Datasets:

hatakeyama-llm-team

/

PMC

like 0

Previous reports indicate altered metabolism and enzyme kinetics for various organisms, as well as changes of neuronal functions and behaviour of higher animals, when they were exposed to specific combinations of weak static and alternating low frequency electromagnetic fields. Field strengths and frequencies, as well as properties of involved ions were related by a linear equation, known as the formula of ion cyclotron resonance . Under certain conditions already a aqueous solution of the amino acid and neurotransmitter glutamate shows this effect.An aqueous solution of glutamate was exposed to a combination of a static magnetic field of 40 μT and a sinusoidal electromagnetic magnetic field (EMF) with variable frequency (2–7 Hz) and an amplitude of 50 nT. The electric conductivity and dielectric properties of the solution were investigated by voltammetric techniques in combination with non linear dielectric spectroscopy (NLDS), which allow the examination of the dielectric properties of macromolecules and molecular aggregates in water. The experiments target to elucidate the biological relevance of the observed EMF effect on molecular level.An ion cyclotron resonance (ICR) effect of glutamate previously reported by the Fesenko laboratory 1998 could be confirmed. Frequency resolution of the sample currents was possible by NLDS techniques. The spectrum peaks when the conditions for ion cyclotron resonance (ICR) of glutamate are matched. Furthermore, the NLDS spectra are different under ICR- and non-ICR conditions: NLDS measurements with rising control voltages from 100–1100 mV show different courses of the intensities of the low order harmonics, which could possibly indicate "intensity windows". Furthermore, the observed magnetic field effects are pH dependent with a narrow optimum around pH 2.85.Data will be discussed in the context with recent published models for the interaction of weak EMF with biological matter including ICR. A medical and health relevant aspect of such sensitive effects might be given insofar, because electromagnetic conditions for it occur at many occasions in our electromagnetic all day environment, concerning ion involvement of different biochemical pathways. A possible influence on life processes was already mentioned in the late 19 century , singlet century , and the century .et al. [B of the static component and the frequency f of the alternating EMF relate to the "ion cyclotron resonance (ICR) formula":Ferromagnetism has been implicated in animal navigation distort the field. This induces alternating voltages over and currents through the solution, which are detected by 2 auxiliary electrodes in order to avoid polarisation effects. Phase shifts and distortions of the obtained signals, as compared to the input signal, contain information on damping and relaxation kinetics. Therefore, the signals are y domain -24. Usuasample is the signal output intensity of the nth harmonic from the sample measuring channel, and U(n)ref the corresponding value from the reference channel.Where U(n)et al. [Zhadin et al. reportedet al. . By recoAll preparations were performed with doubly de-ionized water. The solutions were degassed and stored under Argon, in order to avoid oxidation of the solute and increased electrode fouling during the subsequent measurements. An acidic solution of 2.24 mM Glu was adjusted to pH = 2.85 ± 0.03 with a stock solution of 5 mM HCl. Equilibration was assumed, when the pH varied less than ± 0.03 for at least one minute. All procedures were performed at 20°C. For yielding a reference signal, an aqueous solution of HCl was provided by diluting the HCl stock solution with water to pH = 2.85. All solutions were stored at 4°C under Argon.1, E2) consisting each of 4 gold wires with a diameter of 0.25 mm, mounted parallel at a distance of 2 mm on a teflon frame. The required sample volume was 1 ml. These electrode carriers are mounted on a stable socket for electric connection and mechanical adjustment (not shown). The cuvettes are enclosed by a hermetically sealable plastic tank (T) with a copper bottom, which is filled at a height of 2 cm around the cuvettes with water for thermal coupling to an outer temperature controlled water bath. The setup is kept under Ar atmosphere throughout the experiment. Thermic control (20 ± 0.1 °C) of the cuvettes is provided by a water thermostat with a sequential home built temperature fine controller, ensuring highly stable working conditions for the electrodes. Once assembled, these components form a mechanically stable unit, with in- and outlets for gas and samples by small teflon hoses (not shown). The assembly is placed in the center of a solenoid (S), consisting of two cylindrical coils with a inner diameter of 16 cm and a height of 7 cm for applying the vertically orientated EMF (B). The coil for the static field component consisted of 300 turns of coated copper wire (diameter 0.5 mm), the other coil was winded above and had 50 turns.The experimental arrangement for differential non-linear dielectric spectroscopy (DNLDS) is shown in Figure For electric and magnetic shielding the complete setup resides in a grounded double-walled Permalloy box with a total wall thickness of 1 mm. A overall inhomogeneity ≤ 0.3 % of the generated fields was determined inside the box with a triaxial CXM539 magnetometer over the cuvette locations. For coil calibration the relation of field strength to coil current could be ascertained directly in measurement series with the magnetometer for 0.1–100 μT, showing a overall deviation from linearity ≤ 0.2 % (DC and AC), so currents corresponding to even lower field strengths were obtained by extrapolation.Signal processing was mostly done as previously described . Figure et al. [et al. [2 (0.5 M in water) in a ultrasonic bath , and finally rinsed with de-ionized water (<2 μS). This treatment resulted in amplitude deviations ≤ 5% over an experimental session of up to 2 h. If electrodes were not used for DC measurements, but for NLDS, they were additionally coated with a thin polymer film in order to improve noise reduction and stability [For cleaning, the electrodes were first treated with chromosulfuric acid for 1 h at room temperature and intensively rinsed with de-ionized water. This procedure was repeated approximately once per week. An improved long-term electric stability was obtained by slight modifications of the treatments described by Woodward et al. and Yard [et al. : The eletability .2 from the solutions, avoid oxidation reactions and subsequent arising of reactive oxygen species (ROS) in the solute, then the hoses were sealed with rubber caps. After reaching a stable temperature of 20 ± 0.2°C, measurements were started. First 10 "dummy" scans were performed, in order to obtain a dynamic equilibration of the electrodes. dc B= 40 μT was selected as static magnetic field component for the ICR condition, because it is of comparable intensity as the natural geomagnetic field of the earth. A new sample was used for every experiment, an "aging effect" of the test solutions was observed, similar to an earlier seen effect, which resulted in a decreasing reproducibility for experiments with magnetic field exposed lipid vesicles [The cuvettes could be charged with the test solutions, discharged and rinsed through the teflon hoses by a syringe. A sample volume of 1 ml was used. Device specific, systematic errors were routinely checked by exchanging the electrode arrays used for sample and reference measurements and testing several cuvettes of the same type. After loading they were flooded with Argon for about 10 min. in order to remove Ovesicles .Three types of techniques for measuring the electric currents in the solutions were applied, always using the gold electrode array described above:et al. [dc B= 40 μT or 50 μT and a frequency sweep of the alternating magnetic field ac B= 50 nT from 2 to 7 Hz with 0.025 Hz/s and a resolution of 0.05 Hz were used.1) For the validation of the ICR parameters of the Glu-HCl solution, the experiment of Zhadin et al. was repeet al. , superimdc B= 40 μT was used.2) For the investigation of the ICR transition with NLDS the same magnetic field setup is used like described under 1), the NLDS sine wave was applied on the electrodes (instead of the DC-voltage) and a constant magnetic field dc B= 40 μT and ac B= 50 nT, 4.14 Hz fixed), for reference experiments only the static component (dc B= 40 μT) was applied with dc Bswitched off. The amplitude of the sinusoidal scanning voltage was increased in each experiment from 100–1100 mV in steps of 10 mV, record by record, the duration of each cycle was 4 s. The two data sets (from Glu-HCl and HCl sample) yielded by every single record were seperately Fourier transformed in order to get the spectra, these two spectra were divided by themselves (Glu-HCL spectrum by HCl spectrum) and the ratio spectrum was subsequently attached to a data file on a harddisc for later evaluation.3) Finally the FRV setup allowed the frequency analysis of the electric signals with variable amplitudes using the DNLDS technique described above. Glu-HCl samples were exposed to constant ICR conditions . Subsequently, the pH-dependence was determined under identical magnetic field and scanning conditions mentioned above. Resonance effects are only seen in a narrow pH range of Glu-HCl (pH 2.75 – 2.90), with an maximum at 2.85, and vanishes outside this range.Applying a constant magnetic field of n et al. , and theet al. [After this verification of the experiment of Zhadin et al. , these edc B= 40 μT (no acB). A voltage range of 100–1000 mV was selected to allow a comparison with the voltammetric information out of the frequency resolved voltammetry (FRV). Again, maxima of conductivity were obtained, they lie at 250 ± 10 mV for Glu-HCl and 280 ± 10 mV for water/HCl pH 2.85 (data not shown).Further some DC voltage scans were performed with the gold electrode array for Glu at pH 2.85, and for dilute HCl adjusted to pH 2.85, applying only a static magnetic field dc B= 40 μT and a ac Bwith f = 4.15 Hz). 15 experiments were performed and averaged. Figure nd harmonic . The full dataset is shown in Figure st harmonic is split up into 2 closely spaced peaks around the ICR frequency. This is also well seen in Figure Next, the solutions were investigated by NLDS spectroscopy, in order to investigate in which way the frequency composition of the current spectra will change, when the predicted ICR condition for Glu-HCl is matched were normalized to ± 1, and all 12 experiments were averaged, Figure 100 DNLDS spectra were recorded with single 2 Hz sinus signals with 100 mV amplitude. t + 0.5015). The course seems to reach a new steady value after on/off switching of the alternating magnetic field with a time delay, which seems larger, when ICR is switched off. The average current change after the switching processes is -0.2 nA/s, the negative values result from comparison with a reference.Changes of the signal intensity become obvious, when switching the alternating magnetic field on or off. Over the entire experiment there seems to be a constant drift which we take as an indication for irreversible processes. This drift is indicated by the dotted line, which results from a linear regression of the entire dataset (-0.0039dc B= 40 μT), but not acB. Each of the two groups of experiments were averaged separately. Then the two resulting datasets were subtracted . This differential dataset had a total amplitude of 2.03 ± 0.38 dB, presenting just the contribution of Glu, because the voltammetric background from HCl was subtracted.Finally, the FVR method should show the intensity distributions of the harmonics of the DNLDS spectra and their dependence from the used amplitude of the electrode input voltage. Again Glu-at pH = 2.85 was investigated, using diluted HCl (pH 2.85) as the reference. The ratio of the resulting two NLDS power spectra was calculated according to equation (2), resulting in a logarithmic DNLDS spectrum. 101 such scans (4 s each) were performed for every single experiment, during which the amplitude of the applied course of 4 periods of a 2 Hz sine voltage increased from 100 to 1100 mV in 10 mV steps. Corresponding datapoints of the successive single DNLDS spectra generated one AC voltammogram each, for the respective frequency. Altogether, a set of 201 frequency resolved voltamogramms was obtained, because every spectrum contains 201 data values. Subsequently 20 such experiments were performed in which the solution was exposed to ICR conditions, alternating with 20 experiments, were only the static field was applied frequency of the ions. Interactions of the internal electric and external magnetic field could probably cause side band modulations. They are probably responsible for the seen splitting up of the ICR resonance peak with variable amplitudes. Two explanations for this effect would be possible. The additional electric field caused by the AC signal of the NLDS could modulate the charged particles inside a "quantum box", whatever will be the reason for its existence. An indication for such a mechanism could be the more or less ordered local maxima of conductivity in spectral as well as in the voltammetric domain of the data. But the frequency dependent conductivity band shifts of the FRV experiments Figure could eik figure when usiFor progressed investigation of the observed effects some additional properties of the electric charge environment of the Glu ion should be known. The isoelectric point of Glu is at pH 3.22, the pK of the α-COOH-group is 2.19, that of the β-COOH at 4.25, the small optimum for the EMF effect around pH 2.85 does not coincide with any of these points. The Debye-Hueckel radii for Glu are about 5 nm, they determine the free ion movement, and influence consequently the current. Moreover, they could be responsible for a proper fit of the spatial ion distribution to the environing structure whatever, which enables a resonant EMF effect.The results strengthen the idea, that weak electromagnetic fields can cause an resonance effect on molecular or even supramolecular scale in electrolyte solutions ,35, and In general any kind of a suitable coherence mechanism should be essential for the observed effects in a dense medium like water, which had to support an energy gap against the thermal fluctuations of the environment, and enable a movement of charged particles which are only magnetically coupled to their outer environment. Not at least, the high sensitivity of the ICR to weak electromagnetic fields should be regarded. It makes the modulation of biological processes by the weak EMF of our everyday environment conceivable , possiblThe geomagnetic field, with all its anomalies and regional differences , in combEMF: (low frequency) electromagnetic fieldICR: ion cyclotron resonanceNLDS: non linear dielectric spectroscopyDNLDS: differential non linear dielectric spectroscopy.FRV: frequency resolved voltammetryGlu-HCl: A glutamate solution adjusted to pH 2.85 with hydrochloric acid (HCl).The author itself carried out all experiments and drafted the manuscript.

Neurogenic Para-Osteo-Arthropathy (NPOA) occurs as a consequence of central nervous system injuries or some systemic conditions. They are characterized by bone formation around the main joints.In order to define some biological features of NPOAs, histological and immunohistological studies of the soft tissue surrounding osteoma and Ultrasound examination (US) of NPOA before the appearance of abnormal ossification on plain radiographs were performed.We have observed a great number of ossifying areas scattered in soft tissues. US examination have also shown scattered ossifying areas at the early stage of ossification. A high osteogenic activity was detected in these tissues and all the stages of the endochondral process were observed. Mesenchymal cells undergo chondrocytic differentiation to further terminal maturation with hypertrophy, which sustains mineralization followed by endochondral ossification process.We suggest that periosteoma soft tissue reflect early stage of osteoma formation and could be a model to study the mechanism of osteoma formation and we propose a mechanism of the NPOA formation in which sympathetic dystony and altered mechanical loading induce changes which could be responsible for the cascade of cellular events leading to cartilage and bone formation. Neurogenic Para Osteo-Arthropathies (NPOA) occurs in patients with brain or spinal cord injury, hemiplegias, various encephalopathies, tetanus or neuroThe first clinical manifestations are local inflammatory signs, tumefaction and progressively limited range of motion of the involved joint region. Those appear between the second and tenth weeks after the onset of the pathological condition . DespiteAs shown by radiographic and scintigraphic observations, heterotopic bone formation evolves from an early appearance of soft tissue densification and attenuation of the muscle signal to a mineral signal . After 6Very little is known about the pathophysiology of NPOA formation. Assuming such a freezing of the process of NPOA formation and an involvement of the periosteoma tissues in the reported relapses following surgery, we postulated that the periosteoma soft tissues could show some of the very early stages of the NPOA formation. We performed histological, histochemical and immunohistochemical studies of soft tissues dissected from the periphery of osteomas. We used samples of varying age lesions and searched for the main osteogenic and chondrogenic markers: alkaline phosphatase (ALP) activity, type I collagen and osteocalcin (OCN) for the bone -13, and The 28 specimens were obtained from 27 patients undergoing orthopedic surgery for osteoma excision. NPOA's were localized on: elbows (7), hips (18) and knees (3). The time from the neurologic insult ranged from 5 months to 216 months. The initial conditions were: 11 Brain Injuries (BI), 3 Spinal Cord Injury (SCI), 1 BI plus SCI, 4 strokes, and 9 patients sustained coma of various etiology .Specimens obtained during the course of surgery, referred to in this paper as "osteoma", were immediately placed in sterile Gibco Hanks' balanced salts solution at 4°C for transportation. The soft connective tissue was easily dissected off from the osteoma in order to exclude any part of the bony mass Fig . The spe2O2 until total clearing of oxygen bubbles. Non-specific protein binding was performed with 10% non-immune serum, same host as secondary antibody, in PBS with 1% Bovin Serum Albumin . Sections were then incubated with primary antibodies for 1 hour at room temperature, or 24 hours at 4°C with anti-type I collagen. Excess antibody was removed by washing the sections with PBS. Sections were incubated 1 hour with horseradish peroxydase-labeled secondary antibody diluted in PBS. 3-3'diaminobenzidine (DAB) solution was then added in order to obtain staining. Sections were counter-stained with hematoxylin-eosin or nuclear red/eosin, dehydrated, and mounted with Mountex medium . Controls were systematically performed omitting the primary antibody. Slides were examined by light microscopy using a Leica DMR microscope .The anti-human monoclonal mouse antibodies against type II collagen , OCN , anti-human polyclonal goat antibody against type I collagen , anti-rat polyclonal rabbit antibody against type X collagen and anti-human polyclonal rabbit antibody against VEGF were used at 1 mg/ml. Peroxidase-conjugated goat anti-mouse was purchased from Immunovision Technologies , peroxidase-conjugated goat anti-rabbit from Dako and peroxidase-conjugated donkey anti-goat from Santacruz Biotechnology . They were used at a 1/20, 1/50 and 1/100 dilution, respectively. Frozen sections post-fixed with acetone were treated with hyaluronidase one hour at 37°C. For type X collagen immunostaining slides were treated first 15 minutes at 37°C with hyaluronidase (5 mg/ml in PBS), washed two times in PBS, then 15 minutes with chondroitinase (2 U/ml in PBS), and washed two times in PBS. Immunohistochemistry was performed using ABC method. Briefly, endogenous peroxydase activity was eliminated with 0.3% HMost of the patients were referred to Raymond Poincaré teaching hospital, at the time of surgery. US examination was performed when NPOA was clinically suspected in five patients whose rehabilitation has begun. Five hips were explored by US in two BI and three SCI. Linear 8 to 15 MHz and sectorial 4 MHz transducers (Sequoia Acuson-Siemens Erlangen) were used. A sectorial low frequency transducer was used because in the hip area NPOA can be very large and very deep especially in the gluteus area compared to the subcutaneous plane. US examination was combined with color and energy Doppler. In all cases a plain film was obtained the same day as the US examination.Non mineralized connective tissues from the periphery of the osteoma were examined by light microscopy on Erlich's hematoxylin-eosin-stained sections. Several kinds of tissues appeared on the slides so the diversity of these figures deserves a systematic analysis which will be completed in the next sections. Briefly, the ground basis of our preparations was a more or less fibro-cellular connective tissue displaying sometimes edema and/or necrosis. Suffering and degenerating tissues with vacuolized myofibers, thrombotic vessels and adipose tissue were often observed Fig . MusculaMorphologically normal vessels were rarely observed and winding of the vasculature was an almost constant finding. Many of the vessels were thrombotic, sometimes with hyperplastic intimae or media Fig . Some peThese findings point to a chondrogenic or osteogenic differentiation of formerly undifferentiated mesenchymal cells from the stroma and the vessel walls. More advanced stages of cartilaginous differentiation were frequently observed in avascular areas with varying degrees of chondrocyte maturation. Morphologically recognizable columns of chondrocyte-like cells presenting a high ALP activity were observed. Moreover, we could observe all the stages of progressive chondrocyte differentiation from quiescence to chondrocyte hypertrophy/matrix mineralization and endochondral ossification Fig .A high ALP activity was also found in cells surrounding the cartilage areas undergoing mineralization and embedded in a slight envelope of woven bone with ALP positive cells Fig . On the Bands of eosinophilic material stained partially by Von Kossa underlined some borders of the mineralized cartilage. These osteoid-like bands were lined by cells which morphologically appeared to be osteoblast-like cells.To confirm the osteoblastic nature of these cells, immunolabelling for OCN was performed Fig . In fronIn order to document the collagenic composition of these tissues and confirm their osseous or cartilaginous nature, immunolabelling for type I, II and X collagens were performed.Conspicuous immunolabelling for type X collagen was observed in most of the hypertrophic chondrocytes and in their matrix. The immunoreactivity became more intense nearby the mineralization front. In addition the matrix of the fibrous and non cartilage-like tissue around some mineralized areas was unexpectedly labelled Fig . ControlDistribution of type II collagen was limited to the matrix of non hypertrophic and prehypertrophic chondrocytes with high ALP activity Fig . NeverthBone deposition was frequently observed by polarized light and confirmed by type I collagen immunostaining Fig . Type I In order to determine the chronology of events at work in the described endochondral ossification, we performed serial cryosectioning of samples in which a cortical bone followed soft tissue. These samples seem to be appropriate to have all stages of osteogenesisOne of the specimens appeared to contain an aponeurotic tissue which showed signs of bursitis. In a highly cellular tissue we observed a high angiogenic activity. Bundles of vessels surrounded amorphous and avascular zones Fig . Some ofAt this stage a strong ALP activity was observed in the cells surrounding the cartilage zone as well as in non mineralized hypertrophic areas Fig . FinallyTo further confirm the process of endochondral ossification, we decided to search for VEGF expression. Immunolabelling of these tissues with VEGF monoclonal antibody, showed a labelling of the hypertrophic chondrocytes as well as an intense labelling of activated osteoblats lining the osteoid. Some clusters of rounded cells also expressed VEGF in the fibrous part of these preparations Fig .US examination showed a huge focal disorganization of the muscles in the area of the suspected NPOA. Normal longitudinal muscular striation disappeared and was replaced by a relatively well defined mass with a very heterogeneous echostructure. The masses ranged from six to eleven centimeters of long axis. No scattered ossified areas were detected by US at this stage. Hypervascularization was detected on Doppler examination inside and outside the NPOA tumors Fig .Classical zone phenomenon previously described in the literature ,16 was vThe zone phenomenon became visible on the second US examination performed one week later Fig .The opacity of the early ossification became slightly visible on plain films only two weeks after the US detection of zone phenomenon Fig .NPOA pathogenesis is still poorly understood, and the exact environmental and humoral conditions underlying the ossifying process are not clear. In this study we postulated that periosteoma soft tissues display interrupted early stages of osteoma formation, which could help us to understand the chronology as well as the mechanism of osteoma formation. Thus, histological and immunohistological experiments were performed on 28 specimens. Moreover, ultrasound examination of suspected NPOA tumor on five patients permitted to follow osteoma formation in the early stages before ossification.Histological studies have shown varying amount of muscle and connective tissue degeneration in which some areas underwent reorganization. Islands of cartilage, woven bone, and mature lamellar bone were a constant finding in most of specimens, whatever the estimated age of the studied lesion. The spatial organization of chondrocytes was reminiscent of the epiphyseal growth plate or of the fracture callus organization . In the Some sections showed a high expression of type X collagen in the hypertrophic chondrocytes areas, and unexpectedly in non differentiated mesenchymal tissue. As this labelling did not occur in other fibrocellular areas it was unlikely to be produced by a binding of the antibody to some other matricial component of the extra cellular matrix. It was shown, that type X collagen is not only associated with chondrocyte proliferation and hypertrophy, but also with resting chondrocytes, cells at the border of the perichondrium and resting cartilage of the fetal femoral head .The finding of still degenerating muscular fibers and early chondro-osteogenesis accompanied by heavy ALP activity in large parts of the soft tissues in old lesions (till 8 years) is singular. Except when serial sectioning was performed the studied specimens were carefully dissected from the osteoma during the surgery or at the fixation time. Therefore the extra-osteoma localization of these tissues can without any doubt be assumed. In one study "recent It was claimed that osteoma develops in the periphery of a muscle in which some myofibers undergo degeneration ,26, and On the other hand it has been shown that hypoxia promotes chondrocyte differentiation ,35. In oThe volume of the tumor is acquired during the very early stages of NPOA. After tumefaction there is no real change in the tumor size . Moreovede novo cartilaginous differentiation. US examination of the same NPOA tumor one week later showed scattered ossifying nodules. This nodular activity is in accordance with our histological finding in periosteoma soft tissue. Extense of the hypoxic area determines the size of each nodule. Areas with important hypoxia induce larger cartilage zones which could join together after ossification but small nodules remain scattered in periosteoma soft tissue. These results confirm that, periosteoma soft tissue has the same pattern of early stage of osteoma ossification, and could be a model of ossification for further studies.On tissue section, VEGF immunolabelling revealed a more intense expression by osteoblasts and osteoblast-like cells, in addition to its expected expression by hypertrophic chondrocytes. VEGF induces neoangiogenesis and then endochondral ossification occurs. The restoration of normoxic conditions promote the onset of lamellar ossification and hamper any other Moreover, NPOA occurs in neurologically deficient patients with altered mechanical loading. Mechanical loading is of pivotal importance to the development, function and repair of all tissues in the musculoskeletal system. In nonfunctional joints, as it is the case of these patients, the absence or reduction of intermittent hydrostatic pressure in the articular cartilage could permit cartilage degeneration and the progressive advance of the ossification These mechanical influence could indeed shed light on the finding that osteomas only occur near the main joints.Moreover, Carter and associates have also shown that intermittently applied shear stresses (or strain energy) promote endochondral ossification and that intermittently applied hydrostatic compression inhibits or prevents cartilage degeneration and ossification. Thus, the imbalance of these forces among these patients can promote endochondral ossification of the cartilage nodules in areas of high shear (deviatoric) stresses.Urist demonstrated that the induced endochondral bone is resorbed once the inductive agent has disappeared . We haveWe therefore propose a model of the NPOA lesion formation. The sympathetic hyperactivity causes major changes in the peripheral vascular dynamics. As related some of these changes end in vascular stasis and/or thrombosis . Edema fSome questions remain which deserve further studies. Why do NPOAs form only around the main joints? Why are they not resorbed as does any intramuscularly implanted bone graft . What frIn conclusion, our results demonstrate that periosteoma soft tissues are a replica of the early stages of osteoma formation, and could be used as a model for NPOA formation. We propose also a mechanism for osteoma formation in which hypoxia is a major cause of nodular osteoinduction and chondrocyte differentiation. Combination of hypoxia and applied shear stresses induce endochodral ossification. Finally our results indicate implication of different types of mesenchymal cells in NPOA formation but US examination support specially muscular origin hypothesis.The pre-publication history for this paper can be accessed here:

The purpose of the study was to compare the knowledge scores of medical students in Problem-based Learning and traditional curriculum on public health topics.We planned a cross-sectional study including the fifth and sixth year medical students of Dokuz Eylul University in Turkey. The fifth year students were the pioneers educated with PBL curriculum since the 1997–1998 academic year. The sixth year students were the last students educated with traditional education methods. We prepared 25 multiple-choice questions in order to assess knowledge scores of students on selected subjects of Public Health. Our data were collected in year 2002.Mean test scores achieved in PBL and traditional groups were 65.0 and 60.5 respectively. PBL students were significantly more successful in the knowledge test (p = 0.01). The knowledge scores of two topics were statistically higher among PBL students. These topics were health management and chronic diseases.We found that mean total evaluation score in the PBL group was 4.5 points higher than in the traditional group in our study. Focusing only on the knowledge scores of students is the main limitation of our study. Upon the graduation of the first PBL students in the 2002–2003 academic year, we are planning additional studies regarding the other functions of a physician such as skill, behaviour and attitude. During the last 25 years, ideas concerning the aim, structure and system of medical education have been discussed. Debates generally have arisen from the perception that medical education couldn't serve the purpose of improving health standards of the communities ."Health for All" was adopted in 1977 and launched at the Alma Ata Conference in 1978 to underline the fact that large numbers of people and even whole countries were not enjoying an acceptable standard of health . In ordeIn the Edinburgh Declaration of the World Medical Association in 1988, similar problems were mentioned and the purpose of the medical education was declared as training physicians capable of improving communities' health standards. This declaration suggested that medical education should be focused on common health problems of the large communities, and the medical school curriculum should be restructured according to the health requirements of the community. According to the declaration, medical students must gain professional skills and social values in addition to theoretical knowledge and the principle of lifelong medical education should be adopted .The ideas and suggestions mentioned above have aroused strong winds of change in the medical education arena. Mc Donald et al. from Mc Master University determined an approach based on the community's main health problems and stressed the importance of focusing on these problems while designing their medical school's curriculum .Since then, this approach has been adopted by many medical schools all over the world. The schools which designed their curriculum according to the priority health problems of the community, managed to raise the physicians' awareness of their community and the preventive measures and solutions of their main health problems.In Turkey, problems of medical education have been discussed since early 1970s. Several studies showed that the goals of medical education did not overlap with the health requirements of the Turkish community. The education of health professionals was abstracted from the realities of the country. In 1990s Turkish Parliament and Turkish Medical Association determined and reported the difficulties of medical education. In a 1991 report of the Turkish Parliament, the facts that the number of qualified physicians who were trained according to the health needs of the country was limited and that this number was not sufficient to improve its health standards were underlined. Several deans from different medical schools of the country contributed to Turkish Parliament's study and reported that a greater importance should be given to the health problems of the population while planning the educational programs and the medical education should not be restricted to the university hospitals .In The Turkish Medical Association's report the fact that medical education was not relevant to health needs of the country was emphasized. New medical graduates were not fully aware of common national health problems. The recommendations of the Turkish Medical Association to improve the health standards of the Turkish population were; training the general practitioners capable of working effectively in the primary health care and restructuring the medical education on a community basis and implementing Problem-based Learning methods .International developments and the reports of Turkish Parliament and Turkish Medical Association led the faculty of Dokuz Eylül University School of Medicine (DEUSM) to seek solutions to the problems mentioned in the reports. As a result, Problem-based Learning (PBL) a more active and student-centred learning- was adopted and launched in the 1997–98 academic year. One of the main features of the education program was its relevancy to the philosophy of community-based medical education .The curriculum of DEUSM was structured considering social, biological, behavioural and ethics objectives of medical education. The curriculum was structured in a modular system and adopted to a spiral configuration providing horizontal and vertical integration. During the first three years of undergraduate education, PBL sessions are the main focus of a modular structure. The weekly schedule of a module allowed for all the educational activities such as PBL sessions, lectures, field studies, communication skills and clinical skills courses lectures existing one hour a day in the weekly program support the PBL sessions and independent learning .PBL sessions were based on written problems, which are likely to happen in real life. Special emphasis was also given to the integration of knowledge, acquisition of professional and moral values and to the development of communication skills.Medical knowledge and practical skills that a physician is supposed to have were on the basis of the advice of Turkish Medical Association and the faculty departments. The Department of Public Health also contributed to the education program by setting social standards and determining the most important health problems of the community.PBL Curriculum of DEUSM aimed to teach the students the main health problems of the community, their prevention and ways of treatment.Public Health topics of Dokuz Eylül University School of Medicine consists of;• Holistic approach in health,• Basic principles of Public Health,• Personal and social points of view on health events,• Bio-psychosocial (holistic) approach to any individual,• Principles of preventive medicine,• Structure and mechanisms of national health organization,• Demographic structure and trends, factors affecting them,• Basic principles of planning and conducting a scientific research on health,• Sound knowledge on leading health problems of the country, personal and social approaches for their solutions,• Environmental and occupational factors threatening community health and their prevention.Cases in the scenarios of the PBL modules were selected among common and important health problems, for which early diagnosis or prevention is possible. Lectures and small group studies with students were also organized to contribute to the educational effectiveness of the modules. Public Health topics of the medical education may be achieved more easily when theoretical knowledge and practical skills are complemented by field studies . It is rPrior to the implementation of PBL curriculum in the 1997–1998 academic year, lectures on Public Health were presented to the first, the third and the last year students by the faculty members of the Department of Public Health. Lectures on bio-statistics and research methods were given weekly throughout the first year. The other topics of Public Health were held in 72-hour Public Health Courses at the end of the third year . In the Comparison of old and new curriculum using some measurement tools is mandatory to observe the effects of innovations. In the literature, the determination of students' performances in scientific or licensing examinations was used to compare the efficiency of traditional education and PBL. Nandi P. et al. reviewed the studies and meta-analyses comparing PBL and traditional lecture-based education methods. In meta-analysis of the data published between 1980–1999, they concluded that PBL helped students show slightly but not significantly better performance than the others on clinical examinations . SimilarBlake et al. compared formerly lecture-based educated and recently Problem-based educated graduates of Missouri-Columbia School of Medicine concerning their performances on medical licensing examinations. They reported that mean scores achieved on these examinations were better among graduates of PBL, but the difference between old and new graduates' scores was not statistically significant .Some other studies have attempted to compare students' performances on special areas of medicine instead of general evaluation. Antepohl and Herzig conducted a randomized controlled study among the students who enrolled for the course of basic pharmacology at the University of Cologne. They randomly divided the students into two groups of PBL and traditional lecture based learning in order to compare their final examination scores. They could not find any significant difference between the two groups. However, in short essay questions there was a tendency towards higher scores among the students in the PBL group. The authors also found that the PBL students reached almost identical scores in their multiple choice questions and their short essay questions whereas the students who had been in the lecture based group scored significantly lower scores in their short essays than in their multiple choice questions .In a multi-centric study conducted by Schmidt et al., comparison of PBL and lecture based learning students showed that PBL students had higher knowledge scores on the areas of primary care services, psychological health, collaboration of different sectors on health and occupational ethics .The purpose of our study was to compare the knowledge scores of medical students in PBL and traditional curriculum on public health topics.We planned a cross-sectional study including the fifth and sixth year medical students of DEUSM. The fifth year students (PBL students) were the pioneers educated with PBL curriculum since the 1997–1998 academic year. The sixth year students were the last students educated with traditional education methods. The knowledge scores of students on Public Health topics were evaluated. In both of the PBL and Traditional curriculum, all the knowledge acquired in the first five years of the school was reviewed during the two-month Public Health internship period in the sixth year. Since this period may remind the students of some issues which may have been previously forgotten, we decided to exclude the sixth year students who have completed their internship period. 56 fifth year students and 78 sixth year students who have not so far completed their internship period in the Department of Public Health were included in our study. Participation rates were 96.4% (54 out of 56 students) in the fifth year and 100% in the sixth.Before the application of the inquiry form, the purpose of the study was explained to the students and their oral consents were obtained.We analyzed the knowledge scores of the two groups of students' on Public Health issues. PBL and traditional programs were the independent variables. Descriptive variables were age and gender.By reviewing a five yearlong section of educational programs, we determined that nine Public Health main topics were common to both PBL and traditional programs. The main topics were communicable diseases, epidemiology, mother and child health, health management, chronic diseases, occupational health, nutritional principles in community, demography and environmental health.We prepared 25 multiple-choice questions in order to assess knowledge scores of students on selected subjects. The number of questions related to each topic was proportional to the time allocated for each of the topic in the curriculum. The content validity of the questions was tested by consulting experts in relevant fields. All the data were collected between February and March 2002. Scoring procedure was implemented over "100 points" where each correct answer was scored "four points" and each wrong answer was scored "zero point".Data were subjected to statistical analysis by the chi-square test and the t-test in SPSS 10.0.Overall mean age was 23.6 ± 2.1 (21–45) years. The rates of male and female students were 55.4 % and 44.6 % respectively. There were no statistically significant differences between the two groups regarding mean ages, gender distribution or other personal variables.Mean scores achieved at the 25 question-test were 65.0 in PBL group and 60.5 in the traditional group. Students in the PBL group were significantly more successful in the knowledge test Table-.The knowledge scores of seven topics were higher among students in PBL curriculum. These topics were communicable diseases, epidemiology, health management, chronic diseases, occupational health, demography and environmental health. Traditional curriculum students were found to be more knowledgeable on two topics; mother and child health and nutritional principles in the community. However, the differences between PBL and traditional students' knowledge scores in only two topics, chronic diseases and health management, were statistically significant Table-.In our study, we found a statistically significant difference between knowledge scores of PBL and Traditional education groups in favour of the PBL group Table .The students of the PBL group had higher knowledge scores on 7 of the 9 identified topics. But the difference between mean scores of the groups was statistically significant in only two topics, "health management" and "chronic diseases". The reason of significantly higher knowledge scores among the students in PBL group may be that these students have more opportunities such as observations during field studies, work-shops or presentations to study on these two topics than those in the other group. They experienced a two week training period in a "community health center" at the end of the first year and observed the health center services and prepared a structured form concerning the procedures of health centers. They also studied in "community health centers" as small groups including two students in each fortnightly during their third year in the school and completed comprehensive forms about the topics on which they studied. The reason of better knowledge scores of PBL group on "chronic diseases" may result from the special educational efforts improving the effects of relevant modules on this topic. Actually special learning opportunities were provided for all topics and we were expecting to find a difference on remaining 7 topics too. On the other hand, the students in the traditional education group had slightly higher mean scores about the topics of "mother and child health" and "nutritional principles in community" although the differences between the groups' mean scores were not statistically significant. These knowledge deficiencies among PBL students were already revealed and an additional module was implemented in the curriculum to compensate them. Curriculum of DEUSM is being looked over by curriculum committee continuously and the departments try to make interventions for problematic parts.We found that the mean total evaluation score in the PBL group was 4.5 points higher than in the traditional group in our study. Actually, we expected a much larger difference between the two groups in favour of PBL students for their education was supported by lectures, small group studies and field studies in addition to the PBL sessions. They also had the advantage of studying on Public Health issues in each year of the school by means of homogenous allocation of the modules and blocks in the first five years instead of accumulation in a short period of time as it was in the traditional curriculum. Therefore, the difference between the evaluation scores of the groups did not meet our expectations although it was statistically significant. The reason for this underachievement of Public Health objectives among our PBL students may be related to both students and PBL tutors. The common perception among the students that they have enough knowledge to say something about social and behavioural aspects of PBL modules lead them to focus on biological objectives more and they do not need to study on social issues in depth. Furthermore, a common misunderstanding among faculty members that achieving the Public Health objectives in PBL is just the responsibility of the Department of Public Health may have led the PBL tutors to withdraw from the responsibility of focusing on these subjects sufficiently. Additionally, when they are less informed or less equipped with supporting material about Public Health objectives, they may not have felt very competent while facilitating their groups by asking appropriate questions.One assumption of curricular comparison studies, included this one, is that students will do better either in one or the other type of curriculum. However, each curriculum demands different skills and deployment of learning strategies from the students. This is important because, it is well known in the educational literature that not all students do well in one particular learning program and that they do better when the program adapts to their preferred way of learning. The studies of learning styles may shed light in why the differences between performance scores are always so close when medical curricula are compared.As we mentioned before, in DEUSM, the written problem used in PBL sessions are oriented to biological as well as social and behavioural objectives. In order to achieve all these three objectives the tutors must attach the same importance to each subject and ensure that their groups give enough time and effort for each objective. But when the tutors get inadequate information and support from the experts of the related subjects, they generally focus only on biological objectives and their groups can't manage to integrate all objectives. If the tutors are less sensitive to objectives other than biological ones, then their students will be less motivated to learn and, like their educators, will be equally insensitive to Public Health topics. In order to prevent this, faculty members of the department of Public Health who take place in the scenario committees review the PBL problems regarding Public Health objectives. They make every effort to insure that the Public Health objectives are included while writing the problems and that the tutors are sufficiently informed on these objectives before their sessions. Field Work Committee has been trying to increase students' motivation and raise their awareness on Public Health issues to increase the effectiveness of field studies.Focusing only on the knowledge scores of students is the main limitation of our study. Upon the graduation of the first PBL students in the 2002–2003 academic year, we are planning additional studies regarding the other functions of a physician such as skill, behavior and attitude.The authors declare that they have no competing interests.EG conceived of the study, participated in the design of the study and drafted the manuscript, BM conceived of the study, participated in the design of the study and coordination, performed the statistical analysis, GA participated in the design of the study and performed the statistical analysis, RU conceived of the study, participated in the design of the study. All authors read and approved the final manuscript.primary prevention method?While working in a health center as a general practitioner, you have noticed that hypertension prevalence is high among the people living in the region under your responsibility. Which of the following would be your choice as a) I would educate the hypertensive patients on their disease.b) I would treat the hypertensive patients with antihypertensive drugs.c) I would send the hypertensive patients to a secondary care hospital for further investigation and treatment.d) I would educate healthy individuals on risk factors associated with hypertension and prevention methods.most common childhood nutritional disorder in Turkey?Which of the followings is the a) Protein calorie deficiencyb) Marasmusc) Iron deficiency anaemiad) Ricketswrong?Which of the following is a) Demography is a science that analyse the body, structure and differentiations of human populations.b) The goal of family planning is to decrease current number of population.c) Dependent population ratio is found by dividing the total number of population younger than fifteen years and older than 65 years of age by the total number of population between 15–65 years of age.d) Principal of pronatalist population policy is to increase the total number of population.is not one of the basic records kept in a health center?Which of the followings a) Household determination card.b) Follow-up card for the females between 15–49 years old.c) Follow-up card for aged individuals.d) Antenatal and postnatal follow up card.e) Infant and child follow-up card.Which of the followings is not among the responsibilities of an occupational health unit?a) Health prevention services in work settingsb) Work safety preventionsc) Following up the health and safety conditions in work settingsd) Preventing any interruption in productione) Giving outpatient clinic services in work setting.not required as an immediate intervention?An 11 year old girl was bitten by a neighbour-dog while she was playing in her house-garden. Which of the followings is a) To investigate if the dog is vaccinated.b) To vaccinate the girl for rabies prevention.c) To clean the wound by soap and water.d) To apply one dose of tetanus vaccine.e) To try to understand how the dog bit the girl.most common used effective family planning (contraception) methods?Which of the followings is the a) Intrauterine deviceb) Withdrawal (coitus interruptus)c) Combined oral contraceptivesd) Condome) Subcutaneous implantsbest represents the environmental health related responsibilities of a general practitioner who works in a health centre?Which of the followings a) Waste control and giving education to correct misapplicationsb) Analyzing and chlorinating drinking water, control of potable waterc) Controlling and improving the condition of toilets,d) Coordination of conduction of above mentioned services by auxiliary personnel of health centre, although these services are among the tasks of municipality.e) All of the statements above are true.After looking over one-year medical records of an internal medicine outpatient clinic, it was found that 25 % of the diagnoses were Diabetes mellitus. Regarding this result a screening procedure was conducted in the field and Diabetes mellitus prevalance was found 5 %.can not be the conclusion of above mentioned situation?Which of the followings I) Outpatient clinic may admit people coming from other regions.II) Outpatient clinic records represent the health status of the community.III) One-fourth of the patients have Diabetes mellitus diagnosis.IV) Field studies are needed to determine the real prevalance of a disease.a) I, IIb) I, IIIc) II, IIId) I, II, IVe) II, III, IVThe pre-publication history for this paper can be accessed here:

Thymine-rich Insulin Response Element (TIRE). The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase). However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3) is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase), whose products are required for gluconeogenesis.Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G6Pase) and insulin-like growth factor binding protein-1 (IGFBP-1), is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression.These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents. Insulin-like growth factors (IGF-I and II) have a broad range of biological activities that include the stimulation of mitogenesis and differentiation, and insulin-like effects on glucose uptake and lipogenesis . These aStudies using inhibitors of PI 3-kinase have demonstrated a requirement for this enzyme in insulin regulation of IGFBP-1 . Indeed,In the present study, we have examined the role of GSK-3 in the regulation of a third TIRE-containing gene promoter, namely IGFBP-1. We demonstrate that four different classes of inhibitors of GSK-3 can mimic the action of insulin and reduce IGFBP-1 gene expression. Furthermore, we find that inhibition of GSK-3 reduces the activity of a heterologous promoter containing the IGFBP-1 TIRE, and propose that this mechanism underlies the repression of all three promoters by inhibitors of GSK-3. Finally, we demonstrate for the first time a requirement for inhibition of GSK-3 in the insulin regulation of the TIRE, and hence IGFBP-1 expression.in vivo, reduces both basal and glucocorticoid-induced IGFBP-1 gene expression . Importin vitro -ethylamino}-nicotinonitrile) was synthesized in 7% overall yield using a convergent approach from 2,4-dichlorobenzoyl chloride and 6-chloro nicotinonitrile respectively -5-(4-methyl-1ctively ( and refsThe rat hepatoma cell line H4IIE was maintained in Dulbecco's Modified Eagle's medium (DMEM) containing 1000 mg/l glucose, 5% (v/v) foetal calf serum, as described previously . Cells wH4IIE cells were serum-starved overnight and treated with hormone/inhibitor for the times and at the concentrations indicated in the figure legends. Total cellular RNA was isolated using TriReagent™ (Sigma) following the manufacturer's instructions. An RNase Protection Assay (RPA) was performed to determine the relative amounts of IGFBP-1 and cyclophilin mRNA in each sample . Band inH4IIE cells were incubated in serum-free medium with hormones and inhibitors for the times and at the concentrations indicated in the figure legends. Cells were then scraped into ice-cold lysis buffer Triton X-100, 10 mM sodium pyrophosphate, 1 mM benzamidine, 0.1 mM PMSF, 0.27 M sucrose, 2 μM microcystin and 0.1% (v/v) 2-mercaptoethanol). Cell debris was removed by centrifugation at 13000 × g for 5 min and the protein concentration determined by the method of Bradford, using BSA as an internal standard.Antibodies to phospho ribosomal protein S6 (Ser-235), phospho-FKHR-L1 (Thr-32) and GSK-3β were purchased from Upstate , while the phospho-specific Ser9/Ser21 GSK-3, Thr-308 PKB, Thr389-S6K1, and Thr-183/Tyr185 p42/p44 MAPK antibodies were purchased from Cell Signalling Technologies . H4IIE cell lysates were prepared following incubation with hormones as described in figure legends and analysed by Western blot analysis.GAAACTTCTTTTG) produces a mutant promoter (BP-1 DM5) that is no longer responsive to insulin [The plasmids BP-1 WT and BP-1 DM5 were a gift from Dr Robert Hall and Professor Daryl K. Granner . The BP- insulin . The FOXThe TOPflash reporter plasmid kit were obtained from Upstate Biotechnology . TOPflash has Tcf binding sites driving luciferase expression. Tranfections were performed using the calcium phosphate procedure as described previously . H4IIE c8 and 109 plaque forming units per ml, incubated at 37°C for 16 hr. Cells were then transfected with 10 μg of BP-1 WT as described above and incubated for a further 24 hr in the presence or absence of 10 nM insulin. Luciferase was harvested and assayed or cell extracts were prepared for western blot analysis, as described earlier.H4IIE cells were infected with virus between a titre of 10As a measure of statistical significance of differences in experimental groups, student t-tests were performed and 5% confidence limits applied.G6Pase, glucose 6-phosphatase; IGFBP-1, IGF-binding protein-1; phosphatidyl inositol 3, kinase, PI 3-kinase; TIRE, thymine rich insulin response element; PKB, protein kinase B; PEPCK phosphoenolpyruvate carboxykinase; GSK-3, Glycogen synthase kinase 3The majority of the data was obtained in equal measure by D.F. and S.P, the CHIR99021 was synthesised, purified and analysed by N.S. and R.M., the adenoviral vectors were produced and characterised by L.M.D. and C.J.R., while the project was conceived and supervised by C.S.

Spontaneous repair is limited after CNS injury or degeneration because neurogenesis and axonal regrowth rarely occur in the adult brain. As a result, cell transplantation has raised much interest as potential treatment for patients with CNS lesions. Several types of cells have been considered as candidates for such cell transplantation and replacement therapies. Foetal brain tissue has already been shown to have significant effects in patients with Parkinson's disease. Clinical use of the foetal brain tissue is, however, limited by ethical and technical problems as it requires high numbers of grafted foetal cells and immunosuppression. Alternatively, several reports suggested that mesenchymal stem cells, isolated from adult bone marrow, are multipotent cells and could be used in autograft approach for replacement therapies.In this study, we addressed the question of the possible influence of mesenchymal stem cells on neural stem cell fate. We have previously reported that adult rat mesenchymal stem cells are able to express nestin in defined culture conditions (in the absence of serum and after 25 cell population doublings) and we report here that nestin-positive (but not nestin-negative) mesenchymal stem cells are able to favour the astroglial lineage in neural progenitors and stem cells cultivated from embryonic striatum. The increase of the number of GFAP-positive cells is associated with a significant decrease of the number of Tuj1- and O4-positive cells. Using quantitative RT-PCR, we demonstrate that mesenchymal stem cells express LIF, CNTF, BMP2 and BMP4 mRNAs, four cytokines known to play a role in astroglial fate decision. In this model, BMP4 is responsible for the astroglial stimulation and oligodendroglial inhibition, as 1) this cytokine is present in a biologically-active form only in nestin-positive mesenchymal stem cells conditioned medium and 2) anti-BMP4 antibodies inhibit the nestin-positive mesenchymal stem cells conditioned medium inducing effect on astrogliogenesis.When thinking carefully about mesenchymal stem cells as candidates for cellular therapy in neurological diseases, their effects on resident neural cell fate have to be considered. During development of the central nervous system (CNS), all types of neuronal and macroglial cells derive from neuroepithelial neural stem cells (NSCs) ,2. NSCs BMPs (Bone Morphogenetic Proteins) are secreted members of the TGF-β superfamily. Together with their receptors, they are abundantly expressed in the brain both during embryogenesis and in the adult -9. More in vivo studies demonstrated that MSCs fuse with host neuronal cells [Cellular therapies using stem cells are promising approaches for the treatment of several chronic or acute neurological diseases such as Parkinson's or Huntial cells ,31. Thesin vitro and demonstrate that MSCs favour astroglial lineage. We observe that npMSCs are able to stimulate astroglial fate in striatal progenitor cultures and to repress neuronal and oligodendroglial fate through the release of diffusible factor(s). Using BrdU incorporation, we demonstrate that this npMSC conditioned medium has no effect on the astrocytic or oligodendrocytic progenitor proliferation. Propidium iodide incorporations suggest that the npMSCs conditioned medium protect GFAP-positive cells from cell death in comparison to the effect of nnMSCs conditioned medium or to the control condition. Meanwhile, no increase of cell death is observed in neuronal and oligodendroglial populations. We then demonstrated that BMP4 is present in a biologically-active form in the npMSCs but not in nnMSCs conditioned medium and is responsible for both the increase of astroglial numbers and the inhibition of oligodendrocyte differentiation in striatal NSC cultures.Recently, we demonstrated that two phenotypes of MSCs could be obtained in culture: nestin-positive MSCs (npMSCs) which are able to integrate some extrinsic signals when co-cultured with neurons leading to a differentiation into astrocyte-like cells and nestin-negative MSCs (nnMSCs) which are unable to adopt a neural phenotype but remain able to differentiate into adipocytes, chondrocytes or osteocytes . When coNeurosphere-derived cells from GFP-positive E16 green mouse striata include neural stem cells and progenitors which are still proliferating but already committed to a given cell fate. Upon transfer on adherent surfaces (poly-ornithine coated dishes), these cells spread and spontaneously differentiate as follows after 5 days of culture: 44.2 ± 2.5% GFAP-positive cells , 15 ± 2.1% Tuj1-positive cells and 5.86 ± 0.6% 04-positive cells . When co-cultivated with nestin-positive MSCs (npMSCs), phenotypic allocation of neurosphere-derived cells (identified as GFP-positive cells) become strikingly different: GFAP labelling is increased to 78.5 ± 3.9% Fig. n = 12, n = 12, n = 8, .To further characterize the mechanism (soluble factor versus membrane-bound factor) responsible for such an increase in astrocytes number in presence of npMSCs, we tried to induce the differentiation of neurospheres with npMSC conditioned medium. The following data were obtained: 77.5 ± 2.5% of the neurosphere-derived cells became GFAP-positive, 4.3 ± 0.9% were Tuj1-positive and 1.5 ± 0.6% were 04-positive medium (DEM/F12 + B27) did not show any significant differences increase the astrocytes numbers while inhibiting neuronal and oligodendroglial numbers. Conversely, nnMSCs (with a maximum of 5 passages in vitro) only decrease the neuronal differentiation. Since similar results were obtained using MSC conditioned media, we concluded that these effects could be mediated by diffusible factor(s). We then analysed the effect of various conditioned media on the cell proliferation (using BrdU incorporation) as well as the cell death (using propidium iodide incorporation) in each neurosphere-derived cell types and at two different differentiation period (48 or 96 hours). We only observed a significant decrease of propidium iodide incorporation in GFAP-positive cell population at 48 hours of differentiation suggesting that soluble factor(s) select astroglial lineage by protecting those cells from cell death.As we mentioned above, environment is able to modify the cellular differentiation capacity. In this study, we addressed the question of a possible effect of MSCs on neural progenitor cell fate and we choose an The activity which drives neurosphere-derived cells into astrocytes only occurs in npMSC conditioned medium while the neuronal differentiation-inhibiting activity is present both in np- and nnMSC conditioned media. We tried to identify the astrogliogenetic factor(s) by measuring the expression by nn- and npMSCs of cytokines known to promote an astroglial fate -41. Our The release by npMSCs of biologically-active form of BMP4 which promotes astroglial differentiation and inhibits oligodendroglial differentiation is consistent with previous studies demonstrating that BMPs play multiple roles in development . Other sWhen considering the use of MSCs in cell replacement strategies for the treatment of various neurological diseases, it should be taken into account that those cells could also influence the development host neural precursors.6 marrow cells were plated on 175-cm2 tissue culture flask in DEM/10% foetal bovine serum (Invitrogen). After 24 hours, the non-adherent cells were removed. When the rMSCs became confluent, they were resuspended with 0.25% Trypsin and 1 mM EDTA and then sub-cultured. Nestin expression by MSCs was induced as described in [Adult rat bone marrow was obtained from femoral and tibial bones by aspiration and was resuspended into 5 ml of DEM . Betweenribed in .6 cells/75-cm2 tissue culture flask) in DEM/F12 supplemented with EGF and B27 (Invitrogen), a multi-component cell culture supplement devoid of any growth factor. When the size of neurospheres reached approximately 50 cells, they were dissociated into a single cell suspension by trituration and replated in fresh culture medium. Neurospheres with a maximum of 3 passages were used in this study.Green C57BL/6 mice embryos or NMRI mice were used as a source of striatal neural progenitor and stem cells. Green mouse express GFP under control of the β-actin promoter [MSCs and neurospheres were plated on polyornithine coated dishes for 5 days, in DEM/F12 containing only B27 supplement and were then processed for immunocytochemical analysis as described below.MSCs were placed in DEM/F12 medium supplemented with B27 (Invitrogen), during 3 days. The conditioned media were then filtered with 0.22 μm-pore filter before being replaced on plated neurospheres during 5 days.The cultures were fixed with 4% (v/v) paraformaldehyde for 15 minutes at room temperature and washed 3 times in TBS buffer. They were then permeabilized in 1% Triton-X100 (v/v) for 15 minutes and washed 3 times in TBS buffer. Non-specific binding was blocked by a 1 hour treatment in TBST (TBS buffer with 0.1% Tween) containing defatted milk powder (30 mg/ml). The cells were then incubated for 1 hour at room temperature with either anti-glial fibrillary acidic protein , or Tuj1 , or O4 primary antibodies (diluted in blocking buffer). After 3 washes in TBS, cells were then incubated in FITC- or Cy5-conjugated anti-mouse IgG or IgM for 1 hour at room temperature and in the dark. The nuclei were stained with ethidium homodimer . The preparations were then mounted in Fluoprep™ and observed using a Bio-Rad MRC1024 laser scanning confocal microscope. The fraction of positive cells was determined by counting 10 non-overlapping microscopic fields for each coverslip in at least three separate experiments (n then corresponds to the number of coverslips).After 24 hours or 3 days of culture, BrdU which is a S-phase marker, or propidium iodide was added to the differentiating neurosphere cultures for 18 hours before fixation and staining. Tuj1, O4 and GFAP immuno-labellings were performed as described above. For BrdU labelling, coverslips were then post-fixed for 10 minutes in 4% (v:v) paraformaldehyde, incubated in HCl 1 N for 20 minutes at 37°C, washed with sodium perborate solution and finally incubated with an anti-BrdU antibody for 1 hour at room temperature and Cy-5-conjugated anti-rat antibody, 1 hour at room temperature. The preparations were analysed as describe above.Total RNA was prepared using the RNeasy total RNA purification kit . For cDNA synthesis, random hexamer primers (Invitrogen) were used to prime reverse transcriptase reactions. The cDNA synthesis was carried out using Moloney-murine leukemia virus (M-MLV) Superscript II Reverse transcriptase (Invitrogen) following the manufacturer's instructions. Quantitative PCR was carried out using standard protocols with Quantitec SYBR Green PCR Kit (Qiagen). The PCR mix contained SYBR Greeen Mix, 0.5 μM primers Table , 1 ng DNAfter 72 hours of culture, the conditioned medium (1.5 ml) from cultures of neural progenitor cells, npMSCs and nnMSCs were incubated with heparin sepharose CL-6B at 4°C for 24 hours. After centrifugation (700 × g), the supernatant was removed and bound proteins were eluted in loading buffer by heating at 70°C for 10 minutes. The protein concentrations of various samples were quantified using the "RC DC Protein Assay" and equal protein quantities were loaded in each lane in a 15% sodium dodecyl sulfate polyacrylamide gel and electrophoresed. Then the proteins were transferred to PVDF membrane using a Trans-Blot Semi-Dry Transfer apparatus (Bio-Rad). The membranes were saturated with 3% gelatin (BioRad) during 1 hour at 37°C, then incubated for 1 hour with a monoclonal antibody against BMP4 or actin, as control for protein loading at room temperature and then washed several times with PBS-0.1% Tween. The membrane was then incubated in Cy5-conjugated anti-goat IgG or anti-mouse IgG for 1 hour at room temperature, in the dark. After several washes in PBS, the membranes were scanned using a Typhoon 9200 Scanner (Amersham Biosciences) and subsequent analyses were performed with ImageQuant Software (Amersham Biosciences).Neurospheres were plated on polyornithine-coated dishes and incubated during 5 days in DEM/F12 medium supplemented with B27 (Invitrogen) and previously conditioned by npMSCs during 3 days or not. Anti-BMP4 antibody was added on day 1 of this incubation.SW performed most of the work and wrote a first draft of the manuscript; FB performed quantitative RT-PCR; GH, GM and PL were involved in the writing of the manuscript; BR conceived the study and participated in its design and coordination. All authors read and approved the final manuscript.

Tasks involving conflict are widely used to study executive attention. In the flanker task, a target stimulus is surrounded by distracting information that can be congruent or incongruent with the correct response. Developmental differences in the time course of brain activations involved in conflict processing were examined for 22 four year old children and 18 adults. Subjects performed a child-friendly flanker task while their brain activity was registered using a high-density electroencephalography system.General differences were found in the amplitude and time course of event-related potentials (ERPs) between children and adults that are consistent with their differences in reaction time. In addition, the congruency of flankers affected both the amplitude and latency of some of the ERP components. These effects were delayed and sustained for longer periods of time in the children compared to the adults.These differences constitute neural correlates of children's greater difficulty in monitoring and resolving conflict in this and similar tasks. Conflict tasks involve the selection of a sub-dominant object or response in the presence of a competing dominant object or response. One of the most common tasks used in the literature to measure conflict is the flanker task. In this task, a target surrounded by stimuli suggesting either the same (congruent) or the opposite (incongruent) response is presented. Conflict is induced by incongruent flankers which, compared to congruent ones, produce larger reaction times and reduced response accuracy .conflict monitoring to describe these operations. Once conflict is detected, it is necessary to determine the appropriate action in a goal-directed manner. Depending on the task, the resolution of conflict might involve different processes .Different cognitive operations appear to be involved in processing conflict . First, Monitoring and resolving conflict is a function of executive attention . A netwoRecent studies have dissociated the brain areas within the executive network that are responsible for monitoring and resolving of conflict . In a fMYoung children have more difficulty than older children and adults performing tasks that involve conflict. Using conflict tasks adapted to children, we have reported a considerable reduction in the amount of interference produced by distracting information in children from 2 to 3 years of age . This reSome developmental studies have been carried out using neuroimaging aimed at understanding the brain mechanisms that underlie the development of executive functions. For instance, Casey and her colleagues conducteA number of studies have used the high temporal resolution of event related potentials (ERPs) to assay the timing of action-monitoring processes with adults. The N2 is one of the ERP indexes that have been associated with executive attention. The N2 is a pre-response negative deflection in the ERP at around 300 ms post-stimulus, which appears to be larger (more negative) for trials that involve more conflict. The N2 is observed over parietal and frontal leads and has been obtained with both flanker ,20 and GOnly a few ERP studies have been conducted with children using conflict tasks. In one of these studies, a flanker task was used to compare conflict resolution in three groups of children aged 5 to 6, 7 to 9 and 10 to 12, and a group of adults while P3Recently, Davis et al. conducteSo far, the literature suggests that monitoring and resolution of conflict involve separate brain areas in adults, and that children activate similar, but somewhat larger areas. Moreover, the N2 component of the ERPs appears to be related to activation coming from the ACC and to be mainly associated with conflict monitoring, whereas later components (e.g. LPC) might result from prefrontal sources of activation and could be related to conflict resolution.The flanker task is an appropriate experimental paradigm for assessing conflict processing. The aim of this study was to use a version of this task with children and adults to assess developmental differences in the time course of the different operations involved in conflict processing. We have recently developed a flanker task appropriated for use with children as young as 4 years . In thisTo study the time course of conflict processing, we examined the latency to significant differences between the ERPs for congruent and incongruent trials, and the sustainability over time of these differences. In the adult literature, the amplitude of the N2 component has been shown to be modulated by the congruency of distracting information in flanker tasks and has been related to conflict monitoring, but this component was not assessed in the study by Ridderinkhof and van der Molen. We aim to replicate the effect with adults using our child-friendly flanker task as well as analyzing this ERP component in 4 year olds. While there may be subcomponents of the N2 sensitive to other types of manipulations such as the degree to which the predicted identity of a display is violated , in our Means of the median RT and percentage of errors are shown in Table A similar 2 (Group) × 2 (Flanker Type) ANOVA was conducted using percentage of errors as the dependent measure. Again, the main effects of Group = 22.33; p < .001) and Flanker Type = 7.08; p < .05) were significant, whereas the Group × Flanker Type interaction was marginal = 3.28; p = .078).Figure We hypothesized that particular ERP components would be sensitive to the presence of conflict in the display. To examine these predicted effects, we computed the latency and amplitude of the peaks of the N1, N2 and P3 components in both groups and of the LPC in the group of children separately for congruent and incongruent conditions in a selection of frontal and parietal leads . To control for possible influence of this difference on the amplitude of the ERPs , the numFor the peak latency, the main effect of Group was significant in all the ERP components. The main effect of Flanker Type was significant for the N1, P3 and LPC. No significant interactions were found for any of the ERP components for the latency data.For the peak amplitude values, the main effect of Group was significant for the N1 and N2. The main effect of Flanker Type was not significant for any of the components although it was marginally significant for the N1 and for the LPC in the children. The main effect of Channel was marginal for the N2 and highly significant for the P3. Interestingly, there was a significant Group × Flanker interaction for the P3, indicating a significant effect of the type of flankers in the peak amplitude of this component for children = 6.0; p < .05) but not for adults (F < 1).Although the peak amplitude of ERP components is a widely used measure to look at effects of the variables of interest in the patterns of brain activation, these effects can certainly occur along the entire epoch and not only in the peaks of the components. To examine the effect of congruency in the amplitude of the registered activity in the entire epoch, we computed amplitude differences between congruent and incongruent conditions sample by sample along the ERP segment in all channels for children, and a selection of channels around the Fz, Fcz and Pz positions in the adult data. T-tests were carried out to assess the significance of these differences along the epoch. In Figure In order to explore possible associations between the amplitude and latency dimensions of the ERP components and the particular cognitive processes measured by reaction time (RT), we examined correlations between RT measures and patterns of brain activity at Fz, Fcz and Pz positions and their left and right equivalents. Correlations were computed independently for adults and children. The first set of correlations involved the conflict effect as measured by subtracting the RT for congruent trials from the RT for incongruent trials (conflict score) and the overall RT as behavioral measures, and the overall (across flanker conditions) latency and amplitude of the ERP components as electrophysiological measures. For the adults, the overall RT correlated negatively with the amplitude of the N1 at channel F3 , and positively with the latency of the N2 component at channel Fc4 . For the children, the overall RT correlated negatively with the amplitude of the P3 at channel P4 , and positively with the latency of the N1 at channel F4 and the N2 at channel Fcz . No significant correlations were established between any of the overall ERP components and the conflict score in either adults nor children.Finally, correlations were calculated between the behavioral measures of overall RT and conflict score, on the one hand, and the effect of flankers on the amplitude and latency of the peaks of the ERP components on the other. For the adults, overall RT correlated positively with the N2 latency effect at Fcz and the P3 amplitude effect at P4 , whereas the correlation was negative with the N2 latency effect at Fc4 . On the other hand, the conflict score correlated positively with the amplitude effect on the N2 at Fc4 and Fcz , although the last effect was only marginal. In the children, the overall RT correlated negatively with the N2 latency effect at Fc3 , and marginally with the N1 amplitude effect at Fz and F4 . However, the conflict score correlated negatively with the P3 latency effect at channel P4 .As expected, young children showed increased difficulty compared to adults in both processing the target and dealing with distracting information incongruent with the correct response. The greater difficulty of the task for children was reflected in children's much longer overall RT and conflict scores. The main goal of the current study was to analyze the differences in brain activation between children and adults underpinning their behavioral differences. Our results show differences among children and adults in both the time course of brain activations overall and across flanker conditions.Significantly larger N1 and N2 amplitudes were found for children than for adults, whereas the P3 showed equivalent amplitudes in the two groups. Children usually show larger event related potentials and often with delayed latency compared to adults ,24. ThesDifferences in latency of the ERPs components can be of special interest when it comes to accounting for differences in RT. Accordingly, children showed significant delays in the latency of all components compared to adults. The difference between children and adults was greater in the later components, suggesting that children's delay in target processing is more pronounced in later stages of processing. An objection to this conclusion is that latency and amplitude of the waveforms deflections are not independent, given the fact that greater peak latencies can be expected with more pronounced differences in amplitude. However, two pieces of information in our data point to the fact that differences in amplitude cannot account for all differences in latency. First, the P3 component shows a large difference in latency despite no overall differences in amplitude. Second, the overall RT appears to correlate negatively with the amplitude of some of the components in both children and adults, whereas it correlates positively with latency measures.In addition, overall RT appear to correlate with the overall amplitude and latency of some ERP components, while no significant correlations are established between these and the conflict score, suggesting that the general speed of processing but not the ability to manage conflict might be related to the general form of the ERP.It should be borne in mind in comparing the adult data with previous studies conducted with other flanker tasks that the child-friendly version of this task used in our study was very easy for adults. This could account for the modest amplitude differences between congruent and incongruent trials in this study compared to what has been found with other versions of the flanker task . From whAs shown in Table On the other hand, 4 year old children do not show differences in brain activity among the two flanker conditions until approximately 500 ms post target. Therefore, the effect of flankers is not observed at this age in the relatively early N1 component, and only very weakly at the N2 and twenty-two children participated in the study. All participants were right-handed. The adult participants and the parents of children involved in the study gave written consent prior to the experimental session. Both children and adults were paid for participating in the study.The stimulus sequence for each trial was controlled using E-Prime . Each trial began with a sound to alert participants about the start of the trial. One second after the sound, a line with five drawn fish was presented in the center of the screen Figure . The cenEEG was recorded using a 128-channel Geodesic Sensor Net for chilThe EEG signal was digitized at 250 Hz. Impedances for each channel were measured prior to recording and kept below 80 kΩ during testing. Recording in every channel was vertex-referenced and the time-constant value was 0.01 Hz for both children and adults. Data were recorded using Net Station 2.0 (EGI Software) and processed using Net Station 3.0.vs adults difference was significant (t(23.4) = -3.66; p < .001).Once acquired, data were filtered using a FIR bandpass filter with 12 Hz low-pass and 1 Hz high-pass cutoffs. Continuous EEG data was segmented into target-locked epochs. The epochs were 1 sec. long for adults (-200 ms to 800 ms around target) and 1.7 sec. long for children (-200 ms to 1500 ms around target). Segmented files were scanned for artifacts with the Artifact Detection NS tool using a threshold of 70 μV (adults) or 100 μV (children) for eye blinks and eye movements. Segments containing eye blinks or movements as well as segments with more than 25 bad channels were rejected. Within each segment, channels with an average amplitude of more than 200 μV or a difference average amplitude of 100 μV were also discarded from further processing. Finally, particular channels were rejected if they contained artifacts of any kind in more than 50% of the segments. Children's data were also visually inspected trial by trial to make sure the parameters of the artifact detection tool were appropriate for each child. As a consequence of the artifact detection procedure, an average of 36% of the ERP segments in the children data and an average of 18.5% of the ERP segments in the adults were rejected. The larger number of rejected segments for the children was due to a higher frequency of blinks, mouth and/or head movements, speaking, and other behaviors that generate artifacts on the EEG signal during the experimental procedure. Thus, we decided to have a criterion of a minimum of 12 clean segments per flanker condition among the correctly responded trials for further processing individual data. All adults participants and a total of 14 children reached this selection criterion. The average number of segments included in the averaged ERPs was 53.2 (SD: 23.1) for the children , and 80.3 (SD: 17.3) for adults , and this children Artifact-free segments for correct responses were averaged across conditions and subjects and re-referenced against the average of all channels. The 200 ms preceding the target served as baseline.MRR, MIP & MKR designed the study and participated in the theoretical elaboration of the paper. MRR was responsible for the data collection and data analysis processes. CPD designed and performed part of the statistical analysis on the EEG data.

Salmonella leads to activation of signaling cascades that ultimately initiate the proinflammatory gene program. The transcription factor NF-κB is a key regulator/activator of this gene program and is potently activated. We explored the mechanism by which Salmonella activates NF-κB during infection of cultured intestinal epithelial cells and found that flagellin produced by the bacteria and contained on them leads to NF-κB activation in all the cells; invasion of cells by the bacteria is not required to activate NF-κB.Infection of intestinal epithelial cells by pathogenic Salmonella. Flagellin expression was required for Salmonella invasion of host cells and it activated NF-κB via toll-like receptor 5 (TLR5). Surprisingly, a number of cell lines found to be unresponsive to flagellin express TLR5 and expression of exogenous TLR5 in these cells induces NF-κB activity in response to flagellin challenge although not robustly. Conversely, overexpression of dominant-negative TLR5 alleles only partially blocks NF-κB activation by flagellin. These observations are consistent with the possibility of either a very stable TLR5 signaling complex, the existence of a low abundance flagellin co-receptor or required adapter, or both.Purified flagellin activated the mitogen activated protein kinase (MAPK), stress-activated protein kinase (SAPK) and Ikappa B kinase (IKK) signaling pathways that lead to expression of the proinflammatory gene program in a temporal fashion nearly identical to that of infection of intestinal epithelial cells by Salmonella mediated NF-κB and proinflammatory signaling and gene activation by this flagellated pathogen. In addition, expression of the fli C gene appears to play an important role in the proper functioning of the TTSS since mutants that fail to express fli C are defective in expressing a subset of Sip proteins and fail to invade host cells. Flagellin added in trans cannot restore the ability of the fli C mutant bacteria to invade intestinal epithelial cells. Lastly, TLR5 expression in weak and non-responding cells indicates that additional factors may be required for efficient signal propagation in response to flagellin recognition.These collective results provide the evidence that flagellin acts as the main determinant of Salmonella and other enteroinvasive pathogenic bacteria such as enteroinvasive E. Coli, Shigella and Yersinia upon infection of IECs leads to the up-regulation of the expression of host genes, the products of which activate mucosal inflammatory and immune responses and alter epithelial cell functions aminomethane (Tris) was purchased from Fisher Scientific . Fetal calf serum was purchased from US Biotechnologies Inc. . Para-nitro-phenylphosphate (PNPP) was purchased from Aldrich Chemical . The Polyacrylamide gel electrophoresis (PAGE) supplies: acrylamide, bis-acrylamide, sodium dodecyl sulfate (SDS), TEMED, and ammonium persulfate were purchased from Bio-Rad Laboratories . Dulbecco's modified essential medium (DMEM), DMEM:F12, phosphate buffered saline (PBS), glutamine, penicillin G, streptomycin, amphotericin B, and Grace's Insect medium were purchased from Invitrogen . Luria Broth (LB) was purchased from Becton Dickson and Co . The protease inhibitors: aprotinin, bestatin, leupeptin, pepstatin A, and phenylmethylsulfonyl fluoride (PMSF) were purchased from Cal Biochem . Protease inhibitor cocktail contained 10 μg/ml aprotinin, 2.5 μg/ml leupeptin, 8.3 μg/ml bestatin, and 1.7 μg/ml pepstatin A. Phorbol 12-myristate 13 acetate (PMA), N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (Hepes), anisomycin, and 2-[N-morpholino]ethanesulfonic acid (MES) were purchased from Sigma Chemical . All other reagents were purchased from Sigma Chemical or Fisher Scientific unless stated otherwise.2 atmosphere. T84 colorectal carcinoma cells (ATCC CCL-248) were cultured in DMEM:F12 with 2 mM glutamine, 5% Fetal Calf Serum, 100 Units/ml Penicillin G, and 100 μg/ml Streptomycin at 37°C in a humidified 5% CO2 atmosphere. H5 insect cells (Invitrogen) were cultured in Grace's medium with 2 mM glutamine, 10% Fetal Calf Serum, 100 Units/ml Penicillin G, 100 μg/ml Streptomycin, and 0.25 μg/ml amphotericin B at 28°C. MyD88-/- & TLR2-/-/TLR4-/- double knockout cells were obtained from Shizuo Akira and Osamu Takeuchi and grown in DMEM with 2 mM glutamine, 10% Fetal Calf Serum, 100 Units/ml Penicillin G, and 100 μg/ml Streptomycin at 37°C in a humidified 5% CO2 atmosphere.HT29 human intestinal epithelial cells (ATCC HTB-38), HeLa cervical epithelial adenocarcoma cells (ATCC CCL-2), 293T kidney cells (CRL-11268), A549 lung carcinoma cells (ATCC-185), and T98G glioblastoma cells (ATCC CRL-1690) were cultured in DMEM with 2 mM glutamine, 10% Fetal Calf Serum, 100 Units/ml Penicillin G, and 100 μg/ml Streptomycin at 37°C in a humidified 5% COSalmonella typhimurium strain SJW1103 [Salmonella typhimurium and can only express the Phase I fliC flagellin, SJW86 (SJW1103 FliC::TN10), and SJW134 (SJW1103 FliC and FljB deletions) were obtained from Robert Macnab and have been described [Salmonella serovar dublin strain 2229, strain SE1 (2229 SopE mutant), strain SB2 (2229 SopB mutant), and SE1SB2 (2229 SopE and SopB mutant) were obtained from Edward Galyov and have been described [Salmonella strains for stimulation were grown in LB at 37°C without agitation for 16 hours, centrifuged at 6,000 × g for 1 minute, gently washed with PBS, and gently suspended in DMEM to maintain cells with attached flagella.bilized) is a wilescribed . Salmoneescribed ,15. SalmSalmonella host is internalized by mammalian cells, obtained from Stanley Falkow [Plasmid pFM10.1 (ampicillin resistance), encodes a green fluorescent protein (GFP) expressed after the ord, CA) and was S. dublin 2229 or S. typhimurium SJW1103. Starter cultures were grown in Luria broth (LB) for 18 hours at 37°C with aeration, diluted 1:5000 in fresh LB, and grown for 12 hours under the same conditions. All subsequent procedures were performed at 4°C. Cells were removed from the medium by centrifugation at 10,000 × g for 5 min and discarded. The supernatant containing flagellin was filtered through a 0.8 micron filter to remove residual cells. Supernatant was concentrated 100 fold using an Amicon 100 kiloDalton (kDa) cutoff membrane (Millipore). Initial studies used concentrated culture supernatant from S. dublin strain 2229 that was treated with DNase, RNase, Protease K, boiled for 20 min or 100 mM DTT at 37°C for 2 hours and used for stimulation of cultured cells.Native flagellin was harvested from S. typhimurium 1103 bacterial culture supernatant was washed 4 times by 1:10 dilution with 50 mM MES, pH 6.0, 50 mM NaCl and re-concentrated. Material not retained by the 100 kDa membrane was discarded. Washed culture supernatant was fractionated by gel permeation or anion exchange chromatography for analysis. For long-term storage, washed culture supernatant was supplemented with protease cocktail and stored at -20°C.Concentrated Fractionation by gel permeation chromatography was performed with a Superose 12HR column (Pharmacia) on a Bio-Logic system (Bio-Rad). One-half mililiter of 100× washed supernatant was separated on the column at 0.4 ml/minute in 50 mM Hepes, pH 7.4, 200 mM NaCl. Fractions (0.5 ml) were collected, and 50 μl was fractionated by SDS-PAGE and stained with Bio-Safe Coomassie (Bio-Rad). Thirty microliters of each fraction was used for stimulation of HT29 cells (60 mm dishes) for 45 min and NF-κB DNA binding activity in the resulting whole cell extracts extracts were assayed by EMSA. The column was standardized with catalase (232 kDa), aldolase (158 kDa), abumin (67 kDa), ovalbumin (43 kDa), and Chymotripsinogen A (25 kDa), all obtained from Amersham-Pharmacia.Fractionation by anion exchange chromatography was performed with Poros HQ matrix on a Bio-Logic system. Five mililiters of 100× washed supernatant was separated at 1 ml/minute in 50 mM Hepes, pH 7.4, and a NaCl gradient from 50–500 mM. Fractions were collected and 5 μl of each fraction was examined by 10% SDS-PAGE. Proteins were fractionated on duplicate 10% SDS-PAGE precast gels (BioRad). One gel was stained with Bio-Safe Coomassie (Bio-Rad) and the protein bands were isolated for Mass Spectroscopy analysis (CCF Mass spectroscopy core facility) from the other identical non-stained gel, by electro-elution with a whole gel eluter (Bio-Rad) and SDS was removed with SDS-Out per the manufacturers directions. Proteins isolated from bands B1 to B6 were acetone precipitated by addition of 20 μg Aprotinin and 5 μg of BSA to each eluted fraction, ice-cold acetone (-20°C) was added to 80%, mixed well and precipitated overnight at -20°C. Proteins were pelleted by centrifugation at 14,000 × g in the cold for 30 min, acetone/liquid was removed and the pellets washed 2× with 1 ml acetone (-20°C). After removal of the acetone, protein pellets were air dried and then resuspended and denatured in 5 μl of 6 M guanidinium hydrochloride (Gu-HCl) at room temperature for 30 min. Resuspended proteins were two-fold serially diluted in DMEM to a final Gu-HCl concentration of 55 mM to renature the proteins. Two hundred fifty microliters of individual renatured proteins/DMEM were added per ml to HT29 cells (60 mm dishes) and whole cell extracts were prepared 45 min after stimulation and were assayed for NF-κB DNA binding activity by EMSA.S. typhimurium 1103 containing flagellin was boiled for 20 minutes and precipitants removed by centrifugation at 15,000 × g. The supernatant containing flagellin was diluted 1:2 with 50 mM MES, pH 6.0, 50 mM NaCl and mixed with 2 ml Poros SP cation exchange matrix (PerSeptive Biosystems) per 1 liter of original culture. The Poros SP matrix was prepared as a 50% slurry and equilibrated with 50 mM MES, pH 6.0. The flagellin preparation and matrix were mixed on a roller at 12 to 14 RPM for 2 hours. The matrix along with bound contaminants was removed by filtration through a 0.85 micron filter and discarded, flagellin failed to bind to the cation exchange matrix at pH 6.0 and eluted in the flowthrough and was collected.The washed and concentrated culture supernatant from The pH of the flowthrough was adjusted by five-fold dilution of the sample with 50 mM Hepes, pH 7.8, 50 mM NaCl, and loaded onto a Poros HQ anion exchange column equilibrated with 50 mM Hepes, pH 7.4, 50 mM NaCl. The column was washed with 2 volumes 50 mM Hepes, pH, 7.4, 50 mM NaCl, and eluted with a 10 column volume linear gradient of 50–500 mM NaCl in 50 mM Hepes, pH 7.4. Flagellin eluted from the column between 200–275 mM NaCl. Fractions containing flagellin were pooled and concentrated. The preparation was determined to be pure by electrophoresis of 5 μg protein by SDS-PAGE and stained with Bio-Safe Coomassie (Bio-Rad). Samples were stored at -80°C in 50 mM Hepes, pH 7.4, approx 225 mM NaCl, 10% glycerol and protease cocktail. A 4 liter preparation of culture supernatant yielded 2 mg purified flagellin.Gels were fixed and stained . All of the following procedures were performed by the CCF Mass spectroscopy core facility. Excised gel bands were reduced (100 mM DTT), and alkylated (100 mM iodoacetamide). Proteins in the gel bands were digested with modified trypsin with an overnight incubation at 37°C. Tryptic peptides were extracted from the gel with 50% acetonitrile, 0.1% acetic acid, concentrated in a SpeedVac (Thermo Savant) to remove acetonitrile, and reconstituted to 20 uL with 0.1% acetic acid. Extracted peptides were subjected to reversed phase liquid chromatography , coupled to a Finnigan LCQ DECA ion trap mass spectrometer for peptide sequencing, as described .IκBα amino acids 1 to 54 fused to GST or cJUN amino acids 1–79 fused to GST were prepared as previously described -39 and sSalmonella invasion. Cover slips were mounted with Vectashield mounting medium with DAPI , and cover slips sealed to slides.HT29 cells for microscopic examination were grown in 6 well plates on sterile cover slips to a density of 50–75%. Cells were stimulated as described above. After stimulation, cover slips with HT29 cells were washed 2 times with ice cold PBS and fixed with 4% w/v formalin at room temperature for 20 minutes. Cells were washed 4 times with PBS prior to mounting for visualization of Cells for antibody staining were treated with absolute methanol for 20 minutes following formalin fixation, then washed 3 times with PBS supplemented with 0.1% BSA (PBSB) and used directly or stored in the cold after azide was added to 0.02%. For p65(RelA) localization, cells on coverslips were blocked for 1 h at 37°C with PBS supplemented with 1% BSA. The PBSB was removed, washed once with PBSB and coverslips were placed cell-side down onto 150 μl of p65 antibody diluted 1:1500 in PBSB on a square of parafilm and placed in a humidified chamber at 37°C for 1.5 h. Coverslips were removed and placed cell-side up in 6-well dishes and washed 3 × 5 min with PBSB. Coverslips were then removed and placed cell-side down onto 150 μl of FITC-labeled donkey anti-rabbit secondary antibody (1:300 in PBSB) on a square of parafilm and placed in a humidified chamber at 37°C for 1.5 h. Coverslips were removed and placed cell-side up in 6-well dishes and washed 5 × 5 min with PBSB, removed and placed cell-side down onto slides mounted with Vectashield with DAPI and then sealed. NF-κB localization was determined by indirect immunofluorescence. Samples were observed on a Leica DMR upright microscope at 400× with oil immersion and equipped with FITC and UV filters. Images were collected with a MicroMax RS camera , and Image Pro plus, version 4.5, software . Color enhancements were performed with Image Pro plus software. Visible light plus color overlays for Fig. 8 Salmonella/ml at 37°C for desired times and extracts prepared as below. Cells harvested beyond one hour were washed with warm PBS and supplemented with warm DMEM, 2 mM glutamine, and 200 ug/ml gentamycin after 1 hour and returned to 37°C until extract preparation desired.Mouse embryo fibroblasts (MEFs) or HT29 cells were grown in DMEM as above to a density of 90% prior to stimulation. All cells were washed with warm PBS and supplemented with DMEM without serum or antibiotics in preparation for stimulation. Cells were stimulated with; 10 ng/ml TNFα, 1 μg/ml flagellin unless specified otherwise, 20 μg/ml Anisomycin, 12.5 ng/ml PMA, or 10Cells were washed with ice-cold PBS and all subsequent steps carried out at 4°C or on ice. Cells were scraped from the dish in ice-cold PBS, and collected by centrifugation at 1000 × g for 1 minute. Cells were lysed by suspension in 50 mM Tris-HCl, pH 7.6, 400 mM NaCl, 25 mM beta-glycerol phosphate, 25 mM NaF, 10 mM PNPP, 10 % glycerol, 0.5 mM sodium orthovanadate, 0.5% nonidet-40 (NP-40), 5 mM benzamidine, 2.5 mM metabisulfite, 1 mM PMSF, 1 mM DTT and protease inhibitor cocktail as described .NF-κB DNA binding assays were carried out as previously described ,35,38. AHT29 cells, 90–95% confluent in 35 mm round dishes, were prepared for stimulation as above and treated with a 1 ml suspension of Salmonella SJW1103 or SJW134 or left untreated in triplicate as above. After one hour, HT29 cells were washed 4× with warm PBS, supplemented with warm DMEM, 2 mM glutamine, and 200 μg/ml gentamycin, and incubated at 37°C for 4 hours. Cells were then harvested as above and lysed by suspension in 1 ml sterile distilled water. Ten-fold serial dilutions were prepared in PBS and 100 μl of each dilution was plated on LB agar plates and grown at 37°C for 20 hours. Colonies were counted and averaged.2). Immunopellets were resuspended in 30 μl Kinase buffer with 0.1 mM orthovanadate, 50 μM "cold" ATP, 5 μCi γ-32P-ATP, 2 mM DTT, and 2 μg of soluble GST-IκBα1–54 or GST-cJUN1-79, and incubated at 30°C for 30 minutes. Reactions were stopped by the addition of 15 μl 4× SDS-PAGE loading buffer, heated at 95°C for 5 minutes, and resolved on 10% SDS-PAGE gels by standard procedures. Gels were rinsed, stained with Bio-Safe Coomassie (Bio-Rad) to visualize protein bands, rinsed, photographed then dried and exposed to Kodak X-OMAT AR film to detect substrate phosphorylation.Whole cell extracts (250 μg) were supplemented with 150 μl of Buffer A , and immuno precipitation kinase assays carried out as described using eiProtein samples (40 μg) were resolved by SDS-PAGE on a 10% acrylamide gels by standard procedures, and proteins transferred to PVDF membrane (Millipore) and probed with antibodies as described . MembranAll DN-TLRs were constructed using PCR. The universal 5' primer consisted of a 5'KPN I restriction site followed by sequences encoding the kozak sequence, translational start site, and preprotrypsin leader sequence of pCMV-1 (Sigma) that all the wild-type TLRs were initially cloned into. The 3' anti-sense (AS) primers were human TLRgene-specific primers (sequences available upon request) that created a stop codon immediately after a conserved tryptophan in Box 9 of the TLR TIR homology domain according to Bazan , thus crRenilla luciferase normalization reporter and 1.85 μg pCDNA3.1 plasmid DNA as bulk filler DNA) and fire-fly luciferase expression was normalized to Renilla luciferase expression using the dual-luciferase assay . Fold inductions were calculated and values between experiments did not vary more than 15%, a representative experiment is presented. Transfection of 293T cells was performed with lipofectamine 2000 (Invitrogen) in 6-well dishes in triplicate as per the manufacture's protocol. TLR expression plasmids were added at 2 μg/well, and NF-κB and normalization control plasmids were as above with HT29 cells and pCDNA3.1 plasmid DNA as bulk filler DNA to a final DNA mass of 4 μg/well. Fold inductions were calculated and values between experiments (N of 3) did not vary more than 10%, a representative experiment is presented.HT29 cells were transfected with Lipofectamine Plus (Invitrogen) as previously described . In tran2PCR was performed with an iCycler (Bio-Rad) to quantify TLR1 through TLR10 mRNA, 18S rRNA, and GAPDH mRNA. RT2PCR (25 ul reaction volume) was performed with the appropriate primers (SuperArray) per manufacturers instructions in triplicate with HotStart Taq DNA polymerase (SuperArray) at 95°C for 15 min to activate Taq and amplified for 40 cycles . RT2PCR was performed on the minus RT controls with TLR5 primers to detect DNA contamination. Real-time PCR analysis was performed using SYBR-green (Perkin-Elmer) according to manufacture's instructions with the specific primer pairs indicated above and primer pairs for 18S ribosomal RNA as reference RNA (Classic 18S primer pairs – Ambion Inc). Cycle time (Ct) was measured using the iCycler™ and its associated software (Bio-Rad). Relative transcript quantities were calculated by the ΔΔCt method using 18S ribosomal RNA as a reference amplified from samples using the Classic 18S primer pairs from Ambion, Inc . Normalized samples were then expressed relative to the average ΔCt value for untreated controls to obtain relative fold-change in expression levels. Fold change in mRNA expression was expressed as 2ΔΔCt. ΔCt is the difference in threshold cycles for the TLR mRNAs and 18S rRNA. ΔΔCt is the difference between ΔCt non-simulated control and ΔCt stimulated sample. Values for fold-induction varied less than 5% among replicates.Cells N = 3) were stimulated 3 hours at 37°C with TNFα or FliC or left untreated and harvested for total RNA isolation. Total cellular RNA was extracted from cells with Trizol reagent (Invitrogen) [ were stiSalmonella invasion protein; PMA, phorbol 12-myristate 13 acetate; PNPP, para nitrophenyl phosphate; TK, thymidine kinase; BF, bright field; NP-40, nonidet-40; NRS, normal rabbit serum; IN, input; Ct, cycle time.The abbreviations used are: FBS, fetal bovine serum; IL-1, interlukin-1, SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; EMSA, electromobility shift assay; IB, immunoblot; KA, kinase assay; GST, glutathione S-transferase; PBS, phosphate-buffered saline; TNFα, tumor necrosis factor α; NF-κB, nuclear factor kappa B; IKK, Ikappa B kinase; IκB, Ikappa B; PCR, polymerase chain assay; RT-PCR, reverse transcription polymerase chain assay; Gu-HCl, guanidinium hydrochloride ; MAPK, mitogen activated protein kinase; SAPK, stress-activated protein kinase; ERK, extracellular regulated kinase; TLR, toll-like receptor; DN, dominant-negative; JNK, Jun N-terminal kinase; AP-1, activator protein-1; MEF, mouse embryo fibroblast; WCE, whole cell extract; IEC, intestinal epithelial cell; MCP1, macrophage chemoattractant protein 1; TTSS, type III secretion system; Sip, TT and AD initiated the study and performed the majority of the experiments and contributed equally and were assisted by NK and JL. MD constructed a number of DN-TLRs and JD developed the study, provided funding support, oversaw the project and also constructed a number of mutant TLRs.

Profile-based analysis of multiple sequence alignments (MSA) allows for accurate comparison of protein families. Here, we address the problems of detecting statistically confident dissimilarities between (1) MSA position and a set of predicted residue frequencies, and (2) between two MSA positions. These problems are important for (i) evaluation and optimization of methods predicting residue occurrence at protein positions; (ii) detection of potentially misaligned regions in automatically produced alignments and their further refinement; and (iii) detection of sites that determine functional or structural specificity in two related families.For problems (1) and (2), we propose analytical estimates of P-value and apply them to the detection of significant positional dissimilarities in various experimental situations. (a) We compare structure-based predictions of residue propensities at a protein position to the actual residue frequencies in the MSA of homologs. (b) We evaluate our method by the ability to detect erroneous position matches produced by an automatic sequence aligner. (c) We compare MSA positions that correspond to residues aligned by automatic structure aligners. (d) We compare MSA positions that are aligned by high-quality manual superposition of structures. Detected dissimilarities reveal shortcomings of the automatic methods for residue frequency prediction and alignment construction. For the high-quality structural alignments, the dissimilarities suggest sites of potential functional or structural importance.The proposed computational method is of significant potential value for the analysis of protein families. Profile-based methods of sequence analysis use multiple sequence alignments (MSA) to extract information about conserved features of a protein family, which are impossible to decipher from a single sequence. Such methods increase both the sensitivity of homology detection and the quality of produced alignments -10, mainin silico sequence design that generates native-like sequences from a structural template. Detection of discrepancies between the model and the real data would assist the analysis of the model's performance and its further improvement. To our knowledge, such statistical assessment has not been proposed up to date.Statistical analysis at the level of individual MSA positions may be used to compare residue frequencies predicted from some model to the actually observed residue usage at the given position in sequence homologs. The model may represent, for example, a method for Several approaches have been proposed to detect potential regions of low alignment quality in sequence-sequence and sequence-profile alignments. These approaches range from identifying low-scoring regions in pairwise alignment to more When the analyzed alignment is highly reliable, detecting positions of significant dissimilarity may reveal sites that determine functional or structural specificity of otherwise similar proteins. Several approaches have been proposed that use comparison of multiple sequence alignments in order to predict such sites -21. HoweP-value Estimation for Alignment Columns), to the analysis of real MSA.In this work, we consider approximate analytical estimates of P-value in two settings: (1) comparison of an alignment column to an emission vector of residue probabilities, and (2) comparison of two alignment columns. These estimates allow detecting cases where the null hypothesis (assumption of similarity) can be confidently rejected. We performed simulation experiments that show consistency of the estimates with the statistical model, and applied our method, PEAC is generated by given vector of emission probabilities f. If this hypothesis is rejected, then the set of emission probabilities is inadequate for the description of the residue content in this alignment column.given alignment column (vector of residue counts ρ(n | f), which is difficult for analytical consideration. To calculate the P-value, we use the multivariate Gaussian approximation of the multinomial distribution, based on the assumption of large statistical samples :The assumed null model of random columns corresponds to a multinomial form of x = {xi} is a random d-dimensional vector of residue counts of size , f is emission vector of residue frequencies, is the mean vector of residue counts, Σ = ||cov|| is the covariance matrix. This approximation of p.d.f. allows for the analytical expression for the P-value (Appendix 1 [see where ix 1 see ): is a regularized gamma-function, d is dimensionality of vector f. Thus, P-value is described by a χ2 distribution with (d - 1) degrees of freedom.where f = {fi}120 to generate a large number Ω = 107 of random columns of a fixed size N, i.e. Ω sets of N residues drawn randomly according to probabilities fi. For each random column, residue counts n = {ni}120 were derived and the multinomial probability of its generation was calculated as , where is the multinomial coefficient. All Ω generated columns were sorted by ρmult in the ascending order. For a given P-value P*, the column number ΩP0 was chosen from this sorted list. This column corresponded approximately to the multinomial P-value P*. This P-value was compared to our estimate Pestim (formula (2)) calculated for the chosen column in the Gaussian approximation of multinomial distribution. For each value P* we performed 10 independent simulations and plotted average values of Pestim against P*, which showed their general consistency. Figure f derived from real alignment columns, and for three typical column sizes N. The accuracy of estimates becomes poorer for lower column sizes and more skewed frequency sets ) with P-values based on the multinomial model. In particular, we used a set of residue frequencies ets Fig. . Howeverm* and n* are generated by a single vector of emission probabilities. As the prior distribution of emission vectors, we use the maximum likelihood (ML) estimate based on m* and n*. Such prior should produce the conservative upper estimate of the P-value. Rejection of hypothesis H0(2) would mean that the two alignment columns are highly dissimilar.two observed columns The P-value for this hypothesis is calculated in three steps:n, m}, we produce the ML estimate of the p.d.f. for emission vectors f that can generate both columns simultaneously. We assumed a simple form of multivariate Gaussian distribution and calculated ML estimates of its mean and variance values (formulae B5).a). Given the two vectors of residue counts {θ(f) as the prior to calculate the posterior probability ρ) that a pair of random columns {n, m} is produced by any single emission vector f. Similarly to problem 1, we use multivariate Gaussian approximation of the multinomial distribution that assumes large total residue counts in the generated columns. The posterior probability density can be calculated asb). We use this p.d.f. ρ) = ∫ρ θ (f) df     (3)c). Using (3), we calculate P-value as the integral (Appendix 2 see ):θ(f) is a ML estimate based on the observed alignment columns. The partial integral ∫ρ dm dn can be calculated analytically for any emission vector f, but analytical calculation of full integral (4) is problematic. However, an approximate estimate of this value would suffice, since (i) expression (4) already contains approximations introduced by estimates of θ(f), ρ) and ρ); and (ii) we are interested in a conservative estimate of the upper P-value limit. Hence, we calculate an approximate upper estimate of P-value :erf(x) is error function, andwhere f was used to produce a column of size N by random draw according to these frequencies. Having the vector residue counts n in this column, we produced another vector of counts m that made our estimated P-value Pestim equal to the specified value P0. To produce this vector, we considered sets of residue counts as points in multidimensional and randomly chose a straight line passing through the point n. On this randomly directed line, we found the point m as the solution of equation Pestim = P0, where Pestim is defined by formula (5). Thus, we generated a pair of columns that corresponded to the specified P-value according to the PEAC estimate. We compared this estimate to the actual P-value P* calculated for the generation of m and n by the original vector f. As shown by the plot of P* against Pestim : (1) a given alignment column is generated by a given set of emission residue frequencies; and (2) two given alignment columns are generated by a single set of residue frequencies. We applied both types of estimates to the analysis of real multiple alignments, detecting cases of significant dissimilarity where the null hypotheses were confidently rejected.-320 and 1.0, with the median being approximately 0.01.Using our method, we assessed the consistency between predictions of residue frequencies based on structural considerations, and the frequencies in multiple alignments of sequence homologs. Specifically, we prepared a dataset of 1695 PDB structures and made predictions of residue propensities at each position, based on local structural environment. In parallel, the sequences corresponding to these structures were used as queries for PSI-BLAST searches, and profiles of detected confident sequence homologs were constructed (see Methods). The effective residue frequencies at profile positions were compared to the structure-based predictions, and P-values for each position were estimated using PEAC. The histogram of produced P-values for all positions is shown in Fig. P < 10-100). These sites were located mainly in the secondary structure elements, most frequently at their ends, and corresponded to unusual local distortions of 3D conformations. We compared residue content in the corresponding subset of alignment columns to the whole dataset. As shown in Fig. To analyze the cases of most pronounced discrepancy between our structure-based predictions and residue frequencies observed among sequence homologs, we chose ~1000 protein positions (0.3% of the whole dataset) that had lowest P-values of their carboxyl caps (data not shown). When we excluded glutamates and aspartates whose charge could be neutralized by contacts with positively charged arginine, lysine or histidine, the remainig portion of the set was still comprised of mostly buried residues In automatically produced alignments of sequences or structures, consideration of profiles of confident homologs helps to detect inconsistencies. According to our observations, these inconsistencies are caused mainly by alignment errors. (ii) In the high-quality structure based alignments, where structural equivalence of residues is confident, the low P-values may indicate functional specificity of spatially aligned residues.As an example of application (i), we evaluated our method by ability to predict erroneous residue matches produced by an automatic sequence aligner , as com-2.We then sorted all ClustalW positional matches by ascending P-values and classified them as true or false predictions of ClustalW errors. For our purpose, the ClustalW matches different from those in BaliBase were considered true positive predictions; whereas correct matches were considered false positives. Having the ranked list of true and false positive predictions, we generated sensitivity curve collected pairs of protein domains that are structurally similar according to the DALI alignments in the F-2 and the median was approximately 0.1 10-2. For identities around 25% . Using Insight II suit for molecular modeling and simulation (Accelrys), we performed a detailed manual analysis of structural superposition for a portion of the corresponding structural alignments. We found that the majority of inspected positions were apparently misaligned. Approximately 80% of these residues were located within 5 positions from a gap introduced in the structural alignment. Vicinities of gaps generally correspond to less similar fragments of aligned structures, which are more difficult to superimpose and where alignment errors can occur more frequently.We considered residue contents of the MSA columns corresponding to these low-P-value position pairs, and compared these contents to the average residue frequencies in the whole MSA datasets. In the set corresponding to 15 ± 1% sequence identity, the most pronounced difference was a higher frequency of aspartate at the position pairs with low P-values Fig. . In the We further concentrated on the aligned structural positions that showed unusual residue frequencies in the corresponding MSA columns. In the set corresponding to 15 ± 1% sequence identity, we considered positions with highly conserved aspartate, whereas in the set corresponding to 25 ± 1% sequence identity, we considered positions with high combined frequency of methionine, leucine and isoleucine. In an attempt to exclude apparently misaligned positions, we considered only those positions that were distanced more than 5 residues from gaps in the FSSP structural alignment. We selected and manually analyzed 16 of such positional matches. However, even among these selected matches most of the discrepancies were still caused by apparent alignment errors: 10 cases corresponded to structural misalignments , and 3 cases were caused by biased residue frequencies at profile positions, due to errors in PSI-BLAST alignments of sequence homologs. The remaining 3 position pairs did not involve apparent errors of either DALI or PSI-BLAST. These pairs might represent real differences in residue preferences at structurally equivalent positions.b). In glyoxalase II, D134 binds zinc atoms directly [Figure directly , whereasdirectly Fig. 7Cb. In glya illustrate superposition errors as the typical source of low P-values for automatic structural alignments. DALI . However, such alignment corresponds to low positional P-values, indicating a significant difference between structure-based and sequence-based position similarity. The optimal profile-based alignment . These proteins possess the same α/β knot fold but belong to different SCOP families, SpoU-like RNA 2'-O ribose methyltransferase and Ybea-like, respectively. Using manually curated structure-based alignment of the two proteins and MSAs of their homologs detected by PSI-BLAST, we considered structurally equivalent positions that were well aligned in space . We found 24 such positions, the majority being concentrated in the region of dimer interface, which includes the 'knotted' C-terminal helix D detection of potentially misaligned regions in automatically produced alignments and their further refinement; and (iii) detection of sites that determine functional or structural specificity in two related families.We proposed P-value estimates to assess statistical significance for (1) comparison of a single position in a multiple alignment to a set of emission residue frequencies; and (2) comparison of two alignment positions. Computational implementation of these estimates showed its potential value for several important tasks in sequence analysis: (i) evaluation and optimization of methods predicting propensities for residue occurrence at protein positions, such as protocols for neffPSIC for each symbol in the alignment column , and then applied the following transformation [Effective residue counts at alignment positions were calculated based on the PSIC method. ormation :neff corresponds to the number of randomly aligned sequences with the average number of residue types per position equal to neffPSIC .-5. In the resulting multiple alignments of detected homologs, we purged sequences whose identity to the query was less than 25%, so that only confident sequence homologs were used for profile construction. We split query sequence into fragments of fixed length F. For each fragment, we extracted the corresponding segment of the multiple alignment and removed the sequences with deletions (gaps) in this fragment. For a query of length L we produced L-F+1 sub-alignments and derived effective residue counts as described above. In this work, we used the library of profile fragments of length F = 6, which provided accurate results when applied to the prediction of local structural environment from a sequence profile [We applied our method to compare structure-based predictions of residue probabilities to the actual residue frequencies observed among sequence homologs. For such a comparison, we produced sequence profiles that correspond to fragments of known 3D structures. Briefly, we used a non-redundant set of structures from PDB . SCOP ,46. entr profile .φ and ψ dihedral angles) at the given position and the preceding position, and solvent accessibility of the sidechain at the given position. For a given position we used the partition of Ramachandran plot into 15 classes proposed by Shortle [The equilibrium frequency of an amino acid at a position in protein structure reflects the energetic fitness of the sidechain in the local structural environment ,39. To e Shortle For the As the second application, we estimated statistical significance of similarity between pairs of columns in multiple alignments. Namely, we used pairs of structurally similar proteins , proWe chose protein pairs with relatively low sequence identities, where detection of similarity between sequences is not straitforward. We focused on two identity ranges: 25 ± 1% (at the upper bound of twilight zone) and a lower range of 15 ± 1%. From each FSSP family, we extracted the parent sequence and all sequences of a significant structural similarity to the parent (Z-score greater than 5.0), with sequence identity to the parent within a given range. We found totally 494 and 1406 sequence pairs with identities 25 ± 1% and 15 ± 1%, respectively. These numbers were reduced by purging symmetric pairs and manual inspection of the remaining domains for the presence of repeats and low-complexity regions. For further analysis, we used 251 sequence pairs with identity 25 ± 1% and 340 pairs with identity 15 ± 1%, each pair representing a unique FSSP family. For each sequence, we ran 5 iterations of PSI-BLAST 2.2.1 against the NCBI nr database and obtained multiple alignments of detected homologs. We then applied a procedure of the alignment processing similar to that implemented in PSI-BLAST [Solvent accessible surface area (ASA) for the residues of interest was determined using NACCESS package , which wRS carried out the theoretical considerations, computational experiments, analysis of the results and drafted the manuscript. NG conceived of the study, and participated in its design and coordination. Both authors read and approved the final manuscript."P-value for multivariate Gaussian distribution".Click here for file"Upper estimate of P-value for similarity between two alignment columns".Click here for file

The coronary artery calcium (CAC) score is an independent predictor of coronary heart disease. We sought to combine information from the CAC score with information from conventional cardiac risk factors to produce post-test risk estimates, and to determine whether the score may add clinically useful information.We measured the independent cross-sectional associations between conventional cardiac risk factors and the CAC score among asymptomatic persons referred for non-contrast electron beam computed tomography. Using the resulting multivariable models and published CAC score-specific relative risk estimates, we estimated post-test coronary heart disease risk in a number of different scenarios.Among 9341 asymptomatic study participants , we found that conventional coronary heart disease risk factors including age, male sex, self-reported hypertension, diabetes and high cholesterol were independent predictors of the CAC score, and we used the resulting multivariable models for predicting post-test risk in a variety of scenarios. Our models predicted, for example, that a 60-year-old non-smoking non-diabetic women with hypertension and high cholesterol would have a 47% chance of having a CAC score of zero, reducing her 10-year risk estimate from 15% (per Framingham) to 6–9%; if her score were over 100, however (a 17% chance), her risk estimate would be markedly higher (25–51% in 10 years). In low risk scenarios, the CAC score is very likely to be zero or low, and unlikely to change management.Combining information from the CAC score with information from conventional risk factors can change assessment of coronary heart disease risk to an extent that may be clinically important, especially when the pre-test 10-year risk estimate is intermediate. The attached spreadsheet makes these calculations easy. Aggressive primary prevention of coronary heart disease (CHD) is most appropriate in patients at relatively high risk of CHD events ,2. The cTo answer this question, we need to know the effects of age, sex and other CHD risk factors on the expected distribution of CAC scores. Several large cross-sectional studies have described the prevalence and extent of CAC among different age/sex groups ,8-10 witWe identified a large sample of men and women without clinical CHD who presented for electron beam computed tomography scanning. Using questionnaire data collected from these patients about smoking habits and medical history , we determined how conventional CHD risk factors, along with age and sex, affect CAC scores. We then developed a method for combining information from conventional risk factors and the CAC score , and we present several examples illustrating how that method may be applied in common clinical situations.All persons referred by their physician to an electron beam computed tomography (EBCT) scanning center in Nashville, Tennessee for measurement of coronary artery calcification between May 15, 1995 and December 31, 1997 were eligible for inclusion. Subjects with a history of CHD or complaining currently of any chest pain were excluded, as were subjects for whom CHD risk factor data were incomplete or missing. Only the first CAC score was included for those who received more than one EBCT scan.Current age, sex and presence of CHD risk factors were elicited by questionnaire from subjects and referring physicians. Each subject was labeled with hypertension, high cholesterol and/or diabetes mellitus if they answered affirmatively to the question, "Has your physician ever told you that you needed medicine for X?", or if their physician confirmed that such a condition was documented in their medical records. Patients were labeled as smokers if they currently smoked or had quit smoking within the preceding 3 months. No direct measurements of blood pressure, lipids or glucose were taken for the purposes of this study.We estimated the 10-year risk of a first CHD event using published mathematical models based on the Framingham study . For thi2) with density ≥ 130 Hounsfield units. The CAC score was calculated according to the method described by Agatston [Each subject underwent electron beam computed tomography scanning with an Imatron C-100 or C-150 scanner after giving written informed consent. During a single breath hold, 40 consecutive slices of 3 mm thickness were obtained starting at the level of the carina and proceeding to the level of the diaphragm. Scans were obtained within 100 ms and were electrocardiographically triggered at 60–80% of the R-R interval. Coronary calcification was defined as a plaque of at least 3 consecutive pixels age and sex, 2) age, sex, hypertension, high cholesterol, smoking, and diabetes, and 3) the Framingham 10-year CHD risk estimate. We examined whether the effects of age were linear by testing a quadratic term in the model containing only age and sex. We evaluated the ability of each logistic model to discriminate subjects at high and low risk for CAC using the C-statistic, and estimated the proportion of variability in the extent of CAC explained in each linear regression model using the adjusted-R2 tests with 3 degrees of freedom to compare the expected frequencies based on each model with the observed frequencies. Lower p values, in this case, indicate a poorer fit of the model to the observed data. All statistical analyses were performed with Stata 7.0 .Finally, we used coefficients, intercepts and residual variance from logistic and linear models to estimate the probability that the CAC score of an individual with known risk factors would fall into each of four standard CAC score categories . We estimated these probabilities, using models containing the 10-year risk estimate as the only predictor, for a range of 10-year risk estimates. We also estimated these probabilities, using models with all CHD risk factor predictors, for the specific clinical scenario described in the Introduction (a 60-year-old woman with hypertension and high cholesterol) and for several other scenarios. We compared the actual distribution of CAC scores among 58–62-year-old women with hypertension and high cholesterol in our sample (n = 130) with predictions from 1) our two-stage model, 2) a one-stage model using Ln(CAC score + 1) as a continuous outcome in a linear regression model, and 3) a one-stage model using a censored normal distribution of cube-root transformed CAC scores (a Tobit regression model). This comparison was made both graphically and statistically, using XFirst, we calculated the Framingham 10-year CHD risk estimate according to published models . Next, wWe identified 9341 persons without chest pain or a history of CHD presenting for their first EBCT scan between 4/15/95 and 12/31/97. Our sample was mostly middle-aged, but included persons as young as 35 years and as old as 88 years of age. Forty percent were women. The proportion with cardiac risk factors was high, though only 9% were diabetic (Table th–75th percentile: 0 – 87). The prevalence of zero scores ranged from 80% among women younger than 50 years to 5% among men 70 years old or older. After excluding zero scores, log-transformed CAC scores were approximately normally distributed, and appeared to be strongly associated with age and sex was 135 (± 377), and the median was 4 (25Age and sex were strong predictors of the presence of CAC in logistic regression models Table . There w2 = 0.11) than the full model (R2 = 0.17).Among patients with non-zero CAC scores, age and sex remained strong predictors of the extent of coronary artery calcification, as measured by the Ln(CAC score) Table . Again, Using these models, we estimated the probability of measuring a CAC score in each of four standard CAC score categories using the Framingham 10-year CHD risk estimate, a value easily calculated from conventional CHD risk factors using accessible web- or handheld computer-based software. These probabilities ranged widely based on the value of the 10-year risk estimate, with the probability of measuring a zero CAC score going from 75% (at a 10-year risk of 2.5%) to 13% (at a 10-year risk of 25%) and high cholesterol will have a 15% risk of suffering a CHD event in 10 years, according to the Framingham equation. If this women undergoes EBCT scanning, our models predict a 47% chance that her CAC score will be zero, a 36% chance that it will be between 1–100, a 12% chance that it will be between 101–400, and a 5% chance that it will be greater than 400. By integrating this information with previously published relative risk estimates see , we estiOur strategy outperformed two other modeling strategies in predicting the actual CAC distribution among the 58–62-year-old non-smoking non-diabetic women with hypertension and high cholesterol in our study sample n = 127) are independent predictors of coronary artery calcification. This finding is consistent with previous studies -15. We aFinally, our analysis provides a guide for how to use the CAC score as a surrogate outcome when studying causes of coronary artery disease (a widely used study design -27). TheOur analysis has a number of limitations, perhaps the most important being a lack of clinical detail about participants. While we had information about conventional risk factors , the data were only available from a questionnaire, and were not confirmed by direct measurement. Only dichotomous indicators of such conditions were used. Furthermore, other conditions and indicators of high CHD risk such as family history of CHD, obesity, physical activity, income, education, and levels of C-reactive protein, triglycerides and Lp(a), for example, were unavailable. Whether such factors are important predictors of the presence and extent of coronary artery calcification is unknown. On the other hand, CHD risk assessment is often based on the same type of limited information we had available on each of our patients, so the models we present are perhaps more easily applicable to common clinical situations than models based on more detailed clinical data. Furthermore, a historical indicator of past exposure to high blood pressure or high cholesterol, as we had access to in this study, may actually be more useful as a predictor of CAC than treated blood pressure measured at one point in time. Another important limitation of this study is our lack of data on race/ethnicity – our results may not apply to all ethnic groups. Finally, our data are limited in application to CAC scores measured by electron beam computed tomography with 3 mm slice thickness and the described protocol. While CAC scores measured by the latest spiral computed tomography scanners appear to be similar to those generated by electron beam computed tomography , we cannThe Clinical Research Roundtable at the Institute of Medicine has identified translation of clinical research findings into improvements in medical care as the "next scientific frontier" . While oMP has received speaking and consulting fees from Bayer.MJP conceived the idea for the study, performed the analysis and drafted the manuscript. JAT and MP helped design and interpret the analysis. CM provided statistical guidance and interpretation. TQC recruited the patients and collected the data. WSB provided senior guidance in all aspects. All authors reviewed and commented on multiple drafts of the manuscript and approved the final draft.The pre-publication history for this paper can be accessed here:This spreadsheet is used for combining information from conventional risk factors and the coronary artery calcium score to estimate coronary heart disease risk in an individual patient. Step 1: Enter your patient's clinical information (the red numbers). Step 2: Choose an assumption about the coronary artery calcium score relative risks (optimistic or conservative). Step 3: Find the following results: 1) "Pre-test" 10-year risk of coronary heart disease (CHD) based on Framingham equations; 2) The probability of having a coronary artery calcium (CAC) score that falls within 4 standard CAC score categories; and 3) The "post-test" 10-year risk of CHD for each CAC score category. Step 4: Use the results to interpret a CAC score, or to decide whether or not to order a coronary artery calcium scan. If a score that would change your management is unlikely to occur, it may not be worth the money.Click here for file

Previous research indicated that women are more vulnerable than men to adverse psychological consequences of weight gain. Other research has suggested that weight gain experienced during antipsychotic therapy may also psychologically impact women more negatively. This study assessed the impact of acute treatment-emergent weight gain on clinical and functional outcomes of patients with schizophrenia by patient gender and antipsychotic treatment .Data were drawn from the acute phase (first 6-weeks) of a double-blind randomized clinical trial of olanzapine versus haloperidol in the treatment of 1296 men and 700 women with schizophrenia-spectrum disorders. The associations between weight change and change in core schizophrenia symptoms, depressive symptoms, and functional status were examined post-hoc for men and women and for each medication group. Core schizophrenia symptoms (positive and negative) were measured with the Brief Psychiatric Rating Scale (BPRS), depressive symptoms with the BPRS Anxiety/Depression Scale and the Montgomery-Asberg Depression Rating Scale, and functional status with the mental and physical component scores on the Medical Outcome Survey-Short Form 36. Statistical analysis included methods that controlled for treatment duration.Weight gain during 6-week treatment with olanzapine and haloperidol was significantly associated with improvements in core schizophrenia symptoms, depressive symptoms, mental functioning, and physical functioning for men and women alike. The conditional probability of clinical response (20% reduction in core schizophrenia symptom), given a clinically significant weight gain (at least 7% of baseline weight), showed that about half of the patients who lost weight responded to treatment, whereas three-quarters of the patients who had a clinically significant weight gain responded to treatment. The positive associations between therapeutic response and weight gain were similar for the olanzapine and haloperidol treatment groups. Improved outcomes were, however, more pronounced for the olanzapine-treated patients, and more olanzapine-treated patients gained weight.The findings of significant relationships between treatment-emergent weight gain and improvements in clinical and functional status at 6-weeks suggest that patients who have greater treatment-emergent weight gain are more likely to benefit from treatment with olanzapine or haloperidol regardless of gender. Because antipsychotic drugs are considered the core treatment modality for schizophrenia the diffAlthough most of the literature on treatment-emergent weight gain tends to focus on this event as adverse, a growing body of research has demonstrated a significant link between beneficial therapeutic response and treatment-emergent weight gain. With the exception of a few studies that failed to find an association between weight gain and better clinical outcome -9, most The study of gender differences in the relationship between treatment-emergent weight gain and therapeutic response has gained limited attention and provided conflicting results. A brief report on weight gain during clozapine therapy indicated that greater weight gain was associated with clinical improvement among women, but not among men . In contWomen in the general population appear to be vulnerable to the adverse emotional and psychosocial consequences of weight gain. For women, obesity has been linked to lower life satisfaction, increased social isolation , and lowThe primary objective of this study was to expand on prior research and investigate whether the relations between acute weight gain during antipsychotic therapy and treatment outcomes differ based on patient gender and the specific antipsychotic used in the treatment regimen, olanzapine or haloperidol. This study also aimed to broaden the definition of therapeutic response by extending beyond positive and negative symptoms of schizophrenia to depressive symptoms and levels of mental and physical functioning, because these domains tend to deteriorate with weight gain among women in the general population.We used data of 1296 men and 700 women who participated in a randomized, double-blind, multi-center, clinical trial comparing olanzapine to haloperidol . ParticiParticipants were randomly assigned in 2:1 ratio . Although randomization was not stratified on gender or any other patient characteristics, it resulted in a 2:1 ratio for males (870/426) and for females (426/233). The olanzapine group (N = 1337) included 467 women and 870 men, and the haloperidol group (N = 659) was comprised of 233 women and 426 men.Participants were randomly assigned to olanzapine, 5 to 20 mg/day, or haloperidol, 5 to 20 mg/day. The type of antipsychotic medication used prior to enrollment was not assessed in the current study, but the likelihood of previous treatment with an atypical antipsychotic drug was very low, because the study was initiated in 1994 when only clozapine was available in some of the sites. Further, randomization worked for patient and illness characteristics , and theWe used data from the acute phase, the first 6 weeks of the study, for several reasons. First and foremost, this study was a 6-week randomized double blind clinical trial with a 46-week "responder maintenance period", in which only patients who responded to the acute 6-week treatment per predetermined response criteria were eligible to continue. Consequently, the study design did not permit a longer-term analysis on the link between weight gain and improvement because only patients who improved during the first 6-weeks phase were followed-up for a longer time period. Second, the 6-week period represents a relevant time frame often used in clinical practice to determine treatment outcome and decide on treatment discontinuation . For manDuring the 6-week acute phase, the mean modal dose was 13.2 mg/day (SD = 5.8) for olanzapine and 11.8 mg/day (SD = 5.6) for haloperidol. There were no discontinuations due to weight gain as an adverse event for any treatment group during the 6-week study period, and the rate of discontinuation for any cause was similar for women (62.7%) and men (60.8%), with a significantly smaller proportion of the patients in the olanzapine group (33.5%) than in the haloperidol group . In addition, the percentage of patients who discontinued treatment because of an adverse event or a lack of efficacy was significantly higher in the haloperidol group than in the olanzapine group. Further details on the parent study design and primary findings are available elsewhere .2).This investigation used measures of positive and negative symptoms ("core schizophrenia symptoms"), depressive symptoms, functional status, and body weight. Core symptoms of schizophrenia were assessed by the Positive Symptom and the Negative Symptom subscales on the BPRS extracted from the Positive and Negative Syndrome Scale (PANSS) . Levels To enhance comparability of findings on different measures, the clinical measures were all standardized to z-scores. For the BPRS Core Symptoms, MADRS, and BPRS Anxiety and Depressive Subscale, this was done by subtracting the measure's overall mean and dividing by the measure's standard deviation at baseline. A single measure of depressive symptoms was calculated as the average of the standardized MADRS and BPRS Anxiety and Depressive Subscale. If a score was missing on either depression measure, the score on the available measure was used. The two depression measures were pooled because each is an independent and valid estimate of patients' level of depressive symptoms, and aggregating them should provide the best and most comprehensive estimate of depressive symptoms. Additionally, the pooling helped minimize loss of data, which are assumed not to be missing at random. The SF-36 Physical and Mental Component scores were converted from T-Scores to z-scores.Baseline comparisons used independent samples t-tests for continuous variables and chi-square tests for categorical variables. Effects of treatment and gender on independent variables were assessed using ANCOVA, with the baseline score as well as the number of weeks in the study as covariates. The relationship between change in weight and change in each outcome variable was assessed using separate multiple linear regression analyses, each with corresponding clinical change score as a dependent variable, the corresponding baseline score and number of weeks in the study as covariates, and the following independent variables: weight change, treatment group assignment, and gender. In an additional analysis, the interactions of these three independent variables were added to the regression models.The analyses included measures from baseline and the 6-week visit. Missing data were handled by carrying forward the last observation for all patients with at least one post-baseline assessment. All analyses were performed using the Statistical Package for the Social Sciences (SPSS) version 11.0.Relative to men, women were older, more likely to be Caucasians, were more likely to be overweight or obese, had less severe positive symptoms, lower levels of physical functioning, and had higher levels of depressive symptoms Table . Women w2 = 51.8, p < 0.001).In order to illustrate the differences in weight gain by treatment group and gender, the patients were grouped into thirds based on their percentage of change in weight from baseline. Approximately one third of all patients (29.8%) lost weight (any decrease), one third (36.6%) had relatively stable weight (0% to <3% increase), and one-third (33.6%) gained weight (≥ 3% increase). The corresponding mean weight changes in kilograms were -2.1 kg, 0.9 kg, and 4.6 kg, for lost, stable, and increased weight groups, respectively. Figure 2. Within the olanzapine treatment group, but not the haloperidol treatment group, significantly more men than women experienced a potentially clinically meaningful weight gain = 4.0, p = 0.045 for women and men in the olanzapine treatment group, and 2.3% vs. 3.5%; χ2 = 0.7, p = 0.40, for women and men in the haloperidol treatment group).Compared to women, men experienced greater increases in absolute weight = 17.3, p < 0.001), were more likely to experience greater increases in BMI = 5.8, p = 0.016), and were more likely to have an increase of at least 7% from baseline body weight . The results indicated that gender was not a significant variable . Therefore, gender was dropped from subsequent analyses.B = -0.038, t(1899) = 5.6, p < 0.001), in depressive symptoms = 5.3, p < 0.001), in mental functioning = 2.0, p = 0.047), and in physical functioning = 2.3, p = 0.021). Because level of depressive symptoms was based on two depression measures, the MADRS and the BPRS depression/anxiety subscale, we repeated the analysis using each of these measure separately. Results were unchanged.Since men and women were not found to significantly differ on any of the clinical outcome measures and had a similar pattern of weight gain within each treatment group, we examined the association between weight change and change in treatment outcomes for all patients within each treatment group. Regression analyses demonstrated that for both olanzapine and haloperidol-treated patients, increases in weight were significantly associated with improvements in core schizophrenia symptoms, (B's) indicated that every one- kilogram increase in weight at 6-weeks was associated with approximately 0.03 standard deviations improvement in each clinical outcome parameter, when controlling for the effects of treatment group, gender, treatment group-gender interaction, baseline weight, the corresponding baseline outcome measure, and the number of weeks in the study.The regression coefficients was about a third of 6.26 kg mean weight gain found at 39 weeks, when weight gain tends to plateau on olanzapine . SimilarAlthough weight gain appears to be greatest and most rapid during the first 6 weeks of treatment with clozapine , and durIt is of interest to note, however, that despite rapid weight gain during the 6-week period in our study, when weight gain is more likely to be noticed by the patients and their clinicians and thus may elicit a negative emotional response, the weight gain in this study was not only linked to improved clinical and functional status but also to reduced emotional distress as measured by the depression scales.Another limitation of the study is its lack of assessment of patients' adherence with medication. It is possible that weight gain and improvement occurred together because improvements occur mostly in patients who are medication adherent. Although this was not assessed in the present study, this possibility was previously studied by Meltzer et al. , who fouAnother study limitation is the correlational nature of the analyses, which precludes cause-effect relationship and allows for the possibility that the observed associations might be due to an unobserved variable or set of variables. Further, the relatively low correlations suggest that the association explains only a small proportion of the variance in treatment outcomes. Response to antipsychotic medications is a complex phenomenon that is associated by numerous relatively independent components and weigNext, because the study included patients with a moderately severe level of symptomatology, the current findings may not generalize to patients with milder or residual symptoms of schizophrenia. However, the relationships among the severity of patients' baseline symptomatology, treatment-emergent weight gain and therapeutic response is currently unclear. And lastly, this study used the SF-36, a self-report measure of functional status, which was not designed to assess the potential impact of weight gain on patients' functional status or quality of life. Preliminary information on the first measure designed to specifically capture the impact of antipsychotic-emergent weight gain on patients' psychosocial functioning was only recently published . One wouWomen (and men) with schizophrenia who gained weight during treatment with olanzapine or haloperidol did not experience worsening of clinical or functional status. To the contrary, they had significant improvements in core symptoms of schizophrenia, depressive symptoms, and mental and physical level of functioning. Although excessive weight gain, regardless of origin, is of concern due to its association with physical health problems, the current findings suggest that patients who have greater treatment-emergent weight gain are more likely to benefit from treatment with olanzapine or haloperidol. Findings highlight the complexity inherent in medication management of schizophrenia patients and the need to balance treatment risks and benefits for each patient. In addition, further prospective studies will be required to assess the effects of weight gain, in both psychiatric and medical terms, on individuals treated for schizophrenia with various antipsychotic medications.The authors are employees of Eli Lilly and Company, Indianapolis, Indiana• HAS conceived of the study, participated in its design, the analytical plan, the interpretation of the results, and drafted the manuscript• MS participated in the design of the study, the analytical plan, the interpretation of the results, and performed the statistical analysis• ZZ and BK participated in the design of the study, the interpretation of the results, and the drafting of the manuscript.The pre-publication history for this paper can be accessed here:

Virtual environments (VE) are a powerful tool for various forms of rehabilitation. Coupling VE with high-speed networking [Tele-Immersion] that approaches speeds of 100 Gb/sec can greatly expand its influence in rehabilitation. Accordingly, these new networks will permit various peripherals attached to computers on this network to be connected and to act as fast as if connected to a local PC. This innovation may soon allow the development of previously unheard of networked rehabilitation systems. Rapid advances in this technology need to be coupled with an understanding of how human behavior is affected when immersed in the VE.This paper will discuss various forms of VE that are currently available for rehabilitation. The characteristic of these new networks and examine how such networks might be used for extending the rehabilitation clinic to remote areas will be explained. In addition, we will present data from an immersive dynamic virtual environment united with motion of a posture platform to record biomechanical and physiological responses to combined visual, vestibular, and proprioceptive inputs. A 6 degree-of-freedom force plate provides measurements of moments exerted on the base of support. Kinematic data from the head, trunk, and lower limb was collected using 3-D video motion analysis.Our data suggest that when there is a confluence of meaningful inputs, neither vision, vestibular, or proprioceptive inputs are suppressed in healthy adults; the postural response is modulated by all existing sensory signals in a non-additive fashion. Individual perception of the sensory structure appears to be a significant component of the response to these protocols and underlies much of the observed response variability.The ability to provide new technology for rehabilitation services is emerging as an important option for clinicians and patients. The use of data mining software would help analyze the incoming data to provide both the patient and the therapist with evaluation of the current treatment and modifications needed for future therapies. Quantification of individual perceptual styles in the VE will support development of individualized treatment programs. The virtual environment can be a valuable tool for therapeutic interventions that require adaptation to complex, multimodal environments. Visual imaging is one of the major technological advances of the last decade. Although its impact in medicine and research is most strongly observed in the explosion of PET and fMRI studies in recent years , there hLet us first define what we consider a VE and consider the signals that need to be transmitted for such a system to operate remotely (TeleImmersion). VE is immersion of a person in a computer generated environment such that the person experiences stereovision, correct perspective for all objects regardless of their motion, and objects in the environment move in a natural fashion with subject motion. To achieve theses characteristics, certain technology must be utilized. To provide stereovision, slightly different images must be presented to the right and left eyes with little if any cross talk between the two images. In some systems this is provided by using field sequential stereo in combination with liquid crystal shutter glasses . In this system the right liquid crystal lens is clear while the left is opaque and the perspective scene generated on the screen is that for the right eye. Then the left eye lens is clear and the right is opaque and the left eye's view is displayed. This method of producing stereo has found its way into projection based systems ,5 and deRegardless of the system used, to keep all the stereo objects in the correct perspective and to keep them from being distorted when the person moves in the environment, it is necessary to track the movements of the person so that the computer can calculate a new perspective image given the reported location of the person's head/eyes. The tracking systems that are used to do this are varied. The most commonly used of these are the 6-degrees of freedom (DOF) magnetic tracking systems . With these systems a small sensor cube is placed on the subject and the location of the sensor within the magnetic field is detected. When the sensor is place on the head or glasses of the person the orientation of the head and therefore the location of the eyes can be presumed. Other non-magnetically based systems use a combination of acoustic location to delineate position and acceleration detection to obtain body coordinates in space. The combination results in 6 DOF for the location information . Other systems use cameras to track the person and then transform this information to the 6-DOF needed to maintain a proper image in the VE .So far we have confined our discussion to visual objects and have not considered the use of haptic or other forms of information to be integrated into the VE system . To provIn networked VEs several types of data need to be transmitted between collaborating sites: 1. the main data-set itself (this often consists of 3D geometry); 2. the changes to the data-set (these occur when collaborating users modify the geometry in some way – perhaps by moving the object or deforming it); 3. the virtual representation of the remote collaborator (this often is referred to as an avatar); 4. the video and/or audio channel (that facilitates face-to-face conversation.) Video has limited use in stereoscopic projection-based VEs because the large shutter glasses that the viewer uses to resolve the stereo tends to hide the viewers face from the camera. Furthermore most stereoscopic projection systems operate in dimly lit rooms which are usually too dark for effective use of video.The common model for data sharing in networked VEs is to have most of the main data-set replicated across all the sites and transmit only incremental changes. Furthermore the main data-set is often cached locally at each of the collaborating sites to reduce the need for having to retransmit the entire data-set each time the application is started. Classically TCP (Transmission Control Protocol – the protocol that is widely used on the Internet for reliable data delivery) has been the default protocol used to distribute the data-sets. TCP works well in low-bandwidth below 10 Mb/s) or short distance networks. However for high-bandwidth long-distance networks, TCP's conservative transmission policy thwarts an application's attempt to move data expediently, regardless of the amount of bandwidth available on the network. This problem is known as the Long Fat Network (LFN) problem Mb/s or , howeverChanges made to the 3D environment need to be propagated with absolute reliability and with minimal latency and jitter. Latency is the time it takes for a transmitted message to reach its destination. Jitter is the variation in the latency. Fully reliable protocols like TCP have too much latency and jitter because the protocol requires an acknowledgment to verify delivery. Park and Kenyon have shoth of a second) by a more recent update.The virtual representation of a remote collaborator (avatar) is often captured as the position and orientation of the 3D tracking devices that are attached to the stereoscopic glasses and/or 3D input device (e.g. a wand). With simple inverse kinematics one is able to map this position and orientation information onto a 3D geometric puppet, creating lifelike movements . The 3D Audio and video data are similar in property to the avatar data in that they usually comprise an unending stream that is best transmitted via UDP to minimize latency and jitter. Often video and audio packets are time stamped so that they can be synchronized on the receiving end. When more than two sites are involved in collaboration it is more economical to send audio/video via multicast. In multicast the sender sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data. For example, a user send their data to a multicast address and the routers that receive the data send copies of the data to remote sites that are subscribed to the multicast address. One drawback of multicast is that it is often disabled on routers on the Internet as one can potentially inundate the entire Internet. An alternative approach is to use dedicated computers as "repeaters" that intercept packets and transmit copies only to receivers that are specifically registered with the repeater. This broadcast method tends to increase the latency and jitter of packets, especially as the number of collaborators increases.QoS refers to a network's ability to provide bandwidth and/or latency guarantees. QoS is crucial for applications such as networked VE, especially those involving haptics or tele-surgery, which are highly intolerant of latency and jitter. Early attempts to provide QoS (such as Integrated Services and Differentiated Services) have been good research prototypes but have completely failed to deploy across the wider Internet because telecommunications companies are not motivated to abide by each others QoS policies. It has been argued that QoS is unnecessary because in the future all the networks will be over-provisioned so that congestion or data loss that result in latency and jitter, will never occur. This has been found to be untrue in practice. Even with the enormous increase in bandwidth accrued during the dot-com explosion, the networks are still as unpredictable as they were a decade ago. Ample evidence is available from the online gaming community which often remarks about problems with bandwidth, latency and jitter during game sessions . These gFrustrated by the lack of QoS on the Internet, there is growing interest in bypassing the traditional routed Internet by using the available dark fiber in the ground. Dark fiber is optical fiber that has not yet been lit. Currently it is estimated that only about 5–10% of the available fiber has been lit, and each fiber has several terabits/s of capacity. The dot-com implosion has made this dark fiber and wavelengths of light in the fiber, very affordable. The newly emerging model is to construct a separate customer-owned network by purchasing or leasing the fiber from a telecommunications company, and installing one's own networking equipment at the endpoints. A number of federally supported national and international initiatives have been underway for the last few years to create customer-controlled networks explicitly for the scientific community. These include the National Lambda rail , StarLigThe ability to use virtual technology for rehabilitation is a function of cost, availability, and the kind of applications that can best utilize the network and provide rehabilitation services. Thus far, tele-rehabilitation research has focused on the use of low speed and inexpensive communication networks. While this work is important, the potential of new high-speed networks has not gathered as much attention. Consequently, we have little but imagined scenarios of how such networks might be utilized. Let us consider the case where a high-speed network connects a rehabilitation center and a remote clinic. The question is what kind of services can be provided remotely.The scenario that we envision is one where patients are required to appear at a rehabilitation center to receive therapy. Our scenario could work in several conditions. For example, a therapist at one location may want an opinion about the patient from a colleague at another location or, perhaps, the therapist can only visit the remote location once per week and with virtual technology the daily therapy could still be monitored by the therapist remotely. In our imagined condition we have a therapist at a rehabilitation center with VE, haptic and video devices and software to help analyze the incoming data feeding to a remote clinic with identical equipment connected together through a dedicated high speed network. As displayed in Fig. A system as described above is possible today although expensive. The network characteristics that would be needed for each information channel would be as follows. A high-bandwidth connection would be needed for video and audio streamed to the plasma displays at each location, in addition to the high bandwidth a low latency and jitter connection would be needed for the Varrier Display system (VE). For a force feedback haptic device communicating between the patient and the therapist, a low network bandwidth could be used but the latency and jitter need to be low.After all possible consideration of how to best construct the virtual system, the next concern is how to associate the complex stimuli with the behavior of interest. The relative influence of particular scene characteristics, namely field of view (FOV), scene resolution, and scene content, are critical to our understanding of the effects of the VE on our response behaviors and the Expectation of the visual scene characteristics will also influence responses in a VE. When subjects had some knowledge of the characteristics of a forthcoming visual displacement most reduced their postural readjustments, even when they did not exert active control over the visual motion . Thus weThe challenge is to determine whether the subject has become immersed in the environment, i.e., has established a sense of presence in the environment (see paper by Riva in this issue), and then to establish the correlation between the stimulus and response properties. The experience within the VE is multimodal, requiring participation of all sensory pathways as well as anticipatory processing and higher order decision making. Consequently, it is difficult to attribute resultant behaviors to any single event in the environment and responses across participants may be very variable. We have united an immersive dynamic virtual environment with motion of a posture platform to recorIn our laboratory, a linear accelerator (sled) that could be translated in the anterior-posterior direction was controlled by D/A outputs from an on-line PC. The sled was placed 40 cm in front of a screen on which a virtual image was projected via a stereo-capable projector (Electrohome Marquis 8500) mounted behind the back-projection screen. The wall in our system consisted of back projection material measuring 1.2 m × 1.6 m. An Electrohome Marquis 8500 projector throws a full-color stereo workstation field (1024 × 768 stereo) at 200 Hz [maximum] onto the screen. A dual Pentum IV PC with a nVidia 900 graphics card created the imagery projected onto the wall. The field sequential stereo images generated by the PC were separated into right and left eye images using liquid crystal stereo shutter glasses worn by the subject . The shutter glasses limited the subject's horizontal FOV to 100° of binocular vision and 55° for the vertical direction. The correct perspective and stereo projections for the scene were computed using values for the current orientation of the head supplied by a position sensor attached to the stereo shutter glasses (head). Consequently, virtual objects retained their true perspective and position in space regardless of the subjects' movement. The total display system latency from the time a subject moved to the time the new stereo image was displayed in the environment was 20–35 ms. The stereo update rate of the scene (how quickly a new image is generated by the graphics computer in the frame buffer) was 60 stereo frames/sec. Flock of birds data was sampled at 120 Hz.The scene consisted of a room containing round columns with patterned rugs and painted ceiling Fig. . The colSubjects gave informed consent according to the guidelines of the Institutional Review Board of Northwestern University Medical School to participate in this study. Subjects had no history of central or peripheral neurological disorders or problems related to movements of the spinal column and a minimum of 20/40 corrected vision. All subjects were naive to the VE.We have tested 7 healthy young adults (aged 25–38 yrs) standing on the force platform (sled) with their hands crossed over their chest and their feet together in front of a screen on which a virtual image was projected. Either the support surface translated ± 15.7 cm/sec (± 10 cm displacement) in the a-p direction at 0.25 Hz, or the scene moved ± 3.8 m/sec (± 6.1 m displacement) fore-aft at 0.1 Hz, or both were translated at the same time for 205 sec. Trials were randomized for order. In all trials, 20 sec of data was collected before scene or sled motion began (pre-perturbation period). When only the sled was translated, the visual scene was visible but stationary, thus providing appropriate visual feedback equivalent to a stationary environment.Three-dimensional kinematic data from the head, trunk, and lower limb were collected at 120 Hz using video motion analysis . Infrared markers placed near the lower border of the left eye socket and the external auditory meatus of the ear were used to define the Frankfort plane and to calculate head position. Other markers were placed on the back of the neck at the level of C7, the left greater trochanter, the left lateral femoral condyle, the left lateral malleolus, and on the translated surface. Markers placed at C7 and the greater trocanter were used to calculate trunk position, and shank position was the calculated from the markers on the lateral femoral condyle and the lateral malleolus.For trials where the sled moved, sled motion was subtracted from the linear motion of each segment prior to calculating segmental motion. Motion of the three segments was presented as relative segmental angles where motion of the trunk was removed from motion of the head to determine the motion of the head with respect to the trunk. Motion of the shank was removed from motion of the trunk to reveal motion of the trunk with respect to the shank. Motion of the shank was calculated with respect to the sled.The response to visual information was strongly potentiated by the presence of physical motion. Either stimulus alone produced marginal responses in most subjects. When combined, the response to visual stimulation was dramatically enhanced Fig. , perhapsUsing Principal Component Analysis we have determined the overall weighting of the input variables. In healthy young adults, some subjects consistently responded more robustly when receiving a single input, suggesting a proprioceptive (see S3 in Fig. Results from experiments in our laboratory using this sophisticated technology revealed a non-additive effect in the energy of the response with combined inputs. With single inputs, some subjects consistently selected a single segmental strategy. With multiple inputs, most produced fluctuating behaviors. Thus, individual perception of the sensory structure was a significant component of the postural response in the VE. By quantifying the relative sensory weighting of each individual's behavior in the VE, we should be better able to design individualized treatment plans to match their particular motor learning style. Developing treatment interventions in the virtual environment should carry over into the physical world so that functional independence will be increased for many individuals with physical limitations. In fact, there is evidence that the knowledge and skills acquired by disabled individuals in simulated environments can transfer to the real world -31.The ability for us to use this technology outside the area of research labs and bring these systems to clinics is just starting. However, the cost is high and the applications that can best be applied to rehabilitation are limited. The cost of such systems might be mitigated if this technology allowed therapists and patients to interact more frequently and/or resulted in better patient outcomes. Such issues are under study now at several institutions. This brings us to the idea of tele-rehabilitation, which would allow therapy to transcend the physical boundaries of the clinic and go wherever the communication system and the technology would allow . For exaThe ability to provide rehabilitation services to locations outside the clinic will be an important option for clinicians and patients in the near future. Effective therapy may best be supplied by the use of high technology systems such as VE and video, coupled to robots, and linked between locations by high-speed, low-latency, high-bandwidth networks. The use of data mining software would help analyze the incoming data to provide both the patient and the therapist with evaluation of the current treatment and modifications needed for future therapies.The ability to provide rehabilitation services to locations outside the clinic is emerging as an important option for clinicians and patients. Effective therapy may best be supplied by the use of high technology systems such as VE and video, coupled to robots, and linked between locations by high-speed, low-latency, high-bandwidth networks. The use of data mining software would help analyze the incoming data to provide both the patient and the therapist with evaluation of the current treatment and modifications needed for future therapies. Although responses in the VE can vary significantly between individuals, these results can actually be used to benefit patients through the development of individualized treatments programs that will raise the level of successful rehabilitative outcomes. Further funding for research in this area will be needed to answer the questions that arise from the use of these technologies.

The Proteome section contains extensive data on each of 19 HIV-1 proteins, including their functional properties, a sample analysis of HIV-1HXB2, structural models and links to other online resources. The HIV-1 Protease Cleavage Sites section provides information on the position, subtype variation and genetic evolution of Gag, Gag-Pol and Nef cleavage sites. The HIV-1 Protein Data-mining Tool includes a set of 27 group M (subtypes A through K) reference sequences that can be used to assess the influence of genetic variation on immunological and functional domains of the protein. The BLAST Structure Tool identifies proteins with similar, experimentally determined topologies, and the Tools Directory provides a categorized list of websites and relevant software programs. This combined database and software repository is designed to facilitate the capture, retrieval and analysis of HIV-1 protein data, and to convert it into clinically useful information relating to the pathogenesis, transmission and therapeutic response of different HIV-1 variants. The HIV-1 Proteomics Resource is readily accessible through the BioAfrica website at: Most Internet online resources for investigating HIV biology contain either bioinformatics tools, protein information or sequence data. The objective of this study was to develop a comprehensive online proteomics resource that integrates bioinformatics with the latest information on HIV-1 protein structure, gene expression, post-transcriptional/post-translational modification, functional activity, and protein-macromolecule interactions. The BioAfrica HIV-1 Proteomics Resource Although the HIV-1 genome contains only 9 genes, it is capable of generating more than 19 gene products. These products can be divided into three major categories: structural and enzymatic ; immediate-early regulatory , and late regulatory proteins. Tat, Rev and Nef are synthesized from small multiply-spliced mRNAs; Env, Vif, Vpu and Vpr are generated from singly-spliced mRNAs, the Gag and Gag-Pol precursor polyproteins are synthesized from full-length mRNA. The matrix (p17), capsid (p24) and nucleocapsid (p7) proteins are produced by protease cleavage of Gag and Gag-Pol, a fusion protein derived by ribosomal frame-shifting. Cleavage of Nef generates two different protein isoforms; one myristylated, the other non-myristylated. The viral enzymes are formed by protease cleavage of Gag-Pol. Alternative splicing, together with co-translational and post-translational modification, leads to additional protein variability [Phylogenetic analysis, on its own, provides little information about the conformational, immunological and functional properties of HIV-1 proteins, but instead, focuses on the evolution and historical significance of sequence variants. To understand the clinical significance of genetic variation, sequence analysis needs to be combined with methods that assess change in the structural and biological properties of HIV-1 proteins. At present, information and tools for the systematic analysis of HIV-1 proteins are limited, and are scattered across a wide-range of online resources ,3. To faWe have categorized the Proteomics Resource into the following main subject headings Figure &3:HIV Proteome – Information about structure and sequence, as well as references and tutorials, for each of the HIV-1 proteins proteins using information available in public databases and tools ; the other from singly-spliced mRNA (p16) [MEPVDPRLEPWKHPGSQPKTA-21; the hydrophobic residues are highlighted in bold, and polar residues are italicized) at the N-terminus of the protein; the cysteine-rich disulphide bond region (22-CTNCYCKKCCFHCQVC-37); the core, basic and glutamine-rich region (49-RKKRRQRRRAHQNSQTHQASLSKQ-72) that is important for nuclear localization and TAR-binding activity, and the RGD cell-attachment site that binds to cellular integrins. In addition to being expressed in HIV-1-infected cells, Tat is also released into the extracellular fluid where it acts as a growth factor for the development of Kaposi's Sarcoma. Additional information about Tat and its protein-protein interactions can be found on the proteome page of the BioAfrica website located at .In the HIV-1 Proteome section, each of the 19 HIV-1 proteins has a webpage that is divided into six parts: "general overview", "genomic location", "domains/folds/motifs", "protein-macromolecule interactions", "primary and secondary database entries", and "references and recommended readings" Figure . The oveHXB2 , sequencB2 [HXB2 , and proB2 [HXB2 ,6 . ImportaPost-translational cleavage of the Gag, Gag-Pol and Nef precursor proteins occurs at the cell membrane during virion packaging, and is essential to the production of infectious viral particles. Drugs that inhibit this process, the protease inhibitors (PIs), are the most potent antiretroviral agents currently available. Thus it is important to collect information, not only on the sequence of protease enzymes from different HIV-1 subtypes, but also on the natural polymorphisms and resistance mutations that may effect their catalytic activities, drug responsiveness, substrate specificities, and cleavage site characteristics. Studies have shown that resistance mutations in the protease of subtype B are associated with impaired proteolytic processing and decreased enzymatic activity, and that compensatory mutations at Gag and Gag-Pol cleavage sites can partially overcome these defects . These fThe cleavage site section of the BioAfrica webpage is the direct extension of a recent publication in the Journal of Virology describing the location and variability of protease cleavage sites Figure . TogetheHXB2 isolate, which, in addition to a premature stop codon, contained no cAMP/cGMP, PKC or CKII phosphorylation sites.The HIV-1 Protein Data-Mining Tool contains twelve sequence analysis techniques for assessing protein variability among different strains of HIV-1 Figure . These tThe HIV-1 BLAST Structure Tool facilitates the analysis of HIV-1 protein structure by allowing for rapid retrieval of archived structural data stored in the public databases Figure . Users mThe HIV-1 Proteomics Tools Directory is divided into two web pages. The initial webpage is a concise compilation of some of the most commonly used protein-specific Internet resources Figure . This "bThe impending rollout of antiretroviral therapy to millions of HIV-1-infected people in sub-Saharan Africa provides a unique opportunity to monitor the efficacy of non-B treatment programs from their very inception, and to obtain critical new information for the optimization of treatment strategies that are safe, affordable and appropriate for the developing world. An integral part of this massive humanitarian effort will be the collection of large amounts of clinical and laboratory data, including genetic information on viral subtype and resistance mutations, as well as routine CD4+ T-cell counts and viral load measurements. The mere collection of this data, however, does not ensure that it will be used to its maximum potential. To achieve full benefit from this explosive source of new information, the data will need to be appropriately collated, stored, analyzed and interpreted.[The rapidly emerging field of Bioinformatics has the capacity to greatly enhance treatment (and vaccine) efforts by serving as a bridge between Medical Informatics and Experimental Science. By correlating genetic variation and potential changes in protein structure with clinical risk factors, disease presentation, and differential response to treatment and vaccine candidates, it may be possible to obtain valuable new insights that can be used to support and guide rationale decision-making, both at the clinical and public health levels. The HIV-1 Proteomics Resource, described in this report, is an initial first step in the development of improved methods for extracting and analyzing genomics data, converting it into biologically useful information related to the structure, function and physiology of HIV-1 proteins, and for assessing the role these proteins play in disease progression and response to therapy. The Resource, developed at the Molecular Virology and Bioinformatics Unit of the Africa Centre of Health and Population Studies, is a centralized user-friendly database that is easily accessed through the BioAfrica website at .AA – Amino AcidBLAST – Basic Local Alignment Search ToolCKII – casein kinase IICTLs – cytotoxic T-lymphocytesDIP – Database of Interacting ProteinsDNA – deoxyribonucleic acidEnv – envelope glycoproteinGag – group-specific antigen polyproteinGIF – Graphics Interchange FormatHIV – Human Immunodeficiency VirusHIV-1 – Human Immunodeficiency Virus Type-1HTTP – Hypertext Transfer ProtocolLTR – long-terminal repeatmRNA – messenger RNANCBI – National Center for Biotechnology InformationNef – negative factorPDB – Protein Data BankpI – isoelectric pointPIs – protease inhibitorsPKC – protein kinase CPol – polymerase polyproteinRev – ART/TRS anti-repression transactivator proteinRNA – ribonucleic acidRNase H – ribonuclease HTat – transactivating regulatory proteinVif – virion infectivity factorVpr – viral protein RVpu – viral protein UThe author(s) declare that they have no competing interests.RSD created and maintains BioAfrica's HIV proteomics resource, HIV proteome section, proteomics tools directory, HIV-1 protein data-mining tool and HIV structure BLAST tool; performed protein sequence and structural model analyses; and wrote the manuscript.TDO conceived and maintains the BioAfrica website, and continues to oversee its rapid expansion; created the cleavage sites section; and participated in the design and implementation of the HIV proteomics resource.CS participated in the design of the HIV proteomics resource, with an emphasis on the proteomics tools directory.SD participated in the design and creation of the HIV proteome section, with an emphasis on the HIV-1 Tat protein.MG participated in the design of the HIV proteomics resource, with an emphasis on the HIV proteome section.SC supervised the project, and participated in the design and implementation of the HIV proteomics resource.All authors read and approved the final manuscript.A table containing a comparative summary of potential functional motifs in the HIV-1 Tat proteins of subtypes B and C, as identified using PROSITE.Click here for file

This paper analyzes the effect of the mean-square error principle on the optimization process using a Special Case of Hopfield Neural Network (SCHNN).The segmentation of multidimensional medical and colour images can be formulated as an energy function composed of two terms: the sum of squared errors, and a noise term used to avoid the network to be stacked in early local minimum points of the energy landscape.Here, we show that the sum of weighted error, higher than simple squared error, leads the SCHNN classifier to reach faster a local minimum closer to the global minimum with the assurance of acceptable segmentation results.The proposed segmentation method is used to segment 20 pathological liver colour images, and is shown to be efficient and very effective to be implemented for use in clinics. Segmentation is an important step in most applications that use medical image data. For example, segmentation is a prerequisite for quantification of morphological disease manifestations and for radiation treatment planning ,2, for cA Number of algorithms based on approaches such as histogram analysis, regional growth, edge detection and pixel classification have been proposed in other articles of medical image segmentation. In recent years, Artificial Neural Networks (ANNs) have been proposed as an attractive alternative solution to a number of pattern recognition problems. In our previous works , we haveHopfield network for the optimization applications consists of many interconnected neuron elements. The network minimizes an energy function of the form:Vk is the output of the kth neuron, Ik is the bias term, and Tkl is the interconnection weight between the kth and lth neurons. The energy function used in the segmentation problem is slightly different from the one defined by Hopfield and the arguments are given in [where N is the number of neurons, given in .The results that have been obtained in were preThe segmentation problem of an image of N pixels is formulated in as a parRkl is the Mahalanobis distance measure between the kth pixel and the centroid of class l, Rkl is also equivalent to the error committed when a pixel k is assigned to a class l. The index n in is the power or weight of the considered error in the energy function of the segmentation problem, and Vkl is the output of the klth neuron. Nkl is a N × M vector of independent high frequency white noise source used to avoid the network being trapped in early local minimums. The term c(t) is a parameter controlling the magnitude of noise which is selected in a way to provide zero as the network reaches convergence. The minimization is achieved by using SCHNN and by solving the motion equations satisfying:where Ukl is the input of the kth neuron, and μ(t) is a scalar positive function of time, used as heuristically motivated stopping criterion of SCHNN, and is defined as in [where ed as in by:β(t) = t(Ts - t)     (4)t is the iteration step, and Ts is the pre-specified convergence time of the network which has been found to be 120 iterations [kth pixel and the centroid of class l given by:where erations . The netXk is the P-dimensional feature vector of the kth pixel (here P = 3 with respect to the RGB color space components), is the P-dimensional centroid vector of class l, and Σl is the covariance matrix of class l. The segmentation algorithm is described as follows [where follows .Step 1 Initialize the input of the neurons to random values.Step 2 Apply the following input-output relation, establishing the assignment of each pixel to only and only one class.Step 3 Compute the centroid and the covariance matrix Σl of each class l as follows:nl is the number of pixels in class l, and the covariance matrix is then normalized by dividing each of its elements by .where Step 4 Update the inputs of each neuron by solving the set of differential equations in (2) using Eulers approximation:Step 5 if t <Ts, repeats from Step 2, else terminated.For this study, a total of 20 liver tissue sections were provided by the pathological division of National Cancer Center in Tokyo. These sections were taken using needle biopsy, stained with hematoxylin and then magnified with an optical microscope. Figure Ts values between 30 and 120 iterations. Similar curves were obtained for the rest of the images of the dataset. As it is illustrated in Figure Ts = 120 iterations gives the optimal solution, the same as it is with MRI data [Figure MRI data .Rkl in the cost function (2), we have provided a simple modification to the above algorithm as follows:In order to study the effect of the weight of the Mahalanobis distance Step 1 Use the same random initialization N × M matrix, as input of the neurons, when minimizing the energy function (1) with different error's weight n.This condition is added to the algorithm in order to make sure that the random field does not have any effect on the generated results.Step 2 trough Step 5 remain the same.n in equation (2). As aforementioned, the pre-specified convergence time of SCHNN is fixed to Ts = 120 iterations. However, we can clearly see from Figure n in Equation (2), the same convergence point or a close position is reached in half the time of the one reached with n = 2 and Ts = 120 iterations. So, this raises the following question: what is the type of relation between the variable n in (2) and the pre-specified convergence time Ts?Figure n that corresponds to the optimum solution with Ts = 120 iterations. From Figure n = 6 gives the optimum solution with Ts = 120. Similar figures to Figure Before answering this question, it is essential to know at this level what is the best value of n, in Equation (2). When both (Ts and n) used together they give a local optima in the energy landscape of SCHNN. Figure n in Equation (2) that are obtained with Ts values 120, 60, and 30. We realized that the curves corresponding to Ts = 120 and Ts = 60 intersect in their optimum solutions obtained with n = 6, and the two curves are similar when n is in the range 5–10. However, the curve corresponding to Ts = 30, shows higher error at convergence of all values of n.In order to study the effect of the pre-specified time, we repeated the above experiments with different Ts values. We realized that each value of Ts corresponds to a value of n in (2) when it takes the value of six where SCHNN gives an optimum and acceptable results that agree with the pathological experts point of views. However, with other values of n, the random initialization may affect the solution of the problem, or in other words, may affect the error of the SCHNN at convergence as shown in Figure In order to see the effect of the random initialization on the results of the algorithm described in section 3, we have executed the same algorithm with different initialization matrices and the curves of the convergence values of SCHNN corresponding to these initializations are shown in Figure We analyzed the effect of considering the mean-square error in formulating the segmentation problem of multidimensional medical images. We have shown, empirically, that considering an integer power equal to six, of the error in the energy function of the problem, helped SCHNN to converge twice as fast as the same optimal solution obtained with the mean-square error algorithm. This result is promising to make our segmentation method useful for a Computer Aided Diagnosis (CAD) system for liver cancer and the like. In our future work, we will study deeply the effect of the random initialization and its effect on the segmentation result and on the SCHNN classifier.The author(s) declare that they have no competing interests.Rachid carried out the theoretical study, the sequence alignment and drafted the manuscript. Mohammed participated in the design of the study and performed the analysis and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

ABCG5 or ABCG8, comprising the STSL locus, are now known to cause this disease and their protein products are proposed to function as heterodimers. Under normal circumstances cholesterol, but not non-cholesterol sterols, is preferentially absorbed from the diet. Additionally, any small amounts of non-cholesterol sterols that are absorbed are rapidly taken up by the liver and preferentially excreted into bile. Based upon the defects in sitosterolemia, ABCG5 and ABCG8 serve specifically to exclude non-cholesterol sterol entry at the intestinal level and are involved in sterol excretion at the hepatobiliary level.The molecular mechanisms that regulate the entry of dietary sterols into the body and their removal via hepatobiliary secretion are now beginning to be defined. These processes are specifically disrupted in the rare autosomal recessive disease, Sitosterolemia (MIM 210250). Mutations in either, but not both, of two genes Here we report the biochemical and immuno-localization of ABCG5 and ABCG8 in human liver, gallbladder and intestine using cell fractionation and immunohistochemical analyses.We raised peptide antibodies against ABCG5 and ABCG8 proteins. Using human liver samples, cell fractionation studies showed both proteins are found in membrane fractions, but they did not co-localize with caveolin-rafts, ER, Golgi or mitochondrial markers. Although their distribution in the sub-fractions was similar, they were not completely contiguous. Immunohistochemical analyses showed that while both proteins were readily detectable in the liver, ABCG5 was found predominately lining canalicular membranes, whereas ABCG8 was found in association with bile duct epithelia. At the cellular level, ABCG5 appeared to be apically expressed, whereas ABCG8 had a more diffuse expression pattern. Both ABCG5 and ABCG8 appeared to localize apically as shown by co-localization with MRP2. The distribution patterns of ABCG5 and ABCG8 in the gallbladder were very similar to each other. In the small intestine both ABCG5 and ABCG8 appear to line the brush border. However, at the level of the enterocyte, the cellular distribution patterns of ABCG5 and ABCG8 differed, such that ABCG5 was more diffuse, but ABCG8 was principally apical. Using standard deglycosylation methods, ABCG5 and ABCG8 do not appear to be glycosylated, suggesting a difference between human and mouse proteins.We report the distribution patterns of ABCG5 and ABCG8 in human tissues. Cell fractionation studies showed that both proteins co-fractionated in general, but could also be found independent of each other. As predicted, they are expressed apically in both intestine and liver, although their intracellular expression patterns are not completely congruent. These studies support the concept of heterodimerization of ABCG5 and ABCG8, but also support the notion that these proteins may have an independent function. The gastrointestinal tract is the initial barrier to dietary constituents and is important in regulating nutrient entry, as well as keeping non-nutrients out. Additionally, the hepatobiliary system acts as an additional filter to rapidly excrete such non-nutrients into bile, thus keeping the net retention of these potential toxins low. Mammals have evolved many mechanisms in the gastrointestinal tract to select out usable dietary constituents from those that maybe potentially toxic to the body. It is apparent that the ATP-binding cassette proteins (ABC proteins/transporters) are the machinery that mediate the ATP-dependent transport of a wide variety of substrates that range from xenobiotics to peptide fragments . A subsede novo synthesis and hepatobiliary secretion. Sitosterolemia, a rare autosomal recessive disorder of sterol metabolism results in the disruption of dietary sterol entry and hepatobiliary sterol secretion [STSL, are known to cause this disease [in vitro and in vivo data, these 'half-transporters' are proposed to function as obligate heterodimers. In vitro experiments have shown that both proteins are needed to be co-expressed for apical expression and that these may function as mutual chaperones in the ER for maturation [In vivo experiments in mice have not been consistent. Using the Abcg5/Abcg8 double knockout mice, Graf et al has shown that by inoculating them with adenoviral constructs for Abcg5 and Abcg8 that both are required for expression of both proteins [et al and our group have constructed mouse models deficient in either Abcg5 [One of these processes involves the regulation of sterol entry and excretion. Whole body cholesterol homeostasis is a tightly regulated process, involving dietary absorption, ecretion -6. Under disease -9. Basedturation ,11. In ver Abcg5 or Abcg8er Abcg5 that shoIn this report, we examined the location of these two proteins using cellular fraction and immunohistochemical analyses of human liver, gallbladder and small intestine. We found a general concordance of co-expression of both proteins, but we also noted that ABCG5 and ABCG8 could be found in plasma membranes, as well as in intracellular membrane locations independent of each other. Additionally, deglycosylation of human liver membranes with peptidyl N-glycosidases did not alter the mobility of the proteins after SDS-PAGE, suggesting that these proteins may not be glycosylated in human liver. This differential localization suggests that perhaps ABCG5 and ABCG8 may have functions independent of each other, as well as functioning as heterodimers.Tissue aquistion. Human liver donated for transplantation, but deemed unsuitable for transplantation on inspection by the transplant service was obtained in accordance with IRB approval. As soon as the liver was deemed unsuitable pieces were either snap-frozen in liquid nitrogen and stored at -80°C or liquid nitrogen until use, or placed in ice-cold 2-methylbutane and stored in liquid nitrogen. Samples from more than nine different donors were used in these studies. Additionally, human gallbladders and segments of proximal small intestine were obtained from patients under going either laproscopic cholecystectomy or pancreatoduodenectomy (Whipple procedure). These tissues were directly taken from the operating room in normal saline on ice to be processed directly for frozen sectioning.Anti-membrin, anti-transferrin, and anti-calnexin antibodies were obtained from Stressgen , anti-caveolin antibody from BD Bioscience , anti-MDR1 that also detects MDR2/3 (C219) from Centocor Inc. , anti-MRP2 (cMOAT) from Chemicon International and secondary antibodies were purchased from Jackson Immuno research . Polyclonal rabbit anti-sera to human ABCG5 and ABCG8 peptides were generated in-house, using a 20-peptide immunogen from human ABCG5 and a 22-peptide sequence from human ABCG8 . The anti-sera were further purified using peptide affinity columns and stored at a concentration of 0.8 mg/ml in Immuno Pure Binding Buffer . For peptide blocking experiments the peptides were dissolved in DMSO , incubated with the corresponding peptide for 1 1/2 hours at 37°C then used for immunoblotting as described below.g for 10 minutes, the pellet containing any undisrupted cells and nuclear debris were re-homogenized with one-half the initial volume of homogenization buffer, centrifuged at 1000 g for 10 minutes and this process was repeated once more. Supernatants were pooled and subjected to centrifugation at 100,000 g for 40 minutes. The resulting pellet, deemed the crude membrane fraction, was used as the starting material for Western blotting and fractionation experiments.Crude total membrane isolation was carried out with minor modifications as previously described . All theHuman liver crude total membrane proteins were re-suspended in 30% Nycodenz solution (Nycodenz in 5 mM Tris-HCl pH 7.5 and 1 mM EDTA). This suspension was loaded on top of a 40% Nycodenz solution cushion in an ultracentrifuge tube, overlaid by consecutive 23%, 20%, 15% and 10% Nycodenz solutions and subjected to centrifugation at 39,000 rpm for 16 hours at 4°C in a SW41 rotor . After centrifugation, 800–1000 μl fractions were sequentially removed from the top, combined with two volumes of homogenization buffer (see above) and centrifuged at 39,000 rpm at 4°C for 40 minutes to remove the Nycodenz. The resulting pellets were re-suspended in buffer , the protein content determined by the method of Lowry and fractions analysed by SDS-PAGE. Equal amounts of protein (25 μg) per lane were loaded.The procedure for membrane fractionation was essentially as described for the Nycodenz fractionation, except for the homogenization buffer used . The sucrose density gradient fractionation was modified as previously described . Human l® Chemiluminescence Reagent Plus .Proteins resolved by SDS-PAGE were transferred onto nitrocellulose membranes. Membranes were then blocked for 1 hour in 5% dry milk in PBS-T and incubated with primary antibody against either ABCG5 or ABCG8 in 5% milk in PBS-T overnight at 4°C. Blots were washed three times for 5 minutes in TBS-T with 150 mM NaCl, incubated with goat-anti-rabbit conjugated HRP antibodies (1:10000 dilution), washed for three times 5 minutes and developed with Western LightningSnap-frozen liver, gallbladder and intestine tissues were used to cut 8 μm thick frozen sections, air-dried for 30 minutes onto glass slides and kept at -80°C until used. The slides were stained with hematoxylin, rinsed with PBS three times, fixed for 10 minutes with cooled methanol at -20°C and rinsed with PBS three times. The slides were treated with blocking solution (10% donkey serum in 0.1 M glycine/PBS) for 30 minutes at room temperature and incubated with primary antibody overnight at 4°C. The slides were washed with PBS and incubated with secondary antibody (goat-anti-rabbit conjugated with Cy3™ or rhodamine or FITC) for 20–30 minutes at room temperature, rinsed with PBS three times and examined under an Olympus BX-5 confocal microscope with Fluoview.Peptide antibodies were raised against human ABCG5 and human ABCG8 and affinity purified prior to use (see Methods). The immunogen peptides used for the antibodies were selected since they were sequences that lay outside of the predicted transmembrane domains and based upon antigenicity.Western blotting experiments Figure showed tCrude total membrane proteins from human liver were fractionated by Nycodenz gradient centrifugation and examined for localization markers by western blot analyses Figure . After NTo examine whether ABCG5 and ABCG8 were associated with membrane rafts, total membrane proteins from human liver were solubilized with ice-cold 1% Triton X-100 detergent and fractionated by sucrose density gradient centrifugation Figure . FractioThus, ABCG5 and ABCG8 have significant overlap with each other suggesting co-localization. However, these proteins did not seem to co-localize with any specific membrane marker except transferrin, when two different methods of fractionation were utilized.It has been shown previously that ABCG5 and ABCG8 are expressed only in the liver and intestine . To furtSerial sections of human gall bladder were incubated with each antibody and pre-immune serum was used as a negative control. Both ABCG5 and ABCG8 were detected in the epithelium of gall bladder mucosa Figure and 5B. Both ABCG5 and ABCG8 were detected in the apical surfaces of the enterocytes in biopsy samples of the small intestine , the apical patterns of expression of these proteins in both the liver and intestine would seem to suggest that these proteins seem to traffic to these specialized membranes normally. In the absence of an independent method, and the lack of a direct assay for function, whether these proteins form an active heterodimer can not be resolved at present.Finally, although rodent sterolins are glycosylated and In summary, we report the first immunolocalization of ABCG5 and ABCG8 in human liver, gall bladder and intestine. Our data show that these proteins are located in membranes and can have an apical expression in all of these tissues. Biochemical, as well as immunolocalization studies show that while both proteins co-localize in general, they can also seem to have expression patterns that may be independent of each other.None declared.ELK and MHL performed the experiments, KDC and DBA provided the liver and surgical samples respectively SBP was responsible for supervision, data analyses and obtaining funding for these experiments. ELK and SBP wrote the paper.The pre-publication history for this paper can be accessed here:

The present paper expresses the author's views about the practical utility of Health Behavior Theory for health behavior intervention research. The views are skeptical and perhaps even a bit exaggerated. They are, however, also based on 20-plus years of in-the-trenches research focused on improving health behavior practice through research.The author's research has been theoretically driven and has involved measurement of varying variables considered to be important theoretical mediators and moderators of health behavior. Regretfully, much of this work has found these variables wanting in basic scientific merit. Health Behavior Theory as we have known it over the last 25 years or so has been dominated by conceptualizations of behavior change processes that highlight cognitive decision-making. Although much of health behavior practice targets what people do rather than what they think, the logic of focusing on thoughts is that what people think about is the key to what they will do in the future, and that interventions that can measure and harness those processes will succeed to a greater extent than those that do not. Unfortunately, in the author's experience, the premise of cognitive theories has fallen short empirically in a number of ways. The cognitive schemata favored by most health behavior theories are difficult to measure, they do not predict behavioral outcomes very well, there is little evidence that they cause behavior, and they are hard to change directly.It is suggested that health behavior researchers reconsider their use of these theories in favor of models whose variables are more accessible to observation and experimental manipulation and that most importantly have strong empirical support. The author has been conducting research on behavioral treatment of obesity for about 25 years. During that time, the dominant conceptual models guiding intervention development have been cognitive behavior models that have their origin in psychological theory. Those most often cited include the Health Belief Model , ProtectWeinstein's summary is illustrative of the fact that Health Behavior Theory has tended to be particularly interested in understanding people's motivation to change behavior rather than ability to change. Moreover, motivation is thought to be the result of a relatively complex, but logical, interpretation of large quantities of information about self and environment. The theories that Weinstein reviewed deal almost exclusively with behavioral decision processes in people's minds. They have few if any terms relating to how information gets into peoples minds or how subsets of it receive more or less attention. Broader health behavior theories such as Social Cognitive Theory or the Transtheoretical model have addressed issues and variables outside the person to a greater extent, but the fundamental interest in and belief in psychological variables as the key force in determining health behavior remains.The implications of the focus of health behavior theory on psychological determinants of behavioral decision-making for my own research area of interest, obesity treatment, are several. One is the inclusion of measures of psychological characteristics in most research protocols . A second is the inclusion of treatment elements that specifically target psychological perceptions and processes independent of the diet and physical activity behaviors that actually produce weight change . A third is the belief that psychological reactions to treatment experiences themselves are very important and deserve independent attention. Common behavioral prescriptions for weight-loss goals and frequency of self-weighing are exemplary .The problem with the emphasis on cognitive variables in weight-control research is that they have so far failed to meet fundamental scientific criteria for empirical verification. Thus, they also have not led to a better understanding of the weight-loss process, have not improved our ability to predict weight-loss outcomes, and have not led to improvement in treatment methods. In some cases it is even arguable that they have made treatment worse. I will illustrate these problems with results from my own research.Like most behavioral researchers in the obesity area, I have attempted to measure elements of health behavior theory in every obesity intervention project I have ever conducted. I have assessed weight-loss goals, behavioral and weight-loss self-efficacy, psychological well-being, perceived barriers to diet and physical activity change, stages-of-change, and perceived social support. How well have empirical examinations of these factors fared as predictors of success in weight control?We have examined the predictive value of self-efficacy assessments in several of our studies and describe the results from three of these here in more detail -10. In tThe second study examined mood and situational self-efficacy in 55 men and 58 women before and after a 16-week weight-loss treatment with a 1-year follow-up . Women hThe third study examined predictors of weight change over a 2-year period in 460 men and 1172 women who received a low-intensity weight-loss intervention delivered through their HMO . The selOur overall conclusion from the analyses described above, as well as others not pursued in as great detail, is that self-efficacy is a weak predictor of weight loss and is inconsistent across study populations and gender. It tends to increase with weight loss. However, treatment-induced increases in efficacy are not predictive of longer-term weight-loss success.We have also attempted to measure barriers to adherence to weight-control behaviors in many of our studies -14. The Goal-setting has long been of interest to health behavior theory and in recent years has attracted attention in weight-loss research when it was realized that most people who enter weight-loss treatments want to lose a lot more weight than is realistic given the potency of current weight-loss methodologies . When asPerceived social support is another psychological factor thought to influence health behavior decision-making. We have measured social support in a variety of ways in our studies, ranging from single-item questions to multipaged assessments attempting to differentiate among informational, instrumental, and emotional support. The results, unfortunately, have closely paralleled those we have seen with other assessments of barriers to adherence. Assessments of social support prior to treatment do not predict weight loss. Average reports of social support tend to parallel weight loss itself. When people lose weight they report more social support. When they regain, they report less. In other words, perceptions of social support are not predictive of success in weight-loss treatments.Self-monitoring of health behavior is incorporated into many health behavior theories, usually as part of a person's assessment of achieved outcomes. Although self-monitoring is usually considered a positive element in the adoption of health behavior, in obesity treatment frequent self-monitoring of weight has tended to be down-played or even discouraged on the grounds that disappointing results may undermine motivation. This is another example in which health behavior theory may have indirectly led to incorrect treatment recommendations. In weight-loss treatments, active discouragement of frequent self-observation of weight has become popular based on the premise that more frequent weighting will cause psychological stress and lower self-efficacy. Recently, we have examined the relationship between frequency of self-weighing and body weight in both clinical and population samples and have found, somewhat to our surprise, that frequency of self-weighing is one of the strongest single predictors of body weight cross-sectionally, and change in the frequency of self-weighing is one of the strongest predictors of weight change . The direction of predictions, however, is opposite that derived from theory. People who weigh themselves more weigh less and are more successful in losing weight.A final failure of current health behavior theory to prove useful in weight-control research is a recent examination of the relationship between a stage-of-change measure adopted from Prochaska and short- and long-term weight loss . CategorOur most recent effort to utilize health behavior theory in obesity intervention research is a study that attempted to examine the effectiveness of experimentally-induced outcome expectancies on weight loss . Obese men and women participated in an 8-week weight-loss program with 18-month follow-up in which they were assigned to one of two expectancy groups. The optimistic group was told that focusing exclusively on the positive benefits of weight loss would be valuable in ensuring that they remained motivated in their weight-loss efforts and was given assignments during weekly group sessions and homework between sessions to reinforce this optimistic mindset. A "balanced" expectancy group received the instructions that focusing on both the positive and negative aspects of weight loss, a balanced approach, would be most conducive to maintaining weight-loss motivation. This group also received assignments to reinforce their message. Results of this study indicated that the expectation induction was successful initially but difficult to maintain in the face of real weight-loss experience. We were also unable to show that experimentally-induced expectations influenced weight-loss success.To summarize the findings described above, I have had considerable difficulty over the last 25 years in confirming that the psychosocial variables favored by health behavior theory are of much value for obesity intervention research. They do not predict weight loss well, either as mediators or moderators. There is little evidence to support the idea that targeting them for intervention improves weight-loss outcomes. It is, of course, arguable that the weak findings relating to health behavior theory variables are due in large part to methodological weaknesses, either in measurement tools and/or their frequency of measurement. I would argue, however, that 25 years is long enough to wait for improved methods and that it is time to look elsewhere for variables that better predict weight-change outcomes and that, therefore, may form a better basis for improving future treatments.Given the lack of success finding support for cognitive mediators of behavior change in weight loss, one might surmise that progress in improving weight-loss interventions over the last 20 years must have been dreary indeed. Somewhat surprisingly, however, that is not the case. In fact, the short-term (6 to 12 months) success of weight-loss treatments has approximately doubled over that time and several variables have been identified that reliably enhance treatment outcomes. It has been clearly shown experimentally that increasing treatment length , prescriThe argument above about the practical limitations of many popular theories of health behavior is not meant to be a call to abandon theory. Behavior scientists have amassed much useful information about the principles underlying human behavior that should be valuable for health behavior interventions. Much is known about human perception, learning, motivation, and responsiveness to environmental opportunities and contingencies. Health behavior intervention lies at the interface between people and their environment. Interventionists change aspects of the environment with the intention of producing changes in how people behave. What is needed to advance health behavior intervention is theory that addresses relationships between modifiable aspects of the environment and behavior. There is no doubt that cognitive processes are involved in these relationships. However, the extent to which current theories capture this is questionable. Data now available suggest that easily obtainable information about people's cognitive processes adds little to our ability to predict the results of interventions. Thus, it may be wise to pay more attention to applied theories like classical behavior theory , communiNone declared.

Proteins having similar functions from different sources can be identified by the occurrence in their sequences, a conserved cluster of amino acids referred to as pattern, motif, signature or fingerprint. The wide usage of protein sequence analysis in par with the growth of databases signifies the importance of using patterns or signatures to retrieve out related sequences. Blue copper proteins are found in the electron transport chain of prokaryotes and eukaryotes. The signatures already existing in the databases like the type 1 copper blue, multiple copper oxidase, cyt b/b6, photosystem 1 psaA&B, psaG&K, and reiske iron sulphur protein are not specified signatures for blue copper proteins as the name itself suggests. Most profile and motif databases strive to classify protein sequences into a broad spectrum of protein families. This work describes the signatures designed based on the copper metal binding motifs in blue copper proteins. The common feature in all blue copper proteins is a trigonal planar arrangement of two nitrogen ligands [each from histidine] and one sulphur containing thiolate ligand [from cysteine], with strong interactions between the copper center and these ligands.Sequences that share such conserved motifs are crucial to the structure or function of the protein and this could provide a signature of family membership. The blue copper proteins chosen for the study were plantacyanin, plastocyanin, cucumber basic protein, stellacyanin, dicyanin, umecyanin, uclacyanin, cusacyanin, rusticyanin, sulfocyanin, halocyanin, azurin, pseudoazurin, amicyanin and nitrite reductase which were identified in both eukaryotes and prokaryotes. ClustalW analysis of the protein sequences of each of the blue copper proteins was the basis for designing protein signatures or peptides. The protein signatures and peptides identified in this study were designed involving the active site region involving the amino acids bound to the copper atom. It was highly specific for each kind of blue copper protein and the false picks were minimized. The set of signatures designed specifically for the BCP's was entirely different from the existing broad spectrum signatures as mentioned in the background section.These signatures can be very useful for the annotation of uncharacterized proteins and highly specific to retrieve blue copper protein sequences of interest from the non redundant databases containing a large deposition of protein sequences. Most proteins can be grouped, on the basis of similarities in their amino acid sequences, into a limited number of protein families. Proteins or protein domains that belong to a particular family usually share functional attributes and are derived from a common ancestor. Highly conserved sequences in protein families are generally important for the function of a protein and/or for the maintenance of its 3-dimensional structure. Within the last decade, the sensitivity of sequence searching techniques has been improved by profile or motif-based analysis, which uses information derived from multiple sequence alignments to construct and search for sequence patterns -4. By stBy doing a keyword search, the protein sequences mined out from different databases is highly varied owing to different levels of redundancy. This could be due to the different strengths and weaknesses underlying the analysis algorithms used in different databases. The usage of the broad range signatures existing in databases, for the retrieval of blue copper proteins like the type 1 copper blue, multiple copper oxidase, cyt b/b6, photosystem 1 psaA&B, psaG&K, and reiske iron sulphur protein brings out different kinds of copper proteins and a lot more of unrelated proteins. A search once again becomes necessary for sorting out the required blue copper proteins. The usage of pattern database would be more selective as it can identify family members based on the conserved functional region patterns. Keeping these broad spectrum signatures in mind, more specific and targeted protein signatures for each of the blue copper proteins was designed. The diagnostic success of these specified signatures over the wide range signatures mentioned lies in the number of true positives picked over the minimal or nil false positives picked from the non redundant databases.Blue copper proteins, which are also known as cupredoxins, are small, soluble proteins 10 – 14 kDa) whose active site contains a type 1-copper . All the – 14 kDaThe use of active site patterns or signatures is very rapidly becoming one of the essential tools of sequence analysis ,15. Althth position, cysteine at the 74th position, histidine at 79th position and methionine at the 74th position are bound to the copper atom involved in electron transport chain.The eukaryotic blue copper proteins chosen for the study were plantacyanin, plastocyanin, cucumber basic protein, stellacyanin, umecyanin, uclacyanin, and cusacyanin. The prokaryotic blue copper proteins were rusticyanin, sulfocyanin, halocyanin, azurin, pseudoazurin, auracyanin, amicyanin and blue nitrite reductase. Plastocyanins are found both in eukaryotes and prokaryotes. Table The number of sequences retrieved for a protein from different databases by keyword search are tabulated in Table The signatures already available for each of the blue copper proteins retrieved from the Prosite motif database are listed in Table As shown in 'Appendix 1 see ' the newThe members of a protein family can be identified by collecting the matching sequences to profile or motif databases. Protein signatures are sequence motifs diagnostic to a protein family indicating function. Signatures are matched to protein sequences in the non redundant databases and is scored using a dynamic programming algorithm which permits permeability in gap distance and residue type . GeneratBy doing a keyword search, we get varied results from the different databases as indicated in Table The protein signatures in a way can be compared to primers used for amplification. The more specific and concise a primer, the more specific is the amplification, similarly more specific the protein signature more significant are the picks from the non redundant databases. Specific signatures in a way reduce the time taken to pool related sequences from the abundantly available sequences from the non redundant databases. For example as shown in Table Signatures designed around the functionally important regions of a protein are valuable for annotation. In this study, specific signatures were designed around the active site regions of each of the blue copper proteins plantacyanin, plastocyanin, uclacyanin, stellacyanin, rusticyanin, sulfocyanin, amicyanin, halocyanin, pseudoazurin, azurin and nitrite reductase. These will be very useful for annotating uncharacterized proteins as blue copper proteins. Further, because of their high specificity to each subclass, they can be used in classifying the various subtypes of blue copper proteins.The blue copper proteins were distinguished based on the source of origin as prokaryotic and eukaryotic. The active site residues of the eukaryotic and prokaryotic blue copper proteins, which bind the copper metal atom, were identified from the Protein Data Bank and tabulated.The name of each of the blue copper protein was given as a query in the keyword searches at NCBI, SwissProt, TrEMBL, PIR, EMBL and PDB databases to check for the number of sequences retrieved from each database and the results were tabulated.The signatures already existing for each of these blue copper proteins were identified from the Prosite motif database and tabulated. These already existing signatures were used as query patterns in the PIR Motif/Peptide match and a search was made against the PIR-nREF database. The PIR-nREF database consists of sequences from the PIR , SwissProt , TrEMBL , GenPept , Ref Seq and PDB . The number of protein sequences matching the query was retrieved and the query results were tabulated.Each of the blue copper proteins from different sources were chosen from the different sequence databases and aligned using the multiple sequence alignment tool ClustalW. Conserved regions, which include the amino acids bound to the copper, reflecting the active site imparting a vital biological role of electron transport were chosen to design signatures. In regions showing 100% conserved sequences they were identified as conserved peptides. An example of how the functional protein signatures were designed is shown for plastocyanin in Appendix 1 see . The sigPG, AVG and SA participated in the design and coordination of the study. AVG carried out the bioinformatics search, the designing of the signatures and drafted the manuscript. PG and SA read and approved the final manuscript.Designing protein signatures: Illustrated example Plastocyanin. Plastocyanin sequences of eukaryotic and prokaryotic origin were retrieved from the PDB and SwissProt databases. The eukaryotic sequences were subjected to a ClustalW multiple sequence alignment. Signatures were designed based on the conserved pattern around the active site region [copper binding to four amino acids in plastocyanin]. The same procedure was adopted for plastocyanin sequences of prokaryotic origin. The newly designed signatures were used as queries in the Pattern/peptide match search at the PIR database [Protein Information Resource]. The numbers of plastocyanin sequences retrieved are tabulated in Table 6. The results were compared with the already existing signatures for plastocyanins and the number of sequences that these signatures picked up from the PIR database [data shown in Table 4 & 5].Click here for file

E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants. Cultural standard identification procedures for E. sakazakii include the observation of yellow pigmentation of colonies and a positive glucosidase activity. Up to now, only one PCR system based on a single available 16S rRNA gene sequence has been published for E. sakazakii identification. However, in our hands a preliminary evaluation of this system to a number of target and non-target strains showed significant specificity problems of this system. In this study full-length 16S rRNA genes of thirteen E. sakazakii strains from food, environment and human origin as well as the type strain ATCC 51329 were sequenced. Based on this sequence data a new specific PCR system for E. sakazakii was developed and evaluated.E. sakazakii species. The newly developed 16S rRNA gene targeting PCR system allows identification of E. sakazakii strains from both lineages. The assay's ability to correctly identify different E. sakazakii isolates as well as to differentiate E. sakazakii from other closely related Enterobacteriaceae species and other microorganisms was shown on 75 target and non-target strains.By phylogenetic analysis of the new full-length 16S rRNA gene sequence data obtained we could show the presence of a second phylogenetic distinct lineage within the E. sakazakii isolates from both phylogenetic distinct lines within the E. sakazakii species. The impact of this second newly described phylogenetic line within the E. sakazakii species in view of clinical and food safety aspects need further investigation.By this study we are presenting a specific and reliable PCR identification system, which is able to correctly identify E. sakazakii is considered to be an opportunistic pathogen, implicated in food borne diseases causing meningitis or enteritis especially in neonates and infants , was published up to now for akazakii . HoweverE. sakazakii strains from various sources and of E. sakazakii type strain ATCC 51329 were determined. This sequence data has been deposited in the GenBank . Thereafter, a sequence comparison was performed between the 16S rRNA genes of the fourteen E. sakazakii strains and the E. sakazakii type strain ATCC 29544 by calculation of a distance matrix using the ARB programme. Thirteen E. sakazakii strains used in the study exhibited 99.4 to 100% sequence similarity to the E. sakazakii type strain ATCC 29544 [GenBank: AB004746]. Meanwhile similarity between strain ATCC 51329 and the strain ATCC 29544 was significantly lower (97.9%).As a starting point, the full-length 16S rRNA sequences of thirteen E. sakazakii species. In figure E. sakazakii type strain ATCC 29544, whereas the E. sakazakii strain ATCC 51329 forms a second branch within this group. The subtree was calculated using the TREEPUZZLE tool within the ARB package exhibiting a "consensus tree" from different calculation methods. The value on each branch is the percent occurrence of the branching order in 500 bootstrapped trees. The 92% bootstrap value for the E. sakazakii ATCC 51329 branch strongly supports the theory about the second lineage.Phylogenetic affiliation of the newly obtained sequences to tree_jul04_1450 comprising >28.000 almost full-length (>1449 nucleotides) 16S rRNA gene sequences revealed the presence of two phylogenetically distinct lineages within the E. sakazakii 16S rRNA gene . Within these regions substitutions ranging from two to seven bases are present in all strains investigated and are most pronounced in E. sakazakkii strain ATCC 51329, thus providing the bases for the formation of the second phylogenetic branch. In table E. sakazakii strains investigated in the study in relation to the E. sakazakii typestrain ATCC 29544, E. cloacae typestrain ATCC13047 and E. coli type strain ATCC 11775. Recently, a number of E. sakazakii partial sequences were deposited into the public database , E. sakazakii 1084 fruit powder isolate [GenBank: AY803192], E. sakazakii 954 fruit powder isolate [GenBank: AY752938], E. sakazakii 858 fruit powder isolate [GenBank: AY752936], E. sakazakii 759 fruit powder isolate [GenBank: AY752939], E. sakazakii 236 fruit powder isolate [GenBank: AY752943], E. sakazakii FSM393 baby food isolate [GenBank: AY752941], E. sakazakii FSM33 milk isolate [GenBank: AY752940], E. sakazakii 265 milk powder isolate [GenBank: AY803191], E. sakazakii FSM468 production environment isolate [GenBank: AY752942], E. sakazakii 266 production environment isolate [GenBank: AY803190], E. sakazakii ES4 human isolate [GenBank: AY803186], E. sakazakii ES11 human isolate [GenBank: AY803187], E. sakazakii ES Vo7/24922 human isolate [GenBank: AY803189].AL and TT carried out the experimental part of the study. RS carried out the conception of the study. All authors participated in production and approval of the manuscript.

Patients hospitalized with community acquired pneumonia (CAP) have a substantial risk of death, but there is evidence that adherence to certain processes of care, including antibiotic administration within 8 hours, can decrease this risk. Although national mortality data shows blacks have a substantially increased odds of death due to pneumonia as compared to whites previous studies of short-term mortality have found decreased mortality for blacks. Therefore we examined pneumonia-related processes of care and short-term mortality in a population of patients hospitalized with CAP.We reviewed the records of all identified Medicare beneficiaries hospitalized for pneumonia between 10/1/1998 and 9/30/1999 at one of 101 Pennsylvania hospitals, and randomly selected 60 patients at each hospital for inclusion. We reviewed the medical records to gather process measures of quality, pneumonia severity and demographics. We used Medicare administrative data to identify 30-day mortality. Because only a small proportion of the study population was black, we included all 240 black patients and randomly selected 720 white patients matched on age and gender. We performed a resampling of the white patients 10 times.Males were 43% of the cohort, and the median age was 76 years. After controlling for potential confounders, blacks were less likely to receive antibiotics within 8 hours , but were as likely as whites to have blood cultures obtained prior to receiving antibiotics , to have oxygenation assessed within 24 hours of presentation , and to receive guideline concordant antibiotics . Black patients had a trend towards decreased 30-day mortality .Although blacks were less likely to receive optimal care, our findings are consistent with other studies that suggest better risk-adjusted survival among blacks than among whites. Further study is needed to determine why this is the case. Pneumonia (with influenza) is the leading infectious disease cause of death in the United States and the sixth leading cause of death overall AccordinAs part of the Pneumonia Medical Quality Improvement Study (MQIS) a national expert panel established a set of process of care measures for patients hospitalized with CAP Several The aims of this paper are to 1) examine whether there are significant racial differences in the processes of care that have been associated with mortality for patients hospitalized with CAP, and 2) to examine the relative risks of death within 30-days for blacks versus whites.KePRO, the Medicare Peer Review Organization for Pennsylvania, obtained these data as part of the Pneumonia MQIS project, whose goals is to assess and improve the quality of care for Medicare patients hospitalized with CAP.The study population was Medicare fee-for-service inpatients hospitalized at participating hospitals in Pennsylvania between 10/1/1998 and 9/30/1999. Inclusion criteria included having a primary ICD-9 diagnosis of pneumonia , or a primary diagnosis of respiratory failure (518.81) or sepsis (038. XX) with a secondary diagnosis of pneumonia. Only the first qualifying discharge was considered for each patient.Among the 204 hospitals functioning in PA during the study period, 101 agreed to participate in this study. For each hospital, a random sample of up to 60 discharges with qualifying ICD-9 codes was selected. For hospitals with fewer than 60 qualifying discharges, all charts were selected. In most cases, chart review data was collected by trained record abstractors either on site from the original record, or from photocopies sent to the offices of the Quality Improvement Organization. In two cases, data were collected by the hospital's own staff using an approved QIO data collection instrument (n = 2).Patients were excluded if they had no working diagnosis of pneumonia on admission or received care limited to comfort measures, left the hospital "against medical advice", or were transferred from another acute care hospital. Patients whose race was not white or black were also excluded.Chart review data included demographics, comorbid conditions, physical exam findings, laboratory data, and chest radiograph information. In addition, data on important processes of care for patients hospitalized with CAP were obtained by chart abstraction. These processes of care included: first antibiotics within 8 hours of admission, collection of blood cultures prior to antibiotic administration, oxygen saturation measurement within 24 hours of presentation, and concordance of antibiotic therapy with national guidelines. After initial training the abstractors performed data collection on charts were assessed using gold-standard cases that had been previously evaluated by multiple expert abstractors. If the abstractors did not achieve 95% accuracy, they underwent further training until they had an error rate of less than 5%. In addition, 10% of charts were reabstracted during the review process to monitor the accuracy of chart review. The error rate for these reabstracted charts remained less than 5%.The pneumonia severity index (PSI) was used to assess severity of illness at presentation The PSI Due to the relatively small number of black patients in the cohort (n = 240) we performed a modified resampling procedure of the white cohort with matching to the black patients on age and gender We incluUnivariate statistics were used to compare sociodemographic and clinical characteristics between white and blacks patients. Categorical variables were analyzed using the Chi-square test and continuous variables were analyzed using Student's t-test.Separate discrete conditional logistic regression models were estimated for each of the individual process of care measures, and for 30-day mortality The PSI Of 4889 charts requested, the complete medical record was available for 4823. Of these, 4034 patients, 240 of whom were black, were eligible for inclusion in the study. Patients were excluded because they were neither white or black (N = 231) or because they had no working diagnosis of pneumonia on admission (n = 413), their care was restricted to comfort measures (n = 173), they were transferred from another acute care facility (n = 37), or they left "against medical advice" (n = 14).For each of the ten resamplings 720 white patients were sampled and matched to the 240 black patients based upon the age and gender as previously discussed. The clinical and demographic characteristics of the study population are presented in Table In univariate analysis mortality at 30-days was 7.8% for whites and 5.8% for blacks (p = 0.3), and 82.1% of whites received antibiotics within 8 hours as compared to 75.7% of blacks (p = 0.04). Regarding blood culture performance, 96.4% of white and 97.1% of blacks had blood cultures obtained within 24 hours, and 84.8% of whites and 77.8% of blacks had blood cultures obtained prior to antibiotics (p = 0.03). Oxygenation saturation was assessed within 4 hours of 88.9% of whites and 93.9% of blacks (p = 0.03).Figures In the regression models, after adjusting for severity of illness with the PSI, black patients were significantly less likely to receive antibiotics within 8 hours with an odds ratio (OR) of 0.63 and 95% confidence interval (CI) of 0.41 to 0.97. Black patients also had a trend towards decreased all-cause mortality at 30-day with an OR of 0.4 and 95% CI of 0.16 to 1.0. There were no significant differences between whites and blacks in regards to obtaining blood cultures prior to antibiotics , oxygenation assessment within 24 hours , or use of guideline concordant antibiotics .This study found significant racial differences in an important process of care for patients with CAP, specifically time to antibiotic administration. Our results support the previous studies of racial variation in pneumonia care which demonstrated racial variations in care for patients hospitalized with community-acquired pneumonia. -13Our study also suggests that these variations may have clinically important outcomes since the process measures used to assess quality of care in this study have been previously associated with increased 30-day mortality. -9Our study is also consistent with previous studies which found that blacks hospitalized with CAP have lower short-term mortality rates as compared to do whites ,6 It is Racial variations in CAP are important to assess since unlike coronary artery bypass surgery, hemodialysis, and many other conditions that have been studied, the inpatient treatment of CAP is largely outside of the control of the patient. Although the patient has input into being admitted to the hospital, after that point the patient has little input into the processes of care such as choice and timing of antibiotics, diagnostic testing or location of care. This has several advantages in studies where researchers seek to determine if racial differences in care reflect patient preferences, provider decisions or some negotiation between them.There are several possible explanations for our findings of racial variations in these processes of care. Besides the obvious conclusion that there may be biases that affect care there are several other possible factors that may be responsible that we are not able to examine. One possible factor is that there are geographic or other factors that results in blacks presenting for admission at hospitals with overall lower quality of care for patients with CAP. Although we were not able to control for this factor other studies have suggested that the reverse is usually true. ,13 That To attempt to adjust for imbalances between black and white patients we used a modified resampling technique to generate 10 samples of white patients, which were matched to the black population. We then pooled these results over the 10 samples. This approach allowed us to obtain a more robust estimate of the effect racial variation may have on mortality and processes of care then would be obtained from a single random matched sample InterestThere are several limitations that should be acknowledged. First we did not have information on the physicians, hospitals, or the geographic locations of the providers so we were not able to adjust for clustering. Second our study was limited to Medicare patients hospitalized in Pennsylvania. It will also be important to examine whether patients with other types of insurance, such as Medicaid and managed care, and from other states have similar outcomes. In addition we were also unable to assess the robustness of our analysis using traditional techniques such as model cross validation on a new independent sample, or by randomly subdividing our current sample into a training and test samples, due to our small sample size. However we do have quasi-replication, at least in the white sample, by the multiple sampling that we performed. Finally we were unable to adjust for potential bias in pulse oximetry since this is a retrospective study. However recent work ,19 questDespite these limitations, we believe our results, and the results of other studies, allow us to conclude that blacks are less likely than whites to have processes of care that are considered to represent superior quality of CAP care. Despite this, blacks with CAP have similar, and perhaps lower mortality than whites. Further research should both investigate how to make sure all patients receive optimal CAP care, and identify the factors responsible for the paradoxical advantage in survival that is seen among blacks.None declared.EM and JW conceived the study. EM and JC were responsible for the analysis. EM was responsible for the initial draft of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Amborella, as comprising the basal-most grade of all other angiosperms. A major exception is the recent study by Goremykin et al. , whose analyses of 61 genes from 13 sequenced chloroplast genomes of land plants nearly always found 100% support for monocots as the deepest angiosperms relative to Amborella, Calycanthus, and eudicots. We hypothesized that this conflict reflects a misrooting of angiosperms resulting from inadequate taxon sampling, inappropriate phylogenetic methodology, and rapid evolution in the grass lineage used to represent monocots.Numerous studies, using in aggregate some 28 genes, have achieved a consensus in recognizing three groups of plants, including Acorus and added these plus previously sequenced Acorus genes to the Goremykin et al. (2003) dataset in order to explore the effects of altered monocot sampling under the same analytical conditions used in their study. With Acorus alone representing monocots, strongly supported Amborella-sister trees were obtained in all maximum likelihood and parsimony analyses, and in some distance-based analyses. Trees with both Acorus and grasses gave either a well-supported Amborella-sister topology or else a highly unlikely topology with 100% support for grasses-sister and paraphyly of monocots . Second, we reanalyzed the Goremykin et al. (2003) dataset focusing on methods designed to account for rate heterogeneity. These analyses supported an Amborella-sister hypothesis, with bootstrap support values often conflicting strongly with cognate analyses performed without allowing for rate heterogeneity. In addition, we carried out a limited set of analyses that included the chloroplast genome of Nymphaea, whose position as a basal angiosperm was also, and very recently, challenged.We used two main approaches to test this hypothesis. First, we sequenced a large number of chloroplast genes from the monocot Amborella (or Amborella plus Nymphaea), but not monocots, is the sister group of all other angiosperms among this limited set of taxa and that the grasses-sister topology is a long-branch-attraction artifact leading to incorrect rooting of angiosperms. These results highlight the danger of having lots of characters but too few and, especially, molecularly divergent taxa, a situation long recognized as potentially producing strongly misleading molecular trees. They also emphasize the importance in phylogenetic analysis of using appropriate evolutionary models.These analyses show that Amborella) are themselves the "earliest" angiosperms, but rather that they belong to the lineage of angiosperms that resulted from the first evolutionary split in angiosperm evolution. When the term "sister" is used to refer to a phylogenetic placement it refers to the sister group to the rest of the angiosperms unless otherwise specified.] A breakthrough in the seemingly intractable problem of identifying the earliest lineages of angiosperms occurred in 1999 and 2000, when each of many multigene studies identified the same three groups as the earliest branching angiosperms . The BSses Fig. . The SH-Amborella and Calycanthus is identical with that for grasses-sister across the entire range of both α and PInvar values, while both of these BS values always equal 100 minus the BS value for Amborella-sister when constant sites are removed . The 40 Acorus genes used here come from two closely related species – A. calamus (14 genes) and A. gramineus (26 genes) – and correspond to 65.6% (40/61) of the genes and 71.4% of the nucleotide characters analyzed by Goremykin et al. . A. ML HKY85 and equal rates. B. NJ with distances calculated using an ML HKY85 model and equal rates.Click here for fileNJ analysis using ML proportion of invariant distances. Distances were calculated using the ML HKY85 model, the estimated proportion of invariant sites, and the first- and second-position matrix of Goremykin et al. [19].Click here for fileML trees using third positions only. A. HKY85 model with equal rates. B. HKY85 model with four gamma-distributed rates.Click here for fileAcorus Sister group to the rest of angiosperms found in individual gene analyses using first- and second-position data without Top, ML HKY85 with four gamma-distributed rates. Bottom, Parsimony analysis.Click here for fileAcorus addedSister group to the rest of angiosperms found in individual gene analyses using the ML HKY85 model with four gamma-distributed rates and . Top, all three positions. Bottom, first and second positions.Click here for fileAcorus added and grasses removedSister group to the rest of angiosperms found in individual gene analyses using the ML HKY85 model with four gamma-distributed rates with . Top, all three positions. Bottom, first and second positions.Click here for fileSister group to the rest of angiosperms found in individual gene analyses using parsimony on all three positions. Top, Acorus added. Bottom, Acorus added and grasses excluded.Click here for file

Schistosoma mansoni infected subjects can reduce bleeding, thereby alleviating the pathology caused by schistosomiasis.Management of patients with bleeding oesophageal varices comprises of mainly diagnostic endoscopy, sclerotherapy and band ligation. One of the major problems to do any of the above is the active bleeding which makes any intervention difficult. The neuropeptide hormone somatostatin administered exogenously has caused a reduction in portal hypertension and variceal bleeding in patients suffering from liver cirrhosis. We believe that the symptomatic use of somatostatin for variceal bleeding in Schistosoma mansoni with bleeding from oesophageal varices in the last 24 hours. One group of schistosomiasis patients will be treated with somatostatin and praziquantel, the other with propanolol and praziquantel. Survival graphs will be set up to correlate somatostatin administration with survival time. A two part questionnaire will be set up to control treatment outcomes. The pre-treatment part of the clinical questionnaire will identify inclusion criteria questions, the post-treatment part of the questionnaire will identify treatment outcomes.We herein present a study protocol for establishing this neuropeptide as a potential therapeutic agent in schistosomiasis. Adolescent subjects, age range varying from 12–17 years will be selected, based on several inclusion criteria, most important being infection with We expect that the administration of somatostatin as a bolus followed by a 24 hour long infusion, will stop bleeding immediately, delay rebleeding as compared to the control study group and delay mortality in the somatostatin treated subjects. S. mansoni infected patients. In such patients portal hypertension leads to the formation of portal-systemic collaterals, specifically gastro-oesophageal collaterals (varices). Bleeding of these oesophageal varices can occur depending on the severity of fibrosis, and can be fatal. Praziquantel, the most commonly used anti-schistosomal drug, is effective against the worm stages of the parasite, but has no activity against the pathology (fibrosis) caused by the egg stages or the variceal bleeding that can be fatal in its outcome. These observations have stressed the need to combine praziquantel treatment with symptomatic treatment like with somatostatin.Complications due to severe schistosomiasis include fibrosis, hepatomegaly, splenomegaly, haematemesis, varices, portal hypertension, ascites formation and death . ComplicSomatostatin is emerging as the ideal vasoactive drug for the control of variceal bleeding, and is as effective as sclerotherapy -4. In a Schistosoma caused morbidity. In endemic regions, at any given time, only a fraction of infected patients develop severe hepatic fibrosis. There may be a direct correlation between the development of severe fibrosis and the inability to generate required somatostatin levels. Our ongoing research at the Laboratory of Pathology give evidence to this fact, since somatostatin levels in Senegalese patients with severe morbidity are significantly lower than that in patients with no severe morbidity [We have studied the potential role of somatostatin in modulating orbidity -10. ThisComplications linked to hepato-intestinal schistosomiasis are increasing in the area of Richard-Toll, Northern Senegal. These cases are being identified at the local health centre. However, considering the high prevalence of schistosomiasis in this region, it is likely that the number of severe cases is much higher. Clear guidelines for the management of such severe complications and criteria for referral and surgery are required in this region. The establishment of an algorithm on how to treat these patients and create the appropriate infrastructure is urgently needed. The priority is how to take care of these patients and more so what is the best way of doing this under local conditions. One of the first steps is to critically evaluate the Niamey-Belo-Horizonte ultrasound methodology in patients with severe periportal fibrosis. Efficient management of bleeding varices in the afflicted patients is imperative.Schistosoma mansoni infection. Moreover using this neuropeptide may increase time to failure of drug treatment, decrease incidences of early re-bleeding and incidences of death during the follow up period. Decreased frequencies of late rebleeding may occur, all indicating the safety of using somatostatin. Praziquantel cover would be given to all study patients.Given the background that somatostatin is an ideal vasoactive drug in the field of liver pathology, it is our opinion that somatostatin will be more efficacious and safe as compared to currently used beta blocker drugs like propanolol, in the control of acute oesophageal variceal bleeding due to Age and Morbidity criteria – Adolescent subjects, age range varying from 12–17 years will be selected. The inclusion criterion will be schistosomiasis patients with bleeding from oesophageal varices in the last 24 hours. A random selection will be made to form two groups, a study group and a control group. Control of active infection will be done by means of CAA-strips on urine or blood. Subjects will be asked to fill in an informed consent form and the pre-treatment part of a questionnaire.The inclusion criteria will be established fibrosis due to schistosomiasis of clinical history, physical examination and laboratory findings . Clinically active upper gastrointestinal bleeding (haematemesis of fresh or semi fresh blood and/or melena and/or haematochezia) with or without haemodynamic instability (systolic blood pressure < 80 mm Hg and heart rate > 120 bpm) will be selected. Subjects must be male or non-pregnant, non-lactating female subjects. Females of childbearing potential will have to utilize contraception for the duration of the study. Written or verbal documented informed consent will be needed from all subjects.Exclusion criteria will include participation by subjects in another investigational study within the last 14 days. Subjects may not undergo treatment with endotherapy, i.e. band ligation, sclerotherapy or other . Treatment with somatostatin, vasopressin or their analogues will also be a exclusion criteria. Subjects with end stage liver disease with hepatorenal syndrome, diffuse hepatocellular carcinoma, patent porto-systemic shunts, known diagnosis of non-fibrotic portal hypertension, severe cardiovascular diseases, i.e. acute myocardial infarction and heart failure will be excluded. Concurrent use of metoclopramide is also not advised.Conduct of trial – Active bleeding episode from a potential variceal source should be confimed by a medical team . Patients may be outpatients or already hospitalised patients. Patients will be randomised to either arm in a sequential manner. Randomisation, and the start of study drug infusion if in adjunctive therapy arm, should be accomplished as soon as possible following identification of a patient qualifying for the study and following the conduct of pre-randomisation study procedures.Sample Size Criteria – Assuming a 80% chance of finding a significant difference <0.05 between the two study cohorts, the following statistics were established:(A) If 99% of the untreated subjects and –10% of somatostatin treated subjects bled -5 volunteers per group were sufficient;20% treated subjects bled – 7 volunteers per group were required;30% treated subjects bled-9 volunteers per group were needed.(B) If 90% of untreated subjects bled, and –10% of somatostatin treated group bled – 7 volunteers in each cohort were sufficient;20% of somatostatin treated group bled – 9 volunteers in each group were required;30% of somatostatin treated group bled – 10 volunteers in each group were needed.(C) If 70% of untreated subjects bled, and:10% of somatostatin treated group bled – 12 volunteers per group were sufficient;20% of somatostatin treated group bled – 18 volunteers per group were required;30% of somatostatin treated group bled – 28 volunteers per group were needed.In cirrhotic patients with bleeding oesophageal varices somatostatin administration controls bleeding in more than 80% of the treated patients. Based on this report, we propose to start this pilot study with 10 subjects/group.Two groups of 10 schistosomiasis patients each will be identified. Group (1) will be treated with Somatostatin + Praziquantel (40 mg/kg). For somatostatin treatment the i.v. infusion will be started first; 3 mg somatostatin will be dissolved in the 1 ml of saline provided. This solution will be added to the saline transfusion unit and administered to the patient for the next 12 hours. Once finished the second packet of 3 mg somatostatin will be used similarly for a second saline transfusion unit for the remaining 12 hours. The bolus dose of 250 μg will be dissolved in the 1 ml of saline provided and administered over 90 seconds soon after the start of the i.v. infusion.Group (2) will be treated with Propanolol + Praziquantel.Survival graphs will be set up to correlate somatostatin administration with survival time.OR presence of a 20 mmHg drop in systolic blood pressure from the highest post resuscitation value AND achieving a heart rate of 120 bpm OR a 20 bpm increase from highest post resuscitation value OR Inability to achieve and maintain a Hct of – 27% of Hb of – 9 g/dl despite blood transfusion of 2 units or more.The primary efficacy variable is the number of patients meeting the failure of therapy definition during the infusion period. Failure criteria are defined as death during infusion, persistence of active bleeding , hematochezia, melena.A two part questionnaire will be set up to control treatment outcomes. The pre-treatment part of the clinical questionnaire will identify inclusion criteria questions:(1) When was the last haematemesis incidence?(2) When did the present incident start?The post-treatment part of the questionnaire will identify treatment outcomes. The following questions will be answered:(1) What was the reaction to somatostatin infusion?(2) When did bleeding stop after somatostatin infusion?(3) GI disturbances: Is there abdominal pain, nausea, diarrhea, after somatostatin infusion?(4) Control of early rebleeding: Is there early rebleeding in the 8 days following somatostatin administration?(5) Control of late rebleeding: When is the next rebleeding incident? Subjects will be followed up on a monthly basis, by home visits.(6) Control of mortality: Is there any difference in mortality time between the two groups.(7) Control of fibrosis: Does ultrasonography detect anti-fibrotic effect of somatostatin after treatment?It is expected that the administration of somatostatin as a bolus followed by a 24 hour long infusion, will stop bleeding immediately, delay rebleeding as compared to the control study group and delay mortality in the somatostatin treated subjects. Our protocol that is based on a pilot study will help to establish the importance of somatostatin in schistosomiasis.The author(s) declare that they have no competing interests.Both authors participated in the design of the study.The pre-publication history for this paper can be accessed here:

There are three major B-cell compartments in peripheral lymphoid organs: the germinal center (GC), the mantle zone (MNZ) and the marginal zone (MGZ). Unique sets of B-cells reside in these compartments, and they have specific functional roles in humoral immune response. MNZ B cells are naïve cells in a quiescent state and may participate in GC reactions upon proper stimulation. The adult splenic MGZ contains mostly memory B cells and is also known to provide a rapid response to particulate antigens. The GC B-cells proliferate rapidly and undergo selection and affinity maturation. The B-cell maturational process is accompanied by changes in the expression of cell-surface and intracellular proteins and requires signals from the specialized microenvironments.CCL20 and CCL18 respectively. The MGZ was characterized by high expression of many chemokines genes e.g. CXCL12, CCL3, CCL14 and IFN-associated genes, consistent with its role in rapid response to infections. A stromal signature was identified including genes associated with macrophages or with synthesis of extracellular matrix and genes that influenced lymphocyte migration and survival. Differentially expressed genes that did not belong to the above categories include the well characterized BCL6 and CD10 and many others whose function is not known.We performed laser microdissection of the three compartments for gene expression profiling by cDNA microarray. The transcriptional program of the GC was dominated by upregulation of genes associated with proliferation and DNA repair or recombination. The MNZ and MGZ showed increased expression of genes promoting cellular quiescence. The three compartments also revealed distinct repertoires of apoptosis-associated genes, chemokines and chemokine receptors. The MNZ and GC showed upregulation of Transcriptional profiling of B-cell compartments has identified groups of genes involved in critical molecular and cellular events that affect proliferation, survival migration, and differentiation of the cells. The gene expression study of normal B-cell compartments may additionally contribute to our understanding of the molecular abnormalities of the corresponding lymphoid tumors. Appropriate T- and B-cell migration and timely interaction with antigen presenting cells (APC) are essential for the development of humoral immune responses ,2. Specihigh, CD27- [high, IgDlow and CD27+ phenotype, suggesting that this zone contains mainly memory B-cells [In follicles with developing GCs, the resting B-cells that are not the part of the GC response are pushed outward to form the mantle zone (MNZ) or corona around the GC B-cells. The mantle cell is a pre-GC, immunologically naïve B-cell that is also the putative cell of origin of mantle cell lymphoma . These Bh, CD27- and are h, CD27- . In the h, CD27- . Unlike B-cells .Many previous studies ,16 have We used the Lymphochip cDNA microarray to inves+ CD27-, similar to FACS-sorted naïve B-cells. The GC was easily recognizable and generally contained a higher percentage of non B-cells, including T-cells, macrophages and follicular dendritic cells (FDC). The MGZ was obtained from a spleen with a morphologically clearly defined MGZ containing mostly IgM+ CD27+ B-cells, corresponding to the phenotype of FACS-sorted memory B-cells [GC and MNZ could be readily dissected from tonsillar frozen sections, but MGZ could only be reliably obtained from the spleen Figure . Immunos B-cells . The MGZ B-cells ,21. The Fifteen data sets corresponding to the five sample groups were generated. Different hybridizations were correlated through a correlation matrix plot, and replicated hybridizations were shown to be closely related (R ≥ 0.85). The plots allowed us to check reproducibility of the microarray assay among different samples of each tissue Figure . The numARK2 in GC, CCL20 in MNZ and CMRF-35H in MGZ. Other transcripts were expressed in all compartments with a relatively high differential expression in one, such as SET and FAIM in GC, Cyclin G2 in MNZ, and NM23-H1 and CARD11 in MGZ . The results corresponded well with both microarray and semi-quantitative RT-PCR.Some of the results of the semi-quantitative RT-PCR were further validated by the SYBRCCNB1, PCNA, Ki67), kinetochore association , functional components of mitotic checkpoints and regulators of cell-cycle related events, including centrosome separation/segregation and cytokinesis , as expected from the known high proliferation rate of centroblasts. GC also highly expressed genes involved in DNA repair , as expected from the frequent physiological double-strand DNA breaks associated with somatic hypermutation and isotype switching. The GC profile also showed increased levels of transcripts involved in DNA replication and in transcription and translation .Comparing the gene expression profiles of LCM GC and FACS-sorted GC B-cells revealedCCNA, CCNB1and CCNF and of CDC2 is consistent with the resting state of the MNZ and MGZ B-cells. Characteristically CCNA expression is very low in Go phase and begins to increase in early G1. For the cell to enter the G2/M phase, an association with CDC2 is required [Cyclin G2 (CCNG2) was highly expressed in MNZ cells as compared to either GC or MGZ. The function of CCNG2 differs from the conventional cyclins in negatively regulating the cell cycle [CARD11 in MNZ may also be part of the program in maintaining the quiescent state. CARD11 has been shown to be critical for immune receptor signaling of both T and B-cells through the activation of JNK and NF-κB [CMRF-35H [CBL-B [GAS2 [The low expression of the cyclins required . The trarequired . Howeverll cycle . Studiesnd NF-κB . The incnd NF-κB . InteresCMRF-35H , CBL-B [H [CBL-B , and GAS-B [GAS2 , which mBCL2 expression in GC B-cells makes them vulnerable to undergo apoptosis unless rescued by survival signals [BIK, FASL and PDCD8 (AIF) suggests a further increase in susceptibility to apoptosis in the GC. However, FAIM is overexpressed in the GC and may represent a protective mechanism in GC B-cells that have appropriate BCR signaling and CD40L stimulation with resultant upregulation of FAIM and increased resistance to FASL-mediated apoptosis [BCL2, but have different profiles of other apoptosis/survival genes that may represent specific adaptation of these cells to their unique physiological states and microenvironment. The expression of BNIP3, encoding a proapoptotic protein of the BCL2 family[TCL1 was upregulated in MNZ only and may have an antiapoptotic role in that population.The markedly decreased signals . An incrpoptosis . Presumapoptosis showed ipoptosis . This suL2 family, is markSuppressor of Death Domains (SODD) in MGZ cells, suggesting a complex regulation of signaling through the TNFR superfamily. SODD is associated with TNFR1 in vivo, maintaining the receptor in an inactive monomeric state. The release of SODD from TNFR1 permits the recruitment of proteins such as TRADD and TRAF2 to the activated TNFR1 signaling complex [SODD may be a major mechanism to dampen TNFR1 signaling in MGZ B-cells in the resting state. The higher expression of CARD11 in MGZ may have a pro-survival function, but it may also have a role in MGZ organization. It has been shown that loss of CARD11 in mice resulted in the complete loss of CD5+ peritoneal cells and reduced number of IgD high IgM low mature splenic B-cells, indicating its role in B-cell development [NM23-H1 and NM23-H2, which share an amino acid identity of 88%, were highly expressed in MGZ. NM23 H1 is a granzyme A-activated DNase (GAAD) that is inhibited by SET [NM23-H1 and the low expression of its inhibitor SET was opposite in their expression profile in the GC, suggesting that this expression may influence apoptosis in opposite directions in these two B-cell compartments.There was increased expression of complex . It has elopment . Two clod by SET . The higCCL18, encoding a chemokine secreted by immature dendritic cells (DC), is specifically upregulated in the GC compartment. Our finding was supported by a recent report showing that CCL18 is produced by GC DC and can attract MNZ B-cells towards GC [CCL18 may be especially important during the onset of a GC reaction, the time point to recruit antigen primed pre-GC B-cells, which then interact with GC DC to initiate and maintain the GC reaction. The GC compartment showed increased expression of CXCL10 (IP-10). which has pleiotropic effects, including stimulation of monocytes and T cell migration [Chemokines attract primary B-cells and play an important role in the homing and localization of B-cell subsets at different stages of antigen-independent and dependent reaction . Our micwards GC . The higigration .MIC1, also known as PLAB) [The GC also showed increased transcriptional level of genes that may suppress or control inflammatory responses; e.g., SOCS1 limits cellular response to IFNγ, IL-2 and IL-6,43. Macras PLAB) , is onlyCCL20 was observed in MNZ cells. Human naïve and memory B-cells express the cognate receptor for CCL20, CC-chemokine receptor 6 (CCR6) [CCL20 may play a vital role in naïve B-cell migration and localization in the MNZ. The chemokine gene CXCL12 is highly expressed in MGZ cells. The receptor for CXCL12 is CXCR4, which is present on CD34+ cells, myeloid cells, CD4+ T cells, B-cells, epithelial cells, endothelial cells, and dendritic cells. In the bone marrow, stromal cells secrete CXCL12, which is involved in the emigration of hematopoietic precursors to the marrow during embryogenesis [CCL14 and CCL3 were more highly expressed in the MGZ. CCL14 can activate human monocytes via receptors that also recognize CCL3 [CXCL13 and CCL5 were upregulated in both microdissected MGZ and MNZ compared with the FACS-sorted B-cell populations. Previous studies have established an important role for CXCL13 (BLC) in the development of Peyer's patches (PP) and many peripheral lymph nodes. It also controls B-cell migration and thus the organization of B-cell areas [Increased expression of the chemokine 6 (CCR6) . The higogenesis . In periize CCL3 . CCL3 isize CCL3 . Thus, tll areas . CCL5 were also preferentially expressed and may reflect the unique function of the MGZ to provide the first rapid response to particulate or T cell-independent antigens. The MGZ also showed increased expression of many members of G protein pathways consistent with more active chemotaxis, cell motility and secretory functions. In addition, MGZ cells showed higher expression of IL-7Rα, consistent with the role of the IL-7R in MGZ organization [IL-7Rα expression is also required for the recruitment of precursor cells to develop in secondary lymphoid organs and for the proper structural organization of these organs [A number of IFN-induced genes , encoding a metalloproteinase that preferentially degrades elastin and takes part in the remodeling of extracellular matrix. No collagen-specific gene was up-regulated in the MNZ.Cells function within the context of a three-dimensional (3D) extracellular matrix (ECM) that participates in regulating cellular motility, proliferation and survival. In the GC, lagen IX , and COLlagen XI , were unOsteonectin (SPARC), upregulated in LCM samples, encodes a matrix-associated protein that elicits changes in cell shape, inhibits cell-cycle progression, and influences the synthesis of extracellular matrix [MafB, and c-Maf) were also part of the stromal signature. The Maf family of genes encode bZip nuclear transcription factors and play an important role in morphogenesis and cellular differentiation [ICAM1 and VCAM1. MGZ B cells express the integrin LFA1 which binds to its ligands ICAM1 and VCAM1, and this interaction may control the localization of these B cells [VCAM1, ITGAL (LFA-1) and ITGA6 in the MNZ, suggesting a role for these adhesion molecules in mantle cell localization as well. The kruppel-like transcription factor BCL11a , which is essential for normal B-cell lymphopoiesis, was upregulated in LCM cells only. Interestingly, bone marrow from BCL11a-/- mouse can induce thymic lymphoma in wild type mice. Thus, the increased expression of BCL11a in the MNZ and MGZ may be physiologically relevant to the function of lymphocytes in these regions [Microdissected compartments contained a minor component of stromal T cells, macrophages, dendritic cells and fibroblasts whereas FACS-sorted cells from lymphoid tissues comprise almost exclusively B-cells. Thus, an insight into the gene expression profile of the stromal elements can be obtained by comparing the expression profile of FACS-sorted and microdissected cells. We found a set of genes that likely represent the stromal signature. r matrix . It regur matrix . Two memntiation . These g B cells in this regions .BCL6, CD10, GCET1, GCET2, JAW1 and CD38. A number of genes were clearly upregulated in the MNZ or MGZ but their functional significance is largely unknown. Some of these would be interesting targets for further investigation. Among the genes encoding surface molecules, CD59 was highly expressed in the GC. CD59 antigen is a small protein that inhibits complement-mediated pore formation or lysis by preventing the formation of membrane-embedded C9 multimers [CIITA was markedly down regulated in GC cells, associated with a general low expression of MHC transcripts.Many genes know to be specifically expressed in GC B-cells are found to be upregulated: e. g., ultimers . It is lultimers -63. NotaThe gene expression profiles of the three B-cell compartments reflect distinctive functional attributes of the resident B-cell populations. They also showed different molecular microenvironments that allow the different B-cell populations to differentiate and function properly. GC B-cells have a high proliferation gene signature, whereas MNZ and MGZ cells are characterized by signals that help to maintain the quiescent state. Genes involved in the apoptosis pathway are differentially expressed in the three B-cell compartments, reflecting different adaptations for survival in different B-cell populations. Expression of different chemokines, their receptors, and stromal molecules have been detected. Many of these have been implicated in the establishment of the normal lymphoid architecture in peripheral lymphoid organs and in attracting distinct immune-cell populations to specific lymphoid areas. The expression of unique sets of genes may also reflect the functional adaptation of cells in a specific location, such as genes involved in DNA repair in the GC and genes that are active in innate immune response to infection in the MGZ. Gene expression profiling of B-cell compartments has allowed us to obtain a global survey of the molecular signals that are functionally important in B-cell subpopulations as well as the respective microenvironments. One of the major challenges is to delineate the functions of the uncharacterized genes that are unique to each of the compartments. Another challenge is to exploit these normal transcriptional profiles to further our understanding of the normal immune response and the derangements resulting in the corresponding lymphoid tumors.Tissue blocks of tonsils and spleens were snap frozen in O.C.T immediately after surgery. Four micrometer thick frozen sections of reactive tonsils or spleens on plain glass slides were fixed with 70% ethanol for 30 seconds, rinsed in DEPC water and stained with hematoxylin for 30 seconds, followed by another water rinse. The sections were then dehydrated with 70%, 95% and 100% ethanol for 10 seconds each. Finally, the slides were passed through xylene twice, each for 30 seconds. A consecutive section was immunostained for CD3 to guide the dissection. The three B-cell compartments were isolated using LCM with the Arcturus PixCell II system . To avoid contamination, only well-defined GC, MNZ and MGZ were dissected. Cells were captured at the 15-μm laser setting on CapSure LCM Caps (Arcturus). The laser was set to pulse at 60 mW for 200 ms. The Institutional Review Board of the University of Nebraska approved the usage of tissues for this study.7 B-cells were stained with IgM-Cy-chrome, IgD-FITC and CD27-PE at 4°C for 30 min. MGZ B-cells were isolated from the splenic B-cells gated on the IgMhighIgDlowCD27+ fraction, whereas MNZ B-cells were selected based on IgMlowIgDhighCD27- using the BD FACSVantage™ SE high-speed cell sorter Tissue from fresh spleens or tonsils was cut into small pieces in cold RPMI-1640, and cells released by grinding with a glass tissue homogenizer. The crude cell suspension was passed through a nylon mesh to generate a single-cell suspension. B-cells were firstly isolated using the Human B-cell Isolation Kit and the Midi Macs system . The highly enriched B-cell population (negative fraction) was subjected to 3-color cell sorting. Briefly, 1 × 10in vitro transcription (IVT) using the Ampliscribe™ High yield Transcription Kit containing 1000 units AmpliScribe T7 enzyme at 37°C for 8–12 hours, as per the manufacture's instruction. Second-round amplification and IVT were performed as described previously [Total RNA was extracted from each sample of microdissected cells with Trizol™ and further purified with the RNeasy Mini Kit . RNA amplification was performed using a modified Eberwine protocol . Brieflyeviously . The qua. The aminoallyl group on the dUTP reacts with the ester group on the cyanine dyes. Cy3 dye was used to label the standard cDNA and Cy5 dye the test probe, and hybridization was performed as previously described [Analysis of gene expression was performed using the Lymphochip cDNA microarray, which contained 15,132 cDNA clones representing 7399 known or uncharacterized genes . Labeledescribed .© , which provided an overview of the similarity of expression profiles between multiple samples. Only genes with at least two values out of the triplicate experiments showing similar behavior were included for analysis. The expression data for each gene from an individual compartment was median/mean centered with weighted variance across the two or three replicates showing similar behavior. The initial data reduction was performed using the two-tailed student t-test to compare the differences in gene expression levels between individual compartments. Genes differentially expressed between the two compartments with a p-value of less than 0.05 were selected for further analysis using the Significance Analysis of Microarrays (SAM) approach, as described previously [ or ) and viewed by TreeView.Each tissue type was independently isolated, amplified and profiled in three separate experiments to enhance the reliability of the gene expression data. Images of hybridized microarrays were obtained and processed using GenePix 4000B microarray scanner . Spots or areas of an array with obvious blemishes were flagged and excluded from subsequent analyses. Fluorescence ratios were normalized for each array by applying a single scaling factor to all fluorescent ratios from the array . The coreviously . SAM ass- reverse transcriptase as per the manufacturer's instructions . Five-fold serially diluted cDNAs from GC, MNB and MZB were amplified with gene-specific primers for 30 cycles with the following cycling conditions: A denaturation step at 94°C for 2.5 minutes and then each PCR cycle at 94°C for15 sec, 52°C for 30 sec, and 72°C for 30 sec followed by a final extension at 72°C for 5 min. The human HPRT transcript was used as the comparative standard. The products were analyzed by electrophoresis in 2% agarose gel. The primers were designed to amplify the cDNA close to the 3' end of the transcript, and all the PCR products were less than 200 bp in length.To confirm the differential mRNA expression of the genes identified by the Lymphochip in different B-cell compartments, a semi-quantitative RT-PCR was employed. In brief, 200 ng aRNA was reversely transcribed into cDNA with 200 ng random primer using MMLV-RNase H® Green qPCR Kit on DNA Engine OPTICON2 as per the manufacturer's instructions. The PCR protocol used an initial denaturation of 95°C for 15 minutes followed by 35 cycles . The plate was read at 70°C according to the melting point of the amplicon. Serial dilutions of cDNA from the lymphoid standard [FAIM, CCL3, SODD, NM23-H1, CARD11, Cyclin G2 and CIITA-8) and the endogenous reference genes (HPRT). For each unknown sample, the relative amounts of target cDNAs and reference cDNAs applied to the PCR reaction system were calculated using linear regression analysis from the corresponding standard curves [Some of the results from the semi-quantitative RT-PCR were also validated by the real-time quantitative PCR with DyNAmo™ HS SYBRstandard were used curves . Then thin vitro RNA amplification and semi-quantitative PCR. JI participated in the design of the study, microarray procedure, data analysis, and drafted the manuscript. LX, RL and SS participated in data analysis. JE provided the microarray facility and various technical assistance and advice. LS and AR provided the reference standard, the Lymphochip and helpful discussions. KD, GZ, TM participated in helpful discussions and interpretation of the data. WCC conceived, organized and supervised the study, and participated in the analysis and interpretation of the data. All authors have read and approved the final manuscript.YS carried out the LCM,

Tumours arising from odontogenic tissues are rare and constitute a heterogenous group of interesting lesions. The aim of this study was to determine the relative frequency of odontogenic tumors (OT) among Nigerian children and adolescents 19 years or younger.The histopathology records were retrospectively reviewed for all the tumors and tumor-like lesions of the oral cavity and the jaws seen in children and adolescents ≤ 19 years seen between January 1980 and December 2003. Hematoxylin and eosin-stained sections were re-evaluated and the diagnosis in each case was confirmed or modified according to World Health Organization (WHO) classification, 1992; and were subjected to analysis of age, sex, site of tumor and histopathologic type.A total of 477 tumors and tumor-like lesions were seen in patients ≤ 19 years during the period of the study. Of these, 92 (19.3%) were odontogenic tumors. Benign odontogenic tumors constituted 98.9% of the cases seen, while only 1 case (1.1%) of malignant variety was seen during the period. The mean (SD) age of patients was 14.9 (± 3.1) years . Male-to-female ratio was 1:1; and mandible-to-maxilla ratio was 2.7:1. OT's were most frequently seen in patients aged 16–19 years (46.7%) and the least number (2.2%) were found in patients aged 0–5 years. Among nine histologic types of OT seen, ameloblastoma (48.9%), adenomatoid odontogenic tumor (19.6%) and odontogenic myxoma (8.7%) were predominant. Multicystic/solid and unicystic variants of ameloblastoma were diagnosed in 40 (89%) and 5 (11%) cases respectively.Odontogenic tumors are relatively common in children and adolescents in Nigeria. One out of every 5 children and adolescents with tumors and tumor-like lesions of oral cavity and the jaws seen in this study had a diagnosis of odontogenic tumor. Tumors and tumor-like growths arising from the odontogenic tissues constitute a heterogenous group of particularly interesting lesions, as they display the various inductive interactions that normally occur among the embryologic components of the developing tooth germ . In humaThere are few reports especially from Africa, which have specifically reported the high frequency of odontogenic tumors (OT) in children and adolescents in the literature. In most previous African reports, odontogenic tumours in children were presented as part of orofacial or oral The histopathology records of the Department of Oral Pathology and Biology, College of Medicine, University of Lagos, Lagos, Nigeria, were reviewed for all the tumors and tumor-like lesions of the oral cavity and the jaws seen in children and adolescent ≤ 19 years from January 1980 to December 2003. Hematoxylin and eosin-stained sections was re-evaluated and the diagnosis in each case was confirmed or modified according to World Health Organization (WHO) 1992 classification . The datA total of 477 tumors and tumor-like lesions were seen in patients ≤ 19 years during the period of the study. Of these, 92 (19.3%) were odontogenic tumors. Benign odontogenic tumors constituted 98.9% of the cases seen, while only 1 case (1.1%) of malignant variety was seen during the period. Table Table Ameloblastoma constituted almost half (48.9%) of the odontogenic tumors with female-to-male and maxilla-to-mandible ratios of 1:1.7 and 1:8 respectively. The mean (SD) age of patients in this group was 15.1 (± 3.0) years with most patients (49%) in age group 3. Multicystic/solid and unicystic variants were diagnosed in 40 (89%) and 5 (11%) cases respectively.Adenomatoid odontogenic tumor (AOT) was the second most common tumor in this series (Table es Table accountiOdontogenic myxoma accounted for 8 cases (8.7%) of odontogenic tumors with a male-to-female ratio of 1:3. Only 1 case occurred in the maxilla, the rest (7) were found in the mandible. The patients were found between 10 and 19 years.Odontogenic fibroma accounted for 7 cases (7.6%) of tumors in this series. More cases were found in males and in the mandible. Patients were seen between 5 and 19 years in this group.Ameloblastic fibroma accounted for 5.4% of cases seen. The lesion occurred exclusively in the mandible with a male-to-female ratio of 1:4.Odontomas accounted for 4.3% of OT seen. They were exclusively found in the maxilla with equal sex predilection.Table We present a report of odontogenic tumours in children and adolescents aged ≤ 19 years. This report represents the largest series of odontogenic tumors in children and adolescents in Africa. We found that 19.3% of tumors and tumor-like lesions of the oral cavity and the jaws in children and adolescent in this study were odontogenic tumors. This is similar to the findings of Arotiba . Howeveret al [et al [A major problem in comparing our report with previous studies is the lack of uniformty in the age group studied in those reports. Some studies were restricted to children under the age of 14 years ,15, or 1et al . Al-Khatl [et al ,13; thesOdontogenic tumors were less frequently seen in patients aged 0–5 years in this study in agreement with most reports in the literature ,11-14,17et al [et al [et al [Odontogenic tumors in children are known to have predilection for the mandible -13. Thiset al however l [et al ; whereasl [et al reportedet al [Ameloblastoma was the most common tumor in this study in agreement with reports from Africa ,11. Otheet al found odet al ,11-14. Aet al . Previouet al ,21. Unicet al ,22,23.Adenomatoid odontogenic tumor (AOT) was the second most common OT in this study and 50% of this tumor was found in patients >15 years. Asamoa reportedet al [In children, the reported incidence of myxoma ranges from 1.2% to 39% ,6,9,13. et al reportedet al ,26,27. Tet al ,27 reporet al [et al [Odontogenic fibroma was reported to be rare in children with incidence ranging from 0% to 1.3% of OT ,9,11,13.et al . Arotibaet al reportedl [et al ; whereasl [et al have repl [et al ,26 have et al [et al [et al [Odontomas are often regarded as dental hamartomas, rather than odontogenic neoplasms ,28,29. Oet al , Tanaka l [et al and Satol [et al that repl [et al . This mal [et al ,17, othel [et al ,14 and sl [et al ,25. OdonMalignant odontogenic tumors are rare, most especially in children ,12,15,30Odontogenic tumors are relatively common in children and adolescents in Nigeria. One out of every 5 children and adolescents with tumor and tumor-like lesions of oral cavity and the jaws seen in this study had a diagnosis of odontogenic tumor.The author(s) declare that they have no competing interests.OFA conceived the study, coordinated the write-up and submission of the article, and also reviewed the slides.ALL, WLA and MOO did the literature search and participated in the writing of the manuscript.All the authors read and approved the final manuscript.None declared

A conditional-lethal recombinant virus was constructed in which the expression of the vaccinia virus I7L gene is under the control of the tetracycline operator/repressor system. In the absence of I7L expression, processing of the major VV core proteins is inhibited and electron microscopy reveals defects in virion morphogenesis subsequent to the formation of immature virion particles but prior to core condensation. Plasmid-borne I7L is capable of rescuing the growth of this virus and rescue is optimal when the I7L gene is expressed using the authentic I7L promoter. Taken together, these data suggest that correct temporal expression of the VV I7L cysteine proteinase is required for core protein maturation, virion assembly and production of infectious progeny. The cysteine proteinase encoded by the VV I7L gene, was originally identified based on a sequence comparison with the African Swine Fever virus proteinase and an ubiquitin-like proteinase in yeast ,2. We haresidues ,4. To delac operator and driven off of the T7 promoter, was responsible for cleaving the A17L membrane protein as well as the L4R core protein precursor. In this work, we show that I7L proteinase, in a different inducible mutant virus, this one regulated by the tetracycline (TET) operator/repressor system and driven off of the I7L native promoter, is responsible for cleaving the other core protein precursors (p4a and p4b). We also demonstrate that expression of the I7L gene from its native promoter appears to be important for optimal viral assembly and replication.While this work was in progress, Ansarah-Sobrinho and Moss publisheTo investigate the role of the I7L proteinase in the viral life cycle, an inducible mutant virus was constructed in which the expression of the I7L gene could be regulated by the presence or absence of TET using the components of the bacterial tetracycline operon ,7. This 40 cells [40 cells. At an MOI of 0.1 or 0.5 there was an average reduction of 99.1% of infectious virus particles and infected with vtetOI7L at an MOI of 0.2 plaque-forming units per cell in the absence of TET. Cells were harvested 24 hours post infection (hpi) and the titer determined on BSCene Fig. . This waene Fig. , suggest35S-met and harvested after 24 h. Extracts were immunoprecipitated with I7L antisera and protein detected by autoradiography. With wild type virus, I7L protein was expressed at each TET concentration (data not shown). However, in the mutant virus, expression of I7L enzyme was repressed in the absence of TET and increased with the addition of TET.We have previously shown through transient expression assays that the I7L proteinase is capable of cleaving the p4b, p4a, and p25k core protein precursors ,4 which To determine the effect of TET concentration on p4b core protein precursor processing, cells were infected in the presence of 0 to 5 μg/ml TET, harvested 24 hpi, and the extracts immunoblotted with anti-4b antisera. With wild type virus p4b was processed at each TET concentration as expected, however with the mutant virus, p4b processing was repressed in the absence of TET (data not shown). The slight processing in the absence of TET is likely due to slight leak-through of I7L gene expression in this system. The same results were seen for the processing of p4a, with processing in each of the wild type virus lanes, repressed processing with the mutant in the absence of TET and increased processing in the presence of TET (data not shown). Kane and Shuman have preet al [The morphogenesis of vtetOI7L under nonpermissive conditions was analyzed via electron microscopy. TREx-293 cells were infected with vtetOI7L at an MOI of 1 in the presence or absence of TET and harvested 24 h later. In the presence of TET, cells contained a variety of both immature and mature forms of the virus declare that there are no competing interests.CMB conducted all the experiments and wrote the manuscript. DEH conceived the study, coordinated the research efforts and edited the paper. Both authors read and approved the final manuscript.

The objective of this study was to investigate the relationship between perceived walkability and overall self-rated health among patients who use community-based clinics.A cross-sectional survey was distributed to a convenience sample in three community clinics. Forms were completed by 793 clinic patients. Multiple logistic regression analysis was to control for the effects of demographic variables and lifestyles.Perceiving the availability of places to walk was related to better self-rated health. The most important places were work (OR = 3.2), community center (OR = 3.12), park (OR = 2.45) and day care (OR = 2.05). Respondents who said they had zero (OR = .27) or one (OR = .49) place to walk were significantly less healthy than persons who said they had five or more places to walk.Persons who perceived that they had no place to walk were significantly less healthy than persons who thought they had at least one place to walk (OR = .39). Support for walkable neighborhoods and education of patients about options for walking may be in the best interests of community medicine patients. Much recent interest and research has been directed at the relationship between one's health and where one lives . A numbeNeighborhoods where walking is convenient might encourage their inhabitants to exercise. Indeed, having convenient places to walk in the neighborhood has been related to the proportion of persons in the neighborhood who met current activity recommendations and withThe hypothesis that perceived walkability is directly related to an individual's overall self-rated health has not previously been investigated. The purpose of this project was to test that hypothesis in patients attending community-based clinics. Self-rated health has been shown to accurately predict overall health as measured by other more traditional measures of health .A cross-sectional survey was used to test the hypothesis that patients with good self-rated health perceived the neighborhoods in which they live as having good walkability, and that this effect was independent of demographic characteristics and lifestyle habits that would predict good health. The sample was drawn from three clinics that primarily serve low-income populations. Clients, parents (if the patient was a child) and accompanying visitors were asked to complete surveys and drop them into a box. Participation was voluntary. A total of 1471 surveys were distributed with an overall return of 825 (56.1%) surveys of which 793 (54%) met eligibility parameters. Pregnant women and persons under age 18 were excluded. Assuming 80% power, p < .05, 20% poor health among the persons inhabiting neighborhoods with good perceived walkability and 30% poor health among persons inhabiting neighborhoods with poor perceived walkability, 626 cases were needed to test the hypothesis. Completed forms were received from a total of 793 persons.Return rates varied by clinic. Clinic 1 is a university-based family medicine clinic providing a full range of primary care services to cross-generational clients. It is staffed by family medicine physicians and residents. Census was approximately 85 clients daily, of which, less than 5 % were non-English speaking. Clinic personnel distributed 500 survey forms over an eight week period with an 80.8% return rate.Clinic 2 serves women and children, providing obstetrical, well care (including immunizations), and acute care services to a targeted high-risk, low socioeconomic sub-population. It is staffed by pediatric and OB-GYN physicians and residents. Approximately 30% of the clinic clients do not speak English. A total of 471 surveys were distributed over a period of 18 weeks with a return of 37.4%. Both the large number of obstetrical patients (ineligible for survey) and percentage of non-English speaking clients contributed to the low return rate.Clinic 3 provides primary care services to a population of indigent adults meeting residential and income screening requirements. It is staffed by internal medicine physicians and residents. A total of 500 surveys were distributed in this clinic over a ten week period with a return of 42.6%.The dependant variable for the study was self-rated health. Subjects were asked whether in general they would say their health was excellent, very good, good, fair or poor. Excellent, very good, and good responses were combined to form a category called 'good health' while fair and poor comprised 'poor health'.Leyden's scale of walkability was modified for a US population for this study by droppBoth demographic characteristics and lifestyle variables were used to adjust the associations between perceived walkability and self-rated health. Lifestyle variables were: numbers of fruits and vegetables eaten per day , smoking status , days of physical activity per week that involve at least 20 minutes of exercise , and obese (yes vs no). Obese was defined as body mass index (BMI) >30. BMI was computed from self-reported height and weight.Demographic variables were race/ethnicity , gender, age category, marital status (married vs. not), and highest level of education achieved.Chi square tests were performed to test for any unadjusted associations between self-rated health and each categorical independent variable. Multivariate logistic regression modeling was employed to determine if associations between perceived walkability and self-rated health remained significant after adjustment for demographic and lifestyle variables. Separate logistic regression models were run for each variable. Statistical analysis was performed using EpiInfo 3.2.2.The question about self-rated overall health was answered by 793 respondents. Of these, 67 percent were classified as healthy because they said their health was excellent, very good, or good. The remainder was classified as having poor health because they said their health was fair or poor.The typical respondent was non-Hispanic white, female, had at least a high school education. The sample was evenly spread across age groups. About half were married and about half were not married Table .Unadjusted relationships between demographic variables and self-rated health are shown in Table The most common number of days of exercise per week was zero (34.9 percent). Most people said they ate at least one fruit or vegetable each day, though only less than half had three or more. The percent obese was 43.6. Over 70 percent were non-smokers . Meeting recommended physical activity guidelines is related to better self-rated health . CertainIf promotion of intensive physical activity is problematic, then more moderate activity might be a more reasonable goal. Simple walking, for example, reduces the cost of medical care for the elderly and inteIn addition to valuing leisure-time walking, researchers and clinicians should take into account the benefits of work related activity and housework . So callOne approach to encouraging moderate physical activity is to increase walkability. The convenience of places to exercise is widely recognized to be important; adults generally support local policies that increase the availability of places to exercise -28. WalkOur purpose was to investigate the effect of perceived walkability on the health of patients attending community based clinics. The results should not be interpreted as being relevant to all persons in the community or even to all persons who live in neighborhoods they perceive to be unwalkable, but only to patients attending clinics that serve a disproportionate share of disadvantaged persons. This is important to public health because the success of strategies designed to improve in overall community health will have to focus on the disadvantaged people who bear the greatest burden of poor health. We believe that more studies of disadvantaged clinic populations such as this one are needed in the public health literature.The study reported here of low income primary care patients confirms the relationship between perceptions of convenient walking locations and self-rated health. Health status is measured by just one question, a practice which has become increasingly common in the public health literature,30. HoweAnother limitation of the study is the subjective nature of the walkability measure. Perceptions of walkability may not be accurate and thus objective assessment of walkability might have led to a different conclusion. However, since our purpose was to investigate the relationship between perceptions of walkability and self-rated health, the results are valid for this sample. If community medicine patients are incorrect in their perceptions of neighborhood walkability, then public health education campaigns and personal health education in clinics can inform them about options for walking in their neighborhoods and how they might overcome any perceived barriers.Our results also may have been influenced by the context from which subjects were drawn. Amarillo is located in the Panhandle of Texas. Most of the year the climate is mild, but during the summer season temperatures can average over 90 degrees. In some neighborhoods, crime rates are above the national average and walking after dark might be worrisome. Furthermore, cities in West Texas are designed for automobile traffic, to the detriment of pedestrians and bicyclists. Furthermore, the vast open spaces in the region make it impossible to reach many locations by foot. Accordingly the, culture of the area has not evolved to be supportive of walking. Therefore, our results may not be generalizable to communities where walking has historical been a visible aspect of the culture.Despite these limitations, the results of this analysis are intriguing and warrant further investigation using a prospective study design. The evidence presented suggests that support for walkable neighborhoods and health education about options for walking in their neighborhoods may be in the best interests of community medicine patients.The author(s) declare that they have no competing interests.JER planned the project, analyzed the data and wrote the first draft of the manuscript. JRP contributed comments and revisions to the manuscript. AD organized data collection and wrote a portion of the manuscript.The pre-publication history for this paper can be accessed here:

SDHD that is frequently mutated in paraganglioma and pheochromocytoma, which are, like neuroblastoma, tumours originating from the neural crest. In this study, we sought for evidence for involvement of SDHD in neuroblastoma.Deletions in the long arm of chromosome 11 are observed in a subgroup of advanced stage neuroblastomas with poor outcome. The deleted region harbours the tumour suppressor gene SDHD was investigated on the genome, transcriptome and proteome level using mutation screening, methylation specific PCR, real-time quantitative PCR based homozygous deletion screening and mRNA expression profiling, immunoblotting, functional protein analysis and ultrastructural imaging of the mitochondria.SDHD mutations causing hereditary paraganglioma. No evidence for hypermethylation of the SDHD promotor region was observed, nor could we detect homozygous deletions. Interestingly, SDHD mRNA expression was significantly reduced in SDHD mutated cell lines and cell lines with 11q allelic loss as compared to both cell lines without 11q allelic loss and normal foetal neuroblast cells. However, protein analyses and assessment of mitochondrial morphology presently do not provide clues as to the possible effect of reduced SDHD expression on the neuroblastoma tumour phenotype.Analysis at the genomic level of 67 tumour samples and 37 cell lines revealed at least 2 bona-fide mutations in cell lines without allelic loss at 11q23: a 4bp-deletion causing skip of exon 3 resulting in a premature stop codon in cell line N206, and a Y93C mutation in cell line NMB located in a region affected by germline SDHD in the pathogenesis of neuroblastoma. Also, although a haplo-insufficient mechanism for SDHD involvement in advanced stage neuroblastoma could be considered, the present data do not provide consistent evidence for this hypothesis.Our study provides no indications for 2-hit involvement of MYCN amplification and 17q gain, also have a profound predictive power [MYCN amplification and 1p-deletion in subgroup 2B and 11q-deletion often in combination with 3p-deletion in subgroup 2A [Neuroblastoma (NB) is the most frequent extra-cranial solid tumour in children, originating from immature neural crest cells of the sympathetic nervous system . The tumve power ,3. Preseve power . Subgrougroup 2A -9.SDHD, which encodes the small subunit D of the mitochondrial respiratory chain complex II (succinate-ubiquinone oxidoreductase) [The first evidence for the occurrence of 11q-deletions in NB was obtained in 1991 . Howeverductase) ,18 and wSDHD in tumour development was obtained by the discovery of germline mutations in this gene as the cause for familial paraganglioma (PGL) [SDHD mutations were also detected in patients with apparently sporadic pheochromocytoma (PC) [SDHD mutations in the 5' portion of the gene causing complete disassembly of complex II, whereas PGL are associated with mutations in the 3' region of the gene causing partial inactivation of its catalytic activity [SDHD in oxidative phosphorylation, SDHD has also been presumed to contribute to the function of the mitochondria as oxygen sensors. It was shown that SDHD inactivation leads to a pseudo-hypoxic state and upregulation of hypoxia responsive genes, possibly through increased production of reactive oxygen species (ROS) [SDHD mutations or reduced activity of SDHD might lead to impaired oxidative phosphorylation and hypoxia and thus contribute to NB oncogenesis.The first evidence for a role of ma (PGL) . Somaticoma (PC) ,21. It sactivity -28. PGL es (ROS) . A hypoxes (ROS) . ConsequSDHD as a positional and functional candidate for the presumed NB tumour suppressor gene on 11q23. In order to search for evidence for involvement of SDHD in NB development, an extensive series of investigations was performed on the DNA, RNA and protein level.In view of the above, we considered MYCN amplification. For all NB patients constitutional leukocyte DNA was available. In addition, 31 NB cell lines were included in the analysis of which karyotypes were available. For 20 of these cell lines, comparative genomic hybridization (CGH) data and/or M-FISH (multicolour fluorescence in situ hybridization) results have been published [Neuroblastoma (NB) tumour samples (at least 70% tumour cells) were collected at the Ghent University Hospital n = 32) and in the Molecular Oncology Unit (n = 35). Ethical approval was obtained for the collection of the tumour samples. The latter group includes selected patients with stage 3 or 4 NB without ublished -32. For and in tublished .SDHD transcripts. RNA of the cell line pellets (treated and untreated) was extracted with the RNeasy Mini kit (Qiagen) according to the manufacturer, followed by RNase free DNase treatment on column (Qiagen). A fraction of the untreated NB cell line cultures was also used for functional enzyme assays.Cultures of NB cell lines N206, SK-N-AS, SK-N-SH, NMB, SK-N-FI, CLB-GA, LA-N-2 and NGP were treated with puromycine (100 μg/ml) during 6 hours in order to prevent possible nonsense mediated RNA decay of variant MLL (11q23.3) SpectrumOrange probe (Vysis) and BAC clone RP11-93E4 for the CRTAM gene (11q24.1) in combination with a centromeric probe for chromosome 11. Labelling and FISH was performed as described [The 11q status of the cell lines was evaluated using FISH. FISH was performed using the LSI escribed . For eacSDHD gene. In order to discriminate between whole chromosome loss, and unbalanced 11q loss , two microsatellite markers on 11p (D11S922 on 11p15.5 and D11S1324 on 11p14.1) were analyzed in patients that showed allelic imbalance for all 11q markers . Scoring of loss of heterozygosity (LOH) was performed by calculation of the allelic imbalance factor (AIF) [All NB patients were analyzed with 4 microsatellite markers on 11q23: D11S1986 (11q23.1), D11S1998 (11q23.3), D11S1356 (11q23.3) and D11S1299 (11q23.3), of which D11S1986 and D11S1998 are immediately flanking the SDHD using Primer Express v2.0 (Applied Biosystems) Table . Exon 1 [ . Primers were designed in a CpG island close to the start of the gene (putative SDHD promotor) (chr11: 111495002–111495330: UCSC Genome Browser freeze version July 2003) . Amplification mixtures (50 μl) for the PCR reaction contained 50 ng template DNA, 1× Platinum Taq PCR reaction buffer (Invitrogen), 6 mM MgCl2, 200 μM of each dNTP, 1.25 U Platinum Taq polymerase (Invitrogen), 3% DMSO and 300 nM of each primer. The cycling conditions comprised 4 min polymerase activation at 93°C, 40 cycles with denaturation at 93°C for 30 sec, annealing at 64°C (methylated primers) or 65°C (unmethylated primers) for 30 sec and extension at 72°C for 30 sec, and a final extension for 5 min at 72°C. SssI methylase (New England Biolabs) treated DNA, following the manufacturer's instructions and normal human genomic DNA were used as a positive and negative control respectively after bisulfite modification.On the 31 NB cell lines and on another series of 50 NB tumours of which 15 were included in the mutation analysis, methylation-specific PCR (MSP) was performed as described, with minor modifications . MSP pri and checSDHD exons were designed using Primer Express v2.0 (Applied Biosystems), based on the publicly available SDHD genomic sequence (accession number AB026906) and 500 nM of each primer. The cycling conditions comprised 3 min polymerase activation at 94°C, 35 cycles with denaturation at 92°C for 20 sec, annealing at 60°C for 20 sec and extension at 72°C for 2 min, a final extension for 5 min at 72°C and a slow decrease in temperature to 25°C over 30 minutes. One μl of the PCR products was analyzed on a Ready-To-Run Agarose Gel (1.2%) (Amersham Biosciences).Intronic primers flanking the m(= 62.1°C)+0.7°C and Tm+1.5°C. Exon 2 fragments were eluted at a temperature of Tm(= 55.7°C)+4.8°C. Exon 3 fragments were eluted at a temperature of Tm(= 57.4°C)-0.4°C, Tm+1.1°C and Tm+3.8°C. Exon 4 fragments were eluted at a temperature of Tm(= 56.4°C)-0.4°C, Tm+1.6°C and Tm+3.2°C. Elution of the fragments was performed using standard conditions according to the manufacturer. Elution profiles were analyzed using the Wavemaker software.Denaturing high-pressure liquid chromatography (DHPLC) was performed using the Wave system (Transgenomic). The melting profile of each fragment was determined using the Wavemaker software v4.1 (Transgenomic). Crude PCR product was injected into a preheated, fully equilibrated chromatographic column for the DHPLC analysis. Exon 1 fragments were eluted at a temperature of TSequencing was performed on all cell lines and on tumour samples with aberrant DHPLC elution peaks .Amplified fragments were purified using the Montage PCR96 filter plates (Millipore) or by excision of the fragment of interest from a 1.5% TBE-agarose gel and purification on a GenElute Minus EtBr Spin Column (Sigma-Aldrich). Cycle sequencing was performed using purified amplicons (3–10 ng), the above-mentioned primers Table at a conPCR primers and minor groove binder (MGB) probes for sequence variant IVS4-32T>C were designed using Primer Express v2.0 following the user bulletin guidelines for the design of MGB probes (Applied Biosystems): forward primer 5'TTTTTTGCAGCCAAGTTATCTGTATAG3', reverse primer 5'TGTCCAAGGCCCCTAAAGAA3', MGB probe allele 1 5'TGTGGTTTTTtATTGATG3' labelled with 6-FAM and MGB probe allele 2 5'TGTGGTTTTTcATTGAT3' labelled with VIC. To address the frequency of the sequence variant g.7876A>G (Y93C) in a normal population, the following primers and probe were designed: forward primer 5'GGCTGCTTATTTGAATCCTTGCT3', reverse primer 5'ACTTGCCAGTGACCATGAAGAGT3' and MGB probe variant allele 5'ATGGACTgTTCCCTG3' labelled with VIC. The reaction mixture contained 10 ng of DNA, 100 nM of each MGB probe, 300 nM of each primer and 1× qPCR Mastermix (Eurogentec). For the screening of the g.7876A>G variant, multiplex PCR was performed using primers and probe of the normal allele of the above-mentioned SNP (IVS4-32T>C) and primers and probe for the variant allele g.7876A>G. Reactions were performed on the iCycler Thermal Cycler (Bio-Rad) with the following thermocycling conditions: an initial activation step at 95°C for 10 min, 50 cycles of 95°C for 15 sec and 60°C for 1 min. Allelic discrimination data analysis was performed on the iCycler IQ Optical System Software v3.0a (Bio-Rad).SDHD_IVS4-32).The SNP info for the IVS4-32T>C variant was submitted to NCBI's SNP database as reported previously [Relative CR assay with minCR assay . The comeviously .Enzyme activities were determined spectrophotometrically as previously described .Protein amount was determined with immunoblot analysis of complex II Fp fragment as previously described . Relativ4 for 1 h at 4°C. Block staining in uranylacetate (UAc) in 70 % ethanol was followed by dehydration in ethanol and propylene oxide, and embedding in Epon. Ultrathin sections were counterstained with UAc and lead. At least 2 cells in each culture were photographed at a magnification of 20,000 in a Zeiss electron microscope operating at 50 KV. Per culture, 25–63 mitochondria were examined. Their projected length (largest straight distance) was measured and matrix electron density was compared to the surrounding cytosol.Mitochondria of NB cell lines LA-N-2, SK-N-AS, CLB-GA, NGP, CHP-901, SK-N-SH, SK-N-FI, N206, SJNB-12, SJNB-8, NMB, SJNB-10 and IMR-32, breast carcinoma cell line MCF-7 and, Ewing sarcoma cell line SK-N-MC were analysed by electron microscopy. Monolayers from these cell lines were briefly rinsed twice in PBS and then immersed at room temperature in 3 % glutaraldehyde buffered with Na-cacodylate at pH 7.3 for 1 h. After rinses in this buffer with 1 % bovine serum albumin, cells were scraped off with a rubber policeman, and centrifuged with 3 % glutaraldehyde. After washing, the pellets were postfixed in 2 % buffered OsOElectron microscopic files were made on 11 archived neuroblastic tumours. In addition, previously published cases were examined for mitochondria morphology.MLL locus (11q23.23) (not shown) . No previously unnoticed submicroscopic 11q23-deletions were detected. Screening for homozygous deletions in all SDHD exons was negative for the 31 NB cell lines.Previous karyotyping, comparative genomic hybridization (CGH) and/or M-FISH revealed 11q-deletions in 9 out of 31 neuroblastoma (NB) cell lines -32. In tMYCN amplification, in contrast to the other patient subgroup for which samples were unselected.In 20 of the 67 NB tumour samples, loss of heterozygosity (LOH) or allelic imbalance (AI) (AIF > 2) in the 11q23 region was found analysis and subsequent sequencing of the Two variants were considered as bona fide mutations Figure . The firIn one patient without 11q allelic loss (F11) we observed in both tumour and constitutional DNA a TCTA insertion at position IVS2+37. However, no additional tumour material nor parental material was available for further analysis. So, it remains unclear whether this is a true mutation or a rare polymorphism.In addition, 1 new and 4 known polymorphisms were observed. The H50R variant found in cell line LA-N-2 was described as a polymorphism in several studies -45. ThisSDHD alleles has been deleted, indicates that all three variants are located on the same allele, representing a low frequent haplotype.The presence of the IVS3-29A>G, S68S and IVS4-32T>C variants in a cell line (NGP) and two tumours (F18 and F35), in which one of both SDHD promotor hypermethylation was tested for 31 NB cell lines and 50 NB patients using methylation-specific PCR (MSP). No evidence for methylation was obtained in any of the analyzed NB cases.SDHD cDNA showed that a 4 bp deletion in the intron-exon boundary in cell line N206 caused skipping of exon 3 leading to a premature stop codon.Amplification of the full-length No alternative transcripts could be detected in cell lines NMB, SK-N-FI, NGP and LA-N-2 carrying basepair variants when grown with or without puromycin Figure .SDHD is bi-allelically expressed, thus supporting recent observations in lymphoblastoid cell lines, adult kidney and adult and fetal brain [The above-mentioned cDNA transcript sequencing revealed that al brain ,22, but SDHD expression levels were measured using real-time quantitative PCR in 31 NB cell lines, normal foetal neuroblast cells and 7 normal adult tissues and normal adult tissue mRNA samples (Mann-Whitney test: P = 1.49E-05).) Figure . The SDHSDHD mRNA levels were significantly reduced in cell lines with 11q allelic loss and SDHD mutated cell lines (i.e. NMB and N206) (N = 9) compared to cell lines without 11q allelic loss (N = 22) (Mann-Whitney test: P = 1.49E-03).SDHD gene encodes the small subunit D of the mitochondrial respiratory chain complex II we decided to assess the effect of the basepair variants on the activity of complex II of the respiratory chain by spectrophotometrical measurements in 5 NB cell lines and 3 control NB cell lines without sequence variants . No significant differences in complex II enzyme activity could be demonstrated. Although, in LA-N-2 a slight decrease of complex II activity was observed (data not shown).As the On above-mentioned cell lines and NB cell lines CHP-901, SJNB-12, SJNB-8, SJNB-10 and IMR-32, breast cancer cell line MCF7 and Ewing sarcoma cell line SK-N-MC, immunoblotting of the Fp fragment of complex II showed no significant variation in abundance among the tumour cell lines (data not shown).Electron microscopic analysis of NB cell lines revealed that the morphology of the mitochondria is heterogeneous between the different cell lines, with respect to length, dilated intracrista spaces and condensation of the matrix Table . In mostIn order to examine whether dilated mitochondrial cristae are a feature of many, or all NBs, we studied the mitochondria in electron micrographs from 11 archived and 22 previously published neuroblastic tumours -53. DilaSDHD in neuroblastoma (NB) tumourigenesis. In a first step, mutation and methylation analyses were performed on a large panel of NB cell lines and tumours. A total of seven sequence variants (in nine different samples) were detected of which two could represent bona fide mutations, i.e. missense mutation Y93C in cell line NMB and a 4 bp deletion in cell line N206.In this study, we investigated the possible involvement of SDHD protein frequently altered due to germline mutations in paraganglioma (PGL) families and consequently the structure of the transmembrane subunit and/or association of the catalytic domain subunits SDHA and SDHB to the membrane would be disrupted .The functional consequence of one sequence variant located within an intronic sequence (IVS2+37ins(TCTA)) is more difficult to evaluate due to lack of fresh tumour material, and parental DNA. Further analysis is needed in order to reveal a possible effect on splicing or RNA stability.Finally, one new and 4 known polymorphisms were detected in 5 NB cell lines and 3 tumour samples. Additional screening for homozygous deletions in all cell lines and methylation in cell lines and tumours were negative.SDHD as a classical tumour suppressor gene in NB. However, the finding of two apparently bona fide SDHD mutations in NB without allelic loss of distal 11q leaves the possibility open that the gene contributes to NB oncogenesis due to haplo-insufficiency, rather than functional inactivation of both alleles. In order to investigate this possibility, we decided to perform further studies at transcript and protein level. Interestingly, SDHD expression was shown to be consistently lower in cell lines with 11q allelic loss versus NB cell lines without loss and also significantly decreased in NB cell lines as compared to normal foetal adrenal neuroblast cells of 16, 18 and 19 weeks gestational time with a mean fold difference of 3.61 between neuroblast cells and NB cell lines. A similar correlation between 11q LOH and reduced SDHD expression was recently described in colorectal and gastric cancer [SDHD mutation. However, measurement of complex II activity might only reflect part of the functional properties of SDHD. Also, measurement of differences in protein quantity is far less sensitive than Q-PCR at transcript levels. Therefore, these observations at present do not fully exclude SDHD involvement in NB. Finally, we also looked at the morphologic characteristics of the mitochondria as a possible clue to SDHD dysfunction. In keeping with, at best, partial loss of function of SDHD, we did not observe similar gross morphologic changes as reported for PGL with SDHD mutations , the latter being characterized by destabilization of complex II with loss of enzymatic activity [Based upon these results, we can exclude a role for c cancer . Our finactivity . Howeveractivity . Subsequactivity ,58. ThisSDHD involvement in NB. However, the finding of, albeit rare, bona fide mutations and reduced expression of SDHD in NB with 11q allelic loss hints at a possible haplo-insufficient contribution to tumour development. A better understanding of the different functions of SDHD, in particular its possible contribution to energy independent apoptosis involving the release of cytochrome c and procaspases, will allow further functional assays to asses how this gene contributes to tumour development in general, and the high stage NB phenotype in particular [In contrast to previous findings in PGL and PC, this study excludes a classical two hit Knudson model for rticular ,60.CDKN1B (p27Kip1) [TP53 (p53) [DMP1 [PTEN [APC [NKX3.1 [SDHD in NB, a bipartite mechanism as tumour suppressor gene for the SDHD gene, as described for the APC gene can at present not be fully excluded. Following this hypothesis, germline mutations in SDHD would predispose to PGL or PC development. Rare somatic mutations and more typically loss of one allele could contribute to the metastasizing NB tumour phenotype , not as an initiating step but rather as later event in tumour development. However, further evidence is needed to support the haplo-insufficient involvement of SDHD in cancer. Ultimately, knockout mice for the SDHD gene leading to haplo-insufficiency for SDHD in neuroblast progenitor cells, would be the appropriate test to evaluate this hypothesis.Evidence for contribution to a cancer phenotype through haplo-insufficiency has recently been obtained for a number of loci, including p27Kip1) ,62, TP5353 (p53) , DMP1 [63) [DMP1 , PTEN [6P1 [PTEN , APC [66 [NKX3.1 . In mous [NKX3.1 . AlthougAIF = allelic imbalance factorCGH = comparative genomic hybridizationDHPLC = denaturing high performance liquid chromatographyLOH = loss of heterozygosityMGB = minor groove binderMSP = methylation specific PCRNB = neuroblastomaPC = pheochromocytomaPGL = paragangliomaROS = reactive oxygen speciesSDHD = succinate dehydrogenase, subunit DSNP = single nucleotide polymorphismSRO = shortest region of overlapThe authors declare that they have no competing interests.KDP carried out the genomic and transcriptomic studies, and drafted the manuscript. JH performed the methylation studies. JS carried out the immunoblottings and spectrophotometric analysis that was evaluated by RVC. AN performed the ultrastructural analysis that was screened and discussed by CV, FR and MP. GL and NVR collected the tumour material. JV and FS participated in the study's design and coordination. All authors have reviewed the manuscript and FS and ADP were the final editors of the manuscript.The pre-publication history for this paper can be accessed here:

The problems associated with the ageing immune system coupled with possible solutions were discussed recently at the British Society for Immunology Annual Congress in Harrogate in December 2004. The session "Ageing and the Immune System in vivo" dealt in details with the immune risk phenotype and the potential methods of reversing the problems of an ageing immune system. This is a commentary on that session. From an early age our immune system is introduced to a variety of infectious agents through contact with infected individuals. We also deliberately present our immune responses either to attenuated organisms or to components of infectious pathogens in order to provoke a response. A successful response to these organisms when first encountered provides us with immunological memory to enable our immune systems to make more rapidly responses to the same potentially infectious agents at a later date. In theory the longer we live the better our memory responses and our ability to cope with any potential pathogen seen previously. Since there are no completely sterile environments, individuals who have survived to reach a ripe old age must have combated many possible infectious agents, and have an immune system with a prodigious memory component. Only part of this is true. As we age the memory component of our immune system, as measured by the number of memory cells, does increase. Unfortunately this is not accompanied by improved immunity even to infectious agents that have been overcome earlier in life -4.The problems associated with the ageing immune system coupled with possible solutions were discussed recently at the British Society for Immunology Annual Congress in Harrogate in December 2004. The session "Ageing and the Immune System in vivo" dealt in details with the immune risk phenotype and the potential methods of reversing the problems of an ageing immune system.+CD28- cells (or CD8+CD28-CD27- in the very old), low numbers of B cells and the presence of CD8 T cells which were cytomegalovirus (CMV) tetramer positive. Within both the OCTO and NONA groups Dr Anders was able to show that the immune risk phenotype had some predictive input towards morbidity. This was even more apparent when cognitive impairment was included in the calculations.The concept of the immune risk phenotype was described by Dr Anders Wikby (Jönköping University) who carried out a longitudinal immunological study in order to establish predictive factors for longevity. Dr Anders first worked on a group of normal octogenarians in the OCTA study in Sweden which later became the NONA study as these individuals entered their nineties. Within this group he was able to describe the immune risk phenotype which he characterised by a CD4:CD8 ratio of <1, poor in vitro T cell proliferation, an increase in the number of CD8+ and show an increased incidence with age, so far it seems that clonal expansion is not due to malignant transformation but may follow antigen stimulation. The control of CMV within the body is mainly attributed to CD8+ T cells and Professor Moss revealed that in older individuals up to 50% of CD8+ T cells may be specific for CMV as judged by tetramer staining. It is possible that this increased response to CMV may lead to the impairment of responses to other viruses in the aged. This theme of CMV infection and ageing was then continued by Professor Graham Pawelec (University of Tuebingen) who introduced the use of the KLRG-1 marker as a marker of senescence. T cells which are KLRG-1+ do not proliferate in vitro when provided with a stimulus which would induced proliferation in T cells which lack this marker. In elderly individuals fewer CMV tetramer positive CD8+ T cells secreted interferon-γ in Elispot assays when compared with similar cells from younger individuals. Furthermore between 96 and 99%of the CD8+ T cells which stained with the CMV tetramer also expressed the KLRG-1 marker. The theme of CMV infection in the elderly was further continued by Professor Arne Akbar (University College London) whose research group has recently been analyzing telomere lengths in different T cell subsets using a fluorescent staining technique. In this method telomeres are stained with a fluorescently labeled probe and the brighter the fluorescent labeling the longer the telomere. Using this technique Professor Akbar reported that CMV specific CD4+ T cells in older individuals had very short telomeres indicating their limited replicative capacity and that more of these CMV specific CD4+ T cells expressed interferon-γ.The effect of CMV infection on the immune system in the elderly was also discussed by Professor Paul Moss (University of Birmingham) with particular emphasis on the clonal expansion of T cells. Clonally expanded T cells are usually CD8This view of a bleak future for displaying the immune risk phenotype was countered by the last two presentations which discussed different approaches to reversing the defects seen in the immune system with age. Both of these methods centered around reversing the atrophy of the thymus seen with age. Dr Jayne Sutherland, currently at the Anthony Nolan Research Institute, detailed her work carried out whilst with Professor Richard Boyd (Monash University) on reversing age associated thymic atrophy by surgical or chemical castration. Studies in mice revealed that reversal of thymic atrophy followed surgical castration and in humans chemical castration produced changes in the TREC levels which indicated improved thymic output. Functional studies showed that this treatment improved immune function in the treated aged subjects. This theme of improved immunity following reversal of thymic atrophy was carried further in work reported by Dr Richard Aspinall . He showed how therapeutic intervention with interleukin 7 and derivates could reverse atrophy of the thymus in old animals and also lead to improved immune function compared with age and sex matched controls. In addition he described work done in the Gambia which suggested a link between the development and enlargement of the thymus after birth and the level of interleukin 7 in breast milk.Two speakers from the posters presentations were also chosen to present their results. K. Wang from Professor Janet Lord's group (Birmingham) presented work on dehydroepiandrosterone, (DHEA). This steroid hormone declines with age and treatment of NK cells with DHEA increases NK cytotoxicity and further analysis shows that DHEA induces PKC-β translocation and upregulates perforin expression in these cells. D. Silva from Donald Palmers laboratory presented work on the expression of neuropeptides in epithelial cells from the thymuses of different species.The meeting revealed that much needs to be done in characterizing the changes in the immune system which are associated with ageing, and members of the audience were asked whether they were interested in receiving more details about the newly formed "Differentiation and Immunosenesence Affinity Group" associated with the BSI.

One of the central problems for much of the 20th century was how to reconcile genetic stability with evolutionary change. Genomic fidelity was thought to arise from an inherent invariability in the DNA structure itself. Biologists now know that DNA constantly undergoes modifications as it unwinds, replicates, condenses, twists, and untwists. This dynamic interplay produces both stability and variation—and occasionally genetic damage. If DNA damage goes unrepaired, it can disrupt chromosomal integrity and may lead to cancer and other diseases. When the DNA double helix breaks, the cell must enlist a number of proteins to repair the broken DNA ends, but much remains to be learned about the molecular mechanisms involved. Tracking a protein that binds to single strands of DNA during replication and recombination in living yeast cells, Xuan Wang and James Haber report that this protein plays a role in at least two key steps in the repair of double-strand breaks in DNA.When double-strand breaks occur, the cell mounts a search for similar (homologous) sequences that can be used as a template to repair the damaged sequence. If successful, the broken DNA molecule basepairs with the homologous region and forms a complex, ultimately replacing the damaged sequence with a similar sequence. In yeast—which serves as a stand-in for higher eukaryotes, including humans—this “strand invasion” process requires both an exchange protein, called Rad51, and a single-stranded DNA-binding protein, called RPA (replication protein A). Single-stranded binding proteins bind to regions of DNA that are opened up during replication. They also bind to strands when broken ends of DNA are cut by enzymes that leave long single-stranded tails. RPA proteins are thought to facilitate the formation of Rad51 polymers, or filaments, on single-stranded DNA by clearing away structures that block Rad51's path. The growing filament searches for homologous DNA sequences and promotes the invasion of the single strand, preparing it to copy the homologous template by “repair DNA synthesis,” which patches up the lesion.To investigate how RPA functions in double-strand break repair in a living organism, Wang and Haber created cells with a double-strand break at a specific site and monitored the activity of proteins recruited to repair the damage. With this approach, the researchers could observe these interactions in living yeast to determine what role RPA plays in repairing DNA damage and how it works with the Rad51 protein.The authors show that as soon as a double-strand break occurs, the RPA protein binds to the exposed strand ends, before the Rad51 protein does. This is not unexpected, because this binding order supports the model that RPA prepares the way for Rad51, perhaps by stabilizing the strand long enough for Rad51 filaments to establish themselves. The surprise was that RPA appears to be necessary even after Rad51 binds to the DNA strand, perhaps by stabilizing the interaction with homologous DNA sequences. That RPA is required for successful repair is supported by evidence that a particular mutated form of RPA can stimulate Rad51 DNA binding normally, but inhibits strand exchange and template copying, thus preventing repair of DNA damage.Wang and Haber's work highlights the complex repertoire of DNA–protein and protein–protein interactions that manage and manipulate the genome in the service of genomic stability. The study of DNA repair mechanisms in living cells—a daunting task—promises to lend valuable insights into the truly dynamic nature of maintaining genome stability.

In situ apoM mRNA hybridization demonstrates that apoM is exclusively expressed in the hepatocytes and in the tubule epithelial cells in kidney. Expression of apoM could be regulated by platelet activating factor (PAF), transforming growth factors (TGF), insulin-like growth factor (IGF) and leptin in vivo and/or in vitro. It has been demonstrated that apoM expression is dramatically decreased in apoA-I deficient mouse. Hepatocyte nuclear factor-1α (HNF-1α) is an activator of apoM gene promoter. Deficiency of HNF-1α mouse shows lack of apoM expression. Mutations in HNF-1α (MODY3) have reduced serum apoM levels. Expression of apoM is significantly decreased in leptin deficient (ob/ob) mouse or leptin receptor deficient (db/db) mouse. ApoM concentration in plasma is positively correlated to leptin level in obese subjects. These may suggest that apoM is related to the initiation and progression of MODY3 and/or obesity.Apolipoprotein M (apoM) is a 26-kDa protein that is mainly associated with high-density lipoprotein (HDL) in human plasma, with a small proportion present in triglyceride-rich lipoproteins (TGRLP) and low-density lipoproteins (LDL). Human apoM gene is located in p21.31 on chromosome 6 . Human apoM cDNA (734 base pairs) encodes 188-amino acid residue-long protein. It belongs to lipocalin protein superfamily. Human tissue expression array study indicates that apoM is only expressed in liver and in kidney and small amounts are found in fetal liver and kidney. Human apolipoprotein M (apoM) was found and initially isolated from chylomicrons by Xu and Dahlbäck in 1999 . Gel filThe identified human apoM cDNA (734 base pairs) encoded 188-amino acid residue-long protein. The 5'-untranslated region was 33 nucleotides and the 3'-untranslated region 120 nucleotides, not including the poly (A) tail. Southern blot analysis of different species gave positive signals in all mammalian genomes but not in DNA from chicken and yeast . Sub. Sub1]. in situ hybridization. In day-15 embryos, apoM was expressed in both liver and kidney. During human embryogenesis, apoM was strongly expressed in livers of 3–5 month-old human embryos and continued to be strongly expressed throughout embryogenesis. In the kidney, apoM expression was highest in 5–9 month-old embryos. There was some expression of apoM in small intestine, particularly in later stages of embryogenesis. In skeletal muscle, minute apoM expression was found in 3–5 months-old embryos, and some apoM expression was found in stomach in earlier stages of embryogenesis [in situ apoM mRNA hybridization demonstrated that apoM is exclusively expressed in the hepatocytes and in the tubule epithelial cells in human kidney [in vivo, which may be related to the hepatic lipid and/or lipoprotein metabolism.Northern blot analyses of multiple tissues showed that apoM was mainly expressed in kidney and liver . Furtherogenesis . These fIn vitro, several biological factors have been tested to examine their influences over the transcription and secretion of apoM in hepatic cell line (HepG2 cells). Like apoB, apoM is highly hydrophobic and must co-circulate with lipoprotein particles in the blood stream. It has been demonstrated that apoB could be down-regulated by transforming growth factor-beta (TGF-β) [in vivo. In another study, Xu et al demonstrated that platelet-activating factor (PAF) could up-regulate apoM expression in HepG2 cells, whereas, lexipafant, a PAF-receptor antagonist significantly suppressed the mRNA levels and the secretion of apoM in HepG2 cells in a dose-dependent manner. Neither tumor necrosis factor-α (TNF-α) nor interleukin-1α (IL-1α) influences apoM expression or secretion in HepG2 cell cultures [ (TGF-β) ,8. Xu et (TGF-β) . It suggcultures . It indiin vivo and in vitro [in vivo. Richter et al. reported that apoM gene expression could be regulated by HNF-1α. Mutant HNF-1α-/- mice completely lack expression of apoM in liver and kidney. Serum apoM levels in HNF-1α+/- mice are reduced by 50% compared with wild-type animals. By analyzing the apoM promoter and identifying a conserved HNF-1 binding site, they showed that HNF-1α is a potent activator of apoM promoter, that a specific mutation in the HNF-1 binding site abolished transcriptional activation of apoM gene. HNF-1α protein can bind to the HNF-1 binding site of apoM promoter in vitro [ob/ob mice [ob/ob mice and in leptin-receptor deficient db/db mice than in control mice. Furthermore, leptin administration significantly increased plasma apoM levels and apoM mRNA levels in liver and in kidney in ob/ob mice [in vivo.Administration of adrenocorticotropic hormone (ACTH) has beneficial effects on plasma lipoproteins -15. A coin vitro ,19, indiin vitro . Liang a/ob mice , suggest/ob mice . Xu et a/ob mice . It is c2, n = 51). In univariate analysis, apoM correlated significantly to leptin , BMI , fasting insulin , total cholesterol , and LDL-cholesterol . The correlations between apoM and cholesterol and between apoM and leptin remained significant after adjustment for the influence of BMI. Forward stepwise multiple regressions when leptin, BMI, insulin and cholesterol were entered in a model as independent variables and apoM as the dependent variable showed that cholesterol and leptin were independent predictors of circulating apoM. These two parameters yielded an r2 of 0.28, thereby explaining approximately 30% of the variance in apoM. Hence, apoM is positively correlated to leptin and negatively correlated to cholesterol levels in humans [Xu et al. investigated the relationship between plasma apoM levels and leptin levels, body mass index (BMI), fasting glucose, fasting insulin as well as lipoprotein concentrations in females displaying a wide range in BMI (18.9–57.1 kg/mn humans . Richtern humans . Alzheimn humans -26. Incrn humans ,28, suggn humans . With thin vivo and in vitro. HNF-1α is one of the most important activator of apoM gene promoter. Plasma apoM concentration is positively correlated to leptin levels and negatively related to plasma cholesterol levels. Both leptin and leptin receptor are essential for apoM expression in vivo. Plasma apoM levels may be used as the marker for identification of MODY3. The detailed relationship between apoM and MODY3 as well as obese needs further investigation.In conclusion, apoM is a novel HDL apolipoprotein. Like apoB apoM could be regulated by several cytokines

Bacillus subtilis MreB and Mbl have been shown to perform dynamic motor like movements within cells, extending along helical tracks in a time scale of few seconds.Bacterial actin-like proteins have been shown to perform essential functions in several aspects of cellular physiology. They affect cell growth, cell shape, chromosome segregation and polar localization of proteins, and localize as helical filaments underneath the cell membrane. Bacillus subtilis MreB has a dual role, both in the formation of rod cell shape, and in chromosome segregation, however, its function in cell shape is distinct from that of MreC. Additionally, MreB is important for the localization of the replication machinery to the cell centre, which becomes aberrant soon after depletion of MreB. 3D image reconstructions suggest that frequently, MreB filaments consist of several discontinuous helical filaments with varying length. The localization of MreB was abnormal in cells with decondensed chromosomes, as well as during depletion of Mbl, MreBH and of the MreC/MreD proteins, which we show localize to the cell membrane. Thus, proper positioning of MreB filaments depends on and is affected by a variety of factors in the cell.In this work, we show that Our data provide genetic and cytological links between MreB and the membrane, as well as with other actin like proteins, and further supports the connection of MreB with the chromosome. The functional dependence on MreB of the localization of the replication machinery suggests that the replisome is not anchored at the cell centre, but is positioned in a dynamic manner. In vitro, actin filaments can deform vesicles and thus push membranes, providing the force to elongate cellular extensions such as pseudopods complemented with 1% casamino acids. Fluorescence microscopy was performed on an Olympus AX70 microscope. Cells were mounted on agarose gel pads containing S750 growth medium on object slides. Images were acquired with a digital CCD camera; signal intensities and cell length were measured using the Metamorph 4.6 program . For and 3D reconstruction, 10 to 12 images (spacing between 0.2 to 0.38 μm) were taken through the focal plane, and processed in Metamorph 6 program. DNA was stained with 4',6-diamidino- 2-phenylindole and membranes were stained with FM4-64 .For microscopic analysis, H J D S performed all experiments, PLG helped with 3D image reconstructions, conceived the study, and participated in its design and coordination. All authors read and approved the final manuscript.

We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined.p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction.p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected.Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein. INI1 mutations, and cause particularly grim clinical outcomes [The current World Health Organization classification for tumors of the nervous system includes medulloblastoma, medulloepithelioma, ependymoblastoma, supratentorial primitive neuroectodermal tumor (sPNET) and atypical teratoid/rhabdoid tumor (ATRT) in the category of embryonal brain neoplasms . These toutcomes . Medullooutcomes . Global outcomes .Little is known about the differences in p53 expression and function among the various embryonal brain tumor subtypes. Initial reports on the p53 tumor suppressor gene suggested it was mutated in 10% or less of medulloblastomas . HoweverSeveral other lines of evidence also support a role for the p53 pathway in medulloblastomas. First, medulloblastomas sometimes arise in the context of Li Fraumeni syndrome, in which p53 germline mutations predispose patients to a wide range of neoplasms . Second,It has been suggested that viral infection of human CNS tissues could promote formation of brain tumors by inhibiting p53 and Rb activity . Some reIn order to confirm the association between p53 immunopositivity, clinical outcome, and embryonal tumor subtype, we stained a tissue array containing representative cores from 80 embryonal brain tumors for p53. We also investigated JC virus infection as a possible mechanism for accumulation of p53 protein by searching for viral sequences using a highly sensitive quantitative real time polymerase chain reaction (PCR) assay. We found an association between p53 immunoreactivity, clinical outcome, and tumor subtype, but did not detect JC virus in medulloblastoma or supratentorial PNET.Medulloblastomas and other embryonal brain tumors diagnosed at the Johns Hopkins University Department of Pathology were identified through review of departmental records. Classic, desmoplastic/nodular and large cell/anaplastic medulloblastomas were classified using World Health Organization guidelines . NuclearThe tissue array was sectioned at four microns, deparaffinized, and subjected to antigen retrieval by steaming (20 minutes at 80°C). Slides were then incubated at room temperature for 45 minutes with monoclonal antibody directed towards p53 . Primary antibody was detected using the avidin-biotin complex (ABC) method with diaminobenzadine serving as the chromagen. We semiquantitatively graded staining intensity as negative, weak, or strong. Carcinomas with mutations leading to p53 stabilization were used as positive controls. No staining was seen in the absence of primary antibody (negative control).JC virus sequences were amplified from DNA using the forward primer PEP-1 (5'-AGT CTT TAG GGT CTT CTA CC-3') and reverse primer PEP-2 (5'-GCC AAC CTA TGG AAC AG-3') . Additio1/N was used to calculate the fiducial (exact) 95% upper bound of JC virus prevalence.p53 statistical analyses were performed using GraphPad PRISM4 software . A two tailed Fishers Exact test was used to compare immunohistochemical staining profiles between groups. Significance of survival differences was assessed using log-rank analysis of Kaplan-Meier curves. The formula 1-We used immunohistochemistry to examine p53 protein expression in representative cores from 80 embryonal brain tumors on a tissue array. Cores from 5 of the cases could not be evaluated due to crush artefact, cautery, or low cellularity. Of the remaining 75 tumors, 64 were medulloblastomas; 31 of these medulloblastoma were of the classic subtype, 13 were nodular/desmoplastic, and 20 were large cell/anaplastic. The tissue array used in this study also contained 11 other CNS embryonal tumors, including 8 sPNET and 3 ATRT. Among the sPNET were 3 with the long epithelial surfaces characteristic of medulloepithelioma.Immunoreactivity for p53 was present in a minority (35%) of the 75 embryonal tumors, and a relatively small subset of cells stained in most of the positive cases. In all positive cases the majority of the immunoreactivity was in tumor cell nuclei. An example of a nodular medulloblastoma with weak, scattered p53 immunoreactivity is shown in Figure We next examined whether p53 immunopositivity was associated with worse clinical outcomes in embryonal brain tumor patients. Of the 75 tumors from 73 patients scored on the array, survival data was available for 66 individuals. 61 percent of patients were alive at last contact, with follow up times ranging from 3 to 215 months (median 47 months). When survival of the entire embryonal brain tumor cohort was analyzed, 67% (31/46) of patients with p53 immunonegative tumors were alive, as compared to 45% (9/20) of patients with immunopositive tumors. Log rank analysis of Kaplan Meier survival curves confirmed the significance of this difference (P = 0.02). When only the 56 medulloblastoma patients with clinical follow up were analyzed, 71% of individuals with p53 negative tumors survived, compared to 58% of individuals with p53 positive tumors. However, these differences were not significant on log rank analysis (P = 0.25). The 6 patients with intensely immunoreactive tumors all died from their disease in less than two years.3 - 2 × 105 per PCR assay (mean 3.4 × 104). Because two copies of ERV-3 are present per human genome, DNA from at least 1000 cells was assayed in each PCR reaction. In contrast, all of the specimens tested were completely negative for JC virus. The quantitative Taqman assay was able to detect a minimum of ~10 copies of JC virus per PCR reaction as determined using a standard dilution curve. Thus the number of JC virus genomes should not exceed 10 per 1,000 tumor cells. Given our 0% detection rate, the 95% confidence limit for the largest value of the 'true' underlying JC virus prevalence is no more than 7.6% (1-(0.05)1/38).To address the possibility that p53 accumulation in medulloblastoma and other embryonal brain tumors is due to viral infection, we used quantitative RT PCR to search for viral sequences in tumor DNA. Of the cases used on the tissue array, 19 had material frozen suitable for high-quality DNA extraction. Four of these cases were p53 positive. Also available in our frozen tumor bank was tissue from 14 additional embryonal lesions . We did not detect JC virus sequences in any of these 33 tumors. We repeated the analysis on DNA extracted from a different tumor tissue fragment in 5 cases, but these spatially distinct regions also failed to contain viral DNA. ERV-3, an endogenous human retroviral element, served as a control and was easily amplified from tumor DNA samples as compared to non-anaplastic ones (18% positive). The percentage of p53 immunopositive medulloblastomas in our study (27%) fell within the previously reported range of 3% to 53% ,17,33,34Interestingly, supratentorial PNET and ATRT were also more commonly p53 immunopositive than non-anaplastic medulloblastoma in our study. While extracerebellar PNET were included in several earlier studies, p53 immunoreactivity was not reported separately for these lesions ,15. Ho aClinical outcomes were significantly worse for embryonal brain tumor patients in our study whose lesions were p53 immunopositive. However, cases most commonly positive for p53 are all more clinically aggressive than non-anaplastic medulloblastomas, making it difficult to infer causality resulting from p53 accumulation. p53 expression did not predict outcome within the group of medulloblastoma patients, although all 3 strongly p53 immunopositive tumors were severely anaplastic and associated with quite short survival. Interestingly, in a recently published report, Ray and colleagues found that p53 immunoreactivity was the only biological marker predictive of poor outcome on both univariate and multivariate analyses in a group of 112 medulloblastoma patients .We also examined the potential role of viral infection as a mechanism for p53 protein stabilization in medulloblastoma. None of the four p53-positive cases from our tissue array with frozen material available contained viral sequences. We also tested nine additional samples of histological subtypes that were more commonly associated with p53 immunopositive staining (anaplastic medulloblastomas and sPNETs) where p53 staining was not performed. None of these tumors were JCV positive. While sample availability precluded complete testing of all confirmed p53 positive tumors for JCV, the available data do not support a causal role for JCV infection in p53 accumulation and development of embryonal brain tumors.The impact of viruses on medulloblastoma pathogenesis is controversial. The most commonly implicated agents are the polyomavirus family members JC virus, BK virus and SV40 virus. Of these, JC virus, which infects approximately 80% of the pediatric population and can cause CNS disease in immunosuppressed patients, has been most studied. It was shown decades ago that inoculation of JC virus into rodents resulted in formation of medulloblastoma-like cerebellar tumors ,22,42,43We failed to detect JC virus sequences in the 33 cases examined, using a sensitive and specific technique which should identify as few as 10 viral genomes per PCR reaction. This suggests the p53 immunopositivity we observe is not caused by JC virus infection in the majority of cases. Our data are also not consistent with the hypothesis that ongoing JC virus infection is common in medulloblastoma. Other recent studies have also reported a lack of JC virus DNA in medulloblastomas. Hayashi and colleagues failed to identify JC viral sequences in 13 medulloblastomas . Kim andIn summary, we find significantly increased p53 protein levels in anaplastic medulloblastomas, sPNET, and ATRT as compared to classic and nodular medulloblastoma. JC virus was not detected in the 33 tumors examined, suggesting that T-antigen binding does not appear to be an ongoing factor in the pathobiology or p53 protein accumulation of embryonal brain tumors.The author(s) declare that they have no competing interests.Drs. Eberhart, Shah and Gravitt planned the study and wrote the initial manuscript draft. Dr. Eberhart, Ms. Chaudhry and Ms. Khaki collected samples, isolated DNA, and performed immunohistochemical staining. Dr. Gravitt supervised and R Daniel performed the JC virus copy number analysis in tumors. All authors reviewed and commented on the final manuscript.The pre-publication history for this paper can be accessed here:

The Angiotensin Converting Enzyme (ACE) insertion/deletion (I/D) polymorphism has received much attention in pharmacogenetic research because observed variations in response to ACE inhibitors might be associated with this polymorphism. Pharmacogenetic testing raises the hope to individualise ACE inhibitor therapy in order to optimise its effectiveness and to reduce adverse effects for genetically different subgroups. However, the extent of its effect modification in patients treated with ACE inhibitors remains inconclusive. Therefore our objective is to quantify the effect modification of the insertion/deletion polymorphism of the angiotensin converting enzyme gene on any surrogate and clinically relevant parameters in patients with cardiovascular diseases, diabetes, renal transplantation and/or renal failure.Systematic Review. We will perform literature searches in six electronic databases to identify randomised controlled trials comparing the effectiveness and occurrence of adverse events of ACE inhibitor therapy against placebo or any active treatment stratified by the I/D gene polymorphism. In addition, authors of trials, experts in pharmacogenetics and pharmaceutical companies will be contacted for further published or unpublished data. Hand searching will be accomplished by reviewing the reference lists of all included studies. The methodological quality of included papers will be assessed. Data analyses will be performed in clinically and methodologically cogent subgroups. The results of the quantitative assessment will be pooled statistically where appropriate to produce an estimate of the differences in the effect of ACE inhibitors observed between the three ACE genotypes.This protocol describes a strategy to quantify the effect modification of the ACE polymorphism on ACE inhibitors in relevant clinical domains using meta-epidemiological research methods. The results may provide evidence for the usefulness of pharmacogenetic testing for individualised ACE inhibitor therapy. Research in genetics and genome sequencing has led to a better understanding of the molecular genetic mechanisms and to the detection of inter-individual genetic differences, so-called polymorphisms, which may have a functional consequence on the response to drugs. Pharmacogenetic tests provide information to better predict and prevent therapeutic failures and adverse drug reaction and raise the hope for an individualised pharmacotherapy -3. AlthoThe ACE polymorphism identified in 1990 by Rigat and co-workers is one oTherefore, our objective is to systematically review all randomised controlled trials that assessed to what extent the insertion/deletion polymorphism of the angiotensin converting enzyme gene influences the effect and adverse events of angiotensin converting enzyme inhibitors on any surrogate and clinically relevant parameters in patients with cardiovascular disease, diabetes, renal transplantation and/or renal failure.We will perform literature searches in (Pre-) MEDLINE , EMBASE , Biosis , the Cochrane Controlled Trials Register and the Science citation index. A preliminary literature search in Medline has been carried out to estimate the range of relevant literature. Out of the citations of the pilot searches (172 citations) we identified articles that met our inclusion criteria. Keywords of these articles were used to refine our search strategies. In collaboration with an information specialist we designed the final search strategies for the six databases avoiding any language restrictions Click here for file

Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD) is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown.2, n = 319) and high BMD at the lumbar spine. Significant findings were verified in two additional sample collections.We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs) located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (<0.87 g/cmPDE4D) gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (<0.91 g/cm2) and 138 females with high (>1.04 g/cm2) lumbar spine BMD. Odds ratios were 1.5 (P = 0.035) in the original sample and 2.1 (P = 0.018) in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09). We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD.Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4 gene family in human osteoporosis.This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in normal and osteopenic mice, but up until now there have been no reports implicating any member of the COL1A1) gene has shown one of the most consistent associations to osteoporosis, even if the association is generally weak for BMD and varies between populations [BMP2, the gene encoding for bone morphogenetic protein 2, as responsible for the linkage [The postmenopausal loss of bone mass and subsequent increased risk of low-energy (fragility) fractures is an important public health problem, especially in countries with a high proportion of elderly individuals. More than 1 million fragility fractures, primarily in postmenopausal women, occur each year in the US. The annual direct medical costs exceed US$10 billion -5. Thereulations -11. Linkulations -19. So f linkage . NeverthPDE4D, the gene encoding cyclic AMP-dependent phosphodiesterase 4D, with lumbar spine BMD. PDE4D selective inhibitors have been shown to promote osteoblast differentiation in progenitor cells [Studies that rely on direct association approaches based on linkage disequilibrium within populations are expected to have greater statistical power and be more feasible to implement than traditional linkage studies to identify common variations that influence common, complex traits such as osteoporosis . Recentlor cells and to ior cells but the The population sample from which the discovery samples were chosen consisted of 5,436 female twins collected at the Twin Unit at St Thomas Hospital, London, England. They were selected without regard to health or trait. The volunteers had been recruited through advertisements and had undergone extensive investigation at the Twin Unit at St Thomas Hospital. Investigations included several questionnaires inquiring about present and past diseases, symptoms, family history, socio-economical factors, and medication. Subjects underwent an extensive clinical assessment including DEXA measurements of bone mineral density and anthropometric measurements ,24. All A twin sample from Royal North Shore Hospital, Sidney, Australia was collected similarly as the UK twin collection. 731 individuals including twin pairs and singletons with lumbar spine BMD assessments were available for genotyping study that collected sib pairs concordant and discordant for bone mineral density . ProbandAll studies were approved by the appropriate research ethics committees. All participants gave their informed consent to participate in genetic studies before enrollment.Bone mineral density was estimated from the L1-L4 vertebrae, hip, and forearm using DEXA according to the user's manual for the Hologic QDR 4500W, at all collection sites.A set of 25,494 SNP markers was selected from a collection of 125,799 experimentally validated polymorphic variations [For pooled DNA assays, 25 ng of case and control DNA pools was used for amplification at each site. All PCR and MassEXTEND™ reactions were conducted using standard conditions . RelativBMP2 were AGCTGGGCCGCAGGAAGTTCG (forward PCR primer), TCGTCAGAGGGCTGGGATGAG (reverse PCR primer) and TGAGGGGCGGCCCGACG (extension primer).Primers used to genotype rs1498608 were ATAACCTCGGGGTCCAGAAA (forward PCR primer), GAATCCCTGTTCATTCCTTG (reverse PCR primer) and CCCTAAAAACTGTTCCAGGTA (extension primer). The primers used to genotype the Ser37Ala polymorphism in -5, PCR/mass extension = 1.7 × 10-4, and chip measurement = 1.0 × 10-4.Tests of association between adjusted lumbar spine BMD group and each SNP using pooled DNA were carried out in a similar fashion as explained elsewhere . BrieflyTests of association using individual genotypes were carried out using a chi-square test of heterogeneity to compare allele frequencies, and Fisher's exact test to compare genotype frequencies (due to low frequency contingency table cells). Confidence intervals and P-values for odds ratios were derived using Fisher's exact test. When one or more cell counts were zero, non-infinite odds ratios were estimated by adding 0.5 to each cell . In the 2 = 0.82) [2 in the low BMD group and 1.11–1.60 g/cm2 in the high BMD group, corresponding to the upper and lower 22nd percentiles. Other characteristics of the samples are described in Table We carried out a genome-wide association study using 25,494 SNPs located within 10 kb of 15,995 LocusLink annotated genes. An overview of the investigative process is shown in Figure = 0.82) . The selPDE4D on chromosome 5q12. Allele frequencies for the T allele based on genotyping were 0.91 in the low lumbar spine BMD pool and 0.88 in the high BMD pool . Complete genotype counts and summary statistics are reported in Table One of the associations was found with rs1498608, an A/T polymorphism within intron 5 of Genome-wide studies using tens of thousands of SNPs and liberal statistical selection criteria are expected to yield a high proportion of false positive associations. To distinguish the true genetic effects from among the false positives, the 78 selected SNPs were genotyped in a second twin sample from Australia.2, P = 0.049) or TT genotypes, thus confirming the results observed in the unrelated tails of this sample. Similar GEE analyses carried out for femoral neck and hip BMD were not statistically significant.The Australian replication sample, a combination of female and male twin pairs and singletons, was analyzed in two ways. First, to create a design and carry out an analysis comparable to the discovery sample, unrelated individuals were selected from the lower and upper quartiles of the sex-specific adjusted lumbar spine BMD distribution Table . A simil2, P = 0.11) and the TT genotypes. Using Z-scores at the femoral neck (P = 0.0007 and 0.0004), total hip (P = 0.003 and 0.007), and lumbar spine (P = 0.03 and 0.02) as dependent variables confirmed this pattern of association. In all cases the AT and TT genotypes had very similar point estimates.Being a sample of mostly affected sib pairs, this sample was unsuitable for formation of groups with contrasting BMD because of the preponderance of individuals with low BMD Table . TherefoPDE4D.In order to better define the extent of the region of association and possibly identify other SNPs more strongly associated with BMD, we performed DNA pool based association fine mapping in the UK sample using 80 publicly available intronic SNPs in the 100 kb region surrounding the incident SNP Figure . This an2 (P = 0.0029). There were no homozygous Ala individuals in this sample.As described in the discussion below, PDE4D inhibition is known to influence BMP2-induced alkaline phosphatase activity in osteoblast precursor cells. Recently, variation in the gene encoding BMP2 was found to be associated with osteoporosis in a study employing whole genome linkage and subsequent positional cloning . Since wPDE4D is associated with low bone mineral density at the lumbar spine in females. PDE4D encodes cyclic AMP-dependent phosphodiesterase 4D. Phosphodiesterases are a superfamily of enzymes involved in degradation of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) [PDE4 genes in human osteoporosis. However, variation in PDE4D was recently reported to be associated with the risk of ischemic stroke [PDE4D variants may have effects on the risk for different common diseases. There are other examples of genes having such pleiotropic effects, the most notable being APOE in hyperlipidemia and Alzheimer's disease [PDE4D association with stroke was strongest for a region in the recently extended 5' end of the gene, which is close to 1,000 kb upstream of rs1498608 [PDE4D to the risk of osteoporosis as well as stroke, it is possible that different domains are involved in the different diseases.In an association study using SNPs in nearly 16,000 genes we obtained evidence that variation in the SNP rs1498608 located within e (cGMP) ,35. cAMPe (cGMP) -39, whice (cGMP) -45. The e (cGMP) , and dege (cGMP) and to ae (cGMP) ,48. PDE4e (cGMP) . PDE4 ine (cGMP) . In spit disease ,51. It sBMP2 and measures of osteoporosis in an international family-based sample ascertained via low BMD probands. Although not statistically significant, this finding was supported by the results in the discovery sample of unrelated high and low spine BMD subjects. The allele frequency in the low BMD group was 2.2% and in the high group 1.4%, with an odds ratio of 1.6 (P = 0.28). The rare allele was less common in our low BMD group than the low spine BMD group (3%) in the Icelandic sample. However, our allele frequencies in the low and high BMD groups and the resulting OR corresponded well with the figures in the Danish sample reported in the same paper [BMP2 and PDE4D in either sample. However, given the low minor allele frequencies of each SNP, there was very little power to test for interaction effects.Given the interaction between BMP2 and PDE4 for the inhibition on osteoblastic differentiation in vitro, it is interesting to note that variants in the gene encoding for BMP2 have also been found to increase risk of osteoporosis in humans . In the me paper . We founPDE4D and lumbar spine bone mineral density was detected, providing the first evidence that a variant of this gene could contribute to the risk of osteoporosis in humans. The effect was similar in size in premenopausal and postmenopausal women, indicating that the effect would be on the attainment of peak bone mass rather than the rate of decrease in BMD after menopause. The lack of a detectable interaction with female sex hormones is supported by having observed a similar genetic effect in the small sample of males in our study. The genetic contribution to peak bone mass is possibly bigger and definitely better documented than the as yet unproven genetic influence on postmenopausal bone loss [PDE4D could contribute to this effect, especially in light of the documented anabolic effect on bone by PDE4 inhibitors.The starting point of the present study was a large-scale association study of more than 25,000 SNPs located in 16,000 genes. After a stepwise selection process an association between an intronic SNP in one loss , and it An association with an intronic SNP provides little evidence for a change in amount or function of the protein that could explain the association. None of the 80 SNPs investigated as part of the association fine mapping were non-synonymous coding changes, which is consistent with the extraordinary lack of variation that others have reported for all PDE classes and PDE4PDE4B in our assay set, rs1318475, was taken through to the second stage . These results suggest that further investigation into possible associations between variants in all PDE4 genes and bone mineral density may be justified.Given the functional similarity between different PDE4 enzymes, we went back and scrutinized our data for associations with SNPs in the other PDE4 genes that may have been overlooked during the first stage of the scan. The only SNP in PDE4D marker and bone mineral density was one result from over 25,000 hypothesis tests. A conservative Bonferroni adjustment to yield an experiment-wide type I error rate of 0.05 would demand a test-wise p-value on the order of 10-6. Given the modest sample size, only common variations with relatively large effects (OR > 2) would reach such significance levels. Instead, we chose to be more mindful of the role of type II error rates and apply a more liberal set of criteria in the initial phases of the study and verify true genetic effects by independent replication. The analysis of 78 selected markers in the Australian replication sample resulted in multiple associations of continuing interest, with rs1498608 displaying one of the strongest associations. A one-sided test of association comparing the results in the discovery and replication samples yields a p-value of 0.0074. This would not be considered significant on an experiment-wide level after Bonferroni adjustment, which would require a p-value on the order of 0.0006 or lower. The analysis in the international replication sample produced contradictory data in that the A allele, which in the first two samples was associated with increased lumbar spine bone mineral density, was associated with decreased BMD at all tested sites. The pattern of association evident from the first two samples, with AT and TT genotypes having very similar point estimates, was preserved in this sample, even in the face of the reverse direction of association. The highly statistically significant association between rs1498608 and femoral neck and hip BMD in this third sample and the consistency in the pattern of association would be unexpected from a spurious result. A possible explanation for the contradictory results could be the fact that the international sample consists mostly of individuals with low BMD since the probands all have a BMD Z-score < -1.5, and most of the siblings also have low BMD. It is possible that within such a selected sample the relationship between rs1498608 and BMD could be altered due to interactions with other genetic or environmental factors.The route by which these genetic associations were arrived at and the potential for spurious association must be considered. Recent published work has brought light to the need for proper validation to verify genetic findings for complex traits -56. In tPDE4D variants in the genetic contribution to BMD in humans merits further investigation.The well-documented anabolic effect on bone by PDE4 inhibitors lends indirect support for the association reported here, and it would seem that the possible role of The result of the present large scale association study together with data from previously published animal models suggest that genetic variation in the gene encoding PDE4D contributes to the variation in lumbar spine BMD in humans.The authors of this manuscript affiliated with Sequenom, Inc. declare competing financial interests, which may include current or prior receipt of salary and/or stock ownership, as Sequenom, Inc. may be affected financially by the publication of this manuscript.RR drafted the manuscript and participated in study design and data analysis. SM was study project leader and participated in data analysis. SK supervised the operational aspects of the study, and was responsible for the development of the SNP marker assay set. CH and GM participated in the development of the SNP marker assay set. SW was project manager for the international multicenter study. PS was principal investigator for the Australian Twin collection. TS was principal investigator for the UK twin and international collections. MN participated in study design, performed the statistical analyses and helped draft the manuscript. AB had the overall scientific responsibility for the study.The pre-publication history for this paper can be accessed here:

Drosophila melanogaster genome were analyzed in vivo, confirming 15 active enhancer regions. A comparison with Drosophila pseudoobscura sequences revealed that conservation of binding-site clusters accurately discriminates functional regions from non-functional ones. 27 predicted gene-regulatory regions in the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters.The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns.We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity. The transcription of protein-coding genes in distinct temporal and spatial patterns plays a central role in the differentiation and development of animal embryos. Decoding how the unique expression pattern of every transcript is encoded in DNA is essential to understanding how genome sequences specify organismal form and function.cis-acting sequences that control transcription, identifying which trans-acting factors act on each regulatory sequence, and determining how these interactions affect the timing and organization of transcription. The first step in this process is by no means straightforward. Regulatory regions are often large and complex. Functional cis-acting sequences are found 5' and 3' of transcripts and in introns, and can act over short or long distances. Most of the described animal regulatory sequences were identified by experimental dissection of a locus, and astonishingly few of these are well characterized.Understanding gene regulation requires discovering the cis-regulatory modules (CRMs) - tend to contain functional binding sites for several different transcription factors, often with multiple sites for each factor.Despite the paucity of good examples, as multiple regulatory sequences from different organisms were identified and characterized, some common features became apparent ,2. Most in silico methods to identify regulatory sequences on the basis of binding-site clustering have been developed and applied to animal genomes [in vivo regulatory activity [As the first animal genome sequences were completed -6, resea genomes -10. Someactivity -17, yet Drosophila development is perhaps the best system in which to apply and evaluate these methods. Development of the Drosophila embryo is arguably better understood than that of any other animal. Sophisticated genetic screens [in situ expression studies [The transcriptional regulatory network governing early screens ,19 have screens and in s studies . TranscrDrosophila melanogaster genome with unusually high densities of predicted binding sites for the early-acting transcription factors Bicoid (BCD), Hunchback (HB), Krüppel (KR), Knirps (KNI) and Caudal (CAD). As nine of these regions overlapped previously known CRMs, we proposed the remaining 28 as predicted CRMs (pCRMs). We tested one of the previously untested pCRMs for enhancer activity in a standard reporter gene assay [giant (gt) in a posterior stripe. Here, we report the systematic testing of the remaining 27 untested pCRMs for enhancer activity, resulting in collections of both bona fide positive and false-positive predictions, allowing us to develop and evaluate methods to improve the accuracy of methods for identifying functional cis-regulatory sequences.In a previous study , we idenne assay ,23 and sD. pseudoobscura was rec species ,26, and Drosophila suggest that similar methods will be valuable in insects as well [D. melanogaster and D. pseudoobscura showed that known regulatory regions are only slightly more conserved than the rest of the non-coding genome [Most methods used to identify regulatory sequences from interspecies sequence comparison are fairly simple. They identify 'conserved' non-coding sequences (CNSs), operationally defined as islands of non-coding sequence with relatively high conservation flanked by regions of low conservation, and assume that this conservation reflects regulatory function. Although crude, these methods have been remarkably effective in identifying mammalian regulatory sequences ,28, and as well . However as well ,31. Simig genome , highligrunt (run), even-skipped (eve), hairy (h), knirps (kni) and hunchback (hb). To determine whether any of the remaining 28 pCRMs also function as enhancers, we generated P-element constructs containing the pCRM sequence with minimal flanking sequence on both sides fused to the eve basal promoter and a lacZ reporter gene . As the margins of the tested sequences do not precisely correspond to the margins of the clusters, we assigned a unique identifier (of the form CEXXXX) to each tested fragment .The 37 pCRMs are shown in Table We successfully generated multiple independent transgenic fly lines for 27 of the 28 pCRMs. We repeatedly failed to generate transgenes containing CE8007. This sequence contains five copies of an approximately 358 base-pair (bp) degenerate repeat. One additional pCRM (CE8002) also contains tandem repeats. While we were able to generate transgenes for CE8002 and assay its expression, these two tandem repeat-containing pCRMs (CE8007 and CE8002) were excluded from subsequent analyses.in situ RNA hybridization to the lacZ transcript in embryos at different stages in at least three independent transformant lines. Nine of the 27 transgenes showed mRNA expression during embryogenesis of gt expression in the blastoderm as previously described [CE8001 is 5' of the gene for the gap transcription factor escribed .nub). The CRM recapitulates the endogenous blastoderm expression pattern of nub, first detected as a broad band extending from 50 to 75% egg length. Although nub expression continues in later embryonic stages, CE8011 expression is limited to the blastoderm stage.CE8011 is 5' of the gene for the POU-homeobox transcription factor nubbin (odd-skipped (odd) and drives expression of two of its seven stripes: stripe 3 at 55% and stripe 6 at 75% egg length. This CRM also has the ability to drive later, more complex, patterns of expression. During stages 6 and 7, expression is detected in the procephalic ectoderm anlage and in the primordium of the posterior midgut. By stage 13, expression is also detected in the anterior cells of the midgut which will give rise to the proventriulus, the first midgut constriction, the posterior midgut and microtubule primordial as well as cells in the hindgut, all similar to portions of the pattern of wildtype odd protein expression previously described [CE8010 is 5' of the pair-rule gene escribed .fushi-tarazu (ftz) and drives expression of two of its stripes: stripe 1 at 35% and stripe 5 at 65% egg length. Using a similar CRM reporter assay, this pattern of expression was also detected by [CE8024 is 3' of the pair-rule gene POU domain protein 2 (pdm2) and appears to completely recapitulate its stage-12 expression pattern, which is limited to a subset of the developing neuroblasts and ganglion mother cells of the developing central nervous system. A similar pattern of expression was previously described for the protein product of pdm2 [nub.CE8012 is in the third intron of of pdm2 . It is wsqz) and recapitulates the wild-type expression pattern of sqz RNA in a subset of cells in the neuroectoderm at stage 12. The wild-type sqz expression pattern was previously described [CE8027 is 3' of the gene for the Zn-finger transcription factor squeeze (escribed .CG9650) that is maternally expressed and deposited in the embryo. This strong maternal expression potentially obscures a zygotic expression pattern. Two additional adjacent genes, CG32725 and CG1958, showed no expression in whole-mount in situ hybridization of embryos.The remaining three active pCRMs cannot be easily associated with a specific gene. CE8005 drives expression in the ventral region of the embryo. It is 3' of a gene encoding a ubiquitously expressed Zn-finger containing protein , which is expressed maternally, possibly obscuring an early zygotic expression pattern (a few in situ images show a hint of striping). sbb is also expressed later in development in the ventral nervous system. An additional potential target, Otefin (Ote), is also expressed maternally and relatively ubiquitously through germ-band extension. All other nearby genes displayed in Figure in situ hybridization or by microarray.CE8016 drives a seven-stripe expression pattern in the blastoderm. It is in the first intron of ftz stripe and two stripes at 39% and 87%. It is in the first intron of ome (CG32145), which is not expressed maternally and has no blastoderm expression, but is expressed late in salivary gland, trachea, hindgut and a subset of the epidermis. All other nearby genes displayed in Figure in situ hybridization or by microarray.CE8020 drives an atypical four-stripe pattern in the blastoderm - two stripes at 7% and 26% that are anterior to the first ome CG3245, whichWith these results, and the nine previously known enhancers, at least 15 of the 37 highest density clusters of the five transcription factors used in our initial screen have early-embryonic enhancer activity. The remainder of this paper examines 35 of the original 37 clusters, with the two tandem repeat-containing clusters excluded. We divide these 35 into three categories - 15 positives (the nine overlapping previously known enhancers plus the six new enhancers identified here), three ambiguous (the three positives without a clear regulated gene), and 17 negatives (see Table reaper), so out of 16 pCRMs located within 20 kb of a gene with appropriate expression, 15 (94%) are active enhancers.All 15 positives are within 20 kb of the transcription start site of transcripts expressed in spatiotemporal patterns consistent with regulation by the maternal and gap transcription factors used in our screen . Only one of the 17 negatives was located within 20 kb of a plausible target (PCE8021 is 7 kb upstream of p = 0.017). The positives have a slightly higher density of binding sites, but this difference was not significant. The binding site composition of the positives and negatives are similar . Although others have reported that some factors have characteristic spacings with respect to themselves and other factors [The positives are, on average, larger than the negatives , a difference that is significant by the Komogorov-Smirnov (KS) test would have been successfully identified by such simple comparative methods, positive pCRMs do not collectively appear distinguishable from flanking sequence on the basis of conservation alone. Although positive pCRMs are almost all in highly conserved blocks, there is a surprisingly high amount of non-coding sequence conservation throughout these regions, and most negative pCRMs are also contained in highly conserved blocks. It remains to be seen whether this difference in the conservation landscape of Drosophila non-coding sequences compared to vertebrates reflects a significant difference in the functional organization of non-coding sequences, or simply indicates that there is too little divergence between D. melanogaster and D. pseudoobscura to detect useful differences in the rates of evolution (see Discussion).We first assessed whether positive pCRMs could be distinguished from their flanking sequences based on degree of conservation. In vertebrate comparative genomics, relatively simple methods (such as VISTA ) are comD. melanogaster and D. pseudoobscura. For each pCRM-containing region, we identified orthologous contigs from the D. pseudoobscura assembly and aligned them using the alignment program LAGAN [p = 0.002 by KS test), the distribution of conservation scores for positive and negative pCRMs overlap considerably, and thus conservation alone is not a useful way of distinguishing positive and negative pCRMs regions in randomly chosen sections of the genome Figure . PositivD. melanogaster and D. pseudoobscura, and that most D. melanogaster enhancers should have functional orthologs in D. pseudoobscura. For those enhancers we seek to identify here - namely those where binding site clustering reflects their function - we expect clustering to be found in both D. melanogaster and D. pseudoobscura. Conversely, clusters that simply occur by chance in either genome but do not reflect the function of the sequence should not be conserved. Thus, looking for conservation of binding-site clustering should provide a valuable way of distinguishing functional and non-functional binding-site clusters in the D. melanogaster genome.We expect that most genes will have similar expression patterns in D. melanogaster binding site that overlaps a predicted D. pseudoobscura binding site for the same factor in an alignment as an 'aligned' site. We require overlap and not perfect alignment to compensate for alignment ambiguity; the overwhelming majority (85%) of aligned sites are perfectly aligned. Although there is only a subtle difference in the binding-site density in the positive and negative pCRMs in D. melanogaster (22.7 sites/kb compared to 22.2), the density of aligned binding sites in positive pCRMs (13.8 sites/kb) is nearly twice that in negative pCRMs (6.8 sites/kb). This is a highly significant difference (p < 0.001 by KS test) and aligned site density better discriminates positive and negative pCRMs than sequence conservation , and soervation ,26.D. melanogaster to be 'preserved' if it can be matched to a corresponding site in the D. pseudoobscura pCRM . If we consider both aligned and preserved sites to be conserved, then roughly 80% of the sites in positive pCRMs are conserved compared with 40% in negative pCRMs.To characterize the extent of binding site conservation independent of positional conservation, we computed a second measure of binding-site conservation. We consider an unaligned binding site in D. pseudoobscura orthologs of active D. melanogaster CRMs we observe an increase in binding-site density that cannot be explained by the positional conservation of sites found in D. melanogaster or the random occurrence of sites in the genome. Several of the 15 positive CRMs have high densities of these preserved but unaligned sites, but two in particular, runt stripe 3 and hairy stripe 6, stand out from the rest. These two have almost as many preserved sites as strictly aligned sites.The density of preserved but not aligned sites in positive pCRMs (4.3/kb) is considerably higher than in negative pCRMs (2.2/kb) or random sequences (1.8/kb). Thus, in the Aligned plus preserved (conserved) site density Figure almost pD. melanogaster and D. pseudoobscura successfully distinguishes positive and negative predictions made using the D. melanogaster sequence alone, we incorporated comparative sequence data into our enhancer-prediction algorithm CIS-ANALYST [As the conservation of binding sites and binding-site clusters between -ANALYST . Instead-ANALYST .Using 17 negative pCRMs and an expanded set of 25 positive pCRMs as are five other known enhancers. One of our negative pCRMs, CE8021, is ranked number 12.As eCIS-ANALYST has markedly better specificity than CIS-ANALYST, we sought to identify BCD, HB, KR, KNI and CAD targets that were missed with the relatively stringent criteria used in our previous analysis. Rather than use a stringent cutoff (15 binding sites per 700 bp) as we did in , we perfDrosophila embryonic expression patterns [To focus our search for new enhancers on genes likely to be regulated by BCD, HB, KR, KNI and/or CAD, we searched FlyBase and a dapatterns and idencis-regulatory modules in Drosophila. Analysis of the in vivo activity of 36 high-density clusters of predicted BCD, HB, KR, KNI and CAD binding sites identified in our previous study [in vivo. An evolutionary analysis of these sequences - based on comparisons of the D. melanogaster and D. pseudoobscura genomes - shows that sequence conservation alone can not reliably discriminate cluster-containing regions that function in vivo from those that do not. However, a new method that combines binding-site clustering and comparative sequence analysis to search for binding-site clusters that are present in multiple species does reliably discriminate active and inactive clusters. Using this method, we make several hundred predictions of new CRMs, a large number of which are located near likely target genes.We performed a large and comprehensive evaluation of the efficacy of computational methods for the identification of functional us study offers cThe success of relatively simple binding-site clustering methods here and in other work is remarkable given the crudeness of these methods. As our negative predictions demonstrate, the mere presence of a cluster of binding sites is not sufficient to make an active embryonically expressed CRM. Although these 17 sequences have binding-site densities and compositions indistinguishable from their functional cousins, they do not function as enhancers in a simple transgene assay.D. pseudoobscura orthologs of these negative pCRMs have binding-site clusters, and few are near genes with appropriate expression patterns. Thus it is unlikely that many function in their endogenous locations in vivo.It is possible that some of these negative pCRMs may be functional enhancers that respond to the factors used in our screen, perhaps requiring a different promoter or other flanking sequences not used in the transgene. While further experiments could address this possibility, we felt these were a low priority, as few of the cis-regulatory sequences.Both the general activity and, more important, the specific regulatory output of a CRM are a complex, and still poorly understood, function of the specific architecture of its sites. The emerging picture of the ordered multiprotein complexes that mediate enhancer activity suggests constraints on enhancer composition and architecture ,2,47 whoin vivo function related to their observed expression patterns. However, the poor conservation of these elements in D. pseudoobscura suggest that they do not have a regulatory function, and raises the possibility that some 'random' clusters of binding sites have the necessary characteristics to be active enhancers in the proper genomic environment . That any such sequences exist suggests that the compositional and architectural constraints on binding sites in enhancers may be fairly weak.It is intriguing that three of the clusters we tested direct expression patterns that bear no obvious relationship to the expression of a neighboring gene despite our extensive efforts to identify such genes. We cannot yet exclude the possibility that these pCRMs have an Whatever the nature of these constraints, it is clear that binding-site density is not the sole defining characteristic of functional enhancers. However, it is a surprisingly effective distinguishing one, and the usefulness of this and related methods suggestsftz and odd. ftz and odd are generally classified as 'secondary' pair-rule genes whose expression is governed by other pair-rule genes rather than by the maternal and gap transcription factors that govern the so-called 'primary' pair-rule genes . Howeveftz enhancer is an evolutionary relic of the homeotic role played by ftz in primitive insects [D. melanogaster and D. pseudoobscura, it seems unlikely that this element is purely vestigial. In fact, Yu and Pick [ftz gene and show that stripes 1 and 5 appear before other ftz stripes and they postulate the existence of stripe-specific regulatory elements that may exist outside of the characterized zebra and upstream elements such as the one identified and characterized in this study. The conservation of binding sites in both the ftz and odd enhancers suggest that they play an important role in development, and further call into question the distinction between primary and secondary pair-rule genes.It has been suggested that the insects , a view and Pick examinednub and pdm2 are expressed in the anterior and posterior midgut primordium and in neuroblasts. CE8011, found immediately upstream of nub, regulates its early expression, and not its later neuroblast expression. In contrast, CE8012, found in an intron of pdm2 regulates its expression only in neuroblasts and not earlier. While we did not detect a neuroblast enhancer for nub or a blastoderm enhancer for pdm2 in our single-species binding-site cluster search, a number of interesting pdm2 regions were discovered in our eCIS-ANALYST search (two are listed in Table Two of the new enhancers (CE8011 and CE8012) are adjacent to and apparently regulate two linked genes with very similar patterns of embryonic expression. Both Drosophila enhancers have been known to work at distances of up to 100 kb, but most are within 10 kb of their target gene. All of our true-positive predictions were within 10 kb of the known or predicted transcription start site of a gene with a pattern that was known, or plausibly could have been, regulated by the five regulators used in our screen . In contrast, only one of the negative predictions was this close to such a gene - an additional four were within 50 kb. As the comprehensive atlas of embryonic expression patterns is completed [The accuracy of our enhancer predictions would almost certainly be improved if we restricted our search space to genomic regions adjacent to genes known to be regulated by particular transcription factors. ompleted ,53 it wiDrosophila. Even assuming the availability of binding data for all of these factors, it will not be possible to search for targets of all combinations of these factors - there are too many possibilities. This is not just a practical problem - it is a fundamental statistical problem. While the false-positive rate for a single combination of factors is low, if we tried even all pairs of factors, it is likely that every region of the genome would have a high binding-site density for some collection of factors. Sequence data from other Drosophila species may allow us to determine which of these collections are conserved and therefore likely to be functional, but it is unlikely that all aspects of regulation can be inferred from comparative analyses and therefore it is essential that we continue to dissect the regulatory network by traditional means.Comprehensive methods for inferring regulatory interactions where they are not already known will be critical for the widespread application of binding-site clustering methods. In addition to allowing less stringent focused screens, they will also help overcome the combinatorial challenge raised by the existence of up to 700 sequence-specific transcription factors in Drosophila transcription factors. The initial success of methods that use in vitro binding data to predict regulatory targets has prompted the characterization of binding specificities for many additional factors. However, the heterogeneity of approaches used makes it difficult to combine these data in an optimal manner. In addition, most of the available transcription factor binding data consists of a few to several dozen high-affinity sites. While these data are very useful, they do not fully represent the binding capacity of a factor and thus do not permit the identification of intermediate or low-affinity sites which are known to be important in some regulatory systems [A greater current limitation in the widespread application of binding-site clustering methods is the absence of high-quality binding data for most systems . We have systems to charaD. melanogaster and D. pseudoobscura was surprising. A major motivation for the National Human Genome Research Institute (NHGRI) support of the D. pseudoobscura genome sequencing was the identification of conserved regions that would guide the annotation of functional sequences in D. melanogaster. D. pseudoobscura was chosen as the second member of this genus to be sequenced in part because it was felt that it had separated from D. melanogaster sufficiently long ago that non-functional sequences would exhibit substantial divergence. However, despite an evolutionary separation that is greater than human and mouse (an average synonymous substitution rate of 1.8-2.6 substitutions/site [The extent of non-coding sequence conservation between ons/site comparedons/site ), and deons/site .One reason for the limited efficacy of these methods is that they do not recognize the specific patterns of conservation characteristic of different classes of functional sequences. For example, coding sequences can be easily recognized from the characteristic triplet pattern in evolutionary rates where the third (and often synonymous) position of codons tends to evolve at a greater rate than the first two positions ,57. Simiodd stripe enhancer) and PCE8015 that this sequence is actively responding to the presence of these binding sites. The poor conservation of binding sites in PCE8015 (no greater than is found in random regions of genome) suggests either that the BCD, HB, KR, KNI and CAD sites in this region are not functional or that the region is undergoing rapid functional diversification. Of course the absence of binding site conservation does not suggest that the sequence is non-functional, merely that these sequences are unlikely to have the particular function we are studying here.Contrast PCE8010 the probability of finding a site for the same factor in the orthologous region of D. pseudoobscura, even if the site is not in the same position. Thus, in this set of positive pCRMs, there appears to be selection to maintain binding site composition, but not always the specific order and orientation of sites. This is consistent with models of enhancer plasticity that have been proposed and discussed elsewhere [In addition to this colinear conservation, we also observe that there is an overall enrichment for binding sites in positive pCRMs independent of the conservation of individual sites. Specifically, the presence of a binding site for a factor in a positive lsewhere ,59-61.D. melanogaster and D. pseudoobscura) most binding sites are conserved and found in the same place. Over longer evolutionary distances, individual binding sites are often poorly conserved even as the overall composition and function of a CRM is conserved.The relative importance of binding-site architecture and binding-site composition to maintaining the function of an enhancer over evolutionary time remains unclear. Over relatively short evolutionary distances . The PCR product was digested with AscI and NotI, and inserted in its native orientation into the AscI-NotI site of a modified CaSpeR-AUG-bgal transformation vector [eve basal promoter, starting at -42 bp and continuing through codon 22 fused in-frame with lacZ [w1118 embryos, as described previously [DNA fragments identified as candidate CRMs were amplified from either bacterial artifical chromosome (BAC) or n vector containiith lacZ . The P-eeviously ,64. Traneviously from eacin situ RNA hybridizations were performed as previously described [gt), RE14252 (odd), RE34782 (nub), RE49429 (pdm2), and RE47384 (sqz). Exon 1 of the ftz gene was amplified from genomic DNA using forward primer 5' GCGTTGCGTGCACATC and reverse primer 5' ATTCTTCAGCTTCTGCGTCTG. The PCR product was cloned into the TA vector (Invitrogen) and used to generate ftz RNA probe.Embryonic whole-mount escribed . RNA prolacZ RNA probes were labeled with digoxigenin-11-UTP (Roche). Hybridizations were performed as described above with the following modifications: (1) 2 μl of each probe were added to give a final concentration of 1:50; (2) sequential alkaline phosphatase staining was performed first with Sigma Fast red to detect endogenous transcripts, stopped by washing for 30 min in 0.1 M glycine-HCl pH 2.2, 0.1% Tween-20 at room temperature, and then continued as described to detect lacZ expression.RNA probes, using cDNAs or genomic DNA as templates, were labeled with fluorescein-12-UTP while The input to the genome assembly was the set of whole-genome shotgun reads from the Baylor Genome Sequencing Center retrieved from the National Center for Biotechnology Information (NCBI) Trace Archive, consisting of 2,607,525 total sequences. After trimming the sequences to remove vector and low-quality regions, the average read length was 607 bp. Approximately 75% of the reads were from short insert (approximately 2.5-3.0 kb) libraries, with another 25% from longer (6-7 kb) libraries. Another 46,040 reads came from the ends of 40-kb fosmids.j, which measures the probability that a contig is repetitive on the basis of its depth of coverage. The default setting is very conservative: if a contig has more than 50% likelihood of being repetitive, it is marked as such and is set aside during most of the assembly process. For large highly repetitive mammalian genomes this setting may be appropriate, but for D. pseudoobscura we found that setting it to 90% or higher produced considerably better contigs, while apparently causing few if any misassemblies.We ran the Celera Assembler several times, and found that by adjusting one parameter in particular we could produce considerably better assemblies. In particular, the assembler has an arrival rate statistic The overall assembly contained 10,089 scaffolds and 10,329 contigs, containing 165,864,212 bp. The estimated span of the scaffolds, using the gap sizes estimated from clone insert sizes, is 172,362,884. The largest scaffold was 3.05 million base-pairs (Mbp) and the scaffold N50 size was 418,046. There are 308 scaffolds larger than 100,000 bp, whose total span is 129.5 Mbp. The N50 contig size, using 166 Mbp as the genome size (not counting gaps), was 43,555. Another measure of assembly quality is the number of large contigs: if we define 'large' as 10 kbp, then the assembly contains 3177 large contigs whose total length is 131,067,828 bp. All of our contigs and scaffolds are freely available by anonymous ftp at [D. melanogaster and D. pseudoobscura in regions containing pCRMs were determined as follows. The D. melanogaster genomic sequence of the region of interest (with known repetitive elements masked) was extracted from a BioPerl genome database [D. pseudoobscura contigs/scaffolds were identified using WU-BLAST 2.0 [D. melanogaster sequence were treated as separate hits. After examining dot-plots of the hits, we noticed a large number of small, local inversions that were found in both our assembly and the assemblies released by the Baylor Human Genome Sequencing Center. We used BLASTZ [D. pseudoobscura sequence. Each D. pseudoobscura sequence was aligned to the D. melanogaster corresponding sequence using LAGAN 1.2 [eve and h loci contain three pCRMs each, and PCE8003 and PCE8004 are within 20 kb of each other). Twenty-eight regions had aligned D. pseudoobscura sequence that spanned all or most of the region. For three regions we were not able to identify large regions of orthologous sequence; these were excluded from subsequent comparative analyses. Dot-plots of the alignments from all 30 regions are available at [The extent and pattern of conservation between database containidatabase . PotentiLAST 2.0 using ded BLASTZ ) to autoAGAN 1.2 with deflable at .D. melanogaster bases aligned to the identical base in aligned regions (percent identity).The conservation of a specific genomic segment was scored as the fraction of D. pseudoobscura binding site for the same factor in the LAGAN alignment. Only overlap, and not strict alignment, was required to compensate for small errors in the alignment. A non-aligned binding site was considered 'preserved' if it could be matched to a D. pseudoobscura site for the same factor within the bounds of the pCRM, allowing each D. pseudoobscura site to be the match for only a single D. melanogaster site. The number of aligned plus preserved sites for each factor in a region is thus equal to the minimum number of sites for that factor in the two species.We used two definitions of binding-site conservation. A binding site was considered 'aligned' if it overlaps a predicted D. melanogaster genome (with annotated repetitive elements and transposable elements masked) and the D. pseudoobscura scaffolds described above. NUCmer was run with the command line parameters (-c 36 -g 10 --mum -d 0.3 -l 9). NUCmer generated a collection of short, highly conserved regions of homology ('anchors') spaced on average every 1 kb throughout the D. melanogaster genome. Anchors flanking either side of a D. melanogaster region of interest were used to pull out the corresponding D. pseudoobscura region, and additional flanking anchors were examined to ensure that the region was unambiguously orthologous. The region identified was re-aligned to the melanogaster region with LAGAN 1.2 using default settings.To develop an orthology map for genome-wide searches, we used NUCmer to alignD. melanogaster genome, sampled uniformly from all non-coding sequence. For 3,300 of these, we could find orthologous regions in D. pseudoobscura, and these were used to calculate the properties of random non-coding sequence shown in Figure To characterize properties of non-coding sequences across the genome, we picked 4,000 1-kb segments of the D. melanogaster genome were determined as described in [Binding-site clusters in the ribed in , where tribed in using thribed in . In the D. melanogaster cluster, we identified the corresponding D. pseudoobscura region using the homology anchors described above. A pairwise alignment was made using LAGAN 1.2 (default parameters), and the number of aligned and preserved binding sites were determined as described above. The 2-kb flanking either side of the pCRM was included in the alignment to avoid edge effects, and was subsequently removed when calculating pCRM properties.For each potential D. melanogaster sites followed an approximately logarithmic curve . From this observation, we classified a D. melanogaster binding site cluster as conserved if:We examined our functional (positive) and non-functional (negative) pCRMs and noticed that in the positives, the lower bound for the number of conserved sites as a function of NSm is the number of binding sites in the D. melanogaster pCRM and NSc is the number of conserved binding sites. Different values of the logarithmic base b give different behavior. The data shown in Additional data file 3 support values of b between 1.15 and 1.4. We defined a more intuitive parameter, CF (conservation factor), which can range from 0 to 1 where 0 is the least stringent threshold (b = 1.4) and 1 is the most stringent (b = 1.15)where b = 1.4 - (CF * (1.4 - 1.15))     (2)CF values of 0.25, 0.5, 0.55 and 0.75 and manually inspected the results with respect to false-negative and false-positive rates based on our 15 positive and 17 negative pCRMs . While we did not strictly optimize a single metric, we picked the values that gave a reasonable balance between false positives and false negatives, b = 0.25 for aligned sites alone, and b = 0.55 for aligned plus preserved sits.We performed genome searches with D. melanogaster. We merged overlapping clusters from runs 1-3, yielding 929 non-overlapping clusters as described in Results.eCIS-ANALYST genome searches were run with the following parameters: min_sites = 10, wind_size = 700 (run #1), and min_sites = 13, wind_size = 1,100 (run #2). All conserved clusters (with conservation defined as described in Equations 1 and 2 above) were combined. In order to capture weaker clusters, we performed an additional run (run number 3) using min_sites = 9, wind_size = 700. For this low stringency run, we used a non-standard conservation threshold different from the one described above, accepting all clusters with at least four aligned plus preserved sites, independent of the number of sites in Four metrics were then used to rank these 929 pCRMs: the number of aligned binding sites; the density of aligned binding sites; the number of aligned plus preserved binding sites; and the density of aligned plus preserved binding sites. All values were normalized according to background distribution of random non-coding sequences. The four normalized values were then summed to compute an overall score, which was then renormalized to arrive at a final z-score used to rank pCRMs in Tables The following additional data files are available with the online version of this article.D. melanogaster genome. The blue line plots the cumulative distribution. The colored asterisks show the average values for each class of pCRM. The panel below the histogram shows the values for each pCRM .Additional data file Additional data file D. melanogaster pCRMs to the number of aligned sites (top panel) and aligned plus preserved sites (bottom panel). Blue dots represent the 15 positive pCRMs from the text; green dots the ten known CRMs that were below the threshold used in [Additional data file used in ; red dotD. melanogaster sequence relative to their D. pseudoobscura ortholog. The location of binding sites in D. melanogaster, binding sites in D. pseudoobscura and aligned binding sites along with the density of sites averaged over 700 bp are shown in the bottom three panels for each region.Additional data file Additional data file The binding site densities (column 1), aligned site densities (column 2), and aligned plus preserved site densities (column 3) for individual transcription factorsClick here for additional data fileExpression patterns of 65 genes adjacent to 122 pCRMs identified by eCIS-ANALYSTClick here for additional data fileD. melanogaster pCRMs to the number of aligned sites (top panel) and aligned plus preserved sites (bottom panel)Discrimination of positive and negative pCRMs. Comparisons of the number of predicted binding sites in Click here for additional data fileNew pCRMsClick here for additional data fileThe primers used to amplify pCRMs for transgenicsClick here for additional data fileAdditional information from Table 2Click here for additional data fileAll new pCRMs from genome-wide eCIS-ANALYST located within 20 kb of annotated transcriptClick here for additional data fileAll new pCRMs from genome-wide eCIS-ANALYST located more than 20 kb from annotated transcriptClick here for additional data fileGenes with anterior-posterior patterns and the source of the informationClick here for additional data fileAll new pCRMs from genome-wide eCIS-ANALYST located within 20 kb of gene with anterior-posterior patternClick here for additional data fileAll new pCRMs from genome-wide eCIS-ANALYST located between 20 kb and 50 kb from gene with anterior-posterior patternClick here for additional data file

Animal studies involving rabbits and a porcine model have demonstrated host tolerance of the implant. There have been no reports describing the histological changes in a human laryngectomy specimen with a Gore-Tex implant.Expanded polytetrafluroethelyne (e PTFE, Gore-TexThe histological findings in a laryngectomy specimen of a patient previously implanted with e PTFE for medialization of a paralyzed vocal fold following excision of a vagal neurofibroma were studied.Histopathology revealed a mild foreign-body giant cell granulomatous reaction with some associated fibrosis. The granulomatous response was limited to the periphery of the Gore-Tex and although it closely followed the profile of the material it did not encroach into or significantly break up the material. There was no significant neutrophilic or lymphocytic inflammation.Our findings are consistent with the animal models confirming that Gore-Tex implantation does not result in a significant granulomatous reaction in the human larynx over a 13-month period. Moreover, there is no evidence of resorption or infection. Further, the lack of lymphocytes in association with the granulomas indicates that there is no significant immunological hypersensitivity. Histologically, the slight permeation by connective tissue is similar to that seen in Gore-Tex vascular and cardiac implants. The degree of the slight giant cell response appears to be dependent on the profile of the material; a sharp edge incited more of a response than a flat surface. Unilateral vocal fold paralysis is symptomatic when it results in failure of the mobile vocal fold to approximate the paralyzed vocal fold during adduction. Despite the lack of movement, the paralyzed vocal fold will often contact the contra lateral mobile vocal fold permitting adequate glottic closure .Medialization laryngoplasty is a common procedure used to restore glottic competence. This procedure was popularized by Ishiki and initially used in patients with vocal fold paralysis. In recent years, the indications for this procedure have expanded to include most forms of glottic incompetence, including the use of bilateral medialization in mobile vocal folds for vocal fold bowing and atrophy .Although medialization is now widely accepted, the choice of implant material is still a subject of controversy. The ideal vocal fold injection material would be readily available, have excellent biointegration with no or minimal immunologic response, has an excellent biomechanical in vivo match to the injection site tissues, and is deliverable through a fine-gauge needle. Such a material does not presently exist.Teflon (Polytetrafluoroethylene) was the first modern material used for vocal fold injection. Long-term results, unfortunately, have shown an unacceptably high rate of granuloma formation associated with Teflon injection. This results in a gradual degradation of the injected material by foreign body giant cells and fibroblastic proliferation in the location of the implant . Autolog®) has been advocated as an implant material for medialization of the vocal fold [Recently, an expanded polytetrafluroethelyne implant with cricothyroid approximation. Videofluroscopy and Speech assessment confirmed an improvement in aspiration and speech. Six months later, her symptoms recurred with subsequent aspiration pneumonia. A decision was made after lengthy counseling to proceed with a laryngectomy 13 months following the implantation of Gore-Tex. Figure The patient subsequently underwent right medialization using Gore-Tex implant declare that they have no competing interests.All authors equally contributed towards the background research and writing of the paper.The pre-publication history for this paper can be accessed here:

Desmoid tumour is a benign, non metastasising neoplasm characterised by an elevated deposition of organic macromolecules in the extracellular matrix (ECM). The matrix metalloproteinases (MMPs) are a family of zinc-dependent proteinases involved in the degradation of ECM macromolecules. The MMPs and their natural inhibitors (TIMPs) have been implicated in tumour growth, invasion and metastasis. In this study we provide evidence that the in vitro cultured cell line from desmoid tumour accumulates more collagen fibres in the ECM than healthy fibroblasts.3H-thymidine incorporation, MMP expression by substrate gel zymography and TIMP expression by Western blot analysis.We investigated collagen accumulation by Desmoid fibroblasts showed a reduction in MMP activity and an increase of type I and III collagen and TIMPs compared to normal fibroblasts.The increase in collagen in desmoid fibroblasts was due to inhibited collagen degradation (reduction of MMP activity) rather than to increased collagen synthesis. Adding toremifene, an anti-estrogen triphenylethylene derivate, to desmoid fibroblasts reduced collagen accumulation by decreasing mRNA expression and increasing collagen degradation. Confluent cultures were obtained after 48 h of in vitro maintenance. The cells were cultured for 12 h in MEM. The medium was then discarded to avoid serum factor contamination. Toremifene was dissolved in ethanol and all the cultures were maintained in MEM containing ethanol or MEM containing toremifne in ethanol and treated as described below.Fibroblast cell lines were obtained from patients with Gardner's syndrome and were provided by NIGMS . The GMO 6965 cell line was obtained from phenotypically healthy fibroblasts, and the GMO 6888 cell line was obtained from desmoid fibroblasts. All cell lines were cultured in Eagle's minimal essential medium (MEM) supplemented with 20% fetal bovine serum (FBS) , 2% non-essential amino acids (GIBCO), 2 mM L-glutamine, 100 U/ml penicillin and 100 U/ml streptomycin in a humidified 5% CONormal (control) and desmoid fibroblasts were cultured for 24 h in MEM and ethanol or MEM containing 1 μM toremifene in ethanol . Then 50 μl of sterile 0.4% trypan blue solution was added to each culture well; cultures were incubated at 37°C for 15 min. Viable cells (trypan blue negative) and dead cells (trypan blue positive) were counted by a Burker chamber.3H-proline in the presence or absence of 1 μM toremifene. In a second set of experiments desmoid fibroblasts were cultured in MEM supplemented with L-ascorbic acid (50 μg/ml), β-aminopropionitrile fumarate (50 μg/ml) for 48 h with or without toremifene. 3H-proline was added for 48 h, for the last 24 and for the last 3 h. At the end of the labelling period collagen was extracted using the method of Webster and Harvey dCTP (3000 Ci/mM) by random priming (Amersham RPN 1601). Hybridisation was performed at 65°C overnight using 106cpm/ml probe in the same buffer used for pre-hybridisation. After hybridisation, the nylon membrane was washed twice in 1 mM EDTA pH 8, 20 mM Na2HPO4 pH 7.2 and 5% SDS at 65°C (5 min each) and then washed twice with 1 mM EDTA pH 8, 20 mM Na2HPO4 pH 7.2 and 1% SDS at 65°C (5 min each). The filters were stripped and re-hybridised with a GAPDH probe to assess blot loading. For autoradiography the membranes were exposed to Kodak X-Omat film at -80°C for 1 day. Autoradiographies were analysed by computerised scanning densitometry. Results are expressed as the ratio of procollagen α1(I)/control GAPDH densitometry signals.Total RNA was isolated from confluent cultures of normal and desmoid fibroblasts maintained for 48 h in MEM alone or supplemented with 1 μM toremifene using the method of Chomczynski and Sacchi . For NorA 670 bp Eco RI-Hind III cDNA fragment from human pro-collagen α1(I) and a 1.3 kb PstI cDNA fragment from rat glyceraldehyde-3-phosphate dehydrogenase were used as probes in hybridisation .2, 0.02% sodium azide, pH 7.4) and then dialysed overnight against the same buffer. The latent procollagenase was activated with trypsin (10 μg/ml) and then the trypsin was inactivated with soybean trypsin inhibitor (100 μg/ml). Acetic acid soluble type I collagen (25 μl of a solution 2 mg/ml) from bovine skin was incubated with the activated collagenase solution for 24 h. The products of the collagen digestion were separated by electrophoresis using 6% acrylamide gel containing SDS. The gels were stained with 0.25% Coomassie brilliant blue G-250 , destained appropriately and fixed . The digestion products were quantified with a computerised scanner.Collagenase activity was determined using the method of Khorramizadeh et al., . Conflueg to remove cell debris, dialysed against bidistilled water for 24 h, lyophilised and used for zymography and Western blot analysis as described below.Confluent normal (GMO 6965) and desmoid (GMO 6888) fibroblasts were washed with 0.9% NaCl and cultured for 12 h in serum-free MEM. This medium was discarded to avoid contamination by serum factors and cells were cultured for the next 24 h in MEM and ethanol (control) or in MEM containing 1 μM toremifene in ethanol . Conditioned media (CM) were collected and centrifuged for 10 min at 350 2, 0.02% Brij-35 and 200 mM NaCl at 37°C for 24 h. Gels were stained with Coomassie brilliant blue G-250. Proteinase activity, observed as cleared (unstained) regions, was converted to dark regions to better observation of bands.CM were analysed for gelatinases and collagenases by zymography. Samples were separated under non reducing condition on 6% polyacrylamide gels containing 1 mg/ml of gelatin or 1 mg/ml collagen (Sigma) . In one CM were analysed for type I and type III collagen, MMP-1, MMP-2, MMP-9, TIMP-1 and TIMP-2 by Western blotting using specific monoclonal antibodies. Aliquots of CM, containing 50 μg of proteins, were separated on SDS-10% polyacrylamide gels under reducing conditions and transferred on to a nitrocellulose membrane. The membrane was blocked with blocking solution and incubated with the specific monoclonal antibody in antibody solution . Bound antibody was detected with a sheep anti-mouse peroxidase-conjugated antibody in antibody solution. Western analysis was performed using chemiluminescence reagents from Amersham Pharmacia Biotech.Protein concentrations were determined by the Lowry assay of aliqut-test. Data are expressed as the means ± SD of four determinations. In other experiments, the results are reported as means ± SD of three separate experiments, each performed in quadruplicate. Statistical analysis was performed by Student's two-tailed t-test and by analysis of variance (ANOVA) followed by Sheffe F-test.In some experiments, statistical analysis was performed using Student's The amount of dead cells and viable cells in normal fibroblasts, desmoid fibroblasts and desmoid fibroblasts plus toremifene was evaluated after 24 h of in vitro maintenance in the presence of trypan blue Table . Granted3H-proline mRNA level in normal and desmoid fibroblasts . Toremifene down regulated procollagen mRNA expression by 58% in desmoid cells.Northern blots were performed to analyse procollagen αMedia from normal and desmoid fibroblasts with or without toremifene were analysed by Western blotting to evaluate the presence of type I and III collagen using specific monoclonal antibodies Fig. . Densito1 and α2 chains of type I collagen into their corresponding 3/4 and 1/4 fragments than the collagenase in desmoid fibroblasts gene expression, which showed mRNA levels were only lower in desmoid cells treated with toremifene. Normal and desmoid fibroblasts expressed different amounts of MMPs. Several studies suggest that MMPs are over-expressed in malignant tumour progression and facilitate both local tumour invasion and metastasis [Desmoid tumour is a benign non-invasive and non-metastasising neoplasm with an abnormal ECM macromolecule deposition which is stimulated by TGFβ1 ,23,24. T1 . There iroblasts , in the tastasis ,28. Difftastasis . They matastasis ,30. Nishtastasis showed Mtastasis ,33. Thertastasis . In thistastasis . Moreovetastasis which istastasis . Using Wtastasis ; hence, Upregulation in both inhibitors of MMPs may explain why the Desmoid tumour is characterised by an abundant deposition of ECM macromolecules and is neither malignant nor invasive. Toremifene addition to desmoid fibroblasts reduced the accumulation of collagen fibres but its mechanism of action remains unclear. Toremifene increased MMP-1 and MMP-2 activity by 8% and 25% respectively and decreased TIMP-1 by 18%. Despite these modest effects type I collagen degradation in 3/4 and 1/4 fragments increased almost 4-fold.1 was 6-fold higher in desmoid than in normal fibroblasts and that toremifene significantly reduced TGFβ1 activity and TGFβ1 membrane-receptors [1 because the growth factor enhances organic macromolecule accumulation in the ECM via a reduction in MMP-1 and MMP-2 [1 activity. Further studies on the regulation of MMP activities may clarify the role of toremifene on ECM degradation and provide important clues about pathogenesis of desmoid tumour.Our previous studies showed that TGFβeceptors . So the nd MMP-2 and an ind MMP-2 , so favoThe author(s) declare that they have no competing interests.CB carried out collagen synthesis, collagenase activity and drafted the manuscript.CL and GB participated in the design of the study and carried out Northern blot analysis.LM and GG carried out RT-PCR, zimography and oestrogen receptor assay.AB and LC carried out Western blot analysis and performed the statistical analysis.PL conceived of the study, and participated in its design and coordination.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Current business models for drug development are inefficient and ineffective - drugs are not reaching all who need them. Hubbard and Love contend that it is time to explore some alternatives The AIDS crisis has brought to public notice what has always been generally true—that the existing business model for drug development leads to high prices and unequal access. There is now widespread dissatisfaction with drug prices in both the developed and deveToday's high drug prices are a direct consequence of a business model that uses a single payment to cover both the cost of manufacture of a drug and the cost of the research and development (R&D) carried out by manufacturers to discover it. A 20-year patent-based marketing monopoly is then granted to the drug's developers to prevent their prices being undercut by ‘generic’ copies produced by manufacturers who do not have R&D costs to recover. Preventing such ‘free riding’ on R&D has become a global trade issue at the World Trade Organisation (WTO) . The impUnfortunately, monopoly-based business models have unpleasant side effects. Since the primary responsibility of any company is to maximise return on investment, it is unsurprising that there is pressure on pharmaceutical companies to set drug prices to whatever level gives the highest return, excluding those individuals who cannot afford to pay, rather than maximising the number of patients treated. There is also pressure to misuse the power given by patents, using them as anticompetitive weapons to block innovation and extend marketing monopolies. And there are growing fears that the huge growth in the use of patents is in itself starting to inhibit research . SomethiPropping up the present structure for financing R&D is the wby any means, not just by the implementation of strict TRIPS intellectual property rules, as at present.Analysis of worldwide drug expenditure shows that spending varies, but is close to 1% of the gross domestic product (GDP) in most developed and developing countries . AssuminCountries that met the norm would then be free to decide whether they wanted to follow a strictly patent-based system as at present, with high drug prices for 20 years, or experiment with new models based on the creation of separate competitive markets for sales and R&D . CountriThe existing system , despiteOne obvious approach is direct funding of drug development. For example, the National Institutes of Health (NIH), the national agency in the United States, already spends $27 billion per year on research, a substantial amount of which is directed towards drug development, including clinical trials. The NIH already has a track record in developing important drugs for severe illnesses, such as cancer or AIDS, showing that this is a viable model. It is also widely recognised that much of the research carried out across the world by similar agencies underpins the existing commercial research that leads to new drugs.www.mmv.org), the Global Alliance for TB Drug Development , the International AIDS Vaccine Initiative (www.iavi.org), the Drugs for Neglected Diseases Initiative (www.dndi.org), and the Institute for One World Health .Governments could expand direct funding for drug development, either through the existing structures in academia or through funding R&D arms of existing companies to carry out specific drug R&D. Such directed drug development funding could be similar to existing nonprofit development projects, such as those currently resourced to address treatments for neglected diseases like malaria and tuberculosis (TB). Examples of such projects are the Medicines for Malaria Venture could easily become bureaucratic and inefficient.As a possible alternative, we propose a competitive financing scheme that would work through R&D investment intermediators. These R&D funds would be licensed and regulated (like pension funds). Their role would be to manage R&D assets on behalf of consumers. Individuals (or employers) would be required to make minimum contributions into R&D funds, much as there are mandatory contributions to social security or health insurance or to pension funds. Government would set the required contribution, but the individual (or employer) would be free to choose the particular intermediator that received their contributions. Intermediators would compete to attract funds to invest in R&D on the basis of their prowess for drug development and upon their priorities. Different business models for financing R&D could be tested in such a market, with intermediators experimenting with prize systems, direct investments in profit or nonprofit entities, open collaborative public good models, or other approaches.We believe the economics of a change in the paradigm for funding R&D are highly favourable. Taken together, the two core steps of changing the trade framework and moving away from marketing monopolies can change the world in a positive way. We can raise global R&D levels as a matter of policy and ensure that resources flow into the areas of the greatest need, and we can do so knowing that the poor and the rich will have access to new inventions at marginal cost. Policy-makers will be weaned from their current unhealthy addiction to ever-higher levels of intellectual property rights as the only instrument to raise R&D levels, a path that has increasingly reached diminishing returns or become counterproductive. With new instruments to address the overall levels of R&D investment, policy-makers can more constructively address the well-known inefficiencies in the patent system without the fear that global R&D levels will suffer and explore alternative models . At the The most important is the World Trade Organisation (WTO) agreement on Trade-Related Aspects of Intellectual Property (TRIPS), which requires member countries to issue 20-year patents on all fields of technology. All but the least-developed countries must comply by 2005. Going much further than the TRIPS are a plethora of regional and bilateral ‘TRIPS-Plus’ trade agreements, pushed in particular by the United States, which require even higher levels of intellectual property protection, such as limitations on the use of compulsory licensing, a tool used by governments to override the strong exclusive rights of a patent in return for compensation to patent owners. In 2001 the WTO adopted the Doha Declaration on TRIPS and Public Health, which said that ‘the Agreement can and should be interpreted and implemented in a manner supportive of WTO Members’ right to protect public health and, in particular, to promote access to medicines for all'. In order to promote ‘access to medicines for all’, countries have to find new ways of financing R&D.

Anyone who's ever had a physical exam knows the monosynaptic stretch reflex arc. When the doctor taps your patellar tendon with a hammer, your quadriceps muscle briefly stretches and your knee responds with a quick kick. This involuntarily reflex is mediated by muscle spindles, specialized muscle structures containing both proprioceptive (sensory) and motor neurons. Proprioceptive neurons send information about how much the muscle is stretched to the spinal cord, and motor neurons emanating from the spinal cord tell the muscle to contract, which corrects the stretch.This reflex circuit is established in the developing embryo, when neurons migrate through and around developing tissues and send their axons to their signaling targets. Many neurons will successfully extend their axons into a target—which might be a muscle, another neuron, or some other tissue—but not all survive the process. Whether a neuron lives or dies depends on a family of growth factor proteins called neurotrophins. If a sensory neuron doesn't get enough neurotrophin-3 (NT-3), it will die.Proper development of the sensory/motor circuit also depends on NT-3, which is expressed in limb buds, muscle spindles, and the ventral spinal cord: muscle spindle development depends on sensory axons, and motor neuron connections depend on developing limb buds. It has not been clear, however, whether NT-3 simply ensures the survival of proprioceptive neurons or whether it also helps establish the proprioceptive reflex arc. In a new study, Reha Erzurumlu and colleagues demonstrate a clear role for NT-3 in axon guidance.Bax, which activates the cell death pathway for sensory neurons. This system removes NT-3 signaling without killing the sensory neurons, so the researchers can investigate any effects NT-3 may have on axon behavior.Attempts to investigate the axon guidance theory have been difficult since sensory neurons die without NT-3. To circumvent this problem, the authors developed a “double knockout” mouse model that deletes both the NT-3 gene and the apoptosis-promoting gene Erzurumlu and colleagues showed that sensory neurons, in the absence of NT-3 signaling, project to the right places but never reach their final destination. In normal development, sensory neuron axons travel into the ventral spinal cord and form synapses with motor neuron dendrites in the ventral horn to establish the reflex arc circuit. In the double knockout mice, sensory neurons manage to extend into the spinal cord, but then get lost; they can't find the ventral horn, so they never form a synapse with the motor neuron dendrites. The failure to establish connections between the sensory axons and motor neurons in mice lacking NT-3, the authors argue, indicates that NT-3 is required for proper axon targeting.Similarly, deprived of NT-3 signaling, sensory neuron axons fail to reach their ultimate targets in peripheral muscle. They project down toward the muscle but don't recognize the muscle and thus cannot enter or innervate it. Consequently, the muscles' sense organs, the muscle spindles, cannot differentiate. The authors argue that these findings, along with the results of tissue culture experiments, show that NT-3 acts as a short-distance cue for proprioceptive axons, which travel in the right direction but ultimately lose their way without NT-3.Altogether these results show that proprioceptive axons require NT-3 not just for survival, but to reach their proper endpoints in the peripheral and central nervous system. NT-3 also helps proprioceptive axons initiate muscle innervation and spindle differentiation. Researchers developing therapies to treat neurodegenerative injuries have increasingly focused their attentions on growth factors like NT-3. By identifying the molecules and mechanisms that establish connections between sensory and motor neurons during development, it may be possible to engage similar processes to attenuate neurodegeneration and even repair damaged nerves.

Thus, activation requires conformational changes across the interface that coordinate the positioning of catalytic residues in both GTPase sites. A distinct class of mutants exhibits half-site reactivity and thus allows us to further uncouple the activation of individual GTPases. Our dissection of the activation process suggests discrete conformational stages during formation of the active SRP•SRP receptor complex. Each stage provides a potential control point in the targeting reaction at which regulation by additional components can be exerted, thus ensuring the binding and release of cargo at the appropriate time.The signal recognition particle (SRP) mediates the cotranslational targeting of nascent proteins to the eukaryotic endoplasmic reticulum membrane or the bacterial plasma membrane. During this process, two GTPases, one in SRP and one in the SRP receptor , form a complex in which both proteins reciprocally activate the GTPase reaction of one another. Here, we explore by site-directed mutagenesis the role of 45 conserved surface residues in the Ffh-FtsY interaction. Mutations of a large number of residues at the interface impair complex formation, supporting the importance of an extensive interaction surface. Surprisingly, even after a stable complex is formed, single mutations in FtsY can block the activation of GTP hydrolysis in A molecular dissection of the bacterial signal recognition particle-receptor complex reveals discrete stages that provide control points in the protein targeting reaction, ensuring appropriate timing of binding and release GTPases comprise a superfamily of proteins that provide molecular switches to regulate many cellular processes, including translation, signal transduction, cytoskeletal organization, vesicle transport, nuclear transport, and spindle assembly . In manyTwo homologous GTPases, one in the signal recognition particle (SRP) and one in the SRP receptor , mediate the cotranslational targeting of membrane and secretory proteins to the eukaryotic endoplasmic reticulum (ER) membrane or the bacterial plasma membrane. During the targeting reaction, SRP and SR switch between different functional states . SRP firHowever, the regulatory mechanism of the SRP family GTPases provides a notable exception to the “GTPase switch” paradigm. Unlike many other GTPases, no external GEFs or GAPs are known for the SRP and SR GTPases. Instead, Ffh and FtsY bind nucleotides weakly, and nucleotide dissociation and exchange are very fast ; thus, tRas GTPase fold. In addition, all SRP family GTPases contain a unique “N” domain, which together with the G domain forms a structural and functional unit called the NG domain. The crystal structures of the individual Ffh and FtsY NG domains show that both proteins have a wide-open GTP-binding pocket, and the apoforms of these proteins are stabilized by a network of side-chain interactions in the empty active site How do these GTPases act as reciprocal activating proteins for one another, and (ii) how does the SRP family of GTPases switch between the “on” and “off” states, as the GTPases are predominantly in the GTP-bound state as they enter the targeting cycle and no stable, GDP-bound state exists under cellular conditions?Escherichia coli FtsY and showed that mutations that have deleterious effects on the Ffh-FtsY interaction define a large surface patch on FtsY that lies on its interaction surface with Ffh identified in the crystal structure does not equal the dK (16 nM) of the Ffh•FtsY complex. Likewise, the mK of the reaction with mutant FtsY does not necessarily equal the dK of the mutant Ffh•FtsY complex, and thus cannot meaningfully distinguish between mutational effects on complex formation and GTPase activation.In contrast, for Class II and III mutants, the rate of GTPase reaction remains slow even at saturating concentrations of FtsY (data for representative mutants are shown in 0k). Addition of mutant FtsY [FtsY(mt)], which can form a complex with Ffh, will sequester the Ffh molecules into a less active Ffh•FtsY(mt) complex complex.To circumvent these problems, we devised an assay to determine the ability of each FtsY mutant to inhibit the interaction of wild-type FtsY with Ffh. This assay allowed us to monitor selectively complex formation between Ffh and the FtsY mutants. The conditions of the assay were designed so that in the absence of any mutant FtsY as an inhibitor, a robust GTPase reaction mediated by Ffh and wild-type FtsY was observed A, k0. Ad2-fold weaker than the affinity of wild-type FtsY for Ffh stood out as strong inhibitors. These mutants -specific Ffh mutant, Ffh D251(248)N. Asp251(248), located in the GTP-binding consensus motif, is conserved throughout the GTPase superfamily and forms a hydrogen bonding network with the N2 and N3 amino protons on the guanine ring . In the presence of XTP, Ffh D251(248)N stimulates the GTPase reaction of FtsY and, reciprocally, its XTPase reaction is stimulated by FtsY in the presence of GTP. We therefore used Ffh D251(248)N to monitor the individual hydrolysis events—XTP hydrolysis from Ffh D251(248)N and GTP hydrolysis from the mutant FtsY constructs—in the Ffh D251(248)N•FtsY complex.The mutants described above were identified by analyzing the sum of the two GTP hydrolysis reactions from both Ffh and FtsY. All of the Class II and III mutants must be defective in ine ring . The AspAs expected, all of the Class II and Class III mutants were defective in both hydrolysis reactions and, similarly, all but one Class I mutant and most of the neutral mutants showed no significant defect in either of the two reactions (unpublished data). Five half-site mutants, however, stood out from the pool of originally categorized Class I and neutral mutants see , green. 2-fold, whereas the reciprocal reaction, GTP hydrolysis by Ffh, is reduced only 2- to 4-fold N, thereby reversing the nucleotide specificity of the two binding partners. Upon complex formation, FtsY D449(248)N becomes XTP specific and reciprocally activates GTP hydrolysis in Ffh. Consistent with the results observed with Ffh D251(248)N, all Class IV mutations thus analyzed reduce the rate of XTP hydrolysis from mutant FtsYs by more than 10o 4-fold . Thus taThe mutational analyses described here define four distinct classes of mutants that map to the Ffh-FtsY interface. Each mutant class blocks the reaction in a different way and at a distinct stage, demonstrating that (i) multiple conformational rearrangements are required to form an activated Ffh•FtsY complex and (ii) some rearrangements can be blocked without preventing other rearrangements from taking place. The different classes of mutant interrupt the reaction in different ways, as represented by the states depicted in We previously showed that FtsY exhibits little discrimination between different nucleotides in its free, uncomplexed form, but gains substantial specificity for GTP only in the Ffh•FtsY complex . We therThe crystal structure of the Ffh•FtsY complex also shows that Ffh undergoes similar N-G domain rearrangements upon complex formation, although the effects of this rearrangement on nucleotide specificity are less apparent, as free Ffh already displays significant discrimination between nucleotides . Indeed, mutations at the N-G domain interface in either Ffh or FtsY impair complex formation, supporting the functional importance of this rearrangement in both binding partners . We propboth active sites, the defect in these mutants is not a consequence of simply removing a catalytic residue. Rather, this suggests that even after a stable, closed complex is formed, activation requires additional conformational changes (the “docking” process) that align active-site residues with respect to the bound nucleotides in both GTPase sites , suggesting that the mutant proteins have assumed the closed conformation in the complex. Because single mutations in FtsY can disrupt GTPase activation in The model in 135TFRAAA). As concluded from the structure, this loop can move relatively independently from the rest of the protein comes from three of the Class II mutants, , which all map to the conserved IBD loop to either Ala or Trp also results in a Class II phenotype. This residue in FtsY hydrogen bonds across the interface to the ribose 3′-OH of the nucleotide bound to Ffh. The ribose 3′-OH reciprocally donates a hydrogen bond back to the γ-phosphate of the twinned substrate in FtsY to inhibit the interaction between Ffh and wild-type FtsY, as described in detail in the text see A. The da2+ as described in Fluorescence emission spectra were acquired as described in

However, HLA-A24+ melanoma patients-oriented immunotherapy has not been fully investigated. In the present study, we investigated the effect of dendritic cell (DC)-based immunotherapy on metastatic melanoma patients with HLA-A2 or A24 genotype.Metastatic, chemotherapy-resistant melanoma is an intractable cancer with a very poor prognosis. As to immunotherapy targeting metastatic melanoma, HLA-A2Nine cases of metastatic melanoma were enrolled into a phase I study of monocyte-derived dendritic cell (DC)-based immunotherapy. HLA-genotype analysis revealed 4 cases of HLA-A*0201, 1 of A*0206 and 4 of A*2402. Enriched monocytes were obtained using OptiPrep™ from leukapheresis products, and then incubated with GM-CSF and IL-4 in a closed serum-free system. After pulsing with a cocktail of 5 melanoma-associated synthetic peptides restricted to HLA-A2 or A24 and KLH, cells were cryopreserved until used. Finally, thawed DCs were washed and injected subcutaneously (s.c.) into the inguinal region in a dose-escalation manner.-HLA-DR+ in melanoma patients was 46.4 ± 15.6 %. Most of DCs expressed high level of co-stimulatory molecules and type1 phenotype (CD11c+HLA-DR+), while a moderate number of mature DCs with CD83 and CCR7 positive were contained in DC products. DC injections were well tolerated except for transient liver dysfunction . All 6 evaluable cases except for early PD showed positive immunological responses to more than 2 melanoma peptides in an ELISPOT assay. Two representative responders demonstrated strong HLA-class I protein expression in the tumor and very high scores of ELISPOT that might correlate to the regression of metastatic tumors. Clinical response through DC injections was as follows : 1CR, 1 PR, 1SD and 6 PD. All 59 DC injections in the phase I study were tolerable in terms of safety, however, the maximal tolerable dose of DCs was not determined.The mean percentage of DCs rated as linThese results suggested that peptide cocktail-treated DC-based immunotherapy had the potential for utilizing as one of therapeutic tools against metastatic melanoma in Japan. Despite many attempts in the last few years to target cancer-specific antigens, a breakthrough in terms of clinical response has yet to be achieved mainly because of a scarcity of effective genuine cancer antigens, immunological evasion, or an immunosuppressive state.Melanoma-associated antigens are categorized as class I human leukocyte antigen (HLA)-restricted cancer/testis antigens which arFrom a clinical point of view, several vaccination strategies for stage IV melanoma using a combination of several (more than 3) peptides with a restriction to HLA-A2 have been reported to date ,11. Howe7/body/shot of the National Cancer Center, Tokyo. All patients gave written informed consent. All patients had received prior surgery, chemotherapy and radiation before and after OptiPrep™ separation. The percentage of DCs was rated as the lin-HLA-DR+ population . The additional DC-related markers were determined on gated lin-HLA-DR+ cells. The following peptides restricted to HLA-A2 or A24 were synthesized according to GMP standards by Multiple Peptide Systems, CA. HLA-A2: MART-127–35 (AAGIGILTV), gp100209–217 (IMDQVPFSV), tyrosinase368–376 (YMDGTMSQV), MAGE-2157–166 (YLQLVFGIEV), MAGE-3271–279 (FLWGPRALV) ; HLA-A24: gp100152–160 (VWKTWGQYW), tyrosinase206–214 (AFLPWHRLF), MAGE-1135–143 (NYKHCFPEI), MAGE-2156–164 (EYLQLVFGI), MAGE-3195–203 (IMPKAGLLI).Leukapheresis products from 7 L of processed blood were washed and centrifuged using density-adjusted OptiPrep™ , then the monocyte layer at the top was retrieved. Cells were transferred to an X-fold culture bag and cultured in the presence of GM-CSF at 50 ng/ml and IL-4 at 50 ng/ml (CellGenix) in X-VIVO15 serum-free medium . After 7 days, harvested cells were pulsed with a cocktail of 5 melanoma-specific synthetic peptides (25 μg/ml each) restricted to HLA A2 or A24 and KLH . DC-enriched cells were washed and cryopreserved in Cryocyte bags until used. The purity of CD14Skin metastatic lesions were obtained from patients who gave written informed consent. The expression of melanoma tumor antigens was investigated using RT-PCR as described previously . HLA proAdverse effects were evaluated according to the NCI Common toxicity criteria after 3 DC injections. Standard conventional definitions of major objective responses were used. Stable disease (SD) was defined as less than a 25% change in size with no new lesions lasting at least 4 weeks. Clinical response was rated as maximal through the DC vaccinations. The patients received up to 10 injections on the condition that at least one measurable lesion showed more than stable disease (SD) response and/or an ELISPOT assay performed after 4 injections indicated a positive response for more than 1 melanoma-associated peptides. PBMC samples were harvested before and 29, 78, 134 and 190 days after the 1 st DC injection, and frozen prior to use for immunological monitoring tests. All patients were followed up for 2 years after the enrollment into the study.6 per ml and divided into non-adherent and adherent cells. Adherent cells were treated with a peptide cocktail and β2-microglobulin for 2 hrs, and co-cultured with non-adherent cells in the presence of IL-2 at 15 U/ml and IL-7 at 10 ng/ml. On day 7, non-adherent cells were re-stimulated with peptide-pulsed adherent cells. On day14, responder cells (1 × 104/well) were incubated with peptide-pulsed target cells in a 96-well culture plate coated with anti-IFN-γ antibody overnight. Finally positive spots stained with anti-IFN-γ antibody were measured using the KS ELISPOT system . HLA-A2-restricted Influenza M1 peptide (GILGFVFTL) or HLA-A24-restricted EBNA3A peptide (RYSIFFDY) was used as a negative control.The ELISPOT assay was performed using in vitro re-stimulations. Briefly, PBMCs were incubated in a 24-well culture plate at 4 × 10+-enriched T cells were obtained by the depletion of CD4+ T cells using Dynabeads M-450 CD4 and used for tetramers staining. The staining was performed according to the method reported by Kuzushima et al [PBMCs were re-stimulated twice in vitro and utilized for tetramers staining. CD8ma et al . The PE-+) and Th2 (IL-4+) was calculated in PBMC samples obtained before and after DC vaccination.PBMCs were stimulated with 25 ng/ml of PMA (Sigma) and 1 μg/ml of ionomycin (Sigma) for 5 hrs in a 96-well culture plate. Breferdin A (10 μg/ml) was also added to cultures in the last hour. After the stimulation, cells were stained with FITC-anti-CD4 MoAb, and subsequently intracellular staining was performed with fix/permealization buffer and PE-labeled anti-IFN-γ or anti-IL-4 MoAb . Finally, the ratio of Th1 (IFN-γThe HLA-A2 or A24 peptide cocktail solution diluted to a dose of 5 μg/ml (each peptide) and KLH (50 μg/ml) were injected intradermally on the patient's forearm and the redness and induration at the injection site was measured. PPD was used as a positive control.t-test. Values of p < 0.05 were considered significant.Statistical differences were analyzed using Student's paired two-tailed -HLA-DR+ in melanoma patients was 46.4 ± 15.6 %, not different from that in healthy volunteers (data not shown). The frequencies of the DC-related markers were determined on gated lin-HLA-DR+cells : HLA-class I 97.5 ± 0.9 %, CD80 87.6 ± 6.9 %, CD86 85.5 ± 7.4 %, CD1a 55.2 ± 24.2 %, CD83 29.9 ± 13.3 %, CCR7 32.4 ± 13.7 %, DC SIGN 78.2 ± 19.3 %, CD11c+HLA-DR+ 90.6 ± 6.0 %, CD123+HLR-DR+ 0.99 ± 1.3 %. Most of DCs expressed high level of co-stimulatory molecules and type1 phenotype (CD11c+HLA-DR+), while a moderate number of mature DCs with CD83 and CCR7 positive were contained in DC products. On the other hand, the T cell-stimulating activity of DCs investigated in the MLR assay using allogeneic T cells was as strong as that of DCs obtained from healthy volunteers (data not shown).The mean percentage of DCs rated as linAn analysis of melanoma antigen expression by RT-PCR was performed in 3 cases. The expression of more than 2 antigens in the tumor was verified in all cases. HLA protein expression was positive in 5 out of 9 cases Table . In cont+ cases (patients 5 and 9) showed HLA-A2 peptide-specific CTL responses before the vaccination. Patients 1 and 6, which showed remarkable clinical responses, exhibited many CTL precursors against a HLA-24 restricted peptide-cocktail , however it was only transient and disappeared in spite of the continuance of DC injections. Rheumatoid factor and anti-nuclear antibody were negative before the injection, but increased to 1:160 and 1:40, respectively after the injections finished in patient 1. No clinical symptoms of autoimmune disease were found in patient 1 , 1PR (patient 1), 1SD and 3 PD were obtained -pulsed DC vaccines, and showed a limited response [Clinical trials of specific immunotherapy against metastatic melanoma using peptide-pulsed Mo-derived DCs have been performed in mainly Western countries, and some fruitful results were obtained ,10,11. Iresponse -24. Conset al. [In our study, peptide cocktails combining 5 peptides for each HLA type (HLA-A2 or A24) were prepared and used for DC pulsing. Our clinical study revealed positive ELISPOT responses against more than 2 peptides in all 6 evaluable cases. In previous reports, clinical DC therapy using more than 3 melanoma peptides demonstrated the induction of a specific CTL response against multiple melanoma peptides ,11. Howeet al. demonstrTo refine the quality and protocol of the tumor-specific immunotherapy for clinical trials, the prediction of clinical response in an individual is important and shouFirst of all, as to HLA expression in the tumor, patients 1, 2, 6 and 7 were positive, and patients 4 and 5 were negative. HLA-negative cases showed a progression of the tumor. Even in positive cases, patient 7 turned negative in the course of DC therapy, showing tumor progression. Loss of HLA expression in melanoma is reported to be a complex phenomenon associated with melanoma antigen loss , β2-micrSecond, the amplitude of the CTL response in the ELISPOT assay seems to be another key factor predicting anti-tumor response. Patients 1, 6 and 7 showed large responses to peptide cocktail in ELISPOT, and patients 2, 4 and 5 showed small responses. The former exhibited a remarkable regression of tumor except patient 7. On the other hand, the latter showed a poor response. There was a likely tendency that the amplitude of the CTL response was associated with tumor regression. Also, it was difficult to predict when immunological responses like CTL induction start to be activated in vivo during DC vaccination, and this question needs to be answered. In the present study, because of a limited number of patients given DC vaccines, the tendency that HLA-class I protein expression in the tumor and the amplitude of ELISPOT responses are seemingly associated with tumor regression is not convincing.+ cells after Opti-prep separation is still low and may not be reproducible. Therefore, other clinical grade-monocyte separation methods using an elutriator or negative selection with CD2 and CD19 MoAbs [+ CTL in lymph nodes. Such a novel method will be needed to develop an effective cancer vaccine.Finally, in order to improve tumor response in the present study, there are still some issues regarding clinical DC preparation. First of all, the purity of CD1419 MoAbs should b+ metastatic melanoma.In the present study, we investigated the effect of dendritic cell (DC)-based immunotherapy on metastatic melanoma patients with HLA-A2 or A24 genotype. Nine cases of metastatic melanoma were enrolled into a phase I study using HLA-A2 or A24-restricted peptide cocktail-pulsed DCs. All 6 evaluable cases showed positive immunological responses to more than 2 melanoma peptides in an ELISPOT assay. Clinical response through DC injections was as follows : 1CR, 1 PR, 1SD and 6 PD. All 59 DC injections in the phase I study were safely administered to patients. These results suggested that peptide cocktail-treated DC-based immunotherapy had the potential for utilizing as one of therapeutic tools against HLA-A2 or A24DC, dendritic cell ; HLA, human leukocyte antigen ; GM-CSF. granulocyte macrophage-colony-stimulating factor ; IL, interleukin ; KLH, Keyhole limpet hemocyanin ; CTL, cytotoxic T cell ; DTH, delayed-type hypersensitivity ; CR, complete remission : PR, partial remission ; SD, stable disease ; PD, progressive disease ; RT-PCR, reverse transcription-polymerase chain reaction ; IFN, interferon ; PBMC, peripheral blood mononuclear cell.The authors declare that they have no competing interests.YA participated in the design of the study and drafting the manuscript and were responsible for completing the study. RT, NI, MS, YH carried out apheresis and cell processing and were responsible for DC production. AY and NY were responsible for the clinical side of the study. IK, IN, KT and KM participated in the design of the study and performed biological assays. YT and KY reviewed the manuscript. All authors read and approved the final manuscript.

Biliary-enteric anastomosis especially Roux-en Y hepaticojejunostomy is frequently used for biliary diversion in benign biliary strictures. In this study, we present the results of hepaticojejunostomy with external metallic circle.Hepaticojejunostomy with external metallic circle were performed in eight male Sprague-Dawley rats. At the end of the third month, anastomoses were analysed for patency and stability of external circles.Relaparotomy revealed that all the anastomoses were patent and circles were in original places.To provide the patency of narrow hepaticojejunostomy anastomoses, external metallic circle can be a good alternative to use of internal stents in suitable cases. Although the risk of late bile duct cancer complicating biliary-enteric anastomosis has been well documented ,2, biliaExternal metallic circle had been used for the end to end choledochocholedocostomy in rats by Tez et al . The patThe aim of this study was to examine applicability of external metallic circle in hepaticojejunostomy.Eight male Sprague-Dawley rats weighing 250 to 300 g were used. The animals housed under environmentally controlled conditions at 21 ± 2°C and 30% to 70% relative humidity with a 12-hour dark and 12-hour light cycle. Free access to water and standard laboratory food was provided. Before the operations, the rats were fasted overnight and were only allowed free access to water. Guiding Principles in the Care and Use of Laboratory Animals was strictly adhered to at all times together with the recommendations from the Declaration of Helsinki.A surgical microscope , Codman microsurgical instruments, jeweler's forceps, and 10-0 Ethilon suture were used. Rats were anaesthesized with intramuscular injection of ketamine hydrochloride 100 mg/kg and xylazine 10 mg/kg. Under sterile conditions, a midline abdominal incision was made, and the peritoneal cavity was opened. After the traction of duodenum towards the left, the common bile duct was identified and a complete transection midway between the portal hilus and the duodenum was performed by means of sharp dissection. Proximal end was used for hepaticojejunostomy and distal end was closed by a tie. An opening was made on the wall of the jejunum, wide enough to match the size of the duct at a distance of 4–5 cm from the pylorus. Hepaticojejunostomy was performed by the help of surgical microscope with a silver made external metallic circle. All anastomoses were performed by the same investigator (S.K.). The principle of the technique was to tie the sutures over an external metallic circle 20 to 50 percent greater than the original outer diameter of the bile duct. The circle was handmade from a round-bodied silver wire 0.1 to 0.2 mm thick and 1.0 to 1.2 mm in diameter. The external metallic circle was incorporated at the anastomotic line without any effort to slip it over the cut end of the bile duct. The first suture was placed passing inside the circle and tied over the circle, passing through all layers of duct wall and intestinal wall. The remaining sutures were placed and tied according to the same principles. After completion of sutures, the circle was automatically exteriorised (Figure All anastomoses were completed with five or six sutures. Mean operation time was 30 minutes.One rat died in the postoperative fourth day. In necropsy, there was anastomotic disruption on the anterior surface of anastomosis and external circle was on the original place.At the end of third month, relaparotomy was performed on the remaining seven rats. There were no anastomotic dehiscense or biliary leakage. In all animals, there was a good connective tissue mass between the bile duct and jejunum. Dissection of the anastomosis region revealed that all the anastomosis were patent and all the circles were staying in original places.For the past 10 to 15 years, hepaticojejunostomy has been the method of choice for the treatment of benign biliary stricrures ,7. In thIn a previous study of us , we showWe think that external metallic circles are also applicable to end to side hepaticojejunostomy anastomosis, should the extra sutures were placed between the circle and jejunal serosa neighbouring the anastomotic line following the completion of anastomosis. To provide the patency of narrow hepaticojejunostomy anastomoses, external metallic circle can be an alternative to use of internal stents in suitable cases.The authors declare that they have no competing interests.EG designed the study, performed the operations and prepared the manuscript. MK, MT, and MKı participated in performing the operations. MKo participated in the design of study and coordination. SK performed the microsurgical anastomosis. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Matrix metalloproteinases [MMPs], which degrade the extracellular matrix, play an important role in the invasion and metastasis of squamous cell carcinomas. One MMP, MMP-13, is thought to play a central role in MMP activation. The purpose of this study was to investigate MMP-13 and TIMP-1 expression in squamous cell carcinomas of the head and neck and to relate these levels of expression to histologic patterns of invasion.This study included T1 lesions obtained via biopsy from the larynx, tongue, and skin/mucosa of 78 patients with head and neck squamous cell carcinomas. The relationship between expression of MMP-13 and TIMP-1 and the mode of tumor invasion [MI] was evaluated immunohistochemically, using breast carcinoma tissue as a positive control.Increased expression was observed in highly invasive tumors, as reflected by the significant correlation between the degree of staining for MMP-13 or TIMP-1 and MI grade [p < 0.05]. There was no significant relationship between the degree of staining for MMP-13 or TIMP-1 and patient age, sex, tumor site, or tumor histologic grade. In addition, levels of staining for MMP-13 did not correlate with levels of staining for TIMP-1.The expression of MMP-13 and TIMP-1 appears to play an important role in determining the invasive capacity of squamous cell carcinomas of the head and neck. Whereas additional studies are needed to confirm these findings, evaluating expression of these MMPs in small biopsy samples may be useful in determining the invasive capacity of these tumors at an earlier stage. The invasion of surrounding tissues by neoplastic cells is one of the most important steps in tumor progression. Proteolytic enzymes such as matrix metalloproteinases [MMPs] contribute to tumor expansion by degrading components of the extracellular matrix [ECM]. MMPs are a 21-member family of zinc-dependent endopeptidases, which are capable of degrading most ECM components including collagen, elastin, fibronectin, and gelatin. Whereas this facilitates processes such as wound healing, enhanced MMP activity has been observed in a variety of pathologic conditions including osteoarthritis, rheumatoid arthritis, cardiovascular disease, and neoplasia .MMPs can be divided into subgroups, which include collagenases, stromelysins, stromelysins-like MMPs, gelatinases, membrane-type MMPs, and others . MMP-13 MMPs can be inactivated by specific tissue inhibitors of matrix metalloproteinases [TIMPs]. Thus far, four different TIMPs have been identified and implSquamous cell carcinoma [SCC] of the head and neck region is a major problem. Many studies have shown that MMPs are expressed in SCCs ,14,15, wBetween 1998 and 2003, we obtained 78 incisional and excisional biopsy samples from the primary tumors of 78 patients with invasive SCC who were admitted to the Head and Neck Surgery and Plastic Surgery Departments. Fifty-four men and 24 women were included in the study, and the mean patient age was 64 years [range: 26 to 88 years]. T1 stage tumors from the larynx, tongue, and skin or mucosa of the face, cheek, lip, nose, and ear were studied. Table Tumors were histologically graded as well G1], moderately [G2], or poorly [G3] differentiated and TIMP-1 antibodies. The tissue sections were deparaffinized in xylene, rehydrated in an alcohol series, and immersed in distilled water. The sections were then boiled in a citrate buffer solution in a microwave oven X3 for 10 minutes for antigen retrieval of both the MMP-13 and TIMP-1 antibodies. Endogenous peroxidase activity was blocked by exposing sections to a 0.3% solution of hydrogen peroxidase in phosphate-buffered saline [PBS] for 10 minutes at room temperature. After the sections had been rinsed with TRIS buffer, primary antibodies were applied for 60 minutes at room temperature followed by TRIS buffer. Linking antibody and streptavidin peroxidase complex were then added consecutively for 10 minutes at room temperature, and sections were washed again in TRIS buffer. After applying AEC chromogen, the sections were washed in deionized water, counterstained and mounted. Breast carcinoma tissue (which showed positive staining) was used as positive control during the evaluation of MMP-13 and TIMP-1 immunostaining.One pathologist [NC] evaluated the stained slides associated with each case. The degree of staining for MMP-13 and TIMP-1 was scored as follows: 0, no staining of the tumor or stromal cells; 1+, weak [< 50%] positive staining of the tumor cells and/or weak staining of stromal cells; 2+, moderate [> 50%] positive staining of the tumor cells and/or moderate staining of stromal cells; 3+, extensive staining of the tumor cells and/or strong staining of stromal cells Figs. . No normIf necessary, surgery or radiotherapy was performed after the diagnosis. All patients were followed-up postoperatively for a mean interval of 20 months [range: 7 to 36 months]. During this period, 2 of 78 [2.6%] patients died from their tumors , and 1 patient died of an unrelated cause. Seventy-five of 78 [96.2%] patients were free of disease at the end of the follow-up period.The chi-square test was used for statistical analysis. Data were analyzed using SPSS for Windows 10,0. A p level <0.05 was considered to be statistically significant.Although expression of cytoplasmic MMP-13 was primarily detected in tumor cells, it also was seen in stromal cells. MMP-13 expression was evident in tissue from 44 [56.4%] of the 78 patients. High levels of MMP-13 were noted in highly invasive tumors. There was no difference in the amount of staining between tumor centers or margins. Significant TIMP-1 expression was detected in tissue from 42 [53.8%] patients. Prominent labeling was confined to the stroma surrounding the tumor cells.Table Table There was no statistically significant relationship between the degree of staining for MMP-13 or TIMP-1 and patient age, sex, tumor site, or histologic grade. Also, the degree of staining for MMP-13 did not significantly correlate with the degree of staining for TIMP-1.As tumor invasion and metastasis affect a patient's prognosis, it is important to predict the invasive potential of tumors such as SCCs at an early stage. Several steps are involved in the invasion and metastasis of malignant cells including the attachment of cells to the ECM, the breakdown of matrix components, cell detachment, and migration of cells through the degraded matrix. This complex process requires several proteases, and the local balance between these proteases and protease inhibitors appears to be crucial. The MMPs represent one family of degrading proteases, which are expressed in various tumors. Many studies have shown that MMPs, especially MMP-2, -3, -9, are expressed in SCCs ,12,16-18The expression of several MMPs has been investigated in SCCs including MMP-9 and MMP-13. MMP-9 expression was found to correlate the most strongly with advanced pathological stages, and patients with HNSCCs also may have elevated serum concentration of MMP-9 ,19. FurtMMP-13 is a member of the collagenase family, which degrades fibrillar collagens of types I, II, III, IV, X, and XIV, tenascin, fibronectin, aggrecan, versican, and fibrillin-I. It is now accepted that MMP-13 plays a key role in the MMP activation cascade, both activating and being activated by several MMPs ,11. MMP-MMP-13 expression has also been observed in transformed, but not primary, human epidermal keratinocytes ,15. AlthTIMP-1 is another protein that has been implicated in tumor growth. TIMP-1 mRNA has been detected in well-differentiated cancer cells, proliferated keratinocytes, and endothelial cells ,14, and In some studies, no association between MMP-13 and TIMP-1 expression and any clinicopathological variables was found, or TIMP expression did not correlate with tumor growth . Our resBecause of the relatively short follow-up interval, we are unable to demonstrate whether MMP-13 and TIMP-1 expression is related to long-term survival. However, 75 of our 78 patients were free of disease after a mean follow-up interval of 20 months. As poor outcomes are the result of local recurrences and distant metastasis, factors that reflect the invasive and metastatic potential of SCCs, such as MMPs, could be helpful in predicting patient prognosis. Thus, further investigation of MMPs may not only clarify their role in tumor invasion but also may facilitate the development of new therapeutic approaches.The results of this study suggest that MMP-13, which plays a central role in MMP activation, and the MMP inhibitor, TIMP-1, help regulate the invasiveness of HNSCCs. Although other methods are needed to confirm these findings, examination of MMP-13 and TIMP-1 expression in small biopsy samples might be useful in determining the invasive capacity of these tumors at an earlier stage.None declared.NC drafted and wrote the manuscript.KM and EC performed the surgery and follow-up of the patients.ED participated in the design and coordination of the study.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

The thymus is the primary site for T-cell development and induction of self-tolerance. Previous approaches towards manipulation of T-cell differentiation have used intrathymic injection of antigens, as proteins, cells or adenoviruses, leading to transient expression of the foreign protein. Lentiviral vectors, due to their unique ability to integrate into the genome of quiescent cells, may be best suited for long-term expression of a transgene in the thymus.Young adult mice were injected in the thymus with lentiviral vectors expressing eGFP or the hemaglutinin of the Influenza virus under the control of the ubiquitous phospho glycerate kinase promoter. Thymi were examined 5 to 90 days thereafter directly under a UV-light microscope and by flow cytometry. Intrathymic injection of lentiviral vectors predominantly results in infection of stromal cells that could be detected for at least 3 months. Importantly, hemaglutinin expression by thymic stromal cells mediated negative selection of thymocytes expressing the cognate T-cell receptor. In addition and despite the low multiplicity of infection, transduced thymocytes were also detected, even 30 days after injection.Our results demonstrate that intrathymic delivery of a lentiviral vector is an efficient means for stable expression of a foreign gene in the thymus. This new method of gene delivery may prove useful for induction of tolerance to a specific antigen and for gene therapy of severe combined immunodeficiencies. The final maturation of T-cells involves the selective loss of either the CD4 or the CD8 molecules to generate fully mature single-positive (SP) cells with cytotoxic/suppressor or helper/regulator function, respectively.The thymus is a bilobate organ derived from embryonic endoderm and mesoderm differentiation and is located just above the heart (reviewed in ). It is During this process, the TCR-mediated positive and negative selection of T cells ensures the selection of a diverse TCR repertoire able to react with foreign peptide presented by autologous major histocompatibility complex (MHC) molecules, but tolerant to self-antigens. This property renders the thymus an attractive site for manipulation of T-cell tolerance. To date, results on tolerance induction via direct manipulation of the thymus have been scarce (reviewed in ). Howevein vivo [in vivo to infect hepatocytes and muscle cells [Due to their ability to infect resting cells and to stably integrate into the genome, lentiviral vectors represent powerful new tools for long-term expression of a given transgene in vivo . Lentivile cells , antigenle cells ,12, as wle cells . We reas9 TU143B/ml) to inject between 7 × 107 to 1.2 × 108 infectious units in the thymus of normal C57Bl/6 mice. Infected cells could readily be detected at day 5 post-injection by direct examination of the thymi under a UV microscope is available . Six days figure . Overalls figure . Our res+ cells could be detected by flow cytometry within the thymocytes obtained from dilacerated thymi . Collectively, these results show that immature thymocytes can be infected by in situ lentiviral infection. However, we were unable to clearly detect infected T-cells in the spleen of injected mice, likely due to their small representation within the pool of mature lymphocytes in the absence of a selective advantage for the transduced thymocytes.We next investigated whether developing T-cells would be infected upon IT injection of the lentiviral vector. Five days post-injection of the LvPGK-GFP vector into the thymus of a normal mouse, very few eGFPi figure . Most ofin situ analysis suggests that thymic epithelial cells represent the vast majority of infected cells, and studies are underway to more precisely define the cells targeted by IT lentiviral injection. Whatever the proportion of cortical, medullar epithelial cells, or thymic dendritic cells that are transduced, we show here that this results in an antigen presentation that efficiently mediates negative selection of specific thymocytes. This is not due to the injection of a "crude" preparation of viral supernatant that could have non-specifically affected T cell differentiation. Indeed, we injected 10 times lower amounts of p24 from the LvPGK-HA vector than of the LvPGK-GFP vectors, suggesting that negative selection of HA-specific thymocytes was a direct effect of HA expression by thymic stromal cells. This is further supported by the analysis of the frequencies of 6.5+ thymocytes which shows deletion of 6.5hi cells within CD8SP cells, an MHC class-II restricted population in these TCR-transgenic mice [We report herein that IT injection of a lentiviral vector results in the predominant infection of thymic stromal cells, and to a low level infection of thymocyte progenitors. Significant infection of liver cells was also detected. This observation is reminiscent of what was observed by DeMatteo et al. with adenoviral vectors . Togethenic mice . Down monic mice . Therefoin vivo gene therapy of severe combined immunodeficiencies (SCID) affecting T-cell development the multiplicity of infection was estimated to be lower than 0.4 and (ii) lentiviral transduction of murine T cells is far less efficient than of human T cells . Since tiewed in ). Indeed gamma-c , or to t gamma-c . Our res gamma-c . Given t gamma-c . FurtherResults presented herein may have important implications for the experimental and therapeutic manipulation of the immune system, and notably for tolerance induction and the correction of SCID.C57Bl/6 mice were obtained from Charles River/IFFA Credo Laboratories at 6 weeks of age and were used at 8 to 10 weeks-old. SFE TCR-Tg mice were bre6 293T-cells were co-transfected with the transfer vector, the packaging and the envelope plasmids in 10-cm dishes using the calcium phosphate method as described [gag p24 ELISA .The plasmid encoding the lentiviral vector pRRLsin.PPT.hPGK.GFPpre (LvPGK-GFP) has been described elsewhere . Images were processed using Adobe Photoshop .6 cells were stained with the following monoclonal antibodies : CD4-APC , CD8-CyCr (Cychrome) and either CD3 or pan beta-chain of the TCR-PE (phycoerytrin) or purified anti-clonotypic TCR for the HA peptide SFERFEIFPK presented by MHC class II I-Ed (clone 6.5) . Cell suspensions were numerated and 10ne 6.5) followeDN: double negativeDP: double positiveSP: single positiveIT: intra thymicIV: intra venousHA: hemaglutininMOI: multiplicity of infectionSCID: severe combined immunodeficienciesGM devised and realised the experiments, analysed the data and wrote the manuscript. DK conceptualised the study and edited the manuscript.

Inteins are "protein introns" that remove themselves from their host proteins through an autocatalytic protein-splicing. After their discovery, inteins have been quickly identified in all domains of life, but only once to date in the genome of a eukaryote-infecting virus.Here we report the identification and bioinformatics characterization of an intein in the DNA polymerase PolB gene of amoeba infecting Mimivirus, the largest known double-stranded DNA virus, the origin of which has been proposed to predate the emergence of eukaryotes. Mimivirus intein exhibits canonical sequence motifs and clearly belongs to a subclass of archaeal inteins always found in the same location of PolB genes. On the other hand, the Mimivirus PolB is most similar to eukaryotic Polδ sequences.The intriguing association of an extremophilic archaeal-type intein with a mesophilic eukaryotic-like PolB in Mimivirus is consistent with the hypothesis that DNA viruses might have been the central reservoir of inteins throughout the course of evolution. Poxviridae, Iridoviridae, Phycodnaviridae and Asfarviridae, and suggested its early origin, probably before the individualization of the three domains of life ]. Pfam [. Multiple sequence alignments were generated with the use of T-Coffee [Sequence homology searches were carried out with the use of the BLAST programs against ]]. Pfam searchesT-Coffee . Intein T-Coffee . All theT-Coffee .The sequence and annotation data for the Mimivirus PolB and intein was deposited to GenBank (accession number: AY606804). The complete genome sequence of Mimivirus is also available at GenBank (accession number: NC_006450). For a comprehensive description of the Mimivirus complete genome sequence and preliminary characterizations of the viral particle, see .The author(s) declare that they have no competing interests.HO carried out most of the sequence analysis, contributed to the interpretation of the results, and drafted the manuscript. DR contributed to the interpretation of the results. JMC contributed to the construction of the sequence alignment, participated in the interpretation of the results and finalized the manuscript.Supplementary figure S1 Sequence alignment of Mimivirus PolB and eukaryotic Polδs. The Mimivirus intein sequence is removed, and its insertion site is highlighted by amino acid residues in red corresponding to the left three and right three resides around the insertion site. Three Mimivirus specific inserts were highlighted by blue letters. Conserved carboxylate residues in the exonuclease and polymerase active sites are highlighted by green background. Eukaryotic sequences were Encephalitozoon cuniculi (TrEMBL/SWISS-PROT: Q8SQP5), Schizosaccharomyces pombe (P30316) and Glycine max . Sequence alignment was obtained with the use of T-Coffee.Click here for fileSupplementary figure S2 Sequence alignment of Mimivirus insert i3 and known intein sequences. Intein sequences are from Methanococcus jannaschii replication factor C (Mja RFC-3) and Pyrococcus abyssi replication factor C (Pab RFC-2).Click here for file

Deinococcus radiodurans is likely to outlast even the cockroach. Its ability to endure radiation is truly impressive: it can withstand a dose a thousand times that which will kill a human. How it accomplishes this phenomenal feat of survival is the subject of a study in this issue by John Battista and colleagues at Louisiana State University in Baton Rouge and at the University of Wisconsin at Madison.It is often said that after a nuclear catastrophe, cockroaches will inherit the earth, because they are so resistant to the harmful effects of ionizing radiation. But should the unthinkable come to pass, the bacterium D. radiodurans, however, largely prevents exonuclease digestion, an ability which has previously been shown to be linked to the activity of a gene with the rather uninformative name of DR0423. But how, exactly, does this gene accomplish this life-saving feat?While radiation damages many cellular components, it is the fracturing of the cell's DNA that is the most harmful. DNA breaks can be repaired, but in doing so, the cell is racing against time. The exposed free ends of the DNA invite digestion by the cell's own enzymes, called exonucleases. If the DNA is not stitched back together quickly enough, the exonucleases will degrade it past the point of repair, and the cell will ultimately succumb. Large doses of radiation can fracture a chromosome in thousands of places, far in excess of the repair ability of most cells. D. radiodurans susceptible to ionizing radiation. Together, these results clearly indicate that the DR0423 gene product is critical for protecting the bacterium. Based on this, they dubbed the gene ddrA, for “DNA damage response.” They also found that DdrA, the protein encoded by ddrA, binds to single-stranded fragments of DNA, exactly like those found at the broken ends of the DNA double helix when damaged by radiation. Finally, they showed that when DdrA bound to these broken ends, they were protected from digestion by exonucleases.To answer this question, Battista and colleagues first showed that, following radiation exposure, DR0423 was upregulated 20- to 30-fold, and that deletion of the gene renders D. radiodurans from the effects of desiccation, a condition much more common in the life of a bacterium, and one which also induces widespread DNA damage. While ddrA cannot prevent the damage, it can preserve the DNA from degradation until conditions once again allow the bacterium to function, and repair its DNA.An important question about this system is what it is actually good for. Since the level of radiation tolerated by the bacterium is found nowhere on earth, of what use is such an efficient DNA protection system? The answer might be that it also protects

The constitutive androstane receptor plays a key role in the transcriptional activation of genes that encode xenobiotic/steroid and drug metabolizing enzymes.The expression of CAR mRNA throughout the circadian rhythm is reported for the first time in phase with the clock gene Bmal1 and in antiphase with the clock-controlled gene Rev-erbα mRNAs, with a peak at Zeitgeber time (ZT) 20 and a trough at ZT8, and a peak/trough ratio of 2.0. The diurnal difference in CAR mRNA expression might underlie the 1.7-fold difference in the magnitude of the PB-dependent induction of CYP2B1/2 mRNA.The circadian oscillation of xenosensor gene CAR mRNA expression is partially responsible for chronopharmacokinetics and chronopharmacology in disease. O-oxime (CITCO) in humans . In contrast, it was increased by 3.8-fold of the control level when the rats were treated from ZT20 to ZT1 [nighttime treatment] , UGT1A1 and MRP2. Blood-bilirubin level reaches a minimum at the end of the light period and a maximum at the end of the dark period . It is pO-dealkylation of 7-alkoxycoumarin fluctuate daily in F344 rats with high values during the dark period [Per1, Per2, Cry1 and Rev-erbα. Recently, the transcription of Alas1 gene encoding for the aminolevulinate synthase 1 (Alas1) that is rate-limitting enzyme in a heme biosynthesis was reported to be controlled in the circadian clock mechanism.Hepatic CYP2B1/2 mRNA level was found to be synchronized with the CAR mRNA oscillation 0, 4, 8, 12, 16, 20 and 24: ZT0 was lights-on and ZT12 is lights-out. For the PB-induction of CYP2B, the rats were i.p. injected with PB at ZT8 and ZT20 and sacrificed at ZT13 and ZT1, respectively. The livers were then dissected and used for the isolation of total RNA.Eight week-old male Wistar rats (Clea) were kept under a 12-hours light-dark (LD12:12) cycle and provided food and water Total RNA was extracted from rat liver homogenate using an RNeasy Kit . After incubation at 65°C for 10 min, the extracts were quickly placed in an ice-cold water bath. Oligo-dT primed cDNA was synthesized from 1 μg of total RNA using RTG You-Prime First-Strand Beads , and left at room temperature for 1 min. Reverse transcription was then performed at 37°C for 1 hour to obtain cDNA. PCR was next performed in a total reaction mixture (25 μl) containing 1 μl each of RT-reaction mixture, Ex Taq DNA polymerase and each of primer pair. cDNA was amplified for 24 (GAPDH), 27 (CAR) or 30 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec, and extension at 72°C for 1 min in a thermal cycler. The reaction products were separated by agarose gel electrophoresis and analyzed by a Flour Imager (Amersham Biosciences) after staining with ethidium bromide. Real-time PCR was carried out for the quantitation of each transcript in a reaction mixture consisting of 2 μl of the cDNA, 1 μl each pair of primers, 21 μl of water and 25 μl of iQ SYBER™ Green Supermix . PCR was performed with an initial enzyme activation step at 95°C for 5 min followed by 50 cycles of denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec and extension at 72°C for 45 sec in a real-time DNA thermal cycler . The following oligonucleotides were used as forward and reverse primers, respectively: 5'-ACCAGTTTGTGCAGTTCAGG-3' and 5'-CTTGAGAAGGGAGATCTGGT-3' for CAR, 5'-GAGTTCTTCTCTGGGTTGCTG-3' and 5'-ACTGTGGGTCATGGAGAGCTG-3' for CYP2B1/2, 5'-AACATGGCACTGAGCAGGTCTCC-3' and 5'-GGCATGTCCTATGAACATGTACC-3' for REV-ERBα, 5'-GCAAACTACAAGCCAACATTTCTAT-3' and 5'-CTTAACTTTGGCAATATCTTTTGGA-3' for BMAL1, and 5'-ACCACAGTCCATGCCATCAC-3' and 5'-TCCACCACCCTGTTGCTGTA-3' for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The amplified cDNA was quantitated by the number of cycles (or cross point) at which the fluorescence signal was greater than a defined threshold during the logarithmic phase of amplification. The results were shown relatively to the control level after normalization to that of GAPDH.None declared.K.Y. conceived of the study, carried out all experiments and drafted the manuscript. S.O. and T.H. contributed to the experiment, and N.T. participated in the design of the study and its coordination. Y.I. participated in the design of the study and drafted the manuscript in collaboration with K.Y. All authors read and approved the final manuscript.

Heroin injection is associated with health and social problems including hepatitis C virus (HCV) transmission. Few studies have examined the circumstances surrounding initiation to heroin injecting, especially current users initiating others. The current study aimed to examine the age of first heroin use and injection; administration route of first heroin use; relationship to initiator; the initiation of others among a group of heroin users; and to examine these factors in relation to HCV status and risk.Heroin users in Sydney were recruited through needle and syringe programs, a methadone clinic and snowballing. Participants were interviewed about their own initiation to heroin use, blood-borne virus risk and knowledge, and whether they had initiated others to heroin injecting. Information on HCV status was collected via self-report. Data was analysed using univariate and multivariate statistical techniques for Normally distributed continuous and categorical data.The study recruited 399 heroin users, with a mean age of 31 years, 63% were male, 77% reported heroin as their primary drug and 59% were HCV positive (self-report). Mean age at first heroin use and injection was 19 and 21 years, respectively. The majority of heroin users commenced heroin use via injecting (65%), younger users were less likely than older users (>30 years) to commence heroin use parenterally. Participants were initiated to injection mainly by friends (63%). Thirty-seven percent reported initiating others to heroin injection, but few factors were related to this behaviour. Those with longer heroin using careers were more likely to report initiating others to heroin injection, but were no more likely to have done so in the preceding 12 months. Participants who had initiated others were more likely to have shared injecting equipment (12 vs 23%), but were no more likely to be HCV positive (self-report) than those who did not.Interventions to prevent heroin users initiating others to injecting are necessary. Peer groups may be well positioned to implement such interventions. Heroin is one of the most commonly injected illicit substances worldwide ,2. HeroiHepatitis C is probably the most prevalent health infection among injecting drug users (IDU) worldwide. The prevention of hepatitis C has proven difficult; unlike hepatitis B there is currently no vaccine available and programs which have been successful in reducing HIV have had only a small impact on the HCV epidemic ,14. It hA decrease in the age of initiation to drug use, including heroin use, across birth cohorts has been documented in both Australia ,18 and tet al. examined a number of factors surrounding initiation to injecting among a group of young, recently initiated IDUs [Crofts ted IDUs . They foted IDUs -23. A reted IDUs . Howeverted IDUs .et al. found that 47% of recently initiated IDUs had also initiated another into injecting and of those who had, few informed new initiates of BBVI risk [Little attention has been paid to the initiation of others into injecting . One smaBVI risk . The relCrofts and colleagues found that the majority of recently initiated IDU were aware of HIV and hepatitis B and that the viruses could be transmitted via shared injecting equipment . A much This study examined initiation to heroin injection. Specifically the study aimed to examine: 1) age of first heroin use and first heroin injection; 2) route of first heroin use; 3) relationship to initiator; and 4) the initiation of others among a group of heroin users. These factors were then examined in relation to demographic variables such as gender, ethnicity, level of education and also blood borne virus status.Heroin users in Sydney were volunteers recruited through needle and syringe programs and a methadone clinic. In order to sample a range of heroin users, snowballing, facilitated by a peer interviewer, was also used. Drug users were eligible to participate if they reported the use of heroin at least once a month in the preceding six months. All participants gave informed consent to be interviewed and received AUD20 for travel expenses.A structured questionnaire was administered to participants by trained interviewers. Information was sought on blood-borne virus status and knowledge, and initiation to heroin use and included questions on age of first heroin use, age of first heroin injection, relationship to initiator and the number of times participants had initiated others to injecting.Information on HCV status was collected via self-report. Self-reported HCV status has a concordance of approximately 80% for those who have been tested ,28. For To determine ethnicity, participants were asked how they identified ethnically, those identified as being of Aboriginal or Torres Strait Islander decent were categorised as Indigenous, those not born in Australia and those born in Australia but who identified as belonging to another ethnic group were categorised as 'other Australian'.The study was approved by four institutional ethics committees: University of New South Wales Human Research Ethics Committee, Central Sydney Area Health Service Ethics Review Committee, South Western Sydney Area Health Service Research Ethics Committee, and South Eastern Sydney Area Health Service Research Ethics Committee.t-tests and one-way analysis of variance. Linear regression was employed to test the relationship between continuous variables. The chi square (χ2) statistic was used for univariate analysis of categorical data. Multiple logistic regression, using backward elimination, was used for multivariate analysis to examine independent relationships between dichotomous variables. All data were analysed using SPSS version 11.01.Continuous variables were assessed using The sample consisted of 399 heroin users, of whom 63% were male. The mean age of participants was 31 years . The majority of participants were born in Australia (78%), a small proportion of which identified as another ethnic group. Participants were categorised as either 'Australian' (67%), Indigenous (17%) or 'other-Australian' (16%). The majority (81%) of participants had attended secondary school, but only 42 (11%) participants had tertiary education. Thirty-four (9%) participants had completed primary (elementary) school only. Sixty-one percent of participants had a history of incarceration.Heroin was the primary drug used by 77% of the sample, with a median of 9.5 years of use and injecting. The majority (98%) of the sample injected heroin; 14% of the sample had been injecting heroin for three years or less and 80% for more than three years (18 cases had missing data for this variable). Those who did not inject heroin were excluded from analysis pertaining to injecting.The mean age at first heroin use was 19 years, and the mean age of first injection was 21 years . The mean age of first heroin use and first heroin injection was similar for males (18 years for both) and females . There were no differences in terms of ethnicity for either age of first heroin use or first heroin injection .t395 = -1.89, p = .0.56). Participants who completed primary school only, were a mean age of 17 (SD 4.8) years when they first injected heroin and the mean age of first injection for those who attended secondary school and above was 20 (SD 6.3) years .For those who completed primary school only, the mean age of first heroin use was 17 (SD 5.4) years and 19 (SD 6.0) years for those who attended secondary school or above, the difference failed to reach significance . Similarly, current age and age of first injection were also significantly related .Heroin was most commonly first administered by injection (65%). For the 141 participants who used non-parenteral routes of administration on initiation of heroin use, the most common method was smoking (burning and chasing), with 28% of the sample reporting initiating heroin use with this method. Only seven percent first used heroin intranasally, orally or by other means.t379 = 4.36, p = 0.001).Participants who first injected heroin and those who first used heroin non-parenterally, commenced heroin use at similar ages . Those who initiated heroin use by injection had been using heroin for more years than those who initiated heroin use non-parenterally . There were no differences in the proportion of participants who commenced heroin use via injecting in terms of gender or level of education .Route of administration was also associated with ethnicity: 74% of Indigenous participants commenced heroin use via injection, 69% of 'Australians' and 36% of 'other Australians' . Level of education was not entered into the model as there were too few participants with only primary school level of education who commenced heroin use via a non-parenteral route of administration.2 = 43.92, 4df, p < .001) and the Hosmer and Lemeshow test indicated good fit . Gender was not a characteristic independently associated with route of first heroin injection and was removed from the model. Participants aged less than 25 years and 25–30 years were less likely than those aged 30 years or more to initiate heroin use via injecting. 'Other Australians' were also less likely to reported initiating less injecting . Specifically, a greater proportion of females were taught to inject by their partner than were males , while more males were taught to inject by a friend (or other) than females . The relationship between participants and their 'initiators' did not differ according age of first injection, ethnicity or level of education across those initiated by friends, family or their partner.Participants were usually taught to inject by a friend (63%), family member (14%) or their partner (11%). Ten percent of the sample reported 'other', which was typically self-taught. Males and females differed significantly in terms of who taught them to inject (χOver a third (37%) of participants reported having taught someone to inject drugs and 17% had done so in the preceding 12 months. Among those who had ever taught someone to inject (n = 149), the median numbers of people taught was three (range: 1–200) and two (range: 1–50) in the preceding 12 months.t = -3.08, df = 370, p = 0.002). However, this difference diminished for those who had recently (preceding 12 months) taught someone to inject (11 years for both groups).Similar proportions of males and females reported teaching someone to inject ever (38% vs 37%) and in the preceding 12 months (16% vs 19%). There was also no significant difference in terms of ethnicity or mean age of those who had ever taught someone to inject ever or in the preceding 12 months. Those who had taught someone else to inject heroin had been injecting for a greater mean number of years than the remainder of the sample . Two-hundred and thirty-five participants self-reported being HCV positive.2 = 9.14, df = 1, p = 0.003). IDUs typically become infected with HCV early in their injecting career [2 = 7.93, df = 1, p = 0.005). There was no difference in self reported HCV status between those who had initiated someone to injecting in the preceding 12 months and those who had not.Participants who reported being HCV positive initiated heroin injecting at a younger mean age than the remainder of the sample . HCV positive participants were more likely to report initiating heroin use via injecting than those who were HCV negative . Of these, seven reported being HIV positive. One-hundred and forty-seven participants (37%) reported having been vaccinated against hepatitis B. There were no differences between those who reported being vaccinated against hepatitis B and those who had not in terms of age at first heroin injection, initial route of administration and initiating some one else to injecting in the preceding 12 months.2 = 3.51, df = 1, p = .061).Only a small number of participants (9%) reported having used a needle or syringe after someone else in the month preceding interview. Sharing needles and syringes was not associated with mean age at initiation to heroin injection or initial route of heroin administration. More participants who had recently initiated someone to injecting (i.e. preceding 12 months) reported sharing needles and syringes (17%) than those who had not recently initiated someone (8%), though the difference failed to reach significance and to have recently initiated someone to injecting compared to those who not shared injection paraphernalia. There was no difference in terms of age at first heroin injection.Sharing (borrowing or lending) injection paraphrenia in the month preceding interview was reported by just over half (52%) the sample. Participants who had engaged in this behaviour were more likely to have initiated heroin use via injecting and only 17% reported doing so in the preceding 12 months. Crofts et al. sampled only young injecting drug users (i.e. 17–24 years) [Increasing attention has been paid to the role of IDUs in initiation to injecting drug use , though 4 years) , whereasA third of the sample initially used heroin by non-parenteral routes of administration. Participants from ethnically diverse backgrounds were more likely than other participants to have first used heroin by means other than injecting, which is consistent with other Australian research which found smoking heroin to be more common among Indochinese than Caucasian heroin users .Participants who commenced heroin use via injecting were also older than those who first used a non-injecting route of heroin administration, possibly indicating an overall shift toward non-injecting routes of administration. A number of interventions aimed at reducing the incidence of transition to injecting have received attention . One stuThe current study found a direct significant relationship between current age and age of first heroin use and first heroin injection. This result is consistent with other Australian research ,18. NeveAlthough the proportion of participants reporting using a needle or syringe after another person (sharing) in the preceding month was low, it is consistent with other research examining transitions to injecting , but lowThe majority of the sample believed themselves to be HCV positive and, not surprisingly, those who injected at a younger age were more likely to be HCV positive and to have first used heroin via injection. Though importantly, there was no difference in terms of HCV status between those who had recently taught another to inject and those who had not.This study has confirmed that initiation to heroin use in Australia typically occurs via injection, though this is less apparent among younger heroin uses. The study has also found that more than a third of heroin users have initiated others into injecting, with close to a fifth having done so recently. Many of those who engaged in this behaviour tended to take greater injection related risks which has important implications for the transmission of blood-borne infections. A better understanding of the circumstances surrounding the initiation to heroin injection is needed. Peer-led interventions, which have been found to be effective in changing IDUs' attitudes and behaviours , may havThe author(s) declare that they have no competing interests.C Day coordinated the study, was responsible for the statistical analysis and writing the paper. P Dietze was responsible for study design at the national level, secured funding and provided comments on the manuscript. J Ross and K Dolan supervised all aspects of the work and provided extensive comments on the manuscript.

It has been established that careful diabetes self-management is essential in avoiding chronic complications that compromise health. Disciplined diet control and regular exercise are the keys for the type 2 diabetes self-management. An ability to maintain one's blood glucose at a relatively flat level, not fluctuating wildly with meals and hypoglycemic medical intervention, would be the goal for self-management. Hemoglobin A1c (HbA1c or simply A1c) is a measure of a long-term blood plasma glucose average, a reliable index to reflect one's diabetic condition. A simple regimen that could reduce the elevated A1c levels without altering much of type 2 diabetic patients' daily routine denotes a successful self-management strategy.A relatively simple model that relates the food impact on blood glucose excursions for type 2 diabetes was studied. Meal is treated as a bolus injection of glucose. Medical intervention of hypoglycaemic drug or injection, if any, is lumped with secreted insulin as a damping factor. Lunch was used for test meals. The recovery period of a blood glucose excursion returning to the pre-prandial level, the maximal reach, and the area under the excursion curve were used to characterize one's ability to regulate glucose metabolism. A case study is presented here to illustrate the possibility of devising an individual-based self-management regimen.Results of the lunch study for a type 2 diabetic subject indicate that the recovery time of the post-prandial blood glucose level can be adjusted to 4 hours, which is comparable to the typical time interval for non-diabetics: 3 to 4 hours. A moderate lifestyle adjustment of light supper coupled with morning swimming of 20 laps in a 25 m pool for 40 minutes enabled the subject to reduce his A1c level from 6.7 to 6.0 in six months and to maintain this level for the subsequent six months.The preliminary result of this case study is encouraging. An individual life-style adjustment can be structured from the extracted characteristics of the post-prandial blood glucose excursions. Additional studies are certainly required to draw general applicable guidelines for lifestyle adjustments of type 2 diabetic patients. It is well established that diabetes can lead to acute and chronic complications, compromising the health and quality of life. Results from various studies have demDietary management is frequently referred as the cornerstone, or the initial step, in treating of type 2 diabetes mellitus. Foods containing carbohydrates play an important role in the diet. The glycemic Index (GI) ranks foods according to their post-prandial glycemic responses. The GI was introduced more than twenty years ago and has been widely adopted in diabetes management in Australia, New Zealand, Canada, the United Kingdoms, and France . The WorMost published GI lists are for single food items only. A GI is a numerical measure of how a carbohydrate would increase one's blood glucose level over a period of two or three hours (for diabetic patients) after eating ,7. The aDiet exchange lists are usually recommended for diabetic patients to use in formulating a sensible meal plan. However, an exchange list is not always convenient to use. Moreover, there is a lack of ethnic diet exchange lists. For a member of an ethnic minority to follow a diet exchange list, he or she must prepare his or her own meal away from the rest of the family. Nutall and Chasuk have strWhen diet alone cannot effectively control the type 2 diabetic conditions, medical interventions, such as insulin injections or dispensing hypoglycaemic pills, are usually the next step of managing type 2 diabetes mellitus. Medical interventions notoriously exacerbate the fluctuation of blood glucose excursions. Even with the smallest dosage of hypoglycaemic drug (5 mg glucotrol or glyburide) once in the morning, the subject of this study still experienced frequent acute hypoglycaemias. Besides, his A1c levels hovered around 6.5 levels for many years following his physician's advice of taking 5 mg glucotrol per day. It became obvious that a properly designed drug dispensing regimen was needed to avoid hypoglycaemic bouts and effectively reduce A1c levels.Fasting blood glucose measurements are not consistent indicators, fluctuating widely from a low of 70 mg/dL to a high of 200 mg/dL (with most frequent range lay between 90 to 150 mg/dL) that were experienced by this type 2 diabetic subject prior to the model-based lifestyle adjustment. Initially, the subject tried to adjust lifestyle based on fasting glucose measurements, but it was not successful. His A1c measurements crept from 6.3 to 6.7 in a year. As glucose binds irreversibly to haemoglobin molecules within red blood cells, the amount of glucose that is bound to haemoglobin is directly tied to the concentration of glucose in the blood. The average life span of erythrocytes is about 120 days , measuriIt has been established that exercise can effectively alleviate diabetic conditions. Although no rigorous investigation has been performed here, nor is the focus of this current study, a forty-minute exercise of swimming, or weight lifting, or jogging, or any combination of these, prior to a meal or 3 to 4 hours after a meal, can significantly depress the volunteer's post-prandial blood glucose levels. However, it is impractical to substitute hypoglycemic pills with a multiple daily exercise schedule. A sensible lifestyle adjustment is required to manage the diabetic conditions without altering much of daily routines.Post-prandial blood glucose excursions (time series) for type 2 diabetes vary widely depending on the variety and the amount of food consumed. It also depends on long and short term physical conditions (exercise routines and stress levels such as insomnia) to a lesser scale. The recovery periods of blood glucose excursions returning to the pre-prandial level (or baseline) for diabetics are generally longer than those for non-diabetics. Although a simple glucose-insulin interaction compartmental model exists , not allA biophysically-based model of impulse-force-generated heavily damped oscillatory system is used here to capture the post-prandial blood glucose characteristics of type 2 diabetes. The model follows the general approach of glucose-insulin interaction model (bolus injection of glucose) with a few modifications, for which parameters can readily be interpreted and a case study is presented for exploring its potential applications. Rather than using single food items for their published GI values, or its cumbersome weighted mean of multiple ingredients in a meal, normally consumed lunch for the subject was used for the test meal. Based on the preliminary results obtained from the model, a moderate lifestyle adjustment was devised for the subject: swimming 20 laps for 40 minutes in a 25 m pool in the morning and dispensing 1/4 of 5 mg glyburide 1/2 to 1 hour before lunch and dinner – that enables him to reduce 10% of his A1c level in six months and maintain the desirable lower level for the subsequent six months.The subject is a mid-sixty healthy male of 180 lbs with 5'10" frame, leading a productive professional life. He has been diagnosed with type 2 diabetes for more than 30 years. Initially, he was on diet regimen for nearly twenty years and then was instructed by his physician to dispense 5 mg glucotrol once every morning. He experienced frequent acute hypoglycemia that led him to discuss a possible self-managed regimen with his family physician.i.e., at hour 5, for a total of 11 readings.Lunch was chosen as the test meal for having sufficient time to take post-prandial measurements. The test meals were 15 sets of lunches that consisted either (1) 10 to 12 oz of steamed rice, stir-fried vegetables with 4 oz canned tuna (or steamed cod), or (2) 10 to 12 oz spaghetti with 6 medium sized meat balls (from Sam's family package). Five sets of data each were collected from: (i) without taking hypoglycemic pills before test meals; (ii) 1/4 size of 5 mg glyburide pills were dispensed pre-prandially right before the meal and (iii) 1/4 size of 5 mg glyburide pills were dispensed pre-prandially an hour before the test meals. One pre- and 8 to 12 post-prandial blood glucose measurements were taken at 30-minute intervals starting at the beginning of a meal : (i) for 6 hours, (ii) for 5 hours, and (iii) for 4 hours. In addition, for case (iii) two reference measurements were taken with one right before dispensing the pill and one an hour after completion of the 8 post prandial measurements, The purpose of the first set of measurements was to establish the baseline for this diabetic subject: the recovery period of post-prandial blood glucose excursion without medication. The second and the third sets of the trials were designed to quantitatively measure the hypoglycemic drug effects and the most optimal time frame to administer the pills. Raw data were averaged and the corresponding standard deviations were also calculated for 5 replicates at given times. The averaged data were then used for modeling analysis.f(t); effects of exercises and hypoglycemic medication are lumped as the damping factor, β. The differential equation of such an oscillatory system, that is used to describe post-prandial blood glucose excursions, can be found in many physics texts:The post-prandial blood glucose excursion can be considered as a hormone regulated resilient system. The food intake is treated as a bolus injection of glucose, and thus the impulse force x represents blood glucose level over the baseline at time t, ω0 is the system natural frequency 2, where AUCdata is calculated from the averaged data points by the trapezoidal rule and AUC is calculated from Eq. (5).4. Fine tune these three parameters by using MATLAB function fminsearch .5. These three parameters can further be fine-tuned by GlucoseModel and GlucoseModel1 (for Pill one hour prior) to estimate these model parameters and calculating the relevant diabetic characteristic measures: τ, xmax, AUC are listed in the Additional files Two MATLAB user defined functions: F, ω, β, and those characteristic parameters: RP, τ, xmax, and AUC, the latter three are calculated from Eqs. (3) to (5). Also included in Table 2 values that indicate how well model curves fit the data.Table F is the result of food impact, or the rate of glucose being absorbed into the blood stream. The interpretation of F is rather difficult as the liver acts as a storage compartment for glucose [F, ω, and β are more or less influenced by the liver function, the impact on F deems more pronounced as it has a direct impact on the glucose levels in the blood stream. As the function of the liver is not included in the current model, the estimated F values can only be loosely inferred as a function of insulin level, F increases as hypoglycemic drug depresses the blood glucose levels that in turn increases the absorption rate of glucose into the blood stream as in the case of 1/4 pill taken right before the meal. When the drug is taken an hour before the meal, the liver may have sufficient time to regulate blood glucose levels that additional glucose absorption becomes less intensive.The parametric value of glucose . Liver rω and β along with the intake of hypoglycemic drug are expected, which renders favorable characteristic parameters of τ, RP and AUC, all of these are decreasing with the moderate level of medication. The characteristic parameter xmax has significantly depressed for the 1/4 size glyburide taken one hour before the meal while in the other two cases xmax are roughly the same. This implies that the hypoglycemic drug has a net delay effect. Moderate hypoglycemic medication can enhance the liver function to regulate blood glucose levels, alleviating its fluctuation intensities. Interestingly, many ratios of characteristic parameters are roughly equal to constants for all three cases, which indicates that characteristic parameters are not mutually independent. Table τ xmax/AUC and are extremely attractive as both τ and xmax can be estimated with fewer number of post-prandial measurements that one may use τ and xmax to estimate more interpretable characteristic parameters of AUC and PR.The increases of F value) in comparison with the other two cases. The exceedingly long RP of nearly 7 hours is undesirable: as it implies that the next meal time arrives before the blood glucose level could return to the baseline, i.e., an elevated blood glucose level would be sustained for a prolonged period of time. The high RP and AUC are unmistakably the characteristics for type 2 diabetes. Figure Parametric values for no-pill trial reveal that glucose absorption rate is generally slower . This is meant to check if the blood glucose would remain near the baseline level. The drop of blood glucose levels between -1 and 0 hours are roughly 10 mg/dL, which can be contributed to the mild liver intervention. No net hypoglycemic drug effect is taking place before the meal as evidenced from the initial rise of the blood excursion curve as shown in Fig. PR and xmax are decreased by 20% and their combination that reflected in AUC dropped nearly 35% in comparison to those for pill taken at meal trial as shown in Table F decreased a little from the one for pill at meal trial, which may indicate an hour after dispensing the pill, a quasi-equilibrium state has been reached among the liver function, hypoglycemic drug effects, and the bolus injection of glucose. The system frequency ω increased for more than 25%, which gives a shorter RP that compares favorably with non-diabetics. The drop of damping factor β may be the result of low F, as both τ and xmax are already significantly reduced that further strengthening of β becomes unnecessary. The hour 5 measurements confirm that although the model curve shows a decreasing trend, upon returning to the base level the blood glucose excursions practically stabilizes. In addition, the volunteer patient did not experience any hypoglycemia even two to three hours after the final post-prandial measurement.From the personal experience of the participating subject, the hypoglycemia usually occurs 3 to 4 hours after taking the pill. The trial described in the previous section also reveals that no significant hypoglycemic drug effect is detected in the initial two hours. In order to learn the drug impact on an empty stomach, an additional glucose measurement was made prior to taking the hypoglycemic pill at -1 hour. Another measurement was also taken an hour after the blood glucose excursion returned to the baseline 40 minute swimming in a 25 m pool in the morning, (b) a fruit of mid-size apple or its equivalent and a cup of coffee with cream for breakfast without taking hypoglycaemic pill, (c) moderate lunch with 1/4 size of 5 mg glyburide taken 1/2 to 1 hour before the meal, (d) moderate early dinner, 4 hours prior to bed time, with 1/4 size of 5 mg glyburide taken 1/2 to 1 hour before the meal, (e) snack a mid-size banana, or a small bag (3.5 oz) of peanuts, or 6 crackers when needed in between meals. With this regimen, he was able to reduce his A1c level from 6.7 to 6.0 in 6 months and maintained at this level for the subsequent 6 months. Moreover, he has not had any hypoglycaemic bouts ever since he particitipated in this study more than two years ago.Elevated blood glucose excursions during the night would boost the A1c levels. To keep a low average fluctuation of blood glucose excursion amplitudes, the evening meal is crucial. In order to avoid hypoglycaemia during the sleep, an early dinner is advised. The subject has been able to keep post-prandial blood glucose levels within 200 mg/dL with the mean fasting reading of 90 ± 20 mg/dL. Occasionally he consumes a can of beer or sugar free deserts. Although no rigorous study has been performed, a forty-minute exercise of swimming, or weight lifting, or jogging, or any combination of these is roughly equivalent to the effect of 1/4 size of 5 mg glyburide. Nonetheless, it is impractical to exercise more than once a day, thus the subject takes 2.5 mg of hypoglycemic pill a day instead. His physician originally prescribed him to take one 5 mg hypoglycemic pill daily. That was more that 10 years ago. The regimen did not work very well as he experienced hypoglycaemic bouts often. This model-based regimen not only reduced A1c level but entirely eliminated hypoglycaemic symptoms. In addition, one fasting blood glucose measurement in the morning is sufficient for him to maintain a healthy daily routine of exercise, consuming meals/snacks and leading a productive life with mental and physical activities.etc. Although this model-based self-management regimen for the type 2 diabetic subject is only a case study, it certainly provides a general guideline for an applicable life-style adjustment. Currently not all the model parameters are entirely clear, additional data are required to draw a meaningful general conclusion. A pilot project of testing this regimen on six type 2 diabetic patients in a regional nursing home is proposed for the next phase of study.Lifestyle adjustments are the best regimens for many chronicle ailments such as diabetes, hypertension, high cholesterol levels, τ xmax/AUC and are approximately constants, the combination of τ and xmax can then be used to estimate AUC and PR with fewer number of post-prandial measurements. This would be much more convenient to characterize a type 2 diabetic subject than using AUC and PR.If future studies support that the ratios of RP and AUC , carry clear meaning that can be used to characterize type 2 diabetic subjects from non-diabetics, the implications of model parameters, F, ω and β are not as translucent. With additional data, one may be able to draw plausible conclusions about (a) how F is influenced by food intakes, drug (delaying) effects, and liver (regulatory) functions; and (b) how ω and β behave, whether they are independent of F and of each other, or all three somewhat mutually dependent. Better understanding of these parameters would definitely enhance the self-management for type 2 diabetes.Although derived characteristic parameters: This model-based lifestyle adjustment has another advantage: it can be used to manage each individual needs. Nutall and Chasuk have strRP, τ, xmax, and AUC. Applying a small dosage of medical intervention prior to a meal can keep the blood glucose at a relatively flat level and depress the overnight blood glucose excursion; however, this practice needs the approval from one's family physician and is not recommended here.For those individuals who are interested in self-managing the type 2 diabetes, the general advice is: avoiding big meals, may snack moderately between meals, eat an early dinner – about 4 hours before bedtime, and exercise regularly. If one is interested in "normal" meal effects on one's post-prandial blood glucose excursion, taking a pre-prandial blood glucose measurement prior to a typical lunch and 8 to 10 post-prandial measurements at half-hour intervals for 5 or more replicates and follow the procedure described here to obtain these characteristic parameters Sole authorship: data collection/analysis, model building, parameter estimation/interpretation, and the design of life-style adjustment regimen for the participating subject.GlucoseModel to estimate model parameters: F, β, ω and to calculate the relevant diabetic characteristic measures: τ, xmax, AUC.MATLAB user defined function: Click here for fileGlucoseModel1 (for Pill one-hour prior) to estimate model parameters: F, β, ω and to calculate the relevant diabetic characteristic measures: τ, xmax, AUC.MATLAB user defined function: Click here for file

Quorum sensing is a process of bacterial cell-to-cell communication involving the production and detection of extracellular signaling molecules called autoinducers. Recently, it has been proposed that autoinducer-2 (AI-2), a furanosyl borate diester derived from the recycling of S-adenosyl-homocysteine (SAH) to homocysteine, serves as a universal signal for interspecies communication.Vibrio strains had strong, bidirectional matches to the periplasmic AI-2 binding protein LuxP and the central signal relay protein LuxU. The initial two-component sensor kinase protein LuxQ, and the terminal response regulator luxO are found in most Proteobacteria, as well as in some Firmicutes, often in several copies.In this study, 138 completed genomes were examined for the genes involved in the synthesis and detection of AI-2. Except for some symbionts and parasites, all organisms have a pathway to recycle SAH, either using a two-step enzymatic conversion by the Pfs and LuxS enzymes or a one-step conversion using SAH-hydrolase (SahH). 51 organisms including most Gamma-, Beta-, and Epsilonproteobacteria, and Firmicutes possess the Pfs-LuxS pathway, while Archaea, Eukarya, Alphaproteobacteria, Actinobacteria and Cyanobacteria prefer the SahH pathway. In all 138 organisms, only the three Vibrio strains. Thus, other organisms may either use components different from the AI-2 signal transduction system of Vibrio strains to sense the signal of AI-2, or they do not have such a quorum sensing system at all.The genomic analysis indicates that the LuxS enzyme required for AI-2 synthesis is widespread in bacteria, while the periplasmic binding protein LuxP is only present in Vibrio which converge to trigger luminescence in V. harveyi [V. cholerae [V. harveyi, the structure of autoinducer-2 (AI-2) has been determined in a complex with the sensor protein LuxP [Quorum sensing through small signal molecules called autoinducers is an important process for the regulation of population density dependent cellular processes in bacteria, including the production of antibiotics and virulence factors, conjugation, transformation, swarming behaviour and biofilm formation ,2. Recen harveyi and exprcholerae ,5. Two cein LuxP and showV. harveyi reporter strains [E. coli genes is transcribed differently with culture supernatants containing AI-2 compared to culture supernatants from luxS- mutants [E. coli serotype O157:H7 (EHEC) is controlled by a LuxS dependent molecule, which was later shown to be not AI-2 but AI-3 whose structure is not known yet and which does not activate the V. harveyi bioreporter strain [The LuxS enzyme responsible for the last enzymatic step of AI-2 synthesis is present in a wide phylogenetic range of bacterial genera and AI-2 produced by heterologous organisms triggers luminescence in the strains ,8. Thus mutants ,10. Recer strain . It is ar strain .V. cholerae [Streptococcus pyogenes [Streptococcus pneumoniae [Neisseeria meningitidis [Clostridiuim perfringens [- mutants showed severe defects in the expression of virulence factors. In some other pathogens luxS- mutants showed none or very subtle changes in virulence related traits . In Salcroflora .Vibrio strains is well experimentally proven [V. harveyi it is composed of a soluble periplasmic AI-2 binding protein LuxP, and a phosphorelay cascade resulting in density dependent activation of the lux operon motif for direct DNA binding [The signal detection system for AI-2 from y proven binding . At low binding . At highThe LuxS enzyme responsible for the last enzymatic step of AI-2 synthesis has at the same time an important function in the activated methyl cycle of the cell, since it is necessary for recycling of the toxic intermediate SAH . Two patPseudomonas aeruginosa [Despite intensive research on AI-2 in the last years the available data do in many cases not allow to clearly separate the metabolic function of the LuxS gene product from its possible signalling activity in interspecies communication. Winzer and his colleagues ,26 analyruginosa . TherefoBifidobacterium longum NCCC2705 and Escherichia blattae, no organism has both the sahH and luxS gene. Interestingly, each organism has only a single copy of the highly conserved luxS gene. These results are consistent with the studies of Winzer and his colleagues [The distribution of the orthologs of the proteins involved in AI-2 production, SAH degradation and recycling, and AI-2 signalling is listed in Supplementary Table s1 and s2 and 2. Alleagues .Bifidobacterium longum). Within the Proteobacteria, Alphaproteobacteria clearly use the one-step detoxification pathway, while there is a dividing line going across the Betaproteobacteria and the Gammaproteobacteria. For the Betaproteobacteria, the pathogen Neisseria meningitidis uses the two step pathway, while Ralstonia solanacearum and Nitrosomonas europaea use the one-step pathway. With the exception of the Xanthomonadales and Pseudomonadales, all Gammaproteobacteria presently sequenced use the Pfs/LuxS pathway.The presence of either a one-step or a two-step detoxification pathway for SAH follows a phylogenetic pattern. Eukarya and Archaea use exclusively the one-step pathway to degrade SAH, while Bacteria use either the one-step or the two-step pathway depending on their phylogenetic position Fig. . The twoBorrelia burgdorferi (Spirochaetes) and Deinococcus radiodurans R1 (Deinococcus-Thermus), while the organisms from other sequenced phyla use the SahH pathway. The second sequenced strain from the phylum Spirochates, Leptospira interrogans, uses the SahH pathway. These results are also consistent with the analysis of Winzer et al. [Only one or two representatives have been sequenced from other microbial phyla, so it is premature to generalize these findings. However, presently the Pfs/LuxS pathway has been found in r et al. .Exploring the ERGO database containiBifidobacterium longum, which is the only species of Actinobacteria having LuxS, and which at the same time has the SahH pathway for recycling of SAH, is most closely related to that of the phylogenetically only distantly related Lactobacillus plantarum. Both bacteria share the same habitat, being commensals of the healthy human gut. There would have been ample opportunities for B. longum to acquire luxS by horizontal gene transfer from Lactobacillus. The Lactobacillus branch also contains a small subcluster with luxS from Borrelia burgdorferi, a Spirochete, which is most similar to luxS from Clostridium acetobutylicum. The third branch is dominated by Bacillales. Interestingly, it also includes two of three sequenced Epsilonproteobacteria, namely two strains of Helicobacter pylori. However, the closely related Campylobacter jejuni forms a separate, deeply branching lineage. These data confirm those of Lerat & Moran [Campylobacter jejuni luxS and the fact that γ-Proteobacterial LuxS genes were monophyletic in our analysis, but comprised two different branches in their tree. In addition, we included luxS sequences from Enterococcus faecalis and Deinococcus radiodurans. The robustness of the tree topology is caused by the high degree of conservation of luxS and strongly supports the resulting conclusions regarding gene transfer for some species.The sequences of LuxS orthologs were aligned and a phylogenetic tree was built from the alignment. There are clearly three bigger branches in the phylogenetic tree Fig. . The fir & Moran . Small dHelicobacter pylori, Streptococcus pyogenes and Enterococcus faecalis lack MetE/MetH but have MetK. The overview of such enzymes in Eukarya and Archaea is more complicated probably because of their incomplete identification by searching homologues to proteins with known functions or because of the existence of other unknown pathways or enzymes in these organisms.To complete the metabolic cycle of SAH, the common product homocysteine of the two degradative pathways is converted to methionine by a homocysteine methyltransferase , then to SAM by SAM synthetase (MetK). SAH is one of the products of SAM-dependent transmethylases. The distribution of MetE, MetH and MetK was analysed in a similar way to LuxS (Supplementary Table s1 ). As a gVibrio for the sequenced genomes are listed in Supplementary Table s1 and s2 [Vibrio strains. And only Vibrio strains have both the orthologs for the hybrid sensor kinase LuxQ and the two component response regulator LuxO. In addition, five other orthologs of LuxQ were found using the reciprocal best hit strategy, namely in Brucella melitensis, Brucella suis, Streptococcus agalactiae (two different strains), and in Methanosarcina mazei. For the two component response regulator LuxO, four additional orthologs were found in Bradyrhizobium japonicum, Listeria monocytogenes, Lactobacillus plantarum and Thermotoga maritima. Given the complexity of the proteins involved and the limited number of sequences presently available, it is not possible to draw consistent conclusions from this finding at this point.The reciprocal best-hit orthologs of the signal transduction cascade from 1 and s2 and 2. UVibrio strains than to the AI-2 binding protein LuxP. We reconstructed the 3D models of LuxP proteins from different Vibrio strains by applying the method of SwissModel. All these LuxP proteins have similar 3D structures as expected from the high similarity of their sequences (data not shown). The three-dimensional structure of LuxP is very similar to that of D-ribose-binding proteins [Vibrio organisms are actually functional AI-2 binding proteins.However, if not the reciprocal best-hit strategy but the uni-directional best-hit search was applied, 28 organisms were found to have homologues to LuxP. The LuxP homologues of 25 of these organisms were more similar to D-ribose binding proteins of proteins . Because104 organisms were found to have homologues both for the hybrid sensor kinase LuxQ, and the two-component response regulator LuxO. Most organisms had several homologous genes for these two-component systems, so that altogether 315 genes were found for LuxQ and 340 for LuxO. This was caused by the fact that several domains of the sensor and regulator components of signal transduction systems are highly conserved. We were not able to identify the unique binding domain from the sensor protein LuxQ specific for the detection of the AI-2 signal.The reciprocal best hit strategy of sequence similarity comparisons was used here to distinguish orthologous from paralogous genes. Orthologs are genes in different species that evolved from a common ancestral gene by speciation. Paralogs are genes originating from duplication events within a genome. Orthologs tend to retain the same function in the course of evolution, whereas paralogs often evolve new functions . The recHowever, it should be noted that in most cases the functions of these paralogs are not experimentally characterized and cannot be deduced by bioinformatics methods. Because of the high conservation among these regulatory components, it is hard to exclude the possibility that some of them may serve as alternative sensors for detecting the AI-2. On the other hand, the unidirectional best hits for the studied metabolic enzymes were basically the same as the reciprocal best hits, suggesting that the metabolic enzymes for the activated methyl cycle were seldom duplicated during the course of evolution.The presence of either of two possible SAH degradation pathways in most living cells indicates their importance in the central cell metabolism. Both Archaea and Eukarya use exclusively a one-step detoxification pathway for SAH, indicating that this may be the ancient type of metabolism. The distribution of the two-step Pfs/LuxS pathway for detoxification of SAH within the domain Bacteria appears to be phylogenetically conserved. Since the currently sequenced genomes are biased towards pathogens, it remains to be seen if a similar phylogenetic pattern will also be found in non pathogenic bacteria from soils, sediments and marine environments. Previous studies ,26 came Bifidobacterium longum NCC2705, possesses both pathways. This species is a key commensal of the healthy human gastrointestinal tract and vagina. The double pathways may be helpful to recycle and use methionine more economically or to accomplish its dependence on H2S or methanethiol for methionine biosynthesis [Escherichia blattae, was also identified to have both pathways . However, their physiological roles in this species have still to be clarified.Interestingly, a unique species from the genomes in the KEGG database, namely ynthesis . AnotherBifidobacterium longum, Helicobacter pylori, Clostridium acetobutylicum and Borrelia burgdorferi, with the insect or mammalian gut serving as a melting pot of species.The phylogenetic tree of LuxS does not in all cases correspond to the 16S rRNA based microbial phylogeny. Thus, horizontal gene transfer might have resulted in the acquisition of LuxS genes e.g. in Vibrio spp. having a LuxS enzyme the production of AI-2 has been demonstrated using the Vibrio harveyi reporter strain BB170 .Pseudomonas aeruginosa, which does not contain the luxS gene [luxCDABE reporter plasmids and light induction was tested in the presence of AI-2 synthesized enzymatically from SAH or by co-culture with a luxS containing clinical isolate of Streptotoccus sp. (strain CF004). The fact that six of these virulence gene promoters were upregulated both by AI-2 and coculture with CF004 suggests a specific effect of AI-2 on the transcription of virulence associated genes in Pseudomonas aeruginosa, although the signalling cascade within the cell is presently unknown.However, if AI-2 is indeed a universal signal molecule, it may be useful for bacteria to detect it even if they do not produce it themselves. This was shown to be actually the case in uxS gene . Here, tV. harveyi reporter strain which is most probably a furanosyl-borate-diester. The detection cascade, if any, for this compound in the producing organisms must be different from that in Vibrio strains and is presently not known. The diversity of physiological effects observed in luxS- mutants can either be interpreted as the result of a defect in a global quorum sensing regulatory mechanism, which may also be caused by a LuxS dependend compound other than AI-2, or as the result of a defect in the central methyl cycle of the cell. Thus, although there are intriguing indications for a LuxS dependent universal signal molecule in Bacteria, direct proof regarding the chemical nature of the compound and its signalling mechanism in non Vibrio organisms is presently missing.The presence of luxS in many phylogenetic groups within the domain Bacteria indicates that these bacteria, while recycling SAH in a two-step enzymatic process, at the same time produce a compound able to stimulate luminescence in a The protein sequences of 138 sequenced genomes were downloaded from KEGG (Status June 2003) and reformatted as local blast databases. The non-redundant protein database of NCBI (nr) and the E. coli K12 and LsrR, -A, -B, -C, -D, -E, -F and G from Salmonella typhimurium [To achieve a more complete finding of the proteins functionally similar to the proteins related to either the metabolic pathway or the signal transduction pathway of autoinducter-2, the NCBI protein database was at first searched with the relevant functional terms such as "AI-2 production" or "LuxS". A phylogenic tree was constructed based on the alignment of the relevant matches by using the component AlignX of the bioinformatic software suite "Vector NTI Advance" . From each branch of the tree, one protein was selected. All of them were put together into a file as a blast query to represent a function. It is not necessary for the members of this function to be similar to each other in sequence level. This facilitates the finding of evolutionarily far-related proteins by blast search. The protein sequences of MetK, MetE and MetH from himurium were useThe queries were used to search for their respective orthologs from the local KEGG genome databases by applying the reciprocal best hit strategy with a bThe phylogenetic tree for the orthologs was built with the neighbour-joining (NJ) method using VeJS conducted the data mining work and contributed to writing the manuscript. RD cooperated with the access to the ERGO database. IWD initiated the study, contributed to the concept and drafted the manuscript. APZ supervised the study and contributed to writing the manuscript. All authors read and approved the final manuscript.Supplementary Table s1. Presence of AI-2 synthesis and detection genes in 138 completed genomes of the KEGG database (July 2003). Abbreviations: luxS, AI-2 synthetase/SRH cleavage enzyme; pfs, SAH-nucleosidase enzyme; sahH, SAH hydrolase; metH and metH, methionine synthetase; metK SAM synthetase; luxP, AI-2 binding protein; luxQ, membrane bound hybrid sensor kinase; luxU, histidine phosphorelay protein ; luxO response regulator. See Fig. 1 for further information on the synthesis pathway and Fig. 2 for the phosporelay detection cascade. Organisms shaded violet contain neither luxS nor sahH.Click here for fileSupplementary Table s2. The accession numbers of the genes in Supplementary Table s1. Abbreviations as in Supplementary Table s1.Click here for fileSupplementary Table s3. Presence of the Salmonella lsr gene homologs in the completed genomes of the KEGG database (July 2003). Abbreviations as in Supplementary Table s1. X denotes bi-directional hits, ? denotes unidirectional hits.Click here for file

Spatial variation in patterns of disease outcomes is often explored with techniques such as cluster detection analysis. In other types of investigations, geographically varying individual or community level characteristics are often used as independent predictors in statistical models which also attempt to explain variation in disease outcomes. However, there is a lack of research which combines geographically referenced exploratory analysis with multilevel models. We used a spatial scan statistic approach, in combination with predicted block group-level disease patterns from multilevel models, to examine geographic variation in prostate cancer grade and stage at diagnosis.We examined data from 20928 Maryland men with incident prostate cancer reported to the Maryland Cancer Registry during 1992–1997. Initial cluster detection analyses, prior to adjustment, indicated that there were four statistically significant clusters of high and low rates of each outcome (later stage at diagnosis and higher histologic grade of tumor) for prostate cancer cases in Maryland during 1992–1997. After adjustment for individual case attributes, including age, race, year of diagnosis, patterns of clusters changed for both outcomes. Additional adjustment for Census block group and county-level socioeconomic measures changed the cluster patterns further.These findings provide evidence that, in locations where adjustment changed patterns of clusters, the adjustment factors may be contributing causes of the original clusters. In addition, clusters identified after adjusting for individual and area-level predictors indicate area of unexplained variation, and merit further small-area investigations. Ideally, contextual analysis allows for consideration of both attributes that are generalizable across multiple settings, and geographically referenced relationships – influences that occur in context with each other. However, a tension exists between geographic variation analysis, which identifies the location and nature of the variation, and non-spatial analysis, which may identify characteristics of environments or individuals associated with variation, but does so without spatially specific models.Spatial variation in disease characteristics occurs, and multiple statistical methods have been developed to determine whether patterns of variation occur by chance alone, or whether variation is unlikely to have happened at random. One typConversely, conventional non-spatial analysis methods may be used to identify important influences on individual or area-level disease variation. For example, hierarchical or multilevel regression can be used to simultaneously examine individual and area-level characteristics which are associated with variation in disease incidence, characteristics, or outcome . HoweverThe study of disease patterns in prostate cancer, for example, can be informed by geographic analyses. Prostate cancer is a disease with strong geographic variation, both internationally and also within individual countries or regions . Like moWhen considering the utility of a geographic approach to prostate cancer influences, it may be useful to think of three broad categories of factors. There are factors which may be, at first consideration, purely non-geographic in influence. An example of this might be the influence of the biological characteristics of the cancer on the disease course, such as the relationship between histologic grade of tumor on the stage or extent of disease at diagnosis . This reOther factors, such as age, might be considered to be pseudo-geographic in influence. The age distribution of the male population would vary across almost any geographic area under consideration, and there is also a strong age-disease relationship in prostate cancer, with the risk of the disease increasing with age. However, the age-disease relationship is not likely to be primarily driven by geography. Adjusting for the distribution of age within a population of interest is often desirable, in order to remove the confounding caused by age, and simulate the geographic variation we would expect to see if we had populations with identical age distributions.A third and more complex category of influences are those for which geographic context is critical to their causal pathway, and thus these variables may be only partially understood outside of their geography. Examples might be individual social or behavioral characteristics such as ethnicity or race, income, insurance or education, occupation, diet or body size.For example, the consistently greater risk for prostate cancer among men of African ancestry compared to all other ethnic groups in the world suggests fundamental biologic causes that supersede geographic influences. However, substantial geographic variation within the US African-American population, as well as international variation between African, Afro-Caribbean, and US men of African ancestry suggests complex multigenerational social and geographic influences .Even influences that we may confidently classify as so fundamental as to be geographically immutable, such as the relationship between tumor biology and disease progression, could be influenced by geographic variation in access to care or medical practices, dietary, occupational, or environmental agents, or individual variation in behaviors such as tobacco use, exercise, or body size. Therefore, the extent to which any factor's influence on a cancer outcome varies by context or location offers tremendous insight into the mechanisms of influence.The purpose of this research was to combine cluster detection analysis techniques with multilevel modeling of area-level influences on disease patterns, in order to examine the relationship between social-environmental influences and spatial patterning. We used data from the Maryland Cancer Registry on incident cases of prostate cancer occurring in Maryland from 1992 to 1997, and examined variation in two disease characteristics which contribute significantly to overall disease burden: histologic grade of tumor, and stage of disease at time of diagnosis. The use of geographic analysis of prostate cancer outcomes of interest, in combination with modeling of known risk factors, may prove useful in understanding how much of the strong geographic patterns in prostate cancer can be explained by individual and area-level influences, and how much remains, as of yet, unexplained.For each of our two outcomes of interest, higher tumor grade and later stage of disease at diagnosis, we first modeled the "crude" or unadjusted variation in these outcomes across the entire State. This was done by calculating a block group-specific expected rate of each outcome, based simply on the number of cases within the block group and the overall rate of the outcome across the State, and comparing the ratio of observed to expected cases with the given outcome at the block group level. We then used estimates from multivariate models to refine our estimates of the expected number of higher grade or later stage cases, and recalculated, at the blockgroup level, the ratio of observed to expected cases with the outcome of interest. Throughout each set of three analyses, the observed number of cases remained the same, and the expected number (the denominator) varied with each adjustment. Therefore, if an independent variable in a regression model was positively associated with excess risk for the outcome of interest, it increased the regression-estimated expected number of such cases, and thus decreased the observed-to-expected ratio in areas where it was observed. Factors which were negatively associated with risk for the outcome, when adjusted for, reduced the number of such cases expected, and, in turn, increased the observed-to-expected ratio. The methods used are explained in greater detail in the methods section.Table Figure Figures Figure The most likely cluster is a geographically small densely populated area in Baltimore City, with a relative risk (RR) of 1.28 (p = .001). The second most likely non-overlapping cluster is a large area in the center of the Eastern Shore of the Chesapeake Bay, with a significantly lower rate of high grade tumors in men with prostate cancer . Two small areas of lower rates in the suburban areas outside of Baltimore City were identified, one to the north of the City and one to the southwest .Figure Figure The most likely cluster in this analysis is an area of higher than expected rates of aggressive tumor among cases, located to the west of Baltimore City . This small area was previously identified as the most likely cluster in figure Figures Statistically significant clusters of high or low rates were identified in four geographic areas in the unadjusted analysis figure . As descFigure Figure These geographic analyses provide information on both biological influences on cancer, as well as those more closely influenced by patterns of medical care. For tumor biology, the results of the unadjusted analysis suggest that one primarily rural area of the State, as well as two affluent suburban areas, appear to offer protection from high grade tumor histology. On the other hand, the urban Baltimore area has higher than expected rates of high grade tumors among men diagnosed in the time period 1992–1997.Individual case characteristics change this picture dramatically, but do not "explain away" all variation in this important disease characteristic. For example, black race is an important risk factor for aggressive tumor biology; therefore, it is reasonable to speculate that area differences in the proportion of African-American men in the case population may have accounted for some of the clustering in figure Figure Large areas of the rural Eastern Shore of Maryland are no longer identified as being contained inside non-overlapping areas of statistically significant lower risk for aggressive tumor biology, with the protected area being narrowed from a radius of 54.65 kilometers to 30.88 kilometers. Conversely, the small protective area in affluent Howard County between Washington and Baltimore has now grown from a radius of 14.81 kilometers in figure 3 to 48.62 kilometers in figure The influence of area level social resources on high grade of tumor was complex: the men with the lowest risk for aggressive tumors were white men living in small areas of greater income, nested within counties of overall low social resources. Therefore, clusters remaining in figure The cluster in Baltimore City reflects the fact that Baltimore City does not fit the overall model of low resource counties as protective. Baltimore City is the single urban county in the lowest range of the index; the rest of the lower resource counties are predominantly rural. Therefore, moving from figure Conversely, the protective clusters are found in counties with high social resource index scores, centered in Montgomery County in the Washington, D. C. suburbs, and in an area with slightly low scores, Talbot and Queen Anne's counties on the Eastern Shore. For the D.C. suburbs, their rate in figure For the Eastern Shore, the lower rate of aggressive disease has been consistent across all three cluster analyses. For low social resource counties such as Dorchester, the adjusted predicted rate in figure Finally, Anne Arundel County, which had higher than expected rates in the individually adjusted analysis, is now no different than expected, arguing that the relatively high social resource index score for this county led to a closer approximation of expected proportion of cases with aggressive disease.When considering the geographic patterning of later stage at diagnosis for men with prostate cancer in Maryland during the time period 1992 to 1997, it appears from the unadjusted analysis that men in certain rural areas were much more likely to come into treatment with more advanced disease than those in the suburban, more affluent areas of the State. Individual characteristics of the patients appear in some ways to have masked these geographic differences, in that the clusters generally remain or become more important once the case population mix of characteristics such as age, race, tumor biology, and year of diagnosis is taken into account figure . AdditioFrom figure Prostate-specific antigen (PSA) testing was widely available in Maryland during the entire time period of this study (1992–1997). This suggests that more global barriers to health care, rather than differential access to this specific diagnostic tool, were more important in creating these patterns of late stage diagnosis.Although there is no statistical test to evaluate the proportion of variation explained in a multilevel model, because of the inclusion of random effects, it is reasonable to state that, overall, our adjustment methods did account for substantial variation in rates of aggressive disease and late stage diagnosis, by considering important influences – characteristics of the men themselves, as well as characteristics of their environments.In spite of this, variation in these cancer characteristics remained substantial across the State. In fact, whether the measure used is the number of cases, number of block groups, or geographic area, figures An additional caveat in the interpretation of these cluster detection analyses is related to the choice of criteria used for reporting clusters. In consideration of the large amount of data being examined, both in terms of geographic area and number of cases, we chose to report clusters only if they had a statistical significance of p < .05, and contained no geographic overlap with a more significant cluster. These restrictions meant that a given geographic area could possibly be described as part of a cluster of excess or reduced risk in one analysis, and not in other, based on small changes in expected number of cases, or based on the identification of a more significant cluster nearby.These findings have implications on both a practical cancer control level, as well as for further research in prostate cancer. For state and local health agencies, trends in area-level patterns of cancer outcomes over time can be used to monitor change, whether to evaluate the effectiveness of geographically distributed interventions such as screening or treatment programs, or identify population changes which may increase need for services. Unadjusted cluster analyses provide valuable information for cancer control planners who need to address areas of greatest need, regardless of the cause. However, adjusted analyses identify geographically unique situations, such as the persistently elevated rates of later stage diagnosis in two rural areas of Maryland. For researchers, analytic techniques which identify both explained and unexplained geographic variation may provide information about the multilevel synergistic factors influencing cancer patterns, or, at a minimum, identify areas and populations meriting further study.More detailed information on these data and methods has been reported previously . With IROf 24,189 cases, 23,993 had verifiable Maryland addresses. Ninety-one percent were successfully geocoded, and nine percent were assigned to an imputed location within their zipcode by algorithm. An additional 3063 cases were not used, due to missing demographic or clinical data, or because their race was neither African-American or white, leaving a final analysis population of 20,928.We used individual case characteristics from the Registry record, including age at diagnosis, race, year of diagnosis, tumor stage, and tumor histologic grade. Based on case residence, we added to each case record selected 1990 US Census characteristics of three nested geographic units surrounding the case location – the Census block group, Census tract, and county. Our record for each case therefore contained individual demographic and clinical characteristics based on the Cancer Registry data, point location of residence, and Census measures for the case's block group, tract and county of residence.housing resources , three income measures , four population composition measures , two social class measures and five material deprivation measures .We created seventeen possible area-level social indicators for each block group, tract, and county from the 1990 US Census STF-3 file : three mFor continuous variables (case age and census measures), we compute standardized measures to reduce collinearity, by centering each case value at the population mean, and dividing by the standard deviation. For year of diagnosis, we centered the values at 1994, a midvalue in our six year time window.We chose two outcomes of interest which are associated with differences in prostate cancer disease severity and longterm survival for patients – histologic grade, or degree of cell differentiation, of the tumor, and stage, or extent, of disease at time of diagnosis. For each outcome, we dichotomized the data and examined the likelihood of the more negative outcome. For tumor grade, we compared tumors staged as 3 or 4 (poorly differentiated or undifferentiated) to those graded as 1 or 2 (well or moderately well differentiated). For stage at diagnosis, we used the Surveillance, Epidemiology and End Stage (SEER) summary stage , and comIn order to explore the geographic patterns of our two outcomes of interest, we used the spatial scan statistic to detecOur cluster detection method identified clusters of both high and low rates, with a maximum scanning window size to include up to 50% of the population at risk. Secondary clusters were reported if they had no geographic overlap with more likely clusters. P-values were derived from 999 simulated Monte Carlo replications under the null hypothesis of spatial randomness of outcomes of interest.We conducted three separate cluster detection analyses for each of the two prostate cancer outcomes: higher histologic grade of tumor, and later stage at diagnosis. In the unadjusted analysis, under the null hypothesis, the expected number of more aggressive grade or late stage cases in a block group was calculated by multiplying the total case population of the block group by the statewide rate of the outcome of interest. Thus, in the unadjusted analysis, a block group would be expected to have the same rate or proportion of late stage or high grade cases in its case population as the State. In the two adjusted analyses, the expected number of aggressive grade or later stage cases was calculated from a regression model containing individual case characteristics, or from a regression model with both individual and area-level covariates. Based on the expected counts, the number of aggressive grade and later stage cases in each block group was modeled as a Poisson distribution.For the unadjusted analyses, we also used a Bernoulli model to compare the distribution of so-called "cases" (those with aggressive grade or late stage) to "controls" (less aggressive grade or early stage) based on point location of each residential address, rather than rates within block groups. This was useful to compare the sensitivity of the Poisson model assumption for aggregated data to that of the unaggregated Bernoulli method. No major differences in results were found, and to allow proper comparison between the adjusted and unadjusted analyses, the Poisson model results are presented for all three types of analyses..For each cluster identified, we list the radius, number of block groups in the cluster, the observed versus expected number of late stage or aggressive grade cases, the relative risk and the p value. The relative risk is the risk of the respective outcome within the cluster, compared to the population's risk. We report clusters with statistical significance p < .05 that do not overlap with another reported cluster with a lower p-value. Calculations were done using the freely available SaTScan v4.0 software We used the results of two multivariate modeling methods to calculate the expected count of aggressive grade and late stage cases in each block group. In prior work we builtIn logistic regression models including only individual level predictors, our final model included the following statistically significant associations with higher histologic grade of tumor: older age (Odds Ratio (O.R.) 1.17, 95% Confidence Interval (C.I.) 1.13, 1.21), black race , more recent year of diagnosis , and an interaction between age and year of diagnosis .To build the multilevel models, we tested each of the 17 area-level indicators at each level, starting with block group, and also tested for interactions at each level and between levels. To avoid unstable models, when we found multiple significant Census predictors, we computed and tested simple indices by summing relevant Census measures. We also tested for random effects, to account for additional variability. In a multilevel logistic regression model of aggressive tumor grade, each of the above individual level variables remained significant. In addition, two area-level indicators were significant in the final model: block group median household income , with an interaction between black race and income , and a standardized county resource index, composed of four summed county-level measures: percent high school graduates, percent employed, percent moved within the past five years, and median household income (in $1000 units) . Random intercept terms were found to be significant at the block group and county level.In logistic regression models including only individual level predictors, our final model included the following statistically significant associations with late stage at diagnosis: older age , black race , higher tumor grade , missing tumor grade , more recent year of diagnosis and interactions between age and black race , grade and year of diagnosis , and missing grade and year of diagnosis .In the multilevel logistic regression model of late stage at diagnosis, each of the above individual level variables remained significant. In addition, two area-level indicators were significant in the final model: block group percentage of white collar workers among the employed population , and the standardized county resource index . A statistically significant interaction existed between county resource score and older age , and random intercept terms were found to be significant at the block group and county level.The models described above were used to calculate an expected count of aggressive grade and late stage cases, respectively, for each block group. This was accomplished by taking the inverse logit transform of the expected linear predictor in each logistic regression model, yielding a set of estimated probabilities for each outcome. These probabilities were then aggregated to the block group level, providing expected block group-specific counts of later stage and aggressive grade cases.By definition the expected linear predictors includes only estimates from fixed effects in each multilevel logistic regression model. The random effects at the block group and county level, although influential on parameter estimation, were not included in these calculations. Compared to the unadjusted results, geographic patterns shown in the adjusted analyses could be interpreted as those existing after controlling for individual and area-level factors, respectively. In essence, this approach explores residual geographic variation. For this reason, information from the random effects is not included in determining expected outcome counts.AK obtained funding and data for this research, and was PI on the project. She conceptualized and conducted the analysis, and drafted the manuscript. MK directed the development and interpretation of the spatial analysis. FC worked with AK to develop and interpret the multilevel models used, as well as the methodology for imputation. All authors participated in the preparation and approval of the final version of the manuscript.

The use of antithrombotic agents and falls are independently associated with an increased risk of hemorrhagic injury. However, few studies have delineated the risk of fall-related hemorrhagic complications in persons who are taking antithrombotic therapy. The objective of this study was to compare the rates of fall-related hemorrhagic injury in hospital in-patients who are taking and not taking antithrombotic therapy.A 4-year retrospective chart review of consecutive patients who fell during admission to a 500-bed tertiary-care teaching hospital was conducted. Major hemorrhagic injuries including subdural hematomas and major bleeding/cuts, patients' use of antithrombotic medication and their anticoagulation status at the time of their fall were recorded.A total of 2635 falls in 1861 patients were reviewed. Approximately 10% of falls caused major hemorrhagic injury. One fall resulted in a subdural hematoma. Persons taking warfarin were less likely to suffer a fall-related major hemorrhagic injury compared with persons not taking antithrombotic therapy . Logistic regression showed that fall-related major hemorrhagic injury was associated with female gender , use of aspirin and use of clopidogrel , but not with the use of warfarin or heparin, or the intensity of anticoagulation.In this study, compared with persons taking no antithrombotic therapy, those taking warfarin had lower rates of fall-related hemorrhagic injuries. The absolute rate of the development of fall-related intracranial hemorrhagic injury such as subdural hematomas was low, even in persons taking warfarin. These counter-intuitive results may be due to selection bias, and suggest that physicians are very conservative in selecting patients for warfarin therapy, choosing only those who are sufficiently healthy to be at much lower than average risk of suffering fall-related hemorrhagic injuries. This phenomenon may lead to physicians overestimating the potential for fall-related major hemorrhagic injury in persons taking antithrombotic therapy, with the possible denial of warfarin therapy to many of those who would benefit. This perception may contribute to the care gap between the number of patients who would theoretically derive overall benefit from warfarin therapy and those who are actually receiving it. Howevet al examinedet al using deet al . Thus, set al . The objThe protocol was approved by the Ottawa Hospital Research Ethics Committee and is in compliance with the Helsinki Declaration. Since implementation of a fall prevention program in 1991, the Ottawa Hospital – Civic Campus, a 500-bed tertiary care teaching hospital, has had a formal policy of documenting the pertinent details of all patient-related falls occurring within the hospital. Using its dedicated falls database, the records of consecutive falls occurring over a 4-year period were identified. The hospital policy requires completion of an incident report when patients fall. Information collected includes the time and circumstances of the fall, the type of injury (including head injury) that occurred and a categorization of its severity, and the need for subsequent follow-up. A member of the physician team must eventually review all fall incident reports, follow-up any significant injury from the fall and document this information in the hospital record and incident report.Hemorrhage (i.e. cuts or bruising) was classified as major if the immediate attention of a physician was required, or a clinically apparent intracranial hemorrhage subsequently occurred. All other hemorrhage was classified as minor.Since patient falls can be seen as a reflection of sub-optimal nursing care, the hospital has adopted a non-punitive approach to the completion of reports in order to focus on improving the process that led to the falls. The hospital recognizes that the value of the falls database is predicated on maximum completion of incident reports, leading to the assignment of nurse practitioners dedicated to ensuring the completion of the falls reports. Therefore, it is unlikely that falls leading to an injury would not be captured. During the study period, the hospital had no formal policy or guidelines governing the use of antithrombotic therapy in patients.For all identified falls, the hospital records of the corresponding in-patient admission were retrieved. Data extraction from these charts included pertinent patient demographic information, and the use of antithrombotic therapy at the time of the fall. The indications for the use of the particular antithrombotic therapy were also recorded. Using computerized laboratory reports, the international normalized ratio (INR) and partial thromboplastin time (PTT) values that were closest to the time of the fall were also recorded. Patients' INR values at the time of the fall were determined as follows:1. If an INR had been done within 12 hours pre- or post-fall, this was accepted as the INR value at the time of the fall. For patients with both 12 hour pre- and post-fall INRs, these values were averaged.2. For patients not receiving warfarin, if an INR had not been done within 12 hours of the fall and the closest temporal INR was within the normal range (INR<1.2), this was accepted as the INR value occurring at the time of the fall. If the INR values were abnormal, then the pre- and post-INR values temporally closest to the time of the fall were averaged.3. For persons receiving warfarin at the time of the fall, if no 12 hour pre- and post fall INRs were available, then the pre- and post-fall INR values done temporally closest to the fall were averaged.4. For persons who did not have an INR while in hospital and were not receiving warfarin, their charts were reviewed for possible reasons to have an elevated INR . If these were not present, their INR were deemed to be normal (INR 1.0).For patients taking heparin, an identical approach was used for determining the PTT values at the time of their fall.The discharge summaries, nursing notes and medical notes of the hospital records were also reviewed for any immediate and subsequent complications due to the fall including head trauma, subdural hematoma, intracerebral hemorrhage, fractures, major and minor hemorrhage. Multiple falls by the same person were considered independent events. Data extractors were not blinded to the exposure status of patients or their outcomes.Statistical analysis was performed using SPSS software version 10 . Chi-square testing was performed to determine the relationship between individual demographic and clinical factors, and the occurrence of major hemorrhage. Step-wise forward logistic regression analysis was then performed with variables that had p-values < 0.20 on univariate analysis. Given that multiple statistical comparisons were performed, a p-value < 0.01 was considered statistically significant.For the 4-year period, there was a total of 2664 recorded falls in 1861 patients. Despite numerous attempts, the corresponding hospital records could not be located for 29 (1.1%) of the falls. Thus, pertinent data were available and extracted regarding 2635 falls. A significant percentage (29.4%) of patients fell more than once during their admission. The average age of the patients was 71.5 years , with most being male (55.2%).Table 1 see shows thTable 2 see shows thThere was also one fall possibly resulting in an intracerebral hemorrhage occurring in a 60 year old female. She also suffered head trauma from her fall, but was not taking any antithrombotic therapy, and her INR and PTT values were in the normal range at the time of the fall. She recovered from this injury, with no apparent sequelae.The absolute rate of major hemorrhagic injury was lower in persons taking warfarin, compared with those taking no antithrombotic therapy at all . A comparison of major hemorrhagic injury between those with normal INR values (INR = <1.3) and those in the therapeutic range (INR 2–3) showed a strong trend towards fewer complications in the group with therapeutic INRs ; INR 2–3, 6.9% (15/218); odds ratio 0.65, 95% CI; 0.38, 1.13; p = 0.15). A similar comparison between those with normal INRs and those with INRs between 3–5, showed no statistical difference in hemorrhagic complications between the two groups ; INR 3–5, 11.4% (9/79); odds ratio 1.14, 95% CI; 0.56, 2.32; p = 0.70).Univariate analysis demonstrated a very strong relationship between gender and the occurrence of fall-related major hemorrhagic injury , with females being much more likely to suffer one of these complications compared with males (13.3% (157/1181) versus 8.7% (126/1454); p < 0.001). Univariate analysis also showed that there were trends towards an increase in the occurrence of major hemorrhagic injury with increasing age (p = 0.04), increasing INR values at time of fall (p = 0.04), and the use of clopidogrel (p = 0.05) or aspirin (p = 0.20). There was no relationship between major hemorrhagic injury with PTT values at time of the fall (p = 0.27), the use of warfarin (p = 0.42) or the use of heparin (p = 0.62). Similar analyses using major bruising/cuts alone yielded almost identical results. This was due to the occurrence of only one subdural hematoma and one intracerebral hemorrhage.Logistic regression analysis showed that the factors important in the development of major hemorrhagic injury due to falls were female gender , the use of aspirin and the use of clopidogrel . Of note, increasing age was not an independent risk factor and there was no interaction between warfarin and aspirin use.Repeating the analyses with exclusion of all recurrent falls in individuals (n = 1861) resulted in no significant differences in the results reported above.Of note, fractures occurred in 1.4% of falls (n = 38), with 20 of these being hip fractures.Falling is a common phenomenon in both hospitalized and commNumerous studies -15 have The overall results of this study found that persons taking warfarin were less likely to suffer a fall-related hemorrhagic injury, compared to those taking no antithrombotic therapy. This counter-intuitive result may be due to selection bias. That is, physicians were very conservative in selecting patients for warfarin therapy, choosing only those who were robust enough to be at very low risk of suffering a fall-related hemorrhagic injury. Thus, physicians possibly overestimate the potential for major hemorrhagic injury in persons taking antithrombotic therapy, leading to the possible denial of warfarin therapy to many of those in whom warfarin would otherwise be indicated. This practice may contribute to the well-documented care gap between the number of patients who would theoretically derive overall benefit from warfarin therapy and those who are actually receiving it. ,17 HowevIn this study, only 1 SDH occurred as a result of the more than 2500 falls. Therefore, it was not possible to perform meaningful statistical analyses regarding the contributors to this complication. However, the results confirm that fall-related subdural hematomas are not common in older hospitalized persons, even if they are taking antithrombotic agents. That being said, the development of the single SDH found in this study was almost certainly related to the concomitant use of warfarin and aspirin, with an associated INR of greater than 4.0.The reason(s) for this study finding that female patients have a greater risk of developing fall-related hemorrhagic injury is unclear. Age was not a factor as the mean age of female patients (71.6 years) was similar to male patients (71.5 years). Also, the percentages of female and male patients taking warfarin, heparin, clopidogrel or aspirin in this study were very similar. Other studies ,19 have The use of aspirin or clopidogrel is generally considered to be less likely to lead to major hemorrhagic injury when compared with the use of warfarin or heparin. Therefore, it was surprising to find that there was a weak, but statistically significant association between fall-related major hemorrhagic injuries and the use of aspirin or clopidogrel, but no such relationship with the use of warfarin or heparin. Again, this result may be due to selection bias, with physicians favoring the use of aspirin or clopidogrel over warfarin or heparin in persons who are less healthy and more prone to serious hemorrhagic injury if they fall.There are a number of limitations to our study. Due to the retrospective design, it was not possible to apply standardized definitions and measures when determining the occurrence, severity and consequences of falls. Also, we examined the injuries related to hospital-based falls. Therefore, it is unclear whether our results are generalizable to other settings. However, the 10.7% rate of major fall-related hemorrhagic injury in this study is similar to previous hospital- and community-based studies ,12 that The study also has an important strength. Not all fall-related major hemorrhagic injury is identifiable immediately after a fall. We were able to follow-up the sequelae of falling throughout the course of the patients' hospital admission. Therefore, it is unlikely that we failed to identify any serious consequences of falling in our study population.This study provides evidence that the absolute rate of the development of fall-related subdural hematomas is low, even in persons taking warfarin. Also, the lower than expected rate of fall-related hemorrhagic injury in persons taking warfarin suggests that physicians may overestimate the potential for fall-related major hemorrhagic injury in older persons taking antithrombotic therapy, leading to an overly conservative approach to assessing the risk of anticoagulant-related bleeding. This information may help close the care gap between the number of patients who would theoretically benefit from anticoagulant therapy and the number that actually receive it. Further study is necessary to delineate the characteristics of patients who are at high risk of developing fall-related hemorrhagic injury when taking antithrombotic therapy.The author(s) declare that they have no competing interests.MM and FM proposed the study. All authors participated in the design of the study and contributed to the drafting and revision of the manuscript. AB and ML conducted the chart reviews.TABLE1Aug04revised.doc : this is Table 1 entitled, "Fall-related antithrombotic use"Click here for fileTABLE2Aug04revised.doc : this is Table 2 entitled, "Consequences of falls"Click here for file

Research focuses have shifted from "curing" autism to finding better diagnostics for early intervention, improving behavioral therapies, and gaining insight into the autistic brain At first glance, the preschool classroom on the other side of the two-way mirror looks like any other—brightly colored rugs, scattered toys, and tiny chairs. But almost immediately an observer notices differences in the Team Toddle students here at the Neuropsychiatric Institute of the University of California at Los Angeles (UCLA) .A therapist instructs a toddler on his colors, flashing a rapid sequence of blocks at him. When the toddler starts rocking in his chair and repeatedly touching his forehead, the therapist physically restrains his hands, placing them back on the tabletop until he stops the repetitive behaviors and focuses once again on her face and the blocks. During playtime, a two-year-old girl sits by herself in the corner, fixated on some picture cards, oblivious to a group of other children playing with a racetrack and to the therapist who tries to draw her out to join the group.These children lack some of the key social skills that normal toddlers pick up naturally—looking to others for reassurance or cues, focusing on faces, and playing together. Social and communication impairment is a hallmark of autism and can show up as early as 12–18 months of age. But with an unknown cause, and genetic linkages still hazy, there is little consensus among researchers on how the disorder develops in children and how it causes a broad spectrum of social, language, and behavioral deficits.Following one line of research, David Amaral's laboratory at the M.I.N.D. Institute at the University of California at Davis Medical Center in Sacramento has recorded, in autistic brains, a brain volume increase in a specific structure, the amygdala, which is thought to be important for social behavior. A similar study at the University of Washington in Seattle (UW) has reached the same conclusion. “There are so few facts about autism, to have two labs come up with the same data is phenomenal,” says Amaral. “We feel confident this is a real finding, but what does it mean to these kids?”On another research track, using functional imaging, Ralph-Axel Müller, a cognitive neuroscientist at San Diego State University sees a scattering of brain activation in autistic brains that he views as an indication of a more general brain development problem underlying the disorder . He has “Since there is no major hypothesis as to cause [of autism], there are many plausible ideas,” says Amaral. “If we go after all of them, we will waste all of our resources. [We have to] come to some consensus about which are most plausible.” At least two levels of pursuit exist for tracing brain problems associated with autism—the exploration of the general developmental disruptions that result in an autistic brain, and the examination of more specific problems in particular brain structures that produce symptoms. Although scientists still debate how autism evolves in a patient, the field has begun in the last decade to replicate findings and make science-based arguments for interventions. Progress has come in small steps, with advances in neuroimaging and more rigorous experimental designs.Research focuses have shifted from “curing” autism to finding better diagnostics for early intervention, improving behavioral therapies, and gaining insight into the development and function of the autistic brain. Both advocacy groups and government programs have started to bring together neuroscience and genetics experts, clinicians, and families to sharpen the focus of studies and ensure progress in what has often been a messy field.Autism spectrum disorder strikes between one and six out of every 1,000 children around the world, but diagnosis and treatment are currently limited to developed countries. Autism is four times more prevalent in boys than girls, but makes no racial, ethnic, or socioeconomic distinctions. It is characterized by three main symptoms: impaired language, social and communicative deficits, and repetitive and stereotyped behaviors, such as hand flapping, rocking, and unusual responses to sensory stimuli. Autism spectrum disorders can be broken down into other categories, such as low-functioning autism (IQ below 70), high-functioning autism (IQ above 70), and Asperger syndrome (similar to high-functioning autism but with no language deficit).Researchers suspect that there are even more distinct subsets of autism patients. For example, some patients also have epilepsy, and it has been suggested that there is a regressive form of autism—children who, at two or three years of age, appear to regress and lose developmental milestones they had already achieved. Researchers say that sorting out these different profiles—or phenotypes—of autism will be especially important in sorting out which genes or which brain abnormalities are implicated for particular deficits. This sorting should also help clarify the mounds of contradictory data that have dogged the field, by tamping down the experimental “noise” in studies. Boosting the number of children studied and following them from early infancy through adolescence and beyond will also be key components of future studies.“There is not going to be rapid progress in autism research unless we subtype,” Amaral says. He predicts that “brain differences in kids with a regressive form of autism will be different than those of kids with the more congenital type of autism.” He and others are teaming up in an autism phenotyping project that will characterize 600 children into categories of autism . Splitting autism into subtypes will boost both neurobiology and genetics studies to find A key area of research explores the brain's response to human faces at a young age. Studies at the UW Autism Center have shown that unlike typically developing three-year-olds, autistic children do not show a differential brain response to their mother's face compared to that of a stranger. While dysfunctional face recognition may be one of the more devastating symptoms for caregivers, it is also one of the most promising avenues for research to determine how autistic brains process their world differently.Sara Webb, a child psychologist at UW, has followed about 70 autistic children since the age of three for a longitudinal study that will test many parameters until they reach age nine. Her work has already shown that autistic three-year-olds process seeing a strange toy differently from seeing a favorite toy, in the same way a normal child does. But activity in their brains—measured through a network of electrodes placed on the scalp—is similar whether the face is familiar or strange. This, Webb says, led to two hypotheses: either the brain area for face processing is not set up correctly in autistic children, or the way these children incorporate experiences from their environment is so different that the brain area develops improperly.“We think the latter is a more likely explanation at this point,” says Webb. “By the time they are adolescents or adults, they are showing the [proper] response for familiar faces.” Indeed, a functional MRI (fMRI) study by UW neuroimaging researcher Elizabeth Aylward showed that the brains of high-functioning adolescents and adults did activate the face-recognition center, the fusiform gyrus, when shown a very familiar face. However, the same subjects did not activate the center when viewing strange faces. This points to the possibility that greater experience seeing the familiar face can eventually influence the appropriate brain areas.“You need the biological wiring set up properly, but you also need experience for it to function normally,” says Aylward. “We're guessing what is missing is the experience.” To test that idea, one of her graduate students will “train” half of the autistic patients in face recognition—something most children pick up on their own—by having them study, manipulate, and match faces using computer games. Then fMRI scans will be done again to see if the fusiform gyrus might now be activated when viewing strange faces, as it is in control subjects. Intense training of a similar type for reading has already been shown to effect change in brain activation in as little as three weeks for children with dyslexia.In their model, it is as if “all the parts are there, ready to go, but somehow they haven't gotten the ignition turned on,” says Aylward. At the 2004 annual meeting of the American Association for the Advancement of Science , the UW center director Geraldine Dawson explained that this tackling of specific deficits will help researchers attach them to particular “mind modules” in the brain and will ultimately lead to the genes that control the development or function of those modules. That modular view, however, is not shared by many of her colleagues elsewhere, who argue that autistic behaviors are the result of a system-wide perturbation of early brain development and connectivity.For example, Müller points to structural studies that seem to uphold his theory of overall disorganization of the brain's cortex. Work by Manuel Casanova and colleagues at the University of Louisville shows that the “minicolumns” of neurons that make up the cortex are narrower and more numerous in autistic brains. Normally, these organized bundles appear very early in the developing fetal brain. In postmortem studies of autistic brains, Casanova found that the minicolumns had the same number of neurons, but smaller margins between the bundles. The margins, Casanova says, may act like “a shower curtain of inhibition that prevents information from flooding adjacent minicolumns.”Reducing those margins, he hypothesizes, could mean that an autistic brain has too much positive feedback, acting like a noisy amplifier. “For an autistic individual who is trying to piece together too much information from a face, maybe it's like looking at the sun,” he says.More general studies of adult autistic neuroanatomy have given conflicting results—most likely from diversity in the study populations—that make functional inferences difficult, if not impossible. But recent studies that focus on developing autistic brains earlier in life have revealed intriguing differences from normally developing children.Several studies have shown that from ages two to four, autistic children have larger overall brain volumes (and correspondingly larger head circumferences) than normal children, but that the difference had disappeared by about age six or seven. Since autism is usually diagnosed around age two or three, when the brain is already abnormally large, Eric Courchesne and colleagues at University of California, San Diego hypothesized that brain overgrowth must occur earlier, before signs of autism appear.In an elegant retrospective study, the team analyzed head circumference and brain volume measurements of autistic children that started at birth and continued until 14 months of age. The study revealed that at birth, autistic children's head size is much smaller than healthy children, in the 25th percentile, but by 6–14 months, their head size had increased to the 84th percentile, an excessive growth rate. The increase correlated with increased brain volumes of both gray and white matter regions measured by structural imaging between ages two to five.The Courchesne study strongly suggests that with autism, significant unregulated brain growth occurs in the first year of life. The team also found an association between greater increases in brain size in infancy and a later age for first word, worse repetitive behavior, and a trend toward more severe autistic symptoms later, at diagnosis. The rapid growth of autistic brains may produce too many connections too quickly, without the opportunity to be shaped by the experience and input that a typically developing child accumulates over many years. At age six or later, when the growth slows, the already derailed connections may no longer be able to incorporate experiences. “By that time,” write Courchesne et al., “the period of plasticity that allows the exquisite and graceful complexity of the human brain to emerge will have passed.”This idea that autistic brains are developing at warp speed, to their detriment, fits intriguingly well with what is known about treatment of autism—the earlier and more intense behavioral therapy an autistic child receives, the better the outcome will be. That's why the toddlers at UCLA get one-on-one training by therapists, who fire rapid questions and physically repeat tasks until they sink in.Stephanny Freeman, co-director of the Early Childhood Partial Hospitalization program at UCLA , says these methods would be alien to, and lost on, typically developing two-year-olds, who would be bewildered by such a highly structured environment. Her colleague and co-director, Tanya Paparella, chimes in, “It as if we are opening a window or door to the autistic brain.” Keeping that door open as long as possible in very young autistic patients seems to give them a better prognosis than older children, who are more difficult to treat.But while most agree that early and intense therapy is good for autistic children, until recently, little research on intervention methods existed. Connie Kasari, an educational psychologist at UCLA, along with Freeman and Paparella, has run one of the first randomized, controlled trials on therapies designed to teach autistic kids social skills. The group tested two skills in particular—sharing attention with others and pretend playing . The teaThe team's results show that autistic children can learn these skills from intense training. At least anecdotally, some of these children have gone on to function in normal school classrooms, even making a few friends, although they are still a bit socially awkward. Whether or not improvements in those skills will correlate with language improvements will require further testing. But Kasari notes that this work is not universally accepted in the autism therapy community, and that many more controlled studies will have to be published before a system-wide change in autism preschool education can occur.In the last decade, National Institutes of Health funding for autism research has increased from $10 million to $80 million, and much of that has been funneled into large, multidisciplinary research projects. Advocacy groups such as Cure Autism Now and the National Alliance for Autism Research greatly influence which autism research projects get funded, both through their own grant programs and also by lobbying Congress for increased federal grants. Some question whether it is wise to let emotions and the desire to find a cure drive research agendas. In the past, tensions between government programs and advocacy programs have run high.Casanova, for one, criticizes the disproportionate flow of money to what he calls imaging and genetic “fishing expeditions” and says more should go to neuropathology studies. He points out that only about 40 postmortem, mostly adult, autistic brains have been studied so far, a tiny fraction compared to those studied in other neuropathological disorders like Alzheimer's disease or schizophrenia.But Daniel Geschwind, a neurogeneticist at UCLA, defends this approach, saying that a well-planned fishing expedition that uses the right technology and looks in the appropriate places can result in a “freezer full of fish.” He also says that parent organizations keep the field honest by “constantly reminding us to keep an eye on the ball and don't get distracted.” Geschwind, Amaral, and other top experts have recently been recruited by advocacy groups or by friends with autistic children to shift some of their research questions to examining autism.As more researchers in genetics and neuroscience have become involved, Amaral says, the tensions between the parent groups and the National Institutes of Health have eased. “The parents communicated to the scientists the tremendous need for research and the scientists convey back to them which [research projects] make sense to fund,” he says. He adds that advocacy groups have been indispensable to research, setting up large genetic and brain tissue banks and enlisting families to participate in those efforts.So, researchers say, the goals of the National Institutes of Health programs and the advocacy programs have started to come together to focus on well-executed studies that might lead to better diagnostics and earlier, proven interventions. The work of Courchesne et al. suggests that children at risk for autism might easily be diagnosed by head circumference measurements as early as the first few months of life. Imaging studies combined with training programs, such as the work at UW on face recognition, may one day be able to verify that behavioral interventions are effective at activating target brain areas. As researchers work to untangle the causes and effects of brain dysfunctions in autism, Aylward notes, there is good reason to be hopeful: “Although this is a genetic disorder, we know there is plasticity in the young brain.”Evidence abounds that autism results from multiple gene mutations. Identical twins share an autism diagnosis 60%–95% of the time, and a younger sibling of an autistic child is 50 times more likely to have autism. There are also four times as many autistic males as females, indicating a possible sex chromosome difference in inheritance. Genetics researchers estimate that autism is the result of mutations in anywhere from 2 to 20 genes.By studying the commonly inherited pieces of chromosomes in autistic siblings, geneticists have identified a handful of chromosome hotspots. However, each region contains hundreds of individual genes, and narrowing down to specific mutations will require studies that either involve thousands of families or tackle specific phenotypes. Daniel Geschwind, a neurogeneticist at UCLA, has already completed such a study. It reveals a linkage—the probability that a region contains a gene or genes linked to the disorder—between language deficits and a hotspot region on Chromosome 7. His team looked at a more homogenous group of autistic patients, all of whom had a similar language delay measured quantitatively by time to first spoken word.“Endophenotypes measure something that underlies the disorder in a significant way and [therefore probably] also underlies a genetic component,” says Geschwind. “We're trying to identify characteristics that really underlie the genetic peaks of interest.” Another such study, by Margaret Pericak-Vance and colleagues at Duke University Medical Center , used the characteristic of “insistence on sameness”—a subset of stereotyped behaviors such as resisting change in routine or environment, and compulsions. By running a genetic analysis on a group of patients with the highest “insistence on sameness” scores from diagnostic tests, the Duke team increased the linkage score and further narrowed the hotspot region on Chromosome 15.

Patients' trust in physicians and in the medical profession is vital for a successful patient-physician relationship. Trust is especially salient in critical medical situations, such as serious side-effects, hospitalizations, and diagnoses of serious medical conditions, but most trust studies have been done with the general population or in routine primary care settings. This study examines the association between patient-physician encounters in such critical medical situations and patients' trust in their physician and in the medical profession in general.A random national telephone survey was conducted using validated multi-item questionnaire measuring trust and satisfaction with physicians and with the medical profession. A seven item questionnaire measured the patient-physician encounters in critical medical situations. A total of 1117 subjects aged 20 years and older with health insurance were included for analyses. Spearman rank order correlations were used to determine the association of encounter variables with trust in physicians and the medical profession.Prescription of medications by primary care physicians that patients believed might have side effects was negatively correlated with trust in physician in multivariate analysis. A primary care physician evaluating the patient for a condition the patient believed was serious was positively correlated with trust in physician . Being hospitalized was positively correlated with trust in the medical profession .Hospitalization, perceived seriousness of condition, and concerns about the risks of medications were found to be associated with patient trust in physicians or the medical profession. These findings highlight the salience of trust in serious physician-patient encounters and the role that patient vulnerability plays in determining patient trust. Patients' trust in their physicians is vital for a successful treatment relationship ,2, whichThe national sample was selected by random digit dialing, with the sampling frame generated by a random sample from a proprietary database of working residential telephone exchanges in the continental United States. The sampling frame was provided by Survey Sampling, Inc. of Westport, Connecticut. Survey Sampling, Inc. maintains a database of working residential telephone exchanges in the continental United States. In selecting the numbers to be called in this study, an exchange was randomly selected and then a random number between 0000 and 9999 was generated to complete the number. This process was repeated until a sufficient quantity of numbers had been generated. Between April-June 1999, a total of 4028 numbers dialed (minimum 15 attempts each) yielded 2637 (65 %) responses. Households were excluded with no one over the age of 20 (n = 66) or where the adult respondent with the next birthday did not have health insurance (n = 151) or had not seen a health professional at least twice during the past two years (n = 248). Respondent selection within eligible households was done using the next birthday method. Contacts with the 2172 potentially eligible individuals resulted in the following dispositions: 1117 (51.4%) were interviewed; 571 (26.3%) refused; 484 (22.2%) were unable to participate .All subjects were asked a core set of questions about their regular health care provider, demographic characteristics, satisfaction with care, physical and mental health, and preferences regarding seeking care and making medical decisions. Satisfaction was measured in two ways: a single item on patients' satisfaction with their physicians and a 12-item scale on patients' satisfaction with the healthcare that they have been receiving from all sources during the past few years. Two validated trust scales were used , each usA questionnaire naming seven medical situations with dichotomous responses (Yes/No) was developed to identify encounters with physicians separately for the patient's primary physicians and for other physicians if their services were utilized. The items in the questionnaire were created after expert review by a panel of physicians, behavioral scientists, and health lawyers and piloted in patient focus groups.These iteDependent variables for the study were physician trust and medical profession trust. Independent variables included patient-physician encounter variables and other significant variables mentioned in the previous section identified from a previous study. These hyTable Table Table These findings suggest that the patient-physician encounters in critical medical situations are associated with patients' trust in physicians. Of seven conditions that indicate more serious experiences, four were found to have a significant relationship with either trust in one's primary physician or trust in the medical profession. The three conditions not found to be significantly related to trust include the two that were less threatening than the others – minor surgery, and referral to a specialist. The significance of critical medical situations might arise either from the salience of trust in these situations, or from the vulnerability that is created by more serious medical conditions or procedures.It is important to note that the relationship with trust was positive for two intensity indicators, but negative for a third. The positive relationship lends support to the theory that trust arises from vulnerability and therefore is potentially higher when there is a greater need to trust. However,Another interesting pattern that emerged in this initial, exploratory analysis is the type of trust that related to different encounter variables. Most variables were related to trust in the subject's primary physician, but overnight hospitalization was also related to increased trust in the medical profession, and when other predictors of trust were controlled for, significance remained only for trust in the medical profession. This is consistent with the fact that hospital treatment is more of a team effort that reflects on the performance of the medical system. Other encounter variables that were significant for both types of trust in the bivariate analysis remained significant only for physician trust after adjusting for other predictors of trust. This is consistent with the theory that the primary object of trust in most treatment settings is the treating physician.Due to the limitations of this study, these findings and interpretations should be regarded as preliminary. This was an exploratory cross-sectional study whose particular inclusion criteria resulted in a sample that does not exactly correspond to the socio-economic distribution of the general United States population. The cross-sectional design leaves open the possibility that current levels of trust could affect recall of past events. The study asked about the impact of previous encounters on current physician trust, but it should be noted that the current physician may not be the one involved in previous encounters. Another limitation is that it was not possible to know the degree of vulnerability associated with each type of experience. Also, most measures were based on subjects' unverified reports.Summarizing the results, this study found significant associations between patient-physician encounters in medical situations and trust in primary physicians and in the medical profession. These associations reflect the role that vulnerability plays in the psychology of trust. Future research should focus on identifying in further detail which forms of encounters affect which types of trust, and in what directions. Also, more research is needed to understand why these encounters affect trust and what factors modify these relationships. Such research could help to identify threats to trust and further maintain trust and trustworthy conditions. This is especially important in the current era in which many people fear that trust in medical care is rapidly eroding.None declared.RB and RAS conceived the paper. RB and MAH were responsible for data collection. RB and RAS conducted the data analyses. RAS was primarily responsible for writing the paper. The manuscript was reviewed and critically revised by RB and MAH.The pre-publication history for this paper can be accessed here:

Microarray technology allows researchers to simultaneously monitor changes in the expression ratios (ERs) of hundreds of genes and has thereby revolutionized most of biology. Although this technique has the potential of elucidating early stages in an organism's phenotypic response to complex ecological interactions, to date, it has not been fully incorporated into ecological research. This is partially due to a lack of simple procedures of handling and analyzing the expression ratio (ER) data produced from microarrays.Nicotiana attenuata, using procedures that are commonly used in ecologic research. Each gene is represented by two independently labeled PCR products and each product was arrayed in quadruplicate. We present a robust method of normalizing and analyzing ERs based on arbitrary thresholds and statistical criteria, and characterize a "norm of reaction" of ERs for 6 genes with different ERs as determined across all analyzed arrays to provide a biologically-informed alternative to the use of arbitrary expression ratios in determining significance of expression. These gene-specific ERs and their variance (gene CV) were used to calculate array-based variances (array CV), which, in turn, were used to study the effects of array age, probe cDNA quantity and quality, and quality of spotted PCR products as estimates of technical variation. Cluster analysis and a Principal Component Analysis (PCA) were used to reveal associations among the transcriptional "imprints" of arrays hybridized with cDNA probes derived from mRNA from N. attenuata plants variously elicited and attacked by different herbivore species and from three congeners: N. quadrivalis, N. longiflora and N. clevelandii. Additionally, the PCA revealed the contribution of individual gene ERs to the associations among arrays.We describe an analysis of the sources of variation in ERs from 73 hybridized cDNA microarrays, each with 234 herbivory-elicited genes from the model ecological expression system, While the costs of 'boutique' array fabrication are rapidly declining, familiar methods for the analysis of the data they create are still missing. The case history illustrated here demonstrates the ease with which this powerful technology can be adapted to ecological research. The 'genomics revolution' has provided the information needed to analyze how a genome responds to the environment in the formation of the "transcriptome", the portion of the genome that is transcribed. Microarrays, which offer the ability to analyze the expression ratios (ERs) of thousands of genes simultaneously, represent one of many new tools produced by this effort. However, not all biological disciplines have benefited equally from this technology, and array technology has not been widely adopted by the ecological community for a number of reasons. The large genome-wide arrays are only available for select model organisms, which may not be appropriate for many ecological questions. Moreover, the complexity of their analysis and the costs of the available commercial software solutions prohibit their adoption by small research groups and constrain the number of biological experiments that can be conducted even by large, better-funded groups. 'Boutique' arrays – on which a smaller fraction of the transcriptome, typically representing a selection (hundreds) of genes specific to a class of genetic elements or response types – are readily created for a non-model organism at costs that are affordable for small research groups. However, the problems remain of how best to normalize and analyze array data. A large number of software solutions are available but no clear best solution has emerged -5.A recent review has examined the types of arrays as well as the ecological and evolutionary questions that can be addressed with microarrays . Here weNicotiana attenuata ; 2) both ER1 and ER2 were significantly different from 1 as evaluated by t-tests to control for ER-variance and ER-sample size. An arbitrary threshold was utilized for two reasons: first, to account for normalization errors, and second, to account for the fact that replicate data did not result from repeated hybridizations with the same RNAs but from repeated probe spotting.Because the arrays included both up- and down-regulated genes, the calculation of a microarray-specific normalization factor provided a valuable alternative to the use of external reference controls, which may or may not be influenced by the elicitation conditions ,20-22. TTo evaluate our criteria, we hybridized three arrays with the same cDNA pools and found that 210 of 234 genes (84%) had the same regulation identified by the criteria described above. Of the 30 genes that did not show consistent regulation between the two repeated hybridizations, 24 had the same direction in mean ER but did not meet the statistical requirements for a significant change. These 3 replicate arrays were located together in both the cluster analysis , the error structure on a non-log scale is presented (Fig. A cluster analysis of 35 arrays was performed based on Ward's method and the squared euclidian distance ,24. To eTo test for differences between the groups of different PCR qualities, Kruskal-Wallis ANOVA on Ranks was used. Test statistics and cluster analyses were performed with SPSS 11.0, PCA was carried out with the Canoco 4.5 package .MH carried out the analysis of the microarray data, KG supervised the molecular work. ITB conceived of and coordinated the project, and ITB and MH wrote the manuscript.

Injury to the peritoneum during surgery is followed by a healing process that frequently results in the attachment of adjacent organs by a fibrous mass, referred commonly as adhesions. Because injuries to the peritoneum during surgery are inevitable, it is imperative that we understand the mechanisms of adhesion formation to prevent its occurrence. This requires thorough understanding of the molecular sequence that results in the attachment of injured peritoneum and the development of fibrous tissue. Recent data show that fibroblasts from the injured peritoneum may play a critical role in the formation of adhesion tissues. Therefore, identifying changes in gene expression pattern in the peritoneal fibroblasts during the process may provide clues to the mechanisms by which adhesion develop.In this study, we compared expression patterns of larger number of genes in the fibroblasts isolated from adhesion and normal human peritoneum using gene filters. Contributions of TGF-beta1 and hypoxia in the altered expression of specific genes were also examined using a semiquantitative RT-PCR technique.Results show that several genes are differentially expressed between fibroblasts of normal and adhesion peritoneum and that the peritoneal fibroblast may acquire a different phenotype during adhesion formation. Genes that are differentially expressed between normal and adhesion fibroblasts encode molecules involved in cell adhesion, proliferation, differentiation, migration and factors regulating cytokines, transcription, translation and protein/vesicle trafficking.Our data substantiate that adhesion formation is a multigenic phenomenon and not all changes in gene expression pattern between normal and adhesion fibroblasts are the function of TGF-beta1 and hypoxia that are known to influence adhesion formation. Analysis of the gene expression data in the perspective of known functions of genes connote to additional targets that may be manipulated to inhibit adhesion development. Peritoneal adhesions resulting from surgical injury are often associated with pelvic pain, bowel obstruction and infertility . EpidemiParietal and visceral peritoneum that surfaces the intraperitoneal organs is covered by a layer of squamous epithelial cells, the mesothelium. The submesothelial layer consists of fibroblasts, macrophages and blood vessels. Surgical abrasion to the peritoneum releases mesothelial cells, macrophages, fibroblasts, and blood containing cytokines and several cell types at the site of injury. Coagulation of blood creates a fibrinous mass between injured surfaces. In some patients fibrinolysis of clot followed by proliferation of mesothelial cells covers the wound. In others, failure of fibrinolysis followed by proliferation and migration of fibroblasts into the proteinous mass generates fibrous tissues of adhesion. Consequently, the process of adhesion formation include inflammatory response, fibrin deposition, cell-proliferation, -differentiation, -migration, -death, angiogenesis, extra cellular matrix (ECM) turnover regulated by cytokines, hypoxia, genetic and epigenetic factors .Recent studies illustrate roles of peritoneal fibroblasts in adhesion development -10. It iTissues were collected at the initiation of surgery and after the entry into the abdominal cavity of female patients (25–50 years) undergoing laparatomy for pelvic pain as described earlier . All pat2) for 3 days in DMEM (Life Tech.) supplemented with 10% fetal bovine serum (Life Tech.) and antibiotics . The monolayer of cells were passaged in trypsin-EDTA solution (Life Tech.). Cells at 3–5 passages were cultured in serum free medium in 75 cm2 flasks to 75% confluency prior to studies.The primary cultures were maintained in a humidified incubator . Radiolabeled cDNA was separated from the free nucleotides using Bio-Spin 6 chromatography column (Bio-Rad Laboratories). Gene filters were labeled as adhesion or normal fibroblasts and washed with 0.5% sodium dodecyl sulfate (SDS) prior to prehybridization. Individual membrane was transferred to separate roller tubes of the hybridization oven , each containing MicroHyb hybridization solution (Research Genetics) supplemented with Human Cot-1 DNA (Life Technology) and Poly dA (Research Genetics). The membranes were rotated at 10 RPM and at 42°C for 2 h. Radio-labeled cDNA prepared from adhesion and normal fibroblasts total RNA was denatured by heating in a boiling water bath for 3 min. The denatured probes were then injected into the prehybridization solution containing respective membrane. The membranes were hybridized with respective probe for 18 h at 42°C. The hybridization solution was then replaced with washing solution (2 × SSC containing 1% SDS). The temperature of the oven was raised to 50°C and RPM of rotors was increased to 15. Membranes were washed for 20 minutes when washing solution was replaced with a batch of fresh and prewarmed (50°C) washing solution. Washing was continued for additional 20 min. A third wash was performed with 0.5 × SSC solution containing 1% SDS at 55°C for 15 minutes. Membranes with cDNA spots facing up were covered with Saran wrap and exposed to phosphor screen (Kodak) for overnight. The screen was scanned with a Phosphor Imager . After acquisition of signal intensities from the normal and adhesion fibroblasts of one patient, filters were stripped according to protocol and subjected to gene filter experiments with the RNA samples from a second patient and images were scanned. Tiff images obtained from normal and adhesion fibroblasts of two patients were analyzed using Pathway 4 software (Research Genetics) for the identification of differentially expressed genes between the normal and adhesion fibroblasts of each patient.Total RNA was isolated from monolayer of fibroblasts at 12 h of culture in serum free medium using Trizol reagent (Invitrogen Inc.). Human Gene Filters containing 4325 known human cDNA spots were used for the identification of differentially expressed genes between adhesion and normal fibroblasts from human peritoneum. Method suggested by the manufacturer was strictly followed. In brief, 10 μg of total RNA from monolayer cultures of fibroblasts were subjected to cDNA synthesis in presence of 10 μl 2, 0.2 mM dNTP, 0.5 U Taq Polymerase and 1 μM each of sense and antisense primers. Primer sequences were determined using Primer3 software from the Internet . The control primers (sense 5'-ggaggttcgaagacgatcag-3' and antisense 5'-cgctgagccagtcagtgtag-3') were expected to provide an amplicon of 509 bp from human 18S ribosomal subunit cDNA (gi: 337376). Accession numbers of genes of interests are provided in Table Steady-state levels of mRNA of selected genes that are known to have a role in cellular adhesion, proliferation, migration, apoptosis and demonstrating different expression levels between adhesion and normal fibroblasts in the gene filter experiments were verified further by a previously described semiquantitative RT-PCR method . Total R. Band intensities were plotted to determine the linearity of PCR reactions for the amplification of target transcripts. Target cDNA were amplified by PCR from normal and peritoneal fibroblasts at specific PCR cycle within its linear range of amplification. Total RNA samples from normal and adhesion fibroblasts of 4 patients were used for the RT-PCR experiments. Optical densities obtained from amplicons of 4 patients were used to derive mean ± standard error of mean values representing relative levels of each mRNA species in normal and adhesion fibroblasts.Initially cDNA of interests were amplified from normal peritoneal fibroblasts at different (25 to 35) PCR cycles. PCR products were subjected to agarose gel electrophoresis. Molecular weight marker were also loaded in adjacent lanes. DNA in the gel were stained with 1:10,000 dilution of SYBR Green I dye and photographed using a DC 120 Kodak digital camera for the verification of size and analysis of band intensity using Image J software 1 or hypoxia (2% Oxygen) for 24 h. Control plates were cultured for the same duration in absence of TGF-β1 or hypoxia. Total RNA was isolated from the control, TGF-β1 and hypoxia treated cells and subjected to RT-PCR reactions as described above to determine relative levels of 18S ribosomal subunit and gene specific transcripts in the control and treated cells. RT-PCR experiments were conducted twice with the normal peritoneal fibroblasts isolated from 3 patients to have six control, six TGF-β1 treated and six hypoxia exposed amplicons. This included normal fibroblasts from one new patient and two patients that were used exclusively for RT-PCR experiments for the confirmation of gene array data. Optical densities of amplicons from six control or treated cells per mRNA species were used to derive the mean ± standard error of mean values for comparison.Effects of TGF-β1 or hypoxic conditions on the steady state levels of specific gene transcripts in the normal peritoneal fibroblasts were also studied to examine the possibility of adhesion causing factors potentiating the gene expression pattern in the normal fibroblasts similar to adhesion fibroblasts. Normal peritoneal fibroblasts were cultured in six well culture plates (FALCON). When confluent, monolayer of cells in culture were exposed to 1 ng/ml TGF-βBand intensity value of each RT-PCR experiment was used to derive Mean ± Standard error of Mean using Statview 4.5 software . Differences between Means were tested for significance by one-way analysis of variance with the specific post hoc test using the same software to compare differences in the steady state levels of different mRNA species.Hybridization intensities of radio labeled cDNA from normal or adhesion fibroblasts from both the patients were different when analyzed using Pathway software. Comparison of hybridization intensities from individual gene spots between normal and adhesion fibroblast RNA Figure demonstrGene filter data from two patients showed similar expression pattern of collagen type 1 alpha 2), Collagen type III , fibronectin 1, Matrix metalloproteinase-1 (MMP-1), Transforming Growth Factor beta-1 (TGF-β1), TGF-β2 and tissue plasminogen activator as reported earlier using multiplex PCR technique interacts with laminin1 P1, collagen I, collagen IV, perlecan and fibulin-2 in the extracellular space and stabilizes the basement membrane. It also interacts with α6β1 and α3β1 integrin receptors on cells . RelativTM4SF molecules (tetraspanins) play important roles in cell migration and in the generation of complexes with integrins functionally relevant for cell motility, tumor progression and wound healing . It is pVersicans (CSPG2) are also known to influence α4β1 and α2β1 integrin mediated invasion of melanoma cells . Higher Because MT-1e transcripts are detected in cell types that have undergone myoepithelial differentiation , signifiContrary to increase in the above mentioned mRNA species in the adhesion fibroblasts, steady state levels of IGFBP3 precursor transcript were found to be lower. Because IGFBP-3 is known to inhibit cell growth by sequestering IGF, its decreased level may enhance proliferation of adhesion fibroblasts . ReducedOur attempts to examine the regulatory roles of TGF-β1 and hypoxia, factors known to promote adhesion development , on the 2 (PGE2) is shown to inhibit TGF-β1 induced expression of α-SMA, production of Collagen I and the transformation of fibroblasts to myofibroblasts via EP2 signaling [P311 (PTZ17) and Interferon γ treatments, which inhibits TGF-β1 induced myofibroblast transformation [It is known that a new phenotype of fibroblasts is induced during wound healing. These fibroblasts, termed- myofibroblasts, express higher levels of α-smooth muscle actin and vinculin-containing fibronexus adhesion complexes . Fibroblignaling . Additioormation ,47.During the course of normal wound healing, myofibroblasts disappear, possibly by apoptosis . In cont2, EP2 blockers, interferon γ, P311 and applying measures to induce apoptosis in the peritoneal fibroblast at the site of injury. The obvious question – "how to maintain apoptosis at a desired level for normal peritoneal healing?" however, remains to be answered.It is evident from our study that steady state levels of several genes are different between adhesion and normal peritoneal fibroblasts in human and that adhesion development may be a function of several genes. Changes in the functional interdependence of these genes at the site of injury may transform normal peritoneal fibroblast into cell type/s with altered phenotype. These cells- designated as adhesion fibroblasts may mimic previously known myofibroblasts and are highly proliferative. These cells resist apoptosis and secrete ECM molecules to renovate basement membrane. With changed expression pattern of cell surface molecules these cells may respond to intracellular signaling for migration over the fibrin clot. This altered nature of adhesion fibroblasts therefore may play a major role in the formation of the fibrous mass of adhesion-tissue that bridges adjacent and injured peritoneum. Blocking changes in the expression or function of genes necessary for this transformation of normal peritoneal fibroblasts may curtail adhesion formation. This could be achieved by the application of PGECollagen type IV chain (COL4A2), Nidogen 2 (NID2), Chondroitin sulfate proteoglycan 2 (CSPG2), S100 Calcium binding protein A10 (S100A10), Transmembrane 4 superfamily member 1 (TM4SF1), Metallothioneine (hMT-Ie), Insulin-like growth factor binding protein 3 precursor (IGFBP3), Transforming growth factor (TGF), Prostaglandin E2 (PGE2), Urokinase Plasminogen activator receptor (uPAR), Annexin 2 and S100A10 complex (AIIt), tissue Plasminogen Activator (tPA), Plasminogen Activator Inhibitor (PAI), Cyclooxigenase (COX), Matrix metalloproteinase (MMP), Tissue Inhibitor of Metalloproteinase (TIMP), Interferon γ (IFN-γ), IL (Interleukin).GMS and MPD were responsible for the isolation of peritoneal fibroblasts from normal peritoneum and adhesion tissues as well as establishing hypoxia chambers. MPD provided patient information and valuable suggestions during writing the manuscript. UKR performed microarray and semiquantitative RT-PCR experiments, analyzed the data and wrote the manuscript.

Histone acetyltransferases can be classified into two distinct groups (type A and B) on the basis of cellular localization and substrate specificity. Type B histone acetyltransferases, originally defined as cytoplasmic enzymes that acetylate free histones, have been proposed to play a role in the assembly of chromatin through the acetylation of newly synthesized histones H3 and H4. To date, the only type B histone acetyltransferase activities identified are specific for histone H4.The acetylation of the core histone NHTo better understand the role of histone acetylation in the assembly of chromatin structure, we have identified additional type B histone acetyltransferase activities specific for histone H3. One such activity, termed HatB3.1, acetylated histone H3 with a strong preference for free histones relative to chromatin substrates. Deletion of the GCN5 and ADA3 genes resulted in the loss of HatB3.1 activity while deletion of ADA2 had no effect. In addition, Gcn5p and Ada3p co-fractionated with partially purified HatB3.1 activity while Ada2p did not.Yeast extracts contain several histone acetyltransferase activities that show a strong preference for free histone H3. One such activity, termed HatB3.1, appears to be a novel Gcn5p-containing complex which does not depend on the presence of Ada2p. Histones H3 and H4 are among the most evolutionarily conserved proteins (>90% identity from yeast→humans) . Octamer2-terminal tails of the histones. These domains, which protrude from the core of the nucleosome, are free to interact with, and be acted upon by, the nuclear environment. The past several years has seen the identification of numerous enzymes that are capable of modifying the histones. These enzymes are generally found in large, multi-subunit complexes and have activities that are not only specific for a given histone but are specific for particular amino acid residues within the histone ). Supernatant from a 1500 × g, 15' spin at 4°C was retained as a cytosolic extract. Pelleted material was washed once with Buffer A then resuspended in DN(1000) . Supernatant from another 1500 × g spin as above yielded the nuclear extract. This extract was dialyzed O/N at 4°C into DN(0) to a conductivity similar to that of the cytosolic extract. Extracts were cleared by high speed centrifugation prior to their chromatographic fractionation.Cells were grown to mid-log phase in 1% yeast extract, 2% peptone, 2% glucose and 50 μg/mL ampicillin at 30°C. Cells were harvested at 4000 × g, 10', 4°C and total grams of cells recorded. All buffers contain 1.0 mM PMSF. Spheroplasts were prepared essentially as described previously using 0.25 mg of Zymolyase per gram of cells for spheroplasting . Spheroppurifier – Pharmacia) was employed for all column runs.All columns were equilibrated with and run using DN Buffers. HPLC (ÄKTA DEAE – Cleared extracts were loaded onto a HiPrep 16/10 DEAE FF column (Pharmacia). Following a 5 C.V. wash with DN(50), proteins were eluted with a linear, 20 C.V., salt gradient from 50 mM to 1.0 M NaCl. A flow rate of 1.0 mL/min. was used and 3.0 mL fractions were collected.CM – Either pooled peak fractions, dialyzed into DN(0) until at similar conductivity as DN(50) start buffer, or Flowthrough from the DEAE were loaded onto a HiPrep 16/10 CM FF column (Pharmacia). The column was washed and proteins eluted as described above.Mono Q – The flowthrough fraction from the CM column was loaded onto a Mono Q HR 5/5 column (Pharmacia). Following a 5 C.V. wash with DN(50), a 20 C.V., linear, salt gradient was employed as above and 0.5 mL fractions were collected.4)2SO4 (0.516 g/mL) over 30' at 4°C. Following an additional 30' equilibration period at 4°C, precipitated protein was pelleted and resuspended in 300 μL cold, DN(0).Peak fractions of HatB3.1 activity from the Mono Q column were pooled and brought to 75% . The column was equilibrated with and run in DN(350) at a flow rate of 0.3 mL/min. and 0.25 mL fractions were collected. Molecular weight standards were run using the same parameters and 24 μL aliquots of every other fraction run on a 10% SDS-polyacrylamide gel. The elution profile of the MW standards was determined by protein visualization via Coomassie blue staining.3H-Acetyl Coenzyme A and ~1.0 mg/mL core histones or chromatin in a final volume of 100 μL at 1X [DN(75)]. 50 μL of each reaction was analyzed for HAT activity via liquid scintillation counting. The remaining assay mixture was brought to 1X [SDS Load Dye] to stop the reaction. In general, aliquots (24 μL) of these remaining assay mixtures were run on 18% SDS-polyacrylamide gels to resolve the histones. Gels were incubated in Autofluor , dried down and acetylated histone species visualized via fluorography.Chicken erythrocyte core histones and chromatin were isolated as previously described ,76. TypiSuperose 6 fractions exhibiting HAT B3 activity, as determined above, were run on 10% SDS-polyacrylamide gels and proteins were either visualized by silver staining or transferred to nitrocellulose using a semi-dry transfer apparatus (Biorad). Blots were processed following standard procedures. Goat, polyclonal antibodies against Gcn5p, Ada2p and Ada3p were used at 1:100 dilutions in 5% Milk/TBS-T. Donkey, HRP-labeled Anti-Goat IgG secondary antibody was used at 1:2500 dilution followed by detection with ECL+Plus (Pharmacia) and visualization via phosphoimager .A.R.S. performed all of the experiments presented here and drafted the manuscript. M.R.P. directed the project and edited the manuscript.

The rapid progress in the field of genomics is increasing our knowledge of multi-gene diseases. However, any realistic hope of gene therapy treatment for those diseases needs first to address the problem of co-ordinately co-expressing several transgenes. Currently, the use of internal ribosomal entry sites (IRESs) is the strategy chosen by many researchers to ensure co-expression. The large sizes of the IRESs (~0.5 kb), and the difficulties of ensuring a well-balanced co-expression, have prompted several researchers to imitate a co-expression strategy used by many viruses: to express several proteins as a polyprotein. A small peptide of 18 amino acids (2A) from the foot-and-mouth disease virus (FMDV) is being used to avoid the need of proteinases to process the polyprotein. FMDV 2A is introduced as a linker between two proteins to allow autonomous intra-ribosomal self-processing of polyproteins. Recent reports have shown that this sequence is compatible with different sub-cellular targeting signals and can be used to co-express up to four proteins from a single retroviral vector. This short peptide provides a tool to allow the co-expression of multiple proteins from a single vector, a useful technology for those working with heteromultimeric proteins, biochemical pathways or combined/synergistic phenomena. For the last 20 years, the gene therapy field has centred many of its efforts on finding ways to deliver a therapeutic gene to certain target cells in order to produce a therapeutic result. It was soon clear that it was necessary to deliver at least two genes, because a reporter/marker gene was needed in order to track the expression of the therapeutic gene . There has been a large increase in vector development during these years, with the appearance of many new viral and non-viral vectors. However, since the late 1980s, few improvements have been made 'inside' those vectors. The linkage of the two genes of interest (therapeutic and reporter) has remained the same. The different strategies known for co-expression were reported during the 1980s -splicing, multiple promoters, fusions, reinitiation and IRESs-, at the same time that the first gene therapy experiments were being performed . Not surprisingly, this strategy is indeed used by cells, although not very often, in particular for the co-ordinated secretion of different proteins and peptides. Recently, several groups have been trying to utilize this co-expression strategy. One of the possibilities is to introduce the target site for a cellular proteinase between two cistrons cloned in frame forming a single open reading frame . In thicis-acting hydrolase element). From a biotechnological standpoint, all that is needed is to clone the coding sequence of 2A, followed by the codon for the first amino acid of the next FMDV protein (2B), in frame between the two genes one wishes to co-express. The synthesis of the peptide bond between the last amino acid (Gly) of 2A and the first (Pro) of 2B is skipped, producing an upstream protein with a C-terminal tail of 18aa (2A) and a downstream protein with a Pro at the N-terminus. The extra sequences have minimal effect on the activity of most proteins and none on their stability. In fact, the 2A peptide has been used as an efficient tag for immunoprecipitation and Western blotting, although commercial antibodies are not yet available. Interestingly, additional CHYSEL sequences have been found in viruses other than FMDV underwent a rapid co-translational self-processing. It was soon realised that the key was a small 18aa peptide (2A) that directed its own separation from the growing polyprotein. During the last decade, this mechanism has been studied in detail, resulting in a simple model: the small 2A peptide, during its translation, interacts with the exit tunnel of the ribosome to induce the "skipping" of the last peptide bond at the C-terminus of 2A. The crucial point is that the ribosome is able to continue translating the downstream gene, after releasing the first protein fused in its C-terminus to 2A (reviewed in ). This tces, see ).Herpes simplex virus-1 thymidine kinase, HSV1TK; interleukin-12, IL-12; viral antigens, etc.) in transient transduced or stable cells lines and in animals. A full list of publications using 2A is available on the web [The initial publications using this strategy have shown that 2A skipping can be used in the typical viral vectors used for gene therapy (retrovirus and adeno-associated virus) to reliably co-express many reporter proteins and therapeutic proteins ,9. Not oam genes ,9.The CHYSEL strategy of co-expression is also compatible with the most disparate sub-cellular localisations -10. ProtThe results reported in reference should bΔP/ΔP × CD3ζ -/- mice were transplanted with bone marrow from wt C57BL/6 mice or CD3εΔP/ΔP × CD3ζ -/- mice transduced with a retrovirus encoding the four CD3 subunits, and in both cases TCR surface expression was detected and the T cells proliferated normally after immune stimulation. Bone marrow from CD3εΔP/ΔP × CD3ζ -/- mice without CD3 transduction did not restore T-cell development. T cells were also reconstituted in sub-lethally irradiated RAG-1-/- mice (lacking mature T and B lymphocytes) in which bone marrow from CD3εΔP/ΔP mice (lacking CDε and with a severe inhibition of CD3γ and CD3δ), transduced with a retrovirus encoding these three subunits (via two 2A sequences), was used for a transplant into the RAG-1-/- mice. The same experiment using three vectors encoding the CD3 subunits separately was unsuccessful.Lethally irradiated CD3εThe development of FMDV 2A as a cloning tool is an example of how dangerous pathogenic viruses can be harnessed by biotechnology for human benefit. Their molecular "tricks" (as IRES or CHYSEL sequences) are gradually becoming part of the biotechnologists' toolbox. The development of the polycistronic vectors here discussed is a big step forward, a decade and a half after the launching of the very first gene therapy trial with the aim of introducing in blood cells just a single therapeutic gene, adenosine deaminase (ADA), and the NEO marker . These rNone declared.

Functional decline threatens independent living and is common among individuals diagnosed with cancer, especially those who are elderly. The purpose of this study was to explore whether dietary and exercise practices are associated with physical function status among older cancer survivors.Mailed surveys were used to ascertain data on physical function, dietary fat, fruit and vegetable (F&V) consumption, and exercise among elderly diagnosed with early stage (I-II) breast (N = 286) or prostate cancer (N = 402) within the past 18 months.Sixty-one percent of respondents reported diets with <30% of energy from fat, 20.4% reported F&V intakes of 5+ daily servings, and 44.6% reported regular vigorous exercise. Significant, independent associations were found between physical functioning and reported dietary fat intake, F&V consumption, and exercise. A simultaneous multiple regression model controlled for age, race, gender, time since diagnosis and concurrent health behaviors yielded the following estimates: (1) 0.2 increase in the SF-36 physical function subscale (PFS) score with each reported 1% decrease in percent energy from fat (p < .0001); (2) 0.9 increase in the SF-36 PFS score for each reported serving of F&V/day (p = .0049); and (3) 15.4 increase in the SF-36 PFS score with a positive response for regular vigorous exercise (p < .0001).Results of this cross-sectional survey suggest that regular vigorous exercise and consumption of diets low in fat and rich in F&Vs are associated with higher levels of physical functioning among older cancer survivors. Interventions that promote healthful lifestyle change may deliver considerable benefit within this ever increasing and vulnerable population. There are 9.6 M cancer survivors in the US today, and 61% are age 65 or older . UnfortuWe explored associations between lifestyle factors and physical functioning among elderly cancer survivors who were screened for Project LEAD (Leading the Way in Exercise And Diet), a home-based, diet and exercise intervention trial . BrieflyT-tests and chi-square analyses were performed to determine if respondents differed from non-respondents on age, time since diagnosis, race and gender, and to test for differences between male and female respondents. Pearson correlation coefficients indicated associations between F&V intake and percent dietary fat, and physical function scores. T-tests were used to explore associations between exercise and function. Linear regression analyses permitted an examination of associations between physical function and health behaviors controlling for several likely confounders including gender, age, race, time since diagnosis and concurrent health behaviors. Given the homogeneity in stage at diagnosis, stage information was omitted from this analysis.Between August 2000 and May 2003, 2,431 cases were identified and physician approval for contact was granted for 2,034 cases. Incomplete address information existed for 24 of these cases, yielding 2,010 viable posted surveys, of which 688 complete surveys were returned (34% response rate). Characteristics of respondents and non-respondents are provided in Table Data regarding physical function and lifestyle behaviors are provided in Table Modest correlations were obtained between the indicators of exercise and diet, with positive agreement noted between F&V intake and exercise (Pearson ρ = .12/p = .003) as well as F&V intake and dietary fat (ρ = .42/p < .0001). An inverse association was noted between dietary fat and exercise (ρ = -.08/p = .05). In bivariate associations, all three behaviors were significantly associated with SF-36 physical functioning scores (p < .05): F&V intake (ρ = .09), dietary fat (ρ = -.10), and vigorous exercise (ρ = .37). In multivariable linear regression analyses, with the SF-36 PFS score serving as the dependent variable and controlling for age, race, gender, time since diagnosis, and concurrent health behaviors, the simultaneous associations of the three indicators remained statistically significant (independent) and yielded the following estimates: (1) a 0.2 increase in the SF-36 PFS score with each reported 1% decrease in percent energy from fat (p < .0001); (2) a 0.9 increase in the SF-36 PFS score for each reported serving of F&V/day (p = .0049); and (3) a 15.4 increase in the SF-36 PFS score with a positive response for regular vigorous exercise (p < .0001).In comparing these cross-sectional data on lifestyle behaviors of older cancer survivors to normative data reported on healthy elders, as well as to previous data reported on general populations of breast and prostate cancer survivors (where a dearth of data have been reported on older cancer survivors per se), we find both differences and similarities. Like data that exist on healthy elders (age 65+) responding to the 2000 Behavioral Risk Factor Surveillance System (BRFSS) survey , or findA potential explanation for the higher physical function scores exhibited within our sample may relate to the higher prevalence of healthful lifestyle practices which in turn may increase physical function. This links back to the primary thrust of this study, which was to determine evidence for a link between functional status and health behavior.Our results suggest that regular vigorous exercise and a diet rich in F&Vs and low in fat is associated with higher levels of physical functioning among elderly recently diagnosed with cancer. Although the association between exercise and improved function has been reported repeatedly in other studies among elders ,23, thisFurthermore, only one study to date has reported the link between diet composition and physical function. Ortega et al. found that diets low in fat and high in F&Vs were associated with higher levels of physical functioning among a sample of upper socio-economic, elderly male Spaniards at risk for cardiovascular disease . This prThe primary limitations of this study relate to respondent bias and cross-sectional design. Our response rate of 34% is indeed less than the 59% we have achieved in previous mailed surveys among similar populations . Given tFindings of this study support the recent American Cancer Society diet and exercise guidelines for survivors , which cF&V: Fruits and VegetablesSF-36: Short Form-36 Health SurveyPFS: Physical Function SubscaleThe author(s) declare that they have no competing interests.WDW, ECC, MCM, CFP and HJC conceived of the study, and participated in its design. DCS participation in the coordination of the study, as well as data cleaning and interpretation of findings. RS performed the statistical analysis. All authors read and approved the final manuscript.

Several previous epidemiological studies have shown a relation between drinking water quality and death in cardiovascular disease whereas others have not found such a relationship. An intervention study was undertaken to evaluate the effect of water with added magnesium and natural mineral water on blood pressure.A group of 70 subjects with borderline hypertension was recruited and consumed 1) a water low in minerals, 2) magnesium enriched water or 3) natural mineral water, in a random, double blind fashion during four weeks.Among persons with an initial low excretion of magnesium or calcium in the urine, the urinary excretion of magnesium was increased in the groups consuming the two waters containing magnesium after 4 weeks. A significant decrease in blood pressure was found in the group consuming mineral water at 2 and 4 weeks.The results suggest that minerals taken in water are significant for the body burden and that an intake of mineral water among persons with a low urinary excretion of magnesium or calcium may decrease the blood pressure. Further studies should investigate the extent of mineral deficiency in different populations and the efficiency of different vehicles for supplying minerals, particularly magnesium and calcium. A relation between mortality from ischaemic heart disease (IHD) and drinking water characteristics was first shown in Japan in 1957 and reviIn a case-control study, an inverse relation was found between the amount of magnesium in drinking water and death from acute myocardial infarction and for females also between the amount of calcium and death . Diets rRegarding individual minerals, several studies have been reported where hypertensive subjects were treated orally with nutritional doses of magnesium . The resEpidemiological studies on cardiovascular disease suggest that drinking water is an important vehicle for the supply of minerals . This isThe present intervention study was undertaken to determine the effect of minerals in water on one of the major risk factors for cardiovascular disease – blood pressure. Subjects with slightly elevated blood pressure consumed water with different levels of minerals. Serum and urinary levels of minerals were measured as a marker of intervention and blood pressure was measured before and after the intervention.Female and male subjects, aged 45 – 64 years (n = 70) were recruited by advertising in local newspapers. Inclusion criteria were living in an area with low magnesium content in the drinking water, systolic pressure 15 mm above normal values for their age, diastolic pressure above 90 mm Hg, and within 20% of ideal body weight. Exclusion criteria were hypertension target organ damage, chronic diseases , pregnancy, and taking oral contraceptives or regular intake of mineral supplements. Subjects with a diastolic pressure above 100 mm Hg were advised to consult a physician for treatment. A few persons decided not to seek a physician's advice and choose to participate anyway. The Ethical committee at the Medical faculty, University of Gothenburg, approved the study.Blood pressure was measured using standardized techniques before the intervention, at 2 weeks and at the end at 4 weeks. Two separate recordings were made (diastolic pressure as Korothoff phase 5) after 5 minutes of supine rest. The blood pressure is reported as the average of these recordings.idem). Magnesium and calcium levels in urine were expressed as the creatinine ratio.Blood samples were taken before and after the intervention to determine the serum concentration of magnesium, calcium, sodium, creatinine and potassium . Before and after the intervention period, 24 hours urine samples were collected and the amounts of magnesium, calcium, and creatinine were determined . Table Table In spite of the random allocation to the different waters, it was found that the group consuming water C comprised a larger number of persons with a high initial systolic pressure. In the groups receiving waters A and B, none of the subjects had systolic blood pressures above 170 before the intervention. The subjects drinking water C were divided into those with an initial systolic pressure above and below 170 mm. For the group with the higher pressure (n = 6), there was a decrease in the systolic pressure before and at 4 weeks p = 0.023) but no difference at 2 weeks or for diastolic pressure. The results from the remainder of the group are also shown in Table but no dThe study is of exploratory character, based on a relatively small number of subjects and should be interpreted with care. There is also a lack of some data that retrospectively would have been of interest such as sodium in the urine and the effect of water with only calcium added. We do not think, however, that this has any influence on the major conclusions from the study.The intervention with the two waters with added magnesium influenced the body burden in terms of an increased excretion of magnesium in urine. This is consistent with findings from previous intervention studies ,17 althoThe intervention with water containing high amounts of several minerals decreased the blood pressure significantly in contrast to water with magnesium only where no significant effect was detected. This does not exclude that an effect could have been found with the latter water, had the intervention time been longer. On the other hand, the finding supports the concept that interventions should be performed under conditions similar to the ones present in normal environments, rather than with one specific agent. This could also explain the lack of an effect in previous studies where single minerals have been given as reviewed in the introduction.In summary, the results suggest that waterborne minerals constitute a supply for the body burden, that the urinary excretion can be used as a physiologically relevant indicator of the body burden of magnesium and calcium, and that the supplementation of magnesium together with other minerals may reduce blood pressure among persons with a low body burden of magnesium and calcium, either due to an insufficient intake through food or water, or through some metabolic/clinical disturbance. Additional studies are needed to explore this further.The study was supported by an unconditional grant to Gothenburg University from the Nestlé Water Institute, Vittel, France. The authors had full freedom for data analysis, manuscript preparation and submittance to a journal. RR has not received any fees or salaries for this work, including article processing charges, nor does he own any shares or has any other financial interest in the company. MA was an employee at the Water Institute at the time of the study.RR and MA jointly developed the research plan. RR conducted the field study. RR and MA jointly analyzed the data and wrote the manuscript.The pre-publication history for this paper can be accessed here:

Chronic obstructive pulmonary disease and emphysema are a frequent result of long-term smoking, but the exact mechanisms, specifically which types of cells are associated with the lung destruction, are unclear.+ and CD8+ T lymphocytes that expressed chemokine receptors CCR5 and CXCR3 (both markers of T helper 1 cells), but not CCR3 or CCR4 (markers of T helper 2 cells). Lung lymphocytes in patients with chronic obstructive pulmonary disease and emphysema secrete more interferon gamma—often associated with T helper 1 cells—and interferon-inducible protein 10 and monokine induced by interferon, both of which bind to CXCR3 and are involved in attracting T helper 1 cells. In response to interferon-inducible protein 10 and monokine induced by interferon, but not interferon gamma, lung macrophages secreted macrophage metalloelastase , a potent elastin-degrading enzyme that causes tissue destruction and which has been linked to emphysema.We studied different subsets of lymphocytes taken from portions of human lungs removed surgically to find out which lymphocytes were the most frequent, which cell-surface markers these lymphocytes expressed, and whether the lymphocytes secreted any specific factors that could be associated with disease. We found that loss of lung function in patients with chronic obstructive pulmonary disease and emphysema was associated with a high percentage of CD4These data suggest that Th1 lymphoctytes in the lungs of people with smoking-related damage drive progression of emphysema through CXCR3 ligands, interferon-inducible protein 10, and monokine induced by interferon. The underlying changes that cause smoking-related damage are unclear. This paper suggests that there is a skew towards increased T helper 1 lymphocytes, which may drive progression of this damage A rho smoke ,9,10,11.ho smoke . Furtherho smoke . It has ho smoke .Chemokines, their receptors, and cell adhesion molecules regulate migration of immune cells into inflamed tissue ,16,17,18In this study we determined the dominant T helper phenotype in lung samples from ex-smoker individuals with moderate to severe COPD and emphysema and control individuals with no evidence of smoking-related lung disease. Analysis of chemokine receptor expression on isolated peripheral lung lymphocytes from ex-smokers with COPD/emphysema indicated that both CD4 and CD8 T helper cells are strongly polarized to the Th1 phenotype compared to T cells isolated from lung tissue of normal individuals or individuals with non-smoking-related obstructive lung disease. The same cells spontaneously secreted more IFN-γ and CXCR3 receptor ligands MIG and IP-10 in the COPD and emphysema group than in the group without emphysema. Further, IP-10 and MIG, but not IFN-γ, upregulated macrophage metalloelastase from isolated lung macrophages. Together, our findings reveal the strong association between COPD/emphysema- and Th1-driven adaptive immunity, suggesting a link to lung destruction mediated by IFN-γ, MIG, and IP-10.Twenty-eight non-atopic ex-smoker individuals see undergoiAll participants were recruited from the surgical clinic at the Michael E. DeBakey Veterans Affairs Medical Center and the Methodist Hospital, and were undergoing lung resection for diagnostic or therapeutic purposes . Study pHigh-resolution CT (two in emphysema group and two in control group) or conventional CT analysis was used to detect emphysema, characterized by the presence of areas of low attenuation contrasted with surrounding normal lung parenchyma ,33. CT s7 cells for future analysis.Lung lymphocytes were isolated by modifying established protocols, using a combination of mechanical fragmentation, enzyme digestion, and centrifugation procedures described previously ,36,37. VThe following monoclonal antibodies were purchased from BD Biosciences Pharmingen : FITC-, Cy5-, and PE-conjugated anti-CD4, -CD8, -CD3, -CD14, -CD69, -CXCR3, -CCR3, -CCR4, and -CCR5. For enzyme-linked immunosorbent assay studies, anti-human antibodies to IFN-γ, IL-4, IP-10, MIG, I-TAC, and the appropriate secondary reagents were purchased from R&D Systems .7 cells/ml, and 50 μl of cells was incubated with antibodies to CD3 and CD4 or CD8.Phenotypic characterization of T cells was done by two-color flow cytometry using combinations of the following monclonal antibodies: FITC-conjugated anti-CD4, -CD8, and -CD14; PE- and Cy5-conjugated anti-CCR4, -CCR3, -CCR5, and -CXCR3. Freshly isolated lung lymphocytes were resuspended to 1 × 10Lung lymphocytes were cultured in the presence or absence of phorbol myristate acetate (PMA)/ionomycin and brefeldin A for 12 h. Cells were harvested, fixed with formaldehyde, permeabilized with saponin, and intracellularly labeled for IFN-γ and IL-4, in addition to staining for surface CD69, CD4, and CD8 according to the manufacturer's recommendations .Lung lymphocytes were isolated from surgical tissue and cultured in vitro in triplicate for 4 d. Supernatants were collected and stored at –80 °C for future analysis. Standard antibody-based enzyme-linked immunosorbent assay was used to measure supernatant concentrations of IP-10, MIG, IL-4, and IFN-γ according to the manufacturer's instructions (R&D Systems and BD Biosciences Pharmingen).Peripheral blood mononuclear cells and lung macrophages were isolated by positive selection using immunomagnetic beads conjugated with anti-CD14, and cultured in serum-free medium prior to overnight stimulation with 0, 50, 250, or 500 ng/ml of IFN-γ, IL-4, MIG, I-TAC, and IP-10. Supernatants were collected, and MMP12 was detected using anti-human MMP12 (R&D Systems) by Western blotting according to the manufacturer's instructions.+ lung macrophages stimulated overnight with rIP-10 (500 ng/ml) in the presence or absence of blocking anti-CXCR3 antibodies . Two-step real-time reverse transcription PCR was used to determine the relative expression of mRNA using the ABI Perkin Elmer Prism 5700 Sequence Detection System as described previously [Total cellular RNA was extracted from CD14eviously .Paraffin-embedded, and fresh-frozen lung sections (5 μm) were immunostained using monoclonal antibodies against human MMP12 (R&D Systems) or non-immune antisera by an immunoperoxidase protocol and counterstained with hematoxylin as recommended by the manufacturer.p < 0.05 was considered statistically significant.The Mann-Whitney test and Student's T test (two-tailed) were used to compare differences between the two groups of subjects. n = 10) and emphysema (n = 18) groups, and did not discriminate between these populations . Together, these data indicate that a strong type 1 bias is characteristic of the T cells isolated from the peripheral lung of participants with COPD and emphysema and that this immune phenotype correlates with the lung destruction that is characteristic of this disease. Further, we have shown for the first time, to our knowledge, that CXCR3 expression, a marker of Th1 inflammation, extends to lung monocytes and macrophages.Although human lung macrophages are not known to express CXCR3, we suspected based on the immunohistochemical localization of this chemokine receptor that CD14or CXCR3 . In addi+/CD8+ lung lymphocytes. Surface staining for CD4 was not feasible with this protocol; however, the percentage of CD8−/IFN-γ+ cells was approximately equal to that of CD8+/IFN-γ+ cells . This information confirmed our finding that the predominant Th1 bias in COPD/emphysema reflects the microenvironment unique to the lungs of ex-smoker individuals. The prevalence of asthma among people who smoke is currently not known, but in order to study COPD/emphysema in a population without other confounding variables, people who might have had asthma were excluded, and thus our findings are restricted to non-asthmatic individuals with emphysema.+ and CCR8+ T cells express IL-4, and CCR4 expression was prominent in people with severe atopic dermatitis, which decreased upon abatement of disease activity [+/CXCR3+ T cells in the airway epithelium and submucosa [+ T cells in emphysema patients and the functional interplay between Th1-related chemokines and elastolytic MMPs.Our use of T cell chemokine receptor expression analysis to determine recruitment of lung T cells is not without precedent. Analysis by immunohistochemistry of airway mucosa of people with atopic asthma after antigen challenge revealed that large numbers of CCR4activity ,43. Immuubmucosa . We exteIn addition to detailing surface chemokine receptor expression, we have functionally confirmed the marked Th1 bias of peripheral lung T cells, demonstrating that either at rest or following stimulation, these cells secrete IFN-γ and not IL-4. Our findings therefore confirm the utility of chemokine receptor expression patterns in the initial assessment of T cell effector phenotype.Destruction of lung parenchyma in emphysema is thought to occur through excessive proteolysis mediated by the elastin-degrading enzymes MMP2, MMP9, and MMP12 from the MMP family, and by neutrophil elastase from the serine proteinase family ,46. CytoAlthough this was an entirely human study, our findings show remarkable parallels with studies performed in mice. MMP12 deficiency has been shown to protect mice against emphysema after chronic exposure to cigarette smoke, implying that MMP12 may be the key proteinase in the development of emphysema in this species ,50. StudMany people develop long-term lung problems after smoking, including a condition called emphysema. At the very end of the airways are tiny air sacs. In healthy people, the air sacs stretch and relax easily on breathing in and out. But in people with emphysema, the air sacs fill up with air but can't empty out properly, so air gets trapped, making breathing difficult. While the symptoms of emphysema can be treated, there are no treatments that can reverse the damage to the lung.The researchers studied two groups of patients, all ex-smokers who had been admitted to a hospital to have part of their lung removed—some because of cancer, some for other reasons. The researchers studied the lung samples and looked to see exactly what type of immune cells the patients with emphysema had in their lungs and found that most of the immune cells were of one particular type. The researchers also showed that the immune cells could tell other lung cells to produce chemicals that can damage the lung.Lung damage in emphysema may not be caused directly by toxins in cigarette smoke. Instead, if you have emphysema, your body may react to the toxins and produce a special kind of immune cell that is key in causing the lung damage. So perhaps if doctors can find a way to change how this cell behaves, it might be possible to reduce or limit the lung damage. Obviously, not smoking, or stopping smoking, is the best way to prevent COPD or emphysema.The study is quite small, which means that the results may not be completely accurate; in particular, the study did not include detailed information from patients who had never smoked. So it is too soon to say for sure whether these special immune cells really are the link between smoking and lung damage in emphysema. Researchers will need to study many more patients with emphysema as well as people who have never smoked.Two places to start are the patient Web pages of the following professional organizations.http://www.yourlunghealth.org/diseases_conditions/copd/American Association for Respiratory Care: http://www.brit-thoracic.org.uk/public_content.asp?pageid=9&catid=21&subcatid=177The British Thoracic Society:

Osteosarcoma is a highly malignant bone neoplasm of children and young adults. It is characterized by extremely complex karyotypes and high frequency of chromosomal amplifications. Currently, only the histological response (degree of necrosis) to therapy represent gold standard for predicting the outcome in a patient with non-metastatic osteosarcoma at the time of definitive surgery. Patients with lower degree of necrosis have a higher risk of relapse and poor outcome even after chemotherapy and complete resection of the primary tumor. Therefore, a better understanding of the underlying molecular genetic events leading to tumor initiation and progression could result in the identification of potential diagnostic and therapeutic targets.We used a genome-wide screening method – array based comparative genomic hybridization (array-CGH) to identify DNA copy number changes in 48 patients with osteosarcoma. We applied fluorescence in situ hybridization (FISH) to validate some of amplified clones in this study.PRDM16), 6p21.1 , 8q24, 12q14.3 (IFNG), 16p13 (MGRN1), and 17p11.2 . We validated some of the amplified clones by FISH from 6p12-p21, 8q23-q24, and 17p11.2 amplicons. Homozygous deletions were noted for 32 clones and only 7 clones showed in more than one case. These 7 clones were mapped to 1q25.1 (4 cases), 3p14.1 (4 cases), 13q12.2 (2 cases), 4p15.1 (2 cases), 6q12 (2 cases), 6q12 (2 cases) and 6q16.3 (2 cases).Clones showing gains (79%) were more frequent than losses (66%). High-level amplifications and homozygous deletions constitute 28.6% and 3.8% of tumor genome respectively. High-level amplifications were present in 238 clones, of which about 37% of them showed recurrent amplification. Most frequently amplified clones were mapped to 1p36.32 (This study clearly demonstrates the utility of array CGH in defining high-resolution DNA copy number changes and refining amplifications. The resolution of array CGH technology combined with human genome database suggested the possible target genes present in the gained or lost clones. Osteosarcoma (OS) is a primary malignant tumor of bone arising from primitive bone-forming mesenchymal cells and it accounts for approximately 60% of malignant bone tumors in the first two decades of life . These tChromosomal aberrations in osteosarcoma are highly complex and characterized by high frequency of amplifications. These amplifications may result in the overexpression of genes and contribute to the genomic instability in osteosarcoma. The identification of genes within the amplified sites is crucial for understanding the biology and clinical behavior of osteosarcoma. Until, recently gene amplification has been detected by PCR, southern blot analysis or FISH-based approach using gene specific probes. These techniques are inherently restricted to the previously known amplified genes in the genome. In contrast, genome-wide screening of amplified chromosomal regions with CGH has become an important tool for the detection of amplified regions in the tumor genome. So far published chromosomal CGH studies in osteosarcoma have identified several high-level chromosomal amplifications at 1p22, 1p31, 1q21, 1q23, 2q24, 3p25, 3q26, 6q24.3, 4q12, 5p14-p15, 5q33, 6p12-p21, 6q24.3, 7p21-p22, 8q12-q23, 10p21, 10q11.1, 10q22, 11q13, 11q23, 12p13, 12q12-q15, 17p11.2, 17q21, 18q22, 19p13.1 and 20p11.2 [A total of 48 tumors from 42 patients were collected from the Texas Children's Cancer Center, Houston, TX and Memorial Sloan Kettering Cancer Center, New York . All tissues in this study were obtained after IRB approved informed consents were signed. The age at diagnosis ranged from 5 years to 71 years at diagnosis. The histological information of 42 patients is presented in Table The array used in this study consists of 967 human BACs, which were spaced approximately 3 megabase across the whole genome. These arrays were obtained from Spectral Genomics, Houston, TX. The experiments were performed according to the manufacturer's protocol. Arrays were pre-hybridized with human Cot-I DNA and salmon testes DNA to block the repetitive sequences on BACs. One microgram of normal DNA (reference) and tumor DNA (test) was labeled with cy5-dUTP and cy3-dUTP respectively, by random priming. To avoid dye bias, we performed dye swap experiments for each sample. The probe mixture is dissolved in hybridization mixture, denatured, cooled, and mounted with 22 × 60 mm coverslip. Hybridizations were performed in sealed chambers for 16–20 hours at 60°C. After post hybridization washes, arrays were rinsed, dried with compressed air, and scanned into two 16-bit TIFF image files using Gene Pix 4000A two-color fluorescent scanner and quantitated using GenePix software .After scanning of the slide, the fluorescent intensities of the green and red channels were background subtracted. The resulting values were normalized by intensity based local weighted regression method (Lowess) to correct for systematic bias in dye labeling and fluorescent intensity . Then thp-values of the each clone by comparing to the clone with median variance using chi-square distribution . The clones that have p-value greater than preset cutoff 0.9 were considered as invariant clone set, i.e. clones that do not vary significantly in all experiments. Then the mean and standard deviation of the log ratios of these invariant clones in each experiment were calculated. The clones with log ratios that exceed mean +/- 2 × SD of the invariant set were considered gains and losses, respectively. For amplification and homozygous deletions, clones were defined to have at least 2 fold of the upper bound threshold and 4-fold of lower bound threshold, respectively. The gene(s) present in the clones were identified using UCSC browser by downloading gene table (refFlat) from human gene assembly, July 2003. We search the candidate genes based on linear mapping position, which include 100 kb up and downstream from the clone center position. The supplemental data for this article is available at: We developed a new analytical method called invariant analysis to define the significant copy number changes. This method is designed to: i) increase the power of the analysis by combining all the cases in our dataset to define an invariant population (unchanged population); and, ii) to address the signal to noise differences among individual cases due to sample and hybridization variability. Our goal is to define a set of unchanged clones that can be used to calculate the upper and lower bound thresholds of the log ratios for the unchanged population in each experiment. First, we calculated the variance of each clone from all the experiments. We computed the . The experiments in each of the two groups, amplification and normal, used for comparison were defined based on the invariant analysis (see above). The clones that have p <0.001 were considered as significant. We chose a stringent cutoff to minimize the multiple testing problem.Significant clones in 6p, 8q, 12q and 17p amplicons were calculated using 2-sample t-test with randomized variance model FISH was performed to validate and quantify chromosomal amplicons using clones from 6p12-p21 , 8q24.3 (RP11-89K10), and 17p11.2-p12 clones, and centromeric clone from 6 (pEDZ6) were labeled with Spectrum Red or Spectrum Green by nick translation. Hybridization and FISH analysis was performed as described previously .To define the gains and losses in our experiments, we used invariant analysis for the first time to describe genomic changes by array CGH. In this method, we defined an invariant clone set that has low variance of log ratios among all the array experiments. After the mean and standard deviation of the log ratios in the invariant set of each experiment were calculated, clones that have higher or lower log ratios than the mean +/- 2SD of the invariant set (upper bound and lower bound) were used to define gains and losses. We chose to use this method because it addresses some of the shortcomings of the modeling method, such as using all information provided in a set of experiment to determine the unchanged population instead of using one experiment at a time. However, the variation of each experiment is accounted for because the thresholds are calculated using the invariant set from each experiment. It also does not require a separate reference set for comparison. Finally, it provides an adjustable cutoff to optimize the thresholds to the training data, if provided.The amplified and homozygously deleted clones were defined to have at least 2 fold of the upper bound and 4-fold of lower bound, respectively. Figure Copy number changes excluding clones from sex chromosomes were involved in a significant fraction of most tumor genome. The estimated average genomic distance between clones was ~3–4 Mb. The frequency of clones showing gains (79%) was greater than losses (66%). High-level amplifications and homozygous deletions constitute 28.6% and 3.8% of tumor genome respectively. The most frequently deleted clones were identified from the chromosomal regions 2q31.1, 3p14.1, 4p16.2, 6q12, 6q21, 6q27, 7q35, 10p15.1, 10q22-q23, 10q25-q26, 11q25, 13q12.2, 13q14.3, 13q22.1, 17p13.3 and 17q12 (Table Homozygous deletions were noted for 32 clones (3.8%). Recurrent homozygous deletions were noted for 7 clones that are were mapped to 1q25.1 (4 cases), 3p14.1 (4 cases), 13q12.2 (2 cases), 4p15.1 (2 cases), 6q12 (2 cases), 6q12 (2 cases) and 6q16.3 (2 cases). Figure ROR1), 1p36.1 (PRDM16), 1q21, 1q23 (TNFF6), 2q24, 3p25, 3q26.1, 4p16.3, 5p14, 5q33, 6p11.2-p21, 7p21, 8q12.1, 8q24.13, 10p21, 10q11.1, 10q22 (KCNMA1), 11q13, 11q23 (GRIK4), 12q12, 12q13-q15, 12q21-q21.33, 17p11.2-p12, 17q21 (NGFR), 18q22, and 19p13.1 (NFAT). Of these amplified sites, 6p11.2-p21, 8q12.1, 8q24.13, 12q12, 12q13-q15, 12q21-q21.33, 16p13 and 17p11.2-p12 were frequent.Previous studies using CGH have identified several chromosomal amplification sites in osteosarcoma. Because of the limitation of the method, it fails to pinpoint the precise site of amplicon. However, the present study by array CGH has identified 238 clones (28.6%) with high-level amplifications. Recurrent amplifications were noted in ~37% of the total amplified clones cases analyzed. High-level amplification of the clones from same region was noted in 25% of the cases by array CGH. We found that most of the cases with amplification of 6p12-p21 displayed either increased or slightly varying degree of copy number increase across the 6p12-p21 region. The combined log ratios from all the cases defined the boundaries of amplification between RP3-329A5 and RP11-79F13. The amplicon spans approximately 9.4 Mb with amplification peak for clone RP11-81F7. Further, we used FISH to validate 6p amplicon on tumor metaphase and interphase cells from cases 274, 364, 426 and 527. Increased copy numbers for clones RP11-91E11, AL391415, RP11-81F7, RP11-79I2, RP11-90H17 and RP11-79F13 were noted in interphase cells with maximum copy number increase for clone RP11-81F7 Figure . This waMost cases with 8q gain, displayed varying degree of copy number increase predominantly from 8q12.1 (16.9%), 8q21.13 (29%), and 8q24.3 (35%). High-level amplifications were also noted from 8q12.1 tumors analyzed by array CGH. Three distinct amplicons – AMP1 (12q12), AMP2 (12q14.1) and AMP3 (12q21.33) were noted across the entire long arm of chromosome 12 Figure . Of thesAmplification of 17p11.2 was noted in 27% of the cases analyzed by array CGH. The amplicon was composed of three clones RP11-64B12 (p = 0.0000014), RP11-89K6 (p = 0.00000005) and RP11-189D22 (p = 0.0000001) and covering 3.7 Mb region on the short arm of chromosome 17 Figure . We usedThis study represents the first application of genome-wide copy number changes by array CGH in osteosarcoma. Recent studies in breast, renal and bladder cancer showed the potential assessment of this technology in detecting high-resolution copy number changes ,11,14. Tp53 significantly correlates with genome-wide DNA instability and seems to represent a major genetic factor contributing to the extremely high levels of genomic instability found in high-grade osteosarcomas [Gene amplification is an important genetic mechanism in human cancers, as it clearly associated with tumor progression and has a prognostic significance and has even provided a target for therapeutics ,18. Thessarcomas .CDC5L, HSPCB, and NFKBIE, and HGNC and MRPL14 are the target genes from 6p12-p21 amplicon. Of these genes, CDC5L may be an important gene in cancer because of its role as a positive cell cycle regulator for G2/M transition[HSPCB was shown recently by cDNA microarray studies on osteosarcoma [Our analysis have identified frequently amplified clones from 6p11.2-p21, 8q12.1, 8q24.13, 12q12, 12q13-q15, 12q21-q21.33, 16p13 and 17p11.2-p12. Amplification of clones from 6p12-p21 region was noted in 25% of the cases analyzed. This was consistent with the previously published results by CGH. By array CGH, we refined the 6p amplicon to 9.4 Mb with amplification peak for clone RP11-81F7. We recently demonstrated the origin of 6p amplicon as consequence of tandem duplication of clones RP11-81F7 and RP11-79F13 [ransition. ConsistNSE2 (breast cancer membrane protein 101 kDa) gene.High-level amplifications were also noted from 8q12.1 (RP11-550I15 – 6.3%), 8q21.13 (RP11-89H1 – 6.3%), 8q24.3 (RP11-89K10 – 6.3%) and RP11-637F16 (12.5%). There were no candidate genes present in clones RP11-550I15, RP11-89H1 and RP11-637F16, but clone RP11-89K10 contained GLI, CHOP, SAS, HMGI-C, CDK4, HDM2, and PRIM1 from 12q13-q15 region in osteosarcoma [IFNG from AMP2 , which is physically mapped close to the HDM2 oncogene locus[IFNG strongly suppresses osteoclastogenesis by interfering with the RANKL-RANK signaling pathway. IFNG induces rapid degradation of the RANK adaptor protein, TRAF6, resulting in strong inhibition of the RANKL-induced activation of the transcription factor NFKB and JNK [ELK3 and PCTAIRE protein kinase 2 (PCTK2). ELK3 is a member of the ETS-domain transcription factor family and the protein is activated by signal-induced phosphorylation [PCTK2 belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases and play an important role in the regulation of the mammalian cell cycle [CCND2, ETV6, and KRAS2 from 12p region [High-level amplification of clones on 12q revealed three distinct sites of amplifications – AMP1 (12q12), AMP2 (12q14.1) and AMP3 (12q21.33). Pervious studies have shown the amplification osarcoma ,23. The ene locus. Previou and JNK . The AMPrylation . The proll cycle . High-lep region .PP3A, SMCR5, DRG2, FL11, MYCD, SOX 17, ELAC2, and PMP22). Recent studies have shown the amplification of some of the genes identified in the present study from 17p11.2-p12 in high-grade OS by semi-quantitative PCR and cDNA microarrays [Amplification of 17p11.2 was noted in 27% of the cases analyzed by array CGH. Our array CGH analysis has identified three clones with high-level amplifications that spans ~3.7 Mb region on 17p11.2. Several candidate genes were identified within these clones in an atypical myoproliferative disorder [NUFIP1P) and BAI3 gene (brain-specific angiogenesis inhibitor gene), which is to homologous to BAI1 and shown to suppress glioblastoma [The present array CGH analysis has identified seven recurrent clones exhibiting homozygous deletions from 1q25.1, 3p14.1, 13q12.2, 4p15.1, 6q12, 6q12 and 6q16.3. These chromosomal regions were consistent with previously reported studies by loss of heterozygosity (LOH) and CGH ,31. The disorder . Homozygblastoma .In summary, high resolution array-based CGH revealed large number of chromosomal aberrations previously identified in osteosarcoma by chromosomal CGH and conventional cytogenetic methods. The present study allowed precise identification of smaller DNA copy number alterations, which suggest the presence of specific target genes in osteosarcoma. Although this study suggested several possible target genes from amplified regions from 6p, 8q, 12q and 17p, but these genes should be validated by other molecular and immunohistochemical approaches on well-defined large patient samples. Further, interaction or association studies between small genomic losses and gains will facilitate the identification of new genetic pathways in the pathogenesis of osteosarcoma.None declared.TKM and KJ have contributed towards the data analysis. LP, ML, RG, and CL were assisted in sample collection and clinical information of the patients. X-YL has involved in array CGH experiments and data collection. CPH has involved in extracting the gene information from BAC clones. SS has provided the arrays used in this study. PHR was involved in the planning, and organization of the project.The pre-publication history for this paper can be accessed here:

Small-cell neuroendocrine carcinoma in the duodenum is an extremely rare neoplasm with poor prognosis.A 57-year-old man presented with sudden onset gastrointestinal bleeding and fainting attacks. Duodenoscopy and hypotonic duodenography revealed a 3 × 3 cm protruding tumor with ulcerations situated opposite the ampulla of Vater in the second part of the duodenum. Local excision of the tumor was performed, followed by adjuvant chemotherapy with 5-fluoro uracil and leucovorin. Examination of the tumor by immunohistochemistry and electron microscopy indicated it to be neuroendocrine in nature, expressing synaptophysin and AE1/AE3, and containing dense core granules. The patient showed no sign of recurrence and has been disease-free for more than 48 months after surgery.Most cases of small-cell neuroendocrine carcinoma in the duodenum show rapid progression of the disease, and even radical surgery with or without chemotherapy do not prevent death. We report a rare subtype of small-cell neuroendocrine carcinoma. This subtype appears to have a much better prognosis, and may be amenable to local excision, if the lesion is away from the ampulla of Vater. Duodenal Neuroendocrine tumors constitute 5% of all gastrointestinal neuroendocrine tumors ,2. Most A 57-year-old man presented with sudden gastrointestinal tract bleeding and episode of fainting. Duodenoscopy Figure and hypoA laparotomy was performed. As there was no serosal invasion or regional lymphadenopathy wide local excision of the tumor was performed. On gross examination, the tumor showed two ulcerations and two different morphological components Figure and 2b. 2) and leucovorin (20 mg/m2) were administered. The patient showed no sign of recurrence and is disease-free 48 months after surgery.The patient was discharged three weeks after operation with uneventful postoperative period. Four cycles of monthly adjuvant chemotherapy with 5-fluoro uracil (5-FU) (325 mg/mNeuroendocrine carcinomas (NEC) in the duodenum are extremely rare, and are classified as either 'small-cell' or 'non small-cell' types. The small-cell NEC occurring in the duodenum and elsewhere in gastrointestinal tract are similar to the small-cell carcinoma of the lung ,8. Only The natural course of small-cell NECs in the duodenum is still not clear. Most cases reported in the literature show rapid progress of the disease, with radical surgery and/or chemotherapy not altering the clinical course, and thus a poor prognosis. In six of the previous eight cases, patients underwent pancreaticoduodenectomy for removal of the tumor, while the remaining two did not undergo surgery because of multiple liver metastasis or poor general condition. In spite of radical resection with or without adjuvant chemotherapy, most cases showed rapid recurrence and metastasis. Of the eight reported cases, one was unusual as it occurred in a middle-aged female with rapid progress of the disease but effective response to adjuvant chemotherapy using 5FU, tumor necrosis factor, and interferon this patient survived for more than eighteen months . The preThis report identifies a new subtype of small-cell NEC in the duodenum. This subtype appears to have a much better prognosis, and may be amenable to local excision, if the lesion is away from the ampulla of Vater.None declared.NS, MT, MK, KY, KK, HN took part in the operation, performed the literature search and drafted the manuscript for submission. HN supervised the preparation of the manuscript and edited the final version for publication. TS, KS performed pathological investigations and contributed to the pathological content of the manuscript.All authors read and approved the manuscript.

Contrast-induced nephropathy is an important cause of acute renal failure. We assess the efficacy of acetylcysteine for prevention of contrast-induced nephropathy among patients undergoing intravascular angiography.We conducted a systematic review and meta-analysis of randomized controlled trials comparing prophylactic acetylcysteine plus hydration versus hydration alone in patients undergoing intravascular angiography. Studies were identified by searching MEDLINE, EMBASE, and CENTRAL databases. Our main outcome measures were the risk of contrast-induced nephropathy and the difference in serum creatinine between acetylcysteine and control groups at 48 h.higher incidence in six of the latter studies). The pooled odds ratio for contrast-induced nephropathy with acetylcysteine relative to control was 0.54 and the pooled estimate of difference in 48-h serum creatinine for acetylcysteine relative to control was -7.2 μmol/L . These pooled values need to be interpreted cautiously because of the heterogeneity across studies, and due to evidence of publication bias. Meta-regression suggested that the heterogeneity might be partially explained by whether the angiography was performed electively or as emergency.Fourteen studies involving 1261 patients were identified and included for analysis, and findings were heterogeneous across studies. Acetylcysteine was associated with a significantly reduced incidence of contrast-induced nephropathy in five studies, and no difference in the other nine (with a trend toward a These findings indicate that published studies of acetylcysteine for prevention of contrast-induced nephropathy yield inconsistent results. The efficacy of acetylcysteine will remain uncertain unless a large well-designed multi-center trial is performed. Contrast-induced nephropathy is a leading cause for acquired acute reductions in kidney function ,2. DespiThe pathophysiology of contrast-induced nephropathy remains incompletely understood. However, current evidence suggests that contrast media induce prolonged vasoconstriction and medullary ischemia coupled with generation of free radicals and oxidative injury to tubular cells -11.Acetylcysteine, a thiol-containing anti-oxidant, has been hypothesized to prevent contrast-induced nephropathy. The potential benefit of acetylcysteine is believed to be mediated by its properties as a scavenger of free-radical species and by increasing the synthesis of nitric oxide, a potent vasodilator, in response to ischemic or other toxic injury in the kidney . Given tWe identified published randomized controlled trials of acetylcysteine for prevention of contrast-induced nephropathy during intravascular angiography using both electronic and manual search strategies. We supplemented this by scanning the reference lists of all identified articles, reviewing selected conference proceedings, and by contacting experts in the field. All languages and types of publications were considered eligible. The comprehensive literature search was initially performed in April 2003 and updated in June 2004 to identify any potential new studies that may have appeared.MEDLINE , EMBASE and CENTRAL databases were searched via OVID using an approach recommended for systematic reviews of randomized trials . PubMed Two individuals (SMB and WAG) independently evaluated identified articles for eligibility on the basis of four inclusion criteria: 1) study design , 2) target population (patients undergoing intravascular angiography), 3) intervention and 4) outcome .Two reviewers (SMB and WAG) independently extracted data from all primary studies fulfilling eligibility criteria. Any discrepancies in extracted data were resolved by consensus. Data extracted included identifying information, focus of the study, details of study protocol and demographic data. The primary outcome measures were the incidence of contrast-induced nephropathy and change in serum creatinine. The secondary outcome measure was requirement for renal replacement therapy. Authors of the studies were contacted for additional information when applicable.et al [Two reviewers (SMB and WAG) independently assessed methodological quality of individual studies. Any disagreements were resolved by consensus. Items used to assess study quality were methods of randomization, any blinding, use of a placebo, reporting of losses to follow-up or missing outcome assessments, and evidence of important baseline differences between the groups -18. An oet al .The presence of heterogeneity can compromise the interpretation and validity of meta-analyses and can result from significant differences in methodology, study populations, interventions, outcomes, or chance . A priorData from all of the selected randomized controlled trials were combined to estimate the pooled odds ratio (OR) with 95% confidence intervals (CIs) using a random-effects model as described by Der Simonian and Laird ,21. The A total of 66 unique citations were identified by our initial search strategy Figure . After tAll the randomized controlled trials were published in the years 2002 through 2004. Tables The definition of contrast-induced nephropathy was variable across studies. Four studies defined contrast-induced nephropathy as a > 44.2 μmol/L increase in serum creatinine from baseline ,29,32,37The reported incidence of contrast-induced nephropathy was variable across studies. Table Table Meta-regression was performed to assess a number of clinical and study quality factors that may have led to heterogeneity across studies. Interestingly, these analyses suggest that the heterogeneity may be partially explained by whether the angiography procedures were performed electively or as emergency, because studies where all enrolled patients were undergoing elective procedures had significantly lower odds ratios than did studies where emergency cases were included .Other meta-regression analyses demonstrated that the heterogeneity could not be accounted for by differences in patient age , baseline serum creatinine , volume of contrast media or diabetes mellitus . Likewise, heterogeneity was not accounted for by differences in study quality including use of blinding , concealment of randomization , use of placebo or overall Jadad score .There was some evidence to suggest possible publication bias according to Begg's test and a trend with Egger's test . Figure Our meta-analysis of 14 peer-reviewed studies of patients undergoing intravascular angiography may lead some to conclude that the administration of acetylcysteine causes a reduced incidence of contrast-induced nephropathy. However, such a conclusion may be premature based on data published to date because our systematic review reveals considerable heterogeneity of findings across trials. Furthermore, our meta-analysis of post-treatment creatinine values does not reveal any truly meaningful difference in serum creatinine levels at 48 h between the acetylcysteine and control groups. Finally, insufficient data are available to allow inferences to be drawn about the efficacy of acetylcysteine on clinically meaningful endpoints such as dialysis, length of hospitalization or mortality.et al that recently received considerable attention, and that rather firmly concluded that acetylcysteine is beneficial [et al, and more directly address the relevance of this heterogeneity in the overall interpretation of study results. Two other meta-analyses have also recently been published, and similarly concluded that acetylcysteine is beneficial; however, these studies also failed to adequately address the issue of the considerable heterogeneity across studies [This meta-analysis has several features that distinguish it from a similar meta-analysis by Birck neficial . First, neficial . Fourth, studies ,42. Coll studies . Many wi studies ,45 make The presence of heterogeneity and/or publication bias can compromise the interpretation of meta-analyses and result in erroneous and potentially misleading conclusions ,43. A stdefinitely efficacious based on data published to date. Our firm conclusion based on this meta-analysis of published trails is that although the data seem quite promising, the efficacy of acetylcysteine has not been definitively proven.There are many parallels between the intravenous magnesium story and our meta-analysis findings for acetylcysteine. The marked heterogeneity of findings across studies, and the finding of funnel plot asymmetry (indicating possible publication bias), ought to be viewed as strong cautionary points against making firm conclusions about the efficacy of acetylcysteine. And while it is true that acetylcysteine is inexpensive, easy to use and has a favorable side-effect profile, it is probably premature to conclude scientifically that it is To isolate potential sources of heterogeneity we performed a meta-regression analysis exploring several clinical and study quality factors. There was no evidence of association between effect size and baseline serum creatinine, volume of contrast media, or diabetes mellitus, all independently identified risk factors for development of contrast-induced nephropathy ,53. HoweFunnel plot asymmetry is often interpreted to indicate publication bias. However, it is important to consider that this asymmetry may also be due to other sources of bias that deserve further examination. In particular, fundamental disparities in study design, inconsistencies in methodological quality and differences in the definition of primary outcomes may have contributed to funnel plot asymmetry. Our meta-regression analysis explored the potential role of several study quality factors, and none were identified as statistically significant predictors of apparent acetylcysteine efficacy across trials. Nonetheless, it is quite possible that other unmeasured study quality factors may have contributed to biased results and accompanying funnel plot asymmetry.Contrast-induced nephropathy continues to be an active subject matter for clinical investigation ,56. A deAll of the above leads us to conclude that while acetylcysteine appears to be safe and inexpensive, its efficacy for the prevention of contrast-induced nephropathy remains unproven. The results of the trials that we reviewed to date should be viewed as early promising evidence of benefit, and suggest that it is now perhaps reasonable to use acetylcysteine in routine care because of its relative ease of use and safety. However, its true efficacy will remain uncertain unless a definitive well-designed multi-center trial is performed. Such a clinical trial will be most relevant if it addresses a priori clinically meaningful endpoints of renal insufficiency, rather than surrogate endpoints based on changes in creatinine levels alone, and further considers stratification on hypothesized important subgroups that may benefit such as those with a low ejection fraction .The authors declare that they have no competing interests.SMB developed the study protocol, conducted literature search, screened articles for eligibility, extracted data, analyzed data, interpreted results, wrote and revised the manuscript. WAG contributed to protocol development, screened articles for eligibility, extracted data, analyzed data, interpreted results, and provided critique of successive drafts of the manuscript. Both authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Microarrays are a powerful tool that have multiple applications both in clinical and cell biology arenas of common lung diseases. To exemplify how this tool can be useful, in this review, we will provide an overview of the application of microarray technology in research relevant to common lung diseases and present some of the future perspectives. Microarray technology is rapidly becoming a standard technology used in research laboratories all across the world. Since its first application in the mid 1990s -7 with oDNA microarrays, microscopic arrays of large sets of DNA sequences immobilized on solid substrates, are valuable tools in areas of research that require the identification or quantitation of many specific DNA sequences in complex nucleic acid samples . They ar1. Determination of transcriptional programs of cells for a given cellular function or when they are exposed to certain conditions leading to activation, inhibition or apoptosis.2. Compare and contrast transcriptional programs to aid diagnosis of diseases, predict therapeutic response and provide class discovery and sub-classification of diseases.3. Identification of genome-wide binding sites for transcriptional factors that regulate the transcription of genes.4. Prediction of gene function.5. Identification of new therapeutic targets .6. Development of public databases that will help us understand the functioning of complex biological systems.7. Genetics of gene expression: Although this is a relatively new study field, it is advancing rapidly with major implications in complex clinical traits by the identification of promising candidate genes. Thus, we briefly review the current implementations of this novel approach highlighting its necessity in the research field. Treating mRNA transcript abundances as quantitative traits and mapping gene expression quantitative trait loci for these traits has been pursued in gene-specific ways. Unlike classical quantitative traits, the genetic linkages associated with transcript abundance permits a more precise look at cellular biochemical processes. Schadt et al. describeDNA microarrays are used to estimate the levels of mRNA in the cell. The process can be described in three steps:Array construction: Currently, there are two widely used microarray technologies:1) • In situ synthetized oligonucleotide (20–25 mers) microarrays-mainly oligonucleotides synthetized by photolithography or ink-jet technology on a glass surface.• Spotted, in glass or nylon membrane matrices, microarrays-mostly created by robotic printing of pre-prepared cDNAs or oligonucleotides (polymerase chain reaction-PCR-generated products from cDNA libraries or clone collections) ,15.Sample preparation and array hybridization: The next step in the microarray experiment is to prepare the material that will be hybridized with the microarray. Gene expression is measured by the amount of mRNA therefore it must be extracted from the sample cells or tissues. For high-density microarrays one has to convert mRNA into cRNA, whereas for spotted arrays one can use mRNA, cDNA, or cRNA. The RNA needs to be labeled so that the detecting machinery can measure the quantity of RNA present. In oligonucleotide microarrays mRNA is extracted from experimental samples and is labeled with a fluorescent oligonucleotide (biotin). The biotin labeled cRNA and each sample is hybridized to a separate array, the array is scanned and absolute expression levels are obtained for each probe by using a dedicated laser scanner. In contrast, in spotted microarrays, mRNA is extracted from a sample and a control and one is labeled with cy-5 (red fluorescent dye) and the other with cy-3 (green fluorescent dye). Expression values are based on the competitive hybridization of the two samples being directly compared on a single array. Conventionally, in radioactive nylon membrane arrays RNA probes are labeled with P33 or P32 dCTP during a reverse transcription reaction. The great advantage of nylon microarrays is that they require relatively small amounts of PCR products because radioactive targets have a higher intrinsic detectability whereas in glass arrays the quality of RNA is not as critical as it is in nylon arrays. Therefore nylon arrays are mainly used when sample material is scarce or a small number of genes need to be assayed [2) assayed ,17.3) Image analysis and data acquisition: The laser causes excitation of fluorescently or radioactively labeled cDNA probes. Only the spots representing mRNAs in the sample give emission signals. The emission is measured using a scanning confocal laser microscope for fluorescently labeled arrays or a flat-bed scanner for radioactive nylon arrays and finally data is analyzed by appropriate software. In spotted microarrays using fluorescent probes if particular mRNA from the sample is in abundance, the spot with a complementary probe will be red; if the concentration of the particular mRNA is higher in the control, the spot will be green. If both samples contain the same amount of a given mRNA, the spot will be yellow is a refractory and lethal interstitial lung disease characterized by fibroblast proliferation, extracellular matrix (ECM) deposition and progressive lung scarring. The incidence of IPF is estimated at 15–40 cases per 100.000 per year, and the mean survival from the time of diagnosis is 3–5 yr regardless of treatment ,21. The -/-), thus protected from pulmonary fibrosis, and wild type mice. Interestingly a simple hierarchical cluster analysis identified most of the known TGF-β1 inducible genes preferentially induced in wild type mice. The latter finding provides support for the hypothesis that β6 knockout mice are protected from pulmonary fibrosis as a consequence of failure to activate TGF-β. The great importance of this study results from the identification and the global availability of several genes that are likely to be directly relevant to the fibrotic process. However the inability of microarray technology to detect genes that are not included in the array, identify critical proteins that participate in biological responses and ascribe changes in gene expression in specific cellular types limit the scientific rigidity of the data derived and highlights the necessity for combined application of novel approaches.In another study Kaminski et al. used oliFurthermore driven by the same perspective idea to investigate the gene expression pattern in bleomycin-induced pulmonary fibrosis, Katsuma et al. construcin vivo was established in a separate set of confirmational experiments in rats where it was revealed an overexpression of the ID by myofibroblasts within the fibrotic regions. These novel suggestions have major impact on our understanding of the crucial role of TGF-β1 as a fibroblast differentiation factor in response to fibrogenic stimuli. Nonetheless the present study does not determine the precise role of ID in regulating fibroblast responses to TGF-β1. To do so this study should be coupled with independent methods using ID blocking strategies. Moreover the use of incomplete arrays that detect only the included genes, the variability of cellular composition of tissues studied even from the same organ and the inability of this technology to distinguish changes in cellular composition from transcriptional changes pose major limitations to the global application of these results. Furthermore these observations offer plausible explanations for the lack of similar effects of TGF-β1 in previous studies.One of the most informative studies scrutinizing the global gene expression profile of fibroblasts in response to one of their most potent activators, TGF-β1, has been published by Chambers et al. Gene expMoreover, bleomycin-induced pulmonary fibrosis rat model was extensively studied by Liu et al. with theThese preliminary results suggest that this technology could identify unexpected molecular participants in IPF and might help in the development of novel targets for improved treatment. The method may also allow molecular fingerprinting that could improve the ability to identify subclassifications of pulmonary fibrosis that might be more informative than the current classification based primarily on histologic and radiographic patterns . NonetheAsthma is one of the most serious allergic diseases associated with both genetic and environmental factors such as allergens, respiratory tract infections, and atmospheric pollutants. Most asthma is associated with atopy, a predisposition to generate immunoglobulin (Ig)-E against environmental allergens . HoweverMicroarray technology offers a new opportunity to gain insight into global gene expression profiles in asthma, leading to the identification of asthma associated genes. Several experimental models have been used for this purpose although no animal disease model is identical to human disease. Zou et al. were theBrutsche et al. designedSeveral morphologic changes in the airways of patients with asthma have been attributed to the Th-2 produced cytokines such as IL-13 and IL-5. However the molecular mechanisms underlying the contributions of these cytokines to asthma remain largely unknown.in vivo and in vitro.Towards this direction Lee et al. applied One of the greatest disadvantages of microarrays and at the same time challenges for most of the investigators is the objective difficulty dealing with the results of the experiments resulting from the large quantities of information. Currently, the hurdle faced is the routine interpretation of this information to identify among thousands of dysregulated genes, those who are informative, causal and specific to the phenotypic change of interest. Thus, Temple et al. comparedMicroarrays apart from their remarkable effectiveness in identifying novel gene expression patterns can also be used to clarify physiological mechanisms underlying the actions of numerous drugs, such as those applied in the management of patients with asthma. Several studies have utilized microarray technology to assess the gene expression profile of cells and tissues before and after treatment with commonly applied drugs such as corticosteroids. Two of them are reviewed here.Recently, Hakonarson et al. in additMicroarray analysis performed by Laprise et al. indicateMast cells represent key cells in the initiation and progression of asthma, releasing several mediators of inflammation, such as certain cytokines and chemokines. The past few years several studies have been focused on the identification of new mast cell products through the gene expression analysis. In one of them published by Sayama et al. applicatFurthermore, Nakajima et al. in theirMicroarrays using nylon membrane radioactive cDNAs have already been applied in the research field of asthma and much good work has been done with this technology.Brutsche et al. applied One of the first gene-profiling studies highlighting the potential role of chemokines and their receptors in the pathogenesis of asthma was conducted by Syed et al. They useIn another study Banerjee et al. in theirAccumulated evidence from these analyses revealed that microarray analysis can be a powerful tool for identifying mediators of allergic asthmatic disease through a genomic-based strategy using non-human primates and provide us a novel large scale of differentially expressed genes. Additionally, authors compared different cellular models sharing similar experimental paradigm to focus on the most likely informative genes and filter out the bystanders. The application of this approach further streamlined the pivotal role of microarrays in determining transcriptional responses of genes to several inflammatory cytokines and in identifying gene expression patterns and important mediators associated with the initiation and the progression of asthma. Moreover, microarrays coupled with separate set of experiments have provided the investigators with useful knowledge concerning the efficacy of the already applied drugs in the treatment of asthma and helped them to understand their anti-inflammatory role in terms of physiology and molecular biology. Nevertheless, most of the studies exhibited essential weaknesses generated by the heterogeneity of samples studied and compared and by the disability of microarrays to quantify gene expression and yield information about transcriptional responses and post-translational protein modifications. Therefore more in depth analysis of the microarray results is needed in combination with novel approaches that will help us focus on the specific genes and elucidate their role in the cellular function and the pathogenesis of asthma Tables ,3.Chronic obstructive pulmonary disease (COPD) is a chronic disease characterized by progressive airflow obstruction, chronic cough and dyspnea in advanced stages, caused by smoking, environmental, and hereditary factors. It is associated with two clinical entities, chronic bronchitis and emphysema. In nowadays, the invention and application of microarray technology offers scientists the opportunity to gain a better understanding on the pathophysiology of COPD through the identification of novel gene expression patterns, leading to illumination of genes candidates for modern therapeutical approaches .It is already known that chronic bronchitis can be induced by several types of environmental pollutants such as diesel exhaust particles (DEP). Though recently a microarray study has been published by Koike et al. addressiMicroarray approach is already being applied in respiratory clinical pharmacology with the identification of genes {Yamanaka et al. } that caOne of the major limitations in our attempt to elucidate the exact role of specific cell types in the pathogenesis of COPD is the compact anatomy of the lung which makes unraveling specific cell type gene expression changes difficult, requiring immunoelectron microscopy or laser capture microdissection. The first study to perform quantitative cell type-specific gene expression analysis using the pioneering technology of laser capture microdissection in human tissue samples coupled with RT-PCR and cDNA approach was recently published by Fuke et al. Authors Several inflammatory cytokines have been implicated in the pathogenesis of emphysema, including TNFa, a molecule with versatile pathogenetic mechanisms. As a means to investigate some of them that culminate to lung-pathology, Vuillemenot et al. applied Despite the clear link of smoking to the risk for chronic bronchitis, only 15–20% of cigarette smokers develop COPD, suggestiOne of the most exciting aspects of microarrays is their use as tools for actively introducing serendipity to one's research . In expePresently, very few studies dealing with the role of HOX genes in the adult respiratory system are available in the literature. Golpon et al. investigCollectively these results suggest that microarray analysis with its ability to highlight gene expression profiles on a large scale and coupled with progressive technologies and independently validated data has led researchers to shed further light into transcriptional programs regulating emphysema and to the identification of common mediators and molecular pathways involved in the pathogenesis of both COPD and pulmonary fibrosis, indicating novel targets for therapeutic interventions and useful genetic markers assessing susceptibility to COPD. Although limitations such as inconsistency between findings derived by microarray approach and independent studies, lack of functional changes assessment and significant data variability can be detectable in these studies, however evidence derived from these analyses is valuable and heavily informative Table .4. Novel interactions between factors (antioxidant genes) previously associated with ALI and factors (surfactant proteins) previously not associated with ALI emerged from the application of functional genomics during nickel-induced ALI. Data derived from this experiment and partially confirmed by Northern blot analysis and nuclease protection assays is valuable and consistent with the ongoing attempts to treat ALI with exogenous surfactant-associated proteins [Acute lung injury (ALI), a severe respiratory syndrome, develops in response to numerous insults. This syndrome that responds poorly in therapeutic interventions and has a poor prognosis has been associated with a myriad of mediators including cytokines, reactive oxygen and nitrogen species, growth factors and proteolytic enzymes ,55. Despproteins in combiAlthough the fibroproliferative response to lung injury occurs in high frequency in patients with ALI, the mechanisms of this response are largely unknown. One of the most meaningful and informative studies addressing this important issue was recently published by Olman et al . AuthorsALI is frequently associated with endotoxemia and is characterized by the accumulation in the lungs of large populations of neutrophils activated to produce proinflammatory mediators. Many studies had demonstrated a critical role of the endotoxemia-induced activation of NF-κB in neutrophils in the development of ALI ,60. One To gain a more comprehensive understanding on the complex interplay between several inflammatory cytokines involved in the pathogenesis of pulmonary edema, several group of investigators {Cher et al. , SabbadiThe study of Perkowski et al. has beenOne of the first gene-profiling studies to address an important disease process, such as sepsis at a multisystem level, was that of Ward et al. Using DNIn summary, these studies exhibit the crucial role of a novel molecular technology in discovering, through global analysis of gene expression, genes previously identified only by their DNA sequence. Although the array analysis provides in some studies a comprehensive overview of gene expression in the lung during ALI ,58,61,64Sarcoidosis is a chronic systemic disorder characterized by the presence of non-caseating granulomas and accumulation of T-lymphocytes and macrophages in multiple organs . The mecCollectively these findings not only reveal the importance of the microarray platforms in identifying gene expression patterns that give the scientists the opportunity to elucidate the pathophysiological processes of complex diseases, such as sarcoidosis but also illuminate some of their origin disadvantages.The last five years has seen the emergence of a novel technology applied in almost every aspect of respiratory research, a technology that has also great future perspectives and may provide scientists with numerous avenues of investigation that have clinical implications. Since nowadays, microarray technology has been successfully used for the identification of potential target genes for therapeutic intervention in IPF, mechanisManaging and mining the huge amount of data generated by microarray experiments still remains a major challenge and limitation for most investigators. Whether gene expression changes are considered primary vs. reactive for a given disease is a complicated issue, and one can only begin to judge that if the methods and approaches used to generate the data are of sufficient scientific rigidity. The diversity and scope of the data require the creation of multidisciplinary teams consisting of physicians, biologists and bioinformaticians . Thus, wBecause of the statistical issues raised by microarray technology, it is necessary for any meaningful interpretation that the data is replicated using independent methodological criteria, preferably with separate samples rather than the tissue or RNA used to derive the original targets. A rapid high through-put method for confirmation of microarray data is quantitative RT-PCR. Alternatively, Northern blots or ribonuclease protection assays provide the benefit of direct quantification. So far some studies have started to adapt these approaches Figure but therCurrently, the use of microarray technology in respiratory research is limited by the tissue sample, incomplete available arrays and the analysis of data generated from this technology. Clinical use of microarrays technology is still in its infancy and remains exploratory. For these array-based methods to become truly revolutionary, they must become an integral part of the daily activities of the typical molecular biology laboratory and biomedical institute. There is plenty of room for technical improvements, further development, and more widespread acceptance and accessibility. Optimistically thinking we expect that over the next few years the pattern of development and use of microarrays will be on a similar trajectory to that seen for computers and other high-tech electronic devices, which started out as exotic and expensive tools in the hands of the few developers and then moved quickly to become easier to use, more available and less expensive. Alternatively authors believe that so far microarrays have not added much to our understanding and the possibility to live up to the great 'hype' that was generated belongs to the distant future.Our view is that the application of these approaches will improve dramatically the effectiveness and reliability of microarray technology in studies of diseases of complex organs like the lung, and will have a major impact on our understanding of molecular pathogenesis for the foreseeable future. Whether our hopes will be fulfilled or disproved remains to be seen.ADA: Adenosine DeaminaseALI: Acute Lung InjuryASM: Airway Smooth Musclea-SMA: a-Smooth Muscle ActinBAL: Bronchoalveolar lavageCAGE: Composite Atopy Gene ExpressionCOPD: Chronic Obstructive Pulmonary DiseaseCCR7: Chemokine Receptor 7DEP: Diesel Exhaust ParticlesECM: Extracellular MatrixeQTL: expression quantitative trait locusG.I: Gene IntensityIg: ImmunoglobulinID: Inhibitor of DifferentiationI/D: Intensity/Background ratioIPF: Idiopathic Pulmonary FibrosisMBP: Major Basic ProteinMCs: Mast CellsMCP: Monocyte Chemoattractant ProteinMMP: Matrix MetalloproteinaseNF-κB: Nuclear Factor-Kb2: snake venom phospholipase A2nsPLART-PCR: real time-polymerase chain reactionTGF-b: Transforming Growth Factor-bTNF: Tumor Necrosis FactorUIP: Usual Interstitial PneumoniaVEGF: Vascular Endothelial Growth FactorThe authors declare that they have no competing interests.AT, GP and DB were involved with the study conception. AT performed the data acquisition and interpretation. DB and GP were involved in revising the article for important intellectual content. All authors read and approved the final manuscript.

Endosymbiotic bacteria live within a host species. There are many and diverse examples of such relationships, the study of which provides important lessons for ecology and evolution Symbiosis, an interdependent relationship between two species, is an important driver of evolutionary novelty and ecological diversity. Microbial symbionts in particular have been major evolutionary catalysts throughout the 4 billion years of life on earth and have largely shaped the evolution of complex organisms. Endosymbiosis is a specific type of symbiosis in which one—typically microbial—partner lives within its host and represents the most intimate contact between interacting organisms. Mitochondria and chloroplasts, for example, result from endosymbiotic events of lasting significance that extended the range of acceptable habitats for life. The wide distribution of intracellular bacteria across diverse hosts and marine and terrestrial habitats testifies to the continued importance of endosymbiosis in evolution.PLoS Biology, the publication of the full genome sequence of the reproductive parasite Wolbachia allows the first genomic comparisons across this range , and their impressive genetic diversity that spans several major bacterial groups. More recently, studies in genomics of obligate mutualists—and now The distinct lifestyle of endosymbionts has clear effects on rates and patterns of molecular evolution. Compared to free-living relatives, endosymbionts are thought to have reduced effective population sizes due to population bottlenecks upon transmission to host offspring and, in the case of obligate mutualists that coevolve with their hosts, limited opportunities for gene exchange. The nearly neutral theory of evolution predictsIt is increasingly clear the distinct lifestyle of endosymbionts also shapes the architecture and content of their genomes, which include the smallest, most AT-rich bacterial genomes yet characterized . A commoBuchnera of three aphid host species, Wigglesworthia of tsetse flies, and Blochmannia of ants , and a relatively young mutualist of weevils (Sitophilus oryzae primary endosymbiont [SOPE]) show that genome streamlining in the endosymbionts may preclude extracellular existence, and highlight modifications in metabolic pathways to complement specific host physiology and ecology .Facultative mutualist: A beneficial symbiont that associates with the host, but can also live apart from it. Examples include Rhizobium spp. that associate with legumes, but also have a free-living stage to their life cycle.Obligate mutualist: A beneficial symbiont that lives exclusively with its host and depends on the host for survival. Examples include many nutritional endosymbionts of insects, which cannot survive outside of the insect host cell. These associations are reciprocally obligate when the host cannot survive without the endosymbiont.Parasite: A symbiont that has a negative effect on host fitness, in contrast to a mutualist, which increases host fitness.Reproductive parasite: A symbiont that manipulates host reproduction to its own benefit, but at the expense of host fitness. Reproductive parasites typically bias offspring toward infected females.Symbiosis: An association between two more species.

In a previous study we demonstrated the existence of numerical and functional alterations of γδ T cells in healthy elderly. Recently, we analysed the involvement of γδ T lymphocytes in malignant melanoma, describing a lower frequency of circulating γδ T cells, an altered pattern of cytokine production, and an impaired in vitro expansion of these cells in primary cutaneous melanoma patients.In this study we investigated the existence of numerical and functional alterations of circulating γδ T cells in young/adult and old melanoma patients, comparing the data obtained with age-matched healthy subjects.+ T cells was significantly and similarly reduced in young/adult and old melanoma patients and in old healthy subjects in comparison with young healthy donors. The decrease was due to a reduction of Vδ2 T cells whereas the number of Vδ1 T cells was not affected. A higher percentage of γδ+ T cells producing TNF-α was found in old healthy donors, whereas a reduced number of TNF-α-producing γδ+ T cells was present in melanoma patients independently by age. No significant difference was observed in IFN-γ production. After a 10-day in vitro culture, both the percentage and the expansion index of γδ T cells, and in particular of Vδ2 subset, were significantly and similarly reduced both in young/adult and old melanoma patients, and in healthy aged people, in comparison with young/adult healthy subjects.We demonstrated that the number of circulating γδOur study demonstrates that the numerical and functional impairment of γδ T cells found in melanoma patients is not correlated with age and that it has characteristics very similar to the alterations of γδ T cells found in old healthy subjects. We suggest that a similar impairment of γδ T cell population may be related to the increased susceptibility to tumors present in the elderly as well as in the pathogenesis of malignant melanoma. In huAlthough little is known about the physiologic significance of γδ T cells, their marked reactivity toward mycobacterial and parasitic antigens as well as tumor cells suggests that γδ T cells play a role in the anti-infectious and anti-tumoral immune surveillance ,4. Few dOn the basis of the pivotal role that γδ T cells may have in the elderly and in the immune response against melanoma we tried to find out a possible correlation in the alteration of γδ T cells between aged people and melanoma patients. In this study we evaluated the peripheral representation, the in vitro expansion, and cytokine production γδ T cells from young/adult and old melanoma patients, comparing the results with those obtained in age-matched healthy controls.Human peripheral blood was obtained from 9 young , 12 old melanoma patients, and 10 young , and 13 old healthy donors. Healthy subjects were volunteers in good and stable clinical conditions, and had laboratory parameters in the physiological range. We excluded subjects in poor health with degenerative diseases or in therapy with drugs interfering with the immune system. Melanoma patients have been admitted to the Dermatology Unit of the I.N.R.C.A. Hospital of Ancona. Melanoma patients were in good health other than for the existence of melanoma as checked on the basis of clinical and laboratory parameters. The investigations were performed after approval by a local institutional review board. A written informed consent was obtained from each subject. Diagnosis of melanoma was histologically confirmed. All patients brought cutaneous primary non-metastatic melanoma and were staged according to the new American Joint Committee on Cancer staging system for cutaneous melanoma . A blood2+ and Mg2+- free phosphate buffered saline and resuspended in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum, penicillin (100 U/ml) and streptomycin (100 μg/ml) at a concentration of 1.5 × 106/ml. Mononuclear cells were cultured in the complete medium supplemented with 100 U/ml of IL-2 . Phosphoantigen-specific stimulation of γδ T cells was performed using the nonpeptidic antigen isopentenylpyrophosphate . The cells were incubated at 37°C in an atmosphere of 95% air, 5% carbon dioxide, at 90% relative humidity in 24 well plates.Fresh peripheral blood mononuclear cells (PBMC) were fractionated on Ficoll-Paque and separated by density gradient centrifugation . Cells from the interface of the gradients were washed twice with CaPBMCs were analysed for cell phenotype through double staining with the following monoclonal antibodies (mAbs): anti-CD3 (PE) and anti-pan γδ T cells (FITC), or anti-TCR Vδ1 or anti-TCR Vδ2. The phycoerythrin (PE) -conjugated monoclonal antibody anti-CD3 was purchased from EuroClone . The fluorescein isothiocyanate (FITC) -conjugated anti-pan TCR γδ, anti-TCR Vδ1, and anti-TCR Vδ2 were purchased from Endogen . IgG1 (Becton Dickinson) was used as isotype control.6 PBMCs were washed in PBS containing 0,1% NaN3 plus 5% FBS and labelled with 5 μl of anti-CD3 or anti-TCR Vδ1 MoAbs or 2.5 μl of anti-pan TCR γδ or anti-TCR Vδ2 for 30 min in ice. At the end of the incubation, cells were washed in PBS containing 0,1% NaN3, resuspended in PBS (Gibco) and immediately analysed with a Coulter XL flow cytometer.0.5 × 106 stimulated cells were stained with the anti-pan TCR γδ mAb for 30 min at 4°C. Fixation-permeabilization of cells was performed in PBS/2% paraformaldehyde for 15 min at 4°C, followed by incubation for 30 min at room temperature in the dark with PE-conjugated anti-human IFNγ mAb or anti-human TNF-α mAb diluted in PBS, 1% BSA, and 0.05% saponin. Cells were finally washed twice in PBS, 1% BSA, and 0.01 % saponin and analysed on a XL flow cytometer (Coulter).Mononuclear cells were stimulated with IPP and IL-2 for 18 h, and GolgiPlug was added during the last 12 h of culture to block intracellular transport processes and allow cytokine accumulation. 0.5 × 10PBMC were cultured for up to 10 days in the complete medium supplemented with 100 U/ml of IL-2 and 30 μg/ml of IPP to determine a phosphoantigen-specific stimulation of γδ T cells. After 1 wk of culture, the volume corresponding to half the culture medium was replaced by fresh medium. On day 10 of culture viable cells were determined by trypan blue exclusion and used for FACS analysis. The viability was always greater than 98% as determined by trypan blue exclusion. The expansion of γδ T cells was followed by cytometric analysis through double staining of stimulated cells with anti-CD3 (PE) and anti-pan γδ, or anti Vδ1, or anti Vδ2 T (FITC) mAbs. The absolute number of γδ T cells in each culture was calculated as follow: × /100. The γδ T cell expansion index was then calculated by dividing the absolute number of γδ T cells in stimulated cultures by the absolute number of γδ T cells before culture .P < 0.05). The statistical analysis was performed with SigmaStat software version 1.03 .Data were analysed for statistical significance by using parametric or nonparametric tests according to the distribution of the data. Comparisons of variables among groups were made by one-way analysis of variance (ANOVA) or Kruskal-Wallis one-way ANOVA on ranks. When significant differences were found, the differences among groups were made by the Student-Newman-Keuls method or Dunn's method. Difference between means was considered significant at the 5% level . As shown in Table Peripheral blood lymphocytes from 9 young/adult and 12 old melanoma patients and 10 young and 13 old healthy subjects were analysed for the percentage and the absolute number of γδ T cells through double staining with anti-CD3 and anti-γδ mAbs. As shown in Table Since it has been demonstrated that activated γδ T cells produce TNF-α and IFN-γ, we studied the intracellular production of these cytokines in one-day stimulated γδ T cells from healthy subjects and melanoma patients. As shown in Fig. The expansion of γδ T cells was evaluated after 10 days of culture in the presence of IPP and low dose interleukin-2 (IL-2). Both the proportion of γδ T cells, evidenced by double staining FACS analysis, and their relative increase in comparison with the γδ T cell number found on day 0 (expansion index), were evaluated. As shown in Fig. We and others have demonstrated an impaired potential of γδ T cells in aged people, as evidenced by the reduction of the absolute number of circulating γδ T cells, in particular of the Vδ2 T subset, an altered pattern of cytokine production, an impaired in vitro expansion of these cells, and an increased expression of the early activation marker CD69, in aged people in comparison with young subjects ,17,18. RWe demonstrated that both the number of circulating γδ T cells and their in vitro expansion were decreased in melanoma patients and that the impairment did not correlate with the age of patients. Young/adult and old melanoma patients had a similar derangement of γδ T cells, and this impairment had numerical and functional characteristics like to those found in old healthy subjects. This evidence stresses the relevant role that this lymphocyte population may exert, either directly or through the regulation of T cell-mediated specific responses , both inThe reduction of γδ T cell number well correlated with the decrease of the Vδ2 T cell subset, i.e., the most frequent subset of circulating γδ T cells . The Vδ2Under normal conditions, γδ T cells respond to antigen challenge by secreting large quantities of TNF-α and IFN-γ ,21 whichIn conclusion, we demonstrate that the numerical and functional derangement of γδ T cells which we have found in melanoma patients, is not correlated with age of donors, and that old patients with cutaneous primary melanoma have an impairment of γδ T cells similar to that found in old healthy subjects. This evidence suggests a link between γδ T cell deterioration and the low protection against infections and tumor diseases present in the elderly, as well as the inefficacious immune defense against melanoma, both in young/adult and old ages.

The analysis of synonymous and nonsynonymous rates of DNA change can help in the choice among competing explanations for rate variation, such as differences in constraint, mutation rate, or the strength of genetic drift. Nonphotosynthetic plants of the Orobanchaceae have increased rates of DNA change. In this study 38 taxa of Orobanchaceae and relatives were used and 3 plastid genes were sequenced for each taxon.rbcL, matK and rps2) show significant rate heterogeneity among lineages and among genes. Many of the non-photosynthetic plants have increases in both synonymous and nonsynonymous rates, indicating that both (1) selection is relaxed, and (2) there has been a change in the rate at which mutations are entering the population in these species. However, rate increases are not always immediate upon loss of photosynthesis. Overall there is a poor correlation of synonymous and nonsynonymous rates. There is, however, a strong correlation of synonymous rates across the 3 genes studied and the lineage-speccific pattern for each gene is strikingly similar. This indicates that the causes of synonymous rate variation are affecting the whole plastid genome in a similar way. There is a weaker correlation across genes for nonsynonymous rates. Here the picture is more complex, as could be expected if there are many causes of variation, differing from taxon to taxon and gene to gene.Phylogenetic reconstructions of relative rates of sequence evolution for three plastid genes non-photosynthetic lineages. However, there is also some force affecting synonymous sites as well. At this point, it is not possible to tell whether it is generation time, speciation rate, mutation rate, DNA repair efficiency or some combination of these factors. Rates of DNA sequence evolution vary among taxa and among genes, and the causes of this variation are many. In some cases, generation time has been shown to be correlated with rates in plants. For example, annual plants can sometimes have higher rates of DNA evolution than perennials . In one rN) and synonymous rates (rS). For example, when rN increases relative to rS, relaxation of purifying selection is a possible explanation. However, when rS increases, but the rN/rS ratio is not greatly affected, then an increase in the mutation rate is a possibility. An example of this is Plantago mitochondrial DNA [e) can increase the fixation rate of neutral and slightly deleterious mutations. Thus, if slightly deleterious mutations are common, both rS and rN are expected to be higher when Ne is low [A useful method for distinguishing among the potential causes of rate variation is to separately examine nonsynonymous rates and nonsynonymous (dN) substitutions can be measured and are used to compare rates and calculate rate ratios.Rates can also vary if the underlying mutation rate varies ,11 or ifEpifagus virginiana, a nonphotosynthetic plant, has an increased rate of sequence evolution for plastid DNA in general [rps2 gene indicate a significant increase for both dN and dS. This suggests that purifying selection is at least partially relaxed and that there has been an increase in the rate at which mutations are entering the population in this species, due to increased mutation rate or lax DNA repair. MatK, another plastid gene, is characterized by a partial relaxation of purifying selection in the clade containing Epifagus, Orobanche and Boschniakia [E. virginiana and 38 of its relatives for three plastid genes: rps2, matK, and rbcL. Each of these genes is present in photosynthetic relatives of Epifagus, is accelerated (or even lost) in Epifagus or related parasitic plants. Although plastid encoded, the three genes encode proteins that participate in different processes in the plastid. rps2 encodes the ribosomal protein S2 in small subunit ribosome, matK is an intron maturase, and rbcL encodes the large subunit in the CO2-fixing enzyme RUBISCO. We ask several questions: When does the rate increase observed in Epifagus begin, relative to the evolutionary loss of photosynthesis? What are the causes? Relaxation of constraint? More mutations entering the population? Are these patterns consistent across multiple plastid genes? general -17 and rchniakia . In thisSchwalbea relative to the Alectra-Orobanche clade, the Bartsia-Melampyrum clade and the Castilleja-Pedicularis clade. It was also unresolved concerning the relationships among the outgroups Mimulus, Kigelia, Hemimeris, Verbascum, Antirrhinum and Veronica.Phylogenies of the Orobanchaceae and relatives were constructed using maximum parsimony (MP) and maximum likelihood (ML). The MP analysis discovered four most parsimonious trees of 3817 steps, with CI = 0.6275, CI (excluding uninformative characters) = 0.5118, and RC = 0.3888. The strict consensus tree was unresolved as to the position of Cistanche-Epifagus clade. When the MP consensus and the ML consensus were combined into a semistrict consensus tree, a completely resolved tree resulted. This tree is shown in Fig. The ML analysis found two trees, with -ln likelihood values of 24525.88663. The strict consensus of these trees was unresolved, but in a different place, regarding the position of the All three gene trees exhibited statistically significant rate heterogeneity (p < 0.0005), as assessed by the Kishino-Hasegawa (K-H) test . Synonymrps2 and rbcL synonymous and nonsynonymous evolution is poorly correlated, but in matK, the correlation is better have increases in both synonymous and nonsynonymous rates. Rates are not, however, increased in Boschniakia, Harveya, Hyobanche, Lathaea, Alectra orobanchoides, and Striga gesnerioides.Some of the non-photosynthetic plants, usually show an identical pattern of who is faster than whom. This indicates that the causes of synonymous rate variation are affecting the whole plastid genome in a similar way.Synonymous rates vary markedly among taxa. For example, the branches leading to lar Fig. . For exaMatK is much more rapidly evolving than the other two genes for nearly all taxa, but Epifagus' rbcL pseudogene has a similar rate. When looking at taxa across genes, there is much less consistency than with the synonymous rates. There are some big differences, such as the branch lengths for Striga, Cycnium and Schwalbea, and the Euphrasia species. Overall the picture is more complex, as could be expected if there are many causes of variation, differing from taxon to taxon and gene to gene.There is even more extensive variation in nonsynonymous rates, both among taxa and among genes. This is not surprising because these genes have different functions and some of the taxa are photosynthetic while others are not. The scale bars in Figs. matK rate variation is very similar in the synonymous and nonsynonymous figures. This fits well with the fact that it is less constrained overall, as can be seen by comparing the scale bars in Figs. The pattern of Harveya, Hyobanche and Boschniakia do not have higher synonymous rates.Rates were compared by using two categories at a time and testing for significant differences using likelihood ratio tests. These tests are summarized in Table matK: 2×LR = 10.67, df = 1, p = 0.001; rbcL: 2×LR = 31.3, df = 1, p = 2.2 × 10-8; rps2: 2×LR = 8.56, df = 1, p = 0.00343.Purifying selection is relaxed in the nonphotosynthetic plants for all three genes. The test values are as follows. Epifagus pseudogene has been excluded. Its unconstrained evolution is not typical of "nonsynonymous" change and its position on the plot made it an extreme outlier with an enormous influence on the regression line.Another way to describe the difference in the pattern of synonymous and non-synonymous rates is to say that the former are more correlated across genes. This can be seen in Fig. rps2 and rbcL, the synonymous plots are more highly correlated, whereas for matK, which is relatively unconstrained, they are about the same.For Epifagus [Epifagus, Cistanche, and the Orobanche species, have increases in both synonymous and nonsynonymous rates, indicating that both (1) selection is relaxed, and (2) there has been a change in the rate at which mutations are entering the population in these species. However, rate increases are not immediate upon loss of photosynthesis, since we do not see increases in Boschniakia, Harveya, Hyobanche, Lathaea, Alectra orobanchoides, and Striga gesnerioides. This pattern is similar to that found using smaller data sets [The dramatic rate increase observed in Epifagus , with brata sets ,20. Separs (and therefore larger ds) than a species-poor sister group. This was suggested as a cause of rate variation in non-coding DNA in the Lentibulareaceae [Orobanche is not). Thus, accurate numbers of species cannot be assigned to individual branches or clades. However, a few things can be noted. Euphrasia, with ~170 spp., is clearly more speciose than its sister group, with 3 spp. It has a somewhat faster ds. However, the Schwalbea lineage, with a single species, has a fairly high ds. Its position is not certain, but its sister group is probably the Bartsia – Melampyrum clade (>300 spp.), the Castilleja – Pedicularis clade, (>700 spp.), or the union of the two. These groups have do not have dramatically higher ds values; in fact the Castilleja – Pedicularis clade's value is slightly lower.The speciation rate hypothesis predicts that more speciose clades should have a faster areaceae . In thisBartsia, Euphrasia and Melampyrum contains mostly annuals [ds values, as one would expect from a generation time effect. However, both Euphrasia and Melampyrum contain almost exclusively annuals and have very different rates. Likewise, the large clade containing Boschniakia and Epifagus contains mostly annuals and has an overall high ds. The perennials Boschniakia and Cistanche have lower ds than their sister taxa, which also supports the generation time hypothesis, but there is as much variation among categories as between categories.Differences in generation time may play some role in the observed rate variation. However, as was found previously , the pat annuals and has The distinctive pattern of rate increases in Orobanchaceae has at least two causes. It is clear that there is a relaxation of constraint in many non-photosynthetic lineages. However, there is also some force affecting synonymous sites as well. At this point, it is not possible to tell whether it is generation time, speciation rate, mutation rate, DNA repair efficiency or some combination of these factors. Clearly, generating additional data from nuclear and mitochondrial genes would help us to more clearly distinguish among these hypotheses. Some of the above-mentioned hypotheses would be expected to affect nuclear and mitochondrial genomes in a similar fashion, whereas factors affecting mutation rate or efficiency of DNA repair would not, as these process involve different, though perhaps overlapping, sets of enzymes in each of the three genomes -24.We sampled 15 photosynthetic and 16 nonphotosynthetic Orobanchaceae, and eight outgroup taxa. The specimens used and their GenBank accession numbers are given in Table rps2 as in [matK as in [rbcL as in [rps2, 7 matK, and 5 rbcL sequences.We amplified and sequenced s2 as in , matK astK as in , and rbccL as in . A totalrps2 alignment was simple, containing only two small indels. For matK and rbcL, a search for the best alignment was conducted using Clustal X and a variety of alignment parameters. Alignments were evaluated according to the following optimality criterion: whichever alignment yields the MP tree(s) with the highest consistency is considered the best alignment[), which uses the simple indel coding method of Simmons and Ochoterena [rps2 had just one small indel and was aligned by eye. For matK, the optimal computer alignment was generated using GOP = 5 and gap extension penalty (GEP) = 1. Transitions were weighed the same as transitions. The RC from the analysis with indel characters included was 0.3693. The RC without indel characters was 0.3759. The alignment was then adjusted by eye. This final alignment yielded RC values of 0.3878 (indel characters included) and 0.3763 (indel characters excluded).The alignment. For alialignment and 0.4499 (indel characters excluded).For rps2, positions homologous to positions 48–660 of the Nicotiana gene were used. For matK, the entire gene was used. For rbcL, positions homologous to Nicotiana gene positions 5–1325 were used. The three genes were then combined into a single data set. PAUP* 4.0b8 [Nicotiana tabacum as the outgroup taxon, TBR branch swapping and 100 random addition replicates. Bootstrap analyses were conducted with the same settings, except with only 40 random addition orders. 500 bootstrap replicates were performed.For P* 4.0b8 was usedML analyses excluded indels. Using the hLRT method of the program ModelTest 3.06 , the ML . At least nine of the rbcL "genes" are probably pseudogenes. These are indicated in Figure Orobanche caryophyllaceae and Cistanche phelypaea "genes" have internal stop codons and thus are probably also pseudogenes. There may also be other pseudogenes with intact ORFs, making their pseudogene status less obvious [Overall rate heterogeneity was assessed using the K-H test as implemented in PAUP, using the same ML analyses, except that the starting tree was a neighbor-joining tree and the analysis was limited to 40 rearrangements. Nonsysnonymous and synonymous changes were reconstructed on branches using the codon-based likelihood model of Muse and Gaut , as impl obvious . Once a dN, dS, and the dN/dS ratio (ω) in likelihood ratio tests [Orobanche, Epifagus and Cistanche branches and (2) Harveya, Hyobanche and Boschniakia branches. Each of these tests used the data set from a single gene and compared two nested hypotheses: H1: the photosynthetic and non-photosynthetic branches share a single value . H2: the photosynthetic and non-photosynthetic branches have two separate values. If the tree has a significantly higher likelihood under H2, that is taken as evidence that the nonphotosynthetic branches have higher rates. Scatter plots and correlation tests were used to examine the degree of correlation between synonymous and nonsynonymous sites within a gene, and also to see if either class of sites was correlated between genes.Rate increases were compared among categories of taxa (such as photosynthetic and non-photosynthetic), using io tests . These tio tests indicateNDY and CWD conceived of and designed the study together. NDY did the sequencing, data analyses and drafted the manuscript. CWD provided the genomic DNA samples and provided the conducive laboratory environment, both physical and intellectual, as well as many suggestions for the manuscript.

The mining of information from scientific literature using computational tools has tremendous potential for knowledge discovery, but how close are we to realizing this potential? Biological databases offer access to formalized facts about many aspects of biology—genes and gene products, protein structure, metabolic pathways, diseases, organisms, and so on. These databases are becoming increasingly important to researchers. The information that populates databases is generated by research teams and is usually published in peer-reviewed journals. As part of the publication process, some authors deposit data into a database but, more often, it is extracted from the published literature and deposited into the databases by human curators, a painstaking process.www.ebi.ac.uk/embl/) or ArrayExpress (www.ebi.ac.uk/arrayexpress/), nobody receives credit for the submission of a fact to a database without an associated publication. As long as this practice continues, curation will be necessary to add the (re)formalised facts to biological databases.Research literature and scientific databases fulfil different needs. Literature provides ideas and new hypotheses, but is not constrained to provide facts in formats suitable for use in databases. By contrast, databases efficiently provide large quantities of data and information in a standardised schema representing a predefined interpretation of the data. While the acceptance of a paper can enforce the submission of data to a central data repository, such as EMBL , Unified Medical Language System (www.nlm.nih.gov/research/umls/), and MedDRA (www.meddramsso.com/NewWeb2003/index.htm) [Curators fulfil a second important task: they know how to define standards for data consistency, in particular, the most relevant terminology, which has led to the design of standardised ontologies and controlled vocabularies (see dex.htm) . These tControlled vocabulary: A set of terms, to standardise input to a database.F-measure: A statistic that is used to score the success of NE recognition by text mining tools. The F-measure is an average parameter based on precision (how many of the entities found by the tool are correct identifications of an entity) and recall (how many of the entities existing in the text did the tool find).Machine learning: The technology and study of algorithms through which machines (computers) can “learn”, or automatically improve their systems through data gathered in the past (experience).Ontology: A set of terms with clear semantics (language), clear motivations for distinction between the terms, and strict rules for how the terms relate to each other.The problem with curation of data is that it is time consuming and costly, and therefore has to focus on the most relevant facts. This compromises the completeness of the curated data, and curation teams are doomed to stay behind the latest publications. So, is it possible for curation and text mining to work together for rapid retrieval and analysis of facts with precise postprocessing and standardisation of the extracted information?www.gene.ucl.ac.uk/hugo; 20,000 gene and protein names), GO , Uniprot/Swiss-Prot , and other databases. In addition, terms describing diseases, syndromes, and drugs are available from the Unified Medical Language System. Altogether, about 500,000 terms constitute the basis of domain knowledge in life sciences. To gain some perspective of this figure: an average individual handles 2,000 to 20,000 terms in his or her daily language, and Merriam-Webster's Collegiate Dictionary provides definitions for 225,000 terms (www.merriam-webstercollegiate.com/).There are several software tools that perform well in the identification of standardised terms from the literature. Examples include Textpresso and Whatizit ,6,7,8. EThe identification of all terms by a text mining system still sets challenging demands. All variants of a term have to be taken into account, including syntactical variants and synonyms. In the case of ambiguities, relevant findings have to be distinguished from other findings—a process referred to as disambiguation. Depending on the curation task, it might therefore be advantageous to select only part of the terminological resources and thus restrict the domain of the terminology to the curators' needs .Available text mining solutions are concerned with named entity (NE) recognition , with identification of relationships between NEs (such as protein interactions), and with the classification of text subphrases according to annotation schemata in general (thyroid receptor is a thyroid hormone receptor) ,13,14,15Not all terms used in the literature (NEs) can actually be found in some kind of database . Text mining methods therefore have to detect new terms and map the term to known terminology . If sevewww.pdg.cnb.uam.es/BioLINK/BioCreative.eval.html, and JNLPBA, www.genisis.ch/~natlang/JNLPBA04/) [Over the past several years text mining research teams have presented various approaches that train a software tool to locate representations of gene or protein names ,18. ThesLPBA04/) ), which www.cs.cornell.edu/projects/kddcup/) had to select documents from a given corpus that contained relevant experimental results about Drosophila [Additional information-extraction methods have been proposed, for example, for the documentation of mutations in specific genes and for the extraction of the subcellular location of proteins ,13. An eosophila .For all automated information-extraction methods, it is obvious that access to literature is crucial. Electronic access has, of course, already had a huge impact, but the structure and organisation of manuscripts could also be improved. For example, semantic tags could be integrated into the text. The markup would not appear on web pages or when the document is printed, but it would help software to deal with semantic aspects of the document. Inserting tags, for example, to mark protein names would allow retrieval software to find documents about proteins even if they look like common English words, such as “you” or “and”. Retrieval engines currently often ignore such terms. In addition, explicit tags would enable text mining methods, for example, when looking for protein–protein interactions, to use the correct semantic interpretation.Text mining systems already available today, such as Whatizit, can integrate semantic tags during submission, which have to be verified by the author. Text mining is ready to deliver tools whereby information is passed back to the authors about the proper use of terminology within their documents. If the use of a term raises conflicts or ambiguities or if the use of a term is wrong, the author is asked to provide feedback. The curation effort is resolved at the earliest possible time-point. Author, publisher, reviewer, and reader profit from consistent information representation, which leads to better dissemination of documents and journals and easily offsets the additional cost in the generation of an article. Publishers and authors have to agree on standards though.Text mining solutions have found their way into daily work, wherever fast and precise extraction of details from a large volume of text is needed. We have to keep in mind, however, that any text mining tool, just like other bioinformatics resources, will only be suitable for a limited number of tasks. For example, the same text may serve curators from different communities who extract different types of facts, depending on their domain knowledge. Furthermore, different communities have different expectations for accuracy. For example, curators dealing with a small set of proteins prefer tools with high recall, whereas curators dealing with a large number of proteins prefer tools with high precision.Although text mining cannot dissect English sentences completely, and cannot extract the meaning and put the facts into a database, text mining tools are becoming increasingly used and valued. Text mining is ready to deliver handling of complex terminology and nomenclature as a mature service. It is only a matter of time and effort before we are able to extract facts automatically. The consequences are likely to be profound. Not only will we have a more effective approach for the mining of knowledge from the literature, our approach to the publication process itself might change. If a fact is clear enough for automatic extraction, it could be reported in a fact database instead of a publication. As methods improve, authors will see more and more of their text being analysed and formalised in a database. If appropriate quality control is provided, and if authors receive due credit for their deposition of facts into databases, we might well see a shift towards original papers describing new creative ideas and visions rather than just listing facts.

They are built from 14 different (VHA)-subunits. The paper addresses the question of sub-cellular localisation and subunit composition of plant V-ATPase in vivo and in vitro mainly by using colocalization and fluorescence resonance energy transfer techniques (FRET). Focus is placed on the examination and function of the 95 kDa membrane spanning subunit VHA-a. Showing similarities to the already described Vph1 and Stv1 vacuolar ATPase subunits from yeast, VHA-a revealed a bipartite structure with (i) a less conserved cytoplasmically orientated N-terminus and (ii) a membrane-spanning C-terminus with a higher extent of conservation including all amino acids shown to be essential for proton translocation in the yeast. On the basis of sequence data VHA-a appears to be an essential structural and functional element of V-ATPase, although previously a sole function in assembly has been proposed.Vacuolar Hin vivo-FRET between subunits fused to variants of green fluorescence protein in transfected cells.To elucidate the presence and function of VHA-a in the plant complex, three approaches were undertaken: (i) co-immunoprecipitation with antibodies directed to epitopes in the N- and C-terminal part of VHA-a, respectively, (ii) immunocytochemistry approach including co-localisation studies with known plant endomembrane markers, and (iii) +-ATPase. Immuno-localisation of VHA-a shows that the recognized subunit is exclusively located on the endoplasmic reticulum. This result is in agreement with the hypothesis that the different isoforms of VHA-a may localize on distinct endomembrane compartments, as it was shown for its yeast counterpart Vph1.All three sets of results show that V-ATPase contains VHA-a protein that interacts in a specific manner with other subunits. The genomes of plants encode three genes of the 95 kDa subunit (VHA-a) of the vacuolar type H Plant V-ATPase has been identified at the vacuolar and various other endomembranes, and also at the plasma membrane [1-part), and VHA-a, c, c', c", d and e for membrane-associated subunits (V0-part) [A. thaliana, oat and barley [A. thaliana [Mesembryanthemum crystallinum [Arabidopsis and Mesembryanthemum express a similar set of subunits [0-sector since its subunit composition is not resolved yet. VHA-a is the subunit with the highest molecular mass within the V-ATPase and reveals a bipartite structure. As first shown in yeast, VHA-a consists of a 50 kDa hydrophilic N-terminal domain and a hydrophobic, membrane-spanning C-terminus [o-domain [Vacuolar Hmembrane -3. The tmembrane . V-ATPasV0-part) . In planV0-part) ,7. Follod barley ,7. Howevthaliana . The sectallinum , and a tsubunits . An impoterminus -13. Inteterminus could noterminus . Anotherterminus . VHA-H io-domain .The aim of the study was to improve the understanding of V-ATPase distribution in plant cells with emphasis on the localization of VHA-a and VHA-H in the V-ATPase structure. Three specific questions were answered using different methodology: (i) Is VHA-a part of the V-ATPase structure? (ii) Where are different subunits localized within plant cells? (iii) Is FRET a suitable method to investigate subunit interaction within the complex, for example between VHA-a and VHA-c, and VHA-H and VHA-B.M. crystallinum was identified (AI822404) with similarity to known genes coding for VHA-a in yeast. Using RACE-PCR a full length cDNA was obtained with a size of 2783 bp. Its open reading frame encoded a hypothetical protein of 93.1 kDa. Database search with the program FASTA revealed the highest similarities to the entries At2g21410 (77%), At4g39080 (76 %) and At2g28520 (60 %) from the A. thaliana genomic database and also significant similarity on the amino acid level to the genes Stv1 (34 %) and Vph1 (38 %) from S. cerevisiae. These two latter genes are coding for isoforms of the yeast 100 kDa subunit whereas all other subunits of the yeast vacuolar ATPase are encoded by one gene each. The sequence alignment between the newly cloned amino acid sequence from M. crystallinum, the three isogenes from A. thaliana and the two isogenes from yeast a cDNA fragment from A. thaliana and M. crystallinum to the distinct yeast isoforms Vph1 and Stv1, in order to define orthologous genes, was not possible on basis of the amino acid sequence alignment. The comparison of the C-termini revealed a higher degree of sequence conservation interrupted through various short insertions or deletions. The sequence was analysed for secondary structures and membrane topology . The prediction correlated regions of high sequence conservation with the localisation of putative transmembrane domains , introduced and expressed in E. coli. The 42 kDa and 13 kDa polypeptides were purified to homogeneity by chromatography on Ni-NTA and by preparative SDS-PAGE. The 42 kDa polypeptide was recognized by a purified antibody against yeast Vph1 [N-term (not shown). The presence of VHA-a was investigated in plant endomembranes and soluble fractions rapidly prepared from 5 week old M. crystallinum plants. In the soluble and the membrane-fraction, the serum against McVHA-aN-term identified two polypeptides with apparent molecular masses between 65 and 70 kDa . Without protection from proteolysis, a band at about 50 kDa and a doublet band above 60 kDa were predominant. In the sample with protease inhibitor, the 95 kDa band appeared although as one of five bands of similar intensity if decreasing transfer efficiency of high molecular mass polypeptides from the gel to the membrane is assumed. Apparently, VHA-a is prone to degradation. However, the results also indicate that VHA-a is part of V-ATPase. To further prove that tentative conclusion, immunoprecipitation was performed using anti VHA-aN-termand anti VHA-amemb followed by Western blot analysis with anti VHA-E and anti-VHA-A and a labelling of the Golgi apparatus significantly stronger than with anti-VHA-a and excitation spectra (acceptor) and need to be situated in close proximity. Half maximum energy transfer takes place at distance of the Förster radius R0. Cyan and yellow fluorescent proteins constitute such a FRET pair and were fused to the C-termini of various subunits of V-ATPase. Under the assumption of freely rotating fluorophores, R0 is close to 5 nm. The size of the V-ATPase complex is about 15 nm (diameter) × 25 nm (length from lumen side to tip of head). Arabidopsis protoplasts were co-transformed with vector constructs of VHA-a fused to YFP and VHA-c fused to CFP under the control of the 35S promotor. Upon excitation of doubly labelled protoplasts at 458 nm both, CFP and YFP showed strong fluorescence this corresponds to a distance between VHA-a, and VHA-c of ~5.4 to 7.2 nm (mean 6.3 ± 0.8 nm). Here it has to be pointed out that each ring of the rotor V0 contains 5 VHA-c-subunits and one VHA-c"-subunit. Hence, dependent on the position of the VHA-c/CFP-subunits in the ring different distances between CFP-labelled VHA-c subunits and the YFP-labelled VHA-a subunit will result.FRET allows to investigate protein-protein interaction nce Fig. . Fluoresnce Fig. . This faSimilar experiments were performed with onion epidermis cells Fig. co-transArabidopsis gene products contain all charged amino acids that have been shown to be essential for proton-translocation at conserved positions in the membrane spanning region of the C-terminus have previously indicated a distribution of V-ATPase among nearly all endomembranes of the secretory pathway including the plasmalemma -3, 33-3-333-35. 1-structure of V-ATPase. The presence of both subunits on all these membranes shows the presence of fully assembled V-ATPase.In our examination the antisera against VHA-A and -E showed a staining of the tonoplast and to a lesser extent also of the ER and Golgi-Apparatus (data not shown). VHA-A and E are part of the cytoplasmically exposed VN-term on the other hand. Immuno-labelling indicates that VHA-aN-term antiserum exclusively labels the ER with some rare association on Golgi stacks. These results are surprising since the sequence features of McVHA-a suggest an essential involvement of VHA-a in proton transport. A possible explanation might be the presence of three different isoforms in A. thaliana and O. sativa which all share the localisation of the charged amino acids responsible for proton-translocation is exclusively associated with V-ATPase localised on the ER. The hypothesis of a compartment-specific localisation of VHA-a subunits is supported through several findings in plants and yeast. In yeast all known subunits and chaperones of the V-ATPase are encoded by one gene. Only the 100 kDa VHA-a is encoded by two different isoforms (Vph1 and Stv1) [S. cerevisiae and A. thaliana . In genend Stv1) ,39. In aficiency . The N-tIn plants, Matsuoka et al. were ablIn vivo-FRET in protoplasts expressing VHA-B/CFP and VHA-H-YFP confirms the orientation of the C-termini of VHA-B and H in close vicinity. It should be noted that co-expression of other pairs of chimeric donors and acceptors such as VHA-E/CFP and VHA-c/YFP did not elicit FRET after excitation of CFP (not shown). The assumed location of the C-terminus of VHA-c in the lumen of the endomembrane compartments and the C-terminus of VHA-E most likely in the vicinity of the head is in agreement with the negative result, i.e. the absence of FRET between VHA-E/CFP and VHA-c/YFP. The studies exemplify the suitability of FRET to analyse structural features of V-ATPase in vivo. The efficient but variable FRET in cells expressing VHA-c/CFP and VHA-a/YFP allows two conclusions: First, the C-termini of VHA-c and VHA-a are likely to be located on the same, i.e. luminal, side of the endomembrane compartments supporting the topological model with nine transmembrane-domains of VHA-a in plants as previously suggested for yeast [Our results from FRET analysis also allows to make some structural assignments: From crystal structure of F-ATP synthase, the C-termini of subunit β, homologous to VHA-A, and subunit α, homologous to VHA-B, are located in close vicinity and oriented to the membrane . Occurreor yeast ,23 , 4 mM dithiothreitol and a few crystals of phenylmethylsulfonylfluoride [® cocktail was added throughout the procedure. Following differential sedimentation and gradient centrifugation, tonoplast enriched membranes were recovered from a 30%/35% sucrose interphase, sedimented, frozen in liquid nitrogen and stored at -80°C.Leaves (50 g) of fluoride . As indi® system according to the supplier .Membrane proteins were separated on 12.5% sodium dodecylsulfate polyacrylamide gels, transferred to nitrocellulose and probed with anti-VHA-E , anti-VHFor immunoprecipitation, membranes were solubilised in 50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1 mM EDTA and 2% (v/v) Triton X-100, 5 μl anti VHA-a antiserum was added, and the samples were shaken at room temperature for 45 min. Then 150 μl protein A-sepharose equilibrated in the same buffer was added. After 15 min, the suspension was placed on a cushion of 1 ml of 40% sucrose and spun at 10,000 × g for 1 min. The sediment was washed thrice with 50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100 and 0.1 % (w/v) SDS, and finally once in 125 mM Tris-Cl, pH 6.8. The sediment was boiled in loading buffer and analysed by Western blot using rabbit antisera raised against VHA-E or A.N-term and anti-VHA-aMemb. For both the corresponding cDNA fragments of Mc-VHA-a were amplified by PCR using primer combinations a-nterm-f (ATG CGA TCG GAG CCG ATG CAA) and a-nterm-r (TTC ACC CAA CTC ATC GGT GG) encoding the 42 N-terminally located fragment, and a-memb-f (CTT CCA AAG CCC TTT ATT ATG) and a-memb-r (TCA CTC ATG TCC ACC ATG TCA ATC) encoding the polypeptide loop of about 13 kDa located between transmembrane domain 3 and 4 according to the topological model of Vph1p of S. cerevisiae [E. coli JM109. The 6x-his-tagged proteins were expressed, purified by chromatography on Ni-nitrilotriacetate columns, separated by preparative SDS-PAGE, excised as protein bands, eluted and used for immunization . In addition, antisera against subunits VHA-A , VHA-E, calreticulin in a site-directed manner after amplification from cDNA using th2, 4 mM morpholinoethane sulfonic acid, KOH , phl 5.7) and checked for sufficient intactness in the microscope. In short, 1 mm leaf slices of 3- to 5-week-old Arabidopsis plants were vacuum-infiltrated and cell walls were digested in media containing 1.5 % (w/v) cellulase R10 and 0.4 % (w/v) macerozyme R10. Protoplasts were gently sedimented by centrifugation, resuspended in W5 medium, sedimented again, resuspended in MMG medium and checked for sufficient intactness in the microscope. 110 μl PEG-medium (4 % (w/v) polyethylene glycol 4000, 0.2 M mannitol, 0.1 M CaCl2) and 20 μl plasmid DNA (3 μg/μl) were added to 100 μl protoplast suspension. The samples were incubated at room temperature for 15 min and then consecutively diluted with 0.5, 1, 2 and 4 ml W5-medium with 15 min incubation steps in between . Following 24 h incubation at 25°C, sedimented protoplasts were used for analysis.Protoplasts were gently sedimented by centrifugation, resuspended in W5 medium, sedimented again, resuspended in MMG medium . The distance between macrocarrier and tissue was 12 cm. The epidermis tissue was incubated for about 20 h at room temperature in the dark prior to analysis.Cells of onion epidermis were placed on filter paper soaked with one-strength MS basal medium in petri dishes and were transiently transformed with a biolistic approach. Gold particles were suspended in 50 % glycerol. 8.33 μl of the suspension were mixed with 8.33 μl plasmid DNA (1 μg/ μl), 8.33 μl 2.5 M CaCl4, 10 mM EGTA, 1 × phosphate buffered saline, pH 6.8), washed, permeabilised in 0.5% Triton X-100 and washed again. Following blocking of non-specific binding sites with 1 % bovine serum albumin, primary antibody was added for over night at 4°C. Washed samples were incubated with secondary antibody labelled with Cy3, Cy5 or FITC for 1 h. Double labelling was performed by combined application of primary antibodies from rabbit and guinea pig. Slides were mounted with Citifluor Mounting Medium. Fluorescence analysis was performed with a confocal laser scanning microscope Leica TCS-SP2 equipped with three lasers and excitation wavelengths of 458, 476, 488, 514, 568 and 633 nm. The double dichroic mirror DD488/543 was used for fluorescein isothiocyanate (FITC), and for Cy5 the triple dichroic mirror TD488/543/633 was used. Background was controlled and photomultiplier voltage (800 V) selected for maximum sensitivity in the linear range.Immuno-labelling was performed according to . In brie2PO4, 50 mM NaH2PO4, pH 7.0) for 45 min, washed with EM buffer and dehydrated with a series of increasing concentration of acetone. Samples were embedded in epoxyresin , cut into ultra-thin cross-sections of 60–70 nm and immobilized on 200 mesh gold nets. Immuno-decoration was performed with antibody diluted in Tris-buffered saline NaN3) for an hour. Samples were washed five times and incubated with secondary antibody conjugated to 15 nm gold particles. The samples were stained with 0.1 % (w/v) uranyl acetate for 5 s and afterwards with 2 % lead citrate. The samples were analysed with an electron microscope at 75 kV.Cells were fixed in 2.5% glutaraldehyde in EM buffer (50 mM KHo = 5 nm [CFP/bleached - ICFP/unbleached)/ICFP/unbleached and R = ((Ro6/E)-Ro6)1/6, where E is the transfer efficiency, and ICFP the fluorescence emission intensity in the CFP peak.Transformed protoplasts and onion epidermis cells were examined for the localisation of the CFP/YFP-fused proteins using the same CLSM set-up as mentioned above. Autofluorescence of 10 protoplasts, as well as reference spectra of YFP and CFP-derived fluorescence were recorded in the spectral range of 480 to 700 nm, averaged and used for corrections. Excitation was recorded at 458 nm (CFP and FRET) and 514 nm (YFP), respectively. Scan speed was 800 Hz. Acceptor dye was bleached with 100 % laser intensity. Emission spectra were recorded and averaged from 20 transformed protoplasts. For a first estimate of transfer efficiency, a Foerster radius for green fluorescence protein variants of Ro = 5 nm was used+-ATPase; Vph1: VHA-a subunit isogene in yeast; YFP: yellow fluorescence proteinCFP: cyan fluorescence protein; CLSM: confocal laser scanning microscope; FRET: (Förster) fluorescence resonance energy transfer; PAGE: polyacrylamide gel electrophoresis; Stv1: VHA-a subunit isogene in yeast; VHA: vacuolar HN-term; TS: co-transfection of protoplasts and epidermis cells, CLSM analysis; SB: immuno-co-localisation and discussion; SS: co-immuno-precipitation; MH: preparation of anti VHA-aMemb; BS-J: immuno-co-localisation and discussion; JR and MS: FRET analysis; DG: transformation and construct design, KJD: project design and supervision.CK: VHA-a sequence analysis, immuno-cytochemistry, transient expression systems, preparation of anti VHA-a

Only controlled blocks are capable of confirming the zygapophysial joints (ZJ) as the pain generator in LBP patients. However, previous workers have found that a cluster of clinical signs ("Revel's criteria"), may be valuable in predicting the results of an initial screening ZJ block. It was suggested that these clinical findings are unsuitable for diagnosis, but may be of value in selecting patients for diagnostic blocks of the lumbar ZJ's. To constitute evidence in favour of a clinical management strategy, these results need confirmation. This study evaluates the utility of 'Revel's criteria' as a screening tool for selection of chronic low back pain patients for controlled ZJ diagnostic blocks.This study utilized a prospective blinded concurrent reference standard related validity design. Consecutive chronic LBP patients completed pain drawings, psychosocial distress and disability questionnaires, received a clinical examination and lumbar zygapophysial blocks. Two reference standards were evaluated simultaneously: 1. 75% reduction of pain on a visual analogue scale (replication of previous work), and 2. abolition of the dominant or primary pain. Using "Revel's criteria" as predictors, logistic regression analyses were used to test the model. Estimates of sensitivity, specificity, predictive values and likelihood ratios for selected variables were calculated for the two proposed clinical strategies.Earlier results were not replicated. Sensitivity of "Revel's criteria" was low sensitivity (<17%), and specificity high (approximately 90%). Absence of pain with cough or sneeze just reached significance (p = 0.05) within one model."Revel's criteria" are unsuitable as a clinical screening test to select chronic LBP patients for initial ZJ blocks. However, the criteria may have use in identifying a small subset (11%) of patients likely to respond to the initial block (specificity 93%). It is estimated that 15 – 40% of chronic low back pain patients have pain arising from the lumbar zygapophysial joints (ZJ). PreviouBecause prognosis for acute low back is good, invasive and expensive and invasive diagnostic testing cannot be justified. However, persistent disabling pain needs more intensive investigation in order to determine appropriate management strategies. Back pain of ZJ origin may be treated using intra-articular steroid injection,10., or The current study objectives were to estimate the predictive value of the two clinical strategies of Revel et al (1998), using similar measurement parameters (75% reduction in pain VAS after ZJ block), and apply alternative analytic methods to explore any potential utility of the variables used.This study utilized a prospective, blinded, concurrent, reference standard-related validity design with intra-articular ZJ or medial branch blocks as the reference standard against which clinical variables were compared. Local Institutional Review Board approval was granted at the beginning of the study. A 75% or more reduction in pain following ZJ block on pain VAS was designated as reference standard A, the same standard used by Revel et al (1998). Based on pain drawings and patient self-report, complete abolition of the patient's primary or dominant pain was designated as reference standard B. Dominant pain location was acquired by pain drawing and direct questioning, and documented prior to clinical examination and diagnostic injection in a prospective manner. Post injection dominant pain location was acquired by reference to pain drawings and direct questioning also.Patients with low back pain with or without lower extremity symptoms, referred to a private radiology practice in New Orleans, USA specializing in the diagnosis of spinal pain, were invited to participate in the study. Patients receiving ZJ blocks were either referred specifically for that procedure or had the procedure included in their radiology examination based on pre-injection clinical evaluation by the injectionist (CA). Between May 2001 and October 2002, physical therapists attended the clinic in blocks that ranged from 4 to 8 weeks (ML) and examined patients. Normal scheduling was not affected by the presence of the visiting therapists, so patients were consecutive during these periods. All patients had undergone imaging studies prior to referral from a variety of medical and paramedical practitioners. Some were self-referred.Patients were excluded from the study if they were unwilling to participate, were too frail to tolerate a physical examination, or were deemed by any member of the clinic team to be unable to comprehend the study procedure. Prior to the formal clinical examination, clinic staff recorded basic demographic and medical data.100 mm visual analog scales (VAS) scales for current, best and worst pain. A current pain VAS was repeated after the clinical examination and following ZJ blocks. The 23-point Roland-Morris Disability Questionnaire was compHistory taking and a structured physical examination were carried out by a physical therapist with 30 years of clinical experience as a manipulative therapist (ML). Some patients were examined by a physical therapist with 17 years experience (SBY). The clinical examination occupied 30 to 60 minutes and included many tests besides those necessary for the current analysis, as part of a larger project. Inconclusive findings or incomplete examinations were documented. The physical examination included a visual assessment of range of motion, recording anatomical location of dominant pain, nerve tension tests, key muscle strength tests, tendon reflex tests, light touch sensitivity, a McKenzie styled ePrior to ZJ blocks, the radiologist reviewed case notes and imaging studies, and conducted a physical examination that guided the type of diagnostic procedure to be employed and the target structures. Intra-articular ZJ joint injection or MBB using standard technique was carrPhysical therapists conducting the clinical examination were blinded to the results of previous imaging studies and diagnostic injections, the Roland, Zung and MSPQ questionnaires. The injectionist was blinded to the results of the physical therapy examination and diagnostic conclusions.Basic statistical values for demographic variables and regression analyses were calculated using statistics software (Minitab version 13.31 © Minitab Inc 2000). Differences between included and excluded patients were evaluated with the student's t, chi square, and Kruskal-Wallis tests where appropriate. Significance for differences was set at p < 0.05.Calculations of sensitivity, specificity, predictive values and likelihood ratios with 95% confidence intervals were performed using Confidence Interval Analysis software © Bryant T.N. 2000.Initial ZJ blocks were carried out on 151 chronic low back pain patients. Thirty-four patients were excluded from analysis as they received another intervention in the same procedure session and did not return for differentiating and confirmatory blocks. One case was excluded through incomplete data on Revel's criteria. Following ZJ block, 27 of 116 patients satisfied reference standard A. Data required for determination of Reference standard B were missing for five of the 116 cases. Eighteen of these 111 patients satisfied reference standard B. Table In specifically evaluating Revel's criteria against reference standard A, logistic regression failed to achieve significance as a model . Two variables; "absence of pain with coughing and sneezing" and "no exacerbation of pain rising from flexion", showed a trend towards significance as predictors within the model (p = 0.07).Using Revel's criteria within a logistic regression with reference standard B as the response variable, a strong trend towards significance was reached . One component variable (age over 65) individually reached significance within the model: . In the whole sample 12.5% were aged over 65 years whereas of the 19 positive responders six were over 65 years (31.6%).The same patients satisfied both strategies of Revel et al. Estimated sensitivity, specificity, predictive values and positive likelihood ratios for both strategies of Revel et al are presented in Table Of the 27 patients satisfying reference standard A, 13 (48%) returned for confirmatory ZJ blocks. Three of these reported 75% or more reduction in pain following the confirmatory block. None of the three patients with confirmed ZJ pain satisfied Revel's criteria.The current data produces results that are in stark contrast to those of Revel et al (1998) with sensitivity low and specificity high. However, 'no pain with cough and sneeze' and 'no exacerbation of pain rising from flexion' approached statistical significance in relation to a 75% reduction pain after ZJ block (reference standard A). These variables are in line with Revel's results. Age over 65 is associated with reference standard B (abolition of primary pain). Likelihood ratios for the criteria are lower in the current data also. Some of the differences in results may be explained by a number of factors:1. Revel et al's study was a placebo controlled design whereas we did not routinely utilize a similar or equivalent control.2. The patients in Revel et al's sample were older (mean 58 versus 43 years), and had a shorter duration of symptoms (mean 78 versus 160 weeks).3. It is also possible that the high level of standardization when acquiring the criteria data in the current study, and the prospective methodology might have contributed to the differences in results.Following anaesthetic blocks, patients frequently state that the pain prompting consultation is abolished, yet a post-procedure pain VAS still registers more than 0/100. In this study reference standard B was evaluated as an alternative to the usual standard, so that pain in areas above the lumbar spine or pain directly attributable to the needle insertion site do not result in inappropriate post procedure VAS scores. In the interests of developing more precise instruments documenting results of diagnostic blocks, we propose that in future studies, the VAS scale should specifically refer to the primary pain complaint for which the diagnostic block is undertaken.Based on the current data, Revel's criteria are not suitable as a screening test to select patients suitable or unsuitable for an initial screening ZJ block. Such a screening device should have high sensitivity to ensure that most patients likely to respond are included in the initial diagnostic block. Our study suggests that, at best, Revel's criteria, might identify a small subset (11%) of patients likely to respond to a screening block (specificity 93%).Neither strategy utilizing Revel's criteria is suitable as a clinical screening device for selection of chronic LBP patients for initial diagnostic ZJ blocks. In contrast to Revel's findings, the current data demonstrated low sensitivity and high specificity for these clinical criteria. The high specificity of the criteria reported in this study relates to a single uncontrolled screening block. Consequently these criteria can not considered diagnostic of painful lumbar ZJ. Only placebo controlled or double ZJ blocks are able to diagnose this source of low back pain.The author(s) declare that they have no competing interests.ML conceived the design of the study, examined all but 10 patients, carried out data analysis and prepared the manuscriptBÖ assisted in project design and manuscript preparationCNA assisted in project design, provided facilities and conducted fluoroscopically guided injectionsBMcD carried out data analysis and assisted in manuscript preparation.All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Male suicide rates continued to increase in Scotland when rates in England and Wales declined. Female rates decreased, but at a slower rate than in England and Wales. Previous work has suggested higher than average rates in some rural areas of Scotland. This paper describes trends in suicide and undetermined death in Scotland by age, gender, geographical area and method for 1981 – 1999.Deaths from suicide and undetermined cause in Scotland from 1981 – 1999 were identified using the records of the General Registrar Office. The deaths of people not resident in Scotland were excluded from the analysis. Death rates were calculated by area of residence, age group, gender, and method. Standardised Mortality Ratios (SMRs) and 95% confidence intervals were calculated for rates by geographical area.Male rates of death by suicide and undetermined death increased by 35% between 1981 – 1985 and 1996 – 1999. The largest increases were in the youngest age groups. All age female rates decreased by 7% in the same period, although there were increases in younger female age groups.The commonest methods of suicide in men were hanging, self-poisoning and car exhaust fumes. Hanging in males increased by 96.8% from 45 per million to 89 per million, compared to a 30.7% increase for self-poisoning deaths. In females, the commonest method of suicide was self-poisoning. Female hanging death rates increased in the time period.Male SMRs for 1981 – 1999 were significantly elevated in Western Isles , Highland , and Greater Glasgow . The female SMR was significantly high only in Greater Glasgow .All age suicide rates increased in men and decreased in women in Scotland in 1981 – 1999. Previous findings of higher than expected male rates in some rural areas were supported. Rates were also high in Greater Glasgow, one of the most deprived areas of Scotland. There were changes in the methods used, with an increase in hanging deaths in men, and a smaller increase in hanging in women. Altered choice of method may have contributed to the increased male deaths. Compared to the adjacent countries of England and Wales, Scotland had a low suicide rate through most of the twentieth century . This diSeveral authors have noted the importance of suicide in Scotland as a public health problem ,10. TherWe used anonymised information on deaths by suicide and undetermined deaths provided by the General Register Office for Scotland (GROS). Deaths registered during 1981 – 1999 were included if the cause of death was recorded as suicide or as undetermined cause (ICD-9 E950-E959 and E980-E989 respectively). Undetermined deaths were included as suicide deaths may be misattributed ,14.Population figures were taken from the GROS annual reports for the mid-year of each period. For analyses by area, if a death was registered away from the person's home address, the death was allocated to their area of residence, rather than the area in which they died. Deaths of people resident outside Scotland were identified using country codes, and were excluded. As far as possible, therefore, results reflect the rates of suicide and undetermined deaths of people resident in each area of Scotland. Standardised Mortality Ratios were calculated for National Health Service administrative areas, with 95% confidence intervals. In time period descriptions, the periods 1981 – 1985, 1986 – 1990, 1991 – 1995, and 1996 – 1999 were used. Data were analysed using Excel and SPSS.There were 14502 deaths recorded as suicide or undetermined cause in the time period. Of these deaths, 28.5% occurred in females (n = 4137) and 71.5% in males (n = 10365).Table Examining changes by age group in males Table , there aIn women, there were increases in the three youngest age groups, with a 76% increase in rates in the under 15 year old group, 150% in the 15 – 24 year group and 37% in 25 – 34 year olds (Table The epidemiology of suicide in Scotland has changed greatly between 1981 and 1999. Male suicide rates have increased in all age groups up to and including 35 – 44 years. The highest male suicide and undetermined death rates in 1996 – 1999 were in the 25 – 34 year age group. In women, rates dropped in age groups from 35 – 44 years up to and including 75 years and over. Rates increased in younger women.There is limited information on the factors underlying individual deaths from suicide in Scotland. Squires and Gorman reviewedSome methods of self-harm have higher case fatality rates . FirearmThe difference between areas was also of note. The lower rates of increase in the areas with the highest initial rates may reflect to regression to the mean. Method availability may be iAvailability of method would not explain the differences between apparently similar rural areas. Previous work has found that deprived areas of Scotland tend to have higher suicide rates ,28. DeprUsing routine information allowed a large number of suicide and undetermined deaths to be included in this series. There are, however, limitations to the use of anonymised routine data. No qualitative information was available, and our exploration of the data was limited to trends with no examination of possible underlying causes. The increase in the rate of deaths recorded as suicide or undetermined cause of death, but where no detail on method was included, could conceal recent trends. The increase as a percentage of relevant registrations was small, however, increasing from 7.5% in the first period to 9.1% in the last period studied. The classification of deaths as suicide is often difficult, but the inclusion of undetermined deaths as well as deaths recorded as suicide should have helped to minimise bias from under identification ,30. SquiA divergence between male rates in England and Wales and in Scotland, and in male and female rates within Scotland, had been identified for the first part of the time period described here. This work found that male rates of suicide and undetermined death continued to increase in Scotland, but also identifies increases in younger female age groups. Examination of changes in method by male and female age group will help to establish whether changes in case fatality because of altered method choice may be pSome rural areas of Scotland had significantly elevated male suicide rates. We have suggested that access to lethal means of suicide may be one contributing mechanism for this, and have also noted the higher than expected suicide numbers in some rural occupations . Rural aThe authors declare that they have no competing interests.CS had the idea for the study, wrote the grant application, contributed to the design and interpretation and drafted the paper. Diane Gibbs and Tracey Rapson analysed the data. Paddy Hopkins contributed to the design, undertook part of the analysis, and commented on the interpretation of the results. Alan Belbin and Alistair Hay contributed to the design and helped interpret the results. All authors read and approved the final draft of the paper.The pre-publication history for this paper can be accessed here:

Batrachochytrium dendrobatidis was identified from sick and dead frogs. Since then, several lines of evidence suggest that B. dendrobatidis may be involved in frog declines: the fungus has been found on frogs in afflicted areas; lab studies show that it's highly pathogenic to some frog species; and pathological evidence links it to host mortality. But with little information about the prevalence of this fungal infection in wild frogs, or how the disease impacts frogs in the wild, the causal role of this chytrid fungus remains unclear.Amphibian declines have reached crisis proportions in various parts of the world. In many areas, habitat loss is the likely culprit. But when mass die-offs suddenly occurred in relatively undisturbed habitats, the cause was far less obvious. Fourteen species suffered either extinctions or major declines in the pristine rainforests of Queensland, Australia, between 1979 and 1993. It was suggested in 1996 that some unknown disease had spread through the populations, but no pathogen was discovered until 1998, when the fungus B. dendrobatidis on frogs in their natural habitat, Richard Retallick et al. focused on six species living in the high-elevation rainforest streams of Eungella National Park in Queensland, Australia, where frog losses were “particularly catastrophic.” Two species vanished between 1985 and 1986: the Eungella Gastric-Brooding Frog (Rheobatrachus vitellinus), which is now thought extinct, and the Eungella Torrent Frog (Taudactylus eungellensis), which later reappeared in a few small populations. Other local frog species escaped this period relatively unscathed.To evaluate the effects of B. dendrobatidis had yet to be identified, but Retallick retained the toe tips, and the authors tested the toes for disease in 2002–2003. Fungal infections were found in two species—T. eungellensis and Litoria wilcoxii/jungguy ; the other four species were infection-free. L. wilcoxii/jungguy did not decline to any great extent during the 1985–1986 die-off.Retallick captured frogs from six sites from 1994 to 1998, clipped one or two toe tips from each frog to age and identify them, and then released the frogs back into the wild. At the time, T. eungellensis frogs was greatest at three particular sites, which showed peak infections during cooler months. Prevalence of infection was highest during winter and spring, but did not vary from year to year, suggesting that the infection is now endemic. Fungal infections were found in 27.7% of L. wilcoxii/jungguy frogs, with no evidence that prevalence differed among sites, seasons, or individuals . The probability of recapture was significantly lower for frogs that were already infected when first captured. While this might suggest a correlation between infection and death, it's impossible to distinguish death from simple failure to recapture the animal. On further analysis, McCallum and colleagues found no evidence that survival differed between infected and uninfected frogs, suggesting that this potentially devastating amphibian disease now coexists with the frogs, with little effect on their populations.The proportion of infected T. eungellensis, a rainforest frog listed as endangered, “now persist with stable infections of B. dendrobatidis.” While these findings do not exonerate the fungus as the agent of mass declines, they do rule out the possibility that the fungus caused the decline, then vanished from the area, allowing frog populations to recover. The authors allow that it's possible that B. dendrobatidis did not cause the initial T. eungellensis declines. Or alternately, the fungus could have emerged as a novel pathogen in the ecosystem, causing massive casualties before some form of evolutionary response took hold. Surviving frog populations may have evolved resistance to the pathogen, for example, or less virulent strains of the fungus may have evolved. If it turns out that frog populations can develop resistance to the chytrid fungus, the researchers point out, then a conservation program of captive breeding and selecting for resistance could potentially thwart the extinction of these, and other, critically endangered frogs. A critical next step, then, is to determine whether frogs and fungus do coevolve.These results, the authors conclude, “show unequivocally” that remaining populations of

The purpose of this study was to evaluate the role of study quality assessment of primary studies in cancer practice guidelines.Reliable and valid study quality assessment scales were sought and applied to published reports of trials included in systematic reviews of cancer guidelines. Sensitivity analyses were performed to evaluate the relationship between quality scores and pooled odds ratios (OR) for mortality and need for blood transfusion.Results found that that whether trials were classified as high or low quality depended on the scale used to assess them. Although the results of the sensitivity analyses found some variation in the ORs observed, the confidence intervals (CIs) of the pooled effects from each of the analyses of high quality trials overlapped with the CI of the pooled odds of all trials. Quality score was not predictive of pooled ORs studied here.Had sensitivity analyses based on study quality been conducted prospectively, it is highly unlikely that different conclusions would have been found or that different clinical recommendations would have emerged in the guidelines. Quality assessment of trials included in systematic reviews of evidence is a resource intensive and scientifically controversial endeavour. On the one hand, the routine use of quality assessment in the development of systematic reviews is encouraged by the Evidence-based Practice Center Program of the Agency for Healthcare Research & Quality (AHRQ) and the Cochrane Collaboration, two well respected groups that coordinate a substantial number of systematic reviews -3. IndeeThe concept of incorporating study quality assessment into systematic review methodology has also found empirical support. There is evidence that studies of lower methodological quality tend to report larger treatment effects than high quality studies -7. For eAlthough this seminal work yields compelling results, these findings are not universal and the issue is not without detractors -14. SomeTogether these results suggest the study quality issue is controversial and that the merits of this methodological step in systematic review requires thoughtful analysis. Indeed, West et al conclude with recommendations advocating for research dedicated to comparing quality rating systems and the role of quality assessment within individual clinical contexts and for studies targeted at determining specific quality factors that make a difference in final quality scores .The Practice Guidelines Initiative of the Cancer Care Ontario's Program in Evidence-based Care (PEBC) uses the Guidelines Development Cycle to create cancer practice guidelines comprised of a systematic review of the research literature, an interpretation and consensus of the evidence by members of the guideline development team, clinical recommendations informed by the evidence, and an external review process by Ontario clinicians -19. We f1. What valid and reliable quality assessment instrument would be most appropriate for our context?2. How is study quality currently being used in published systematic reviews of cancer trials and what is the relationship between effect size and study quality in this disease area?3. What impact would study quality assessment have on the clinical recommendations made in evidence-based practice guidelines developed by the PEBC?For a comprehensive review of the strengths and weaknesses of quality assessment instruments, readers are referred to the 2002 West et al. evidence report commissioned by the AHRQ . For ourTo locate systematic reviews on oncology topics, the strategy suggested by Moher et al for finding systematic reviews was combThe validated scales were applied by two methodologists (MJ and MC) to studies reported in any our practice guidelines that included a pooled analysis based on at least ten randomized trials related to the main guideline question. Intraclass correlation coefficients with 95% confidence intervals (CI) were calculated using a random sample of the RCTs to assess inter-rater reliability, one coefficient calculated for each of the scales used. Because of budgetary limitations for staff time, the analysis was conducted on 18 randomly selected studies rather on the whole group of articles. This is a methodological limitation as fewer studies result in larger confidence intervals and less precise estimates. This may account for the difference in reliability ratings we found for the Sindu scale compared to published norms based on total quality score. Where the scale developer suggested a cut-off point for low versus high quality, this was used. Where no cut point was specified, the observed median study quality score was used as the dividing point between low and high quality. Meta-analyses were repeated with the high quality studies. Because there would never be a situation in which guideline developers would consider low quality studies only, a meta-analysis using this sample of the studies was not conducted.Four scales meeting our criteria were found; two instruments, Jadad et al and Cho The literature review located 32 published systematic reviews on oncology-related topics that included some measure of study quality. Five of the reviews examined changes in pooled estimates of effect size of mortality rates when meta-analysis was restricted to high-quality randomized trials -30. As sThree of the PEBC practice guidelines included at least 10 RCTs in their systematic reviews of the evidence and were eligible for inclusion in this evaluation -33: concAt the conclusion of our study, we identified a fourth practice guideline which originally did not meet our 10 RCT inclusion criteria, but later did so after it was updated. The guideline focused on the role of erythropoietin (EPO) in the management of cancer patients with non-hematologic malignancies . Unlike Intraclass correlation coefficients used to established inter-rater reliability were 0.71 for the 3-item Jadad scale , 0.80 for the 6-item Jadad scale , 0.62 for the Sindhu scale , and 0.63 for the Downs & Black Scale . Disagreements were resolved by consensus. Where consensus could not be reached, a third rater (MB) assessed the items and provided the tiebreaker score.While the total quality scores emerging from each of the different scales did all significantly correlate with one another (range r = .35 to r = .73), there was considerable variation in the classification of studies as high quality or low quality as a function of the scale that was applied Table . For exaThe 20 comparisons from the 18 trials included in the head and neck concomitant therapy systematic review yielded 2, 14, 12 and 14 high quality studies, respectively, when the Jadad 3-item, the Jadad 6-item, the Sindhu and the Downs & Black scales was used. Although both Jadad 6-item and Downs & Black scales both assessed 14 comparisons to be from high quality studies, only 11 of these 14 studies were the same. For the 12 comparisons from studies categorized as high quality with the Sindhu scale, 10 of these were also rated high quality by both the Jadad 6-item and the Downs & Black scales, the other 2 were rated as high quality by the Jadad 6-item scale only. There was 1 comparison from a study rated as high quality by the Jadad 6-item scale only and two from studies rated as high quality by the Downs & Black scale only.Mortality data used for the meta-analysis included in the guideline reports were available for two guidelines and need for blood transfusion data were available for the third ,32,34. FOnly the 6-item Jadad scale was applied to the studies of the EPO guideline and the data were pooled to calculate an overall risk ratio for blood transfusion . The risSeveral conclusions can be drawn from this study and review of the literature. First, there are established methods for assessing the quality of randomized controlled trials in which data on adequate reliability and validity were available. West et al uncovered 32 scales, check lists and component systems concerned with evaluating RCTs ; more thAlthough all of the scales we used have established reliability and validity estimates, we found that the number of trials categorized as high quality or low quality depended specifically on the scale that was applied. For the head and neck cancer systematic review, the number comparisons from high quality studies ranged from 2 to 14 . The range for the colon cancer review was 0 to 9. There was also considerable variability regarding the specific quality category in which each trial was placed. These finding are consistent with those of Juni et al [The lack of consistency of study classification from one scale to the next and the lack of clear cut-off criteria for users to employ when measuring quality of studies, presents a challenge to guideline developers when they need to make choice about which instrument they ought to adopt if the choose to adopt an instrument at all. Rather than clear evidence driving our decisions, we considered other features of the instrument in our decision making. Of the rating scales we examined, our preferred choice would be the Jadad 6-item instrument. In contrast to the others considered in this report, this instrument is relatively easy to implement and interpret and good inter-rater reliability was established. Further, although the 3-item version of the Jadad scale is most commonly used, we found the original 6-item version to be more relevant in our clinical context as it provides greater variation in scores. In the cancer discipline, few trials are placebo-controlled and treatment allocation tends to be poorly reported. In contrast to the pain trials which were profiled in the development phase of the Jadad instrument, the majority of the items in the 3-item version (randomization and blinding items) yield no variation in scores in our context and are, therefore, not useful to discriminate among cancer trials. The 6-item version of the scale more aptly differentiates quality across studies and includes more quality domains for which an empirical basis has been established .Another conclusion that can be drawn from this study is that effect size can be related to study quality but that the nature of the relationship in one clinical area may not generalize to another clinical area. Some of the original work examining the role of study quality reinforces the need to be mindful of the variation among studies included in systematic review -7. HowevWe conducted sensitivity analysis on the systematic reviews comprising the guidelines developed by the PEBC. Only four systematic reviews among 36 eligible practice guidelines included more than 10 trials with data appropriate for pooling; three from which we could extract data. Although there was some variation in the odds ratios observed, the confidence intervals of the pooled effects from each of the analyses of high quality trials overlapped with the confidence intervals of the pooled odds with all of the trials. In no case would the conclusions based on these results be affected by restricting the meta-analysis to only high quality studies; the recommendations remained the same. Had sensitivity analysis based on study quality been conducted prospectively, it is highly unlikely that different conclusions would have been drawn from the systematic review or that different clinical practice guidelines would have been formulated.Together, these findings lead to our final conclusion that measuring study quality did not translate into altered conclusions from a systematic review in the oncology domain for the outcomes we used here. Thus, at this time we have decided that measuring study quality using a numerical assessment scale for the purposes of sensitivity analysis will not be a routine part of our guideline development program. We will, however, encourage guideline developers to describe the variation among studies and to point out methodologic flaws. In addition, it will be important for us to repeat this study looking at other outcome measures, such as quality of life and adverse effects, as they become more routinely reported in primary cancer research and incorporated into our practice guidelines. Outcomes other than those studied here may be more sensitive to the issues of study quality.This study highlights a strategy that may be useful for guideline programs to utilize in making decisions regarding the methods employed in their guideline development process. It is important that scientific inquiry be maintained in studying the value and role of study quality assessment rather than accepting its role as convention. By exploring it within a specific clinical context one can identify it's most appropriate application.The author(s) declare that they have no competing interests.MB, MJ and GB conceived of the project idea and developed the protocol. MB, MJ, and MC conducted by study. SH provided statistical advice and AJ provided conceptual advice. The manuscript was drafted initially by MB and MJ. All authors contributed to the final version submitted for publication.The pre-publication history for this paper can be accessed here:

Mast cell (MC)-derived serine proteases have been implicated in a variety of inflammatory processes. We have previously shown that rat peritoneal MC (PMC) express mRNA for protease activated receptor 2 (PAR-2), a G-coupled receptor activated by trypsin-like proteases. Recent evidence also suggests that MC-induced inflammation can be mediated through PAR. Therefore, we hypothesized that specific PAR-2 agonist peptides (PAR-2ap) induce protease release from PMC.Western blot analysis of PMC supernatants revealed that a PAR-2ap, tc-LIGRLO (10 μM), stimulated the release of rat MC protease (RMCP)-1, RMCP-5 and carboxypeptidase-A. The release was evident by 20 min but further increased up to 8 h. To study the biological effects of protease release we tested supernatants from tc-LIGRLO, tc-OLRGIL (inactive control peptide) and antigen-activated PMC for proteolytic activity by seeding with TNF (150 pg/ml), incubating for 8 h at 37°C, and measuring TNF remaining in the supernatants. Supernatants from tc-LIGRLO-stimulated PMC degraded 44 % of seeded TNF (n = 5). Moreover, this TNF proteolysis was dependent on the concentration of tc-LIGRLO used to stimulate PMC, and was significantly inhibited (94 %) by soybean trypsin inhibitor. Antigen and tc-OLRGIL induced no significant release of such proteolytic activity.These data indicate that a PAR-2ap induces the release of proteases from mast cells, which may degrade extracellular cytokines and other substrates thus modulating the inflammatory response. Peptides that are similar in sequence to the tethered ligand domains of PAR-2, such as SLIGRL-NH2 (SLI) or tc-LIGRLO-NH2 (tc-LIG) are able to interact directly with the activation site and act as potent agonists [Protease activated receptor-2 (PAR-2) has been identified on a variety of cell types including eosinophils , neutropagonists .A growing number of studies have identified a role for PAR-2 in inflammation. There is a delayed onset of inflammation in PAR-2 knock out mice , and PARin vivo could be MC-mediated. The administration of PAR-2ap or trypsin into the rat hind paw enhanced vascular permeability and caused edema formation, which can be abolished by repeated pre-treatment with compound 48/80, known to deplete the MC of its granular content [et al., 1999 [The ability of serine proteases to activate MC and the observation that MC express PAR-2 ,13, sugg content . By contl., 1999 showed tActivation of PAR-2 on the surface of mast cells could act as part of an autocrine and paracrine positive feedback loop through the release of serine proteases that could activate further PAR-2 on mast cells or other neighboring cells. Therefore, we investigated the direct effects of PAR-2ap on the release of serine proteases from purified PMC and the effects of these released proteases on extracellular protein degradation. In particular we studied the release of rat mast cell protease-1 (RMCP-1), RMCP-5 and carboxypeptidase A (CPA).To identify proteases released by mast cells following PAR-2ap stimulation we activated PMC with tc-LIG (10 μM), and analyzed the supernatants for various mast cell proteases by western blotting, using antisera against the amino-terminal sequences of RMCP-5 and MC-CPA and an antiserum against RMCP-1 protein. In supernatants from tc-LIG-treated PMC one band for RMCP-1 (30 kDa), two bands for RMCP-5 (34 and 35 kDa), and three bands for CPA were detected Fig. . The PARNippostrongylus brasiliensis antigen (Nippo Ag) (10 We/ml) induced no detectable release of any of the three proteases studied , which however, was associated with protease release , tc-LIG (10 μM), tc-OLR (10 μM) or compound 48/80 (0.5 μg/ml) for 20 min or 8 hr at 37°C and the supernatants were collected. These supernatants or media were then seeded with 150 pg/ml of rat recombinant TNF and incubated for an additional 8 hr. At the end of the incubation TNF was measured by ELISA and the proteolytic activity was calculated as % degraded TNF (as discussed in the methods section). Proteolytic activity in the supernatants of sham-treated cells was subtracted from that in the supernatants of activated PMC. Supernatants from sham-treated PMC showed significant loss of seeded TNF (17 ± 7 % at 20 min and 22 ± 5 % at 8 hr) as compared to media. At both 20 min and 8 hr of treatment supernatants from tc-LIG-treated MC (10-0.1 μM) showed a greater loss of seeded TNF compared to supernatants of sham-treated MC (p < 0.05), suggesting tc-LIG-mediated activation induced the release of proteolytic activity. Proteolytic activity, following subtraction of spontaneous proteolytic activity released, was 44 ± 5 % at 8 hr and 30 ± 4 % at 20 min following PMC activation with 10 μM of tc-LIG before seeding with TNF. SBTI inhibited TNF loss from the supernatants of tc-LIG (10 μM) stimulated PMC by 82% Fig. , confirmWe have previously shown that PMC express PAR-2 mRNA, that can be regulated by cytokines and PAR-2ap . We haveNippo Ag.In this study, we provided the first direct evidence for serine protease release from PMC measured by Western blot analysis of the supernatants, in addition to proteolytic activity assays. The sizes of released RMCP-1 (~30 kDa), RMCP-5 and CPA are similar to the sizes of the stored forms of these proteases that we published previously . The difin vivo and in vitro. The release of RMCP-2 by rat mucosal mast cells has been reported to be induced by antigen challenge in parasitic infections, and during anaphylaxis [2+ ionophore and antigen activation of PMC [Previous studies have shown that activation of MC to release protease activity may be induced by a variety of agents both phylaxis -21. The phylaxis . Furthern of PMC .In our experiments FcεRI-mediated PMC stimulation did not release detectable levels of RMCP-1, RMCP-5 or CPA, or any proteolytic activity with the ability to degrade TNF. It is possible that FcεRI-mediated activation induces low levels of protease release which is undetectable by Western blotting. Furthermore, the lack of demonstrable proteolytic activity in the supernatants does not necessarily indicate that proteases are not released since it may be due to an FcεRI-mediated simultaneous release of protease inhibitors stored in the MC. Indeed, MC produce and release secretory leukocyte protease inhibitor (a chymase inhibitor) and latexin (a CPA inhibitor) ,24. FinaGiven that RMCP-1 and RMCP-5 are present in the supernatants of tc-LIG-stimulated MC, it is likely that these proteases are involved in the TNF degradation. However, antibodies to RMCP-1 inhibited TNF degradation by supernatants of sham treated cells but did not affect the additional degradation of supernatants from tc-LIG activated MC (unpublished observation). We cannot rule out that PAR-2ap activated PMC release other proteases, including the tryptases RMCP-6 and RMCP-7 , which min vivo. It may be that such proteolytic activity directed against TNF, and possibly other cytokines, is an important anti-inflammatory function for mast cell serine proteases.Our data further suggest that MC may regulate TNF function by releasing proteases that can directly degrade this cytokine. Given that both TNF and serine proteases are stored and released from MC, our present findings suggest an important mechanism by which MC may regulate TNF function In vitro, MC tryptase can stimulate histamine release by human tonsillar [The expression of PAR-2 by mast cells and the involvement of MC in PAR-2-mediated inflammation has been controversial. onsillar and guinonsillar MC, but onsillar . Tryptasonsillar , indicatonsillar and rat onsillar mast celonsillar , but othonsillar . Taken ttrans-cinnamoyl group, which acts to stabilize the peptide and prevent its degradation by aminopeptidases. It is unlikely that the different sensitivity to proteases can explain fully the difference between the effects of the two PAR-2ap peptides. It is also unlikely that the trans-cinnamoyl modification on tc-LIG is solely responsible for tc-LIG-mediated activation of MC, because it is also present on the reverse sequence peptide tc-OLR, but does not have the same effects with tc-LIG on protease release, as shown in this study, or in the release of β-hex, as we showed before.In a previous study we have shown that only one of two PAR-2ap (tc-LIG) activates β-hex release from PMC . The othCompound 48/80 along with other cationic compounds can activate MC by directly interacting with a pertussis toxin sensitive component . Our pre2 has been identified pharmacologically in murine vascular smooth muscle [Recently, a new receptor activated by the PAR-2 activating peptide tc-LIGRLO-NHh muscle . In thatOur study provides evidence that a PAR-2ap, tc-LIG, activates MC to release proteases and proteolytic activity that could potentially have both pro- and anti-inflammatory functions. We further showed that these proteases may degrade extracellular proteins and affect the inflammatory environment in areas of mast cell activation. Although the presence and function of PAR-2 on MC is still controversial, our findings indicate that PAR-2 may be part of an autocrine loop. PAR-2 activation leads to the release of serine proteases which in turn may further activate more PAR-2 receptors on mast cells and also on other cells.2-terminal sequences were synthesized at Zymogenetics Inc, Seattle, WA, and used to immunize rabbits to develop specific polyclonal anti-protease antibodies. Professor H. Miller, Edinburgh, Scotland, kindly provided rabbit antibody to RMCP-1.Compound 48/80, 4-methylumbelliferyl-N-acetyl-β-D-glucosaminide (β-hexosaminidase (β-hex) substrate) and soybean trypsin inhibitor (SBTI) were purchased from Sigma Chemical Co. . PAR-2ap and PAR-2 control peptides (PAR-2cp) were synthesized by the Peptide Synthesis Facility, Faculty of Medicine, University of Calgary. These peptides were determined to be ≥ 95 % pure by mass spectrometry and HPLC. Polyclonal RMCP-5 and CPA antibodies were produced and characterized as described previously . BrieflyNippostrongylus brasiliensis, by a single subcutaneous injection of 3000 third-stage larvae in 0.5 mL of saline as described previously [Outbred male Sprague-Dawley rats (weight 250–500 g) were purchased from Charles River Canada Inc., . Rats were maintained in an isolation room with filter-topped cages to minimize unwanted infections. For the experiments where MC were activated through their IgE receptor, rats were sensitized to eviously . The expFifteen mL of ice-cold Hepes-buffered Tyrodes buffer supplemented with 0.1% BSA was injected into the peritoneal cavity of each rat for the isolation of PMC. MC in peritoneal lavage fluids were enriched by centrifugation through a discontinuous density gradient of Percoll, as described previously . Recover6 cells/mL. Cells were placed in 1.5 mL Eppendorf tubes or in 48 well plates, incubated at 37°C for 10 min, and then the same volume of pre-warmed (37°C) PAR-2ap or controls in complete RPMI were added, to give a final cell concentration of 0.5 × 106 cells/mL. The cells were incubated for different times (20 min to 8 hr) depending on the experiment.After isolation and enrichment, PMC were rested in RPMI supplemented with 5% FBS for 2 hr at 37°C. After incubation, the cells were washed twice by centrifugation (150 g) and resuspended in RPMI at 1 × 10Nippostrongylus brasiliensis Antigen /mL [To measure spontaneous release of mediators by PMC, cells were mixed with media alone. As positive controls, either compound 48/80 (0.5 μg/mL) or (WE)/mL ) were miSupernatants were concentrated (10×) using Centricon (YM-10) centrifugal filter devices . For Western blot analysis, proteins were transferred electrophoretically to a polyvinylidene difluoride (PVDF) membrane using the Semi-Dry Trans Blot System. The membranes were blocked in Tris-buffered saline containing 0.02% Tween, 5% w/vmilk (Bio-Rad Laboratories) and 5 % v/vgoat serum (Invitrogen) for 1 hr. The membranes were probed with 1/1000 dilution of anti-RMCP-1, 1/600 anti-CPA, 1/5000 anti-RMCP-5 and then incubated with donkey anti-rabbit IgG HRP-conjugated antibody (1:5000). Protein bands were detected by enhanced chemiluminescence using ECL Western blotting detection system .β-hex was measured in the supernatants and cell pellets, as described . ResultsTo measure release of proteolytic activity, supernatants from stimulated PMC (containing secreted TNF) were transferred to a 96-well plate. After 2 min incubation, exogenous TNF or medium was added to the supernatants and mixed to give a final concentration of 150 pg/ml. Plates were incubated at 37°C for 8 hr and then TNF content was measured by ELISA. Percent TNF proteolysis was calculated by the following formula:% TNF degraded = 1 - (TNF recovered / (rat recombinant TNF seeded + measured TNF release) × 100)For protease inhibition experiments SBTI (1 mg/ml) was added to the supernatants before seeding with TNF. The supernatants were then processed as above and used to measure TNF degradation.Supernatants from activated PMC were analysed for TNF using a rat TNF ELISA kit , according to manufacturer's instruction. The sensitivity of the TNF assay was < 10 pg/ml. To exclude the possibility that proteases contained in PMC supernatants interfere with ELISA determination of TNF we incubated the TNF antibody coated wells with PMC supernatants washed them and then added specified amounts of TNF for determination. Pre-incubation with PMC supernatants did not affect the ability to measure TNF, indicating that the proteases in PMC supernatants do not degrade the antibodies of the assay.t-test and ANOVA.All values are given as mean ± standard error of mean (SEM) for the numbers of experiments noted and statistical analyses were performed using the Student's β-hex β-hexosaminidaseCPA carboxypeptidase-A2 (PAR2-cp)LSI LSIGRL-NHMC mast cellPAR protease-activated receptorPAR-ap protease-activated receptor-agonist peptidePAR-cp protease-activated receptor-control peptidePMC peritoneal mast cellsRMCP-1,5 rat mast cell protease-1, 5SBTI soybean trypsin inhibitor2 (PAR2-ap)SLI SLIGRL-NHtrans-cinnamoyl-LIGRLO-NH2tc-LIG trans-cinnamoyl-OLRGIL-NH2tc-OLR Nippo Ag Nippostrongylus brasiliensis Antigen.WE worm equivalentHNA carried out the majority of the experiments presented and drafted the manuscript. This work was part of his MSc thesis. GRS assisted with mast cell isolation and some of the activation experiments and participated in the experimental design. JLW participated in the design of the study. MDH participated in the design of the study. ADB participated in the design of the study, supervised the work shown and made substantial contributions in manuscript preparation. HV participated in the design of the study and contributed in the preparation of the final manuscript. All authors read and approved the final manuscript.

The carcinogenesis of colorectal cancer has been accepted by a model for a cascade of genetic alterations, named the adenoma-carcinoma sequence. In order to elucidate the carcinogenesis of the colorectal cancer more clearly, the genetic abnormalies of the non-neoplastic mucosal epithelium of the colon and rectum should be investigated. It has been speculated that colonic Paneth cell metaplasia (PaM) is one of the pre-neoplastic mucosa of colonic cancer. Therefore, we studied the propria mucosa of the right colon with PaM from the standpoints of the frequency of the K-ras codon 12 mutations (K-ras), which is initial genetic abnormality in colorectal cancer, and the loss of heterozygosity of microsatellite markers (LOH-MS), which has a relationship to development of colorectal cancer.Fifty-two regions with PaM histopathologically from 12 surgically resected right colon specimens were studied. DNA extraction of the colonic mucosa with PaM was obtained using a microdissection method, and the frequency of the K-ras of PaM was investigated by enriched polymerase chain reaction-enzyme linked mini-sequence assay, and the frequency of the LOH-MS of PaM was examined by high resolution fluorescenced labeled PCR primers.K-ras mutation was detected in fifteen regions among 52 PaM (28.9%). All mutations were a single mutation and GGT changed to AGT in eleven and GAT in four. LOH-MS were detected in twenty-one regions among 52 PaM (40.4%) . No K-ras mutations and LOH-MS were detected in the controls .Colonic mucosa with Paneth cell metaplasia may be one of the pre-neoplastic mucosa in the development of the colonic epithelial neoplasia. Vogelstein et al. have repHowever, the genetic abnormalities of the non-neoplastic mucosal epithelium of the colon and rectum has not been investigated, except the aberrant crypt foci and hypeWe have speculated previously that the colorectal Paneth cell metaplasia (PaM) is one of pre-neoplastic mucosa on the development of the colorectal epithelial neoplasias , becauseThe main purpose of the present study was to investigate the frequencies of the K-ras codon 12 mutations (K-ras) and the loss of heterozygosity of dinucleotide microsatellite markers (LOH-MS) in the propria mucosa with PaM of the right colon.The materials were 12 surgically resected specimens of right colon, which had the colonic carcinomas were present, and histological diagnosis was assessed at the Department of Pathology, Juntendo Izunagaoka Hospital. Although we have intended to investigate the PaM in the normal colon of the individuals without cancer, using the biopsies specimens, it was difficult to detect the PaM in these specimens. No inflammatory bowel diseases were included in the materials. Informed consent was obtained from all the patients to investigate the genetic alterations in the current study.The specimens were fixed in 10 % buffered formalin solution and prepared by cutting the non-neoplasitic area into 3 – 5 mm sections. Each section was embedded in paraffin and stained with hematoxylin and eosin (HE), followed by immunohistochemical staining for anti-lysozyme . Immunohistochemical stainings were performed by the avidin-biotin-peroxidase-complex method, at dilution of 1 : 100.Fifty-two colonic mucosal regions with PaM, distant from neoplastic lesion, aberrant crypt foci and hyperplastic polyp, were detected by HE staining and anti-lysozyme antibody staining, and these mucosa were used as the target regions in the current study.All paraffin blocks of the target regions and 12 paraffin blocks with no PaM as controls of each materials were used for the DNA extraction.Paraffin blocks with the target foci mentioned above were prepared for DNA extraction. The target foci were microdissected using a 20-gauge needle, comparing the slide with HE staining in the same position. The extracted DNA was diluted with 5 ml of TaKaRa DEXPAT .2, 1 μM each primer, 0.625 U Taq DNA polymerase and 1 × PCR buffer in a thermal cycler. Then, 10 μL of the denatured second PCR product was hybridized with probes to detect the K-ras codon 12 wild-type (GGT) and six mutant DNAs were immobilized, at 55 degrees of temperature for 30 minutes, and 100 μL of biotinylated A and 0.01 U of TdqDNA polypmerase were added and incubation was continued at 55 degrees of temperature for 30 minutes.Mutation of K-ras was analyzed and compared by enriched polymerase chain reaction-enzyme linked mini-sequence assay (PCR-ELMA). In PCR-ELMA ,9, upstrFor development, 100 μL of avidin-horseradish peroxidase conjugate was added and the reaction was performed at room temperature for 30 minutes. Then, 100 μL of tetramethyl-benzidine (TMB) substrate was added and the plates were left to develop in the dark at room temperature for 20 minutes. Finally, 100 μL of stop solution was contained and the light absorbance of each sample was measured by spectrophotometry with a 450 nm filter wavelength were selected for LOH among the microsatellite markers, recommended by National Cancer Institute, because commonly it has been thought to be difficult to study the LOH using mononucleotide microsatellite markers.2, 1 μM each primer marked with fluorescent dye of three colors as blue, green and yellow, 0.625 U Taq DNA polymerase and 1 × PCR buffer in a thermal cycler. 2. The electrophoresis was conducted 2 hours by means of an ABI-377 DNA auto-sequencer . 3. A comparison was made of peaks of same marker arising from normal tissue and the propria mucosa with PaM, using the Gene Scan TM waveform analyzed softwave, and LOH were assessed. That is to say, LOH (+) was assessed when the ratio of the peak area of was less than 70 % or was more than 143 %.These LOH-MS were investigated using high resolution fluorescenced labeled PCR primers in proportion to the method of Tsuchida et al. . The outThe data were analyzed statistically with Student's t-test (t-test) and chi-square test ; a p-value of less than 0.05 was considered to be significant.K-ras mutation was detected in fifteen regions among 52 PaM (28.9 %). All mutations were a single mutation. For K-ras mutation patterns, 11 showed GGT to AGT, and four showed to GAT.LOH-MS was detected in twenty-one regions among 52 PaM (40.4 %) . No K-ras mutations and LOH-MS were detected in the controls .Thus, the frequency of both K-ras mutation and LOH-MS in the colonic mucosa with PaM were significantly higher than those of the controls .K-ras mutations have been detected in several human neoplasias -14, and In order to conclude the carcinogenesis of the colorectal cancer more clearly, the genetic abnormality of the non-neoplastic mucosal epithelium of the colon and rectum should be investigated, however, because the colorectal cancers are derived from the colorectal mucosa. It is also important for the preventive medicine of the colorectal cancer to know the carcinogenesis of it.However, until now, the genetic abnormalities of the colorectal non-neoplastic mucosa is unclear, except the aberrant crypt foci and hypeWe have already reported that the colorectal Paneth cell metaplasia (PaM) is one of pre-neoplastic mucosa on the development of the colorectal epithelial neoplasias , becauseTherefore, K-ras mutation and the loss of heterozygosity of microsatellite markers of PaM were investigated in this study, and the current study is thought to be the first report focusing on this.Our results showed that K-ras mutation was detected in fifteen regions among 52 PaM (28.9%), and LOH-MS was detected in twenty-one regions among 52 PaM (40.4%).Namely, K-ras mutation and LOH-MS of PaM were not rare and the frequency of those of PaM were higher than those of the normal colonic mucosa, and it came to light that some PaM had the genetic abnormalities which had a relationship to the development of colorectal cancer.Paneth cells, which are usually situated at the base of the glands of the small intestine, were first identified by Scwalbe in 1872,Now, these cells have been one of the most famous cells in the gastro-intestinal tract, however, the detail function of these is not clear. Paneth cells are sometimes seen in the colorectal tubules, for example in the proximal colonic mucosa of elderly subjects ,17, in pDescribed above, many riddles about Paneth cell are still remained. And the gene abnormalities of colonic mucosa with PaM in the current study may be not equal to those of single Paneth cell in the colonic mucosa, because it is difficult to obtain only single Paneth cell in the colonic mucosa, even if microdissection method is used.However, we have been able to investigate the colonic mucosa with PaM, and we think it very interesting that some PaM have K-ras mutation and the loss of heterozygosity of microsatellite markers, and these PaM may be thought to be the pre-neoplastic mucosa in development of the colonic epithelial neoplasia. Further molecular studies concerning Paneth cell metaplasia in the large bowel should be warranted.Colonic mucosa with Paneth cell metaplasia may be one of the pre-neoplastic mucosa in the development of the colonic epithelial neoplasia.PaM, colonic Paneth cell metaplasia; K-ras, K-ras codon 12 mutations; LOH-MS, loss of heterozygosity of microsatellite markers; HE, hematoxylin and eosin; PCR, polymerase chain reaction; ELMA, enzyme linked mini-sequence assay

Since their discovery a decade ago, microRNAs (miRNAs) have emerged as major regulators of gene expression in eukaryotes of all kinds. Only 20 to 40 nucleotides long, a miRNA binds to a specific target sequence within a much longer messenger RNA (mRNA), inhibiting its translation and thus controlling expression of the corresponding gene even after the DNA itself has been read. Within the human genome, there are about 250 genes that code for miRNAs. Each miRNA has the potential to bind to many different transcripts. Variations in miRNA sequence dictate the gene transcripts to which each will bind most strongly.Caenorhabditis elegans, growth control and apoptosis in the fruitfly Drosophila melanogaster, hematopoietic differentiation in mammals, and leaf development, flower development, and embryogenesis in the plant Arabidopsis thaliana. Despite their significance, the full range of genes miRNAs target is unknown, as is the best method for discovering them. In a new study, Debora Marks, Chris Sander, and colleagues describe an algorithm for determining the targets of miRNAs, and show they include more than 10% of all human genes.It has become clear that miRNAs play a critical role in controlling gene expression, for example, in larval developmental transitions and neuronal development in the worm The algorithm uses three factors to evaluate whether a potential target site is likely to actually be regulated by miRNA. First, the target site must have some degree of sequence complementarity to one or more of the known miRNAs. Second, the strength with which the predicted target and its miRNA bind together, which can be calculated from the sequence and other structural factors, must be higher than some threshold. Finally, evolutionary conservation—the presence of the target–miRNA pair in different organisms—is factored in, because the likelihood that the target and miRNA actually pair in vivo is greater if the pair is found in multiple types of organisms.Using these principles, and the specific weighting they assigned to each factor, Marks and colleagues identified 2,273 genes in humans, rats, and mice that are likely targets for miRNA regulation. This is probably an underestimate of the total, since the researchers required each candidate gene to have at least two miRNA target sites. The authors identified another 2,128 genes with only one target site, but note that the false-positive rate here is likely to be high. Whatever the final number, the implication is that several thousand of our approximately 30,000 genes are under the control of miRNAs. Of special interest is that these putative targets include many genes known to be associated with the fragile X mental retardation protein, a crucial but still poorly understood player in mRNA regulation, whose absence leads to a type of mental retardation called fragile X syndrome.Drosophila, 28 have close relations in mammals. Second, an individual miRNA may regulate multiple genes—Marks and colleagues found that the average miRNA interacts with seven distinct mRNAs, with a range from 0 to 268. Third, the genes regulated by a single miRNA may be functionally related, such as components of the protein degradation system or specific signal transduction pathways. Fourth, single genes may be regulated by multiple miRNAs—the gene that encodes amyloid precursor protein, for example, has at least eight miRNA sites—suggesting that expression may be combinatorially controlled by numerous cellular influences.The researchers' findings also reinforce several emerging principles of miRNA-based regulation. First, it is widespread among multicellular eukaryotes, and sequences are surprisingly conserved. Of the 78 known miRNAs in These results provide resources for a host of experiments to elucidate the mechanism of miRNA action, which is not well understood. Several of the identified mammalian miRNA–target pairs have near-perfect matching sequences. In both plants (where miRNAs were first discovered) and animals, such matches are associated with degradation of the mRNA.www.microrna.org), who can modify its parameters as experimental results and new models dictate.The authors fully recognize that their algorithm, called miRanda, is not the last word in miRNA target identification. In order to improve both the search for targets and the algorithm itself, they are making the algorithm and full sets of results in vertebrates available free to other researchers (

PLoS Medicine addressed the issue of ensuring equity in distributing AIDS medications. Reis and Capron discuss the study's implicationsA study by Wilson and Blower in the February issue of Of the roughly 40 million people living with HIV , an estiGiven this gap between what can be done and what needs to be done, the people who set policies and administer programs to provide ART in high-burden countries are faced with difficult questions of distributive justice. Decisions regarding the pricing of ARTs and other care for patients with HIV/AIDS, the distribution of treatment centers, and potential measures to overcome barriers for vulnerable populations will determine who will get access to treatment and who will die. In order to deal with these crucial issues, decision-makers need guidance on how to design policies on equitable access to ART that respect human rights norms and ethical standards.PLoS Medicine [A new study by Wilson and Blower, published in the February issue of Medicine , addressMedicine . Wilson While the authors suggest that their method could be adapted to take other objectives into account, here they have taken an exclusively egalitarian approach to equity. Although this notion of equity is broadly accepted, other important approaches could have been taken into consideration. Simple equality in access can actually produce inequities (because a fair approach would differentiate among groups in the population according to their different needs); further, under some theories, those who are least advantaged generally should receive a disproportionate share of newly distributed benefits (the maximin principle) . In geogIn determining equitable spatial accessibility for the application of their model to KwaZulu–Natal, the authors used a rather rough estimation of HIV prevalence . As prevalence greatly varies between specific communities, future studies would certainly benefit from using more disaggregated data where available . SimilaPlace matters, but spatial accessibility is only one factor to be overcome in ensuring equitable access to health services. Studies show that even when services are available at a near distance, factors such as temporal accessibility, disease perception, stigmatization, and outright discrimination heavily influence “effective demand” . MoreoveWilson and Blower have developed a mathematical model to determine the fair geographical distribution of ART treatment sites and have applied it to the specific setting of KwaZulu–Natal. Despite some methodological and data limitations, such studies can inform policy-makers' decisions regarding the location of HIV services. Since distance to a treatment center is strongly determinant of patients' ability to access care, WHO is developing a service availability mapping tool to monitor relative equity between districts and identify major gaps in service availability, for example, availability of ART and prevention of mother-to-child transmission programs.Not only is further research needed to refine the spatial accessibility model presented by the authors but careful attention must be paid to other factors that affect access to HIV services and to the underlying assumptions as to what would constitute fair distribution. In a recent guidance document, WHO and UNAIDS recommended that ART programs include special measures to ensure access of vulnerable and marginalized populations and women to ART . The dec

Leukemia is a clonal disorder characterized by uncontrolled proliferation of haematopoietic cells, and represents the most common form of cancer in children. Advances in therapy for childhood leukemia have relied increasingly on the use of high-dose chemotherapy often combined with stem-cell transplantation. Despite a high success rate and intensification of therapy, children still suffer from relapse and progressive disease resistant to further therapy. Thus, novel forms of therapy are required.This study focuses on dendritic cell (DC) vaccination of childhood leukemia and evaluates the in vitro efficacy of different strategies for antigen loading of professional antigen-presenting cells. We have compared DCs either loaded with apoptotic leukemia cells or transfected with mRNA from the same leukemia cell line, Jurkat E6, for their capacity to induce specific CD4+ and CD8+ T-cell responses. Monocyte-derived DCs from healthy donors were loaded with tumor antigen, matured and co-cultured with autologous T cells. After one week, T-cell responses against antigen-loaded DCs were measured by enzyme-linked immunosorbent spot (ELISPOT) assay.DCs loaded with apoptotic Jurkat E6 cells or transfected with Jurkat E6-cell mRNA were both able to elicit specific T-cell responses in vitro. IFNγ-secreting T cells were observed in both the CD4+ and CD8+ subsets.The results indicate that loading of DCs with apoptotic leukemia cells or transfection with tumour mRNA represent promising strategies for development of cancer vaccines for treatment of childhood leukemia. Leukemia represents the most common form of cancer in children. There are two main types of childhood leukemia, acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML). The success rate in treatment of childhood leukemia has improved continuously over the past decades , and todImmunotherapy based on vaccination with dendritic cells (DCs) has emerged as an attractive new form of therapy for cancer in general, and DC-based vaccines have already shown promise in follicular non-Hodgkin's lymphoma, and in other hematological malignancies -7. DCs aVaccination with tumor antigen-loaded DCs has been shown to induce both Th and CTL responses, and tumor regression in some patients ,17. An i2), IL-7, IL-2 and IL-12 from R&D Systems . Staurosporin was obtained from .GM-CSF was purchased from Novartis , IL-4, TNFα, IL1β and IL-6 from CellGenix , and Prostaglandin E2 . Non-adherent cells were collected and frozen for later use as responder cells. Adherent cells were cultured in 3 ml CellGro DC medium, supplemented with 800 U/ml GM-CSF and 10 ng/ml IL-4 every second day, until day 5 when maturation of DCs was induced by addition of maturation cocktail for 24 h. Characterization of DC phenotype was done by staining 0,5 × 106 cells with fluorochrome-labelled antibodies against the Lin1 panel , HLA-DR, CD1a, CD80, CD83, and CD86 , and analyzing by FACSCalibur flow cytometry (Becton Dickinson). The mAb isotypes used were IgG1 FITC, IgG2a PE, IgG1 APC .PBMC from healthy donors were obtained by density gradient centrifugation . Monocyte-derived DCs were generated under serum-free conditions from the adherent fraction of PBMCs cultured in six-well plates at a density of 4 × 10Jurkat E6 cells obtained from American Type Culture Collection (ATCC) were exposed to 1 μM staurosporin for 3 h to induce apoptosis. Apoptotic cell death was assessed using Annexin V-FLUOS as described by the manufacturer . For assessments of phagocytosis, Jurkat E6 cells were stained with the green fluorescent dye PKH-67 (Sigma Aldrich) as described in the kit manual, exposed to 1 μM staurosporin for 3 h and incubated with immature DCs at a ratio of 3:1. After 6 h, immature DCs were labelled with a red fluorescent antibody (mAb CD1a-PE). Phagocytosis of apoptotic cells was measured quantitatively by flow cytometry. Similarly, phagocytosis was visualized by confocal laser microscopy using apoptotic Jurkat E6 cells pre-stained with PKH-26 red fluorescent dye (Sigma Aldrich) and DCs stained with the green fluorescent dye PKH-67.6 cells using Trizol Reagent as described by the manufacturer . Poly (A)+ mRNA was isolated from total RNA using the GenoPrep Direct mRNA kit . Purified mRNA was used fresh or stored at -80°C until use. Transfection of DCs with mRNA was performed as described previously [6 cells) were mixed with mRNA, transferred to a 4-mm-gap cuvette and pulsed with a BTX ECM-830 square-wave electroporator using instrument settings 500 V and 1 ms. Transfected cells were incubated on ice for 30 s followed by addition of 2.0 ml cold CellGro DC medium supplemented with 10 ng/ml IL-4, 800 U/ml GM-CSF and maturation cocktail (see above), and transferred to standard culturing conditions. Transfection with EGFP-pCIpA102 mRNA (10 μg/400 μl) encoding the green fluorescence protein [Jurkat E6 cells were used as a source of tumor material. Total RNA was isolated from 20–25 × 10eviously , with mi protein was usedThe Negative Isolation Kit was used for isolation of CD4 and CD8 T cells according to the manufacturer's protocol. Isolation was performed on day 7 after in vitro priming, before setting up the ELISPOT assay.6) expressing Jurkat E6-cell mRNA or loaded with apoptotic Jurkat E6 cells, were co-cultured with 3 × 106 autologous non-adherent PBMC for 7 days in 1.0 ml CellGro DC medium without serum, before setting up the ELISPOT assay. The cultures were tested for INF- production in an ELISPOT assay [5, 1.0 × 105, 2.0 × 105 and 4.0 × 105 responding cells and 0.5 × 104 DCs per well. Mock transfected DCs were used as control. The assay was done in duplicate. Spots were counted manually, and the frequency of reactive T cells was calculated according to the formula: (spots with transfected DC - spots with non transfected DC)/number of T cells added.Mature DCs and early apoptotic cells were accordingly used in all experiments. To verify apoptosis after 3 h exposure to staurosporin, cells were stained with annexin V-FLUOS and examined by flow cytometry. The assessments showed that more than 90% of the cells were annexin-V positive Fig. .To study uptake of apoptotic leukemia cells by immature DCs, Jurkat E6 cells were stained with the red fluorescent dye PKH-26 before induction of apoptosis. Immature DCs were stained with the green fluorescent dye PKH-67. Apoptotic Jurkat E6 cells were then co-incubated with immature DCs for various periods of time to determine the optimal conditions for internalization of apoptotic Jurkat E6 cells. We observed that immature DCs ingested apoptotic Jurkat E6 cells within 6 h of co-incubation. Phagocytosed apoptotic Jurkat E6 cells (red stained) were observed inside or in the process of being phagocytozed by immature DCs (green stained) by confocal microscopy Fig. .Flow cytometry was used to further determine the efficiency of DC loading with apoptotic leukemic cells. In these experiments, apoptotic Jurkat E6 cells had been pre-stained with the green fluorescent dye PKH-67 and DCs were identified by staining with PE-conjugated anti-CD1a. Highly efficient uptake of apoptotic Jurkat E6 cells was confirmed, since virtually all CD1a positive cells showed green PKH-67 staining Fig. .Following antigen loading, DCs were matured in the presence of pro-inflammatory cytokines for 24 h. Assessments by flow cytometry confirmed that this treatment led to up-regulation of CD83, and the co-stimulatory molecules CD80 and CD86, in compliance with a mature DC phenotype Fig. .Transfection of cells with tumor-derived mRNA is an alternative method for loading of DCs with tumor antigens. mRNA from the Jurkat E6 cells was isolated and electroporated into DCs according to previously optimized methods . FollowiELISPOT assay of INF-γ producing cells is the method of choice for assessments of T-cell responses against cancer vaccines representing a heterogeneous mixture of antigens. This assay measures in a quantitative way the number of reactive T cells in pre and post-vaccination samples and thus directly relates the effect of vaccination to in-vivo expansion of reactive T cells. Autologous T cells were stimulated with tumour-mRNA transfected DCs and with DCs loaded with apoptotic Jurkat E6 cells. Fig. secreting T cells. However, it appeared that DCs loaded with tumour-mRNA in general were most potent in inducing T-cell responses.Immunotherapy for childhood leukemia has the potential to contribute to long-term control or cure of the disease. Until now immunotherapeutic approaches for leukemia have been limited to trials of cytokine therapy . FurtherWe observed that the frequencies of induced INF-γ producing T cells depended on the individual donor, the method of antigen-loading and the subset of T cells studied. Such variations are not surprising, since the model system used employs allogeneic cells and no effort was done to HLA match the blood donors with the Jurkat cell line in these experiments. Since the experimental system is based on the use of an allogeneic cell line, we expect multiple antigens, encoded by a broad array of polymorphisms, including other HLA alleles to be involved. We have therefore taken advantage of the genetic differences between responding cells and the leukaemia cell line by using the combined repertoires of membrane expressed and cross presented allo-antigens as a sensitive readout for immunological response in our experiments.We expected that the two different procedures would provide some differences in loading of HLA molecules with tumour-derived antigens and subsequently in the responding T-cell subsets. According to the current dogma, processed peptides from phagocytosed apoptotic cells would be directed to HLA class I molecules by a process known as cross-presentation and to HLA class II molecules by the classical pathway. Cross-priming of CTL with antitumor activity has been demonstrated with DCs loaded with apoptotic tumour cells ,21,35. SThe aim of the present study was to determine if loading of DCs with antigens derived from a tumour cell line, either as apoptotic cells or as mRNA would provide a basis for an efficient vaccine, using ELISPOT as a read-out of immune responses. It has been shown that DCs transfected with antigens encoded in tumor mRNA is capable of inducing potent T-cell responses against tumour-specific epitopes . While p secreting T cells. However, it appeared that DCs loaded with tumour mRNA in general were most potent in inducing T-cell responses.In our study we demonstrate that both DCs loaded with apoptotic Jurkat E6 cells or transfected with mRNA isolated from Jurkat E6 cells, can induce T-helper and CTL responses against antigens derived from allogeneic leukemic T-cells. We also show that the two different methods of antigen-loading did not result in any apparent differences in the phenotype of the mature DCs. In terms of immune responses both methods of antigen loading produced DCs capable of inducing INF-The author(s) declare that they have no competing interests.SJJ performed preparation of DCs and T cells, assessments of apoptosis and phagocytosis of apoptotic cells, preparation of Jurkat E6-cell mRNA and transfection of DCs, isolation of T-cell subsets CD4 and CD8 and induction of primary T cell responses. SSL did the transfection of DCs with EGFP mRNA and fluorescence microscopy of DCs. RP, FW and GG planned the project.The pre-publication history for this paper can be accessed here:

Late referral to specialist nephrological care is associated with increased morbidity, mortality, and cost. Consequently, nephrologists' associations recommend early referral. The recommendations' effectiveness remains questionable: 22–51% of referrals need renal replacement therapy (RRT) within 3–4 months. This may be due to these recommendations addressing the specialist, rather than the primary care providers (PCP).The potential of specialist intervention aiming at slowing progression of chronic renal failure was introduced individually to some 250 local PCPs, and referral strategies were discussed. To overcome the PCPs' most often expressed fears, every referred patient was asked to report back to his PCP immediately after the initial specialist examination, and new medications were prescribed directly, and thus allotted to the nephrologist's budget.In retrospective analysis, the stage of renal disease in patients referred within three months before the introductory round , was compared to referrals two years later .Relative number of patients remained stable (28%) for mild/ moderate chronic kidney disease (MMCKD), while there was a noticeable shift from patients referred severe chronic kidney disease (SCKD) to patients referred in moderate chronic kidney disease (MCKD) .Individually addressing PCPs' ignorance and concerns noticeably decreased late referral. This stresses the importance of enhancing the PCPs' problem awareness and knowledge of available resources in order to ensure timely specialist referral. Late referral to specialist care for renal failure is associated with increased morbidity, mortality, and cost . ConsChronic renal disease may be asymptomatic for a very long time. This stresses the importance of primary care providers in ensuring timely referral to a renal care center. Levin reviewedThe problem of late referral seems to be ubiquitous, if discussions with colleagues world- wide may be believed, and has led to numerous local, regional and national initiatives aiming at ensuring timely referral into specialist care. Some initiatives,8 succesThis article summarizes findings from a local initiative started by one of the authors (K.H.) in 1997 in the city of Dortmund, Germany.In Germany, about 90% of the population are covered by the mandatory health insurance system ("Gesetzliche Krankenversicherung"). All physicians who wish to treat these patients are organized in associations, which negotiate a budget with the insurance companies. Depending on the specialty, a typical per capita budget is then assigned per patient for a period of three months. This budget covers consultation fees, and the cost of medication prescribed. If a physicians exceeds the total budget thus calculated for his practice, the insurance companies can demand restoration of funds. Typically, a GP's per patient budget would be much lower than a nephrologist's. During the time period described here, the nephrologist's budget per patient was about ten times as much than a general practitioner's. While this budget strategy is intended as a safeguard against excess prescriptions, it has been criticized by many physicians for inducing sub- optimal treatment as practice owners comply rather with budget demands than with best practice guidelines.Dortmund, a town of 589000, has a physician to patient ratio of 141/ 100000 (German average: 156/ 100000). There are five nephrological centers, including two hospitals. Currently, 172 general practioners ("Allgemeinärzte und Praktische Ärzte"), 123 internists ("Ärzte für Innere Medizin") and 21 urologists are listed in Dortmund. One of the internist practices supervises a dialysis center, but does not provide specialized nephrological consultancy. GPs, internists and urologists were considered primary care providers, as all referrals for treatment of chronic renal failures came from one of these specialties. There were no major fluctuations of physician numbers between 1997 and 1999, the period for which data was analyzed here.Joint initiatives by all five nephrology centres in Dortmund to give PCPs a series of lectures on treatment of chronic renal disease met with little response, as the presenters regularly outnumbered the audience. In the spirit of the Declaration of Helsinki, part II.1.: , K.H. deIn order to do so, education was brought to the primary care providers, as opposed to bringing the PCPs to education. Over a period of 18 months, K.H. introduced himself and the potential of timely nephrological care in delaying or even halting the progression of chronic renal disease to PCPs- General Practitioners, and specialists in Internal Medicine and Urology. This introductory round included participation in local PCPs' round tables and PCP organized continuous medical education events, but also individually meeting some 250 PCPs for discussion. During these sessions, the topic of renal disease was subtly introduced during discussions on the more common diseases and risk factors, such as cardiovascular disease, hypertension and diabetes mellitus.During these teaching sessions and discussions, three arguments were repeatedly brought forward by the PCPs:1. Mild- moderate renal failure should be treated by the primary care providers, while the nephrologists' task was seen in providing renal replacement therapy.2. Referral to specialist care meant risking the loss of the patient to the specialist's practice .3. If patients did return from specialist consultation, they were usually carrying recommendations for costly permanent medication, such as ACE inhibitors, that put a heavy burden on the PCP's budget.The first of these arguments was addressed by the "teaching module" of the visits. PCPs were given an executive summary of the complexities of diagnostic and therapeutic procedures used in state- of- the- art nephrology, and the potential of intensified treatment by specialists aiming at slowing the progression of renal failure was explained in detail.Secondly, all patients referred were asked to report back to the referring PCP within one week of the consultation, by which time a summary of findings and appropriate counsel had been sent ahead.recommendations, drug prescriptions were handed out directly and so allotted to the much higher nephrologist's budget, thus easing the financial pressure on the primary care providers. More importantly, also the follow- up prescriptions were done in the renal care center, so that at no time the PCPs budget became endangered.Thirdly, instead of drug The present study investigates the question whether improving the PCP's knowledge about the potential of timely treatment of chronic renal failure, in combination with addressing their economic concerns, succeeded in encouraging timely referral to specialist care.2, moderate chronic kidney disease (MCKD), 60 ml/min/1.73 m2 > ECC > 20 ml/min/1.73 m2, and severe chronic renal disease (SCKD), ECC < 20 ml/min/1.73 m2. Due to small proband numbers in the subgroups, the null hypothesis ("no inter- group differences") was tested by the non- parametric, two sided Chi- square test. Survival was estimated by Kaplan- Meier analysis. Statistical analysis was carried out using the SPSS v11.5 package.Retrospective analysis of patients' records. Analysis of patient records was carried out by a final year medical student (TDV). All patients had agreed to have their data used for quality control measures at the time of referral. Specifically informed consent was obtained from all patients still alive at the time of data collection. Two groups were selected by date of first contact with the nephrologist: Group A, third quarter 1997, immediately before the start of the initiative, and Group B, third quarter 1999, six months after the last visit to a primary care provider had taken place. All new patients whose records indicated referral for nephrological specialist treatment were included in the study. Criteria were subnormal creatinine clearance (ECC) or elevated serum creatinine, elevated blood pressure, proteinuria, or erythrocyturia. The patients in each of the two groups were divided into three subgroups according to their renal function: mild/moderate chronic kidney disease (MMCKD), ECC > 60 ml/min/1.73 mTable The present study is a retrospective analysis of patient data from a single nephrological referral centre, and statistics are carried out on a data set of limited size (n = 18 only in the pre- intervention group A). As such, the statistical significance of the findings is doubtful, and the results might be interpreted as akin to a case report, or a medical anecdote.As such, however, it may have a value quite different from, but equal to that of a randomized, controlled study.Aronson recently discussed the value of medical anecdotes; of the More often than not, observational studies give similar results to controlled randomized trials,13, and The positive finding of the present study is that active recruiting strategies may improve the referral pattern. Following the discussions with individual PCPs, more patients were referred to specialist care at a stage where appropriate treatment may slow or even halt the progression of chronic renal failure. This should benefit first the patient, and then in the long run society as a whole. Recent studies,15 have Late referral to specialist care in chronic renal disease remains a problem world- wide. As early as 1984, focusing on the question under which circumstances renal replacement therapy should be initiated or not, questionnaires showed significant differences in the attitudes of nephrologists and non- nephrologists towards referral. SimilarIt has been speculated that this may be because these recommendations address the specialist, rather than the primary care providers (PCP),2.At present, a medline search using the keywords "referral" and "chronic renal failure" listed a total of 81 references since 1974, with only 48 in specialist, not necessarily nephrological journals, while adding "guideline" reduced the reference list to a disappointing three references from the years 1998 and 1999, which included, however, a fully accessible online guideline in the Canadian Medical Association's journal. Neither the American, nor the European Renal Associations' guidelines,4 were fBetter results were obtained using the same search terms on a general search engine (Google), leading at first hit to the DOQI webpage, which includes the free access to full text guidelines. An extensive search using the same terms in German, however, showed no relevant results but an abundance of lay articles of dubious quality. This scarcity of qualified information might exclude those physicians not fluent in English from gathering relevant and up- to- date information. National renal care associations should therefore consider extending their educational efforts beyond their specialist members and selectively target PCPs and their respective professional associations.In the present study, two arguments brought forward by PCPs to explain their reluctance to refer early focused on the economic burden this presented to their own practice, rather than society as a whole. These two arguments concerned budget penalties if too much money was spent on the (costly) pre- dialytic patients with chronic kidney disease, and loss of patients after referral. This is an unusually frank statement.macro- economic level. Micro- economic considerations in the distribution of health care are only hinted at[The majority of 22 medline hits using the search terms "economy" and "renal disease" address the question of best cost- efficiency of treatment strategies on a Due to the retrospective design of this study, one cannot analyze to what extent the PCPs' economic considerations rather than their educational state were responsible for their referral pattern. The fact that financial concerns were the tenor of the individual discussions, however, indicates that health care planners may profit from taking this into account.The authors hope that this single- centre study will entice multi- centre RRT providers to conduct a prospective, large scale study to further investigate the relative contribution of the factors discussed here.The initiative presented here shows that timely specialist referral in renal care can be achieved. National and regional differences in the organization of health care provision may lead to variant strategies to implement optimal health care, but close collaboration with the primary care providers is essential.ECC: endogenous creatinine clearanceMCKD: moderate chronic renal diseaseMMCKD: mild/moderate chronic renal diseasePCP: primary care providerRRT: renal replacement therapySCKD: severe chronic renal diseaseThe authors declare that they have no competing interests.K.H. started the initiative, carried out all the teaching modules and gave access to the data.T.D.V. retrieved the data from archived filesZ.A.L. did statistical analysisM.L. did statistical analysisA.M. did statistical analysis and wrote the manuscript.The pre-publication history for this paper can be accessed here:

Caenorhabditis elegans. We show tight conservation of the HIF-1/VHL-1/EGL-9 hydroxylase pathway. However, persisting differential gene expression in hif-1 versus hif-1; vhl-1 double mutant worms clearly distinguished HIF-1–independent effects of VHL-1 inactivation. Genomic clustering, predicted functional similarities, and a common pattern of dysregulation in both vhl-1 worms and a set of mutants , with different defects in extracellular matrix formation, suggest that dysregulation of these genes reflects a discrete HIF-1–independent function of VHL-1 that is connected with extracellular matrix function.The von Hippel-Lindau (VHL) tumor suppressor functions as a ubiquitin ligase that mediates proteolytic inactivation of hydroxylated α subunits of hypoxia-inducible factor (HIF). Although studies of VHL-defective renal carcinoma cells suggest the existence of other VHL tumor suppressor pathways, dysregulation of the HIF transcriptional cascade has extensive effects that make it difficult to distinguish whether, and to what extent, observed abnormalities in these cells represent effects on pathways that are distinct from HIF. Here, we report on a genetic analysis of HIF-dependent and -independent effects of VHL inactivation by studying gene expression patterns in Besides its known function of inactivating hypoxia-inducible factor (HIF), genetically engineered worms clearly demonstrate that there exist HIF-independent effects of the von Hippel- Lindau tumor suppressor Oxygen-Caenorhabditis elegans. Whereas mammalian cells possess three HIF-α isoforms that are targeted by VHL, C. elegans has a single HIF-α homolog (HIF-1) and a single VHL homolog (VHL-1), simplifying the genetic approach bearing defects in genes involved in extracellular matrix function, supporting the existence of a conserved non-HIF pathway connecting VHL with an as yet unknown extracellular matrix function.To address this we have used a genetic approach in approach . Since hC. elegans, a whole-genome microarray was probed to compare transcript patterns in vhl-1 versus wild-type worms (n = 1). From this array a set of genes was assayed quantitatively by ribonuclease (RNase) protection were strikingly downregulated by VHL-1 and the egg-laying defective phenotype of egl-9, none of the worm strains showed obvious phenotypic abnormalities. Interestingly, hif-1 corrected the phenotype of egl-9.To determine the extent to which disruption of the conserved EGL-9/HIF-1 pathway mediates these effects we studied wild-type, egl-9 worms of the six genes contained a potential HIF-1 binding core motif (RCGTG) within an arbitrarily defined region that was conserved in Caenorhabditis briggsae expression in normoxia was entirely dependent on HIF-1, whereas other genes retained substantial normoxic expression in hif-1 worms showed modest upregulation, and one gene (phy-2) showed modest downregulation, by hypoxia that was independent of HIF-1, VHL-1, and EGL-9 , suggesting that the VHL-1–independent repressive effects on nhr-57 may be nonenzymatic.Though the six genes all conformed to the above patterns to demonstrate regulation by the EGL-9/HIF-1 pathway , there w-1 worms A. Second pathway C. Interehif-1; vhl-1 and hif-1 worms (n = 3). Fewer genes showed differential expression than in the vhl-1 versus wild-type array; however, persisting differential expression did suggest the existence of VHL-1 pathways that are independent of HIF-1 contained a potential HIF-1 binding site (HBS) within an arbitrarily defined region that was conserved in C. briggsae have shown that the entire 110-kb region containing the coregulated gene cluster is arranged in tandem with a second nearly identical segmental duplication of the locus . At this level of identity, our microarray and RNase protection analyses cannot discriminate between the two copies of each gene, so for all of our analyses we have only used the names of the distal copy and genes from the proximal copy were excluded from computational analyses.Interestingly, all six genes validated by RNase protection assay to be negatively regulated by VHL-1 in a HIF-1–independent manner localize within 45 kb on Chromosome V . We applied single-linkage clustering (nearest-neighbor method) to identp ≪ 10−5 B. Recentegl-9; hif-1 versus hif-1 worms . Further experiments on dpy-18; hif-1 double mutant worms clearly indicated that the effects of DPY-18 on this group of genes were (like the effects of VHL-1) HIF-1 independent and the e (DMOG) were tesgon-1 (heterozygote), mig-17, and unc-6 mutant worms but not in the cuticle-associated dpy-11, bli-4, or sqt-3 mutant worms that are distinct from protein hydroxylation. These experiments indicated that the six genes were, to varying extents, upregulated in the basement membrane-associated nt worms . Conversnt worms and SQT-vhl-1 inactivation in different genetic backgrounds, these data clearly distinguish HIF-1–dependent and –independent effects of VHL-1 on gene expression. Somewhat surprisingly, all of the VHL-regulated genes analyzed fell into one of two patterns: independent of HIF-1 and EGL-9 and dependent on DPY-18, LET-268, GON-1, MIG-17, and UNC-6, or the reverse, suggesting that they reflect perturbation of two discrete aspects of VHL-1 function.By comparing the effects of vhl-1 versus wild-type array underlines the importance of the HIF-1 pathway in VHL-1 function. Computational analysis revealed that five of these genes have at least one HIF-1 binding core motif (RCGTG) that is conserved in C. briggsae within an arbitrarily defined promoter region, suggesting that they are direct HIF-1 transcriptional targets. Several genes have mammalian homologs that are HIF targets regulation by VHL-1 were located within 45 kb on Chromosome V. Analysis of the microarray data revealed that there was indeed a single, highly significant (p < 10−5) chromosomal cluster of genes negatively regulated by VHL-1 in a HIF-1–independent manner and that in total this cluster extended over 110 kb to include F56A4.9, Y45G12C.9, Y45G12C.12, and Y45G12C.2 in addition to the six genes validated by RNase protection assay. The chromosomal localization of genes in C. elegans is not random, with functionally related genes located close to one another , gon-1 aoteases) , and unc netrin) —suggest netrin) . These aronectin . Most turonectin . Howeverronectin . Though Escherichia coli strain HT115(DE3) expressing double-stranded (ds) RNA on Nematode Growth Medium containing 1 mM isopropyl-β-D-thiogalactopyranoside (ITPG) and 50 μg/ml ampicillin for 72 h. Plasmids for ds RNA production were derivatives of the L4440 vector and were obtained from J. Ahringer ; ds RNA sequences are available on WormBase (http://www.wormbase.org). Wild-type worms were Bristol strain (N2); mutant strains were obtained from the Caenorhabditis Genetics Center (gon-1 worms (maintained at 18 °C). The double mutants hif-1; vhl-1, egl-9; hif-1, and dpy-18; hif-1 were constructed using either fog-2 or unc-51 to mark hif-1(+); the double mutant egl-9; vhl-1 was constructed using unc-42 to mark egl-9(+); PCR was used to confirm homozygosity.Worms were studied as mixed-stage populations or as synchronized populations following brief exposure to sodium hypochlorite. Exposure to hypoxia (2% or 0.1% oxygen), DIP (200 μM), and DMOG (1 mM) was for 18 h . RNA ints Center . Strainsvhl-1 worms and hif-1 versus hif-1; vhl-1 worms were performed on independent samples of RNA , using near full-genome C. elegans DNA microarrays ; primary array data are available on the SMD (http://genome-www.stanford.edu/microarray) and are also shown in hif-1 versus hif-1; vhl-1 microarray comparisons (n = 3) the log2 fold change was calculated as the mean of the three log2 transformed fold changes. To test for significant upregulation, the mean log2 fold change was compared with zero using a Student's t test. The genes were ranked by amplitude of fold upregulation and a subset of genes was selected for potential validation by RNase protection assays ; (b) mean Cy3-dUTP and Cy5-dUTP background-corrected signal intensities exceeding 300 and 100 U, respectively (lower intensities than these were difficult to detect by RNase protection assay); and (c) high spot quality as judged by manual inspection. For the hif-1 versus hif-1; vhl-1 microarray comparisons (n = 3), genes (which had been filtered as described above) were considered to be differentially expressed if the mean fold change was greater than 2.0 as reciprocal best matches by BLASTN, initiated with the C. elegans gene coding sequence (a single ortholog of F56A4.2 could not be defined). Translation initiation sites were inferred in both C. briggsae and C. elegans through alignment with the C. elegans coding sequence . Sequences encompassing the 1,000 nucleotides upstream to 250 nucleotides downstream of the translation start sites for orthologous genes were aligned using DNA Block Aligner (C. elegans and C. briggsae.(1) Identification of potential HBSs see . Ortholo Aligner with the Aligner , identifhttp://genome.ucsc.edu/). The software used for simulations and clustering was implemented in Perl and is available on request.(2) Single-linkage analysis to determine spatial clusters of VHL-1–dependent, HIF-1–independent genes see . A maximhttp://genome-www.stanford.edu/microarray.Primary microarray data can be viewed at Table S1vhl-1 versus wild-type comparison.Primary microarray data for the (6.5 MB XLS).Click here for additional data file.Table S2hif-1; vhl-1 versus hif-1 microarray comparisons. Continued in Tables Primary microarray data for the three independent (6.6 MB XLS).Click here for additional data file.Table S3Continuation of (6.6 MB XLS).Click here for additional data file.Table S4Continuation of Tables (6.6 MB XLS).Click here for additional data file.http://www.ebi.ac.uk/arrayexpress/) under accession number E-SMDB-23.Primary array data have been deposited in ArrayExpress (H. sapiens VHL gene discussed in this paper can be found in Online Mendelian Inheritance in Man (OMIM) under accession number 608537 (http://www.ncbi.nlm.nih.gov:80/entrez/dispomim.cgi?id=608537).The C. elegans genes discussed in this paper can be found in the WormBase database by including the name of the gene at the end of the URL .The

When pathogens enter your body, most wind up engulfed (by phagocytes), poisoned (by stomach acids), or flushed out of your system. These defenses kick in when a bacterium's toxic secretions bind to cellular receptors that trigger a chain of events ending in an innate response. A wide variety of cells and chemicals, including phagocytes and cytokines, initiate the inflammatory reaction that redirects innate defenses in the bloodstream to the infected site.If all goes well, the innate system successfully contains and eliminates a pathogen at the site of infection. But if infection persists, so will the inflammatory response, and these first responders turn traitor. It's thought that the immune response rather than the bacteria, for example, causes diarrhea in food poisoning. And when infection leads to death—as happens in septic shock—the immune response may be just as culpable as the infectious microbe.Drosophila and the food-borne pathogen Salmonella. Working with mutant strains of both fly and bacteria, the authors identified genes important to the development of infection and disease and showed that the host's reaction can indeed be lethal.To better understand the interplay between pathogen and host in the onset of infection and disease, David Schneider and colleagues turned to the genetically compliant fruitfly Drosophila phagocytes find, engulf, and kill invading microbes and then alert the rest of the immune system—and how Salmonella circumvents these defenses to initiate disease.Pathogens possess various means to infect their host, unleashing toxins and secreting molecules that enhance virulence by breaching cell membranes and altering the intracellular environment. Fruitflies combat these intrusions with various innate responses, including phagocytosis. In this study, the authors investigated how Salmonella strain (S. tyhphimurium) that produces two pathogenicity complexes, called type III secretion apparatuses, which shuttle virulence molecules through the host's cell membrane and into its cytoplasm. One complex, SPI1, facilitates cell entry while the other, SPI2, retools the intracellular environment to suit bacterial growth. The authors created a series of less virulent Salmonella strains and examined their effects on wild-type (nonmutant) flies. In addition, they looked at infections of wild-type Salmonella in flies carrying mutations in two critical immune response pathways .Schneider and colleagues used a Salmonella died much faster than the Toll mutants and had far more bacteria in their blood. When Schneider and colleagues correlated Salmonella population numbers with fly fate, they discovered something surprising. In other bacteria models, flies die when bacterial pathogen numbers reach a critical mass. Here, Salmonella populations hit a ceiling and the flies died with comparatively few bacteria. In flies infected with Salmonella strains lacking either one or the other virulence complex, the flies survived despite increased bacterial growth.Imd mutants infected with nonmutant eiger gene—a homolog of the human TNF gene—live longer with Salmonella infections. This is the same phenomenon seen in TNF-induced septic shock, when patients die as much from their immune system's response to infection as from the bacteria itself. Since many of the proteins involved in the Drosophila imd pathway have counterparts in the mammalian antibacterial immune response, the model described here can help identify the genetic agents of metabolic collapse associated with bacterial infections in humans.The authors explain this surprising finding with a model in which the fly's immune response produces substances that ultimately engineer its own destruction. Their model is supported by experiments showing that flies carrying a mutation in the

Knowledge of how synapses alter their efficiency of communication is central to the understanding of learning and memory. The most extensively studied forms of synaptic plasticity are long-term potentiation (LTP) and its counterpart long-term depression (LTD) of AMPA receptor-mediated synaptic transmission. In the CA1 region of the hippocampus, it has been shown that LTP often involves a rapid increase in the unitary conductance of AMPA receptor channels. However, LTP can also occur in the absence of any alteration in AMPA receptor unitary conductance. In the present study we have used whole-cell dendritic recording, failures analysis and non-stationary fluctuation analysis to investigate the mechanism of depotentiation of LTP.We find that when LTP involves an increase in unitary conductance, subsequent depotentiation invariably involves the return of unitary conductance to pre-LTP values. In contrast, when LTP does not involve a change in unitary conductance then depotentiation also occurs in the absence of any change in unitary conductance, indicating a reduction in the number of activated receptors as the most likely mechanism.These data show that unitary conductance can be bi-directionally modified by synaptic activity. Furthermore, there are at least two distinct mechanisms to restore synaptic strength from a potentiated state, which depend upon the mechanism of the previous potentiation. These2+/calmodulin-kinase II (CaM-KII)-mediated phosphorylation of GluR1 which occurs during LTP [Recent studies have provided information on the possible mechanisms underlying postsynaptic alterations in synaptic strength. There is evidence that AMPA receptors are inserted into the postsynaptic membrane during LTP -15 and rring LTP , and whiring LTP . Therefode novo LTD .We have recently used peak-scaled non-stationary fluctuation analysis of synaathways; ,23). In athways; . Indeed,N) [N never involves a change in γ (DPN). These data show, firstly, that there are two distinct molecular mechanisms for the reduction of synaptic strength that are dependent on the nature of the preceding LTP and, secondly, that γ can indeed be bi-directionally modified in response to synaptic activity.In the present study we have investigated a second form of LTD known as depotentiation (DP), which is a reversal of pre-established LTP -27. LTP N) . We wereUsing whole-cell recordings from the proximal apical dendrites of hippocampal CA1 pyramidal cells, minimal stimulation of nearby afferents evoked EPSCs that could be reliably resolved from failures with a holding potential of 0 mV. This resulted in stable LTP .N). As noted previously [In agreement with a previous study , cells feviously , there wFigure rise: baseline = 1.6 ± 0.2 ms, LTPγ = 1.7 ± 0.3 ms, DPγ = 1.7 ± 0.2 ms, n = 11; τdecay: baseline = 8.3 ± 0.6 ms, LTPγ = 8.2 ± 0.6 ms, DPγ = 8.9 ± 0.7, n = 11; Figure For this group of cells, DP, induced by pairing stimulation (baseline frequency) with a holding potential of -40 mV, always resulted in a reversal of the γ increase, as indicated by the current-variance plot Figure . SimilarN), as indicated by the current-variance plot , a small depression of less than 50 % was associated with no change in success rate as well as a decrease in potency (potency ratio = 0.54 ± 0.04). This suggests that in these cells there was an additional decrease in Pr or n. Therefore, for DPγ, the change in γ did not fully account for the amplitude change in every cell . This il Figure but did l Figure .N). As reported previously for different data sets from this age of rats [N). In the present study we saw a similar proportion of LTP expressed by changes in γ versus N. Strikingly, we observed a precise relationship between the mechanism of DP and the form of preceding LTP; LTPγ was always reversed by DPγ, and LTPN was always reversed by DPN.In this study we have shown that there are two mechanisms for NMDA receptor-dependent DP, a reduction in γ (DPγ) and a decrease in the number of activated AMPA receptors ? It is unlikely that this type of depression is due to a change in channel kinetics because there was no change in EPSC kinetics . The. TheN)? ics see ,35. Post. PostN? ee [open or in theee [open .N are indistinguishable from those that we and others have reported recently for de novo LTD [de novo LTD were mutually occlusive, indicating a convergence of mechanisms. These data argue strongly for a postsynaptic mechanism of expression. Furthermore, since pep2m causes the removal of AMPA receptors from the membrane surface, as determined immunocytochemically [de novo LTD is due to the physical elimination of synaptic AMPA receptors. Other evidence for a postsynaptic mechanism for de novo LTD includes a reduction in the postsynaptic sensitivity to glutamate [N a change from a single low conductance state to a single high conductance state, 2) changes in open times within a burst and, 3) changes in the proportion of time spent in different conductance states. Since AMPA receptors are known to have multiple conductance states ,33 we hade novo LTD was induced there was never a change in γ [de novo LTD and DP. Moreover, we have also investigated these possibilities using our standard compartmental model [decay which was never observed experimentally, and 2) pronounced changes in asynchrony necessary to cause an artefactual change in γ cause large deviations from the parabolic relationship in the current-variance plot (unpublished observations) and alterations in τrise [rise and τdecay [Other theoretical possibilities exist to explain DPγ. For example, the silencing of synapses close to the patch electrode leaving more distant synapses contributing a lower net γ due to electrotonic filtering, or a decrease in trial-to-trial asynchrony of transmitter release. We believe that these possibilities are unlikely because in every cell in which nge in γ . If suchal model . This shin τrise , also nein τrise . Such chin τrise , howeverd τdecay , which wIn summary, we have shown that there are two distinct molecular mechanisms for the reduction of synaptic strength. Although previous studies have provided evidence that LTD is associated with dephosphorylation of serine 845 on GluR1 ,17 it is4, 26 NaHCO3, 2 CaCl2, 1 MgSO4, 15 glucose, 2 ascorbic acid, 0.05 picrotoxin, saturated with 95% O2 / 5% CO2, at room temperature (23–25°C). Individual dendrites were visualised using infrared illumination and DIC optics and approached under visual control. Whole-cell dendritic recordings of synaptic currents were obtained at a holding potential of -70 mV using patch electrodes (6–10 MΩ) filled with a solution containing (in mM): 135 CsMeSO4, 8 NaCl, 10 HEPES, 0.5 EGTA, 4 Mg-ATP, 0.3 Na-GTP, 5 QX-314, pH 7.25, 285 mOsm. Schaffer collateral-commissural fibers were stimulated at 0.5 Hz using a platinum monopolar or concentric bipolar electrode, which was positioned 20–40 μm from the dendrite parallel to the input pathway. The stimulus intensity was set to evoke some failures to enable a failures analysis to be performed and to ensure that the majority of EPSCs were, for any given trial, evoked by release from a single site. However, to elicit sufficient EPSCs to obtain a baseline estimate of γ before "washout" of LTP it was usually necessary to set the success rate fairly high . As a result it is likely that multiple release sites contributed to the recordings. LTP was induced by pairing 40–60 stimuli (baseline frequency) with a holding potential of 0 mV. DP was induced following the induction of stable LTP by 100–200 stimuli (baseline frequency) at -40 mV holding potential. All recordings were made using an Axopatch 1B amplifier, signals were filtered at 5 kHz (8 pole Bessel filter), digitised at 10 kHz and stored on computer. EPSC amplitude and input resistance were analysed and displayed on-line using the 'LTP' program [Hippocampal slices (400 μm) were obtained from 12–15 day old rats and perfused with an extracellular solution containing (in mM): 124 NaCl, 3 KCl, 1.25 NaHPO program ). Seriesvs. the mean current amplitude and the single channel current was estimated by fitting the data to: σ2 = iI - I2/N + bl, where σ2 is the variance, I is the mean current, N is the number of channels activated at the peak, i is the single channel current and bl is the background variance. The single channel conductance (γ) is then γ = i/V, where V is the driving force . Response amplitude was measured in two ways. For failures, amplitude was estimated by measuring the difference between the average current over two time windows of equal length, one immediately before the stimulus artefact and the other centred on the peak of the mean EPSC. For estimation of the amplitude of successes the peak amplitude over a set time window was determined. Failures were identified visually, and potency was calculated as the mean EPSC amplitude excluding failures. For analysis of EPSC kinetics, rise time was estimated by the time-constant of a single exponential fit of the rising phase of the mean EPSC waveform. For decay, the time-constant of the single exponential fit to the decay phase was used. For display of individual EPSC traces in the figures, the stimulus artefact was digitally subtracted using an average of identified failures. All histograms are represented as smoothed line plots (SigmaPlot ver 5.0). Data are expressed as % of baseline . Statistical significance was assessed using the Student's t-test . All values are expressed as mean ± s.e.m.Non-SFA was performed as described previously . BrieflyAL performed most of the electrophysiology. MJP and MAW also contributed some recordings. PM provided some information that guided the work. TB performed the modelling that provided the theoretical frame-work. JI helped with the design and analysis of experiments. GLC coordinated the work and contributed to its design. All authors read and approved the manuscript.

The notion of a neurally encoded “reward system” that reinforces pleasure-seeking behaviors first emerged fifty years ago. Psychologists James Olds and Peter Milner discovered this phenomenon when their “lack of aim” landed an electrode outside their target while studying the behavioral responses of rats given electrical stimulation to a particular brain region. It was known that stimulation of certain brain regions would induce an animal to avoid the behavior that produced the stimulus. But in the rat with the “misplaced” electrode, stimulation of this new region caused the rat to repeat the behavior that caused the stimulus. Stimulation of certain brain regions provides a very strong incentive to restimulate, creating a feedback loop that reinforces both the behavior and the neural response to it. When gentle shocks were delivered to the rat hypothalamus, for example, the animals would “self-stimulate” 2,000 times per hour by pushing a lever. The neurotransmitter dopamine, it was later discovered, plays an important role in the brain's reward system—and in laying the biochemical foundation of drug addiction.Essential for normal central nervous system function, dopamine signaling mediates physiological functions as diverse as movement and lactation. The dopamine transporter (DAT) is involved in terminating dopamine signaling by removing the dopamine chemical messenger molecules from nerve synapses and returning them into the releasing neurons . DAT can also bind amphetamine, cocaine, and other psychostimulants, which inhibit dopamine reuptake, and, in the case of amphetamine, also stimulate the release of dopamine through DAT. It's thought that abnormal concentrations of dopamine in synapses initiate a series of events that cause the behavioral effects of these drugs. The biochemical steps underlying amphetamine-induced dopamine release, however, are not well characterized. Now, a team led by Jonathan Javitch and Aurelio Galli has identified a chemical modification of DAT that is essential for DAT-mediated dopamine release in the presence of amphetamine. Since this modification does not inhibit the ability of DAT to accumulate dopamine, it may suggest a molecular target for treating drug addiction.Embedded in the membrane of nerve cells, the dopamine transporter has a “tail,” called the N-terminal domain, that protrudes into the cell interior and consists of a stretch of about 60 amino acids. Many of these amino acids are potential sites of phosphorylation, a chemical reaction in which a phosphate group is added through the action of enzymes called kinases. Amphetamine has been shown to increase kinase activity and Margaret Gnegy, a coauthor of the current research article, showed previously that inhibiting protein kinase C activity blocks amphetamine's ability to release dopamine. Therefore, Javitch, Galli, and Gnegy hypothesized that N-terminal phosphorylation of DAT might play a critical role in the dopamine overload caused by amphetamine.The researchers found that amphetamine-induced dopamine release was reduced by 80% in cells expressing a mutant dopamine transporter in which the first 22 amino acids of the N-terminal domain had been removed (del-22). Surprisingly, this truncated transporter displayed normal dopamine uptake. In a full-length DAT, mutation of the five N-terminal serine amino acids to alanine amino acids, which prevented phosphorylation, produced an effect similar to removing the 22 amino acids. In contrast, replacing these five serine residues with aspartate residues to mimic phosphorylation led to normal dopamine release as well as normal dopamine uptake.These findings suggest that phosphorylation of one or more of these serine residues is necessary for amphetamine to flood the synapses with dopamine. While phosphorylation is a normal mechanism for regulating protein activity in a cell—and DAT is “significantly phosphorylated” under normal conditions—amphetamine could increase the level of DAT phosphorylation. Elucidating the mechanisms through which phosphorylation of DAT's N-terminus facilitates dopamine overload could lead to the development of drugs that block the “rewarding” effects of amphetamines and other addictive psychostimulants without interfering with normal dopamine clearance.

Combination therapy of irinotecan, folinic acid (FA) and 5-fluorouracil (5-FU) has been proven to be highly effective for the treatment of metastatic colorectal cancer. However, in light of safety and efficacy concerns, the best combination regimen for first-line therapy still needs to be defined. The current study reports on the bimonthly FOLFIRI protocol consisting of irinotecan with continuous FA/5-FU in five German outpatient clinics, with emphasis on the safety and efficiency, quality of life, management of delayed diarrhea, and secondary resection of regressive liver metastases.2), L-FA (200 mg/m2) and 5-FU bolus (400 mg/m2) on day 1, followed by a 46-h continuous infusion 5-FU (2400 mg/m2). One cycle contained three fortnightly administrations. Staging was performed after 2 cycles. Dosage was reduced at any time if toxicity NCI CTC grade III/IV was observed. Chemotherapy was administered only to diarrhea-free patients.A total of 35 patients were treated for metastatic colorectal cancer. All patients received first-line treatment according to the FOLFIRI regimen, consisting of irinotecan . Dose reduction was necessary in ten patients. Grade III/IV toxicity was rare, with diarrhea (14%), nausea/vomiting (12%), leucopenia (3%), neutropenia (9%) and mucositis (3%). The overall response rate was 31% (4 CR and 7 PR), with disease control in 74%. After primary chemotherapy, resection of liver metastases was achieved in three patients. In one patient, the CR was confirmed pathologically. Median progression-free and overall survival were seven and 17 months, respectively.The FOLFIRI regimen proved to be safe and efficient. Outpatient treatment was well tolerated. Since downstaging was possible, combinations of irinotecan and continuous FA/5-FU should further be investigated in neoadjuvant protocols. ColoRectal Cancer (CRC) have been demonstrated to benefit from chemotherapeutic treatment in terms of both quality and duration of life [Patients with advanced of life . Of thes of life ,3. 5-Flu of life -, was a of life -9. TheseIrinotecan (CPT-11), a potent inhibitor of the enzyme topoisomerase I, has demonstrated anti-tumorogenic activity in metastatic colorectal cancer, when used alone or in combinations with FA/5-FU, as adjuvant or palliative treatment (for review see 10 or 11). In randomized phase III clinical trials, second-line therapy with irinotecan significantly improved survival compared to supportive care or to inHowever, the best regimen of irinotecan and FA/5-FU has yet to be defined. Altogether, irinotecan combined with continuous FA/5-FU infusions seemed to be superiorly active and less toxic than combination with FA/5-FU bolus regimens ,7. RecenFurthermore, irinotecan schedules of weekly and of once every two or three weeks demonstrated similar efficacy and quality of life, as well as significantly lower incidences of severe diarrhea in patients with 5-FU-refractory, metastatic colorectal cancer -17. In cTo date, little data is available regarding irinotecan combined with the simplified bi-monthly LV5-FU2 regimen as a first-line treatment in patients with metastatic colorectal cancer . TherefoAfter approval by the local ethical committee, patients were consecutively recruited from five German outpatient clinics . Eligibility requirements included (1) histologically documented adenocarcinoma of the colon or rectum and progressive measurable metastatic disease, (2) minimum life expectancy of three months, (3) Karnofsky performance status ≥ 60, (4) adequate hematologic, hepatic, and renal function, and (4) no prior chemotherapy for metastatic disease. Participants needed to be between 18 and 75 years of age. This study required that previous adjuvant 5-FU-based therapy with or without radiation therapy be completed at least 6 months prior to entry. Patients with CNS metastases, bowel obstruction, or ileus were excluded from the study. The study was approved by the ethics commission board responsible for all participating institutions. Prior to treatment, all patients gave written informed consent.2 d1, 5-FU bolus 400 mg/m2 d1, followed by 5-FU 46 h continuous infusion 2400 mg/m2 (simplified LV5-FU2 schedule). To prevent expected toxicities, patients were carefully informed of the potential risk of delayed diarrhea and neutropenia and the need for early intervention with loperamide [As previously described -16, treaperamide and metoperamide . Atropinperamide . AntiemePrimary measures of the study were the overall objective response rate , overall survival, and quality of life. Secondary measures included the disease control rate (ORR + stable disease), time to progression, and frequency and severity of toxicities. Quality of life was assessed after inclusion into the study and as often as possible during the course of treatment, using the EORTC QLQ-C30 (version 2) questionnaire .Safety assessments and complete blood counts were performed weekly. Toxicity was graded according to National Cancer Institute Common Toxicity Criteria (NCI CTC). Toxicities not defined by NCI CTC criteria were classified as grade 0 (none), grade I (minor), grade II (moderate), grade III (severe), and grade IV (life-threatening). In case of any toxicity grade II, with the exception of hand-foot syndrome or alopecia, the next scheduled doses of irinotecan, folinic acid and 5-FU were delayed for a maximum of 1 week (or resolution of diarrhea for at least five days). In case of toxicity grade III/IV or if improvement from grade II to I (or resolution of diarrhea) was not achieved by two weeks, the following chemotherapy doses were reduced by 20 percent. If grade III/IV toxicity did not improve by 2 weeks, treatment was discontinued. Dose reductions were mandatory from the first cycle of chemotherapy in case of toxicity higher than grade II, and chemotherapy was resumed only after complete recovery from diarrhea.Tumor response was assessed according to World Health Organization (WHO) criteria. Tumor reassessment by the same imaging method used to establish baseline tumor measurement was generally performed after every two courses of therapy until progression. A complete response (CR) was defined as complete disappearance of evidence of cancer. A partial response (PR) was defined as a reduction in the sum of the products of the bi-perpendicular diameters of all measurable lesions by at least 50%. Progressive disease (PD) was defined as an increase in the sum of the products of the greatest bi-perpendicular diameters of all measurable lesions by at least 25% or the appearance of new lesions. Stable disease was defined as any reduction or increase in measurable lesions which did not meet the criteria for PR or PD. Confirmed objective responses were those for which a follow-up scan obtained at least four weeks later demonstrated the persistence of the response. The assessment of response and progression was based on investigator-reported measurements.Statistical analysis including survival analysis according to Kaplan-Meier was performed with the SPSS software package. The deadline for data evaluation was March 15, 2004. Survival was measured from the time of diagnosis to the date of death or last follow-up. Progression-free survival was calculated from treatment onset to the time of progression, study withdrawal or death of any cause. Patients who received at least one dose of the treatment regimen were evaluated for toxicity, and patients who completed at least two chemotherapy cycles were evaluated for response.Between 10/2001 and 5/2003, 35 consecutive patients with metastatic colorectal cancer were enrolled into the study. The median age of these patients was 62 years, ranging from 38 to 73. Baseline characteristics of all patients are summarized in table The 35 patients received a total of 151 chemotherapy cycles , consisting of 451 administrations. Overall, 51 of all administrations had to be delayed for one week. During the complete study period, 19 patients had a delay of therapy for a median of nine days and in 10 patients (29%) a dose reduction was necessary at some point during the treatment period. The most common cause for discontinuation of study treatment was disease progression . In case of discontinuation, 16 (46%) patients received a second line treatment with either oxaliplatin plus a FA/5-FU consisting regimen or an epidermal growth factor receptor antagonist.Hematologic toxicity was mild to moderate in the majority of patients table . Only onWith regard to response, four complete (CR) and seven partial responses were seen, and thus an overall response rate of 31% was observed table . In addiQuality of life data were obtained before and at least once during treatment from 13 patients . The 13 In the current phase IV study we evaluated toxicity and efficacy of the FOLFIRI combination of irinotecan with FA/5-FU as first-line chemotherapy for metastatic colorectal cancer. This combination was established within a phase I clinical trial with a recommended irinotecan dose of 180 mg/qm ,16. IrinIn the majority of our patients the FOLFIRI regimen was well tolerated. Gastrointestinal toxicity or thrombembolic events were never fatal. Most hospitalizations were for prevention rather than treatment of life-threatening conditions. Delayed diarrhea, a well known side effect of irinotecan , was genOverall, we observed relatively low toxicity in our study, with NCI CTC grade III leucopenia amounting to 3%, diarrhea to 14% and nausea/vomiting to 11%. The toxicity observed in our study was lower than that reported by Douillard et al. in the pivotal European first-line trial in the patient group receiving weekly irinotecan (80 mg/qm), 24-h HD-5-FU (2300 mg/qm) preceded by 2-h FA 500 mg/qm . In thisThe response rate achieved in our study (31%) was quite comperable tp previously published data ,7,14,26.Three reasons may account for these differences in survival between the studies. The most important reason may be that a higher percentage of patients in our study had two or more metastatic sites, indicating a larger tumor burden and consequently a worse prognosis regarding survival . Second,It appears particularly noteworthy that after chemotherapy three of our patients achieved surgical resectability of their metastases. To our knowledge these results are the first ever reported to suggest a potential role for the FOLFIRI regimen in the neoadjuvant setting. Thus far, studies of regional chemotherapy for initially unresectable colorectal liver metastases could demonstrate some success with secondary curative surgery. In two recently published retrospective studies chronomodulated chemotherapy with oxaliplatin and FA/5-FU was used as neoadjuvant treatment for patients with unresectable colorectal liver metastases ,28. TherThe FOLFIRI regimen, consisting of irinotecan with continuous FA/5-FU over 48 h, given on an outpatient basis was safe and well tolerated in our study. The rate of severe side effects was comparably low with this bi-monthly regimen. As tumor control was achieved in about 75% and downstaging of metastatic disease was possible in some cases, combinations of irinotecan plus continuous FA/5-FU should be further investigated in neoadjuvant protocols for initially unresectable liver metastases.CRC Colorectal CancerFOLFIRI chemotherapeutic regimen consisting of irinotecan combined with continuous FA/5-FU infusionsFA Folinic Acid5-FU 5-FluorouracilHD-5-FU high dose 5-FUNCI CTC National Cancer Institute Common Toxicity CriteriaCR Complete remissionPR Partial responseSD Stable diseasePD Progressive diseaseTTP Time to progressionOS Overall survivalMM, SS and AT drafted the manuscript. MM and MH initiated the study. JS, CZ, HH, BA, MS, OK, T, PG and MH were involved in the patient's treatment as well as the documentation of response and side effects.The pre-publication history for this paper can be accessed here:

Keratins are members of the intermediate filaments (IFs) proteins, which constitute one of the three major cytoskeletal protein families. In hepatocytes, keratin 8 and 18 (K8/18) are believed to play a protective role against mechanical and toxic stress. Post-translational modifications such as phosphorylation and glycosylation are thought to modulate K8/18 functions. Treatment of mouse with a diet containing griseofulvin (GF) induces, in hepatocytes, modifications in organization, expression and phosphorylation of K8/18 IFs and leads, on the long term, to the formation of K8/18 containing aggregates morphologically and biochemically identical to Mallory bodies present in a number of human liver diseases. The aim of the present study was to investigate the relationship between the level and localization of the stress inducible heat shock protein 70 kDa (HSP70i) and the level and localization of K8/18 phosphorylation in the liver of GF-intoxicated mice. The role of these processes in Mallory body formation was studied, too. The experiment was carried out parallely on two different mouse strains, C3H and FVB/n.GF-treatment induced an increase in HSP70i expression and K8 phosphorylation on serines 79 (K8 S79), 436 (K8 S436), and K18 phosphorylation on serine 33 (K18 S33) as determined by Western blotting. Using immunofluorescence staining, we showed that after treatment, HSP70i was present in all hepatocytes. However, phosphorylated K8 S79 (K8 pS79) and K8 S436 (K8 pS436) were observed only in groups of hepatocytes or in isolated hepatocytes. K18 pS33 was increased in all hepatocytes. HSP70i colocalized with MBs containing phosphorylated K8/18. Phophorylation of K8 S79 was observed in C3H mice MBs but was not present in FVB/n MBs.in vivo, there is no direct relationship between GF-induced stress and K8/18 phosphorylation on the studied sites. The K8/18 phosphorylation pattern indicates that different cell signaling pathways are activated in subpopulations of hepatocytes. Moreover, our results demonstrate that, in distinct genetic backgrounds, the induction of K8/18 phosphorylation can be different.Our results indicate that GF intoxication represents a stress condition affecting all hepatocytes, whereas induction of K8/18 phosphorylation is not occurring in every hepatocyte. We conclude that, Intermediate filaments (IFs) with microtubules and actin microfilaments are the major cytoskeletal components of most vertebrate cells -4. IF prIt is now generally accepted that, in multilayered epithelia, one of the function for keratins IFs is to protect the tissue from mechanical stress -9. The fAs for epidermal keratins, the production of transgenic mice targeting K8 or K18 has been necessary to unravel the role of IFs in simple epithelium such as in the liver. In hepatocytes, K8/18 is the only keratin pair and thus both keratins are necessary to form an IF network. Transgenic mice expressing K8 or K18 carrying mutations that affect filament formation, develop mild hepatitis and display greater liver sensitivity to mechanical and toxic stress than wild type animals ,13.Recent studies from Ku et al. -16 have Long-term treatment of mice with a diet containing griseofulvin (GF) induces the development of an hepatitis associated with the formation of MBs, which are biochemically and morphologically similar to those found in humans ,28. ThisIn the present study, we investigated the effect of chronic GF intoxication on hepatocytes from C3H and FVB/n mouse strains. We monitored the expression of the stress inducible form of the heat shock protein 70 kDa (HSP70i) and the induction of K8/18 phosphorylation at specific sites: K8 on serine 79 (K8 S79), K8 on serine 436 (K8 S436), K18 on serine 52 (K18 S52) and K18 on serine 33 (K18 S33) . We The modifications in the amount of HSP70i, K8/18, and phosphorylated keratins were analyzed by Western Blotting of total proteins from control and GF-treated C3H and FVB/n mouse livers . GF intoxication induced an increase in keratin levels in livers from both mouse strains Fig. . HSP70i,Total proteins from C3H and FVB/n livers were probed with antibodies against K8 pS79, K8 pS436 and K18 pS33 Fig. . SignifiWe analyzed at the cellular level, by double immunofluorescence staining, the distribution of HSP70i and IFs on liver sections of control and GF-treated C3H and FVB/n mouse livers.In control hepatocytes, IFs formed a complex cytoplasmic network that was denser at the cell membrane and particularly around the bile canaliculi Fig. . Our bioCryosections of control and GF-treated C3H and FVB/n mouse livers were fixed with 4% paraformaldehyde and processed for double immunofluorescence staining. As mentioned above, control mice showed hepatocytes with a cytoplasmic IF network, which was denser at the cell periphery Fig. . K8 pS79After 2 weeks of GF-treatment, hepatocytes were enlarged and an increase in cytoplasmic IF network was observed Fig. ,4,5C. ThIn the case of K18 S33, its phosphorylation was increased in most hepatocytes. Most of the staining was observed at the periphery of the cells, delimitating clearly the bile canaliculi. A few hepatocytes showed high levels of cytoplasmic K18 pS33 Fig. .After 6 weeks of GF-treatment, the distribution of hepatocytes containing K8 pS79 and K8 pS436 was different from the one observed after 2 weeks of treatment. Clusters of labeled cells were smaller, whereas labeled isolated cells became more prominent Fig. ,4F. SingAfter 5 months of GF-treatment, MBs were present in some hepatocytes in both mouse strains Fig. ,4G,5G. MDouble immunostaining with anti-HSP70i and anti-phosphorylated keratins (K8 pS79 or K8 pS436) was performed for studying the localization of HSP70i in relation to keratin phosphorylation. The results showed that HSP70i and phosphorylated K8 species colocalized in some cells or clusters of cells. Labeled singlet or doublet cells were more numerous after staining with the anti-K8 pS79 than after staining with the anti-K8 pS436. These cells could correspond to cells that are undergoing mitosis. This is supported by previous studies which showed that the phosphorylation of K8 on S79 and S436 occurs during mitosis ,48. ThisThe presence of K8 pS79 and K8 pS436 was also detected in islets of cells. Interestingly, both antigens were present in the same clusters of cells surrounding unstained cells that were most likely undergoing apoptosis. These unstained cells are evocative of detached cells during anoikis, an apoptotic process that can be induced by loss of cell-cell anchorage. Stress and apoptosis has been shown to modulate K8 S79 and K8 S436 phosphorylation ,48. The via K8. Our study show that colocalization of HSP70i and IFs occurs only in a few hepatocytes. Since the hepatocytes, in which colocalization was observed, contained K8 pS79 or K8 pS436, HSP70i binding to IFs in these cells may be related to the presence of keratin phosphorylation and participates to cellular pathways involving phosphorylated K8/18 on specific sites. Ku et al. [Liao et al. have shou et al. have shou et al. , HSP70i u et al. ,53. HoweChronic intoxication of mice with GF induces the formation of MBs. Numerous studies have demonstrated the presence of different phosphorylated K8/18 species within MBs, suggesting that K8/18 phosphorylation could participate in the MB formation processes ,54. In oThe treatment with GF that represents a toxic stress, most likely, involves the activation of stress activated protein kinases (SAPKs) in some hepatocytes. SAPKs p38 and JNK are physiologic kinases for K8 S79 and K8 S436 ,55. We pOur results show that increases in HSP70i, K8/18 expression and K8/18 phosphorylation constitute early events in the response of hepatocytes to the presence of GF. These observations support a role for keratins in preserving cellular integrity during stress conditions induced by the presence of a chemical agent ,35. HSP7ad libitum. GF-treated mice were fed a diet containing 2.5% (w/w) GF for different periods of time: 2 weeks, 6 weeks and 5 months according to the method of Denk et al. [Experiments were performed with adult C3H mice and FVB/n mice weighing 25 to 30 g. Two mouse strains were used to minimize the potential effect of different genetic background on the response of hepatocytes and to facilitate the interpretation of the data. All animals were housed with a 12-hour light-dark cycle and allowed the consumption of water and of a standard mouse semi-synthetic diet , both k et al. . Control® Laboratories Canada, Burlington, ON) were used to perform immunolabelling with mAbs LJ4 and 5B3. The secondary antibodies used for Western blotting were as follows: biotinylated goat anti-rat IgG, biotinylated donkey anti-mouse IgG and peroxydase donkey anti-rabbit IgG . Other reagents used were: Horseradish Streptavidin Peroxydase-conjugated (SPC) , Bovine Serum Albumin (BSA) , Leupeptin , Pepstatin , Aprotinin , Normal Horse Serum (NHS) , Luminol .The antibodies used were as following: Troma 1, a rat monoclonal antibody (rAb) that recognizes K8 ; LJ4, a ®) in PBS , incubated with the primary antibodies for 45 min, at room temperature, washed in PBS containing 0.2% (v/v) Tween 20 and incubated for 45 min with the appropriate secondary antibody: biotinylated goat anti-rat IgG , biotinylated donkey anti-mouse IgG and horseradish peroxydase donkey anti-rabbit IgG . When biotinylated secondary antibodies were used, membranes were washed with PBS-Tween 20 and incubated with streptavidin conjugated with horseradish peroxydase for 30 min and washed with PBS-Tween 20. The chemiluminescent horseradish peroxydase substrate Luminol was added to the membranes according to recommendations of the company, and membranes were exposed to Blue X-Omat X-ray film sheets to localize antibody binding.Livers were homogenized in 62.5 mM Tris-HCl, pH 6.8 containing 2.3 % (w/v) SDS, 50 mM sodium fluoride, 10 mM EDTA, 1 mM sodium pyrophosphate, 1 mM DTT, 1 mM PMSF, 1 μM leupeptin , 1 μM pepstatin , 2.5 μg/ml aprotinin . Proteins were separated by electrophoresis on 10% SDS-polyacrylamide gels . Protein® Laboratories Canada, Burlington, ON) and an Avidin/Biotin blocking kit according to recommendations of the company. Normal horse serum was added to solution during incubation step with secondary antibody. For heat shock proteins staining, liver sections were incubated with anti-HSP 70i diluted in TBS containing 10% BSA for 45 min at 37°C, washed in TBS and incubated for 45 min at 37°C with a FITC conjugated donkey anti-rabbit IgG diluted in TBS containing 10% BSA. For detection of HSP70i, K8 pS79 and K8 pS436, the sections were treated with 1% (v/v) Nonidet P-40 following fixing step with 4% paraformaldehyde.Cryosections (4 μm) of fresh liver were fixed with 4% (w/v) paraformaldehyde in PBS pH 7.2 for 20 min, at room temperature, and rinsed in PBS or TBS upon staining protocols. Since fixation can affect antibody-binding capacity, cryosections were also fixed with cold acetone (-20°C) for 10 min. For the detection of K8, sections were incubated with rAb Troma 1 at room temperature, washed in PBS and incubated with a FITC or a TRITC conjugated goat anti-rat IgG for 45 min, at room temperature. For immunostaining of K18 pS33, sections were incubated for 1 hour, at room temperature with anti-K18 pS33 (8250) diluted in PBS containing 10% (w/v) BSA, washed in PBS and incubated for 45 min with a FITC conjugated donkey anti-rabbit IgG in PBS containing 10% BSA . Immunostaining with anti-K8 pS79 (LJ4) and anti-K8 pS436 (5B3) mAbs, was done using the M.O.M. (mouse on mouse) detection kit (Vector® BX60 photomicroscope.The tissues were mounted in P-phenylene diamine diluted in 50% (v/v) glycerol. The slides were kept at -20°C and photomicrographs were collected using an OlympusHSP70i – inducible form of 70 kDa Heat shock protein. GF – griseofulvin. IFs – intermediate filaments. K8 – keratin 8. K8/18 – keratin 8 and keratin 18. K8 S79 – serine 79 on keratin 8. K8 pS79 – phosphorylated serine 79 on keratin 8. MBs – Mallory bodies.MF carried out all western blotting analyses, performed the immunofluorescence studies and participated in drafting the manuscript. LV participated in the design of the study. MC participated in the design of study, its coordination and drafting the manuscript. All authors read and approved the final manuscript.

Formins are multidomain proteins defined by a conserved FH2 (formin homology 2) domain with actin nucleation activity preceded by a proline-rich FH1 (formin homology 1) domain. Formins act as profilin-modulated processive actin nucleators conserved throughout a wide range of eukaryotes.Dictyostelium discoideum. With the exception of ForI and ForC all other formins conform to the domain structure GBD/FH3-FH1-FH2-DAD, where DAD is the Diaphanous autoinhibition domain and GBD/FH3 is the Rho GTPase-binding domain/formin homology 3 domain that we propose to represent a single domain. ForC lacks a FH1 domain, ForI lacks recognizable GBD/FH3 and DAD domains and ForA, E and J have additional unique domains. To establish the relationship between formins of Dictyostelium and other organisms we constructed a phylogenetic tree based on the alignment of FH2 domains. Real-time PCR was used to study the expression pattern of formin genes. Expression of forC, D, I and J increased during transition to multi-cellular stages, while the rest of genes displayed less marked developmental variations. During sexual development, expression of forH and forI displayed a significant increase in fusion competent cells.We present a detailed sequence analysis of the 10 formins (ForA to J) identified in the genome of the social amoeba Dictyostelium formins: all isoforms might display actin nucleation activity and, with the exception of ForI, might also be susceptible to autoinhibition and to regulation by Rho GTPases. The architecture GBD/FH3-FH1-FH2-DAD appears common to almost all Dictyostelium, fungal and metazoan formins, for which we propose the denomination of conventional formins, and implies a common regulatory mechanism.Our analysis allows some preliminary insight into the functionality of Mice with mutant alleles fail to form proper limbs and kidneys [Diaphanous) [Eukaryotic cells rely on de novo nucleation mechanisms to generate actin filaments in order to elicit spatial and temporal remodeling of their actin cytoskeleton. Besides the Arp2/3 complex, nucleation activity has been recently demonstrated also for formins (reviewed in ). Forminphanous) ,5. Due tphanous) ).The FH2 (formin homology 2) domain is the defining feature of all formins. It is very well conserved and is almost invariably preceded by a proline-rich region, the FH1 (formin homology 1) domain ,7. In viIn most fungal and metazoan formins the FH1-FH2 core is accompanied by a less well conserved N-terminal FH3 (formin homology 3) domain involved in targeting . In planDictyostelium discoideum is an attractive model organism to investigate the components of the actin cytoskeleton and the signaling pathways involved in its regulation [Dictyostelium amoebae are equipped with a complex actin cytoskeleton that endows the cells with motile behavior comparable to that of human leukocytes. In fact, a genome-wide survey revealed that the repertoire of cytoskeletal components of Dictyostelium is more similar to metazoa followed by fungi than to plants . In Dictyostelium, nine formins have been previously identified but only three of them have been characterized to some extent [In vivo experiments with GFP fusions showed that the N-terminal region of ForC targets the protein to places of active actin reorganization, like macropinosomes, phagocytic cups and cell-to-cell contacts [The social amoeba gulation ,19. Dicte extent . Mutantscontacts .Dictyostelium sequencing projects in order to achieve a complete inventory of formin genes. A detailed sequence analysis of the 10 formins identified revealed that, with the exception of ForI and ForC, all other formins conform to the domain structure GBD/FH3-FH1-FH2-DAD present in almost all fungal and metazoan formins, for which we propose the denomination of conventional formins. Our sequence analysis also indicates that the GBD and FH3 domains constitute a single domain also found in two Dictyostelium RasGEFs (guanine nucleotide exchange factors). The expression pattern of formin genes during asexual and sexual development was studied using real-time PCR. Our analysis allows some preliminary insight into the functionality of Dictyostelium formins: all isoforms might display actin nucleation activity and, with the exception of ForI, might also be susceptible to autoinhibition and regulation by Rho GTPases.We have made use of the information released by the Dictyostelium [Dictyostelium we sought to exploit the available databases in order to achieve a complete inventory of formin genes in its entire length. The sequences already reported by Kitayama et al. [Dictyostelium genomic DNA database. This allowed assembly of complete genomic sequence for forA through forI. In order to verify the predicted amino acid sequence for each formin, Blast searches were performed against the Dictyostelium EST database. In cases where no EST sequences were available, like forG and forI, introns were verified after RT-PCR.In a previous publication 9 genes that potentially encode proteins of the formin family were identified in ostelium . For soma et al. were useforJ, whose genomic sequence was also retrieved and inspected. Recent completion of the assembly of the Dictyostelium genome allowed us to confirm our gene predictions and map each formin gene to its corresponding chromosome locus . Formin genes are dispersed all over the six chromosomes (each chromosome harbors at least one formin gene), and in no case two or more genes are placed adjacent to each other along with these two intron positions underscore the view that all Dictyostelium formin genes might have arisen from a common ancestor gene. After duplications and divergence from this ancestral formin gene introns were acquired or lost and additional domains and extensions were appended to some genes.Only two intron positions are conserved among es Figs. and 4. IDictyostelium formins was determined by means of bioinformatics tools and visual inspection. Although formins vary considerably in length (935 residues of ForI versus 2546 of ForJ), with few exceptions they have in common a core of about 1100 residues that harbors a GBD/FH3-FH1-FH2-DAD structure characteristic of most fungal and metazoan formins have one or more stretches of intervening repetitive sequences of variable length rich in Arg, Gln or Ser. Such repetitive sequences are characteristic of many Dictyostelium genes. The crystal structure of the FH2 domain of two formins, Bni1p and mDia1, has been recently solved [Dictyostelium formins in the context of these two structures. The FH2 domain fold is almost entirely α-helical. It is a stable dimer that forms a closed parallelogram-shaped ring. The structure of this domain can be subdivided into subdomains. At the N-terminus a so-called lasso is connected to a globular knob but the important methionine residue (Met7) [Dictyostelium formins as well as in members of the FHOD (formin homology domain containing protein) and plant class1 subfamilies.All residues of the sequence motif GNY/FMN participate in dimerization. This motif is also highly conserved in almost all e (Met7) is preseDictyostelium formins) and Arg5 (substituted by Lys in ForB and ForE). These residues were found mutated in temperature-sensitive yeast mutants [Also very conserved are some residues probably involved in binding to actin, like Ile3 (absolutely conserved) in the N-terminal subdomain and Lys9 in the post region (substituted by Arg in ForB and ForH). Mutation of these residues in Bni1p to Ala and Asp, respectively, abolished actin nucleation and barbed end capping activity of the FH2 domain , and rep mutants ,24, and mutants .Dictyostelium formins, indicating that all ten formins might be functional actin nucleators.In summary, all essential residues in the FH2 domain revealed by structural and functional studies in metazoan and fungal formins are conserved in Dictyostelium and other organisms and to investigate whether different species share subfamilies of formins, we constructed a phylogenetic tree based on the alignment of complete sets of sequences of FH2 domains from selected organisms, including representatives of fungi, plants, invertebrates and vertebrates. We retrieved sequences of already characterized formins and additionally we made a search of further available sequences through the SMART server with the FH2 domain as query. Appart from the ten sequences of Dictyostelium, we collected a total of 62 sequences, 21 from plants, 5 from yeasts, 6 from D. melanogaster, 6 from C. elegans and 14 from human. Taking into account that some genes might not have been predicted accurately and that predicted proteins not supported by EST sequences were not considered for our analysis, further metazoan formins, especially from human, most probably went unidentified in our search.In order to establish the relationship between formins of C. elegans members are more divergent. The phylogenetic analysis reveals clustering of most formins into well defined classes. Yeast formins form a separate class whereas plant formins significantly group into any of two classes. Metazoan formins do not constitute a single cluster, rather they distribute into a number of subfamilies. The FHOD, Diaphanous and FMNL (formin in leukocytes) subfamilies have representatives in human, D. melanogaster and C. elegans. The Cappuccino/Formin and DAAM (Dishevelled-asssociated activator of morphogenesis) subfamilies, as well as a novel subfamily, is present in human and D. melanogaster, but seems to be absent in C. elegans. Delphilin constitutes a subfamily with a unique member present only in human. Finally, C. elegans has some additional divergent formins apparently unique to this organism.The phylogenetic tree Fig. supportsDictyostelium formins are 45.5% similar to each other, with ForC being only slightly more divergent (40.0%/20.4% similarity/identity to the rest of Dictyostelium formins). A comparable degree of similarity (identity) was found to members of several subfamilies of metazoan formins, and ranged between 40% (20%) and 48% (24%). Similarity (identity) to plant and yeast formins was lower: 38% (19%) and 36% (17%) respectively. Dictyostelium ForC and ForG cluster together with the Cappuccino/Formin group (75% bootstraps), whereas ForI very weakly clusters with the FHOD subfamily (53% bootstraps). However, taking into account that the FH2 domain is highly conserved, the position of these three Dictyostelium formins in the tree does not necessarily mean functional relationship with the mammalian counterpart, because other domains are probably responsible for diversity of localization and function. Bootstrapping does not support a significant clustering of the rest of the Dictyostelium formins, and only few members cluster together with a reasonably high number of bootstraps .On average, Dictyostelium, with the notable exception of ForC. The length of the FH1 domains is very variable among formins (10 to >500 amino acids). It constitutes a binding site for the actin monomer binding protein profilin, as well as for SH3 and WW domain containing signaling proteins [Dictyostelium formis have a variable number of these motifs, between 1 in ForD and 8 in ForA , RasGEFs, fungal formins and members of the Diaphanous, DAAM, FMNL and FHOD subfamilies .We constructed a phylogenetic tree based on a multiple alignment of the GBD/FH3 domain of ies Fig. . With feain Fig. . In manyDictyostelium formins revealed a DAD in all members with the exception of ForI or downstream of the FH2 domain (ForD and ForJ) that might constitute potential protein interaction sites with regulatory or targeting functions.Like metazoan and fungal formins, most nds Fig. . For exaDictyostelium formins have additional recognizable domains at their N-terminus or gradually increased (forF) or decreased after the onset of development.The expression patterns observed during asexual development can be classified into two major groups. Expression of forH and forI displayed a significant increase of about 3-fold in fusion competent cells compared to fusion incompetent cells. Cells cultured in light submerged conditions have a reduced sexual fusion competency [forH and forI were enriched in fusion competent compared to light submerged cells, indicating that this enrichment is related to the acquisition of the fusion competence rather than to the submerged condition that was included to induce the fusion competence.When expression was analyzed during sexual development only mpetency ,33. In pDictyostelium, which in this organism comprises 10 genes. A comparison of the domain composition of formins from diverse phyla allows their grouping into four major classes , which includes all fungal and almost all metazoan formins. This is in agreement with a genome wide analysis that places Dictyostelium closer to fungi and metazoa than to plants .We have performed a detailed sequence and expression analysis of the formin family of ses Fig. . In geneWith very few exceptions all formins have in common a FH2 domain immediately preceded by a FH1 domain. The FH1-FH2 combination constitutes the minimal core that is fully functional in terms of actin nucleation and elongation activity . We therefore propose the use of the name conventional formins for those subfamilies with the general structure GBD/FH3-FH1-FH2, although in particular members or in alternatively spliced variants a domain (but never the FH2) might be absent, indicating whether the protein is Rho-regulated where documented experimentally. The name Diaphanous-related formin should be restricted to the metazoan members of the Diaphanous subfamily, like human DRF1 to 3.The designation Diaphanous-related formin has been applied to those formins that interact with activated Rho GTPases . HoweverDictyostelium formins is scarce. Only three isoforms, formins A, B and C have been characterized to some extent. Mutants lacking ForA, ForB or both showed no detectable phenotype, whereas deletion of forC led to formation of aberrant fruiting bodies with short stalks and unlifted sori, suggesting this formin mediates actin remodeling during multicellular stages [Dictyostelium formins are expected to be functional according to their highly conserved FH1-FH2 structure; therefore a certain degree of functional redundancy is expected. However, diversity might arise through specific targeting and activation by Rho GTPases conferred by the GBD/FH3 domain, through interaction of specific SH3-domain containing proteins with the FH1 domain and by virtue of unique additional domains. These issues need to be addressed experimentally in the future.Functional data on r stages . DictyosForC and ForI might be exceptions in terms of regulation. ForC lacks a FH1 domain and consequently does not bind to profilins . AlthougDictyostelium formins have domains at their N-termini that are not found in other formins and might confer unique additional functions or ways of regulation or targeting. The C2 and C1 domains of ForA and ForE, respectively, might regulate activation or targeting of the molecule through interaction with specific lipids [Three c lipids ,30, whilc lipids . In genec lipids ,16 and tforC, D, I and J, displayed an increase in expression during transition to multi-cellular stages. During this phase cells acquire aggregation competence in parallel with maturation of signaling pathways involved in remodeling of the cytoskeleton. At least for forC gene expression data correlate with a developmental role, as mentioned above [rac1b and racF2 was found increased during the analysis of a gamete-enriched cDNA library [Functional diversity might also be related to different patterns of local and temporal gene expression. Our gene expression analyses also suggest specific roles during asexual and sexual development. Four genes in particular, ed above . ForH an library . It is tDictyostelium discoideum expresses 10 formins that with few exceptions conform to the domain structure GBD/FH3-FH1-FH2-DAD. This arhitecture and the high degree of conservation of the FH2 domain allow some preliminary conclusions about the functionality of Dictyostelium formins: all isoforms may display actin nucleation activity and, with the exception of ForI, may also be susceptible to autoinhibition and to regulation by Rho GTPases. Although functional redundancy may be expected to occur to some extent among Dictyostelium formins, specific roles may be conferred by the GBD/FH3 domain, which is less well conserved than the FH2 domain, and by specific patterns of gene expression during asexual and sexual development.The social amoeba Dictyostelium, fungal and most metazoan formins can be grouped within the class of what we designate conventional formins, characterized by the structure GBD/FH3-FH1-FH2-DAD. The GBD and FH3 domains, whose boundaries had not been defined previously, probably constitute a single domain. The architecture shared by conventional formins implies a common regulatory mechanism based on autoinhibition through intramoleculr interaction of the GBD/FH3 and the DAD domains and activation through release of this interaction upon binding of Rho GTPases. Formins of the other classes (plant formins and Delphilin) lack GBD/FH3 and DAD domains and must therefore have other mechanisms of activation.We propose four major classes of formins based on a comparison of the domain composition of proteins from diverse phyla. Note. While our manuscript was under review a phylogenetic analysis of the FH2 domain by H. N Higgs and K. J. Peterson has been published. These authors used a larger set of FH2 domains that includes only three formins from Dictyostelium. The topology of the phylogenetic tree described in that article and that of our tree are essentially coincident, and all seven metazoan groups identified by their authors can be found in our tree, with the novel subfamily INV comprising our HsKIAA1727, DmAE003560 and CeAF106580 sequences. Higgs and Peterson, however, do not recognize the GBD/FH3 region as a domain present in a larger number of formin subfamilies.Dictyostelium formins were used as query for BLAST searches [Dictyostelium genome project databases at The Welcome Trust Sanger Institute, Baylor College of Medicine, The University of Cologne and the Department of Genome Analysis of the Institute of Molecular Biotechnology in Jena. Nearly all of this data was generated at the aforementioned institutes with a small part of it produced at the Institute Pasteur. After assembly of the genome further analyses were performed through the Dictybase server [Dictyostelium formins can be found in Table The amino acid or DNA sequences of searches of the De server . BLAST se server . AccessiS. cerevisiae Bni1p, P41832; Bnr1p, P40450; S. pombe Fus1, L37838; Cdc12, 786133; For3, AL035247. D. melanogaster Cappuccino, U34258; Diaphanous, U11288; FHOD, AE003554; FMNL, BT003654; DAAM, AAF45601; a novel formin, AE003560. C. elegans FHOD, U88314; Cyk-1, U40187; FMNL, AC024798; novel formins, Z78013, AF106580 and Z22174. H. sapiens Formin 1, AK127078; Formin 2, XM_351329; FHOD1, AF113615; FHOD3/FHOS2, KIAA1695; DRF1, AF05187; DRF2, Y15909; DRF3, BC034952; Delphilin, XM_353725; FMNL1, AF432213; FMNL2/FHOD2, KIAA1902; WBP3/FMNL3, NM_175736; DAAM1, NM_014992; DAAM2, AL833083; a novel formin KIAA1727. Sequences of plant formins were obtained from Cvrčková et al. [Dictyostelium RasGEF-L and RasGEF-V can be accessed at Dictybase [Accession numbers of the sequences retrieved for phylogenetic analyses are as follows. Protein sequences were aligned using the ClustalX program D. discoideum AX2 strain was grown at 21°C in shaking suspension in axenic HL5 medium [K. aerogenes in BSS either in the darkness or in the light. Cells cultured for 15 hours in the dark become fusion-competent cells. However, cells cultured for 15 hours in the light condition exhibit reduced fusion competency, and are designated light submerged cells. Cells on SM agar plates [5 medium . AX2 cel5 medium . In brier plates are fusiTotal RNA was purified from both asexually and sexually developing cells with the TRIZOL reagent . Asexually developing cells on phosphate agar plates were colFor RT-PCR, first strand cDNA synthesis was performed with M-MLV reverse transcriptase on poly A+ mRNA purified with the Oligotex system from total RNA. PCR fragments were cloned into the pGEM-T Easy vector system and sequenced. DNA sequencing was done at the service laboratory of the Center for Molecular Medicine, Cologne, using an automated sequencer .FR conceived the study, performed the assembly of genomic sequences and the sequence alignments and drafted the manuscript. TM and HU carried out the gene expression studies. AKM performed RT-PCR and cloning. CK and TQPU participated in the design of the study and the assembly of genomic sequences. All authors read and approved the final manuscript.

Anxiety and depression co-occur in children and adolescents with anxiety commonly preceding depression. Although there is some evidence to suggest that the association between early anxiety and later depression is explained by a shared genetic aetiology, the contribution of environmental factors is less well examined and it is unknown whether anxiety itself is a phenotypic risk factor for later depression. These explanations of the association between early anxiety and later depression were evaluated.Anxiety and depressive symptoms were assessed longitudinally in a U.K. population-based sample of 676 twins aged 5–17 at baseline. At baseline, anxiety and depression were assessed by parental questionnaire. Depression was assessed three years later by parental and adolescent questionnaire.Shared genetic effects between early anxiety and later depression were found. A model of a phenotypic risk effect from early anxiety on later depression provided a poor fit to the data. However, there were significant genetic effects specific to later depression, showing that early anxiety and later depression do not index entirely the same genetic risk.Anxiety and depression are associated over time because they share a partly common genetic aetiology rather than because the anxiety phenotype leads to later depression. Anxiety and depressive disorders are some of the most common psychiatric diagnoses in children and adolescents respectively. Both are known to be associated with major impairment in childhood and adverse consequences in later life -4. EstimDepression and anxiety co-occur more commonly than would be expected by chance in children and adolescents. This co-occurrence has been identified both in clinical studies of children and adolescents and general population samples that have examined sub-clinical levels of depression and anxiety symptoms ,17. MoreCross-sectional twin studies of children ,29 and aIn the present study, we set out to examine two hypotheses that may explain the observed associations between early anxiety and later depression.1. Early anxiety symptoms and later depression symptoms are associated because of shared risk factors.2. The association between anxiety symptoms and later depression symptoms is mediated by a risk effect of the phenotype of anxiety.Families from a systematically ascertained, population-based register of all twin births between 1980 and 1991 in South Wales, U.K. were invited to participate. This register forms a sub-sample of the Cardiff Study of All-Wales and North West of England Twins (CASTANET). Twins who had emigrated were excluded, as were cases in which one of the twins had died or had a serious illness. At the first wave of data collection in 1997, there were a total of 1109 pairs of twins aged 5–17 years although not all of these individuals were eligible to participate at both time points (see below). Data were collected by postal questionnaire. Families received three reminders and telephone reminders when numbers could be traced. The same methods were used three years later to collect longitudinal data except that families received four reminders. To be invited to participate in the follow-up study, we required that the twins were living together in the same home and were under the age of 18 years. Twins were required to live in the same home in order to minimise heterogeneity of environmental risk factors that can impact on genetic and environmental parameter estimates. The focus of the follow-up study was childhood psychopathology and for that reason young people aged 18 and over were not included. At time 1, there were 986 twin pairs who were within the age range of the study at both time points.In the first wave of the study , 670 families provided questionnaire responses giving a response rate of 61%. Comparison of responders and non-responders using Townsend Scores which inOf these, 338 families replied, giving a total response rate of 75%. There were no significant socio-demographic differences between responders and non-responders at time 2 . Zygosity was assigned using a twin similarity questionnaire which has been shown to be over 90% accurate in distinguishing identical from fraternal twins [At time 1, parents were asked to complete the Children's Revised Manifest Anxiety Scale which asFor descriptive statistics, (correlations and mean comparisons), the survey commands in the program STATA were use2 critical value for the number of degrees of freedom gained in the reduced model.Analysing data from twins provides a means of estimating the relative contribution of genetic and environmental effects on individual variation in behaviour. In the basic (ACE) model, variation can arise from three sources: 1) additive genetic effects (A); 2) common environmental effects (C); 3) unique environmental effects (E). Common environmental effects are non-genetic factors that serve to make twins more similar to one another while unique environmental effects are non-genetic factors that uniquely influence one individual within a twin pair and tend to make the individuals in a twin pair different from each other. Model fitting was carried out using the programs Mx and LISRBivariate analysis allows the covariance of two traits to be partitioned into covariance that is due to additive genetic factors, common environmental factors and unique environmental factors. The covariance parameters for the Cholesky model presented . Qualitative sex differences test whether the set of genes influencing the phenotype differs by gender i.e. different genes , this is done by estimating the genetic correlation for opposite sex DZ pairs and comparing the fit of this model to one that constrained the genetic correlation to 0.5. In addition, a bivariate sex limitation model was tested . This moThere were no significant mean differences on anxiety or depressive symptoms by gender . Age was not associated with anxiety or depressive symptoms . The mean age of children at time 1 was 10.58, range 5.58–17.83, and at time 2, was, 12.64, range 8.75–17.25. Symptoms of early anxiety and later depression were strongly correlated (parent-rated symptoms r = .479. The correlation was slightly lower for symptoms across rater (parent rated anxiety and adolescent rated depression), r = .335.2 = 1.505, Δ df = 3), nor were there qualitative genetic differences . For depression, univariate models for parent-rated and self-rated scores indicated no significant gender effects for the magnitude of genetic effects nor qualitative gender differences . Finally, for parent rated symptoms, results from the bivariate sex limitation Cholesky model showed no significant gender differences in the covariation between anxiety and depression in that the genetic and environmental covariation could be equated across the genders with no significant deterioration in fit . However, for self-rated symptoms, one parameter, i.e., the non-shared environmental covariation parameter, could not be equated across the genders . Estimates from this model for boys were; Aanx = 50, Canx = 17, Eanx = 32, Ac = 10, Cc = 47, Ec = -11, Adep = 9, Cdep = 5, Edep = 40; and for girls were; Aanx = 47, Canx = 22, Eanx = 30, Ac = 12, Cc = 13, Ec = 8, Adep = 30, Cdep = 12, Edep = 24; χ2 = 30.93, df = 32, AIC = -33.07). These results are presented in addition to those for the combined sample = 11, p = .001).Table It has been shown that the aetiology of depression varies significantly according to age, with greater common environmental effects in children aged 8–10 than in adolescents aged 11–17 ,46,47. TFollowing this finding of significant common environmental covariation the nature of this latent factor was further examined. Information on a potential common environmental variable, general family functioning was available. Family functioning was correlated with anxiety symptoms at time 1 . Bivariate analyses controlling for family functioning are shown in table 2 = 48.82, Δ df = 1, p < .001). Thus, it does not appear that anxiety leads to depression through direct phenotypic effects, but that, anxiety and depression symptoms are associated over time because they share aetiological factors in common.Finally, a model that included a direct causal path from anxiety to depression was fitted a common genetic/environmental aetiology or 2) a phenotypic risk effect of early anxiety. There was significant genetic covariation between anxiety and later depression. . This result is consistent with the association between early anxiety and later depression being due to a common genetic aetiology. However, the genetic overlap between early anxiety and later depression was far from complete in that there were significant, separate genetic effects on anxiety and genetic influences specific to later depression. Thus, in this sample, symptoms of anxiety and depression in children and adolescents share only a partly common genetic aetiology.In addition to genetic covariation, significant shared environmental covariation between anxiety and depression was also observed. It appeared that some of the shared environmental covariation between anxiety and depression observed in parent ratings of anxiety and depression was due to shared rater effects as the common environmental covariation (Cc) was no longer significant when analyses were performed with data across different informants. However, including family adversity as a measured environmental risk factor into a model with data from different informants also resulted in a small decrease in the Cc parameter estimate.The model that included a direct causal path from early anxiety symptoms to later depression symptoms provided a significantly poorer fit than the general bivariate model. These results suggest that anxiety is not an aetiologically distinct phenotype that is in itself a risk factor for future depression symptoms, but rather that the covariation over time arises from the common genetic and environmental architecture. It should be noted though, that some of the common environmental covariation is likely due to shared rater effects, because we found that this path became non significant in cross-informant analyses.The present findings are consistent with those of several other twin studies that have reported strong genetic correlations between symptoms of anxiety and depression in children and adolescents ,29,31 anThe lack of significant univariate and bivariate gender differences in genetic and environmental parameters estimates for parent reports in the present sample is of interest. The results for self reports of depression are less clear, previous analysis of a larger sample, from which the present sample was drawn, did find sex differences for self rated depressive symptoms as measured by the long version of the Mood and Feelings Questionnaire (MFQ) , which wHow do the present findings fit with results from family studies? Several family studies of the offspring of depressed parents have found increased rates of anxiety rather than depressive disorders ,25 and RAs mentioned previously, several groups have shown that the aetiology of depressive symptoms differs between children (8–10) and adolescents (11–17) ,46,47. TAnxiety and depressive symptoms are strongly associated over time. This association does not appear to be due to a phenotypic risk effect of early anxiety. Rather, early anxiety and later depression are associated due to a common aetiology. This was primarily a common genetic aetiology although family functioning and a single informant rating on both sets of symptoms also contributed to this association. Some of the common genetic aetiology may act as indirect genetic effects via behaviour (gene-environment correlation and gene-environment interaction).The author(s) declare that they have no competing interests.AT and FR conceived the paper. FR carried out statistical analysis and wrote the paper. AT and MBM wrote and edited the paper. MBM provided statistical support. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Teaching -- and testing -- students creatively is a challenge, but new public databases and more accessible literature are now helping to develop the critical thinking skills of students The next generation of life scientists are currently undergraduates—and the success of this generation depends upon the quality of the education they receive. It is clear the expectations for undergraduate education are changing . When thEarly in my teaching career, I discussed graduate student preparation with a colleague at MIT. He said new graduate students knew about the different methods, they could even recite fine definitions—but if you asked them which method would be best to answer a particular question, they were uncertain. This reinforced my attitude towards teaching and testing. I realized that teaching science to students should be modeled on the way all scientists learn new information: in the context of an interesting question and on a need-to-know basis. This new style of teaching, “applied education,” would require me to reorganize reading materials for students, since most textbooks are written by someone who already knows all the information and has organized it accordingly. For example, describing membrane structure, protein structure, and signal transduction in Chapters 5, 12, and 15, respectively (spanning 227 pages) is not helpful for most students. It makes more sense to cover these three topics in close succession.www.bio.davidson.edu/courses/Molbio/Publicschedule.html#anchor99574051). So, for example, in my classes students first read the elegant paper by www.bio.davidson.edu/courses/Molbio/molecular.html#2003exams). Based on this success, I have designed my genomics course on the “applied education” principle .Gradually, I converted all my courses over to this “applied education” format in which students were learning new information the same way all other scientists do. I began by asking questions that could be answered by learning the information provided by textbooks or the literature. With time, I realized that published research papers are ideal teaching tools because they cover information in the context of an interesting question and new material is presented as needed. This led me to collect series of related papers to create my own course materials is a rich repository of and portal to open access articles, BioMed Central publishes a growing number of open-access journals, and there are a few new open-access education journals such as Cell Biology Education (http://www.cellbioed.org) and the Journal of Undergraduate Neuroscience Education . As the newest player in the open-access arena, PLoS Biology has further enriched the growing espritdes-corps of publishing and has already improved undergraduate education. My students now have equal access to a growing portion of the literature that Nobel laureates and investigators at wealthy institutions enjoy.When I was a graduate student (in the late 1980s and early 1990s), PubMed was restricted to those institutions that could afford the subscription fee; now PubMed is freely available to all who have Internet access. This change in access to PubMed has significantly improved undergraduate training by providing students with the opportunities to do literature searches for their lab reports, papers, seminars, and of course original research. Free access to information in the life sciences has continued to evolve with the newest phenomenon in publishing—open-access journals. PubMed Central is forced to make difficult choices about which journals we can afford. The number of journal subscriptions goes down in proportion to the rise of subscription costs, but fortunately this loss is being offset by the creation of new open-access journals.http://www.bio.davidson.edu/molecular). Now I use PDF files for students to print and for me to display in class with no loss of information due to reformatting or resolution problems in which I capitalize on a confluence of two trends in the field: public domain databases and open-access journals (www.bio.davidson.edu/courses/genomics/2003/cain/home.html). But genomics courses are not the only beneficiaries, since other classes at many institutions require students to mine public domain databases (www.bio.davidson.edu/people/macampbell/Hope/DQ/DQ9.html and www.bio.davidson.edu/people/macampbell/Hope/DQ/DQ10.html). First-year students use Genome Browser and BLAST to determine the molecular causes of cystic fibrosis and Huntington disease, respectively. The benefit of public databases and open-access literature to educators is obvious and immediate. Images can be used in lectures, and papers can be distributed easily and on short notice for class use. There is no need to worry about limited access due to subscription costs nor an obligation to obtain copyright permission from publishers, which is a bothersome and sometimes expensive process for busy faculty members. By reducing nonproductive busy work for faculty, open-access journals have already created an environment that is improving undergraduate education today with long-term benefits in creating research-ready graduate students.During the past three years, I have taught an undergraduate course in genomics . Open-access journals make these two educational goals much more feasible because students can utilize current findings immediately without having to wait for interlibrary loans, which can take up to two weeks, can cost up to $20 per article, and can result in poor-quality black-and-white photocopies.Two common educational goals are to encourage students to become skeptical of unsubstantiated claims and to enable students to evaluate data critically. One way to accomplish these goals is to capitalize on the natural curiosity of students and ask them to compare topics in the popular press to that in the scientific literature . Students were asked to combine what they learned from the paper and the course and choose new proteins . As a result of these professional interactions, students became participants in a community of scholars, interacting with investigators at the University of California, San Francisco, while taking their exams.At the end of their exam, students were given an opportunity for extra credit points (a maximum of three points out of 100 available on the exam) if they provided constructive criticism directly to the database curators. About 70% of the students sent comments, including this one: “In recently using your database, I found it difficult to search the The use of open-access journals for teaching and testing has already improved my courses. I can provide exam questions that are more interesting, more educational, and more current. Furthermore, I accomplish two tasks simultaneously: I keep abreast of new developments in my field and I write exam questions. But what do students think? While I have not formally assessed student attitudes, I have collected information from end-of-semester course evaluations, including the following comments: “One of the best parts of the entire course for me were the exams. The exams really gave me an opportunity to show how I could work through real problems. This class definitely increased my critical thinking skills. Each test presented me with new ideas and problems to work through. I enjoyed the idea that each exam would be a learning experience.”PLoS Biology, my students benefit from free access to published research results. Free access to research literature enhances student learning and helps produce the next generation of graduate students, who are then better trained. Open-access publishing provides the right mix of benefits for educators and students alike.Teaching is a lot like raising children. Like parents, teachers provide learning opportunities in part by modeling the behavior we want our students to learn. By choosing the most current literature as testing material, my students realize that I read the literature to stay current in my field and that there are always new opportunities to learn, analyze, and design experiments, etc. By my choosing open-access papers such as those published in

Saccharomyces cerevisiae genome for fragments conferring a growth-impairment phenotype identified 714 fragments in about 84,000 clones tested.A screen of the Saccharomyces cerevisiae for fragments that confer a growth-retardation phenotype when overexpressed in a multicopy plasmid with a tetracycline-regulatable (Tet-off) promoter. We selected 714 such fragments with a mean size of 700 base-pairs out of around 84,000 clones tested. These include 493 in-frame open reading frame fragments corresponding to 454 distinct genes (of which 91 are of unknown function), and 162 out-of-frame, antisense and intergenic genomic fragments, representing the largest collection of toxic inserts published so far in yeast.We have screened the genome of Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, Arabidopsis thaliana and Schizosaccharomyces pombe, have revealed a large number of novel genes of unknown functions. In S. cerevisiae, for example, around 1,800 genes encode proteins that so far remain functionally uncharacterized (compilation from Saccharomyces Genome Database (SGD) [S. cerevisiae has been extensively studied, serving as a test case for novel and important developments in functional genomics. Such developments include transposon-mediated gene inactivation and tagging [in situ gene tagging [The complete genome sequences of various eukaryotic model organisms such as se (SGD) , the gen tagging , the ana tagging -6, two-h tagging -9, prote tagging ,11, two- tagging , proteom tagging ) and pro tagging . Even in tagging ,16 . The complete list of inserts is described in Additional file 1 and 2, and results are summarized in Table S. cerevisiae . In our screening, 32 ORFs were found twice, two ORFs were found three times and one ORF (YHR056c in the CUP1 region) was found four times, the cloned fragments being either overlapping (22 ORFs) or non-overlapping (13 ORFs). Mean size of the coding region of inserts is 659 bp. The chosen cloning strategy favors recovery of central-or carboxy-terminal coding parts of the natural yeast genes, whereas the amino-terminal coding regions are rare [The 493 inserts corresponding to in-frame ORF fragments represent 454 distinct annotated ORFs , which are randomly distributed throughout the 16 chromosomes of are rare . In our To find possible common characteristics, we have compared between themselves all the peptides encoded by in-frame ORF fragments. BLASTP analysis was combined with detection of characterized conserved domains, of COG patterns (clusters of predicted orthologous groups of proteins ), and ofAs well as comparing inserts to each other, we also analyzed the totality of the conserved domains present in all peptides encoded by the 493 toxic inserts . Characterized domains are found, at least partially, in a total of 281 inserts . Of a total of 183 distinct domains, 46 are represented more than once. We have compared the frequency of these 46 domains among the toxic inserts versus their frequency among the 5,803 ORF-encoded proteins of the entire genome (Table These 37 domains correspond predominantly to various transporter domains (11 cases), such as amino-acid permeases and mitochondrial carrier protein domains. The toxicity of these domains is probably due to the presence of transmembrane spans. Indeed, 132 out of the 493 toxic peptides contain at least two transmembrane spans, including cases where one span is putative . Among these, 63 contain three or more predicted spans and 26 have five spans or more. Putative spans were also recognized in 84 other ORF fragments .RNA-and DNA-binding domains (nine cases) involved in replication, transcription or translation functions, such as PUF, KH and rrm, are also much more represented than expected Table . The PUFOther important domains for interactions with polypeptides, phospholipids or small molecules (nine cases) are also over-represented. The WD40 motif, a propeller-like platform for stable or reversible binding of proteins in eukaryotes, has been found in inserts of 12 distinct ORFs . The 12 ORFs code for proteins having interactions with other proteins in complexes related to RNA processing or transcription , and ninThe serine/threonine protein kinase domain (S_TKc) is significantly under-represented in our screen. Among the 10 toxic inserts whose cognate genes code for protein kinases (PK), only four contain this domain . In these four cases, the S_TKc domain is either truncated , or flanked by a coiled-coil region and/or a low-complexity segment. Two other inserts contain the PBD (and PH) domains, and the four remaining inserts contain no characterized domain to date. As it is known that overexpression of some protein kinases is deleterious for cells (see and refeThe remaining 137 domains (out of 183) were found only once each. Many correspond to functional categories described above, such as transport, metabolism, and interactions with nucleotides, other proteins or other ligands. Seven domains associated with ubiquitination functions were also found . Several of the domains encountered have also been isolated as mammalian genetic suppressor elements (GSEs), which are cDNA fragments that inhibit cell growth . A number of these peptides are highly charged, either negatively or positively . Such charged peptides might interact in an artifactual way with other charged domains of proteins or nucleic acids or with small molecules. Interestingly, the prion-like (Q+N)-rich domain was found in eight of the natural peptides having low-complexity regions.We have seen above that 493/714 toxic inserts are in-frame fragments of protein-coding genes. The complete list of the 454 genes corresponding to these toxic inserts is given in Additional dat file 1 and 2. Their sizes range between 282 bp and 14,733 bp. The mean size of this distribution is 2,401 bp (standard deviation (SD) 1,671 bp), to be compared with a mean size of 1,444 bp for the entire set of 5,803 ORFs of the yeast genome. The bias towards longer ORFs is expected from our cloning strategy (see above). Note that the 35 ORFs that we found more than once are nearly randomly distributed in various size classes.S. cerevisiae.We examined the distribution of these genes according to different criteria, such as function, subcellular localization, viability and phylogeny Table and compAmong the 454 ORFs identified, 91 are unclassified, and function is not yet clear for six others . The remaining ORFs represent a variety of functional classes among the selected ORFs. This is a significantly higher percentage than in the whole genome, where 939/5,803 genes (16.2%) are essential are ascomycete-specific and 10 (2.2%) are orphan genes. This distribution is significantly different from the distribution among the 5,803 genes of S. cerevisiae, where 64% of protein-coding genes are conserved , we fineas 106 2% are ascNOP4 gene whose disruption is lethal. Six of these genes are singletons; three others have a paralog already known as toxic upon overexpression. Six out of the 13 still have no known function to date , indicating that the toxic effect is not the result of mislocalization of the overexpressed fragment. The gene MSC1 had already been screened [Schizosaccharomyces pombe and has a role in meiotic recombination. The TRM3 gene contains a carboxy-terminal domain responsible for tRNA methyltransferase activity [To compare the phenotypes conferred by overexpression of the entire gene and of the gene fragment, we have cloned the cognate entire genes of 13 in-frame toxic inserts into the vector pCMha191 . One criterion for the choice of the genes was the absence of a mutant phenotype of the corresponding gene disruption at the time this work was started, except for the screened as a toxactivity , which iactivity .Additional data file 2 analyzes the 221 other toxic inserts which do not correspond to in-frame fragments of annotated ORFs. Sixty-eight inserts correspond to natural ORF fragments cloned in an antiparallel orientation, most of them being entirely included within the ORF sequence (47 cases), the others overlapping the intergenic upstream region of the natural ORF (17 cases) and sometimes the next gene as well (four cases). Their toxicity can result either from the overexpression of an antisense RNA or from the overexpression of a toxic artificial peptide encoded by a fortuitous ORF. Several arguments favor the second hypothesis. First, short ORFs longer than 24 codons (maximum observed 250 codons), and in-frame with the start codon of the cloning vector, are observed in 53 cases . A number of those artificial ORFs are due to the 'mirror' effect produced by codon-biased natural ORFs ,41. But Fifty-three additional inserts correspond to natural ORF fragments cloned out-of-frame with respect to the plasmid-borne ATG codon, of which only 12 code for artificial ORFs longer than 24 codons reveals no significant similarity. None of these artificial ORFs corresponds to the 137 new annotated yeast genes of Kumar et al. [et al. [et al. [In total, short artificial peptides may be encoded by 92 out of the 162 inserts described above. Comparison of the 92 peptides between themselves reveals several low-complexity sequences , mostly encoded by antiparallel ORF fragments whose direct amino-acid sequence is itself of low complexity. Comparison with the proteins of r et al. , to the [et al. or to th [et al. . Even thAmong the 59 remaining inserts, 17 belong to Ty elements, 10 of which are in-frame ORF fragments corresponding to TyB only ), whereas all antisense fragments (three inserts) correspond to TyA. Y' elements, which are present in 20 copies in the genome, are represented by nine inserts, all coding for highly basic or acidic peptides which contain repeats of amino acids or motifs, and confer a strongly toxic effect . Considering that these inserts are toxic, their observed number is not different from that expected from the size and number of Y' in the genome.REP1, REP2 and FLP1. The seven other inserts are out-of-frame or antisense fragments of FLP1, or fragments of intergenic regions, all (except two) coding for artificial ORFs. Finally, mtDNA is represented by 12 fragments, mostly corresponding to intergenic regions on the minus strand of the chromosome. Artificial peptides highly enriched in the amino acids tyrosine (Y), isoleucine (I), and lysine (K) are encoded by 10 out of the 12 mitochondrial inserts.Four inserts from yeast chromosome XII are fragments of genes coding for 18S or 25S RNA, two inserts being cloned in the sense orientation. The 2 mm plasmid is represented by 17 fragments, 10 of which are in-frame fragments of ORFs coding for The general fitness of living organisms largely depends on a harmonious equilibrium between the various cellular components and on their capacity to maintain homeostasis. The intricate circuitries that regulate gene expression form the basis of these properties, and massive deregulation of single components may result in flagrant phenotypic defects leading to serious growth impairment or even cell death. Our large-scale screening of the yeast genome using random genomic fragments resulted in a collection of several hundreds of inserts showing toxic effects on cell survival or growth when overexpressed. These toxic effects are expected to result from several distinct molecular situations that have been encountered at various frequencies in our experiments. Of the total of 714 toxic inserts studied, a majority (69%) correspond to the overexpression of fragments originating from natural protein-coding genes . But, interestingly, a large minority (23%) correspond to noncoding DNA fragments. The remaining cases correspond to fragments of Ty or Y' elements, of the 2 μm plasmid or of mtDNA which, after analysis, can be attributed to one of the two previous categories. Toxic fragments of natural gene products are interesting to consider with respect to the functions of the corresponding genes. But the second category may be even more promising in that it offers us a description of DNA sequences that cannot be overexpressed in a cell without a deleterious effect.TOR1 and TOR2 genes, toxicity is specific to a central domain of the proteins distinct from their carboxy-terminal protein kinase domain; overexpression of the entire gene has no effect, and can even cure the negative effect of the overexpressed domain [et al. [TOR1, TOR2, TEL1 and TRA1 - were selected in this work, all represented by inserts of the central region of these proteins , the ZnF C3H1 domain of CTH1 [GCN4 [The toxicity of coding fragments may result from the imbalance between products of tightly controlled genes, or from the titration of active complexes by the presence of truncated proteins and/or isolated domains. In addition, nonspecific effects might also exist, for example, as a result of an abnormal intracellular localization of an artificially overabundant peptide or protein. We did not attempt to distinguish experimentally between these possibilities for all the coding inserts isolated in this work. Taking into account only specific effects, in the limited number of cases in which the entire gene corresponding to a toxic insert was cloned in the overexpression vector (see Results), we verified that toxicity was due, in most cases, to the disruption of the precise dosage of an essential cellular component and, in some cases, to the titration effect exerted by the incomplete fragment of the natural protein (the entire protein is not toxic when overexpressed). A few examples where the domain responsible for toxicity upon overexpression is known can be found in the literature. In the case of d domain . Alarcon [et al. have proe effect . In othe of CTH1 and the H1 [GCN4 . All theEven in the absence of precise mapping of the toxic domain present in our clones, we were able to explore the nature of the domains found in each insert. Our experiment has shown a bias towards domains corresponding to transport functions and to various interactions Table . As mentAs our results also showed a bias towards a number of interaction domains, we have examined the known interactions of the proteins encoded by the 454 genes found in this screen . Genetic interactions were also considered, excluding the coexpression results obtained in microarray experiments. It appears that 88.3% of our genes code for proteins which have known genetic or physical interactions, or are members of complexes . Moreover, for 60% of these (242/401), at least one of their known partners is also found in our screen . Among the 53 genes having no known interactions, 24 correspond to transporter or membrane proteins .S. cerevisiae, which had previously identified a total 231 genes or gene fragments that were toxic when overexpressed [et al. [et al. experiment. Common biases are, however, observed in favor of transcription, cell-cycle and cellular transport genes. Overall, only 33 of our 454 ORFs were previously identified by the previous authors . Twenty-five other genes from the previous screenings not found here are members of paralogous gene families represented in our work . The limited overlap may result from partial genome coverage. However, by screening 84,086 clones , we must have encountered a total of 4,677 ORFs, each being represented 1.6 times as an ORF fragment . We have thus screened for toxicity around 80% of the natural yeast ORFs. But the limited overlap of results may also be explained by the experimental bias introduced by each technique. The previous experiments were mostly based on cDNA cloning, which favors short and highly expressed genes, whereas our genomic library favors large ORFs (mean size 800 ± 557 codons per ORF) and has no expression bias. In addition, the largest previous experiment [The biases we have observed show little overlap with previous screenings of xpressed ,28-30,49S. cerevisiae. A collection of toxic polypeptides, acting as genetic suppressor elements and interfering with major cellular functions, is of interest not only in antifungal research but also as a means of identifying new domains with major physiological roles.The finding of a large minority of toxic inserts corresponding to noncoding DNA is puzzling. Indeed, some of the toxic inserts originate from annotated but questionable ORFs, and some originate from antisense or intergenic fragments which can artificially be translated into small ORFs. None of these peptides has recognizable characterized domains, but many of them are charged, mostly positively and some have amino-acid sequences of low complexity. It could be proposed that all these small ORFs represent a reservoir of potentially new gene sequences in the genome. In addition, 100 of the in-frame toxic inserts had no characterized domains and sometimes no predicted secondary structure. These inserts do not contain conserved domains, COGs or TMS, and are not biased in amino-acid composition . They may correspond to domains that have not yet been described, or to domains whose structure has diverged, but another possibility would be that some protein domains are perhaps not structured in a permanent way before evolving towards a structurally functional domain. Interestingly, a significant proportion of the expressed peptides we selected are specific to ascomycetes, or are even true orphan genes that have no known homolog in any other species than Finally, given the large number of inserts encoding very short ORFs , we cannot exclude the possibility that some transcripts are toxic through hypothetical mechanisms that may include, for example, nonspecific interactions with other cellular or nuclear complexes or through overloading of some component(s) involved in RNA metabolism.In a large-scale phenotypic screening of overexpressed random DNA fragments, we selected around 470 genes whose domains inhibit or impair growth when overexpressed. Many functional categories are represented, transporter proteins being especially over-represented, and genes of unknown function represent one-fifth of our selection. Our approach gave access to genes controlling intracellular and membrane structures, as well as to genes whose deficiency is compensated for by genetic redundancy. Comparable approaches, using efficient phenotyping technology and apprWe have carried out an analysis of toxic protein domains, pointing out the importance of binding domains and of protein-protein interactions correlated to regulation of cell growth and cell division. This provides a large body of data for targeting more specific studies on the modular construction of proteins and the role of interaction domains in multicomponent assembly of physiological complexes. Finally, in some cases, the deleterious effects in our system of inserts that encode very short ORFs may suggest that overexpression of some transcripts is also toxic for cell growth.Mata/α, ura3-52/ura3-52, trp1-Δ63/+, leu2-Δ1/+, his3-Δ200/+) [Matα, ura3-Δ851, trp1-Δ63, leu2-Δ1) [Matα, ura3-Δ851, trp1-Δ63, leu2-Δ1, his3-Δ200, ade2-661) were used for transformations and growth defect screening. All strains are isogenic derivatives of S288C.Total yeast DNA from strain FY1679 (-Δ200/+) was a geEscherichia coli DH10B cells .The yeast genomic library was constructed using Yeast cells transformed by pCMha190 recombinants were grown at 30°C on glucose synthetic complete medium lacking uracil (SC - URA) always supplemented with 10 μg/ml doxycycline (Sigma) (uninduced conditions). Phenotypic tests were done on solid medium (12 cm × 12 cm plates) containing 70 ml of SC - URA + 10 μg/ml doxycycline (uninduced conditions) or SC - URA without doxycycline (overexpression conditions). Yeast cells transformed by pCMha191 recombinants were grown at 30°C on SC - tryptophan medium, with or without addition of doxycycline. Plasmid loss was carried out on SC plates containing uracil (50 mg/l) and 0.1% of 5-fluoroorotic acid (5-FOA).URA3 or TRP1 (pCM184) as selection markers [BamHI-NotI fragment was replaced by a synthetic linker with ends compatible with these sites and introducing an ATG codon followed by an in-frame HA-tag, a BamHI cloning site, and stop codons in the three frames by replacement of the centromere and replication origin with a 2 μm plasmid replication origin. This was PCR-amplified from pCMha190 using primers M1 and M2 using Pfu polymerase (Stratagene), and ligated to the 5,953 bp EcoRI-BglII fragment of pCMha184.Plasmids pCMha184, pCMha189, and pCMha190 were derived from the centromeric or episomal (pCM190) overexpression vectors, containing a tetracycline-regulatable promoter system and markers . In the s Figure . The epiMCM1 and AUAI (861 and 285 bp respectively), which are toxic when overexpressed under the control of a GAL1 promoter [MCM1, cloned in the high-copy pCMha190 vector, had a clear and constant toxic effect on yeast growth when overexpressed. We thus decided to build the library into pCMha190 and to choose the MCM1 gene as a control for toxic phenotype in overexpression conditions.The overexpression system was checked by cloning two short genes, promoter . Both geMCM1 control gene were cloned into the BamHI digested plasmid pCMha191 (TRP1 marker). Genes were PCR-amplified from genomic DNA . For each gene, two independent plasmids were transformed into yeast strain FYBL2-5D. In parallel, the same strain was transformed with the plasmids bearing the corresponding toxic inserts.Thirteen complete genes corresponding to 13 selected toxic inserts (see Results) and the YGL039w and YAL062w/GDH3 ORFs, were modified by PCR synthesis , then recloned in vivo into pCMha190 using homologous recombination [Two toxic inserts, 156C1 and 57B6, which are antiparallel fragments of bination in yeastThe adaptor-based strategy ,54 was uSonicated total yeast DNA fragments from FY1679 ranging in size from 200 to 1,200 bp were treated with mung-bean nuclease, T4 DNA polymerase and Klenow enzyme following the manufacturers' protocols. Blunt ends of DNA fragments were ligated to the following adaptor:5'-pATCCCGGACGAAGGCC-3'3'-GGCCTGCTTCCGG-5'.BamHI and filled in with dGTP by the Vent (exo-) polymerase (New England Biolabs) was ligated to the purified adaptor-DNA inserts . The ligation result is drawn in Figure Excess of unligated adaptors and small adaptor-DNA fragments were eliminated by two consecutive purifications using Chroma spin+TE-400 columns (Clontech). Vector predigested with E. coli DH10B cells were performed with 1.8 μl of ligation mix and plated onto 2YT medium containing 100 μg/ml ampicillin (four 12 × 12 cm plates per transformation) giving 25,000 to 45,000 clones per transformation.Electroporations of 40 μl of A total of 51 independent transformations were made. This corresponds to 1,888,000 clones. We tested 150 clones for the presence of an insert and observed that more than 85% contained one . Colonies from each transformation were pooled and distinct Qiagen Tip 500 DNA preparations were made and stored separately for yeast transformation. Final concentration of DNA was 300 to 1,300 ng/μl. The detailed protocol of library construction is available on request.Another library had previously been constructed with the same vector ligated to a distinct DNA-adaptor preparation and was partially used, giving rise to 160,000 primary clones. Characteristics of the transformants were the same as described above. Eight pools of plasmid DNA were prepared from this first library.We carried out a total of 28 independent transformations of yeast by the LiAc method : five wiMCM1, respectively) were also inoculated into each microplate. Cultures were grown overnight at 30°C and stored at 4°C before dilutions for phenotypic examination. Screening of the toxic phenotypes after overexpression was done in a two-round selection, using the 'drop test', which allowed us to see even slightly impaired growth effects. Ten-fold serial dilutions in water were made from each 96-well culture microplate with a Beckman Biomek 2000 robot, then manually replicated with the 96-pin Beckman replicator onto SC - URA + doxycycline and SC - URA plates in parallel or with the Q-Pix robot for overnight growth. Non-toxic and toxic control clones and RNA were examined manually for their position relative to the coding sequences.S. cerevisiae annotated ORFs and to the 308,738 sequences of our internal database (see below).Sequences of inserts other than in-frame ORF fragments were systematically translated into amino-acid sequences from the junction with the adaptor up to the first stop codon encountered in the insert. Sequences coding for more than 24 amino acids were internally compared using BLASTP, then compared to the et al. [S. cerevisiae was filtered to eliminate all spurious ORFs or unlikely real genes, as well as Ty, Y' and mitochondrial ORFs, yielding a final list of 5,803 ORFs [Genetic entities corresponding to the toxic inserts were identified by comparison with the DNA sequences of the 16 chromosomes (available in the Comprehensive Yeast Genome Database (CYGD) at MIPS ); with oet al. ; with thet al. ; and witet al. . The set803 ORFs . For all803 ORFs containi-3 were examined individually before validation.Comparisons among the peptides encoded by in-frame ORF fragments were done using BLASTP . Alignme-4 for most domains, and 10-3 for short domains (60 amino acids or fewer). Domains were considered as present even when represented only partially. In describing genes were done using TopPredII implemenS. cerevisiae [Descriptions of selected genes and their products were retrieved from the Yeast Proteome Database and in protein complexes using three different sources: YPD files foet al. ; data coet al. , MIPS [3et al. and unpuPx of encountering any gene x times is described by a Poisson distribution:We consider that our library contains DNA fragments randomly distributed throughout the genome. Out of 84,086 clones tested, 11% contain a DNA fragment cloned in-frame with the frame of the natural ORF , the others containing noncoding, out-of-frame or antisense DNA fragments. If we use the simplifying assumption that all genes are equally represented among the 9,530 clones (not taking into account the size diversity of genes), each of the 5,803 ORFs will be represented 1.64 times . The probability m, the mean of the distribution, is 1.64. This is used to estimate the fraction of genes not encountered: for x = 0 and probability p = 0.19, the number of non-encountered genes = 1,126. Thus, by screening a total of 84,086 clones, we have encountered a maximum of 4,677 ORFs .where The following additional data are available with the online version of this article. Additional data file Lists and coordinates of the 493 in-frame fragments of annotated ORFs giving toxic phenotypes when overexpressed, and short description of their cognate genesClick here for additional data fileA list and description of the 221 DNA toxic inserts other than in-frame ORF fragmentsClick here for additional data fileA description of the peptides encoded by the 493 toxic ORF fragments, and of the cognate proteinsClick here for additional data fileThe content of the 57 groups of peptide inserts sharing similaritiesClick here for additional data fileA list and description of protein domains found only once among the toxic insertsClick here for additional data fileThe genes selected in this work whose products are members of complexesClick here for additional data fileGenes selected in this work whose products are known as interacting with each otherClick here for additional data fileThe sequences of the oligonucleotides used in this workClick here for additional data fileA figure showing the phenotypes induced by overexpression of antiparallel ORF fragments before and after introduction of a stop codon upstream of the artificial ORFsClick here for additional data file

Health-related quality of life instruments are expected to be of particular value in routine care of people with multiple sclerosis (MS), where they may facilitate the detection of disease aspects that would otherwise go unrecognised, help clinicians appreciate patient priorities particularly in terms of treatment goals, facilitate physician-patient communication, and promote shared decision-making. However, it appears that these instruments are little used routine clinical approaches to people with MS. To address this issue, I performed a bibliographic search of studies that evaluated the efficacy of generic or disease-specific health-related quality of life (HRQOL) instruments in MS clinical practice from clinicians' or patients' perspectives. I found only one cross-sectional study, which compared preferences for three instruments, and assessed acceptability in people with MS.Reasons for lack of transfer of HRQOL measurements to clinical practice may be cultural, methodological, or practical. With regard to MS, the proliferation of instruments seems to constitute a barrier, with no particular instrument having gained wide popularity or consensus. Other barriers are lack of resources for the administration, collection and storage of the data, and inability of clinicians to score, interpret, and use HRQOL instrument to guide clinical care. It is therefore important to refine existing tools, extending clinical validation to wider contexts and cultures. More studies assessing acceptability and clinicians' and patients' preferences for different instruments are also required. Multiple sclerosis (MS) is a demyelinating disease of the central nervous system of unknown etiology and poorly understood pathogenesis. There is a north-south gradient of MS prevalence in the northern hemisphere, with highest levels in northern regions . It is aInterest in measuring outcomes in MS has increased markedly over the past 20 years. Standardised instruments have been developed, the most-used being the Expanded Disability Status Scale (EDSS) which isMore recently, the importance of MS outcome assessment from the perspective of the person with the disease has been recognised . After 1HRQOL studies in MS have drawn attention to the multiplicity of domains that may be compromised by the disease, and the effects of this compromise on ability to cope. As expected, people with MS, especially those with a progressive course, report reduced physical functioning compared to the general population ,11,29-31The ultimate aim of measuring HRQOL is to provide a comprehensive assessment of patients' health status, to serve as a baseline from which to tailor interventions, pharmacological or otherwise, and assess their effectiveness, both in the clinical trial setting and in routine care. HRQOL instruments are expected to be of particular value in routine care, where they may improve the detection of disease aspects that would otherwise go unrecognised, help clinicians appreciate patient priorities particularly in terms of treatment goals, facilitate physician-patient communication, and promote shared decision making. In addition HRQOL data from clinical trials can provide information that clinicians can usefully discuss with their patients . UnfortuIt appears that HRQOL instruments are little used in routine clinical approaches to people with MS. To address this issue, I searched MEDLINE (1966–2004), the Cochrane Library and the Cochrane MS Group trials register (2004) for studies that evaluated the efficacy of generic or MS-specific HRQOL instruments in clinical practice from the clinicians' or MS patients' perspective, also checking study references. Studies considering patient-reported outcomes other than HRQOL, and domain-specific measures were excluded.I found only one study, a cross-sectional postal survey conducted in Canada, published in 2004 . This stThe reasons for lack of transfer of HRQOL assessment into clinical practice may be cultural, practical, or methodological -43. WithPractical considerations be particularly important in clinical settings, where data must be provided promptly and in an understandable manner to be of use. Instruments must be administered, processed, scored, stored and retrieved – all of which have logistic and financial implications . Most HRAnother factor limiting the dissemination of HRQOL tools in MS clinical practice is likely to be that too many instruments are available, and unlike EDSS, none has emerged as clearly superior to any other.Existing HRQOL tools for people with MS should be refined and their clinical validation pursued in the widest possible cultural context. More studies assessing instrument acceptability and preferences of clinicians and people with MS are also needed. It would be useful for example to implement computer-based technology (touch-screens and adaptive administration to reduce respondent burden by selecting pertinent items and omitting inappropriate ones) and other alternatives to traditional paper-and-pencil or interview methods, which should of course be evaluated for acceptability and reliability . The obj

Drosophila serve as a wonderful model for studying aspects of innate immunity, i.e. the physical, cellular, and molecular features that provide the first lines of defense against infections in flies and man Drosophila melanogaster (http://flybase.bio.indiana.edu/). Components in these pathways perform the same biochemical functions and act in the same order in both fruitfly and mammalian cells.Organisms of vastly differing morphologies, ecologies, and behaviors—such as fruit flies and humans—are now known to share a multitude of molecular, cellular, and developmental processes. Not only is there extensive similarity in the sequences of fly and human genes, but in addition, almost all of the proteins and major signal transduction pathways that control cell division and differentiation in mammals are also found in the fruitfly Evolutionary conservation is of considerable practical and theoretical importance to biologists. First, it provides a valuable source of data for the reconstruction of phylogeny . Evoluti“Innate” immunity refers to the variety of physical, cellular, and molecular features that provide the first lines of defense against infections. The relatively quick innate immune responses operate along with slower but more targeted adaptive immune responses that generate antigen-specific mechanisms that eventually lead to the destruction and elimination of the pathogen.In mammals, the skin and the epithelial lining of the mucosal tissues act as the primary nonspecific barriers, impeding infectious agents from entering the body. The mucous membrane barrier traps microorganisms, and the cilia present on the epithelial cells assist in sweeping the microbes towards the external openings of the respiratory and gastrointestinal tracts. If infectious agents gain entry into the body, internal innate immune responses become activated and rapidly eliminate the infection. Internal innate immune agents and responses include (amongst others) low pH of the stomach and vagina, proteolytic enzymes and bile in the small intestine, and phagocytosis.Phagocytosis is a fundamental innate immune mechanism carried out by a number of different cell types, including macrophages. Specific macrophage subpopulations are associated with different tissues . Their main function is to consume microorganisms, other foreign substances, and old, dying cells.Innate immunity is present from birth, and the information for innate immune responses is inherited. Cells in the mammalian innate immune system detect “microbial nonself” by recognizing pathogen-associated molecular patterns PAMPs; . PAMPs aAdaptive immunity is characterized by greater specificity than innate immunity, as the adaptive immune response can not only distinguish foreign cells from self, but can also distinguish one foreign antigen from another. Another hallmark of adaptive immunity is memory, which enables the body to remember specific adaptive responses in response to specific antigens. Immunological memory allows the body to make a greater and more rapid second response when the body is reinfected by the same pathogen. Immunological memory underlies both immunization and resistance to reinfection, conferring a tremendous evolutionary advantage to vertebrates. The adaptive immune response has nearly infinite flexibility: the T and B lymphocytes of the acquired immune system can rearrange the elements of their immunoglobulin and T-cell receptor genes to create billions of clones with distinct antigen receptors. In organisms where both innate and acquired immune systems are present, there is a clear interdependence between the two systems. For a fully functional immune system, these components must act in synergy.Drosophila melanogaster serves as a wonderful model for studying aspects of the innate immune system that might otherwise be obscured by the actions of the adaptive immune response. Insects defend themselves against parasites and pathogens by invoking a multitude of innate immune responses .Because it lacks an adaptive immune response, esponses . Like huPLoS Biology, Drosophila. The mammalian ortholog of Collier (Early B-cell Factor) is involved in B-cell differentiation in mice.Once within the body cavity, microbes may be consumed by the phagocytic blood cells called plasmatocytes . Larger Drosophila hemolymph also coagulates and participates in host defense and wound healing make the fly susceptible to fungal or gram-positive bacterial infections. However, Toll does not act as a pattern recognition receptor in the fly; instead its activation depends on the presence of the processed (active) form of the growth-factor-like polypeptide Spätzle. Processing of Spätzle depends on a serpin-controlled proteolytic cascade (The eceptors . Mutatio cascade .Drosophila Toll pathway were identified in earlier genetic screens for developmental mutants, those in the Imd pathway have been the focus of more recent studies, mainly in the context of Drosophila immunity (While components of the immunity . The effimmunity . Using aDrosophila is now guiding scientists to explore the immune system of other insects such as the mosquito, Anopheles gambiae, that spreads human malaria. Immune responses in this mosquito are linked to the elimination of the malarial parasites (Anopheles and Drosophila reveals the presence of the Toll signaling pathway in the mosquito genome, even though there are some differences in genes encoding pathogen recognition and signal transduction molecules (The impressive progress in our understanding of innate immunity in arasites . A compaolecules . A detaiThe homologs of many genes involved in innate immune responses in flies and humans have also been found in mice, sharks, nematodes, and plants e.g., . In spec

The discovery of experience-dependent brain reactivation during both slow-wave (SW) and rapid eye-movement (REM) sleep led to the notion that the consolidation of recently acquired memory traces requires neural replay during sleep. To date, however, several observations continue to undermine this hypothesis. To address some of these objections, we investigated the effects of a transient novel experience on the long-term evolution of ongoing neuronal activity in the rat forebrain. We observed that spatiotemporal patterns of neuronal ensemble activity originally produced by the tactile exploration of novel objects recurred for up to 48 h in the cerebral cortex, hippocampus, putamen, and thalamus. This novelty-induced recurrence was characterized by low but significant correlations values. Nearly identical results were found for neuronal activity sampled when animals were moving between objects without touching them. In contrast, negligible recurrence was observed for neuronal patterns obtained when animals explored a familiar environment. While the reverberation of past patterns of neuronal activity was strongest during SW sleep, waking was correlated with a decrease of neuronal reverberation. REM sleep showed more variable results across animals. In contrast with data from hippocampal place cells, we found no evidence of time compression or expansion of neuronal reverberation in any of the sampled forebrain areas. Our results indicate that persistent experience-dependent neuronal reverberation is a general property of multiple forebrain structures. It does not consist of an exact replay of previous activity, but instead it defines a mild and consistent bias towards salient neural ensemble firing patterns. These results are compatible with a slow and progressive process of memory consolidation, reflecting novelty-related neuronal ensemble relationships that seem to be context- rather than stimulus-specific. Based on our current and previous results, we propose that the two major phases of sleep play distinct and complementary roles in memory consolidation: pretranscriptional recall during SW sleep and transcriptional storage during REM sleep. Rats exposed to novel objects during periods of wakefulness generate neural activity that is correlated with patterns observed in subsequent sleep episodes Sleep is important for the consolidation of newly acquired memories . The disstrictu sensu neuronal reactivation during sleep in mammals has only been investigated in the hippocampocortical loop representing larger-scale neural rhythms were simultaneously recorded from four different brain regions: HP, primary somatosensory “barrel field” CX, ventral posteromedial thalamic nucleus (TH), and putamen (PU) and S7. In our studies, neural signals were continuously recorded across the natural sleep–wake cycle for 48–96 h, with a single 1-h exposure to four complex objects placed in the four corners of the recording box C. All obn= five templates per animal). Control templates were selected from epochs of alert WK 24 h or 48 h before novel stimulation , during which familiar tactile stimulation was produced by the contact of whiskers with the smooth walls of the recording box, to which animals had been habituated. Templates were matched against the entire record of neuronal activity using the neuronal ensemble correlation method . This indicates that the neuronal firing patterns concomitant with novel stimulation persisted significantly more during the ensuing time than patterns sampled 24 h or 48 h before novel stimulation, when animals were in the same behavioral state , but without novel objects to explore. The effect was independently observed, to a variable degree, in all the five animals studied . First, we tested whether the neuronal ensemble correlation method could detect any trace of neuronal reverberation lasting at least more than 1 h after exposure to novel stimulation. For this, we examined correlation profiles obtained for all recorded neurons (three to four brain areas pooled together) in each animal. As shown in p values generated by Bonferroni comparisons between post- and prenovelty correlation distributions . This indicates that the neuronal changes associated with exposure to novel stimuli were highly distributed through the neuronal populations sampled. Furthermore, judging by the maximum neuronal ensemble correlations observed . Indeed, experience-dependent changes were not statistically different across different forebrain areas . The temporal evolution of p values (Bonferroni comparison) associated with single-area correlation profiles shows that significant reverberation was present in 16 of 18 recording sites for several hours after exposure to novel stimulation , with SW ratios being significantly higher than those of both WK and REM . Indeed, significant state-specific differences in post-/prenovelty correlation ratios were individually detected in four of five animals .Single-area results indicate that neuronal ensemble correlations often peak during discrete epochs that last a few hours. We also noticed marked oscillations of the correlation trace in several recorded sites . These observations suggest that some underlying biological process, with slow evolution but with sharp phase transitions, governs the long-term reverberation of neuronal firing patterns. To test whether transitions in the wake–sleep cycle could amount for these effects, we investigated how experience-dependent changes in neuronal correlations varied across the three major rat behavioral states: WK, SW sleep, and REM sleep. A comparison across states of post-/prenovelty correlation ratios calculated from averages of entire recordings indicated a significant state-specific effect . Next, we tested the possibility reported in hippocampal place cells that expp values can be observed for speed factors 10 times and 20 times faster than normal WK rates, while speed factors near the physiological range (2×–0.5×) show stronger and similar effects. This was the case even in the HP, in contrast with previous findings in hippocampal place cells recorded in highly trained animals performing a spatial navigation task are substantially less detectable over time.Our results fend off three major objections to the notion that neuronal reverberation during sleep may underlie memory consolidation. First, significant experience-depen-dent changes in neuronal ensemble correlations can be tracked as late as 48 h after the reference novel experience, being therefore compatible with memory impairment effects of sleep deprivation applied hours or days after training . Second,An important result of the present study is the inverse correlation between neuronal correlations and concurrent firing rates. Although all neuronal activity templates were taken from epochs of high arousal WK when firing rates were generally high, their neuronal reverberation during subsequent WK was not very prominent , agreeing with values previously reported for pairwise or many-A third important point regards the observation that neural activity sampled when animals were aroused, but not touching the objects, yielded neuronal reverberation that was nearly identical to that obtained when animals made sensory contact with the objects. This indicates that the kind of experience-dependent neuronal reverberation detected by the neuronal ensemble correlation method does notIt has been suggested that the neuronal reverberation of newly acquired synaptic changes during SW sleep may lead to the recall and storage of new memories by way of “calcium-mediated intracellular cascades” capable of opening the “molecular gates to plasticity” . This hyThe fact that neuronal reverberation is sustained for long epochs during SW sleep suggests that unconsolidated synaptic changes may not only be recalled, but also amplified over time during SW sleep. Indeed, a progressive increase of neuronal correlations across single SW sleep episodes was often observed so as to reach steady-state behavioral activity and baseline wake–sleep cycles. Behaviors were continuously recorded by way of two infrared-sensitive CCD video-cameras; infrared illumination was used to monitor behavior when visible lights were off. Behavioral states were coded as WK, SW sleep, or REM sleep based on a spectral analysis of LFPs and visual inspection of videotaped behaviors, according to previously described criteria Figure .TM code running in a computer cluster comprising 32 CPU . Neuronal ensemble correlations were calculated following the method in CxN matrices corresponding to simultaneously recorded spike trains of C neurons binned into N intervals of a certain length. Our results were obtained using 9 s-long templates binned with 250 ms-long bins with as many neurons as were available for the brain areas in question. Hence, each template pattern yielded a Cx36 matrix. Target data comprising 24 h or 48 h were sparsely sampled (every 30 s) and binned into matrices of the same dimensions. For a C×N template data matrix x and a target data matrix y sampled at time t, the ensemble correlation index Ct is obtained by:Data were processed and analyzed by custom-made MATLABwherec, y¯, and σy). and MATLABTM software were used for descriptive statistics and hypothesis testing.Templates were selected by careful scrutiny of behavior recorded on videotapes and of the corresponding spectral characteristics of hippocampal LFPs, so as to assure sampling during alert WK . ParticuFigure S1Four different objects were used to produce CSS.(9.7 MB PPT).Click here for additional data file.Figure S2All animals were highly habituated to the recording box, so that exposure to novel complex objects caused a general increase in the animals' arousal. Four of five animals showed an increase in time spent in WK with respect to SW and REM sleep during CSS (A), as compared to adjacent pre- and postnovelty periods of equal length (60 min). The only exception was rat 1, which showed nevertheless a marked exploratory drive, spending nearly 20% of the exposure period in direct whisker-contact with the objects (B). Individual object preferences were moderately varied, as indicated in (C).(746 KB PPT).Click here for additional data file.Figure S3Teflon-coated tungsten wires were assembled in multielectrode arrays shaped to fit different neuroanatomical targets.(282 KB PPT).Click here for additional data file.Figure S4Frontal brain sections stained for cresyl-violet were used to determine the sites of electrode placement. Electrode tracks, tissue scars, and reference electrolytic lesions performed a few days before sacrifice were used to delimit the implant sites, indicated in red in the figure below. Numbers on the right represent standard AP coordinates in milli(6.3 MB PPT).Click here for additional data file.Figure S5To record neuronal activity, differentiated neural signal was preamplified and digitized at 40 KHz. Up to four neuronal action potentials per recording channel were sorted online and validated by offline analysis according to the following cumulative criteria: voltage thresholds greater than two standard deviations of amplitude distributions; signal-to-noise ratio greater than 2.5 (as verified on the oscilloscope screen); less than 1% of interspike intervals smaller than 1.2 ms; and stereotypy of waveform shapes, as determined by a waveform template algorithm and principal component analysis. In order to continuously record individual neurons for up to 96 h, we used an adaptive algorithm that adjusts waveform templates based on the recent accumulated mean shapes (1% of midline every 20 min). This allows for the same neuron to be tracked across consecutive days, as verified by the superimposition of waveforms acquired thoughout the experiment .(3 MB PPT).Click here for additional data file.Figure S6Up to 159 neurons were recorded from three to four different brain areas.(1.4 MB PPT).Click here for additional data file.Figure S7LFPs were recorded in parallel with spikes from the same electrodes. Neural signals were split, preamplified , and filtered (0.5–400 Hz) by way of a Plexon LFP board. Signals were then fed to the MAP acquisition principal component through a NIDAQ card and digitized at 500 Hz. Behaviors were constantly recorded in videotape by two diametrically opposed infrared-sensitive CCD cameras . A millisecond-precision timer was used to synchronize the acquisition of spikes, LFPs, and videotape records.Behavioral states were identified by the combined inspection of videotapes and the spectral content (1–20 Hz) of LFPs. Behaviors were classified according to the following criteria: (1) alert WK: active exploration with whisking, plus strong hippocampal θ rhythm; (2) quiet WK: stillness or grooming, with eyes open and low-power hippocampal θ rhythm; (3) SW sleep: stillness with eyes closed, plus large-amplitude hippocampal δ rhythm; (4) REM sleep: overall stillness with intermittent whisking, eyes closed, strong hippocampal θ rhythm.The inspection of videotape records readily separates alert and quiet WK from sleep states, but the separation of SW and REM sleep relies strongly on LFP analysis. Hippocampal LFP is particularly useful to disambiguate SW and REM sleep: SW sleep has a strong δ band (2–4 Hz), while REM sleep shows increased θ band (5–8 Hz). The distinction between alert and quiet WK was used only for template selection . For all other purposes, alert and quiet WK data were combined into a single WK category. The graphs depict the θ/δ hippocampal spectral ratios (mean ± SEM) of the three major behavioral states for rat 5 (entire recording).(2.1 MB PPT).Click here for additional data file.Figure S8The figure shows the effect of using different bin sizes to calculate neuronal ensemble correlations. We observed quantitative differences , but qualitatively the correlations profiles are equivalent, i.e., have very similar shapes.(404 KB PPT).Click here for additional data file.

As the secretory source of vitamins, peptides and hormones for neurons, the choroid plexus (CP) epithelium critically provides substances for brain homeostasis. This distributive process of cerebrospinal fluid (CSF) volume transmission reaches many cellular targets in the CNS. In ageing and ageing-related dementias, the CP-CSF system is less able to regulate brain interstitial fluid. CP primarily generates CSF bulk flow, and so its malfunctioning exacerbates Alzheimers disease (AD). Considerable attention has been devoted to the blood-brain barrier in AD, but more insight is needed on regulatory systems at the human blood-CSF barrier in order to improve epithelial function in severe disease. Using autopsied CP specimens from AD patients, we immunocytochemically examined expression of heat shock proteins (HSP90 and GRP94), fibroblast growth factor receptors (FGFr) and a fluid-regulatory protein (NaK2Cl cotransporter isoform 1 or NKCC1). CP upregulated HSP90, FGFr and NKCC1, even in end-stage AD. These CP adjustments involve growth factors and neuropeptides that help to buffer perturbations in CNS water balance and metabolism. They shed light on CP-CSF system responses to ventriculomegaly and the altered intracranial pressure that occurs in AD and normal pressure hydrocephalus. The ability of injured CP to express key regulatory proteins even at Braak stage V/VI, points to plasticity and function that may be boosted by drug treatment to expedite CSF dynamics. The enhanced expression of human CP 'homeostatic proteins' in AD dementia is discussed in relation to brain deficits and pharmacology. Accumulating evidence supports the idea that continually decreasing choroid plexus (CP) function in advanced ageing exacerbates Alzheimer's disease (AD). As part of a new paradigm to explain brain interstitium deterioration in age-related dementias, increasingly more attention is being paid to the role of compromised blood-CSF and blooEfficient CSF turnover is essential for a healthy brain. It depends upon an exquisite balance between CSF formation and reabsorption . CompromIn serving the brain's metabolic needs by supplying 'biochemical goods', the CP uses CSF as a conduit for convecting substances . NumerouReduced formation of CSF and stagnated flow in ageing and AD limits tStructure intimately relates to function in various epithelia. Therefore it is useful to analyze histopathological damage to CP at various stages of AD in order to clarify the onset of functional losses at the blood-CSF barrier. Ageing and AD cause similar degeneration in CP. Structural changes in AD though are usually greater than in non-demented control counterparts . Serot aSeveral features characterizing the CP in AD are highlighted in Table Due to the functional nexus of the CSF with brain interstitial fluid, the neuronal microenvironment in AD is impacted by markedly altered transport and permeability in CP. When neurodegenerative diseases, ischemia ,28 and e+] and immune molecule content of the CNS extracellular fluid [The CP is multifunctional, performing a wide range of homeostatic functions for the CNS . CSF homar fluid . AccordiMoreover to provide steady neuroprotection by regulating the extracellular milieu, the CP must protect itself against various stressor agents that build up during ageing and disease. There have been few investigations of the homeostatic systems within CP that stabilize choroidal functions in the face of ageing and AD. We have explored some candidate systems for compensatory responses by CP. Cytoplasmic heat shock proteins chaperone and perform housekeeping to maintain a healthy steady-state intraepithelial milieu ,32. GrowIt is difficult to functionally assess the CP in vivo ,33, partInformation about functional proteins in human CP is scarce. However protein expression was recently analyzed in autopsied lateral ventricle CP from normal adult brains and in those with confirmed AD ,37. The Ageing and AD dementia tax the CP and other CNS transport interfaces. In late life the deteriorating brain presents many potentially-destructive metabolites to the CSF for multi-site excretion into blood. The greater burden of macromolecule disposal in AD occurs when CP and arachnoid membrane, due to ageing debilities, are less able to transfer solutes. Nevertheless the CP seemingly attempts to maintain its 'epithelial soundness' when challenged to perform additional cleansing acts for the brain extracellular fluid (CSF).In healthly, young adults the CP epithelium sensitively acclimates to chemical and physical distortions in blood, CSF and parenchyma. Following cortical stabbing in rats, the CP upregulates TGFβ presumably to provide this CSF-borne growth factor for repairing the injury . A similAccordingly to assess pathophysiologic consequences of AD we investigated human CP's ability to upregulate certain functional proteins in advanced states of AD dementia. With advancing knowledge about intricate cell physiology it is relevant to evaluate components of cellular homeostasis. The term 'homeostatic proteins'refers to chaperones, receptors and transporters that stabilize the internal environment of the cell. CSF stability depends in large part upon CP epithelial homeostasis. Our group has analyzed several 'homeostatic proteins' involved in CP intracellular milieu stabilization:A wide spectrum of protection against neurodegeneration is provided by HSPs. The list of protective effects bestowed by HSP molecules is diverse and includes: accelerated degradation of misfolded proteins, maintenance of membrane lipid integrity, prevention of deleterious protein aggregation, and preclusion of damage to the translational apparatus ,42. HSPsTo evaluate human CP expression, we selected HSPs overexpressed in AD brains: GRP94 and HSP90. In contrast to previously found upregulation in brain, there was downregulated GRP94 in lateral ventricle CP. In aged controls there was abundant staining in the epithelial cytoplasm and stroma ontogeny, ii) normal adult maintenance, and iii) neurodegeneration.FGF and FGFr are also fundamentally important in fostering neuron generation from stem cells in the subventricular zone (SVZ). This requires coordination between the CP-CSF and periventricular regions ,48. Pharnd but not 3rd gestational week [Receptor plasticity in aging and AD is better seen in light of information on FGF/FGFr expression dynamics in early life. In the fetus the formation of CP, neuronal stem cells and brain is promoted by CP growth factor secretion and CSF distribution ,49. InteFGF2 derived from CP is also conveyed by CSF bulk flow to the fetal germinal matrix where it acts on stem cell FGFr to promote neuronal maturation . By thisThe FGF/FGFr system also has a key role in adult CNS fluid homeostasis. CP helps the brain adapt to alterations in blood composition and flow. In otherwise healthy young adults, the imposition of dehydration or sudden ischemia upon the CNS elicits striking adaptive changes in CP epithelium. To endure insults by chemical or physical stressors , it is cDehydration seriously threatens CNS functions. Adjustments to dehydration in the healthy adult brain feature ion and water redistribution among fluid compartments. These compensatory responses to plasma hyperosmolality stabilize neuronal and interstitial volumes. Brain 'barriers' or transport interfaces are sites for the fluid homeostatic mechanisms. A working model for the restoration of fluid balance is offered: Dehydration or hyperosmolality upregulates the FGF2 and AVP peptides in CP ,52. FGF2Ischemia is another disorder with neuropathological consequences that are mitigated by growth factor upregulation or administration . BilaterFGF2 titers and FGFr receptor densities in degenerating CNS compartments provide insight on adaptive responses. FGF2 concentration is augmented in the AD brain . Moreove1-43 [FGF2 has an interesting relationship with amyloid. A worthwhile goal is to probe mechanisms of FGF2 interaction with amyloid in neuronal networks, extracellular matrix and CP-CSF. FGF2 co-localizes with several chemical forms of amyloid. Neuronal coexistence of FGF2 and amyloid precursor protein (APP) ,65 intim1-43 and atte1-43 . In the 1-43 ,70. ThisFGF2-mediated protective regulation of CP transport phenomena potentially affects the course of neurodegeneration. Considerable evidence points to CP's ability to remove Aβ from CSF -73. ThisThe diminished ability of CP to form fluid in advanced ageing and AD begs the question of how epithelial ion transport proteins are altered by distorted neurochemistry in senescence. In very old laboratory mammals the Na-K-ATPase activity of CP and the CSF generated by it are cut in half ,76. AnotThe cation-Cl superfamily of cotransporters includes NKCC1 and consists of 7 isoforms that actively transport Na and/or K electroneutrally with Cl . NKCC1 iThe NKCC1 helps cells and organs adjust to disrupted fluid balance. One thus expects homeostatic upregulation of this CP cotransporter in AD with its altered CSF dynamics. For delineating NKCC1 expression we used the T4 antibody to immunostain CP at various stages of AD dementia. Robust staining of the lateral ventricle plexus (even at Braak stage V/VI) occurred in the apical membrane and cytoplasm , then it might be feasible to prevent the early manifestations of AD (Braak stages I/II) from intensifying into the debilitating pathology of V/VI.One class of agents with considerable potential for AD therapeutics is the growth factor group. A useful paradigm for CSF growth factors and neuroprotection has evolved from experiments on transient forebrain ischemia in rats ,60. The Several other growth factors synthesized by CP and secreted into CSF should be explored in translational research dealing with interacting ischemia, hydrocephalus and AD ,103,104.In searching for agents to modify CP epithelial protein expression, the route of delivery of the active drug is of primary importance. Unlike the brain with its impermeable microvessels, the CP readily takes up water-soluble drugs from the plasma due to the highly-permeable choroidal capillaries. Consequently water-soluble agents freely diffuse to receptors or binding sites at the basolateral surface of the epithelium. Access of blood-borne hydrophilic compounds to the CSF-side of CP however is problematic because the tight junctions and basolateral membrane impede diffusing molecules as small as mannitol . MoleculTo circumvent the blood-CSF barrier, therapeutic agents are delivered into CSF by lateral ventricle catheters in experimental animals or hydroA compelling aspect of CSF translational research is to identify agents that effectively regulate fluid formation by CP. Whereas the difficulty in congenital hydrocephalus is to downregulate CSF formation, the challenge in AD is to enhance CSF turnover perhaps by accelerating fluid production as well as outflow. Augmented flow of CSF enhances 'sink action' ,109. ThiAnother CP pathology meriting pharmacological attention is the massive fibrosis that progressively envelops the interstitium in old age. This interstitial fibrosis is even more extensive in AD . FibrosiThe CP has the main responsibility for CSF homeostasis. Therefore the functional status of the blood-CSF barrier is of great consequence to the CNS. Maintaining the CSF at a stable, specialized composition is of the utmost importance to neurons. CSF is prominent in regulating brain interstitial fluid with which it exchanges nutrients and waste products. Diseases markedly affect these molecular exchanges. Maintaining healthy bidirectional transport across the CP epithelium (CSF-blood) and ependyma (CSF-brain) is thus integral to a sound brain fluid environment.CSF macrocirculation through the ventriculo-subarachnoid system together with CSF microcirculation in the perivascular Virchow-Robin spaces ,111 perfAs the main generator of CSF, the CP has a pivotal role in helping the brain cope with the twin stressors of ageing and disease. More attention should be focused on the blood-CSF interface for pharmacologic opportunities to stave off CP dysfunction. Our findings on human CP expression of HSP90, FGFr and NKCC1 demonstrate that this epithelium in AD reacts to metabolic insults by upregulating certain proteins. This suggests that even diseased CP could respond to therapeutic agents, thus opening new vistas for treating CSF dysfunction in age-related dementias.Investigation of CP in AD is an area that is opening up. Translational research can now intensely focus on molecular factors that disable the CP to the point of reducing its ability to preserve brain integrity. Systematic CSF analyses using mass spectrometry and other cutting-edge biotechnology should generate neurochemical data specific for disease stages. New imaging approaches are essential to provide much needed functional data for CP, CSF and periventricular regions in AD patients. This should expedite the modeling of CP-CSF malfunctions and their resolution. Deeper insight into the pathophysiology of the blood-CSF transport interface will help to realize the development of novel therapeutic regimens for the AD family of diseases.AD, Alzheimer's disease; APP, amyloid precursor protein; Aβ, beta amyloid; AVP, arginine vasopressin; BBB, blood-brain barrier; CP, choroid plexus; FGF2, basic fibroblast growth factor 2; FGFr, receptor for fibroblast growth factor; GRP94, glucose regulatory protein 94; HSP90, heat shock protein 90; NGF, nerve growth factor; NKCC1, Na-K-2Cl cotransporter secretory isoform 1; NPH, normal pressure hydrocephalus; TGFβ, transforming growth factor beta; SVZ, subventricular zone; TFI, transient forebrain ischemia; VEGF, vascular endothelial growth factor; IGF-II, insulin-like growth factor II; HGF, hepatocyte growth factor;The author(s) declare that they have no competing interests.CJ had the primary responsibility of organizing and writing the review, and had NIH support (NS 27601) to do the NaK2Cl cotransporter experiments. PM carried out the NKCC1 immunostaining runs with the T4 antibody and provided interpretation of the regional stainings. RT conducted the experimental analyses of the heat shock proteins and generated figures. AS did the image processing analyses of the cotransporter expression and assisted with the literature analysis. JD contributed ideas for the altered CP-CSF dynamics in hydrocephalus and ventriculomegaly. GS has developed the model that CP-CSF malfunction exacerbates AD progression, and helped to revise the manuscript. ES was responsible for the FGFr experiments and interpreted the human CP data. All authors read and approved the final manuscript.

There is wide variation in the quality of care provided by primary care practices to individuals with chronic illnesses. Individual doctor attitudes and interest have been demonstrated to influence patient outcomes in some instances. Given the trend towards larger practices and part-time working, continuity of care is likely to fall and thus practice-based rather than individual general practitioner attributes and attitudes are likely to become increasingly important. The aim in this paper was to examine the extent to which individual general practitioner (G.P.) attitudes to the care of people with epilepsy cluster within practices and predict patient-rated quality of care.The sample consisted of 1255 people with active epilepsy (a recent seizure or on anti-convulsant medication for epilepsy) and 199 GPs from 82 general practices. Measures of GP attitudes (a 17-item GP attitudes questionnaire) and patient-rated quality of epilepsy care were obtained. 1210 individuals completed initial questionnaires and 975 patients filled in final questionnaires one year later. Responses were achieved from 64 practices and 115 GPs .2 main factors were found to underlie GP attitudes to the care of people with epilepsy and these demonstrated clustering within practices "epilepsy viewed as a primary care responsibility" 0.40), and "medication skills". GP-rated scores on "epilepsy care being a primary care responsibility" were a significant predictor of patient-rated quality of GP care (p = 0.031). Other contributory factors were seizure frequency (p = 0.044), and patient-rated "shared decision making" (p = 0.022).Specific general practitioner attitudes to the care of people with epilepsy cluster within practices and are significantly associated with patient-rated quality of epilepsy care. It is important to take these findings into consideration when planning primary care interventions to ensure people with epilepsy receive the benefits of available medical and surgical expertise. There is wide variation in the quality of care provided by primary care practices to individuals with chronic illnesses . IndividThere is a marked trend to larger partnerships in primary care practices and more flexible working practices. It is likely, therefore, that continuity of care will continue to fall, and that patient experience of care of a particular condition will be based on contact with more than one general practitioner . Thus prIn the next few years there is likely to be considerable reorganisation of the way in which epilepsy care within primary care is delivered, with GPs taking on a more active role in providing care. Information on how individual general practitioners view and value their role in providing epilepsy care is considered as important . HoweverIn this paper, data from a completed community-based study on people with epilepsy are used to examine the following questions:1. To what extent do individual general practitioner attitudes to the care of people with epilepsy cluster within practices?2. Do general practitioner attitudes predict how people with epilepsy rate the quality of the general practitioner care of their epilepsy?General practitioners and adults with epilepsy taking part in an intervention study in Greater Manchester provided information for this study. The results of the intervention study have been reported . No grouEthical approval was obtained in the 4 areas of Greater Manchester from where patients were approached. The patients who consented to participate in the study had their medical records examined to extract data on recording of clinical information about epilepsy and other markers of quality of care. Patients were also sent questionnaires for self-completion. These included both a generic quality of life measure- the EUROQOL 5D and a diGeneral practitioners completed a 17-item GP epilepsy attitudes questionnaire at the end of the study. Responses to items such as "I feel comfortable changing the type of anti epileptic drugs in my patients" were scored using a Likert scale. The attitudes scale was developed and validated for a previous study and results reported in an earlier paper .Mean practice scores for each item on the GP attitudes questionnaire were computed and significant factors underlying the grouping identified . Clustering of responses on the attitudes questionnaire were examined using the intra-class correlation coefficient both for individual items as well as for a mean score of responses to items loading on each of the main factors. Finally linear regression analysis with the patient-rated quality of care provided by the practice as the dependent variable and GP attitudes and other patient derived measures as independent variables was carried out (using aggregated GP attitude and patient scores). Intervention group was adjusted for. P values of 0.05 and 95% confidence intervals were used to assess significance.1255 patients consented to participate in the study and 975 patients filled in final questionnaires. 199 GPs from 82 practices consented to participate in the study. Responses were obtained from 115 GPs from 64 practices . 29 practices had a single respondent. These practices were excluded from the analysis of attitude clustering. In this study 54% of individuals were seizure-free in the previous year ("controlled" seizures) and 46% had reported a seizure in the previous year ("uncontrolled" seizures).Factor analysis with varimax rotation was undertaken on aggregate GP responses. Four factors had an eigenvalue of above 1.2. Three of these factors were selected after the scree test. Both the Kaiser-Meyer-Olkin measure of Sampling adequacy test (0.778) and Bartletts test for sphericity suggested that factor analysis was appropriate for this data set. Using guidelines for identifying significant factor loadings based on sample size from Hair et al.[Responses to the 11 questions that were included in the first three factors were further examined. The aim was to detect if significant clustering of responses to these items occurred within practices. The average cluster size was 2.74.The results of the factor analysis and clustering of attitudes for the two main factors are listed in Table patient seizure frequency and patient-rated "shared decision making" and GP-rated score on "epilepsy care being a primary care responsibility" (Factor 1). Recording of clinical information about epilepsy was not a significant predictor of patient-rated quality of GP care.Data from 60 practices where both patient and general practitioner data were available were used in the linear regression analysis. As the data were obtained at the end of an intervention study, the intervention group was also included as an independent variable. The results of this analysis are given in Table Some further bivariate analyses were also undertaken. Recording of clinical information about epilepsy by GPs was not significantly associated with the GP-rated score on epilepsy care being a primary care responsibility but was associated with seizure frequency.In this study two main factors ("epilepsy viewed as a primary care responsibility" and "medication skills") were found to underlie GP attitudes to the care of people with epilepsy. Responses to questions constituting these factors demonstrated a high and significant level of clustering within practices. The main factor that accounted for the largest proportion of variance, general practitioner-rated "epilepsy viewed as a primary care responsibility", significantly predicted patient-rated quality of care. Patient-rated shared decision-making and seizure frequency were other significant predictors of patient-rated quality of GP epilepsy care. Recording of clinical information by GPs about epilepsy was not associated with GP attitudes to epilepsy care but was related to patient seizure frequency.In this study general practitioner attitudes to the care of people with epilepsy were found to cluster within practices to a considerable extent. This has not previously been shown in the U.K. A recent Dutch study showed tThere is relatively little information of the relationship of GP attitudes to patient ratings of the quality of GP epilepsy care. Existing evidence suggests that GPs with a special interest in a particular condition improves outcomes . The resThe results of a multilevel analysis examining patient and doctor predictors of patient satisfaction from the Netherlands suggestePatient ratings of the quality of care do vary according to whether individuals have controlled or uncontrolled seizures. Individuals with controlled seizures rate the quality of care provided higher than individuals with uncontrolled seizures. However why the ratings of care provided are higher is not clear as individuals with controlled and uncontrolled epilepsy differ from each other in other characteristics that may influence quality ratings apart from seizure frequency .At practice level GP attitudes are not related to mean practice patient seizure frequency. Although it is likely that individual GP attitudes will be influenced by whether an individual patient has controlled or uncontrolled seizures it is not possible to empirically demonstrate this relationship, as nearly all general practitioners will see a mix of individuals with "controlled" and "uncontrolled" seizures in a given year. Their attitudes to the care of people with epilepsy will be influenced by this spectrum of epilepsy severity .In terms of limitations of the results, some practices did not consent to take part in this intervention study and not all GPs who participated completed questionnaires. However there were no significant differences between practices that participated and did not participate in terms of size, average deprivation or training status . MoreoveSpecific general practitioner attitudes to the care of people with epilepsy are significantly associated with patient-rated quality of epilepsy care and cluster within practices. It is important to take these findings into consideration when planning interventions and services. General practitioners need to have good knowledge and skills in the management of epilepsy and should be aware of and utilise current guidelines for good clinical epilepsy care -19 to fuThe author(s) declare that they have no competing interests.AT designed and ran the study, undertook the analysis and wrote the manuscript. MR was involved in the design and running of the study and edited the paper.The pre-publication history for this paper can be accessed here:

Post-translational modification by Small Ubiquitin-like Modifiers (SUMO) has been implicated in protein targeting, in the maintenance of genomic integrity and in transcriptional control. But the specific molecular effects of SUMO modification on many target proteins remain to be elucidated. Recent findings point at the importance of SUMO-mediated histone NAD-dependent deacetylase (HDAC) recruitment in transcriptional regulation.Rad60, Esc2 and mouse NIP45 . Different proteins of the novel family are known to interact directly with histone NAD-dependent deacetylases (HDACs), structural maintenance of chromosomes (SMC) proteins, and transcription factors. In particular, the highly non-trivial designation of the first of the two successive SUMO-domains in non-plant RENi provides a rationale for previously published functionally impaired mutant variants.We describe the RENi family of SUMO-like domain proteins (SDP) with the unique feature of typically containing two carboxy-terminal SUMO-like domains. Using sequence analytic evidence, we collect family members from animals, fungi and plants, most prominent being yeast Till now, SUMO-like proteins have been studied exclusively in the context of their covalent conjugation to target proteins. Here, we present the exciting possibility that SUMO domain proteins, similarly to ubiquitin modifiers, have also evolved in a second line – namely as multi-domain proteins that are non-covalently attached to their target proteins. We suggest that the SUMO stable fusion proteins of the RENi family, which we introduce in this work, might mimic SUMO and share its interaction motifs . This presumption is supported by parallels in the spectrum of modified or bound proteins e.g. transcription factors and chromatin-associated proteins and in the recruitment of HDAC-activity. Among ubiquitin-related proteins, containing at least one domain with a ubiquitin-like fold, one can distinguish ubiquitin-like modifiers (UBLs) and ubiquitin domain proteins (UDPs) .UBLs can be covalently attached to target proteins analogously to ubiquitin. Unlike ubiquitin, UBLs mostly do not directly target proteins for degradation , althougIn contrast to UBLs, UDPs are not conjugated to other proteins and lack the C-terminal double glycine motif characteristic for ubiquitin and ubiquitin-like modifiers. They are a heterogeneous class of usually multi-domain proteins, which are unrelated outside of their ubiquitin-like domain . In seveThe biological relevance of non-conjugatable multi-domain proteins having a domain with clear relationship to UBLs like SUMO, rather than ubiquitin, is yet unknown. Here, we present a detailed sequence analysis of a family of SUMO-like domain proteins (SDPs) containing one or two SUMO-like domains. Members of the proposed RENi family act as factors in transcriptional regulation, chromatin silencing and genomic stability.During the study of the predicted nuclear subset of the Drosophila proteome, we encountered the unknown 424 amino acids long protein CG4449 NP_651134). Initial analysis of its sequence complexity shows that the disordered N-terminal half of the protein is followed by a likely globular segment . Indeed, a compositionally biased, polar low-complexity region (LCR) spans almost the entire N-terminal 220 amino acids (AA) as reported by CAST [1134. IniThe C-terminal half of CG4449 turns out to contain an internally repeated segment identifiable with RADAR region .In conclusion, we found that the Drosophila protein CG4449 NP_651134) has a tripartite architecture: with a N-terminal LCR followed by two globular domains with a SUMO-like fold (termed SD1 and SD2). Whereas SD2's similarity to single domain SUMO-like sequences can be easily detected with BLAST tools, the identification of SD1 is non-trivial , H. sapiens , M. musculus and C. elegans . All these proteins contain a LCR at the N-terminus followed by two SUMO-like domains, the first of which has mostly diverged away beyond recognition thresholds using traditional sequence-profile searches including the two SUMO-like domains, collects a family of animal proteins with the same tripartite organization in D. melanogaster CG4449 (220–424) and the corresponding sequences derived from A. gambie, X. laevis, C. elegans, C. briggsae, M. musculus and H. sapiens A. thaliana , O. sativa , S. pombe , S. cerevisiae , Y. lipolytica , C. glabrata and in other recently published fungi proteomes [S. cerevisiae and S. pombe homologs correspond to the studied Rad60 and Esc2 proteins, respectively [A multiple sequence alignment of the globular C-terminal half of s Figure was usedroteomes . The S. ectively ,15; the These HMM-search results suggest the most likely plant and lower eukaryote orthologues to the animal NIP45-like proteins. For establishing the orthology relationship, these initial results need to be confirmed by reciprocal searches independently performed for fungal and plant proteins. Further below, we present this evidence for the homology between the C-terminal part of the proteins found in the various taxonomic groups.C. glabrata representative (CAG57776) and retrieving the best and significant hits in the proteomes of S. cerevisiae, S. pombe, K. lactis, C. albicans, Y. lipolytica, D. hansenii, A. nidulans [M. musculus , A. thaliana , C. elegans .The set of fungal RENi proteins can be autonomously collected using a BLASTP search started with the nidulans . The domnidulans ). A HMM A. thaliana against the TIGR Gene indices of barley, maize, rice, potato and soybean [A. thaliana in Y. lipolytica and H. sapiens proteomes [Potential plant RENi homologs, derived in a full-length TBLASTN search with soybean , show a soybean ) and a ct 8e-05) .We propose to name the collected group of protein sequences the RENi-family after its most studied members Rad60, Esc2 and NIP45. All representatives have a similar sequence architecture involving a N-terminal low complexity region with many polar and (positively) charged residues and a C-terminal globular part with one (plant proteins) or two SUMO-like domains.The use of a model representing the complete globular region of RENi proteins was essential for the successful collection of the family. A global HMM spanning the SD1 and SD2 domains tests for homology in the whole globular part and, correspondingly, directly collects the RENi family. In contrast, when using the C-terminal half of various RENi family members as query sequence in PSI-BLAST , the seaWhile RENi proteins of the fungal, metazoan and mycetozoan taxa contain two C-terminal SUMO-like domains SD1 and SD2), only the second one can be clearly defined in plant representatives and rad663E and A graph representation of the pair-wise similarity relationship for SD1 and SD2 sequences to other known ubiquitin-like domains is involved in chromatin silencing via the recruitment or stabilization of the Sir (silent information regulators) complex [ complex ,28. It i complex and, thu complex and act complex as well complex ,32. With complex but also complex .NIP45, the one studied RENi in metazoa, has been implied in gene regulation, where it needs its DNA-binding partner NFATp for this activity . StrikinThere is little experimental data on the importance of the predicted SUMO-like domains in RENi proteins. Nevertheless, all listed functions of RENi proteins conform with the known role of SUMO in transcriptional regulation and the control of genome integrity . In the In this report, we use sequence-analytical methods to infer the homology relationships between RENi family members and determine their tripartite (bipartite for plant homologs) domain architecture. A N-terminal polar low-complexity segment and two consecutive SUMO-like domains in the C-terminal half characterize the functionally described fungal and metazoan RENi proteins. While the more C-terminal SD2 is easily detectable, it is the particularly divergent SD1 that was shown in fungi to be essential for the assayed molecular functions. Due to the likely limited sequential- requirements, this SUMO-like domain is difficult to detect and has been missed in previous analyses of individual family members. The identification of the more N-terminal SUMO-like domain SD1 helps rationalizing experimental findings for mutant fungal RENi family members.RPS-BLAST and FFASThe sequence analytic work was executed by MN. All authors contributed to evaluating the results and making the discoveries reported here. MN prepared all the figures and, together with FE, the manuscript text. All authors read and approved the final manuscript.

Nova-1 and Nova-2 genes. Anti-Ri antibodies are typically detected in the serum and cerebrospinal fluids of patients with neurological disorders such as opsoclonus/myoclonus and cerebellar ataxia and in association with gynecologic and breast malignancies.The IgG autoantibody ANNA-2 (anti-Ri) is a type 2 antineuronal antibody that has been found to bind to highly conserved and widely distributed adult brain proteins encoded by the This report describes an unusual example of a 33-year-old female patient who developed short-term memory deficits over a 3-month period. An extensive neurological work-up, including a panel of paraneoplastic markers was negative with the exception of a high titer serum Anti-Ri . A large left ovarian mass was palpated, surgically resected and eventually diagnosed as a mature cystic teratoma. Post-operatively, memory deficits had disappeared within 1 month and serum Anti-Ri titers had decreased significantly to 1:256. An extensive diagnostic work-up for other malignancies was negative.Although, Anti-Ri antibodies are typically associated with malignancies, this case illustrates the potential association between benign tumors and this autoantibody. Paraneoplastic syndromes (PNS) are signs or symptoms attributable to tissue damage at sites that are remote from a primary malignancy or their metastases. PNS involving virtually every level of the neuro-muscular system have been described -3. TypicA wide variety of anti-neuronal antibodies have been associated with the many PNS-associated neurologic disorders . These aA 33-year-old nulligravid female with no significant past medical history presented to her physician with complaints of a short-term memory loss of approximately three months' duration. This included an inability to remember details about 24-hour old events. There had been no major socio-economic or personal changes in her life over this period. A detailed neurologic examination was notable only for her presenting complaint. Routine laboratory work-up, including a lumbar puncture were all within normal limits. A physical examination revealed a large right adnexal mass, which upon ultrasonographic assessment showed internal features suggestive of a malignancy. A panel of serum paraneoplastic autoantibodies was then requested, including anti-Hu, anti-Yo, anti-Ri, anti-Tr and anti-Ma1/2. All were normal with the exception of IgG anti-Ri, measured at 1:15,360 by an indirect immunofluorescence method. An extensive diagnostic work-up failed to reveal any malignancies. The patient subsequently underwent a right salpingo-oophorectomy, and her adnexal mass was diagnosed as a benign mature cystic teratoma of the ovary. Almost immediately following her surgery, the patient expressed a subjective improvement in her symptoms. Within a month, the serum anti-Ri had decreased to 1:256, and a detailed neurologic examination revealed resolution of her symptoms. She has not experienced any relapse in her symptoms in the 1 year since her surgery.Nova-1 and Nova-2 genes and which may play a role in neuronal maturation and homeostasis [In 1988 and 1991, Budde-Steffen at al and Luqueostasis -9. As theostasis . Indeed,eostasis . The speeostasis . What theostasis , the vasIs it possible that the presence of the autoantibody and the ovarian tumor are completely fortuitous?. Given the temporal relationship between the resolution of her symptoms and the sharp decrease in her anti-Ri titer following her surgery, we believe this is unlikely. However, the precise mechanistic basis for this association as well as potential influence of outside factors remains to be elucidated. It should also be noted that high titers of Anti-Ri have been identified in patients with a history of ovarian cancer but without any evidence of a PNS, suggesting caution in assessing the specificity of this auto-antibody for PNS.In summary, we describe in this report an association of a common anti-neuronal antibody (anti-Ri) in a patient with a benign neoplasm, mature cystic teratoma of the ovary, and whose neurologic symptoms, short-term memory deficits, was apparently associated with her tumor. Although, Anti-Ri antibodies are typically associated with malignancies, this case illustrates the potential association between benign tumors and this autoantibody.The authors declare that they have no competing interests.Dr Fadare wrote the initial version of the manuscript.Dr Hart managed the patient, provided clinical information, and revised the manuscript.

However, some but not all studies in mice and humans (though none in rats) have found that CLA promotes insulin resistance. The molecular mechanisms responsible for these effects are unclear, and there are conflicting reports on the effects of CLA on peroxisomal proliferator-activated receptor-γ (PPARγ) activation and expression. We have conducted three experiments with CLA in obese mice over three weeks, and one over eleven weeks. We have also investigated the effects of CLA isomers in PPARγ and PPARα reporter gene assays.Studies in rodents and some studies in humans have shown that conjugated linoleic acid (CLA), especially its trans-10, cis-12 isomer in the diet of female genetically obese (oblep/oblep) mice for up to eleven weeks reduced body weight gain and white fat pad weight. After two weeks, in contrast to beneficial effects obtained with the PPARγ agonist rosiglitazone, CLA or CLA enriched with its trans-10, cis-12 isomer raised fasting blood glucose and plasma insulin concentrations, and exacerbated glucose tolerance. After 10 weeks, however, CLA had beneficial effects on glucose and insulin concentrations. At this time, CLA had no effect on the plasma TNFα concentration, but it markedly reduced the plasma adiponectin concentration. CLA and CLA enriched with either isomer raised the plasma triglyceride concentration during the first three weeks, but not subsequently. CLA enriched with its trans-10, cis-12 isomer, but not with its cis-9, trans-11 isomer, stimulated PPARγ-mediated reporter gene activity; both isomers stimulated PPARα-mediated reporter gene activity.Inclusion of CLA or CLA enriched with its oblep/ob lepmice. Activation of both PPARγ and PPARα may contribute to the improvement in insulin sensitivity. In the short term, however, another mechanism, activated primarily by trans-10, cis-12-CLA, which probably leads to reduced adipocyte number and consequently reduced plasma adiponectin concentration, may decrease insulin sensitivity.CLA initially decreased but subsequently increased insulin sensitivity in The major components of CLA, are the cis-9, trans-11 and the trans-10, cis-12 isomers, both of which have biological activities. The t10, c12-isomer is the one primarily responsible for the effects of CLA on weight gain and insulin sensitivity. The CLA used in the present study contains these isomers in roughly equal proportions.The term conjugated linoleic acid (CLA) refers to a mixture of positional and geometric isomers of linoleic acid mice, despite causing weight loss [falep/fa lepand Zucker diabetic fatty falep/fa leprats [In previous studies, CLA or t10, c12-CLA has exacerbated glucose tolerance and raised plasma insulin levels in normal and genetically obese α, since TNFα is associated with apoptosis of adipocytes but causes insulin resistance. TNFα mRNA levels were markedly increased in isolated adipocytes from normal mice that had been fed on CLA for as little as four days . Surprisdblep/db lepmice with CLA for eleven weeks improved glucose tolerance and reduced plasma insulin concentration during the glucose tolerance test, indicating improved insulin sensitivity. Treatment for five weeks also improved glucose tolerance but plasma insulin was raised [dblep/db lepmice because β-cell failure as well as insulin resistance affects glucose homeostasis, and glycosuria can cause weight loss. Therefore, to investigate the effect of CLA on glucose homeostasis further, we have conducted four experiments in oblep/ob lepmice. We have included rosiglitazone as a comparator in one experiment and compared the effects of t10, c12- and c9, t11-enriched CLA with CLA in another experiment. The first three experiments were over 22 days, whereas the fourth was extended to eleven weeks and included measurements of plasma TNFα and adiponectin. An intriguing finding is that whereas CLA initially exacerbated glucose tolerance and raised the plasma insulin level, after ten weeks it began to improve glucose tolerance and lower the plasma insulin levels.Although most studies in mice have found that CLA exacerbates glucose tolerance and raises the plasma insulin concentration, in one study treatment of s raised . It is sWe also describe activation of PPARγ by t10, c12 but not by c9, t11-CLA, whereas PPARα was activated by both isomers.oblep/oblep) mice reduced their body weight, or weight gain compared to mice fed on a diet containing a similar amount of sunflower oil concentration in experiment 3 Table , and CLAAfter ten weeks CLA had no effect on the plasma TNFα concentration. The plasma adiponectin concentration, by contrast, was markedly decreased Table .CLA enriched with t10, c12-CLA (50 and 100 μM), but not with c9, t11-CLA, stimulated PPARγ-mediated reporter gene activity Figure . In contdblep/db lepmice [A number of studies have found that CLA reduces weight gain and fat accretion in both rats and mice. Those that have failed to show such effects are generally those that have used low levels of CLA or CLA that contained low concentrations of t10, c12-CLA . Studiespdb mice , show expdb mice -10. In hpdb mice , but doupdb mice -13, and pdb mice ,12,14. Tpdb mice .oblep/oblep) mice as our model of insulin resistance. There is only one previous report of the effect of CLA in oblep/ob lepmice [oblep/ob lepmice with CLA. These benefits were achieved faster with the higher than the lower dose (10 g/kg diet) of CLA.Our study raises the possibility that an initial exacerbation of glucose tolerance, apparently due to insulin resistance, might, after prolonged treatment with a high dose of CLA, be followed by improved insulin sensitivity and glucose tolerance. We used genetically obese and maintained at 23 ± 1°C with lights on from 07:00 to 19:00 h. They were housed in plastic cages with bedding and fed 'rat and mouse standard diet' . Six days before the start of the studies they were allocated to treatment groups (6 mice per group), such that each group had a similar mean bodyweight. The CLA and other treatments were mixed with powdered diet and given ad libitum. The mice were killed by cervical dislocation in experiments 1 to 3; in experiment 4 they were anaesthetised with sodium pentobarbitone and exsanguinated through an aortic catheter. All procedures were conducted in accordance with our Home Office, UK project licence under the Animals (Scientific Procedures) Act and as agreed by the University of Buckingham Ethical Review Board.Female C57Bl/6 CLA (in acid form), including isomer-enriched CLA, and sunflower oil were provided by Loders Croklaan, Wormerveer, The Netherlands. The CLA used in experiments 1, 2 and 3 was Clarinol™ A-60, containing 30% c9, t11-CLA and 31% t10, c12-CLA and 25% oleic acid. The CLA used in experiment 4 was Clarinol™ A-80, containing 40% c9, t11-CLA and 40% t10, c12-CLA. Rosiglitazone was synthesised by Dextra Laboratories, Reading, Berks, UK.ad libitum, and after 22 days when they had been fasted for 16 hours, immediately before termination of the experiment.At the start of treatment the mice weighed 34.5 ± 4.3 g (mean ± S.D.). The treatment groups were high oleic (83.5%) sunflower oil ; rosiglitazone (10 mg/kg diet) plus high oleic sunflower oil (15 g/kg diet); CLA (Clarinol™ A-60: 15 g/kg diet). An oral glucose tolerance test was conducted after 14 days as described below. 30 min prior to giving glucose, when the mice had been fasted for 4.5 hours, blood (100 μl) was taken for the measurement of plasma insulin and triglycerides. Plasma insulin and triglycerides were also measured after 21 days when the mice were feeding At the start of the treatment the mice weighed 44.0 ± 3.2 g (mean ± S.D.). A group fed on powdered chow alone was included. The doses of CLA (Clarinol™ A-60) and sunflower oil in the other two groups were increased to 25 g/kg diet. The oral glucose tolerance test and other measurements were carried out as described for experiment 1, except that the glucose tolerance test was one day earlier (i.e. after 13 days).At the start of treatment the mice weighed 34.1 ± 2.1 g (mean ± S.D.). The treatment groups were high oleic sunflower oil (25 g/kg diet); CLA (Clarinol ™ A-60: 25 g/kg diet); CLA with the CLA component of Clarinol enriched to 90% with t10, c12-CLA (25 g/kg diet); similarly, CLA enriched to 90% with c9, t11-CLA (25 g/kg diet). The oral glucose tolerance test and other measurements were carried out as described for experiment 2. In addition, the plasma non-esterified fatty acid concentration was measured in the blood taken prior to the glucose tolerance test, and the liver, pancreas, parametrial white adipose tissue depot and interscapular brown adipose tissue depot were weighed at termination.At the start of treatment the mice weighed 31.6 ± 3.8 g (mean ± S.D.). The treatment groups were high oleate (as glyceride) sunflower oil (25 g/kg diet); CLA (Clarinol A80: 10 g/kg diet) plus high oleic sunflower oil (15g/kg diet); CLA (Clarinol A80: 25 g/kg diet). Oral glucose tolerance tests preceded by blood sampling for the measurement of triglycerides, insulin and non-esterified fatty acids were taken after 14, 35 and 70 days of treatment. After 77 days of treatment the animals were anaesthetised in the fed state and blood was taken from the thoracic aorta for the measurement of plasma TNFα and adiponectin. Tissues were weighed as in experiment 3. Body length was measured from the tip of the nose to the anus.In each experiment oral glucose tolerance was measured after 13 or 14 days. In experiment 4 it was also measured after five and ten weeks. The mice were fasted for five hours before being dosed with glucose . Blood samples (20 μl) were taken from the tip of the tail after applying a local anaesthetic (lignocaine) and immediately before and 30, 60, 90, 120 and 180 min after dosing the glucose. They were mixed with haemolysis reagent and blood glucose was measured in duplicate using the Sigma Enzymatic (Trinder) colorimetric method and a SpectraMax 250 . Areas under the glucose tolerance curve (0–180 min) and other manipulations and analysis of the data were carried out using Prism software, version 3.0 .Blood was collected into EDTA-coated microcuvettes for the measurement of plasma insulin, non-esterified fatty acids and triglycerides. Plasma was stored at -80°C. 5 μl plasma samples were assayed using kits for triglyceride (Sigma enzymatic colorimetric method), non-esterified fatty acids and insulin .For the measurement of plasma TNFα and adiponectin , blood was taken into tubes containing 200 units of heparin and plasma was stored at -80°C.MluI and BglII and ligated into pNF-κ B-luc that had been cleaved with the same restriction endonucleases. Ligated DNA was transformed into competent JM109, E. coli cells (Promega). pcDNA3/PPARα was prepared by removing the human PPARα cDNA insert from pUC18/hPPARα as a NruI/BamHI fragment and ligating it into EcoRV/BamHI cleaved pcDNA3.1(-) (Invitrogen). Ligated DNA was transformed into competent JM109, E. coli cells (Promega).pRSV/hRXRα and pcDNA3/hPPARγ1 were both obtained from Professor VKK Chatterjee . PPPRE3TK-luc was prepared by replacing the NF-kB enhancer element of pNF-κB-luc (Clontech) with a cassette of 3 PPAR Response Elements (PPREs). A double-stranded PPRE cassette was prepared using the 'Klenow fill-in' technique. An 113 bp oligonucleotide (PPRE3) 5'- GCATTCACGCGTCAAATATAGGCCATAGGTCATTCTCGAGCAAATATAGGCCATAGGTCATTCTCGAGCAAATATAGGCCATAGGTCAGATTCGATCAATATAGGCCATAGGTCACTCGAGGCAACAGATCTTACGCATG -3' containing a triplet of PPREs and appropriate restriction endonuclease sites was used as a template for synthesis of a second DNA strand. This was primed by PPRE3R, 5'-CATGCGTAAGATCTGTTGCC-3', which is complementary to the 3' region of PPRE3. 20 μl annealed PPRE3 and PPRE3R, 1.5 μl 2 mM dNTPs, 1 × Klenow Buffer and 5 units DNA Polymerase I (Klenow fragment), were incubated for 1 hour at 37°C and then 10 minutes at 75°C, purified by ethanol precipitation and resuspended in sterile water. The double-stranded PPRE cassette was digested with 2. Transient transfections were performed using LipofectAMINE as directed by the manufacturers (GibcoBRL). For the PPARγ assay Cos-7 cells were plated in 24-well plates at a density of 0.375 × 105 cells/well. Cells were transfected in serum-free medium (DMEM containing 2 mM L-glutamine) with pPPRE3TK-luc, pRLTK, pRSV/hRXRα and pcDNA3/hPPARγ 1 at concentrations of 0.4, 0.03, 0.02 and 0.02 μg/well, respectively. Five hours after transfection cells were fed with 250 μl/well of serum-free medium containing various concentrations (0–100 μM) of CLA . Cell lysates were prepared after 46 hours using 100 μl 1 × passive lysis buffer (Promega) per well. Firefly and renilla luciferase activities were measured using a Dual Luciferase Assay kit (Promega), as described by the manufacturers. Measurements were performed on an MLX microtitre plate luminometer (Dynex). For the PPARα assay Cos-7 cells were plated in 24-well plates at a density of 0.5 × 105 cells/well. Cells were transfected in serum-free medium with pPPRE3TK-luc, pRLTK, pRSV/hRXRα and pcDNA3/hPPARα at concentrations of 0.4, 0.04, 0.03 and 0.03 μg/well, respectively. Five hours after transfection DMEM supplemented with 2 mM L-glutamine and 20% SBCS was added to the cells. Following 18 hours incubation at 37°C/5% CO2 the medium was removed and replaced with medium (DMEM supplemented with 2 mM L-glutamine and 10% SBCS) containing various concentrations (0-100 μM) of CLA enriched to 85% with the c9, t11 isomer or 81% with the t10, c12 isomer prepared in 0.1% DMSO. After 24 hours of treatment cell lysates were prepared and luciferase activity measured as described above.Cos-7 cells (ECACC No. 87021302) were routinely cultured in DMEM containing 10% FCS, 2 mM L-Glutamine, 100 iu/ml penicillin and 100 μg/ml streptomycin at 37°C/5% COData were analysed by one-way analysis of variance followed by LSD test with the sunflower oil treatment as the control. Means are of 6 values with SEM.in vivo experiments and analysed materials from these. AM conducted the in vitro experiments. MS and MC conducted the initial analysis and interpretation of the data. JA reanalysed some of the data and wrote the manuscript with input from the other authors, and in particular from AE and IM with respect to interpretation and perspectives.MC, LB, IM and MS devised the experiments. EW, MS and CS, supported by JO and SW conducted the

Prochlorococcus sp. are marine bacteria with very small genomes. The mechanisms by which these reduced genomes have evolved appears, however, to be distinct from those that have led to small genome size in intracellular bacteria. Prochlorococcus species, the smallest and most abundant photosynthetic organism in the ocean, have recently been published. Comparative genome analyses reveal that genome shrinkage has occurred within this genus, associated with a sharp reduction in G+C content. As all examples of genome reduction characterized so far have been restricted to endosymbionts or pathogens, with a host-dependent lifestyle, the observed genome reduction in Prochlorococcus is the first documented example of such a process in a free-living organism.Three complete genomes of P. marinus SS120 that is even more pronounced in P. marinus MED4. This acceleration has affected every functional category of protein-coding genes. In contrast, the 16S rRNA gene seems to have evolved clock-like in this genus. We observed that MED4 and SS120 have lost several DNA-repair genes, the absence of which could be related to the mutational bias and the acceleration of amino-acid substitution.Our results clearly indicate that genome reduction has been accompanied by an increased rate of protein evolution in Prochlorococcus have to be selectively neutral, as the large size of populations imposes low genetic drift and strong purifying selection. We assume that the major driving force behind genome reduction within the Prochlorococcus radiation has been a selective process favoring the adaptation of this organism to its environment. A scenario is proposed for genome evolution in this genus.We have examined the evolutionary mechanisms involved in this process, which are different from those known from host-dependent organisms. Indeed, most substitutions that have occurred in Mycoplasma genitalium [Buchnera [Nanoarchaeum equitans [Buchnera genome is devoted to biosynthesis of amino acids which are essential to its host [The size of bacterial genomes is primarily the result of two counteracting processes: the acquisition of new genes by gene duplication or by horizontal gene transfer; and the deletion of non-essential genes. Genomic flux created by these gains and losses of genetic information can substantially alter gene content. This process drives divergence of bacterial species and eventually adaptation to new ecological niches . In somenitalium or phytonitalium and symbBuchnera -8 or theequitans . In the equitans and 35 kequitans , respectits host .Prochlorococcus [5 cells/ml) in all nutrient-poor areas of the world's oceans between 40°N and 40°S and is probably the most abundant photosynthetic organism on Earth [b to a ratio; the second inhabits the upper layer of the ocean and has a low divinyl-chlorophyll b to a ratio [Prochlorococcus marinus MED4 [P. marinus SS120 [Prochlorococcus species MIT9313 [So far, all characterized examples of genome reduction have been associated with a change from a free-living to a host-dependent lifestyle . It is trococcus -15. The on Earth ,17. It hon Earth . The fir a ratio . The gennus MED4 , and of us SS120 and Proc MIT9313 , have reProchlorococcus sp. MIT9313 branches at the base of the Prochlorococcus radiation, close to the Synechococcus group [Prochlorococcus HL clade, encompassing the MED4 strain, appears to be the most recently evolved Prochlorococcus group, consistent with the fact that this clade is much less diversified than are the LL clades.Phylogenetic trees based on 16S rRNA sequences or 16S-2us group . In contSynechococcus sp. WH8102 genome [Despite the close relatedness of these strains, their genomes vary widely in terms of size, G+C content and the number of protein-coding genes Table . While t2 genome , MED4 ha2 genome . HoweverSynechococcus and Prochlorococcus but also between MIT9313 and the two other Prochlorococcus strains and more amino acids encoded by A+T-rich codons .The downsizing of MED4 and SS120 genomes during evolution is associated with a genome-wide adenine (A) and thymine (T) enrichment Table . Second,-12) for BLAST comparisons. In contrast, our analysis is based on identification of reciprocal best hits without the use of any particular threshold (apart from the default BLAST threshold) and consequently allows the detection of orthologous relationships whatever the gene lengths or the level of similarity. Still, our ortholog identification process is rather strict and the set of orthologs identified in this study probably corresponds to a lower estimate of the actual number of orthologs shared by the four genomes. This set of genes represents a substantial percentage of the total pool of all protein-coding genes in P. marinus MED4 (73.2%) and SS120 (69.2%) and about half of the gene set in Prochlorococcus sp. MIT9313 (56.2%) and Synechococcus sp. WH8102 (51.1%). These percentages are consistent with the differences in the respective number of genes within these genomes and probably constitute an estimate of the core of genes conserved in all marine picocyanobacteria. This is sensibly more than the pool of around 1,000 orthologs identified by W.R. Hess . The difr genome .Prochlorococcus genomes, we have investigated whether it also affects the rate of protein sequence evolution in these genomes. We used the 1,306 orthologs common to the four genomes to estimate the amino-acid substitution rate in each genome. Branch lengths calculated for a given tree topology indicate that protein sequences evolved at significantly different rates (P < 0.001) between MED4, SS120 and MIT9313. Therefore the hypothesis of a constant evolutionary rate between these strains can be rejected for protein-coding genes. The calculation of branch-length ratios reveals that the amino-acid substitution rate is 2.04-fold higher inMED4 than in SS120 (dA/dB) and 3.81-fold higher in MED4 than in MIT9313 ((dA+dX)/dC). This rate is also 2.31-fold higher for SS120 than for MIT9313 ((dB+dX)/dC). Computation of branch lengths for each functional category shows that the increased rate of amino-acid replacement in protein sequences concerns every category to the rate of synonymous substitutions (dS) is commonly used to measure the relative rate of purifying selection acting at the protein level. We determined dS and dN for each gene pair of every group of orthologs and their values were averaged for each genome. Surprisingly, we observed saturation at synonymous sites for all genome pairs (dS > 2) and the calculation of the dN/dS ratio was thus impossible. Still, the average dN was higher between MED4 and SS120 (0.36) than between SS120 and MIT9313 (0.32). The lowest dN was observed between MIT9313 and WH8102 (0.24), a finding which is consistent with the relative acceleration of amino-acid substitutions in MED4 and in SS120.The ratio of the rate of nonsynonymous substitutions ), as well as several other marine Synechococcus spp. , it is reasonable to assume that the common ancestor of all Prochlorococcus species also had a genome size around 2.4 Mbp. Under this hypothesis, the genome reduction which has occurred in MED4 would correspond to around 31%. By comparison, the extent of genome reduction in the insect endosymbiont Buchnera, as compared to a reconstructed ancestral genome, is around 77% [P. marinus SS120 - and a fortiori the MED4 genome - is considered to be near minimal for a free-living oxyphototrophic organism [The process of genome reduction which has occurred within the ound 77% . The genorganism and dataProchlorococcus lineages and host-dependent organisms have undergone genome reduction associated with accelerated substitution rates, these phenomena must have arisen from very different causes as the resulting gene repertoires of the two types of organisms differ tremendously. Indeed, the genome evolution of endosymbionts and obligatory pathogens is driven by two main processes which have mutually reinforcing effects on genome size and evolutionary rates. Being confined inside their host, these bacteria have tiny population sizes and are regularly bottlenecked at each host generation or at each new host infection. Consequently, they experience a strong genetic drift [If both ic drift involvinic drift ,29 as weic drift . This geic drift ,31-33. Fic drift -6,8,9,32Prochlorococcus, the very large size of field populations [P. marinus SS120 only two such genes are missing . One noteworthy exception is the presence in Prochlorococcus, but not Synechococcus, of flavodoxin and ferritin, two proteins that possibly give Prochlorococcus a better resistance to iron stress. Apart from that, Synechococcus appears more like a generalist, in particular with regard to nitrogen or phosphorus uptake and assimilation [a priori be more suited to sustain competition. Hence, we assume that the key to the success of Prochlorococcus resides less in the development of a specific complex or pathway to cope better with unfavorable conditions than in the simplification of its genome and cell organization, which can allow this organism to make substantial economies in energy and material for cell maintenance.If it is neither the relaxation of purifying selection nor an increase in genetic drift that has been the main factor causing hococcus ,34, stromilation , and shoper se is a potential source of substantial economies for the cell, as it reduces the amount of nitrogen and phosphorus, two particularly limiting elements in the upper part of the ocean, which are necessary, for instance, in DNA synthesis. Another advantage is that it allows a concomitant reduction in cell volume. It has been previously suggested that, fProchlorococcus genomes. Using a rate of 16S rRNA divergence of 1% per 50 million years [Prochlorococcus and Synechococcus. The ancestral Prochlorococcus cells must have developed in the LL niche, a niche probably left free by other picocyanobacteria. Given the considerable difference in genome size between the LL strains MIT9313 and SS120, it appears that genome reduction itself must have started in one lineage(s) within the LL niche some time after Prochlorococcus differentiation from its common ancestor with marine Synechococcus species. Why the selection has affected only one (or some?) and not all Prochlorococcus lineages remains unclear. Examination of the gene repertoire of P. marinus SS120 [ada gene, which may be responsible for the shift in base composition, but also possibly several others, not necessarily involved in GC to AT mutation repair and were secondarily lost in the LL-adapted lineages.Later during evolution one LL population which probably already had a significantly reduced cell and genome size must have progressively adapted to the HL niche and eventually recolonized the upper layer. How this change in ecological niche was possible is still hard to define. Comparison of the gene set that differs between the LL-adapted SS120 and the HL-adapted MED4 shows that very few genes might be sufficient to shift from one to the other niche, including a multiplication of li genes and the Prochlorococcus has similar features to that in host-dependent prokaryotes: genome reduction, bias toward a low G+C content, acceleration in the evolution rate of protein-coding genes, and loss of DNA-repair genes. In contrast to the latter organisms, however, in Prochlorococcus this evolution does not appear to be the result of genetic drift or relaxed selection being exerted on some gene categories. Indeed, purifying selection is very efficient in Prochlorococcus, as rRNA genes have evolved at a similar rate in all genomes. Despite the decrease in G+C content and an accelerated rate of evolution of protein-coding genes, purifying selection must also act on these genes and avoid potentially deleterious mutations. We hypothesize that a reduction in genome size can constitute a selective advantage for life in the open ocean, both at depths where photon energy is low and in surface waters where nutrients are scarce.Genome evolution in the free-living genus Prochlorococcus has led to populations highly specialized to narrow ecological niches, at the expense of versatility and competitiveness in changing conditions. Indeed, not only is the distribution of the Prochlorococcus genus limited to low latitudes but theProchlorococcus marinus MED4, P. marinus SS120, Prochlorococcus sp. MIT9313 and Synechococcus sp. WH8102 were downloaded from the Genome division of the NCBI Entrez system. A few additional genes which were modeled in at least one genome and were present in the other genomes but not modeled were included in our dataset .The complete genome sequences and annotations of Genome sequences translated in their six reading frames were aligned with the Promer program of the MUMmer 3.0 system .Codon usage was computed for every open reading frame (ORF) of each genome with the EMBOSS program cusp. Amino-acid usage was derived from the results produced by cusp.We used a sequence-similarity based approach which is similar to the procedure used for the cluster of orthologous groups (COGs ). For eaProchlorococcus genomes (hypothesis of the molecular clock). The same analysis was applied to orthologs of each functional category.Protein sequences from each of the groups of four orthologous genes were aligned using ClustalW with defdS) and non-synonymous (dN) substitution rates were obtained from the Yn00 program of the PAML 3.13 package [Nucleotide sequences of each group of orthologs were aligned with Protal2dna according to alignments of their corresponding amino-acid sequences . Pairwis package .The following additional data are available with the online version of this article. Additional data file The orthologous genes classified by functional categoryClick here for additional data fileA a fasta file of orthologous genes which were modeled in at least one genome and present but not modeled in the other genomesClick here for additional data file

Haemophilus influenzae. The list has grown considerably since then: add over 160 bacterial species (and counting), most major model organisms, and an ever-growing list of mammals—including, of course, humans. With 99% of our genome now fully sequenced, the Human Genome Project's next major goal is to identify all the functional elements contained in our 2.85 billion nucleotides. Such an effort is hardly trivial: producing the sequence of a mammalian-size genome can run from $10 to $50 million, the estimated price tag of the Cow Genome Project.It's hard to believe it was just ten years ago that scientists reported the first complete genome sequence of an organism, the bacterial pathogen In an ideal world, any organism would be fair game for sequencing, but in the real world, sequencing resources are scarce. Comparing genome sequences turns out to be a great way to identify regions that have important functions, but comparative genomics studies would be far more efficient if scientists could figure out in advance which genomes would reveal the most information about a particular question. Taking up that challenge, computational biologist Sean Eddy reports a statistical model that predicts how many genomes, and at what evolutionary distance, are needed for effective comparative genomic analyses. In addition to confirming some working principles of comparative genomics, the model also reveals a surprisingly simple guideline for future studies.Comparative genomics works by aligning sequences of different organisms to identify patterns that operate over both large and small distances. Aligning mouse chromosomes with human chromosomes, for example, shows that 99% of our protein-coding genes align with homologous sequences in mice. Underlying such analyses is the principle that DNA sequences that are highly conserved are likely to be functionally important. A common assumption is that adding more comparative genomes to the alignment helps distinguish functionally significant from irrelevant conserved sequences.How do you go about creating an abstract model that captures what Eddy calls the “essential flavor of comparative genomic analysis”? His model puts aside the specific characteristics of individual organisms, genomic features, and analysis programs in favor of identifying higher-level patterns and scaling relationships, specifically between the number of genomes, evolutionary distance, and feature size (features include genetic elements like exons and transcription factors).The model shows that the number of genomes required to identify conserved regions—that is, regions evolving under selection—scales inversely with the size of the feature being sought. Thus, to look for conserved sequences half as long, you need twice as many genomes, assuming a constant evolutionary distance and statistical power. For example, to identify a conserved human feature the size of a coding exon (about 50 nucleotides), it is sufficient to compare just the human and mouse genomes. But to identify conserved single nucleotides, you would need 55 comparative genomes at “mouse-like” evolutionary distances (roughly 75 million years).Things get a little trickier when varying evolutionary distance. We can see a substitution only at a given point in time: we can't tell how many times a site has changed, for example, or whether it changed at some point and then changed back. But at short evolutionary distances—where it's safer to assume no sites have changed more than once—the evolutionary distance is roughly the same as the fraction of sites identified as changed, and evolutionary distance and the number of genomes needed scale inversely. Therefore, the closer the evolutionary distance, the more genomes needed: one would need seven times as many comparative genomes using human/baboon distances, for example, compared to human/mouse distances. So when it comes to using primate sequences to study the human genome, our most distant relatives (such as lemurs) offer far more comparative analysis power than our next of kin (chimps and bonobos).While this model confirms the intuitive assumption that identifying smaller features requires more genomes, it reveals an inverse scaling relationship far more direct, and precise, than previously imagined. With the next phase of the Human Genome Project under way, Eddy's model offers valuable guidelines for identifying which genomes and how many might best meet this ambitious goal.

Gdf5 gene (a bone morphogenetic protein [BMP] family member) to develop new mouse lines that can be used to either activate or inactivate genes specifically in developing joints. Expression of Cre recombinase from Gdf5 bacterial artificial chromosome clones leads to specific activation or inactivation of floxed target genes in developing joints, including early joint interzones, adult articular cartilage, and the joint capsule. We have used this system to test the role of BMP receptor signaling in joint development. Mice with null mutations in Bmpr1a are known to die early in embryogenesis with multiple defects. However, combining a floxed Bmpr1a allele with the Gdf5-Cre driver bypasses this embryonic lethality, and leads to birth and postnatal development of mice missing the Bmpr1a gene in articular regions. Most joints in the body form normally in the absence of Bmpr1a receptor function. However, articular cartilage within the joints gradually wears away in receptor-deficient mice after birth in a process resembling human osteoarthritis. Gdf5-Cre mice provide a general system that can be used to test the role of genes in articular regions. BMP receptor signaling is required not only for early development and creation of multiple tissues, but also for ongoing maintenance of articular cartilage after birth. Genetic variation in the strength of BMP receptor signaling may be an important risk factor in human osteoarthritis, and treatments that mimic or augment BMP receptor signaling should be investigated as a possible therapeutic strategy for maintaining the health of joint linings.Articular cartilage plays an essential role in health and mobility, but is frequently damaged or lost in millions of people that develop arthritis. The molecular mechanisms that create and maintain this thin layer of cartilage that covers the surface of bones in joint regions are poorly understood, in part because tools to manipulate gene expression specifically in this tissue have not been available. Here we use regulatory information from the mouse Through genetic manipulation, these authors have reduced signaling by bone morphogenetic factors in joint regions, and created a valuable model for the study of arthritis Thin layers of articular cartilage line the bones of synovial joints and provide a smooth, wear-resistant structure that reduces friction and absorbs impact forces . Loss orJoint formation begins during embryogenesis, when stripes of high cell density called interzones form across developing skeletal precursors . ProgramWnt14 is expressed in stripes at the sites where joints will form, and it is capable of inducing expression of other joint markers when misexpressed at new locations in the limb containing the Gdf5 locus was modified by homologous recombination in bacteria to insert a cassette encoding Cre-internal ribosome entry site (IRES)-human placental alkaline phosphatase (hPLAP) into the translation start site of Gdf5 line used for all subsequent breeding experiments was seen to precede LACZ expression during successive development of joints in the digits mice to analyze the pattern of Cre-mediated lacZ recombination throughout development. Joints in developing limbs begin forming in a proximal-distal pattern such that the shoulder joint forms prior to the elbow joint. In addition, three major stages of early joint development have been defined by histology as (1) interzone formation, (2) three-layer interzone formation, and (3) cavitation mice were crossed with vitation . Consistvitation B and 1C,vitation . Sectionvitation D and 1E elopment . Adult ehemistry .lacZ expression. Starting at E13.5, LACZ activity is detected in an anterior and posterior domain of the limb bud . Previous studies have shown that the recombined floxPBmpr1a allele mimics a null allele of the Bmpr1a locus when transmitted through the germline . BMP signaling is known to be required for growth of the external ear of mice . Finally, mutant animals showed obvious skeletal changes in whole-mount skeletal preparations. At some sites in the ankles, joints seemed to be missing entirely, with fusion of bones that would normally be separate. For example, the second distal tarsal was fused to the central tarsal bone in every conditional knockout animal examined (18 of 18), a phenotype not observed in controls (zero of 18) B and 3C.o of 18) B–3E is down-regulated in the interzone region .In most joints of ions see C, no chaions see D, no difCol2a1 and Aggrecan (Agg), the genes encoding the major structural proteins of cartilage matrix , a gene expressed specifically in the periarticular and perichondral regions of developing joints . Less severe reductions were also seen in articular cells of tarsals and metatarsals in the hindfeet (unpublished data). By 2 wk of age, Col2a1 expression was reduced in most cells of the articular region and Collagen 10 (Col10a1) (Collagen 1 (Col1a1) expression, increase proliferation, and result in cells with flattened, fibroblast-like morphology . While recombined LACZ marker expression was detected in most articular cartilage cells, it was also observed in scattered subarticular chondrocytes, growth plate chondrocytes, and osteoblasts . Together, these data suggest that BMPR1A activity is required in postnatal joint articular cartilage to maintain expression of many genes encoding structural components of cartilage matrix.By 1 wk after birth, obvious differences began to be detected in the articular regions of mutant animals. The expression of r region L and 5Q,r region K and 5P,Col10a1) M and 5R Col10a1) . Inhibitrphology . Howevereoblasts O and 5T Sox9 is required for normal cartilage differentiation, for expression of cartilage extracellular matrix (ECM) genes including Agg, and is a direct transcriptional regulator of the key cartilage matrix gene Col2a1 , toward the regions where surface articular cartilage was severely eroded or missing .Agg and Col10 expression were all reduced in mutant articular regions of the forefeet and hindfeet by 7 wk of age, and the beginning signs of cartilage loss were observed (unpublished data). By 9 mo of age, many regions of articular cartilage were completely missing or extremely fibrillated, leaving regions of exposed bone on the surface . The overall shape of mutant knee skeletal elements appeared similar to controls, although the fibrocartilaginous meniscus that resides between the femur and tibia appeared much less dense in mutants at E16.5. Some cartilage formed in the meniscus region, but the size of these elements was greatly reduced and contained abundant cells with fibrous, noncartilaginous appearance (unpublished data). This reduction of the meniscus can also be seen in sections from 7-wk- and 9-mo-old animals . By postnatal day 7, Safranin O staining and Bmpr1a is required cell-autonomously in articular cartilage .At 7 wk of age the normally domed tibial epiphysis was flattened and depressed in the knees of mutant animals, markedly reducing the distance between the growth plate and articular surface F and 7I.floxPGdf5-Cre/Bmpr1a mutant animals showed a highly significantly reduced ability to grasp and remain suspended on a slender rod . Mutant mice also showed a clear decrease in the maximum range of mobility of two different joints in the digits, as assayed by passive manipulation . The structural, histological, marker gene expression, and functional changes in mutant mice demonstrate that BMPR1A is required for normal postnatal maintenance of articular cartilage.The histological signs of joint arthritis were accompanied by functional impairments in both grasping ability and range of motion in mutant animals. Gdf5-Cre recombination system bypasses the early embryonic lethality of Bmpr1a mutations, and provides important new information about the role of this receptor in limb and skeletal development.Previous studies suggest that BMP signaling is involved in a large number of developmental events. Many of these events occur early in embryogenesis, and complete inactivation of BMP receptors causes death by E9.5 . The GdfBmpr1a with Gdf5-driven Cre include webbing between digits, lack of joint formation at specific locations in the ankle, and failure to maintain articular cartilage after birth, resulting in severe arthritis. Previous studies have shown that manipulation of BMP signaling alters interdigital apoptosis during development of the limb, but no experiment has identified a specific member of the BMP signaling pathway that is required for this process and the R26R LACZ marker (expressed following Gdf5-Cre recombination) suggests that recombination-stimulated changes in gene expression may be delayed for a 0.5–1 d in the digit region type II receptor also disrupts normal articular cartilage maintenance followed by IRES-hPLAP directly behind the ATG start site of Gdf5. In the process, 583 bp of the first exon of Gdf5 was removed and no functional GDF5 protein is predicted to be produced. The 5′ homology arm was subcloned from a PCR product tailed with XhoI and Bsp120I restriction sites that contains 781 bp of 5′ genomic Gdf5 sequence ending at the ATG translation start site . Cre was subcloned from a 1.1-kb Bsp120I/EcoRI fragment of pML78. IRES hPLAP was subcloned from a 2.1-kb PCR product tailed with EcoRI and SpeI sites that contains the hPLAP translation stop site . The 3′ homology arm was subcloned from a 0.8-kb PCR product amplified from a 0.9-kb XhoI Gdf5 genomic subclone containing part of the first exon and downstream intron. The forward primer contains the 3′ end of the first exon and is tailed with a SpeI site; the reverse primer is from the T7 promoter of the vector containing the 0.9-kb subclone and flanks the intronic XhoI site . The targeting construct was built and verified in pBSSK , then digested with XhoI and subcloned into pSV1, the vector used for homologous recombination (A mouse 129x1/SvJ BAC library (Invitrogen) was screened to identify a 140-kb BAC from the E. coli to placebination . SoutherloxP site present in the BAC vector, pBeloBAC11, was removed to prevent the addition of undesired Cre target sites into the genome. To do this, BAC DNA was prepared by CsCl separation, digested with NotI to free the insert from the vector, and size-fractionated over a sucrose gradient. Aliquots of fractions were run on a pulse-field gel and Southern blotted using vector-specific DNA as a probe. Fractions containing unsheared insert and almost no detectable vector DNA were dialyzed in microinjection buffer (10 mM Tris [pH 7.4] with 0.15 mM EDTA [pH 8.0]) using Centriprep-30 concentrators . This purified insert DNA was adjusted to 1 ng/μl and injected into the pronucleus of fertilized eggs from FVB/N mice by the Stanford Transgenic Facility. Transgenic founder mice were identified by PCR using Cre-specific primers 5′-GCCTGCATTACCGGTCGATGCAACGA-3′ and 5′-GTGGCAGATGGCGCGGCAACACCATT-3′, which amplify a 725-bp product, and were assessed for absence of BAC vector using vector-specific primers 5′-CGGAGTCTGATGCGGTTGCGATG-3′ and 5′-AGTGCTGTTCCCTGGTGCTTCCTC-3′, which amplify a 465-bp product. Three lines of Gdf5-Cre mice were established and maintained on the FVB background. Matings with R26R Cre-inducible LACZ reporter mice . Cryosections of tissue were assayed by TUNEL using the In Situ Cell Death Detection Kit, Fluorescein . Following TUNEL, slides were washed in PBS, blocked with PBS + 0.05% Tween-20 + 5% goat serum, washed again, and incubated with a 1:200 dilution of a rabbit anti-phospho-histone-H3 antibody called Mitosis Marker to identify cells in mitosis. Cy3-labeled anti-rabbit secondary antibody was used to detect the antibody. Cell nuclei were labeled with DAPI, and slides were mounted in Vectamount and visualized at 100× magnification. The area of selected anatomical sites were measured, and the number of TUNEL-labeled nuclear fragments and the number of Cy3-labeled nuclei were counted from three 10-μm sections spanning 50 μm, from three control and three mutant animals. The number of labeled cells in the metacarpal-phalangeal and metatarsal-phalangeal joints was counted in a 290 μm × 365 μm rectangle placed around the center of the joint. The posterior region of the fifth digit was defined by drawing a line from the tip of the digit down 2.15 mm and across to the lateral edge of the tissue. For this analysis, the Tissue from animals ranging from stages E14.5 to P14 was prepared for analysis by fixing in 4% paraformaldehyde (PFA) in PBS for 45 min to 4 h depending on the stage; washing three times in PBS, once in PBS + 15% sucrose for 1 h, and once in PBS + 30% sucrose for 2 h to overnight depending on the stage; and then freezing in OCT. Tissue from animals aged 7 wk to 9 mo was processed similarly to earlier stages except that it was decalcified in 0.5 M EDTA (pH 7.4) for 4 d prior to incubating in sucrose. All solutions were prechilled and used at 4 °C with agitation, and skin from tissues of P0 or older mice was lacerated or removed prior to processing.Tissue was then cryosectioned at 12 μm and processed. Staining of sections with Safranin O, Fast Green, and Harris' hematoxylin was carried out using standard histological procedures. Detection of LACZ activity with X-Gal was performed as described and was Bmpr1a .RNA in situ hybridization was performed as described , with thBmpr1a , Col2a1 in PBS (pH 5) at 37 °C for 30 min to 2 h depending on the stage. Slides were then washed in PBS, treated with 0.3% hydrogen peroxide in 100% methanol for 30 min, washed, blocked with PBS + 0.05% Tween20 + 5% goat or fetal bovine serum, washed again, and incubated with primary antibodies in PBS + 0.05% Tween 20 + 1% goat or fetal bovine serum overnight at 4 °C. Biotin-labeled secondary antibodies (Vector Labs) were tagged with HRP using the Vectastain Elite ABC kit (Vector Labs) followed by detection with DAB (Vector Labs). Primary antibodies and dilutions used were: goat anti-mouse MMP13, 1:100 ; rabbit anti-human SOX9, 1:500 ; rabbit http://www.ncbi.nih.gov/Genbank/) accession numbers for the genes discussed in this paper are Gdf5 (AC084323) and Bmpr1a (NM_009758).GenBank (

The HCMV amplicon vector replicated independently and was packaged into infectious virions in the presence of helper virus. This vector is capable of delivering and expressing foreign genes in infected cells including progenitor cells such as human CD34+ cells. Packaged defective viral genomes were passaged serially in fibroblasts and could be detected at passage 3; however, the copy number appeared to diminish upon serial passage. The HCMV amplicon offers an alternative vector strategy useful for gene(s) delivery to cells of the hematopoietic lineage.We have constructed and evaluated the utility of a helper-dependent virus vector system that is derived from Human Cytomegalovirus (HCMV). This vector is based on the herpes simplex virus (HSV) amplicon system and contains the HCMV orthologs of the two HCMV is a member of the betaherpesvirus family ,48. OtheSor OriL) and a DNA cleavage/packaging signal [cis-acting functions can be relatively small ranging from ca. 90–150 base pairs (bp) for the ori and ca. 250–300 bp for the a sequence. The functional HCMV oriLyt is much more complex than either of the HSV oris; the HCMV oriLyt consists of multiple direct and inverted repeats and extends over at least 1500 bp [a sequence varies in size from ca. 550 bp to 762 bp, however, the conserved pac-1 and pac-2 cis-elements which determine the sites for cleavage of replicated viral DNA are present [Defective HSV viruses created by high multiplicity serial passage of virus stocks have been described on numerous occasions and have been characterized in detail at the molecular level ,43,52,67g signal ,57,60-62 1500 bp ,37. HCMV 1500 bp . The HCM present ,58,64,65et al. 2003 [In contrast to HSV, HCMV does not efficiently produce defective virus genomes, this difference may be related to the distinct biology of the two viruses . Howeveral. 2003 , describHCMV infects cells of the hematopoietic lineage ,39,55,68varRIT , were propagated in human fibroblasts (HF) cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum . Recombinant HCMV, RC2.7EGFP, expressing enhanced green fluorescent protein (EGFP) , under the control of the major early 2.7 promoter, was constructed by cotransfection of plasmid pEAG2.7EGFP with a set of overlapping cosmid clones derived from HCMV Toledo .HCMV Toledo , and HCMV Townea sequence, was obtained from Ed Mocarski (Stanford University). pEAG2.7EGFP was derived by cloning the EGFP gene from plasmid pEGFP-N2 between the EagI and SmaI site of the β2.7 gene taken from Toledo . HCMV amplicon plasmid Tn9-8 was derived by inserting the 6 kpb DraI fragment of TownevarRIT , and cloned into the HCMV amplicon Tn9-8 at the PstI site in both orientations. The gpt gene in Tn9-8-gpt was derived by cloning a PCR fragment from Escherichia coli DH5α using the primer pairs 5'CTGCAGCTAGTCTAGACTGGGACACTTCACATGAGC3'and 5'CTGCAGCTATGTATCTAGAGCCAGGCGTTGAAAAGATTA3'.Plasmid pON205 , contains the Towne strain ) Figure , spannin et al., . The pla4 precipitation of approximately 4 μg of Tn9-8 amplicon DNA. The Tn9-8 DNA was transfected into approximately 1 × 106 passage 16 human fibroblast (HF) cells. At 24 hours post transfection, the cells were infected with CMV Towne at a multiplicity of infection (MOI) of 5 plaque forming units (PFU) per cell. Fresh medium was added to cells four days after infection and cells were harvested at 6 to 7 days post infection as described previously . Virus stocks are prepared by three freeze-thaw cycles. Serial passages of amplicon-containing viral stocks on fresh HF cells were superinfected with CMV Towne as a helper virus at a MOI of 1.Plasmid DNA was transfected by CaPOViral DNAs were digested with restriction enzyme, electrophoresed in 0.8% agarose gels, transferred to Hybond-N+ nylon membranes (Amersham Corp.), , and immobilized with a UV Crosslinker 1000 . DNA on the membrane was probed with fluorescein-labeled pUC9 DNA using conditions previously described .5 CD34+ cells were used for each infection with TN9-8GF5 amplicon containing stocks, RC2.7EGFP virus, CMV Towne virus, or uninfected cell control. The cells mixed with virus were centrifuged at 500 × g for 10 mins at room temperature and were then placed in 37°C water bath for one hour. Following this the cells were cultured in 6-well cell culture plates (Costar) for 18–72 hours. At the end of the incubation the cells were harvested for CD34 staining.The isolation of cord blood CD34+ stem cells was carried out by All Cells Inc. using CD34 Progenitor Cell Isolation Kit . The positive selection of the CD34+ cells was carried out using hapten-conjugated antibody to CD34+ followed by anti-hapten antibody coupled to MACS Microbeads. The magnetically labeled cells are enriched on positive selection columns in the magnetic field. The purity of the CD34+ population was >95% as analyzed by flow cytometry. The purified CD34+ cells were suspended in Iscove's modified Dulbecco's Minimal Essential Medium containing 5% fetal bovine serum. 2 × 10Amplicon containing viral stocks prepared from passage 1 were used to infect HF or human CD34+ cells maintained in 12 well culture plates. At 24 hour intervals post infection, the wells were observed for EGFP expression with a Nikon TE2000 microscope under UV illumination. Immunostaining for CD34+ cells was done using Phycoerythrin (PE)-conjugated anti-CD34 antibody . Infected or control cells were incubated with 20 μl of PE-labeled anti-CD34 antibody for 45 minutes at room temperature and subsequently were washed twice with PBS containing 0.1% BSA. The cells were directly analyzed for EGFP and CD34+ staining on a FACSCalibur instrument , at 18 and 36 hours post infection.a sequences was constructed. Theoretically, due to the large size of the HCMV genome, an amplicon derived from this virus should be able to carry the large DNA inserts and be capable of efficient introduction into hematopoietic cells by infection.In order to exploit the natural tropism of HCMV for cells of the hematopoietic lineage, in a nonlytic manner, an HCMV amplicon i.e. a plasmid containing the HCMV oriLyt and EcoRI E fragment of Towne that was not present in the Toledo strain [EcoRI E region spans in part the complex oriLyt region [BamHI sites in Figure During analysis of cosmid clones of HCMV strain Towne, sequence heterogeneity was observed in the o strain . The Ecot region ,2,24,37.t region . This secis-acting functions required for the propagation of the defective virus genomes in the presence of helper virus [EcoRI site of pON205. The resulting amplicon was designated Tn9-8 cells, and subsequently infected with HCMV Towne strain at an MOI of 5 to provide helper virus replication functions. Seven days later, infected cells were harvested, sonicated, and viral stocks were prepared for passage to fresh HF cells. Fresh HF cells were infected with the progeny of the transfection/infection and incubated for 7 days. The DNA from these infected cells was harvested (designated passage 1), restricted with blotted . Southera Figure , lane 2.r Figure . This regpt), were serially passaged in HF cells. Defective viruses could be detected at passage 3 when probed with plasmid pUC9; however, the copy number appeared to diminish upon serial passage (not shown). Selection with mycophenolic acid on Tn9-8-gpt amplicons did not enhance recovery.Packaged defective viral genomes derived from Tn9-8 or a derivative containing a selectable marker (Tn9-8-gpt), digested with Pst I and Hind III, respectively, in order to analyze monomeric repeat units. The Hind III-digested DNA was circularized by ligation and used to transform E. coli bacteria to analyze structure and to demonstrate shuttle vector capability between eucaryotic and bacterial hosts. A number of plasmids prepared from the rescue attempt had a restriction enzyme pattern indistinguishable from the input . Digestion with NaeI produced a fragment of the predicted size of a unit length a sequence (762 bp), and this product hybridized with an a sequence specific probe (PstI-SgrAI fragment from Tn9-8), promoter was used as test reporter gene. Two resulting amplicon plasmids designated Tn9-8GF5 and Tn9-8GF7 both expressed EGFP following transfection of HF cells in the absence of helper virus, as expected (not shown). Packaged amplicons were generated by introduction of Tn9-8GF5 into cells and infecting with HCMV 24 hours later at an MOI of 5. Transfection-derived viral stocks were passaged onto fresh HF cells supplemented with Towne helper virus at an MOI of 1. Viral stocks prepared from passage 1 were used to infect HF cells and grown on 12-well tissue culture plates. A limited number (ca. 0. 1%) of brightly fluorescing cells could be seen by microscopic examination at 24, 72 and 96 hours post-infection promoter prepared from passage 0 and passage 1 were used to infect CD34+ cells derived from cord blood. Starting at 24 h after infection, CD34+ cells were examined for EGFP expression by fluorescent microscopy. EGFP expression was observed in TN9-8GF5 amplicon-infected CD34+ cells starting at 24 h post-infection. The cells remained positive for EGFP expression for more than 96 hrs, at which point the cells were terminated population infected with either TN9-8GF5 amplicon containing viral stocks or with the CMV-EGFP virus, RC2.7EGFP (3.6%) Figure , &7b or ) Figure &7c. The) Figure , and 7e.We have shown that a replication-defective virus vector system that is derived from HCMV is capable of delivering and expressing foreign genes in infected primary cells including progenitor stem cells such as human CD34+ cells. Further improvement and optimization of the system offers the potential to deliver gene-based therapies to multipotent cells.Foremost among the advantages of the vector system we have described is the potential ability to efficiently infect and deliver genetic information to hematopoietic stem cells CD34+) and other dividing and non-dividing cell types which may support HCMV infection + and oth,39,55,68in vivo and in vitro [ex vivo culture conditions, which preserve the developmental properties of the stem cells [in vitro with HCMV [in vitro culture of cord blood derived CD34+ cells. In a separate study, cord blood derived CD34+ cells cultured with IL-3 in vitro showed a progressive decline of the CD34+ population and more differentiated cells originating in the CD34(-) population [in vitro culture has been observed. EGFP expression was also seen in the CD34(-) population (Fig The infectivity of CD34+ cells from seropositive and seronegative subjects with HCMV has been tested both in vitro . Furtherin vitro . The HCMin vitro . The appem cells ,22. Umbiem cells . In our ith HCMV , reportepulation . In our tion Fig , &7c. Itcis-acting ori and packaging sequences, and have no structural gene sequences. However, amplicon containing viral stocks are a mixture with HCMV replication competent helper virus. HCMV induced cell-differentiating effect, if any, might be minimized using a helper virus-free amplicon system. In this regard, it should be possible to test a number of strategies to prepare helper virus-free stocks [Further studies of HCMV infection in CD34 cells will help in defining whether CD34+ infected cells undergo cell differentiation by increased expression of other markers such as CD33, CD38, HLA-DR or cytokines. It is also relevant to note here that HCMV virus carries homolog sequences for HLA-related and cytokine-related molecules and infection can induce cellular cytokines ,46,50,66e stocks ,63. ThesThe authors of this publication are supported financially by salary and shares of MedImmune Inc., during the completion of this work. A patent application has been filed with the United States Patent Office relating to the content of this manuscript. The authors have assigned all rights of ownership to MedImmune Inc. The authors declare that they have no other competing interest.a' sequence analysis. GWK provided critical intellectual input. RRS provided the original idea and experimental design as well as cloning of the amplicon, generation of amplicon stocks and Southern analysis.KM carried out the expression analysis in human fibroblasts and CD34 cells. MNP & GMD generated amplicon stocks and MNP did the '