for large-vessel vasculitis (UMIN000010414). The subjects included patients newly diagnosed with Takayasu arteritis and giant cell arteritis. The study objective was to clarify the current state and efficacy of therapeutics for large-vessel vasculitis in Japan and to evaluate the utility of the current diagnostic criteria and classification for large-vessel vasculitis. The primary outcome measure of this study is remission rate. The study began in November 2012, and patients will be registered until March 2014. Final follow-up will be completed in March 2016.The International Cooperation Research Subcommittee is leading the effort to join some international collaborative clinical research studies: the Diagnostic and Classification Criteria in Vasculitis Study (DCVAS) (NCT01066208), the Plasma Exchange and Glucocorticoid Dosing in the Treatment of ANCA-Associated Vasculitis (PEXIVAS) Study (NCT00987389), and a comparison study of phenotype and outcome in microscopic polyangiitis between Europe and Japan.A genome-wide association study in AAV patients registered in the Japanese clinical studies RemIT-JAV and RemIT-JAV-RPGN, and a prospective study of the severity-based treatment protocol for Japanese patients with MPO-ANCA-associated vasculitis (JMAAV) , is also

RyRs were isolated from rat hearts, perfused in a Langendorff apparatus for 5 min and subject to 1 min perfusion with 1 µM isoproterenol or without (control) and snap frozen in liquid N2 to capture their phosphorylation state. Western Blots show that RyR2 phosphorylation was increased by isoproterenol, confirming that RyR2 were subject to normal ß-adrenergic signaling. Under basal conditions, S2808 and S2814 had phosphorylation levels of 69% and 15%, respectively. These levels were increased to 83% and 60%, respectively, after 60 s of ß-adrenergic stimulation consistent with other reports that ß-adrenergic stimulation of the heart can phosphorylate RyRs at specific residues including S2808 and S2814 causing an increase in RyR activity. At cytoplasmic [Ca2+] <1 µM, ß-adrenergic stimulation increased luminal Ca2+ activation of single RyR channels, decreased luminal Mg2+ inhibition and decreased inhibition of RyRs by mM cytoplasmic Mg2+. At cytoplasmic [Ca2+] >1 µM, ß-adrenergic stimulation only decreased cytoplasmic Mg2+ and Ca2+ inhibition of RyRs. The aK and maximum levels of cytoplasmic Ca2+ activation site were not affected by ß-adrenergic stimulation.Here we investigate how ß-adrenergic stimulation is mediated by 1) increasing the activating potency of Ca2+ binding to the luminal Ca2+ site and decreasing its affinity for luminal Mg2+ and 2) decreasing affinity of the low-affinity Ca2+/Mg2+ cytoplasmic inhibition site. However in systole, ß-adrenergic stimulation is mediated mainly by the latter.Our RyR2 gating model was fitted to the single channel data. It predicted that in diastole, ß During this response, increased catecholamine concentrations stimulate cardiac β-adrenergic receptors, resulting in adenylyl cyclase activation, increased cyclic AMP and increased activity of cyclic AMP-dependent protein kinase A (PKA). Increased intracellular causes contraction. Diastolic relaxation occurs with cessation of Ca2+ release and Ca2+ sequestration by the SR Ca2+ uptake transporter (sarcoplasmic/endoplasmic reticulum Ca2+-ATPase) Systolic contraction follows activation of sarcolemmal voltage-gated L-type Ca32P incorporation assays and known to be phosphorylated in vivo; namely S2808/S2809, S2814/S2815 (depending on the species) and S2030 in vitro phosphorylation sites on RyR2 -adrenergic stimulation is limited by a lack of knowledge of how RyR2 is regulated by phosphorylation within the cell. Most investigations show increased RyR2 activity in lipid bilayers with in vitro phosphorylation at these sites by exogenous PKA and CaMKII 2+2+ inhibition -adrenergic stimulation. Therefore, just how ß-adrenergic signaling alters regulation of RyR2 by luminal and cytoplasmic Ca2+ and Mg2+ is unknown. In this study, we perfused isolated rat hearts with the ß-adrenergic agonist, isoproterenol, then incorporated RyR2 from these hearts into artificial lipid bilayers whilst preserving their phosphorylation state. The response of RyRs to luminal and cytoplasmic Ca2+ and Mg2+ indicated significant and novel changes in RyR2 function associated with increased RyR2 phosphorylation at S2808 and S2814 induced by ß-adrenergic stimulation. Since it is not feasible to measure RyR2 regulation under diastolic [Ca2+] and [Mg2+] (their activity is too low), we used a RyR2 gating model to predict the effects of ß-adrenergic stimulation on RyR2 activity within cells under diastolic conditions.Three phosphorylation sites have been confirmed by Healthy male adult rats (Sprague-Dawley) were heparinized , and anesthetized with Isoflurane. Hearts were rapidly removed and immediately perfused via the Langendorff method . Homogenization was carried in 3×15 s bursts with a rotor-stator homogenizer (HD Scientific) followed by 10 manual strokes of a loose glass/glass Dounce homogenizer. The homogenate was then centrifuged at 7000 rpm for 20 min in Beckman Optima L-100XP Ultracentrifuge. The resulting supernatant was centrifuged at 50000 rpm for 30 min. The pellet from this step was re-homogenized with a tight manual glass/glass Dounce homogenizer in homogenization buffer also containing 0.65 M KCl , incubated for 30 min and then centrifuged at 7000 rpm for 15 min. The supernatant was centrifuged at 50000 rpm for 1 h, and the resulting pellet was resuspended in storage buffer, snap frozen in liquid nitrogen and stored at −80°C. The NaF present in our buffers was to prevent ongoing activity of phosphatases (PP1 and PP2A) during SR vesicle preparation. The whole procedure was carried out at 4°C.cis (cytoplasmic) and trans . For vesicle fusions the cis solution contained (mM): 250 Cs+ , 1–5 CaCl2 , and 500 Mannitol ; while trans solution contained (mM): 50 Cs+ , 0.1 CaCl2 and 10 TES. For channel recordings, [Cs+] in trans solution was raised to 250 mM by adding an appropriate volume of 4 M CsCH3O3S. During experiments the composition of the cis solution was altered by local perfusion, which provided solution exchange within ∼1 s trans solutions was altered by addition of aliquots of stock solutions. All experiments were performed at room temperature (21–26°C).Lipid bilayers were formed form a mixture of phosphatidylethanolamine and phosphatidylcholine (8∶2 wt/wt) in 50 mg/ml n-decane. Lipid bilayers were formed across a delrin hole (approximately 100 µm diameter), separating two experimental compartments, N-tris [hydroxymethyl] methyl-2-aminoethanesulfonic acid; ICN Biomedicals) and adjusted to pH 7.4 by CsOH , using a TPS digital pH meter. Free [Ca2+] ≤3 µM was buffered using 4.5 mM BAPTA ethane- N, N, N’, N’- tetraacetic acid; Invitrogen) and additional 1 mM dibromo BAPTA was used for 10 µM free Ca2+. Sodium citrate was used to adjust free [Ca2+] between 10–50 µM. A Ca2+ electrode (Radiometer) was used to determine free [Ca2+] in the experimental solutions and the purity of Ca2+ buffers and Ca2+ stock solutions using titrations against a 100 mM CaCl2 standard (Fluka).All solutions were made with MilliQ water and were pH buffered with 10 mM TES . The ratio of fluorescence intensities at 340 and 380 nm were calibrated in the experimental solutions also containing 5 µM Mag-fura-2, 4.5 mM BAPTA, (free [Ca2+] <1 µM) and MgCl2 from aliquots of a calibrated stock.All recording solutions contained ATP , which buffers MgStandard techniques were used for SDS PAGE and Western Blotting . We also used an antibody against dephosphorylated S2808 (DepS2808) as a cross check for pS2808. The average degree of S2808 phosphorylation was quantified as both pS2808 immunostaining relative to maximum PKA phosphorylation and also DepS2808 staining (1- DepS2808 staining) relative to minimal phosphorylation in PP1 incubated samples. Similarly, S2814 phosphorylation was expressed as pS2814 immunostaining relative to maximal phosphorylation levels achieved using calcium calmodulin (CaCaM) to activate endogenous CaMKII. Maximal and minimal phosphorylation levels were determined from the time courses of phosphorylation during incubations with PP1, PKA and CaCaM . Significance was calculated by Student’s All experimental procedures were approved by the University of Newcastle Animal Care and Ethics Committee (A-2009-153).Mean heart rate was 220±18 bpm . S2814 phosphorylation in control hearts was not different to RyR2 dephosphorylated by PP1 with 2 mM ATP and the luminal bath contained 0.1 mM Ca2+. We investigated the concentration dependencies of cytoplasmic and luminal Ca2+]. RyR2 was dephosphorylated in-bilayer by adding PP1 (7–10 units) to the cis bath for 5 min either by local perfusion or by aliquot addition of PP1 cis chamber was perfused with solutions lacking PP1 and with cytoplasmic [Ca2+] of 100 nM or 10 µM and the same channel was recorded again (recordings shown in 2+ (2+ (n = 7), PP1 did not change either opening rate or mean open duration . oP) due to an increase in RyR opening rate whereas PP1 incubation led to a 15-fold decrease in oP due to decreases in both opening rate and mean open duration.RyR2 was dephosphorylated to assess whether changes in RyR2 activity after ß-adrenergic stimulation were due to increased RyR2 phosphorylation. The activity of RyR2 from control and isoproterenol stimulated hearts was measured with 100 nM and 10 µM cytoplasmic (minP) with no significant effect on aK for activation or maximal Ca2+ activation (maxP), suggesting that the Ca2+ sensitivity of the cytoplasmic Ca2+ activation site of RyR2 was not affected by isoproterenol. The Ca2+ dependencies of oP were also reflected in RyR2 opening rate .RyR2 from control and isoproterenol stimulated hearts were strongly activated by micromolar cytoplasmic Ca µM Ca2+ and inhiing rate . At sub 2+ from 10 to 100 µM. 2+]-dependencies of the oP, opening rate (ok) and mean open time (oT) of control and isoproterenol treated RyR2 with diastolic (100 nM) cytoplasmic [Ca2+]. In the absence of luminal Ca2+, RyR2 from control and stimulated groups had a mean o = P0.003 and exhibited a bell-shaped luminal [Ca2+]-dependence with peak activity occurring in the presence of ∼100 µM. Peak oP of RyRs from the isoproterenol-stimulated hearts was 4-fold larger (oP = 0.045) than control was previously shown to be due to Mg2+ competing with Ca2+ at cytoplasmic and luminal Ca2+ activation sites; in RyRs from control and stimulated hearts (2+ inhibition of oP (iK (p = 0.003) by 4.5-fold compared with control than control, indicating decreased Mg2+ inhibition via the low affinity divalent binding site.We also investigated effects of adrenergic stimulation on Mgmic Ca2+ . We foun2+ activation properties of rat RyR2s in the presence of physiological concentrations of cytoplasmic Mg2+ (1 mM) and in the presence of 1 mM luminal Ca2+ and cytoplasmic domains (A-site) of RyR2 have Ca2+ affinities of 8 µM and 2 µM, respectively. These sites trigger a common gating mechanism to produce synergistic activation by luminal and cytoplasmic Ca2+. The cytoplasmic domain also possesses two inhibitory sites with Ca2+ affinities of 0.4 µM (I1-site) and 1.5 mM (I2-site). Magnesium, which competes with Ca2+ at the L-, A- and I2-sites, inhibits RyRs and shapes the Ca2+-dependent activation of RyRs 2+ and Mg2+ can pass through open channels and act at cytoplasmic facing sites.The RyR2 gating model considers Ca2+ The opening rate in response to Ca2+ binding to the luminal Ca2+ activation site (L-site) increased 20-fold, accounting for the increased opening rate at low cytoplasmic [Ca2+] was slowed 2-6-fold, accounting for the increase in mean open duration (2+/Mg2+ inhibition site (I1-site) was reduced by 40%, accounting for the reduced Ca2+ inhibition (2+ inhibition in the presence of 10 µM cytoplasmic Ca2+ (2+ activation site (A-site). Model fits to the data indicated a 25% change in the Mg2+ affinity of the A-site which accounted for the systematic, though non-significant increase in RyR activity in RyR opening rates and mean open durations , and 6 w2+ . None thc [Ca2+] and incring rate . 2) Therhibition , 3) RyR2duration . 4) The hibition and Mg2+mic Ca2+ . Interes2+ in cytoplasm and lumen is 1 mM, 2) Ca2+ and Mg2+ fluxes through RyR2 are slightly larger in the presence of intracellular [K+] than with 250 mM Cs+ and that 3) intracellular Ca2+ buffering is substantially weaker and slower in the cell than in our bilayer solutions. Assumptions 2 and 3 affect the feed-through parameters, AX and IX in the model , the model predicts a RyR2 open probability in the range 10−7 to 10−6 which is far too small to be measured by single channel recording. Under these conditions, ß-adrenergic stimulation increases RyR2 oP by 20-fold, which was due to an increase in the ability of luminal Ca2+ to activate the RyR (The model predicts that under systolic conditions where cytoplasmic [Ca RyR2 Po . This isand Mg2+ . Under d the RyR .1- and I2-sites during ß-adrenergic stimulation contribute to increasing RyR2 oP under both diastolic (2+ binding to the L-site contributes a 3-fold increase in RyR2 activity during ß-adrenergic stimulation (2+)), decreased Mg2+ inhibition at the L-site contributed another 50% increase (2++Mg2+)) and reduced cytoplasmic Mg2+ inhibition contributed another 3-fold increase in activity (1-site and A-site contributed ∼1.7-fold each). The I2- and A-sites made no significant contribution to ß-adrenergic stimulation. In systole, the only significant contribution to ß-adrenergic stimulation came from a decrease in cytoplasmic Mg2+ inhibition and supra-physiological luminal Ca2+ (50 mM). However, the degree of RyR activation seems to depend on the presence of ATP and Mg2+. In the absence of ATP and Mg2+, isoproterenol stimulation caused a 15-fold increase in RyR2 activity and less than a 2-fold increase in the presence of ATP 2+. Here, we present the first investigation of how ß-adrenergic stimulation alters the various Ca2+ and Mg2+ regulation mechanisms in RyR2 and their relative roles in physiological Ca2+ release from the SR. We identify four actions of ß-adrenergic stimulation on RyR2 gating which we associate with three mechanisms: #1) a 3- to 5-fold increase in RyR2 activation by luminal Ca2+ (2+ (2+ binding site (L-site) 2+ inhibition at mM concentrations increased RyR2 mean open durations (2+ inactivation (I2-site). The cytoplasmic Ca2+ activation, associated with the cytoplasmic Ca2+ activation site ; consistent with the finding that exogenous CaMKII removes Mg2+ inhibition with 5–10 µM Ca2+et al.Regulation of RyR2 by phosphorylation and luminal Cain vitro Langendorff perfusion method so that hearts could be snap frozen within one minute of administering isoproterenol. perfusion of isolated rat hearts, 2) data acquisition and analysis, 3) SDS PAGE and Western Blotting, 4) in-vitro Exogenous PP1, PKA and endogenous CaMKII activity assays and 5) a summary of heart rates and phosphorylation levels determined by Western Blots for each heart used in this study (Table S1). Additional details of the model are included in Tables S2 and S3.(DOCX)Click here for additional data file.File S2Figures of supporting information on the analysis of phosphorylation of RyR2 in Western Blots. These figures demonstrate 1) the feasibility of reprobing Western Blots, 2) the time course of PP1 incubation of SR vesicles, 3) the time course of binding by antibodies to phospho-S2808 and phospho-S2814 in response to PKA and CamKII incubation, 4) that endogenous phosphatases do not alter S2808 phosphorylation in bilayer experiments and 5) that ATP does not alter S2814 phosphorylation in bilayer experiments.(PDF)Click here for additional data file.

In Norway almost all pregnant women attend one routine ultrasound examination. Detection of fetal structural anomalies triggers psychological stress responses in the women affected. Despite the frequent use of ultrasound examination in pregnancy, little attention has been devoted to the psychological response of the expectant father following the detection of fetal anomalies. This is important for later fatherhood and the psychological interaction within the couple. We aimed to describe paternal psychological responses shortly after detection of structural fetal anomalies by ultrasonography, and to compare paternal and maternal responses within the same couple.A prospective observational study was performed at a tertiary referral centre for fetal medicine. Pregnant women with a structural fetal anomaly detected by ultrasound and their partners and 100 with normal ultrasound findings (comparison group) were included shortly after sonographic examination (inclusion period: May 2006-February 2009). Gestational age was >12 weeks. We used psychometric questionnaires to assess self-reported social dysfunction, health perception, and psychological distress : Impact of Event Scale. General Health Questionnaire and Edinburgh Postnatal Depression Scale. Fetal anomalies were classified according to severity and diagnostic or prognostic ambiguity at the time of assessment.Median (range) gestational age at inclusion in the study and comparison group was 19 (12–38) and 19 (13–22) weeks, respectively. Men and women in the study group had significantly higher levels of psychological distress than men and women in the comparison group on all psychometric endpoints. The lowest level of distress in the study group was associated with the least severe anomalies with no diagnostic or prognostic ambiguity (p < 0.033). Men had lower scores than women on all psychometric outcome variables. The correlation in distress scores between men and women was high in the fetal anomaly group (p < 0.001), but non-significant in the comparison group.Severity of the anomaly including ambiguity significantly influenced paternal response. Men reported lower scores on all psychometric outcomes than women.This knowledge may facilitate support for both expectant parents to reduce strain within the family after detection of a fetal anomaly. In Norway about 98% of pregnant women attend the routine ultrasound examination at 18 weeks of gestation. Detection of fetal structural anomalies triggers psychological stress responses in the women affected . NeverthFrom studies addressing the impact of routine ultrasound examination on the psychological well-being of expecting parents, we know that men report less distress symptoms compared to women . In thesIn a previous study we showed that maternal psychological distress shortly after detection of a fetal malformation was related to the severity of the anomaly, diagnostic and prognostic ambiguity, and gestational age . The aimPregnant women and their partners were included consecutively from May 2006 to February 2009. Convenience sampling for both groups was undertaken, i.e. inclusion of subjects was not performed during vacations and in periods with heavy clinical workload. This paper concerns the responses of the fathers. The women (and their partners) were excluded if they were not fluent in Norwegian, were less than 18 years old, had an overt psychiatric diagnosis , or the woman expected multiplets.The study group consisted of 155 male partners of pregnant women with confirmed fetal structural anomalies detected by ultrasound. The women were referred to our tertiary referral centre based on suspicion of a structural fetal anomaly during obstetric ultrasound examination after 12 gestational weeks .The comparison group included 100 male partners of women scheduled for delivery at our hospital. They had no history of fetal anomalies or severe obstetric complications, and were included following a routine ultrasound scan with normal findings .Medical and obstetric history, socio-demographic variables, the time interval between the suspicion of an anomaly at the referring hospital and psychometric assessment, the tentative diagnosis, and gestational age were recorded as previously described .The ultrasound examinations at our tertiary centre were performed by consultants in fetal medicine. Before inclusion all couples were counselled by the fetal medicine specialists and specialists in pediatrics, pediatric surgery, pediatric cardiology, medical genetics, or neurosurgery, as required.Fetal diagnoses were classified according to severity and significant prognostic or diagnostic ambiguity at the time of inclusion. Ambiguity was defined as: a) the anomaly had significant inherent prognostic variation, or b) a definite diagnosis was dependent on the results of further investigations (e.g. an invasive test). See Table Participating men completed the questionnaires within a few days after the ultrasound examination at our tertiary referral centre. The questionnaires were completed at the hospital (a few men in the comparison group filled out the questionnaires at home) and the participants were instructed not to discuss their responses before completion. Social dysfunction and health perception (somatic symptoms) were assessed by the corresponding subscales of General Health Questionnaire (GHQ-28) . EndpoinIES-22 measures three subscales of psychological and behavioural distress during the previous week: intrusion (7 items), avoidance (8 items), and arousal (7 items). Intrusion is characterised by unbidden thoughts and images, troubled dreams, strong waves of feelings, and repetitive behaviour, related to the experience of knowing about the fetal condition. Avoidance includes ideational constriction related to the fetal condition, denial of the consequences of the anomaly, blunted sensations, behavioural inhibition, and emotional numbness. Arousal measures distress-associated psycho-physiological activation and includes items addressing anger and irritability, a heightened startle response, concentration difficulties, and hypervigilance. Each IES item has a score range of 0–5 yielding a scoring range of 0–35 for intrusion and arousal, and 0–40 for avoidance. A score < 9 in any of the dimensions was considered to be within the normal range, 9–19 was defined as a moderate response, while 20 or more indicated intrusion, avoidance, or arousal of clinical importance .GHQ-28 has four subscales, each with seven items, measuring social dysfunction, health perception (somatic symptoms) and psychological distress (anxiety and severe depressive symptoms) during the preceding two weeks. Likert scoring was used to compare distress levels within and between groups. Case score is a dichotomous scoring method (item scores 0-0-1-1). The GHQ-28 sum case score provides an estimate of the prevalence of clinically significant psychological distress, defined as a sum case score ≥ 6 . Clinically significant depression was defined as a GHQ-28 depression subscale case score ≥ 2. GHQ items 24, 25, 27, and 28, were used to assess suicidal ideation .The EPDS consists of ten questions and is a self-rating scale designed to detect postnatal depression. Five items measure dysphoric mood, two measure anxiety, and three (one per item) measure guilt, suicidal ideas, and “not coping” experienced during the previous week. The EPDS-10 has been validated for use during pregnancy, including men , 17]. W. W17]. WSample size calculation was based on Skari et al. who repoThe questionnaires were optically readable. Completed questionnaires were scanned with Cardiff TeleForm version 10.1 , and stored in Access version 97 . Calculations were performed with SPSS version 18.0 .For descriptive statistics, we used parametric or non-parametric analyses, as appropriate. Analysis of variance (ANOVA) was used to identify predictors of psychosocial distress, including the categorical variable on classification of severity with ambiguity, paternal age, number of previous children, education, gestational age at inclusion, and time interval from suspicion of fetal anomaly to assessment. Continuous variables were transformed into categorical variables (relevant groups). We made cross-tabulations concerning possible interactions between the background variables. The requirements of minimum expected cell frequency were fulfilled. To study correlation between men and women (within the couple) we used Spearman’s Rho.ANOVA was first performed with each of the independent variables separately. Subsequently, a full analysis was run of all the relevant independent variables with all possible two-way interaction effects for each of the responses. Interaction effects with p > 0.1 were excluded. After reanalysing the data, the interaction effects with p < 0.05 were included in the final model. To control the overall significance of the test for those variables with more than two levels we used Tukey’s HSD post hoc test for detailed analyses of the effects. This methodology is underlying all statements in the results section when more than one level was used. Standard residual plots were used for model evaluation. Levene’s test of equality of error variances was used to test the assumptions underlying the analysis of variance. We used a significance level > 0.05 to avoid violation of the assumption of homogeneity of variance.st 2005 (Reference number S-05281). Written informed consent was obtained before participation. In accordance with the study protocol, any participant with a case score of ‘1’ on items addressing suicidal ideation was contacted for clinical evaluation within the same day, and if necessary, offered psychiatric assistance.The study was approved by the Regional Ethics Committee of Southern Norway December 21The mean paternal age was almost the same in the study- and comparison group; 33 (SD 6) and 34 years (SD 5), respectively. Age within gender category did not differ between the groups p > 0.120). In both groups men were significantly older than women (p < 0.001). In the study group, more men than women had junior college or less . There was no such difference in education in the comparison group. For other background variables see Table 20. In boAll psychometric responses were higher in the study group than in the comparison group Table . Within In the study group the correlations in psychometric scores within the couples were highly significant for all psychometric endpoints with p < 0.001, see one example, Figure We performed unadjusted ANOVAs for the men in the study group, with six independent variables . The outcome variables were IES intrusion, avoidance, and arousals, GHQ sum Likert, and EPDS sum. Fetal diagnostic and prognostic severity with inherent ambiguity was the only explanatory factor that reached statistical significance concerning three of the psychometric measures Tables  and 5.Adjusted ANOVAs in the study group of men with the same explanatory variables showed that diagnostic and prognostic severity of fetal anomaly was significant for all IES subscales and sum EPDS (p = 0.001). GHQ sum Likert did not reach significance (p = 0.426). There were no consistent patterns in the interactions among components, see Table Post hoc tests (Tukey HSD test) showed that the men in the category “Mild to moderate severity with available treatment, often with good result, without prognostic ambiguity” had significantly lower scores than the men in the other categories as presented in Table Expectant fathers experienced psychological distress after prenatal detection of a fetal anomaly. We observed a significant difference in all psychometric assessments between the men in the fetal anomaly group and the men in the group with no fetal anomaly, e.g. mean (SD) values for IES intrusion were 16.5 (8.7) and 6.7 (5.6), respectively. Distress levels were lower than for the women in the respective groups. This pattern concurs with findings by Skari et al. in fatheIn our study the severity of the fetal malformation and ambiguity concerning diagnosis and prognosis were the only predictors of paternal psychological distress, social dysfunction and health perception. Neither gestational age nor any of the other background variables influenced the paternal psychological reaction, as they do in pregnant women .After prenatal detection of a fetal anomaly both parents will experience psychological shock and acute grief . In our Matthey et al. discusseThe lower scores in men compared to women for IES and GHQ might be due to the same mechanism, i.e. gender differences in the response to some of the questions. However in an evaluation of IES after 20 years of use, no gender difference was detected . Goulia In contrast, Clarke et al. argue that there is evidence in social psychology research literature for females generally reporting higher levels of depression, anxiety and psychosomatic stress than males . These dA study from Australia and New Zealand describes how first time fathers experience significant distress even in normal pregnancies . It highThe background variables age, educational level and number of previous children were significantly different between men and women in the two groups, but only education was different between the men in the two groups. The men tended to be older than the women and the women had higher educational level than the men. These trends are consistent with the traditional societal pattern in Norway over the last decades. It is unlikely that these differences can explain the difference in psychological stress scores between men and women or between the men in the two groups.The correlation of psychometric measurements within couples in the study group Figure  is probaA weakness of the study is that we do not have distress measurements prior to the event, i.e. prior to the ultrasound examination detecting fetal anomaly. Due to the unpredictable occurrence of fetal anomalies this was not feasible. The strength of the study is the sample size, the incorporation of a comparison group, and the use of validated and widely applied questionnaires.The selection of instruments to assess psychological response during pregnancy may be subject to discussion , althougDespite the frequent use of ultrasound examination in pregnancy, little attention has been devoted the psychological response of the expectant father to the detection of fetal anomalies. Men in the group with fetal anomaly had significantly higher scores on all distress measures than the men in the group without fetal anomaly. The severity of anomaly and diagnostic and prognostic ambiguity influenced the paternal psychological response. Although men had lower scores than women on all psychometric outcomes, the correlation of distress levels associated with the detection of fetal anomalies within couples was high. This knowledge may facilitate intensified support for both expectant parents in situations of detected fetal anomaly and thus help reduce strain within the family.EPDS: Edinburgh postnatal depression scale; GHQ: General health questionnaire; IES: Impact of event scale.The authors declare that they have no competing interests.AK planned and performed the study, analysed the data, and wrote the paper. AH participated in performing the study and writing of the paper. UFM participated in planning the study and writing of the paper. TN participated in analyzing the data and writing of the paper. HS participated in planning the study and writing of the paper. GH participated in planning and performing the study, and writing of the paper. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2393/13/147/prepub

Two well-known plant cation/proton antiporters are NHX1 and SOS1, which perform Na+ and K+ compartmentalization into the vacuole and Na+ efflux from the cell, respectively. However, our knowledge about the evolution of NHX and SOS1 stress responsive gene families is still limited.Gene duplication events have been proposed to be involved in the adaptation of plants to stress conditions; precisely how is unclear. To address this question, we studied the evolution of two families of antiporters. Cation/proton exchangers are important for normal cell function and in plants, NaNHX family expanded and specialized, the SOS1 family remained a low copy gene family that appears to have undergone neofunctionalization during its evolutionary history. Additionally, we found that both families are under purifying selection although SOS1 is less constrained.In this study we performed a comprehensive molecular evolutionary analysis of the NHX and SOS1 families. Using available sequences from a total of 33 plant species, we estimated gene family phylogenies and gene duplication histories, as well as examined heterogeneous selection pressure on amino acid sites. Our results show that, while the We propose that the different evolution histories are related with the proteins’ function and localization, and that the NHX and SOS1 families are examples of two different evolutionary paths through which duplication events may result in adaptive evolution of stress tolerance. It has been argued that gene duplications underlie mechanisms to achieve stress adaptation ,2. ThereSalt tolerance is a complex trait that is thought to have originated multiple times in plants , and it +,K+/H+ antiporters are also associated with salt tolerance [Cation/proton exchangers are essential to the normal function of the cell. Besides helping regulating internal pH, cell volume, and cytoplasmic ion homeostasis -7, theseolerance ,11, and olerance ,13.+,K+/H+ exchangers belong to a superfamily of monovalent cation/proton antiporters (CPA) and are divided in two families, CPA1 and CPA2 [+ efflux from the cell. NHX proteins, on the other hand, are intracellular proteins that compartmentalize Na+ and K+ in the vacuole [All Naand CPA2 . The CPAand CPA2 . Within and CPA2 ,16, and vacuole -19.Arabidopsis thaliana, the NHX protein family has six members that are classified into two classes [+ and K+[+ compared to Na+[In classes . The cla classes and have[+ and K+,20. Clas[+ and K+ and haveed to Na+.NHX genes which encode these proteins have different expression patterns and responsiveness to abiotic stresses [AtNHX1 and 2 were shown to be expressed at high levels in all plant tissues, while AtNHX3 and 4 were mainly expressed in root and flower tissues, respectively [AtNHX5 was also expressed in all tissues but at lower levels [AtNHX6 expression was detected only in shoots and roots by RT-PCR [AtNHX1-3 were shown to be responsive to both salt stress and abscisic acid (ABA) [AtNHX5 was only responsive to salt stress, suggesting that its response is ABA-independent [NHX genes promoted the recovery of a salt sensitive yeast mutant [NHX1 and 5, or rice NHX1 (among others), resulted in increased salt tolerance in transgenic plants [Previous reports have shown that the Arabidopsis stresses ,22. AtNHectively ,22. AtNHr levels ,22, whilid (ABA) , AtNHX5 t mutant ,22 and nc plants ,24-27.2+ binding SOS3 undergoes dimerization and enhances the serine/threonine protein kinase activity of SOS2. The SOS3/SOS2 complex is targeted to the plasma membrane and activates SOS1 [The other protein that characterizes this cation/proton exchanger family is SOS1, which belongs to the well-known salt tolerance Salt-Overly-Sensitive (SOS) pathway -30. Salttes SOS1 -30.+/H+ antiporter [+[SOS1 has been called NHX7 by several authors, and was thus thought to be part of the NHX gene family ,16. Prevtiporter , howeverporter [+, thus su+, SOS1A helps protect the cell from the deleterious effects of this ion. Additionally, SOS1A seems to have an important role in long-distance Na+ transport, thus helping to regulate the Na+/K+ ratio in roots and shoots [+ compartmentalization in the vacuole, protecting the cell from the deleterious effects of this ion and maintaining cytoplasmic ion homeostasis [NHX over-expressing plants result from an improved ability to retain K+ after stress induction [The importance of these two families of proteins in plant salt tolerance is well established. By promoting the efflux of Nad shoots . On the eostasis ,34. Recenduction -37.+,K+/H+ antiporters can help clarify the mechanisms leading to plant stress adaptation associated with gene duplication events [NHX and SOS1 plant genes, or to do a phylogeny analysis of the entire monovalent CPA gene family, as in others [NHX and SOS1 gene families have very different evolution trajectories and suggest that these divergent evolutionary histories are related to the evolution of their function and cellular localization. Finally, we suggest that the NHX and SOS1 families represent examples of two different paths in the molecular evolution of stress tolerance.Despite the key roles these genes play in salt tolerance in plants, little is known about the evolutionary histories of both gene families. Understanding the evolution of Nan events ,2,38. Inn others . InsteadNHX genes among the various species is shown in Table C. reinhardtii, and we used 1 sequence from the budding yeast S. cerevisiae as an outgroup. The NHX phylogeny agrees with the classification of these proteins in two distinct evolutionary groups. We obtained two main clades, with ~99% bootstrap support, which showed evolutionary divergence of NHX protein groups according to their protein localization, as previously reported [We selected 121 genes in 33 taxa that appear, or are described, to belong to the NHX family. The distribution of reported ,40 and to some genes still remaining to be identified. In this reconciled tree, all the branches with bootstrap support inferior to a set value (here 75%) are rearranged to achieve the most parsimonious duplication and loss history for the gene family. Nevertheless our results, together with the fact that non-plant species also have multiple NHX genes [We observe that multiple independent duplication events have occurred throughout the evolutionary history of the NHX family. Based on the reconciled phylogeny Figure , we estiHX genes ,39, suggSelaginella moellendorffii), moss (Physcomitrella patens), and the green photosynthetic alga (Chlamydomonas reinhardtii) we could not assess divergence from the more closely related species to the angiosperms. Sequences from more gymnosperm species are available as EST sequences in PlantGDB database, which coupled with greater availability of genomics resource data from other non-flowering plant taxa species, could potentially be used in the future to examine more closely the precise origins of specific gene family clades. However, our results suggest that NHX proteins grouping with AtNHX1 and 2 might be more recent and specific to seed plants. Nevertheless, bootstrap supports obtained for these branches were not very high seed plants. NHX1 and 2 proteins consistently grouped separately from proteins from basal plant lineages such as spikemoss suggested that more species might possess more than one Putative SOS1 protein. The existence of two SOS1 genes has been described previously for Arabidopsis thaliana[Cymodocea nodosa) [Chenopodium quinoa) [We found that eight plant species, including es Table . At the thaliana and two nodosa) and quin quinoa) . Neverthet al. [A. coerulea, E. grandis, and M. esculenta have deletions in the N-terminus of the protein when compared to the Arabidopsis SOS1 proteins. This suggests that SOS1-like proteins from these three species might have a smaller transmembrane region, but further biochemical analyses need to be performed to confirm this.As in Arabidopsis, the species with two SOS1-like proteins usually displayed differences in protein length Table . Howeveret al. that it Eucalyptus grandis and one A. thaliana protein.The SOS1 phylogeny and two amino acid residues are under positive selection (dN/dS ~ 1.23) - a valine at position 366 (V366) and a serine at position 738 (S738) were identified in our analysis as strong candidate residues to be under neutral or positive selection, but these were not as well supported as the other three sites. Nevertheless, these other residues might be indeed under neutral or positive selection since the tests designed to detect positive selection are very stringent.Like the NHX proteins, the SOS1 proteins are generally subject to purifying selection, but our analysis indicates that some amino acid sites appear to be under positive selection. Among the land plants the SOS1 proteins had an average dN/dS of ~0.16. Using alignments that largely represented orthologous sequences, the glutamine at position 958 (Q958) in http://expasy.org/tools/), however, the positively selected residue V366 is in a predicted transmembrane helix. Amino acid site Q958 is predicted to be in a transition zone between coiled and beta-sheet regions, and residue S738 is predicted to be in a random coil.In general, structurally constrained sites should be under stronger purifying selection, while unstructured sites have higher levels of amino acid replacements . AccordiA. thaliana protein when mutated [Two of these residues, V366 and S738, are in the cytoplasmic domain of AtSOS1A Figure  but do n mutated . Like S7 mutated . Thus, iSOS1-like proteins similar in length (∆ < 110 amino acid residues) showed a difference in dN/dS values less than 0.1, while species that retain two putative SOS1-like proteins with very different length (∆ > 400 amino acid residues) displayed a difference in dN/dS values always greater than 0.2. Furthermore, in the cases where the two putative SOS1-like proteins substantially differed in length, the shortest appeared to be evolving faster than the longer protein from the same species [SOS1 proteins that differ in length is that the duplication of some SOS1 genes did not result in functionally equivalent gene copies, and hence functional divergence between copies is immediately observed.More data is needed to verify if this trend is statistically significant. Nevertheless, we can speculate that the possible relation between the differences in protein length and dN/dS might be due to the relative recent occurrence of the duplications in idopsis) . AnotherNHX and SOS1 plant gene families exhibit markedly different evolutionary histories - while the NHX family expanded and developed functionally specialized members throughout the history of the land plants proteins also exhibit functional differentiation, although they are not always functionally equivalent to their Arabidopsis homologues. For example, both AtNHX5 and OsNHX5, which are both part of clade 1 allowed retrieval of homologous sequences of OsNHX1 from the algae Chlamydomonas reinhardtii and the gymnosperm Picea sitchensis. In these particular cases, sequences with an e-value lower than 10-10 were used. Additionally, we also retrieved from NCBI sequences identified as being NHX- or SOS1-like from the yeast Saccharomyces cerevisiae (ScNHX1 – YDR456W) and from salt tolerant plant species and OsSOS1A Os12g44360), in Node Consensus BLASTp of Phytozome v7.0 to obtaig44360, iIn order to improve the quality of the alignments obtained, sequences shorter than 500 or longer than 940 or 1200 amino acids from the NHX and SOS1 families, respectively, were removed from the study . This exclusion was performed because the alignments these sequences produced had a large number of discontinuous aligned stretches and we had low confidence on the homology assignments from these alignments. The identifiers of all the sequences used, and their respective database origin, are listed in the Additional file Saccharomyces cerevisiae as the outgroup sequence. The SOS1 phylogeny was estimated from 32 sequences in 23 plant species (Table P. patens used as outgroups. These outgroups were chosen because the S. cerevisiae sequence (NHA1) most similar to the plant SOS1 genes proved difficult to align with the rest of the plant genes.The phylogeny of NHX proteins was obtained from 121 sequences in 33 different species (Table http://evolution.genetics.washington.edu/phylip.html). Branches with a good support (>75% bootstrap) were generally the same in the consensus trees obtained using either NJ (data not shown) or ML, although generally ML resulted in higher bootstrap support values.Alignments of protein sequences were obtained using MUSCLE and the http://www.mobot.org/mobot/research/apweb/) we constructed a cladogram representing the species tree of The codon-cleaned alignments and the NJ phylogenetic trees (both rooted and unrooted), were further used in Codeml from the PAML package to deterBranch-site model from CodNHX: Sodium hydrogen exchanger; SOS: Salt overly sensitive; dN: Number of non-synonymous substitutions per non-synonymous site; dS: Number of synonymous substitutions per synonymous site; dN/dS: Non-synonymous/synonymous substitution rate ratio.The authors declare that they have no competing interests.Arabidopsis thaliana SOS1A secondary and tertiary structure, looking specifically at the sites predicted to be under neutral or positive selection in the SOS1 proteins. SN, MMO, and MDP conceived the study, participated in its design and coordination, and helped to draft the manuscript. All authors read and approved the final manuscript.ISP participated in the design of the study, carried out the computational analysis, and drafted the manuscript. MMP helped carrying out the computational analysis. IAA performed the analysis of the Figures depicting NHX and SOS1 phylogenies; the species tree used for reconciliation of gene trees; SOS1 phylogenetic tree where branch lengths represent non-synonymous/synonymous rate ratios (dN/dS); and SOS1 phylogenetic tree where branch lengths represent the rate of synonymous substitutions.Click here for fileList of all sequences used in this study with reference to the database from which they were retrieved. Known salt tolerant plant species are highlighted in grey background. A simplified version of the original sequences’ identifiers was used in this study, since the majority of phylogenetic software have limitations for sequence names.Click here for file

Saccharophagus degradans 2–40 is a γ-subgroup proteobacterium capable of using many of the complex polysaccharides found in the marine environment for growth. To utilize these complex polysaccharides, this bacterium produces a plethora of carbohydrases dedicated to the processing of a carbohydrate class. Aiding in the identification of the contributing genes and enzymes is the known genome sequence for this bacterium. This review catalogs the genes and enzymes of the S. degradans genome that are likely to function in the systems for the utilization of agar, alginate, α- and β-glucans, chitin, mannans, pectins, and xylans and discusses the cell biology and genetics of each system as it functions to transfer carbon back to the bacterium. For autotrophs and heterotrophs, whether prokaryotic or eukaryotic, these polymers are associated with proteins and membranes, extracellular polysaccharides, structural elements of the cell wall, and/or storage forms of carbon . They caSaccharophagus degradans 2–40 is a rod-shaped bacterium with a salt requirement typical of marine bacteria and capable of processing many CPs to their elemental sugars or sugar derivatives [Alteromonadales group was isolated from decaying saltwater marsh grass, Spartina alternaflora, in a marine estuary [Sde2–40 is unusual in its ability to utilize CPs of algal, higher plant, fungal and animal origin as sole carbon and energy sources. Sde2–40 is able to grow using agar, alginate, cellulose, chitin, α- and β-glucans, galacto-/gluco-mannans, various xylans, citrus pectin or laminarin as the primary carbon and energy source. This bacterium is also able to produce polyalkanoates from these polysaccharides [ estuary –5. It is estuary . Sde2–40charides ,9.et al. [The unusual character of this bacterium was further revealed by the genome sequence . Based uet al. . Each sy2.l-galactose-α-1,3-d-galactose) joined by β-1,4 bonds that forms a helix in aqueous environments. The galactose moieties of the repeating neoagarobiose units can be methylated, pyruvated, sulfonated or glycosylated to form various substituted derivatives with different gelling and solubility characteristics.Agar is an agarocolloid gel formed of unsubstituted and substituted agarose polymers . It is aSde2–40 is capable of rapid growth on agars and agarose as the dominant carbon source and produces multiple agarases [Sde2–40 degrades agar employs five β-agarases, designated Aga50A, Aga16B, Aga86C, Aga50D and Aga86E [endo-β-agarase with a GH16 domain that rapidly degraded agar and agarose to neoagarotetraose [exo-lytic agarase releasing neoagarobiose directly from agar [agarases ,14. The d Aga86E ,16 and ad Aga86E . These atetraose . The iderom agar .A feature of Aga16B and Aga86E is the inclusion of multiple CBM6 domains . CBM6 isE. coli, enabled the slow pitting of agar [exo-enzyme producing neoagarobiose like Aga50D. Both contain an amino acid sequence at their N-termini known as a lipobox [Two cell-associated agarases, Aga86C and Aga50A, are also produced by this bacterium ,21. Aga8 of agar . One exp lipobox . This is lipobox –25.Sde2–40 agarolytic system is a neoagarobiose hydrolase that converts the neoagarobiose released by the activity of the β-agarases to galactose and 3,6-anhydro-α-galactose. This activity was predicted to be produced by Sde2–40 [The remaining component of the Sde2–40 and show Sde2–40 ,26. The Sde2–40 ,17. InteSde2–40 can be assembled. Irrespective of the activity, these agarases appear to be coordinately expressed as the activities are only observed during growth on agar or agarose [Sde2–40 appears to Aga16B. The resident CBM6 domains may play a role in attachment of this enzyme to algal cell walls to minimize diffusion of the enzyme and could also function to destabilize the cell wall polymers. The surface-associated Aga86C may function in a similar capacity to produce neoagarooligosaccharides. Both enzymes would increase accessibility of the exo-acting enzymes to their substrate. Neoagarobiose would be produced by the activity of secreted Aga86E, Aga50D, and possibly the cell-associated Aga50A. The observation that neoagarobiose hydrolase is cytoplasmic indicates that this bacterium imports the released neoagarobiose. A candidate sugar transporter is divergently expressed from aga86C, again suggesting common regulation, and like other co-localized agarase genes, has its strongest homolog in Pseudoalteromonas atlantica. This transporter is designated here as AgaT as a candidate neoagarobiose transporter. Once in the cytoplasm, neoagarobiose would be converted to galactose and 3,6-anhydro-α-galactose by the activity of neoagarobiose hydrolase. The released galactose is most likely metabolized by the Leloir pathway as the enzymes for the other metabolic pathways of galactose are missing in the genome annotation [Using these data, a model for agarose degradation by agarose ,14,21,263.d-mannuronic acid (M) and α-l-guluronic acid (G) [Fucus distichus [Azotobacteriaceae and Pseudomonadacease [Alginic acid is a viscous, high molecular weight polymer composed of β-1,4-linked stretches of β-acid (G) . These sacid (G) . Alginatistichus . Alginatadacease as an exO-linked glycosidic bond forming unsaturated uronic acid-containing oligosaccharides [endo- and exo-acting alginate lyases have been identified, ultimately releasing 4-deoxy-l-threo-5-hexosulose uronate from the non-reducing terminus [Alginate is degraded by a group of enzymes known as alginases –33. Algicharides ,33,34. Tterminus ,33.Sde2–40 is able to grow on sodium alginate as a sole carbon source [Sde2–40 appears to produce an array of alginate lyases with Alg6F as the key example (d-mannuronate) lyases. Many of these enzymes also include CBM16 and CBM32 domains as well. Some of these enzymes carry a FA58C domain that is a less defined CBM. Like other carbohydrase systems, five enzymes also include a lipobox suggestive of a surface localization. The apparent redundancy in the system could explained by: (1) substrate specificities of the enzymes; (2) endo vs. exo activity of the enzymes; and (3) possible differential regulation of the source genes by different substrates.n source ,35,36. T example . These el-threo-5-hexosulose uronate. After import, the 4-deoxy-l-threo-5-hexosulose uronate could be converted to 2-dehydro-3-deoxygluconate by an isomerase, phosphorylated by a kinase and then cleaved to produce pyruvate and triose phosphate [l-threo-5-hexosulose uronate. In addition, there is a divergently expressed GntR homolog that could function in the regulation.Degradation of polymeric alginate obviously occurs outside of the bacterium because all alginate lyases thought to be produced by this bacterium have secretion signals and the bacterium lacks a mechanism to import alginate. Thus, the bacterium must have mechanisms to import the released 4-deoxy-hosphate ,33. Puta4.α-Linked glucans are ubiquitous polymers that include starches, glycogens, and pullulans. Starch is formed of amylose which is essentially unbranched α-1,4 glucan, and amylopectin is based upon amylose with an α-1,6 linkage approximately every 30 glycosyl units to initiate a new stretch of amylose. Glycogen is like amylopectin but the frequency of branching via α-1,6 linkages is higher. Pullulan is formed of maltotriose joined by an α-1,6 linkage. α-Glucans are easily utilized for metabolism due to its easily digestible nonplanar structure with α-1,4-linked glycosyl units forming a helix in solution. Branching further disrupts this structure. Starches are commonly found in algae and plants [Degradation of amylose by bacteria usually involves α-amylases that predominantly release maltotriose, maltose and some glucose. The better-known β-amylases produced by many other organisms specifically release maltose. α-Glucosidases cleave the remaining glycosyl bonds to release glucose. A third family of enzymes that include pullalanases hydrolyzes the α-1,6 bond.S. degradans [Sde2–40 indicates the presence of a complete system to hydrolyze α-linkages between glucan units also carry lipoboxes. Only a GH13 α-glucosidase (Gly13E) and a sucrose phosphorylase (Suc13F) appear to be cytoplasmic. The presence of a strong candidate sucrose phosphorylase in the cytoplasm argues that this bacterium must have a mechanism to import dimeric sugars.Overall, it would appear that since most enzymes to convert starch to glucose are secreted or surface associated, the activities of these enzymes combine to form glucose outside of the cell. Assuming they are expressed and functional, these enzymes would release glucose for importation. Import of external glucose most likely involves a sugar transporter and glucokinase. Genes 904 and 1018 are annotated to encode homologs of a glucokinase. In addition gene 1017 is divergent expressed from 1018 and encodes a glucose/galactose transporter. Metabolism of the imported glucose is predicted to occur by the Entner-Douderoff pathway as genes for the diagnostic enzymes of this pathway are present in the genome and the physiology of this bacterium is similar to pseudomonads that typically use this pathway.5.endo- and exo-glucanases that hydrolytically form cellobiose and cellodextrins that are converted to glucose by the activity of β-glucosidases.Globally abundant cellulose is formed of linear β-1,4-glucan that assembles into paracrystalline structures in water . It is fS. degradans is well established as a cellulolytic bacterium and the enzymes produced by this bacterium are described in Sde2–40 secretes at least 15 β-1,4-endoglucanases, three of which have been reported to be processive endoglucanases that appear to substitute for the cellobiohydrolases apparently absent in this system [s system . This, hs system . Three os system . Additios system ,38, suchs system . These es system ,40.Sde2–40 [cep94A gene in an apparent operon with a putative sugar transporter, but there is insufficient information at the present time to predict function of this apparent transporter.Cellobiose produced by the activity of the classical and/or processive endoglucanases appears to be metabolized by two pathways . CytoplaGenes of the cellulolytic system are regulated by their substrate. For selected genes of the cellulolytic system, qRT-PCR has been used to identify gene sets with similar patterns of expression. As predicted from previous biochemical studies on this bacterium , there w6.N-acetylglucosamine [N-acetyl-glucosamine [N-acetyl-β-glucosamine is then imported, deacetylated and deaminated to form fructose 6-phosphate. Alternatively the polymer can be deacetylated externally to form chitosan and then cleaved by chitosanases.The second most abundant polysaccharide in the environment is chitin formed of poly β-1,4-cosamine . It is fcosamine . A chiticosamine . N-acetyS. degradans produces a chitinolytic system that has been partially characterized by genome annotation, molecular cloning, and biochemical characterization of purified products [endo-acting domain whereas the proximal GH18 is an exo-acting enzyme. The juxtaposition of these domains would place production of chitobiose by this enzyme directly at the surface of the cell where it could enter the periplasm via by outer membrane porins. There is also one surface-associated N-acetyl-glucosaminidase (Hex20A) that could convert the externally produced chitobiose and chitodextrins to N-acetyl-β-glucosamine as well. In addition, there is an apparent periplasmic form of this enzyme that could convert periplasmic chitobiose and chitodextrins to N-acetyl-β-glucosamine. The N-acetyl-β-glucosamine produced by the activity of either enzyme would be imported into the cytoplasm by a NagE homolog, an inner membrane transporter, and converted to fructose 6-phosphate by the remaining Nag system 4-mannose with at least 5% α-1,6-galactose. Mannans are primarily found as glucomannans that can be a constituent of red algal cell walls and as galactomannans found in some leguminous seeds and fungi [Sde2–40 is able to utilize both glucomannan and galactomannan as the primary carbon source for growth [endo-acting β-1,4-mannanase (Man5O) and an exo-acting β-1,4-mannosidase (Man5N) Expression of the genes for a carbohydrase system are specifically induced by contact with their substrate; (2) the structural properties of the secreted carbohydrases favor adsorption to their substrate; and (3) the sugars or sugar derivatives derived from CPs are generated at the cell surface to maximize their uptake. This insures the maximum economy of use for each substrate CP.Although the native habitat for In this bacterium, carbohydrases are produced on a “per need” basis as the carbohydrase systems are subject to tight genetic regulation. The degradative system for a specific polymer is only expressed in the presence of that polymer . This reThe bacterium must also have at least one mechanism to perceive the signal molecule. This argues for the involvement of a regulatory system to activate expression of contributing genes. For example, the cellodextrins produced by the basally expressed glucanases induce transcription of the genes in the cellulolytic system of this bacterium. Interestingly, as many as three regulatory systems could function in this process. Each regulatory system would have its own transcriptional factor. Understanding what genes are co-expressed in this bacterium as part of the regulon for each cognate transcriptional factor could help understand how to digest specific carbohydrates and raw biomass.The localization of the carbohydrases of each system provides a plausible explanation for how CPs are used as food. Each system involves secreted enzymes to depolymerize their target CPs as the enzymes have easily recognized type II secretion signal sequences. These secreted enzymes appear to be adapted to the marine environment as they do not function well at the acidic pH’s typical of many terrestrial systems, but instead, require the more neutral environment of seawater. In addition, the activities of these secreted enzymes seem to be tolerant to salt concentrations as high as 5%.Another unifying feature of these secreted carbohydrases is the inclusion of CBMs. The secreted enzymes many times carry one or more CBMs joined to the catalytic domains by flexible linkers. These CBMs likely assist in the adsorption of secreted enzymes to their substrate. Thus, the adsorption modules function to minimize the loss of the host enzyme through diffusion. Since adsorption occurs independently of catalytic activity, these enzymes would still be able to solubilize their substrate polymer. Loss of secreted carbohydrases would be minimal as they would only be produced when the bacterium is adsorbed to that substrate and the secreted carbohydrases would be bound to their substrate through their CBMs to limit diffusion. For those enzymes that lack obvious CBMs, it will be interesting to see if they interact with proteins that do carry CBMs as part of multimeric complexes.Interestingly, the secreted carbohydrases are likely to only partially depolymerize their substrate CPs to form soluble oligosaccharides. Degradation of the oligosaccharides to their constituent sugars or sugar derivatives appears, in many cases, to occur at the cell surface using secreted enzymes with lipoboxes. In those cases where it has been examined, the enzymes with lipoboxes are cell-associated as predicted . In thiendo-acting forming chitooligosaccharides and the closer domain is exo-acting producing chitobiose. Thus the most diffusible products of chitin are formed at the cell surface [An example of this strategy is found in the Chi18B chitinase produced by this bacterium. Expression of the source gene is induced by chitin. This dual domain enzyme appears to be secreted and anchored to the outer membrane due to the presence of a lipobox. The catalytic domains are separated from this lipobox by a long polyserine domain (∼110 residues) that would place the enzyme at the outer membrane surface. This placement is augmented by the position of the distinct catalytic domains in which the more distant domain is surface .etc.) appears to occur at the cell surface in some cases as these enzymes have lipoboxes. This was not anticipated as homologs of many secreted depolymerases only act on the core polymer lacking modifications. This predicts that the depolymerases of this bacterium may lack specificity in their substrate preference . Alternatively, the secreted enzymes may be limited in their activity until the surface-associated enzymes act on the material. Thus, close proximity to the adsorbed bacterium would be necessary for these secreted enzymes to be active.Other systems are more complicated as the core polymers are modified. Removal of the modifications (e.g., pectin esterases, acetoxylan esterases, Pseudoalteromonas atlantica, and thus, are a candidate to have been acquired as a genetic unit. Alternatively, more classic bacterial evolution could have occurred in which acquired genes are duplicated at nearby locations [This bacterium has the potential to produce a large number of carbohydrases to degrade the CPs found in the marine environment. Most other bacteria produce substantially fewer carbohydrases and tend to degrade less types of CPs . With suocations . On the ocations .In conclusion, the carbohydrase systems of this bacterium are providing new insights into the degradation of CPs. In some cases, the enzymes of a system seem to be similar to those of other bacteria. In other cases, new activities are identified to explain oddities in the system. This bacterium, thus, can serve as a paradigm for processing of complex polysaccharides in the marine environment and offers the opportunity for comparative studies with terrestrial systems.

Hbenzo[b]thienodiazepine), and OlzHomo -10H-benzo[b]thieno diazepine), for their tendency to induce weight gain in rats. Weight gain and metabolic changes were measured in female Sprague Dawley rats. Animals were treated orally with Olz, OlzEt, OlzHomo (3 or 6 mg/kg/day), or vehicle (n = 8), three times daily at eight-hour intervals for 5 weeks. Furthermore, a phencyclidine (PCP)-treated rat model was used to examine the prevention of PCP-induced hyperlocomotor activity relevant for schizophrenia therapy. Male Sprague Dawley rats were pre-treated with a single dose (3 mg/kg/day) of Olz, OlzEt, OlzHomo, or vehicle (n = 12), for 2 weeks. Locomotor activity was recorded following a subcutaneous injection with either saline or PCP (10 mg/kg). Olz was found to induce weight gain, hyperphagia, visceral fat accumulation, and metabolic changes associated with reduced histamatergic H1 receptor density in the hypothalamus of treated rats. In contrast, OlzEt and OlzHomo presented promising antipsychotic effects, which did not induce weight gain or fat deposition in the treated animals. Behavioural analysis showed OlzEt to attenuate PCP-induced hyperactivity to a level similar to that of Olz; however, OlzHomo showed a lower propensity to inhibit these stereotyped behaviours. Our data suggest that the therapeutic effectiveness of OlzHomo may be delivered at a higher dose than that of Olz and OlzEt. Overall, OlzEt and OlzHomo may offer a better pharmacological profile than Olz for treating patients with schizophrenia. Clinical trials are needed to test this hypothesis.Olanzapine (Olz) is one of the most effective antipsychotic drugs commonly used for treating schizophrenia. Unfortunately, Olz administration is associated with severe weight gain and metabolic disturbances. Both patients and clinicians are highly interested in the development of new antipsychotics which are as effective as atypical antipsychotics but which have a lower propensity to induce metabolic side effects. In the present study, we examined two new derivatives of Olz; OlzEt (2-ethyl-4-(4′-methylpiperazin-1′-yl)-10 Since the blockade of the H1 receptors has been repeatedly described as the most likely mechanism for atypical antipsychotic drug-induced weight gain, the present study further explored the therapeutic potential in vivo of these two analogues of Olz in an animal model of schizophrenia while assessing their metabolic side effects. We found that OlzEt and OlzHomo compounds display a significant reduction in metabolic side effects (weight gain and adiposity) compared to Olz. Thus OlzEt and OlzHomo may present as potential new drugs for schizophrenia therapy.We have previously examined two new analogues of Olz; OlzEt (2-ethyl-4-(4′-methylpiperazin-1′-yl)-10Australian Code of Practice for the Care and Use of Animals for Scientific Purposes (2004).All experimental procedures were approved by the Animal Ethics Committee, University of Wollongong, and conducted in accordance with the ad libitum access to water and standard laboratory chow diet . Animals were then randomly assigned to one of the following treatment groups: 3 or 6 mg/kg/day of Olz , OlzEt , OlzHomo , or vehicle (n = 8), three times daily at eight-hour intervals. Following 1 week habituation in their new environment, the animals underwent training to self-administer a sweet cookie dough pellet for 1 week. Cookie dough administration was performed as previously reported for 5 weeks In the first series of experiments (Study 1), female Sprague Dawley rats (7 weeks old) were used to investigate weight gain and adiposity effects of a chronic treatment with Olz, OlzEt, and OlzHomo. Animals were obtained from the Animal Resources Centre and housed individually at 22°C, on a 12 h light-dark cycle with At the end of Study 1, female rats were fasted for 10 h prior to sacrifice by carbon dioxide asphyxiation. Upon sedation, blood was removed and collected in Lavender Vacutainer tubes containing EDTA for hormonal testing. Samples were immediately centrifuged (1000 g for 10 min at 4°C), after which plasma was aliquoted and stored at −20°C until use. Fasting plasma insulin, leptin, and adiponectin levels were measured using commercially available Milliplex kits and Luminex 100. Plasma samples were processed by Southern IML Pathology for levels of glucose, cholesterol, triglycerides, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) levels. White fat pads and sub-scapula brown fat pads were dissected from each animal and individually weighed. Brains were immediately removed, dissected into hypothalamus and prefrontal cortex, snap frozen in liquid nitrogen and then stored at -80°C until use.In the next experiment (Study 2), the effects of Olz, OlzEt, and OlzHomo subchronic administration on PCP-induced behaviours were tested in male Sprague Dawley rats (180–200 g). Animals were housed in pairs in the same conditions described above. Following a 1 week habituation period, rats were treated orally with a sweet cookie dough pellet containing 3 mg/kg/day of Olz, OlzEt, OlzHomo, or vehicle (n = 12), three times daily at eight-hour intervals for 2 weeks. Animals were injected subcutaneously with either saline or PCP 30 min following the final drug/cookie administration. Open-field behavioural testing was performed 15 min after this injection.via Ethovision video-tracking software . Animals were euthanized 120 min following the open-field test as described above; brains were rapidly removed from the skull and dissected into prefrontal cortex and striatum, snap frozen in liquid nitrogen and stored at −80°C until required for the receptor binding assays.The open field test was used to determine the behavioural effects of the pre-treatment of Olz, OlzEt, and OlzHomo on PCP-treated animals. To minimise stress during the experiment, animals underwent a 10 min habituation period for the open-field test one day prior to the experiment. As previously described 2, 5HT2A, and H1 receptors respectively. The assays were performed according to previously described procedures 3H]-Spiperone , with or without 2 µM (+) butaclamol , 10 nM [3H]-Ketanserine in the absence or presence of 10 µM methysergid , or Pyrilamine with or without 2 µM doxepin , for D2, 5HT2A, and H1 receptor binding assays, respectively. Radioactivity was measured by a beta liquid scintillation analyser .The striatum, prefrontal cortex, and hypothalamus were used in radioligand binding assays to measure the receptor binding density of DData were statistically analysed using SPSS . Total weight gain, total food intake, energy efficiency, insulin, leptin, adiponectin, glucose, cholesterol, triglycerides, HDL, LDL, fat mass, and binding density were analysed by one-way analyses of variance (ANOVA) for each dose of Olz, OlzEt, and OlzHomo. Repeated ANOVA measures (COMPOUNDS×DAYS as repeated measures) were employed for cumulative weight gain, and food and water intake. Open-field parameters were also analysed by one-way ANOVA. Student's t-tests were used to determine the significance of differences between the saline and PCP-treated rats. Multiple comparisons were performed using Tukey or Games–Howell post hoc tests. Where Kolmogorov–Smirnov tests showed data to be distributed non-parametrically, Kruskall–Wallis tests were applied followed by Mann–Whittney U post hoc analysis. Correlations were identified using Pearson's correlation tests or Spearman's correlation tests for non-parametric data. Linear regression was performed in groups with significant correlations. Significance was set at P<0.05.3,27 = 7.11, P = 0.001) and 6 mg/kg Olz administration compared to the control group. However, the effects of both OlzEt and OlzHomo on body weight gain were not significantly altered compared to the control groups. OlzEt and OlzHomo showed a significant reduction in weight gain compared to the Olz group with 3 mg/kg and 6 mg/kg doses , and the interaction between these two factors . As illustrated in 3,27 = 10.73, P = 0.001) that began after 6 days of treatment. In contrast, OlzEt and OlzHomo administration did not affect food intake for either of the tested doses. Post hoc analysis showed that total food intake after 5 weeks of treatment with OlzEt and OlzHomo (6 mg/kg) was significantly lower than Olz administration (Body weight gain was found to be significantly increased following both 3 mg/kg (Fctively) . A repeactively) ). A signctively) .F3,28 = 8.98, P = 0.002). However, OlzEt and OlzHomo treated animals did not show any significant difference in relation to visceral fat deposition compared to controls was significantly increased in 6 mg/kg Olz treated rats compared to the control group (controls . Significtively) . There wctively) .F3,23 = 10.46, P<0.01). In contrast, OlzEt and OlzHomo administration did not affect the fasting plasma insulin levels in the tested rats compared to the controls. Additionally, both compounds showed higher insulin levels than those measured in Olz treated animals with 6 mg/kg doses and 3 mg/kg doses compared to the control groups. However, plasma leptin levels were significantly decreased following both 3 mg/kg and 6 mg/kg OlzHomo compared to controls. Fasting plasma adiponectin levels were found to be significantly higher after chronic administration of Olz but were found to be lower following OlzHomo treatment compared to controls , as well as a significant positive correlation between leptin levels and fat deposition . The inscontrols . Both lecontrols . A signi= 0.026) . Plasma = 0.026) .Levels of plasma cholesterol, triglycerides and LDL were found to be unaltered in the treatment groups at both the 3 mg/kg and the 6 mg/kg dose compared to controls . HDL lev1 receptor density in the hypothalamus of the female animals treated for 5 weeks compared to controls, while the H1 receptor density remained unchanged in animals treated with either OlzEt or OlzHomo for both tested doses (Olz (3 mg/kg and 6 mg/kg) significantly reduced the Hed doses . There wctively) .3,31 = 4.97, P = 0.023, and F3,31 = 8.19, P = 0.008) treated rats compared to controls. However, the effect of OlzHomo treatment on reducing locomotor activity was not significant compared to the controls (P = 0.42). Mean velocity was also reduced in animals treated with Olz . One-way ANOVA revealed significant changes in the centre and periphery durations following 2 weeks of treatment with OlzEt . Moreover, t-test results showed a significant effect of acute PCP administration on the distance travelled in animals treated with Olz, OlzEt, OlzHomo or control compared to their equivalent saline groups.Behavioural results are illustrated in 2 receptor density in the striatum of the male rats compared to controls . However, in the PCP-treated groups, a significant reduction was found following Olz and OlzEt treatments compared to controls. Similarly, 5HT2A receptor density in the prefrontal cortex of the animals treated with Olz and OlzEt was significantly decreased in both saline and PCP groups groups .N-methyl-D-aspartate (NMDA) receptor antagonist animal models of schizophrenia such as PCP have been widely used to test new drugs that have been developed for future schizophrenia therapies 1–D4; serotonin 5HT2A and 5HT2C; muscarinic M1; and adrenergic α1, and α2 receptors, may underlie its ability to block PCP-induced behaviours 2A receptors plays a part in PCP-induced hyperlocomotion. This effect may be prevented by 5HT2A antagonism by Olz at the level of motor pathways in the spinal cord or in the brain 2 and 5HT2A receptors in the striatum and prefrontal cortex respectively, which may partly explain the way in which OlzEt inhibits the PCP-induced behaviours in vivo. On the other hand, OlzHomo demonstrated a lower affinity for blocking these two receptors, which may contribute to its lack of efficacy for alleviating the PCP-induced hyperactivity. In fact, since the ambulation in OlzHomo/PCP-treated rats was comparable to the control/PCP group, we postulate that the potential for therapeutic effectiveness of an OlzHomo regime may be achieved at a higher dose than that at which Olz and OlzEt are administered.Regarding its clinical relevance, Olz has been shown to attenuate the hyperlocomotion and anxiety induced by PCP administration in animals 2 and 5HT2A receptors, we measured the neurochemical changes in the brain following the PCP challenge. Consistent with previous reports 2 and 5HT2A receptor densities in the striatum and prefrontal cortex respectively, in adult male PCP-treated rats, did not differ from saline-treated controls. However, subchronic treatment with Olz and OlzEt induced a long-lasting down-regulation in the binding capacities of D2 and 5HT2A receptors in both saline and PCP-treated animals. As previously suggested, the down-regulation of these two receptors may partly contribute to the blockade of PCP-induced behavioural changes, including hyperlocomotion To further validate our hypothesis regarding the effect of PCP on the levels of Dfatty acid synthase and adiponectin genes in vitro adipogenesis result and with previous animal and clinical studies 3 receptors in the pancreatic β-cells which regulate insulin secretion may contribute to the reduction in plasma insulin concentrations observed in our study In contrast with study 2, female rats were used in study 1 since the metabolic side effects following antipsychotic treatment (such as Olz) reported in the literature have been more pronounced in females compared to males vs. vehicle rats, these animals seemed to remain insulin sensitive. This is supported by our results showing no significant difference in the lipid profiles performed in the Olz treated rats compared to the vehicle rats.With regards to the levels of plasma glucose, our results did not show any significant difference between the different treatment groups compared to the controls, which is in accordance with results from recent clinical studies 2A, 5HT2C, 5HT6, α1A and H1 receptors and their obesogenic effects has been repeatedly reported in various studies 1 receptors 1 receptors is directly involved in the activation of the hypothalamic AMPK signalling pathway, which stimulates food intake and positive energy balance and reverses the anorexigenic effect of leptin 1 receptor affinity in antipsychotic-induced weight gain and fat deposition. As shown in our previous report 1 receptors compared to that of Olz (Ki = 0.13). Therefore, the pronouced antagonism of OlzEt and OlzHomo at the H1 receptors may be responsible for their significantly attenuated propensity to induce weight gain and metabolic dysfunction, which are associated with Olz treatment. Furthermore, corresponding with previous reports, the present study demonstrated a significant negative correlation between hypothalamic H1 receptor density and weight gain and accumulative fat mass in rats. H1 receptor density in the hypothalamus has been markedly reduced following chronic treatment with Olz (at both 3 mg/kg and 6 mg/kg doses) but not with OlzEt and OlzHomo, supporting the importance of the H1 receptor in Olz-induced obesogenic side effects. In agreement with our observation, the down-regulation of H1 receptor expression has been previously reported in the hypothalamic nuclei of rats treated with Olz 1 receptor density following OlzEt and OlzHomo treatments may explain the lack of orexigenic effects of these two compounds in the treated rats. Thus, the involvement of the H1 receptors in Olz-induced obesity and fat deposition might be closely related.The affinities of atypical antipsychotics for the 5HTIn general, while our study confirmed the effect of Olz administration on metabolic alterations in rats, we showed that OlzEt and OlzHomo administrations did not induce either enhancing effects on body weight and food intake or detrimental consequences on fat deposition and metabolism. Our findings appear to have reasonable predictive validity for different aspects of Olz-induced weight gain/adiposity and metabolic abnormalities which mimic the clinical situation.1 receptors in the hypothalamus. Our results showed that both OlzEt and OlzHomo appear to be promising new candidate compounds which did not result in weight gain, visceral fat deposition and metabolic dysfunction. However, based on the pharmacological proprieties alone, OlzEt presented with a similar profile to Olz during behavioural assessment in the open-field test with regards to blocking PCP-induced hyperactivities. These findings suggest that the long lasting down-regulation of D2 and 5-HT2A receptors induced by sub-chronic Olz and OlzEt treatment may play a part in blocking PCP-induced behaviours. The fact that OlzHomo had a reduced capacity to inhibit PCP-induced behaviours could also be explained by its lower affinity for the D2 and 5HT2A receptors in the brain compared to that of Olz and OlzEt. Therefore, if the OlzHomo regime was to be delivered at a higher dose than that of Olz and OlzEt, then the therapeutic effectiveness of OlzHomo may be increased. Given the limitations associated with animal models, we suggest that the present results be taken with caution. Only further behavioural studies and clinical trials will reveal the predictive validity of this preclinical model for the therapeutic efficacy and metabolic side effects of these two compounds.In conclusion, our findings confirmed the obesogenic effect of Olz administration, coupled with the down-regulation of the HTable S1Correlation and regression analysis. Pearson's correlation tests for radioligand receptor binding, metabolic and hormonal parameters in female Sprague Dawley rats following 5 weeks treatment with Olz, OlzEt, OlzHomo (3 mg/kg or 6 mg/kg), or vehicle (Control).(PDF)Click here for additional data file.

This study discusses an appropriate framework to measure system performance for the task of neonatal seizure detection using EEG. The framework is used to present an extended overview of a multi-channel patient-independent neonatal seizure detection system based on the Support Vector Machine (SVM) classifier.The appropriate framework for performance assessment of neonatal seizure detectors is discussed in terms of metrics, experimental setups, and testing protocols. The neonatal seizure detection system is evaluated in this framework. Several epoch-based and event-based metrics are calculated and curves of performance are reported. A new metric to measure the average duration of a false detection is proposed to accompany the event-based metrics. A machine learning algorithm (SVM) is used as a classifier to discriminate between seizure and non-seizure EEG epochs. Two post-processing steps proposed to increase temporal precision and robustness of the system are investigated and their influence on various metrics is shown. The resulting system is validated on a large clinical dataset of 267 h.In this paper, it is shown how a complete set of metrics and a specific testing protocol are necessary to extensively describe neonatal seizure detection systems, objectively assess their performance and enable comparison with existing alternatives. The developed system currently represents the best published performance to date with an ROC area of 96.3%. The sensitivity and specificity were ∼90% at the equal error rate point. The system was able to achieve an average good detection rate of ∼89% at a cost of 1 false detection per hour with an average false detection duration of 2.7 min.It is shown that to accurately assess the performance of EEG-based neonatal seizure detectors and to facilitate comparison with existing alternatives, several metrics should be reported and a specific testing protocol should be followed. It is also shown that reporting only event-based metrics can be misleading as they do not always reflect the true performance of the system.This is the first study to present a thorough method for performance assessment of EEG-based seizure detection systems. The evaluated SVM-based seizure detection system can greatly assist clinical staff, in a neonatal intensive care unit, to interpret the EEG. The vast majority of neonatal seizures are subclinical making them difficult to detect and treat . The onlA number of methods and algorithms have been proposed previously in an attempt to automatically detect neonatal seizures. However, their transition to the real-life usage in NICUs has been limited mainly by unsatisfactory performance . One algOne of the main constituent parts of the standardised performance assessment framework are the metrics employed. The metrics used to report the results of these seizure detection systems vary from publication to publication. Some papers only report clinically motivated event-based metrics ; others Apart from metrics, the above-mentioned published studies differ in many other ways: some studies report results as an average over training and testing data in contrIn 22.1The metrics used to assess the performance of a seizure detector task can be divided into epoch-based and event-based metrics.2.1.1Epoch-based metrics can be viewed as application irrelevant metrics – every epoch is considered as a separate testing example regardless of the importance that its (in)correct classification has for a particular task. In a binary decision problem such as the seizure detection, the decision made by the classifier can be represented in a structure known as a confusion matrix or contingency table. The confusion matrix has four categories: true positives (TP) are epochs correctly labelled as seizures; false positives (FP) refer to epochs incorrectly labelled as seizure; true negatives (TN) correspond to correctly labelled non-seizure epochs and finally, false negatives (FN) refer to epochs incorrectly labelled as non-seizure.Epoch-based metrics for seizure detection come from two theories: signal detection theory and information retrieval theory. From the former, sensitivity and specificity are reported in most papers and are ROC curves, however, can present an overly optimistic view of an algorithm’s performance if there is a large skew in the class distribution . This un2.1.2The event-based metrics are thought to reflect the performance of a system for a specific application. Unlike the epoch-based metrics, the subsequent decisions of the same class are joined to create an event. Two scores are defined; good detection rate (GDR) is the percentage of seizure events correctly identified by the system as labelled by an expert in neonatal EEG. If a seizure was detected any time between the start and end of a labelled seizure this was considered a good detection .The other score is the number of false detections per hour (FD/h) calculated as the number of predicted seizure events in 1 h that have no overlap with actual reference seizures. To cope with the spiky nature of false detections, the metric FD/h is at times reported by joining not only subsequent false detections but also those that lie closer than 30s apart from each other . The resThe curve of variation of GDR with FD/h should be reported to enable a valid comparison of different systems. To the best of our knowledge, this has not been reported previously. The main reason for this is that many algorithms require the careful selection of a number of rules and thresholds and do nA new metric which is proposed in this work is the mean false detection duration (MFDD). It is assessed by averaging the durations of all false detections produced by the system at a single operating point (with a chosen threshold). It will be shown in the experimental part of this paper that reporting the two event-based metrics can be misleading unless the MFDD is also reported. In a real application, FD/h indicates the number of times a clinician has to check the results of an automatic detector in vain; however, it is important, we believe, to also report the mean duration of these false detections. For instance, if both systems give 90% of GDR, the first one at a cost of 1 FD/h with 20 m duration and the other at a cost of 2 FD/h each with 1 m duration, the second system may be preferred as the results of the first system imply that ∼33% of time a clinician has to check the EEG monitor in vain, with only ∼3% of time in the second case.2.2A dataset composed of EEG recordings from 17 newborns obtained in the NICU of Cork University Maternity Hospital, Cork, Ireland was tested. The patients were full-term babies ranging in gestational age from 39 to 42 weeks. All newborns had seizures secondary to hypoxic ischemic encephalopathy (HIE). A Viasys NicOne video EEG machine was used to record multi-channel EEG at 256 Hz using the 10–20 system of electrode placement modified for neonates. The following eight bipolar EEG channels are used in this study: F4-C4, C4-O2, F3-C3, C3-O1, T4--C4, C4-Cz, Cz-C3, and C3-T3. The combined length of the recordings totals 267.9 h (mean duration per patient is 15.76 h) and contains 705 seizures which range from less than 1 min to more than 10 min in duration (mean seizure duration is 3.89 min). The dataset contained a wide variety of seizure types including both electrographic-only and electro-clinical seizures of focal, multi-focal and generalized types. All seizures were annotated independently by 2 experienced neonatal electroencephalographers using video EEG. The continuous EEG recordings were not edited to remove the large variety of artifacts and poorly conditioned signals that are commonly encountered in the real-world NICU environment. The dataset used is thoroughly described in 2.3The system described in detail in Classification consists of two steps – training and testing. The leave-one-out (LOO) cross-validation method is used to assess the performance of the system for patient-independent seizure detection. This way, all but one patients’ data is used for training and the remaining patient’s data is used for testing. This procedure is repeated until each patient has been a test subject and the mean result is reported. The leave-one-out method is known to be an almost unbiased estimation of the true generalization error ; that isThe training data for the SVM classifier are first normalized anisotropically by subtracting the mean and dividing by standard deviation to assure commensurability of the various features. This normalizing template is then applied to the testing data. In the testing stage, the obtained classifier is applied separately to each channel of the testing data. The outputs of the SVM are converted to posterior probabilities and filtered with a moving average filter (MAF). The averaged value is then compared to a threshold from the interval [0 1]. After comparison, binary decisions are taken per channel: 1 for seizure and 0 for non-seizure. The binary decisions are then fused as follows: if there is a seizure in at least one channel, the whole epoch is marked as a seizure, otherwise it is denoted as a non-seizure. The ‘collar’ technique is applied last – every seizure decision is extended from either side to compensate for possible difficulties in detecting pre-seizure and post-seizure parts. In the experimental part of this study, the influence of the collar on the system performance, especially for event-based metrics is analyzed.3An example of how reporting various metrics may be used to assess the performance of the system and to provide a detailed overview of the system behaviour is given in this section.The performance of the system in terms of ROC and PR areas for various parameters of post-processing is shown in The effect of post-processing is further explored on event-based metrics. Specifically, widths of 0, 40s (10 epochs) and ∼3 m (50 epochs) were chosen to investigate the influence of the collar on the event-based metrics. The curve of variation of GDR with FD/h for 8 different collar widths with MAF = 15 is shown in x-axis. The figure can be used to describe fully the performance of the system and for a complete comparison among the various seizure detection systems.To better examine the behaviour of the system with MAF = 15 and collar = 40s, results are shown in 44.1As can be seen from It is also evident from 4.2It is obvious from 4.3It can be seen from In contrast to the low values of specificity obtained for 1 FD/h in 4.4For all the patients shown in However, for patients 1, 2, 5, 7, and 10, which are highlighted in We and others have reported the discrepancy that exists between seizure number and actual seizure burden, i.e. the total amount of time the baby spends in seizure . TherefoA proper investigation of how seizure morphology and location can influence the seizure detection rate and detected seizure burden is required and will be the focus of our future work.4.5As it can be seen from For a false detection rate in excess of 0.25 FD/h, the event-based GDR tends to closely match the epoch-based sensitivity/recall measure which also measures the amount of detected seizure burden. This indicates that the system shows equally high temporal precision and detection rates. The main significant difference appears at 0 FD/h where a sensitivity of less than 20% results in a GDR in excess of 50%. At this point, only the most evident seizure parts of more than a half of all seizure are detected with no false detections produced.The robustness of the system can also be observed by examining the FD/h (30s) metric which appears to be quite close to the actual FD/h up to 4 FD/h. Hence, for the proposed system there is no need to adapt the metric to better match the system behaviour. It is worth outlining the difference between the collar technique and the FD/h (30s) metric as both approaches are shown to decrease the actual FD/h. In the first case, the collar forms a part of the overall classification system and is applied before any metrics are calculated. Thus, increasing the collar will decrease FD/h but it also influences other metrics as shown in In fact, A variety of metrics were calculated in this study, however, the post-processing parameters of the system were chosen to maximize the ROC area, with the other metrics observed to help explain the behaviour of the system in a particular situation or for a chosen patient.4.6Most recently published neonatal seizure detection systems claim to offer the best “state of the art” performance. However, the testing protocol used in the reported papers is so different that such claims are difficult to verify. A fair comparison among seizure detection systems is quite complicated for several objective reasons which are outlined below.Consider first the data used to test the systems. Several studies do not have a clear division of the data used to train and test the algorithm and thus, in many cases, report test results on the data on which the system has been developed . There aN-fold cross-validation (The majority of studies on neonatal seizure detection have performed a split of data into training and testing, either performed once or repeatedly in a certain statistical routine. Most studies prefer a static data division (also known as the hold-out or split sample method – one filidation .Another point to be taken into account is that with the static division of the dataset the performance of a particular model trained on a particular chunk of data is reported. In practice, a reader or developer who wants to exploit a reported technique will most likely have a different dataset at hand; thus, the reported performance cannot be guaranteed for him/her. What is examined with the LOO procedure is not a particular model but indeed the methodology used to obtain such a model. The last point means that the LOO estimate gives effectively a robust prediction of the performance that other researchers/practitioners will obtain using this method, but trained on their data. Only a few papers used the LOO for performance assessment .Averaging over inhomogeneous data also affects performance assessment. In It has been also argued in Different seizure etiology and gestational age of the babies in the exploited datasets is another issue which is important for comparison of detectors. Not all studies clearly It is worth noting that for the above-mentioned reasons, as summarised in A comparison of results with other studies is also complicated by a variety of metrics, and the way authors report their results. Below, there is an attempt to compare the algorithms for neonatal seizure detection reported in several recent studies. The comparison is only possible because the curves of performance are repoIn a system which utilises a classifier based on a multilayer perceptron , a speciIn The system developed in In In Direct comparison can be made to our previous work as the d5The study has presented an overview of common metrics, experimental setups and testing protocols forming a framework to facilitate possible future comparisons between EEG-based seizure detection systems. An SVM-based multi-channel neonatal seizure detection system has been overviewed in the proposed framework. The system has been validated on a large clinical dataset and the results have been reported. Two post-processing steps have been introduced and their influence on the system performance has been analysed. It has been shown that reporting only event-based metrics may lead to over-optimistic performance and a new metric has been proposed here to accompany the event-based metrics. The proposed SVM-based seizure detection system allows for the control of the final decision by choosing different confidence levels which in turn makes the proposed system flexible for clinical needs.

We show that MRI monitoring of BBB-opening could serve as an indicator of the scale and distribution of AAV transduction. Transduction peaked at 3 weeks and neurons and astrocytes were affected. This novel, noninvasive delivery approach could significantly broaden the application of AAV-viral-vector-based genes for treatment of CNS diseases.Recombinant adeno-associated viral (rAAV) vectors are potentially powerful tools for gene therapy of CNS diseases, but their penetration into brain parenchyma is severely limited by the blood-brain barrier (BBB) and current delivery relies on invasive stereotactic injection. Here we evaluate the local, targeted delivery of rAAV vectors into the brains of mice by noninvasive, reversible, microbubble-facilitated focused ultrasound (FUS), resulting in BBB opening that can be monitored and controlled by magnetic resonance imaging (MRI). Using this method, we found that IV-administered AAV2-GFP (green fluorescence protein) with a low viral vector titer (1×10 Gene therapy is a potentially powerful means of treatment of various diseases with genomic causes. Recombinant adeno-associated viral (rAAV) vectors provide several advantages including no pathogenicity, typical persistence of the transgene as an episome, low immunogenicity, complete removal of all viral genes, and long-term gene expression 12 vg), organs such as liver and heart would be significantly infected and it remains viral toxicity concerns.Intravenous (IV) administration of viral vector delivery is comparable less invasive, however, it appears to be ineffective for CNS delivery due to the BBB blockage. The BBB is formed by tight junctions between the endothelial cells of the cerebral capillaries and blocks AAV diffusion and entrance from the blood stream to the brain parenchyma 9 viral genomes.Microbubble-enhanced focused ultrasound (FUS) has been shown to locally and temporally disrupt the BBB All animal experiments were approved by the Institutional Animal Care and Use Committee of Chang Gung University and adhered to their experimental animal care guidelines . Animal were shaved and a PE-10 catheter was inserted in the tail vein for substance administration during the experiment. Seventy-four outbred imprinting-control-region (ICR) mice were separated into two groups. Group 1 consisted of twenty-nine mice that were used to optimize the time course of AAV infection from 1 to 6 weeks . Group 2Recombinant adeno-associated virus (AAV) is a proven research and therapeutic tool 11 vg with the inject volume of 30 µL in mice Virus containing pAAV2-IRES-hrGFP was produced with the AAV2 helper system . Briefly, plasmid DNA was used to transfect 293T cells at 80% confluence. Cell lysates were collected 48 hr post-transfection and purified by CsCl density gradient centrifugation. Titers of rAAV-hrGFP were determined by RT-PCR analysis by calculating the viral genome copy number. The biodistribution of the employed pAAV2-IRES-hrGFP transduction were mainly found in liver and spleen 2 window at the bottom of the tank. 30 µL of viral vectors with the titer of 1×109 viral genomes per gram (vg/g) of treated animal were bolus injected through the same PE-10 catheter and immediately followed a 0.3 mL/kg microbubbles bolus injection mixed with 20 µL of saline. The center of the focal zone was placed at a 2–3 mm depth of penetration for each hemisphere. With a 10-second delay, ultrasonic energy was delivered to the brain transcranially using a spherically focused transducer . Burst-mode ultrasound with burst length 10 ms, pulse-repetition frequency (PRF) 1 Hz, and duration 120 seconds was used. The input electric power was 3–8 W ; corresponding acoustic pressure amplitude of 0.44–0.7 MPa). Animals were sacrificed 1–6 weeks later. The recovery process from ultrasound-induced brain damage was carefully monitored. Besides of the FUS experimental group, three control experiments were performed: (1) FUS only without AAV delivery ; (2) viral vector IV administration only without FUS exposure ; (3) direct viral vector injection and 2% vaporized isoflurane using an anesthesia vaporizer. The top of the cranium was shaved with clippers, and a PE-10 catheter was inserted into the tail vein for injections. The animal was placed directly under an acrylic water tank with its head attached tightly to the thin-film, 4×4 cm2; in-plane resolution = 173×256 mm2; slice thickness = 0.5 mm; flip angle = 70°; acquisition time = 156 seconds).The degree of BBB opening was monitored with a 7-Tesla magnetic resonance scanner and a 4-channel surface coil was used on the top of the mouse brain. A gradient echo FLASH sequence was performed to acquire T1W images (pulse repetition time (TR)/echo time (TE) = 300/3.81 msec; FOV = 21×25 mmAnimals were sacrificed 2–3 weeks after FUS sonication. The brains of these mice were quickly removed and frozen for embedding in Optimal Compound Temperature compound . Embedded brains were sectioned serially into 10-μm-thick slices with a cryostat microtome . After washing with PBS, slides were subjected to immunoflurorescence (IF) with a fluorescent microscope to confirm the expression and determine the distribution of AAV2-GFP protein in the brain. Sections were fixed with 4% paraformaldehyde, rinsed with PBS, blocked with serum for 30 min at room temperature, and incubated with rabbit-anti-GFP polyclonal antibody at 4 °C overnight. After rinsing with PBS, the sections were incubated with goat-anti-rabbit IgG conjugated with rhodamine for 1 hour at room temperature in the dark. To distinguish the AAV-transfected cell type, mouse-anti-neuronal nuclei (NeuN) monoclonal antibody and rabbit-anti-Glial Fibrillary Acidic Protein (GFAP) polyclonal antibody were then used on the same sections, then incubated with Cy3-conjugated Goat-anti-mouse and Cy3-conjugated Goat-anti-rabbit secondary antibodies respectively. Images were acquired and merged, to determine which cell types has been transfected. Finally, every section was stained with hematoxylin and eosin (HE) for histological examination.2 flow rate). T1-weighted MR images were acquired immediately after the completion of Gd-DTPA administration followed by flushing with saline (0.5 mL/kg) and heparin (0.2 mL/kg) to identify the BBB-disrupted region (with 10-second time lapse before acquiring MRI). In contrast, AAV2-GFP expression and distribution in tissue was detected by fluorescence microscopy, so these two modalities could be combined to predict the efficiency of AAV infection.Animals (n = 26) were well positioned in the MR bore (within 1-minute time lapse after FUS exposure) with the animal head attached with a receive-only surface loop coil (diameter 20 mm). Animals were anesthetized with isoflurane interfaced with a digital CCD camera mounted on an fluorescence microscope . Results are expressed as means ± standard error (SE) of duplicate or more measurements, obtained from three or more independent experiments. Data were analyzed using one-way ANOVA followed by un-paired post-ANOVA tests using the Bonferroni correction. Values of p<0.05 were considered statistically significant. Cell transduction rate was calculated by counting the ratio of GFP-positive cell among the total cell number per selected region-of-interest (100×100 µm2) in each IHC stained slide .Quantitative analysis of the GFP-positive area was performed on a personal computer running image processing software and neuronal marker NeuN . GFP signal from AAV2-GFP clearly colocalized with GFAP, demonstrating that the viral vectors successfully transduced astrocytes . A small9 vg/g). This suggests the combined use of viral-vector intravenous administration with FUS-BBB opening is a potential technique to achieve targeted gene delivery for CNS disease treatment noninvasively.In this study, we demonstrated the use of microbubble-facilitated FUS to enhance local BBB opening that successfully facilitated local AAV-2 penetration into the brain parenchyma and produced gene expression in CNS cells in mice. Unlike current invasive procedures involving direct local injection of viral vector, our FUS procedure concentrated ultrasound transcranially to induce local BBB opening for expressing genes at specific target regions in a noninvasive manner. We also demonstrated that GFP expression correlated well with MRI signal enhancement, suggesting the possibility of using MRI-monitored BBB-opening can not only served as an indicator of therapeutic agent amount 12 vg/g 9 vg/g employed in this study is relatively low and nearly the currently reported lowest dose to perform AAV gene delivery .(TIF)Click here for additional data file.Figure S2Quantitative analysis of EB extravasation. (a) Calibration curve of known EB standards and OD values. (b) EB quantities determined from the standard curve for three different acoustic powers. Results are indicated as means and SEM values for the experimental and contralateral brains; n = 3. (c) Percent increase in EB compared to control for three different acoustic powers. 97.65%, 508.2% and 726.49%, respectively of the EB leakage increase was observed in 0.44-, 0.53- and 0.7-MPa sonicated brains.(TIF)Click here for additional data file.Figure S3Transmission electron micrographs (TEMs) of control and FUS-exposed CNS capillaries. (a) Control capillary showing intact tight junction structure (bar = 115 nm). (b) Capillaries after 0.53-MPa FUS exposure revealing compromised tight junctions and numerous vesicles in endothelial cell cytoplasm (bar = 115 nm); (c) magnified tight junction from (b) showing inter-endothelial craft induced by FUS (bar = 1500 nm); (d) capillaries with 0.7-MPa FUS exposure showing large inter-endothelial tight-junction craft (bar = 115 nm).(TIF)Click here for additional data file.Figure S4Cell-type specific AAV transduction. Here we show the comparison of AAV transduction rate in glial cells and neurons in control and FUS-BBB opened brain regions.(TIF)Click here for additional data file.Figure S5Immunofluorescence confirmation of AAV2-GFP expression. Neuronal Nuclei (NeuN) and Glial Fibrillary Acidic Protein (GFAP) immunofluorescence, and HE staining in (a) contralateral and (b) experimental brain. Neurons (nuclei stained by NeuN) appeared similar between the two sides of the brain, but glial cells were increased in the experimental lateral brain. HE-staining showed that the tissue structure was not severely damaged by FUS treatment. Bar = 200 µm.(TIF)Click here for additional data file.Table S1Summary of numbers of animal used for focused ultrasound experiments.(DOCX)Click here for additional data file.Method S1Cloning of AMCase and setup of AMCase-overexpressing cell line and rAAV. This supplemental methods section provides a detailed description of the AMCase cloning, the setup of AMCase-overexpressing cell line and the production of recombinant AAV.(DOCX)Click here for additional data file.Method S2Real-time PCR and Western blotting. This supplemental methods section provides a detailed description of the use of real-time PCR and Western blotting to confirm the GFP expression in the brain.(DOCX)Click here for additional data file.Method S3Focused ultrasound calibration and assessment of blood-brain barrier disruption. This supplemental methods section provides a detailed description of focused ultrasound calibration and measurement, as well as the use of Evans Blue (EB) infiltration and staining to assess the BBB-opening.(DOCX)Click here for additional data file.Method S4AAV direct injection as a positive control. This supplemental methods section provides a detailed description of the AAV direct injection as a positive control group.(DOCX)Click here for additional data file.

RIZ1 was re-expressed in the TE13 cells by reintroducing the gene through transfection or by removal of transcriptional repression through treatment with a DNA methyltransferase (DNMT) inhibitor. To reintroduce the gene, the open reading frame of the RIZ1 gene was inserted into the eukaryotic expression pcDNA3.1(+) vector and pcDNA3.1(+)/RIZ1 was purified and transfected into the TE13 ESCC cells. Removing transcriptional repression involved treating the TE13 cells with 5-aza-2′-deoxycytidine (5-aza-CdR), a DNMT inhibitor. RIZ1 mRNA and protein expression were determined by quantitative polymerase chain reaction (qPCR) and western blotting. The rate of apoptosis of the cells was determined by flow cytometry. A recombinant eukaryotic human RIZ1 expression plasmid, pcDNA3.1(+)/RIZ1, was constructed and confirmed by sequencing. RIZ1 mRNA and protein expression increased in pcDNA3.1(+)/RIZ1 stably transfected cells. Treatment with 5-aza-CdR for 48 and 72 h resulted in increased RIZ1 protein expression and increased the rate of apoptosis in the TE13 cells (P<0.01). In conclusion, transfection of the TE13 cells with the eukaryotic pcDNA3.1(+)/RIZ1 expression vector and reversal of transcriptional repression of RIZ1 using 5-aza-CdR demonstrate that it is possible to re-express RIZ1 in TE13 cells. Furthermore, the re-expression of RIZ1 led to an increased rate of apoptosis and this method may provide new therapeutic possibilities.The tumor suppressor protein retinoblastoma protein-interacting zinc finger gene 1 (RIZ1) is downregulated in several types of cancer, including esophageal squamous cell carcinoma (ESCC). The present study used two Esophageal squamous cell carcinoma (ESCC) is a malignancy that arises from esophageal epithelial cells and represents ~2% of all tumor types by incidence . The treRetinoblastoma protein-interacting zinc finger gene 1 (RIZ1) plays a significant role as a tumor suppressor gene in esophageal cancer. RIZ1 has previously been reported to be expressed at low levels in esophageal carcinoma tissues compared with the adjacent non-cancerous tissues ,4. FurthThe study was conducted in accordance with the Declaration of Helsinki. Approval for this study was obtained from the Ethics Committee for the Use of Human Subjects of Tianjin Medical University General Hospital . Patients provided their written consent to participate in this study and this consent was also approved by the Ethics Committee for the Use of Human Subjects of Tianjin Medical University General Hospital.3, 10.4 g RPMI-1640 and 1,000 ml ddH2O , supplemented with 10% fetal bovine serum (Gibco), 1X L-glutamine (2 mM), 100 U/ml penicillin and 100 μg/ml streptomycin. The cells were incubated at 37°C in a 5% CO2 humidified incubator.The human ESCC TE13 cell line was purchased from American Type Culture Collection and cultured in RPMI-1640 containing 4.76 g HEPES, 2.0 g NaCOThe esophageal cancer tissues and the matched adjacent non-cancerous tissue samples were obtained from the Department of Cardiothoracic Surgery of Tianjin Medical University General Hospital following the surgical excision of the tumors. All the specimens were placed in liquid nitrogen immediately following the resection and stored at −80°C until RNA or genomic DNA extraction. None of the patients were administered chemotherapy or radiation therapy prior to surgery and the diagnoses of all the patients were pathologically confirmed to be esophageal squamous carcinoma.6-1×107 cultured cells and the tissue samples were ground into a fine powder using a pestle and mortar prior to incubation in TRIzol (100 g/l). The RNA pellets were resuspended in diethylpyrocarbonate-treated H2O. The total RNA concentrations of the samples were quantified using a UV spectrophotometer .RNA was isolated from cell lines or tissues using TRIzol according to the manufacturer’s instructions. TRIzol (1 ml) was added to 5×10Reverse transcription was performed to produce complementary DNA (cDNA) using 2 μg RNA, molony murine leukemia virus (M-MLV) reverse transcriptase, ribonuclease inhibitor and dNTPs mixture according to the manufacturer’s instructions. Semi-quantitative polymerase chain reaction (PCR) was performed using the cDNA templates.4, 2 μl each of the forward and reverse primers, 1 μl cDNA, 1 μl KOD-Plus Ver. 2 enzyme and ddH2O. Each PCR amplification required specific conditions according to the melting temperature and size of the amplicon as follows: Initialization at 94°C for 2 min, 35 cycles of denaturation at 98°C for 10 sec, annealing , amplification at 72°C 1 min and a final extension at 72°C for 10 min. The quality of the amplified products was analyzed using 12 g/l agarose gels with a UV spectrophotometer (Beckman Coulter) and the quantitative PCR reaction products were sequenced.According to the published NCBI RIZ1 mRNA sequence (NM_012231), the size of the protein coding region is 5,157 base pairs that are positioned between base pairs 857 and 6,013. Due to the size of the amplicon, the open reading frame may be divided into five sections, designated A603, A1200, B, C and D. The primers were previously designed for the five amplicons of RIZ1 by Primer 5.0 software as follows: Forward: 5′-GTGGCTAGCATGAATCAGAACACTACTG-3′ and reverse: 5′-TTGGCCAGAGGTGAAATCTGG CTC-3′ for A603; forward: 5′-TGGCTGCGATATGTGA ATTG-3′ and reverse: 5′-CTCTACGCTGATGCCGTCTC-3′ for A1200; forward: 5′-GCTGATGGCAAAGCATCTG-3′ and reverse: 5′-AATTCCTTGCCTTCAGAGTCAC-3′ for B; forward: 5′-TCAAAGAAAGTCATTCAGTGC-3′ and reverse: 5′-CGGTGATGGTACTGAAATG-3′ for C; and forward: 5′-GCCTCAATCAGCATTACC-3′ and reverse: 5′-GTCTACTCTTTGAAGAATGGTC-3′ for D. PCR amplification for each amplicon of RIZ1 was also performed using cDNA from normal, control esophageal tissue. The PCR reactions were performed in a volume of 50 μl, consisting of 5 μl 10X KOD buffer, 5 μl 2 M dNTPs, 3 μl 25 mM MgSOThe amplicons were extracted from the agarose gel using the TIANgel Midi Purification kit according to the manufacturer’s instructions. Each of the five amplicons were separately inserted into a T Trans1-T1 Phage Resistant vector , transformed into Trans1-T1 Phage Resistant competent cells, plated on agar containing ampicillin, and X-gal and white colonies were selected for further analysis. Following the expansion of the selected bacterial colonies, plasmid DNA was extracted by alkaline lysis . Restric5 in a volume of 2 ml media, incubated at 37°C and allowed to reach a confluence of 90–95%. After 24 h, the media were replaced with complete serum-free RPMI-1640 or antibiotics-free medium in preparation for transfection. Ultra-pure pcDNA3.1(+)/RIZ1 plasmid DNA was extracted using the HighPure Mini Plasmid kit . A liposome-mediated method . The primer (10 μM) sets that were used were as follows: Forward: 5′-TCTGCTGTTGACAAGACCC-3′ and reverse: 5′-GCATCAATGCACATCCATC-3′ for RIZ1; and forward: 5′-GAAGGTGAAGGTCGGAGTC-3′ and reverse: 5′-GGGTGGAATCATATTGGAAC-3′ for glyceraldehyde 3-phosphate dehydrogenase. The reactions were performed using a LightCycler qPCR system according to the manufacturer’s instructions. Briefly, the reaction involved an initial denaturation step at 94°C for 5 min followed by 45 cycles of denaturation at 95°C for 5 sec, annealing at 59°C for 20 sec and extension at 72°C for 10 sec, followed by the generation of thermal melting curves. Each sample was run in triplicate for each gene.The PcDNA3.1(+)/RIZ1-transfected TE13 cells were homogenized in RIPA buffer and the protein concentrations were determined using the bicinchoninic acid protein assay kit . The cell lysates (30 μg) were separated by 8% SDS-PAGE, transferred to nitrocellulose membranes and immunoblotted with the indicated antibodies. All the antibodies were purchased from Abcam , including the RIZ1 and the β-actin primary antibody and the secondary antibody goat anti-mouse. The bands were visualized using the PowerLook scanner and quantified with ImageQuant software. The relative expression of RIZ1 was calculated as the gray value for RIZ1 divided by the gray value for β-actin. The TE13-untransfected and empty vector transfected cells were used as negative controls.5 TE13 cells were seeded in six-well plates and allowed to attach for 12 h. Cell cycle synchronization was achieved by serum starvation in serum-free RPMI-1640 media for 24 h. The cells were subsequently transfected with pcDNA3.1(+)/RIZ1 and harvested after 24 h. The cells were fixed in 70% ice-cold ethanol overnight, treated with DNase-free Ribonuclease (Takara), stained with propidium iodide and subjected to analysis using a FACSAria™ . The data were analyzed using ModFit LT software . The TE13-untransfected and empty vector transfected cells were used as controls.To determine the effect of overexpressing RIZ1 on apoptosis, 2×105 in six-well plates and treated with 10 μM DNMT inhibitor, 5-aza-CdR (Sigma-Aldrich), for 24–72 h. The drug was refreshed daily. The 5-aza-CdR was removed and the cells were subsequently incubated for 120 h.The TE13 cells were seeded at a density of 2×10−averageΔΔCT × 100%. T-tests and one-way ANOVA were used to analyze parametric data. The statistical analysis of the group comparisons involved one-way ANOVA and the χ2 test was used to compare enumerated data; P<0.05 was considered to indicate a statistically significant difference.Statistical analysis was performed using SPSS 18.0 . The data are presented as the mean ± standard deviation. The qPCR results are presented as 2In order to re-express RIZ1, a recombinant plasmid was generated to enable the ectopic overexpression of RIZ1 in TE13 cells. Due to the size of the protein coding region of the RIZ1 gene, the target was divided into five amplicons, A603, A1200, B, C and D. RNA was isolated, reverse transcribed into cDNA and amplified by PCR. Each of the five amplicons were subsequently ligated into the T Trans1-T1 Phage Resistant vector and used to transform the competent bacterial cells. Blue-white screening and ampicillin selection was used to select the potential positive colonies. Following the expansion of the colonies in liquid culture, the plasmid DNA was extracted by alkaline lysis. Successful recombination was verified by restriction enzyme digestion and sequencing. The five amplicons of the RIZ1 fragment were then ligated into the eukaryotic pcDNA3.1(+) expression vector. The RIZ1 fragment was successfully inserted into the pcDNA3.1(+) plasmid to produce recombinant pcDNA3.1(+)/RIZ1, with each amplicon in the correct order . qPCR anThe promoter of the RIZ1 gene in the TE13 cells, which expressed low levels of RIZ1, was observed to be methylated. The loss of this methylation was hypothesized to result in the re-expression of RIZ1 . Therefoet al vector is an efficient eukaryotic expression vector. Transcription of the inserted sequence is controlled by the human cytomegalovirus promoter, whilst there is a transcription termination signal downstream ,21,22. CRIZ1 is a tumor suppressor gene that prevents the progression of esophageal carcinoma. In the present study, the eukaryotic pcDNA3.1(+)/RIZ1 expression plasmid was used to transfect human squamous esophageal carcinoma TE13 cells, in order to re-express RIZ1. Furthermore, the re-expression of RIZ1 was attempted using the DNMT inhibitor, 5-aza-CdR, to reverse the methylation of the RIZ1 promoter in the TE13 cells. The DNMT inhibitor, 5-aza-CdR, has been used in the clinic for the treatment of certain solid tumors and hematological diseases, including myelodysplastic syndrome and acute myeloid leukemia . New thein vivo models in order to establish new methods to combat and potentially cure esophageal carcinoma using gene and cellular transplantation therapy. Additionally, further research on the mechanism of action of the RIZ1 tumor suppressor gene may lead to the development of new biomarkers for early diagnosis and prognostic evaluation in esophageal cancer.The present study demonstrated that the transfection of pcDNA3.1(+)/RIZ1 or the application of 5-aza-CdR increased the expression of RIZ1 and effectively increased the rate of apoptosis in TE13 cells. This raises the possibility that the re-expression of RIZ1 may induce apoptosis in malignant esophageal cancer cells. Furthermore, the experiments have led to the development of a cell line in which RIZ1 is overexpressed and the detailed biological characterization of this cell line will follow. Future studies will focus on

Reported findings are inconsistent whether hypothalamic-pituitary-adrenal (HPA) signaling becomes hyperactive with increasing age, resulting in increasing levels of cortisol. Our previous research strongly suggests that offspring from long-lived families are biologically younger. In this study we assessed whether these offspring have a lower HPA axis activity, as measured by lower levels of cortisol and higher cortisol feedback sensitivity.Salivary cortisol levels were measured at four time points within the first hour upon awakening and at two time points in the evening in a cohort comprising 149 offspring and 154 partners from the Leiden Longevity Study. A dexamethasone suppression test was performed as a measure of cortisol feedback sensitivity. Age, gender and body mass index, smoking and disease history (type 2 diabetes and hypertension) were considered as possible confounding factors.Salivary cortisol secretion was lower in offspring compared to partners in the morning and in the evening . Salivary cortisol levels were not different after dexamethasone (0.5 mg) suppression between offspring and partners .Offspring of nonagenarian siblings are marked by a lower HPA axis activity , but not by a difference in cortisol feedback sensitivity. Further in-depth studies aimed at characterizing the HPA axis in offspring and partners are needed. Cortisol secretion is tightly regulated by the hippocampus and the hypothalamic-pituitary-adrenal (HPA) axis through a negative feedback mechanism Changes in HPA axis activity are associated with numerous pathophysiological conditions, for example persons under chronic stress or with depression have, on average, higher levels of cortisol Since the aforementioned studies compare young and old subjects, results from these studies might be confounded by a difference in prevalence of age-related diseases and depression. In the Leiden Longevity Study we have previously shown that middle aged offspring from long lived nonagenarian siblings seem biologically younger than their age and environmentally matched partners as reflected in a lower prevalence of age-related diseases The Leiden Longevity Study was designed to identify genetic and phenotypic markers related to longevity. A more detailed description of the recruitment strategy of the Leiden Longevity Study can be found elsewhere For the present study 388 subjects (194 offspring and 194 partners) were enrolled from the Leiden Longevity Study. Saliva cortisol data were incomplete or invalid in 84 subjects (45 offspring and 39 partners) and these subjects were therefore excluded from the analyses. One subject (partner) used oral corticosteroids at the time of the study and was thus excluded from the analyses as well. None of the participants used inhaled corticosteroids. In total, data from 149 offspring from 93 families and 154 controls (their partners) were used for analyses. This study was approved by the Medical Ethical Committee of the Leiden University Medical Center and written informed consent was obtained from all participants.Subjects were asked to collect saliva samples at home on an average weekday. Instructions for saliva sampling were given both orally (by a research nurse) and written. In total, six saliva samples for cortisol determination were obtained at one day. Four samples were taken at different time points in the first hour after awakening . These four time points were used to assess the CAR. The other two samples were taken in the evening, namely at 10 pm and 11 pm, as an estimation of the lowest cortisol levels during the day. For analyses, we refer to these samples to be taken at day “0”. After the last saliva sample (at 11 pm), subjects were asked to ingest one dexamethasone tablet (0.5 mg). At awakening the next day (day “1”), one additional saliva sample was taken for an estimation of the cortisol level after dexamethasone treatment.Measurements were performed using fully automatic equipment. Cortisol was measured using an Electrochemoluminescence Immunoassay (ECLIA) on the Modular E-170 Immunoanalyser . Coefficients of variance were below 5.7% in the morning and below 9.7% in the evening samples.Additionally, weight and height were measured by research nurses at the study center. Information about current smoking habits was obtained using a questionnaire and information on disease history was obtained via the general practitioner and antidepressant drug use was obtained via the pharmacies.g) i) with respect to the level of cortisol at time point 0 All data used for this study were normally distributed. The Area Under the Curve was calculated with respect to the ground as a measure for cortisol secretion in the first hour after awakening and for the evening time points and chi square statistics . Analyses concerning the comparison between offspring and partners in salivary cortisol concentrations were performed using linear regression models. First, data are presented unadjusted for possible confounding factors. Second, data are presented after adjustment for the possible confounding factors: age, gender, body mass index and current smoking habits. Third, an additional analysis was performed in which adjustment was made for the history of type 2 diabetes and hypertension. Fourth, analyses were additionally adjusted for the use of antidepressant drugs, as these were previously described to associate with cortisol levels. Correlation between morning and evening cortisol levels was calculated using pearson chi square. The analysis concerning the dexamethasone suppression test was additionally adjusted for the cortisol salivary concentration at awakening at day 0 to account for possible differences observed at day 0 that might modify the results at day 1. In addition, an interaction term in the statistical model was used to assess whether the association between age and the AUCAll statistical analyses were performed using SPSS for Windows . In addition, analyses were adjusted for familial relationship using residual weight in SPSS. P-Values below 0.05 were considered statistically significant.Characteristics of the study population are presented in A graphical presentation of the cortisol awakening response in offspring and partners is presented in g between offspring and partners persisted, and reached statistical significance (p = 0.048). Additionally, adjusting for antidepressant drug use did not materially change the difference in morning AUCg between offspring and partners. Restriction to couples comprising an offspring and partner did not materially change the difference either. Furthermore, the AUCi with saliva cortisol concentration at awakening as a reference was not different between offspring and partners (p = 0.66).To estimate the total cortisol secretion within the first hour on awakening, the AUC was calculated with respect to the ground as well as to the cortisol level on awakening. Results on total cortisol secretion on awakening are presented in g between offspring and partners were similar when the analysis was additionally adjusted for disease history as well as when antidepressant drug use was included as a potential confounding factor. The trend towards lower evening cortisol levels in offspring was similar in females and males . The association between the AUC of the cortisol awakening response and the AUC of the evening cortisol was similar for offspring and partners .Results of the overnight dexamethasone test are presented in In this study we aimed to investigate cortisol levels and cortisol feedback sensitivity in relation to familial longevity. We first showed that salivary cortisol levels were lower in the offspring compared to their partners both in the morning and in the evening. Second, we showed that cortisol feedback sensitivity, as estimated by a dexamethasone suppression test, was similar between offspring and partners, suggesting that the difference between offspring and partners in salivary cortisol concentration is most likely not caused by a difference in cortisol feedback sensitivity.Previous research showed that, when comparing young and old subjects, cortisol levels were higher during the night in older subjects compared to younger subjects i), was similar in both groups. Because the increase upon awakening was similar in both groups and because the offspring had lower levels of cortisol in both the morning and evening it might be suggested that offspring have lower total cortisol secretion compared to their partners.The cortisol awakening response is dependent on both the circadian rhythm as well as on awakening itself Socio- economic status is described to influence the cortisol awakening response also With increasing age, sensitivity to cortisol is decreasing. A recent study showed that increasing the dexamethasone dose has no additional effect on inhibiting cortisol secretion in elderly, whereas it does in younger subjects This study has a few limitations to address. As this study was performed home-based, strict standardization and timing by which the saliva samples were taken cannot be ascertained. Additionally, we observed an increase in cortisol levels at 11 pm compared to 10 pm, in which a decrease was expected. A possible explanation could be that subjects who normally slept earlier were subjected to stress when asked to take saliva samples at 11 p.m. (thereby increasing their cortisol level). A third limitation of this study was that we did not have information on depression at the time of the study. Instead, we used information from the pharmacies on antidepressant drug use. The limitation of this strategy is that also participants with, for example, neuropathic pain and anxiety disorders might take antidepressant medication. However, as the number of participants taking antidepressant medication is small, the effect will likely be negligible. Despite these shortcomings, which probably resulted in an increased variation in the dataset, we were still able to demonstrate lower salivary cortisol levels in offspring from long-lived families both in the morning and evening.In conclusion, the results of this study show that familial longevity might be marked by lower levels of morning and evening cortisol. Dexamethasone suppression tests revealed that it is unlikely that a major change in cortisol feedback sensitivity explains these effects, although a repetition with a lower dose is recommendable. This study describes an association between cortisol levels and familial longevity. More research should be performed to characterize what mechanism is responsible for the lower levels of cortisol in the offspring group. Moreover, more research and replication with increased precision and standardization should be performed to further characterize the differences in HPA axis activity between longevity families and controls.

To the Editor: In 2010, the city of Ngaoundéré in Cameroon experienced its first reported epidemic of meningococcal meningitis. Ngaoundéré, with an estimated population of 180,000, is the main city in the Adamaoua region in northern Cameroon. The 2 northernmost regions of Cameroon, North and Far North, are considered to belong to the African meningitis belt samples, 46 cases were apparent meningitis in which the patients had turbid CSF, and 46 were clinical cases diagnosed in an epidemic context. The male:female ratio of the patients was 2.7:1. The mean age of patients was 19 years, and median was 17 years.During February–April 2010, a total of 126 cases of meningitis were reported in the Adamaoua region. Of the 126 cases, 34 were confirmed by identification of N. meningitidis serogroups A, C, W135, and Y .CSF specimens from 34 patients were sent to the Centre Pasteur du Cameroun in Garoua for testing. Laboratory procedures included assessing CSF turbidity, Gram staining, searching for soluble capsular antigens by using the Pastorex latex agglutination kit , and testing by the dipstick rapid diagnostic test for 2. Susceptibility to antimicrobial drugs was tested according to the recommendations of the Antibiogram Committee of the French Society for Microbiology (www.sfm.asso.fr). An isolate of N. meningitidis was sent to the World Health Organization Collaborating Centre for Reference and Research on Meningococci in Oslo, Norway, for molecular analyses, as described (www.neisseria.org). The result was that the isolate, a N. meningitidis serogroup A clone of sequence type 7, was susceptible to β-lactams and chloramphenicol but resistant to trimethoprim/sulfamethoxazole.All 34 specimens were positive for serogroup A by agglutination, rapid test, or both. CSF specimens were cultured on blood agar and chocolate agar supplemented with PolyViteX and incubated at 37°C in an atmosphere of 5% COThis epidemic occurred in an area where the mean annual rainfall for the past 30 years was 1,460 mm . This value should exclude Ngaoundéré from the African meningitis belt, for which the southern limit of annual rainfall was classically considered to be the 1,100-mm isohyet .This epidemic at the border of the African meningitis belt raises the question of the belt limitation and its potential expansion southward. These topics should be addressed through active and standardized surveillance in countries such as Cameroon, which are not entirely included in the belt of 126 suspected cases had a lumbar puncture performed at the Ngaoundéré Regional Hospital or at the Norwegian hospital. With the help of the laboratory, an increasing number of cases of meningitis in Cameroon are confirmed cases (

There is a growing number of empirical reports of environmental change simultaneously influencing population dynamics, life history and quantitative characters. We do not have a well-developed understanding of links between the dynamics of these quantities.2. Insight into the joint dynamics of populations, quantitative characters and life history can be gained by deriving a model that allows the calculation of fundamental quantities that underpin population ecology, evolutionary biology and life history. The parameterization and analysis of such a model for a specific system can be used to predict how a population will respond to environmental change.3. Age-stage-structured models can be constructed from character-demography associations that describe age-specific relationships between the character and: (i) survival; (ii) fertility; (iii) ontogenetic development of the character among survivors; and (iv) the distribution of reproductive allocation.4. These models can be used to calculate a wide range of useful biological quantities including population growth and structure; terms in the Price equation including selection differentials; estimates of biometric heritabilities; and life history descriptors including generation time. We showcase the method through parameterization of a model using data from a well-studied population of Soay sheep Ovis aries.5. Perturbation analysis is used to investigate how the quantities listed in summary point 4 change as each parameter in each character-demography function is altered.6. A wide range of joint dynamics of life history, quantitative characters and population growth can be generated in response to changes in different character-demography associations; we argue this explains the diversity of observations on the consequences of environmental change from studies of free-living populations.7. The approach we describe has the potential to explain within and between species patterns in quantitative characters, life history and population dynamics. Ovis aries we demonstrate the ease in which such a model can be constructed, parameterized and analysed.Life history descriptors such as generation time and mean lifetime reproductive success, ecological variables including population growth rate and structure, and evolutionary quantities like heritability, selection differentials and phenotypic and genetic variances provide the foundations on which population biology is built. A growing number of studies report joint change in various pairs of these quantities when populations experience environmental change of the character distribution constructed from a population at a point in time is the population size at that time. If the entire character distribution could be tracked the dynamics of the character and the dynamics of population size could be jointly investigated within a single model . Such a Unfortunately simply tracking the dynamics of a character distribution is not sufficient to link the fields of population ecology, life history and character evolution. This is because researchers in the different fields are often interested in the contribution of specific processes to observed patterns of change. The processes that evolutionary biologists are interested in include selection, phenotypic plasticity, ontogenetic development and maternal effects because these are the dominant drivers in altering the means and variances of heritable character distributions . In contStage- and age-stage structured population models provide a powerful framework in which to investigate the dynamics of deterministic ; stochasOur aim in this section is to develop general theory linking integral projection models (IPMs), the Price equation, generation length and (biometric) heritability estimates from motAge-stage-structured matrix models provide a general mathematical description (based on accounting identities) of the dynamics of population size and structure . Both agThe IPMs are built on functions that describe the associations between a character (or characters in the multivariate case) and survival, fertility, development of the character among survivors and the probability density distribution of offspring character values given parental characters . Relatioz and survival S, fertility R, ontogenetic development of the character among survivors G, and offspring character values D within each age class a and at each time t. Additionally, assume that viability selection occurs before ontogenetic development among survivors, and fertility selection (conception) occurs before reproductive allocation determines offspring character values. Models could be formulated such that growth occurs before survival, fertility, and reproductive allocation but such models are not discussed further here. Denote the number density of individuals at age a and character value n. The dynamics of this number density distribution from t to t + 1 can be written, Assume (1) that a population is sufficiently large so demographic stochasticity can be ignored and (2) that relationships exist between a character t and t + 1 that survive to t + 1. t + 1 as a function of parental character values at time t. The number density distribution of offspring character values produced by each age-class is generated in two steps: a recruitment function R produces a number density distribution of parental character values that is then transformed into the number density distribution of offspring character values by the probability density function D. The integral is taken over all parental character values. To obtain the population level number density distribution of newborns, we sum the age-specific number density distributions of offspring characters across all ages. As well as contributing to the offspring number density distribution, each n will produce the distribution n. S removes number density from n before a probability density function G describes how ontogenetic development transforms density among survivors.Definitions of variables are provided in z. However, it is useful to approximate IPMs in discrete matrix form to aid their analysis and R and the functions S and R as matrices . Matrices are denoted with boldface font: for example G. Integral operators provide a powerful notation that covers both kernels and their matrix approximations. We denote integral operators using tildes, for example The IPMs and their matrix approximations can be used to predict population size and structure one time step ahead. IPMs also predict change in means and variances of the character number density distribution over a time step as a function of selection and other processes captured by the age-structured Price equation . In stoca at time t is just mth moment of the character value is The z1,z2 are the components of a vector valued phenotypic character, we can track the phenotypic covariance via the joint moments If From here on we focus on a scalar character but the analyses extend to vector-valued characters along the lines of the above equation.As with character values, we can compute the averages of survival rates, a at time t. Clearly, the dynamics in a at timeamics in and the amics in . These ft and t + 1 for i = i,…,iv (σ2(Z(t)) , of the character number density distribution can then be written, In the following equations we denote means and variances of the number density distributions across all ages as = i,…,iv . Change i,…,iv is the Dirac delta function. In discrete space the Dirac delta function is the Kronecker delta.We track cohort dynamics by iterating z produced at age a by a parent born at time t with a character value z′ is denoted M and is given by The expected number density of offspring with character value t with character value z′, we add together offspring produced at all ages through some (possibly large) maximum age A, To find the lifetime reproduction t with a character number density distribution a an offspring number density distribution A cohort born at T by a frequently used identity We can use these equations to calculate a number of life history quantities. Such calculations make sense in a constant, density-independent environment, when rates are time-independent. In our model, age-dependence complicates the known methods . We defiidentity , which ior ML in : recall In practice no one is going to solve these integral equations. Instead we use a discrete matrix approximation and turn the integrals into sums, as we illustrate in the next section.We now turn to the breeder's equation. The breeder's equation has been widely used to understand phenotypic change of heritable characters . Specifih2. The heritability is the ratio of the additive genetic variance Va to the phenotypic variance σ2(Z). Heritabilities and additive genetic variances can be estimated in many ways. The classic biometric approach we use here is through a regression of daughter character values measured at age a against maternal character values also at age a. Twice the slope of the regression line is the character heritability 1b)] lookn(t). The ith element of this vector represents the number of individuals in age-class a and character class j. Each possible character class is included within each age even if no individual of age a can have that value. For example, it may be impossible for a new recruit to have an average adult body mass. However, there is an element in n(t) at this impossible character value but this element will always be zero. If we have nine age-classes and 100 character classes n(t) will consequently be of length 900, with elements 1–100 representing age class 1 ), elements 101–200 representing age class 2 ) etc.To write our discretized age-stage IPM as one large matrix requiresn(t) to n(t + 1) with matrix elements equal to predicted values of S, R , G and D calculated at the mid point value of each stage class. We also define a vector z consisting of these mid-point values of each stage-class , R(t), G(t), D(t), Ψ and Γ are square ‘block’ matrices consisting of an array of age-specific matrices defined above. An age-specific sub-matrix of this large matrix is described with indices . The S(t) and R(t) matrices are diagonal describing survival and recruitment rates of individuals in each age-character class – they are discretized versions of S and R. Each sub-matrix G describes transition rates between stage classes within an age-class among survivors, except it does not yet age the survivors by 1 year (see below). Each sub-matrix D describes the transition rate from maternal stage to offspring stage, except that it does not yet place offspring into the age-class of new recruits. See the online Each of the matrices Γ and Ψ describe age transitions. Γ moves offspring out of the maternal age class into the new recruit class (aged 1) – the top row of sub-matrices of Γ are all identity matrices while all other sub-matrices contain only zeros. Ψ acts in a similar manner to Γ but ages survivors. Ψ and Γ are time invariant. The functions D are approximated by ΓD(t), while the functions G are approximated by ΨG(t). We will report quantities at equilibrium, so now drop the index t.The matrices λ, is the population growth rate are of the form exp (α + βZ)/(1 + exp (α + βZ)) where α and β are obtained from logistic regressions for survival. The functions R are obtained by combining the reproduction and litter size (twinning) functions, both which are of the same form as the logistic models for survival. If we define the twinning functions as φ and the fertility functions as F then R = F). To estimate growth kernels G it is necessary to combine the function describing mean body size at year t + 1 given body size in year t with a function describing the variance around these associations and scaling so that all transition rates out of an age-stage class sum to unity. The variance function is identified by regressing the squared residuals around the mean body mass function against body mass (t + 1 against body mass in year t as αμ and βμ and the intercept and slope of the variance function as ασ and βσ. If we next define μ(z) = αμ + βμz, the probability density function describing transition rates between z and z′ is, The resultant character-survival functions D functions for each age-class. We next define the integration limits in , R(t), G(t) and D(t) we generated 100 phenotypic classes ranging from 0 to 37·5 kg as this provided a good approximation to the continuous functions and G summed to one by dividing each element by the sum of estimated transition probabilities. All statistical analyses and model construction and analysis were conducted in (The same logic is used to define the imits in and 1b)D: asymptotic population growth, λ; mean character value at the population level a = 1,…,4; variance in character value at the population level σ2(Z) and within each of our four age classes σ2(Z(a)) for a = 1,…,4; the contributions of viability selection, fertility selection, growth among survivors, reproductive allocation and the demographic weights to σ2(Z) summed over age-class and R functions were on the logistic scale we rescaled perturbations to the same scale as the G and D functions.Intercepts and slopes of each of the statistical functions used to parameterize the IPMs were independently perturbed by 1% and new IPMs and matrix approximations constructed. The direction of each perturbation was chosen so as to increase Associations between body mass and: (i) survival; (ii) fertility; (iii) next year's body mass among survivors; and (iv) offspring body masses when they recruit to the population are displayed in GIn general, predictions of the quantities we estimated from the matrix approximation of the IPM corresponded well with observation . The larOur estimate of the character heritability was consistent with published estimates obtained through use of the animal model . We did We now turn to the effect of perturbations on the population at equilibrium. In λ , unsurprisingly, increased with increasing survival and fertility rates, with increasing growth rates that move individuals more quickly into the fertile ages, and with increase in mean offspring size. Generation time (which we compute via growth rate r and net reproductive rate R0) responded differently: it was not sensitive to early survival, decreases when early fertility increased, and increased with senescent fertility and survival; these changes can be understood in terms of the offsetting increases in r and R0. The changes we found in the mean character value and the overall strength of viability selection are consequences of the changing age-stage structure of the population. When early survival rates increase or growth rates increase, the population structure shifts to include a higher proportion of larger older individuals; increasing early fertility has the opposite effect. A similar, but smaller, effect was observed through perturbing parameters in the mean function in the reproductive allocation kernels D. For both types of kernel, increasing parameters generates larger individuals that increases survival and fertility rates and consequently changes both population growth and age-stage structure.Population growth D). Thus the covariance will be age-specific, and the overall heritability that we estimate is an average of age-specific covariances. Increased survival rates imply that an individual's total reproductive output is more dispersed with respect to its age, and as the slope of the mean growth rate functions tend to unity the total reproductive output becomes dispersed over a wide range of sizes. The result is to lower the overall parent-offspring covariance and reduce heritability. Increasing early fertility, on the other hand, tends to reduce the age-dispersion of lifetime reproduction, and thus increases heritability. It is noteworthy that the parent-offspring covariance and heritability are most sensitive to perturbations of the growth rates of parents between birth and ages at reproduction are the only biological processes that change density. All the quantities we calculate, and indeed all meaningful quantities that can be calculated within population biology, derive from these functions. We believe that continued development of structured models will prove fruitful in understanding how fundamental parameters in population biology are influenced by processes as diverse as maternal effects and persistent individuals differences, environmental and demographic stochasticity, density and frequency dependence, genotype-by-environment interactions and phenotypic plasticity.Our approach require the statistical analysis of data routinely collected by field and laboratory biologists to parameterize character-demography associations – there are numerous systems where sufficient data exist .Change in a character, or population size within a population of a single species, can have effects elsewhere within the ecosystem through altering patterns of interspecific competition, rates of predation and causing trophic cascades (

Streptococcus thermophilus industry strain, and rarely reported for laboratory strains. Here, we provide a second native system showing efficient adaptation. Infected by a newly isolated virus HHPV-2, Haloarcula hispanica type I-B CRISPR system acquired spacers discriminatively from viral sequences. Unexpectedly, in addition to Cas1, Cas2 and Cas4, this process also requires Cas3 and at least partial Cascade proteins, which are involved in interference and/or CRISPR RNA maturation. Intriguingly, a preexisting spacer partially matching a viral sequence is also required, and spacer acquisition from upstream and downstream sequences of its target sequence (i.e. priming protospacer) shows different strand bias. These evidences strongly indicate that adaptation in this system strictly requires a priming process. This requirement, if validated also true for other CRISPR systems as implied by our bioinformatic analysis, may help to explain failures to observe efficient adaptation to purified viruses in many laboratory strains, and the discrimination mechanism at the adaptation level that has confused scientists for years.The clustered regularly interspaced short palindromic repeat (CRISPR)-Cas system mediates adaptive immunity against foreign nucleic acids in prokaryotes. However, efficient adaptation of a native CRISPR to purified viruses has only been observed for the type II-A system from a Clustered regularly interspaced short palindromic repeats (CRISPRs), together with CRISPR-associated (Cas) proteins, comprise a recently discovered prokaryotic adaptive immune system against invasive genetic elements . Repeat Streptococcus thermophilus DGCC7710, a wildly used industry strain , and a preexisting spacer partially matching the viral DNA. Thus, we present evidences that adaptation mediated by this native CRISPR system strictly requires a priming process.The type I-B CRISPR-Cas system in haloarchaeal cells has been shown to be highly transcribed and ableThe HHPV-2 viral genome sequence was deposited in the GenBank database under the accession number KF056323.Haloarcula hispanica strains and plasmids used in this study are listed in Supplementary Table S1. The strain DF60 (ΔpyrF strain of H. hispanica ATCC 33960) and its derivative mutants were cultured at 37°C in AS-168 medium with uracil added to a final concentration of 50 mg/liter. Strains transformed with an expression plasmid were cultured in yeast extract-subtracted AS-168.E. coli JM109 was cultured in Luria–Bertani medium and used for cloning. Ampicillin was added to a final concentration of 100 mg/liter when needed.H. hispanica culture (3:1) and screened for plaques on top agar, as previously described was mixed with a mid-exponential escribed . After 6H. hispanica culture for enrichment. After 6-day incubation with aeration, the culture was collected and the cells were removed by centrifugation . The supernatant was subjected to a 0.25 μm filter and subsequently to the VIVAFLOW 50 system for pre-purification and concentration. Purification was performed by rate zonal centrifugation in a sucrose gradient of 10–20% (w/v), followed by a second centrifugation in a gradient of 10–50% (w/v) . The light scattering virus band was collected and diluted with 18% (w/v) salt water. Titers were determined by plaque assays.Top agar containing virions was inoculated into an early exponential For transmission electron microscopy observations, the purified virions were allowed to adsorb to the grid for 1.5–2 min, and then stained with 2% (w/v) uranyl acetate for 15–30 s. Micrographs were taken with a JEM-1400 electron microscope at 120 kV in the EM unit of the Institute of Microbiology, Chinese Academy of Science.H. hispanica culture was infected by purified HHPV-2 at a multiplicity of infection of 1. The mixture was incubated at room temperature without shaking for 5 min and then in a shaker for 25 min. Dissociative virions were removed by centrifugation, and cells were suspended and inoculated into 100 ml of fresh medium. For the uninfected control, the same treatment was performed except that 18% (w/v) salt water containing no viruses was used for mock infection. Growth curve was plotted using a DU800 spectrophotometer, with three replicates for each condition.For growth curve plotting, 1 ml of exponential The viral genome was isolated from the purified virions. Briefly, the virion architecture was destroyed by addition of distilled water and proteinase K, followed by extraction with phenyl–chloroform (1:1 v:v). Nucleic acids in the aqueous phase were precipitated by adding 1/10 volume of 3 M sodium acetate (pH 4.8) and 2 volumes of ethanol, followed by incubation at −20°C for 20 min and centrifugation at 4°C for 10 min. The precipitate was dissolved by distilled water, if necessary, with incubation at 37°C.−1 DNA, respectively.The viral genome was digested with RQ1 DNase I (Promega) and Mung Bean Nuclease (Takara) according to the manufacturer’s instructions. The single-stranded DNA (ssDNA) (ФX174ss) and double-stranded DNA (dsDNA) (ФX174ds) from phiX174 phage (purchased from New England Biolabs) were used as controls. The nucleic acid concentrations were determined using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific) and 1 μg was used for each reaction. RQ1 DNase I and Mung Bean Nuclease were used at 1 U and 0.025 U μgSupplementary Table S2), and the polymerase chain reaction (PCR) products covering the whole genome were sequenced. The sequence data were assembled and analyzed using Vector NTI Advance 10 software. The open reading frames (ORFs) were searched and annotated, respectively, using the ORF_finder and PSI-BLAST programs at NCBI (http://www.ncbi.nlm.nih.gov). A previously reported degenerate primer mix (5′-ATGAATTCNNNNNNGATC-3′) was usedpyrF gene (Supplementary Table S1). Primers used for plasmid construction are listed in Supplementary Table S2.Plasmids for gene knockout were constructed based on the suicide plasmid pHAR , and playrF gene (Supplemcas mutants and CRISPR variants were constructed using the previously described pop-in-pop-out strategy (cas gene(s), upstream and downstream fragments were separately amplified using corresponding UF/UR (upstream forward/upstream reverse) and DF/DR (downstream forward/downstream reverse) primer pairs, respectively, and then linked by bridge PCR with UF/DR primers. The linked fragments were inserted into the suicide plasmid pHAR to generate plasmids for cas knockout and validated by DNA sequencing. These plasmids were transformed into H. hispanica DF60 cells according to the Halohandbook online protocol , and mutants were screened as previously described was used for plasmid construction and mutant screening. The strategy with a fescribed . Each cacas complementation were constructed by cloning a fragment containing the cas operon promoter and the corresponding cas gene(s) into the expression vector pWL502. When necessary, the promoter and the encoding sequence were separately amplified with corresponding UF/UR and DF/DR primer pairs, and then linked by bridge PCR with UF/DR primers. A common UF primer (Comple_promoter-UF) was used. Alanine replacement of Cas3 residues was performed by PCR amplification with the plasmid template, a modified pGEM-T vector bearing a wild-type Cas3-encoding gene. The PCR products were digested with DpnI and transformed into E. coli JM109 cells for cloning. Clones encoding Cas3 point mutants were screened by DNA sequencing.Plasmids for The plasmid target pVS was constructed by cloning a 475-bp HHPV-2 fragment (genomic positions 7880–160) into pWL502. For the construction of other target plasmids (pCTC1-PLUS etc.), complementary oligonucleotides were annealed, forming sticky ends, and inserted into linearized pWL502 (digested by BamHI and KpnI).H. hispanica culture was diluted 1:20 with fresh AS-168 medium, infected by HHPV-2 at a multiplicity of infection of 1 and cultured with shaking at 37°C until stationary stage. When necessary, serial sub-inoculations over several weeks were performed with repeated addition of fresh virus dilutions. For each PCR reaction, 100 ng genomic DNA was used as template. Primers are listed in Supplementary Table S2. Unless specified, oligonucleotides complementary to the leader (ExTest-LD) and spacer3 (ExTest-SP3) were used for DF60 and cas mutants, and oligonucleotides complementary to cas2 (ExTest-CAS2) and spacer1 (ExTest-SP1) were used for CRISPR mutants.To monitor spacer acquisition by PCR on virus infection, exponential Spacer acquisition from a plasmid target was similarly examined. The transformants were inoculated into yeast extract-subtracted AS-168 medium, cultured to exponential stage, subsequently transferred (1:100) into fresh AS-168 medium and then cultured until stationary stage. The stationary cultures were subjected to PCR analysis as described previously.http://weblogo.berkeley.edu/logo.cgi) to determine the PAM (protospacer adjacent motif).For protospacer analysis, the virus-infected or pVS-transformed DF60 culture was serially diluted and spread onto agar-containing AS-168 to obtain individual colonies. Colony PCR was performed to screen for clones containing an expanded CRISPR, which was subsequently analyzed by DNA sequencing. Based on the sequence information of new spacers, protospacers were identified by a Basic Local Alignment Search Tool (BLAST) search against the HHPV-2 genome or the plasmid sequence. The upstream sequence of each protospacer was collected and analyzed with Weblogo . A single turbid plaque produced on the ica lawn A was picica lawn B. The viica lawn C, indicaica lawn D. Intereica lawn , and polcultures E. A sligH. hispanica ATCC 33 960 genome carries a single CRISPR locus that is preceded by a cas operon consisting of four core cas genes (cas1–4) and four putative Cascade-encoding genes (cas5–8) .The (cas5–8) A. To mon(cas5–8) B. Thus, . Notably, all the newly acquired spacers derived from the viral DNA, and none from the chromosome, indicating either a strict discrimination mechanism or the lethal effects of host-derived spacers. Apparently, this non-engineered CRISPR system adapted to HHPV-2 both efficiently and accurately. The newly acquired spacers confer host cells immunity to HHPV-2 reinfection . However, despite this immunity, subsequent spacer acquisition was still observed .By plating the infected culture on agar medium, individual colonies showing CRISPR expansion were isolated and their PCR products were analyzed by DNA sequencing. For each individual colony, the higher molecular weight band proved to be a result of one or more spacer integration events (Supplementary Table S3). Therefore, the PAM sequence for this system seems to be a conserved TTC, which is consistent with a previous in silico analysis of Haloquadratum walsbyi spacers with metavirome data (Nearly 94% (91 of 97) of the protospacers (from which new spacers were acquired) were preceded by a TTC PAM C, whereaome data .E. coli type I-E system, Cas1 and Cas2 have been shown indispensable and sufficient for mediating naïve spacer acquisition . However, a mutant (Δcas5–8) with the four genes simultaneously deleted was easily constructed . Similarly, Δcas5–8 cells did not acquire spacers until these genes were simultaneously complemented (In the uisition . Single ure S3A) . These mure S3A) A, sugges mutants A. For anlemented A, suggesSupplementary Figure S4A). In contrast, >95% (100 of 105) of the cas3-complemented colonies acquired spacers efficiently . Therefore, the naïve adaptation pathway seemed inactivated in this system .The RecB nuclease domain of Cas4 has been reported to be fused with Cas1 in some type I systems , which sin vitro that Cas3 possesses ssDNA nuclease and ATP-dependent helicase activities , alanine replacement was performed for nine conserved residues, including putative key residues within the HD-type nuclease domain and the DExD/H-box helicase domain . As expected, cells producing Cas3 point mutants with these key residues replaced failed to acquire spacers . When infected, cells (Δsp2–6 and Δsp2–12) retaining spacer13 showed evident CRISPR expansion, whereas those with spacer13 deleted (Δsp1–14 and Δsp13) or truncated (Δsp7–13 and Δsp2–13) failed to acquire spacers to an HHPV-2 fragment A. To det spacers C, suggesSupplementary Figure S4).For mutants whose priming adaptation was blocked by deleting/truncating the priming spacer, naïve adaptation was supposed to be unaffected. Given the knowledge that naïve adaptation stimulates subsequent priming adaptation during a prolonged cultivation ,14, we sA plasmid target (pVS) bearing a viral fragment containing the priming protospacer of spacer13 was constructed. Remarkably, efficient adaptation was observed when the wild-type DF60 cells were transformed by pVS, but not by the control plasmid A. We furE. coli (Supplementary Table S3) and mapped them onto the viral genome. Unexpectedly, different strand bias between DNA sequences upstream and downstream of the priming spacer was observed (rep gene) and displace the non-target strand (the coding strand of the rep gene) of the priming protospacer. Nearly 86% (50/58) of the upstream protospacers are located on the non-target strand of the priming protospacer, whereas ∼89% (25/28) of the downstream ones on the target strand. The preferred orientations of upstream and downstream protospacers, respectively, match and counter to the orientation of the priming protospacer. Only 11% (11/97) of the protospacers resided within genome positions 2279–4400 , and thus strand preference could not be identified. Besides, spacer acquisition from the non-target strand upstream of the priming protospacer seemed more efficient (50:25) than from the downstream target strand.Priming adaptation exhibits a strand bias in E. coli ,14; thusobserved A. Accordobserved , the crRSupplementary Table S4). The distribution of the theoretical PAM motif (TTC) on HHPV-2 genome and pVS showed no evident strand bias (Supplementary Table S5), thus the spacer acquisition strand bias could not have derived from uneven PAM distribution. Given this knowledge and the different DNA sequences of HHPV-2 and pVS, an intrinsic mechanism is expected to determine the observed preference pattern.A similar preference pattern was observed during adaptation to the plasmid target pVS (S. thermophilus (S. thermophilus DGCC7710 wild-type CRISPR1 locus (under the GenBank accession number EF434469) contains 32 preexisting spacers before infection. With these spacers as query sequences, a BLAST search was performed against the genomes of Ф858 and Ф2972 phages, to which CRISPR adaptation was observed. Interestingly, the preexisting spacer12 partially matches to the Ф858 genome, spacer14 to the Ф2972 genome and spacer21 to a conserved sequence from both genomes contain spacers partially matching one or more viral genomes with an E value < 0.001 (Supplementary Table S6). The other strains also carry spacers with lower similarities to haloviral sequences. Representative matches are shown in In addition, a BLAST search with 720 spacer sequences was performed against 13 available haloviral genomes. Despite the limited virus information, five strains , as well as a preexisting spacer (spacer13) partially matching the viral DNA. These genetic requirements raised the hypothesis that the observed adaptation was primed by this spacer. Efficient adaptation was reproduced to an engineered plasmid bearing the spacer13-partially-matched viral fragment. During the virus- and the plasmid-based invader assays, spacer acquisition consistently exhibited a strand preference pattern directed by the priming spacer. These combined results reinforced the judgment of the observed adaptation to be a primed process. Regarding that the virus HHPV-2 and the host strain nd Spain , respectS. thermophilus, and found preexisting spacers partially complementary to the Ф858 and Ф2972 genomes and HHPV-2 genome. Though the requirements for these spacers need to be further tested by genetic studies, the possibility of their priming roles in the previously reported adaptation .We further investigated the case in genomes A, with maptation was conser spacer and HHPVaptation . HoweverThe inactivation of naïve adaptation in our system is surprising because naïve adaptation is a prerequisite for any subsequent primed processes, and CRISPR adaptability will be compromised especially when encountering a new virus. However, in the view of self-immunity, inactivation of the naïve pathway is reasonable and necessary, especially for laboratory strains. During long-term virus-free culturing, the host DNA of laboratory strains has served as the only DNA sources, in this case, naïve adaptation could be detrimental because it does not discriminate between non-self versus self DNA well , and hosS. solfataricus CRISPR system, adaptation was observed to an environmental virus mixture, but curiously, not to a single purified virus (STSV2) (In a recent study on (STSV2) . This diE. coli, the movement of the adaptation machinery appears also in the 3′–5′ direction, but specifically on the non-target strand activity . In E. ct strand ,14. Thus on Cas3 ,32, we hchanisms .Figure In summary, adaptation of this haloarchaeal type I-B system was proved to be a priming process, and the naïve pathway seemed inactivated. The universality of this priming requirement needs to be tested by future studies on more CRISPR systems of other subtypes. These studies will be of great significance because they will help to explain the discrimination mechanism at the adaptation level, which has confused scientists for years.The HHPV-2 viral genome sequence was deposited in the GenBank database under the accession number KF056323.Supplementary Data are available at NAR Online.National Natural Science Foundation of China . Funding for open access charge: National Natural Science Foundation of China [30925001].Conflict of interest statement. None declared.

This study proposes a new approach for investigating bias in self-reported data on height and weight among adolescents by studying the relevance of participants’ self-reported response capability. The objectives were 1) to estimate the prevalence of students with high and low self-reported response capability for weight and height in a self-administrated questionnaire survey among 11–15 year old Danish adolescents, 2) to estimate the proportion of missing values on self-reported height and weight in relation to capability for reporting height and weight, and 3) to investigate the extent to which adolescents’ response capability is of importance for the accuracy and precision of self-reported height and weight. Also, the study investigated the impact of students’ response capability on estimating prevalence rates of overweight.Data was collected by a school-based cross-sectional questionnaire survey among students aged 11–15 years in 13 schools in Aarhus, Denmark, response rate =89%, n = 2100. Response capability was based on students’ reports of perceived ability to report weight/height and weighing/height measuring history. Direct measures of height and weight were collected by school health nurses.One third of the students had low response capability for weight and height, respectively, and every second student had low response capability for BMI. The proportion of missing values on self-reported weight and height was significantly higher among students who were not weighed and height measured recently and among students who reported low recall ability. Among both boys and girls the precision of self-reported height and weight tended to be lower than among students with low response capability. Low response capability was related to BMI (z-score) and overweight prevalence among girls. These findings were due to a larger systematic underestimation of weight among girls who were not weighed recently and among girls with low recall ability for weight .This study indicates that response capability may be relevant for the accuracy of girls’ self-reported measurements of weight and height. Consequently, by integrating items on response capability in survey instruments, participants with low capability can be identified. Similar analyses based on other and less selected populations are recommended. Fourth and finally, the study aims to investigate the impact of students’ response capability for estimating prevalence rates of overweight.Data are from the Aarhus School Survey, a school-based cross-sectional questionnaire survey conducted in the city of Aarhus, the second largest city in Denmark (314.000 inhabitants). The overall aim of the study was to investigate health, health behaviour, social relations and well-being of schoolchildren in Aarhus. The survey is an interim data collection of a nationally representative survey conducted every fourth year constituting the Danish contribution to the cross-national Health Behaviour in School-aged Children (HBSC) survey . The HBSThe Aarhus School Survey applied a strategic sampling procedure to ensure sufficient variability in socioeconomic position and ethnic background. Thirteen schools were included and all students at grade five, seven and nine were invited corresponding to the age groups of 11, 13 and 15 years. A total of 2.100 students were included in the final data file corresponding to 99% of the students present on the day of data collection and 89% of the students enrolled in the sampled classes.The procedures for data collection resembled the procedures applied in the HBSC survey ,17. In eParts of the internationally standardised HBSC instrument were applied for measuring socio-demographic factors, health, weight and height, health behaviours, well-being and social relations . AdditioSelf-reports of weight and height were collected by the items “How much do you weigh without clothes?” (in kg.) and “How tall are you without shoes?” (in cm.).The following questions on response capability were placed apart from the two first questions on weight and height in the questionnaire.We obtained information on weighing and height measuring history by two items: ‘When were you last weighed/height measured? with the response categories: a) within the past week, b) within the past month, c) within the past half year, d) more than half a year ago, and e) don’t remember’. We dichotomised weighing history into being weighed ‘within the past month’ (recently) versus the combined ‘more than one month ago’ and ‘don’t remember’ categories (not recently). Height measuring history was dichotomised into being measured ‘within the past half year’ (recently) versus the combined ‘more than half a year ago’ and ‘don’t remember’ (not recently).Perceived recall ability was measured by the following two items: ‘Many children and adolescents have trouble remembering their weight/height. How well do you remember your weight/height?’ with the following response categories: a) exactly, b) approximately, c) not very well, and c) don’t remember it. We dichotomised weight and height recall ability into ‘exactly’ and ‘approximately’ (high) versus ‘not very well’ and ‘don’t remember’ (low).We defined two four-category combined variables on response capability for weight and height, respectively, by combining the variables on measuring history (recently/not recently) and perceived recall ability (high/low). Also, a dichotomized combined variable on BMI response capability was constructed. High BMI response capability included students who were recently weighed and height measured and who had also high recall ability for weight and height. Students not fulfilling these requirements were categorised by low BMI response capability. Students with missing data on weighing/height measuring history or recall ability were coded missing in the combined variables.Parents’ occupational social class was measured by students’ reports of their parents’ occupation, coded into social class and categorised according to highest ranking parent into ‘high’, ‘medium’, ‘low’, and ‘unclassifiable’. Family structure was based on students’ reports on who they live with and categorised into ‘traditional family’ , ‘single-parent family’ , ‘reconstructed family’, and missing information. Students living in other family structures were low in number (n = 15) and were left out of analyses. Further, we categorised migration status based on students’ reports on own and parents’ place of birth and students were classified into ‘Danish’, ‘immigrants’ and ‘descendants of immigrants’.After students had completed the questionnaire survey they were invited for a consultation where direct weight and height were measured to the nearest 0.1 kg and 0.5 cm by two school health nurses at the school settings following standardised instructions. The consultations were conducted within one to three weeks following the questionnaire survey. The same weighing balance (model Seca 882) was applied for collection of all data on weight. Students were weighed wearing underclothes or the minimum clothes acceptable to them. The types of clothing were recorded. Students’ height was measured standing without shoes under standardised instructions ensuring perpendicular measures at a correctly placed height measuring scale. Following data collection, data on weights were corrected for students wearing more than underclothes (n = 860) by extracting mean weights for typical pants, skirts and long-sleeved tops. The individual extraction weight of the clothe item was done according to the student’s measured height in one of three height groups, based on the total height distribution of the sample.Table The study complies with the Helsinki II declaration. In Denmark there is no formal agency for approval of population based surveys and the schools decide autonomously whether to participate in such surveys. The survey was conducted under full confidentiality, informed consent and voluntary participation.2). The meaning of BMI-values varies depending on a child’s age and gender and BMI-values were therefore transformed into z-scores based on data tables and formulas provided by WHO [BMI was computed for each individual .Not having been height measured recently and low recall ability for height and weight were each observed among approximately one fifth of the study population while one third had not been weighed recently. The proportion of students with high response capability for weight and height was 62.7% and 67.6% respectively. The proportion of students with high capability for reporting BMI was 48.7% Table .The proportion of missing values on weight and height was significantly higher among students who had not been weighed and height measured recently and among students who reported low recall ability. Analyses of the distribution of missing values by the combined measure of response capability for weight showed that the proportion of missing values was high when students reported low recall ability irrespectively of when they were last weighed . The same pattern was seen for the combined measure of response capability for height (data not shown).Table Table 2, SD = 0.61) than high BMI response capability . A larger random measurement error was observed among students with low response capability.Table Table Table The presented results from a Danish population of school children aged 11 to 15 showed that approximately one third of the students have low response capability for weight and height, respectively. Every second participant had low response capability for BMI. Students who reported low recall ability were less likely to report their weight in the survey irrespective of when they were last weighed. The same pattern was found for response capability for height. This indicates that reporting of weight and height depend more on recall ability than on weighing and height measuring history.Both boys and girls underestimated their weight. The average underestimation was relatively small, 0.8 kg for boys and 1.8 kg for girls. This difference by gender is in line with a number of previous studies ,21,25-27Generally, adolescents tend to overestimate their height ,10-12,28BMI z-scores were underestimated when based on self-reports of weight and height irrespective of gender and BMI response capability. A gender difference was identified as girls with low BMI response capability systematically underestimated their BMI z-scores more than girls with high BMI response capability. Difference in BMI z-scores among boys did not vary across BMI response capability. These differences by gender are also reflected in the analyses of overweight prevalence. Among boys, the difference in underestimation of overweight prevalence constituted only 0.58 percentage points (with the largest underestimation among boys with high response capability) while the difference constituted 1.33 percentage points among girls when comparing students with low and high BMI response capability. Generally, the overall misclassification of height and weight from self-reported data resulted in an underestimation of the proportion of overweight boys of approximately 5% and an underestimation of overweight girls of approximately 6%.Among both boys and girls low response capability seems to be consistently associated with a larger random measurement error while a systematic underestimation of BMI z-score and overweight prevalence due to low response capability was only observed among girls. These finding were due to a systematic underestimation of weight among girls who were not weighed recently and among girls with low recall ability for weight. The results therefore indicate that integrating measures of response capability for weight and height among adolescents in questionnaire surveys may be appropriate for identifying adolescent girls with an increased risk of reporting erroneous information on weight. Following, analyses and conclusions drawn based on self-reported data only can be evaluated and adjusted accordingly, e.g. by comparing analyses conducted with and without inclusion of adolescents with low response capability. One way to benefit from information about response capability is to carry out sub-group analyses among participants with high response capability. If analyses in such sub-groups produce prevalence levels and associations which are very different from analyses on the entire study population, this would be an indication of severe problems of misclassification in the entire study population. The present study is however the first of its kind and additional studies in other and less selected populations are needed to generate a more general picture on the influence of response capability for reporting height and weight among adolescent boys and girls. Generally, it should however be prioritized that possible adaptions of study designs are conducted to minimise the proportion of students with low capability for reporting height and weight. One approach could be to encourage participants to weigh and measure themselves prior to data collection. This has been suggested earlier by Wang et al. (2002) .In the presented multivariate analyses measured height and weight were included in the final models. This led to some reduction in estimates indicating that some overlap may exist between the applied measure of response capability and social desirability when adolescents report weight and height. This finding is supported by the fact that overweight prevalence is higher in the groups of students who report not having been measured recently compared to those who are and in the groups of student with low recall ability compared to students with high recall ability. Still, despite adjusting for measured values significantly larger systematic underestimations were seen among girls with low response capability compared to girls with high response capability.The presented results should be evaluated in light of the methodological approach employed. For the concept of response capability a number of assumptions are made. We define response capability by time since last weighing/height measure and ability to recall. This approach does not consider other factors including availability and accuracy of home equipment for weighing and measuring, how the weighing and measuring are conducted, and whether the child is aware of the measured values. The participation rate was generally high and we do not anticipate substantial selection bias. However, the study is not representative and the prevalence figures cannot be generalised across populations. We propose repetition of this study in other and less selected study populations.The present study showed that one third of students aged 11 to 15 years had low response capability for height and weight when responding in a self-administrated questionnaire survey. Both boys and girls underestimate their weight. Also among both boys and girls the random measurement error tended to be largest among students with low response capability while only among girls with low response capability there was a systematically larger underestimation of weight. Consequently, a similar larger underestimation of BMI z-score and overweight prevalence was found among girls with low response capability. Boys over-reported their height, and for both boys and girls the random measurement error tended to be larger among students with low response capability. For both boys and girls, there was no systematic difference in reporting height by response capability. The present study indicates that this approach may be particularly relevant for studies including self-reported measurements from girls. Repetition of this study in other and less selected study populations is recommended.The study was financed by the Nordea Foundation. The Nordea Foundation was not involved in the study design, data analyses or interpretation of results. The authors declare no competing interests.MR is the principal investigator of the Aarhus School Survey. MR conceived and coordinated the study, contributed to its design, acquisition of data, statistical analyses, interpretation of data and drafted the manuscript. BH co-conceived the study and contributed to its design and coordination and revised the manuscript critically. MTD contributed to the design of the study and to the statistical analyses and revised the manuscript critically. OM contributed to the design of the study, interpretation of data and revised the manuscript critically. All authors read and approved the submitted manuscripts.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2288/13/85/prepub

Mutations of human αA-crystallin cause congenital cataract by protein aggregation. How mutations of αA-crystallin cause disease pathogenesis through protein aggregation is not well understood. To better understand the cellular events leading to protein aggregation, we transfected cataract causing mutants, R12C, R21L, R21W, R49C, R54C, R116C and R116H, of human αA-crystallin in HeLa cells and examined the formation of intracellular protein aggregates and aggresomes by confocal microscopy.YFP-tagged human αA-wild-type (αA-wt) was sub-cloned and the mutants were generated by site-directed mutagenesis. The αA-wt and the mutants were individually transfected or co-transfected with CFP-tagged αA-wt or αB-wild-type (αB-wt) in HeLa cells. Overexpression of these mutants forms multiple small dispersed cytoplasmic aggregates as well as aggresomes. Co-expression of αB-wt with these mutants significantly inhibited protein aggregates where as co-expression with αA-wt enhanced protein aggregates which seems to be due to co-aggregation of the mutants with αA-wt. Aggresomes were validated by double immunofluorescence by co-localization of γ-tubulin, a centrosome marker protein with αA-crystallin. Furthermore, increased ubiquitination was detected in R21W, R116C and R116H as assessed by western blot analyses. Immunostaining with an ubiquitin antibody revealed that ubiquitin inclusions in the perinuclear regions were evident only in R116C transfected cells. Pulse chase assay, after cycloheximide treatment, suggested that R116C degraded faster than the wild-type control.Mutants of αA-crystallin form aggregates and aggresomes. Co-expression of αA-wt with the mutants increased aggregates and co-expression of αB-wt with the mutants significantly decreased the aggregates. The mutant, R116C protein degraded faster than wild-type control and increased ubiquitination was evident in R116C expressing cells. Cataract of the eye lens is the leading cause of blindness worldwide The α-crystallin gene family consists of two similar genes coding for αA-crystallin, CRYAA located on chromosome 21q22.3, and for αB-crystallin, CRYAB located on chromosome 11q22.1 A recent report Since mutants of αA-crystallin contribute to the development of congenital cataract through the formation of aggregated proteins precipitated in the cells of eye lens, we evaluated the expression of mutants of αA-crystallin in mammalian cells (HeLa cells) in terms of identifying the cells having aggregates and aggresomes as the general cellular response to having over expressed mutant proteins Dpn I for 1 hour at 37°C and 1 µl of PCR product was transformed with XL-10 Gold competent cells. The transformants were selected on LB agar medium plates containing 50 µg/ml Kanamycin. The mutant constructs were sequenced and confirmed by DNA sequence analysis. Untagged pCDNA3.1-αA-wt and the mutant R116C were PCR amplified from appropriate cDNA templates and sub-cloned into Xho I and Eco RI sites of pCDNA3.1 (-) vector . The constructs were validated by restriction digestion and DNA sequence analyses.To generate mutants, QuickChange site directed mutagenesis kit was used. Appropriate mutagenic primers of human αA-crystallin for the mutants, R12C, R21L, R21W, R49C, R54C, R116C and R116H were designed and used for PCR. The PCR products were amplified by using YFP-tagged αA-wt as a template DNA with the following PCR conditions, the mix was initially denatured at 95°C for 1 min followed by 95°C for 50 sec, 60°C for 50 sec and 68°C for 5 minutes for 16 cycles and followed by overall extension at 68°C for 7 minutes. The PCR product was digested with HeLa cells purchased from ATCC, Manassas, VA were grown in 35 mm dishes and 80–90% confluent cells were transfected with Lipofectamine 2000 and a total of 2 µg of plasmid DNA encoded for αA-wt and αB-wt and or mutated constructs fused with either CFP or YFP were used. In one set of experiments, individual constructs for αA-wt and the mutants and for co-expression studies, equal amount of both αA-wt and αB-wt with mutated αA constructs were transfected. Transfected cells showing aggregates were typically counted at x40 magnification. Fields were randomly chosen and about 300 cells were counted per experiment and repeated at least three times and counts were blindly performed.An LSM 510 Laser Scanning Microscope with 63x oil-immersion objective was utilized. To visualize CFP and YFP fluorescence, cells expressing fluorescent proteins were excited at appropriate laser beam and filtered with both dichromatic band pass filters, captured at 12 bit 512 x 512, multitrack channel images with CCD cameras with the following configurations: for CFP channel, the cells were excited with 458 nm filter by argon-ion laser and the emission intensity was collected using band pass (BP) 475-525 nm filters and for YFP channel, the cells were excited with 514 nm filter by argon-ion laser and the emission intensity was collected using BP 530–600 nm filters. Both the CFP and YFP was excited using argon-ion laser at 25 mW, 2.0 and 0.5% exposure respectively.Degradation of αA wild-type and the mutant αA-R116C proteins was assessed using cycloheximide-chase assay. HeLa cells were grown in 35 mm dishes and transfected with untagged αA-wt and the mutant R116C. After 24 h transfection, cells were treated with 20 µg/mL of cycloheximide (Sigma) for the indicated time period and lysed with lysis buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate and 0.1 mM EDTA supplemented with cock-tail protease inhibitors (Roche Diagnostics) and 3M Urea. For immunoblot analysis, 5 µg of total protein was loaded into 12% SDS-PAGE and the western blot was probed with a rabbit polyclonal anti-αA-crystallin antibody at a dilution of 1 in 6000.After 48 hours transfection, cells were lysed with lysis buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate and 0.1 mM EDTA supplemented with cock-tail protease inhibitors and 3M Urea. Further, the cell lysate was sonicated and the protein concentration was measured by BCA assay method. For each sample, 5 µg of total protein was loaded into 12% SDS-PAGE and electroblotted to PVDF membrane. The blots were blocked with 5% non-fat dry milk prepared in TBST and subsequently incubated with primary antibody for αA-crystallin , αB-crystallin for one hour at room temperature. Blots were washed with TBST for three times and incubated with appropriate HRP-conjugated secondary antibodies for one hour at room temperature. Enhanced Chemiluminescence substrate was used and the signal was detected by exposing the blots on films. For loading control, blots were stripped with Restore Western Blot stripping buffer and re-probed with a rabbit polyclonal antibody against β-actin for 1 hour at room temperature.Cells were grown on 35-mm cover glass bottom dishes. After 48 hours transfection, cells were washed with PBS, fixed with 4% paraformaldehyde for 20 minutes at room temperature (RT) and permeabilized with 0.5% Triton X-100 for 10 minutes at RT. Cells were blocked with 5% normal goat serum (NGS) for one hour at RT. The cells were simultaneously incubated with αA-crystallin mouse monoclonal antibody and a rabbit polyclonal antibody for γ-tubulin for overnight at 4°C. The cells were stained with Alexa Flour 594 (mouse) and Alexa Fluor 488 (rabbit) (Molecular Probes) for one hour at room temperature. Nuclei were counter stained with Hoechst 33342. The images were acquired with an LSM 510 Meta Carl Zeiss Confocal microscope at x63 objective and analyzed using AIM Imaging Software.In all the experiments, values were expressed as mean ± SD. Two-tailed Student's t-test was used for statistical analysis. The p value < 0.05 was considered as significant.To investigate whether the mutants of αA-crystallin forms aggregates in cells, YFP-tagged wild-type and the mutants of αA-crystallins were transfected individually in HeLa cells. Cells transfected with CFP or YFP alone showed a homogenous expression of the fluorescent protein in both nucleus and cytoplasm (data not shown). Cells transfected with αA-wt showed a homogenous distribution of its expression in the cytoplasm alone and there was a little or no aggregation was observed in these cells . Cells tTo investigate whether co-expression of αA-wt can inhibit aggregates caused by mutants of αA-crystallin in cells, we transfected YFP-tagged αA-mutants with CFP-tagged αA-wt. Co-expression of CFP-αA-wt with YFP-αA-wt constructs in HeLa cells did not show any aggregates and a homogenous expression of protein was evident in the cytoplasm . HoweverTo investigate, whether αB-wt co-expression can inhibit protein aggregates caused by mutants of αA-crystallin, cells were transfected with CFP-αB-wt and YFP-tagged αA-crystallin mutants.. The results indicate that a significant decrease and to validate these inclusions as aggresomes, transfected cells were subjected to double immunostaining with a mouse monoclonal αA-crystallin (red) and rabbit polyclonal γ-tubulin, (a centrosome marker protein) (green) antibodies. For this study, untagged pCDNA3.1 constructs of both wild-type and the mutants R116C (severely affected cells) and R21L (mildly affected cells) were used in order to eliminate the false positive signal by overlapping of YFP signal with the Alexa Fluor 488, both of these signals being acquired at argon-ion laser line in confocal microscopy. The results showed that only in R116C, the co-localization of αA-crystallin with γ-tubulin occurred as yellow punctate signals in the perinuclear region validated these structures are aggresomes whereas,Since our finding that mutants of αA-crystallin form intracellular aggregates in cells and this aggregate formation may affect protein turn over which may contribute to the pathogenesis of the cataract, we next asked whether mutation in αA-crystallin may affect protein's turn over by faster degradation, cells were treated with cycloheximide (for inhibition of protein synthesis) and at different time points. After 24 h transfection, the cells lysed and a total protein of 5 µg from each of the sample was subjected to immunoblot probed with αA-crystallin antibody . For this study, we used untagged constructs of αA, i.e. pCDNA3.1/αA-wt and pCDNA3.1/αA-R116C. As shown in A number of reports implicated UPS dysfunction in a range of aggregation prone mutant proteins in neurodegenerative diseases. To explore any effects of aggregation-prone αA-crystallin mutants might have on UPS proteolytic function, we measured the level of polyubiquitinated proteins in whole cell lysate subjected to western blot probed with anti-ubiquitin antibody . Distinct polyubiquitin conjugated proteins accumulated in cells transfected with mutants, R21L, R21W, R116C and R116H . Altoget, R116C and R116H showing the most effect and R49C and R54C showing the least effect. αB-crystallin is known to be a better molecular chaperone than αA-crystallin and as it has been shown earlier with C-terminal truncated αA-crystallins In the present study, we have demonstrated that overexpression of the cataract causing mutants of αA-crystallin in HeLa cells led to the formation of multiple intracellular protein aggregates. There was no evidence for the endogenous expression of both αA- and αB-crystallins in these cells as shown in our earlier study Also, this study provides the first evidence for cataract causing mutants of αA-crystallin forming aggresomes in cells. Accumulation of misfolded proteins results from saturation of protein degradation system observed in conformational diseases like Huntington disease It has been suggested that unfolded proteins develop into insoluble form that cannot be degraded, their sequestration in one large mass may facilitate their removal by autophagy In summary, we have demonstrated overexpression of αA-crystallin mutants forming small dispersed cytoplasmic aggregates and aggresomes in HeLa cells. Co-expression of αB-wt significantly inhibits aggregates caused by the αA mutants. The mutant R116C has short half-life and degraded through ubiquitin-proteasome pathway that may contribute to the development of congenital cataract in human beings.

Development of retinal detachment models in small animals can be difficult and expensive. Here we create and characterize a novel, cone-rich retinal detachment (RD) model in the chick.Retinal detachments were created in chicks between postnatal days 7 and 21 by subretinal injections of either saline (SA) or hyaluronic acid (HA). Injections were performed through a dilated pupil with observation via surgical microscope, using the fellow eye as a control. Immunohistochemical analyses were performed at days 1, 3, 7, 10 and 14 after retinal detachment to evaluate the cellular responses of photoreceptors, Müller glia, microglia and nonastrocytic inner retinal glia (NIRG). Cell proliferation was detected with bromodeoxyuridine (BrdU)-incorporation and by the expression of proliferating cell nuclear antigen (PCNA). Cell death was detected with terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL). As in mammalian models of RD, there is shortening of photoreceptor outer segments and mis-trafficking of photoreceptor opsins in areas of RD. Photoreceptor cell death was maximal 1 day after RD, but continued until 14 days after RD. Müller glia up-regulated glial fibriliary acidic protein (GFAP), proliferated, showed interkinetic nuclear migration, and migrated to the subretinal space in areas of detachment. Microglia became reactive; they up-regulated CD45, acquired amoeboid morphology, and migrated toward outer retina in areas of RD. Reactive NIRG cells accumulated in detached areas.Subretinal injections of SA or HA in the chick eye successfully produced retinal detachments and cellular responses similar to those seen in standard mammalian models. Given the relatively large eye size, and considering the low cost, the chick model of RD offers advantages for high-throughput studies. Retinal detachment (RD) is a clinically important cause of visual loss; it is common and it is destructive to vision and to the eye itself. Poor visual acuity resulting from RD has been studied in humans and animal models for decades Changes to the photoreceptors, glia, and macrophages/microglia appear to be critical in the pathobiology of RD. Specifically, the photoreceptor outer segments (OS) degenerate and many of the photoreceptors apoptose, resulting in thinning of the outer nuclear layer (ONL) Spermophilus beecheyi) and it has been used as a model for RD A wide variety of mammalian species have been used to model retinal detachments and proliferative vitreoretinopathy, including rabbits, cats, mice, and primates The chick has been used to study the development of the visual system With this study we want to add further value to the use of the chick in biological research. We propose to develop a new chick model of RD using subretinal injection of hyaluronic acid. We hope to use its many modeling advantages which include (1) a cone-rich retina, (2) novel retinal glia [present in non human primates but not in rodents], (3) the wealth of data on micro and macroglial molecular responses to retinal damage and retinal regeneration, (4) the availability of mutant ocular strains, (5) a sequenced genome, (6) low cost, (7) widespread availability, (8) ease of handling, and (9) large eyes amenable to experimental manipulation.Retinal detachments and controls were examined at days 1, 3–4, 7, 9–10, and 14–16. The RPE initially appeared flattened at day 1, with loss of apical processes . By 9 daImmunohistochemical analyses of photoreceptors showed mis-trafficking and disorganization of L/M opsin, S opsin, and rhodopsin in areas of retinal detachment . These cTo evaluate the timecourse of photoreceptor death in this model, TUNEL analysis was performed. Cell death was significantly increased in detached retina AP AP .Cell proliferation, particularly of Müller glia, has been reported following retinal detachment in mammalian models 4 relative intensity units in control retina to 25.0×104 in RD retina at day 1 (p = 0.0092), and the CD45 density sum increased from 7.2×105 to 64.2×105 (p = 0.0165). Density sum was significantly elevated in day 3 RD retina at 59.0×105 compared to day 3 controls at 4.0×105 (p = 0.0118), the other days did not reach significance after Bonferroni correction.A highly localized infiltration and activation of retinal and subretinal microglia and macrophages is characteristic in mammalian models of RD Recently, a novel population of glial cells has been detected in the retinas of multiple species, including chick and primates To the best of our knowledge, this is the first study utilizing the chick as a model of retinal detachment. There are many biologic, logistic, and practical advantages of the cone rich chick model system. Briefly, they offer advantages in cones, glia, characterized retinal responses, sequenced genome, availability, low cost, ease of handling, and large eyes. While chicks are not generally selected based on genetic strain, there are some ophthalmic mutants available [as reviewed in 2) is in the visual streak, analogous to the fovea centralis, in a horizontal strip of retina 2mm ventral to the optic nerve head As an alternative to the ground squirrel, the chick compares favorably in terms of availability, handling, and cost. The chick and ground squirrel cones have similarities, but some differences . Chick rDespite some differences in their cone structure as compared with mammals, chick cones showed similar responses to retinal detachment. The photoreceptor outer segments demonstrated abnormalities in the detached areas as soon as one day after detachment. There was mis-trafficking of photoreceptor opsins and rhodopsin, similar to that in other models of detachment The ground squirrel retina has been evaluated with histologic, molecular, and electrophysiologic techniques to determine rod and cone responses to RD. As in other mammalian species, outer segment degeneration began at 1 day. Rex et al. Although there is permanent loss of some photoreceptors following RD, re-attachment studies have demonstrated recovery of rods and cones, including re-expression of cone opsin There is a local response of Müller glia in most mammalian models of RD and also in human retinectomy specimens AP). These studies support the notion that macroglial cells contribute to subretinal scar formation after retinal detachment Chick retina contains a recently-identified special glial cell type termed non-astrocytic inner retinal glia (NIRG). NIRG-like cells have been identified in the retinas of multiple species including dogs and monkeys, but not in the retinas of rodents Similar to other studies of mammalian models, the macrophage/microglial response to RD in the chick is dramatic. Microglia are resident tissue macrophages of the CNS. In the chick eye they are identified by immunostaining with CD45 In conclusion, the chick model of RD shares many similarities with human, and advantages over other mammalian models. It is a cone-rich and research friendly model, and it could offer added insights into the pathobiology of retinal detachment. It could be helpful for high-throughput studies of neuroprotective or anti-proliferative agents that would ameliorate RD.Gallus gallus domesticus) were obtained from the Department of Animal Sciences at The Ohio State University. They were used at postnatal days 7 to 21 (P7–P21) to create the retinal detachment model under an IACUC approved protocol (#2009A0139). Only one eye was treated. The chicks were housed with free access to Purina chick starter and water in a 12 h light-to-dark cycle in a stainless steel brooder.Leghorn chicks were anesthetized with inhaled isofluorane via nonrebreather mask. Pupil dilation was achieved with multiple rounds of drops of tubocurarine hydrochloride . Tubocurarine, a neuromuscular blocking agent that is a competitive antagonist of nicotinic neuromuscular acetylcholine receptors Left eyes were prepped with betadine swabs and a pediatric lid speculum was inserted. A lateral canthotomy was created with a sterile razor blade for better exposure of the globe. The conjunctiva was stabilized with 0.12 forceps and then was dissected temporally with a 25 g needle tip to expose the sclera. A 25 g needle on a 5 cc syringe was inserted approximately 3 mm posterior to the limbus and vitreous was aspirated from the central vitreous cavity until the eye softened slightly. The subretinal injection was then performed through this opening with a custom blunt-tip 30 g needle on a Hamilton syringe by gently embedding the tip of the needle into the central retina. The tip was visualized through the pupil by using an operating microscope while the cornea was covered by a glass coverslip and Genteal gel. Subretinal injections of approximately 25 microliters of sterile saline (n = 3) or undiluted hyaluronic acid were delivered to the left eye to bleb-up the retina. The eye was dressed with erythromycin ophthalmic ointment at the end of the procedure. Eyes were enucleated for analysis at day 1 (n = 7), 3–4 (n = 10), 5–7 (n = 6), 9–10 (n = 3), and 14–16 (n = 6).2 gas inhalation followed by pneumothorax induction. Enucleation was performed by dissecting off the periocular tissue and muscle attachments to the globe with forceps and Wescott scissors and severing the optic nerve. The globe was processed, fixed and sectioned as previously described Animals were euthanized by COIntravitreal injections of 2 micrograms 5-bromo-20-deoxyurdine were delivered approximately 4 hours prior to euthanization as previously described Apoptosis was evaluated with the TUNEL assay with the In Situ Cell Death Kit per the manufacturer’s instructions.Immunohistochemistry was performed to detect markers as previously described 2. The total area of retinal CD45 immunofluorescence was calculated for regions with pixel intensities above a determined threshold and averaged per group. The average density was calculated as the mean pixel value above threshold within threshold-designated regions. The density sum was calculated as the total of pixel values for all pixels within threshold-designated regions. For TUNEL measurements, the number of immunofluorescent cells above threshold was determined for regions with pixel intensities above a determined threshold using Image-Pro 6.2. For outer nuclear layer thickness measurements, Image-Pro 6.2 was used to measure the height of the outer nuclear layer averaging evenly-spaced measurements taken per 20X field Photomicrographs were obtained using a Leica DM5000B fluorescent microscope and Leica DC500 digital camera. Confocal images were obtained using a Zeiss LSM 510 at the Hunt-Curtis Imaging Facility. Image analysis was previously described To determine whether differences in outer nuclear layer thickness, TUNEL-positive cells, and microglia in the detached retina at different timepoints were significant, analysis of variance (ANOVA) was first performed to confirm a difference in measurements with p<0.05 considered significant. Subsequent least squares means testing with Bonferroni correction was performed ). SAS v9.2 from the SAS Institute Inc. was used for analyses.

TNF 308 G/A polymorphism and risk for type 2 diabetes mellitus (T2DM). However, the sample sizes of most of the studies were small. The aim of this study is to evaluate the precise association between this variant and risk for T2DM in a large-scale meta-analysis.Many investigations have focused the association between TNF 308 G/A polymorphism and T2DM. The key words were as follows: diabetes, tumor necrosis factor and polymorphism/variant/genotype. This meta-analysis was assessed by Review manager 5.0.All publications were searched on the association between TNF 308 G/A polymorphism were 1.03 (0.95–1.12), 1.03 (0.94–1.13) and 1.03 (0.78–1.36) in overall, Caucasian and Asian populations, respectively. The sensitivity analysis further strengthened the validity of this association. No publication bias or heterogeneity was observed in this study.There were 18 studies identified. The odd ritos (ORs) and 95% confidence intervals (CI) for GA+AA versus GG genotype of TNF 308 G/A polymorphism and risk for T2DM.In summary, there was no significant association detected between the The prevalence of diabetes is high, with high rates of morbidity and mortality. World Health Organization (WHO) estimations predicted that by the year 2030, 350 million individuals worldwide would suffer diabetes TNF gene, such as −238, −308, −857, −1031 in human TNF 308 G/A polymorphism found guanine (G) replaced by adenine (A) in TNF 308 position TNF gene transcription than that of wild-type in vitro expression studies TNF 308 G/A polymorphism as a risk factor for type 1 diabetes mellitus (T1DM) et al.As genetic variations in the promoter region may regulate TNF-α production, single nucleotide polymorphisms in the promoter region of the TNF 308 G/A polymorphism would be associated with the risk for T2DM.In this study, we have therefore conducted a meta-analysis from all eligible studies to confirm whether We searched several databases through November, 2010 for all publications on the association between TNF 308 G/A polymorphism and T2DM. The key words were as follows: diabetes, tumor necrosis factor and polymorphism or variant or genotype. In addition, we also searched references of retrieved articles. Studies should meet the following criteria: (1) case-control study; (2) only diabetes as outcome, and (3) at least two comparison groups (diabetes vs. control groups) involved in a single study. Exclusive criteria: no report about the genotype frequency, or insufficient information for data extraction. The MOOSE Checklist and the flow chart for the studies were shown as TNF 308 G/A polymorphism and the risk for T2DM Finally, we identified 18 studies on the association between Two authors extracted data independently and in duplicate, and reached on all items, including: author's last name, journal and year of publication, country of origin, selection and characteristics of diabetes cases and controls, ethnicity of the study population, genotypes (rs1800629) and numbers of cases and controls. The results were compared and disagreements were discussed and resolved with consensus.2I statistics that was interpreted as the proportion of total variation contributed by between-study variation. If there was no statistical heterogeneity among studies (2I<50% and P>0.05), the ORs and 95% CI would be estimated for each study in a fixed-effects model. Otherwise, a random-effect model should be employed. In sensitivity analysis, relative influence of each study on the pooled estimate was assessed by omitting one study at a time. Funnel plots were used to evaluate publication bias. All P-values were two-tailed.The meta-analysis was performed by using Review manager 5.0. We pooled the odds Ratios (ORs) for TNF 308 GA+AA versus GG genotype and further conducted subgroup analyses by ethnicity. Heterogeneity among studies was examined with The detailed characteristics of the studies included were shown in TNF 308 G/A polymorphism in the overall 18 studies and subgroups did not reach the significant difference. The ORs of GA+AA versus GG for T2DM were 1.03 (0.95–1.12) for the overall, 1.03 (0.94–1.13) for Caucasian and 1.03 (0.78–1.36) for Asian, respectively. There was no evidence of heterogeneity among the overall 18 studies or subgroups .It has been shown in TNF 308 G/A polymorphism and T2DM in the promoter region of TNF was found to increase the expression of this pro-inflammatory cytokine in culture cells and positive associated with risk for T1DM TNF 308 G/A polymorphism and T2DM, but the results were still unclear.Inflammation has been widely known as an important feature of T2DM, with high levels of pro-inflammation cytokines, including IL-1, IL-6 and TNF-α. As TNF-α can impair insulin signal pathways and lead to B-cell destruction, elevated TNF-α is considered playing a central role in the development of T2DM. The TNF 308 G/A polymorphism did not contribute to the development of T2DM. However, T2DM is a complex disease, and both environmental and genetic factors are involved in the development of T2DM. There are some points should be concerned for the inconsistent results in early reports. Firstly, ethnic differences may attribute to these different results, since the distributions of the TNF 308 G/A polymorphism were different between various ethnic populations. For instance, the frequencies of TNF 308 G/A polymorphism allele differs from 9% in Chinese population TNF 308 G/A polymorphism. Thus, even if the variation has a causal effect on T2DM, it may take a long time to be observed. Supporting this deduction, Ishii et al. reported that FPG in older men was higher and a trend for triglycerides to be higher and HDL cholesterol to be lower in the group with TNF 308 G/A polymorphism, but not in the young TNF 308 G/A polymorphism. The effects of the TNF 308 G/A polymorphism are so small that in the short period the difference can not be observed. In addition, interaction of the TNF gene with other pro- and anti- inflammatory cytokine genes plays an integrated role in destruction of pancreatic beta cells TNF 308 G/A polymorphism was found in susceptibility to T2DM.In this large-scale meta-analysis, the combined evidence suggested that et al. found that TNF-α levels were not significantly different between Japanese T2DM patients with and without this variation et al.TNF 308 G/A polymorphism and metabolic syndrome had indicated that individuals carrying TNFA allele had significantly higher fasting insulin level, systolic arterial blood pressure, higher risk of developing obesity and maybe HOMA-IR, but no significant association with BMI. WHR, fasting glucose and plasma leptin levels, which suggested TNFA allele would increase the risk of metabolic syndrome TNF 308 G/A polymorphism was more common in T2DM patients with than without macrovascular disease TNF 308 A allele conferred a significant risk for T1DM TNF 308 G/A polymorphism might not increase the development of T2DM, but it can enhance the risk for human metabolic disorder and some autoimmunity diseases.However, this variant was reported to be related to some metabolic disorders and T1DM. Furta conclusion, we did not find any evidence of association between TNF 308 G/A polymorphism and T2DM in this large-scale meta-analysis. Further prospective research, with larger numbers of participants and fully confounding risk factors considered, such as age, sex, ethnicity and life style, is warrant to examine the possible effects of this variation on T2DM to confirm our conclusion.In Checklist S1(DOC)Click here for additional data file.Figure S1The flow chart of the included studies.(DOC)Click here for additional data file.

The implementation of evidence-based treatments to deliver high-quality care is essential to meet the healthcare demands of aging populations. However, the sustainable application of recommended practice is difficult to achieve and variable outcomes well recognised. The NHS Institute for Innovation and Improvement Sustainability Model (SM) was designed to help healthcare teams recognise determinants of sustainability and take action to embed new practice in routine care. This article describes a formative evaluation of the application of the SM by the National Institute for Health Research Collaboration for Leadership in Applied Health Research and Care for Northwest London (CLAHRC NWL).Data from project teams’ responses to the SM and formal reviews was used to assess acceptability of the SM and the extent to which it prompted teams to take action. Projects were classified as ‘engaged,’ ‘partially engaged’ and ‘non-engaged.’ Quarterly survey feedback data was used to explore reasons for variation in engagement. Score patterns were compared against formal review data and a ‘diversity of opinion’ measure was derived to assess response variance over time.Of the 19 teams, six were categorized as ‘engaged,’ six ‘partially engaged,’ and seven as ‘non-engaged.’ Twelve teams found the model acceptable to some extent. Diversity of opinion reduced over time. A minority of teams used the SM consistently to take action to promote sustainability but for the majority SM use was sporadic. Feedback from some team members indicates difficulty in understanding and applying the model and negative views regarding its usefulness.The SM is an important attempt to enable teams to systematically consider determinants of sustainability, provide timely data to assess progress, and prompt action to create conditions for sustained practice. Tools such as these need to be tested in healthcare settings to assess strengths and weaknesses and findings disseminated to aid development. This study indicates the SM provides a potentially useful approach to measuring teams’ views on the likelihood of sustainability and prompting action. Securing engagement of teams with the SM was challenging and redesign of elements may need to be considered. Capacity building and facilitation appears necessary for teams to effectively deploy the SM. The implementation of evidence-based treatments or technological innovations that demonstrate the delivery of high-quality care at acceptable cost is essential if we are to meet the healthcare demands of aging populations . HoweverThe National Health Service (NHS) Institute for Innovation and Improvement Sustainability Model (SM) wasThe SM is a self-assessment tool that details ten key determinants or ‘key factors’ that increase the likelihood of sustainability and continuous improvement. The model was developed using information gathered from various sources. A review of management literature related to sustainability and research involving project leaders, directors, clinicians, and global health care experts within a national NHS Improvement Program initially identified over 100 factors considered to be important ingredients for sustaining change. Through focus groups and other means, 250 NHS staff and health care experts were asked to rank these factors from 1 to 10 and from this the final 10 factors were derived [The factors are grouped into three domains entitled ‘Process,’ ‘Staff’ and ‘Organization.’ The ‘Process’ domain explores the credibility of the new practice and the extent to which staff believe it will increase efficiency, make jobs easier, and be continued when current staff leave. The ‘Staff’ domain assesses frontline staff awareness of and involvement in organizational changes and the commitment of clinical and organization leaders. The ‘Organization’ domain assesses the new practice’s ‘fit’ with existing organizational culture, strategic aims, and infrastructure .For each of the ten factors, individual team members choose from one of four statements or ‘levels’ that they feel represent the ‘best fit’ with their current situation. This is an ordinal scale with the highest level representing the most favorable perspective on sustainability. The model developers used the data from their research (see above) and regression analyses to derive a weighted numerical score for each level of each factor, with the staff domain perceived as most important , followed by ‘process’ 31%), and ‘organization’ (17%). Figure %, and ‘oIndividual responses are aggregated into team scores. These team scores, generated at regular intervals as the implementation of new practice progresses, represent the SM’s prediction of the ‘likelihood of sustainability.’ They are intended to raise awareness of determinants of sustainability at an early stage, enable teams to assess their own progress against them, and prompt discussion and action where scores in any of the domains is consistently low.This article describes an application of the SM by the National Institute for Health Research (NIHR) Collaboration for Leadership in Applied Health Research and Care for Northwest London (CLAHRC NWL), a five-year program supporting frontline care teams implement evidence-based practice using mechanisms such as care bundles, care pathways, reviews and assessments, and new methods of testing for disease. The clinical focus of these projects was varied. Secondary care projects included medicines management , chronic heart failure, HIV testing at the point of care, and alcohol services. Projects at the interface of primary care and secondary care focused on the implementation of care bundles for patients with community-acquired pneumonia and for patients being discharged from hospital after an acute exacerbation of chronic obstructive pulmonary disease (COPD), as well as projects in primary care or community settings, including vascular risk assessment, sickle cell disease, alcohol use, and improving access to psychological therapies for people with mental health problems. We give our perspective on the potential of the SM to help teams develop and implement new practice and take action likely to improve the prospects of sustainability. Using multiple data points generated from 19 implementation projects over an 18-month period, we explore the ‘acceptability’ or teams’ willingness to engage with the SM and the extent to which it prompts teams to take action to promote sustainability. We discuss the challenges we experienced in applying the SM and briefly outline how we adapted our approach to its use in subsequent cohorts.CLAHRC NWL supports multidisciplinary teams of approximately 8 to 10 people to implement new evidence-based healthcare practice in their organization. Team membership varied, but typically included a clinical lead ) a project manager, an executive sponsor , and frontline staff delivering care in that disease area. For example, a COPD project team included, in addition to the above, a specialist respiratory nurse, an anti-microbial pharmacist, and a respiratory physiotherapist.In the early stages of adopting the new practice, teams are given time to plan how to proceed with the intervention, identify what processes may need to change, and who needs to be involved. They then test the impact of changes to care delivery and adapt their approach where necessary using an iterative approach. The SM is used from the beginning alongside a basket of other quality improvement tools, including process mapping, Plan-Do-Study-Act cycles, and real-time measurement as part of an overall methodological approach based on Langley’s Model for Improvement .The rate at which teams adapt new practice to their local care environment will vary, but CLAHRC NWL funds teams for 18 months to develop, test, and implement the required changes to processes of care delivery and secure sufficient engagement and support for new practice in their organization. CLAHRC NWL saw the SM as a potentially useful way to encourage teams to begin building strategies to enhance prospects for sustainability at an early stage of implementation. Distinctions between an initial ‘implementation phase’ and a later ‘sustainability phase’ were seen as unhelpful. Without considering the issues raised by the SM , the implementation of new practice may be ineffective. For example, a team may prefer to work in isolation initially to get their new practice ‘right,’ but if they neglect to involve the right people (such as frontline staff or key managers) at an early stage the viability of new practice in that organizational setting may be undermined. Teams are introduced to the SM during initial training sessions and asked to complete it at the start of the project to establish a baseline and subsequently every three months throughout the funded period. Team members anonymously enter their responses using an online reporting tool software system designed by CLAHRC NWL that generates mean overall team scores for each factor and domain and bar charts comparing these against maximum possible scores.Teams are asked to set aside 5 to 10 minutes in routine meetings to discuss their sustainability scores and to decide what if any actions can be taken to address any factor identified as potential barriers to long-term success. Quarterly completion was chosen to coincide with the quarterly Collaborative Learning and Delivery (CLD) events run by CLAHRC NWL to enable teams to get away from their work environment at regular intervals. Data from the SM are intended to inform team discussions on progress to date and next steps. The scores are also displayed at these events to provide an opportunity to share learning with other teams.Regular completion of the SM is designed to help capture changing perspectives over time as the challenges to implementation become clear and as team membership changes . CompletBecause aspects of the SM entailed a judgment of sorts on fellow team members , anonymous completion of the SM was considered important to enable all team members to express opinions without fear of repercussions.A prerequisite for the successful application of the SM in healthcare settings is the willingness of teams to engage—to complete scores, assess results, and take action where scores indicate a risk of the new practice they are introducing not being sustained. One also needs to have confidence in the validity of the measurement underlying the SM—that the measures used ‘accurately represent the concept being assessed’ .As part of a formative evaluation of the SM to assess the extent to which these prerequisites for successful application appeared to have been met, we triangulated different sets of data available to us as managers of this collaborative program. The teams’ engagement with the SM was assessed using three criteria. The first was the number of sustainability scores registered (assessed through the recording of scores in an online software tool designed by CLAHRC NWL). The second and third criteria are evidence of consideration or discussion of the issues raised by the SM scores and action taken to address concerns on sustainability raised by the SM. For example, if a team’s SM scores indicated concerns over staff involvement (with low scores in the ‘staff’ domain), then evidence of action taken to increase involvement (such as training sessions or staff involvement in the design of new practice) would count towards assessment of engagement.Evidence of discussion and action relating to sustainability are primarily derived from coding of minutes of ‘two-way’ reviews (where project teams meet with CLAHRC NWL staff for two-hour discussions every six months) and ‘end of project’ reports provided by the teams. Using these data and tacit knowledge of the project acquired through routine regular contact, two CLAHRC NWL staff rate teams independently and compare findings. Differences of opinion were discussed in the wider CLAHRC NWL team until a group consensus was achieved.To illustrate the types of actions taken in response to SM scores to improve the prospects for sustainability, an example of a project designed to improve the prescribing for the elderly is used. In the early stages of the project, the areas highlighted by SM scores as having the greatest potential for improvement were ‘effectiveness of the system to monitor change’ (in the Process domain) and ‘staff involvement and training’ (in the Staff domain). To improve systems to monitor change, the team worked with CLAHRC NWL to set up a system to regularly measure patients checked for medication they were using, and adverse drug reactions (ADRs), where medications were stopped or the dose was reduced. These data were used by the project team to monitor progress, to feed back to directorates within the hospital to raise the profile of the work, and to illustrate potential cost savings of improved prescribing and reduced ADRs. To improve engagement of frontline staff, the team delivered teaching and training sessions, disseminated awareness-raising material (such as posters and handouts), sent group emails, engaged staff in a Delphi exercise on the design of a tool to record patients’ medication, and ensured key frontline staff were included in the project team. Senior staff were engaged through invitations to join the project team, presentations at meetings regularly attended by managerial and senior clinical staff, and publicizing of the work through hospital communication channels such as newsletters. A Medication Passport, designed with the input of patients, was endorsed by the Royal Pharmaceutical Society and helped to ensure a national profile for the project’s work.We classified the 19 project teams into three categories—‘engaged,’ ‘partly engaged,’ and ‘not engaged.’ Teams with no entries for one or more quarter were classified as ‘not engaged’ and excluded from subsequent analysis. ‘Engaged’ teams showed evidence of consistent completion of the SM by the majority of team members, discussion of issues raised by the scores, and action taken to promote sustainability. Those with more sporadic quarterly completion and more limited discussion and action taken were classified as ‘partly engaged.’ In a series of charts, we compare the pattern of SM scores for ‘engaged’ and ‘partly engaged’ teams over time and, put simply, whether these make sense based on what we know about action taken by projects to promote sustainability. These data are presented in aggregated form in the article. We also present data in a more granular form in Additional file We hypothesize that if, as claimed, the SM promotes understanding of and measures progress towards sustainability, then over time a closer agreement on the likelihood of the project work being sustained is likely to emerge from the SM scores. To test this hypothesis, we derived a ‘diversity of opinion’ measure to assess variation and the extent to which responses to the model diverge or converge over time. The ‘diversity of opinion’ measure was defined to be the range of the responses for each factor in the model each time a team completed their responses. Thus it is calculated as follows: using the unweighted responses 0 to 3, subtract the lowest response from the highest response given by the specified team on the specified occasion for the specified factor. For each factor a score of 0 indicates no diversity of opinion or full agreement, meaning that every respondent chose the same statement or level of response at that point in time. A score of 3 indicates high diversity, where at least one respondent chose the highest weighted statement and one chose the lowest weighted statement. Scores of 1 or 2 represent intermediate degrees of diversity in the responses. This is a purely descriptive measure, and captures the maximum difference between team members on a given factor, on a given occasion. The range was chosen over other statistical measures of variation (such as interquartile range or standard deviation) because it is appropriate for four-level ordinal scale data and captures the existence of diversity among a small number of measurements, in a simple manner that is straightforward to interpret. It is important to note that this measure is not intended to be associated with any sense of ‘better’ or ‘worse.’ In particular, the authors make no assumption about whether or not a greater diversity of opinion within a team is beneficial or detrimental to success of implementation or to sustainability. At the CLD events referred to above, we also gathered feedback using a simple anonymized questionnaire from team members regarding ease of understanding, ease of application, and usefulness of the SM to explore reasons for variation in engagement.Seven of the 19 teams analyzed were categorized as ‘engaged’ , five as ‘partly engaged’ and seven as ‘not engaged’. Tables Figures A comparison of ‘engaged’ and ‘partly engaged’ teams shows that scoring trends diverge. Looking at trends over time, Figures After this second quarter, the scoring trends of ‘engaged’ and ‘partly engaged’ teams diverge. In the ‘Staff’ domain the scores for ‘engaged’ teams rise between quarters two and five. Chart A1 in Additional file Scoring trends for the ‘Process’ domain are also consistent with project activity. As part of the CLAHRC NWL’s program, all teams received training and ongoing support to apply quality improvement methods to experiment with and iteratively adapt their new practice to fit with processes of care delivery. Teams used these to experiment with changes to care delivery processes initially on a small scale, measure impact through Plan-Do-Study-Act cycles and statistical process control, and refine or adapt their approach to implementation where necessary to fit with existing processes of care delivery in their organization. CLAHRC NWL helped teams to define process measures and set up computerized online systems to enable weekly monitoring of progress. A greater tendency for ‘engaged’ teams to focus on process-related issues is consistent with their higher SM scores in this domain. The comparatively higher scores in the ‘Organization’ domain for ‘engaged’ teams also reflect action to raise the profile of their work among senior managers and clinicians and to show how successful implementation of project work can contribute to that organization’s aims.Interestingly, for many ‘engaged’ teams, particularly in the Staff domain, there is a fall in teams’ scores in the penultimate quarter of measurement The precise reasons for this would need more detailed research, but we suggest this may be another ‘reality check’ as the 18-month project funding nears completion.It is important to state that it is possible the patterns in Figures This confidence was reinforced by the analysis of diversity of opinion. Figure As time progresses, there is a shift towards more agreement within project teams, represented in the figure as a shift towards the left in the distribution. For us, this indicates what one would expect to see with a valid model—a growing consensus on the prospects for sustainability (positive or negative) as the funding period draws to a close. This does not mean to suggest that consensus or diversity of opinion is a good or bad thing, simply that a clear pattern of emerging consensus is apparent from this analysis.Every six months we asked team members to rate the ease of understanding and application of the model and its usefulness. Figure As managers of this collaborative program, we aimed to assess strengths and weaknesses of the SM when applied in clinical settings. To the best of our knowledge this is the first study describing the use of the SM by teams to help promote sustainability and it explores, as advocated in a previous study of the SM, ‘whether the SM could be used to diagnose and address sustainability problems in real time’ . It provThe data presented here are encouraging in some respects. There are teams who engaged with the SM, have shown an understanding of determinants of sustainability, and taken action to try and improve the prospects of their new practice being sustained. The consistency between SM scores and teams’ propensity to take action to try and promote sustainability and the ‘diversity of opinion’ scores gives us confidence as managers of the program that the SM is measuring what it purports to be.However, securing engagement is challenging, with seven out of 19 projects not engaged and feedback from teams indicating difficulty in understanding and applying the tool.The results section showed teams members’ ratings of ease of understanding and application of the SM and its usefulness falling over time. Based on our ongoing contact and periodic discussions with teams, we can highlight common observations of team members that may help explain negative reactions. Some believed that sustainability was an issue to be considered at the end of the project and that there was no value in using the model throughout, especially in the early stages. There were concerns regarding the number of questions and the amount of text in supporting documentation. It was felt by some that the wording of the forced choice statements were inadequate to describe a project’s state of development. For some, terminology used in the model was difficult to grasp or too vague, and some thought the results were difficult to interpret.Over time we found that team members tended to fall into one of three camps in terms of attitude: those who had not found a way to engage with the SM at any level and were unenthusiastic; those who were completing it each quarter as required but were sceptical about its value; and those who had engaged and identified ways to make it useful within their projects. In this analysis, levels of engagement with the SM did not appear to be associated with any particular characteristics of the team, setting or type of project.per se from the capacity building used to support it or from the impact of other quality improvement methods designed to help teams make their new practice sustainable. Ultimately, effectiveness depends on whether a project using the SM embeds new working practice as ‘a mainstream way of working within a year or two’ [This study’s analytical approach is designed to assess whether the data from the SM is consistent with our knowledge of what is happening on the ground in projects. There are methodological limitations to this approach, and one needs to be cautious about interpretation. While the data indicate that teams more engaged with the SM took more action to promote sustainability and the level of engagement was positively associated with SM scores, we can not say with certainty that the SM prompted action or that such action would not have occurred in the absence of the SM. Also, because responses were entered anonymously, we did not monitor changes longitudinally by individual team member or team role. Neither was it possible to separate the impact of the SM or two’ , but it Some of these methodological limitations could be addressed using a more traditional research design such as a controlled study. However, much will be learned about how best to apply tools like the SM by repeating studies of this kind, describing how frontline teams react and making use of available data to explore strengths and weaknesses. The testing of initial designs of this or any similar tool in clinical settings will help highlight strengths and weaknesses and aid iterative development.Based on what we have learned in our application of the SM so far, we see three areas as important for future effective application of the SM—content, design, and facilitation.et al. that emphasizes human and technical resources, opportunities for staff participation, and the alignment of new practice with the organization’s strategic goals and its added value [Many determinants of sustainability proposed in the SM are consistent with those identified in other studies. For example, Shediac-Rizkallah and Bone emphasized value . Sadof eed value .However, there is scope to expand the variables considered. We agree with Scheirer’s argument for a stronger emphasis on the political and economic environment as the context for long-term sustainability . The appConcerns were expressed by staff over aspects of the SM’s design that should be considered in future work. The SM is an ambitious attempt to get teams to apply complex ideas, many of which will be unfamiliar to frontline staff. It requires respondents to consider four statements covering ten separate factors affecting sustainability, compare their collective scores against maximum possible scores, and consider what action could or needs to be taken. Future work may be needed to simplify the structure to lighten the ‘cognitive load.’ A more user-friendly design and further development of question wording may help reduce some of the resistance. It may be useful to compare the SM’s design with Washington University’s approach, which poses five questions in eight separate domains with a 7-point scale .Facilitation of the SM is key to enabling teams to better understand the concepts underpinning the model and encourage teams to apply it. It is important to note that the work described in this study was undertaken in the early stage of a five-year program. Since then, the CLAHRC NWL team have gained more experience in communicating key messages and supporting the application of the SM. We developed novel approaches to training and facilitation in using the SM. On realizing that a didactic approach (with a plenary speaker presenting theory) was having limited success, we changed the way we introduced the SM to subsequent cohorts. This included the use of peer exemplars and allowing teams to brainstorm issues from their experience that may affect sustainability and mapping these to the SM to demonstrate its relevance to their experience. To some teams we also offered facilitated discussion within routine meetings. We observed meetings and mapped the subject matter of team discussions to the factors in the SM. We recommended ways to increase uptake and use of the SM including completing the model at the beginning of the meeting, having administrative support enter the responses during the meeting, and having a later slot on the agenda to discuss the results. Teams are also set challenges such as ‘stakeholder mapping’ exercises to help identify key people that need to be engaged to help promote sustained practice. Attempts to implement the SM elsewhere will need to factor this type of facilitation into their strategy.Research has increased our knowledge of what facilitates or impedes the sustained application of evidence-based interventions in local organizational settings . The SM There are no competing interests in this article.CD led the conception, design and drafting of the paper, TW, CH led on analysis and interpretation of data and RM, CM, KP and JS made substantial contributions to conception and design of the paper. All authors read and approved the final manuscript.Domain scores by team.Click here for fileScoring trends by the ten key factors.Click here for file

Hyperekplexia is a rare neurological disorder characterized by neonatal hypertonia, exaggerated startle responses to unexpected stimuli and a variable incidence of apnoea, intellectual disability and delays in speech acquisition. The majority of motor defects are successfully treated by clonazepam. Hyperekplexia is caused by hereditary mutations that disrupt the functioning of inhibitory glycinergic synapses in neuromotor pathways of the spinal cord and brainstem. The human glycine receptor α1 and β subunits, which predominate at these synapses, are the major targets of mutations. International genetic screening programs, that together have analysed several hundred probands, have recently generated a clear picture of genotype-phenotype correlations and the prevalence of different categories of hyperekplexia mutations. Focusing largely on this new information, this review seeks to summarise the effects of mutations on glycine receptor structure and function and how these functional alterations lead to hyperekplexia. Hyperekplexia OMIM #149400), or human startle disease, was first reported in 1958 by Kirstein and Silfverskiold49400, or. We now GLRA1 gene that encodes the α1 subunit of the inhibitory human glycine receptor (hGlyR) chloride channel[GLRA1 gene represents the major gene of effect[GLRB gene which encodes the hGlyR β subunit[SLC6A5 gene which encodes the presynaptic glycine transporter type-2[Shiang and colleagues were first to show that hyperekplexia is caused by hereditary mutations in the channel. Althougf effect,9, hyper subunit-15 or inr type-2-19. Mutar type-2 and collr type-2. Howeverr type-2, the anaInhibitory glycinergic synapses are located predominantly in the spinal cord and brainstem-24 and dRecently, thanks to large-scale systematic genetic screening programs, several hundred hyperekplexia probands have been examined and the results have generated a clear picture of the type and prevalence of mutations, their inheritance modes and the mechanisms by which they affect hGlyR structure and function,11,12,25T. marmorata[C. elegans[GlyRs belong to the Cys-loop family of pentameric ligand-gated ion channel (pLGIC) receptors. The X-ray molecular structures of several pLGIC receptors have been solved, including two bacterial homologues crystallized in the closed and open states, respectively-29, a nimarmorata and a gl. elegans. As this. elegans. Upon gl. elegans-35.In humans, four α subunits (α1 – α4) and a single β subunit have been described. The human α4 subunit is considered a pseudogene on the grounds that it incorporates a premature stop codon upstream of the final TM4 domain. hGlyRs de novo meaning that neither parent possesses the mutation[GLRA1 mutations[Most α1 hGlyR hyperekplexia mutations are either missense mutations whereby a single nucleotide change results in a codon change for a different amino acid, or nonsense mutations whereby a single nucleotide change leads to a premature stop codon that provide useful insights into the structure and function of hGlyRs and/or the pathophysiological mechanisms of hyperekplexia.GLRA1 mutations resulting in spontaneous channel activity have been identified: Y128C[So far, four d: Y128C, Q226E, Q226E, located at the top of the TM1 domain Figure A, B, alsV280M, in the TM2-TM3 loop, exhibits a dramatically enhanced glycine sensitivity and spontaneous channel activity suggesting a drastic destabilization of the closed channel state. This woY128C is located in the inner β-sheet of the ECD. The mechanism by which it induces spontaneous activity is not yet resolved, but given its distance from the TMD, it seems likely that it causes non-specific structural alterations.R414H, in the TM4 domain, results in a very low rate of spontaneous activity and has weak, if any, effects on glycine sensitivity, single channel conductance and expression efficiency. It is tThe high level of spontaneous activity in the Y128C, Q226E and V280M mutant hGlyRs directly contributes to the observed reduction in the glycine-induced current amplitude. The tonR271Q and R271L, at the extracellular end of the TM2 domain, are the most frequently occurring and the most studied hyperekplexia mutations. They are both inherited in an autosomal dominant manner,65,67,72The TM2-TM3 loop located adjacent to R271 is an important structural element involved in transmitting glycine binding signals from the binding site to the activation gate-35. GiveThese and other mutations that impair channel gating cause hyperekplexia by reducing the rate of chloride influx through synaptic hGlyRs. Depending on the mutation, this may be achieved via a combination of a reduced maximum channel open probability, a reduced single channel conductance and/or a reduced the glycine sensitivity which would diminish the likelihood of the channels being effectively activated by synaptic glycine concentrations. The consequent reduction in glycinergic current magnitudes would disinhibit motor neurons thereby leading to enhanced firing activity and more potent muscle contractions. As noted above, hyperekplexia patients develop compensatory mechanisms to cope with the level of excitatory activity required for normal motor control. One comAlthough hyperekplexia patients with R271Q/L mutations are effectively treated with clonazepam,4,6, novThe autosomal dominant mutation Q266H in the TThe autosomal dominant mutation R218Q in the ECD produces a dramatically reduced sensitivity to glycine, which is probably the primary reason for its hyperekplexia phenotype,89. Low The autosomal dominant P250T mutation in the TM1-TM2 loop reduces glycine-activated current amplitudes and induces fast desensitization with a time constant near 120 ms,91. The The P230S hyperekplexia mutation in the TM1 domain also induces fast desensitization with a time constant near 1 s. AdditioMany hyperekplexia mutations reduce cell surface expression, thereby reducing the maximal glycine-induced current amplitude. For the autosomal recessive mutations, S231R and I244N, both located in the TM1 domain, R252H in the TM2 domain and R392H in the TM4 domain, it was shown that treatment with the proteasome blocker lactacystin significantly increased the accumulation of mutated α1 subunits in intracellular membranes suggesting that the mutated subunits were recognized by the endoplasmatic reticulum control system and then degraded via the proteasome pathway. Thus, tGLRA4 gene, it suggests that a review of the presumed pseudogene status of GLRA4[hGlyRs incorporating premature stop codons usually do not form functional receptors at the cell surface,69,95. H of GLRA4,36 and oGLRA1 V170S mutation was shown to produce an autosomal dominant form of hyperekplexia[Low concentrations of zinc (0.01 - 10 μM) have long been known to potentiate hGlyRs. As zincekplexia. When thekplexia. This reGLRB gene has only recently been identified as a major gene of effect in hyperekplexia[GLRB hyperekplexia mutation was identified in 2002[de novo L285R substitution is also likely autosomal dominant given the nature of its effect on receptor function (see below) and the fact that it was identified in a heterozygous proband[The ekplexia-12 altho in 2002. To date in 2002, althoug proband,12,15, b proband,12, expede novo mutation, L285R, provides an exception to the above pattern of effect on the grounds that it produces spontaneous channel activity when co-expressed with α1 wild type hGlyR subunits[The subunits,12, and subunits. It has subunits-102, subGLRA1 mutations, GLRB mutations are strongly associated with delays in gross motor development and speech acquisition in humans[GLRA1 and GLRB results in distinct startle phenotypes[Unlike n humans. This faenotypes. The difenotypes,104.GLRA1 and GLRB hyperekplexia mutations can be grouped into three main categories. The first includes those dominant mutations located in and around the TM2 domain that do not impair cell surface expression but disrupt hGlyR function by either inducing spontaneous channel activity or by reducing glycine sensitivity, chloride conductance and/or open probability. The second category includes those recessive missense mutations located throughout the receptor that result in a deficiency in cell surface targeting of hGlyRs. The final category includes recessive nonsense and deletion/frameshift mutations, the so called null genotypes, which preclude the formation of full length functional pentamers. The analysis of the molecular mechanisms of these mutations has provided unexpected insights into the structure and function of GlyRs and also into glycinergic signaling mechanisms in health and disease. By describing some of these molecular mechanisms, we hope that we have been able to provide explanations for the phenotypes of many gene-positive patients.hGlyR: Human glycine receptor; nAChR: Nicotinic acetylcholine receptor; pLGIC: Pentameric ligand-gated ion channel; TM: Transmembrane.The authors declare that they have no competing interests.Both authors participated in developing and discussing the ideas and in writing the manuscript. Both authors have read and approved the final manuscript.

The level of educational attainment is increasingly being recognized as an important social determinant of health. While higher educational attainment can play a significant role in shaping employment opportunities, it can also increase the capacity for better decision making regarding one’s health, and provide scope for increasing social and personal resources that are vital for physical and mental health. In today’s highly globalized knowledge based society postsecondary education (PSE) is fast becoming a minimum requirement for securing employment that can afford young adults the economic, social and personal resources needed for better health. Canada ranks high among OECD countries in terms of advanced education, with 66% of Canadians having completed some form of postsecondary education. Yet youth from low income indigenous and visible minority (LIIVM) backgrounds continue to be poorly represented at PSE levels. The current study aimed to understand the reasons for this poor representation by examining the experiences of LIIVM students enrolled in a postsecondary program. Findings show that the challenges they faced during the course of their study had an adverse impact on their health and that improving representation of these students in PSE will require changes at many levels. The World Health Organization’s Commission on the Social Determinants of Health has presented overwhelming evidence that health and quality of life are socially determined and that entrenched health inequities among people originate not so much from lack of hospital or community based services as from the failure of Governments to address the “social determinants of health” . These rThere are several interrelated pathways through which educational attainment is linked with health . Higher vs. 42.9% of those without a high-school diploma. In 2006, the Organization for Economic Co-operation and Development (OECD) reported that the percentage of people claiming positive life satisfaction increased with educational attainment [In today’s highly globalized knowledge based society postsecondary education (PSE) is fast becoming a minimum requirement for securing employment that can afford young adults the economic, social and personal resources needed for better health and quality of life. Young adults who do not pursue postsecondary education are likely to experience a lower socio economic status (SES) than those who acquire further education and skills . In 2005tainment . Advancetainment .Canada ranks high among OECD countries in terms of advanced education with 66% of Canadians aged 25 to 64 having completed some form of post-secondary education. However, youth from indigenous and low income backgrounds are under-represented at postsecondary levels . IncreasGiven the unequivocal benefits of PSE for health and well-being, and the number of students from low income backgrounds who are unable to access PSE, the experiences of those from these backgrounds who make it to postsecondary educational institutions becomes very important. The focus of this study is on the school experiences of students from low income indigenous and visible minority (LIIVM) backgrounds enrolled in a postsecondary educational setting in Western Canada and the influence of these on their health and well-being.Lack of financial capital is one of the most widely cited barriers. A steep increase in undergraduate student fees in the last fifteen years has lured many youth from low income backgrounds to join the labor force instead of undertaking postsecondary education [Lack of proximity to postsecondary institutions, which are usually located in major cities and urban areas, and transport problems are other factors that can substantially impact the costs associated with obtaining this education, especially for those low income students living in rural and remote areas. Parental levels of educational attainment play an important role in youth entering and persisting with postsecondary education. Studies show that children of parents who have completed postsecondary education are substantially more likely to enroll in higher education than those whose parents’ educational attainment did not exceed high school [Students from low income (LI) backgrounds face several inter related barriers to pursuing and persisting with postsecondary education. ducation . Lack ofh school . This pah school ,20.While a significant number of students from low income backgrounds experience difficulties accessing postsecondary education, those from LIIVM backgrounds may face additional barriers arising from factors like systemic discriminatory practices and acculturative stress that can be experienced much more intensely by immigrants from visible minority backgrounds ,22. ThesFor many indigenous and visible minority students the mainstream University may represent an impersonal, intimidating and hostile environment in which little of the cultural knowledge, traditions and values they bring are recognized or valued. Kirkness and Barnhart highlighDespite these barriers an increasing number of students from LIIVM backgrounds are enrolling in postsecondary education to improve their chances of gaining better jobs and wages. This includes a significant number of mature aged (25 years and above) learners. Many of these students are attracted by state-sponsored financial assistance schemes that are offered by liberal Governments to mitigate some of the educational barriers faced by students from low income backgrounds . Many LIThe purpose of the current study was to examine the aspirations of LIIVM enrolled in postsecondary study, the challenges they faced during the course of their study program and their perspectives on how these influenced their health and well-being. Research on minority students has mostly been conducted at postsecondary institutions that serve predominantly mainstream students. For the purpose of this study a community college that serves a large population of low income students from diverse cultural backgrounds was selected. The following specific questions were examined: (a) what are the aspirations of indigenous and visible minority students enrolled in a postsecondary educational program? (b) What challenges did indigenous and visible minority students face during the course of their study? (c) What are the students’ perspectives on how these challenges influenced their health and well-being?A qualitative methodology informed by interpretive phenomenology was emplThe study was open to all students from indigenous and visible minority backgrounds attending a Human Services program in the community college. Students were recruited with the assistance of the program coordinator who disseminated information about the study to students in their classrooms. Study information was also displayed on the school notice boards. Students who expressed interest to participate in the study provided their contact details to the program coordinator who in turn provided these to the research investigators. A total of 14 students—seven indigenous and seven immigrant students—volunteered to participate in the study. This included 11 female and three male students.In-depth semi-structured face to face interviews were conducted by the first author and two graduate research assistants trained in qualitative research interviewing. Each interview lasted for a maximum of 2 h. Interviews started with broad open ended questions: “Tell me what a typical day at school is like”; “Tell me why you decided to go back to school; “Tell me about some challenges you face as a student ; “Can you share with me how some of these challenges make you feel or affect your health; “What supports do you have”? All interviews were audiotaped after receiving consent and transcribed verbatim.Data were analyzed using thematic analysis. Each transcript was read several times independently by two members from the research team in order to obtain an overall understanding about participant experiences and challenges and how they coped with these. In keeping with qualitative data analysis the transcripts were coded into meaningful segments and then combined into categories to generate themes . The codExcept for three, all students in the study sample received student financial assistance from the Provincial Government. Although the study did not specifically target mature aged or first generation migrant students, all those who agreed to participate were mature aged (their age ranged from 25–52 years) and all the immigrant students were first generation Canadians who had migrated within the last 10 years. The majority of the students (11/14) had caregiving responsibilities—they had young children or had caregiving responsibilities for extended family members. Most of the study participants (11/14) worked between 5 to 8 h a day to supplement their earnings.We present below the themes in response to each of the research questions.I was tired of being on social assistance because it’s like they have to know your life. They dictate your life, right, depending’ on which worker you have, right. They ask questions like about income, about umm who’s all living’ with you and stuff like that. And some of it’s personal you know, and some of them they don’t need to know….”“Students aspired to get jobs as welfare and community workers at the end of the program. All students were in agreement that the program they were in would help them to get jobs that could improve the quality and standard of life for their family members. Some students said that the program of study provided the opportunity to move out of dead end menial jobs that offered little scope for economic and social advancement. In the case of some others it offered a way out of Government social assistance which they perceived as oppressive and disempowering. As commented by one student:I come across a lot of the Africans that are coming in and they express a lot of problems with integration into the mainstream and there is the need for somebody that they will be comfortable with, their own—they say that they feel intimidated over the time you know and that somebody of their own would be very comfortable.”“Many immigrant student participants had experienced difficulties in the process of settling in Canada. Some had come in as refugees from war torn countries and had experienced difficulties navigating their way through services and accessing help from service providers. These students expressed that gaining employment as community workers would fulfill their desire to help new immigrants and refugees. This is captured well in the following excerpt:Three immigrant students already had graduate degrees from overseas that were not recognized in Canada. These students had enrolled in the program to upgrade their qualifications and gain employment that was more in line with their interest and previous training. One of these students was a qualified teacher with several years of teaching experience overseas. Another student who had technical qualifications had worked at odd jobs for 11 years after migrating to Canada in order to support his family. In the case of some students their caregiving responsibilities had delayed their entry into postsecondary study and they were looking forward to a new break in their lives.I wanted to show my daughter who’s gonna be ten this year that she could go to school, you know… that she doesn’t have to work at low-paying jobs or, or be on welfare, right… I wanted to change all that for her.”“An additional reason mentioned by some students for entering postsecondary study was the desire to be good role models for their growing children. This is illustrated by the following excerpt:Thus, for many students attaining postsecondary education meant breaking out of the lived experience of social subordination from an intergenerational perspective. The above excerpt also suggests that while children may inhibit many women from poor socioeconomic backgrounds from undertaking and persisting with study , childreAs stated earlier, the majority of students in the program (11/14) were receiving state sponsored financial assistance to pursue postsecondary study. An ironic theme that emerged from the research findings is how a programmatic resource presumably designed to target financial barriers to education turned out to be a significant health determinant. Three concerning realities emerged from narratives informing this theme: first, inadequacy of assistance, second, conditions of the financial assistance scheme and third, information control. Working together, these lived realities had significant health implications for the students.If the intent of the assistance is to help people like me not become burden on the system but to become a productive member they were going to give me something that will sustain me to go through the program. At the end of the day after the tuition fee, I was left with $840 to pay for my rent, transport and lodge. Most students in my course were breaking down…”“Inadequacy of assistance is about the student’s everyday predicament that the financial assistance scheme falls short of supporting their needs arising from the multiple realities of their lives. A student summarized this in a way that speaks to voices from other peers in this research study:The participants in this study were matured adults trying to empower themselves through education; this personal campaign was typically waged notwithstanding a background of complex, troubling life histories that continue to bear on them with hefty psychological baggage and pressing everyday material responsibilities. The indigenous student participants represented those who had grown up in impoverished reserve households where schooling has been inter-generationally an endeavor of self-actualization far beyond everyday immediate material deficits and behavioral crises that preoccupy life on reserves. Others represented a struggling immigrant life following years of harsh existence as in cases of running away from oppressive regimes and of eking out a horrific existence in refugee camps. With being students, current life-styles for many of these students encompassed intercepting realities such as single parenthood, spousal violence, homelessness, poverty trying to stay clean from an addiction. All these past and current lived realities add up to a typical student life, as reported by study participants.By all accounts as represented by the above quote, the financial assistance scheme—however, it awards according to individual needs—made little room if any at all to accommodate unplanned situations and unexpected monetary demands that imaginably pop up in the everyday lives of students mired in their respective internal and external psycho-social environments that often lend limited order and predictability. The students’ narratives highlighted situations such as taking refuge from family violence, lending money to a family member in crisis, an unplanned move of residence, expenses associated with moving and securing rental of another apartment, expending on children’s extra-curricular recreation and interference from child welfare services for having left their children alone at home after school. When situations such as these arise the monthly budget associated with the financial assistance scheme gets subverted and these students are more at risk of confronting and coping with a chaos of stressful concerns and physical exertion. In order to deal with these the majority of the students on assistance were forced to take up full or part time employment to top up the financial assistance and this created much physical and mental strain.Career investigation: Qualified students must have a set of employment goals…Referral to training: Student advisor to approve your training plan…Commencement of training: Training commences and you enter Service Management. This is your support system. It monitors your attendance and progress while you are in school.Completion of training: you…start looking for workFollow-up: you will be contacted twice over a six-month period, once at three months and once at six months, for a report on your job search or employment situationAdditionally the conditions of receiving financial assistance for schooling required the students in this study to enroll in full-time studies and to pass all five courses they had to enroll in each semester. Perfect class attendance is expected with little room for excusing absence. While the financial assistance scheme is invariably advertised as a support to these students, the agenda of behavioral management slips into the rule book for assistance applicants and recipients. The following conditions of a typical financial assistance scheme illustrate such an agenda .Career In other words, applying to and receiving from a financial assistance scheme is allowing oneself to be constructed into a client of the scheme where one enters into a contract to complete a job according to external expectations and criteria. In being “clientized”, the student agrees to be assessed, decided for, monitored and interestingly, shepherded and observed beyond the schooling period, which the scheme only funds and therefore should limit itself to be concerned about.In this analytical light, being a scheme client comes with additional workload related to rules and expectations connected to state-sponsored help. Based on what the students in this study described, the daily regime they made effort to maintain to meet the schematic conditions ironically often competed for attention with heavy school work and from time to time, unforeseen, unplanned life events or crises and financial issues within their lives of multiple realities. These conditions became overarching stressors piled on top of other ones—on-going and potential.A third lived reality about the state-sponsored financial assistance scheme is students’ experience that funding bureaucrats at their college were less than helpful in offering information that lends options to arising circumstances that could jeopardize their continuation in school. By the students’ accounts, “if you don’t ask, I don’t tell” guideline seemed to be a part of the operational model of these bureaucratic staff who, ironically, the students commonly referred to as their “advisors”.I had to dig in, even though the system is there, you have to know the vocabulary to use because it’s controlled to a point where they don’t tell you until you ask.”“A student who was taking a full load of five courses as required by the financial assistance scheme and still had to take a 5 h nightly work shift to supplement his income to support dependent children experienced a financial crisis toward the final part of the program. He ended up quitting before completing the studies. By other students’ accounts, such financial schemes typically have provisions to help recipients to get over financial humps in times of extraordinary needs. However, as one female student shared her experience from approaching one of her college’s fund administrators, “I was made to feel as if they’re saying to me “we are doing you a service by giving you assistance”. She never ended up getting the help sought for her financial difficulties. In the end, she did her own on-line research and became aware of provisions within the financial scheme that the administrator could have explored with her without making her feel like society’s burden. In her own words,The linkage of the three lived realities arising from student participation in the financial assistance scheme and the expectation that students must pass all the courses in order to maintain eligibility, caused considerable physical and mental stress that often affected their school performance. This was very well articulated by one student who had observed her peers struggle with (in her words) “mental focus” in the classroom. She further explained: “half the time in class they worry about their lives, their jobs, their kids”. From a critical theory perspective, the linkage of the three lived realities arising from student participation in the financial assistance scheme to their health is “extra-local”—to borrow an analytical descriptor from Dorothy Smith’s sociology based on institutional ethnography . AppliedYet, the physical and mental toll related to staying afloat in the sea of pressure to abide by rules and expectations of the scheme are everyday lived human conditions. Extra-locality of health impact by being student-clients of the scheme therefore becomes a ruling device whereby students’ physical and mental strain and stress from managing themselves as clients are by necessity rendered unrelated, irrelevant and therefore, invisible within the social relations of the scheme involving the administrators/advisors and student-clients. In this sense, all the strain and stress that go into abiding by rules and meeting expectations become extra-localized as students’ personal responsibilities to manage. This further allows a discourse of personal life-style management to be dished out to funded students, which would suggest that self-care and staying healthy is part of the person’s duty so that s/he is able to have full attendance, to pass courses, to complete program, to start looking for work and to stay employed. In other words, the linkage to health is now effectively shifted to being with the funded student’s integrity as clients and away from the scheme.Student Aid Meets Social Assistance invokes the term “supplementarity” to explain that student financial assistance schemes typically go by the principle that they only act as a supplement to available resources [Torjman in her 2009 report esources . In otheIn this ideological light, sense is readily made of the financial assistance scheme that it has a mission to route student-clients to gainful employment; hence the steps cited above in terms of what the scheme in question is expected to do with and to the student-clients. The irony of it all is that as a helping scheme with a public face for the idea of education being a determinant of health, the scheme in practice contributes to constructing oppressive conditions that subvert student-clients’ health and well-being and therefore their effort for academic success. If education is a social determinant of health, financial assistance schemes such as these may become counter-productive as evident by the findings in this study and students are put at risk of having health issues by virtue of being clients of a “helping” scheme.Teachers should incorporate indigenous ways of knowing/learning such as sharing circles as this will contextualize teaching to our lived experiences and make it culturally more relevant—this could help to break down the mistrust and the interaction problems between students and teachers and the cliquey problem we have here.”“Almost all students shared that the program, which was linked with the financial assistance scheme lacked the flexibility to accommodate their life circumstances. Additionally students expressed their discontent about the teaching and assessment practices that were largely based on “reading texts and writing assignments”. Often students had to hand in 3 to 4 essays in a week and this called for several hours of reading from different texts. This meant working through the night which left them constantly tired the following day. One student disclosed that the emphasis on essays forced some students to purchase online essays and submit them as their own. Some students expressed that teaching and assessment practices were very much modeled on western ways of learning. Their views are well captured in the following comment from one student:Classroom social norms and the teaching practices of some teachers are not reflective of the values of equality, empowerment and respect for diversity.”“Another student who had experienced racist interactions between some teachers and students in the classroom shared:The above findings suggest that human service programs that are delivered using traditional Eurocentric formats where students are expected to read texts, attend lectures and focus on written assignments and final grades may be failing to meet the needs of students from diverse cultures, particularly those from LIIVM backgrounds. Recent studies show that such approaches are ineffective in preparing even mainstream students for professional practice in the human services sector ,39.She seems to be promoting inequality through: not penalizing plagiarism, playing favorites, accepting and perpetuating racist attitudes and behaviors from students and creating a hierarchical classroom structure.”“Many students shared that they had chosen this college for pursuing postsecondary study because of its large multicultural and indigenous student community. They expected less discrimination based on factors like race, skin color, class and accent and this was important to them. The students’ experiences however, suggest that this was not the case and that issues of race and racism are not muted even in educational institutions colleges that have a high proportion of minority students. Students shared their experiences of racism and discrimination from some of their white teachers and peers and their general feelings about approaching authority figures like administrators and counselors. One student described one of her white instructors as:Powerless, unable to resolve social conflicts, discouraged social cohesiveness and created a negative classroom atmosphere.”“This student also remarked that social conflicts in the classroom (involving instructors and students) were continually left unresolved by some instructors. Students appeared to be “shut down” when they tried to address these issues. The student said that this silencing had the effect of students interpreting this as a prejudicial action used to avoid confronting racism. This apparent lack of understanding from a minority of instructors left this student and some of her peers feeling (in her words):Excluding you in a conversation, condescending stares and the ‘cliquey problem’ with distinct racial groups sticking together.”“Another student shared that that poor teacher role modeling by at least one instructor was incongruent with the values of equality and social justice promoted and taught in their studies. On another level one indigenous student highlighted her experiences of covert racism from some white students. In the following excerpt she recalls her experiences of feeling alienated by her white peers:White women refuse to acknowledge there is a history and they don’t even want to talk about this history.”“An indigenous student who had a learning disability had experienced ongoing race based harassment and bullying from a group of Caucasian students. When she reported her experience to an instructor she was told that she would have to tackle this on her own. Another student reported:She also perceived that there was a lack of attention by the school’s leadership to address these attitudes and this led to perpetuation of these behaviors and practices by people who harbored these attitudes. The “cliquey problem” with students sticking together in distinct racial groups, is a very common occurrence that can be observed in institutions of higher learning in countries like Canada. These are strategies that students who feel oppressed may use to gain acceptance, visibility and refuge from the hegemony of the dominant group .So I am an immigrant—I don’t want to restructure their school system, but if you speak to anybody and they say that’s how this school system is, you feel like maybe it’s going to look like I’m from a different learning standard, I cannot cope with the learning standard here—or maybe it’s me, I wasn’t educated in this country so maybe it’s me who is having this problem.“I have not spoken to anybody (authority figures) but we students talk amongst ourselves and they say that’s their school system and that’s how it is.I sometimes feel I’m not even supposed to complain because I don’t deserve this. This is like—they (the whites) are doing me a favor, they don’t have to do that for me. Sometimes you get that mentality because of where you come from, so you don’t even see the biases or anything in that system….”Unlike the indigenous students whose historical and political legacy made them highly conscious of and sensitive to issues of oppression and white privilege, immigrant students experienced feelings of powerlessness, guilt, self-blame, inferiority and embarrassment. The following excerpts from immigrant students capture some of these feelings:Some LIIVM students also experienced stereotyping and insecurity as evidenced from the following comment: “I tell my son—we are citizens but the rules are different for us because we are immigrants—we can be deported any time if we create trouble”. Like many others, this student did not want to be seen as a “trouble maker” by asking questions that would make her teachers, administrators or peers feel uncomfortable and create problems such as retribution from faculty and her white peers. While students expressed that the majority of their course instructors were considerate and prepared to extend time for assignments, they did not feel the same about approaching other authority figures like school administrators and advisors.Unlike their indigenous counterparts who had access to an indigenous unit within the college, the visible minority students did not have a dominant body to raise consciousness about their experiences. They lacked a public discourse of sufficient general mainstream acceptance to fuel courage to complain or even ask questions. Their narratives suggest that remaining silent, maintaining group solidarity and sharing their experiences with group members were their ways of coping with their situation of powerlessness. Participating in this research, may have been one of their ways of making their voices heard.Although research on the health effects of the experiences of ongoing racism on students from LIIVM backgrounds is scarce, racism is an important social factor that can influence health and well-being . Racism The students’ ongoing feelings of powerlessness, anger, guilt and shame and apprehensions about approaching fund advisors are evidence of the impact racism can have on mental health. In the following section we discuss students’ perceptions of the influence of the challenges on their health and well-being.I’ve never experienced stress before like what I am experiencing when I started school. I have started to taking pills for stress because I will feel it in my neck, I will feel my muscle—I try not to and I know its stress. Sometimes I would feel like I am drowning so I have to tell myself “stop and just relax” and don’t think about anything until your muscles start to relax because I can feel it. I never experienced those things before until I started school so I know its stress.“The pressure—it is affecting my memory. It’s true because before I had a very good memory but I noticed that since I started school I’m very, very forgetful—last term I was the type who was very attentive. But now I forget things that’s for sure. So now I try to train my memories—train my brain to remember things because I find myself forgetting things easily—very easily. It’s affecting my relationships as well …,I noticed a lot of people dropped the course—when we started I think we were 40 something but now we’re less probably maybe we’re around 20 something. See lots of people dropped the course because they couldn’t take the course load …the pressure.”Students shared that the pressures imposed by the financial assistance scheme, the demands of the course and their multiple roles took a heavy toll on their physical and mental health. They reported to experiencing a multitude of physical and mental health problems that included migraines, extreme fatigue and flashbacks of trauma from past abuse. For some the stress had triggered exacerbations of existing problems such as drinking and smoking. Others reported that they were unable to concentrate in class, had appetite disturbances such as overeating, difficulties with memory and felt constantly worn out. One participant reported that she had started experiencing panic attacks during the course of the program. The following excerpts capture the impact of stress on the students’ health and well-being:Students, particularly those whose close families were overseas missed not being able to see and interact with them on a regular basis. Some students said that they were often confronted with feelings of wanting to give up and questions like ‘is it worth it’. In the case of one immigrant student who had no family in Canada the lack of a support system had led her to the brink of homelessness, isolation and depression.Despite the availability of student counselors, most students in this study reported that they did not access them for a number of reasons. These included not feeling safe to divulge their life circumstances as they felt these may be used against them, not part of their culture to see counselors or doctors for personal problems, that visiting a counselor/doctor for their difficulties meant “failing”, personal inadequacy or having a mental problem, fears of being patronized, apprehensions that advisors and counselors may not understand their situation or being perceived as poor learners. Many expressed that they relied on community elders and band members, close and extended family for advice and emotional support.When asked what kept them going despite the physical and mental stress they experienced they gave several reasons. Some did not want to return to menial dead end, exploitative jobs or a life on welfare and poverty while others said that they had made huge personal sacrifices to return to study and did not want to give up. Students who experienced motivational support from family, their children, elders and band members expressed that they did not want to let down the people who had provided motivation and encouragement all through their journey through school.I grew up in a home where I knew that prayers work. People pray when you have problem. I feel like relief when I’m praying and in my heart I know yes I know there’s a God. Prayer—that’s what kept us going through the war. Back home in the war that’s what we lived on—prayers.”“Some students also expressed their belief in a superior power and the power of prayer that helped them cope with the difficulties they were experiencing. A student who had come to Canada as a refugee from a war torn country said:Other strategies that some of these students used to cope were “using pep talks”, participating in self-care activities like meditation, yoga and exercise, and setting aside one day a week for Sabbath, family activity, or community work.This pilot study examined the career aspirations, challenges and health related perceptions of mature aged learners from low income indigenous and visible minority (LIIVM) backgrounds enrolled in a human services program in a postsecondary educational institution in Western Canada. The findings are based on a sample of 14 students from one postsecondary educational institution and are not be generalisable to LIIVM students from other postsecondary institutions in Canada. Despite this limitation the findings are significant and have important implications for policy and practice. The three key challenges that LIIVM students faced in realizing their career aspirations and goals arose from structural and systemic factors, namely the student financial assistance scheme, institutionalized racism and teaching pedagogies based largely on Eurocentric models. From the social determinants of health perspective each of these factors may intersect in multiple ways to generate an oppressive learning environment that can adversely affect the health and well-being of students from LIIVM backgrounds. The impact of this environment most likely resulted in a high drop-out rate from the study program, and increased self-reporting of physical and mental health problems and the risk of breakdown in the case of students who participated in the study. In this context the finding that participants who had access to informal social support held on to the program suggests that access to culturally relevant support may help to buffer the adverse impact of oppressive learning environments on the health of students.The impact of the financial assistance scheme on students’ health and the neo liberal discourses that such schemes promote has already been discussed. Similarly the impact of ongoing racism on the health of individuals has also been discussed earlier. Students’ experiences of racism are in keeping with previous studies ,47,48 anTeaching pedagogies based largely on Eurocentric models can also exert a significant influence on the psychological health of minority students. Eurocentric teaching approaches rely heavily on the students’ language and written presentation skills and LIIVM students who do not have good language skills may experience additional stress and fare poorly in written assessments. LIIVM often have rich cultural knowledge and work experience from their countries of origin and considerable life experience. Many have experienced war trauma, persecution, discrimination and poverty. Their lived experiences can be an invaluable asset in the human services field. Unfortunately Eurocentric teaching pedagogies provide little scope for acknowledging and incorporating in meaningful ways the rich cultural, historical and experiential knowledge that LIIVM students bring to the learning environment. This can lead to feelings of dissatisfaction and self-devaluation among these students. This can result in some students discontinuing enrollment ,51 and sCreating learning environments for LIIVM students that will help to maintain their health and well-being during the course of their study calls for changes at different levels and the collaborative input of stakeholders from Federal, Provincial and postsecondary educational sectors. In the following section we discuss some of the practice and policy implications of the findings.The State-sponsored financial assistance scheme for students from low income backgrounds is an ideology-based neo liberal policy that aims to move able bodied people on welfare (or those at risk of moving into welfare) into employment so that they do not depend on the state for a livelihood—a code for “so they do not take advantage of the mainstream supporters of the government—the taxpayers”. From this perspective people from LIIVM backgrounds are a group that is at risk of becoming welfare dependent. The public face of this neo liberal policy is to help poor and needy students to gain postsecondary education and support the discourse that education is a determinant of health. Ironically the scheme became counter-productive as it contributed to constructing oppressive conditions for the students and put them at risk of having health issues by virtue of being clients of a “helping” scheme. If this scheme is to serve its intended purpose, it must factor in flexibility as opposed to the expectation that students benefit from “supplementary” income . The multiple realities that these students face on a regular basis must be considered, in addition to the number of courses required each term in order to maintain eligibility. Provision of affordable child care services specifically for students will minimize the chances of children being left alone at home without supervision and the risk of interference from child protection services. Adopting a “one size fits all” approach for the delivery of this scheme and expecting that all students from low income marginalized backgrounds experience the same hardships, and should therefore be subjected to the same criteria for the same amount of financial assistance reflects the false premise that social discrimination is non-existent, that the experiences of all students eligible for financial assistance are equal, and therefore identical, regardless of race or ethnicity ,52,53. TFinancial assistance schemes must also have built in processes to establish transparency within their conditions and regulations, while allowing for anonymity for those who enquire about various options without fear of loss of benefits or other negative consequences. A system which relies on ignorance cannot also claim to assist others in the dissemination and acquisition of knowledge. Students must have easy access to resources that can help them to understand their rights and obligations with respect to financial assistance. Fund administrators and advisors have a crucial role to play in ensuring that LIIVM students accessing these schemes are not disadvantaged because of their race and class. To this end educational institutions must ensure that people hired for these positions are knowledgeable about the scheme, understand the realities of class and race discrimination and are able to interact with students in anti-oppressive ways. This includes being aware of their social locations of power and privilege and how these can distance them from students who need their advice and support. Without these significant changes, both at the levels of policy and its implementation, financial assistance schemes will not only fail as demonstrated by the testimonies of the students in this study but will put students at risk for developing physical and mental health issues.While the impact of ongoing racism on health has been discussed earlier, the pathways through which it affects health include biased information about groups and communities that leads to stereotyping, prejudice, discrimination and oppression . The expStudents from diverse backgrounds like indigenous, African and Asian Americans may learn better in collective and cooperative teaching and learning environments where life experiences and knowledge can be shared among learners, rather than individualist and competitive environments favored by the mainstream culture. Instructors must therefore strive to incorporate a blend of teaching and learning approaches that can benefit all students. In such environments indigenous and visible minority students will feel motivated and acknowledged for their contributions to the learning experience while mainstream students will be introduced to news ways of learning that may be more fulfilling and enriching.The groundwork for this can be secured by helping indigenous and visible minority students to build and expand upon their existing networks, such as ethnic community organizations and leaders, churches or other places of worship, families, and welfare organizations that provide practical forms of help. Student services can also help to establish a strong student mentoring support system that can take an active role in helping marginalized students to develop resources and community networks. They can also introduce student peer support groups where minority students can voice their concerns without fear and peer leaders can ensure that these are conveyed to decision makers responsible for making changes in existing systems that perpetuate discrimination. Since students from visible minority backgrounds may not access mainstream student counseling services, the educational institution must be proactive in ensuring that ethnic counselors are available to students when they need them.Education is a social determinant of health. Although the findings of this study are based on a small sample of students from one community college in Canada and therefore cannot be generalized, they highlight the importance of developing a more inclusive postsecondary education system that is truly committed to the principles of anti-discrimination and antiracism. This can go a long way towards helping LIIVM students and other low income students to achieve their educational goals while maintaining their health and well-being.

The tracking of multiple wireless mobile nodes is not easy with current legacy WSN technologies, due to their inherent technical complexity, especially when heavy traffic and frequent movement of mobile nodes are encountered. To enable mobile asset tracking under these legacy WSN systems, it is necessary to design a specific system architecture that can manage numerous mobile nodes attached to mobile assets. In this paper, we present a practical system architecture including a communication protocol, a three-tier network, and server-side middleware for mobile asset tracking in legacy WSNs consisting of mobile-stationary co-existing infrastructures, and we prove the functionality of this architecture through careful evaluation in a test bed. Evaluation was carried out in a microwave anechoic chamber as well as on a straight road near our office. We evaluated communication mobility performance between mobile and stationary nodes, location-awareness performance, system stability under numerous mobile node conditions, and the successful packet transfer rate according to the speed of the mobile nodes. The results indicate that the proposed architecture is sufficiently robust for application in realistic mobile asset tracking services that require a large number of mobile nodes. Second, simple but effective methods for supporting the mobility and the location-awareness of communication nodes are critical, although this can be quite difficult to achieve. Especially, under legacy WSN technologies such as ZigBee [For mobile asset tracking systems in particular, additional design considerations are required along with the basic WSN system design considerations such as low power consumption and tiny size. First of all, many previous reports have attempted to increase the accuracy of mobile node localization. However, due to the burden of the accuracy factor, numerous mobile nodes could not be supported simultaneously. Since the number of communication nodes can easily amount to thousands in a given service, an effective system architecture is necessary despite limited available resources are placed between the stationary and mobile nodes. The mobile nodes transfer their current location, service-related requests, and response data, such as environmental sensing values and control requests, by sending messages asynchronously to the stationary node that is in the best communicative position. According to the current location of the mobile node, the stationary node can provide various mobile asset tracking services to the mobile nodes located around the stationary node. By enabling bi-directional communication, unlike that found in RFID ,7, improThe remaining of this paper is organized in the following manner: Section 2 examines related studies. Section 3 describes the overall system architecture for the tracking service and discusses the detailed design, including the protocol, the service network, and the middleware. Section 4 evaluates the system in a realistic test bed. Finally, Section 5 concludes by summarizing our current work and presenting future directions.2.ad-hoc routing table, due to the free-mobility of the mobile nodes [Many researchers –11 have le nodes . As mentResearch is currently being conducted in WSN test beds for various applications. There are many test beds for this, including Kansei , Sensene3.3.1.i.e., the drug boxes, medical devices, and patients, can move around the environment freely.It is assumed that a legacy wireless sensor network, including infrastructures such as stationary nodes, has already been deployed in this environment for environmental sensing and control purposes. In order to support the above scenarios, the overall environment is split into multiple unit spaces, such as a room or a floor. Each stationary node is in charge of a unit space in order to monitor its immediate locale. In addition, the stationary node acts as an access point for communication with the mobile nodes (a mobile node and a mobile asset have the same meaning in this paper and are used interchangeably) located in the unit space and is used for the reference location of each mobile node currently in its domain. As mentioned above, mobile nodes can be attached to physical mobile objects, usually in the form of small tags. The mobile asset tracking service entails all communication between the mobile and stationary nodes as well as between the stationary nodes and a server through gateways. The services can be accessed by smart devices, such as smart phones and smart tablet, by using specially designed and optimized service apps.3.2.The Location-ID eXchange (LIDx) concept was developed in our previous research –20. The The server then updates the information regarding the location of each mobile node. In the LIDx protocol, the overall environment is split into multiple unit spaces, which are divided physically into rooms or floors. Each stationary node is in charge of a unit space and periodically sends a LIDx packet (a beacon packet). The mobile nodes collect these beacon packets and select the nearest stationary node’s ID based on signal strength of the packets. LAMD is an acronym for “LIDx-based Asynchronous Message Delivery”, which is used to exchange asynchronous messages (AMs) amongst mobile nodes through stationary nodes. The protocol can be used to set up active and sleep periods for individual radios in order to obtain longer operating times, as it is critical in WSNs to design devices that consume low amounts of power. Effective use of low data bandwidth is as important as the low power feature. In general, sensor networks support a relatively low data rate compared to other communication systems such as Bluetooth or WLAN. Employing mobile nodes in a sensor network may cause a large amount of traffic and insufficient memory, especially in situations where multiple mobile nodes try to access a single stationary node. The proposed protocol is simple enough to be used in the WSN environment. The stationary node broadcasts LIDx packets, and the packet format can be seen in 3.3.In our architecture, all the location information of mobile nodes is centralized in the server. However, services using this information are not only Mobile Asset Tracking/Monitoring; they include Location-based Mobile Resource Reservation, and Message Delivery between mobile nodes as well, especially as remote services. Therefore, in order to provide location information anywhere, we implemented the middleware to the server for common functionalities such as managing location information of the mobile and stationary nodes as well as transferring AMs among the mobile nodes.When a LAMD message is routed to the server from the source mobile node, the middleware determines the target stationary node that most recently detected the destination mobile node. This means that, all necessary information regarding every stationary node must be specified in the middleware so that the mobile node’s location can be matched to the proposed target location. As As mentioned in the Introduction, the new architecture should support both legacy WSN services and the new mobile asset management service with minimum modifications. Thus, a stationary node requires the stationary-side middleware containing a manage mobility tier and service legacy senor network application. Regardless of new data flow for communication between mobile nodes, legacy WSN applications have to be serviced by the same data flow. As both data flows of the proposed architecture and legacy service share the same MAC layer for communication, the middleware should be located between the MAC layer and Network layer, thereby deciding where the received packet will be transferred to the Network layer or middleware. In conclusion, by inserting the middleware into the sensor nodes, we can reuse the legacy WSN network as a sensor network tier in the proposed architecture.3.4.Transferring AMs are completed with middleware support which determines the target stationary node. 4.4.1.We developed a test bed consisting of 300 mobile nodes, four stationary nodes, four gateways, one server, and one smart tablet in order to evaluate the proposed mobile asset tracking system. The indoor service environment had an area of 50 m × 50 m, and the RF coverage of four stationary nodes was sufficient to cover the entire environment. The smart tablet was used to control the evaluation as well as identify the locations of the mobile nodes. The network stack employed Ethernet for the backbone network tier, ZigBee for the sensor network tier, and the LIDx and LAMD (IEEE 802.15.4 MAC) protocols for the mobility tier. The stationary nodes and mobile nodes used TI CC2430s, which employ an 8051 MCU core and a 2.4 GHz RF transceiver.4.2.We evaluated the successful packet transfer rate and RF input power according to both the changing dBm of the stationary nodes and the distance between the stationary and mobile nodes in the microwave anechoic chamber. 4.3.To evaluate the location-awareness of the mobile nodes, four stationary nodes were deployed equidistantly (5 m) and used for location reference. This evaluation was performed in the microwave anechoic chamber in order to prevent RF interference. 4.4.To evaluate network stability while employing numerous mobile nodes in the proposed system, we conducted an experiment for 6 h in the microwave anechoic chamber using one stationary node and either 100 or 300 mobile nodes. Each mobile node sent 20-byte packets per 10 s to the stationary node; the packets included the sequence number. The server calculated the average successful packet transfer rate as well as the standard deviation by analyzing all packets received from the mobile nodes according to sequence number. The setup for this evaluation is similar to that shown in 4.5.Mobile asset tracking systems must work stably and not fail due to fast moving mobile nodes operating at different speeds. In this experiment, we determined the successful packet transfer rate when mobile nodes moved at different speeds. For this experiment, we needed to secure current speed and keep constant velocity of mobile nodes. Therefore, we decided to use a car as vehicle of mobile nodes because it satisfied our requirements. Moreover, although our research was focused around indoor environments, this experiment reveals that proposed architecture is applicable outdoor as well as indoor.We attached five mobile nodes to a car and GPS used to verify the speeds of the mobile nodes. Four stationary nodes were installed at 30 m intervals on a roadside for communication. Similar to the above experiment, the server calculated the average successful packet transfer rate by analyzing all of the packets received from mobile nodes according to changes in the mobile nodes’ speeds. 5.Here, we presented a mobile asset tracking system architecture and evaluated it thoroughly on a test bed. The proposed network architecture is composed of a mobility tier, a sensor network tier, and a backbone network tier according to their communication properties. For use as a communication protocol between the mobility and sensor network tiers, the LIDx and LAMD protocols were suggested for location-awareness of a massive number of mobile nodes and message deliveries regardless of location, which are hard to provide using legacy WSN techniques such as ZigBee. Middleware was developed for the server to transfer AMs accurately amongst mobile nodes and arbitrate between proposed service and legacy service. The evaluation was carried out in a microwave anechoic chamber and on a straight road near our office. We evaluated the performance of the communications between the mobile and stationary nodes, location-awareness performance, system stability under numerous mobile nodes, and system stability according to mobility of the mobile nodes. The accuracy of location-awareness was higher than 84%. The 300 mobile nodes showed a successful packet transfer rate higher than 95.8% and a standard deviation lower than 2.75%. Upon changing the mobile node speed, the architecture could support average successful packet transfer rates higher than 95% at 5 km/h, 10 km/h, 20 km/h, and 30 km/h. The results show that the proposed architecture is applicable to real-world mobile asset tracking services.In future works, we will develop the middleware to decrease network congestion on the server paths and to support self-organizing services. The middleware also will provide novel features, such as resource discovery and service advertising in a distributed and self-organized manner. In the near future, various mobile asset management services based on WSN technology will play an important role in daily life. It is hoped that the proposed architecture will be used as a core technology for these future services.

The hydroxyl O atom deviates by 0.0247 (15) Å from the plane of the benzene ring. The crystal packing features O—H⋯N hydrogen bonds.In the title adduct, C For a related structure, see: Dong & Cheng 2012. 7H7NO3·C7H10N2CMr = 275.31Monoclinic, a = 11.4923 (9) Åb = 9.8362 (8) Åc = 12.7781 (10) Åβ = 103.870 (5)°V = 1402.3 (2) Å3Z = 4Kα radiationMo −1μ = 0.09 mmT = 293 K0.35 × 0.30 × 0.30 mmBruker SMART APEXII area-detector diffractometerSADABS; Bruker, 2008Tmin = 0.968, Tmax = 0.973Absorption correction: multi-scan (13307 measured reflections3498 independent reflectionsI > 2σ(I)2469 reflections with Rint = 0.028R[F2 > 2σ(F2)] = 0.056wR(F2) = 0.185S = 1.033498 reflections184 parametersH-atom parameters constrainedmax = 0.35 e Å−3Δρmin = −0.27 e Å−3ΔρAPEX2 used to solve structure: SHELXS97 global, I. DOI: Click here for additional data file.10.1107/S1600536812041670/pv2590Isup2.hklStructure factors: contains datablock(s) I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

The current case-control study was conducted to assess the value of activated fibroblasts with high α-smooth muscle actin (α-SMA) expression as an indicator of survival in hepatocellular carcinoma (HCC) patients. In total, 47 patients diagnosed with HCC who underwent a liver biopsy at the Veterans Affairs Medical Center between January 2000 and December 2009, and 10 age- and gender-matched controls with normal liver biopsy samples were included in the study. The immunohistochemical staining for α-SMA was performed and classified qualitatively and quantitatively within tumor stroma and perisinusoidal spaces. HCC patients with high qualitative and quantitative expression of α-SMA revealed a statistically significant negative correlation with 3-year and 1.5-year survival rates in comparison with low expression. The results of the present study demonstrated a predictive role of high qualitative and quantitative expression in activated fibroblasts for poor survival in patients with HCC. Activated fibroblasts or myofibroblasts with α-smooth muscle actin (α-SMA) expression are considered to be the main cellular constituents of reactive stroma in a number of solid tumors . These a, >20 positive cells/hpf following appropriate Institutional Review Board approval. A review of the computerized hospital records was conducted to identify the cases of patients diagnosed with HCC who had undergone a liver biopsy between January 2000 and December 2009. A total of 10 age- and gender-matched cases with no histopathological abnormality on liver biopsy were also identified and used as controls. The clinical information with regard to age and survival period were obtained for all study cases. The immunohistochemical staining for α-SMA was performed on the formalin-fixed, paraffin-embedded tissue sections of all study and control cases. The α-SMA staining in the HSCs within the tumor stroma and perisinusoidal spaces was qualitatively classified into the following 4 groups compared with vascular smooth muscle cells (VSMCs): 0, no staining; +1, staining intensity considerably lower than VSMCs ; +2, staells/hpf . QualitaA total of 47 patients were diagnosed with HCC between January 2000 and December 2009. All the study subjects subsequently succumbed to their condition. The survival period following diagnosis ranged between 1 and 94 months . All the study and control subjects were male. Positive staining for α-SMA in control tissue was mainly observed in VSMCs ; inset aThe interaction of tumor cells with surrounding stromal cells has been recognized to promote tumor development by affecting cell proliferation, survival and invasiveness . As impoThe current study revealed that the detection of α-SMA-expressing fibroblasts in HCC provides valuable prognostic information. As α-SMA is a routinely used and relatively inexpensive immunohistochemical stain, the majority of pathology laboratories efficiently employ α-SMA to predict future survival in HCC patients. The present study also supports the role of α-SMA expressing activated HSCs in promoting carcinogenesis, which is considered to be a possible target for future antitumor therapy in HCC.In the present study, due to lack of follow-up staging information for all the patients, the results were not corrected for stage, metastasis and other factors. Due to this same reason, it was not possible to determine whether α-SMA is predictive of metastasis-related survival or is an independent predictive factor. Multicenter-based large studies with detailed and frequent staging evaluation data, which enables multifactorial analysis, are recommended to improve the present understanding of the role of α-SMA-expressing fibroblasts for predicting poor survival in HCC.In conclusion, the current study demonstrated a predictive role of strong and extensive α-SMA expression in activated fibroblasts for poor survival in HCC patients. Strong expression of α-SMA is an excellent marker to anticipate poor 3-year survival . Qualitative α-SMA expression levels in activated fibroblasts appear to present an improved marker for predicting survival compared with quantitative expression.

Associations between polycyclic aromatic hydrocarbons (PAHs) and colorectal cancer have been reported previously but few studies have characterized PAH exposure using biological measurements. We evaluated colorectal cancer risk in relation to urinary concentration of 1-hydroxypyrene glucuronide (1-OHPG), a polycyclic aromatic hydrocarbon (PAH) metabolite, and assessed determinants of PAH exposure among controls in the Shanghai Women’s Health Study (SWHS).total=652).Concentrations of 1-OHPG were measured in spot urine samples collected from 343 colorectal cancer cases and 343 individually matched controls. Questionnaires were administered to collect information on demographic characteristics and reported exposures. Odds ratios were calculated for risk of colorectal cancer in relation to quartiles of urinary 1-OHPG concentration. Potential determinants of natural log-transformed urinary 1-OHPG concentration were evaluated among a combined sample of controls from this study and another nested case–control study in the SWHS urinary 1-OHPG concentration was 2.01 pmol/mL (0.95-4.09). Active and passive smoking, using coal as a cooking fuel, eating foods that were cooked well done, and recent consumption of fried dough were associated with elevated levels of 1-OHPG, though only active smoking and fried dough consumption achieved statistical significance in multivariate analyses.This study does not provide evidence of an association between urinary levels of 1-OHPG and risk of colorectal cancer among women. Several environmental and dietary sources of PAH exposure were identified. Overall, the levels of 1-OHPG in this population of predominantly non-smoking women were considerably higher than levels typically observed among non-smokers in Europe, North America, and other developed regions. Polycyclic aromatic hydrocarbons (PAHs) are byproducts of incomplete combustion of organic materials. Individuals may be exposed to PAHs through various environmental sources including tobacco smoke, ambient air pollution, and consumption of grilled foods . High leColorectal cancer is the third most common type of incident cancer in the world among both men and women . There iHowever, few studies have evaluated the relationship between PAH exposure biomarkers and risk of colorectal adenoma or colorColorectal cancer cases and matched controls were selected from among participants in the Shanghai Women’s Health Study (SWHS), a prospective cohort of approximately 75,000 women enrolled between 1997 and 2000 . Of the A total of 652 controls from the SWHS cohort were included in the analyses of determinants of urinary 1-OHPG concentration .The design and collection of data and specimens in the SWHS has been described . BrieflySubjects were also asked to provide a spot urine sample, which was kept cold and processed within 6 hours for long-term storage. Another questionnaire was completed at the time of sample collection to obtain additional information about diet, smoking, and medication use within the previous week and the 24-hour period prior to urine collection.Colorectal cancer cases were identified through linkage with the Shanghai Cancer Registry and the Shanghai Vital Statistics Unit records, and in biennial follow-up visits with participants. Information on the date of cancer diagnosis was collected, and diagnoses were verified by reviewing medical charts and diagnostic slides. Incident cases of colon and rectal cancers diagnosed through December 2005 were included in this analysis.Measurements of urinary concentration of 1-OHPG were performed using immunoaffinity chromatography and synchronous fluorescence spectroscopy . Assays The assay limit of detection was 0.1 pmol/mL. For measurements below the limit of detection , a value of 0.05 pmol/mL was assigned.th and 75th percentile measurements in controls. Analyses were performed with and without adjustment for the following covariates: age (years); education level; smoking status; aspirin use; estimated fruit, vegetable, and folate intake; measured body mass index (BMI); and leisure time and occupational physical activity [in metabolic equivalent hours per week (MET-h/wk), as estimated in ref. [th percentile of follow-up time to diagnosis of 5.6 years). We also conducted analyses stratified by tumor location and menopausal status.Conditional logistic regression analyses were performed to estimate odds ratios (ORs) and 95% confidence intervals (CIs) for risk of colorectal cancer in relation to creatinine-adjusted urinary 1-OHPG concentration, which was categorized as quartiles based on the distribution in controls. Statistical tests for trend were performed by modeling the within-category medians as a continuous parameter. We also evaluated colorectal cancer risk in relation to creatinine-adjusted urinary 1-OHPG concentration as a continuous variable; as in previous studies , a one u in ref. . Because in ref. , we used in ref. . SeveralAs secondary analyses, we evaluated urinary 1-OHPG concentration as a dependent variable in relation to selected exposures that were suspected a priori to contribute to PAH exposure. These analyses were conducted among a combined set of control subjects (N=652). Measurements of 1-OHPG concentration were corrected for creatinine concentration, and data were natural log-transformed to achieve a normal distribution. Results are reported as the geometric mean (GM) and 95% CI within each exposure category. Self-reported exposures from the baseline questionnaire that were evaluated included active and passive smoking status, cooking fuel type, cooking ventilation conditions, and food preparation methods. We also evaluated smoking and food preparation methods in the last week and last 24 hours prior to sample collection (as reported on the sample collection questionnaire). Independent t-tests were used to evaluate each variable separately in relation to 1-OHPG concentration. We also performed multivariate analyses for exposures reported on the baseline questionnaire (Model 1) and exposures reported for the last 24 hours on the sample collection questionnaire (Model 2); both models were adjusted for age in years, level of education, measured BMI, and study sample .P-values were < 0.05.All statistical analyses were performed using Stata version 10 . Findings were considered statistically significant if two-sided P = 0.4, paired t-test).Colorectal cancer cases and matched controls were similar in level of education, marital status, fruit and vegetable consumption, BMI, folate intake, and physical activity Table . SmokingNo statistically significant differences in risk of colorectal cancer by creatinine-adjusted 1-OHPG concentration were observed; adjustment for selected covariates did not have any appreciable effect on risk estimates Table . Resultsth-75th percentile) urinary 1-OHPG levels with and without adjustment for creatinine were 0.21 (0.11-0.38) μmol/mol creatinine and 2.01 (0.95-4.09) pmol/mL, respectively. Subjects who reported ever smoking had significantly higher 1-OHPG levels than non-smokers (P = 0.03). We observed a borderline significant association between husband’s smoking status and 1-OHPG concentration; women whose husbands were current smokers had higher levels of 1-OHPG than women whose husbands never smoked (P = 0.05). Results for passive smoking were similar when we restricted to women who never smoked. Mean 1-OHPG levels were approximately twice as high among subjects who reported using coal for cooking at their current residence compared to subjects who used gas or other types of fuel, though this difference did not achieve statistical significance (P = 0.08). Relative to subjects who ever ate stir-fried meats, those who did not had higher 1-OHPG levels; this difference was borderline significant (P = 0.05).The geometric mean (95% CI) of creatinine-adjusted 1-OHPG concentrations by categories of selected exposures from the baseline questionnaire are reported in Table P = 0.03) and the last 24 hours (P = 0.04) prior to sample collection. Subjects who reported eating fried dough (yóutiáo) in the last 24 hours also had significantly higher 1-OHPG levels than subjects who did not eat these foods (P = 0.01). No other notable differences in 1-OHPG concentration in relation to recent exposures were observed.We also evaluated creatinine-adjusted 1-OHPG concentration in relation to reported recent exposures from the sample collection questionnaire Table . SimilarP = 0.01).Results of multivariate analyses of creatinine-adjusted 1-OHPG concentration in relation to selected characteristics from the baseline questionnaire (Model 1) and reported exposures within the last 24 hours from the sample collection questionnaire (Model 2) are shown in Table Results of all analyses of colorectal cancer risk and determinants of 1-OHPG levels were similar when 1-OHPG concentration was not corrected for creatinine and when creatinine was included as a covariate in the statistical model (data not shown). We also performed analyses of colorectal cancer risk in relation to those exposures that were associated with elevated urinary 1-OHPG levels , and no statistically significant associations were observed (not shown).In this nested case–control study among participants in the SWHS, we did not find evidence of an association between urinary concentration of 1-OHPG, an established marker of PAH exposure, and risk of colorectal cancer. There is considerable evidence from both animal and human studies that PAHs and PAH-containing materials are carcinogenic [reviewed in ref. . PotentiIn the present study, we sought to further evaluate the hypothesis that PAH exposure is associated with an increased risk of colorectal cancer using urinary 1-OHPG concentration as a quantitative biological measure of PAH exposure. Very few studies have evaluated colorectal cancer risk in relation to biological markers of PAH exposure. A hospital-based case–control study of colorectal adenoma among non-smoking U.S. residents by Gunter et al. characteAs a secondary analysis, we also evaluated potential determinants of urinary 1-OHPG concentration among 652 control subjects from the SWHS cohort. This sample was comprised of women ages 40 to 70 residing in Shanghai, China, only 4.6% of whom ever smoked cigarettes. In general, the levels of 1-OHPG in this population were considerably higher than what is typically observed among non-smokers in the United States, Europe and Korea, where median levels are approximately 0.3-0.4 pmol/mL ,23. The Results of bivariate and multivariate analyses revealed that active and passive smoking, cooking with coal as a fuel source, eating meat or fish that was cooked until it was “entirely brown”, and recent consumption of fried dough products influenced levels of 1-OHPG. However, only active smoking and recent consumption of fried dough products were associated with statistically significant increases in urinary 1-OHPG concentration after adjustment for other covariates. Active cigarette smoking has been consistently associated with higher urinary levels of 1-OHPG in various populations ,25-27. IDiet, in particular consumption of charbroiled meats, has also been recognized as an important determinant of 1-OHPG concentration . Lee et The large sample size, prospective collection of urine samples, and availability of data on potential confounding factors were strengths of this study. Because samples were collected prospectively and results were similar when cases diagnosed within two years of sample collection were excluded, it is unlikely that early disease processes would have affected 1-OHPG measurements. The availability of prospectively collected data on covariates minimized potential recall bias and allowed us to control for potential confounding factors such as age, BMI, physical activity, and fruit and vegetable intake in our analyses.There were also several limitations in this study. Urine was collected as a spot sample for practical reasons, though the interpretation of urinary creatinine levels used for the correction to ≥24 hour urine output may be problematic. To address this issue, we performed sensitivity analyses without correction for creatinine and with adjustment for creatinine concentration as a covariate in the statistical model; results were similar to what was observed in the main analyses.As with most prospective investigations involving a single pre-diagnostic specimen, it is possible that urinary levels of 1-OHPG may not have reflected long-term PAH exposure status or exposure levels during the etiologically relevant period. In our analyses among controls, we identified associations between several reported sources of exposure from the baseline and sample collection questionnaires and urinary concentration of 1-OHPG, suggesting that 1-OHPG levels may be a reasonable reflection of both usual and recent exposure to PAHs. It should be noted that when we evaluated colorectal cancer risk in relation to these sources of PAH exposure, our findings were similarly null. The median time from urine sample collection until diagnosis of colorectal cancer in this study was 3.8 years; continued follow-up of the cohort may be useful to assess relations between long-term PAH exposure and colorectal cancer risk.Most previous studies of determinants of 1-OHPG concentration have been based on relatively small sample sizes, and the inclusion of a large number of healthy subjects (N = 652) was a strength of the present study. However, despite the large sample size, some of the reported exposures were relatively uncommon in this population. Also, there was somewhat less heterogeneity of 1-OHPG levels relative to other highly exposed populations ,26, whicWe did not find evidence of an association between urinary 1-OHPG levels and colorectal cancer risk in this nested case–control study. Future studies with greater duration of follow-up and characterization of PAH exposure over a longer time period are needed to better understand the role of PAHs in the etiology of colorectal cancer.1-OHPG: 1-hydroxypyrene glucuronide; BMI: Body mass index; CI: Confidence interval; CV: Coefficient of variation; GM: Geometric mean; MET-h/wk: Metabolic equivalent hours per week; OR: Odds ratio; PAH: Polycyclic aromatic hydrocarbon; QC: Quality control; SWHS: Shanghai Women’s Health Study.The authors declare that they have no competing financial interests.JNH conducted the data analysis and drafted the manuscript; LML advised on the statistical analyses and helped draft the manuscript; PTS conducted the assays measuring urinary 1-OHPG levels and provided important intellectual content; XOS, GY, BTJ, HLL, NR, YTG, and WZ oversaw subject recruitment and data collection for the cohort study and provided intellectual input into preparation of the manuscript; FK and WHC conceptualized the study, advised on statistical analyses, and helped draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/13/282/prepub

Kengyilia thoroldiana (Keng) J.L.Yang et al. , collected from different environments, were studied using genome in situ hybridization (GISH). We found that intergenomic rearrangements occurred between the relatively large P genome and the small genomes, St (8.15%) and Y (22.22%), in polyploid species via various types of translocations compared to their diploid progenitors. However, no translocation was found between the relatively small St and Y chromosomes. Environmental factors may affect rearrangements among the three genomes. Chromosome translocations were significantly more frequent in populations from cold alpine and grassland environments than in populations from valley and lake-basin habitats (P<0.05). The relationship between types of chromosome translocations and altitude was significant . Intergenomic rearrangements associated with environmental factors and genetic differentiation of a single basic genome should be considered as equally important genetic processes during species' ecotype evolution.Polyploidization is a major evolutionary process. Approximately 70–75% species of Triticeae (Poaceae) are polyploids, involving 23 genomes. To investigate intergenomic rearrangements after polyploidization of Triticeae species and to determine the effects of environmental factors on them, nine populations of a typical polyploid Triticeae species, Polyploidization is a major evolutionary process that can generate species reproductively isolated from their diploid progenitors. An entirely different trait can result in increased rates of polyploidization and increased evolutionary “success” Chromosome painting , genetic mapping, comparative genetics and sequence analysis have provided evidence for intra- and inter-genomic rearrangements in naturally-occurring and synthetic polyploids For chromosome changes in newly-formed polyploids, NCI is only an internal factor. However, few studies have investigated the correlation between external environmental factors and chromosome changes of polyploids, particularly allopolyploids. Natural allopolyploids provide a model system for studying intergenomic rearrangements of polyploids. Because allopolyploids lack diploid pairing fidelity, recombination may occur ectopically among paralogous or homoeologous sequences, and homoeologous recombination may lead to inter-genomic chromosome rearrangements K. thoroldiana, a natural allopolyploid species of Triticeae. Triticeae is a large taxon with ca. 500 diploid and polyploid species Kengyilia genus in Triticeae is one of the best characterized examples of evolution through polyploidization. It is an allohexaploid that arose from hybridization between a tetraploid and a diploid species, which was subjected to chromosome doubling. The Kengyilia genus, predominantly located on the Tibetan Plateau and adjacent areas to the north, includes the St, P and Y genomes, which are very important evolutionary hotspots in Triticeae. The P genome was thought to be independently inherited, and there was no evidence for gene transfer from it to other genomes GISH permits entire genomes to be visualized and allows intergenomic rearrangements to be identified. It was utilized to investigate intergenomic rearrangements in Genomic changes including intergenomic translocations in resynthesized and natural allopolyploids are common consequences of polyploidization across a wide range of species K. thoroldiana were sampled from Qinghai and Tibet provinces by the Chinese Academy of Agricultural Sciences in 2003. The seeds were collected from individual plants. Fifteen individual plants from one population of K. thoroldiana were randomly selected for this study , Agropyron cristatum , Triticum aestivum L. cv. Chinese Spring and Brachypodium sylvaticum (L.) Beauv., using phenol-chloroform extraction as described by Sharp et al. Pseudoroegneria spicata and Agropyron cristatum were labeled separately with Biotin-Nick-Translation Mix and Dig-Nick-Translation Mix .Total genomic DNAs were extracted from young leaves of B. sylvaticum were added for blocking purposes, and the probe∶blockers (St: Chinese Spring: B. sylvaticum) ratio was 1∶60∶60 according to Wang et al. The two-color GISH method adopted here was described by Nederlof et al. fre is the frequency of individuals including chromosome translocation in one population or in nine populations . CVj is the coefficient of variation of each genotype in one population . The synthetic coefficient of variation (CV) of all genotypes was calculated in every population using the following formula modified from Dong jS equals the standard error of each genotype in a population and TrP value of the two-sample test was one-sided, and that of the correlation was two-sided.The types, numbers and frequencies of St, P and Y chromosome translocations, and CV, were statistically analyzed using Microsoft Excel 2003. Other analyses including two-sample test and correlations were performed using SAS8.0 . The ecological environments from which the nine populations were collected were divided into two groups: cold-alpine and grassland (group 1), and valley and lake-basin habitats (group 2) . The difP = 0.0006; A wide range of St, P and Y chromosome translocations were identified using GISH . The frefre) and synthetic coefficient of variation (CV) were used to characterize the frequency of chromosome translocations and genotype diversity, respectively. Both measures varied greatly inter- and intra-population (fre of population Z2538 was the highest (100%), while the genotype diversity was highest in population Z2633, with CV = 70.33% . A two-sample t-test demonstrated no significant difference between the mean CVs for groups 1 and 2 (P>0.05). Generally, the Trfre of populations located in cold alpine or grassland habitat was higher than that of populations located in a valley or lake-basin grassland and a tetraploid species. The present study demonstrated that rearrangements occurred between the large P genome and small St and Y genomes when the allohexaploid hybridization formed. Also, the St and Y genomes were inherited from the same parent, explaining why there was no translocation between them. The results suggest that intergenomic rearrangements occurred after polyploidization, confirming the origin of the Kengyilia genus previously reported by Yen et al. Genomes were not independent after polyploidization. There were P/Y and P/St intergenomic chromosome translocations, but no St/Y chromosome translocation was found in Agropyron (P genome) to cereals without biotechnology. However, this study indicates that the P genome did not behave independently but was very active and subject to natural rearrangements with other genomes after polyploidization. Such intergenomic rearrangements could lead to the production of reorganized genomes that would not occur in the diploid state, making it more difficult to identify the diploid donors of reorganized genomes in allopolyploid species. The B genome of wheat is thought to be an example of such a reorganized genome New reorganized genomes occur after polyploidization. Dewey K. thoroldiana utilized in this study included an intercalary translocation (The results of this study demonstrate that the terminal regions of chromosomes are more actively involved in rearrangements than centromeric regions. Accordingly, P/St intercalary translocations occurred on terminal regions . Some chlocation , Table 2K. thoroldiana collected from various environments were used to study the correlations between the environmental factors and genome rearrangements in our study. The frequencies and types of chromosomal translocations at the intra- and inter-population levels were varied. Genome rearrangements were more frequent in populations collected from a cold alpine and grassland environment than in populations from a lake-basin or valley (K. thoroldiana in a cold alpine and grassland environment may be more than that in a lake-basin or valley.Nine natural populations of r valley . WeidemaK. thoroldiana is the most advanced group in the phylogeny of the Kengyilia genus, and is distributed in the highest altitude of the Tibetan Plateau region K. thoroldiana, consequently leading to genome rearrangements. This implies a correlation between genome rearrangements and environmental factors. The environment becomes more complex and changeable with altitude, and the interference may become correspondingly stronger. Genome rearrangement was more complex in the populations collected at high altitude than that in populations collected at low altitude in our study. Alternatively, there may be complex genome rearrangements in all nine populations after polyploidization, but individuals showing some types of genome rearrangements could not survive in some environments, while others could survive in a more complex environment. Whatever it was, natural selection plays a role in the establishment and maintenance of genome rearrangement after polyploidization. It has also been suggested that natural selection is the major determinant of both RAPD and allozyme diversities, both being correlated with environmental stress In the present study, it was evident that diverse intergenomic rearrangements occurred due to chromosomal translocations, and there was a correlation between genome rearrangements and environmental factors. Genomes did not behave as independent units after polyploidization. Intergenomic rearrangements associated with environmental factors and genetic differentiation of a single basic genome should be considered as equally important genetic processes during ecotype evolution. The genomes of plateau plants are not only affected by nucleocytoplasmic compatibility, but also by environmental factors. The complex environment could affect genome rearrangement, which facilitates the successful establishment of the newly-formed hybrid. Natural selection plays a role in the establishment and maintenance of new species after polyploidization.

Besides the well-accepted head-to-tail 90° uncharged domain-walls, we have identified not only head-to-head positively charged but also tail-to-tail negatively charged domain-walls. The widths, polarization distributions, and strains across these charged domain-walls are mapped quantitatively at atomic scale, where remarkable difference between these domain-walls is presented. This study is expected to provide fundamental information for understanding numerous novel domain-wall phenomena in ferroelectrics.The atomic-scale structural and electric parameters of the 90° domain-walls in tetragonal ferroelectrics are of technological importance for exploring the ferroelectric switching behaviors and various domain-wall-related novel functions. We have grown epitaxial PbTiO Ferroelectrics possess controllable polar states and electromechanical couplings, they were found extensive applications as high-density memories, thin-film capacitors and actuators as well as sensors1234578910113 TiO3 and Pb(Zr0.52Ti0.48)O3 and weak beam transmission electron microscopy1920212223151617181920212223326Tetragonal ferroelectrics generally exhibit two types of domain-walls: 90° and 180° domain-walls, which have dipoles across the domain-walls arranged as 90° (nearly) and 180° configurations, respectively789101112138101178910113 ref. , then 4–O3 refs. ,1718. Th3/SrTiO3 multilayer films and mapped atomic details and polarization distributions across the 90° domain-walls in an aberration-corrected STEM at high angle annular dark field (HAADF) mode. We have directly observed not only positively charged but also negatively charged 90° domain-walls at atomic scale.The atomic and electronic behaviors of ferroelectrics have become readily accessible through aberration-corrected scanning transmission electron microscopy (STEM)283014323335363/SrTiO3 multilayer films were prepared by pulsed laser deposition (PLD). The films were deposited on GdScO3 (GSO) substrate, which exert tensile strain on the epitaxial PbTiO3/SrTiO3 superlattices3940PbTiO3 (PTO) layer near the PbTiO3/SrTiO3 (PTO/STO) interface. The four insets are magnification of images overlying the respective areas. Yellow cycles denote Pb2+ columns and red cycles denote Ti4+ columns. O2− columns are invisible due to its weak scattering effects of electrons. As illustrated by the schematic diagrams in 4+ and O2− columns are shifted upward towards the upper Pb2+ positions and away from the respective lower ones, but the O2− columns are shifted more strongly. As a consequence, a charge dipole forms in the PTO unit-cell because of the separation of negative (O2−) and positive (Ti4+ and Pb2+) charges, as seen by means of coherent high-resolution imaging with negative Cs techniquePs measured in the atomic resolution HAADF image. A careful inspection reveals that in a = 0.389 nm, c = 0.414 nm, ref. a and c domains , thus domain A is shorter than domain B and C on both sides. This results in a complex strain state near the coherent PTO/STO interface which makes a bending of the STO lattice. The changing of one domain to another gives rise to the switching of polarization vector by 90°. Domain C has the same Ps direction as domain B. The position of these 90° domain-walls (DWs), indicated by the blue dotted lines, can be determined directly by mapping the δTi vectors of each PTO unit-cells. It is of interest to notice that the left 90° domain-wall terminates within the PTO matrix, this scenario is suggestive of some unusual dipole behaviors at the bottom left corner of Ps directions in domain A and B have to encounter each other. Thus, a 90° charged-DW (CDW) is identified, with a ‘head-to-head' arrangement of Ps vectors. Such a 90° CDW is actually a broad area and thus is marked by two white dotted lines , which is generally thought to be the location of 90° DWs in tetragonal ferroelectrics2223Ps vectors are determined by corresponding δTi because the relationship between the δTi and the Ps is well-knowna = 0.5488 nm, ref. A careful observation indicates that, on both structural and electric level, the 90° PCDW is rather wider than the 90° UCDW. According the famous Kittel's law, the DW width is a crucial factor for determining the DW patterns and thus the properties such as nonlinear electro-opticsTi and Ps in area I, across the left white dotted line). Amazingly, the changing of both lattice and polarization is much slowly across the 90° PCDW. From domain B to area I, the out-of-plane lattice (cB) continuously changes from 0.42 nm to 0.395 nm without a sharp jump, while the in-plane lattice (aB) almost kept constant of about 0.39 nm to area I (0) and light red (lower segment near the PTO/STO interface) dotted lines. The 90° NCDW separates domain A and B in Ps directions pointing to left and top, respectively across the 90° UCDWs makes obvious contrast in To directly visualize the 2D structural parameters and ‘U.C.', . The uniPs angles of each unit-cell near the 90° PCDW and 90° NCDW are also mapped , which possess positive charges screening the negative bound charges induced by the 90° NCDW. This inference is constant with our observation because the 90° NCDW is less disturbed compared with the 90° PCDW, and the later probably deserved a depletion layer of Vo2+, which was repulsed by the positive bound charges2+ and electron holes, or negative, such as electrons), only one kind of CDW can be effectively screened423 observation where the DW width was absent from atomic-scale information limited by the AFM tip radius. In tetragonal PbTiO3 films of the present study, the difference between the 90° PCDW (carrier depletion) and NCDW (carrier accumulation) at atomic scale may qualitatively explain the different conduction behaviors between ‘head-to-head' and ‘tail-to-tail' 180° DWs in HoMnO3 (ref. Ps and elastic strain for the 90° DWs is much stronger than the 180° DWs8101148The charge carrier accumulation was hypothesized to be a cause for the increased conductivity at the CDWs in ferroelectrics3nO3 ref. . In addi0.2Ti0.8)O3 thin films formed by in-situ electric responseIn summary, by using aberration-corrected STEM, the unusual frustration of dipole arrangements and strain behaviors of 90° CDWs in PTO/STO multilayer films are identified on the atomic-scale, where the widths, polarization distributions, and strains across these charged domain walls are mapped quantitatively. “Glass-like” dipole behaviors are observed at the 90° CDWs. We anticipate the present atomic-scale investigations of the uncharged and charged 90° DWs may help to interpret the switching behaviors, the newly realized domain-wall functions, and the retention failure mechanism in ferroelectrics. Moreover, the present study is expected to clarify the long-standing argument about the width of the 90° DWs in tetragonal ferroelectrics. During the review stage of this paper, a research group in Michigan University reported an occurrence of 90° charged domain walls in Pb(Zr3/SrTiO3 thin films were deposited on GdScO3 substrates by pulsed laser deposition (PLD), using a Lambda Physik LPX 305i KrF (λ = 248 nm) excimer laser. The PbTiO3 targets were 3 mol% Pb-enriched sintered ceramics. The target-substrate distance was 40 mm. The background pressure was 10−5 Pa. During the growth of PbTiO3, the substrate temperature was kept at 650°C, with a laser energy density of 2 Jcm−2, a laser repetition rate of 5 Hz and under an oxygen pressure of 20 Pa. For the growth of SrTiO3 layers, the substrate temperature was also 650°C, with a laser energy density of 1 Jcm−2, a laser repetition rate of 2 Hz and under an oxygen pressure of 8 Pa. Before deposition, the GdScO3 substrate was pre-heated at 750°C for 5 min to clean the substrate surface and then cooled down to the growth temperature (10°C/min). The laser was focused on the ceramic target for 30 min pre-sputtering to clean the target surface. After deposition, the film was in-situ-annealed at 650°C in an oxygen pressure of 5 × 104 Pa for 10 min, and then cooled down to room temperature at a cooling rate of about 5°C/min. The samples for the STEM experiments were prepared by slicing, gluing, grinding, dimpling, and finally ion milling. A Gatan PIPS was used for the final ion milling.The PbTiO4+ shifts (δTi) were deduced. The atom positions were determined accurately by fitting them as 2D Gaussian peaks by using Matlab143334Ti were calculated as a vector between each Ti4+ and the center of mass of its four nearest A-site neighbor Pb2+. The Ps vectors were deduced by the δTi. The visualization of the 2D Ps vectors fitted with a high-brightness field-emission gun (X-FEG) and double Cs correctors from CEOS, and a monochromator operating at 300 kV). The convergence angle of the electron beam is 25 mrad, yields a probe size of less than 0.10 nm. The determination of the atom coordinates in the HAADF-STEM images were carried out by fast Fourier transform (FFT) filtering the images using only a low-pass annular mask restricted slightly more than the resolution limit of the image, thus the lattice spacing and Ti vectors was carrs angles was carrThe project of interfacial STEM characterization in oxides was conceived by Y.L.Z. and X.L.M.; thin film growth, TEM specimen preparation and STEM observations were performed by Y.L.T.; Y.J.W. participated digital analysis of the HAADF-STEM images; W.Y.W., Y.B.X., W.J.R. and Z.D.Z. have contributions in thin film growth; Y.L.T., Y.L.Z. and X.L.M. jointly interpreted the data and wrote the paper.

While data for preterm children health-related quality of life are available, there are little data on the perception of health-related quality of life evaluation by physicians who manage preterm children, or its use in real life and decision making. The aim of this qualitative study is to highlight among physicians, themes of reflection about health-related quality of life in extremely preterm children (less than 28 weeks’ gestation).Focus groups at a French University Hospital with physicians who manage extremely preterm children: obstetricians, intensive care physicians, neonatal physicians and paediatric neurologists. The focus groups allowed the participants to discuss , three principal topics regarding the health-related quality of life of preterm children: representation, expectations in daily practice and evaluation method.We included fourteen participants in the three focus groups. Many themes emerged from the focus groups: approaches for defining health-related quality of life and difficulties of utilization, the role that health-related quality of life should have in the system of care, the problem of standards and evidence-based decision making. Physicians had difficulties with taking positions regarding this concept. There were no differences by gender, age or seniority, but points of view varied by specialty and type of practice. Physicians who had longer specialized care for extremely preterm children were more sensitive to the impact of preterm complications on health-related quality of life.This study provides preliminary results about physicians’ perspective on the health-related quality of life of extremely preterm children. The themes emerged from the focus groups are classically described in other domains but not all in so clear a way . This approach was never developed in the field of prematurity with well-knowed consequences on quality of life. These results require to be confirmed on a larger representative sample. The themes and questions of this broad opinion survey will rest on the information issued from our preliminary interviews. The consequences for extremely preterm children (EPC) are well known in terms of mortality and morbidity,2. InterIn chronic diseases, the perceptions of physicians of the HRQoL of their patients often differ from those of the patients and their families,12-14. WIt would be relevant to highlight the opinions of perinatology experts regarding EPC HRQoL, and in particular physicians because they are the decision-makers. We report in a preliminary qualitative study the first step of the project. The aim was to produce themes of reflection and identify subjects that would imply study on a larger scale.Eligible participants were experts who manage EPC at the French University Hospital of Marseille, composed of four hospitals. Two of them are involved in the care of very preterm children (level 3 maternities), one in the long term follow up of the children; another hospital is involved in the long term follow up. The participants were defined as follows: more than 18 years old; both genders; having a minimal level of resident practice; involved in the care of the EPC ; having agreed to participate in the study; registered on the list of the staff working in the University Hospital. The participants were selected by drawing lots stratified by the main clinical functions from the list. They were asked to complete a short socio-demographic and clinical characteristics questionnaire.We used the qualitative method of focus groups (FGs) to generate data using the opinions collectively expressed by the participants-20, as iFocus groups were designed to include at least one representative from each specialty. Confounding factors such as age, gender, function and practice were also considered; according to the hospitals, preterm children can be cared in departments of neonatal intensive care units where neonatologists work, and in mixed paediatric and neonatal intensive care departments (newborns and older children) where intensive care physicians work. The FG were organized according to the availability of the participants. A minimum of two FGs was planned, but the number was increased until a saturation of information was reached beyond which no new concepts were emerging from the FGs. Five new participants would be selected from new drawing lots.Focus groups were audio-recorded and moderated by a well trained social psychologist (SC) using a discussion guide with guidelines and open-ended questions. The guide was based on an analysis of the literature and centred on the prioritised themes to be discussed: HRQoL representation, expectations in daily practice, HRQoL evaluation as assessment of the HRQoL of parents (“The QoL of achild can be goodeven if the QoLof his or herparents is not”). This finding does not exclude the value of caregivers’ assessments . Because perceptions are inherently subjective, they can vary significantly; a neonatologist asked if a perception could be more valid than the other one and in which perception to trust. (“What is the truth?”).According to all the participants, the concept of HRQoL encompasses several aspects of life and is influenced by the environment in which we live . It is as a complex concept that can be limited to a consequence of one’s health. Although the definition of HRQoL was not clear according to the participants, a consensus emerged about the impact of health on various aspects of life, with particular importance assigned to family, social and school contexts. Parental evaluation of the HRQoL of children was deemed necessary .Participants were confronted with the difficulty of HRQoL subjective and changing nature .One limitation reported by the participants was related to the interpretation of the quantitative values derived from the questionnaires, that asked the meanings of norms. Moreover, the FGs revealed an interest in conducting assessments measuring different dimensions of HRQoL . According to some neonatologists and the two paediatric neurologists, health-related quality of life evaluation could improve communication among families, children and caregivers, helping families anticipate problems and understand why and in what situations HRQoL can decline.Health-related quality of life seems to be a potential informational tool: along with other factors within the framework of prematurity, HRQoL adds an additional dimension to evaluations of the EPC, especially when parents ask for concrete information about the future of their child said that the QoL concept was sometimes used among “There were no differences by gender, age or seniority, but perspectives varied by specialty and type of practice. Physicians who cared for EPC only during the perinatal period said they did not take HRQoL into account. According to them, this notion is too subjective, depending of many factors and too evolutive to be taken into account. The application of this notion in the emergency perinatal contexts cannot be supposed. Conversely, physicians who provided long-term follow-up care for EPC indicated that considering HRQoL was essential, at the same time to improve the relation of care and the information. The paragraphs below illustrate this.Responses to illness arehighly individual, with difficultyin generalising QoL data”), thus limiting its utilization. Some neonatal physicians explained their hesitation and their difficulty in establishing standards for QoL, which cannot be generalizable. Quality of life could suggest a reflection of “life” and the notion of “quality”:“What is a goodlife?” with the “idea of a judgementthat would depend onthe society in whichwe live”.The vision of the HRQoL concept was slightly inconsistent with the themes discussed among the neonatal physicians. In reflecting on HRQoL, some were certain of its value for improving care and providing information. Others were more reserved, noting that HRQoL changes both over time and between patients Paediatric neurologists and neonatal physicians involved in long-term follow-up were conversely more aware of HRQoL methodology. They were more sensitive to the impact of prematurity on HRQoL both because they followed families more closely and because they were aware of the burden of care and the psychological, social and economic consequences. . HRQoL seemed to appear “dangerous” to some participants . Because they provide care focused on patient survival rather than long-term qualitative outcomes, intensive care physicians believe that HRQoL could not represent a decision-making argument in terms of neonatal resuscitation, raising the issue of the “sacredness of life” versus the “QoL”. Consideration of long-term outcomes was irrelevant to professionals involved in acute perinatal care ,14,24,25All the themes discussed hold considerable interest for the participants. These themes touched many dimensions: QoL as both a theoretical and practical issue, the physicians’ practical experience, that of the value as well as the limits to this type of approach. However, three sub-themes seemed particularly relevant to the group.The first one of them concerns the definition of the quality of life.The FGs’ participants seemed to have embraced the definition of HRQoL given by Eiser and Morse, identifying some key elements such as “subjectivity and multidimensional aspects”. AlthougThe second sub-theme concerns the limits of the use of quality of life concepts.One of the limitations identified by users is that it seems difficult that the construct underlying the QoL is not constant at all ages of life of children and adolescents. The adaptive process relative to these specific periods of life are multiple referring indifferently to complex process of redefinition but also of recalibration of response or reprioritization of domains. The nature of HRQoL must be renegotiated throughout life. TherefoWhy would this “evolutionary” factor be a limitation for subjective measurement and not for objective measurement? One obstacle to using QoL measurement seems to be related to the implicit comparison with a standard or norm (perhaps because of a misunderstanding about the tools of measurement). Obviously, this subject is often reported on by experts who argue for the subjectivity of the measure used. However, in the field of so-called “non-objective” measures, many indicators are used to assess consensual aspects, such as intelligence quotient. Additionally, one might similarly question the value of several of our so-called objective measures, such as neurocognitive assessments, behaviour disorders, children’ size… The standards of certain objective criteria are not without problems. This issue raises the problem of the definition of the standard and its utilization. Canguilhem discussed the individualization of the standard in his criticism of the positivist determination of the normal and the pathological. The “paFinally, the third sub-theme concerns decision-making with respect to QoL.The main question addressed in the FGs was whether HRQoL assessments can assist in evidence-based decision-making. HRQoL seems to have a limited impact on perinatal guidelines. Globally, HRQoL is almost exclusively used as secondary criterion,32,33. WRevue française des affairessociales, 2005, 1: 59–81] and in the report of the National Center of health professions’ demography[There were several limitations to our study. Participants were selected from one geographic region, and their experiences and opinions may not be generalizable. It is recognized in FG research that the recruited sample is not representative of the entire population but is rather a snapshot of those people participating in the study. The premography.Focus groups are used to explore topics on which little research has been conducted and have the advantage of enabling researchers to quickly identify the full range of perspectives held by participants. MoreoveOur original, qualitative study provides preliminary results about physicians’ perspective on the health-related quality of life of extremely preterm children. This approach was never developed in the field of prematurity with well-knowed consequences on QoL. These results require to be confirmed on a larger representative sample including leaders of obstetrics, neonatal medicine, neonatal intensive care units of French University Hospitals as well french paediatrician neurologists. The themes and questions of this broad opinion survey will rest on the information issued from our preliminary interviews.EPC: Extremely preterm children; HRQoL: Health-related quality of life; QoL: Quality of life; FG: Focus group; SC: Sophie Condopoulos; MAE: Marie-Ange Einaudi; MCS: Marie-Claude Simeoni.The authors declare that they have no competing interests.MCS, PA and MAE participated in the conception and design of the study. SC and MAE analyzed the data. PA and MAE participated in the drafting of the article. All the authors contributed to a critical revision of the manuscript and made a substantial contribution to its content, and read and approved the final manuscript.

Lactobacillus paracasei J23. The resting cell medium contained (g/L): Glucose 20, Sodium acetate 5.0, MnSO4 0.25 MgSO4 0.5, Ammoniumhydrogencitrate 1.0, KH2PO4 1.0. The resting cell incubation time and temperature were 20 h and 37 °C and the effects of exogenous factors, including amino acids, glycerol, pyruvic acid, and α-ketoglutaric acid were investigated. Cys and Gly could stimulate the production of bacteriocin, while no stimulus effect was observed for Glu, Tyr and Ala. Glycerol and pyruvic acid increased bacteriocin production and the optimum concentrations were 1% and 30 g/L, respectively. Bacteriocin could act as an inducer of its own biosynthesis. These findings are of importance for the further study of bacteriocin biosynthesis regulation and for the improvement of bacteriocin production yields.A resting cell system was developed for bacteriocin Lac-B23 production from BacteLAB growth and bacteriocin production are strongly influenced by carbon sources, nitrogen sources, growth factors, and other exogenous factors. The traditional technique to optimize the above multivariable system is “one-factor at a time” with growing cultures. It may result in incorrect conclusions since effects on cell growth are not readily differentiated from effects on bacteriocin production. The resting cell technique can eliminate many of the problems associated with studies made on growing cultures. Resting cells are non-proliferating and regarded as a source of enzymes for studies on bacterial metabolism. A resting cell system provides a useful tool for studying the regulation of metabolite synthesis, particularly for the influence of factors on bacterial metabolism. Resting cell technology has been successfully applied in many areas of biotechnology such as optimization of antibiotic production , amino aLactobacillus paracasei J23 isolated from Chinese traditional fermented vegetable juice could produce bacteriocin Lac-B23 with a broad inhibitory spectrum [Lactobacillus paracasei J23, a resting cell system was developed and used to select the exogenous factors affecting production of the LAB bacteriocin. The objectives of this work were to evaluate the effects of the exogenous factors on bacteriocin production, and to identify exogenous inducers able to improve bacteriocin yield.In the previous study, spectrum . In this2.2.1.The component of candidate culture medium for the resting cell system is based on the common MRS medium composition. In previous preliminary studies, the composition of MRS has been optimized in preparation for a resting cell system . Based o#5 culture medium. The results showed that the cells of Lactobacillus paracasei J23 maintained the resting state and did not proliferate in #5 medium. It is also found though Lactobacillus paracasei J23 grew better in #2 medium than in #5 medium, but the antimicrobial activity is the same with that of the #5 medium, which suggested that higher biomass concentration could not necessarily result in higher bacteriocin production.It was observed that the antimicrobial activity was 160U while the nucleic acid content changed little in Lactobacillus paracasei J23 could produce bacteriocin under resting cell state in #5 culture medium. It was indicated that the #5 culture medium met the criteria of a resting cell system based on the high antimicrobial activity and little ΔNucleic acid, and was confirmed as a resting cell system. The optimum culture time and temperature were 20 h and 37 °C has been used to optimize medium components . RSM was2.2.According to previous study about the composition of amino acids in the bacteriocin Lac-B23 , the effLactobacillus paracasei J23. It was speculated that the positive effects of Glu, Tyr and Ala on cell growth could be due to their roles as nitrogen sources or growth factors. In addition, Gly and Cys could promote the bacteriocin Lac-B23 biosynthesis as precursor. The effects of amino acids on nisin and pediocin productions by two lactic acid bacteria have been reported [The results in reported , and the2.3.Glycerol is an important intermediate in the metabolic pathways, which can regulate the organism metabolism. The effects of glycerol on bacteriocin Lac-B23 production were investigated in the established resting cell system .Lactobacillus paracasei J23 kept the resting cell state in the whole process. Therefore, it was reasonable that the improvement of bacteriocin Lac-B23 production was not attributed to the cell growth, and glycerol could be added as positive inducer in bacteriocin Lac-B23 production.It showed that glycerol could promote bacteriocin Lac-B23 production. When the added glycerol concentration is above 1%, the bacteriocin Lac-B23 reached a stationary state. Though glycerol was involved in Embden-Meyerhof-Parnas pathway (EMP) and could be used as energy for cell growth theoretically, the 2.4.Pyruvic acid is regarded as one of the key intermediates in Embden–Meyerhof–Parnas (EMP) pathways and the tricarboxylic acid (TCA) cycle, and play significant roles in protein, peptide and amino acid biosynthesis. The effects of various concentration of pyruvic acid on bacteriocin production were studied in the established resting cell system .Lactobacillus paracasei J23 cells remained in the resting cell state during the fermentation. It was interesting that the pH was observed to decrease from 6.5 to 5.5 quickly. It was assumed that pyruvic acid was used as the precursor to promote the biosynthesis of lactic acid, thus leading to the pH decreased. In our previous study, pH had a significant effect on the bacteriocin production, which was enhanced by the relatively low pH. The optimum pH for bacteriocin Lac-B23 production was 5.5. Therefore, it was thought that the effect of glycerol on bacteriocin Lac-B23 production was indirect. It was indicated that addition of pyruvic acid might initiate the bacteriocin Lac-B23 biosynthesis earlier or extend the effective biosynthesis stage.The results show that pyruvic acid exhibits similar effects as glycerol on bacteriocin Lac-B23 production. The optimum concentration was 30g/L, and the 2.5.It has been reported that bacteriocin biosynthesis can be dependent on the presence of an extracellular peptide of the bacteriocin itself produced by the strain, and that bacteriocin may act as an extracellular regulators of its own biosynthesis ,20. The The results suggested that bacteriocin is able to induce ist own production in a dose- and time-dependent manner. the threshold of induction occurred at 20 U/mL, and temporal effectiveness assessments revealed that Lac-B23 must be added before stationary phase (before 6 h) when it was used as inducer. It is indicated that adding extracellular inducer peptide is necessary to achieve a high level of bacteriocin production. This is in agreement with the report of Kleerebezem . Time-de3.3.1.Lactobacillus paracasei J23, which is the bacteriocin Lac-B23 producer obtained from previous screening efforts, was used in this work. L. monocytogenes was used as the indicator organism in the bacteriocin activity assay.3.2.The antagonistic activity was measured by the well-diffusion method. Bacteriocin sample were serially diluted two-fold, and the reciprocal of the highest inhibitory dilution was used to express the arbitrary activity units (AU) per milliliter. In order to eliminate the inhibition of lactic acid on the test organisms, the tested supernatants were adjusted to pH 6.0 with 1 M NaOH and treated with catalase (1 mg/mL) to exclude the inhibition due to hydrogen peroxide production.3.3.Lactobacillus paracasei J23 culture and incubated at 37 °C for 24 h. The antagonistic activity, nucleic acid content (NAC) and dried cell weight (DCW) of Lactobacillus paracasei J23 were examined. The culture medium was confirmed as the resting cell system based on the strong antimicrobial activity, and little change in nucleic acid content. The effect of time and temperature on Lac-B23 production in the resting cell system was investigated at 25, 30, 37 °C for 24 h, respectively. The cell concentration was assayed with a spectrophotometer at 600 nm.Five different culture media was assayed with spectrophotometer. ΔNucleic acid (g/L) was measured as the difference of nucleic acid content between before and after resting cultures.The 3.5.v/v, 0.5%, 1.0%, 1.5%, 2.0%), pyruvic acid were added to the resting cell system for the examination of the effects on the bacteriocin production, respectively. Values are expressed as mean value and standard deviation of triplicate determinations.The effects of amino acids , glycerol, and pyruvic acid on bacteriocin production were investigated by using the established resting cell system. The above five amino acids , glycerol (3.6.The added dose (5 U/mL to 40 U/mL) and added time (0–12 h) of bacteriocin Lac-B23 as self-inducer were investigated in the established resting cell system.3.7.One-way ANOVA was applied to the result of technological properties. All experiments were performed 3 times, and the values are expressed as mean value and standard deviation of triplicate determinations. The SPSS software package was used for this purpose.4.A resting cell system was developed and proved to be a useful tool in screening the exogenous factors on bacteriocin Lac-B23 production. It is possible to enhance yield of bacteriocin Lac-B23 by adding Cys, Gly, Glycerol, pyruvic acid and Lac-B23 itself. These findings are of importance for the further study of bacteriocin biosynthesis regulation and the improvement of bacteriocin yields. In addition, this report could advocate an interest again for the use of resting cell techniques in the areas of regulation and optimization of bacteriocin production.

Increases in chronic illness due to sedentary lifestyles and poor metabolic fitness have led to numerous intervention strategies to promote physical activity (PA). This paper describes the methodological strategies of two short-term PA interventions. Outcome measures reported are PA adherence and compliance rates during the intervention and at 3, 6 and 12-month follow-up.The 40-day interventions were: a pedometer-based walking program (n = 251) and a group-based intensive program (n = 148). There was also an active control group (n = 135). Intervention subjects were prescribed PA each day and required to record all activity sessions (pedometer steps or energy expenditure from heart rate monitors).Compliance (≥ 150 min/wk PA) was highest post-intervention and then progressively decreased across the 12-month follow-up period although they remained significantly higher than pre-intervention rates (zero %). There was significantly higher adherence to 6 months (75.0% and 64.9%), and compliance to 3 months (64.9% and 51.0%), for group versus pedometer subjects. The active control group maintained the highest adherence and compliance rates across the study.The group-based program resulted in higher adherence and compliance rates post-intervention although both types of interventions showed long-term effectiveness to increase activity patterns. Rapid and pervasive technological developments of the 20th century have influenced the way humans spend their time ,2. TheseAn enormous variety of interventions have been conducted around the world. Many have been summarized in systematic reviews and meta-analyses -11. OverOther studies have also examined various types of interventions to help identify the strategies most likely to be successful ,10,12-16There are literally hundreds of possible design features reported which make it problematic to disentangle the specific elements that are important for successful change. A recent Cochrane review found some PA interventions were moderately effective, but there was a need to establish which methods worked best in the long term (including their composition) and among different types of people .Understanding the theoretical basis of interventions is also important in order to tease out the contributions of a range of mediating variables, subject characteristics and other mechanisms for changing behaviours. There are three predominant theoretical approaches in PA interventions: (1) information-based approaches, such as the health belief model, under the expectation that, once educated, participants will make healthier choices, (2) apprDespite the enormous global effort to promote PA there still remains a high proportion of adults who fail to meet current international PA guidelines for optimal health benefits -23. FurtThis paper details the theoretical rationale and design strategy for two short-term intensive interventions (40-DAY PA study). One intervention arm is broadly based on a health-belief model while the other takes a more socio-ecological approach. PA adherence and compliance rates, and a range of health-related measures were tracked during the interventions and at 3, 6 and 12-month post-intervention. The study adds to the literature because it quantifies in detail physical activity patterns within each of two large intervention cohorts including intensity, type, duration and frequency of exercise habits. It facilitates a comparison of two intervention approaches to effect PA and sedentary behaviours over the longer-term and how these are related to both fitness and health-related changes.The 40-DAY PA study was a randomised controlled intervention trial designed to increase PA levels of insufficiently active adults. The study involved two intervention arms and an active control group. The intervention subjects were randomised to one of two 40-day activity programs and subjects were followed for 12 months post intervention. Outcome measures included PA patterns and health and fitness-related parameters (reported in a separate paper).Two types of intervention were used: (1) a limited contact, information-oriented, pedometer-based strategy that was based on the health-belief model, and (2) an intensive, structured, group-based strategy using a multi-layered socio-ecological approach.The University ethics committee approved this study and all subjects gave informed written consent. A total of 553 subjects aged 18-60 yr enrolled using the following selection criteria:• 'insufficiently active' according to the Active Australia Survey (AAS) criteria (< 150 min of weighted PA per week) to be part of the intervention arms; • willing to either (a) wear a pedometer daily for the duration of the 40-day intervention or (b) participate in the 40-day group PA program, or (c) act as controls if they were regularly sufficiently active (averaged ≥ 150 minutes of weighted PA/week for at least the past 12-months)http://sma.org.au/wp-content/uploads/2009/05/new_pre_screening.pdf)• satisfy the pre-exercise screening guidelines using Sports Medicine Australia's screening system or pedometer (n = 157) intervention arm using computer-generated numbers. Allocation concealment was achieved pre-intervention by having the randomisation process conducted after health and fitness testing. It was not possible to conceal the subject's intervention group during the intervention given the nature of the PA. There were an additional 96 subjects who could not attend the group intervention classes (for various reasons) but were otherwise willing to participate in the study. There were no differences in the age, gender or physical activity patterns between the randomised versus non-randomised subjects either pre or post intervention.A number of theoretical components were incorporated in this study for both intervention arms. The primary intra-personal components addressed were self-efficacy , and ouInter-personal and cultural factors were incorporated into both programs, including strategies to make exercise more enjoyable using individual challenges and motivational music , and socTable Other behaviour modification strategies used in this study involved PA monitoring using either pedometers and diaries (pedometer subjects), or heart rate monitors and diaries (group-based subjects). This introduced elements of expectation and personal attention in the knowledge the sessions were checked for compliance . Goal seSix intervention groups were recruited throughout the year to encompass a range of seasons. Each group participated in one 40-day PA program. Morning and early-evening sessions were offered to the group subjects in April (autumn), July (winter) and September (spring). The pedometer interventions were run at the same time periods as the group interventions.Subjects in both intervention groups attended an education session prior to the intervention commencing. They received information on the health benefits of regular PA, national PA recommendations , 10,000 Pedometer subjects were equipped with a pedometer for the 40-DAY PA program. Pedometer subjects were emailed walking maps and approximate step counts throughout the local regions to encourage variety and to help set challenges. In the first week of the intervention subjects were instructed to achieve at least 5,000 steps/day. The step count was gradually increased by 1,000 steps/wk to 10,000 by week six. A weekly email was sent to pedometer subjects outlining the step count goal for the week and tips to increase walking activity. It is a methodology used in numerous interventions and summaries of step increases show changes are typically within the range 1,500-2,500 steps per day following similar interventions ,33. The The group intervention combined elements that have been shown to be important for long-term behavioural change. The program was based primarily on self-efficacy theory proposing that confidence in one's ability to perform activity is strongly related to actually performing that behaviour . FurtherThe intervention educated and motivated with a focus on energy expenditure through activity augmented by the immediacy and security of heart rate monitoring . Individual day (self administered) activities were included and these were also monitored via the heart rate recordings and downloaded each week.The group-based intervention was designed to promote links between the workplace and the community to allow participants to experience new ways to be active . The reqThe intervention was designed to decrease potential for boredom and residual soreness in previously insufficiently active subjects by regularly rotating muscle groups and body areas used in activities. The group intervention involved a range of progressively scheduled activities including body awareness routines, walking, core stability/flexibility sessions, aerobic circuits, team-building challenges, and modified sports and games.The fitness instructors provided leadership, instruction, feedback and guidance during the critical early phase of beginning new activities when many people drop out of PA programs . Group iAll sessions included a 10 min warm-up and a 10 min cool-down/stretching period. Most sessions lasted 60 min and the core involved subjects working at about 60-80% of estimated HRmax. Session intensity was determined on the basis of average HR measurement using the entire session. HR monitors were individually programmed according to the manufacturer's recommendations .The controls were physically active beyond the recommended 150 min/wk of moderate activity. The rationale for using active controls was primarily based on the knowledge that being insufficiently active is among the leading causes of premature death and disability . In longStatistical analysis was performed using SPSS software. Analysis of variance (ANOVA) and t-tests were used for between-group comparisons. Non-parametric analyses such as Kruskal-Wallis were used for variables such as skewed PA and sedentary behaviour data and Chi square to determine patterns of adherence and compliance. Adherence was defined as the continuation of the subjects in the study and quantified as the number of subjects returning for laboratory testing. Compliance was calculated in two ways - both using intention to treat (ITT) analysis: (1) during the intervention it involved achieving the prescribed daily activity, either the step count for the pedometer subjects or a minimum of 30 min of recorded activity for the group subjects specifically for week-by-week within-group analysis, and (2) across the entire study it was also calculated as the proportion of subjects achieving ≥ 150 min PA/wk at test time using the AAS for between-group comparisons.Of the 692 subjects who underwent pre-exercise screening there were 27 (3.9%) at stage 1 and a further 32 (4.6%) at stage 2 who were recommended to seek medical clearance. Medical clearance was given for 57 of 59 subjects. Further medical follow-up was required for the remaining 2 subjects and exercise was contraindicated.The subject characteristics for those starting the program are shown in Table Daily compliance during the intervention was calculated from diaries for the pedometer subjects and from HR monitor files for the group subjects Figure . OverallFigure The average exercise intensities for group sessions and individual days are shown in Figure Figure During the ~15,300 person-hr of activity for the intervention subjects there were 13 reports of musculo-skeletal injuries resulting in withdrawal from the project during the intervention phase. There were no adverse cardiovascular, metabolic or respiratory events despite a significant increase in vigorous PA reported by 79% of the intervention subjects (mostly group subjects) at the post-intervention testing. No difference in the rate of injury was found between the two intervention arms.The intervention arms of the study utilised two different theoretical approaches, both designed to increase PA levels of insufficiently active adults. The results showed significant differences in the patterns of PA during and following the intervention phases of the study.The first theoretical approach was a health information-based pedometer program.The second approach was a group intervention. This involved a layered PA promotion strategy broadly based on the socio-ecological model of behaviour change. There were several common features of the two intervention arms (including those listed above) although there were some key differences as outlined in Table The different PA patterns between the more-layered group approach and the 'usual-treatment' pedometer program were significant to 6-months for adherence and 3-months for compliance (≥ 150 min PA/wk). In other words, there were intervention-specific characteristics that led to more subjects remaining in the program for longer and to a greater likelihood of those subjects reaching PA levels considered sufficient for health benefits both during and after the intervention. There were numerous additional strategies superimposed on the group intervention relative to the pedometer arm making it difficult to pin-point any one element leading to the increased group adherence and compliance. What is consistent is that group interventions have previously been found to result in better adherence than home-based or individual programs . ExercisA 40-day intervention duration was chosen to allow time for physiological improvements so participants could experience first hand new levels of fitness and energy. This has also been shown to be a critical time when those new to PA often undertake exercise inappropriately, become sore or disillusioned through unrealistic expectations or are concerned and confused about how to be active . FollowiInitial PA levels for the intervention subjects were low with a median of 71 min of weighted PA per week. In both intervention arms the proportion of subjects reaching and maintaining sufficient levels of PA was significantly higher than pre-intervention and remained this way throughout the 12-month follow-up . This highlights the successes that can be achieved even with relatively low initial interaction among the pedometer subjects. Interestingly, there was a drop in the proportion of active controls who maintained sufficient levels of PA across the 12-month follow-up. Communication with the non-adherers indicated several were injured, one was pregnant, six had moved away and others were unwilling or unable to continue. Among those returning for testing about 5% of 'regular' exercisers fluctuated above and below recommended levels of activity. Nonetheless, the active controls as a group were clearly able to maintain very high levels of activity and proved stable as a reference group for health benefits.It has been suggested that PA intervention studies should report elements such as injury rates among participants . These dFinally, subjects from all groups commented on the reinforcing value of the periodic health and fitness checks which may have played a role in encouraging adherence among subjects from all groups.per se had less influence on PA behaviour as when the same equipment was used among the group subjects there were clear differences in PA behaviours between the group-led and individual sessions.The subjects ranged widely from students, health professionals, academics, public servants, cleaners etc; mapping of residency codes indicated a predominance of subjects living in the top 40% of the most advantaged metropolitan areas . This faMost authors recognise the importance of robust research to add clarity to the evidence-base for PA interventions that can effect behavioural change. The large cohorts of insufficiently active adults in both short-term interventions showed significant increases in PA patterns to 12-months post intervention. The subjects exposed to a range of elements within the group-based intervention demonstrated significantly higher adherence and compliance rates relative to the pedometer program following the intervention phase.Getting people to change their behaviour, and to sustain healthy behaviours for extended periods of time, is always difficult. This paper details two types of exercise prescription strategies. Both show substantial longer-term results that would be significant for public health if translated to a population level.40-DAY PA: 40-day Physical Activity Study; AAS: Active Australia Survey; ANOVA: Analysis of variance; EE: Energy expenditure; HR: Heart rate; HRmax: Heart rate maximum; ITT: Intention to treat; PA: Physical activity.The authors declare that they have no competing interests.LHN & KIN conceived of the study and participated in the study design and coordination, collected the data, performed the statistical analysis and drafted the manuscript. NL participated in the study coordination, supervised the research group, participated in data acquisition and helped draft the manuscript. JD assisted in the study design. All authors read and approved the final manuscript.KIN is a professor of Exercise Science at the University of South Australia, he received an Australian Research Council linkage grant to undertake the 40-DAY PA study in conjunction with the South Australian Department of Health.LHN is a lecturer in health promotion at Flinders University, the 40-DAY PA study was the principle intervention for her PhD.NL was the project manager throughout the 40-DAY PA studyJD is a senior lecturer in exercise physiology at the University of South Australia.

Poecilia have independently colonized toxic, hydrogen sulfide-rich springs. Even though ecological speciation processes are increasingly well understood in this system, aligning the taxonomy of these fish with evolutionary processes has lagged behind. While some sulfide spring populations are classified as ecotypes of Poecilia mexicana, others, like P. sulphuraria, have been described as highly endemic species. Our study particularly focused on elucidating the taxonomy of the long described sulfide spring endemic, Poecilia thermalis Steindachner 1863, and investigates if similar evolutionary patterns of phenotypic trait divergence and reproductive isolation are present as observed in other sulfidic species of Poecilia. We applied a geometric morphometric approach to assess body shape similarity to other sulfidic and non-sulfidic fish of the genus Poecilia. We also conducted phylogenetic and population genetic analyses to establish the phylogenetic relationships of P. thermalis and used a population genetic approach to determine levels of gene flow among Poecilia from sulfidic and non-sulfidic sites. Our results indicate that P. thermalis' body shape has evolved in convergence with other sulfide spring populations in the genus. Phylogenetic analyses placed P. thermalis as most closely related to one population of P. sulphuraria, and population genetic analyses demonstrated that P. thermalis is genetically isolated from both P. mexicana ecotypes and P. sulphuraria. Based on these findings, we make taxonomic recommendations for P. thermalis. Overall, our study verifies the role of hydrogen sulfide as a main factor shaping convergent, phenotypic evolution and the emergence of reproductive isolation between Poecilia populations residing in adjacent sulfidic and non-sulfidic environments.The process of ecological speciation drives the evolution of locally adapted and reproductively isolated populations in response to divergent natural selection. In Southern Mexico, several lineages of the freshwater fish species of the genus Divergent natural selection, often mediated by environmental variation, is a key driver of phenotypic evolution. Its effects can lead to the emergence of locally adapted populations that exhibit unique traits and occupy habitats with distinct combinations of environmental factors Historically, taxonomists catalogued species solely based on morphological trait variation without considering the underlying mechanisms contributing to phenotypic variation and speciation. Darwin Poecilia, which is part of the livebearer family Poeciliidae, represents an excellent example of the difficulties in aligning evolutionary processes and taxonomy. Poecilia is a diverse group of freshwater fish species that are distributed from the southeastern United States and Middle America to parts of South America and the Greater Antilles P. sphenops (short fin molly) species group, which occurs from northern Mexico to Venezuela The genus Poecilia thermalis Steindachner 1863 P. mexicana in non-sulfidic environments within the same drainage and are characterized by morphological, physiological, behavioral, and life history adaptations that show strong signals of convergent evolution across drainages P. mexicana despite clear morphological differences and strong reproductive isolation, while sulfide spring residents in the Pichucalco drainage have been described as a distinct species, Poecilia sulphurariaHere, we attempt to clarify the status of one such long described species, ner 1863 , which hner 1863 . The spePoecilia thermalis to examine whether it shows similar evolutionary patterns as other sulfidic populations in the region and to shed light on its taxonomy. Specifically, we used morphological, phylogenetic, and population genetic approaches to address three major questions: (1) How do specimens from the type locality of Poecilia thermalis phenotypically compare to other Poecilia populations from sulfidic and non-sulfidic spring habitats in the region? Using a geometric morphometric approach, we tested for potential morphological convergence between P. thermalis and other sulfide spring fish in southern Mexico. We also explored the similarity of body shape between historical samples of P. thermalisP. thermalis from the type locality. (2) What is the phylogenetic relationship of P. thermalis to other mollies? Based on mitochondrial and nuclear markers from a broad taxonomic sampling of Poecilia, we elucidated the phylogenetic position of P. thermalis. We were particularly interested in determining whether the species represents a unique sulfide-adapted lineage within Poecilia. (3) Is P. thermalis genetically isolated from adjacent Poecilia populations? Sulfide spring populations of Poecilia consistently exhibit a high degree of reproductive isolation from non-sulfidic populations despite the small spatial distance and a lack of migratory barriers P. thermalis and P. sulphuraria, and P. mexicana populations from adjacent non-sulfidic habitats.Consequently, this study investigated the re-discovered sulfide spring species Poecilia sulphuraria) and CONAPESCA (DGOPA.09004.041111.3088 for Poecilia sp.). Details about the selection of focal populations are given below for each section separately.All procedures conducted for this study were approved by the Institutional Animal Care and Use Committee at Oklahoma State University (ACUP: AS10-15) and permits issued by the Municipio de Tacotalpa-Tabasco (DFET/23/2011), as well as the Mexican Federal Agencies SEMARNAT (SGPA/DGVS/04315/11 for 2S) in the sulfidic springs is a result of a nearby, active volcano, El Chinchón, and bacterial activity 2S, the sulfidic spring environments differ from non-sulfidic habitats in a variety of environmental factors, including reduced oxygen concentration, structural habitat differences, reduced species richness, and reduced photoautotrophic primary production Our study area lies in the foothills of the Sierra Madre de Chiapas in the northeastern part of the state of Chiapas, where the mountains meet the wide floodplains of the state of Tabasco. Here, four tributaries of the Río Grijalva, the Tacotalpa, Puyacatengo, Ixtapangajoya, and Pichucalco (from east to west), provide a system of naturally replicated non-sulfidic and adjacent sulfidic habitats see . The preP. thermalis at ‘La Esperanza’ has not been resampled since Heller's expedition. Exploration of the general area in May and June of 2012 revealed not one, but two proximate sulfide springs, a larger one (site 7) and a smaller one (site 8) separated by a freshwater tributary (site 9) of the Río Ixtapangajoya : sulfide concentration: 216±38 μM; dissolved oxygen: 1.31±0.39 mg/l; pH: 6.9±0.0; specific conductivity: 4.132±0.083 mS/cm; temperature: 28.7±0.9°C. The smaller spring represents a group of lower discharge springs in a swampy area with dense reeds. The site is merely a shallow pool (about 15×20 m) with a narrow outflow that – at least during our visit at the end of the dry season – eventually disappeared into pasture grounds . Here, we measured the following water parameters : sulfide concentration: 41±3 μM; dissolved oxygen: 1.67±0.21 mg/l; pH, 7.0±0.1; specific conductivity: 2.979±0.071 mS/cm; temperature: 27.2±0.3°C. Overall, the physiochemical conditions in the two La Esperanza springs aligned well with data collected over multiple years in sulfide springs of other drainages While abiotic environmental parameters of other sites investigated here have been published in detail before angajoya . Based oAll specimens for this study were collected using seines, euthanized with buffered MS222 immediately after capture, and fixed in a 10% formaldehyde solution for geometric morphometric analyses. All specimens are housed in the Department of Zoology, Oklahoma State University. In addition, we took fin clips that were preserved in 95% ethanol and stored at 4°C for molecular analyses.Poecilia species. Our sampling included the southern subspecies of P. mexicana mexicana from a variety of non-sulfidic habitats in all drainages, sulfidic ecotypes of P. m. mexicana in the Tacotalpa and Puyacatengo drainages as well as the previously described sulfide spring endemics P. thermalis (Ixtapangajoya drainage) and P. sulphuraria . We also calculated the relative variance as the partial variance for a given term divided by the maximum partial variance value in a model 2S present or not), drainage, and site (nested within the H2S × drainage interaction) as well as all interaction terms as independent variables. Centroid size was included in the models as a covariate to control for multivariate allometry.The weight matrices obtained from the geometric morphometric analyses were first subjected to principal components analyses (PCA) using a covariance matrix to reduce data dimensionality. We retained 9 PC axes with an eigenvalue greater than 1 for the lateral dataset (explaining >95% of variation) and 8 PC axes for the dorsal dataset (explaining >96% of variation). Individual PC axis scores were used as dependent variables in multivariate analyses of covariance (MANCOVA). Assumptions of multivariate normal error and homogeneity of variances and co-variances were met for all analyses performed. Poecilia occurs was analyzed for this study. Shape variation along the first two PC axes and along the sulfide/non-sulfide divergence axes was visualized with thin-plate spline transformation grids using tpsRegr Since random nested factors are not applicable for MANCOVAs, and the use of fixed effects can inflate type I error rates when nested terms are significant, we also analyzed shape variation using a mixed-model nested analysis of covariance (ANCOVA) Poecilia populations relative to each other, including information from both the lateral and the dorsal projection, weight matrices for both projections were combined and subjected to a principal components analysis, from which we retained 14 axes with an Eigenvalue >1. Population-specific estimated marginal means for each axis were calculated using a MANCOVA model as detailed above and used to create a dissimilarity matrix that was subjected to a hierarchical cluster analysis using the neighbor-joining algorithm To fully examine the multidimensional affinities of different P. thermalis collected in 1848 by Heller clustered with specimens we collected from the two La Esperanza springs in 2012. To do so, lateral photographs were taken from the available syntypes in the collection of the Natural History Museum in Vienna (N = 18), and we digitized the same lateral landmarks as for all other specimens. We compared the museum specimens to the samples obtained from the two La Esperanza sulfide springs, the two most proximate non-sulfidic locations in the same drainage (tributary to Río Ixtapangajoya and Río Ixtapangajoya proper), and – given the phylogenetic affinity of P. thermalis to P. sulphuraria (see below) – to the specimens obtained from the Baños del Azufre and La Gloria sulfide springs. Landmark coordinates from said collections were aligned separately. The weight matrix was then subjected to PCA, and the effects of sex and allometry removed from the dataset by using the residuals of a preparatory MANCOVA, in which the principal component scores were used as dependent variables, centroid size as a covariate, and sex as an independent variable. We then conducted a discriminant function analysis (DFA) to elucidate whether museum specimens were classified to the Esperanza sulfide springs based on body shape data. We used a cross-validation technique where discriminant functions were generated based on the data of contemporary samples (training data), and classification probabilities of museum specimens (testing data) to any of the six populations were calculated based on the established functions.Finally, we tested whether the type specimens of P. thermalis, we sequenced a set of genes in specimens from select non-sulfidic and sulfidic habitats included in the morphometric analyses and more distant groups in the genus Poecilia . The distantly related species Cnesterodon decemmaculatus and C. hypselurus were used as outgroups to root phylogenetic trees. A complete list of all taxa examined, along with locality information and GenBank Accession numbers, is provided in Supplementary Table S1 in To establish the phylogenetic relationships of b gene with LA and HA primers The total genomic DNA was extracted from ethanol-preserved fin clips with the DNeasy Blood & Tissue Kit following the manufacturer's protocol. The samples were amplified for several presumably neutral genes commonly used for phylogenetic reconstruction in fishes. Focal genes included the mitochondrial cytochrome We tested for incongruence between mitochondrial (mtDNA) and nuclear (nDNA) markers to determine evidence of introgression. Given the agreement between both datasets (data not shown), we used a concatenated dataset for further analyses. We used MrModeltest version 2.3 For maximum likelihood (ML) analyses, we used RAxML GUI version 1.0 Bayesian analyses were run twice independently in MrBayes version 3.2.1 P. thermalis, samples for population genetic analyses included two proximate non-sulfidic sites within the Ixtapangajoya drainage to test for gene flow between adjacent populations from sulfidic and non-sulfidic waters. Given the phylogenetic clustering of P. thermalis with P. sulphuraria from the Pichucalco drainage (see below), we also included both known P. sulphuraria populations as well as adjacent P. mexicana samples from that drainage into our analyses . Microsatellites were amplified with the Type-it Microsatellite PCR kit from Qiagen . The PCR protocol included an initial denaturation step for 5∶00 min at 95°C, 30 cycles of 1∶30 min at 60°C, and 0∶30 min at 72°C, followed by a final extension step for 30∶00 min at 60°C. The 5 µl reaction mix included 2.5 µl Type-it master mix, 0.4 µl primer mix, 0.4 µl Q-solution, 0.9 µl RNase-free water, and 0.8 µl template DNA. PCR products were analyzed on a CEQ2000 sequencer (Beckman) Coulter; denaturation at 90°C for 2 min, injection at 2.0 kV for 30 s, separation at 6.0 kV for 45 min) along with the manufacturer's internal size standard. Samples were screened using Genome Lab GeTX 10.2 software (Beckman Coulter) and alleles were called manually.FST-values between all population pairs and conducted a Principal Component Analysis (PCA) to further examine genetic distinctiveness between populations using GenAlEx 6.5 We employed the software STRUCTURE 2.3.4 N = 1099 individuals), body shape varied in the position of the anal fin along PC axis 1 and the head size along PC axis 2 . All other factors and the interaction terms also had significant effects on body shape, but only ‘centroid size’, ‘drainage’, ‘site’, and the interaction of ‘H2S × drainage’ explained an appreciable amount of variation , analyses revealed that body shape particularly varied in head length and width, mouth width, and body width at the insertion of the pelvic fins , which exhibited an intermediate morphology clearly grouped the 18 type specimens, for which we were able to obtain lateral body shape data, with contemporary sulfide spring samples, not with proximate non-sulfidic samples. Nonetheless, only 72.2% of samples were assigned to the large La Esperanza spring and Baños del Azufre (11.1%). It should be noted at this point that the sample size for historical specimens was relatively low, such that within population variation in body shape may be underestimated. The examination of additional syntypes, which were not available at the time of our study, consequently could lead to a lower overall classification success.Finally, the DFA and the P. mexicana clade with an average genetic divergence of 6.7%. Phylogenetic analyses strongly (100% BSS and 100% BPP) indicate that P. mexicana, P. sulphuraria, and P. thermalis represent a monophyletic group. However, we did not find P. sulphuraria to be monophyletic, as P. thermalis is most closely related to the P. sulphuraria from the Baños de Azufre population, a relationship that is highly supported . Genetic divergence between P. thermalis and this population of P. sulphuraria was generally low (0.1%) and only slightly less than the divergence to the La Gloria population and P. thermalis together formed one genetic cluster that was distinct from all P. mexicana populations – i.e., the second most likely level of population structure according to Evanno et al. K = 7. In addition to detecting population genetic structure within and between drainages in P. mexicana a clear separation between P. thermalis and P. sulphuraria (s.l.) became apparent as well as between populations within each species . Further support for genetic differentiation between the two species was obtained from the individual-based PCA of the two populations of the sulfidic spring endemic P. sulphurariaP. thermalis and P. m. mexicana from adjacent non-sulfidic habitats or P. sulphuraria from sulfidic springs in the Pichucalco drainage, respectively, indicating an independent evolutionary trajectory of P. thermalis.The re-discovered species, 2S , i.e., they skim the water from the air-water interface (with higher dissolved oxygen concentrations) using their gills P. thermalis. Most importantly, specimens collected by Heller in 1848 mostly grouped with samples from our 2012 survey, suggesting we have visited the locality described in Heller's autobiography P. thermalis to exhibit a typical sulfide spring body shape and to be phenotypically similar to P. sulphuraria. Qualitatively, this is also the case for color patterns and lateral lip appendages on the lower jaw , which are mentioned in the species description of P. sulphurariaP. sulphuraria (s. l.), as specimens from the La Gloria population do not exhibit this morphological trait P. thermalis to P. sulphuraria (as compared to sulfidic and non-sulfidic populations of P. mexicana), our analyses indicated significant differences in body shape between the two species both in the lateral and dorsal projection.Our morphological analyses also provided critical insights about the rediscovered P. thermalis collected in both La Esperanza springs (Ixtapangajoya drainage) to be sister to P. sulphuraria from the Baños del Azufre population , which together were sister to P. sulphuraria from La Gloria and formed a monophyletic group. This group was more closely related to the northern Mexican subspecies of P. m. limantouri than the southern P. m. mexicana populations from adjacent non-sulfidic sites, corroborating earlier investigations P. m. limatouri-like ancestor shared by P. thermalis and P. sulphuraria occurred earlier than sulfide spring colonization by P. m. mexicana in the other drainages. This is reflected in higher genetic divergences between sulfide spring and adjacent non-sulfidic populations in the Ixtapangajoya and Pichucalco drainages compared to the Puyacatengo and Tacotalpa drainages with standing genetic variation for traits adaptive to sulfidic springs. Such a scenario was recently supported in stickleback, where low rates of gene flow from freshwater to marine populations maintain freshwater alleles in the marine environments at low frequency, such that selection upon colonization of a new freshwater system can rapidly reassemble freshwater ecotypes based on allelic variants already present in the ancestral population P. m. limantouri is required to elucidate historical patterns of sulfide spring colonization in the Ixtapangajoya and Puyacatengo drainages. Nonetheless, our data indicate that sulfide spring colonization may not have occurred independently in different drainages, adding an additional layer of complexity in the analysis of speciation patterns in sulfidic spring fishes.Our results indicate that sulfide springs in the Pichucalco and the Ixtapangajoya drainages were not colonized independently, but rather P. sulphuraria and P. thermalis) and non-sulfidic (P. mexicana) environments irrespective of the drainage of origin. As such, the results generally support previously uncovered patterns of strong reproductive isolation between sulfide spring residents and fish from adjacent non-sulfidic sections of the same drainage K = 7 divergent clusters. At this finer scale, the two P. thermalis populations from the Ixtapangajoya drainage were clearly distinct from the two P. sulphuraria populations in the adjacent Pichucalco drainage, reflecting the absence of gene flow due to the lack of contemporary connections between the two drainages.Our population genetic analyses largely supported the phylogeny in that the uppermost level of population differentiation included two clusters distinguishing between populations in sulfidic and the Pichucalco (P. sulphuraria) could be considered as derivatives from the same evolutionary lineage and therefore considered the same species. In this case, the older names takes precedence P. sulphurariaP. thermalis. Alternatively, P. thermalis could be designated as a valid, distinct species restricted to the Ixtapangajoya drainage, which would require the name P. sulphuraria to be restricted to the type locality (Baños del Azufre) and the sulfide spring population at La Gloria (currently a population of P. sulphuraria) to be considered a distinct species awaiting formal description. This interpretation is supported by reciprocal monophyly, significant population genetic differentiation as evident from FST values and principal components analysis, and significant differences in body shape among all three groups. Examination of additional characters, especially meristic traits and the structure of the male copulatory organ (gonopodium), commonly used in poeciliid systematics will hopefully lead to the resolution of the taxonomic conundrum surrounding P. thermalis.The taxonomic history of P. sulphuraria is listed as threatened and federally protected by the Mexican government P. thermalis or as three distinct species in the future, they clearly represent unique evolutionary lineages with highly restricted distributions meriting separate management and a high priority for conservation Regardless of the taxonomic conclusions, our study has direct implications for the conservation of the sulfide spring populations in the Ixtapangajoya and Pichucalco drainages. Currently, Overall, this study confirms the role of hydrogen sulfide in shaping convergent, phenotypic evolution in sulfide spring fishes and causing reproductive isolation between populations residing in proximate sulfidic and non-sulfidic environments. It also illustrates how an integrative, mechanistic approach to studying phenotypic evolution and speciation can inform taxonomy.File S1(PDF)Click here for additional data file.

Francisella tularensis, is a severe, sometimes fatal disease. Interest in tularemia has increased over the last decade due to its history as a biological weapon. In particular, development of novel vaccines directed at protecting against pneumonic tularemia has been an important goal. Previous work has demonstrated that, when delivered at very high inoculums, administration of live, highly attenuated strains of virulent F. tularensis can protect against tularemia. However, lower vaccinating inoculums did not offer similar immunity. One concern of using live vaccines is that the host may develop mild tularemia in response to infection and use of high inoculums may contribute to this issue. Thus, generation of a live vaccine that can efficiently protect against tularemia when delivered in low numbers, e.g. <100 organisms, may address this concern. Herein we describe the ability of three defined, attenuated mutants of F. tularensis SchuS4, deleted for FTT0369c, FTT1676, or FTT0369c and FTT1676, respectively, to engender protective immunity against tularemia when delivered at concentrations of approximately 50 or fewer bacteria. Attenuated strains for use as vaccines were selected by their inability to efficiently replicate in macrophages in vitro and impaired replication and dissemination in vivo. Although all strains were defective for replication in vitro within macrophages, protective efficacy of each attenuated mutant was correlated with their ability to modestly replicate and disseminate in the host. Finally, we demonstrate the parenteral vaccination with these strains offered superior protection against pneumonic tularemia than intranasal vaccination. Together our data provides proof of principle that low dose attenuated vaccines may be a viable goal in development of novel vaccines directed against tularemia.Tularemia, caused by the Gram-negative bacterium Francisella tularensis is a Gram-negative, facultative intracellular, bacterium, whose species includes subspecies tularensis , subspecies holarctica , and subspecies mediasiatica. While subspecies tularensis is considered highly virulent for humans holarctica can cause disease in humans that is not typically lethal mediasiatica is considered avirulent in humans F. novicida species is avirulent in the immunocompetent host F. philomiragia is considered avirulent in humans Following inoculation by a variety of routes, both Type B and Type A subspecies can cause the disease coined tularemia. There are several forms of tularemia, dependent on the route by which the host was exposed to organism. Among these, pneumonic tularemia mediated by Type A subspecies is widely considered the most dangerous. This is, in part, due to the small numbers of organisms required to cause disease, e.g. 15–20 bacteria http://www.cdc.gov/tularemia/statistics/state.html). This interest stems from development and use of virulent F. tularensis as a biological weapon during the mid 20th century F. tularensis, there is renewed effort to develop novel vaccines that effectively protect against tularemia, especially the pneumonic form.Although there are only approximately 100 cases of tularemia per year in the United States and the incidence worldwide is largely unknown, interest in tularemia has increased over the past 10 years . The in-frame single gene deletion mutants SchuS4ΔFTT0369c and SchuS4ΔFTT1676 have been described previously 5′-GCTTGAGGGTGCATTAG-3′) and JC615 (5′-GGTATCTCAGGAGGTGTG-3′) and primers JC610 (5′-GCGAGATCTGGCTCGCTACGCTGTGACTGCCAAG-3′) and JC613 (5′-GCGGTCGACGGTGTGTCTAGATGTGCTC-3′), respectively in vivo infection were propagated as previously described 2, MgCl2, 0.1% glucose, 0.025% ferric pyrophosphate and 2% Medium Enrichment ) at 37°C with constant shaking overnight, aliquoted into 1 ml samples, frozen at −80°C and thawed just prior to use as previously described Bacteria used for ad libitum. All experiments with animals were conducted following approved protocols and under the guidance of the ACUC at Rocky Mountain Laboratories. Following infection with the indicated strains of SchuS4, all animals were regularly monitored for signs of illness. When signs of impending mortality were observed, animals were immediately euthanized.Female C57Bl/6J and Balb/c mice 6–8 weeks of age were purchased from Jackson Laboratories . Groups of 5–10 mice were used in each experiment as indicated. Mice were housed in BSL-2 and BSL-3 containment facilities at the Rocky Mountain Laboratories and provided with food and water 2, in 1 g/L glucose Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum , 10% L929-conditioned medium, and 2 mM L-glutamine (cDMEM) in non-tissue culture-treated Petri dishes. After 5 days, loosely adherent BMMs were washed with PBS, harvested by incubation in chilled cation-free PBS supplemented with 1 g/L D-glucose on ice for 10 min, resuspended in complete medium and replated in 24-well cell culture-treated plates at a density of 1×105 macrophages/well. BMMs were further incubated at 37°C under 7% CO2 atmosphere for 48 h, replenishing with complete medium 24 h before infection.Bone marrow derived macrophages (BMMs) were propagated from C57Bl/6J mice as previously described 2 atmosphere including an initial, rapid warm-up in a 37°C water bath to synchronize bacterial uptake. Infected BMMs were then washed 5 times with DMEM to remove extracellular bacteria, incubated for 40 min in complete medium, and then for an additional 60 min in cDMEM containing 100 µg/ml gentamicin to kill extracellular bacteria. Thereafter infected BMMs were incubated in gentamicin-free medium until processing.For infections, bacteria grown on MMH agar plates for 3 days were resuspended in MMH broth, diluted in complete medium and 0.5 ml were added to chilled BMMs at an appropriate multiplicity of infection (MOI). Bacteria were centrifuged onto macrophages at 400× g for 10 min at 4°C, and infected BMMs incubated for 20 min at 37°C under 7% CO5/well) were infected as described above, washed 3 times with sterile PBS then lysed with 1 ml of sterile deionized water for 3 min at room temperature, followed by repeated pipetting to complete lysis. Serial dilutions of the lysates were immediately plated onto MMH agar plates. Plates were incubated for 3 days at 37°C under 7% CO2 before enumeration of colony forming units (CFUs). The number of viable intracellular bacteria per well was determined in triplicate for each condition and at least 2 independent experiments were performed.To quantify intracellular colony forming units (CFUs), BMMs or intradermally (50 CFU) infected with 2 for 48–72 hours and individual colonies were enumerated.Bacterial loads in target organs were determined as previously described Significance in survival between groups was determined using Mantel-Cox (log-rank) analysis with significance set at p<0.05. Significant difference in bacterial numbers in tissues among groups of animals was determined using one way ANOVA followed by Bonferroni's post-test with significance set at p<0.05. LD50 was determined using the Spearman-Karber method Francisella tularensisin vivo, we sought to examine whether inoculation with these mutants resulted in productive infection or if the mutant strains were immediately eradicated at the site of infection. Mice were infected intradermally or intranasally with a target inoculum of 50 or 10 CFU, respectively. Consistent with our previous observations Numerous studies have established the importance of intracellular proliferation in the virulence of various subspecies and strains of We next assessed bacterial replication and dissemination from the site of infection to peripheral organs. Following intradermal infection, replication of both ΔFTT0369c and ΔFTT1676 was detected in the ear tissue. As expected, numbers of ΔFTT0369c and ΔFTT1676 retrieved from the ear were significantly less than those found in animals infected with wild type SchuS4 . SimilarWe also assessed replication and dissemination following intranasal infection. Similar to intradermal infection, significantly fewer bacteria were retrieved from the lungs of mice infected with either ΔFTT0369c or ΔFTT1676 compared to animals infected with wild type SchuS4 on day 3 and 4 of infection . DissemiWe next determined if animals exposed to low doses of either ΔFTT0369c or ΔFTT1676 mutants that survived and cleared infection were protected against secondary challenge with wild type SchuS4. Previous studies have shown that intranasal immunization offers superior protection compared to parenteral routes, intradermal or subcutaneous We next assessed protection in mice that were first challenged with attenuated strains of SchuS4 intradermally. Regardless of the route of challenge with wild type SchuS4, more animals that were challenged intradermally with attenuated strains of SchuS4 survived infection compared to those that received attenuated SchuS4 intranasally . Specifiin vivo, but would still engender protection against infection with wild type SchuS4. To this end, we generated a double deletion mutant of both FTT0369c and FTT1676 loci and evaluated its ability to infect macrophages and replicate intracellularly in vitro. Compared to the parental SchuS4 strain, which grew by 3 orders of magnitude within BMMs over a 24 h time frame, intracellular viable numbers of the double mutant SchuS4ΔFTT0369cΔFTT1676 did not significantly increase during the first 16 h pi, and even decreased afterwards, similar to both single deletion mutants caused a lethal infection in 20% of inoculated mice . Thus, w mutants . The dou mutants .in vivo. All mice survived low dose infection with ΔFTT0369cΔFTT1676 regardless of the route of inoculation of wild type SchuS4 successfully protected all mice from secondary parenteral infection with wild type SchuS4, but failed to protect more than 14% of animals against pneumonic tularemia Several laboratories have reported success in generating defined Type A F. tularensis offered greater protection against challenge with wild type strains compared to earlier reports. First, vaccination with bacteria deleted of the gene encoding a hypothetical lipoprotein (FTT1103) successfully protected against intranasal challenge of wild type F. tularensis SchuS4 F. tularensis ΔFTT0918ΔclpB could protect approximately 40% of Balb/c mice from aerosol infection with fully virulent SchuS4 4 CFU of SchuS4ΔFTT0369c did not succumb to disease following infection and were readily protected against a low dose intranasal challenge with wild type SchuS4. This suggests that a fairly wide range of vaccinating doses may be used to establish equivalent protection. In contrast, others have had to use anywhere from 105–108 CFU of attenuated SchuS4 strains to achieve similar protection There are two examples in which immunization with attenuated Type A F. tularensis mutants in which effective protection following intranasal infection with SchuS4 was observed in mice vaccinated subcutaneously et al in which intranasal immunization with LVS provoked fewer protective IFN-γ producing T cells compared to subcutaneous immunization Interestingly, unlike other studies, vaccination via the same route as infection with wild type SchuS4 was not required to generate protective immunity. Rather, intradermal vaccination with any of the three mutants elicited a superior protection against both intradermal and intranasal challenge with SchuS4 compared to animals that received attenuated strains via the intranasal route . Thus, oF. tularensis, presumably to allow full unveiling of protective antigens. Absence of bacterial replication might explain lack of development of effective memory immunity in studies in which killed bacteria were used as the vaccinating agent in vitro. However, all three mutants exhibited similarly impaired intracellular replication within macrophages in vitro (in vivo. While both ΔFTT0369c and ΔFTT1676 bacteria exhibited similar replication at the site of infection (lung or ear) and dissemination to and replication in peripheral organs other cell types or extracellular compartments likely support bacterial proliferation.Importantly, our data also suggests that replication deficiency in macrophages in vivo, these results may suggest that the way in which the mutants interacted with the immune system was different. Previously, it has been shown that wild type strains of F. tularensis potently suppress both inflammation and developing T cell responses. For example, we and others have observed that SchuS4 readily inhibits recruitment of inflammatory cells and production of cytokines associated with protective T cell response, e.g. IL-12 Francisella infection can result in degradation of both Major Histocompatibility Complex II (MHCII) and CD86 on the surface of antigen presenting cells Francisella. Therefore, it is possible that the increased protective efficacy observed in mice immunized with ΔFTT0369c bacteria was partly due to the inability of this mutant to effectively inhibit inflammatory and/or T cell responses. In support of this hypothesis, we have recently shown that ΔFTT0369c induced secretion of IL-12p40 from primary dendritic cells, whereas infection with wild type SchuS4 failed to do so When comparing protective efficacy of the single mutants used in this study there was little difference between the strains when immunization occurred via the intradermal route. However, following intranasal vaccination, significantly more animals that were first exposed to ΔFTT0369c bacteria survived intranasal challenge with wild type organism compared to mice immunized with the ΔFTT1676 strain. Since both bacteria had similar patterns of replication and dissemination F. tularensis subspecies can protect against challenge with virulent homologous strains. Furthermore, our results support previous work suggesting screening of mutants in multiple cell types for competence in replication may be necessary for predicting virulence and/or protective efficacy in vivo. Finally, these defined attenuated mutants of SchuS4 may also be useful in defining the role of specific host molecule, e.g. IL-12, or pathways that are required for survival of tularemia.Together our data provide proof of principle that delivery of low doses of live, attenuated vaccine derived from fully virulent Type A