Datasets:

ewhfef

/

mix_cpt

like 1

the world health organization ( who ) has had control of the international spread of infectious diseases as one of its core functions since the first world health assembly ( wha ) in 1948 . the priorities over the ensuing decades have changed , as new diseases have emerged and others have been controlled , and even eradicated as in the case of smallpox . a fundamental , core responsibility of who to provide disease alert and response assistance to countries , and for the global community , has never wavered . who has always depended on its network of collaborating centres and disease experts to assist in responding to outbreaks of specific diseases or unusual events , as well as working actively with member states and donors to provide support whenever and wherever required . at the turn of the century , who 's role and support newly emerging diseases and resurging epidemic - prone diseases continually threaten the health and the economic well - being of the international community . in addition , greater awareness and concern about infectious disease outbreaks and their impacts on health and other sectors were happening against the backdrop of an information revolution , which allowed unprecedented broad access to information that was sometimes unverified and sometimes inaccurate . who recognised that alert and response activities could be better organised and more effectively coordinated . framework for global outbreak alert and response was developed by the department of communicable diseases surveillance and response , and regional offices . this framework introduced inter alia the concept of a global network of technical institutions and networks , coordinated by who , to better focus global resources and relevant expertise to respond to outbreaks which threaten to overwhelm the national capacity of countries , or to contain novel , emergent diseases about which little or nothing is known ( who , 2000a ) . the concepts put forward in this framework document formed the basis for further discussion at a meeting convened by who in geneva in april 2000 . the meeting brought together 121 representatives from 67 partner institutions to address the challenges of disease outbreaks at the start of the twenty - first century and specifically the need for a coordinated approach to address these threats . it was recognised that no single organisation or institution had all the capacity to meet these challenges effectively . not only were outbreaks too numerous and geographically distributed , but also only an effective technical partnership of national and international institutions and networks could operate effectively in the complex political , economic and environmental circumstances that are often significant factors in disease outbreaks . the meeting participants agreed that a new approach was necessary to meet these challenges and that the solution was a global network of partners able to bring the resources of many organisations to bear on the problem . the participants agreed to establish the global outbreak alert and response network ( goarn ) as a network of technical partners and other networks with the capacity and expertise to contribute to an international , coordinated response to outbreaks of epidemic - prone and novel infectious diseases ( who , 2000b ) . goarn would complement the existing outbreak alert and early warning systems , who collaborating centres , disease - specific surveillance networks and coordination mechanisms , national and international surveillance , and laboratory networks for emerging and re - emerging infectious diseases , related training initiatives and programmes and strengthen existing coordination of international response , particularly for outbreak alert and response in emergencies ( heymann , rodier , & the who operational support team to the goarn , 2001 ) . the partner institutions agreed to work together to ensure that appropriate technical assistance would rapidly reach affected countries and populations and would lead to reduced morbidity and mortality and prevent further disease spread . goarn 's functions would be to work as a network of networks to combat the international spread of outbreaks by supporting who 's activities in rapid identification , verification and communication of threats and by ensuring a coordinated mechanism for outbreak alert and response . partners recognised the opportunity presented by improved international support for outbreak response to contribute also to long - term outbreak preparedness and response capacity at all levels . it was also agreed that the structure of the network would be supported by a steering committee consisting of about 20 representatives of network partners , and an operational support team based in who ( who , 2000b ) . participants at the meeting agreed on a series of guiding principles and core functions for the proposed network . the meeting discussed the next steps in setting up the network and agreed that a small interim committee would work together with who in identifying and implementing initial activities . these activities included finalisation of the framework document for a goarn , establishment of a code of practice for network operations , for field operations and for conflict resolution , and agreeing on the guiding principles for international outbreak alert and response ( who , 2000c ) . in addition , and in collaboration with who , a number of essential components were developed to support deploying people in the field and improving coordination , including linkages to the who event management system for epidemics , development of field logistics capability , including field kits and tools , and a mobile communications system the latter an important component to ensure the safety and security of personnel in the field . in may 2001 , the wha adopted a resolution and report on global health security : epidemic alert and response that recognised who 's leadership and efforts in creating goarn as a cost - effective , coordinating mechanism for epidemic alert and response and as a partnership to ensure that the best expertise is harnessed wherever and whenever it is needed . in addition , it recognised that acute responses may lead to longer - term technical assistance and preparedness for outbreaks ( who , 2001 ) . in its original conception , goarn is a network of technical partners and other surveillance networks which would be coordinated and supported by who , and with a steering committee reflecting the make - up of technical institutions and disciplines needed for comprehensive outbreak response . thus the participating technical institutions and networks comprise the membership of goarn , not individuals . the original concept of goarn was that it was to be a partnership of major technical institutes with who . it was also agreed that who would provide the secretariat to support the steering committee and provide operational support to develop the network , and in collaboration with staff in relevant who departments , programmes and offices , to provide communications support and advocacy for the network , and to coordinate and support field missions and response activities . in addition , who would mobilise and provide much of the financial support for goarn . these activities place who at the centre of the core functioning of the network , and thus questions could be raised about the relative independence of the network , and specifically whether who 's role is as one of the partners in the network , or whether goarn should be considered as a more formal initiative of who . the majority of partners , when approached during an external review of goarn , believed that the balance between integration into who 's operations and network independence was about right , and most recognised who as the dominant partner . goarn is thus recognised by who as the body able to provide the broad technical expertise necessary to enable it to assist member states with outbreak response , and more recently , as the operational arm of the new international health regulations ( ihr ; 2005 ) . these issues have been discussed elsewhere by ansell , sondorp , and stevens ( 2012 ) . the initial interim committee was established to develop and propose governance mechanisms , rules and procedures to reflect the make - up and guiding principles of the network . since then , the steering committee has provided direction to the network through monitoring the implementation of the network 's work plan , setting up technical working groups , and approving new member institutions in the network . in early meetings , the steering committee monitored the operation and outcomes of field missions and used these reviews to provide important suggestions for future deployments . as the number of missions increased , and financial pressures made it difficult to maintain the frequency of meetings , the steering committee has focused primarily on providing advice on the development of the network . over the past 13 years , the number of technical partners and participating networks has grown substantially and now numbers 153 institutions and 37 additional networks ( figure 1 ) , the latter encompassing a further 355 members , which together provide a wide geographic reach and broad representation of technical skills and disciplines . partners include government agencies , universities , research institutes , training programmes and networks , non - governmental organisations ( ngos ) , international organisations and a range of related specialist networks , especially those concerned with laboratory investigations , infection prevention and control , clinical management , and who networks managing chemical , environmental and food safety events . the figures in boxes provide the number of partners and network hubs in each who region ( amro = regional office of the americas ; afro = african regional office ; euro = european regional office ; emro = eastern mediterranean regional office ; searo = south - east asian regional office ; wpro = western pacific regional office ) . as goarn established a reputation for competency in major outbreak responses through the provision of technical , multi - disciplinary expertise and grew in recognition ( lazcano - ponce , allen , & gonzlez , 2005 ) , it became increasingly important to ensure access to additional capacity in specific areas of expertise and to individuals with the requisite language skills and to incorporate a wider geographic representation of partners . there has therefore also been a concerted effort over recent years to ensure that the network 's composition is as broad as possible , through engaging technical partners in more countries and regions . this is both consistent with the principle of bringing the most proximate resources to bear as rapidly as possible and leveraging network activities to develop as well as employ partner institutional capacity . while this has been generally successful , there are still gaps that need to be filled over coming years . there has been a continual emergence and resurgence of epidemic - prone infectious diseases and of novel , previously unrecognised emerging diseases that threaten global health and economic stability , many of which have resulted in goarn missions to affected member states and regions ( breiman et al . , 2003 ; formenty et al . , 2005 ; mackenzie , 2011 ; mackenzie et al . , 2004 ) . since 2000 , who has supported and coordinated the network activities to provide an operational framework for goarn partners to respond to major outbreaks of cholera , dengue , encephalitis , influenza , meningitis , nipah , plague , severe acute respiratory syndrome ( sars ) , viral haemorrhagic fevers ( vhf ) , yellow fever and other emerging and epidemic - prone pathogens . partners have also provided experts for deployment to assist in addressing infectious disease impacts of major humanitarian crises , including natural disasters . overall , goarn partners have been deployed on 137 missions , comprising 1471 deployments and 31,629 person days ( table 1 ) in 79 countries , territories or areas ( table 2 ) . in keeping with the guiding principles agreed by partners , all missions have been to support national health authorities and were initiated at the invitation or request of the affected who member state(s ) . however , these missions have also influenced the development of local , national and international capacities and supported more long - term initiatives and relationships . alerts , requests for assistance , operational updates , offers of technical support and details of deployments ( in clinical management , epidemiology , infection control , laboratory support , social mobilisation , risk communications and logistics ) are posted on the goarn sharepoint website , which also provides a mechanism to assist in communications between the operational support team and goarn partners . partner institutions able to respond to requests for assistance nominate expert staff members for deployment , based on a number of factors including expertise in the areas specified by the health authorities in the affected country and appropriate language skills . in most instances terms of reference for field missions and individual deployments are negotiated and agreed in advance with the responsible health authorities in affected countries and the framework . the number of deployments of who and non - who personnel and their fields of expertise are shown in figure 2 . in the first years of goarn operation , field missions were largely in response to outbreaks of disease in single countries , particularly outbreaks of vhf in african countries . these missions sometimes required significant numbers of deployments before the outbreak ended , as occurred during the 2000 outbreak of ebola in gulu , uganda ( lamunu et al . other outbreaks focused on unusual manifestations , such as the high death rate from an outbreak of influenza in madagascar ( who - goarn investigation team , 2002 ) . the first major test of the resilience of the network came in 2003 with the multi - country response to the emergence of sars , the first global threat by a novel agent in the new millennium . goarn played a significant role in the rapid deployment of international teams for missions to china , hong kong sar , vietnam and singapore , as well as supporting the participation of a large number of experts from partner institutions in virtual networks which were rapidly established to investigate the novel , previously unknown infectious agent as well as its epidemiology , infection control and clinical course of disease . the role of who and the contribution of goarn partners has been discussed in detail elsewhere ( heymann , 2004 ; mackenzie et al . , 2004 ; who , 2006 ) . the sars global response provided important lessons for the teams at who regional offices , particularly the regional office for the western pacific ( wpro ) , and at who headquarters , as well as goarn partners . sars highlighted the technical and operational challenges of identifying and deploying international teams to respond simultaneously to requests for assistance from multiple countries . the contribution of goarn partners to controlling sars was recognised by the wha , which urged the member states to continue to collaborate with and , when appropriate , provide assistance to who 's goarn as the operational arm of the global response , and requested the director general to strengthen the functions of who 's global outbreak alert and response network ( who , 2003 ) . additional multi - country and/or prolonged responses have occurred in the past few years , including for highly pathogenic avian influenza ( h5n1 ) ( dinh et al . , 2006 ; who , 2007 ) , for pandemic h1n1 influenza and for cholera outbreaks in zimbabwe ( who , 2009 ) and haiti ( who , 2010 ) . goarn partners also provided assistance to health authorities in indonesia and sri lanka following the asian tsunami . in indonesia , this assistance was provided to support the aceh provincial health office to develop a surveillance / early warning and response network system for the detection of epidemic - prone diseases ; to investigate outbreaks , with confirmation of potential pathogen , mode of transmission and individuals at risk , and appropriate control measures ; and to prepare for outbreak management and control ( ministry of health , indonesia , who assisted by goarn partners , unicef , 2005 ) . increasingly , who regional offices play a critical role in the coordination and deployment of goarn teams , in close collaboration with the operational support team at who headquarters . important disease outbreaks , including leptospirosis in the philippines , cholera in papua new guinea , viral haemorrhagic fevers ( vhf ) outbreaks in african countries and outbreaks of h1n1 in mexico and central and south america have been important catalysts for this change . one important outcome from goarn deployments has been the successful development of field laboratories for haemorrhagic fever outbreaks . the use of a field laboratory to provide rapid diagnosis was first successfully employed by the centers for disease control and prevention ( cdc ) during the ebola outbreak in gulu , uganda , in 20002001 , using antigen capture and reverse transcription - polymerase chain reaction ( rt - pcr ) to diagnose infection in suspect patients and based in one of the two major hospitals in gulu ( centres for disease control and prevention [ cdc ] , 2001 ; okware et al . , 2002 the same laboratory also assisted in the rapid diagnosis of patients in a secondary outbreak in masindi , 170 km south of gulu ( borchert et al . , 2011 ) . the success of the laboratory in gulu prompted further developments in truly mobile laboratories for the diagnosis of haemorrhagic fever cases and to assist epidemiological surveillance , and two novel mobile laboratories were subsequently employed successfully during the marburg virus outbreak in angola in 2005 , with one laboratory in uige , the epicentre of the outbreak , operated by the public health agency of canada ( grolla et al . , 2011 ) using quantitative real - time pcr , and a second laboratory operated by cdc in the capital , luanda , using a new , safe , rapid and reliable high - throughput protocol for rna extraction and quantitative rt - pcr analysis ( towner , sealy , ksiazek , & nichol , 2007 ) . there was a high concordance in test results between the two laboratories , strongly suggesting that field capacity should be enhanced and expanded and be an essential component in future outbreak investigations . a large , shipping container - sized mobile laboratory was developed by members of the universiti malaysia sarawak and successfully deployed to meulaboh , aceh province , during the tsunami relief activities . among the early initiatives of the steering committee was the recognition that while the network 's partners represented a large body of expertise in epidemiology , microbiology or clinical management , there was relatively limited expertise in team leadership and overall coordination of response . to address this gap , the goarn partners and who developed training courses in international outbreak response leadership . subsequently , who regional offices and headquarters provided further training courses , primarily to develop regional capacity for international response . a faculty drawn from goarn partners and from across who has developed and adapted training material , and provided training on field team leadership , management of complex international outbreak response , disease - specific scenarios and rapid containment operations . in the western pacific region , goarn partners and who have collaborated in innovative training approaches and pilot courses . these activities have supported the development of a goarn training faculty and provided a cadre of trained experts in different technical areas of outbreak response . this resource represents an important asset on which to build future response capacity and improve performance in the field . the revised ihr ( 2005 ; who , 2008 ) came into force in mid-2007 and have a number of implications for goarn operations and activities . the purpose and scope of the ihr 2005 are to prevent , protect against , control and provide a public health response to the international spread of disease in ways that are commensurate with and restricted to public health risks , and which avoid unnecessary interference with international traffic and trade ( art . the revised regulations require the states parties to develop specific minimum core public health capacities for surveillance and response , and specifically with regard to surveillance , reporting , notification , verification , response and collaboration activities ( ihr annex 1 ) . the ihr also reaffirmed the central role of who in assisting countries in controlling the international spread of infectious diseases , stating that who shall , at the request of a state party , provide technical guidance and assistance including the mobilisation of international teams of experts for on - site assistance ( art . 13.3 , ihr 2005 ) , and the offer to mobilise international assistance in order to support the national authorities in conducting and coordinating on - site assessments ( art . 13.4 , ihr 2005 ) , both of which would be largely undertaken through goarn . for goarn partners , the revised ihr have resulted in a significant change with respect to the increased sensitivity about rapid information sharing on acute public health events . confidentiality requirements implicit in the revised ihr led to the discontinuation of the who outbreak verification list ( ovl ) . prior to the ihr ( 2005 ) , the ovl was published weekly as a source of information on disease outbreaks provided by who . the ovl was disseminated to subscribers , including who staff worldwide , un agencies , national health authorities , who collaborating centres , field epidemiology programmes and ngos , many of which were also goarn partners at the time ( grein et al . , 2000 ) . to reinforce information flows among goarn and to ensure the network 's capacity to respond rapidly to requests for assistance , the operational support team developed a sharepoint website to provide partners with alerts and details of requests for assistance , together with information on mission planning and deployments , and to support coordination and information sharing on the involvement of partners in ongoing outbreak response . goarn partners do not have privileged access to confidential information that who shared with national focal points for the ihr ( 2005 ) . the sharepoint site is also used to share relevant information on goarn activities not related to specific events , such as meetings of the steering committee and its working groups . as countries make progress towards attaining core national capacities in detection , verification and surveillance , there is an expectation that this increasing self - sufficiency to respond to disease outbreaks and public health events ( art.13.1 , ihr 2005 ) will impact the type and nature of future requests for international assistance to who , the nature of international collaboration to address emerging disease threats and the support of goarn partners . in may 2012 , the wha discussed progress on implementation of the ihr 2005 . in light of the gaps which remain in core capacities and the continuing concern about epidemic and pandemic prone diseases and public health events of international concern , the member states and who renewed their commitment to the full implementation of the regulations . the performance of goarn has recently been subject to an external independent review and evaluation commissioned by the steering committee ( sondorp , ansell , stevens , & denton , 2011 ) . it concluded that over its initial 9 years , goarn had proved to be a capable and effective mechanism for multilateral responses to disease outbreaks through improving field coordination and by rapidly deploying experts when and where needed . in addition , the report of the review committee on the functioning of the ihr ( 2005 ) in relation to influenza a ( h1n1 ) pandemic ( who , 2011 ) also concluded that network partners play a vital role in enabling who to fulfil its international alert and response responsibilities . the findings of these two review processes and their recommendations have been supportive of goarn 's core activities with respect to outbreak responses and in humanitarian crises where there was a potential for outbreaks of disease . they also recognise that the network provides important capacity to address aspects of ihr ( 2005 ) implementation . they clearly demonstrate that goarn has been a major asset to who , and the partners have supported who in fulfilling its role of assisting the member states in containing and controlling epidemic - prone and emerging diseases , as well as providing a response mechanism to assist in other public health emergencies . these reviews have suggested that the goarn partnership consider developing new directions and strategies that leverage the assets of partner institutions to ensure the network remains relevant and effective . the core activities concerned with outbreak response will continue , with support for increased regional response activities coordinated by who regional offices and with a greater use of regional partners in deployments . to support this , further partner institutions will be sought to expand the broad geographic range . in addition , partner institutions will be encouraged to assist the member states in capacity - building in order to fully develop core capacities required for compliance in the revised ihr . the breadth of expertise will be expanded to incorporate the capacity to respond to chemical events or toxic additions to food or accidental release into the environment .

osteoporosis is a common metabolic bone disease with spectrum ranging from asymptomatic bone loss to disabling hip fracture . several studies have reported relationships between medication persistence and reduced fracture risk.[2 - 4 ] highly persistent patients showed significant reduction of relative risk for all fractures , while poor compliers had higher and increased risk of fractures . currently , bisphosphonate therapy raises issues about adverse events with many years of taking bisphosphonates - osteonecrosis of the jaw ( onj ) , severely suppressed bone turnover , atrial fibrillation , subtrochanteric fracture , and esophageal cancer.[5 - 9 ] to avoid such adverse events of long - term treatment , stopping the medication after 5 years of usage and using anabolic agents & other schedule and doses of bisphosphonate were suggested . additionally drug holiday ( dh ) was also suggested since 1 year of dh was not associated with increase in vertebral and hip fractures and even with one year after discontinuation of bisphosphonate treatment , spine and femoral neck bone mineral density ( bmd ) remained higher that placebo group . the purpose of this study is to observe the effects of a ' dh ' on bmd and bone turnover marker during bisphosphonate therapy in korean women with osteoporosis . the study was designed based on retrospective chart review and the study population consisted of 125 women aged 67.0 years old ( 50 - 81 years old ) with osteoporosis ( t - score-3.0 ; lumbar spine or femur of dual energy x - ray absorptiometry [ dxa ] ) who initiated bisphosphonate between 1999 and 2004 . the percentage of coefficient of variation ( cv ) of dxa ( hologic discovery ; hologic , inc . , bedford , ma , usa ) were 0.022% at l1 - 4 , 0.046% at femoral neck , and 0.038% at total femur . if the patients had taken bisphosphonate more than 5 years , 1 year of " dh " was started in 2006 . during the dh , bisphosphonate and calcium were at almost switched to alfacalcidol ( 0.5 g ) or calcitriol ( 0.25 g ) , and calcium ( 158 - 600 mg ) at almost patients . we prescribed one of three treatment regimens ( daily , weekly , monthly ) and divided these patients into alendronate ( n=59 ) , risedronate ( n=58 ) , and ibandronate group ( n=8 ) . and also lumbar and left femoral neck and total bmd , serum parameter ( -crosslaps [ ctx ; roche diagnostics , mannheim , germany , reference range 0.13 - 0.58 ng / ml ] , albumin , phosphorus , total calcium , and total alkaline phosphatase ) , and urinary parameters ( fasting urine calcium , phosphorus , and creatinine ) were measured 1 year before and after the dh . non - parametric and paired t - test ( wilcoxon signed ranks test ) were used for comparing the parameters before and after the dug holiday using spss software version 20 ( spss inc . , chichago , il , usa ) . although the study was designed based on retrospective chart review , the study was started after the approval of institutional review board ( irb ) . mean age was 67.06.7 years , with mean bmi 23.12.9 kg / m , and the duration of bisphosphonate therapy was average 6.11.3 years . we compared the bmd at 1 year before starting dh , on the starting year , and 1 year after the dh for 125 patients who had taken bisphosphonate more than 5 years . changes of lumbar ( l1 - 4 ) bmd between the time of starting and 1 year after the dh was insignificant ( 0.7570.0930.7470.102 g / cm , p=0.135 ) . changes of femoral neck and total bmd were not significant ( 0.5670.079 0.5600.082 , p=0.351 , 0.6980.0080.6910.090 g / cm , p=0.115 respectively ( fig . 1 , table 2 ) . after one year of dh , serum ctx and total alkaline phosphatase were increased significantly ( 0.210.120.790.44 ng / ml , p<0.001 , 54.513.460.415.5 iu / l , p=0.001 respectively ) . serum phosphorus was increased insignificantly ( 3.60.44.00.4 mg / dl , p=0.258 ) . corrected serum calcium was decreased significantly ( 9.00.48.90.8 mg / dl , p=0.02 ) ( table 2 ) . urinary calcium / creatinine ratio was increased significantly ( 0.1320.080.160.09 mg / mg , p=0.012 ) , but urinary phosphorus / creatinine ratio was insignificantly changed . mean age was 67.06.7 years , with mean bmi 23.12.9 kg / m , and the duration of bisphosphonate therapy was average 6.11.3 years . we compared the bmd at 1 year before starting dh , on the starting year , and 1 year after the dh for 125 patients who had taken bisphosphonate more than 5 years . changes of lumbar ( l1 - 4 ) bmd between the time of starting and 1 year after the dh was insignificant ( 0.7570.0930.7470.102 g / cm , p=0.135 ) . changes of femoral neck and total bmd were not significant ( 0.5670.079 0.5600.082 , p=0.351 , 0.6980.0080.6910.090 g / cm , p=0.115 respectively ( fig . 1 , table 2 ) . after one year of dh , serum ctx and total alkaline phosphatase were increased significantly ( 0.210.120.790.44 ng / ml , p<0.001 , 54.513.460.415.5 iu / l , p=0.001 respectively ) . serum phosphorus was increased insignificantly ( 3.60.44.00.4 mg / dl , p=0.258 ) . corrected serum calcium was decreased significantly ( 9.00.48.90.8 mg / dl , p=0.02 ) ( table 2 ) . urinary calcium / creatinine ratio was increased significantly ( 0.1320.080.160.09 mg / mg , p=0.012 ) , but urinary phosphorus / creatinine ratio was insignificantly changed . osteoporosis is a common metabolic bone disease and an important cause of fracture in postmenopausal women . to achieve the maximum effects from bisphosphonate treatment although long - term treatment with bisphosphonate has benefits on fracture reduction undoubtedly , there are some issues with respect to long - term safety . since alendronate has received u.s . food and drug administration ( fda ) approval for the treatment of osteoporosis in 1995 , oral alendronate ( daily and weekly formulation in 1998 , 2001 respectively ) has begun to be used in korea . also risedronate , ibandronate and zoledronic acid have been approved and currently used thereafter . since onj , a traumatic fractures due to severe suppressed bone turnover ( ssbt ) , atrial fibrillation , subtrochanteric fracture , and esophageal cancer , were reported after the introduction of bisphosphonate for the treatment of osteoporosis , long - term safety of bisphosphonate use has been issued . with respect to long - term safety , previous reports were not problematic except 2 rare conditions , onj and atypical fractures . because bisphosphonate are tightly bound to bone after absorption and gradually released over months or years after treatment is stopped , which raises issues about both the possibility of stopping therapy and adverse events with long - term use , a dh was suggested concerning above possibilities . a dh does not mean stopping the medication , but is a period between stop and restart of bisphophonate therapy . during dh , we switched from bisphosphonate and calcium to alfacalcidol ( 0.5 g ) or calcitriol ( 0.25 g ) and calcium ( 158 - 600 mg ) because of approved drug for osteoporosis in korea . nevertheless , there is no strong evidence to provide guidance regarding how long to treat with bisphosphonate or how long the dh should continue . in this study , effects of 1 year of dh on bmd and bone turnover markers in postmenopausal osteoporosis using bisphosphonate for more than five years were observed . our study shows spine and hip bmd changed insignificantly after the dh , but serum ctx and total alkaline phosphatase were increased significantly . however , changes of bone turnover markers and bmd between 1 year before dh and the time of dh were observed not significantly . the results of insignificant changes of bmd and significant increase of serum ctx , total alkaline phosphatase , and urinary calcium / creatinine ratio after cessation of treatment suggest that the bmd is not influenced and increased bone remodeling recovers bone suppression after 1 year of dh . it is very hard to explain the decrease of urinary calcium / creatinine ratio at the time of starting dh compared with that of 1 year before dh , we could speculate that long - term use of bisphosphonate leading to bone suppression may cause reduction of calcium release from bone and decrease of urinary calcium excretion . in the subanalysis of alendronate , risedronate , and ibandronate group , there were no significant differences between three groups ( date not shown ) . . limitations of this study are ; 1 ) there are no data comparing between the patients with dh and without dh , 2 ) bone resorption marker after the dh could not be compared with basal level before initiating bisphosphonate therapy , because urinary deoxypyridinoline / creatinine was only available as a bone markers when initiate treatment . however , change of bone resorption marker after the dh could be observed using serum ctx . in this study , 1 year off the drug is expected to affect no change of bmd , increase bone turnover markers , and be considered to have a positive effect on bone metabolism at least recovering the suppression of bone turnover due to long - term use of bisphosphonate , 3 ) since number of subjects in this study were small , more subjects will be needed to clarify the effects of dh . since at least one year of dh did not influence lumbar and femoral bmd , but significantly increased bone turnover markers , one year of dh could be considered cautiously concerning the severe suppression of bone turnover with respect to long - term safety of bisphosphonate use . this study would suggest the possibility of the dh after long period of bisphosphonate treatment .

luteinizing thecoma with sclerosing peritonitis is a rare ovarian tumor , the etiology and pathogenesis is not clear till date . the entity was proposed in 1994 , and an association with anti - epileptic drugs was suggested . approximately 30 cases has been reported among which a few indian reports has been documented so far . luteinized thecoma of the ovary is microscopically characterized by a group of spindle to polygonal cells with clear , vacuolated , lipid - filled cytoplasm which is linked to tumor oestrogen activity . this neoplasm may be associated with multiple fibrotic nodular thickening of the peritoneum called sclerosing peritonitis . several treatment options like antiestrogens plus luteinizing - hormone - releasing hormone ( lhrh ) agonists , high dose steroids , conservative approaches have been tried . so far , the disease entity is labelled as benign albeit with life - threatening complications due to sclerosing peritonitis . we report a case with unilateral ovarian mass with extensive omental deposits , clinically interpreted as sarcoma which was came out to be luteinized thecoma with sclerosing peritonitis in histopathological studies . a 50-year - old post - menopausal woman , known diabetic and hypertensive , presented to us with huge abdominal swelling and pain . history of single episode of generalized tonic clonic seizure was found and prophylactic phenytoin was started . contrast enhanced computed tomographic ( cect ) scan revealed heterogeneously contrast enhancing mass of 17 12 5 cm arising possibly from ovary . guided fine - needle aspiration cytology ( fnac ) from the mass revealed spindle cell neoplasm without definite features of malignancy [ figure 1 ] . her serum levels of carcinoembryonic antigen ( cea ) and ca-125 were 1.1ng / ml and 27.6 u / ml , respectively . hematological and biochemical parameters were within normal limits except high fasting plasma glucose and elevated lactate dehydrogenase level . total abdominal hysterectomy along with bilateral salpingo - oophorectomy and resection of adherent bowel loop along with mesocolon and supracolic omentectomy was done . fnac smear shows spindle cell neoplasm ( mgg40 ) on gross examination , huge solitary mass measuring 20 19 12 cm with adherent colonic loop , mesocolon , uterus , and cervix was noted . opposite ovary was identified which was normal except one unilocular thin walled cyst , 1-cm diameter . external surface of the mass was nodular and cut surface of mass showed solid cerebriform yellowish areas with mucohemorrhagic and cystic zones [ figure 2 ] . supracolic omentectomy specimen showed numerous patchy whitish thickened areas without any definite nodule . cut surface of ovarian mass shows solid yellowish areas on microscopy , the tumor comprised of fascicles and sheets of plump spindle and oval cells that resembled the cells of theca interna . the cells had fusiform nuclei , fine chromatin , and clear vacuolated to pale eosinophilic cytoplasm . variable number of fibroblastic cells , hyalinized connective tissue plaques are interspersed among the tumor cells [ figure 3 ] . the tumor was completely separated from myometrium , and the adjacent gut wall by its capsule . omental sections showed proliferations of spindle cells along with few cells with clear cytoplasm in whirling fashion [ figure 4 ] . histomorphological diagnosis of thecoma with sclerosing peritonitis was made and immunohistochemistry ( ihc ) was advised . photomicrograph showing luteinized thecoma of the ovary ( h & e40 ) photomicrograph showing omental nodule with spindle cell proliferation and hyalinization on ihc , the cells were reactive for smooth muscle antigen ( sma ) [ figure 5 ] and cd99 [ figure 6 ] supporting sex cord stromal origin . however , cells were nonreactive for estrogen receptor , progesterone receptor , calretinin , cytokeratin . patient developed post - operative sepsis and enterocutaneous fistula and was managed with conservative treatment and was kept in follow - up . tumor cells showing immunoreactivity to sma ( 10 ) tumor cells show immunoreactivity to cd99 ( 10 ) thecomas are relatively rare neoplasms ( 4% of all ovarian neoplasms ) that belong to sex - cord stromal group of tumors . usually post - menopausal woman presents with unilateral large ovarian mass which has well - defined capsule , cut - surface having typical yellow bosselated appearance . luteinized thecomas are a special group which usually occur in younger woman are usually bilateral and often associated with a peculiar condition called sclerosing peritonitis . the process of peritonitis consists of fibroblastic and myofibroblastic cell proliferation separated by collagen and fibrin , mesothelial cell proliferation , and occasionally mononuclear inflammatory cells . some proposed fibrosing soluble cytokines secreted by tumor cells to be responsible for the peritoneal manifestations . the tumor cells are shown to have estrogenic activity and are responsible for menstrual irregularities and endometrial hyperplasia , even co - existing carcinomas in 1530% cases . the clinical presentation of thecoma varies according to the size of the mass , larger ones typically present with abdominal swelling , pain , and ascites . while smaller ones are brought to attention due to hormonal disturbances , those associated with sclerosing peritonitis microscopically , the lesion comprises of fascicles of spindle cells with centrally placed nuclei and a moderate amount of pale vacuolated cytoplasm . intervening tissue shows considerable collagen deposition and hyaline plaque formation which was particularly prominent in this case . a mitotically active variant has been discussed which are particularly common in sclerosing peritonitis but the clinical behavior does not seem to be affected by high mitotic count . immunohistochemical studies have shown the tumor cells to be reactive with calretinin , cd56 , ae1/3 , smooth muscle actin , and desmin , and variably with alpha - inhibin , epithelial membrane antigen , beta - catenin , cd34 , and transforming growth factor - beta , with focal nuclear positivity for estrogen and progesterone receptor . our study found the cells were immunoreactive for sma and cd 99 but nonreactive for estrogen receptor , progesterone receptor , calretinin , cytokeratin . differential diagnoses to be considered in this case were fibroma , sclerosing stromal tumor , stromal leydig cell tumor , and secondary deposits in peritoneum . currently , the concept is that the tumor is benign in behavior although complications due to sclerosing peritonitis bring down the quality of life . few studies advocated conservative approach and followed up the patient for as far as 7 years without any morbidity . current approach is preservation of fertility either with oocyte extraction and preservation or unilateral oophorectomy along with high dose steroid and hormone suppression . post - operative complications due to short bowel syndrome and sepsis are frequent and are managed conservatively . as far our knowledge , only a few cases of unilateral thecoma in post - menopausal woman in india presenting with sclerosing peritonitis has been reported .

central line placement is associated with risk of inadvertent puncture of the artery , pleura , and other nearby structures . these risks have been very much reduced with the use of point of care ultrasound . even though ultrasound can guide proper puncture of the vessel desired , it can not help in following or directing the course of the catheter after venepuncture . a 63-year - old woman , known case of chronic renal failure was admitted to the hospital for urgent dialysis . her serum creatinine was 1444 mol / l , and her blood urea nitrogen was 48.7 she had had dialysis catheter placed many times which she had pulled out during her bursts of aggressive behavior . this time she presented without a dialysis catheter . we decided to place a permacath in the operation theater . we chose the internal jugular as the vein of choice for the procedure . with the ultrasound her previous tunneled catheter which she had pulled out before was in the right internal jugular . it was presumed that either it was thrombosed or hidden in the fibrosis of the surrounding soft tissues . under sterile precautions , it was punctured under ultrasound guidance , and the guide wire was passed . there was a slight difficulty in passing the guide wire but after some manipulation it passed . ultrasound was used and guide wire was identified as a bright speck inside the internal jugular vein ( ijv ) in short axis . having clearly confirmed the guide wire presence in the ijv , we decided to proceed further . typical venous blood was observed exiting from the introducer and the permacath was passed as the introducer was peeled off . typical venous blood was aspirated from both permacath lumens and lumens were flushed and closed with heparin lock . a routine portable x - ray was ordered before shifting the patient to the dialysis unit . when we saw the x - ray , we were shocked to find the catheter entirely in the left side of the heart as though it had passed through the aorta [ figure 1 ] . we took the patient back to occupational therapy and connected a transducer to the catheter port which showed a venous waveform . anyhow it was decided to leave the catheter untouched at that time as the patient was unstable . we urgently placed a regular dialysis catheter in her right femoral vein , and she was sent for dialysis . after 3 days of dialysis , the patient became stable and computed tomography ( ct ) chest was done . the preliminary x - ray done during ct clarified the position of the catheter in the lateral edge of aortic knuckle [ figure 2 ] , which is the location of left superior intercostal vein . the reconstructed coronal and sagittal ct images [ figures 3 and 4 ] showed the catheter tending to go into the accessory hemiazygos vein which communicates with the left superior intercostal vein . the x - ray and ct films also showed large hemothorax on the left side which suggested that the veins were partially damaged by the large catheter . as the patient was very stable , we just removed the catheter and applied pressure dressing at the entry site . the hemothorax was kept under observation as the patient did not have any respiratory distress , and the relatives did not give consent for chest tube insertion . after another 3 days , once consent was obtained , we inserted an intercostal drainage ( icd ) tube on the left side and drained about 1500 ml of altered blood . permacath seen in the left side of the heart large pleural effusion on left side reconstructed coronal computed tomography showing permacath outside heart presumably in left superior intercostal vein sagittal reconstructed computed tomography showing permacath behind aorta one is the left superior intercostal vein . which communicates with accessory hemiazygos as in our case . misplaced central lines in all these locations have been reported and have not usually resulted in serious consequences except in the case of pericardiophrenic vein . misplacement of the large dialysis catheter in these locations has been reported and can have dangerous consequences like hemothorax , pneumothorax , hemopericardium , cardiac tamponade , etc . even though entry of the catheter into a planned vein can be ensured using ultrasound , its subsequent passage can not be controlled .

as malnutrition is often present in cachexia,1 nutritional intervention has been one of the widely accepted strategies recommended by guidelines.2 , 3 , 4 the role of nutritional support in patients with cancer and cachexia has been examined in detail by previous reviews.5 , 6 however , the findings suggest that nutritional interventions have limited effect on survival and that the influence on body weight is inconsistent , partially because it seems difficult to achieve highquality evidence from clinical trials . recruitment problems because of unwillingness or frailty of the patients in such a serious condition ( i.e. cachexia ) are major obstacles for an enrolment of patients , while a large number of participants are needed to achieve adequate power to analyse a widely heterogeneous population . there are several recent reviews of cachexia animal models.7 , 8 , 9 however , the number of reviews with a focus on nutrition is rather limited.7 in the present issue of this journal , giles et al . 10 successfully reviewed the role of the diet composition in experimental animal models of cancer cachexia . the authors have performed a literature review of scientific studies using animal models of cancer cachexia with dietary interventions . the first main result is that the majority of nutrient intervention studies were of n3 fatty acid , which was examined in 16 papers of 44 reviewed articles . the effects of n3 fatty acid , mainly eicosapentaenoic acid and docosahexaenoic acid , are also broadly studied in humans.11 in animal studies , the effect on protein catabolism12 and its antiinflammatory action13 are most pronounced benefits of n3 fatty acid . these actions are thought to be transmitted by attenuating nfb signalling , the ubiquitin proteasome pathway , and antagonizing superoxide dismutase.2 however , although many animal studies have been successful , there is not enough clinical evidence to support a benefit of n3 fatty acid substitution in patients with cachexia.6 , 11 fearon et al . enrolled a total of 200 patients with cancer cachexia and demonstrated that enrichment with n3 fatty acids did not provide an advantage in weight loss.14 jatoi et al . randomized 421 patients with cancerassociated wasting to an eicosapentaenoic acid , megestrol acetate , or both . survival was not different among arms , and they concluded that eicosapentaenoic acid supplement does not improve weight or appetite compared with megestrol acetate alone.15 in their review in the present issue,10 giles et al . pointed out that the effectiveness of n3 fatty acid for antineoplastic actions depended on the levels of polyunsaturated fatty acids in control diet . in addition , the results of studies on n3 fatty acid could be attributed to the polyunsaturated fatty acid deficiency inadvertently produced in control group , because n6 and n3 fatty acids are essential dietary nutrients . as n3 fatty acid has received a lot of attention in recent years because of its broadspectrum effect , these finding are important in view of designing clinical trials . the second important result from this review is that the majority of studies did not provide information about dietary design or did not standardize design , content , source , and overall composition . many studies even failed to report food intake , or total energy and protein content of the diet . the lack of detailed dietary information may prevent correct interpretation of outcomes . based on these results , the authors claimed that diet content and composition should be reported and food intake assessed during the experiments . in addition , they proposed a model to guide dietary design for researchers in preclinical studies . the second criteria is making proportions of macronutrients and microniutrients similar to human intakes ; carbohydrates should account for 4565% , fat 2035% , and protein 1035% of total energy . in the field of drug discovery , high attrition rate in translating the results of experimental studies to clinical trials is problematic.16 as the major cause of attrition are lack of efficacy and safety,16 both of which account for 30% of failures , this type of guidance given by giles et al . may be useful to predict the efficacy of new dietary intervention in the cachexia field . from a clinical point of view , the limited effectiveness of nutritional support in cachexia may partly be explained by the multifactorial nature of this condition.3 , 17 although malnutrition is often present in cachexia , cachexia is distinguished from malnutrition by definition.1 , 3 cachexia differs from malnutrition inasmuch as malnutrition can be reversed by adequate nutrition and/or by overcoming problems of absorption or utilization of nutrients , while cachexia can not be successfully treated by nutrition alone . multidisciplinary approaches including the assessment and intervention in feeding , appetite , swallowing , exercise,18 , 19 psychosocial,20 and psychological issue may be needed to improve nutrition of patients with cachexia . although some of these aspects can also be assessed in animal models,21 , 22 others may be difficult to be monitored or intervened in animal models and vice versa . for example , dwarkasing et al . demonstrated changes in orexigenic peptide ( neuropeptide y and agoutirelated protein ) , anorexigenic gene ( proopiomelanocortin and cholecystokinin ) , and serotonin / dopamine signalling in hypothalamus of cachectic mice,22 and peter et al . showed antianorexic effects of an antimelanocortin4 receptor in lipopolysaccharideinduced cachexia rats.21 needless to say , a psychosocial approach could not be recapitulated in animal models , but there has been a wealth of clinical studies addressing the potential of psychosocial effects.23 lastly , here we consider that there may be distinct mechanisms in cachexia associated with the underlying disease other than cancer such as heart failure , pulmonary disease , and kidney disease . regarding nutrition , heart failure is second most studied underlying disease of cachexia next to cancer.24 it would be most helpful to assess common endpoints and agree on standard operating procedures to increase the comparability of animal studies . this would be particularly helpful to interpret intervention efficacy in cachexia animal studies studying different underlying diseases . the authors have read and certified that they comply with the ethical guidelines for authorship and publishing in the journal of cachexia , sarcopenia , and muscle . m. konishi , j. ishida , s. von haehling , s. anker , and j. springer declare that they have no conflict of interest .

a 46-year - old female with a history of diabetes mellitus , morbid obesity , peripheral vascular disease , and dense peripheral neuropathy was initially treated in another facility ( private outpatient clinic ) for a calcaneal puncture wound with multiple incision and debridement procedures . the patient had a history of smoking for many years and also sustained a calcaneal osteomyelitis secondarily to the original infection with staphylococcus aureus and pseudomonas aeruginosa organisms ( fig . ( a ) preoperative picture of the left calcaneal osteomyelitis with the large wound at initial presentation . ( b ) preoperative angiography showing the popliteal artery occlusion . in our facility , the patient had immediate non - invasive vascular studies that were followed with a lower extremity angiography that showed a vascular occlusion of the popliteal artery around the popliteal fossa ( fig . the patient had agreed to quit smoking and was educated on a diabetic diet regimen with tight control over her blood sugars . at that time , the vascular surgery team performed a lower extremity bypass surgery ( femorotibial ) with the use of a saphenous vein graft while our team performed a simultaneous aggressive debridement of all the necrotic bone and soft tissue . intraoperative bone and soft tissue cultures and biopsies were also obtained . a postoperative regimen of deep vein thrombosis prophylaxis ( low molecular heparin ) and intravenous antibiotics based on the culture results ( keftazidim : 2 g 3 doses and vancomycin : 500 mg 3 doses ) were initiated and the patient 's vascular status of the lower extremity was monitored for approximately 3 weeks . a significant improvement of the skin temperature and blood perfusion of the limb was observed and it was confirmed with further doppler non - invasive vascular studies . at that time , the patient then had further surgical debridement and closure of the large calcaneal defect with a reverse flow sural neurofasciocutaneous flap . at the beginning of the surgery the exact bone resection was defined with a macroscopical inspection under loop magnification ( 6 ) combined with blue methylene fast staining and successive immediate multiple irrigations with normal saline solution . the procedure was followed with the flap dissection of the sural artery and associated neurovascular structures that were identified and ligated proximally . the flap 's pivot point was located distally over the defect area and approximately 57 cm proximal of the lateral malleolar area . the flap was innervated with end - to - end coaptation of the sural nerve at the distal end of the lateral plantar nerves with epineural sutures . the sural flap was then rotated to the defect area and was secured without any skin tension ( fig . the donor area was covered with a split thickness skin graft that was harvested from the ipsilateral thigh . the rest of the uncovered areas were grafted with split thickness skin from the ipsilateral thigh . ( a ) intraoperative picture showing harvesting of the large sural pedicle flap to cover the calcaneal resected osteomyelitis with a severe soft tissue loss . ( b ) immediate postoperative picture showing the insetting of the sural flap at the recipient area with minimal skin tension . during the first postoperative week , the flap sustained a superficial venous congestion and approximately 5% of the flap coverage was lost due to skin necrosis . the venous congestion was managed with the use of a vasodilating agent buflomedil hydrochloride ( 600 mg 1 over 24 h ) and an oral micronized purified flavonoid fraction ( mpff ; daflon , a vasoprotector and venotonic agent ) . the epidermal necrosis was healed after a minor surgical revision and loose reattachment of the flap margins . during the postoperative period the patient continued the intravenous antibiotic therapy for 2 months , followed by oral antibiotic therapy for more than a 1-month period . the patient was also kept non - weight bearing for approximately 3 months after the initial surgery . the flap was completely healed and the patient was ambulatory with a custom molded shoe at 4 months postoperatively ( figs . 3 and 4 ) . final postoperative outcome and range of motion of the ankle at 7-month follow - up . the majority of diabetic foot ulcerations with underlying osteomyelitis are clinically unsuspected and often masked by infected and necrotic soft tissue . if the treatment of osteomyelitis in a diabetic foot ulceration is not adequate , the risk of lower limb amputation will increase ( 2 ) . chronic diabetic foot ulcerations with exposed or probing to bone upon clinical examination may be treated for osteomyelitis . newman et al . ( 3 ) observed that osteomyelitis was present in 100% of diabetic foot ulcers in which the underlying bone was also exposed . palpation of bone in the depths of infected pedal ulcers in patients with diabetes is strongly correlated with the presence of underlying osteomyelitis. in our case report , the chronicity of the calcaneal exposure coupled with the inadequate soft tissue coverage led to the incidence of calcaneal osteomyelitis , which was surgically resected and covered with a reverse flow sural neurofasciocutaneous flap closure . the advantages of this flap compared to other covering methods are the simplicity of the design , the dissection of the pedicle sural flap that can be carried out with a loop magnification without the need for microsurgical instrumentation or anastomosis along with the preservation of the principle vascularization of the lower limb , and the need for only one operation . the sural flap constitutes for a well - vascularized cutaneous islet and offers the possibility of covering a broad range of areas with cutaneous defects in the distal malleolar areas . the sural flap can also be used in cases with serious peripheral vascular compromise as long as the peroneal artery is intact or when a microsurgical procedure is contraindicated . one of the few disadvantages of this flap is that by sacrificing the sural nerve , an inevitable anesthesia area appears over the lateral aspect of the foot that usually is well tolerated by the diabetic patient ( 57 ) . ( 8) was the first to describe the vascularization of the skin in the lower limb and the arteries that follow the trajectory of the peripheral nerves . the sural nerve projects distally in the leg and is in close approximation with the lesser saphenous vein . this nerve is supplied by the superficial sural artery in the proximal third of the calf and by fasciocutaneous branches arising from the peroneal artery in the distal half of the leg along with the suprafascial course of the sural nerve . the sural artery anastomoses with the peroneal artery by means of 35 fasciocutaneous perforators that ensure adequate inverse perfusion of the flap . the peroneal artery supplies the sural artery and venous anastomoses circulate along this artery to ensure venous return . several authors have demonstrated that the main anastomosis of this arterial network is located around 5 cm proximal to the lateral malleolus ( 914 ) . some surgeons do not include the sural nerve in the flap based on the existence of a perforated branch of the peroneal artery that by itself is capable of perfusing the graft without the need to transfer the accompanying nerve ( 9 , 10 , 2 , 15 , 16 ) . in our case report , in addition , some authors have advocated the utilization of a doppler test prior to the intervention that will confirm the integrity of the peroneal artery , its anastomosis with the fasciocutaneous branches , and the precise localization of the pivot point on which the flap should rotate ( 6 , 9 , 12 ) . additional lower extremity angiography may also be needed if the peroneal artery has questionable viability . in our case report the size of the flap was quite large ( 6.515 cm ) and although ( according to the literature ) the complication rates increase secondarily to the harvested pedicle flap size , we did not observe a significant postoperative edema and any donor side morbidity . in this case report , other alternatives for flap closure could have included the utilization of a free flap , lateral supramalleolar flap , and/or the posterior tibial perforator flap . free flap reconstruction of defects requires a lengthy and costly hospitalization , microsurgical training and experience , special instruments , and a two - team surgical approach . the long operative time and functional donor - site morbidity are major disadvantages of this method , especially in patients with diabetes mellitus and multiple associated comorbidities . the lateral supramalleolar skin flap offers a range of coverage similar to that of the sural flap but the dissection is more difficult and offers no more advantages when it is compared to the sural flap . theoretically , the sural flap does not cover as distally as the supramalleolar flap but it has been reported that the distally based sural flap is more reliable regarding the minimal venous congestion and has the ability to cover large weight - bearing areas of the foot ( 5 ) . finally , the posterior tibial perforator flap could have provided another alternative but its main disadvantages included a more difficult dissection and a larger learning curve ( 6 ) . in conclusion , the sural neurofasciocutaneous flap is a simple and reproducible method that can be utilized with a low rate of complications and needs to be considered for soft tissue coverage of any difficult to close calcaneal wound with concomitant osteomyelitis in patients with diabetes mellitus . the authors have not received any funding or benefits from industry to conduct this study .

the study population included the 45 to 65 years old women with type ii diabetes who referred to charity center of diabetes in isfahan . sample size was determined to be 39 , using sample size formula and considering 15% additional samples . the women with type ii diabetes , who were at least diagnosed five years ago , entered the study . exclusion criteria were injecting insulin , having secondary complications of diabetes such as ophthalmic and renal complication , amputation , etc , and having inflammatory diseases with the cpr level of + + + or more . this study was approved by the ethics committee of tehran university of medical sciences ; the aim of the study and its method was explained for the participants and then all of them signed the consent form . 150 patients had the criteria to enter the study from which , 39 patients were selected in each group randomly . some subjects did not end the study and finally , 37 patients set in the omega-3 group and 34 in the placebo group . all the patients filled in a questionnaire for collecting data including age , height , weight , waist circumference , and hip circumference ; besides , their blood samples were taken for blood tests . the hip circumference was measured from the middle and the largest part of it and waist circumference also from the cord at the end of a normal exhalation . in patients with type ii diabetes , the consumption of more than 4 grams epa ( eicosapentaenoic acid ) or dha ( docosahexaenoic acid ) , omega-3 derivatives , can increase the serum glucose and reduce tg17 and some researches mentioned that at least 2,000 mg per day of omega-3 could be beneficial to patients with diabetes.18 so , the omega-3 group was given two capsules containing omega-3 with dose of 2000 mg each day for 8 weeks ; each capsule contained 1,000 mg omega-3 , 65% epa ( 360 mg ) and 35% dha ( 240 mg ) . the placebo group was given two placebo capsules containing 1 g of cornstarch for the same period . then , height , weight , waist circumference , and hip circumference and also the blood sample were checked again with the same method . the blood sampling was conducted after 10 - 12 hours of fasting ( 10 cc in each time ) before taking the antidiabetic tablets . ldl , hdl , tg , cholesterol , glucose , and hba1c levels were measured using pars azmoon kits ( tehran , iran ) . visfatin level was measured using elisa method with the sensitivity of 30 pg / ml via human visfatin kit ( adipogen inc . , south korea ) . the fisher 's exact test was used for qualitative data and student t - test for quantitative data . the weight changes were analyzed by chi - square test and pearson correlation test was used for the data correlation . moreover , paired t - test was used for comparing serum visfatin concentration before and after the intervention in both groups and independent t - test was used for comparing mean concentration changes between the two groups . the omega-3 group and placebo group had no significant differences in terms of underlying variables such as age , sex , education , and occupation . besides , there was no significant difference between the two groups in terms of other variables such as comorbidities and taking medication and the diet type . the obtained data such as bmi , serum visfatin level , weight , waist circumference , hip circumference , whr , blood glucose , and hba1c are shown in table 1 . anthropometric data and visfatin level in two studied groups there were significant differences between the two groups in bmi , weight , waist circumference , hip circumference and whr value after the intervention ; but changes after the intervention in each group were not significant compared to the value before the intervention . serum visfatin level had no significant difference before the intervention between two groups ( p = 0.14 ) ; the serum visfatin level of the omega-3 group had a significant difference after the intervention comparing to its before value ( p < 0.001 ) while the serum visfatin level of placebo group had no significant difference after the intervention ( p > 0.05 ) . fbs level had not significant difference before and after the intervention between two groups ( p > 0.05 ) . hba1c level had no significant difference between two groups before the intervention ( p = 0.8 ) and after it ( p = 0.09 ) ; whereas there was a significant difference in mean of hba1c level difference before and after the intervention between two groups ( p = 0.003 ) . based on the findings of the present study , consumption of omega-3 caused the patients to lose weight while the patients who had not taken it gain weight during the intervention and weight changes in two groups had a significant difference ( figure 1 ) . this study aimed to determine the efficacy of omega-3 on serum visfatin concentration in patients with type ii diabetes . according to the results , these findings show the role of increase in visfatin level and secretion of cytokine from the adipocytes along with receiving omega-3 . the possible reason might be due to more accumulation of adipocytes and/or quicker differentiation and consequently synthesis and more secretion of visfatin to the patients serum level.19 according to the study of tanaka et al , visfatin is secreted from the 3t3-l1 adipocytes which are dependent to the endoplasmic - golgi reticulum or micro - vesicles.20 also , the role of hyperglycemia on the increase of visfatin synthesis from the cultures adipocytes was observed.21 the biological mechanisms of visfatin role in pathogenesis of type ii diabetes are not well determined . unlike berndt et al,22 krzyzanowska et al,23 fukuhara et al,5 and chen et al,7 the present study showed a significant and positive association between the abdominal obesity value and serum visfatin level in patients with type ii diabetes . furthermore , the results of other studies showed a significant correlation between the level of circulating visfatin and bmi value in the participants.561222 otherwise , the results of pagano et al on non - diabetic obesity21 and the study of samara et al on diabetic patients with different weights24 reported the reverse association between bmi and circulating visfatin level . moreover , chen et al found no significant correlation between bmi and circulating visfatin level in patients with type ii diabetes.7 in general , the visceral fat values or abdominal obesity and body obesity which measured by whr and bmi respectively are in association with synthesis and visfatin secretion rates ; based on the study of berndt et al , there is a correlation between the emergence of abdominal visfatin gene and bmi and the percentage of body fat while it had no association with subcutaneous fat;22 this is a reason for secretion of cytokine from the visceral adipose tissue cells or adipocytes.25 according to the present results , the correlation between plasma visfatin concentration and various parameters related to metabolic syndrome such as insulin sensitivity , fasting insulin and fasting plasma glucose can be realized . omega-3 consumption causes more burning of body fat and by increased metabolism cause weight loss in the patients.14 in this study , bmi was also reduced in the omega-3 group and had been increased in the placebo group . in this study , the results of this study showed increase of fasting plasma glucose level in both groups of omega-3 and placebo . this finding was not in accordance with the results of previous studies.2627 this finding showed the role of omega-3 consumption in controlling the hba1c level which itself is an index to assess the quality of controlling plasma glucose level in diabetes which was in accordance with some other studies in this regard.2627 this finding was in contrast with fukino et al study.28 this study , unlike the previous studies , showed a reverse association between circulating visfatin level and fasting blood glucose.6729 there was a direct relationship between fasting glucose changes and visfatin level in the two groups ; because there was no significant relationship between visfatin level and fasting blood glucose . similar to insulin , visfatin can increase the removal of the glucose by the adipocytes and muscle cells and reduce the fasting hepatic glucose production . we did not assess the changes in dietary intakes , lifestyle , and variables including diet and physical activity due to lack of budget ; another study with more subjects could be done to determine these variables effects . at the end , according to controversial issues on insulin - like function of visfatin , this study focused on the effect of omega-3 on the serum visfatin level ; the beneficial effects of omega-3 on diabetes should be studied more in further studies . we did not assess the changes in dietary intakes , lifestyle , and variables including diet and physical activity due to lack of budget ; another study with more subjects could be done to determine these variables effects . at the end , according to controversial issues on insulin - like function of visfatin , this study focused on the effect of omega-3 on the serum visfatin level ; the beneficial effects of omega-3 on diabetes should be studied more in further studies . we did not assess the changes in dietary intakes , lifestyle , and variables including diet and physical activity due to lack of budget ; another study with more subjects could be done to determine these variables effects . at the end , according to controversial issues on insulin - like function of visfatin , this study focused on the effect of omega-3 on the serum visfatin level ; the beneficial effects of omega-3 on diabetes should be studied more in further studies . hh has designed the research collected the data and analyzed it and took plase in writing article draft and revising it ; mjh has designed the research collected the data and analyzed it ; ab wrote article draft and the final version of article . km , gra , mhe , ak , and na were consulted in reseasch designing and had role in article draft .

acne has similar negative effects as chronic systemic diseases on mental , social health and on the patient s quality of life . therapeutic success not only depends on the appropriate selection of drugs , but also on the patient s treatment adherence or compliance . adherence is defined as the extent to which a patient s medication use and behavior matches or is consistent with the physician s prescriptions or whether the patient uses his / her treatment according to the assigned regimen . lack of adherence is an important problem both in general medicine and in dermatologic practice . despite this , few studies are available to evaluate a patient s adherence to treatments or prescriptions . we evaluated the impact of oral and written counseling on acne patients adherence to treatment . a randomized controlled trial was done between november 2008 and february 2009 in our department . we included 80 patients referred for evaluation and treatment of acne that agreed to participate in the study . they were randomized into two groups with a blind sequence of codes in a 1:1 proportion . the control group ( cg ) received oral counseling : education about pathophysiology of acne , treatment details and emphasis in treatment adherence . the intervention group ( ig ) received the same oral counseling , a patient information leaflet , and a phone call at day 15 after treatment initiation to remind patients about treatment , give counseling , and give a chance to answer questions . the evaluation of results was done with a telephone survey , without blinding , at 30 , 60 , 90 days , and 6 months after the first evaluation . this survey evaluated patient self - report of treatment adherence in four categories : ( 1 ) used every day , ( 2 ) used almost every day , ( 3 ) sometimes used , and ( 4 ) never used treatment . they were again rearranged into two categories : ( a ) good adherence : category 1 and ( b ) poor adherence : categories 2 , 3 and 4 . intervention effect was evaluated as rate of good - adherence ( treatment used every day ) . at the 6-month follow - up , a blind evaluator did analysis by intention to treat ( itt ) . the spss ( version 16.0.1 ) program and the mann - whitney u nonparametric test were used for statistical analysis . seventy - one patients completed the study and 9 patients were lost from follow - up : 5 from the ig and 4 from the cg . groups had similar baseline characteristics ( age , sex , severity and type of acne , site of involvement , type of treatment ( topical vs systemic ) and acne duration ) ( table 1 ) . 3- and 6-month follow - up an overall of 70% , 51% , 46% and 34% , respectively , of patients reported good adherence . ig versus cg reported good adherence at 1- , 2- , 3- and 6-month follow - up was 80% versus 62% ( p=0.043 ) ; 56% versus 51% ( p=0.41 ) ; 56% versus 38% ( p=0.087 ) ; and 37% versus 32% ( p=0.4 ) , respectively ( figure 1 ) . good adherence was associated with use of oral treatments ( p=0.021 ) ; attending regular follow up visits ( p=0.021 ) ; increased perception of adverse events : mainly erythema ( p=0.046 ) ; and a high perception of acne improvement ( p=0.064 ) . this high perception of acne improvement was associated to less feelings of shame ( p=0.001 ) ; less use of coverage cosmetics and clothes ( p=0.046 ) ; and less changes in social life ( p=0.03 ) . twenty - two out of the 80 patients ( 27.5% ) attended the 6-month elective follow - up visit , with an overall rate of 73% clinical improvement , without significant differences between groups ( p=0.583 ) . patients who reported good adherence at the first month had a tendency for a greater improvement of their acne : 86% compared with a 43% improvement in the group reporting the patients main reason for poor adherence was , according to them , forgetfulness and desertion interventions to improve adherence to treatment in acne patients are not well defined . in our study , treatment adherence was significantly higher in the first month in the ig compared to the cg ( 80% vs. 60% respectively ) , supporting our hypothesis that adherence could be improved with clinical interventions such as patient information leaflets and a phone counseling . nevertheless , this effect seemed to decrease over time , with a 56% of good adherence at 3-month follow - up in the ig , similar to what is described in the literature with an overall 34% treatment adherence at 6-month follow - up , with no differences between ig and cg . however , these results should be interpreted with caution : there is a possibility of information bias , as the study outcome was not assessed blindly to the exposure . also , we observed a tendency to an improvement in adherence at the 2- and 3-month follow - up in the ig compared to the cg . despite this , the results were not statistically significant . good adherence could help to obtain more effective treatments . in our study , the patients reporting good adherence had better follow - up attendance , higher perception of improvement and a better quality of life . this data should be read carefully , as this is another potential source of bias : the evaluation of the therapeutic response included subjects that attended electively their follow - up visits and did not include all the subjects included in the study . it is probable that patients attending this elective visit were those who had greater improvement , tolerance , and probably better adherence than those who did not attend this final follow - up visit . in order to decrease the risk of bias , future investigations should include all patients in the study in the follow - up visit . another drawback of our study is that the evaluation of adherence ( main outcome ) was based exclusively on patients self - report . new ways of evaluating adherence to treatments include electronic monitors ( automatic indicators located in pill boxes or cream dispensers with memory / records on how many times they were opened or squeezed ) . nolan and friedman elegantly described how patients may tell us how they used their medicines ( i used it religiously ) ; however , it is usually overstated , as comparing the patient s diary with the electronic devices monitoring real adherence in research studies show . some examples include the medication event monitoring system cap ( mems , aardex group , sion , switzerland ) that has the ability to record the date and time of every opening / closing of the medication cap and that can be attached to any cream tube for studies . phone counseling is also an effective alternative for improving a patient s treatment adherence . these two interventions seem very reasonable , given the fact that forgetfulness and desertion are the main reasons for poor adherence as reported by our patients . as adherence improvement decreases over time , we agree with nolan and friedman about the concept that adherence is the fourth dimension in dermatologic treatment and that improving it may help us to understand better treatment outcomes and make effective interventions to improve these outcomes .

hiv infection increases the risk for invasive cervical carcinoma and its precursors , sils [ 14 ] . the introduction of haart has significantly reduced morbidity and mortality in hiv - infected patients . some studies have reported a beneficial effect of haart with increase in regression [ 58 ] , or decrease in progression of sils . in contrast , other studies report no difference in regression and progression [ 9 , 10 ] of sils , when comparing patients on haart and those not on haart . it should be noted that some of these studies had a short - term follow - up and the effect of haart on sils may not be obvious because it takes years to develop hpv - related lesions . two seminal studies done recently showed a definitive beneficial effect of haart on sil in hiv - infected women ; however , these studies did not assess the effect of menopause [ 11 , 12 ] . the number of hiv - infected women reaching menopause and older age is expected to increase due to improved survival on haart . to date , there have only been limited studies which focused on sil in hiv - infected menopausal women . therefore , it is not clear whether the general guidelines regarding cervical cancer screening [ 13 , 14 ] should be applied to hiv - infected menopausal women . the purpose of this study was to assess the long - term effect of haart and menopause on sils in hiv - infected women and to determine the prevalence of sils in menopausal women with hiv infection . this 20-year retrospective study focused on hiv - infected women who were cared for at strong memorial hospital ( smh ) aids center ( ac ) between january 1991 and december 2011 . during this time , smh ac followed 8001061 individuals with hiv infection , of which 30% were women . women were advised to have cervical cytology at baseline and also at 6 months and yearly thereafter if the initial pap test results were normal . women with abnormal pap tests were referred to a gynecology clinic for colposcopy and further management . we had access to the information regarding cytology results and gynecological procedures from both the smh ac and the gynecology clinic . in total , included in the study were hiv - infected women who were at least 18 years old and had 2 or more cervical pap tests . this study was approved by the research subjects review board at the university of rochester . women were excluded if they had had a hysterectomy prior to entry into care and/or if they had less than two cervical pap tests done during the study period . participants were considered to be postmenopausal as indicated by their clinicians in the medical records . clinicians at the smh aids center use the standard definition of 12 months of amenorrhea in the absence of any hormonal therapy , and they use levels of follicle - stimulating hormone as supportive criteria as needed to define menopause in hiv - infected women . pap test results were reported according to the 1988 and 2001 bethesda classification [ 17 , 18 ] as normal , atypical squamous cells of undetermined significance ( asc - us ) , low grade squamous intraepithelial lesions ( lgsil ) , high grade squamous intraepithelial lesions ( hgsil ) , and squamous cell carcinoma . in the 2001 bethesda system classification , atypical squamous cells in which hsils can not be excluded ( asc - h ) are added in the category of atypical squamous cells . for this analysis , we stratified antiretroviral treatments into 4 categories : ( 1 ) haart , ( 2 ) old haart , ( 3 ) any antiretroviral therapy ( any art ) , and ( 4 ) no art . haart was defined as current standard haart regimens of two or more nucleoside reverse transcriptase inhibitors ( nrtis ) plus at least a boosted protease inhibitor or a nonnucleoside reverse transcriptase inhibitor ( nnrti ) or an integrase strand transfer inhibitor ( raltegravir ) or salvage regimen . old haart was defined as triple combination antiretroviral regimens containing indinavir , saquinavir , fosamprenavir , nelfinavir , or nevirapine . progression to sils was defined as worsening cervical dysplasia in subsequent pap test ( e.g. , normal pap test changing to ascus , lgsil , hgsil , or carcinoma in situ or ascus changing to lgsil , hgsil , or carcinoma in situ ) . to check on the progression to cervical lesions , two consecutive pap tests were compared with one another . however , if cervical procedures were done after one pap test , the pap test was not compared to the subsequent pap test . cervical procedures included punch biopsy , cone biopsy , endocervical curettage , loop electrosurgical excision procedure , or cryotherapy . predictors of interest included age , cytology , ethnic group , menopausal status , cd4 cell counts , nadir cd4 cell counts , hiv viral load , hiv medications , risk factors of hiv infection , and history of smoking , and results of pap tests reported using the 1988 and 2001 bethesda classification [ 17 , 18 ] . the number of sexual partners was collected at each visit , but this number may not refer to the number of lifetime sexual partners the patient had . the cox proportional hazards model was used to investigate time to progression to sils allowing for the possibility of a patient having multiple events , and the association of those events with time - dependent covariates ( see table 2 ) , assessed at the visit prior to the event or censoring . to capture potential multiple events , we employed a counting process model which used a partial likelihood determined from the observed survival times of all events , for each subject . the sandwich estimator was used to adjust for the correlation to establish a robust standard error for the parameter estimates . following the assessment of the univariate survival models , a backward selection procedure with a p > 0.05 was used to determine a parsimonious model from the above - mentioned predictors of interest . all candidate predictors were entered into the model , and at each step , those variables , adjusted for all other variables in the model , that failed to have an associated p 0.05 with the criterion , were removed . the model was evaluated after each variable was removed and the process stopped when all variables remaining in the model had a p 0.05 . all analyses used sas 9.3 software ( copyright 2011 , sas institute inc . , cary , nc , usa ) on a windows 7 platform . among the 313 hiv - infected women in the data base , a total of 68 women were excluded ; 38 had a history of hysterectomy , 1 had no available information on antiretroviral therapy , and 29 had fewer than 2 follow - up pap tests documented during the study period ; of these 29 patients , 17 were considered lost to follow - up ( less than two cytology results and last visit prior to 2011 ) , and 12 had entered the cohort recently . there was a significant difference in age at entry where those who were lost to follow - up were on average 5 years older than those not lost to follow - up ( p = 0.0314 ) . while non - hispanics were more likely than hispanics and blacks more likely than whites to drop out of care ( or = 4.16 ( 95% ci : 0.54 , 32.13 ) and or = 1.63 ( 95% ci : 0.50 , 5.33 ) , resp . ) , the width of the confidence intervals and nonsignificant differences ( p = 0.1724 and p = 0.4182 ) may reflect the modest numbers that were lost to follow - up . two hundred forty five hiv - infected women were eligible for analyses . the number of follow - ups among patients ranged from 236 months , and the average number of months between visits over the 245 patients was 11.77 7.10 . the mean number of pap tests for the cohort was 9.6 with a median of 9 ( sd = 6.26 ) , range 232 , and the prevalence of sil was 37% at baseline for the entire cohort . table 1 shows the baseline characteristics of the cohort . in the univariate survival analyses ( see table 2 ) , the hazard ratios ( hr ) revealed that use of haart , higher cd4 cell counts , menopause , increased duration of hiv infection , and increased age were associated with a decreased hazard of progression to sils while increased viral load and being a current smoker versus a former smoker were associated with an increased hazard ratio ; iv drug use was highly suggestive of a greater hazard of progression . at the visit defined as a progression visit 35% had progressed to ascus , 0.37% asc - h , 57% to lgsil , 7% to hgsil , and 0.41% to cancer . in the multivariate survival analysis ( table 3 ) , antiretroviral therapy , cd4 cell counts , duration of hiv infection , menopause , age , iv drug use , and smoking remained in the model . use of haart , higher cd4 cell counts , and increasing age were significantly associated with the lower risk of progression to sils . being menopausal was associated with an increased risk of sils progression contrary to the finding in the univariate analysis . since being menopausal reduced the hazard of progression in the univariate analysis ( table 2 ) but increased the hazard in the multivariate analysis we first looked at the variance inflation factor to see whether multicolinearity might have explained this hazard reversal . the other plausible cause for the phenomenon was the potential role of age as a moderator variable , represented by the interaction of age and menopause in the multivariate analysis . in this model , age as a main effect was not a candidate for consideration in the backward elimination procedure since it served as a moderator variable and was highly correlated with menopause . thus , looking at the contrast of menopause compared to premenopause , the hazard of progression is greater for menopausal women ( hr = 1.63 , 95% ci = 1.032.58 , p < 0.0001 ) . the interaction term of age by menopause further reveals that hiv - infected women who were menopausal at a younger age evidenced a higher rate of progression to cervical sils , while the hazard of progression to cervical sils for older menopausal women was lower ( table 3 ) . the hazard ratio for the interaction term for those women below 38 and above 55 is essentially an expression of the fitted model . in our study population overall , the proportion of menopausal women has been increasing over time ( figure 1 ) . in 2011 , 30% of hiv - infected women were postmenopausal . the prevalence of sils fluctuated each year and ranged from 8.3% to 50% with a median of 30% and there was no statistically significant difference in the prevalence of sils in menopausal women compared to nonmenopausal women ( figure 2 ) . women on haart had half the hazard of progression to sils ( hr = 0.47 , 95% ci : 0.330.68 , p = 0.0001 ) when compared to those on any other art regimen ( old haart and any art ) and no art . this protection afforded by haart was maintained when the therapies were looked at separately as well : old haart ( hr = 0.46 , 95% ci 0.310.69 , p = 0.0002 ) , any art ( hr = 0.35 , 95% ci 0.190.63 , p = 0.0005 ) , or no art ( hr = 0.66 , 95% ci 0.470.92 , p = 0.0139 ) . for each 100 cells/l increase in cd4 cell count , the hazard of progression decreased by 9% ( hr = 0.91 , 95% ci = 0.860.96 , p = 0.0007 ) . while the p value remains the same , the effect of increased cd4 cell counts is more apparent when higher numbers of units of increase in cd4 cell counts are compared . for each year of increase in duration of hiv infection , the hazard of progression decreases by 12% ( hr = 0.88 , 95% ci , 0.850.91 , p < 0.0001 ) . iv drug use increased the hazard of progression by 94% ( hr = 1.94 , 95% ci = 1.332.84 , p = 0.0007 ) as did being a current smoker when compared with those who never smoked ( hr = 1.39 , 95% ci = 0.991.95 , p = 0.0566 ) or a former smoker ( hr = 2.07 , 95% ci = 1.044.16 , p = 0.0397 ) ( table 3 ) . the restoration of the immune function mediated by haart in hiv - infected women may have a positive impact on cervical sils . compared to those who are not on haart , hiv - infected women on antiretroviral therapy tend to have a lower incidence rate of sils and higher probability of remaining free of sils . however , the effect of haart on changes of sils remains unclear and controversial . in their one - year follow - up study of 2,059 women , minkoff et al . reported that hiv - infected women who were on haart had a greater increase in regression and a greater decrease in the progression to sils compared to women who were not on haart . it has also been reported that the use of haart is associated with a higher rate of regression of sils and cins . recently , adler et al . conducted a large prospective study evaluating the effect of haart on hpv - related cervical disease ; in their study , the use of haart increased the regression of cervical lesions . the progression to cervical lesions was also reduced by 15% in those on haart compared to those not on haart , but the result was not statistically significant . on the other hand , schuman et al . reported that progression and regression of sils were not different in hiv - infected women on haart and not on haart and lillo et al reported in recent studies decreased incidence and progression of sil in hiv - infected women receiving modern haart [ 11 , 12 ] . our retrospective cohort of prospectively collected information over 20 years aims to bring more clarity to understand the effects of haart and menopause on the progression to sil in hiv - infected women . we stratified haart as two categories : haart and old haart because art regimens containing indinavir , saquinavir , fosamprenavir , nelfinavir , or nevirapine are not preferred regimens due to lower potency , side effects , and inconvenient dose schedules . old haart because we analyzed up to almost 20 years in cumulative data ( median 9.2 ( 0.419.9 ) years ) . in our study , we found that hiv - infected women on haart had a lower risk of progression to sils . overall , haart decreased the progression to cervical sils by 51% in this stable cohort . our findings suggest that the mixed results regarding the effect of haart on sils may be due to the lack of stratification by arv regimen or the use of arv medications which are considered less potent . in those previous studies [ 510 ] , haart regimens were probably regimens corresponding to old haart as defined in our study alone or a mixture of old haart and haart since these studies were conducted between 1993 and 2000 [ 5 , 6 , 810 ] . therefore , it is not surprising that the results of these previous studies were varied . in a recent study by adler et al . , their haart regimens were not specified and probably included regimens corresponding to haart as defined in our study . an increase of cd4 cell counts is a common direct consequence of haart , and therefore the effect of increased cd4 cell counts on sils indirectly reflects the effect of haart . reported that higher cd4 cell counts were associated with higher rates of regression of sils . other studies have demonstrated that with lower cd4 cell counts , the prevalence of hpv - related cervical lesions is increased . our study demonstrates that higher cd4 cell counts are associated with a lower risk of progression to cervical sils . however , some studies showed a discordant relationship between haart and cd4 cell count relating with hpv - related cervical lesions . studies reporting no correlation between haart and sils in hiv - infected women demonstrated increased prevalence or risk of progression of sils with decreased cd4 cell counts . on the other hand , heard et al . showed positive impact of haart on cervical sils but reported that cd4 cell counts were not associated with regression of sils . these inconsistencies regarding the effect of haart and cd4 cell counts on sils on hiv - infected women suggest that additional immunologic factors may play a role in hpv - related cervical disease in suppression hpv [ 20 , 24 ] . our study finds that more women reached menopause with substantial improvement of morbidity and mortality in hiv infection after the introduction of haart . to our knowledge , only one study has evaluated prevalence of sils in menopausal women with hiv infection . although only 18 patients were included in their study , ceccaldi et al . also observed a high prevalence of sils in postmenopausal women with hiv infection ( 50% ) . our study also finds an increased risk of progression to sils in menopausal women with hiv infection . specially , hiv - infected women who are menopausal and younger age are at a much higher risk of progression to sils than older menopausal women . at 50 , the trend is reversed and may reflect reduction of risky behavior or better adjustment to a changing hormonal environment associated with increased age or possibly better adherence to medical advice since they are still part of the cohort . our finding of an increased risk of progression to cervical sil in hiv - infected women who are menopausal at a younger age is important because it has been previously reported that hiv - infected women tend to become menopausal earlier than the general population [ 26 , 27 ] . in our study , the average age at menopause was lower than that of general population ( average age , 48.3 versus 52 ) . in the general population , persistence of hpv infection is higher in women who are 42 or older when compared to younger women [ 28 , 29 ] and the prevalence of high grade cervical dysplasia and cancer increases with age [ 29 , 30 ] . considering that there were only small numbers of high grade sils in our study , we were not able to assess whether high grade cervical lesions are statistically more prevalent in older hiv - infected women . although the model suggests that older menopausal women have a reduced hazard of progression , we have not addressed the degree of progression . firstly , this is an observational study and as such is limited to the report of the associations that we have found . while additional higher order interactions are of interest , we chose to limit the interactions to the one where the further investigation was necessary ( given the change in direction of the hazard ratio in the multivariate analysis when compared to the univariate and our knowledge of the conceptual relationships between these variables ) , rather than introduce possible spurious associations . the second or third progression might have a higher risk of progression compared to the first progression and we did not fit a separate hazard function for each specific event number . however , when we looked at time to first progression , the use of haart reduced progression to sils in hiv - infected women ( hr , 0.494 , 95% ci , 0.3340.730 , p = 0.0004 ) . for example , progression from ascus to lgsil or one from hgsil to cervical cancer is treated as a progression . the beneficial effect of haart is much less pronounced in advanced sils either due to failure of restoration of hpv - specific immune response and more genetic changes ( e.g. , more hpv dna integration into host dna ) . notably , there were very few ( 41 out of 2,364 pap tests ) high grade cervical lesions in our study . finally , our study did not include information on hpv infection , the main cause of sil . although ahdieh - grant et al . reported that there was no statistical difference in the status of hpv infection between hiv - infected women with regression of sils and no regression , schuman et al . showed that hpv infection is a risk factor related to progression to sils in hiv - infected women . in addition , menopausal stage was determined by the patient 's clinician and although most clinicians follow standard criteria they may not have applied these criteria uniformly for the entire cohort . in conclusion , our study showed that the current standard haart decreases risk of progression to sils in hiv - infected women . however , menopausal women with hiv infection have a higher risk of progression to sils than premenopausal women adjusting for age . furthermore , hiv - infected women who reach menopause at an early age have the highest risk of progression to cervical sils . the findings of this study are important because aging with hiv is a critical issue in the developed world and the additive effects of aging , hiv infection , and/or haart on development or progression to sil are not well understood . future prospective studies examining the prevalence , natural course , and characteristics of hpv - related cervical lesions are needed to identify best practice guidelines for treatment and ultimately improve clinical outcomes in this high risk population . hiv - infected women who reach menopause early have higher risk of progression to sils .

the clinical picture of cerebral venous thrombosis is variable , and a wide spectrum of neurological symptoms has been described . several cranial nerve syndromes in cvt have been identified and attributed to extension of thrombosis into contiguous venous tributaries , which leads to direct pressure and subsequent paralysis of the nerves lying in proximity to the clot . lower cranial nerve palsies in cvt is very rare , and we describe here a patient with paralysis of the 8 , 9 , 10 , and 12 cranial nerve palsies due to cvt . a 34-year - old pregnant lady in last trimester presented with headache of two months duration and difficulty in speaking , swallowing , and tinnitus of two weeks duration . headache was mainly in the occipital region radiating to the retroauricular region and the back of the neck . six weeks after the onset of headache , she developed slurring of speech , hoarseness , nasal twang of voice and difficulty in swallowing with nasal regurgitation . she had also difficulty in moving the tongue side - to - side and hearing with right ear . on examination , the lady was pale , and her speech was dysarthric . there was arching of the palate to the left side , and palatal movements were decreased on right side . her routine blood examinations showed hemoglobin of 10 gms , total count of 7000 cells / cumm , and an esr of 76 mm / hr . her routine urine examination , liver , and renal function tests were normal . magnetic resonance imaging ( mri ) of brain with magnetic resonance venogram was done and showed a thrombus in the right internal jugular vein and sigmoid sinus [ figures 1 and 2 ] . the thrombus was extending to right transverse sinus and confluence of sinuses [ figure 3 ] . the patient was treated with heparin in the hospital for a total of 4 week and subsequently switched over to oral anticoagulants . her neurologic signs and symptoms slowly improved over one week . at the time of discharge , she had residual sensorineural deafness . axial t1-weighted image of base of skull shows focal thrombus within the most superior part of the right internal jugular vein ( white arrow ) axial t1-weighted contrast image shows thrombus in the right sigmoid sinus and internal jugular ( white arrow ) mr venography shows a decreased signal in the right transverse sinus and absent signal in the right sigmoid sinus and internal jugular vein ( white arrows ) thrombosis of the cerebral venous sinuses is characterized by the classical features of headache , seizures , and various focal neurological deficits including cranial nerve palsies . there are only few reported cases of cerebral venous thrombosis affecting the 8th cranial nerve . kim et al . has described cerebral venous thrombosis mimicking acute unilateral vestibulopathy and has stressed the importance of recognizing this entity while evaluating a patient with headache and vertigo . fonseca et al . has reported reversible bilateral sensorineural hearing loss in a woman with cerebral venous thrombosis whose hearing loss reversed with treatment of intracranial hypertension . increased pressure in the subarachnoid space may be transmitted to the endolymphatic system via cochlear aqueduct and the perilymph . this results in increased fluid pressure in the internal ear , causing cochlear dysfunction . increased intracranial pressure however , cvt has also been referred as a direct cause of hypoacusis , in the absence of increased intracranial pressure . cochlear venous blood is collected by cochlear vein and drains through labyrinthine vein into the inferior petrosal sinus or directly into transverse sinus . thrombosis of transverse sinus or internal jugular vein can produce a venous overload and congestion of inner ear structures . damage is due to ischemia secondary to rise in cochlear pressure , resulting from back - pressure effect of extension of thrombus to the cochlear or labyrinthine veins . jugular foramen courses anterolaterally as it exits the skull base , and usually the right jugular foramen is larger than the left in two third of the cases each foramen is separated into an anteromedial portion ( the pars nervosa ) and a postolateral portion ( pars vascularis ) by a fibrous or bony septum . the pars nervosa contains cn ix - xi , the inferior petrosal sinus , and the meningeal branch of the ascending pharyngeal artery . involvement of jugular foramen region producing lower cranial nerve deficit is characterized by several eponymous syndromes like vernet 's syndrome , collet sicard syndrome , villaret syndrome , avellis 's syndrome , schmidt 's syndrome , tapia 's syndrome , and jackson 's syndrome . collet sicard syndrome ( css ) named after frederic collet and jean sicard refers to ipsilateral dysfunction of cranial nerves 9 - 12 due to the pathological process located near the jugular foramen . the current literature has only three reported cases of css as a result of venous thrombosis . has reported a case of collet sicard syndrome with initial sparing of the accessory nerve due to thrombosis of the sigmoid jugular complex . a possible explanation for the initial sparing of the 11th nerve is that it might have been due to the duality of innervation of these muscles supplied by the spinal branch of cn xi and c2 - 4 cervical spinal branches . our case differs from all these , in that our patient had 8th nerve involvement in addition to 9th , 10th , and 12th cranial nerves . such a combination of cranial nerve palsies in cerebral venous thrombosis has not been reported so far . while investigating the cause of lower cranial nerve palsies , one must consider causes like trauma , malignancies , infections , and thrombotic states . mri imaging of brain with an mr venogram is the most sensitive examination in detecting cerebral venous thrombosis . a search was made for a focus of infection and other inflammatory and hematological conditions known to produce cvt , which was negative . in the management of cvt during pregnancy , in addition to supportive care , seizure control and measures to lower intracranial pressure , selection of anticoagulant is important as oral anticoagulants are associated with fetal embryopathy and bleeding in the fetus . recent recommendation favors the use of full - dose low molecular weight heparin ( lmwh ) over unfractionated heparin ( ufh ) , both in the acute phase and subsequent prophylaxis of cvt during pregnancy . lmwh or a vitamin k antagonist should be continued for at least 6 weeks postpartum ( for a total minimum duration of therapy of 6 months ) with a target inr of 2.0 to 3.0 . cvt is not a contraindication for future pregnancies . considering the additional risk that pregnancy confers to women with a history of cvt , prophylaxis with lmwh during future pregnancies and the postpartum period can be beneficial when a patient presents with multiple cranial nerve palsies in the setting of a hypercoagulable state like pregnancy , cerebral venous thrombosis has to be kept as an important differential diagnosis .

torsion of a stimulated ovary occurring after in vitro fertilization ( ivf)/intrauterine insemination ( iui ) is a rare event . ovarian torsion should be suspected and ruled out in any female undergoing ovulation induction for iui or ivf , presenting with severe abdominal pain . a 33-year - old lady with secondary infertility of 7-year duration , with bilateral polycystic ovaries and history of complete septal resection came for further treatment to our clinic . she further took four cycle of iui but failed to conceive . in the third cycle of iui she had mild ovarian hyperstimulation syndrome ( ohss ) but managed conservatively she was on eltroxin 50 mcg daily since 5 years for hypothyroidism and her body mass index was 35 . combined estrogen , progesterone pill was given from day 2 to day 22 of previous cycle and inj . leuprolide acetate ( lupride , sun pharmaceutical , halol , gujarat , india ) 0.5 ml subcutaneously was started on day 21 of her previous menstrual cycle . this was followed by 0.2 ml lupride from day 2 of menstrual cycle stimulation cycle after confirming down regulation . stimulation with recombinant fsh ( recagon organon ) was started on day 2 of menstrual cycle , starting recagon dose was 175 iu s / c for duration of 10 days . peak estrogen level on day of hcg was4995 pg / ml and progesterone 2.7 nmol / l.hcg 5000 iu intramuscularly was given for oocyte maturation . she had moderate ohss managed conservatively with i / v albumin , fluids and high - protein diet . in view of ohss five days after oocyte retrieval , she came with sudden onset of severe right - sided abdominal pain with increasing severity in next 2 hours . on examination , she had tachycardia+ 108/min , blood pressure 100/70 , respiratory rate 20/mnt . she had moderate abdominal distension , severe right - sided guarding and tenderness and abdominal girth 102 cm . abdominal ultrasound done suggested enlarged bilateral ovary - right 1410 cm and left 89 cm with multiple cysts , fluid in paracolic gutter and morrison 's pouch . pain decreased with injection tramadol . with further episode of severe abdominal pain after 2 hours of admission the findings were - uterus normal in size , left ovary 98 cm , right ovary was enlarged and gangrenous and twisted twice over the pedicle 1515 cm , with 500 ml of hemoperitoneum . laparoscopic view of case one where ovary underwent ischemic necrosis and could not be salvaged blastocyst transfer was done 3 months later , but she failed to conceive . a 31-year - old female , with primary infertility since 3 years , bilateral polycystic ovary , previous 4 failed cycles of ovulation induction and timed intercourse came to our clinic for further treatment . ovulation induction with clomiphene-100 mg5 days and human menopausal gonadotrophin ( total dose 300 iu i / m ) was given . injection human chorionic gonadotrophin ( hcg ) 5000 iu was given i / m and iui was done twice at 24 and 48 hrs of injection . twelve days after iui she came with severe left - sided abdominal pain with outside scan suggesting hemorrhagic cyst in left ovary . right ovary was 4.172.78cms and . left ovary was 11.397 cm with two corpus luteal cyst . color doppler suggested enlarged cystic left ovary with heterogeneous reduced echo texture and scanty blood flow suggestive of torsion ( partial torsion ) and minimal ascitis [ figures 2 and 3 ] . doppler study of case 2 showing enlarged ovary with reduced blood flow emergency laparoscopy was done [ figure 4 ] . detorsion was done and the change of color of ischemic bluish tube and ovary was remarkable . peritoneal lavage was given and port closure done . owing to enlarged and friable ovary , fixation of pedicles of ovary could not be done . postoperatively , 2 weeks after , repeat doppler and usg suggested normal sized left ovary with normal blood flow and follicles . laparoscopic view of case 2 where tubo - ovarian torsion was untwisted and normal function regained a 33-year - old lady with secondary infertility of 7-year duration , with bilateral polycystic ovaries and history of complete septal resection came for further treatment to our clinic . she further took four cycle of iui but failed to conceive . in the third cycle of iui she had mild ovarian hyperstimulation syndrome ( ohss ) but managed conservatively she was on eltroxin 50 mcg daily since 5 years for hypothyroidism and her body mass index was 35 . combined estrogen , progesterone pill was given from day 2 to day 22 of previous cycle and inj . leuprolide acetate ( lupride , sun pharmaceutical , halol , gujarat , india ) 0.5 ml subcutaneously was started on day 21 of her previous menstrual cycle . this was followed by 0.2 ml lupride from day 2 of menstrual cycle stimulation cycle after confirming down regulation . stimulation with recombinant fsh ( recagon organon ) was started on day 2 of menstrual cycle , starting recagon dose was 175 iu s / c for duration of 10 days . peak estrogen level on day of hcg was4995 pg / ml and progesterone 2.7 nmol / l.hcg 5000 iu intramuscularly was given for oocyte maturation . she had moderate ohss managed conservatively with i / v albumin , fluids and high - protein diet . in view of ohss five days after oocyte retrieval , she came with sudden onset of severe right - sided abdominal pain with increasing severity in next 2 hours . on examination , she had tachycardia+ 108/min , blood pressure 100/70 , respiratory rate 20/mnt . she had moderate abdominal distension , severe right - sided guarding and tenderness and abdominal girth 102 cm . abdominal ultrasound done suggested enlarged bilateral ovary - right 1410 cm and left 89 cm with multiple cysts , fluid in paracolic gutter and morrison 's pouch . pain decreased with injection tramadol . with further episode of severe abdominal pain after 2 hours of admission the findings were - uterus normal in size , left ovary 98 cm , right ovary was enlarged and gangrenous and twisted twice over the pedicle 1515 cm , with 500 ml of hemoperitoneum . laparoscopic view of case one where ovary underwent ischemic necrosis and could not be salvaged blastocyst transfer was done 3 months later , but she failed to conceive . a 31-year - old female , with primary infertility since 3 years , bilateral polycystic ovary , previous 4 failed cycles of ovulation induction and timed intercourse came to our clinic for further treatment . ovulation induction with clomiphene-100 mg5 days and human menopausal gonadotrophin ( total dose 300 iu i / m ) was given . injection human chorionic gonadotrophin ( hcg ) 5000 iu was given i / m and iui was done twice at 24 and 48 hrs of injection . twelve days after iui she came with severe left - sided abdominal pain with outside scan suggesting hemorrhagic cyst in left ovary . color doppler suggested enlarged cystic left ovary with heterogeneous reduced echo texture and scanty blood flow suggestive of torsion ( partial torsion ) and minimal ascitis [ figures 2 and 3 ] . doppler study of case 2 showing enlarged ovary with reduced blood flow emergency laparoscopy was done [ figure 4 ] . left ovary and tube was twisted thrice over the pedicle , enlarged and ischemic . detorsion was done and the change of color of ischemic bluish tube and ovary was remarkable . peritoneal lavage was given and port closure done . owing to enlarged and friable ovary , fixation of pedicles of ovary could not be done . postoperatively , 2 weeks after , repeat doppler and usg suggested normal sized left ovary with normal blood flow and follicles . laparoscopic view of case 2 where tubo - ovarian torsion was untwisted and normal function regained torsion of a hyperstimulated ovary is much more rarer . in 20% cases it accompanies with pregnancy , with right ovary ovarian torsion is defined as partial or complete rotation of ovarian vascular pedicle and causes obstruction to venous outflow and arterial inflow . concomitant tubo - ovarian torsion is seen in 67% of adnexal torsion.[35 ] ovarian torsion can occur in females of all ages but pregnancy and infertility treatment predispose . symptoms are nonspecific and the classical presentation is sharp localized right or left lower abdominal pain and tenderness with a palpable mass and peritoneal signs . according to shadinger et al all patients ( 100% ) had a chief symptom of abdominal pain , 85% reported vomiting , 56% had leukocytosis and 18% had a documented elevated temperature . grey scale usg combined with doppler is the method of choice for imaging of lower abdominal pain in female . grey scale ultrasound features of torsion include unilateral ovarian enlargement of more than 4 cm which is the most consistent finding . torsed ovary is usually located in midline and superior to the fundus of the uterus . string of pearls sign may be due to follicles displaced to the periphery by marked edema and venous congestion . thus comparison with the morphological appearance and flow pattern of contralateral ovary will aid in diagnosis . complete absence of arterial and venous flow in a morphologically abnormal ovary is a sine qua none of ovarian torsion . however , the most frequent finding is decreased or absent venous flow which may reflect early collapse of compliant venous wall . presence of arterial waveforms may be explained because the symptoms may result from venous thrombosis occurring before arterial obstruction and dual blood supply of the ovary . the utility of color doppler imaging is in determining the viability of affected ovary preoperatively . the promising finding incorporating both grey scale and color doppler sonography are twisted vascular pedicle and whirlpool sign . the twisted vascular pedicle can be visualized on grey scale ultrasound as an ellipsoid or tubular mass with internal heterogeneous echoes . ben - ami and colleagues reported the positive predictive value for torsion in the absence of venous flow as 94% . penna and colleagues reported that color flow findings were normal in 60% and reduced or absent in 40% cases . in cases involving ovulation induction doppler sonography were normal in 25% . albayram and hamper reported duration of pain did not show any statistically significant relationship with presence or absence of ovarian arterial flow . however , the relationship between duration of pain and the absence of venous flow was significant and unexpectedly inverse . ct and mri may be rarely useful when findings on usg and doppler are inconclusive . mimics of ovarian torsion include hemorrhagic cyst , ohss , endometriosis , pid , endometritis , adhesions , a / c appendicitis and ohss . in ohss ovaries appear bilaterally enlarged due to multiple and peripherally located corpus luteal cyst producing spoke wheel appearance . a twisted hyperstimulated ovary can be distinguished from its normal counterpart by separation of cystic elements by marked stromal swelling in torsed ovary . in pcos , ovary volume is commonly more than 10 cubic cm and hence prone to torsion . in adnexectomy was the standard treatment in the past due to fear from thromboembolism after untwisting the ovary . studies have demonstrated that untwisting the vascular pedicle leads to recovery of ovarian function inspite of necrotic appearing ovary . acute onset abdominal pain in any female undergoing infertility treatment should be evaluated to rule out this diagnosis . persistent or intermittent severe abdominal pain is the most consistent symptom and unilaterally enlarged ovary in ultrasound is the most consistent sign . presence of blood flow on doppler indicates viability of ovary and not absence of torsion .

the sensations of bitter and sour deter us from ingesting potential toxic substances and strong acids , while the preferred qualities of sweet , umami ( glutamate ) , and salty encourage us to eat foods containing carbohydrates , amino acids , and sodium . taste sensations are mediated by taste buds , which are small clusters of specialized epithelial cells situated within the oropharynx . over the last two decades , scientists have uncovered the array of g protein - coupled receptor ( gpcr ) cascades and ion channels that mediate taste signaling . expression of these receptors and channels is not , however , limited to taste buds . elements of the taste transduction cascade are expressed by many chemoresponsive epithelial cells scattered within both the alimentary tract and the respiratory passageways . but what are they doing there ? despite the similarities in receptor molecules and transduction cascades , the emerging picture is that the diverse chemoreceptive systems do not all evoke a sensation of taste , but rather serve different functions according to their location . the sensations of taste can be divided into five distinct qualities : salty , sour , bitter , sweet , and umami ( the taste of glutamate ) . the first two of these are transduced by means of ion channels or gated ion channels expressed in a variety of tissues such as kidney ( e.g. , ) . the last three qualities rely on two distinct families of gpcrs first identified in 1999 in taste tissues [ 2 - 5 ] . two different families of taste receptors are known , t1r and t2r : t1rs encode the receptor proteins for sweet and umami , and t2rs do the same for bitter . despite the difference in underlying qualities detected , the two families of taste receptors utilize similar , if not identical , downstream signaling effectors , most notably the g - protein -gustducin , phospholipase c2 ( plc2 ) , inositol 1,4,5-trisphosphate receptor , type 3 ( ip3r3 ) , and the transient receptor potential cation channel trpm5 ( figure 1 ) . indeed , the taste - associated g - protein -gustducin was among the first proteins involved in a gpcr taste transduction cascade to be identified and is still utilized as a marker for chemosensory cells throughout the body . the canonical taste transduction cascade starts with one or more tr families of receptor ( either t1r or t2r ) , which couple to a variety of g - protein subunits , the best described being gustducin . receptor activation releases the beta - gamma subunits of the g - protein complex ( g ) , which activate plc2 to generate the second messenger 1,4,5-inositol trisphosphate ( ip3 ) . the ip3 then triggers the ip3r3 receptor to release ca from intracellular stores . in taste cells , solitary chemosensory cells and secretory cells , the increased intracellular ca both activates the trpm5 channel to depolarize the cell , and facilitates release of transmitters and hormones . in taste buds , in other tissues ( but not taste buds ) , the trpm5-generated depolarization opens voltage - gated ca channels , which further increases levels of intracellular ca . some cells express only some elements of the canonical taste transduction cascade and the rise in intracellular ca acts on other effectors to generate muscle relaxation or changes in ciliary motility . bkca channel , calcium - activated big potassium channel ; ggus , g - protein -gustducin ; gtrans , g - protein -transducin ; plc2 , phospholipase c 2 ; trpm5 , transient receptor potential cation channel , subfamily m , member 5 . identification of these key molecules in taste transduction led several investigators to the surprising conclusion that these taste transduction mechanisms were widespread throughout diverse organ systems , including presumed chemosensory cells of the gut and the respiratory tree [ 9 - 11 ] ( figure 2 ) . the wide distribution of presumed chemosensory cells all displaying most elements of the complete taste transduction cascade from receptor to transduction channel suggests that these taste - like functions do not all give rise to sensations of taste . for example , the pancreatic release of insulin in response to intake of glucose is partially mediated by detection of the glucose by sweet taste receptor signaling in cells of the intestine , but this does not generate a sensation of sweetness . similarly , accidental inhalation of a beverage into the airways triggers receptors there , but rather than evoking a sensation of taste , the substance is irritating and provokes choking or coughing . the term taste should be reserved for the specific sensory perception originating in taste buds of the oropharynx and transmitted via the facial , glossopharyngeal , or vagus nerves to ultimately reach the gustatory cortex after relays in the brainstem and thalamus . taste receptors below , we do not mean to imply that the sensations arising from the various systems described are in any way taste . where we use the term taste inappropriately , we include the quotation marks to denote a more casual , tongue - in - cheek ( sorry about that ) usage . taste buds comprise three types of elongated cells , one of which ( type ii / receptor cells , identified by green fluorescence ) expresses the taste receptor ( tr)-mediated transduction cascade culminating in activation of trpm5 . in the nasal cavity ( top right ) , solitary chemosensory cells express the taste transduction cascade and synapse onto nerve fibers ( red ) arising from the trigeminal nerve . in the trachea taste-like cells are brush cells , which release acetylcholine upon stimulation . some also make contacts with sensory nerve fibers ( red ) from the vagus nerve . in the stomach ( center lower right ) , a variety of enteroendocrine cells express elements of the taste transduction cascade and release into the gut a variety of peptide hormones . numerous brush cells in the gall bladder and bile ducts express the canonical taste transduction cascade ; their function is unknown . in the upper part of the small intestine ( e.g. , duodenum , lower right ) , a variety of enteroendocrine cells express taste receptors and the associated downstream transduction cascade when activated , these cells release a variety of gut peptides as discussed in the main text . this article will explore the diversity of organs that express elements of the taste transduction cascade and their functions in each area . taken together , the findings suggest that the taste transduction cascade is not restricted to taste per se or even to systems regulating food intake . the receptors mediating taste transduction evolved early in the vertebrate lineage , and questions still remain as to what the natural ligands are for many of the nongustatory functions of the taste transduction system . the first indication that elements of the taste transduction cascade might exist outside of the mouth was the report in 1996 of the expression of the taste signaling - associated g - protein -gustducin in brush cells of the stomach and intestine . brush cells are tall , columnar epithelial cells that display a distinctive tuft of stiff microvilli at their apex . based on morphological features , it was suggested that these cells might have a chemosensory function , but the finding of gustducin and later even taste receptors [ 8,16 - 19 ] and trpm5 in these cells confirmed this early speculation . more recent studies reveal that taste transduction - related signaling occurs in a variety of cell types throughout much of the gut from the stomach to the large intestine ( e.g. , ) ( figure 2 ) . despite the widespread expression of taste - related signaling components in the gut , they are not necessary for the post - ingestive hedonic reward of ingested sweet substances , but rather serve digestive functions . members of the t1r family of taste receptors combine in taste cells to form either a sweet receptor ( t1r2 + t1r3 ) or an umami ( glutamate ) receptor ( t1r1 + t1r3 ) . both receptors signal macronutrients necessary for survival ( a carbohydrate energy source and amino acids , respectively ) so it is reasonable to consider that these receptors may respond to similar ligands in the gut to regulate digestive functions . indeed , secretory cells of the stomach express t1r family receptors and release the appetite - inducing peptide ghrelin in response to activation by the appropriate ligand . accordingly , when either sweets or glutamate - rich foods first enter the stomach , they cause the release of ghrelin , which stimulates further food intake . farther down the gastrointestinal tract , sweet substances are detected by enteroendocrine cells that secrete the glucagon - like peptide glp-1 . the presence of circulating insulin results in uptake of glucose from the bloodstream by diverse tissues . activation of the sweet receptors in the gut also drives insertion of the glucose transporters sglt1 ( sodium glucose cotransporter 1 ) and glut2 ( facilitated glucose transporter 2 ) , in the apical membrane of cells of the intestinal epithelium , thereby facilitating uptake of glucose in the upper parts of the gastrointestinal tract . while the presence of t1r - class receptors for macronutrients in the gut is an obvious means to regulate digestive functions , the reason for the presence of t2r bitter receptors seems less clear . one clue comes from the observation that activation of t2r receptors in an enteroendocrine cell line ( stc-1 cells ) results in release of the peptide hormone cholcystokinin ( cck ) , which can reduce gut motility . so , intake of a potential toxin that activates the t2r pathway should decrease the rate at which food passes through the stomach and lower the drive for continued eating ( presumably this response inhibits further ingestion of toxin ) . the bitter - tasting ligand induces enteroendocrine cells to release cck , which in turn excites sensory nerve processes of the vagus nerve to carry the signal to the brain , suggesting that the regulation of food intake involves both peripheral and central controls . however , a recent study suggests that the lower gut motility following intake of bitter substances is not purely dependent on t2r / gustducin signaling or cck . an alternative explanation is that the cck - secreting enteroendocrine cells may be involved in a paracrine signaling system that reduces transfer of toxic substances from the gut into the circulation . this is supported by a study showing that cck ( released in response to bitter - tasting ligands ) then acts on cck2 receptors on nearby enterocytes to increase expression of the transporter abcb1 ( atp - binding cassette b1 ) , which pumps toxins or unwanted substances out of the cytoplasm . in this way , activation of the t2r signaling network indirectly increases elimination of absorbed toxins from gut epithelium before the toxins can enter circulation . when some bitter - tasting ligands are applied to the colonic epithelium , they induce the secretion of anions , which leads to fluid secretion by the epithelium . this induced efflux of fluids is likely to flush out any noxious irritant from the colon . members of the t1r family of taste receptors combine in taste cells to form either a sweet receptor ( t1r2 + t1r3 ) or an umami ( glutamate ) receptor ( t1r1 + t1r3 ) . both receptors signal macronutrients necessary for survival ( a carbohydrate energy source and amino acids , respectively ) so it is reasonable to consider that these receptors may respond to similar ligands in the gut to regulate digestive functions . indeed , secretory cells of the stomach express t1r family receptors and release the appetite - inducing peptide ghrelin in response to activation by the appropriate ligand . accordingly , when either sweets or glutamate - rich foods first enter the stomach , they cause the release of ghrelin , which stimulates further food intake . farther down the gastrointestinal tract , sweet substances are detected by enteroendocrine cells that secrete the glucagon - like peptide glp-1 . the presence of circulating insulin results in uptake of glucose from the bloodstream by diverse tissues . activation of the sweet receptors in the gut also drives insertion of the glucose transporters sglt1 ( sodium glucose cotransporter 1 ) and glut2 ( facilitated glucose transporter 2 ) , in the apical membrane of cells of the intestinal epithelium , thereby facilitating uptake of glucose in the upper parts of the gastrointestinal tract . while the presence of t1r - class receptors for macronutrients in the gut is an obvious means to regulate digestive functions , the reason for the presence of t2r bitter receptors seems less clear . one clue comes from the observation that activation of t2r receptors in an enteroendocrine cell line ( stc-1 cells ) results in release of the peptide hormone cholcystokinin ( cck ) , which can reduce gut motility . so , intake of a potential toxin that activates the t2r pathway should decrease the rate at which food passes through the stomach and lower the drive for continued eating ( presumably this response inhibits further ingestion of toxin ) . the bitter - tasting ligand induces enteroendocrine cells to release cck , which in turn excites sensory nerve processes of the vagus nerve to carry the signal to the brain , suggesting that the regulation of food intake involves both peripheral and central controls . however , a recent study suggests that the lower gut motility following intake of bitter substances is not purely dependent on t2r / gustducin signaling or cck . an alternative explanation is that the cck - secreting enteroendocrine cells may be involved in a paracrine signaling system that reduces transfer of toxic substances from the gut into the circulation . this is supported by a study showing that cck ( released in response to bitter - tasting ligands ) then acts on cck2 receptors on nearby enterocytes to increase expression of the transporter abcb1 ( atp - binding cassette b1 ) , which pumps toxins or unwanted substances out of the cytoplasm . in this way , activation of the t2r signaling network indirectly increases elimination of absorbed toxins from gut epithelium before the toxins can enter circulation . when some bitter - tasting ligands are applied to the colonic epithelium , they induce the secretion of anions , which leads to fluid secretion by the epithelium . this induced efflux of fluids is likely to flush out any noxious irritant from the colon . the first description of taste - related signaling components in the airway was a report by zancanaro and colleagues describing the presence of gustducin - expressing cells in the vomeronasal organ , which is a specialized part of the olfactory system found in many vertebrates but absent in adult humans . the gustducin - expressing cells in the vomeronasal organ are scattered epithelial cells mainly distributed along the incoming ducts of the organ and within the non - sensory epithelium of the organ itself . the morphology of these cells is similar to chemosensory cells scattered within the epidermis of fishes as first described by mary whitear in the 1960s when she referred to them as solitary chemosensory cells ( sccs ) . subsequently , we and others showed that sccs are present throughout the upper respiratory system and express the entire suite of taste - related signaling molecules , including t2r receptors , plc2 , gustducin , and the transduction channel trpm5 . finger et al . demonstrated that the taste signaling cascade is necessary for activation of the sccs . since the sccs synapse onto polymodal pain fibers of the trigeminal nerve , activation of the sccs by bitter ligands evokes trigeminally - mediated reflex changes in respiration . so inhalation of a toxin that activates t2r receptors will be irritating and will provoke reflex changes in respiration not a sensation of taste . more recently , we showed that even some bacterial metabolites and signal molecules can activate the nasal sccs and trigeminal nerve . since the activated trigeminal nerve fibers release peptide modulators ( e.g. , substance p or calcitonin gene - related peptide ) , this causes local neurogenic inflammation of the respiratory epithelium . in this way , sccs act not only as sentinels warning against inhalation of irritants , but also as guardians capable of activating the innate immune system to the presence of potentially damaging toxins or pathogens . in all of the examples presented so far , the taste signaling cascade is used to detect elements in the lumen of an organ ( tongue , gut , respiratory passages ) , and to generate an intracellular cascade to effect release of a neurotransmitter or hormone to signal to other cells in the body . two recent reports on the expression of taste receptors in the airways indicate that taste receptor signaling may also operate in a cell - autonomous fashion , that is , detection of the chemical directly affects function of the responsive cell . the first such report of a cell - autonomous effect of t2r activation was in ciliated cells of human lower airways . cultured human airway epithelium expresses some t2rs along with associated downstream elements . curiously though , the t2rs are present on the cilia of the ciliated epithelial cells with plc2 situated where the cilia insert into the cell body . in this scenario , the t2r - mediated increase in intracellular ca causes an increase in ciliary beat frequency ( figure 1 ) , which the authors suggest would serve to sweep irritants away from the surface of the cell . whereas t2rs can be detected in cultured human airway cells , they are not detected in the lower airways of mice . whether this represents a species difference or the difference between in vivo ( mouse ) and in vitro ( human ) states remains to be determined . the second report of t2rs directing function within an airway cell came from deshpande and colleagues showing that smooth muscle cells of human airways express t2r ( bitter ) taste receptors along with gustducin and some components of the taste - associated plc signaling cascade . application of various bitter - tasting substances to cultured human airway smooth muscle cells produces plc - dependent increases in intracellular ca as would be typical of taste cells or sccs . surprisingly , these increases in intracellular ca are reported to cause relaxation rather than contraction of muscle , which is what is normally seen with increases in intracellular ca . this apparently paradoxical effect in the airway smooth muscle cells is attributed to the proximity of the t2r receptor complex to calcium - activated big potassium ( bkca ) channels ( figure 1 ) , which open in response to increased intracellular ca . in contrast , in taste cells and sccs , activation of the t2r receptor causes increased intracellular ca , as in the airway smooth muscle , but in the sensory cells , the increased intracellular ca triggers the transduction channel trpm5 to depolarize the cell and evoke transmitter release . thus in different signaling contexts , activation of the same receptor can produce opposite cellular - level effects . it should be noted , however , that the findings of deshpande and colleagues have since been questioned in terms of specificity and mechanism ; see . the widespread expression of elements of the taste transduction cascade in numerous tissues of the body points out the necessity for caution in attributing a physiological function to a system based solely on expression of a gene product . activation of taste receptors in taste buds does not give rise to the same sensation as activation of the identical receptors in the airways or gut . the physiological function of a receptor , or a trp channel , or a g - protein , makes sense only in the context in which it is expressed . so despite the title of this article , taste receptors of the airway or gut really should not be thought of as an internal sense of taste , but rather as an entirely different chemoreceptor system . while it is evident that taste receptors and their associated downstream signaling components are widely dispersed in diverse organ systems , the function of the receptors in many tissues remains unclear despite recent advances . for example , why should there be such a prevalence of taste receptor - expressing brush cells in the bile ducts ? the composition of the fluid in the bile ducts is dictated by secretions of the liver , pancreas , and gall bladder , so why is it necessary to diligently monitor the composition of the biliary fluids as they move from gall bladder to intestine ? similarly enigmatic are the reported effects of t2r ( bitter ) agonists on contractile elements of both the airway and the gut . in the trachea , t2r agonists cause muscle relaxation ( see above ) but it is not clear how a bitter substance would have access to the smooth muscle cells of the trachea under physiological conditions . the smooth muscle of the trachea is buried beneath a relatively tight airway epithelium , and it is not obvious how an inhaled bitter substance would penetrate the epithelium to access t2r receptors on the muscle . similarly , the inhibition of smooth muscle contractility by t2r agonists in the stomach is not mediated by any of the peptides released by enterochromaffin cells of the gut and may not even be mediated by t2r receptors . these and other nonspecific effects of bitter ligands emphasize the need to utilize either pharmacological agents or , better still , knockout animals to establish the specificity of transduction pathways and receptors for all physiological effects .

it is described as a proliferation of abnormal keratinocytes limited to the epidermis without invasion of the basement membrane . historically , various terms have been used to define cancer precursors of the vulva including vin grades 1 - 3 and bowen s disease . in 2004 , the international society for the study of vulvovaginal disease reclassified vin to refer only to high - grade intraepithelial lesions of the vulva , including older clinical terms such as bowen s disease , dysplasia , and squamous cell carcinoma in situ ( scurry and wilkinson , 2006 ) . usual type is associated with high - risk oncogenic human papillomavirus ( hpv ) infection , cigarette smoking , and immunodeficiency . the less common differentiated type typically occurs in postmenopausal women and is associated with chronic dermatoses , including lichen sclerosis , and hpv - negative vulvar cancer . although vin is an uncommon disease , incidence is increasing , particularly in women younger than the age of 50 years . the clinical presentation of vin is diverse , and patients may be asymptomatic or have severe pruritus , pain , burning , and dyspareunia . treatment of vin is indicated to decrease progression to invasive disease along with relieving symptoms . due to the rare incidence of vin , there are few large randomized studies , and consequently limited data from which to form guidelines for treatment and follow - up . surgery , with wide local excision or vulvectomy , is currently the standard of care for the treatment of vin . however , surgery often results in significant morbidity , including sexual and psychosocial dysfunction , and is associated with a high rate of recurrence ( lai and mercurio , 2010 ) . alternatively nonsurgical therapy may prevent disfigurement and preserve sexual function , but is limited to patients with no evidence or suspicion of invasive disease on clinical exam or biopsy . available therapeutic options for conservative treatment of vin include imiquimod , cidofovir , indole-3-carbinol , photodynamic therapy , and laser ablation ( hillemanns et al . , 2006 , lai and mercurio , 2010 ) . imiquimod is an immune response - modifying agent currently fda approved for the topical treatment of actinic keratosis , superficial basal cell carcinoma , and external genital warts . although a number of studies support the use of topical imiquimod for the conservative treatment of vin , clear guidelines for optimal treatment duration and follow - up timeline have not yet been determined . we report a case of a woman who was diagnosed with unifocal vin and treated with 5% topical imiquimod cream with complete response . a 75-year - old woman was referred to our dermatology department for an asymptomatic vulvar lesion of unknown duration . no prior treatments had been tried . physical exam revealed a 53 mm white plaque on the right aspect of the clitoral hood ( fig . 1 ) . initial biopsy of the lesion demonstrated full - thickness marked atypia , occasional cleared out cytoplasm ( haloes ) , and parakeratosis , most consistent with hpv - related vin ( fig . 2 ) . treatment was initiated with topical imiquimod 5% cream , five times per week , for 12 weeks . the lesion was re - evaluated after 12 weeks of treatment and repeat biopsy was performed . subsequent biopsy showed moderate to severe squamous dysplasia confined to the basal cell layer with an intense lichenoid inflammatory reaction ( fig . we repeated an additional course of topical imiquimod 5% cream , five times per week for an additional 12 weeks . shave biopsy after 24 weeks of imiquimod therapy demonstrated lichenoid dermatitis with no residual dysplasia or carcinoma ( fig . side effects included local irritation , pain , and candidal infection during the course of treatment . treatment was stopped and patient was evaluated at 3 , 6 , and 9 months without signs and symptoms of recurrence ( fig . 5 ) . imiquimod , a heterolytic imidazoquinoline amide , is an effective alternative to surgery for the treatment of vin . classified as an immune response - modifying drug , imiquimod enhances local skin immune responses by activating toll - like receptor-7 and -8 on macrophages and dendritic cells , which induces the release of pro - inflammatory t - helper cell type 1 cytokines ( interferon- , interleukin-2 , interleukin-12 ) and upregulates cell - mediated immunity ( sauder , 2000 ) . side effects include local pruritus , pain , burning , irritation , and soreness , which are generally well tolerated . a number of studies support the use of topical imiquimod as the conservative treatment of choice for women with vin ( table 1 ) . in a review of three clinical trials , the frequency of application of imiquimod 5% cream ranged from two to three times weekly , with some studies employing slow frequency escalation ( le et al . , 2007 , mathiesen et al . , 2007 , the duration of treatment lasted 16 weeks in all studies , and follow up ranged from 2 months to more than 7 years . the results of these studies demonstrated complete response rates ranging from 30 to 81% , partial response from 9.5 to 38% , and no response from 9 to 30% . based on a review of the literature , small ( < 1 cm ) lesions are more likely to demonstrate a complete response to imiquimod treatment . however , treatment periods in the randomized controlled trials may have been too short to be effective for larger ( > 5 cm ) lesions . a significant association was seen between the local skin reaction achieved and complete disease regression . those that reached a higher degree of local irritation had a better likelihood of observed complete response to treatment ( le et al . , 2007 ) . another potential predictive marker of imiquimod response includes viral clearance , as complete histologic regression of lesions strongly correlates with hpv clearance ( p < patients with complete regression also demonstrated a significant increase in the number of immune cells ( cd1a + dendritic cells , cd8 + t cells , and cd94 + natural killer cells ) in the epidermis with completion of therapy . total amount of imiquimod used did not correlate with observed response to treatment or recurrence rate ( le et al . , 2007 ) . lesion distribution ( unifocal vs. multifocal ) has not been associated with treatment response ( p = .66 ) ( le et al . , 2007 ) . imiquimod cream is able to upregulate the immune response , not only in areas with direct contact to the topical , but also in adjacent areas , which is advantageous when skip lesions may be present . in addition to effects on histologic regression , imiquimod reduces pruritus and pain associated with vin ( p = .008 and p = .004 , respectively ) ( van seters et al . , 2008 ) . in patients with a partial response to imiquimod , clinically significant decreased lesion size may be seen , leading to surgical resection with better - preserved sexual function and improved cosmetic result . an additional benefit of imiquimod is the continued immunostimulant effect on the area after treatment , preventing hpv expression and vin recurrence . ( 2011 ) report on the 7-year follow - up of 24 of 26 patients treated with imiquimod in their original study ( van seters et al . , 2008 ) . of the complete responders , one patient had recurrence of vin 4 years after demonstrating a complete response to imiquimod . 2007 ) demonstrated a significantly lower rate of recurrence and longer time to recurrence compared with primary surgically treated patients ( p = .013 ) . prognostic variables related to vin recurrence include age at diagnosis , smoking , and hpv status . a significantly higher recurrence rate is seen in women aged 65 or older compared with that of women younger than age 65 years ( p = .03 ) ( westermann et al . , 2013 ) . all five patients who had recurrence after complete response to imiquimod in le et al . vin recurrence rate is also higher in women with initial hpv - negative disease . despite the immunostimulant effect , follow - up visits to monitor for recurrence and long - term effects should be employed and biopsy of suspicious areas should be performed for all patients . women with a history of vin should be considered at risk for vin recurrence or vulvar cancer throughout their lifetime . ( 2008 ) performed post - treatment assessments at 7 and 12 months . in women with a complete response to imiquimod therapy , we recommend follow up at 3 , 6 , and 12 months with annual visits thereafter given the slow rate of progression . in conjunction with the results of these studies , our experience confirmed topical imiquimod is effective in the treatment of vin . ideal candidates for imiquimod therapy include nonsmoking , hpv - positive patients younger than age 65 years with small lesions . a longer duration of treatment is needed for patients with larger lesions . slow dose escalation and frequent clinic visits to provide reassurance resulted in improved tolerability and successful completion of the treatment regimen . a thorough follow - up regimen is recommended to monitor for recurrence and progression to invasive disease .

obstructive sleep apnea ( osa ) is a frequent , albeit underdiagnosed problem in children . if left untreated the immediate consequences of osa in children include behavioral disturbance and learning deficits , pulmonary hypertension , as well as compromised somatic growth . however , if not treated promptly and early in the course of the disease , osa may also impose long - term adverse effects on neurocognitive and cardiovascular function , thereby providing a strong rationale for effective treatment of this condition . nonsurgical options for treating osa include weight loss , alteration of sleep posture , oral appliance therapy , external nasal support devices , pharmacological therapy , and continuous positive airway pressure ( cpap ) therapy . surgical treatment options include tracheostomy , mandibular osteotomy with genioglossus or inferior border advancement , uvulopalatopharyngoplasty , laser - assisted uvuloplasty , reduction glossectomy , internal and external nasal reconstruction , tonsillectomy and adenoidectomy , and advancement of the upper and lower jaws . airway obstruction has been noted to occur in seven different sites in the upper airway . retrognathism or retropositioning of the jaw is beginning to be appreciated as a significant risk factor in the development of osa . large advancements of the jaws through traditional orthognathic surgery were accompanied with a high rate of relapse . a 12-years - old female patient who had been operated for left tmj ankylosis six months back , reported with the primary complaint of unaesthetic small chin . on further evaluation , patient revealed excessive day time somnolence , obnoxious snoring , disturbed sleep , dullness throughout the day and inability to concentrate . on clinical examination patient had short - neck , small chin - throat angle , fullness of the cheek on the left - side , flatness of the cheek on the right side , chin deviated to left side , mouth opening of 35 mm and prominent antegonial notch on the left side [ figure 1 ] . preoperative photograph showing asymmetry of chin preoperative cephalogram based on history , clinical examination , lateral cephalogram , and polysomnography , a diagnosis of obstructive sleep apnea due to reduced upper airway space secondary to left tmj ankylosis was made . the treatment plan selected was distraction osteogenesis to advance the mandible by 11 mm that would increase the upper airway space and at the same time correct the asymmetry . an intraoral distractor was fixed in the left angle region [ figure 3 ] . following a latency period of 5 days , the distraction device was activated at the rate of 1 mm / day till the desired lengthe was achieved , that is 11 mm . after 2 months of consolidation period the distractor was removed under local anaesthesia . a thorough postoperative clinical and lateral cephalometric examination the polysomnogram showed an improvement in the respiratory distress index of 5 ( presurgery was 51 ) and a mean oxygen saturation of 98% ( presurgery was 84% ) . obstructive sleep apnea ( osa ) syndrome is a potentially serious disorder affecting millions of people around the world . many of these individuals are undiagnosed whereas those who are diagnosed often exhibit poor compliance with nightly use of continuous positive airway pressure ( cpap ) , a very effective nonsurgical treatment . various surgical procedures have been proposed to manage and , in some cases , treat osa . effective surgical management of osa depends upon developing a complete database and determining different levels of obstruction , which may include nasal , nasopharyngeal , oropharyngeal , and hypopharyngeal / retrolingual , or a combination of these sites . a systematic approach to clinical evaluation , treatment planning , and surgical management surgical treatment may involve various procedures that are performed in different stages depending on the patient 's sites of obstruction . the most commonly performed procedures include nasal reconstruction , uvulopalatopharyngoplasty ( uppp ) , advancement genioplasty , mandibular osteotomy with genioglossus advancement , and hyoid myotomy and suspension . in more severe cases , maxillomandibular advancement ( mma ) with advancement genioplasty surgeries in these cases are aimed at reducing the bulk of the tongue base or providing more space for the tongue in the oropharynx so as to limit posterior collapse during sleep . most surgeries are done in combination and in a multi - step manner , with maxillomandibular advancement , typically being reserved for refractory or severe osa , or for those with obvious and significant maxillomandibular deficiency . a protocol developed by the university of alabama recommends maxillomandibular advancement and uvulopalatopharyngoplasty for respiratory distress index greater than forty . various authors have proposed distraction osteogenesis for maxillomandibular advancement , as a reliable surgical method to alleviate the narrow upper airway in growing osa patients , especially those with severe craniomaxillomandibular deformities . in our case , the etiology of respiratory obstruction was retrognathic and hypoplastic mandible , advancement was planned and achieved through distraction osteogenesis . the positive outcomes were evidenced by patient 's subjective response and duly confirmed by the decrease in respiratory distress index in the polysomnograph ; as well as , an increase in the pharyngeal airway shadow in the lateral cephalometric radiographs . advantages of distraction osteogenesis include greater advancement possible , more stable results , non requirement of grafting , low - risk procedure , obviating the need for intermaxillary fixation in an already compromised airway and at the same time correcting asymmetry due to tmj ankylosis that was the reason behind osa in our case [ figure 5 ] . there are various nonsurgical and surgical treatment modalities available for obstructive sleep apnea , but distraction osteogenesis as a treatment option for patients of obstructive sleep apnea secondary to tmj ankylosis seem to have more favorable results due to greater advancement possible , lesser chances of relapse , and correction of the deformity at the same time .

adolescence denotes a time in which youth begins to experience dangerous behaviors like substance use and delinquency ( 1 ) . delinquent behaviors are commonly defined as behaviors prohibited by law such as drug use , vandalism , larceny , burglary , and violence ( 2 ) . delinquent behaviors such as vandalism and theft are also common in the high school years ( 1 ) . previous studies indicate that during adolescence delinquent behaviors increase dramatically ( 3 ) ; for example , about 15% of adolescents participate in these behaviors at age 11 and about 50% of them at age 17 ( 4 ) . there is also considerable evidence supporting that family plays an important role in the development of adolescent delinquent behaviors ( 5 ) . a family systems perspective on power allows us to consider how dynamic powers within one relationship may influence other relationships or individuals within the family ( 6 ) . besides , the family systems perspective emphasizes the importance of family bonding ( i.e. affective ties ) and family organization ( i.e. adaptability , control ) in the development of delinquency ( 7 ) . tenets of one particular family systems perspective , structural family therapy ( sft ) , seem to possess particular utility as a construction to organize our perception of the systemic antecedents of the violence among children ( 8) . in the family systems theory ( minuchin , 1985 ) cohesion and power are recognized as two fundamental dimensions of family relationships ( 9 ) . both cohesion and power are related to child outcomes such as aggression and self - assertive behaviors ( 10 ) . the power structure is one holistic feature of family systems and relates to a subsystem that describes the manner in which members interact ( 11 ) . in addition , family power structures are reflected in parental disciplinary styles ( 12 ) . from a structural perspective , a dysfunctional family system arises when problems in one or more of the hierarchical , boundary , or alignment elements of its structure impair its resources for coping with and adapting effectively to contextual stressors ( 13 ) . according to this perspective , family problems are diagnosed in the areas of power distribution , boundaries , developmental appropriateness , identified parenthood , and conflict resolution . the concept of boundaries refers to the rules that define who participates in which subsystem ( 14 ) . minuchin ( 1974 ) contended that optimal family structure throughout late adolescence is typified by obvious interpersonal boundaries and a reliable marital alliance in which parents maintain hierarchical power over children and prevent developing cross - generational alliance ( 14 ) . the existence of undifferentiated , excessively included relationships , unresolved marital conflict , and hierarchical misalignments between parent and child , position unnecessary pressure on the young adult and hinders the separation - individuation process . disengaged boundaries create danger as parents are less involved and the adolescent is overly autonomous , leading to disruption of the adolescent s feeling of belonging . the movement of thoughts and feelings between parent and child is indeed intrusive so that the adolescent s sense of feeling separate is smothered . healthy boundaries , in contrast , include a free exchange of equally nurturance and opinion ( 16 ) . the parental power correlates with decreased levels of behavior problems , like violence ( 2 ) . the families of violent adolescents have high rates of abuse , neglect , adverse behavior , and parental deviance and low rates of positive communication ( 16 ) . in other words , identifying family contextual factors that decrease , maintain , or aggravate delinquent behaviors among adolescents has long been encouraged and may be useful for decreasing risk of delinquent behaviors among adolescents exhibiting higher levels of school disengagement ( 1 ) . nevertheless , individual adolescent characteristics also have an important role in delinquent behavior ( 16 ) , although , identity development is an important predictor of risk behavior ( 17 ) . identity formation is one of the major developmental challenges that adolescents and young adults must negotiate with ( 18 ) . to effectively regulate and govern their lives , individuals need to develop a stable and meaningful identity structure , which enables them to maintain a sense of self - continuity over time and space also , it provides a frame of reference for making decisions , problem - solving , and interpreting experience and self - relevant information ( 19 ) . identity style refers to reported preferences in the social - cognitive strategies used to engage or to avoid the tasks of constructing and maintaining a sense of identity . three identity styles have been identified so far : informational , normative , and diffuse - avoidant ( 20 ) . adolescents utilizing an informational orientation are self - reflective and actively seek out and evaluate self - relevant information . those with a normative orientation more automatically adopt prescriptions , values from significant others , and conform to others expectations . young people with a diffuse - avoidant orientation procrastinate and delay dealing with identity issues for as long as possible ( 21 ) . it is important to note that families have the potential to be an important stabilizing influence in the development of adolescent identities . the family structure provides an important environment in which identity development occurs ( 22 ) . as mentioned above , family and individual adolescent characteristics are also important factors in the development and reduction of antisocial behaviors and delinquency . the current research examined the family and individual factors affecting adolescent delinquency . based on what was mentioned , we aimed to compare family power structure and identity style between delinquent and non - delinquent juveniles in tehran , iran . this study was conducted in tehran in 2012 ; it is a causal - comparative study . the sample contained two groups : 80 delinquency adolescents aged between 15 and 18 selected from tehran juvenile correction and rehabilitation centers and a non - delinquency group of 80 adolescents aged between 15 and 18 selected from tehran high school students . the delinquency group was selected by targeting sampling in tehran juvenile correction and rehabilitation centers . the adolescents of the non - delinquency group were selected with cluster sampling method from secondary schools of tehran by group matching , including age and socioeconomic status , also the parents of the two groups were matched for their level of education and employment . the inclusion criteria of the participants were as follows : - age range between 15 and 18 years , - ability to read and write , - without any severe mental disorders like , psychotic and neurotic disorders and physical illnesses , - living with both birth parents . the exclusion criteria were as follow : - age lower than 15 or over 18 years , - addicted or have severe mental disorders and physical disability , - having divorced families or single parent families . participants were asked to complete a demographic questionnaire that included questions about their age , education , birth order and personal information of their parents , including age , degree of education , and job . the family power structure ( fps ) inventory created by saidian was originally prepared in persian in 2002 ( 22 ) . the family power structure contains three subscales : family power domain couple , power structure family , and the method of enforcement of couple power . the maximum and minimum scores in the subscale of the family power structure are 230 and 46 , so that higher scores reflect greater power structure in the family . participants respond to items on a 5-point likert - type scale , ranging from 1 ( not at all true for me ) to 5 ( very true for me ) . in the original study , internal consistency reliabilities were for family power domain couple as 0.83 , family power structure as 0.85 , and the method of enforcement of couple power in the family as 0.73 . identity processing styles were assessed with the identity style inventory ( isi-6 g : white et al . 1998 ) ( 23 ) . on a 1 ( not at all like me ) to 5 ( very much like me ) likert - type scale , participants rate to which extent they considered 40 statements to be self - descriptive . the isi contains 3 continuous style scales : 1 ) the informational style scale ( 11 items : e.g. i have spent a great deal of time thinking seriously about what i should do with my life . ) with coefficient as 0.59 , 2 ) the diffuse - avoidant style scale ( 10 items : e.g. i am not really thinking about my future now ; it is still a long way off . ) with coefficient of 0.78 , and 3 ) the normative style scale ( 9 items : e.g. i prefer to deal with situations where i can rely on social norms and standards , ) with coefficient of 0.64 . the identity commitment scale ( 10 items : e.g. regarding religious beliefs , i know what i believe and do not believe ) had a coefficient of 0.81 in this study . internal consistency reliabilities for the persian version of the scale are reported as informational style , 0.73 ; normative style , 0.66 ; diffuse - avoidant style , 0.67 ; and the identity commitment , 0.73 . after obtaining parental as well as student consent , then , collected data were analyzed using independent t - test , chi - square test , and levene s test by spss-17 software . this study was conducted in tehran in 2012 ; it is a causal - comparative study . the sample contained two groups : 80 delinquency adolescents aged between 15 and 18 selected from tehran juvenile correction and rehabilitation centers and a non - delinquency group of 80 adolescents aged between 15 and 18 selected from tehran high school students . the delinquency group was selected by targeting sampling in tehran juvenile correction and rehabilitation centers . the adolescents of the non - delinquency group were selected with cluster sampling method from secondary schools of tehran by group matching , including age and socioeconomic status , also the parents of the two groups were matched for their level of education and employment . the inclusion criteria of the participants were as follows : - age range between 15 and 18 years , - ability to read and write , - without any severe mental disorders like , psychotic and neurotic disorders and physical illnesses , - living with both birth parents . the exclusion criteria were as follow : - age lower than 15 or over 18 years , - addicted or have severe mental disorders and physical disability , - having divorced families or single parent families . participants were asked to complete a demographic questionnaire that included questions about their age , education , birth order and personal information of their parents , including age , degree of education , and job . the family power structure ( fps ) inventory created by saidian was originally prepared in persian in 2002 ( 22 ) . the family power structure contains three subscales : family power domain couple , power structure family , and the method of enforcement of couple power . the maximum and minimum scores in the subscale of the family power structure are 230 and 46 , so that higher scores reflect greater power structure in the family . participants respond to items on a 5-point likert - type scale , ranging from 1 ( not at all true for me ) to 5 ( very true for me ) . in the original study , internal consistency reliabilities were for family power domain couple as 0.83 , family power structure as 0.85 , and the method of enforcement of couple power in the family as 0.73 . identity processing styles were assessed with the identity style inventory ( isi-6 g : white et al . 1998 ) ( 23 ) . on a 1 ( not at all like me ) to 5 ( very much like me ) likert - type scale , participants rate to which extent they considered 40 statements to be self - descriptive . the isi contains 3 continuous style scales : 1 ) the informational style scale ( 11 items : e.g. i have spent a great deal of time thinking seriously about what i should do with my life . ) with coefficient as 0.59 , 2 ) the diffuse - avoidant style scale ( 10 items : e.g. i am not really thinking about my future now ; it is still a long way off . ) with coefficient of 0.78 , and 3 ) the normative style scale ( 9 items : e.g. i prefer to deal with situations where i can rely on social norms and standards , ) with coefficient of 0.64 . the identity commitment scale ( 10 items : e.g. regarding religious beliefs , i know what i believe and do not believe ) had a coefficient of 0.81 in this study . internal consistency reliabilities for the persian version of the scale are reported as informational style , 0.73 ; normative style , 0.66 ; diffuse - avoidant style , 0.67 ; and the identity commitment , 0.73 . participants were asked to complete a demographic questionnaire that included questions about their age , education , birth order and personal information of their parents , including age , degree of education , and job . the family power structure ( fps ) inventory created by saidian was originally prepared in persian in 2002 ( 22 ) . the family power structure contains three subscales : family power domain couple , power structure family , and the method of enforcement of couple power . the maximum and minimum scores in the subscale of the family power structure are 230 and 46 , so that higher scores reflect greater power structure in the family . participants respond to items on a 5-point likert - type scale , ranging from 1 ( not at all true for me ) to 5 ( very true for me ) . in the original study , internal consistency reliabilities were for family power domain couple as 0.83 , family power structure as 0.85 , and the method of enforcement of couple power in the family as 0.73 . identity processing styles were assessed with the identity style inventory ( isi-6 g : white et al . 1998 ) ( 23 ) . on a 1 ( not at all like me ) to 5 ( very much like me ) likert - type scale , participants rate to which extent they considered 40 statements to be self - descriptive . the isi contains 3 continuous style scales : 1 ) the informational style scale ( 11 items : e.g. i have spent a great deal of time thinking seriously about what i should do with my life . ) with coefficient as 0.59 , 2 ) the diffuse - avoidant style scale ( 10 items : e.g. i am not really thinking about my future now ; it is still a long way off . ) with coefficient of 0.78 , and 3 ) the normative style scale ( 9 items : e.g. i prefer to deal with situations where i can rely on social norms and standards , ) with coefficient of 0.64 . the identity commitment scale ( 10 items : e.g. regarding religious beliefs , i know what i believe and do not believe ) had a coefficient of 0.81 in this study . internal consistency reliabilities for the persian version of the scale are reported as informational style , 0.73 ; normative style , 0.66 ; diffuse - avoidant style , 0.67 ; and the identity commitment , 0.73 . after obtaining parental as well as student consent , participants were asked to answer each question as honestly as possible . students were also asked to complete the isi . then , collected data were analyzed using independent t - test , chi - square test , and levene s test by spss-17 software . as shown in table 1 , the highest category of age in juvenile delinquency group belonged to 16 ( 42.5% ) years and in non - delinquent group belonged to 15 ( 35% ) years . in addition , most delinquent juveniles were the second child in the family ( 26.25% ) and the most nondelinquent juveniles were the first child in the family ( 37.5% ) . the educational attainment of the juvenile delinquency ranged from elementary to high school , among them 52.5% had a secondary school ( education ) . the highest category of education level in the nondelinquent group belonged to the ninth grade ( 31.25% ) . regarding parental educational attainment , the majority of fathers ( 33.75% ) and their mothers ( 42.5% ) had the second school and the high school education , respectively . as for parental employment status , the majority of fathers ( 52.5% ) and their mothers ( 83.75% ) were self - employed and housewives , respectively . table 3 presents the means , standard deviations , levene s test and t - test results of all variables . the results of levene s test show that variance of family power structure and its subscales between 2 groups were unequal so that t - test was used . table 3 shows that there is a significant difference between 2 groups of participants with regard to family power structure and its subclasses as well ( family power structure s total : t = 6.223 , p = 0.001 , df = 141.031 ; family power domain couple : t = 3.632 , p = 0.000 , df = 148.832 ; family power structure : t = 5.256 , p = 0.000 , df = 141.352 ; and the method of power couple enforcement within the family : t = 7.927 , p = 0.000 , df = 145.925 ) . table 4 shows that the chi - square calculated value is greater than the chi - square critical value so the null hypothesis is rejected ( p = 0.001 , x = 24.797 , df = 2 ) . in other words , there is a significant difference between identity styles in delinquent and non - delinquent juveniles . abbreviations : sd , standard deviation ; df , degree of freedom ; t , student s t - test . abbreviations : cf , cumulative frequency ; ni , absolute frequency ; f0 , observed frequency ; fe , estimated frequency . this study was conducted to determine differences with regard to family power structure and identity styles between delinquent and non - delinquent juveniles of 15 and 18 years old . results revealed that there are significant differences between delinquent and non - delinquent juveniles with regard to the family power structure . the results of the current study are comparable to previous findings which have been done in this field . for example , wentzel and feldman ( 24 ) compared the global ratings of family cohesion and family power structure to adolescent behaviors and found that adolescents who rated their parents as egalitarian were most likely to report low levels of depression and high levels of social self - concept and self - restraint . beavers ( 25 ) showed that the power structure of the delinquent juvenile family is anarchy because only one of their parents controls the whole power ( 26 ) . this power of family structure leads to the unknown boundary of their family system ( 27 ) . in a detailed review , the previous study shows that child behavior problems are related to lack of parental support and control ( 28 ) , an imbalanced parent - child relationship ( 29 , 30 ) , lack of cohesion and structure in the family ( 31 - 34 ) , and poor quality of communication between parents and children ( 14 , 35 ) . similarly , the previous study has concluded that the families of violent adolescents have high rates of abuse , neglect , aversive behavior and parental deviance and low rates of positive communication ( 7 ) . further study showed that adolescents originating from two - parent households are less inclined to engage in delinquent behavior than those originating from one - parent families ( 36 , 37 ) . these findings suggest that family structure is a significant predictor of most self - reported delinquent behaviors . based on family systematic perception , family structure was related to breaking and entering , cannabis use , fighting , theft , vandalism , and weapons possession ( 38 ) . the results of the current study reveal that identity style has a significant difference between delinquent and non - delinquent juveniles . it also showed that adolescents who utilize a normative identity style ( relying on social convention and norms to regulate their behaviors ) are nearly identical in both groups . also the informational identity style associates with lower levels of delinquency and a diffuse - evident identity style the prior research indicated that use of the informational and normative styles was negatively linked to delinquency ( 39 , 40 ) . in other words , an information - oriented style relates to a more adaptive pattern of interpersonal behaviors ( 41 , 42 ) . in addition , endorsement of social norms and conventions with strong social ties are associated with less delinquent behavior ( 39 ) . similarly , conscientiousness or constraint as reflected in careful , information - based planning is associated with a lower occurrence of delinquent behaviors ( 43 ) . however , a burgeoning body of literature indicates that individuals with a diffuse - avoidant style engage in self - serving problem behaviors and maladaptive patterns of interpersonal behaviors such as conduct disorders , delinquency , illegal drug use , and alcohol abuse ( 19 , 41 , 42 , 44 - 46 ) , while impulsiveness and low levels of self - control are associated with conduct problems and disorders ( 47 ) . philips and pittman indicated that adolescents employing a diffuse - avoidant style differed significantly from those employing information or normative styles in terms of self - esteem , hopelessness , optimism / efficacy , and delinquent attitudes . diffuse - avoidant participants were less optimistic , had lower self - esteem , expressed greater hopelessness , and had higher delinquent attitude scores than participants using either a normative or an informational style ( 47 ) . regarding the initial studies on system wide dynamics and identity formation indicating that marital stability , clear boundaries , and the absence of intergenerational alliances within the family , facilitate identity development in adolescents , also based on current and previous results studies , it seems that family structure potentially represents a meaningful target of prevention and interventions among delinquent adolescents . limitations of this study were the data source ( just one family member ) and using a self - report measure which increased the possibility that the biased reports based on the explanation of one family member . in addition , the use of retrospective data might have further altered the reliability of the family descriptions .

statins , hmg - coa reductase inhibiters , are effective in the primary and secondary prevention of cardiovascular disease and act principally by reducing cholesterol and triglyceride levels . the relationship between high levels of plasma cholesterol and atherosclerotic vascular disease is clearly established , with a reduction in total cholesterol and ldl cholesterol to below critical levels significantly reducing the risk [ 1 , 2 ] . statins are first - line agents for the prevention of vascular risk , with new drugs being added when the objectives established by guidelines are not reached . vitamin d , in addition to increasing intestinal calcium absorption , reducing parathyroid hormone levels and improving the amount and quality of bone , has a beneficial vascular effect . vitamin d deficiency has been associated with peripheral arterial disease and myocardial infarction [ 3 , 4 ] . firstly , in vitro studies have shown that vitamin d may cause an imbalance between anti - inflammatory and proinflammatory cytokines , reducing nf-b activity , increasing il-10 production , and reducing levels of il-6 , il-1 , interferon , and tnf . thirdly , the association between hypertension and vitamin d deficit is mediated by activation of the renin - angiotensin - aldosterone system . high calcitriol levels reduce plasma renin activity , leading to reduced plasma angiotensin ii concentrations . this modulation of the renin - angiotensin - aldosterone system , in addition to reducing blood pressure , reduces inflammation of the vascular endothelium , thus limiting atherosclerosis progression . therefore , adequate vitamin d levels are necessary for good vascular health . in addition , 1,25-dihydroxycholecalciferol , the active metabolite of vitamin d , bonds with the vitamin d receptor , activating cyp3a4 , an enzyme of the cytochrome p450 system , which metabolizes atorvastatin to its main metabolites . therefore , low vitamin d levels might reduce cyp3a4 activity , increasing atorvastatin levels and making it more effective in reducing cholesterol and triglyceride levels . the objective of this study was to evaluate the response of cholesterol and triglycerides to atorvastatin according to vitamin d levels . exclusion criteria were alcoholism , neoplasia , hyper- or hypocalcemia , and treatment with vitamin d , alendronate , risedronate , zoledronate , raloxifene , pth 1 - 34 , strontium ranelate , or estrogens . after diagnosis , patients received low ( 1020 mg ) or high doses ( 4080 mg ) of atorvastatin as secondary prevention according to baseline levels of cholesterol and triglycerides and the index of vascular risk in accordance with the score chart calibrated for the spanish population . patients were classified according to levels of 25-hydoxyvitamin d ( 25-ohd ) as deficient ( 25-ohd < 30 blood samples were obtained after 8 hours of fasting in the first three days after admission . cholesterol , triglyceride , hdl cholesterol , and phosphatase levels were measured using a hitachi 917 autoanalyser ( tokyo , japan ) . 25-ohd levels were determined by high - performance liquid chromatography with a 12% interassay variation coefficient . a descriptive statistical analysis was made , including measures of central tendency and scattering for quantitative variables . the student 's t - test was used to compare variables and the anova test for multiple comparisons . results are expressed as mean standard deviation ; the level of statistical significance was established as p = .05 . the study was approved by the clinical research committee of the hospital and all patients gave written informed consent to participate in the study . sixty - three patients with acute myocardial infarction ( 40 males and 23 females ) with ages ranging between 37 and 79 years were included . 30 nmol / l in 13 patients , 3050 nmol / l in 34 , and > 50 nmol / l in 16 patients . baseline patient characteristics showed no significant differences between groups , although 76% of patients with 25-ohd < 30 nmol / l have received high doses of atorvastatin . there were no significant differences between the three groups with respect to the distribution of the doses ( table 1 ) . table 2 shows the response to atorvastatin at 12 months according to vitamin d levels . in patients with 25-ohd < 30 nmol / l , there was no reduction in levels of total cholesterol , triglycerides , and ldl cholesterol but there was a significant rise in levels of hdl cholesterol . patients with insufficient and normal vitamin d levels had the expected response , with a reduction in levels of total cholesterol , triglycerides , ldl cholesterol , and elevation of hdl . there were no differences in the response according to gender or the dose of atorvastatin used , with total cholesterol levels falling in patients receiving high doses ( 181 49 versus 157 39 , p = .0008 ) and low doses ( 188 45 versus 169 41 , p = .02 ) . our results show that the reduction in levels of cholesterol and triglycerides was significantly greater in patients with insufficient and normal vitamin d levels compared to those with deficient levels . other authors have shown an added effect of vitamin d , not only on levels of cholesterol and triglycerides but also on the prevalence of cardiovascular disease . the efficacy of atorvastatin depends on its plasma concentrations and those of its hydroxylated metabolites . atorvastatin has low oral bioavailability due to rapid hepatic and renal metabolization by enzymes of the p450 system , mainly cyp3a4 - 1 . this system is a nexus of union between statins and vitamin d. bonding of the active metabolite of vitamin d brings about a change in the conformation of the receptor , which is closely linked to the x receptor of retinoic acid , forming a heterodimer . this activates gene transcription , facilitating the synthesis of specific proteins , including the enzymes of the cytochrome p450 system ( cyp3a11 , cyp3a1 , and cyp3a4 ) . these enzymes participate in the oxidation of atorvastatin , giving rise to the synthesis of two active metabolites , 2-hydroxyatorvastatin and 4-hydroxyatorvastatin . vitamin d induces p450 , reducing concentrations of atorvastatin and its active metabolites , as shown by schwartz , who studied the effects of vitamin d supplements on atorvastatin concentrations and cholesterol in 16 healthy volunteers . however , the inverse was observed , with a fall in total cholesterol and ldl cholesterol levels . the enzyme , 3-hydro-3-methylglutaryl coenzyme a ( hmg - coa ) reductase , plays a key role regulating the synthesis of cholesterol . . found that hydroxylated vitamin d derivatives inhibited hmg - coa reductase activity in lymphocytes stimulated with phytohemaglutinin . experimental studies in various cell lines have shown that treatment with cholecalciferol ( vitamin d3 ) and its metabolites ( 25-hydroxycholecalciferol , 1,25-dihydroxycholecalciferol , and24 , 25- dihydroxycholecalciferol ) inhibit cholesterol synthesis due to inhibition of the activity of hmg - coa reductase , a key enzyme in cholesterol synthesis . this effect is not produced by the active metabolite of vitamin d , 1,25-dihydoxyvitamin d . in addition , 25-hydroxyvitamin d3 can inhibits lanosterol 14- demethylase ( cyp51a1 ) , an enzyme which also intervenes in the synthesis of cholesterol . a deficit of 25-hydroxycholecalciferol increases both reductase and cyp51a1 activity , raising cholesterol levels . atorvastatin acts on this enzyme , and therefore it may be hypothesised that a specific concentration of vitamin d is required for it to synergize with the statin and exert its effect on lipid metabolism . in a previous study , we found an increase in 25-hydroxyvitamin d levels after a year of treatment with atorvastatin , with a reduction in the number of patients deficient in this hormone . similar findings have been observed in two small studies including 18 patients with familiar hypercholesterolemia , where the administration of statins ( lovastatin , simvastatin ) resulted in rises in serum concentrations of vitamin d [ 19 , 20 ] . the mechanism responsible was related to the inhibition of 3-hydroxy-3 methylglutaryl coenzyme a ( hmg - coa ) reductase which catalyzes 7-dehydrocholesterol to cholesterol . this increase might explain part of the beneficial effect of statins on bone metabolism , the increase in bone mineral density , and the reduction in the number of fractures . . recently showed that vitamin d deficiency was associated with an increase in cardiovascular mortality due to heart failure or sudden death in 3229 patients referred for coronary angiography . after adjusting for vascular risk factors , patients with vitamin d < 25 nmol / l had a threefold greater risk of death due to heart failure and a fivefold greater risk of sudden death during the seven - year follow - up . although the study sample is small , our results suggest that plasma 25-ohd concentrations above 30 nmol / l are required for atorvastatin to reduce levels of total cholesterol , triglycerides , and ldl cholesterol in patients with acute myocardial infarction .

down syndrome ( ds ) and it s chromosomal basis is the most common genetic reason for congenital malformations in the human population ( 1 ) . it has been recognized in 1933 ( 2 ) , occurring with an incidence of around 1/733 newborns ( 3 ) . some people with down syndrome are mosaics with only a proportion of trisomy 21 ( t21 ) cells , and a minority have the relevant translocation from the chromosome 21 to another chromosome . the third , and the most common type of down syndrome is standard trisomy 21 , with an extra small chromosome , in approximately 95% of individuals ( 4,5 ) . two facts are worth consideration , in these 95% of children with down syndrome , their extra chromosome is mothers origin , and in more than 80% of cases , the nondisjunction happened during the first meiotic division which completely takes place in the ovary ( 5 ) . the most intensively studied etiological factor for the occurrence of this trisomy is advanced maternal age ( 6 ) , while other risk factors are less well established . the question is , what goes wrong during the meiotic divisions of oocytes ovulated later in reproductive lifespan ? current understanding of the pathways leading to female meiotic errors is based on genetic studies on trisomy cases ( 7 ) . all studies indicate that the incidence of female origin aneuploidy slowly increases after the age of 35 years , and dramatically after the age of 38 years ( 8) . other risk factors include consanguinity , region ( urban or rural ) of residence of the family . besides these , the parental exposure to drugs or chemicals , the habits of father , prenatal scanning , and mothers reproductive functions are potential risk factors for down syndrome . the study aim was to investigate the frequency of down syndrome types in children and its association with maternal and paternal age in bosnia and herzegovina . also , the aim was to investigate possible differences between maternal , paternal and parental ages , according to the down syndrome type . the cross sectional , observational study included 127 children , 49 girls and 78 boys , aged 1 - 180 months suspected to have down syndrome , admitted to the centre for genetics , faculty of medicine university of sarajevo , for cytogenetic analyses and differential diagnosis of down syndrome during the period from january 2010 to may 2015 . children s blood samples were taken in order to perform cytogenetic analysis to confirm or dismiss down syndrome diagnosis and determinate the type of aneuploidy . the data about case maternal and paternal ages were also obtained and the parental age was calculated by summing given mother and father s age ( 9 ) . after obtaining the results of cytogenetic analyses the parental age groups were formed , as less than thirty , from thirty to forty , and forty and older ( 10)diagnosis , and subsequent termination of down s syndrome pregnancies . instructions and rules given by international system of human chromosomal nomenclature ( iscn ) were followed when the cytogenetic analysis was performed ( 11 ) . the informed consent was signed by parents and all performed procedures were in accordance with ethical approval from the faculty of medicine university of sarajevo . the data were presented as the median with range of first and third quartiles because their normality was not satisfied . the differences between groups were tested using chi square test for categorical and mann - whitney test for numerical variables . the characteristics of ds children and their parents are demonstrated in table 1 . no associations between mother and father s age and the type of down syndrome ( x2=6.49 ; the highest frequency of down syndrome cases was in mother s group 2 ( 57 children ) compared to groups 1 and 3 ( 44 ; 26 , respectively ) . considering father s age , the highest frequency of ds cases has also been noted in the group 2 ( 57 children ) , comparing to groups 3 and 1 ( 41 ; 29 , respectively ) . the most common type of down syndrome was standard trisomy 21 ( 86.6% ) , comparing to translocation and mosaicism ( 7.1% ; 6.3% , respectively ) . n - number of subjects ; % -percentage of subjects in each group ; p - probability ; x - chi - square test to represent whether the maternal , paternal or parental ages are different according to down syndrome type , results are given in figure 1 . box - and - whisker plots present the medians of parental ages in standard trisomy , translocation and mosaicism . each bar shows upper and lower quartile , while the square and its central bar indicate interquartile range and median . p - probability ; * and o - outliers the median maternal age in all down syndrome children was 33.0 ( 27.0 - 38.0 ) years , the youngest mother was 15 and the oldest 56 years old . the similar paternal age has been noticed , 35.0 ( 30.0 - 41.0 ) years , with the youngest father aged 17 , and the oldest 58 . the oldest mothers were in the mosaic group of children 35.50 ( 30.25 - 41.50 ) , comparing to the standard and translocation type ( 33.0 ( 27.0 - 38.0 ) , 28.0 ( 23.0 - 31.0 ) , respectively ) . the similar distribution was in the father s age , the oldest ones were in the mosaicism group 36.0 ( 30.0 - 45.75 ) , comparing to standard and translocation groups ( 35.0 ( 30.0 - 41.0 ) , 30.0 ( 27.5 - 32.5 ) , respectively ) . with the parental ages , the oldest parents were in mosaicism compared to standard and translocation groups ( 71.5 ( 60.25 - 87.5 ) vs. 68.0 ( 57.0 - 80.0 ) vs. 57.0 ( 50.5 - 62.0 ) , respectively ) . the significant difference was found only in maternal age between translocation and mosaicism groups ( p=0.036 ) , but mothers of children with standard down syndrome type were not statistically significantly older or younger compared to children with translocation and mosaicism ( p=0.72 , p=0.29 ; respectively ) . figure 1 also shows that no statistically significant difference was found between father s age among translocation and mosaicism types and standard trisomy 21 and mosaicism ( p=0.059 , p=0.50 , respectively ) , but the significant difference was noted between trisomy 21 and translocation ( p=0.032 ) . difference between the sum of parental years and the type of down syndrome was significant when standard trisomy 21 and translocation ( p=0.045 ) , as well as mosaicism and translocation ( p=0.036 ) , were compared . a number of hypotheses could be the answer to the question what could possibly go wrong during meiotic division of oocytes related to advanced maternal age . the most interesting hypothesis about occurrence of chromosomal nondisjunction is compromised microcirculation in perifollicular capillary bed , caused by hormonal imbalance . as a result of decreased volume , reduced blood flow occurs through that area and leads to deficit of oxygen and increase of carbon dioxide and anaerobic products inside the follicle . furthermore , intracellular ph causes displacement of a chromosome in the spindle and its nondisjunction . the compromised microcirculation hypothesis explains why women of all reproductive ages may have a down syndrome child ( 12,13 ) . also , age - related chromosome cohesion loss in oocytes may be female - specific as a cause of aneuploidy ( 14 ) . another hypothesis concerning the link between maternal age and nondisjunction is normal biological ovarian aging that is accompanied by changes in the level of circulating reproductive hormones and a decline in the number of antral follicles maturing per cycle . one of the factors that could impact biological ovary aging is cigarette consumption ( 15 ) . there is also a hypothesis that higher parity is associated with an increased risk of giving birth to a down s syndrome infant for both , women under 35 years of age and for women aged 35 years or more . an increased risk of aneuploidy is also present in women who have had many spontaneous ( and intended ) abortions . maternal health and reproductive potential have a great significance in the occurrence of down syndrome . studies have also shown that the bigger the number of abortions and the younger the mother , the higher the relative risk of a down syndrome birth , compared with the women of the same age with no previous abortions ( 17,18 ) . however there are contradicting reports regarding the maternal and paternal ages and the risk for chromosomal aneuploidy . findings from our study only partially agree with above mentioned results and they reveal that 44 cases ( 34.6% of the studied down syndrome children ) had younger mothers , whose age was less than 30 years . possible reason why mothers of younger age on the territory of bosnia and herzegovina have children with ds is that only advanced - age mothers are submitted for amniocentesis , and according to the studies , a large percentage of ds pregnancies are terminated by abortion . another possible explanation of younger mothers having more children with ds is usage of alcohol , tobacco , environmental toxins and drugs can induce chromosomal non - disjunction ( 16 ) . young mothers - to be are likely to be sleep deprived , have imbalanced diet in order not to put too much weight and those are , very often , unintended pregnancies which are all leading to bad pregnancy habits . habitual risk factors are more common among young mothers and are often correlated with unwanted pregnancies . studies demonstrate that father s age also makes a difference when calculating the chance for genetic abnormalities . our study showed that highest percentage of ds children are in the group of fathers aged 30 and more and older than 40 ( 44.9% , 32.3% , respectively ) . the reasons why younger fathers ( 22.8% of cases ) have children with ds are probably the same as those when talked about young mothers . still , there is one additional reason , a high possibility of younger man having older partner could also contribute to such a high prevalence of ds children . it is wide - known that older men produce more sperm with aneuploidy ( 1 ) . the small increase in the number of older mothers effects the number of down s syndrome pregnancies because the risk of a pregnancy affected with aneuploidy is highly increased for older mothers ; the risk for a mother aged 40 years is 16 times of that compared to 25 year - old mother . the annual number of live births with the down s syndrome diagnosis has remained fairly steady , as the number of terminated pregnancies balance those resulting from the increase related to the age . this plateau will not necessarily remain if the increase of maternal age continues and the proportion of parents that accepts screening and opting for a pregnancy termination remains steady , or decreases . however , the number of women who decide to terminate the pregnancy , when they receive down s syndrome diagnosis , has remained constant at 92% throughout the life of the register ( 10 ) diagnosis , and subsequent termination of down s syndrome pregnancies . since younger women usually do not undergo screening , the possibility of the diagnosis is reduced and they can not decide whether to terminate or deliver pregnancy to the end . when the maternal , paternal or parental ages and the down syndrome types were observed , the results were unexpected . the possible explanation is that a type of translocation ( the one that can not be inherited ) is more common in young parents to be and that s why the screening should be offered to both , mothers with advanced age as well as young mothers . the most common type of down syndrome among children in bosnia and herzegovina is standard trisomy 21 , and it is also the most common in both , mother and father s age group from 30 to 39 years old . when maternal and paternal ages were considered , significant difference was found between translocation and mosaicism in mothers , and between standard trisomy and translocation in fathers . both parents were the youngest in translocation group . advanced paternal and maternal age is one of many other risk factors for developing down syndrome . results of our study show the higher occurrence of ds in younger women , and that is why multidisciplinary approach to identifying the trigger for trisomy appearance and the influence of maternal age is required . molecular approach in addition to the classical ones of genetics , cell biology , biochemistry , epidemiology , cytogenetics , and physiology , may also be considered .

several studies have been conducted citing the neuropsychological consequences regarding non - lethal hanging of adults . the primary findings are described as memory deficits and anterograde - retrograde amnesia . however , isolated memory disturbances can occur , though rarely , without other cognitive dysfunctions accompanying them . other cognitive deficits such as visuospatial impairment , expressive language deficits , behavior and personality changes are usually associated with memory disturbance . in post - anoxic states , post - anoxic burst - suppression electroencephalography ( bs - eeg ) implies a poor prognosis . it is rare to encounter case reports in medical literature about cognitive improvement in patients with bs - eeg . we have documented our evaluation of a patient 's cognitive recovery following bs - eeg after his attempted suicide via lethal suspension . the patient was admitted with a glasgow coma scale ( gcs ) score of 3 , his brainstem reflexes were absent , and he exhibited contracted , non - reactive pupils . eeg electrodes were placed according to the international 10 - 20 system . the burst suppression pattern ( bs ) was observed during the first 3 hours of eeg [ figure 1a ] . intravenous valproic acid ( 2 400 mg per / day ) was used and myoclonic jerks ceased within 2 days . the bs pattern was diagnosed as previously described : high - voltage bursts of slow waves with sharp or spiked transients occuring against a depressed background . bs - eeg continued in the second eeg recording , in the first 24 hours [ figure 1b ] . in the third eeg recording on day 6 , temporal relationship between consciousness and eeg findings are demonstrated in [ table 1 ] . on day 10 , the patient was responding to painful stimuli with flexor motor response in his extremities and he was extubated on day 13 . in the last eeg recording [ figure 2b ] , generalized low amplitude alpha and fast beta activities were revealed and the gcs score increased to 15 . generalized periodic sharp wave paroxysms and background activity was highly suppressed [ 3 hours after injury ] number of paroxysms increased and suppression continued [ 24 hours after injury ] widespread high - amplitude slow wave activity in the frontal region [ 6 days after injury ] fast rhythm activity in the frontal region and alpha rhythm in the parieto - occipital region during the resting state nearly similar to the physiological limits [ 13 days after injury ] temporal relationship between consciousness and eeg findings neuropsychological evaluation was applied for the first month after hospitalization . a total of 10 tests were selected to cover major cognitive domains : wechsler memory scale - iii [ wms - iii , the verbal fluency , dual similarities , clock drawing test , luria drawings , benton face recognition test , famous faces test , benton judgment of line orientation test , hooper visual organization test , boston naming test . also , mild dysfunction was detected in some executive functions like working memory , planning , cognitive flexibility , and inhibitory control . a total of 10 tests were selected to cover major cognitive domains : wechsler memory scale - iii [ wms - iii , the verbal fluency , dual similarities , clock drawing test , luria drawings , benton face recognition test , famous faces test , benton judgment of line orientation test , hooper visual organization test , boston naming test . the outstanding findings were memory deficits , deterioration in the attention . also , mild dysfunction was detected in some executive functions like working memory , planning , cognitive flexibility , and inhibitory control . hanging is one of the most commonly used methods of suicide among both men and women . the impact of lethal suspension on cognitive functioning is dependent on the length of asphyxiation time . enhancing initial diagnoses with eeg and cognitive tests can provide important information in determining the prognosis . post - anoxic bs - eeg implies a poor prognosis as shown in previous related studies . wijdicks et al . reported a repeat eeg in nine patients with bs - eeg on the day of resuscitation . persisting bs - eeg was seen in six patients and transition to alpha coma pattern was seen in three patients . reported 24 consecutive patients who developed bs - eeg within 24 hours after cardiopulmonary resuscitation . in this progression , with only one exception , bs - eeg was followed by another eeg pattern within 1 day , mainly a reactive eeg , isoelectric eeg , generalized continuous epileptiform discharges and eeg . in our patient , bs - eeg continued for 24 hours , followed by different wave patterns on the eeg , which were associated with generalized slow wave patterns and low amplitude alpha activity . parallel to the clinical improvement , the eeg of our patient underwent a dramatic improvement and bs - eeg disappeared completely . post - anoxic bs - eeg and subsequently evolving eeg patterns most probably reflect different forms of dysfunction of severely damaged cortical neurons . earlier studies have demonstrated that patients with myoclonic jerks accompanying post - anoxic bs - eeg exhibit a poor prognosis and anticonvulsant drugs are usually ineffective . medication was not the cause of bs pattern in our case , as the eeg was performed prior to the use of any medication . they revealed that amnesia is not detected in all cases of hypoxic - ischemic injury ; it rarely exists as the only deficit . brain imaging methods as ct , magnetic resonance imaging ( mri ) , single photon emission tomography ( spect ) is useful in showing brain damage . , neuropsychological test battery identified mild memory deficits with an impairment of attention . bs pattern following lethal suspension has been reported for the first time . our case is highly promising as it shows a good prognosis although burst - suppression pattern was perceived in eeg .

the fasciculations can be defined as visible fast , fine , spontaneous and intermittent contractions of muscle fibers . some neurologists call them verminosis , because they look like worms moving below the dermis . undoubtedly , this finding in a neurological examination is of concern , given its close relationship with amyotrophic lateral sclerosis ( als ) , a disease that leads to a depletion of neurons in the fore tip and the pyramidal bundle . the presence of fasciculations , however , is not a sign of als when no other symptoms or signs of involvement of the fore tip and the pyramidal bundle are identified . no one knows whether the origin of als is central , in the first or second motor neurons , in the peripheral , or even in the terminal motor nerve which is an even more intriguing aspect for experts . in short , it is incorrect to associate fasciculations directly to the injury of fore tip of the spinal cord , because the skeletal pathophysiological involvement can be quite broad . this suggests that fasciculation potentials may originate anywhere in the axon , probably within the distal axonal arborization . it is also important to consider that several conditions may trigger them , such as other diseases of the fore tip of the spinal cord ( benign monomelic amyotrophy , progressive spinal muscular atrophies , hirayama disease and others ) , neuromuscular junction disorders , electrolyte disorders , systemic diseases and use of certain medications . also healthy individuals can have fasciculations , although they are generally located in well - defined sites , such as the brachial distal third , the crural area and the eyelids . with regard to fasciculations potentials induced by drugs , masland and wigiton , in a pioneering experimental study , concluded that neostigmine can cause fasciculation potentials by increasing the concentration of acetylcholine at the neuromuscular junction in felines . orsini et al . reported the case of a young man with benign fasciculations , triggered by the use of oral corticosteroids administered in immunosuppressive doses in patients with immune - mediated kidney disease , which subside completely after medication tapering . the objective of this study based on the current literature is to describe various causes of fasciculations and to discuss the pathophysiological skeletal involvement , when present ( table 1 ) . we reviewed several articles using the following databases : lilacs , scielo , medline and pubmed . in our search we used the following keywords : fasciculations , epidemiology , etiology , benign fasciculations syndrome , exercises , amyotrophic lateral sclerosis , motor neuron diseases , neuromuscular diseases , movement disorders , drugs , poisoning , physical activity and their correspondents in portuguese , spanish , japanese in the period between 1940 and 2013 . reed and kurland warned that the presence of fasciculations was not necessarily a prelude to the onset of a progressive and lethal disease , due to the involvement of the lower motor neuron . since then , several authors have explored this topic , defining a benign fasciculation syndrome ( bfs ) , that most frequently affects young healthcare professionals , who , in some cases , have already developed dyspnea . an interesting australian prospective study published recently examined the cases of 20 physicians ( 20 consecutive cases ) complaining of fasciculations . the fasciculations were mainly in the lower limbs , which had normal muscle strength . in the electrophysiological study , fasciculations potentials were of the simple type , motor conduction was normal and no signs of denervation or neurogenic changes of motor units were apparent . these authors , in agreement with others , concluded that physical exercise , stress , fatigue and caffeine abuse can precipitate or aggravate this picture . among the other six individuals in the sample , five patients manifested a cramp - fasciculation syndrome ( denny - brown syndrome ) and only one suffered from als . some authors have stated that , in order to establish the clinical diagnosis of bfs , a minimum of five years is necessary , due to the evolution , in some cases , of the motor neuron disease . a work by fermont et al . the subjects were also interviewed using questionnaires about the exacerbation of caffeine consumption and physical activity . of the total sample , 43% had fasciculations , especially in the hallucis longus abductor muscle . in the lower limbs , the authors have noted that certain physical activities , when very intense , may exacerbate symptoms in the lower limbs . although fasciculations are not classified as a motor disorder , they are conceptually abnormal movements . despite they are not rare , only a few studies investigate the association between fasciculations and motor disorders . in the cerebellum medullary degeneration type 3 ( machado - joseph disease , sca 3 ) , a dominant autosomal disease related to an unstable and increased expansion of the cag trinucleotide , is often associated with cramps , fasciculations and amyotrophy . in a series of 50 cases of sca 3 france et al . kanai and kuwabara posited that in sca 3 the severity of cramps / fasciculations correlates with peripheral axonal excitability , suggesting that the appearance of potentials is associated with subjacent axonal peripheral depletion and attempted sprouting of the remaining motor neurons for reinnervation of partially denervated muscles . recently described in japanese families by kobayashi et al . , it is characterized by an increasing expansion of the hexanucleotide ggcctg repeat in the first intron of the nop56 gene . ikeda et al . found that amyotrophy and fasciculations affected the tongue of most of the 18 sca36 patients , and in more than half of them , trunk and limbs were also affected . in the same period , garca - murias et al . described sca 36 in two families from the region of galicia in spain . however , the observed phenotype differed from the japanese one , since it occurred in association with a cerebellar syndrome , a condition of sensorineural hearing loss and restriction of movement like fasciculation or myokymia , in addition to ( small ) amyotrophy in the tongue . according to the previous description of arias et al . , sca has been present in spain since the 17th century , when such cases were discovered in the galician village of death coast . in certain situations , there are few reports of cases where such correlation is highlighted in the context of an atypical form of parkinsonism called multiple system atrophy ( msa ) . in an original article describing the shy - drager syndrome , a type of msa , the authors reported the coexistence , in the two cases described , of fasciculations with dysautonomia , parkinsonism , cerebellar syndrome and other manifestations . clinical , electrophysiological , and anatomopathological examinations indicated the degenerative involvement of spinal previous ends . in 2008 , luo et al . described the case of a 68-year - old man , whose manifestations were muscle weakness , amyotrophy , fasciculations , tremor and cerebellar syndrome . the enmg was consistent with spinal muscular atrophy ( sma ) and olivopontocerebellar atrophy ( opca ) , a type of msa , which was confirmed by the mri results . as there were no other cases in the family of the patient , the authors reported this to be the first case of sma with sporadic opca . unlike fasciculations , these are more frequent in patients with mas , myoclonus , myokymia , and involved particularly the face . machida et al . reported a case of sporadic amyotrophic lateral sclerosis with multiple system degeneration found at necropsy . a 48-year - old man who died one year after the onset of the disease had muscular atrophy , weakness and fasciculations in various body segments , ataxia and an increase of deep tendon reflexes in all four limbs in addition to rigidity and tremor . the necropsy showed a degeneration of the upper and lower motor neurons , the substantia nigra , the dentate nucleus and the locus coeruleus . under certain situations , , this link can not be considered in the presence of at least two aspects . the pyramidal damage can be so intense that it is not possible to verify a plastic hypertonicity , even when this results from a severe impairment of the substantia nigra . the other aspect is the bureaucratic interpretation of an excellent consensus for the diagnosis of amyotrophic lateral sclerosis , as the el escorial revised , and diseases that are similar to parkinsonism , as can be seen in the brain bank of the parkinson s disease society of the united kingdom . inaccurate reading of guidelines such as these can cause the elimination of different cases , due to their lack of consistency with these criteria . as a result the first references concerning the coexistence of signs of involvement of both the upper and the lower motor neurons and the parkinsonian syndromes date back to almost a century ago . in 1923 , van bertrand and van bogaert reported the pathological involvement of the basal ganglia in patients with als . in 1926 , alajouanine described the existence of motion disorders in rare cases of charcot disease . subsequently , in 1959 , van bondelle and colleagues presented a case of a woman who suffered from parkinson s disease associated with als . more recent studies confirm the relationship between these disorders in experimental animals ( transgenic mouse with super - oxide dismutase - gh1 ) based on brain scintigraphy with an assessment of the dopaminergic transmission . several syndromes , be them sporadic or hereditary , with the most diverse names have been described in relation to overlapping signs of parkinsonism , fasciculations and amyotrophy . symptoms and signs of parkinsonism , usually bradykinesia and axial rigidity , occur in 5 to 17% of als patients and often respond badly to the use of levodopa . in these patients , brain scintigraphy shows a decreased striatal dopaminergic function , while neuropathological studies reveal a neuronal loss in the substantia nigra and in the globus pallidus . on the basis of el escorial criteria they are classified as als - plus syndromes and als mimic syndromes in the presence of a parallel development of als and extrapyramidal signs . however , besides the fortuitous presence of extrapyramidal signs in the clinical course of some patients with als , it is likely that , in some conditions , pd and als develop in the same individual from the same pathogenic pathway . park and colleagues found a decrease in the transportation of dopamine in the putamen of two patients who showed parkinsonian signs and diffuse and progressive involvement in the upper and lower motor neurons . in both , the signs of als preceded the pd ones , while in the other the opposite occurred . the authors also noticed that the decrease in dopamine transportation , determined by a pre - synaptic dysfunction of the nigrostriatal pathway was more pronounced in the contralateral striatum than the parkinsonian signs and reported such cases as als with parkinsonism ( als - d ) . a recent multicentric study , which evaluated 6,471 with als , 7668 controls and 3146 with pd , found a correlation between gene variations in the gene for angiogenin in patients with als and signs of pd and increased risk of developing pd in relatives of patients with als and these variations . the authors suggest that these variations should be linked between the neurodegenerative process of als and pd . it was observed in them the occurrence of symptoms and signs consistent with pd persistent to levodopa and the subsequent development ( a few months to two years later ) of als , in the absence of any other neurological signs or symptoms . gilbert , fahn , mitsumoto and rowland reviewed data from 5500 cases of parkinsonism documented by the columbia university division of movement disorders database and compared with data from columbia university s mda / als research center . as search words parkinsonism and upper motor neuron ( umn ) , lower motor neuron ( lmn ) dysfunction , or both were used . had a form of als - p called by the authors brait - fahn disease , though with minor differences compared to the initial description , whereas in 3 cases there was a cognitive disorder and in 1 there were cerebellar changes . there were also 4 cases of frontotemporal dementia whith als , 6 cases of multiple system atrophy with als and 3 with a potential hereditary spastic paraplegia in which parkinsonism occurred with signs of involvement of lmn with or without a umn disorder . the authors did not specify in how many of these patients fasciculations were assessed , given the fact that they are considered a sign of malfunction of the lower motor neuron , amyotrophy and/or fasciculation . of the 23 cases with both parkinsonism and lmn signs , 11 showed an improvement with the use of levodopa . manno et al . , described 2 cases of brait - fahn - schwartz disease in which progressive parkinsonian symptoms and signs preceded the appearance of als . in these patients , spect with 1231-ioflupane analysis revealed a bilateral reduced striatal uptake and genetic screening for sod1 , tdp-43 , c9orf 72 , fus , angiogenin , park-1 , park-2-park and park-6 7 ( dj-1 ) mutations were negative . in both the dopaminergic therapy ( pramipexole and levodopa ) was effective and long lasting in the treatment of parkinsonian syndrome . annesi et al . described a family from southern italy with a double homozygous mutation in the dj-1 gene and a rather complex phenotype . in two of the patients described , amyotrophy and diffuse myofasciculations coexisted with bilateral piramidalism , bradykinesia , tremor at rest , rigidity . under the heading of neuromyotonias , there are reports of the coexistence of involuntary movements with fasciculations . this group is characterized by the occurrence of a failure of muscle relaxation and continuous muscle fiber activity . this rare syndrome has several causes , such as neoplastic diseases , immune - mediated diseases , including para - neoplastic , hereditary and degenerative diseases . furthermore , it is referred to as canulopatia due to loss of the voltage - dependent potassium channels function ( vgkcs ) damaged by antibodies . the failure of vgkcs results in hyperexcitability of peripheral nerves and consequent continuous muscle fiber activity . clinically , cramps are observed with fasciculations , continuous involuntary muscle activity ( clinical myokymia ) , stiffness , delayed muscle relaxation and hyperhidrosis . in the electroneuromyography , spontaneous discharges of motor unit potentials are detected during the needle test , which appear as generalized myokymia or neuromiotonic discharges . in morvan syndrome ( morvan s fibrillary chorea ) , another neuromyotonia even more unusual in which an hyperactivity in the central nervous systems ( mental confusion , disturbances mnsticos , hallucinations , insomnia and myoclonus ) coexist with peripheral symptoms ( neuromyokymias ) , the combination of fasciculations and movement disorder is controversial . describe fasciculations and tremor in a case of morvan syndrome associated with thymoma , whereas irani et al . do not mention fasciculation in any of the patients in a series of 29 cases with morvan ( 11 manifested thymoma ) . numerous motor neuron diseases occur with fasciculations , such as progressive spinal muscular atrophies , amyotrophic lateral sclerosis , benign monomelic amyotrophy , post - polio syndrome , kennedy s disease , among others . with respect to als , there are few studies that describe the early changes in the motor unit and the pathophysiological aspects both in the initial stage and along the natural course of disease . for this purpose de carvalho and swash studied the neurophysiological aspects of the anterior tibialis muscle ( ta ) in 73 als patients during the disease progression . of these , 61 had a normal muscle strength ( medical research council : 5 ) in ta and 12 a moderate paresis ( medical research council : 4 ) . we also evaluated the potential presence of fasciculations and fibrillations / sharp - waves ( fibs - sw ) , and quantified mu potentials ( mups ) and jitter . als patients with a normal strength in the ta muscle were investigated in serial studies . fasciculation potentials were recorded in the anterior tibialis muscle ( mrc=5 ) in 21 patients with als and normal motor unit potentials . longitudinal studies confirmed that the patients presenting fasciculation potentials as the only abnormality progressed to mup instability before large motor unit potentials associated with fibs - sw were detected . the complexity of fps in patients with weak ta muscle was greater than in the latter group . the authors consider the potential of an early marker in fasciculations ( als ) , which undoubtedly anticipates instability of motor unit potentials or the re - innervation process . this finding can be seen in the early stages of the disease , in which axonal excitability is increased . with disease progression neuronal dysfunction occurs with loss of motor unit potentials and a transitional process of compensatory re - innervation . deficits in neuromuscular transmission are considered one of the most important signs in the pathophysiology of als . among them fasciculation potentials are almost always identified during the clinical and neurophysiological examination , since , according to some authors , they originate in peripheral axons . it is postulated that the dysfunction of potassium channels in axons of als patients evokes hyperexcitability of the membrane ( axonal ) , which show potential fasciculations . an important fact is that the magnetic cortical stimulation can evoke the same potential fasciculations , corroborating the idea that such hyperexcitability may be present in both with the depletion of spinal motor neurons as cortical ( pyramidal tract ) . after analyzing 2681 fasciculation potentials in 17 patients with als , hirota et al . also supports the theory that the origin of fasciculations is combined . according to the authors , all these findings suggest that involvement affects both the central and the peripheral system in als . such considerations may explain in part why patients with peripheral nerve injuries and\or first motor neuron lesions may present potential fasciculations , although not very frequently . thyroid disorders such as hyperthyroidism and inappropriate secretion of thyrotropin syndrome ( ohba ) can also trigger fasciculations . similarly , hypophosphatemia and calcium disorders secondary to hyperparathyroidism can sometimes cause the same . with regard to pharmacological treatments , in a pioneering experimental study wigiton and masland concluded that neostigmine may cause fasciculations potentials by increasing the concentration of acetylcholine in the neuromuscular junction in felines . moreover , due to a similar mechanism , the same occurs during the induction of anesthesia with succinylcholine by endotracheal tube . finelli described an interesting case under the title of drug - induced creutzfeldt - jakob - like syndrome . an elderly manifested rapidly progressive dementia , postural tremor , gait instability , myoclonus and fasciculations caused by a combination of lithium and nortriptyline . postural tremor , multifocal myoclonus , amyotrophy and fasciculations were also reported in a woman treated with topiramate for migraine without aura . orsini et al . also presented a case of fasciculations caused by oral corticosteroids at immunosuppressive doses in patients with immune - mediated kidney disease . described the case of a 54-year - old man who presented a als - like condition after a brief , but intense exposure to elemental mercury . the toxicity of mercury should be considered not only in subjects with recent dysfunction of cells of the anterior horn of the spinal cord , but also with conditions like peripheral neuropathies of unknown origin , tremor , ataxia , and a range of psychiatric symptoms including confusion and depression . presented a case ( 21-year - old man ) of anti vgkc - complex antibody associated with a disorder presenting severe pain and fasciculations that predominantly in a single upper extremity . it is noteworthy that there is no specific treatment for fasciculations , as it is symptomatic . the use of antiepileptic drugs such as carbamazepine and phenytoin has shown a partial therapeutic response . gabapentin can also be used generally at low doses from 300 to 600 mg . however , due to their benign and transitional nature , it is not always necessary to treat fasciculations . a recent study proposed a new approach to treat the cramps syndrome and benign fasciculations through the identification and correction of sleep apnea , which in most cases can be one of the triggers . meanwhile , one should be aware of the diagnosis , rule out the possibility of other neurological diseases and look for less obvious causes or the presence of systemic diseases , sometimes decompensated , for example , thyroid disorders and electrolyte abnormalities . also one should watch for adverse effects to drugs , whose correction and control will allow an adequate therapeutic response . since no specific drug has yet been identified to treat these disorders , a regular clinical monitoring should be performed for some time before formulating the diagnosis . considering the wide pathophysiological skeletal involvement in the genesis of fasciculations , first it is necessary to identify their origin and then the therapeutic target .

diverticular diseases of the gallbladder are unusual congenital or acquired diseases occurring only in 0.1% to 0.2% of cases in previous studies of resected gallbladder specimens.1 - 3 these diseases are divided into congenital ( true ) diverticula and acquired pseudodiverticula according to different developmental , clinical , and pathological features.4,5 we describe a unique imaging case of pseudodiverticulosis of the gallbladder mimicking multiseptate gallbladder accompanied with multiple stones , as confirmed by surgical operation . a 70-year - old woman presented with right upper quadrant abdominal pain radiating to the right lower abdomen ; the pain had begun to aggravate the subject 8 to 9 hours earlier . laboratory tests revealed the followings : white blood cell count , 8.90010/l ; hemoglobin , 13.4 g / dl ; amylase , 36 iu / l ; aspartate aminotransferase , 42 u / l ; alanine aminotransferase , 50 u / l ; and alkaline phosphatase , 162 iu / l . abdominal ultrasonography revealed multiple hyperechoic lesions in the gallbladder and linear septum - like structures in the fundus of the gallbladder . subsequently , endoscopic retrograde cholangiography ( erc ) was performed to evaluate the lesion ; it showed multiple linear septated radiolucent defects and a diffusely scattered bunch of grape - like saccular filling defects in the elongated gallbladder ( fig . 1 ) . operative findings showed a normal outer surface of the elongated gallbladder without any protruding lesions fixed on the gallbladder fossa of the liver ( fig . 2 ) . grossly , multiple black stones and a round saccular lesion with an intervening septum - like structure were noted on the dissected gallbladder specimen ( fig . microscopic findings showed mucosal gland structures downsloping into a thin muscle layer ( characteristically , the muscle layer is not thickened ) , which was different from adenomyomatosis ( fig . gallbladder anomalies are diversely classified according to the shape and position of the phrygian cap , multiseptation , and diverticula . erc can be helpful in making a diagnosis and in the differentiation of these anomalous diseases . one septum or fold of the gallbladder between the fundus and the body is called the " phrygian cap ; " whereas , multiseptate gallbladders are characterized by multiple internal septa of various sizes , and a faintly bosselated external surface.6 - 8 gallbladder diverticulum is an unusual congenital disease , which has the appearance of a hernia - like protrusion of the normal gallbladder wall . this disorder may not be diagnosed until surgically resected because it has no clinical significance unless there are associated diseases.1 - 3 gallbladder pseudodiverticulum is a different type of adenomyomatosis pathologically , and can be differentiated from other similar anomalies based on some important factors . pseudodiverticula have an acquired cause , multiple fundal lesions , an association with gallstones , internal saccular lesions without external hernia - like protrusions , and little to no smooth muscle in the gallbladder wall ( table 1).7,8 in our case , erc revealed a unique shape similar to a bunch of grapes and a septation infilling pattern , contrasting with the fundus of a lengthened gallbladder . we found a multiseptate gallbladder ; it was characterized by a " honeycomb " multicystic pattern and further characterized by multiple fixed lucent defects within an opacified gallbladder . however , operative findings showed a grossly normal gallbladder without any outpouches of the wall or inflammatory changes , and we could see multiple saccular outpouches internally with multiple gallstones when the gallbladder was opened . histopathologic examination revealed multiple pseudodiverticula , which were characterized by multiple downslopings of the mucosal gland to a thin muscle layer of fundus . this lesion was different from the fundal type of lesion that is typical of adenomyomatosis or true diverticula , in terms of the definitive muscle thinness . in summary , we diagnosed a unique , acquired anomaly of multiple pseudodiverticula presenting with calculous cholecystitis , which was pathologically different from true diverticula , adenomyomatosis , or multiseptate gallbladders .

hypertension is predominantly essential , but in 15% of cases it is secondary to renal or endocrine diseases . pheochromocytoma and extra - adrenal paraganglioma are rare chromaffin tumours arising from neural crest tissue that develops into sympathetic and parasympathetic paraganglia throughout the body . these tumours may secrete large amounts of catecholamines and represent an uncommon identifiable cause of resistant hypertension . the world health organization classification uses the term pheochromocytoma only for tumours of adrenal medulla origin and the term paraganglioma for similar lesions that arise from other locations . catecholamine - secreting tumours occur in less than 0.1% of the hypertensive population ; the peak incidence is between the third and fifth life decades , with both genders being equally affected . twenty - five percent of pheochromocytoma and paraganglioma occur in the setting of familial syndromes ( sdh gene mutations ; men 2a / b ; von hipple - lindau ; neurofibromatosis i ; carney triad ) . thus , family history should be carefully investigated in patients with catecholamine - secreting tumours , and all relatives should be screened for hereditary syndromes [ 46 ] . most paragangliomas are solitary , but they tend to be multicentric in hereditary syndromes ; in an institutional series of 12 cases , 25% were multicentric . less than 2% of reported paraganglioma are located in the chest and intrapericardial paraganglioma ( ip ) is even rarer . most ips are large , ranging in size from 3 to 8 cm [ 6 , 7 ] ; in the 72 cases listed in table 1 , the average tumour diameter was about 5 cm . little is known regarding long - term survival of ip patients , as long - term follow - up studies are not available . the rarity of ip is well documented , only 30 cases being reported until 1992 . we reviewed the medical literature subsequently published and found that over the two - decade period 19942013 three institutional series [ 5 , 6 , 9 ] including altogether 33 cases and 39 other individual case reports of ip were described ( table 1 ) . in total , arterial hypertension is the most common clinical presentation of ip ; about 10% of reported paragangliomas are clinically silent ( table 1 ) , the tumour being diagnosed incidentally after chest radiography , computed tomography ( ct ) , or magnetic resonance ( mr ) imaging performed for unrelated reasons . more frequently the disease presents with paroxysmal symptoms of excess catecholamine production , which include hypertension , headache , palpitations , tremor , and facial pallor . hypertension episodes are variable in frequency , severity , and duration and are difficult to treat . the hypertension crisis may induce arrhythmia and myocardial ischemia and may even be fatal . bursts of catecholamine secretion can be provoked by a variety of events , which include accidental or surgical trauma , anaesthesia induction , invasive procedures , and eating food with high level of tyramine ( e.g. , red wine , chocolate , and cheese ) . about 20% of ips are nonfunctioning ( table 1 ) and may present as a mass with symptoms related to compression of other organs , or they are incidentally discovered during imaging studies [ 9 , 10 ] . the diagnosis of functioning paraganglioma requires biochemical testing to document elevated catecholamine secretion and is generally obtained by determining the plasma level of fractionated metanephrines during hypertensive crisis and the 24-hour urine normetanephrine level . imaging exams to localize the tumour and its metastases include ct and mr imaging , coupled with 123-i - metaiodobenzylguanidine ( mibg ) scintigraphy . some ip cases have been incidentally identified by chest radiography , as an enlargement of mediastinum or splaying of the carina by the tumour mass . on ct scan ip typically appears as a well - enhancing mass , predominantly located in the posterior mediastinum or in the aortic - pulmonary window . the most frequent location is in close proximity to the left atrium ( table 1 ) . ct and mr images allow to clarify tumour mass relationships with surrounding mediastinal structures and are of great importance for planning surgical resection . resection must be completed with minimal tumour manipulation to prevent hypertensive crisis and tumour seeding . control of tumour vascular supply requires adequate operative field exposure to avoid injury to surrounding organs . the operative access to the mediastinum depends on location and size of the lesion , as well as on the adjacent structures involved . generally , the surgical approach to ip is with sternotomy , as cardiopulmonary bypass ( cpbp ) is usually planned for tumour removal . less commonly , ip can be resected without cpbp , through left or right thoracotomy , depending on tumour location . if size and location of the lesion are favourable , the approach can also be with minimally invasive videothoracoscopic technique . patients with unresectable or metastatic disease may be treated with chemotherapy , radiofrequency thermoablation , cryoablation , and catecholamine blockade . perioperative management of ip patients is a challenge for anaesthesiologists and surgeons . over the last 50 years , shared management of the patient involving also endocrinologists and cardiologists translated into a marked reduction of perioperative mortality from 4060% to 06% . in preparation for surgery , a detailed medical history is essential , along with physical examination , complete laboratory exams , and evaluation by cardiologist and anaesthesiologist . it is important to detect the presence of a cardiomyopathy or coronary artery disease by ecg , echocardiography , and coronary angiography , if necessary . however , for young patients without history of heart disease , it is debated whether preoperative ecg only is sufficient . echocardiography should be done to assess the presence of hypertrophic , dilated or tako - tsubo cardiomyopathy . this imaging technique is also useful to localize cardiac paraganglioma . if hypertrophic cardiomyopathy as a result of chronic norepinephrine - induced hypertension is found , it is mostly symmetric and concentric [ 12 , 13 ] . an interesting finding in patients with functioning chromaffin tumours is the stress - related tako - tsubo cardiomyopathy , also called left ventricular apical ballooning syndrome . the pathophysiology of stress - induced and chromaffin tumour - induced cardiomyopathy is believed to be similar and mediated by catecholamines causing myocardial stunning . typically in tako - tsubo disease , common electrocardiographic findings in patients with catecholamine - secreting tumours are high qrs amplitudes with abnormal r , changes in st - segment and t waves , and prolongation of the q - tc interval . preoperative medical management to block the deleterious effects of excess catecholamine release and to allow plasma volume expansion is recommended . although -adrenoceptor antagonists , calcium - channel blockers , or angiotensin - receptor blockers have all been recommended , there are no evidence - based guidelines on the preferred drugs for preoperative catecholamine blockade . consequently , there are widely ranging practices and international differences in perioperative pharmacologic management and approved therapies . special preparation of the patient undergoing surgical removal of paraganglioma is necessary once clinical , instrumental , and laboratory evaluations are completed . without preoperative medical treatment , induction of anaesthesia or other stimuli can cause a hypertensive crisis , cardiac arrhythmias , and infarction or stroke , due to massive catecholamine release . pharmacological treatment should be instituted for 1 to 2 weeks before surgery , to optimize cardiovascular function by relaxation of the constricted vasculature , expansion of the reduced plasma volume , and normalization of blood pressure . setting , interventions are focused on maintaining adequate plasma volume and on lowering blood pressure using - and -blockers . alpha - adrenergic blockade should be started prior to -adrenergic blockade to prevent acute hypertensive crisis . alpha - blockade is generally initiated 7 to 10 days before surgery , using different drugs ( phenoxybenzamine , prazosin , or doxazosin ) to achieve a systolic blood pressure below 120 mmhg when seated and below 90 mmhg when standing . it is recommended that no blood pressure > 160/90 mmhg values should be evident 24 hours before surgery , and an orthostatic hypotensive response ( blood pressure > 80/45 mmhg ) should be present . moreover , no electrocardiographic st / t segment changes at least for 1 week should be evident . after reaching these blood pressure values , it is possible to initiate -blocker administration , using low dosages to reduce the risk of negative inotropy . magnesium sulphate has also been shown useful to control blood pressure , when haemodynamic stability is difficult to achieve . during the operative period , it is essential to closely monitor cardiovascular function by electrocardiogram and to assess urine output , pulse oxinmetry , capnography , and body temperature . it may be necessary to monitor cerebral function with electroencephalography , if the patient has a recent history of cerebral infarction . cardiovascular monitoring requires an intra - arterial catheter and a central venous catheter to respond quickly to haemodynamic changes with vasoactive agents or fluid administration . pulmonary capillary wedge pressuremonitoring may be useful because of discrepancy between right - sided and left - sided filling pressures , but the routine use of pulmonary catheters remains controversial . transesophageal echocardiography is useful to optimise intravenous fluid administration and to assess perioperative cardiac function [ 13 , 20 ] . intravenous or inhalation agents have been used with success , but drugs that stimulate the sympathetic system responses or that may cause mechanical stimulation of the tumour by fasciculations , such as succinylcholine , should be avoided . sodium nitroprusside should be used in patients with a history of acute myocardial infarction or congestive heart failure , although this drug has potential for overshoot hypotension . phentolamine is -adrenergic antagonist that can be given intravenously as continuous infusion or as boluses of 1 to 2 mg ; it can cause tachycardia if the patient is not receiving -blockers . calcium channel blockers have some advantages over sodium nitroprusside , such as less risk of deep hypotension , no rebound hypertension , more controlled heart rate , and absence of cyanide toxicity . fenoldopam , a dopamine-1 receptor agonist that causes peripheral vasodilation and increases renal blood flow , may also be used . after tumour removal , it is essential to control hypotension that may result from inadequate intravascular volume , residual -adrenergic antagonist effect , alteration of venous capacitance and haemorrhage . priority should be given to volume replacement , which seems to be the main factor responsible for reduction of intraoperative mortality in chromaffin tumour surgery [ 12 , 22 ] . in addition to blood pressure control , it is necessary to carefully monitor blood glucose level , because hypoglycemia may develop after tumour removal , due to rebound hyperinsulinism , as the inhibitory effect of norepinephrine on insulin secretion is eliminated . to illustrate the intraoperative management of anaesthesia , we report in figure 1 the details of -blocker and -adrenergic antagonist administration in a case undergoing surgery for removal of ip at our institution . the patient , a 34-year - old woman with a history of recent episodes of headache , palpitation , and flushing , had hypertension ( 180/90 mm hg ) poorly controlled by ramipril . she was diagnosed with a functioning ip localized below the left atrial roof ( figure 2 ) . tumour resection was carried out through right thoracotomy without cpbp . a hypertensive crisis developed at the time of general anaesthesia induction ( 210/100 mm hg ) . during the critical steps of surgery , it was necessary to administer a greater amount of the anaesthetic drug sevoflurane , in association with multiple boluses of - and -blockers . total labetalol boluses administered amounted to 125 mg , in addition to continuous infusion of labetalol 2 mg / ml ( maximum administration of 0.266 mg / min ) . phentolamine was administered in boluses of 1 - 2 mg ( 50 mg total ) ( figure 1 ) . after successful resection of the intrapericardial mass , which was histologically shown to be a chromogranin a - positive paraganglioma ( figure 3 ) , the patient was discharged normotensive . some authors have questioned the validity of systematic preoperative optimization of blood pressure and volume expansion , drawing attention to the lack of evidence - based studies . however , there is abundant literature to support a proper pharmacological preparation in all patients with functioning paraganglioma and pheochromocytoma , especially in subjects with cardiovascular risk . alpha - adrenergic blockade ( phenoxybenzamine or phentolamine ) is usually started at the time of diagnosis and it is carried on preoperatively under close blood pressure monitoring , to prevent cardiovascular complications that may occur during surgery due to excess catecholamine secretion . the goal of intraoperative pharmacologic therapy is to prevent sudden rise and fall of blood pressure . beta - adrenergic and calcium channel blockade can be used as adjuncts when blood pressure or tachycardia can not be controlled . at the time of tumour vascular supply control , rapid decrease of catecholamine level and rebound hypotension should be expected , and preoperative volume expansion helps in preventing it . after surgical removal of ip , approximately 80% of patients become normotensive ( table 1 ) . the other 20% remain hypertensive without biochemical evidence of residual tumour , due to associated essential hypertension or to acquired renovascular changes . tumour recurrence in case of incomplete resection may occur ; moreover , approximately 10% ips were found to be malignant ; therefore , systematic follow - up is recommended . there is no general agreement on the method and frequency of follow - up after paraganglioma resection . long - term follow - up is recommended with blood pressure measurements and periodic determination of urinary metanephrines ; if necessary , 123-i - mibg scintigraphy and ct imaging should be obtained . surgical removal is the gold - standard treatment and normalizes blood pressure in about 80% of hypertensive cases ; 20% remain hypertensive , likely due to associated essential hypertension . preoperative medical preparation is critical to prevent cardiovascular complications that may result from excess catecholamine secretion during anaesthesia induction and surgical manipulation of the tumour . alpha - adrenergic blockade and -blockers are usually started at the time of diagnosis and this treatment is carried on perioperatively under close monitoring of blood pressure . due to the rarity of functioning paraganglioma , systematic perioperative optimization of blood pressure and volume expansion has not been validated by randomized studies . however , there is abundant literature to support the value of pharmacological preparation and volume expansion to prevent cardiovascular complications .

mild cognitive impairment ( mci ) often represents a transitional state between normal cognition and alzheimer 's disease ( ad ) [ 1 , 2 ] . accurate prediction of transition from mci to ad aids in prognosis and targeting early treatment . episodic verbal memory impairment and informant report of functional deficits in complex social and cognitive tasks are features of incipient ad , and impairment in these domains is associated with transition from mci to ad [ 4 , 5 ] . most biomarkers of mci transition to ad are related to the underlying disease pathology of amyloid plaques and neurofibrillary tangles . hippocampal and entorhinal cortex atrophy on mri scan of brain , parietotemporal hypometabolism on fdg pet , increased amyloid uptake using pet , and decreased amyloid beta-42 ( a42 ) with increased tau / phospho - tau levels in the cerebrospinal fluid ( csf ) [ 10 , 11 ] each significantly predict transition from mci to ad . the apolipoprotein e 4 allele increases ad risk , but is not a strong biomarker of transition from mci to ad . in a meta - analysis , memory deficits appeared to be superior to mri hippocampal atrophy in predicting transition to ad , but studies in the meta - analysis had highly variable subject inclusion / exclusion criteria and assessment methods . there has been a lack of direct head - to - head comparison of clinical and neuroimaging predictors of transition across different studies . in our single - site study ( questionable dementia or qd study ) that evaluated and followed a broadly defined sample of patients with mci , a published predictor model that included specific cognitive , functional , olfactory , and mri measures strongly predicted transition to ad . in the alzheimer 's disease neuroimaging initiative ( adni ) study , cognitive and functional measures and several biomarkers are assessed in samples of mci , ad , and healthy control subjects at baseline and serially during followup . in this paper , the first goal was to test the accuracy of a combination of predictor variables derived from the qd study to predict transition from mci to ad in a completely independent adni sample . the validation of specific predictor combinations , rather than individual measures , has rarely been done in independent samples . this is essential before specific cut - points , and ranges for specific predictors in such models can be developed with confidence for eventual clinical application . the second goal was to evaluate the relative utility of clinical and mri measures in predicting transition from mci to ad . patients with mci in the qd and adni studies were included , and patients with ad ( adni ) and healthy control subjects ( qd and adni ) were excluded . the 3-year followup samples were chosen because most transitions occur to ad within 3 years of clinical presentation . as previously reported , patients 4185 years old who presented with subjective memory complaints for clinical evaluation to a memory disorders clinic were eligible if they had a folstein mini - mental state exam ( mmse ) score 22 out of 30 , memory impairment defined as mmse recall 2/3 objects at 5 minutes or a selective reminding test ( srt ) delayed recall score > 1 sd below norms , and absence of a consensus diagnosis of dementia made by two experienced raters . baseline mci subtype using the criterion of > 1.5 sd below norms on cognitive tests was determined post hoc by using age , education , and sex - based regression norms derived from 83 healthy control subjects . using this approach , 73% of patients met the peterson criteria for single or multidomain amnestic mci , and this subsample was also compared to adni . patients were followed every 6 months for up to 9 years , and the two raters made a consensus diagnosis at each time point . the sample comprised 148 patients with mci at baseline , and 126 patients were in the 3-year followup sample . data were obtained from the adni study ( http://adni.loni.ucla.edu/ ) , a project launched in 2003 by the national institute on aging , the national institute of biomedical imaging and bioengineering , the food and drug administration , private pharmaceutical companies , and non - profit organizations as a $ 60 million , 5-year public - private partnership . the primary goal is to test whether serial magnetic resonance imaging , positron emission tomography , other biological markers , and clinical and neuropsychological assessment can be combined to measure the progression of mci and early ad . participants 5590 years old were enrolled if they had at least 6 years of education , spoke english or spanish , agreed to longitudinal followup and neuroimaging tests , had single or multidomain mci by the petersen criteria with mmse scores between 24 and 30 , a memory complaint verified by informant , an abnormal memory score ( 1.5 sd below age - adjusted cutoff ) on the logical memory ii subscale ( delayed paragraph recall ) from the wechsler memory scale - revised , and absence of a dementia diagnosis . all participants had a geriatric depression scale score of < 6 and a modified hachinski score of 4 . for a more detailed account of the inclusion / exclusion criteria , please see http://www.adni-info.org . raters at each site made consensus diagnoses at six - month intervals that included an evaluation of transition from mci to ad , which was reviewed by a central committee . of 394 individuals with mci at baseline evaluation , 282 subjects completed 3 years of followup . in the qd study , the srt total recall ( 12 items , 6 trials ) was the strongest predictor among the five hypothesized neuropsychological predictors examined . the srt was not done in adni , but the comparable measure of total recall across 6 trials in the auditory verbal learning test ( avlt ) was not used for study inclusion criteria and was available . informant report of the patient 's functioning using the pfeffer functional activities questionnaire ( faq ) total score and mri hippocampal and entorhinal cortex volumes was additional predictors in the final model in qd that were also assessed in adni . both studies conducted mri on 1.5 t scanners : a single ge scanner in qd , and ge or siemens or philips scanners across 48 sites in adni . in qd , hippocampal volume was assessed by a semiautomated method with specific anatomical landmarks used to define hippocampal boundaries , and entorhinal cortex volume was computed from three slices centered at the level of the mammillary bodies . in adni , mri hippocampal and entorhinal cortex volumes were derived from postprocessed image analysis that used freesurfer ( fs ) version 4.3.0 by researchers at the university of california , san francisco ( ucsffsx ) ; the data are available at http://adni.loni.ucla.edu/. the volume derivation process is described at http://www.loni.ucla.edu/twiki/bin/view/adni/adnipostproc . for both studies , intracranial volume was a covariate in all analyses of hippocampal and entorhinal cortex volumes . summary statistics were calculated to describe the sample characteristics in the adni and qd studies . for each study , chi - square and t - tests were used to detect differences in baseline categorical and continuous variables between mci patients with and without transition to ad by three years of followup ( there were few non - ad dementia cases in both studies ) . the qd and adni studies had different available followup duration times , and therefore survival analysis was not used for comparisons . for both datasets , specific sets of baseline predictors were examined in logistic regression models for the binary outcome of transition to ad within 3 years after baseline evaluation . with each model , sensitivity and specificity were calculated for all possible cut points on the predicted risk of transition to ad to construct receiver operating characteristic ( roc ) curves . from the roc curves , the area under the curve ( auc ) compared to the qd sample , the adni sample was older , had a greater proportion of males , had a higher proportion with the apoe 4 allele , and reported greater functional impairment ( table 1 ) . the samples did not differ in years of educational attainment and mmse scores . the majority of patients in adni ( 157/282 or 55.6% ) and a minority of patients in qd ( 33/126 or 26.1% ) converted to ad by 3-year followup ; the disparity likely related to more stringent inclusion criteria for memory impairment in adni compared to qd . based on logistic regression analyses , the combination of age and mmse was a poor predictor in adni and showed low sensitivity at the fixed level of 90% specificity in qd ( top of table 2 ) . models that included age with mmse and specific combinations of avlt or srt total recall , faq scores , hippocampal and entorhinal cortex volumes showed greater sensitivity , specificity , and predictive accuracy in the qd study compared to adni ( table 2 ) . three predictor models were compared within and across studies with age and mmse , which are common clinical indicators , contained in all models . model 1 included avlt / srt and faq , model 2 included hippocampal and entorhinal cortex volumes , and model 3 included avlt / srt , faq , and hippocampal and entorhinal cortex volumes ( table 2 ) . in each study , the increase in auc for model 1 compared to model 2 was marginal ( around 0.04 in both studies ) and not statistically significant ( bottom of table 2 ) . the auc increased consistently across the two studies when episodic verbal memory ( avlt / srt ) and function ( faq ) measures were added to the model containing the combination of age , mmse , and hippocampal and entorhinal cortex volumes ( p < 0.0001 in adni and p = 0.0254 in qd ; model 2 versus model 3 , bottom of table 2 and figure 1 ) , with an appreciable increase in sensitivity for a fixed specificity of 80% and 90% in both adni ( increases of 17% and 15% , resp . ) and qd ( increases of 10% and 17% , resp . ; conversely , adding hippocampal and entorhinal cortex volumes to avlt / srt , faq , age , and mmse significantly increased the auc in adni ( p = 0.0035 ) but not in qd ( p = 0.20 ) and led to a small increase in sensitivity for a fixed specificity of 80% and 90% in adni ( increases of 2% and 6% , resp . ) and qd ( increases of 2% and 7% , respectively , top of table 2 ) . in both samples , the differences in aucs between the three statistical models examined were very similar ( bottom of table 2 ) . when the qd sample was restricted to patients with baseline amnestic mci ( 32/90 transitioned to ad ) using comparable criteria to adni inclusion criteria for amnestic mci , the results were similar to the entire qd sample : 80.7% were correctly classified for model 1 , 85.5% for model 2 , and 84.2% for model 3 . aucs were 0.877 for model 1 , 0.905 in model 2 , and 0.915 in model 3 without significant differences in aucs , partly because of reduced sample size . within each sample , qd and adni , the differences in aucs between predictor models were similar , suggesting robustness and generalizability across outpatient settings . when advising patients and families about the likelihood of transition from mci to ad , a predictor model with specificity over 80% is essential because a false positive rate of over 20% ( specificity less than 80% ) is clinically unacceptable [ 14 , 15 ] . in the predictor model , adding hippocampal and entorhinal cortex atrophy to age , mmse , and the episodic verbal memory and function measures increased sensitivity only to a small extent at fixed specificities of 80% and 90% . these findings suggest limited added utility for mri hippocampal and entorhinal cortex volumes to clinical assessment of memory and function in predicting transition from mci to ad . in contrast , adding measures of episodic verbal memory and function to the model that combined age , mmse , and hippocampal and entorhinal cortex volumes appreciably increased sensitivity for fixed levels of 80% and 90% specificity in both samples . in both studies , the model that included avlt / srt , faq , and hippocampal and entorhinal cortex volumes with age and mmse showed the strongest predictive accuracy . for episodic verbal memory measures , numerical ranges and cutoffs for specific ages and education levels can inform the likelihood of transition to ad . although delayed recall deficit is typical in ad , both immediate recall ( incorporates learning ) and delayed recall show comparable predictive accuracy for the transition from mci to ad . the use of a single episodic memory measure in the predictor models examined does not replace the need for a comprehensive neuropsychological evaluation for diagnostic purposes . informant reports of faq scores reflect instrumental , social , and cognitive functional impairments , but specific cutoffs for prediction of transition to ad are not established [ 5 , 16 ] . international efforts to standardize mri imaging parameters and methods of volumetric assessment , both of which have varied widely across studies , may lead to the development of specific cutoffs for hippocampal and entorhinal cortex atrophy that improve predictive accuracy . the use of cognitive markers has some advantages over neuroimaging : objectivity in scoring , comparative economy in expense and time , and reliability . one argument is that episodic verbal memory should not be used as a marker because it is used for inclusion criteria and in the diagnostic process . however , evaluation of severity of episodic verbal memory deficit as a predictor in patients with amnestic mci who have episodic verbal memory deficits is analogous to the established strategy of evaluating severity of depression as a predictor of clinical course and treatment response in major depression . further , using memory test scores in prediction creates a statistical handicap , rather than an advantage , by restricting the range in baseline memory test performance . of note , the avlt memory measure examined as a predictor in this paper was not part of the study inclusion criteria in adni ( wms - r logical memory was used ) . the same rationale applies to the incorporation of the mmse , which is widely used and clinically relevant , in predictor analyses even though it is part of the screening criteria for study inclusion . informant report of functional impairment using the faq was not part of the inclusion criteria in either qd or adni , and the definition of mci by the original petersen criteria requires the absence of significant functional impairment [ 1 , 2 ] . therefore , the use of informant report of functional impairment is independent of the diagnostic criteria for mci , and our findings indicate that this type of assessment is important in predicting transition to ad [ 3 , 5 ] . an international panel used the terms prodromal dementia and predementia to indicate that neurobiological markers may identify patients with incipient ad who can not be diagnosed clinically . the new nia diagnostic criteria separate core clinical criteria from research criteria that employ neurobiological markers , partly because diagnostic and predictive accuracy for neurobiological markers has not been fully developed and validated . there have been few comparisons of predictor models between studies . in a comparison of adni to a finnish study , classification performance did not increase after the inclusion of 10 variables that included csf measures , apolipoprotein e 4 , mri measures , age , and education . the overall model was not strong , possibly because key cognitive and functional measures were excluded . another study compared different samples of patients with mci who had fdg pet with generally positive results but without cut - points for clinical application . our report represents a novel independent validation of predictor models that included clinical , memory , functional , and mri measures . the consistency in the differences between models in each study indicates that this two - study comparison is broader and more clinically relevant than prior validation attempts [ 21 , 22 ] . from the adni database , several reports show moderate predictive accuracy for weighted scores within a global cognitive test and moderately strong predictive accuracy for specific neuropsychological test scores , consistent with other studies . the best possible fit from a high - dimensional pattern classification approach using adni mri data led to results similar to our report that used volumetric measures , but other mri analytic strategies using adni data have led to lower predictive accuracy [ 26 , 27 ] . entorhinal cortex volume enhanced prediction in both adni and qd in our comparisons , supporting the evaluation of entorhinal cortex volume as a predictor . the two samples differed in sex and age distribution and cognitive test scores , significant episodic verbal memory deficits were required in adni compared to broader inclusion criteria in qd that may partly account for higher transition rates in adni , and different episodic verbal memory measures and different mri volumetric assessment methods were compared . nonetheless , within each sample for several combinations of predictors the differences in aucs were similar . the high transition rate in adni suggests that some patients diagnosed with mci by 3-year followup may convert in subsequent years , likely leading to a higher rate of false negatives in adni . this may partly explain the lower accuracy for predictor combinations in adni . in adni , the smaller number of patients at 3-year followup was partly related to some recently recruited patients not yet having had the opportunity to reach 3-year followup at the time of data analysis for this paper . this issue also precluded the use of survival analysis in this sample . in qd , we derived the strongest predictors from a set of a priori measures in a large neuropsychological test battery and examined comparable measures from the shorter adni neuropsychological assessment . while administering a comprehensive neuropsychological test battery is important for diagnostic purposes , our clinically relevant approach of examining individual measures facilitates comparison across studies and demonstrates the predictive strength of even a single episodic verbal memory test . it remains unclear if serial imaging measures are superior to baseline imaging in predicting long - term outcome . serial imaging measures provide useful information about structural changes associated with disease progression , but they are expensive , not current clinical practice , and not useful in early converters . cerebrovascular disease may contribute to cognitive decline in these patients [ 19 , 20 ] . however , hyperintensities , lacunes , and infarcts could not be assessed systematically in qd because of the mri sequences obtained ( no flair or comparable sequence ) and therefore could not be compared with adni . absent neuropathological validation , we considered examining csf measures from adni ( not done in qd ) for in vivo validation of transition to ad , but csf was not collected in approximately half the adni sample and neuropathological validation of csf tau and a abnormalities has not been established . in qd , the pathophysiological measure of olfactory identification deficits ( not done in adni ) strongly predicted transition to ad with limited overlap in prediction with the srt and mri measures [ 3 , 29 ] . in adni , fdg indices ( not done in qd ) significantly predicted transition to ad and were superior to the adas - cog , but the adas - cog is a global cognitive measure used primarily in clinical trials of ad patients and is not established as a strong predictor of transition from mci to ad . pet amyloid imaging discriminates among ad , mci , and controls and correlates at autopsy with amyloid plaques . however , approximately 1030% of healthy controls show increased amyloid uptake and whether these subjects have incipient ad needs confirmation in long - term followup studies . the sensitivity and specificity of csf levels of a42 and tau / phospho tau , and their ratio , for predicting mci transition to ad in adni and in a european multicenter study ranged from 65% to 75% , which is slightly lower than that in other reports [ 10 , 11 ] . for csf markers , further refinement of assay technique and validation in long - term followup studies are needed to establish more definitive cut - points for individual and ratio measures that have varied to some extent across studies [ 10 , 11 , 32 ] . this report suggests that volumetric evaluation of medial temporal lobe atrophy adds only marginally to the information obtained by cognitive testing and assessment of episodic memory , and it can not yet be recommended for wide clinical use to assess the risk of patients with mci being diagnosed with ad during followup . in the clinic , visual inspection ratings are likely to lead to lower predictive accuracy than either the qd or adni volumetric assessments . structural neuroimaging with mri remains useful to rule out specific causes of cognitive impairment , for example , stroke , tumor . a key conclusion from this report is that conducting neuropsychological evaluation is important , and interviewing family members or other informants about the patient 's functioning may be at least as important as conducting an mri scan . several clinical and neurobiological markers , including cognitive test scores , functional ability , and mri and fdg pet measures , are influenced considerably by age and other demographic factors , and their utility needs to be evaluated in more heterogeneous samples . the comparative predictive utility of clinical and neurobiological markers needs further assessment across different populations as these measures improve in predictive accuracy .

this was a prospective study of patients with type 2 diabetes and ckd stage iiib or iv ( estimated glomerular filtration rate [ modification of diet in renal disease ] 1544 ml / min per 1.73 m ) selected for treatment with intravenous iron and/or esas between january 2009 and december 2009 inclusive . all patients were attending a single renal service where the decision to commence iron and esa therapy was made by the attending physician . the first group ( group a ) were patients selected for iron therapy according to clinical need , and the second group ( group b ) consisted of patients who were those needing esa treatment . glycemic control in both patient groups was assessed in the month leading up to treatment and once again for a 4-week period 4 months after therapy . these assessments comprised the measurement of a1c , seven - point glucose day profiling ( 7pgm ) three times weekly , and cgm for a minimum of 48 h. a more detailed account of the study methodology and patients are described below . all patients selected for iron therapy had either absolute or functional iron deficiency as evidenced by serum ferritin values < 200 g / l . patients in this group were not on previous or concurrent esa therapy and were vitamin b12 and folate replete . intravenous iron was given as a single dose in the form of low molecular weight iron dextran ( cosmofer ) dependent on the patient 's body weight . this was delivered as an initial intravenous test infusion of 100 mg of iron over 1 h followed by the remaining dose over the next 24 h. all patients receiving esa therapy had hemoglobin 10.5 g / dl and were considered iron , vitamin b12 , and folate replete prior to initiation . patients were considered iron replete following a serum ferritin value > 200 g / l or having received intravenous iron at least 6 weeks prior to esa therapy . esa treatment was given in the form of darbepoetin at 750 nano grams / kg fortnightly and continued throughout the period of the study . the dose of esa was titrated monthly to achieve a target hemoglobin 10.512 g / dl . patients with known hemoglobinopathy , with a history of transfusion or bleeding with the last 6 months , who had been previously treated with esa on renal replacement , or with previous transplantation were excluded from the study . patients in groups a and b were provided with the abbott freestyle freedom lite glucose sensor ( abbott diagnostics , maidenhead , u.k . ) . patients were requested to perform 7pgm three times weekly 1 month before commencement of treatment until the end of the study . cgm was performed using the medtronic cgms ipro continuous glucose recorder ( medtronic minimed , northridge , ca ) . using this system , callibration of cgm readings were made based on patient 7pgm over the similar time period . this was done prior to esa and iron therapy and once again at the end of the study . results from the 7pgm and cgm were downloaded from their respective meters for data analysis . results from the cgm included at least a successful 24-h profile over the monitoring period with no gaps > 120 mins . the management of diabetes control was left to the patients and their health care professional . all a1c measurements were made using ion - exchange chromatography via the menarini ha-8160 a1c analyser ( a. menarini , berkshire , u.k . ) . it has been shown that there is no interference between carbamylated hemoglobin ( present in uremia ) and a1c using this analyser ( 12 ) . patients in groups a and b had samples taken 1 month before commencement of therapy and once again 4 months following treatment initiation . all data were tabulated using microsoft excel and statistical analysis was made using spss 16.0 using paired t tests where appropriate . mean blood glucose ( mbg ) pre- and posttreatment was calculated by taking the average of the daily mean glucose values where there were three more capillary glucose readings per day . as glucose values were measured more frequently over cgm periods , the results were weighted to ensure each measurement was proportional to the inverse of the total number of measurements taken the same day similar to that done in the a1c - derived average glucose study ( 13 ) . data from previous studies were used to calculate the statistical power required in the knowledge that iron has previously been shown to have a larger effect on a1c than esas ( 6,14 ) . assuming the intrasubject variation of a1c is gaussian ( 15 ) , nine patients were required to detect a 1.2% fall in a1c in group a and 13 patients to detect a 1.0% fall in group b , with 80% power to an of p < 0.05 using nquery ( statistical solutions , cork , ireland ) . ethical approval was obtained from the local ethics committee prior to the commencement of the study ( local research ethics committee [ lrec ] no . all patients selected for iron therapy had either absolute or functional iron deficiency as evidenced by serum ferritin values < 200 g / l . patients in this group were not on previous or concurrent esa therapy and were vitamin b12 and folate replete . intravenous iron was given as a single dose in the form of low molecular weight iron dextran ( cosmofer ) dependent on the patient 's body weight . this was delivered as an initial intravenous test infusion of 100 mg of iron over 1 h followed by the remaining dose over the next 24 h. all patients receiving esa therapy had hemoglobin 10.5 g / dl and were considered iron , vitamin b12 , and folate replete prior to initiation . patients were considered iron replete following a serum ferritin value > 200 g / l or having received intravenous iron at least 6 weeks prior to esa therapy . esa treatment was given in the form of darbepoetin at 750 nano grams / kg fortnightly and continued throughout the period of the study . the dose of esa was titrated monthly to achieve a target hemoglobin 10.512 g / dl . all patients selected for iron therapy had either absolute or functional iron deficiency as evidenced by serum ferritin values < 200 g / l . patients in this group were not on previous or concurrent esa therapy and were vitamin b12 and folate replete . intravenous iron was given as a single dose in the form of low molecular weight iron dextran ( cosmofer ) dependent on the patient 's body weight . this was delivered as an initial intravenous test infusion of 100 mg of iron over 1 h followed by the remaining dose over the next 24 h. all patients receiving esa therapy had hemoglobin 10.5 g / dl and were considered iron , vitamin b12 , and folate replete prior to initiation . patients were considered iron replete following a serum ferritin value > 200 g / l or having received intravenous iron at least 6 weeks prior to esa therapy . esa treatment was given in the form of darbepoetin at 750 nano grams / kg fortnightly and continued throughout the period of the study . the dose of esa was titrated monthly to achieve a target hemoglobin 10.512 g / dl . patients with known hemoglobinopathy , with a history of transfusion or bleeding with the last 6 months , who had been previously treated with esa on renal replacement , or with previous transplantation were excluded from the study . patients in groups a and b were provided with the abbott freestyle freedom lite glucose sensor ( abbott diagnostics , maidenhead , u.k . ) . patients were requested to perform 7pgm three times weekly 1 month before commencement of treatment until the end of the study . cgm was performed using the medtronic cgms ipro continuous glucose recorder ( medtronic minimed , northridge , ca ) . using this system , callibration of cgm readings were made based on patient 7pgm over the similar time period . this was done prior to esa and iron therapy and once again at the end of the study . results from the 7pgm and cgm were downloaded from their respective meters for data analysis . results from the cgm included at least a successful 24-h profile over the monitoring period with no gaps > 120 mins . the management of diabetes control was left to the patients and their health care professional . all a1c measurements were made using ion - exchange chromatography via the menarini ha-8160 a1c analyser ( a. menarini , berkshire , u.k . ) . it has been shown that there is no interference between carbamylated hemoglobin ( present in uremia ) and a1c using this analyser ( 12 ) . patients in groups a and b had samples taken 1 month before commencement of therapy and once again 4 months following treatment initiation . all data were tabulated using microsoft excel and statistical analysis was made using spss 16.0 using paired t tests where appropriate . mean blood glucose ( mbg ) pre- and posttreatment was calculated by taking the average of the daily mean glucose values where there were three more capillary glucose readings per day . as glucose values were measured more frequently over cgm periods , the results were weighted to ensure each measurement was proportional to the inverse of the total number of measurements taken the same day similar to that done in the a1c - derived average glucose study ( 13 ) . data from previous studies were used to calculate the statistical power required in the knowledge that iron has previously been shown to have a larger effect on a1c than esas ( 6,14 ) . assuming the intrasubject variation of a1c is gaussian ( 15 ) , nine patients were required to detect a 1.2% fall in a1c in group a and 13 patients to detect a 1.0% fall in group b , with 80% power to an of p < 0.05 using nquery ( statistical solutions , cork , ireland ) . ethical approval was obtained from the local ethics committee prior to the commencement of the study ( local research ethics committee [ lrec ] no . 08/h1304/114 ) . fifteen patients ( 9 male , six female , all caucasian , median age 72 years [ interquartile range { iqr } 6874 ] , median albumin - to - creatinine ratio 6.3 [ 4.376.3 ] ) agreed to participated in this arm of the study . the follow - up period was ( means sd ) 16.4 3.7 weeks . fifteen patients ( 11 male , four female , all caucasian , median age 70 years [ iqr 6275 ] , median albumin - to - creatinine ratio 9.3 [ iqr 6.093.4 ] ) were recruited in this group . four patients were diet controlled , four were on oral hypoglycemic agents , and seven were insulin requiring . no patients received additional oral or intravenous iron therapy over the period of the study following the initiation of esa treatment . no new treatments affecting glycemic control ( e.g. , oral hypoglycemic agents , steroids , - blockers ) were initiated or altered over the study period in all patients . the cgm and the 7pgm data included 1,300 and 250 measurements per subject , respectively , for a total of 1,500 glucose tests over the entire study period . using the 7pgm results , there are a mean 4.7 readings a day , of which 31% of the seven - point profiles were complete . the results of the cgm were retrospectively calibrated with the 7pgm readings performed over the similar period . patients on iron therapy despite a lack of change of glycemic control in the both groups , a1c concentrations fell significantly ( p < 0.001 and 0.013 , respectively , for groups a and b ) . there was no linear relationship between the change in a1c and hemoglobin concentration values . ( group a , pearson two tailed , r = 0.329 , p = 0.23 ; group b , r = 0.313 , p = 0.25 ) . in the group of patients receiving esa therapy , there were seven patients ( 5 male , two female , median age 72 years [ iqr 6279 ] ) who received esa therapy after iron treatment and eight patients ( six male and two female , median age 69 years [ 6174 ] ) who received esa only . all patients who also received iron were treated at least 6 weeks prior to esa therapy initiation . there appeared to be a nonsignificant trend toward esa leading to a further decrease in a1c following the initial fall due to iron ( mean a1c 7.36.9% , p = 0.36 following iron and 6.96.7% , p = 0.13 following esa ) . in contrast , the group of patients receiving esa therapy without iron had a significant fall in a1c from 7.3 to 6.5% ( p = 0.02 ) . mbg did not change in either group ( 9.12 vs. 9.21 mmol / l , p = 0.47 for esa and iron vs. 8,21 vs. 8.26 mmol / l , p = 0.71 for esa only ) , and there was a concurrent rise to hemoglobin ( 9.611.76 g / dl , p < 0.01 vs. 9.411.3 g / dl , p < 0.01 ) and hematocrit ( 0.3100.347 , p < 0.01 vs. 0.3310.384 ) values following therapy . fifteen patients ( 9 male , six female , all caucasian , median age 72 years [ interquartile range { iqr } 6874 ] , median albumin - to - creatinine ratio 6.3 [ 4.376.3 ] ) agreed to participated in this arm of the study . the follow - up period was ( means sd ) 16.4 3.7 weeks . fifteen patients ( 11 male , four female , all caucasian , median age 70 years [ iqr 6275 ] , median albumin - to - creatinine ratio 9.3 [ iqr 6.093.4 ] ) were recruited in this group . four patients were diet controlled , four were on oral hypoglycemic agents , and seven were insulin requiring . no patients received additional oral or intravenous iron therapy over the period of the study following the initiation of esa treatment . fifteen patients ( 9 male , six female , all caucasian , median age 72 years [ interquartile range { iqr } 6874 ] , median albumin - to - creatinine ratio 6.3 [ 4.376.3 ] ) agreed to participated in this arm of the study . the follow - up period was ( means sd ) 16.4 3.7 weeks . fifteen patients ( 11 male , four female , all caucasian , median age 70 years [ iqr 6275 ] , median albumin - to - creatinine ratio 9.3 [ iqr 6.093.4 ] ) were recruited in this group . four patients were diet controlled , four were on oral hypoglycemic agents , and seven were insulin requiring . no patients received additional oral or intravenous iron therapy over the period of the study following the initiation of esa treatment . no new treatments affecting glycemic control ( e.g. , oral hypoglycemic agents , steroids , - blockers ) were initiated or altered over the study period in all patients . the cgm and the 7pgm data included 1,300 and 250 measurements per subject , respectively , for a total of 1,500 glucose tests over the entire study period . using the 7pgm results , there are a mean 4.7 readings a day , of which 31% of the seven - point profiles were complete . the results of the cgm were retrospectively calibrated with the 7pgm readings performed over the similar period . despite a lack of change of glycemic control in the both groups , a1c concentrations fell significantly ( p < 0.001 and 0.013 , respectively , for groups a and b ) . ( group a , pearson two tailed , r = 0.329 , p = 0.23 ; group b , r = 0.313 , p = 0.25 ) . in the group of patients receiving esa therapy , there were seven patients ( 5 male , two female , median age 72 years [ iqr 6279 ] ) who received esa therapy after iron treatment and eight patients ( six male and two female , median age 69 years [ 6174 ] ) who received esa only . all patients who also received iron were treated at least 6 weeks prior to esa therapy initiation . there appeared to be a nonsignificant trend toward esa leading to a further decrease in a1c following the initial fall due to iron ( mean a1c 7.36.9% , p = 0.36 following iron and 6.96.7% , p = 0.13 following esa ) . in contrast , the group of patients receiving esa therapy without iron had a significant fall in a1c from 7.3 to 6.5% ( p = 0.02 ) . mbg did not change in either group ( 9.12 vs. 9.21 mmol / l , p = 0.47 for esa and iron vs. 8,21 vs. 8.26 mmol / l , p = 0.71 for esa only ) , and there was a concurrent rise to hemoglobin ( 9.611.76 g / dl , p < 0.01 vs. 9.411.3 g / dl , p < 0.01 ) and hematocrit ( 0.3100.347 , p < 0.01 vs. 0.3310.384 ) values following therapy . esas and intravenous iron are commonly used therapies in the management of anemia in patients with ckd . patients with both diabetes and ckd have a higher prevalence of severe anemia compared with patients with ckd alone ( 1618 ) . despite the increased usage of esa agents , recent findings have shown that the correction of anemia to levels of hemoglobin in excess of 12.5 g / dl in patients with type 2 diabetes using this therapy has not led to an improvement in mortality but rather an increased risk of stroke . this needs to be interpreted carefully , as the two groups received disproportionate amounts of intravenous iron . indeed , in the placebo group it was noted that there was in increase in the hemoglobin levels with esa agents . hence , best practice would suggest that correction of functional and absolute iron deficiency should be obtained prior to commencement of esa ( 19 ) . this is the first study to robustly show that iron and esa treatments result in a fall in a1c , which is independent of glycemic changes in patients with diabetes and ckd stage iiib and iv . discordantly high a1c values compared with glucose readings have been reported in previous studies and case reports on nondiabetic patients with iron deficiency ( 10,11,20,21 ) and in patients with type 1 diabetes in childhood and pregnancy ( 22 ) . the correction of the iron deficiency in all these patient groups has lead to a fall in a1c values in these patients , though the monitoring of glycemic control of patients has not been as robust compared with our study ( using methods such as fasting plasma glucose or two premeal readings a day ) . several studies have also shown a fall in a1c concentrations following esa treatment in patients with diabetes undergoing hemodialysis ( 7,8 ) . other than a single case report ( 23 ) , there was scarce data to support the class effect of this therapy on patients not on hemodialysis . nakao et al . ( 7 ) reported a fall in a1c in nondiabetic patients with ckd on hemodialysis following esa therapy . a plausible explanation is that in contrast to our study , iron therapy was given concurrently , which has likely to have potentiated the a1c - lowering effect reported . a proportion of patients in our study had both therapies , and though there was a similar trend of combined lowering of a1c in this group , this failed to reach statistical significance . good glycemic control in patients with diabetes and ckd has been shown to be associated with better survival rates ( 24 ) . the results of our study show both statistically and clinically significant falls in the a1c following iron and esa treatment ( mean 0.4% following iron and 0.7% following esa ) in the absence of a change in glycemic control . from a practical view , the data from this study highlights several issues to which diabetes management can be improved in patients with diabetes and ckd . it shows that a1c can be unreliable and can fall following treatment with both iron and esa therapy . it is essential that health care professionals are aware of the potential fluctuations of a1c that can occur in this patient group . alternative methods for measuring glycemic control such as capillary glucose testing and cgm should be used , and therapy should not be based on the a1c value alone . this has particular significance when considering national , international , or health service glycemic targets , such as the quality and outcome framework in the u.k . , which almost exclusively uses a1c as the sole index by which treatment success is judged . glycated albumin has been suggested as an alternative marker to represent glycemic control , as it was noted to be similar ( in contrast to a1c , which was higher ) in patients with iron deficiency and pre - esa compared with patients posttherapy ( 8,20 ) . though this may be true , further study is still required and better correlation between glycated albumin and glycemic control is still needed before this measurement to be more widely used . the strengths of this study lies in the robust monitoring of glycemic control in patients . 7pgm and cgms were used in all patients and glycemic control , treatment , and a1c values were monitored closely . however , this study is limited by its relatively small numbers , and though it managed to show that a1c values fell both with iron and esa , there were insufficient numbers to confirm whether the combined effect of both therapies had an added a1c - lowering effects compared with a single agent given alone . intravenous iron and esa are increasingly common therapies used in the management of anemia in patients with ckd and diabetes . the present study has been able to confirm that reported changes in a1c following these treatments are indeed independent of changes in glycemic control ; therefore , caution is warranted in the interpretation of a1c and management of glycemia when based on this measurement alone . at a time when self - monitoring of blood glucose is being discouraged , especially in non insulin - treated patients ( 25 ) , regular capillary glucose measurements , and the concurrent use of cgm if available , seems essential in order to accurately assess glycemic control in this group of patients .

serum samples were obtained from 823 febrile patients at the secretaria de salud de yucatn and other health institutions in merida during january october 2007 . the patients resided in all 3 states of the yucatan peninsula of mexico : yucatan ( n = 809 ) , quintana roo ( n = 8) and campeche ( n = 6 ) . the study was approved by the institutional biosafety committees at iowa state university ( ames , ia , usa ) and the universidad autnoma de yucatn ( mrida , mexico ) . all serum samples were examined at a dilution of 1:20 by plaque reduction neutralization test ( prnt ) by using cvv ( strain cvv-478 ) , and prnts were performed as described ( 7 ) . a subset of serum samples with antibodies that neutralized cvv were titrated and further analyzed by prnt by using cvv , chlv ( strain chlv - mex07 ) , kriv ( strain kriv - mex07 ) , sourv ( strain njo-94f ) , maguari virus ( strain bear7272 ) , and wyeomyia virus ( strain prototype ) . all of these viruses belong to the bunyamwera ( bun ) serogroup except sourv , which belongs to the california ( cal ) serogroup . titers were expressed as the reciprocal of highest serum dilutions yielding > 90% reduction in the number of plaques ( prnt90 ) . for etiologic diagnosis , the prnt90 antibody titer for each virus was required to be > 4-fold greater than that to the other viruses tested . antibodies that neutralized cvv were detected in 146 ( 18% ) of 823 study participants . the mean ages of patients with and without antibodies that neutralized cvv were 32.0 and 22.3 years , respectively . logistic regression analysis showed that the risk for infection increased significantly with age ( p = 0.0001 ) . serum samples from 50 seropositive patients were titrated and analyzed by comparative prnt to identify the orthobunyaviruses responsible for these infections . six persons were seropositive for cvv , 5 for chlv , and 1 for sourv or a sourv - like virus ; 38 had antibodies to an undetermined orthobunyavirus ( table ) . because sourv was the only cal serogroup virus used in this study , and another cal serogroup virus may have been responsible for the infection , the person who had a sourv prnt90 titer > 4-fold than that to the other viruses tested received a conservative prnt diagnosis of seropositive for sourv or a sourv - like virus . because interserogroup crossreactivity of neutralizing antibodies to viruses in the bun and cal serogroups has not been seen , the 17 persons with antibodies that neutralized sourv and > 1 of the bun serogroup viruses might have been exposed to > 1 viruses from each serogroup . * prnt , plaque reduction neutralization test ; cvv , cache valley virus ; chlv , cholul virus ; kriv , kairi virus ; sourv , south river virus ; magv , maguari virus , wyov , wyeomyia virus ; , titer < 20 ; und , undetermined orthobunyavirus . chlv and potv share the same medium rna segment , so antibodies for these viruses can not be differentiated by prnt . furthermore , antibodies to chlv and potv can not be differentiated by complement fixation test ( 4 ) . thus , we can not dismiss potv as a possible cause of infection in some or all of the study participants who were seropositive for chlv . however , it appears more likely that these persons had been infected with chlv because this virus has been isolated in the yucatan peninsula , whereas no direct evidence has been found for potv in this region . as already noted , serum samples from 38 ( 76% ) of the study participants analyzed by comparative prnt had antibodies to an undetermined orthobunyavirus . most of these persons had low prnt90 titers ; the highest prnt90 titer for 29 of these persons did not exceed 40 . because neutralizing antibody levels decline over time , these findings may indicate that many of these infections occurred years ago , and the trace amounts of neutralizing antibodies that remained were insufficient to yield a > 4-fold difference between the titers of the virus responsible for the infection and the other viruses used in the prnts . another explanation is that some of these persons had been infected with an orthobunyavirus not included in the prnts , although all orthobunyaviruses known to occur in the yucatan peninsula were represented . we found 18% of the 823 yucatan residents participating in our study had evidence of orthobunyavirus exposure . this number is presumably an underestimate ; additional seropositive persons might have been identified if the initial prnts had not been restricted to cvv . in particular , additional seropositive persons likely would have been detected if sourv was used in the initial prnts , because a screening algorithm that includes only a bun serogroup virus would likely miss many cal serogroup virus infections . previous serosurveys have provided information on the seroprevalence of orthobunyaviruses in humans in the united states . for example , antibodies that neutralized cvv were detected in 42/356 ( 12% ) residents in maryland and virginia in 19611963 ( 8) . antibodies that neutralized maguari virus or tensaw virus were detected in 71/300 humans in florida in the 1980s ( 9 ) ; as observed in our study , the highest prnt titers for most of the seropositive persons in that study did not exceed 40 . all persons in our study cohort initially sought care for unspecified fever ; however , we could not determine whether any of these febrile illnesses were a direct consequence of orthobunyavirus infection . the detection of acute orthobunyavirus infections is limited because no igm - capture elisa for orthobunyavirus diagnosis exists . prnts can be used to identify recent orthobunyavirus infections when paired acute and convalescent serum samples are available , but for our study , only single serum samples were available from each participant . orthobunyavirus viremias in humans are transient and of low magnitude , which makes reverse transcription pcr ineffective for the detection of orthobunyavirus rna in serum samples . however , a duplex reverse transcription pcr was recently developed for the detection of cvv rna in human cerebrospinal fluid ( 10 ) . in conclusion these viruses are also a common cause of infection of livestock in this region ( 4 ) . our findings underscore the need to determine whether orthobunyaviruses represent an unrecognized cause of illness in humans and vertebrate animals in mexico .

over recent years , there has been a growing number of reports indicating a relationship between serum thyrotropin and bone remodeling [ 1 - 9 ] . animal studies have shown that reduced expression of the tsh receptor leads to the development of osteoporosis , in accordance with the hypothesis that tsh deficiency may inhibit bone turnover . biologically active tsh receptors are present in the osteoblasts and the administration of recombinant tsh leads to reduced bone resorption and increased bone formation . moreover , the results of research in post - menopausal women with serum tsh in the lower range of normal values suggest a decreased bone mineral density and increased fracture risk as well as in 65 years or older men with subclinical hyperthyroidism or hypothyroidism increased risk for hip fracture was observed . recent results in postmenopausal italian women who had vertebral fractures indicated the existence of the relationship between tsh and fractures independently of thyroid hormone levels , age and bone mineral density . pathogenic role of tsh suppression in the damaged bone tissue , in contrast to increased levels of thyroid hormones is still unknown . the aim of our preliminary study was to verify the relationship between serum tsh and biochemical bone turnover markers in postmenopausal women with normal thyroid function who sustained an osteoporotic fracture to assess whether the differences in tsh concentration within the reference range may affect bone metabolism . 34 women aged 60 - 93 years , admitted to the department of orthopaedics and traumatology at the university hospital in bydgoszcz for osteoporotic fracture , were included in the study . all were euthyroid postmenopausal women that did not receive drugs affecting bone metabolism before fracture . inclusion criteria were : osteoporotic fracture , no treatment with anti - osteoporotic drugs , no previous treatment with drugs potentially causing osteoporosis and fragility fractures , no clinical history of recent significant trauma or prolonged immobilization . only few of them had diabetes mellitus ( 3 ) , renal insufficiency ( 1 ) , rheumatoid arthritis ( 1 ) . the study was approved by the bioethics committee at collegium medicum , nicolaus copernicus university . from all women serum was obtained within less than 2 hours to avoid proteolysis and stored deep - frozen in small aliquots until assayed but no longer than 3 months . in the serum samples , directly after thawing , the following markers were measured : propeptide of type 1 procollagen ( p1np ) ( elisa kit for procollagen i n - terminal propeptide pinp ; uscn , life science inc . ; detection limit was 6,9 pg / ml ; reference range for postmenopausal women < 45,0 ng / ml ) as a bone formation marker , c - terminal telopeptide of type 1 collagen ( ctx ) , ( ctx elisa , immunodiagnostic systems ltd ; detection limit 0,02 ng / ml ; mean value for postmenopausal women 0,439 ng / ml ; range 0,142 - 1,351 ng / ml ) as a bone resorption marker . tsh was assayed using the architect tsh assay ( abbott diagnostics ; detection limit 0,01 mlu / ml , which meets the requirements of a third generation tsh assay ; reference range at postmenopause 0,35 - 4,94 mlu / ml , according to the manufacturer data ) . study group consisted of 29 women with tsh within the reference range ( 0,35 - 4,94 mlu / ml ) and additionally of 5 women with tsh concentration < 0,35 mlu / ml . median age in group with tsh within the reference range was 80 ( 71 - 85 ) years , height 1,61 ( 1,56 - 1,64 ) m , weight 70 ( 60 - 79 ) kg and bmi 27 ( 23 - 29 ) kg / m2 . in all euthyroid women median value of ctx - i was 0,535 ( 0,400 - 0,817 ) ng / ml and was within the reference range for their age , whereas median pinp concentration of 31,2 ( 27 - 39,8 ) ng / ml was in the lower reference range . median tsh was 0,96 ( 0,66 - 1,81 ) mlu / ml whereas the values within 5 - 95th percentile were found to be from 0,46 - 3,40 mlu / ml median age in women with tsh level < 0,35 mlu / ml was 81 ( 65 - 86 ) years , height 1,63 ( 1,62 - 1,64 ) m , weight 80 ( 63 - 98 ) kg and bmi 30 ( 23 - 37 ) kg / m2 . median value of ctx - i was 0,491 ( 0,472 - 0,535 ) ng / ml and was within the reference range for their age , whereas median p1np concentration of 35,6 ( 35 - 38,6 ) ng / ml was in the lower reference range . tsh concentration was 0,24 ( 0,14 - 0,29 ) mlu / ml next , euthyroid post - menopausal women with osteoporotic fracture were divided into 3 groups according to tsh values : 1st tertile from 0,35 to 1,88 mlu / ml , 2nd from 1,89 to 3,41 mlu / ml and 3d from 3,42 to 4,94 mlu / ml ( tab.1 ) . u - mann - whitney test has shown higher median p1np ( p=0,05 ) in the 1st tertile and higher ctx - i in the 3rd tertile . there was no significant differences in concentration of bone turnover markers between group of women with tsh level < 0,35 mlu / ml and those euthyroid postmenopausal women in the 1st tertile . no relationship was observed between tsh and bone formation and resorption markers in all groups of euthyroid postmenopausal women . instead , weight and bmi correlated negatively with tsh ( r=-0,77 p<0,006 and r=-0,73 p<0,02 respectively ) and ctx ( r=-0,68 p<0,03 ) in women in the 1st tertile . no relationship was also observed between tsh and bone formation and resorption markers in a group of women with tsh level < 0,35 mlu / ml . the duration of the resorption process is extended 2-fold and bone formation is prolonged 4-fold . however in hyperthyroidism bone formation and resorption processes are accelerated and remodeling cycle is shortened . in this study we measured serum concentrations of propeptide of type 1 procollagen ( p1np ) as a bone formation marker and crosslinked c - terminal telopeptide ( ctx - i ) , as a bone resorption marker in elderly euthyroid women with osteoporotic fracture ( mainly of the femoral neck ) in attempt to find a relationship between tsh and bone turnover markers . fracture may have an influence on concentration of bone markers which in the immediate postfracture period does not alter but clearly increase during fracture healing . to exclude any influence of fracture consequences and repair on bone turnover markers , especially p1np and ctx - i concentrations , we collected blood samples within 18 hours after fracture . the association between tsh concentration and bone turnover markers in relation to the risk of fragility fracture is still a matter of debate . the association of thyrotropin with bone mineral density and bone markers in postmenopausal women was very recently reported by baqi et al . they observed that bone mineral density ( bmd ) and the concentrations of biochemical bone turnover markers were significantly more favorable in patients with tsh in the range of 0,35 - 6,3 mlu / ml than in those with tsh<0,3 mlu / ml which is consistent with the view that tsh itself possibly plays a positive role influencing the bmd in adult women . this is however , not consistent with the results of our preliminary study because we observed similar p1np and ctx concentrations in the group with tsh concentration < 0,35 mlu / ml and these women with tsh of 0,35 - 4,94 mlu / ml . differences may result because of the fact that in the study of baqi et al women were without fractures whereas our subjects had fractures and because of small numbers of patients in both groups , only 5 and 29 with tsh of 0,35 - 4,94 mlu / ml . in another study murphy et there was an increased bone turnover reflected by osteocalcin , p1np and ctx concentrations in women with tsh below 0,5 mlu / ml compared to women with tsh of at least 0,5 mlu / ml . bauer et al found no consistent evidence that low tsh was associated with accelerated bone loss in older ambulatory women . those findings are similar to ours , because we also observed no relationship between tsh and bone formation and resorption markers in euthyroid postmenopausal women as well as in women with tsh concentration < 0,35 mlu / ml . however , it is worth to note that in our subjects with fractures , whether they were euthyroid or had decreased tsh , bone resorption was as expected for their age ( 0,535 and 0,491 ng / ml , respectively ) whereas bone formation was in the lower reference range ( 31,2 and 35,6 ng / ml ) . in the study of martinez et al performed in a large cohort of spanish postmenopausal women the mean concentration of p1np in women between 70 - 85 years of age was found to be 43 - 50 ng / ml and mean concentration of ctx was 0,36 - 0,44 ng / ml . median tsh in a group with tsh within 0,35 - 4,94 mlu / ml was a little lower 0,96 ( 0,66 - 1,81 ) mlu / ml compared to women with vertebral fractures in mazziotti study 1,1 mlu / ml ( 0,66 - 3,10 ) . our study had several limitations : a small number of euthyroid women with fractures and in the group with tsh concentration < 0,35 mlu / ml , which may influenced on these preliminary results . as tsh concentration is characterized by a circadian rythm and the blood collection should be performed at fasting state we could only include in the study those women in which blood collection was performed at the same time of a day . bmd and concentrations of thyroid hormones ( ft4 , ft3 ) were not measured ; tsh was measured only once . we found no consistent evidence that in euthyroid postmenopausal women with osteoporotic fractures tsh concentrations within the reference range were associated with changes in bone turnover markers .

as blood vessels nourish all the tissues and organs in the body , it is unsurprising that abnormal formation and maintenance of blood vessels contribute to pathogenesis of numerous disorders . indeed , excessive vascular formation causes cancer , arthritis , psoriasis and infectious disease , and so forth , whereas atherosclerosis , restenosis , hypertension , stroke , neurodegeneration , preeclampsia , respiratory distress , and osteoporosis are characterized by insufficient vessel growth or abnormal vascular remolding , and the list is still growing . vascular formation is coordinated in several modes comprising vasculogenesis primitive vascular labyrinth assembly , angiogenesis vascular sprouting and branching , and arteriogenesis endothelial cell tubules covered by vascular mural cells [ 24 ] . after vessel maturation , enduring changes in the vascular composition and structure , known as vascular remodeling , occur in response to a number of stimuli . vascular remodeling not only associates with vessel repair and adaptation , but also eventually affects luminal diameter and the thickness of vessel wall in every direction . both vascular formation and remodeling are complicated processes including recruitment , migration , proliferation , and apoptosis of vascular cells consisting of stem / progenitor cells , endothelial cells ( ecs ) , vascular smooth muscle cells ( vsmcs ) , and other mural cells . it is common that extracellular matrix ( ecm ) molecules play important roles in vessel development and morphogenesis by providing supportive matrix scaffold for cells , interacting with certain matrix receptors on cells and supplying growth factors that impact cellular function . reciprocal interaction between vascular cells and their ecm is critical in blood vessel formation and remodeling . matrix metalloproteinases ( mmps ) are a family of zinc - dependent proteolytic enzymes that degrade various components of ecm and mediate ecm remodeling in both physiological and pathological processes . a major function of mmps is degradation of ecm to facilitate the progression of cell migration and invasion . however , a variety of research works reveal that proteolytic activity of mmps controls availability of active molecules such as growth factors [ 6 , 7 ] . increasing evidence suggests that mmps play a critical role in vascular formation and remodeling through degrading vascular basement membrane and ecm proteins and modifying angiogenic growth factors and cytokines . in normal physiological conditions , mmps activities are regulated at multiple levels , including gene transcription , activation of zymogens and interaction with specific inhibitors in order to limit mmps activity . striking the balance enlarges mmps activity and probably leads to pathological alterations in blood vessels . the purpose of this review is to discuss the biological activities of mmps in vascular formation and remodeling , especially to focus on increasing evidence elucidating the effects of mmps on stem / progenitor cells , ecs , and vsmcs and their pathogenic role in related diseases . mmps are expanding family of endopeptidases first discovered in 1962 as a collagenase in resorption of the tadpole tail . to date , the mmp family has at least 24 members , although some of them have not been well understood . typical mmps consist of a propeptide , a catalytic domain , a linker peptide ( hinge region ) and a hemopexin domain . the zn binding motif hexxhxxgxxh in catalytic domain is the signature to assign proteinases to mmp family [ 6 , 10 ] . mmps are categorized by their structure and substrates into collagenases , gelatinases , stromelysins , matrilysins , membrane - type ( mt)-mmps , and others . collagenases including mmp-1 , mmp-8 , mmp-13 , and mmp-18 cleave interstitial collagen type i , ii , and iii and digest some of other ecm and non - ecm proteins . gelatinases degrade both collagens and gelatins and include mmp-2 ( gelatinase a ) and mmp-9 ( gelatinase b ) which are the most widely studied mmps in blood vessel . stromelysins comprise mmp-3 , mmp-10 and mmp-11 . mmp-3 and mmp-10 have similar substrate specificities , and both digest wide range of ecm molecules and participate in prommps proteolysis , while the structure and function of mmp-11 , also called stromelysin-3 , diverge from other two stromelysins . matrilysins which lack hemopexin domain include mmp-7 ( matrilysin-1 ) and mmp-26 ( matrilysin-2 ) . mmp-7 processes many cell surface molecules , while mmp-26 degrades a number of ecm components . membrane - type ( mt)-mmps consist of four transmembrane mmps , mmp-14 ( mt1-mmp ) , mmp-15 ( mt2-mmp ) , mmp-16 ( mt3-mmp ) , and mmp-24 ( mt5-mmp ) and two glycosyl - phosphatidylinositol - anchored mmps , mmp-17 ( mt4-mmp ) and mmp-25 ( mt6-mmp ) . other mmps that are not classified in previous categories include mmp-12 , mmp-19 , mmp-20 , mmp-21 , mmp-23 , mmp-27 , and mmp-28 [ 6 , 10 , 11 ] . many studies of in vitro cultured cells and normal or diseased blood vessels reveal that both vascular cells and inflammatory cells in vessel wall can produce mmps which participate in diverse vascular physiology and pathogenesis . to date , major mmps expressed in vascular tissue and cell types include mmp-1 , mmp-2 , mmp-3 , mmp-7 , mmp-8 , mmp-9 , mmp-12 , mmp-13 , mt1-mmp , and mt3-mmp [ 8 , 12 ] . most mmps are synthesized and secreted as inactive zymogens called prommps which have a cysteine switch motif prcgxpd coordinating with zn in catalytic domain to maintain latency . prommps can be activated in vitro by chemical agents , such as thiol - modifying agents , oxidized glutathione , sodium dodecyl sulfate , chaotropic agents , and reactive oxygen species through the disturbance of cysteine - zn interaction of the cysteine switch . however , stepwise activation of prommps in vivo is more complicated with removal of propeptide , disruption of cysteine - zinc binding , and detachment of the hemopexin domain , which is more likely conducted by other mmps or other classes of proteinases such as plasmin and neutrophil elastase . for example , prommp-2 is activated by most mt - mmps but not mt4-mmp . once activated , mmp catalytic domains contact with protein substrates and cleave at specific sites so as to breakdown the extracellular scaffold or modify biologically active molecules residing in ecm . in blood vessels , matrix scaffold degradation is mediated by activation of mmps to facilitate endothelial and mural cell migration and invasion . in addition , various mmps are necessary for releasing and processing of non - matrix molecules including growth factors such as fibroblast growth factors ( fgfs ) , insulin - like growth factors ( igfs ) , transforming growth factor- ( tgf- ) and tumour necrosis factor- ( tnf- ) and their receptors , as well as integrins , plasminogen and adhesion molecules , and so forth , which impact vascular cell recruitment , proliferation , migration , and apoptosis in angiogenesis and vascular remodeling . vascular inflammation is a complex process encompassing multiple types of cells and various biological factors , which is initiated by tissue damage . coordination of pro- and anti - inflammatory cytokines and chemokines regulates cell proliferation , adhesion , chemotaxis , migration , and apoptosis in inflammatory sites [ 16 , 17 ] . in diseases related to angiogenesis and vascular remodeling , inflammation is identified and is always imbalanced , exacerbated , and chronic [ 18 , 19 ] . angiogenesis sustains inflammation by providing metabolic demands to inflammatory cells , while inflammation promotes angiogenesis via releasing several cytokines and chemokines which impact vascular cell function and behavior . similarly , vascular inflammatory process is prominent in hypertension , atherosclerosis and restenosis , and so forth , in which abnormal vascular remodeling plays a predominant role . during vascular remodeling , various cytokines are secreted from inflammatory cells such as monocytes , macrophages , and neutrophils , contributing to further recruitment of inflammatory cells and proliferation , migration , and apoptosis of ecs and vsmcs [ 17 , 20 ] . mmps function as such inflammatory cytokines during vascular formation or remodeling . in matured and quiescent vessels , but in tissues undergoing abnormal angiogenesis and vascular remodeling , mmps are markedly expressed , secreted , and activated . inflammatory cells such as macrophages and neutrophils are an important resource of mmps in vascular tissue . inflammatory factors , including tumor necrosis factor - alpha ( tnf- ) and interleukins ( ils ) , stimulate mmp expression . in turn , mmps degrade ecm to facilitate migration and recruitment of cells including inflammatory cells and cleave cell surface receptors and other non - ecm molecules to mediate adhesion , proliferation , and apoptosis of cells in vessel wall which are involved in inflammatory process . . many studies investigating the relationship between mmps and vascular biology demonstrate that a number of factors leading to angiogenesis and vascular remodeling - related diseases regulate mmp expression and activation , such as hemodynamics , oxidative stress , inflammation , hormonal factors , and hypoxia , ( figure 1 ) . hemodynamic forces such as shear stress and arterial pressure regulate mmp expression and participate in vascular remodeling . elevated transmural pressure activates mmp-2 and mmp-9 in ex vivo porcine carotid arteries . in a murine model of blood flow cessation induced arterial remodeling , an early and significant increase in mmp-9 expression precedes the formation of intimal hyperplasia . low fluid shear stress induced mmp-9 expression involves integrins - p38 mapk or erk1/2-nf - kappab signaling pathways . remodeling due to hemodynamic adaptation of the vein to the arterial condition leads to saphenous vein graft bypass failure . ex vivo vein support system and in vivo animal model of vein graft reflect that high shear stress and increased venous pressure and wall tension induce overexpression of mmp-2 and mmp-9 , which in turn drives vein graft wall remodeling [ 2629 ] . oxidative stress induced by imbalance between elimination and production of reactive oxygen species ( ros ) has deleterious effect on vascular biology via excessive activation of mmps . ros formation via the nadph oxidase ( nox ) induced by mechanical stretch enhances mmp-2 mrna expression and pro - mmp-2 release . oxidative stress induces the loss of retinal capillary cells by regulating the proapoptotic role of mmp-2 . mmp-9 secretion and activity in monocytes are enhanced by increased nox - dependent superoxide radical ( o2 ) production in the atherosclerotic process . in hindlimb ischemia , nox2 derived ros production increases mt1-mmp expression and mmp-9 activity , leading to neovascularization and tissue repair . nox4 induces mmp2 transcription via stimulating foxo activity , while nox1 in neointimal vsmcs initiates redox - dependent phosphorylation of erk1/2 and subsequent mmp-9 activation following vascular injury . in addition , a variety of other vascular mmp stimuli modify mmp functions via ros - dependent ways . homocysteine contributing to arterial remodeling induces increased activation of latent mmp-2 through an oxidative / nitrative dependent mechanism [ 37 , 38 ] . high glucose stimulating mmp-1 , mmp-2 , and mmp-9 expression in cultured endothelial cells and macrophages is associated with ros production [ 3941 ] . smoking - induced mmp activation promotes vascular remodeling through vascular inflammation and oxidative stress . regarding to the effects of oxidative stress in vascular remodeling , antioxidant approaches are used to reduce the upregulation of mmps and attenuate the tissue remodeling during vascular diseases [ 43 , 44 ] . inflammatory process involving mmp activities is essential for the vascular remodeling , entailing reorganization of the ecm scaffold of the vascular wall , and particularly mediating atherosclerotic plaque progression and rupture [ 12 , 21 ] . inflammatory cells such as macrophages , mast cells , and neutrophils are the main sources of mmps , and inflammatory cytokines like tnf- and ils stimulate mmp expression and activation [ 21 , 22 ] . taking tnf- , il-17 and il-18 as examples , tnf- activates mmp-9 gene expression at transcription level , while il-17 and il-18 also stimulate mmp-9 expression via nuclear factor - kappab ( nf-b ) and activator protein 1 ( ap-1 ) signaling activation [ 46 , 47 ] . hormonal stimuli including angiotensin ii ( ang ii ) , estrogen , and progesterone take part in vascular remodeling through activating vascular mmps as well . ang ii stimulates mmp-8 and mmp-13 activity in atherosclerotic lesions , inducing intraplaque hemorrhages and plaque rupture via mmps mediated degradation of interstitial collagen i . ang ii also increases mmp-2 expression and activity in vascular remodeling during atherosclerosis , intimal and medial thickening , and hypertension [ 4951 ] . in addition , an early increase in mt1-mmp expression with a subsequent increase in mmp-2 and mmp-9 activity has been observed in ang ii induced aneurysm formation , and mmp-9 production in aortic aneurysms relies on ang ii / erk pathway . postmenopausal women receiving hormone replacement therapy are more likely to suffer from intimal hyperplasia after vascular intervention and bypass graft failure , which implies the significant role of estrogen and progesterone in vascular remodeling . estrogen deficiency induced by ovariectomy gives rise to a reduction of active mmp-2 in the initial phase and a concurrent elevation of mmp-2 and mt1-mmp expression in latter period . vsmcs incubated with estrogen and progesterone show upregulation of mmp pathway by increasing mmp-2 activity via enhancement of mt1-mmp expression , and inhibition of mt1-mmp prevents estrogen - stimulated increases in mmp-2 activity . hypoxia increasing expression levels of hypoxia inducible factor 1 ( hif-1 ) and vascular growth factors has a significant role in vasculogenesis , angiogenesis , and vascular remodeling [ 57 , 58 ] . hypoxia results in an overall upward tendency of vascular mmp-2 and mmp-9 expression . in vitro studies reveal that exposure of ecs to prolonged hypoxia enhances mmp-2 expression and activity [ 59 , 60 ] . consistently , rat exposed to hypoxia shows increased mmp-2 protein level and activity in aorta . chronic hypoxia also accelerates the development of atherosclerosis along with activated mmp-9 in apoe(/ ) mice . however , hypoxia might regulate mmp expression transcriptionally due to its effect on activation of some transcriptional factors such as ap-1 and nf-b which are primarily involved in mmp gene expression [ 63 , 64 ] . multipotent adult stem / progenitor cells implicated in angiogenesis and vascular remodeling contribute to physiological and pathological processes through recruitment and migration into blood vessels and secretion of growth factors and cytokines . bone marrow serves as a reservoir for several stem / progenitor cell populations , including mesenchymal stem cells ( mscs ) , endothelial progenitor cells ( epcs ) , and hematopoietic stem cells ( hscs ) . another source of stem / progenitor cells involved in vascular diseases is blood vessel wall harboring mscs , epcs , and other stem / progenitor cells [ 66 , 67 ] . recruitment of stem / progenitor cells undergoes escaping from their niche , invading ecm and engrafting into target site where they proliferate and differentiate . mt1-mmp , mmp-2 , mmp-9 , and mmp-8 have been reported to function in stem / progenitor cell mobilization and recruitment in blood vessel formation and vascular remodeling ( table 1 ) . bone marrow - derived stem cells ( bmscs ) induce an angiogenic effect and elicit vessel morphogenesis both in vitro and in vivo depending on proteolytic ability of mt1-mmp . lumican inhibits in vitro tube - like structure formation by bone marrow - derived mscs via downregulation of mt1-mmp expression and activity in mscs , and overexpression of mt1-mmp enhances msc migration and invasion . mmp-9 induced in bone marrow cells releases soluble kit - ligand , allowing translocation of bone marrow epcs and hscs from quiescent bone marrow niche to proliferative vascular niche . deficiency of mmp-9 attenuates ischemia - induced neovascularization through an impairment of bone marrow - derived epc adhesion , migration , and proangiogenic functions . in tumor angiogenesis studies using mmp-9 knockout mice , transplanting tumors are unable to grow after irradiation in mmp-9 knockout mice , but tumor growth could be restored by transplantation of wild - type bone marrow . cd11b+ myelomonocytic cells rather than epcs in transplanted bone marrow are responsible for immature vessels formation and tumor growth . moreover , it has been reported that elevated mmp-9 expression is associated with postinterventional restenosis . studies on coronary stent implantation patients reveal that active mmp-9 produced by neutrophils related to vascular injury possibly leads to mobilization of bmscs ( cd34 + stem cells ) , which may contribute to reendothelialization as well as restenosis [ 73 , 74 ] . mmp-2 , as another major vascular mmp , shows a significant role in normal and tumor angiogenesis and development of atherosclerotic and neointimal lesions [ 127129 ] . these biological effects may attribute to a novel role of mmp-2 in stem / progenitor cells function . bone marrow - derived epcs ( c - kit+ stem cells ) from mmp-2(/ ) mice display marked reduction in invasive and proliferative abilities and angiogenic responses . ischemia - induced neovascularization in mmp-2(/ ) mice is impaired and can be restored by transplantation of bone marrow - derived mononuclear cells from mmp-2(+/+ ) mice , that suggests mmp-2 as a critical modulator of epc mobilization and vascular formation . the pathogenic role of mmp-8 in progression and instability of atherosclerotic plaque has been discovered [ 130 , 131 ] . we generated apoe(/ ) mmp-8(/ ) double knockout mice and found substantially reduced extent of atherosclerotic plaque in these mice . furthermore , recent study from our group clearly shows that mmp-8 plays an important role in stem / progenitor cell migration and their recruitment from arterial lumen and adventitia into atherosclerotic plaque . adam10 cleavage and maturation by mmp-8 and subsequent e - cadherin shedding from cell surface could be the underlying molecular mechanism by which mmp-8 mediated stem / progenitor cell mobilization . previous studies elucidating the function of mmps on stem / progenitor cells in blood vessels formation and vascular remodeling mainly emphasize on degradation of ecm promoting stem / progenitor cell mobilization and recruitment . however , mmps are able to improve cell differentiation in other tissues [ 132134 ] . therefore , whether mmps regulate proliferation and differentiation of stem / progenitor cells in vascular tissue via cutting and activating non - ecm molecules such as transcription factors needs further investigations . vascular ecs comprising a single layer of cells on the inferior surface of the blood vessels have unique and distinct function in vascular biology , especially in new blood vessel formation and angiogenesis . during vascular formation or angiogenesis , ecs active mmps degrade vascular basement membrane and other ecm resulting in detachment of ecs which is imperative in proliferation , migration , invasion , and even apoptosis of ecs and is an initial step of angiogenesis or vascular formation . in addition , mmps can modify non - ecm molecules such as vascular endothelial growth factor receptors ( vegfr ) and urokinase - type plasminogen activator receptor ( upar ) and their signaling pathways to affect ec vitality and behavior . many mmps have been shown to exert multiple impacts on ecs functions and angiogenesis ( table 2 ) . mmp-1 and mmp-8 , two important collagenases , are highly active in vascular tissue and may sensitize ec function . stimulation of ecs with active mmp-1 promotes expression of vegfr2 , a main binding receptor for vegf - a and subsequent elevated endothelial proliferation through activation of protease activated receptor-1 ( par-1 ) and nf-b pathway [ 77 , 78 ] . our most recent study provides strong evidence to suggest that mmp-8 plays an important role in ec angiogenesis in vitro , ex vivo , and in vivo by regulating the conversion of ang i to ang ii , pecam-1 expression , -catenin nuclear accumulation , and cell proliferation and migration related gene expression . wound healing migration model reveals that expression of mt1-mmp is upregulated during ec migration and its activity can modulate endothelial migration , invasion , and formation of capillary tubes . mt1-mmp contributes significantly to ec migration in both 2d collagen - coated surfaces and 3d collagen matrices , while secretory - type mmp-1 , mmp-2 , mmp-9 , and mmp-13 are not critical for ec movement in 3d collagen gels . in 3d collagen matrices , mt1-mmp - dependent collagen proteolysis is required in ec lumen formation and generation of vascular guidance tunnels that allow subsequent ec migration and tube network formation which is vital for blood vessel assembly . mt1-mmp also acts as a key effector of nitric oxide ( no ) in no - induced ec migration and angiogenic processes via its collagenolytic function . furthermore , mt1-mmp performs not only as a matrix - degrading enzyme , but also a signaling molecule on ecs . mt1-mmp mediates small gtpases rhoa and rac1 activation and subsequent ca and nox - dependent signaling pathway , ultimately promoting tissue factor ( tf ) and plasminogen activator inhibitor-1 ( pai-1 ) protein expression , in thrombin - stimulated endothelial cells . mmp-2 appears to be an essential molecule determining ec fate , paradoxical effects on both survival ( angiogenesis ) and cell death . two major apoptotic pathways in ecs , caspases and p38 mapk , enhance mmp-2 synthesis and affect ec behavior via different activation form of mmp-2 . the partially active form supports survival and migration , while the fully active form leads to apoptosis , and eventually the ratio between these two mmp-2 activation forms in environment determines ec functions [ 59 , 85 ] . overexpression of mmp-12 cleaves urokinase - type plasminogen activator receptor ( upar ) and impairs upa - dependent human microvascular ec proliferation , migration , and capillary morphogenesis in systemic sclerosis [ 86 , 87 ] . loss of function of mmp-12 in systemic sclerosis ecs restores the ability to induce vascularization . mmp-7 , a matrilysin , accelerates the proliferation of human umbilical vein ecs in vitro and directly induces angiogenesis . soluble vegf receptor-1 , an endogenous vegf inhibitor via blocking vegf access to membrane receptors , can be degraded by mmp-7 , which liberates vegf and enhances vegf - induced vegfr2 phosphorylation . the presence of mmp-7 finally promotes endothelial migration and tube formation via vegf - vegfr2 downstream activation in ecs . abnormal vsmc proliferation , migration , and apoptosis are the main causes of vascular remodeling implicated in multiple vascular disorders , including hypertension , restenosis , and atherosclerotic plaque progression and rupture . alterations of vsmc functions / behaviors also play important roles in physiological and pathological angiogenesis since vsmc and other mural cell recruitment is required for vessel formation and maturation . ecm degradation and remodeling indispensable to vascular structure alterations highlight mmp functions in vsmc behaviors . mmp-2 , mmp-9 , mt1-mmp , mmp-3 , mmp-1 , and mmp-7 have been recognized in vascular tissue and play pathogenic roles in vascular remodeling via regulating vsmc behaviors ( table 3 ) . in cultured vsmcs , stimulation of mmp-2 production is related to mitogenesis and migration of vsmcs . pulmonary arterial hypertension ( pah ) characterized by medial hypertrophy and ecm remodeling of pulmonary arteries is associated with mmp-2 . elevated mmp-2 is found in pah arteries and its overexpression and activation stimulate vsmc proliferation leading to medial wall thickness [ 92 , 93 ] . oxidized ldl ( ox - ldl ) , a risk factor promoting atherogenesis , induces vsmc proliferation through activating multiple pathways . mmp-2 triggers ox - ldl induced activation of sphingomyelin / ceramide pathway and subsequent erk1/2 activation and dna synthesis that finally leads to vsmc proliferation . mmp-2 deficiency resulted in deceased arterial smc migration and invasion ability in vitro and attenuated intimal hyperplasia after carotid ligation in vivo . transfection sv - smcs with mmp-2 sirna resulting in mmp-2 silencing inhibits invasive capacity of cultured human sv - smcs . young and aged human aortic smcs possessing different migratory ability at least partially attribute to mmp-2 expression and activation . young smcs show higher migratory capacity due to producing more active mmp-2 , while aged smcs only produce inactive zymogen form of mmp-2 . moreover , many factors stimulate migration of vsmcs in mmp-2-dependent manner . for example , interleukin - l ( il - l ) , an inflammatory cytokine which is related to vsmc migration during neointimal formation , enhances active mmp-2 synthesis and activation of pro - mmp-2 , stimulating vsmc migration . rat vsmcs overexpressing mmp-9 show enhanced migration and invasion in the collagen invasion assay as well as boyden chamber in vitro and increased invasion into medial and intimal layers when seeded on the outside of the artery in vivo . genetic mmp-9 knockout impairs migratory activity of isolated vsmcs and decreases intimal hyperplasia [ 101 , 102 ] . in addition , lack of mmp-9 reorganizes collagenous matrix and reduces vsmc attachment to gelatin [ 95 , 102 ] . it indicates that mmp-9 not only degrades ecm , but also conducts a connection between cell surface and matrix . various cytokines induced in vascular injury and immunoinflammatory responses contribute to atherosclerosis and restenosis through mmp-9 mediated vsmc migration . tnf- upregulates nuclear foxo4 , which in turn activates transcription of mmp-9 gene , through the n - terminal , sp1-interactive domain , and the c - terminal transactivation domain of foxo4 . both il-18 and il-17 mmp-9 expression induced by il-18 and il-17 is via nf-b and ap-1 signaling activation [ 46 , 47 ] . studies also find that vsmc replication is significantly decreased in mmp-9(/ ) arteries . recent evidence shows that mmp-9 regulates vsmc proliferation by modulating cell adhesion as well as cadherin and -catenin association . cleaves n - cadherin and releases -catenin which translocates to the nucleus and regulates cyclin d1 expression in vsmcs . mt1-mmp is initially described as an activator of mmp-2 in vascular remodeling . in neointimal development subjected to balloon catheter injury , increased mt1-mmp level is of importance to mmp-2 activation and neointimal formation [ 103 , 104 ] . however , since mt1-mmp possesses a broad spectrum of substrates , an increasing number of studies demonstrate that mt1-mmp participates in vascular remodeling not only via mmp-2 activating . proteinases such as plasmin , cysteine proteinases , mmp-2 , and mmp-9 previously linked to vsmc migration in 2d substrata do not play a vital role in 3d matrix environment , whereas mt1-mmp , a key pericellular collagenolysin of type i and iii collagens , enhances vsmc invasion into 3d collagenous barriers in vitro . furthermore , mmt1-mmp deficiency attenuates neointimal hyperplasia and arterial lumen narrowing in vivo via a mmp-2 , and mmp-9-independent role . on the other hand , mt1-mmp cleaves or modulates cell surface molecules to influence vsmc behavior . platelet - derived growth factor ( pdgf)/pdgfr signaling pathway is critical in vsmc migration and proliferation during vasculature development and vsmc phenotypic switch [ 106 , 107 ] . in vsmc investment of the vasculature , mt1-mmp associates with pdgfr as a necessary cofactor . active mt1-mmp functions as a pdgf - b selective regulator of efficient induction of pdgf - b / pdgfr downstream signal transduction that eventually leads to proliferation and chemotaxis of vsmcs . mt1-mmp additionally , in vsmc dedifferentiation , mt1-mmp proteolytically processes ldl receptor - related protein 1 ( lrp1 ) and promotes endocytosing of pdgfr-3-integrin - mt1-mmp - lrp1 complex , which impairs the negative regulation of pdgfr depending on ligands binding to lrp1 [ 109 , 110 ] . moreover , apoe is also shown to inhibit pdgf - induced vsmc migration and proliferation [ 111 , 112 ] . this process is mediated via apoe binding to lrp1 and subsequent activation of camp - dependent protein kinase a [ 113 , 114 ] . interestingly , apoe is identified as a mt1-mmp substrate , so that mt1-mmp can cleave apoe to suppress apoe - lrp1 binding and downstream signaling [ 115 , 136 ] . to sum up , mt1-mmp - dependent lrp1 and apoe cleavage activate pdgf / pdgfr signaling pathway and then enhance vsmc proliferation and migration . interstitial flow is elevated in vascular injury and hypertension and is believed to participate in vsmc migration and vascular remolding . in an in vitro 3d collagen i system , upregulation of mmp-1 mediates interstitial flow enhanced vsmc migration , while mmps inhibitor gm6001 attenuates flow enhanced migration . erk1/2 phosphorylation and increased expression of ap-1 transcription factor c - jun are implicated in interstitial flow induced mmp-1 expression and vsmc motility . additionally , studies of mmp-1 in pah depict the preventive effect of mmp-1 in medial hypertrophy and enhanced remodeling of pulmonary arteries . mmp-1 transgenic mice show decreased medial hyperplasia via impaired cell proliferation of vsmcs and reduced excessive collagen deposition the main cause of vein graft failure is intimal hyperplasia , a process dominated by proliferation and migration of vsmcs . recently , a common insertion / deletion polymorphism in mmp-3 gene promoter region , known as 5a/6a polymorphism , is reported . there is evidence suggesting that 5a/6a polymorphism is related to mmp-3 expression and activation and individuals ' susceptibility to many cardiovascular diseases . however , mmp-3 5a/6a polymorphism does not affect invasion of saphenous vein smcs isolated from patients with different genotypes . mmp-3 knockout significantly reduces vsmc migration in vitro and neointima formation after carotid ligation in vivo . combination of mmp-3 and mmp-9 knockout or knockdown reveals that mmp-3 mediated activation of mmp-9 is required and efficient in neointimal hyperplasia . preventive effects of mmp-3 in venous neointima via gene transfer and deteriorative role of mmp-3 found in carotid neointimal hyperplasia using genetic knockout seem paradoxical . the possible explanation could be the diverse properties of vein and artery , the distinct procedures inducing neointimal formation , or even the different methods generating genetic modifications . the fact that mmp-3 possesses the broadest substrate specificity among all mmps makes it more complicated to fully understand the exact roles of mmp-3 in vsmc functions and vessel formation . effects of mmps on vsmc proliferation and migration are widely discussed in various studies . however , there areonly a few studies to investigate the functional involvements of mmps in vsmc apoptosis . mmp-7 , detectable in unstable atherosclerotic plaques , cleaves n - cadherin which is vital in cell adhesion and survival and then promotes vsmc apoptosis . therefore , mmp-7-dependent n - cadherin cleavage and cell apoptosis may promote plaque development and rupture . it has been shown that several cell survival and vsmc viability maintaining factors including n - cadherin , platelet - derived growth factor ( pdgf ) , heparin binding endothelial growth factor ( hb - egf ) , and insulin - like growth factor 1 ( igf-1 ) can be cleaved and modulated by mmps . however , direct evidence presenting mmps mediated vsmc apoptosis still needs to be achieved in the future work . in conclusion , mmps including mmp-1 , mmp-2 , mmp-3 , mmp-7 , mmp-8 , mmp-9 , mmp-12 , and mt1-mmp play a crucial role in blood vessel formation , remodeling , or angiogenesis through regulating the functions or behaviors of stem / progenitor and vascular cells . numerous stimuli which are risk factors of blood vessel - related disorders such as oxidative stress , inflammatory factors , hemodynamic forces , hormones , and hypoxia provoke mmp expression and activation . once activated , mmps modulate various behaviors of stem / progenitor cells , vascular ecs and vsmcs , which in turn contribute to physiopathological processes in vascular formation , remodeling as well as angiogenesis . the major and predominant role of mmps in angiogenesis is still the degradation of ecm components to promote recruitment of stem / progenitor cells and facilitate migration and invasion of ecs and vsmcs . in addition , effects of mmps on cell proliferation and apoptosis are discovered . it has been well known that other important molecular mechanisms by which mmps regulate vascular cell proliferation and apoptosis are via proteolytically cleaving and modulating non - ecm molecules in vegf - vegfr signaling , upa - upar signaling , and cell - cell adhesion . as vascular cells are fundamental elements participating in vascular formation , remodeling , or angiogenesis , regulation of vascular cell behaviors via modulating the expression and activation of mmps seems to provide a reasonable way for therapeutic purpose . tissue inhibitors of mmps , inhibitory antibodies , and chemically - synthesized mmp inhibitors show certain effects on amelioration of pathological changes in animal models of vascular diseases [ 11 , 138 ] . however , only doxycycline has been approved by the food and drug administration for clinical application until now . this is partially due to the broad substrate spectrum , overlapped proteolytic effects , and wide distribution of mmps and nonspecificity of mmp inhibitors . several approaches such as site specific delivery and generating mmp inhibitors with increased selectivity are thought to be helpful for mmps - targeted therapy . however , further understanding of mmps governing vascular cell behaviors and their specific underlying mechanisms is still essential to develop novel therapies . except for mmp inhibitors , factors promoting mmp gene transcription and signaling

saponins are key constituents of panax ginseng meyer to exhibit various pharmacological activities . to date , approximately 80 kinds of saponin have been isolated from p. ginseng . most have two kinds of dammarane - type triterpenoid moieties as aglycones : protopanaxdiol ( diol , ppd ) and protopanaxtriol ( triol , ppt ) . only ginsenoside ro analogs have oleanolic acid as an aglycone . nuclear magnetic resonance ( nmr ) is the most common method for identifying ginsenosides , but many variations and inaccuracies can be found in the published nmr data . we previously described the several physicochemical and spectroscopic characteristics of four major diol - ginsenosides , rb1 , rb2 , rc , and rd , and the ginsenoside rg1 , all of which were measured using standard methods . we also identified their signals using two - dimensional nmr spectroscopic methods . in this study , we obtained physicochemical and spectroscopic data for four major triol- saponins : the ginsenosides re ( 1 ) , rf ( 2 ) , rg2 ( 3 ) , and 20-gluco - rf ( 4 ) . the aglycone of the ginseng triol - saponins is a ppt , which is a dammarane triterpenoid hydroxylated to c-3 , c-12 , and c-20 via -linkage and to c-6 via -linkage with a double bond between c-24 and c-25 . in triol - saponins , the ginsenosides re ( 1 ) and 20-gluco - ginsenoside rf ( 4 ) are bisdesmosidic and the ginsenosides rf ( 2 ) and rg2 ( 3 ) are monodesmosidic saponins . the ginsenoside re ( 1 ) has an -l - rhamnopyranosyl-(12)--d - glucopyranose moiety at 6-oh and a -d - glucopyranose moiety at 20-oh . the 20-gluco - ginsenoside rf ( 4 ) has a sophorose moiety ( -d - glucopyranosyl-(12)--d - glucopyranose ) at 6-oh and a -d - glucopyranose moiety at 20-oh . the monodesmoside ginsenosides rf ( 2 ) and rg2 ( 3 ) have sophorose and -l - rhamnopyranosyl-(12)--d - glucopyranose moieties , respectively , at 6-oh ( fig . 1 ) . the literature has varying assignments for the nmr signals for the hydroxyl group - linked atoms , the methyl carbon atoms , the olefinic carbon atoms , and for protons linked to individual carbon atoms [ 515 ] . this study definitively identified individual proton and carbon signals using the two - dimensional nmr techniques of correlation spectroscopy , nuclear overhauser effect spectroscopy , heteronuclear single quantum correlation ( hsqc ) , and heteronuclear multiple bond connectivity ( hmbc ) . melting points , specific rotation , ir absorbance , and fast atom bombardment ( fab)/ms data were obtained using standard methods and data were compared to findings in the literature [ 5,7,10,1521 ] . the retention factor ( rf ) of each saponin in both normal and reverse - phase tlc experiments and the retention time of each ginsenoside by carbohydrate - based hplc were also determined . six - year - old fresh ginseng roots were purchased from the geumsan ginseng market in chungnam , korea in october 2007 . kieselgel 60 and lichroprep rp-18 were used for column chromatography ( merck , darmstadt , germany ) . kieselgel 60 f254 and rp-18 f254s were used as tlc solid phases ( merck ) . the former used a mobile phase of chcl3methanol ( meoh)h2o ( 65:35:10 ) and the latter used meoh h2o ( 2:1 ) . detection of substances on tlc plates was by observation under a uv lamp ( spectroline , model enf-240 c / f ; spectronics corp . , new york , ny , usa ) or by spraying developed plates with 10% aqueous h2so4 followed by heating and observing color development . hplc was at 50c and 30 psi using an lc-20a ( shimadzu , kyoto , japan ) with an evaporative light scattering detector ( elsd ; shimadzu ) . hplc analytical columns were carbohydrate es ( 5 m , 250 46 mm ; grace , deerfield , il , usa ) eluted with step - wise gradients at a flow rate of 0.8 ml / min using solvent a ( acetonitrile h2o isopropanol = 80:5:15 ) and solvent b ( acetonitrile h2o isopropanol = 60:25:15 ) . b was 25% from 0 min to 12 min , 25 80% from 12 min to 32 min , 80 90% from 32 min to 33 min , 90% from 33 min to 38 min , 9025% from 38 min to 40 min . nmr spectra were recorded on a varian inova as 400 spectrometer ( 400 mhz ; varian , palo alto , ca , usa ) with 0.0625 mol of each ginsenoside ( 59.1 mg re , 50.0 mg rf , 49.0 mg rg2 , and 60.1 mg 20-gluco - rf ) dissolved in 0.75 ml ( 0.083 m ) pyridine - d5 and placed in a 5-mm - diameter nmr tube ( norell , landisville , nj , usa ) with a tetramethylsilane standard adjusted to 0 ppm . ir spectra were measured with an ir spectrometer ( model 599b ; perkinelmer , waltham , ma , usa ) . for each sample , 2 mg were dissolved in 100 ul of meoh and a drop of the solution was added to a caf2 salt plate ( spectral systems , hopewell junction , ny , usa ) and evaporated . fab / ms was carried out with a jms-700 mass spectrometer ( jeol , tokyo , japan ) using glycerol as a matrix . optical rotation was measured with a p-1020 polarimeter ( jasco , tokyo , japan ) on 10 mg of each ginsenoside , dissolved in meoh in a 1 ml sample cell at a depth of 1 dm ( jasco ) . melting points were obtained using an ez - melt mpa 120 automated melting point apparatus ( stanford research systems , sunnyvale , ca , usa ) , and values obtained were uncorrected . six - year - old fresh ginseng roots ( 20 kg fresh weight ) were cut into pieces and extracted with 90% meoh ( 5.45 l ) for 24 h at room temperature . extracts were filtered through filter paper and residues were extracted twice more with 80% meoh ( 4 l ) . filtrates were evaporated under reduced pressure at 45c to yield 2.2 kg of dried extract . dried extract was partitioned between ethyl acetate ( 3 l 3 ) and h2o ( 3 l ) . the remaining h2o layer was extracted with n - butanol ( n - buoh , 2.8 l 3 ) . each layer was concentrated under reduced pressure to obtain ethyl acetate ( 25 g ) , n - buoh ( 169 g ) , and h2o fractions . the n - buoh extract ( 160 g ) was applied to a silica gel column ( 10 cm 24 cm ) and eluted in three steps with chcl3meoh h2o ( step 1 = 65 l of 10:3:1 , step 2 = 55 l of 8:3:1 , and step 3 = 30 l of 6:4:1 ) to yield 24 fractions ( pgb1pgb24 ) . fractions pgb9 and pgb10 were combined ( 18.08 g , ve / vt = 0.350.43 , where ve was volume of eluent for the fraction and vt was total elution volume ) , and separated on a silica gel column ( 6.5 cm 15 cm ) with chcl3meoh h2o ( 65:35:10 , 111 l ) as eluent to obtain 14 fractions ( pgb9 + 10 - 1pgb-9 + 10 - 14 ) . fractions pgb9 + 10 - 10 and pgb9 + 10 - 11 were combined ( 13.4 g , ve / vt = 0.6750.781 ) , and separated on a silica gel column ( 7 cm 16 cm ) with chcl3:n - buoh : meoh : h2o ( 10:1:3:1 , 104 l ) as eluent to obtain eight fractions ( pgb-9 + 10 - 10 + 11 - 1pgb-9 + 10 - 10 + 11 - 8 ) . fraction pgb9 + 10 - 10 + 11 - 5 ( 434 mg , ve / vt = 0.410.49 ) was fractionated over an octadecyl silica gel ( ods ) column ( 4 cm 6 cm , meoh l ) into 16 fractions ( pgb9 + 10 - 10 + 11 - 5 - 1pgb9 + 10 - 10 + 11 - 5 - 16 ) including ginsenoside rg2 [ 3 , pgb9 + 10 - 10 + 11 - 5 - 13 , 36.1 mg , ve / vt = 0.770.84 , tlc rf = 0.31 ( rp-18 f254s , meoh h2o = 3:1 ) , and rf = 0.45 ( kieselgel 60 f254 , chcl3meoh-h2o = 65:35:10 ) ] . fractions pgb16 and pgb17 were combined ( 12 g , ve / vt = 0.650.72 ) , and separated on a silica gel column ( 4 cm 6 cm ) with a chcl3meoh h2o ( 65:35:10 , 98 l ) as eluent for 20 fractions ( pgb16 + 17 - 1pgb16 + 17 - 20 ) . pgb16 + 17 - 7 ( 370 mg , ve / vt = 0.180.20 ) was fractionated over the ods column ( 4 cm 5 cm , meoh h2o = 3:1 , 2 l ) for 20 fractions ( pgb16 + 17 - 7 - 1pgb-16 + 17 - 7 - 20 ) including ginsenoside rf [ 2 , pgb16 + 17 - 7 - 16 , 3.4 mg , ve / vt = 0.7120.798 , tlc rf = 0.42 ( rp-18 f254s , meoh - h2o = 3:2 ) , and rf = 0.44 ( kieselgel 60 f254 , chcl3meoh fraction pgb16 + 17 - 9 ( 1.7 g , ve / vt = 0.250.29 ) was separated over the ods column ( 4 6 cm , meoh l ) into 36 fractions ( pgb16 + 17 - 9 - 1pgb16 + 17 - 9 - 36 ) including the 20-gluco - ginsenoside rf [ 4 , pgb16 + 17 - 9 - 12 , 223 mg , ve / vt = 0.220.27 , tlc rf = 0.54 ( rp-18 f254s , meoh = 2:1 ) , rf = 0.31 ( kieselgel 60 f254 , chcl3meoh h2o = 65:35:10 ) ] and the ginsenoside re [ 1 , pgb16 + 17 - 9 - 15 . 68.3 mg , ve / vt = 0.380.40 , tlc rf = 0.50 ( rp-18 f254s , meoh h2o = 2:1 ) , and rf = 0.36 ( kieselgel 60 f254 , chcl3meoh the purity of the isolated compounds was over 99% as determined by hplc and h - nmr . most of the saponins were obtained as white powders , in agreement with most of the literature in which ginsenosides were obtained as white or colorless powders . preliminary experiments showed that more precise and accurate melting points were obtained with the stanford research systems melting point apparatus we used than with the fisher - john instrument used previously . as a result , melting points determined in this study often differed significantly from values found in the literature . the melting points of ginsenoside re ( 1 ) in the literature are from 168c to 198c , whereas the results of this study indicated a melting point of 186187c . the literature value for ginsenoside rf ( 2 ) is 197198c , whereas this study found that it was 180181c . the reference - state melting point of ginsenoside rg2 ( 3 ) is 187189c in the literature , whereas it was found to be 191192c in this study . the reported melting point for 20-gluco - ginsenoside rf ( 4 ) is 204c , whereas this study found that it was 204205c . ginsenoside re ( 1 ) has an optical rotation of 1.0 according to previous studies , whereas it measured 1.80 in this study . likewise , the optical rotation of ginsenoside rf ( 2 ) is + 6.99 in other studies , whereas a value of + 13.80 was obtained here . the specific rotation of ginsenoside rg2 ( 3 ) measured 3.84 , whereas the literature value is + 6.0 . for 20-gluco - ginsenoside rf ( 4 ) , the literature value is + 21.0 , whereas the result obtained here was + 64.00. the many hydroxyl groups of the ginsenosides studied here make them insoluble in nonpolar solvents such as chcl3 or ccl4 . therefore , each compound was mixed with kbr and compressed under reduced pressure to form a pellet for ir absorbance measurement . however , spectroscopic interference derived from water absorption by the pellet required the use of an alternative method , in which the saponin was dissolved in meoh , cast onto caf2 or lif plates , and allowed to evaporate . ginsenosides re ( 1 ) , rf ( 2 ) , rg2 ( 3 ) , and 20-gluco - rf ( 4 ) exhibited absorption peaks corresponding to the o h stretching of each hydroxyl group ( 3359 , 3360 , 3391 , and 3360 , respectively ) , c h stretching ( 2929 , 2924 , 2930 , and 2930 ) , c = c stretching ( 1642 , 1637 , 1635 , and 1635 ) , c h bending ( 1072 , 1071 , 1070 , and 1074 ) , and c o bending ( 1045 , 1031 , 1048 , and 1032 ) . thus , mass spectra are usually obtained with fab / ms instead of ei / ms . the soft ionization method fab / ms distinguishes between molecular ions and fragment ions of relatively smaller proportions . the negative ionization method showed better spectrums for the ginsenosides than a positive ionization method . ginsenoside re ( 1 ) showed a molecular ion at m / z 945 ( [ m - h ] ) and fragment ions peaks at m / z 765 , 475 , and 265 . the molecular ion of ginsenoside rf ( 2 ) was observed at m / z 799 ( [ m - h ] ) with fragment peaks at m / z 475 and 325 . ginsenoside rg2 ( 3 ) showed m / z 765 ( [ m - h2o - h ] ) as a pseudomolecular ion peak and m / z 281 and 255 as fragment ion peaks . 20-gluco - ginsenoside rf ( 4 ) revealed a molecular ion peak at m / z 961 ( [ m - h ] ) with a fragment ion peak at m / z 799 . nmr spectra were obtained at 40c from 0.08 m solutions of compounds dissolved in pyridine - d5 . each spectrum was the accumulation of eight scans for h - nmr and > 1024 scans for c - nmr . tms was used as an internal standard adjusted to 0 ppm . because ginsenoside re ( 1 ) contains two attached sugar moieties pyridine - d5 has few double bonds and many oxygen - linked carbon atoms so it was a better solvent for nmr measurements because it resulted in less overlap between the ginsenoside- and solvent - derived signals than deuterated methanol or dmso - d6 . the methyl carbon atoms c-18 , c-19 , c-29 , and c-30 of ginsenoside re ( 1 ) in pyridine - d5 corresponded to peaks at c 17.386 , 17.628 , 17.780 , and 17.325 , respectively . the carbon signals were confirmed based on cross peaks with corresponding proton signals for c-18 , c-19 , c-29 , and c-30 at h 1.14 , 0.93 , 1.33 , and 0.92 , respectively , in the hsqc spectrum ( fig . cross peaks were also seen in the hmbc spectrum , with h-26 at h 1.58 showing cross peaks with the carbon signal at c 17.886 ( c-27 ) , and h-28 at h 2.04 with the carbon signal at c 17.780 ( c-29 ; fig . methylene proton signals h-15 ( h 0.82 , 1.48 ) and h-22 ( h 1.75 , 2.34 ) differed from the chemical shifts in the literature . these signals were confirmed using the cross peaks with corresponding carbon signals for c-15 at c 30.822 and c-22 at 36.092 in the hsqc spectrum ( fig . c - nmr measured in dmso - d6 showed peaks that were generally shifted upfield compared to those in spectra acquired in pyridine - d5 . the extent of this shift was 0.292.37 ppm . also , h - nmr measured in dmso - d6 exhibited peaks shifted upfield compared to those measured in pyridine - d5 . in particular , oxygen - linked proton atoms h-3 , h-6 , and h-12 of the aglycone moiety , as well as the hemiacetal proton atoms h-1 , h-1 , and h-1 of the sugar moieties , showed chemical shifts of 0.51 ppm for h-3 , 0.67 for h-6 , 0.60 for h-12 , 0.75 for h-1 , 1.36 for h-1 , and 0.72 for h-1. among the eight methyl groups , h-18 , h-21 , h-28 , and h-29 showed the largest shifts upfield of 0.20 ppm , 0.33 ppm , 0.83 ppm , and 0.59 ppm , respectively . the chemical name of ginsenoside re ( 1 ) is 6-o-[-l - rhamnopyranosyl(12)--d - glucopyranosyl]-20-o--d - glucopyranosyl-3,6,12,20-tetrahydroxydammar-24-ene , and we could completely assign the h and c - nmr chemical shifts of the compound as in tables 2 and 3 . the observed chemical shifts of c-18 ( c 17.568 ) , c-19 ( c 17.757 ) , c-27 ( c 17.848 ) , c-29 ( c 16.916 ) , and c-30 ( c 16.969 ) in the c - nmr spectrum of ginsenoside rf ( 2 ) differed from those in the literature . these shifts were confirmed from cross peaks with corresponding proton signals at h 1.14 for c-18 , 0.94 for c-19 , 1.62 for c-27 , 1.42 for c-29 , and 0.81 for c-30 in the hsqc spectrum ( fig . in addition , in the hmbc spectrum , h-26 at h 1.65 showed a cross peak with the carbon signal at c 17.848 ( c-27 ) , and h-28 at h 2.03 with the carbon signal at c 16.916 ( c-29 ; fig . the chemical name of ginsenoside rf ( 2 ) is 6-o-[-d - glucopyranosyl(12)--d - glucopyranosyl]-3,6,12,20-tetrahydroxydammar-24-ene , and we could completely assign the h and c - nmr chemical shifts of the compound ( tables 2 and 3 ) . the methyl carbon atoms c-18 , c-19 , c-27 , c-29 , and c-30 of ginsenoside rg2 ( 3 ) in pyridine - d5 corresponded to peaks at c 17.196 , 17.667 , 17.757 , 17.667 , and 16.969 , respectively . the carbon signals were confirmed based on cross peaks with corresponding proton signals h 1.13 for c-18 , 0.91 for c-19 , 1.59 for c-27 , 1.29 for c-29 , and 0.89 for c-30 , in the hsqc spectrum ( fig . carbon signals were also confirmed with the hmbc spectrum with methyl proton signals at h 1.64 ( h-26 ) and h 1.99 ( h-28 ) showing cross peaks with carbon signals at c 17.757 ( c-27 ) and c 17.667 ( c-29 ; fig . both methyl proton signals at h 1.59 ( h-27 ) and h-26 correlated with carbon signals at c 126.202 ( c-24 ) and c 130.691 ( c-25 ; fig . the chemical name of ginsenoside rg2 ( 3 ) is 6-o-[-l - rhamnopyranosyl(12)--d - glucopyranosyl]-3,6,12,20-tetrahydroxydammar-24-ene , and we could completely assign the h and c - nmr chemical shifts of the compound ( tables 2 and 3 ) . for tetracyclic triterpene glycosides , many of the methine and methylene proton signals overlapped upfield , and many of the oxygenated - methine and oxygenated - methylene proton signals of sugars overlapped in h - nmr spectra . thus , one - dimensional nmr techniques were not useful for identification of those protons . to date , peak assignments in nmr data for tetracyclic triterpene glycosides have been based on previously reported data . however , many of the earlier data might be erroneous because of instrument - resolution limitations . little nmr data are available for 20-gluco - ginsenoside rf ( 4 ) , the chemical name of which is 6-o-[-d - glucopyranosyl(12)--d - glucopyranosyl]-20-o--d - glucopyranosyl-3,6,12,20-tetrahydroxydammar-24-ene . in this study , the definite assignment of nmr data of the compound was established for the first time by extensive nmr experiments including correlation spectroscopy , nuclear overhauser effect spectroscopy , hsqc , and hmbc ( tables 2 and 3 ) . by normal - phase silica gel tlc ( chcl3meoh h2o = 65:35:10 ) , rf values were 0.27 for re ( 1 ) , 0.37 for rf ( 2 ) , 0.51 for rg2 ( 3 ) , and 0.28 for 20-gluco rf ( 4 ) . = 2:1 ) yielded rf values of 0.57 , 0.29 , 0.13 , and 0.65 , respectively . in 10% h2so4 with heating , hplc retention times were 27.1 min for re ( 1 ) , 20.6 min for rf ( 2 ) , 10.3 min for rg2 ( 3 ) , and 30.2 min for 20-gluco rf ( 4 ) .

we identified 8,029 individuals aged 065 years entered in the registry from 1996 to 2005 . data were routinely collected after patient consent in a standardized fashion from 50 british cystic fibrosis specialist centers . of 8,029 patients , 6,678 had complete baseline data defined as registration followed within the same calendar year by a visit consisting of an annual review plus a clinic visit . of these 6,678 patients , 761 ( 11.4% ) with diabetes were excluded . of the 5,917 individuals without diabetes , 721 lacked further follow - up , leaving 5,196 with at least one annual follow - up visit , and 3,275 patients ( aged 2.055.3 years ) with complete data for all covariates . patients with complete data ( compared with those without ) did not differ by sex but were older ( median 14.1 vs. 5.2 years , p < 0.0001 ) , due mainly to the difficulty of acquiring pulmonary function testing in babies and young children . diabetes was defined as a physician diagnosis of diabetes , plasma glucose values consistent with diabetes from oral glucose tolerance testing ( ogtt ) , or treatment with insulin or oral hypoglycemic drugs . risk factors examined included age , sex , ethnicity , age of diagnosis of cystic fibrosis , respiratory infections , bmi , and pancreatic , hepatic , or pulmonary dysfunction . they also included supplemental feeding , prior organ transplantation , corticosteroid use , and method of detection ( whether cystic fibrosis was detected via screening and cftr genotype ) . bmi was calculated as weight in kilograms divided by the square of height in meters . pancreatic dysfunction was defined as use of pancreatic enzyme supplementation , and hepatic dysfunction was defined as portal hypertension , abnormal liver function tests , or use of the bile acids ( ursodeoxycholic acid or taurine ) . pancreatic enzyme supplementation was expressed as total daily dose of the lipase component and as daily dose per kilogram of body weight . an individual was considered infected with bacteria or fungi if these were cultured from sputum at baseline or if a physician had diagnosed chronic infection from at least two isolates in the year before baseline . organisms included pseudomonas aeruginosa , staphylococcus aureus , burkholderia cepacia , haemophilus influenzae , methicillin - resistant s. aureus , and aspergillus fumigatus . pulmonary function was measured using forced expiratory volume at 1 s ( fev1 ) and forced vital capacity expressed as percentage predicted ( 11 ) . genotypes associated with cystic fibrosis were coded into five established classes reflecting cftr function of defective production , processing , regulation , conductance , and quantity of cftr protein ( 12 ) as follows : i : g542x , r553x , w1282x , r1162x , 6211gt , 17171ga , 1078t , and 3659c ; ii : f508 , i507 , n1303k , and s549n ; iii : g551dand r560 t ; iv : r117h , r334w , g85e , and r347p ; v : 3849 + 5ga , and a455e ; and unknown : 711+igt , 2184da , and 1898+iga . patients with two alleles within the same class or only one allele typed were assigned that class . incidence rates for cfrd were calculated as the number of new cases divided by follow - up time among the 5,196 patients with baseline and follow - up data and stratified by 10-year age - groups and sex . in this retrospective cohort , follow - up time lasted from registration to the first detection of diabetes or censoring and is expressed in person - years . among the 3,275 individuals with complete data , we tested differences between patients who did and did not develop diabetes with tests for categorical variables and t tests or kruskal - wallis tests for normally or nonnormally distributed continuous variables . proportional hazards modeling identified potential risk factors . for categorical variables , we evaluated proportional hazards assumptions using kaplan - meyer survival curves . we chose variables for multivariate modeling if they were associated with cfrd in univariate analyses at p 0.05 . age at baseline , bmi , bmi z score , and fev1 were coded as continuous . binary variables included sex , ethnicity ( at least one nonwhite parent versus two white parents ) , hepatic dysfunction , supplemental feeding , respiratory infections , abpa , oral pancreatic enzyme supplementation , and corticosteroid use ( oral and/or inhaled ) within the year before registration . age of diagnosis of cystic fibrosis and dose of pancreatic enzyme supplementation were coded as binary variables around the medians . we coded cftr genotype by class as described and as a binary variable ( class i ii vs. iii we calculated hazard ratios ( expressed as relative risks [ rrs ] ) with 95% cis . we performed database manipulations using cach ( intersystems , 2007 ) and statistical analyses using r ( r development core team , 2007 ) . diabetes was defined as a physician diagnosis of diabetes , plasma glucose values consistent with diabetes from oral glucose tolerance testing ( ogtt ) , or treatment with insulin or oral hypoglycemic drugs . risk factors examined included age , sex , ethnicity , age of diagnosis of cystic fibrosis , respiratory infections , bmi , and pancreatic , hepatic , or pulmonary dysfunction . they also included supplemental feeding , prior organ transplantation , corticosteroid use , and method of detection ( whether cystic fibrosis was detected via screening and cftr genotype ) . bmi was calculated as weight in kilograms divided by the square of height in meters . pancreatic dysfunction was defined as use of pancreatic enzyme supplementation , and hepatic dysfunction was defined as portal hypertension , abnormal liver function tests , or use of the bile acids ( ursodeoxycholic acid or taurine ) . pancreatic enzyme supplementation was expressed as total daily dose of the lipase component and as daily dose per kilogram of body weight . an individual was considered infected with bacteria or fungi if these were cultured from sputum at baseline or if a physician had diagnosed chronic infection from at least two isolates in the year before baseline . organisms included pseudomonas aeruginosa , staphylococcus aureus , burkholderia cepacia , haemophilus influenzae , methicillin - resistant s. aureus , and aspergillus fumigatus . pulmonary function was measured using forced expiratory volume at 1 s ( fev1 ) and forced vital capacity expressed as percentage predicted ( 11 ) . genotypes associated with cystic fibrosis were coded into five established classes reflecting cftr function of defective production , processing , regulation , conductance , and quantity of cftr protein ( 12 ) as follows : i : g542x , r553x , w1282x , r1162x , 6211gt , 17171ga , 1078t , and 3659c ; ii : f508 , i507 , n1303k , and s549n ; iii : g551dand r560 t ; iv : r117h , r334w , g85e , and r347p ; v : 3849 + 5ga , and a455e ; and unknown : 711+igt , 2184da , and 1898+iga . patients with two alleles within the same class or only one allele typed were assigned that class . incidence rates for cfrd were calculated as the number of new cases divided by follow - up time among the 5,196 patients with baseline and follow - up data and stratified by 10-year age - groups and sex . in this retrospective cohort , follow - up time lasted from registration to the first detection of diabetes or censoring and is expressed in person - years . among the 3,275 individuals with complete data , we tested differences between patients who did and did not develop diabetes with tests for categorical variables and t tests or kruskal - wallis tests for normally or nonnormally distributed continuous variables . proportional hazards modeling identified potential risk factors . for categorical variables , we evaluated proportional hazards assumptions using kaplan - meyer survival curves . we chose variables for multivariate modeling if they were associated with cfrd in univariate analyses at p 0.05 . age at baseline , bmi , bmi z score , and fev1 were coded as continuous . binary variables included sex , ethnicity ( at least one nonwhite parent versus two white parents ) , hepatic dysfunction , supplemental feeding , respiratory infections , abpa , oral pancreatic enzyme supplementation , and corticosteroid use ( oral and/or inhaled ) within the year before registration . age of diagnosis of cystic fibrosis and dose of pancreatic enzyme supplementation were coded as binary variables around the medians . we coded cftr genotype by class as described and as a binary variable ( class i ii vs. iii we calculated hazard ratios ( expressed as relative risks [ rrs ] ) with 95% cis . we performed database manipulations using cach ( intersystems , 2007 ) and statistical analyses using r ( r development core team , 2007 ) . the median age of the cohort was 12.0 years ( interquartile range 6.019.8 ) ; 54% were male and 96% were white . the characteristics of the study population and of those who did or did not develop cfrd are shown ( table 1 ) . of 5,196 patients , 526 developed diabetes during 15,010 person - years of follow - up ( median 2.67 years , range 0.088.33 years ) . in 40% ( 211 patients ) , diabetes was diagnosed on the basis of insulin use , in 22% ( 117 patients ) from ogtt results , in 4% ( 20 patients ) on the basis of use of oral hypoglycemic drugs , and in 1% ( 5 patients ) by a physician . the incidence of diabetes was 3.5% per year . during follow - up , 202 patients died without having the diagnosis of diabetes . the incidence rose with age , was higher in female patients up to age 40 , and declined after age 40 for both men and women . annual incidence rose from 1 to 2% in the first decade to 6 to 7% in the fourth decade ( fig . patients with class i mutations had the highest incidence of cfrd , and those with class v mutations had the lowest incidence ( fig . the incidence was significantly higher in individuals with class i or ii relative to iii to v mutations ( p < 0.01 ) . in univariate analyses , patients with incident cfrd were less likely to have been screened for cystic fibrosis and more likely to have infections , to have liver or pulmonary function abnormalities , and to have used corticosteroids or pancreatic enzyme replacement . the median fev1 in patients who developed cfrd was 57.8% compared with 75.3% in those who did not ( p < 0.0001 ) . bmi was higher and bmi z scores were lower in those who developed diabetes than in those who did not ( table 1 ) . in a multivariate model , increasing age , female sex , decreasing fev1 , liver dysfunction , pancreatic enzyme replacement , corticosteroids use , and cftr genetic class were independently associated with incident diabetes . cftr class i and ii compared with iii to iv was associated with a rr of 1.70 . female patients were 60% more likely to develop diabetes than male patients , and each year of age or percent decrease in predicted fev1 was associated with a 23% increase in risk ( table 2 ) . diagnosis of cystic fibrosis by screening , pulmonary infections , supplemental feeding , and bmi or bmi z score was not associated with cfrd in multivariate modeling . after exclusion of 334 individuals not taking pancreatic enzymes , a multivariate model ( 362 cases among 2,931 patients ) showed no association between the dosage of pancreatic enzyme replacement and cfrd . of 5,196 patients , 526 developed diabetes during 15,010 person - years of follow - up ( median 2.67 years , range 0.088.33 years ) . in 40% ( 211 patients ) , diabetes was diagnosed on the basis of insulin use , in 22% ( 117 patients ) from ogtt results , in 4% ( 20 patients ) on the basis of use of oral hypoglycemic drugs , and in 1% ( 5 patients ) by a physician . the incidence of diabetes was 3.5% per year . during follow - up , 202 patients died without having the diagnosis of diabetes . the incidence rose with age , was higher in female patients up to age 40 , and declined after age 40 for both men and women . annual incidence rose from 1 to 2% in the first decade to 6 to 7% in the fourth decade ( fig . patients with class i mutations had the highest incidence of cfrd , and those with class v mutations had the lowest incidence ( fig . the incidence was significantly higher in individuals with class i or ii relative to iii to v mutations ( p < 0.01 ) . in univariate analyses , patients with incident cfrd were less likely to have been screened for cystic fibrosis and more likely to have infections , to have liver or pulmonary function abnormalities , and to have used corticosteroids or pancreatic enzyme replacement . the median fev1 in patients who developed cfrd was 57.8% compared with 75.3% in those who did not ( p < 0.0001 ) . bmi was higher and bmi z scores were lower in those who developed diabetes than in those who did not ( table 1 ) . in a multivariate model , increasing age , female sex , decreasing fev1 , liver dysfunction , pancreatic enzyme replacement , corticosteroids use , and cftr genetic class were independently associated with incident diabetes . cftr class i and ii compared with iii to iv was associated with a rr of 1.70 . female patients were 60% more likely to develop diabetes than male patients , and each year of age or percent decrease in predicted fev1 was associated with a 23% increase in risk ( table 2 ) . diagnosis of cystic fibrosis by screening , pulmonary infections , supplemental feeding , and bmi or bmi z score was not associated with cfrd in multivariate modeling . after exclusion of 334 individuals not taking pancreatic enzymes , a multivariate model ( 362 cases among 2,931 patients ) showed no association between the dosage of pancreatic enzyme replacement and cfrd . this large , longitudinal , registry - based study documents a high incidence of cfrd among individuals with cystic fibrosis in britain and demonstrates that cftr mutation class independently increases risk . the study also confirms the fact that female patients are at higher risk for cfrd , which is not accounted for by a higher prevalence of risk factors in female patients . the study also confirms the independent associations of poor hepatic and pulmonary function and of use of pancreatic enzymes or corticosteroids with cfrd . the annual incidence of 3.5% we report is similar to the 3.8% reported from a danish study of fewer than 200 patients ( 2 ) . based on extremely small numbers ( 12 and 6 incident cases of cfrd ) and derived from cumulative incidence values , italian ( 8) and greek ( 14 ) investigators show a cfrd annual incidence of 4.0% . the high incidence of cfrd in the first decade in this study suggests that screening for diabetes in this age - group , although not currently recommended in the u.k . , may be justified . whether individuals with screen - detected diabetes fare better has not been determined . cftr protein regulates the function of chloride channels on the apical membrane of epithelial cells and helps regulate transepithelial transport of other ions and water . the grouping of mutations into functional categories is as follows : class i , no synthesis of cftr ; class ii , degradation of cftr in the endoplasmic reticulum ; class iii , transport of cftr to the cell membrane , but no appropriate response ; class iv , diminished action of cftr in the cell membrane ; and class v , normal but inadequate amounts of cftr ( 12 ) . many studies document associations between functional class and complications of cystic fibrosis , including pancreatic dysfunction ( 13,15 ) . this study shows an association between class and cfrd adjusted for pancreatic exocrine function as measured by pancreatic enzyme replacement . investigators have previously searched for genes in cfrd , concentrating either on those associated with type 2 diabetes and inflammation or with cystic fibrosis . f508 homozygosity was associated with cfrd in some , but not all , studies ( 3,1619 ) . a prospective study comprising few patients with incident diabetes ( n = 12 ) ( 8) showed that patients homozygous for f508 were more likely to develop diabetes . a large u.s . registry - based cross - sectional study reported an association of f508 homozygosity and cfrd but presented only univariate results ( 4 ) . a european registry study documented a greater prevalence of diabetes in adults among class ii ( 282 of 1,276 , 22.1% ) mutations than in class iv mutations ( 1 of 65 , 1.5% ) ; however , no statistical testing was performed , and no incidence rate was calculated ( 5 ) . the present study included 377 patients with cfrd , controlled for confounding factors , and , being longitudinal , accounted in part for competing risks ( 13 ) . genotype may predispose to diabetes via pancreatic dysfunction or may play a more direct role . cfrd results more from decreased -cell function than from decreased insulin sensitivity ( 19 ) . this finding supports a function for cftr in pancreatic islets where , in rats , investigators have identified cftr mrna ( 20 ) . in mice made diabetic by streptozotocin , those who were cftr - null ( / ) had higher blood glucose levels than other mice ; the investigators concluded that islet dysfunction is inherent to the cftr state ( 21 ) . cftr has also been identified in the human hypothalamus , ( 22 ) , where it may play a role in glucose regulation . whether pancreatic exocrine dysfunction mirrors pancreatic endocrine dysfunction is not clear . investigators have found pancreatic exocrine dysfunction in both type 2 and type 1 diabetes . in cystic fibrosis , clinicians adjust doses of pancreatic enzyme to enable patients to eat a diet containing fat and diminish gastrointestinal symptoms . however , studies in cystic fibrosis have shown both under- and overtreatment with pancreatic enzymes relative to native pancreatic function ( 23 ) . the strong association between pancreatic enzyme use and incident diabetes in this study suggests that enzyme use is likely to be a good marker of pancreatic function but may itself increase risk . the association between female sex and cfrd is well described ( 4 ) and differs from that for type 1 or 2 diabetes . earlier puberty with glucose intolerance has been proposed as an explanation ( 24 ) and may in part account for our findings because incidence in female patients rose between age 5 and 10 ( not shown ) . yet the absence of a female predominance at age > 30 suggests that women susceptible to diabetes will have developed it or may have died . an association between poor pulmonary function and cfrd has been reported from cross - sectional studies ( 46 ) , and other studies have demonstrated accelerated decline in pulmonary function before diagnosis of cfrd ( 2,25 ) . in cystic fibrosis , it is possible that pre - diabetic ( or prediagnostic ) states worsen pulmonary function . in the present study , poor pulmonary function preceded diabetes and was independent of age , sex , genotype , medical interventions , and other cystic fibrosis related complications . individuals with diabetes ( but without cystic fibrosis ) have lung parenchymal histological changes including thickened basement membrane , fibrosis , and septal obliteration ( 26 ) , suggesting a direct deleterious effect of hyperglycemia . although cystic fibrosis is characterized by a low bmi , this did not itself increase the risk of diabetes . corticosteroid use was independently associated with diabetes , but abpa and organ transplantation , both indications for corticosteroids , were not , even in univariate analyses . this study 's strength was the use of longitudinal , national , and systematically collected data . with respect to possible biases related to incidence rates , the true incidence of cfrd in britain may be higher than we report for three reasons . first , the calculation of time - to - diabetes overestimated true values because patients developed diabetes before their clinic visits . cystic fibrosis trust recommends annual ogtts during periods of clinical stability ( 17 ) , and > 85% ( 20 of 23 ) of adult centers screen for diabetes . for pediatric centers , last , patients excluded from analysis of incidence were older ( 1 year ) and had worse pulmonary function ( fev1 2% lower ) and , therefore , were at higher risk for cfrd . although incidence rates derived from registries may be less reliable than those from cohort studies , frequent follow - up of patients with cystic fibrosis in the u.k . ( because of disease severity and free care ) diminishes this possibility . despite a longitudinal design , the rr we report for genotype may underestimate the true value if patients at high risk for diabetes died before registration or were less likely to undergo genotyping . for each of the variables ( genotype , corticosteroid use , pancreatic enzyme replacement , poor pulmonary function , and poor hepatic function ) , ascertainment bias is possible . if sicker patients had more frequent clinical visits , then their physicians may have been more likely to diagnose diabetes , and this would mean that the rrs we report overestimate true values . in summary , this study documents the high incidence of diabetes in cystic fibrosis and the fact that cftr mutation class influences the risk of diabetes independent of other risk factors . it suggests that screening for diabetes may be merited across the age spectrum . by establishing age - specific incidence rates , this study provides useful information to health care providers , disease modelers , and clinical trialists . finally , by identifying risk factors , this study may help us better understand the pathogenesis of cfrd .

the latest world health organization investigation shows that hepatocellular carcinoma ( hcc ) is one of the most common malignant diseases and the third leading cause of cancer - related death globally [ 1 , 2 ] . in 2008 , about half of the world 's new cases of liver cancer and related - death were from china , of which 70%80% was hcc . the unique feature of hcc is that antecedent hbv - related chronic hepatitis and liver cirrhosis are common precursor conditions . due to the lack of sensitive methods for early diagnosis , many patients were diagnosed in advanced disease , missing the best treatment period . although surgery , chemotherapy , and liver transplantation are effective methods for treatment , the advanced stage of hcc limits their choices for curative treatment . sal - like protein 4 ( sall4 ) , a zinc finger transcription factor , plays an important role in maintenance of pluripotency and self - renewal of embryonic stem cells by regulating stem cell markers first with nanog and second with oct4 and sox2 m [ 46 ] . sall4 mutation causes okihiro syndrome and many researchers have demonstrated that sall4 is essential in hematopoietic stem cells and regulates their expansion . in primary acute myeloid leukemia ( aml ) and myelodysplastic syndrome ( mds ) , the expression of sall4 is higher than health control . at the meaning time , some other kinds of tumor such as colorectal cancer , breast cancer , and wilms tumors also express sall4 [ 4 , 7 , 8 ] . more recently , sall4 has been suggested as a marker of germ cell tumor , including primary and metastatic of yolk sac tumor [ 913 ] . in the liver , some researchers have found that sall4 was reexpressed and associated with the poorest prognosis in a subgroup of adult hepatocellular carcinomas . however , they had some studies about sall4 only in hcc tissues without health controls and nonmalignant chronic liver disease . meanwhile , few studies had been identified that enable the sall4 serological levels with the prognosis of hcc patients . thus , in the study , we estimated the expression of sall4 in hcc tissues and sall4 serum levels , to explore the possibility to use them as a novel prognostic biomarker in hcc patients . total 74 liver tissue sections including 38 patients with hcc , 11 patients with chronic hepatitis b virus ( hbv ) , 13 patients with liver cirrhosis , and 12 healthy controls were obtained from the first affiliated hospital of xi'an jiaotong university medical college ( shaanxi province , china ) from 2011 to 2013 . the clinicopathologic characteristics of these samples such as tumor size , location , and grade of differentiation were recorded . the clinicopathologic features of patients with hcc are summarized as shown in table 1 . of 38 hcc patients , 86.8% ( 33/38 ) were male and 13.2% ( 5/38 ) were female . 15.8% ( 6/38 ) nodal metastasis and 31.6% ( 12/38 ) of hcc patients had vascular invasion . samples of 201 human sera from 127 patients with hcc , 27 patients with chronic hepatitis , 24 patients with liver cirrhosis , and 23 normal controls were obtained from the first affiliated hospital of xi'an jiaotong university medical college ( shaanxi province , china ) from 2011 to 2013 . overall survival of hcc patients was calculated as the time from diagnosis to the date of death . the study was approved by the institutional review board of xi'an jiaotong university and collaborating institutions . all patients had not received preoperative chemotherapy , radiotherapy , and embolization and were classified according to the criteria of american joint committee on cancer stage staging manual , seventh edition ( 2010 ) for hcc . for each analyzed specimen , one or two formalin - fixed paraffin embedded tissue blocks were retrieved to generate 4 - 5 m sections for immunohistochemical labeling with antibodies against sall4 ( 1 : 100 , clone 6e3 ; abnova corporation , taipei , taiwan ) . the primary antibody was detected using biotinylated secondary antibodies ( zhongshan golden bridge biotechnology ltd . the final labeling of the tissue sections was performed using the hrp - streptavidin conjugates . the sections were incubated with diaminobenzidine and counterstained with hematoxylin and visualized via optical microscopy . for the expression of sall4 in hcc tissues , strong nuclear staining in more than 1% of the tumor area the expression of sall4 was semiquantitatively analyzed by an immunohistochemical score combined with the percentage of hepatic cells showing specific immunoreactivity . the scoring system was as follows : the percentage of positively staining cells was graded as 0 ( no staining ) , 1 + : > 0 and 25% of cells positive , 2 + : > 25 and 50% of cells positive , 3 + : > 50 and 90% of cells positive , 4 + : > 90% of cells positive . these results were reported as positive ( score = 1 , 2 , 3 , 4 ) or negative ( score = 0 ) ( figure 1 ) . all 201 sera samples used in the study were collected into anticoagulant containing tubes at the time of diagnosis , centrifuged , cell - free supernatants separated , and stored at 80c until testing . briefly , standard and experimental samples ( pretreated with sample diluents ) were added to an individual well of 96 wells microplates , coated with anti - human sall4 monoclonal antibodies for 2 hours at 37c . then the liquid of each well was removed and further incubated with biotin - antibody for 1 hour at 37c . after washing , the wells were incubated with hrp - avidin for 1 hour at 37c . in the final step , after blocking the reaction with stop solution , the od values for all wells were read at a wavelength of 450 nm on a microplate reader , and then the od value and concentration of sall4 antigen ( u / ml ) of each well were calculated using standards curves . when the concentration of sall4 was less than 37.5 pg / ml ( the lowest limit of the standard curve ) , categorical variables were expressed as percentages . for immunohistochemistry , the fisher exact test and the student 's t - tests were used , to evaluate the significance between two samples involved in the analysis , as indicated . to test the difference between two independent groups , we used also mann - whitney u test . probability value less than 0.05 was considered statistically significant . for 38 hcc tissues , 18/38 ( 47.4% ) showed staining of sall4 and the scores were 1 + ( 9/38 , 23.7% ) , 2 + ( 5/38 , 13.2% ) , 3 + ( 4/38 , 10.5% ) , respectively . we found that the expression of sall4 has no relation with any of the clinicopathologic characteristics assessed ( age , sex , histologic grade , tumor locality , vascular invasion , tumor size , nodal metastasis , tnm stage , and so on ) . we further detected the serological levels of sall4 from 127 patients with hcc , 27 patients with chronic hepatitis , 24 patients with liver cirrhosis , and 23 normal controls . the sall4 positive sera from hcc patients were 64/127 ( 50.4% ) , with significantly higher values as compared with all three controls . no significant differences were detected between the three control groups ( as table 3 and figure 2 ) . in addition , the spearman correlation analysis proved that the serological presence of sall4 had no relationship with serum afp ( r = 0.005 , p = 0.639 ) . next , we had followed up these 64 hcc patients with sall4 positive serum for two years to determine the relationship with tumor recurrence and overall survival . from these 64 hcc patients , the rest of 52 hcc patients received surgery ( 31/52 ) or tace ( 21/52 ) treatment afterwards . then we analyzed the sall4 serum levels of these hcc patients before treatment and after treatment 1 week later . the statistics analysis showed that the concentration of sall4 after treatment within one week reached a peak ( median 229.46 pg / ml , iqr 117.17371.83 ) ( as shown in figure 2(b ) ) , which had a significant difference for sall4 serum levels before treatment ( median 134.43 pg / ml , iqr 90.66257.91 , p < 0.002 ) . furthermore , 40 serum samples from these 52 hcc patients were collected after 7 days and 30 days after treatment . we then discovered that the median concentration of serum sall4 of these patients reached the maximum level after one week after treatment and dropped quickly after one month ( median 80.12 pg / ml , iqr 48.07136.48 , p < 0.0001 ) ( as shown in table 4 ) . as above described , these 64 hcc patients with sall4 positive serum were followed up for two years . during the follow - up these 64 hcc patients , 8 of total 64 hcc patients were out of touch . from remaining 56 hcc patients , 28/56 ( 50% ) showed tumor recurrence . according to the median level of sall4 serum in hcc the high - sall4 group ( 30.43 ng / ml , n = 29 ) had serum sall4 concentration that was equal to or exceeded the median level of sall4 values , whereas low - sall4 group ( < 130.43 ng / ml , n = 27 ) had sall4 serum concentration that was lower than the median level of sall4 values . we then discovered that the high - sall4 patients group had a recurrence of 19/29 ( 65.5% ) while the low - sall4 group had only 9/27 ( 33.3% ) and the difference was significant ( p < 0.016 ) ( as shown in table 5 ) . furthermore , we carried out overall survival analysis ( kaplan - meier analysis ) for these 56 hcc patients . the analysis showed hcc patients with high sall4 serum levels had worse prognosis than patients with low serum sall4 expression ( p = 0.013 ) ( as shown in figure 3 ) , which means hcc patients with low serum concentration of sall4 protein had a better prognosis . the median survival of patients with sall4 low serum levels was of 536 days , whereas the median survival of patients with high sall4 serum levels was only 375 days ( p = 0.023 ) . hepatocellular carcinoma ( hcc ) is one of the most common malignant cancers in the world and is often associated with poor prognosis . tumor recurrence and metastasis are major obstacles to the long - term survival of hcc patients . the better understanding of biology molecular events in the hcc recurrence and metastasis is critically needed . here , we report that high sall4 serum levels are a potential novel biological biomarker correlating with tumor recurrence and poor survival of the hcc patients . sall4 , a transcription factor that plays an essential role in the embryonic development and self - renewal of embryonic stem ( es ) cells , was detected and proved to have a very high expression in leukemia and myelodysplastic syndrome [ 1619 ] . some investigators had confirmed that sall4 is also overexpressed in cells from breast cancer , yolk sac tumor , non - small cell lung carcinomas ( nsclc ) , and testicular germ tumors [ 2023 ] . some researchers have verified that sall4 , a protein expressed in fetal , but not adult , liver cells , was reexpressed in liver tissues of a subgroup of adult hepatocellular carcinomas , which is often associated with bad prognosis . proposed that sall4 was related with hepatocellular carcinoma with poor prognosis and , furthermore , could be used as a potential target protein for therapeutic purposes [ 15 , 24 ] . it has been shown that sall4 has functional role(s ) in metastasis and drug resistance in aggressive endometrial cancer . as a consequence of its functional roles in cancer cell and absence in adult normal tissue , sall4 is both a marker for an aggressive subtype of hepatocellular carcinoma ( hcc ) and a potential target to prevent the high - risk occurrence of endometrial cancer . in the study , we studied the expression of sall4 in hcc liver tissues sections and , then , correlate the relationship between clinical characteristics and sall4 tissue expression . our studies showed that sall4 liver tissue expression was not associated with any of the clinical characteristics assessed ( such as histologic grade , tumor locality , and vascular invasion / metastasis ) . another study proposed that sall4 tissue expression was associated with older age , male sex , intestinal - type histology , and synchronous hepatic metastasis in gastric carcinoma . the data from another study also emphasized sall4 expression was completely negative in hepatocellular carcinoma . meanwhile , there is a study reporting that the expression of sall4 does not rule out secondary somatic malignancies such as hccs , which is almost comparable to our study . collectively , these data indicated that sall4 expression in tumor tissues has high degree of tumor selectivity and complexity . usually these studies about the role of sall4 were focused on tumor cell lines and tumor tissues investigating carcinogenesis and treatment [ 28 , 29 ] . as we know , cell culture studies do not directly address the role of the tumor microenvironment and that cellular responses ( and the genes that control these responses ) may differ from cell line to cell line . although the role of sall4 was evaluated in hcc cell lines and it has been considered as a valuable biomarker and also as potential therapeutic target , the reports relating the sall4 serological levels in hcc patients are scarce , especially in association with overall survival of hcc patients . in the study , our results suggested that sall4 serum concentrations in hcc patients were significantly higher , as compared with the three control groups ( p < 0.001 ) . the sall4 serum levels reached a maximum concentration after one week after treatment and dropped dramatically after one month . in order to further evaluate the role of sall4 serum levels in the prognosis of hcc patients , we interrelated the relationship between sall4 serum concentrations , tumor recurrence , and metastasis , as well as overall survival rate of hcc patients . to perform these analyses , we divided 56 hcc patients into high and low groups , according to sall4 serum level . interestingly , our results for the first time indicated that hcc patients with high sall4 serum levels had poor prognosis , proved by both tumor recurrence and poor overall survival rate . in fact , it is still unclear how sall4 levels are regulated and which target genes are directly activated by sall4 transcription factor in normal hepatic cells . thus , the role of sall4 in cancer is still controversial , while its function in hcc has not yet been determined . in the study , we examined the expression of sall4 in hcc tissues and serum and its clinical prognostic significance . 50.4% hcc patients were detected to have higher serum sall4 level than control groups and the concentration of serum sall4 reached top after treatment within one week and dropped quickly one month later . taken together , these hcc patients with higher serum sall4 expression had poor prognosis both in tumor recurrence and overall survival . to our knowledge , the study for the first time related the sall4 serological levels in hcc patients especially in association with overall survival of hcc patients . although the patient population in the study is limited , our findings are clinically significant , opening a novel avenue for further investigation of molecular events governing the pathogenesis of hcc and its metastatic modality . further studies are required to understand the relationship between high sall4 serum levels and their direct malignancy involvement in hepatic cells . high serum levels of sall4 protein could be used as a novel biomarker predicting tumor recurrence and poor survival rate of patients afflicted with hcc .

molecular imaging is a rapidly growing area of chemistry that aims to visualize cellular function and structure in a noninvasive manner with the in vivo use of specially designed imaging agents . the combination of magnetic resonance imaging ( mri ) and optical imaging offers synergistic advantages over either modality alone . mri has high spatial resolution and good soft - tissue contrast while optical imaging displays high sensitivity and can give information on the local chemical environment . lanthanide - based optical probes have superior fluorescence properties in comparison to organic fluorophores , with luminescence lifetimes stretching to the millisecond region , and time - gated techniques can be employed in order to eliminate interfering background autofluorescence . with the constant advances in cancer treatment , it is becoming increasingly important to detect the early signs of the disease and to establish the efficacy of the concurrent treatment in a noninvasive manner . this can be achieved by the in vivo use of a dual - modal mri / fluorescent probe that responds to a characteristic trait of tumor cells . it is known that the mitochondrial potential in cancer cells is greater than that of healthy cells , and the design of a probe that can accumulate in these energized mitochondria will lead to a tumor - targeting agent . the combination of mri and fluorescence will allow for improved diagnostic accuracy by tumor localization via mri imaging and guided surgery via fluorescence imaging . mri is a noninvasive diagnostic technique that relies on the enhancement of local water proton relaxation . different tissues have different relaxation times , resulting in endogenous magnetic resonance contrast . exogenous agents can be used to enhance this contrast by selectively shortening the t1 ( longitudinal ) or t2 ( transverse ) relaxation time ; these agents include gd(iii ) chelates , manganese complexes , and superparamagnetic nanoparticles . the most successful and commonly used of these exogenous agents are complexes containing the gd(iii ) ion because of its high magnetic moment ( 7.9b ) given by its seven unpaired electrons and its totally symmetric electronic ground state ( s7/2 ) . according to solomon bloembergen morgan theory , the relaxivity of gd(iii ) complexes is governed by a number of factors , including the number of bound water molecules ( q ) , the rotational tumbling time ( rotational correlation time ) of the complex ( r ) , and the mean residence lifetime of gd(iii)-bound water molecules ( m ) . an effective way to increase the relaxivity of a gd(iii ) complex is to increase the number of bound water molecules . we envisioned that the relaxivity could be improved by decreasing the number of coordination sites on the gd(iii ) chelate from eight to seven , allowing for a change from one bound water molecule to two . it is reported however that heptadentate ligands , when bound to gd(iii ) , have unfavorable properties for use as mri probes in terms of thermodynamic and kinetic stability because of the coordinatively unsaturated nature of the complex . eu(iii ) and tb(iii ) chelates based on a do3a core have received a lot of interest as luminescent lanthanide systems . these lanthanides are characterized by their long - lived luminescent excited states ( ms time scale ) and linelike emission spectra , and their complexes have been shown to be useful in biomedicine as luminescent probes . lanthanide metals or ions however , have low absorption coefficients due to laporte - forbidden f f transitions . this can be overcome by attaching an aromatic chromophore to the macrocyclic core to act as an antenna by transferring absorbed excitation energy from its triplet excited state to the excited state of the coordinated lanthanide ion . rhodamine derivatives have received significant attention as fluorescent labeling agents because of their long absorption and emission wavelengths , large absorption coefficients , and high quantum yields . they have been used in a wide range of applications , having great success as chemosensors ( both in vitro and in vivo ) , protein labels , and dual - modal imaging agents . rhodamine derivatives have had particular success as mitochondria targets , as their delocalized organic cationic forms tend to accumulate in the mitochondria of tumor cells as a result of the increased negative mitochondrial potential . the spiro ring - opening mechanism of rhodamine has also led to its extensive use as a chemosensor for metal detection as well as a ph - sensitive probe . under acidic conditions , the rhodamine moiety exists in its highly fluorescent pink - colored open form . upon addition of oh , the structure exists in its spirocyclic form , which is colorless and nonfluorescent . in recent years there have been an increasing number of reports of multimodal imaging probes wherein two or more imaging modalities are combined . the combination of modalities leads to probes that give enhanced visualization and improved reliability of data by synergistically combining imaging techniques to overcome their inherent disadvantages . optical imaging , however , boasts high sensitivity but has limited tissue penetration . as discussed earlier , the combination of the two techniques yields a probe that is able to provide a more complete picture of the biological area of interest . there are few reports of dual - modal mri / optical imaging agents in the literature that are not of nanoparticle nature . these include gou et al.s description of the binding of a cyanine dtpa conjugate to bsa to afford relaxivity rate constants of 15 mm s. the aliphatic nature of the chelate is unfavorable , however , as release of gd(iii ) ions into the body from these types of complexes has been related to nephrogenic systemic fibrosis ( nsf ) . in 1998 gd(iii ) complex conjugate showed no mri contrast enhancement when introduced to xenopus laevis embryos . the same complex conjugate , gd(rhoda - dota ) , was studied alongside a series of hydrophobic fluorescent dye , who found that incorporation of the hydrophobic fluorescent moiety improves cell permeability compared to gd(dota ) . they reported that gd(rhoda - dota ) showed a large increase in r1 relaxivity when bound to albumin and efficient cell permeation when incubated with hela cells . again , however , no significant change in the mr signal of hela cells was observed in the presence of the complex , even though its fluorescence was observed by microscopy . similarly , a rhodamine moiety has previously been conjugated to do3a and consequently labeled with cu to arrive at a dual - modal pet / optical probe . it was found that cu(dota - lrb ) had a surprisingly high tumor uptake compared with other cu - labeled organic cations . the probe was able to selectively localize to the tumor mitochondria with long tumor retention times . the probe and its derivatives have been the subjects of extensive in vitro and in vivo studies showing that there is promise for a gd(iii ) mri / optical analogue to be as successful in vivo . in this paper , we report two novel methods for conjugating fluorescent rhodamine derivatives to do3a . do3a gd(iii ) derivatives as multimodal mri / optical imaging agents by measuring their relaxivity and fluorescence properties as well as their in vitro tumor cellular localization . the tb(iii ) analogues were synthesized to assess their dual - luminescence properties , and it was found that the organic and metal - based luminescence can be separated on different time scales . two new synthetic routes were developed to obtain l1 and l2 ( outlined in schemes 1 and 2 , respectively ) , both commencing from commercially available rhodamine b and involving five straightforward steps . reaction of the carboxylic acid moiety on rhodamine b with bromoethylamine resulted in amide bond formation , giving product 2 . the ligand precursor 3 was prepared by n - alkylation of the tri - tert - butyl ester derivative of cyclen ( tri - t - bu - do3a ) . removal of the tert - butyl ester groups was then carried out using trifluoroacetic acid ( tfa ) to obtain l1 . the successful isolation of the product was confirmed through h and c nmr spectroscopy along with high - resolution mass spectrometry . l1 was coordinated to a series of lanthanide metal chloride salts [ ln = gd(iii ) , tb(iii ) ] in water in a mildly acidic environment ( ph 5.5 ) . after purification , the absence of free lanthanide ions was verified by the use of xylenol orange indicator solution . for each complex , a peak corresponding to the molecular ion with the correct isotopic pattern could be observed by high - resolution electrospray ionization mass spectrometry . the ln.l1 complexes were found to be only partially water - soluble and therefore unsuitable for in vivo applications . thus , the second ligand l2 was developed to overcome the solubility issues of l1 in water . two subsequent amide bond formation reactions on rhodamine b were carried out , first with ethylenediamine to form 4 and then with chloroacetyl chloride resulting in product 5 . this was then conjugated to tri - t - bu - do3a to give 6 in 39% yield , and subsequent deprotection with tfa gave l2 in the same manner as for l1 . the second amide bond was introduced to increase the hydrogen - bond donor and acceptor ability and thereby to increase the water solubility . l2 was complexed with gd(iii ) and tb(iii ) as above , and the complexes ln.l2 were found to be water - soluble . reagents and conditions : ( a ) ( i ) pocl3 , reflux , 18 h ; ( ii ) bromoethylamine , ch3cn , room temperature , 24 h. ( b ) tri - t - bu - do3a , k2co3 , ch3cn , reflux , 24 h. ( c ) tfa , dcm , room temperature , 16 h. ( d ) lncl36h2o , h2o , naoh(aq ) , ph 5.5 , room temperature , 24 h. reagents and conditions : ( a ) ethylenediamine , etoh , reflux , 24 h. ( b ) chloroacetyl chloride , net3 , dcm , room temperature , 2 h. ( c ) tri - t - bu - do3a , k2co3 , ch3cn , reflux , 24 h. ( d ) tfa , dcm , room temperature , 16 h. ( e ) lncl36h2o , h2o , naoh(aq ) , ph 5.5 , room temperature , 24 h. complexes ln.l1 and ln.l2 ( figure 1 ) behave as dual - modal mri / optical imaging probes with gd(iii ) and dual - luminescent probes with tb(iii ) . in this section , we discuss the photophysical properties of both systems . the photophysics of the two ligands with gd(iii ) were found to be very similar , as they exhibited fluorescence emission at 580 nm upon excitation at 560 nm . this short stokes shift and orange fluorescence was expected , as the fluorescence properties of rhodamine and its derivatives have been extensively studied . modification of the carboxylic acid moiety of rhodamine b does not lead to significant changes in the photophysical properties of the chromophore , as no electronic or structural changes occur on the xanthene core , so a very small bathochromic shift is observed ( rhodamine b : ex = 553 nm , em = 572 nm in ethanol ) . structures of ln.l1 and ln.l2 [ ln = gd(iii ) , tb(iii ) ] . the photophysical properties of the tb(iii ) analogues were investigated ( figure 2 ) . under excitation at ex = 310 nm , complex tb.l1 displays exclusively green emission arising from d4fj transitions of terbium . the rhodamine - centered emission is of a very low intensity in comparison with the tb(iii ) emission , indicating efficient ligand - to - lanthanide energy transfer . at ex = 560 nm , therefore , two fluorescence pathways are available to tb.l1 : emission via the lanthanide with energy transfer from rhodamine and direct excitation of the xanthene core . conversely , under excitation at ex = 310 nm , the emission spectrum of complex tb.l2 is dominated by rhodamine emission at 580 nm . applying a 0.1 ms delay to the fluorescence measurement allowed for isolation of the short - lived organic fluorescence of the rhodamine moiety from the long - lived lanthanide luminescence in both complexes . the extra amide bond in l2 renders the complex water - soluble but also introduces a quenching pathway . the additional n h bond is close to the lanthanide center , and fluorescence deactivation may occur via the n h vibrational energy level oscillator . therefore , when complexed with a luminescent lanthanide ion , both ligands behave as dual - luminescent probes . in both tb.l1 and tb.l2 , excitation at 560 nm leads to emission from the organic chromophore at 580 nm , with the fluorescence originating from the xanthene core . using time - gating techniques , tb(iii ) emission is induced in both complexes upon excitation of the isolated phenyl ring of the rhodamine moiety at 310 nm by energy transfer to the tb(iii ) metal center ( figures 2 and 3 ) . in tb.l1 only , tb(iii ) emission can be seen upon excititation at 310 nm without the use of a time delay . the quantum yields of both terbium complexes were determined , and the results were in agreement with the observed spectra , confirming the efficient energy transfer to the terbium metal center in tb.l1 ( = 18.6% ) and the inefficient energy transfer in tb.l2 ( = 0.8% ) . left panel : excitation spectrum ( left ) and emission spectrum ( right ) of gd.l2 with em = 580 nm and ex = 560 nm ( 0 ms delay ) . right panel : absorption spectrum ( left ) , terbium emission ( center ) , and rhodamine fluorescence ( right ) of tb.l2 with em = 545 nm and ex = 310 and 560 nm , respectively ( 0.1 ms delay for terbium emission ) . these are also representative spectra of tb.l1 , although no delay was needed to observe the terbium emission . all of the ln.l1 complex measurements were carried out in methanol , and all of the ln.l2 complex measurements were carried out in h2o ( ph 7.4 , 298 k , 100 m concentration ) . the luminescence decays of the tb(iii ) complexes in both h2o and d2o were also measured ( see the supporting information ) . the luminescence lifetimes in d2o were increased in comparison to h2o because less nonradiative deactivation was induced by o d vibrations than by o h vibrations . from these differences in the rates of energy transfer to h2o and d2o oscillators , the hydration state can be calculated using eq 1 , in which the term 0.06 reflects the quenching effect of unbound water molecules and n is the number of coordinated secondary amide groups , reflecting the quenching effect of the proximate nh oscillators . the emission decays were fitted to monoexponential decays , and the corresponding lifetime measurements of both terbium complexes confirmed the expected coordination numbers of seven for tb.l1 and eight for tb.l2 ( table 1).1 t1 measurements of the gd(iii ) complexes were performed at 400 mhz ( 9.4 t , 25 c ) , and their r1 values were determined . the r1 values of 8.5 and 3.8 mm s obtained for complexes gd.l1 and gd.l2 , respectively , were within the range for gd(iii ) chelates with hydration states of two and one respectively . it is well - known that the presence of hydrophobic moieties within a probe is one of the basic structural requirements for ligand binding to human serum albumin ( hsa ) . hsa is the most abundant protein in blood , and binding to it results in an increase in intravascular retention and relaxivity ( due to a decrease in r of the complex ) . in view of the fact that the rhodamine moiety has extended aromatic rings and hence hydrophobicity , a study was carried out to investigate possible interactions between gd.l2 and hsa . the relaxation rates of a series of solutions of gd.l2 with increasing concentrations of hsa were measured . the relaxation rate was found to remain constant across the series ( figure 4 ) , therefore indicating that there is no significant binding of the probe to the protein . the binding mechanisms of rhodamine b with bovine serum albumin ( bsa ) were previously investigated , and site - selective binding was observed . however , these results were obtained using high molar ratios of rhodamine b to bsa ( > 50 ) . such high concentrations are not practical for use of mri probes in vivo , and indeed , large changes in relaxivity have been observed in cases where the molar ratio of probe to serum albumin have been much lower . it is hypothesized that the steric bulk of the complex is unsuitable for selective binding to hsa . as previously discussed ( vide supra ) , the lactam ring of rhodamine can be intramolecularly opened and closed via changes in ph . the ph sensitivity of gd.l2 was investigated , and to show the sensitivity of the proton - triggered ring opening , a ph titration was carried out wherein the emission intensity was monitored at various ph values ( figure 5 ) . the ph titration showed that gd.l2 , which was nonfluorescent at ph 6.5 or above , rearranged into its fluorescent form at acidic ph . the fluorescence of gd.l2 at ph 4.3 was 50-fold brighter than that at ph 6.5 and 15-fold brighter than that at ph 6.0 , demonstrating that gd.l2 is a sensitive , acid - responsive probe capable of sensing small changes in ph in the range 47 . upper panel : ph - mediated ring opening of the intramolecular sprirolactam of gd.l2 , yielding a highly fluorescent species . lower panels : ( a ) ph - dependent emission spectra of gd.l2 ( ex = 560 nm , em = 580 nm ) ; ( b ) ph titration curve used to determine pka . a titration curve was produced by plotting the emission intensity at em = 580 nm versus ph , which yielded a pka value of 5.11 . it was hypothesized that the change in the charge of gd.l2 on going from ph 7.0 to 4.0 would aid the probe to localize in the more acidic microenvironment of tumor cells . it has been shown that the microenvironment of tumor cells is more acidic than that of healthy tissues ( warburg effect ) . upon entering an acidic environment , the probe can undergo rearrangement to its ring - opened form , which is fluorescent . this cationic acid form of the probe would then be expected to accumulate in the mitochondria . to test the viability of gd.l2 as a dual - modal agent for cancer imaging , in vivo and in vitro studies because of a lack of water solubility , no in vivo studies could be carried out on l1 complexes . the addition of an extra amide functionality within l2 introduced water solubility , and this allowed for the investigation of its biological properties via in vitro and in vivo studies . cell penetration is crucial for the use of imaging probes in the monitoring of biological mechanisms . to this end , the negative mitochondrial potential is reported to be greater in tumor cells than in normal cells , and organic cations such as rhodamine have been shown to accumulate in the energized mitochondria . with this in mind , colocalization experiments were undertaken wherein a known mitochondrial stain ( mitotracker green fm ) was tested against gd.l2 . confocal microscopy images of human embryonic kidney ( hek293 ) cells and primary mouse islet cells ( 70% insulin - containing cells ) were recorded after a 30 min incubation with gd.l2 and mitotracker green ( figure 6 ) . cells were incubated with 215 mm gd.l2 and 100 nm mitotracker green for 30 min , washed twice with krebs buffer , and visualized under a fluorescence microscope . ( d f ) confocal microscopy images of dissociated primary mouse islet cells . cells were incubated with 215 mm gd.l2 and 100 nm mitotracker green for 30 min , washed twice with krebs buffer , and visualized under a fluorescence microscope . images b , c and e , f in figure 6 show clear accumulation of gd.l2 within each cell type . however , a clear colocalization of gd.l2 and mitotracker was not evident ( figure 6c , box ) . moreover , we noted that in cells where significant uptake of gd.l2 was apparent ( as indicated in the primary cells in d f ) , mitotracker accumulation was lower and more diffuse than in neighboring cells , and little , if any , colocalization of red and green staining was evident ( figure 6f ) . these findings are probably best explained by the fact that the gd.l2 fluorescence , which is strongly suppressed at ph > 6.5 ( figure 5b ) , is only readily detectable in cells in which mitochondria are relatively depolarized , such that the mitochondrial matrix ph falls to levels permissive of gd.l2 fluorescence . such mitochondria , however , are expected to be poorly able to retain mitotracker , whose accumulation depends on the inner mitochondrial membrane potential and the ph gradient ( i.e. , high intramitochondrial ph > 7 ) . these results are thus consistent with the known properties of both mitotracker and gd.l2 but are unable to definitively establish a mitochondrial localization of the latter . balb / c nude mice with neck m21 ( human melanoma cell ) xenograft implantations were injected intravenously with 0.1 mmol kggd.l2 . the mice were imaged in a 4.7 t mri instrument at different times ( preinjection , 30 min post injection , and 60 min post injection ) to evaluate the effect of the contrast agent . thirty minutes after the injection of gd.l2 , a 36.5% decrease in tumor average t1 was observed compared with the baseline of the preinjection image ( figure 7a , b ) . this decrease in longitudinal relaxation time was retained at least up to 60 min ( 31.3% decrease ; figure 7c ) . these preliminary images demonstrate that gd.l2 functions successfully in vivo by shortening the t1 of protons in the tumor sufficiently so as to give a more detailed image . the observed accumulation of gd.l2 in the tumor area is consistent with the predicted effect of a lower ph environment on the probe ; the rearrangement of the lactam ring at acidic ph introduces a positive charge in the molecule that can promote the intracellular uptake of the molecule responsible of the average t1 decrease observed in the tumor . parametric t1 maps of a balb / c nude mouse tumor : ( a ) preinjection ; ( b ) 30 min post injection with gd.l2 ; ( c ) 60 min post injection with gd.l2 . the do3a units have been coordinated to paramagnetic gd(iii ) and luminescent tb(iii ) centers . complexation with tb(iii ) gives dual - luminescent probes with two different time scales , and photophysical data collected also show the impact of distance of the sensitizer and linker design from the lanthanide metal center on the efficiency of energy transfer . when complexed with gd(iii ) , they form dual - modal mri / fluorescent probes . ln.l2 is water - soluble and suitable for in vitro / in vivo studies , and gd.l2 has r1 = 3.84 mm s ( 9.4 t , 25 c ) and has been shown to be viable both in vitro and in vivo . the ph sensitivity of the probe means that it functions as an off on luminescent probe that is sensitive to the small ph changes within cells . by coexpression with a known mitochondrial stain , these studies demonstrate that the probe is cell - penetrating , has a ph sensitivity to acidic microenvironments , and is a tumor specific , dual - modal mri / fluorescent contrast agent . no special precautions were taken to exclude air or moisture during reactions or workups , unless otherwise stated . products 2(61 ) and 4(62 ) were prepared via literature methods from commercially available starting materials . h and c{h } nmr spectra were recorded at ambient temperature on a bruker 400 mhz spectrometer and internally referenced to the residual solvent peaks of cdcl3 at 7.26 ppm ( h ) and 77.16 ppm ( c{h } ) or meod at 3.31 ppm ( h ) and 49.15 ppm ( c{h } ) . mass spectrometry analyses were conducted by the mass spectrometry service , imperial college london . microanalyses were carried out by stephen boyer of the science centre , london metropolitan university . icp - ms analysis was carried out by stanislav strekopytov of the natural history museum . absorption and fluorescence spectra of all complexes in either aqueous or methanolic solutions depending on solubility were obtained at room temperature on a perkinelmer lambda 25 spectrometer and a cary varian luminescence spectrometer ( using scan for windows ) , respectively . lifetimes were measured by direct excitation of the sample at 325 nm with a 40 ms pulse of light ( 50 pulses per point ) followed by monitoring of the integrated intensity of light emitted at 545 nm during a fixed gate time of 0.1 ms at a delay time later . the obtained decay curves were fitted to a simple monoexponential first - order decay curve using microsoft excel . fluoresence quantum yields of terbium complexes were determined from the integrated fluorescence intensities of the complexes following a previously reported method using the reference compound na3[tb(dpa)3 ] in water or methanol at 279 nm ( quantum yield = 26.5% or 18.2% , respectively ) . a 1.49 mm solution of gd.l2 in 0.1 m nacl ( 1 ml ) was prepared , from which 15 67 l aliquots ( microlitre pipet , eppendorf ) were taken . each aliquot was adjusted to the required ph using a digital ph meter ( jenway 3510 ) equipped with a glass electrode ( jenway 924005 ) . the ph was monitored and adjusted to acidic or basic conditions using small aliquots of a 1 m hcl or 1 m naoh solution , respectively . the fluorimeter was operated using an excitation slit width of 10 nm and an emission slit width of 2.5 nm . gd.l1 was dissolved in a methanol / water ( 50:50 ) solvent mixture to give a solution of concentration 5 mm . the resulting solutions were placed in 1.7 mm diameter capillaries , which were sealed . the 1/t1 measurements were performed on a bruker avance 400 spectrometer ( 400 mhz ) . these experiments were carried out a minimum of three times , and the relaxivity results given are averages of all experiments . the concentration of gd(iii ) a 1.49 mm solution of gd.l2 in 0.1 m nacl ( ph 7.4 ) was prepared , from which 10 67 l aliquots were taken . to each aliquot was added an aliquot of a 2 mm solution of hsa ( 0.1 m nacl , ph 7.4 ) to give 10 different sample concentrations ( 0 , 0.1 , 0.25 , 0.35 , 0.5 , 0.65 , 0.85 , 1 , 1.5 , and 2 equiv of hsa ) . the solutions were made up to a volume of 100 l by addition of water where required . the resulting solutions were placed in 1.7 mm diameter capillaries , which were sealed . the 1/t1 measurements were performed on a bruker avance 400 spectrometer ( 400 mhz ) . all of the animal experiments were performed by licensed investigators in accordance with the united kingdom home office guidance on the operation of the animal ( scientific procedures ) act 1986 and in keeping with the newly published guidelines for the welfare and use of animals in cancer research . female balb / c nude mice ( aged 68 weeks ; harlan ) were used . m21 cells were injected subcutaneously on the back of mice ( 5 10 cells in 100 l of sterile pbs ) . tumor dimensions were measured continuously using calipers , and tumor volumes ( v ) were calculated using the equation v = abc/6 , where a , b , and c represent the lengths of the three orthogonal axes of the tumor . in vivo mri was performed in a 4.7 t horizontal - bore directdrive mri system ( varian , palo alto , ca , usa ) equipped with 40 g / cm actively shielded gradients ( vnmrj 3.1 ) . for imaging of the tumors and generation of the t1 parametric maps , a 45 mm diameter saddle coil was used in transmit mode and a separate 20 mm diameter stripline resonator was used as a surface coil to accommodate the tumors . imaging was performed with an inversion recovery ( ir ) sequence and the following parameters : axial images ; fov = 35 35 mm ; no slices = 14 ; slice thickness = 1 mm ( zero slice gap ) ; image bandwidth = 156 khz ; tr = 4500 ms ; ti = 6 , 14.6 , 35.4 , 86.1 , 209 , 508 , 1230 , or 3000 ms ; na = 2 ; image matrix = 192 192 ; ta = 12 min . during imaging , animals were anesthetized with 2% isofluorane and respiration and body temperature were monitored via sa physiological monitoring systems ( sa instruments , stony brook , ny , usa ) . body temperature was monitored by a rectal probe and maintained at 35 1 c . t1 maps were generated in imagej by fitting the acquired data to the equation s = s0[1 2 exp(ti / t1 ) ] , where ti is the inversion time and t1 is the longitudinal relaxation time . in order to assign the signal with the appropriate sign for the fitting process , the value of the fit was evaluated during the fitting . rois were then drawn on the t1 maps to delineate the whole tumor with consideration to avoid the edges of the tumor and thus contamination from neighboring tissues and partial volume effects . hek293 cells were cultured in dmem ( lonza ) supplemented with 10% fetal bovine serum ( fbs ) ( lonza ) , 1% glutamine ( lonza ) , and 1% penicillin / streptomycin ( gibco ) . on the day of visualization , cells were washed twice with krebs buffer ( 140 mm nacl , 3.6 mm kcl , 0.5 mm nah2po4 , 0.2 mm mgso4 , 1.5 mm cacl2 , 10 mm hepes , ph 7.4 , 2 mm nahco3 ) pre - equilibrated with 95:5 o2/co2 and containing 25 mm glucose . cells were then incubated with krebs buffer containing 215 mm gd.l2 and 100 nm mitotracker green for 30 min and washed twice with krebs buffer before visualization . images were captured using a zeiss axiovert confocal microscope coupled to a nipkow spinning - disk head ( yokogawa csu-10 ) using a 63 oil objective . a solid - state laser ( crystalaser ) controlled by a laser - merge module ( spectral applied physics ) provided wavelengths of 491 nm to excite mitotracker green ( emission filtered at 525 nm ) and 561 nm to excite gd.l2 ( emission filtered at 620 nm ) . images were captured by a highly sensitive 16-bit , 512 512 pixel back - illuminated em - ccd camera ( imageem 9100 - 13 , hamamatsu ) . islet isolation was carried out as shown in ref ( 69 ) . in short , a female cd1 mouse ( 812 weeks old ) the pancreas was injected with 1 mg / ml collagenase solution through the bile duct and excised . the pancreas was digested by heating with collagenase solution , and islets were isolated through the use of ficoll gradient centrifugation . islets were hand - picked and kept at 37 c in islet medium ( rpmi supplemented with 10% fbs and 1% penicillin / streptomycin ) . islets were dispersed into clusters and single cells according to the procedure in ref ( 69 ) . briefly , islets were incubated with hank s based enzyme - free dissociation buffer ( invitrogen , paisley , uk ) and centrifuged . all but 1 ml of the supernatant was removed , and the pellet was resuspended vigorously via pipetting . the cells were washed and resuspended with rpmi 1640 and then loaded onto a poly - l - lysine - treated coverslip . on the day of visualization , cells were washed twice with krebs buffer ( 140 mm nacl , 3.6 mm kcl , 0.5 mm nah2po4 , 0.2 mm mgso4 , 1.5 mm cacl2 , 10 mm hepes , ph 7.4 , 2 mm nahco3 ) pre - equilibrated with 95:5 o2/co2 and containing 25 mm glucose . cells were then incubated with krebs buffer containing 215 mm gd.l2 and 100 nm mitotracker green for 30 min and washed twice with krebs buffer before visualization . images were captured using a zeiss axiovert confocal microscope coupled to a nipkow spinning - disk head ( yokogawa csu-10 ) using a 63 oil objective . a solid - state laser ( crystalaser ) controlled by a laser - merge module ( spectral applied physics ) provided wavelengths of 491 nm to excite mitotracker green ( emission filtered at 525 nm ) and 561 nm to excite gd.l2 ( emission filtered at 620 nm ) . images were captured by a highly sensitive 16-bit , 512 512 pixel back - illuminated em - ccd camera ( imageem 9100 - 13 , hamamatsu ) . do3a - t - bu - ester ( 0.16 g , 0.28 mmol ) and k2co3 ( 0.05 g , 0.34 mmol ) were dissolved in mecn ( 5 ml ) , and the mixture was stirred for 5 min . 2 ( 0.15 g , 0.28 mmol ) in mecn ( 15 ml ) was added dropwise . the reaction mixture was heated to reflux temperatures for 24 h. the resulting solution was filtered , and the filtrate was concentrated under reduced pressure . the crude product was purified by silica gel chromatography with 120% meoh / dcm , 1% nh3 solution ( 28% ) , affording 3 as a beige solid ( 0.21 g , 37% ) . h nmr ( 400 mhz , cdcl3 ) : 1.18 ( t , 12h , jhh = 7.1 hz ) , 1.43 ( s , 27 h ) , 2.092.15 ( m , 2h ) , 2.293.06 ( m , 16h ) , 3.133.19 ( m , 2h ) , 3.36 ( q , 8h , jhh = 7.4 hz ) , 3.50 ( s , 6h ) , 6.236.43 ( m , 6h ) , 7.047.08 ( m , 1h ) , 7.417.47 ( m , 2h ) , 7.817.84 ( m , 1h ) . c nmr ( 100 mhz , cdcl3 ) : 12.6 , 28.0 , 30.9 , 36.0 , 44.3 , 46.2 , 49.6 , 51.0 , 53.5 , 55.8 , 56.4 , 65.2 , 82.0 , 82.4 , 97.9 , 105.1 , 107.8 , 122.6 , 123.8 , 128.0 , 128.7 , 131.0 , 132.4 , 148.8 , 153.4 , 153.5 , 168.4 , 172.5 . 3 ( 0.20 g , 1 mmol ) was dissolved in ch2cl2 ( 2 ml ) , and trifluoroacetic acid ( 2 ml ) was added dropwise . the solution was stirred at room temperature , open to air , for 24 h. the solvents were removed in vacuo , and the residue was redissolved in ch2cl2 . this was repeated with diethyl ether and again with ch2cl2 until l1 was obtained as a bright - pink solid ( 0.16 g , 96% ) . h nmr ( 400 mhz , cdcl3 ) : 1.17 ( t , 12h , jhh = 7.2 hz ) , 3.063.71 ( m , 24h ) , 4.20 ( m , 2h ) , 6.546.75 ( m , 6h ) , 7.14 ( d , 1h ) , 7.607.64 ( m , 2h ) , 7.80 ( d , 1h ) . c nmr ( 100 mhz , cdcl3 ) : 11.06 , 34.14 , 45.42 , 45.63 , 48.18 , 49.33 , 51.97 , 52.26 , 54.41 , 110.36 , 122.90 , 124.22 , 126.14 , 128.62 , 128.82 , 129.83 , 133.57 , 153.00 , 153.35 , 160.78 , 169.12 . l1 ( 0.04 g , 0.05 mmol ) and gdcl36h2o ( 0.01 g , 0.03 mmol ) were dissolved in water ( 2 ml ) , and the ph was adjusted to 5.5 using 1 m naoh solution . the mixture was stirred at room temperature for 24 h. the reaction precipitate was filtered and then dissolved in dcm . addition of ether to this solution precipitated gd.l1 as a pale - beige powder ( 0.022 g , 84% ) . esi - hrms : calcd for c44h57n7o8gd 969.3510 , found m / z 969.3569 . the complex was prepared by an method analogous to that for gd.l1 using l1 ( 0.26 g , 0.32 mmol ) and tbcl36h2o ( 0.06 g , 0.16 mmol ) to yield tb.l1 as a pale - beige solid ( 0.12 g , 80% ) . esi - hrms : calcd for c44h57n7o8 tb 970.3522 , found m / z 970.3555 . 4 ( 0.50 g , 1.03 mmol ) was dissolved in dcm ( 10 ml ) , and net3 ( 0.1 ml , 1.24 mmol ) was added . the reaction mixture was cooled to 0 c using an ice bath , and chloroacetyl chloride ( 0.1 ml , 1.24 mmol ) in dcm ( 5 ml ) was then added dropwise . the solution was stirred at room temperature for 5 h , and then the solvent was removed under reduced pressure . the resultant solid was dissolved in dcm ( 20 ml ) and washed with water ( 10 ml 2 ) and brine . the organic extract was dried over mgso4 and evaporated to give 5 as a purple solid ( 0.36 g , 62% ) . h nmr ( 400 mhz , cdcl3 ) : 1.18 ( t , 12h , jhh = 7.0 hz ) , 3.10 ( t , 2h , jhh = 7.1 hz ) , 3.34 ( q , 10h , jhh = 7.2 hz ) , 3.95 ( s , 2h ) , 6.316.47 ( m , 6h ) , 7.087.11 ( m , 1h ) , 7.467.48 ( m , 2h ) , 7.937.96 ( m , 1h ) . c nmr ( 100 mhz , cdcl3 ) : 12.42 , 39.50 , 40.39 , 41.43 , 42.42 , 45.01 , 65.65 , 98.87 , 108.96 , 123.08 , 123.88 , 128.41 , 128.53 , 130.22 , 133.03 , 148.26 , 153.17 , 153.55 , 166.80 , 169.46 , 169.85 . tri - tert - butyl - do3a ( 0.32 g , 0.59 mmol ) and k2co3 ( 0.08 g , 0.59 mmol ) were dissolved in mecn ( 20 ml ) and left to stir for 5 min . 5 in mecn ( 20 ml ) the reaction mixture was heated to reflux for 24 h. the resulting solution was filtered , and the filtrate was concentrated under reduced pressure . the crude product was purified by silica gel chromatography using 120% meoh / dcm , 1% nh3 solution ( 33% ) , affording 6 as a beige solid ( 0.12 g , 21% ) . h nmr ( 400 mhz , cdcl3 ) : 1.18 ( t , 12h , jhh = 7.0 hz ) , 1.40 ( s , 27h ) , 1.982.92 ( m , 28h ) , 3.28 ( q , 8h , jhh = 7.1 hz ) , 6.246.41 ( m , 6h ) , 7.017.04 ( m , 1h ) , 7.357.45 ( m , 2h ) , 7.767.83 ( m , 1h ) . c nmr ( 100 mhz , cdcl3 ) : 12.53 , 27.86 , 30.94 , 40.00 , 40.55 , 44.31 , 49.01 , 50.27 , 51.13 , 55.66 , 56.22 , 65.43 , 81.52 , 97.68 , 104.84 , 108.17 , 122.73 , 123.84 , 128.38 , 130.05 , 132.84 , 148.8 , 153.18 , 169.63 , 170.58 , 171.01 , 172.31 . esi - hrms : calcd for c58h87n8o9 1039.6596 , found m / z 1039.6676 . 6 ( 0.30 g , 0.3 mmol ) was stirred in ch2cl2 ( 1 ml ) , and trifluoroacetic acid ( 1 ml , excess ) was added dropwise . the solution was stirred at room temperature , open to air , for 24 h. the solvents were then removed in vacuo , and the residue was redissolved in ch2cl2 . after removal of diethyl ether , this process was repeated , affording l2 as a pink solid ( 0.23 g , 92% ) . h nmr ( 400 mhz , meod ) : 1.15 ( t , 12h , jhh = 6.0 hz ) , 2.84 ( t , 2h , jhh = 7.0 hz ) , 2.973.95 ( m , 26h ) , 3.54 ( q , 8h , jhh = 6.0 hz ) , 6.606.66 ( m , 6h ) , 7.11 ( d , 1h ) , 7.59 ( m , 2h ) , 7.90 ( d , 1h ) . c nmr ( 100 mhz , cdcl3 ) : 10.88 , 38.29 , 39.01 , 45.44 , 46.52 , 50.41 , 53.10 , 110.98 , 115.25 , 122.42 , 123.66 , 128.55 , 128.91 , 133.06 , 153.05 , 161.17 , 161.51 , 169.20 . l2 ( 0.19 g , 0.22 mmol ) and gdcl36h2o ( 0.04 g , 0.11 mmol ) were dissolved in water ( 2 ml ) , and the ph was adjusted to 5.5 using 1 m naoh(aq ) . this crude solution was purified using sephadex g10 chromotography , affording gd.l2 as a pale - beige solid ( 0.03 g , 27% ) . the complex was prepared by an method analogous to that for gd.l2 using l2 ( 0.19 g , 0.21 mmol ) and tbcl36h2o ( 0.04 g , 0.11 mmol ) to yield tb.l2 as a pale - beige solid ( 0.03 g , 27% ) . esi - hrms ( meoh ) : calcd for c46h60n8o9 tb 1027.3737 , found m / z 1027.3805 .

recently , genomic sequencing has become far less expensive , and also has become more efficient , developing even faster than comparable computer technology as predicted by moore s law . this has led to next - generation sequencing ( ngs ) being increasingly used to study nearly all types of malignancies , and gastric cancer is no exception . there have been 2 recent seminal reports that used ngs to sequence large sets of gastric cancer samples to better characterize the genomics of gastric cancer , including a report from the cancer genome atlas ( tcga ) as well as a separate study from the asian cancer research group ( acrg ) . the tcga study evaluated 295 treatment - naive primary gastric adenocarcinomas from multiple participating centers , where analysis included whole - exome sequencing , copy number analysis , dna methylation and rna analysis , microsatellite instability testing , and , on a select group of tumors , whole - genome sequencing . the study from the acrg examined 300 primary gastric adenocarcinomas from a single center in seoul , south korea . this study used 49 gastric adenocarcinomas that previously underwent study with whole - genome sequencing combined with 251 additional specimens , and then used a combination of gene expression profiling , targeted sequencing of genes of interest , as well as genome - wide copy number microarrays . in addition to these 2 large studies , there also have been multiple smaller studies that have used ngs to better characterize the genomics of gastric cancer.14 , 15 , 16 , 17 , 18 the plethora of data obtained from these recent ngs studies has helped define the genetic landscape of gastric cancer , has led to a contemporary approach to the development of genomically based molecular subtypes of gastric cancer , and has elucidated novel gastric cancer driver mutations , which all may lead to new perspectives on therapeutics . genomic data have been used to develop molecular classification systems for many types of cancer including colorectal cancer and pancreatic cancer . although classic classification criteria for gastric cancer has been histologically based ( eg , lauren s and world health organization ) , recent use of genomic data also has led to the development of novel molecular classification schemes for gastric cancer ( figure 1 ) . first , the tcga research network proposed a classification system that divides gastric cancers into 4 distinct subtypes : epstein barr virus ( ebv ) positive , microsatellite instability ( msi ) , genomic stability ( gs ) , and chromosomal instability ( cin ) . ebv - positive tumors , which represented 9% of the tumors sequenced , showed significant cpg island methylator phenotype , as well as the highest levels of dna hypermethylation . this observed dna hypermethylation was consistent with previous reports linking ebv - positive gastric cancers to dna hypermethylation . all tumors from this class showed cdkn2a ( p16ink4a ) promoter hypermethylation , but lacked hypermethylation of mlh1 . these tumors also had the highest rate ( 80% ) of pik3ca mutations , showed a high rate of arid1a mutations ( 55% ) , and very infrequently showed any mutations in tp53 . another important characteristic of this group , for therapeutic purposes , was overexpression of programmed death - ligand ( pd - l)1/2 in combination with increased immune cell signaling signatures . this group of tumors accounted for 22% of the total samples , and showed significant cpg island methylator phenotype , including hypermethylation of the mlh1 promoter . mutational analysis in this group identified a total of 37 significantly mutated genes including tp53 , kras , pik3a , and arid1a , whereas there were only 25 significantly mutated genes in the non - msi cancers . the remaining 69% of tumors from the tcga group were divided based on the presence of extensive somatic copy number aberrations . by using this branch point , the third group defined by the tcga data is the gs group , which comprised 20% of the total samples . this group of tumors comprised the majority of gastric cancers with diffuse histology , and also had the largest percentage of cdh1 mutations consistent with the abundance of diffuse histology in this group . gs tumors also showed an increase in rhoa mutations and cldn18arhgap fusions , and increased expression of cell - adhesion pathway genes . this group showed marked aneuploidy as well as amplifications of receptor tyrosine kinases ( rtks ) . this group also showed a high percentage of tp53 mutations and had primarily intestinal histology . these tumor subtypes derived from the tcga data were found to have distinct clinical signatures as well . for primary tumor location , cin tumors were found more frequently at the gastroesophageal junction and in the cardia , whereas ebv - positive tumors were found more frequently in the fundus and body . in addition , gs tumors were diagnosed at an earlier age ( median , 59 y ) , whereas msi tumors were diagnosed at an older age ( median , 72 y ) . gender differences also were appreciated , with msi tumors being the only group seen more frequently in females ( 56% ) , although 81% of ebv tumors were seen in males . diffuse - type histology was seen most frequently in the gs group , in which 73% of these tumors had diffuse - type histology , however , from an outcomes perspective , none of these 4 subgroups of gastric cancers showed any significant survival differences . in addition to these clinical signatures , some of these tcga - defined gastric cancer subgroups have analogous subgroups in other gastrointestinal cancers as well , such as the msi and cin subgroups that have been noted in colorectal cancer.19 , 22 the acrg study led to the development of a different 4-group classification system for gastric cancer , which included the following subtypes : msi , microsatellite stable ( mss)/epithelial - to - mesenchymal transition ( emt ) , mss / tp53 , and mss / tp53 . the msi subtype represented 23% of the gastric cancers , and showed heavily mutated genetic profiles , with 44% of tumors showing arid1a mutations and 42% of tumors with a mutation in the phosphoinositide 3-kinase ( pi3k)phosphatase and tensin homolog ( pten)mechanistic target of rapamycin ( mtor ) pathway . other heavily mutated genes in this group included kras ( 23% ) and alk ( 16% ) . the remaining mss tumors then were divided based on whether or not they showed gene expression signatures consistent with emt . those showing this signature were classified as mss / emt gastric cancers , which represented the smallest subset ( 15% ) of samples , and showed the lowest number of mutational events per tumor . the remaining mss gastric cancers then were divided based on a tp53 activity signature , into those with tp53 activity ( mss / tp53 ) and those without tp53 activity ( mss / tp53 ) . the mss / tp53 group comprised 26% of the total samples , and this group had the highest percentage of ebv - positive tumors . finally , mss / tp53 comprised 36% of all gastric cancers in this study , and as expected showed the highest prevalence of tp53 mutations ( 60% ) . these 4 gastric cancer subtypes had relevant clinical associations as well , and unlike the tcga subtypes , the acrg subtypes showed survival differences that were validated in 3 independent cohorts . the mss / emt subtype occurred at a younger age than the other subtypes , and the majority of these cancers had diffuse - type histology . these patients also had the worst overall survival , and the highest rate of recurrence , especially involving peritoneal dissemination . in the msi group , these cancers were found predominantly in the antrum , were diagnosed more frequently at either stage i or ii , and were primarily of intestinal - type histology . given the earlier stage of diagnosis , these patients also had the best overall survival . when recurrences did occur , msi as well as mss / tp53 cancers were associated with a higher rate of liver limited recurrences compared with the mss / emt and mss / tp53 groups . of additional interest is that although helicobacter pylori is well recognized to be an important contributor to gastric cancer pathogenesis , h pylori status was not used in either of these classification schemes . in the tcga study , h pylori infection was found very infrequently in the samples tested . in the acrg study , h pylori was found frequently ( 43% of 127 samples tested ) , but there was no association of h pylori infection with any of the defined gastric cancer subtypes . in addition to these 2 larger studies , other smaller studies also have used ngs to develop novel , genomically based classification systems . one such study , based on a cohort of 78 chinese gastric cancer samples , divided gastric cancers into 2 distinct subtypes , including those with high clonality and low clonality . although developing these new genomically based molecular gastric cancer classification schemes is a significant technologic advance over the use of histologic classifications , the larger question that remains is whether these new subtypes can be used effectively to change treatment paradigms to ultimately improve survival in patients with gastric cancer . mutations in tp53 and cdh1 often were considered classic driver mutations of gastric cancer , even before the ngs era . tp53 codes for the nuclear protein p53 , which is a critical tumor suppressor that is responsible for ensuring genome integrity , and whose function can be lost in cancers via a loss - of - function mutation , loss of heterozygosity , or , rarely , methylation . upon activation of p53 in the setting of cellular stress such as dna damage , oxidative stress , or ionizing radiation , p53 can result in arrest of the cell cycle as well as cellular apoptosis . loss - of - function mutation in the tp53 gene is a common pathogenic genetic alteration in cancers of the gastrointestinal tract , including gastric cancer . the tcga confirmed the high frequency of tp53 mutations , showing that tp53 mutations were the most common mutations found in gastric cancer . tp53 mutations were present in 50% of nonhypermutated gastric cancer samples , and 71% of cin samples had tp53 mutations . however , of additional interest was the lack of tp53 mutation in ebv - positive tumors . in the acrg series , tp53 mutations were found in a lower percentage of tumors ( 33% ) , however , it was still the most commonly mutated gene in this set of gastric cancers . although confirmation of the prevalence of tp53 mutations in gastric cancer by the tcga and acrg data is important , this information currently provides no prognostic or therapeutic roles in gastric cancer . a second classically mutated gene associated with gastric cancer is cdh1 , which encodes for the cell adhesion molecule e - cadherin . mutations in cdh1 typically have been associated with a diffuse histologic pattern of gastric cancer , and germline mutation in cdh1 is associated with the autosomal - dominant syndrome hereditary diffuse gastric cancer , which significantly increases the risk of diffuse gastric cancer as well as lobular breast cancer in affected individuals who carry a germline mutated copy of the cdh1 gene.26 , 27 from the tcga data , cdh1 was found to be mutated in 11% of all gastric cancers , with 37% of all genomically stable gastric cancers having a cdh1 mutation . within nonhypermutated tumors , cdh1 was found to be the fourth most commonly mutated gene overall ( behind tp53 , arid1a , and pik3ca ) . in the acrg analysis , similar to the data with tp53 , cdh1 mutations clearly have been validated as frequent mutations in gastric cancer , however , other than in the management of hereditary diffuse gastric cancer families with germline cdh1 mutations , cdh1 mutation status does not alter gastric cancer treatment . the use of ngs has led to the discovery of other candidate genes with similar functions as tp53 and cdh1 , which also may be important in gastric cancer pathogenesis . for example , brca2 , another maintainer of genome integrity , recently was shown to be mutated in 6% of a chinese cohort of gastric cancers , and these mutants correlated with longer survival . however of additional interest is also the recent discovery of another cell adhesion gene that functions in the same complex as e - cadherin , ctnna1 , which codes for -e - catenin . mutations in this gene have been discovered in hereditary diffuse gastric cancer families , however , similar to brca2 , a significantly increased frequency of this mutation has not been detected in the larger ngs studies . although ngs has strengthened the role of tp53 and cdh1 as driver mutations in gastric cancer , at this time the presence or absence of these mutations does not alter treatment strategies . therefore , it also is important to use the data from the ngs studies to determine novel driver mutations that may better impact treatment decisions and outcomes ( figure 2 ) . the major new categories of driver mutations that have been revealed by ngs include chromatin remodeling , cell motility / cytoskeleton , wnt signaling , and rtk pathway genes . chromatin remodeling genes , whose products are responsible for regulating chromatin structure to alter dna accessibility and transcriptional efficiency , frequently are mutated in gastric cancer . the most commonly identified chromatin remodeling gene mutation is in arid1a , which is a putative tumor suppressor that encodes a subunit of the switch - sucrose nonfermentable ( swi snf ) chromatin remodeling complex . this gene was detected initially in 2 smaller gastric cancer sequencing studies.14 , 15 in one of these reports , 22 gastric cancers and paired normal tissue samples had whole - exome sequencing performed , and showed that 27% of gastric cancers had a mutation in arid1a . this group then looked at arid1a mutations in a larger set of gastric cancers ( 109 samples ) and found arid1a mutations in 29% of these samples , primarily in ebv - positive ( 47% ) and msi ( 78% ) tumors . the tcga confirmed this significance with demonstration of arid1a mutations in 14% of all nonhypermutated gastric cancers . similar to prior results , these mutations were concentrated primarily in the ebv - positive cancers ( 55% ) , as well as hypermutated cancers ( 44% ) . similarly , in the acrg data , arid1a mutations were found in 18% of gastric cancers . in addition to arid1a , other less commonly mutated chromatin remodeling genes in gastric cancer include other genes of the swi snf complex including arid1b , as well as genes from the mixed - lineage leukemia ( mll ) family including those encoding mll ( kmt2a ) and mll3 ( kmt2c).15 , 16 another subgroup of frequently mutated genes in gastric cancer are those affecting cell motility and the cytoskeleton , with the most commonly mutated gene in this category being rhoa . rhoa codes for rhoa , which is a rho guanosine triphosphatase that is part of the ras superfamily , and has diverse roles within the cell including functions in cell motility and cytoskeleton remodeling , as well as regulation of the cell cycle . rhoa was found to be mutated in 25% and 14% of diffuse gastric cancers in 2 separate studies , whereas it was not mutated in intestinal - type gastric cancers.16 , 17 in the tcga analysis , rhoa was mutated in 6% of nonhypermutated gastric cancers , with enrichment in the genomically stable subset . although some evidence points toward mutant rhoa producing a gain - of - function protein product , other studies in different tumors have shown that wild - type rhoa serves as a tumor suppressor . apart from rhoa , there are additional cytoskeleton - related genes that are significantly mutated in gastric cancer such as macf1 . wnt signaling is a well - characterized signaling pathway that contributes to tumorigenesis in many cancers , especially of the gastrointestinal tract . the hallmarks of this pathway include increased -catenin ( encoded by ctnnb1 ) signaling , which often is facilitated by inactivating mutations in apc ( encoded by apc ) . pathogenic germline mutations in apc , which typically are truncating , lead to familial adenomatous polyposis , which is a condition that is associated with numerous colon polyps , and increases the risk of colon , gastric , as well as other cancers . the tcga data showed that in nonhypermutated tumors , apc was mutated in 7% of gastric cancers whereas ctnnb1 was mutated in 4% of these tumors . in the acrg , the mutation rates among all samples were 11% and 3% for apc and ctnnb1 , respectively . another regulator of wnt signaling is the e3 ubiquitin ligase rnf43 , which also was found to be mutated in 3% of nonhypermutated gastric cancers and 33% of the hypermutated gastric cancers in the tcga data , as well as in other data sets , thus further showing the likely importance of the wnt signaling pathway in a select set of gastric cancers . ngs has shown genomic alterations in the rtk pathways , which previously have been shown to be important in the carcinogenesis of gastric cancer . clinically , this pathway already has garnered some success therapeutically , with the use of trastuzumab for the treatment of her2-positive gastric cancer as well as the more recent approval of ramucirumab , a monoclonal antibody to vascular endothelial growth factor receptor-2 . as for new targets , pik3ca , which encodes the p110 subunit of pi3k , is critical for rtk signaling and can be activated by specific point mutations . in the tcga study , pik3ca mutations were found in 12% of the nonhypermutated gastric cancers and in 40% of the hypermutated cancers , with a similar percentage of mutations ( 14% ) found in the acrg study . based on the tcga classifications , 80% of the ebv - positive as well as 42% of the msi cancers had a mutation in pik3ca . however , in ebv - positive cancers , the pik3ca mutations were scattered throughout the gene rather than being clustered at classic activating positions , thus requiring further exploration into whether these noncanonical mutations are truly driver mutations of gastric carcinogenesis . the association of ebv - positive cancers with pik3ca mutations also was appreciated in other reports as well . in addition to pik3ca , the downstream rtk effector kras was mutated in 6% of nonhypermutated tumors in the tcga study , and 8% of samples in the acrg study . an additional mechanism of activating downstream rtk effectors includes gene amplification , which was observed with kras in 9% of gastric cancers in one series . although mutations in the erbb family of genes ( including egfr [ erbb1 ] , her2 [ erbb2 ] , erbb3 , and erbb4 ) were less frequent than pik3ca or kras , their signaling pathways often were found to be activated by gene amplification in multiple different studies.11 , 18 , 37 , 38 in addition to these groups of genes specific to defined pathways , there were also a number of other genes that were mutated in a significant percentage of gastric cancers . focusing on the data from hypermutated cancers from the tcga , there were a number of additional frequently mutated genes ( > 20% ) that were not mutated significantly in the nonhypermutated tumors including cic , erbb3 , ptpn23 , vps13a , bcorl1 , fbxw7 , zbtb20 , and hdac4 . among the nonhypermutated cancers from the tcga , there were additional genes that were mutated significantly including smad4 ( 8% ) , which is involved in the transforming growth factor- signaling pathway . in addition , muc6 , which was mutated in 6% of the tcga gastric cancers , is important for the production of cytoprotective mucin , in which inactivation may increase the risk of mucosal injury and subsequent carcinogenesis.11 , 17 increased mutational rates in these genes also were noted in the acrg data , and further study of the roles of their gene products in gastric cancer pathogenesis certainly is necessary to better define their importance . recent ngs studies undoubtedly have provided a wealth of data that has better characterized the genomic landscape of gastric cancer . further validation of the new genomically based gastric cancer classification schemes as well as the novel gastric cancer driver mutations is needed and may be obtained through larger and more diverse ngs studies on gastric cancer samples . a recent analysis that combined multiple ngs studies for a total analysis of 544 gastric cancer samples showed significant mutational rates in 7 new genes ( fbxw7 , xirp2 , nbea , col14a1 , cnbd1 , akap6 , and itgav ) that had not been shown previously to be significantly mutated in gastric cancer . more importantly , translating this genomic data into more effective treatments for gastric cancer remains the major challenge moving forward , and there are important translational questions along this line that must be addressed by the field . first , can genomically based classification schemes better stratify gastric cancers to enable use of more effective treatment regimens ? the large genomic studies from the tcga and acrg , as well as other smaller studies , used ngs to develop novel , well - thought - out , genomically based classification schemes for gastric cancer.11 , 12 the novelty of these schemes are that they classify tumors based on genomic properties , rather than just histologic appearances . conducting future trials to determine if these molecular classifications can better define response to various treatment regimens is certainly important . for example , ebv - positive and msi subtypes of gastric cancer have been shown to have increased expression of pd - l1 and therefore may be good candidates for treatment with immune checkpoint therapy with pd-1/pd - l1 blockade . in addition , treatment options that previously have been unsuccessful in the treatment of gastric cancer could be re - examined to determine if they may in fact be effective in a specific molecular subtype of gastric cancer . second , will targeting somatically mutated driver genes of gastric cancer improve treatment paradigms ? outside of the classic mutations in tp53 and cdh1 , recent ngs studies have shown numerous novel candidate driver mutations in gastric cancer . although the frequency of many of these mutations is low , it remains to be determined whether specifically targeting the pathways in which these mutant genes are involved will serve as an effective therapeutic strategy in a select group of gastric cancers . for example , given the significant increase in pik3ca mutations in ebv - positive tumors , targeting this pathway in ebv - positive gastric cancers may prove to be effective . in addition , it also remains to be seen if any specific mutational profiles of gastric cancer will be able to help prognosticate response to therapy or overall survival . third , can gastric cancer specific somatic sequencing panels be used to personalize therapy for gastric cancer ? given the dramatic reductions in costs associated with ngs , routine somatic sequencing of all gastric cancer tumor samples could soon become a reality . although now gastric cancers have her2 testing performed to decide on the use of trastuzumab , in the future there may be gastric cancer fourth , are there applications of this genomic data that may help improve diagnostic capabilities in gastric cancer ? apart from exploitation of genomic vulnerabilities for therapeutic targeting , there also are conceptual potential applications of these data in molecular diagnostics , such as circulating tumor cells , circulating nucleic acids , exosomes , and protein - based assays that deserve further exploration . in conclusion , the field of gastric cancer genomics has been revolutionized by improvements in ngs technology and the widespread application of ngs to studying this cancer . the advances in this field have led to more advanced classification systems for gastric cancer as well novel driver mutations that may be important for its pathogenesis . however , this wealth of information ultimately will only be helpful to gastric cancer patients if it can be applied effectively to improve both treatment paradigms and survival for these patients , and thus there remains a significant amount of work that must be done .

although iron is an essential nutrient widely used for normal cell function , elevated iron concentrations in the lungs are associated with an increased risk of pulmonary injury . iron - catalyzed oxidative stress contributes to lung injury after exposure to various toxins , including cigarette smoke . smoking has been suggested to increase the concentration of iron in the alveolar macrophages and bronchoalveolar lavage fluid to very high levels and to alter iron homeostasis , both in the lung and systemically.14 copd is one of the most common lung diseases , affecting ~10% of the population older than 40 years worldwide,5 while a recent korean nationwide surveillance indicated its higher prevalence in the korean population.6 an imbalance between oxidants and antioxidants is considered to play a critical role in copd pathogenesis,7,8 while cigarette smoking is a key risk factor for copd development , and most copd patients are current or former smokers.9 ferritin , a ubiquitous intracellular protein , is one of the key proteins that regulates body iron homeostasis and is a marker of the iron store.10 this study investigated the relationship among cigarette smoking , lung function , and serum ferritin concentration , using data collected from subjects participating in the korean national health and nutrition examination survey ( knhanes ) from 2010 to 2014 . the knhanes is a cross - sectional survey of health - related behaviors , health conditions , and the nutritional state of the korean population ( adults and children ) and yields basic statistics for establishing health policies . for this study , data from the 20102014 surveys ( knhanes iv v ) were used , which employed a stratified , multiple - stage , clustered - probability design to select a representative sample of noninstitutionalized civilians from among the korean population . these data comprised information on age , ethnicity , sex , height , weight , smoking status , residency , household income , past history of pulmonary tuberculosis and asthma , and prebronchodilator spirometry values . the study protocol was approved by the institutional review board of yonsei university health service , severance hospital ( approval number : 4 - 2006 - 0101 ) , and was conducted in accordance with the declaration of helsinki . iv v participants ( n=50,405 ) , all individuals older than 40 years who were examined for serum ferritin levels and spirometric data were included in this study . after explaining the procedure of spirometry to participants in detail , spirometry measurements were conducted by four technicians , each of whom underwent two education sessions on pulmonary function testing and quality control , and the principal investigator determined whether they met the criteria for acceptability and reproducibility . spirometry ( vmax 2130 dry rolling - seal spirometer ; sensormedics , yorba linda , ca , usa ) was performed according to the guidelines of the american thoracic society / european respiratory society for standardizing the pulmonary function tests.11 data that produced two acceptable spirometry curves , ie , showing the start of the test and expiration for 6 seconds , with the greatest difference between the two measurements of forced expiratory volume in 1 second ( fev1 ) and forced vital capacity ( fvc ) < 150 ml , were included in the analysis . airway obstruction was defined using the ratio of fev1 to fvc ( fev1/fvc ) < 70% as a fixed cut - off point according to the guidelines set by the global initiative for chronic obstructive lung disease ( gold).12 the severity of airway obstruction was classified as ( 50% fev1 < 80% predicted , gold stage ii ) , and severe iv ) . in addition , normal lung function was defined as fev1/fvc 70% and fvc 80% predicted . a restrictive spirometric pattern was defined as fev1/fvc 70% and fvc < 80% predicted . serum ferritin was measured by immunoradiometric assay using a 1470 wizard gamma counter ( perkinelmer inc . , baseline characteristics were summarized using frequencies and percentages to describe categorical variables and compared using the chi - square test . serum ferritin levels were compared using analysis of variance and are presented as the median and interquartile range ( iqr ) . multivariable linear regression analysis using a stepwise backward technique was performed to assess the correlation among lung function , cigarette smoking , and serum ferritin concentration in a multivariable model adjusted for age , sex , height , and weight . the knhanes is a cross - sectional survey of health - related behaviors , health conditions , and the nutritional state of the korean population ( adults and children ) and yields basic statistics for establishing health policies . for this study , data from the 20102014 surveys ( knhanes iv v ) were used , which employed a stratified , multiple - stage , clustered - probability design to select a representative sample of noninstitutionalized civilians from among the korean population . these data comprised information on age , ethnicity , sex , height , weight , smoking status , residency , household income , past history of pulmonary tuberculosis and asthma , and prebronchodilator spirometry values . the study protocol was approved by the institutional review board of yonsei university health service , severance hospital ( approval number : 4 - 2006 - 0101 ) , and was conducted in accordance with the declaration of helsinki . iv v participants ( n=50,405 ) , all individuals older than 40 years who were examined for serum ferritin levels and spirometric data were included in this study . after explaining the procedure of spirometry to participants in detail , spirometry measurements were conducted by four technicians , each of whom underwent two education sessions on pulmonary function testing and quality control , and the principal investigator determined whether they met the criteria for acceptability and reproducibility . spirometry ( vmax 2130 dry rolling - seal spirometer ; sensormedics , yorba linda , ca , usa ) was performed according to the guidelines of the american thoracic society / european respiratory society for standardizing the pulmonary function tests.11 data that produced two acceptable spirometry curves , ie , showing the start of the test and expiration for 6 seconds , with the greatest difference between the two measurements of forced expiratory volume in 1 second ( fev1 ) and forced vital capacity ( fvc ) < 150 ml , were included in the analysis . airway obstruction was defined using the ratio of fev1 to fvc ( fev1/fvc ) < 70% as a fixed cut - off point according to the guidelines set by the global initiative for chronic obstructive lung disease ( gold).12 the severity of airway obstruction was classified as ( 50% fev1 < 80% predicted , gold stage ii ) , and severe iv ) . in addition , normal lung function was defined as fev1/fvc 70% and fvc 80% predicted . a restrictive spirometric pattern was defined as fev1/fvc 70% and fvc < 80% predicted . serum ferritin was measured by immunoradiometric assay using a 1470 wizard gamma counter ( perkinelmer inc . , data were analyzed using sas v9.2 ( sas institute inc . , cary , nc , usa ) . baseline characteristics were summarized using frequencies and percentages to describe categorical variables and compared using the chi - square test . serum ferritin levels were compared using analysis of variance and are presented as the median and interquartile range ( iqr ) . multivariable linear regression analysis using a stepwise backward technique was performed to assess the correlation among lung function , cigarette smoking , and serum ferritin concentration in a multivariable model adjusted for age , sex , height , and weight . the study population was grouped into three subgroups according to the spirometric results : normal pattern ( n=11,477 ) , restrictive pattern ( n=1,727 ) , and obstructive pattern ( airway obstruction ; n=2,035 ) . of all 15,239 study individuals , the prevalence of airway obstruction was 13.4% , which was significantly higher in men ( 22.3% ) than in women ( 6.5% ) , while a normal spirometric pattern was more common in women ( 82.9% ) than in men ( 65.4% ) . the prevalence of airway obstruction was increased in ever smokers ( former or current ) and with the amount smoked . anemia was more frequent in the restrictive subgroup ( 10.1% ) than in those with normal lung function ( 8.6% ) or with airway obstruction ( 7.6% ) . in the obstructive subgroup ( n=2,035 ) , the presence of anemia did not differ significantly according to the severity of obstruction ( table 1 ) . additionally , the prevalence of airway obstruction was higher in subjects living in urban areas ( 16.8% ) than in those living in a rural area ( 12.2% ; p<0.001 ) and was more frequently observed with a higher household income ( first quartile : 21.9% , second quartile : 14% , third quartile : 10.6% , and fourth quartile : 8.8% ; p<0.001 ) . the prevalence of airway obstruction was 28.8% in individuals with a history of pulmonary tuberculosis ( n=1,040 ) and 12.2% in those without such a history ( n=14,199 ; p<0.001 ) . furthermore , airway obstruction was more prevalent in subjects with asthma ( n=740 ) than in those without this condition ( n=14,499 ; 36.5% vs 12.2% ; p<0.001 ) . table 2 shows the median levels of serum ferritin in the three groups with normal lung function , a restrictive spirometric pattern , and airway obstruction , according to age groups , sex , smoking status , and smoking amount . the median levels of serum ferritin were highest in the airway obstruction group ( 83.9 g / l ) ( iqr : 50.3138.9 ) , followed by the restrictive pattern group ( 74.6 g / l ) ( iqr : 42.6128.3 ) , and lowest in the normal lung function group ( 62.3 g / l ) ( iqr : 33.9104.8 ) . ex- or current smokers had higher serum ferritin levels than never smokers in all three groups categorized by spirometric pattern . although women had lower levels of serum ferritin than men in all three spirometric groups , the level of serum ferritin was significantly lower in women with a normal spirometric pattern than in women with an obstructive pattern ( 45.3 g / l vs 55.9 conversely , among the women with airway obstruction ( n=562 ) , the serum ferritin showed a trend toward a lower level in those with severe obstruction ( 38.3 g / l vs 56.6 g / l ) than those with mild obstruction ( p=0.404 ) . for men , the level of serum ferritin was higher in those with a normal spirometric pattern than in those with airway obstruction ( 102.8 g / l vs 98.8 g / l ; p=0.198 ) . additionally , the serum ferritin level was higher in men than in women in all subgroups determined by smoking status . because of the skewed nature of the distribution , serum ferritin levels were also logarithmically transformed , and the median levels of the log - transformed serum ferritin ( sd ) were 1.91 ( 0.37 ) , 1.84 ( 0.41 ) , and 1.74 ( 0.43 ) in obstructive , restrictive , and normal spirometric patterns , respectively ( p<0.001 ) . in the male population , the median level of the log - transformed serum ferritin was highest in current smokers , while it was highest in exsmokers in women ( table 2 ) . we performed multivariable linear regression analyses to determine the relationships among spirometric results ( fev1 and fev1/fvc ) , serum ferritin , and smoking amounts . after adjustment for age , sex , height , and weight , serum ferritin levels were positively associated with fev1 and fev1/fvc , whereas the smoking amount was negatively associated with these values in our study population ( table 3 ) . the study population was grouped into three subgroups according to the spirometric results : normal pattern ( n=11,477 ) , restrictive pattern ( n=1,727 ) , and obstructive pattern ( airway obstruction ; n=2,035 ) . of all 15,239 study individuals , the prevalence of airway obstruction was 13.4% , which was significantly higher in men ( 22.3% ) than in women ( 6.5% ) , while a normal spirometric pattern was more common in women ( 82.9% ) than in men ( 65.4% ) . the prevalence of airway obstruction was increased in ever smokers ( former or current ) and with the amount smoked . anemia was more frequent in the restrictive subgroup ( 10.1% ) than in those with normal lung function ( 8.6% ) or with airway obstruction ( 7.6% ) . in the obstructive subgroup ( n=2,035 ) , the presence of anemia did not differ significantly according to the severity of obstruction ( table 1 ) . additionally , the prevalence of airway obstruction was higher in subjects living in urban areas ( 16.8% ) than in those living in a rural area ( 12.2% ; p<0.001 ) and was more frequently observed with a higher household income ( first quartile : 21.9% , second quartile : 14% , third quartile : 10.6% , and fourth quartile : 8.8% ; p<0.001 ) . the prevalence of airway obstruction was 28.8% in individuals with a history of pulmonary tuberculosis ( n=1,040 ) and 12.2% in those without such a history ( n=14,199 ; p<0.001 ) . furthermore , airway obstruction was more prevalent in subjects with asthma ( n=740 ) than in those without this condition ( n=14,499 ; 36.5% vs 12.2% ; p<0.001 ) . table 2 shows the median levels of serum ferritin in the three groups with normal lung function , a restrictive spirometric pattern , and airway obstruction , according to age groups , sex , smoking status , and smoking amount . the median levels of serum ferritin were highest in the airway obstruction group ( 83.9 g / l ) ( iqr : 50.3138.9 ) , followed by the restrictive pattern group ( 74.6 g / l ) ( iqr : 42.6128.3 ) , and lowest in the normal lung function group ( 62.3 g / l ) ( iqr : 33.9104.8 ) . ex- or current smokers had higher serum ferritin levels than never smokers in all three groups categorized by spirometric pattern . although women had lower levels of serum ferritin than men in all three spirometric groups , the level of serum ferritin was significantly lower in women with a normal spirometric pattern than in women with an obstructive pattern ( 45.3 g / l vs 55.9 conversely , among the women with airway obstruction ( n=562 ) , the serum ferritin showed a trend toward a lower level in those with severe obstruction ( 38.3 g / l vs 56.6 g / l ) than those with mild obstruction ( p=0.404 ) . for men , the level of serum ferritin was higher in those with a normal spirometric pattern than in those with airway obstruction ( 102.8 g / l vs 98.8 g / l ; p=0.198 ) . additionally , the serum ferritin level was higher in men than in women in all subgroups determined by smoking status . because of the skewed nature of the distribution , serum ferritin levels were also logarithmically transformed , and the median levels of the log - transformed serum ferritin ( sd ) were 1.91 ( 0.37 ) , 1.84 ( 0.41 ) , and 1.74 ( 0.43 ) in obstructive , restrictive , and normal spirometric patterns , respectively ( p<0.001 ) . in the male population , the median level of the log - transformed serum ferritin was highest in current smokers , while it was highest in exsmokers in women ( table 2 ) . we performed multivariable linear regression analyses to determine the relationships among spirometric results ( fev1 and fev1/fvc ) , serum ferritin , and smoking amounts . after adjustment for age , sex , height , and weight , serum ferritin levels were positively associated with fev1 and fev1/fvc , whereas the smoking amount was negatively associated with these values in our study population ( table 3 ) . in this cross - sectional study , we analyzed the associations among serum ferritin levels , cigarette smoking , and lung function in a large cohort derived from the korean population older than 40 years . increased amounts of cigarette smoking were related to higher serum ferritin levels , while lower serum ferritin levels were significantly related to decrease in fev1 and fev1/fvc values . the positive correlation among log - transformed ferritin levels , smoking amounts , and lung function assessed by spirometric data remained significant after adjustment for independent covariates , such as age , sex , height , and weight . collectively , these findings suggest that the iron store may affect pulmonary physiology and , possibly , the risk of airway obstruction , while smoking may alter iron homeostasis . iron is an essential micronutrient that is used in almost every aspect of normal cell function . however , its ability to catalyze the formation of reactive oxygen species can also be a health threat , which can lead to oxidative stress and damage cellular membranes.13 cigarette smoke contains numerous oxidants and prooxidants capable of producing free radicals and enhancing oxidative stress.14 previous studies have suggested the influence of cigarette smoking on iron status by demonstrating cigarette smoke - induced release of iron from ferritin by aqueous extracts of cigarette smoke15 and that such iron mobilization acts as a specific prooxidant mechanism during smoking.16 in addition to other studies showing the increased lavage iron stores in smokers,2,17 ghio et al4 in their animal experiments suggested an alteration in iron homeostasis from cigarette smoke exposure . more specifically , they have shown that such exposure leads to iron accumulation that is dependent on particulates in the smoke and that this change affects oxidative stress , which is responsible for tissue inflammation after smoking . they suggested that the complexation of host iron by particulate matter in the tar phase of cigarette smoke will alter iron homeostasis , both in the lung and systemically.4 in order to regulate iron - catalyzed oxidative stress , lung epithelial cells can rapidly increase the expression of ferritin protein.1 ferritin restricts the capacity of iron to generate reactive oxygen species and free radicals via iron sequestration and , thus , serves as an antioxidant protein.18 using human lavage samples , ghio et al4 demonstrated significantly increased ferritin concentrations in healthy smokers and smokers with copd when compared with healthy nonsmokers . using national health and examination survey iii data from > 7,000 subjects , they also demonstrated significant increases in serum iron and ferritin levels and transferrin saturation among smokers relative to nonsmokers . a prior study by touitou et al19 reported significantly higher levels of plasma ferritin in smokers than in nonsmokers in an elderly population . our study extends these observations in a larger cohort of > 15,000 subjects , representative of the general korean population . in our results , the levels of serum ferritin were highest among subjects with an obstructive pattern , grouped according to spirometric data , and defined as fev1/fvc < 70% . this indicates the impact of smoking on serum ferritin levels , considering that ~70% of those with an obstructive pattern were former or current smokers . alternatively , in the subgroup analysis of only subjects with an obstructive pattern , the levels of serum ferritin were decreased in the subgroups with severe obstruction as defined by sex and smoking . although the role of iron in copd has not been clarified , our results of a positive correlation between serum ferritin levels and lung function parallel the findings of studies that explored iron status in other respiratory diseases . sharkey et al20 have demonstrated that the initial serum ferritin levels measured among patients with acute respiratory distress syndrome predicts the development of this syndrome and multiple organ failure . increased concentrations of iron in the lavage fluid of patients with cystic fibrosis have also been observed.21 alternatively , iron deficiency has been shown to be associated with reduced lung function in a large cohort of north american women.22 in the context of patients with copd , a cross - sectional study has reported associations between iron deficiency and reduced exercise tolerance and more frequent exacerbations.23 further studies are needed to clarify the role of iron status in the development of airway obstructive diseases . although a major strength of this study is the large number of representative participants and their stratification by lung function , there are several limitations to be accounted for . first , serum ferritin is an acute - phase reactant and may be increased in the presence of inflammation . given the lack of data on inflammation , infection , or liver disease in our study population , we can not rule out the potential confounding effect related to the ferritin levels . similarly , we measured only serum ferritin levels as a marker of iron status , and other iron profiles , such as serum iron levels , transferrin , and total iron - binding capacity , could not be included in the analyses . finally , due to the nature of cross - sectional cohort studies , causation could not be investigated and a reverse causality can not be excluded in this study . therefore , we could not determine whether the positive association between fev1 and fev1/fvc and serum ferritin levels observed in this study indicated enhanced detoxification of iron in individuals with better lung functions , or if adequate body iron storage per se favorably affected spirometric results . serum ferritin levels were increased in former or current smokers and were increased with smoking amount in all subgroups of participants categorized according to spirometric results . while the smoking amount was inversely related to lung function , a higher level of serum ferritin was associated with enhanced spirometric results in a representative sample of the general korean adult population . given the findings in this study and the increasing incidence of copd worldwide , future prospective studies will be needed to clarify the causality between serum ferritin levels and lung function and its role in copd morbidity .

parkinson s disease ( pd ) is a progressive neurodegenerative disorder , characterized by bradykinesia , tremor and rigidity with postural instability developing later in the course of the illness along with gait and balance abnormalities.1 the motor symptoms associated with pd arise primarily from dopamine deficiency , although other neurotransmitters are involved . treatment of pd is mainly symptomatic even if recent evidence from the rasagiline trial ( adagio ) suggests that a disease modifying effect can be achieved particularly in the early phases.2 initial treatment aims at replacing dopamine through the administration of oral levodopa or dopamine agonists.36 although oral therapy can significantly improve clinical features for many years , motor response complications ( mrc ) , characterized by wearing off and dyskinesias ( potentially associated with off - period dystonia ) , emerge in up to 80% of patients . their development leads to worsening disability with a significant impact on patient and caregiver quality of life . moreover , non - motor symptoms ( such as urinary disorders , severe anxiety , mood swings , difficulty in concentration , hyperidrosis , itching and fatigue ) may also have a considerable impact on patient and caregiver quality of life particularly in advanced patients . dysarthria , dysphagia , pain , diplopia and urinary urgency - are not responsive to dopamine replacement therapy ( drt ) and likely related to degeneration of in non - dopaminergic neurons.712 possible risk factors for the development of mrc include a younger age of onset , daily dose of levodopa therapy and duration of levodopa therapy . current evidence also suggests that the mode of oral levodopa administration ( resulting in pulsatile stimulation ) may be an important contributing factor for mrc.10,11 substantial evidence now argues against levodopa neurotoxicity.13 this overview provides an update on infusion therapies currently used to provide symptomatic control and reduce mrc in patients with advanced pd . the infusion of dopaminergic drugs achieves steady plasma levels and this can help control mrc in advanced patients . the avoidance of plasma fluctuations helps to minimise dyskinesias since pulsatility may play a role in their mediation.1417 although the precise molecular mechanisms underlying the development of mrc are debated , the following points are generally accepted : dyskinesias appear almost exclusively in patients on levodopa therapy;there is a relationship between dyskinesia and levodopa dosing;there is a time lag between the levodopa initiation and emergence of the motor complications and this is likely related to severity of dopamine denervation . dyskinesias appear almost exclusively in patients on levodopa therapy ; there is a relationship between dyskinesia and levodopa dosing ; there is a time lag between the levodopa initiation and emergence of the motor complications and this is likely related to severity of dopamine denervation . of several possible mechanisms proposed , central , rather than peripheral ( e.g. , relating to dietary proteins and/or the gastric absorption of levodopa ) it is established that standard doses of levodopa / carbidopa do not restore basal ganglia physiology to normal functioning . the administration of intermittent doses of a short - acting formulation of levodopa ( which has a relatively short half - life of about 50 minutes and 1.5 hours in combination with carbidopa ) results in large and uncontrolled oscillations in striatal dopamine levels . such oscillations may increase with pd progression and also with loss of striatal dopamine terminals that can normally store dopamine and buffer the inevitable fluctuations in plasma concentration observed with oral levodopa . these events change the normal physiologic situation , where striatal dopamine receptors are continuously exposed to dopamine , to one in which they are exposed to pathologically high and low concentrations of dopamine . this results in pulsatile stimulation of dopamine receptors , and the consequence of this is further destabilization of the basal ganglia network that is already abnormal in patients with pd.1719 the impact of pulsatile stimulation of striatal dopaminergic receptors is further supported by experiments on 1-methyl-4-phenyl-1 , 2 , 3 , 6-tetrahydropyridine ( mptp)-treated primates . repeated administration of levodopa or other short - acting dopamine agonist drugs , leads to the onset of marked involuntary movements over a relatively short period of time . in contrast , treatment with long - acting dopamine agonists leads to a much lower level of dyskinesia . in mptp monkeys , administration of multiple small doses of levodopa in conjunction with the peripheral catechol - o - methyl transferase ( comt ) inhibitor entacapone removes much of the pulsatility of motor function seen with standard levodopa treatment regimens and , at the same time , results in a lower incidence and intensity of dyskinesia . furthermore , the addition of multiple small doses of levodopa plus entacapone to dopamine agonist treatment also avoids dyskinesia induction in mptp - treated primates.16,2023 it is thought that pulsatile stimulation of striatal dopaminergic receptors induces downstream changes in proteins and genes , causing plastic changes and consequent alterations in striatal output that promotes the development of mrc.18 evidence suggests that chronic intermittent stimulation of normally tonically active dopaminergic receptors brings about alterations in cell signals in striatal dopaminergic medium spiny neurons.16,24 this may potentiate gamma - aminobutyric acid ( gaba)-ergic efferents , particularly , glutamate receptors of the n - methy1-d - aspartate ( nmda ) subtype . in support of this , overactivity of glutamatergic systems in the basal ganglia has been observed in patients experiencing levodopa - induced dyskinesias ( lid),25 while higher internal globus pallidus gabaa receptor content has been observed in post - mortem samples of levodopa - treated dyskinetic patients compared with non - dyskinetic patients.26,27 abnormalities in other nondopaminergic transmission such as serotonergic , 2-adrenergic , opioid and cannabinoid mechanisms , in both priming and expression of lid , have also been reported but their clinical relevance remains to be determined.24,28 the overall hypothesis that pulsatile stimulation of striatal dopamine receptors contributes to the development of levodopa - associated mrc has led to a paradigm shift in the treatment of pd following the development of therapeutic strategies that aim to minimize mrc by providing more continuous dopaminergic stimulation ( cds).18,2933 it is believed that the prevention of mrc may be due to the cds induced by constant levodopa levels , as this avoids the low plasma levodopa - trough levels seen with oral levodopa . based on clinical evidence , additional potential benefits of cds include alleviating nocturnal disturbances , avoiding priming for motor fluctuations and dyskinesia , minimizing daytime sleepiness , preventing the development of gastrointestinal dysfunction and reducing the risk of developing psychosis or behavioral disturbances.30,31,33 it has been applied in several medical conditions such as analgesia , insomnia , alcohol dependence , schizophrenia and others . it was initially used for pd over 60 years ago but later ignored for many years following levodopa introduction . it is also the most potent dopamine agonist and its administration can provide symptom relief comparable to levodopa . apomorphine exerts its antiparkinsonian effect by direct stimulation of striatal post - synaptic dopamine d1 and d2 receptors.34 the drug has a rapid absorption after injection ( cmax 20 min ) , and a short half - life ( almost 43 min ) , and this is consistent with its rapid onset of action , with effects apparent within 515 minutes of subcutaneous administration . clinical studies generally support a role for csai as an effective option for patients with pd and severe fluctuations , poorly controlled by conventional oral drug treatment . overall , studies report an improvement in off - time between 50% and 80% as well as dyskinesia.3440 however , these results were reported several years ago in uncontrolled conditions and mostly in individuals on levodopa monotherapy before other oral dopamine agonists had reached significant clinical application . while the benefit on off time is consistent across all studies , dyskinesia improvement is somehow controversial . widespread use of dopamine agonists since early disease stages usually leads to a reduction of levodopa doses , the main contributor to the development of involuntary movements . dyskinesia reduction generally occurs after a few weeks or months of continuous dopaminergic stimulation as a result of wider therapeutic window . finally , apomorphine monotherapy can be achieved only with high doses ( usually > 100 mg / day ) at a prize of high risk of behavioural adverse events . association with oral levodopa ( most common condition in clinical practice ) de facto does not abolish pulsatility and prevents benefit on dyskinesia . intermittent subcutaneous apomorphine ( penjet ) may also be suitable for the long - term acute treatment of off episodes in patients with advanced pd.41,42 apomorphine injections can be a particularly useful option also in patients who undergo surgical procedures or to treat additional non - motor symptoms like dysphagia or pain occurring during off periods . our experience refers to a prospective study where we compared the effects of csai ( n=13 ) with stn - dbs ( n=12 ) in patients with advanced pd and motor fluctuations and dyskinesias that could not be controlled with standard oral treatment.43 patients were given the choice between the two treatments and many chose apomorphine infusion due to the long waiting list for the dbs surgical procedure . , patients had a 51% reduction in daily off - time and were able to reduce their levodopa dose by 29% at 12 months.43 there was no significant change in the abnormal involuntary movement scale ( aims ) scores , suggesting that apomorphine was not an effective treatment for dyskinesia . neuropsychiatric testing revealed no significant changes in cognition or behaviour , a finding in agreement with other studies.44,45 among patients who received stn - dbs for 12 months , there was a 76% reduction in off - time , a reduction in daily levodopa dose of 62% and an 81% reduction in aims scores . there was a significant worsening of the neuropsychiatric inventory ( npi ) compared with baseline and at least 50% of patients exhibited apathy and other behavioural changes that were not apparent at baseline . similar changes have been reported previously by other groups.46 although both apomorphine and stn - dbs produced significant clinical improvements in this study , both treatments had clear drawbacks . experience also points to additional problems with these treatments . during more than 4 years of follow - up with 50 patients receiving apomorphine , 22 have dropped out of treatment because they felt that their motor control was insufficient . in addition , patients who use longterm apomorphine ( up to 16 h / day for 24 months ) may develop impulse control disorders . five patients developed such disorders , including pathological gambling , internet addiction , compulsive eating and increased libido and acute paranoia with attempted suicide . these effects are dopamine - mediated and ultimately led to treatment discontinuation.43 regarding the practicalities of administering csai , it is generally recommended to pre - medicate patients with the anti - dopaminergic agent domperidone 3 days prior to infusion ( 10 mg 34 times / day ) in order to help suppress any potential nausea and vomiting . the infusion should be initiated at 1 mg / hour apomorphine whilst maintaining initially the same dose of levodopa . the dose of apomorphine should be increased by 0.5/mg / hour every 2/4 hours depending on tolerability . in order to improve dyskinesias , the dose of levodopa should be reduced on a daily basis , if possible , until complete discontinuation . if adverse events occur the infusion should be discontinued for 624 hours . in clinical trials , the most common reported adverse events associated with apomorphine infusion included nodules ( 70% incidence ) , sedation and somnolence ( 23% ) , nausea and vomiting ( 10% ) , renal impairment ( 6% ) , orthostatic hypotension ( 5% ) and coomb test positivity ( 6% ) . in addition , good local hygiene and changing the site of injection are important measures to help prevent panniculitis ( a relatively rare event ) . the use of apomorphine can be limited by compliance , local skin reactions at the site of injection particularly with round - the - clock administration.5,14,19 as with any therapy , the selection of patients suitable to receive csai is of fundamental importance to optimal outcomes . appropriate candidates include patients with idiopathic pd who have responded to levodopa and who experience motor fluctuations and/or with dyskinesias that can not be controlled with oral therapy . patients with cognitive impairment , advanced biological age with orthostatic hypotension , severe systemic diseases ( e.g. , hepatic , renal or cardiac failure ) , or history of dopaminergic psychosis ( which is a contraindication for therapy ) , should be excluded . patient ( and caregiver ) compliance is important to ensure optimal outcomes ; drop - outs for lack of compliance usually occur during the first 13 months of treatment . constant levodopa infusion aims to achieve continuous delivery with an optimised dose that can be kept stable within the patient s individual therapeutic window . gastric emptying must be bypassed to achieve this . a stable constant - rate intravenous infusion of levodopa ( and hence stable plasma levodopa levels ) , first achieved in 1975 , was found to ameliorate motor fluctuations in patients with pd experiencing mrc due to long - term oral levodopa.47,48 it was subsequently hypothesised that the development of a sustained - release formulation of levodopa would lead to improved control of the response fluctuations seen with conventional levodopa preparations . unfortunately with current oral formulations including those that associate comt inhibitors constant plasma levels can not be obtained . it was found that intravenous infusion of levodopa can not be maintained in an individual patient for longer than 710 days due to poor tolerability of venous access ( levodopa is irritating to veins and soft tissues ) and the poor water solubility of levodopa . the subsequent development of a stable concentrated levodopa - carbidopa gel ( duodopa ) ( levodopa / carbidopa 20/5 mg / ml in a carboxymethylcellulose mix ) combined with progress in the construction and application of portable duodenal infusion systems using percutaneous endoscopic gastrostomy ( peg ) , facilitated the clinical use of this approach.49,50 the levodopa - carbidopa gel , which is administered inside the upper intestine via a small tube inserted directly into the duodenum to facilitate permanent use , has proven to be a successful therapeutic strategy.4951 it provides constant plasma levodopa levels , more continuous dopaminergic stimulation and effective treatment of motor complications through physiologic - like activation of dopamine receptors . the avoidance of low plasma levodopa trough levels has been found to reduce motor fluctuations and provide more continuous and predictable clinical benefits for patients.4956 in clinical trials , continuous intraduodenal infusion of levodopa as monotherapy has been shown to be safe and effective with certain advantages over individually optimised combinations of conventional oral and subcutaneous medications in patients with mrc . the direqt ( duodopa infusion : randomized efficacy and quality of life trial)53 study , a randomised , controlled multicentre study involving five centres in sweden , was the pivotal trial for use of the levodopa - carbidopa gel . patients ( n=24 ) with motor fluctuations and dyskinesia were studied in a crossover design to compare individualised , optimized , conventional treatment and levodopacarbidopa gel for two periods of three weeks . levodopa infusion rates averaged approximately 96 mg / hour and the average infusion time was 16.5 hours . video scoring of motor function was assessed by blinded assessors on a global treatment response scale from 3 to 0 to + 3 ( severe off to on to on with severe dyskinesia ) . the primary endpoint was the percentage of ratings spent within the interval 1 to + 1 ( functional on ) for each treatment . overall , 21 patients received levodopa - carbidopa gel infusion and results from 20 patients were included for conventional treatment . the median rating for motor function 1 to + 1 was 100% with levodopa / carbidopa duodenal infusion and 81.3% with conventional treatment ( p<0.001 ) . adverse effects were generally mild and similar between the two treatment regimens . after completing the study , 16 of the enrolled patients chose to be treated with continuous daytime infusion of levodopa / carbidopa.53 our clinical experience suggests that patients appreciate the predictability of this intraduodenal infusion therapy with no medication time points to remember and find the system easy to handle . fluctuating motor performance is an important cause of impaired quality of life in advanced pd to which motor complications per se and psychosocial consequences of on - off fluctuations may contribute.57,58 treatment strategies that stabilize motor performance can improve the situation . in addition to demonstrating improved short- and long - term motor outcome , levodopa / carbidopa duodenal infusion may also help improve patient qol.59,60 in a 12-month study of prospective clinical and quality of life changes in seven evaluable patients with pd , treatment with levodopa / carbidopa duodenal infusion was associated with significant improvements in four pdq-39 domains ( mobility , activities of daily living , stigma , bodily discomfort ; p<0.05 ) . significant improvements in united parkinson s disease rating scale ( updrs)-ii ( activities of daily living ) and iv ( motor complications ) in the on condition ( p<0.02 ) were also observed.59 adverse events are generally related to the device or surgical procedure . the most frequently reported complications related to the intestinal tube included dislocation , occlusion and kink / knot in tube . dislocation of the distal part of the tube from the duodenum into the stomach can lead to sudden deterioration of treatment response with recurring motor fluctuations . adverse events related to the stoma , which may cause discomfort , included secretion from the stoma , infection , proud flesh around the stoma and pain.53,59,60 as it is unlikely that continuous dopaminergic infusion strategies mimic precisely the function of the dopaminergic system in the normal brain , certain cautions remain regarding their use . as they are not physiological , infusion therapies are unlikely to avoid sensitisation and tolerance . this suggests a risk that continuous delivery may also encourage the clinician to add more medications in order to extend the response to each dose of levodopa and to consider 24-hour therapy . an unintended consequence of this may be more acute and long - term dopaminergic toxicity as a result of tolerance . however , clinical experience provides very little evidence for the development of tolerance during therapy with levodopa infusion and it is not infrequent to observe a reduction in dose needed during the first months of treatment . despite these cautions , long - term clinical experience suggests that duodenal levodopa infusion offers an effective alternative in treating patients with advanced pd experiencing mrc.5355 more importantly since levodopa is the most physiologic medication for pd theoretically any patient may benefit from infusion . in clinical practice infusions provide stable plasma levels of dopaminergic medications avoiding peaks and troughs that are typical of oral administration and are the likely to contribute to the development of motor complications . continuous dopaminergic stimulation of dopaminergic medications reduces dyskinesia and widens the therapeutic window in advanced pd . apomorphine effect mimics levodopa is very effective in controlling off time but dyskinesia improvement is limited by the need to continue pulsatile oral levodopa therapy in the majority of the patients . however , its chronic subcutaneous infusion is limited by the occurrence of skin reactions at the site of injection and the risk of psychiatric adverse events when high doses are used . finally , experience with continuous duodenal levodopa infusion shows that dyskinesia and wearing - off improve considerably and benefit also involves quality of life as well as non - motor disability .

the principal goal of the systers project is to automatically partition all the available protein space . because the fully automated classification scheme does not rely on interventions and updates by experts , the systers approach is complementary to expert - curated protein domain or protein family classification schemes like pfam ( 1 ) , smart ( 2 ) or prosite ( 3 ) . the systers database is derived from rigorous all - against - all smith waterman searches ( 4 ) . the resulting pairwise sequence similarities are used in a refined two - step clustering approach that assigns each protein to a family and a superfamily ( a. krause , j. stoye and m. vingron , submitted for publication ) . the systers web resource comprises a multitude of query access points , data retrieval options , pre - processed sequence analyses of individual families and comprehensive views on multiple families ( figure 1 ) . the automatically derived protein families are augmented with expert - curated biological information from various resources . for the functional characterization of each cluster , keywords are extracted from annotations of source sequence databases and are assigned to each family . in systers release 4 , pfam domain assignments to sequences of swiss - prot / trembl ( 5 ) help to visualize the domain architecture of a protein and to identify differences in domain composition within a protein family . the users are offered pre - calculated multiple alignments and phylogenetic trees that can serve as a starting point for their own focused analyses . in this paper , we will describe the differences of systers release 4 compared to previous releases and highlight the recent developments of tools to access and view information on systers protein families and superfamilies . the swiss - prot / trembl database content was extended by several protein data sources with information from completely sequenced genomes ( figure 1 ) : saccharomyces cerevisiae ( 6 ) , schizosaccharomyces pombe ( 7 ) , arabidopsis thaliana ( 8) , drosophila melanogaster , anopheles gambiae , caenorhabditis elegans , caenorhabditis briggsae , takifugu rubripes , mus musculus and homo sapiens ( 9 ) . after removal of redundant sequences , the results of more than 10 pairwise smith waterman comparisons were fed into the clustering procedure ( table 1 ) . only 11.8% of sequences remained as singletons . the majority ( 74% ) of multi - sequence families are perfect , meaning that all sequences in a family match with each other . overlapping : these families might harbour protein pairs that do not share homologous regions , but are linked indirectly via an intermediate protein that has distinct homologous regions in common with both . there are few families with many sequences and many families with only a few sequences . for each protein family , systers provides a comprehensive overview of its member proteins and their annotations . on the entry page , users have access to more detailed information on protein annotations , sequences , multiple alignments , phylogenetic analyses , protein domains , taxonomic distribution and gene structure - related data ( figure 1 ) . in addition to pre - calculated multiple alignments by mview ( 13 ) , the systers web server now offers multiple alignments and upgma trees generated using dialign ( 14 ) . the dialign alignment incorporates all sequences in full length , colour - coded information on alignment quality and pfam domain positions . from mview alignments we derived consensus sequences for each family . the database of consensus sequences can be queried by the user via blast ( 15 ) interface . systers provides a new wizard - like tool that allows a flexible selection of user - defined sequences . in this way subsequently , multiple alignment and upgma trees can be constructed using dialign and viewed online . the keyword list represents a succinct functional description of a family , thus helping to infer functions of hypothetical proteins . we integrated further swiss - prot / trembl annotations such as gene ontology ( 16 ) terms , interpro ( 17 ) terms and enzyme commission ( ec ) numbers ( 18 ) that support function inference . users can supply a list of sequence database identifiers , e.g. from swiss - prot , and are offered to download a list of associated systers protein family ids , extracted keywords and go terms . protein domain positions of all swiss - prot / trembl proteins as annotated in the pfam database are now integrated into systers . domain architectures of all proteins in a systers family are visualized and can easily be compared . this allows to pinpoint differences in domain architectures within the family that might indicate lineage - specific domain acquisitions or losses . we have integrated the taxonomic system as maintained by the ncbi ( 19 ) into systers and offer to visualize the distribution of protein family members over the taxonomic tree . this now allows users to select sequences of a subfamily specified by internal nodes of the taxonomic tree for further analysis . additionally , it is possible to select all systers protein families that have ( at least one / exclusively ) member protein(s ) within a user - defined taxonomic range . a special taxonomic view of a protein family focuses on the presence / absence patterns of member proteins across organisms , also known as phylogenetic profiles ( 20 ) . phylomatrix profiles are based on the representation of 106 completely sequenced organisms in systers protein families , 78 bacteria , 12 eukaryota and 16 archaea . we found 7563 different profiles for 19 374 protein families under the constraint that at least three organisms be present in a family . users can define a list of protein family ids to retrieve a set of profiles . alternatively , phylomatrix can be queried with a specific organism pattern to display profiles of matching families . the systers web server augments information on sequences and protein families by links to a multitude of data resources . in addition , systers can be queried with gene names , with accessions from the embl nucleotide database ( 21 ) or with identifiers of the specialized structure databases , such as pdb ( 22 ) , msd ( 23 ) and imb ( 24 ) . systers is embedded in the network of genomic database resources in the computational molecular biology department of the max planck institute for molecular genetics , berlin , including genenest , splicenest ( 25 ) and corg ( 26 ) . for each protein family , systers provides a comprehensive overview of its member proteins and their annotations . on the entry page , users have access to more detailed information on protein annotations , sequences , multiple alignments , phylogenetic analyses , protein domains , taxonomic distribution and gene structure - related data ( figure 1 ) . in addition to pre - calculated multiple alignments by mview ( 13 ) , the systers web server now offers multiple alignments and upgma trees generated using dialign ( 14 ) . the dialign alignment incorporates all sequences in full length , colour - coded information on alignment quality and pfam domain positions . from mview alignments we derived consensus sequences for each family . the database of consensus sequences can be queried by the user via blast ( 15 ) interface . systers provides a new wizard - like tool that allows a flexible selection of user - defined sequences . in this way subsequently , multiple alignment and upgma trees can be constructed using dialign and viewed online . the keyword list represents a succinct functional description of a family , thus helping to infer functions of hypothetical proteins . we integrated further swiss - prot / trembl annotations such as gene ontology ( 16 ) terms , interpro ( 17 ) terms and enzyme commission ( ec ) numbers ( 18 ) that support function inference . users can supply a list of sequence database identifiers , e.g. from swiss - prot , and are offered to download a list of associated systers protein family ids , extracted keywords and go terms . protein domain positions of all swiss - prot / trembl proteins as annotated in the pfam database are now integrated into systers . domain architectures of all proteins in a systers family are visualized and can easily be compared . this allows to pinpoint differences in domain architectures within the family that might indicate lineage - specific domain acquisitions or losses . we have integrated the taxonomic system as maintained by the ncbi ( 19 ) into systers and offer to visualize the distribution of protein family members over the taxonomic tree . this now allows users to select sequences of a subfamily specified by internal nodes of the taxonomic tree for further analysis . additionally , it is possible to select all systers protein families that have ( at least one / exclusively ) member protein(s ) within a user - defined taxonomic range . a special taxonomic view of a protein family focuses on the presence / absence patterns of member proteins across organisms , also known as phylogenetic profiles ( 20 ) . phylomatrix profiles are based on the representation of 106 completely sequenced organisms in systers protein families , 78 bacteria , 12 eukaryota and 16 archaea . we found 7563 different profiles for 19 374 protein families under the constraint that at least three organisms be present in a family . users can define a list of protein family ids to retrieve a set of profiles . alternatively , phylomatrix can be queried with a specific organism pattern to display profiles of matching families . the systers web server augments information on sequences and protein families by links to a multitude of data resources . in addition , systers can be queried with gene names , with accessions from the embl nucleotide database ( 21 ) or with identifiers of the specialized structure databases , such as pdb ( 22 ) , msd ( 23 ) and imb ( 24 ) . systers is embedded in the network of genomic database resources in the computational molecular biology department of the max planck institute for molecular genetics , berlin , including genenest , splicenest ( 25 ) and corg ( 26 ) . we acknowledge funding from bundesministerium fr bildung und forschung ( bmbf ) through the helmholtz network for bioinformatics ( hnb ) .

post exposure prophylaxis ( pep ) is a medical response to prevent transmission of pathogens after potential exposure and refers to comprehensive management instituted to minimize the risk of infection following potential exposure to blood - borne pathogens ( hiv , hbv , hcv ) . it includes first aid , counselling , risk assessment , relevant laboratory investigations based on the informed consent of the exposed person and source and depending on the risk assessment , the provision of short term ( 28 days ) of antiretroviral drugs , along with follow - up evaluation . healthcare personals ( hcp ) are defined as person paid/ unpaid working in healthcare settings and are potentially exposed to infectious materials such as blood , tissue , specific body fluids , medical supplies/ equipment or environmental surfaces contaminated with these substances are constantly exposed to occupational hazards through exposure of per - cutaneous injury ( needle stick or cut with sharps , contact with the mucus membrane of eyes or mouth of an infected person , contact with non - intact skin ( particularly when exposed skin is chapped , abraded , or afflicted with dermatitis or contact with blood or other potentially infectious body fluids ) . one of the most common yet dreaded hazards in healthcare facilities is the needle stick injury . of these , 100 are infected with diseases such as hepatitis b , hepatitis c , and hiv . centre for disease control ( cdc ) and national aids control organization ( naco ) recommend pep for workers with needle stick injuries . pep for hiv exposure is best when started within golden period of < 2 hours and there is little benefit after 72 hours . pep is available as either basic regimen ( 2 nucleoside reverse transcriptase inhibitor ( nrti ) ) or expanded regimen ( 2nrti and 1 pi drugs ) . naco recommend zidovudine/ stavudine + lamivudine ( basic regimen ) and zidovudine + lamivudine + lopinavir/ ritonavir ( expanded regimen ) , and make efforts to ensure its free of cost availability at all anti reteroviral therapy centers ( artcs ) and integrated counseling & testing centers ( ictcs ) . availability of limited literatures in indian context about pep usage and outcome in hiv care settings necessitated the present study.[68 ] pep record registry as per the naco guidelines is maintained at all artcs , which is coordinated by gujarat state aids control society in the prescribed format . civil hospital , ahmadabad 91 ( 32.7% ) , followed by sir t hospital , bhavnagar 60 ( 21.6% ) , pdu medical college , rajkot 31 ( 11.2% ) , ssg hospital , vadodara 28 ( 10.1% ) , new civil hospital surat 27 ( 9.71% ) , gg hospital , jamnagar 14 ( 5.03% ) , smimer , surat 7 ( 2.52% ) , mg hospital , surendranagar 6 ( 2.16% ) , vs hospital and civil hospital , junagadh each accounting for 5 ( 1.8% ) and district hospital , mahesana 4 ( 1.44% ) . till date , no hcp has approached artc at palanpur , himmatnagar , and reliance surat for pep . it is a prospective study carried over a period from october 2008 to august 2010 . any hcp in government/ private sector in occupational settings having directly/ indirectly exposed to needle stick injuries of a known/ unknown source comprised the study material . it is a prospective study carried over a period from october 2008 to august 2010 . any hcp in government/ private sector in occupational settings having directly/ indirectly exposed to needle stick injuries of a known/ unknown source comprised the study material . a total of 278 cases in hcp at various cities in gujarat were analyzed and out of them , 101 ( 36.3% ) were males and 177 ( 63.7% ) females with male to female ratio of 0.57:1 . majority ( 54.68% ) of exposed hcp comprised of staff nurse and resident doctors/ medical officers followed by laboratory technicians and nursing students ( 26.26% ) . majority of exposed hcps ( 56.8% ) came within 2 hours followed by 29.8% between 2 and 24 hours . needle stick injury was the commonest injury accounting for 75.9% of cases , with majority of them exposed to hollow bore needle ( 64.93% ) [ table 1 ] . demographic profile of healthcare personals correct information regarding the type of contact was elicited in 221 ( 79.5% ) cases . of these , 217 ( 98.2% ) had contact with blood , ( including 1 having contact with blood and vaginal secretions ) , followed by 2 cases ( 0.9% ) of contact with vaginal secretion , and 1 ( 0.5% ) each of contact with saliva and pleural fluid [ table 2 ] . exposure wise majority of them had mild exposure ( 65.1% ) , followed by moderate ( 25.9% ) and severe ( 9.0% ) cases . regarding first aid steps taken after exposure , most common response was wash the affected site with either water or soap and water ( 66.9 % ) followed by application of sprit/ alcohol/ antiseptics ( 14.7% ) and tried to squeeze the affected site ( 7.9% ) . baseline hiv status : out of 278 hcp , baseline hiv test was done in 243 ( 87.4% ) , and all were hiv non reactive ( nr ) . hiv testing is also done at 3 months , but in the study only 81 ( 43.3% ) out of 187 due for 3 months testing turned out and all were non reactive . confirmatory hiv test at 6 months could be done in 71 ( 44.9% ) out of 158 cases due for 6 monthly testing . rest 87 ( 55.06% ) cases did not turn up for follow - up at 6 months . another 120 cases are in the window period . till date , no case of hiv reactivity has been observed in this study [ table 3 ] . per cutaneous inoculation ( by needle or other instrument that pierces the skin ) carries a low risk of hiv transmission of around 0.3% ( 95% ci 0.2 to 0.5 ) ; our study also did not report any hiv case . majority of people ( 63.7% ) in this study who suffered occupational injuries were females . male : female ratio whether in plhiv or patients on art show a male dominance , whereby the male female ratio is around 2:1 . this study shows a female vulnerability in healthcare settings , which needs to be targeted through training of hcp with special emphasis on female employee ( staff nurses , technicians , and helpers ) . proportions of staff nurses ( 28.1% ) , medical officers ( 26.6% ) , and laboratory technicians ( 14.4% ) in our study were high when compared with 19% , 18% , and 10% , respectively , by baheti et al . they all being highly vulnerable for increased risk for acquiring blood borne hiv exposures in care settings in india . pep is the cost - effective measurements in low and middle income countries in hiv care settings for hcp getting exposed to infectious materials . while 120 out of 278 are still in the window period ; rest who could be tested were found non reactive . it may not be true in all cases as 25 hcp had severe exposure and for another 30 we are unsure whether they took it for required 28 days or not . the fact that majority of them ( 5557% ) do not come for repeat testing is a worrying aspect . staff still have the fear of stigmatization and afraid to know their hiv status , more so at the facility where they are working . all healthcare units should ensure to have adequate staff counselling and education about risk of infection after occupational exposure . policies and procedures should be in place and the staff should be aware about the actions to be taken in the event of occupational exposure . however , one encouraging fact was that most of the hcp ( 85% ) exposed to occupational exposure had their baseline hiv test done , all being hiv non reactive . it is important that once pep started , it should be taken for full duration of 28 days . more than 94% respondents who were prescribed the pep took it for full 28 days . detailed counselling is required in such cases for better mental preparation for post pep outcome as well . hcps should be educated to report occupational exposures immediately after the occurrence , particularly because hepatitis b vaccine and hiv - pep is most effective if administered soon after the exposure . exposed hcp of all cadres must be aware of the standard instructions for access to urgent advice of occupational exposure and the fact that hiv testing should be done at the baseline level and after the completion of the pep at interval of 3 and 6 months to confirm the hiv status of exposed hcp . equally important for the hcp is to know how to minimize the injuries and about the round the clock availability of pep , expected adverse events , and the strategies for managing them . it must be noted that pep is not cent percent effective in preventing hiv seroconversion , therefore , pep can not be considered to replace the universal precautions and avoiding occupational injuries . persons who take pep and are under follow up for 6 months should abstain from any high risk behaviour activity and not donate blood . although preventing blood exposures is the primary means of preventing occupationally acquired blood borne diseases , appropriate post - exposure management is an important element of workplace safety . the study highlights the need of standardized protocols for management of exposure to blood borne pathogens . there is a need to report , investigate and follow - up needle stick injuries . drugs for pep for hiv should be available 24 hours readily in hospitals for immediate use by hcps . this study indicates the need to reinforce knowledge regarding various aspects of occupational pep to health care personals especially those associated with nursing ( staff nurse , nursing students ) , resident doctors and laboratory technicians . another study from ahmadabad has shown that by regular sensitization and universal precaution workshops increase the awareness among hcps for reducing hiv infection risk and transmission and prevention through pep . success of entire program depends up on ( 1 ) making pep drugs available everywhere , ( 2 ) making the staff informed about avoiding injuries , following universal precautions and preparing them to take pep as and when indicated with its all associated procedures .

studies have demonstrated that deviations in skeletal components such as the cranial base , mid - facial complex and mandible may be seen in patients with class iii skeletal malocclusion.[13 ] additionally , deviations in head and neck posture can also be associated with this type of malocclusion . several of these studies have evaluated the correlation between head posture and cervical inclination.[411 ] festa and colleagues evaluated the relationship between mandibular length and cervical lordosis . this study sought to evaluate the correlation between class iii skeletal malocclusion and cervical vertebrae anomalies such as vertebral fusion altered intervertebral space and spinal deviation in the iranian population . in this case - control study , 76 subjects aged 17 - 30 yrs referred to several private clinics in tehran were selected based on the selection criteria and were divided into two groups : study group ( 30 patients with class iii malocclusion ) and controls ( 46 subjects with normal growth pattern and mild class i malocclusion ) . the inclusion criteria were as follows : no history of previous orthodontic treatment or orthognathic surgeryno underlying syndrome , respiratory disease , neuromuscular disease or temporomandibular joint disorderno wound , burns , or scarring in the head and necknormal vertical growth pattern ( y axis=61.42.9 , sn - mp=31.85.2 , mm=23.64.5 and jarabak index=62 - 65%)anb<0 for the case group and anb=31 for the control groupall patients in cervical stage 6 ( cs6 ) of cervical vertebral maturation . no history of previous orthodontic treatment or orthognathic surgery no underlying syndrome , respiratory disease , neuromuscular disease or temporomandibular joint disorder no wound , burns , or scarring in the head and neck normal vertical growth pattern ( y axis=61.42.9 , sn - mp=31.85.2 , mm=23.64.5 and jarabak index=62 - 65% ) anb<0 for the case group and anb=31 for the control group all patients in cervical stage 6 ( cs6 ) of cervical vertebral maturation . the 2 groups were matched in terms of age and sex [ table 1 ] . cervical vertebrae morphology was evaluated from lateral cephalograms . in a subject with normal cervical vertebrae , intervertebral spaces were radiolucent [ figure 1 ] . frequency distribution of patients with class iii skeletal malocclusion ( cases ) and controls based on age and sex normal cervical vertebrae as seen on a cephalogram the under study anomalies assessed included : fusion : when articular surfaces in transverse processes of the vertebrae are skeletally fused to each other [ figure 2 ] . block fusion : severe type of fusion where the intervertebral space is completely lost [ figure 3 ] . posterior arch deficiency : is the absence of cortical layer inside the posterior arch . the cortical surface inside the posterior arch of atlas is seen as a smaller than normal opacity [ figure 4 ] . fusion between c2 and c3 block fusion between the body of c2 , c3 and c4 deficient posterior arch of c1 in order to detect fusion , the distance between the articular surfaces of the vertebrae was measured . if the radiolucency between these surfaces was greater than 1 mm , the vertebra was considered normal with no fusion . if the mentioned radiolucency did not exist , the patient was considered as a case of fusion . if the articular surfaces were seen as separate opaque bony structures , the patient would be considered as a case of discontinuous fusion . for posterior arch deficiency , absence of internal cortical layer of the posterior arch owing to this absence , the internal cortical surface of the posterior arch of atlas is seen as a smaller than normal opacity . in order to minimize errors , all lateral cephalograms were controlled again 2 weeks later and then the correlation coefficient was calculated for them . t - test and fisher 's exact tests were used for the comparison of cephalometric indices related to cervical vertebrae anomalies . t - test and fisher 's exact tests were used for the comparison of cephalometric indices related to cervical vertebrae anomalies . no significant differences were detected between the two groups in terms of sex or age [ table 1 ] . a total of 23.3% of cases and 67.4% of controls had normal cervical vertebrae morphology . this difference between cases and controls was statistically significant ( p<0.001 , table 2 ) . incidence of deviations in cervical vertebrae morphology of patients with skeletal class iii malocclusion and controls incidence of fusion was 73.3% in cases and 32.6% in controls which was statistically significant ( p<0.001 ) . in the control group , fusion was only observed between c2 and c3 . in the majority of the case group , however , some cases of fusion between c3 and c4 or c4 and c5 were also detected . incidence of posterior arch deficiency was 16.7% in the case and 4.3% in the control group . the cervical vertebrae assessed were : c1 ( atlas ) : the first cervical vertebra has no body or spinous process . c2 ( axis ) : the second cervical vertebrae of the spine has an odontoid process seen as a cone - shaped process with a rounded apex . the present study showed that the incidence of cervical vertebrae anomalies was higher in patients with class iii skeletal malocclusion compared to those with normal occlusion . kjaer and sonnesen in their study conducted in 2007 in denmark on cervical column morphology in class iii malocclusion patients showed higher rates of fusion in class iii skeletal malocclusion cases ( 61.4% ) compared to those with normal occlusion ( 14.3% ) . in their study , total incidence of cervical column anomalies was higher in skeletal class iii malocclusion cases than in those with normal occlusion but incidence of posterior arch deficiency was not significantly different between the 2 groups . incidence of cervical column anomalies among the iranian population in both the study group and controls was greater than in the danish population . in the kjaer and sonnesen study , most cases of fusion were observed to be between c2and c3 ( except for 2 cases ) . in the control group all fusions were also between c2 and c3 ( 12 ) . sonnesen et al . in their study in 2007 on cervical vertebrae body fusions in patients with skeletal deep bite and controls revealed that incidence of fusion in cervical vertebrae of skeletal deep bite patients was significantly higher than in subjects with normal occlusion . incidence of posterior arch deficiency was also greater in skeletal deep bite patients when compared to normal occlusion in controls . kjaer and sonnesen in their study in 2008 , on cervical column morphology in skeletal open bite patients found that incidence of cervical vertebrae deviations was significantly higher in skeletal open bite cases compared to controls . kjaer et al . in their study in 2007 entitled cervical column morphology related to head posture , cranial base angle and condylar malformation showed that incidence of cervical anomalies was greater in skeletal malocclusion patients than in normal occlusion subjects . studies show that the notochord through its signaling induces the formation and development of body of the cervical vertebrae and basilar part of the occipital bone . via some other signals , the notochord affects the paraxial mesoderm and induces the formation of spinal curve and parts of the occipital bone.[1922 ] results from our study and similar researches highlight the need for further investigations in the fields of genetics and primary stages of fetal development for better understanding of factors influencing the formation of skeletal malocclusions . such studies may help in better recognition of phenotypic differences in patients with skeletal malocclusions especially class iii skeletal malocclusion ( which are due to different genotypes ) and their relationship to cervical anomalies . according to our study results and those of similar researches , a significant correlation exists between cervical vertebrae anomalies and skeletal malocclusions . therefore , genetic studies relevant to the formation and development of the head and neck during embryonic and fetal periods may help to better understand this correlation .

however , many cancers remain refractory to treatment and develop resistance to treatment modalities over time . despite recent therapeutic advances , such as the introduction of monoclonal antibodies and small - molecular inhibitors , treatment responses vary considerably among patients and a high relapse rate with poor prognosis continues to be a major challenge . in case of persistent or relapsed disease , few or no treatment strategies are capable of definitely eradicating residual malignant cells , necessitating therapies with greater efficacy . overwhelming evidence supports the critical role of the immune system , and lymphocytes in particular , in controlling and eradicating cancer . harnessing the immune system to achieve clinical efficacy more than two decades have passed since gross and colleagues first demonstrated the principle of genetically redirecting cytotoxic t lymphocytes to tumor cells and concluded their seminal work with the statement that chimeric t cell receptors with antitumor specificity will enable testing feasibility of this approach in combating human tumors . this study laid the foundation for the development of a series of first generation cars where a tumor targeting antibody single chain variable fragment ( scfv ) is fused directly to the signaling domain of the t cell receptor ( tcr ) signaling complex member cd3 ( figure 1 ) . despite high target - cell specific killing in vitro and encouraging preclinical efficacies in murine tumor models , clinical responses of adoptively transferred t cells expressing -folate receptor ( fr ) specific car in ovarian cancer were disappointing . the absence of efficacy was ascribed to lack of specific trafficking of the t cells to tumor and short persistence of the transferred t cells . first generation cars deliver the primary activation signal to the t cells ( signal 1 ) but the activated t cells are susceptible to anergy or activation induced cell death ( aicd ) in the absence of exogenous costimulation ( signal 2 ) and fail to persist in vivo . further , t cells were expanded ex vivo for up to 56 days with partially insufficient costimulation , a lengthy process known currently to reduce the numbers of less - differentiated cells that maintain proliferative capacity and produce a continuous source of effector progeny after adoptive transfer . years of successive and significant innovations have finally culminated in clinical studies demonstrating the tremendous potential of second generation car expressing t cells ( figure 1 ) . genetic redirection of patient t cells with cars targeting the b lymphocyte antigen cd19 has met with exceptional success in various therapy - refractory hematologic diseases ( reviewed in ) . given their remarkable activity , car t cells are expected to enter the mainstream of health care for refractory or relapsed b - cell malignancies within few years and become the game changer for similar approaches in treating other cancers , such as solid tumors . recent achievements result from novel molecular and immunological insights and provide the basis for further improvements of t cell therapies by driving consecutive developments of car design , optimization of t cell manufacturing , and incorporation of patient preconditioning and suggest novel treatment combinations . the efficacy of adoptive t cell therapy ( atc ) in human cancers was first demonstrated by the induction of molecular remission after donor lymphocyte infusion ( dli ) in myeloid malignancies relapsing following bone marrow transplantation [ 11 , 12 ] . further studies demonstrated that expanded tumor infiltrating lymphocytes ( til ) could induce complete , long - lasting regression of large vascularized metastatic melanomas [ 1315 ] . atc using epstein - barr virus- ( ebv- ) specific t cells showed clinical benefit in various ebv - associated malignancies , including hodgkin 's disease , burkitt 's lymphoma , and nasopharyngeal carcinoma [ 1618 ] . in addition , circulating tumor - reactive t cells from patient 's peripheral blood , when ex vivo expanded in sufficient quantity and administrated to the patients , showed clinical benefit . while these therapies rely on the endogenous t cell repertoires , recent technological advances in t cell engineering with retroviral and plasmid vectors allow the generation of high numbers of tumor targeting t cells by genetically introducing tumor specific t cell receptors ( tcr ) or cars ( figure 1 ) . in contrast to tcrs which recognize peptides derived from cellular proteins presented in the context of major histocompatibility complex ( mhc ) , the more universally applicable cars exhibit high - affinity mhc independent recognition of , in theory , any surface antigen , including carbohydrates and phospholipids [ 2023 ] . the number of open atc studies in cancer registered in https://clinicaltrials.gov/ is rapidly increasing ; as of december 2015 there are more than 200 protocols with the enrollment of more than 8000 patients worldwide . about 40% of the protocols address the use of car t cells ( figure 2 ) with most trials ( 85% ) being conducted in us and in china . about 65% of the studies are directed against hematological malignancies [ 26 , 27 ] . while cd19 is by far the most common antigen targeted in hematological b - cell cancers ( > 80% ) , studies are underway to investigate other target antigens such as cd20 , cd22 , cd30 , ror1 , light chain , cd123 , cd33 , cd133 , cd138 , and b - cell maturation antigen [ 2830 ] . although solid tumors were the first targets of car t cell therapies [ 2 , 31 ] , realistic clinical responses are seen in clinical studies where patients with various b - cell malignancies have been treated with cd19 car t cells . one of the first encouraging reports came from investigators at the national cancer institute ( nci ) which published a case study in 2010 where a heavily pretreated patient with follicular lymphoma experienced a dramatic partial remission ( pr ) after receiving preconditioning chemotherapy followed by infusion of t cells retrovirally transduced to express a second generation cd19 car with a cd28 costimulation domain . shortly after this breakthrough , june 's group at the university of pennsylvania ( upenn ) presented early clinical results showing impressive antileukemia efficacy of t cells transduced with a lentiviral vector carrying a cd19 car with a 4 - 1bb costimulation domain [ 33 , 34 ] . complete remissions ( cr ) were seen in two of the three treated patients with end - stage advanced chronic lymphocytic leukemias ( cll ) and a partial response in the third patient . the results after complete enrollment of the trial were recently published and reported an overall response rate of 57% with 4 out of 14 treated patients in cr and 4 prs . importantly , the study demonstrated that the sustained capability of the car t cells to expand in vivo correlated with clinical responses . furthermore , car t cells persisted and remained functional beyond 4 years in the first two patients achieving cr , with no relapse . cd19 car t cell function and engraftment might be improved further when combined with ibrutinib , which is a small - molecular inhibitor of the enzyme bruton 's tyrosine kinase ( btk ) associated with increased b - cell activation and proliferation . the far most remarkable responses with cd19 redirected t cells have been reported by groups at upenn , memorial sloan kettering cancer center ( mskcc ) , and nci in patients with resistant or relapsed acute lymphoblastic leukemia ( all ) with cr rates ranging from 70 to 90% in approximately 65 patients among the three trials , combined [ 3739 ] . more recently , investigators at great ormond street hospital and university college london institute of child health 's treated a 1-year - old girl with all who had relapsed shortly after bone marrow transplantation ( bmt ) with off - the - shelf banked cd19 car redirected allogeneic t cells derived from a healthy donor ( ucart19 ) . while the treatment resulted in cytogenetic and molecular remission of her leukemia , a second bmt given 3 months after the t cell injection precludes the interpretation of the long - term efficacy of the ucart19 therapy . the infused allogeneic car expressing t cells were gene edited by nucleases to disrupt expression of the endogenous tcrs to avoid alloreactivity . studies have clearly demonstrated that allogeneic car t cells can not only induce tumor regression but also drive gvhd [ 42 , 43 ] and the ucart19 strategy is therefore critically dependent on high tcr knockdown efficacy or efficient depletion of tcr expressing t cells prior to infusion . of interest is also a case report of a multiple myeloma patient in cr after cd19 car t cell therapy despite lack of detectable cd19 expression in 99.95% of the patient 's neoplastic plasma cells . the response is hypothesized to be caused either by elimination of a small population of cd19 expressing myeloma stem cells or by elimination of cd19 expressing cells that play a critical role in sustaining the growth of the myeloma cells . encouraging clinical results have also been obtained in patients with various chemotherapy refractory b - cell lymphomas , including cr in four out of seven evaluable patients with diffuse large b - cell lymphoma ( dlbcl ) after infusion of cd19 car t cells . by contrast , it has been difficult to see the clinical efficacy of car t cells in nonhematological , solid tumors . by targeting the disialoganglioside gd2 expressed on neuroblastoma with car t cells , investigators at baylor college of medicine report some clinical benefit with cr in three of eleven patients with active disease . among open clinical protocols for solid tumors , cars targeting mesothelin , which is overexpressed in a wide range of solid tumors , human epidermal growth factor receptor family members ( her2/erbb2 and her1/egfr ) overexpressed in breast , ovarian , bladder , salivary gland , endometrial , pancreatic , and non - small - cell lung cancer ( nsclc ) [ 4851 ] , and neuroblastoma associated gd2 antigens dominate . however , increasing number of targets is being investigated in clinical trials , such as muc1 and carcinoembryonic antigen ( cea ) overexpressed in various carcinomas , fibroblast activation protein ( fap ) targeting cancer associated fibroblasts in the tumor stroma , and vascular endothelial growth factor receptor 2 ( vegfr2 ) overexpressed in tumor vasculature [ 23 , 5357 ] . many known and numerous yet unidentified factors are likely to contribute to the variability observed in clinical responses across trials and also between individual patients . despite the fact that differences in clinical protocols preclude direct comparisons , clinical data collectively point at t cell expansion and persistence after adoptive transfer as key critical factors for achieving an effective clearance of the cancer . the in vivo fate of the t cells is influenced by several factors broadly related to the car design , the composition of the infused t cells , the tumor type and microenvironment , and recipient preconditioning regimen . savoldo and colleagues elegantly demonstrated the significance of introducing costimulatory domains into second generation cars by treating six lymphoma patients with a mixture of first and second generation car t cells , providing evidence for the enhanced persistence of t cells expressing the latter car configuration . most second generation cars studied in clinical trials incorporate cd28 or 4 - 1bb signaling domains and preclinical and emerging clinical experience suggest that cd28 containing constructs undergo a more rapid expansion and subsequently decline , whereas 4 - 1bb cars confer longer persistence [ 10 , 59 ] . third generation cars incorporating cd28 - 4 - 1bb or cd28-ox40 in combination have demonstrated sustained activation of t cells [ 6064 ] but their effectiveness remains to be evaluated in clinical trials . a clinical study utilizing a cd20-redirected third generation cd28 - 4 - 1bb - cd3 signaling car did not show dramatic responses . zhao and colleagues recently demonstrated superior efficiency of combining cd28 and 4 - 1bb signaling in a novel receptor configuration that provides cd28 costimulation through the endodomain in the car and 4 - 1bb costimulation by expression of the 4 - 1bb ligand , which is coexpressed at the cell surface with the car . the in vivo proliferative capacity depends further on the composition of the t cells in the infused product . long - term persistence and function are provided by central memory phenotype t cells that retain longer telomeres and higher proliferation compared to the more differentiated effector t cell populations [ 4 , 66 , 67 ] . most clinical trials performed today utilize unselected , ex vivo expanded t cells obtained from patient peripheral blood mononuclear cells ( pbmc ) . the use of paramagnetic beads covalently conjugated with agonistic cd3 and cd28 antibodies , such as cts dynabeads cd3/cd28 , in combination with the cts dynamag magnet adapted for culture bags , has been successfully implemented in the clinic as they allow for simultaneous isolation and activation of t cells from the pbmc [ 7 , 68 ] ( figure 3 ) . short duration , in general around 10 days , of the ex vivo expansion results in a final t cell drug consisting of both cd4 and cd8 t cells displaying early memory phenotypes with the ability to expand in the blood of patients and generate long - term memory . more recently , methods to isolate defined t cell subset under good manufacturing ( gmp ) conditions have been developed with the aim to better control the phenotype of the transferred t cells . in a murine tumor model of lymphoma they demonstrated superior efficiency using a car t cell formulation consisting of cd4 t cells derived from the nave cd4 t cell pool with cd8 t cells derived from central memory cd8 t cells at a 1 : 1 ratio , compared to unselected batch t cells and cd8 or cd4 cells alone . memory stem t cells [ 71 , 72 ] , icos costimulated th17-polarized t cells [ 7376 ] , and virus specific memory t cells [ 7779 ] have also attracted interest as effective t cell populations with great replicative potential . one factor that has been shown to impact t cell engraftment and proliferation is the use of lymphodepletion chemotherapy in patients prior to t cell infusion [ 14 , 80 ] . this preconditioning creates space for the expansion of infused cells , limits the competition for homeostatic gamma chain cytokines il-7 and il-15 , depletes regulatory t cells , and activates the innate immune system . finally , relapse with cd19 negative tumor cells after car t cell therapy remains a challenge . single - target therapy may select for and lead to escape of the variants and targeting multiple antigens on tumors would increase the chances of therapeutic efficiency . combination of cars with different specificities , or the use of bispecific tandem cars , which join two antigen - recognition moieties , may prevent relapses due to escape of variants but require further studies . while solid tumors have proven largely refractory to t cell therapy , encouraging preclinical and clinical data support further development . solid tumors are challenging ; their microenvironment is extremely inhospitable and induces t cell anergy . technological advances required to enhance car t cell function and survival in solid tumors include strategies to increase t cell trafficking , t cell resistance to the immunosuppressive environment , and recruitment of other immune effectors ( reviewed in [ 8486 ] ) . t cells must survive and overcome an environment characterized by oxidative stress and hypoxia , the presence of suppressive immune cells and factors , and t cell intrinsic negative regulatory mechanisms including upregulation of inhibitory receptors . trucks ( t cells redirected for universal cytokine - mediated killing ) and armored cars that express cytokines and chemokine receptors and recently also modified to coexpress catalase to protect the t cells from oxidative stress - mediated repression and heparanase to improve t cell penetration through tumor stroma and enhance infiltration [ 8790 ] . combination of atc with checkpoint inhibitor blockade using antagonistic antibodies against the negative regulators ctla-4 and pd-1/pd1-l has also been suggested , and it has been demonstrated that the specific blockade of the pd-1 immunosuppressive pathway significantly enhanced the function of her2 redirected car expressing t cells leading to enhanced tumor eradication in immune competent her2 transgenic mice . recently , studies have also demonstrated promising potential of t cells gene modified with fusion receptors comprising the extracellular domain of pd-1 linked to the cytoplasmic domain of cd28 in reversing inhibitory effects of pd-1 binding [ 92 , 93 ] . given the extreme potency of car modified t cells , the use of this therapy has significant toxic potential [ 9496 ] . toxicities range from life threatening cytokine release syndromes ( crs ) and macrophage activation syndromes ( mas ) to on - target off - tumor toxicity , neurotoxicity , and tumor lysis syndrome ( tls ) . crs and neurotoxicity appear to be frequent in b - cell malignancies but are in most cases treatable and reversible [ 38 , 97 ] . crs is associated with high circulating levels of several cytokines , including interleukin-6 ( il-6 ) and interferon- , and seems to correlate with high antitumor activity and high tumor burden . crs is frequently accompanied by mas , which may partly be driven by elevated levels of il-6 . both crs and mas can be mitigated by infusion of the monoclonal antibody tocilizumab which blocks the action of il-6 and reduces inflammation . the mechanisms underlying the neurologic symptoms including aphasia , tremor and seizures remain poorly understood ; however , it has been reported that mas can be associated with neurological toxicity . on - target off - tumor toxicity of car modified t cells was first reported in a phase i clinical trial of renal cell carcinoma patients treated with t cells expressing a car recognizing carbonic anhydrase ix ( caix ) . here , several patients experienced significant liver toxicity due to the expression of caix on normal bile duct epithelium , necessitating cessation of treatment . the first fatal adverse event due to off - tumor recognition by a car occurred in a patient with colorectal cancer treated with high numbers of t cells expressing a third generation car targeting erbb2/her2 . the patient developed respiratory distress and cardiac arrests shortly after the t cell transfer and died of multisystem organ failure 5 days later . it was postulated that the car t cells recognized erbb2 expressed at low levels in the lung epithelium , leading to pulmonary toxicity and a cascading cytokine storm with a fatal outcome . predicted on - target off - tumor toxicity with depletion of normal b - cells has been reported in nearly all patients treated with cd19 car t cells , and depending on the car configuration , b - cell aplasia lasts from months to years [ 35 , 39 ] . to mitigate this toxicity , patients receive monthly immunoglobulin replacement ; however , long - term follow - up is needed to assess the late effects of b - cell aplasia . because few cars are truly tumor specific but recognize both normal and malignant cells , strategies to improve specificity are warranted . affinity - tuned cars based on low - affinity scfv recognition have been demonstrated to increase tumor specificity for targets that are overexpressed compared to normal tissues expressing the same target at physiological levels . one strategy is based on t cells modified with two different cars , where car number one provides the cd3 signal and initiates killing , whereas car number two transmits the costimulation signal [ 100102 ] . full car t cell activation and function are only achieved when the t cell is engaged by both car antigens . moreover , inhibitory cars ( icars ) that harness natural t cell inhibition exerted by pd-1 and ctla-4 have been demonstrated to protect normal tissue from off - target effects in preclinical mouse models . the inhibitory function of the icar t cell is a result of checkpoint inhibition initiated in response to an antigen found on normal tissue but not on the tumor . other approaches are based on switchable cars ( scar ) and multichain cars ( mccars ) that are activated only in the presence of intermediate switch molecules [ 104 , 105 ] . while the scar design is based on coinfusion of antibody - based switch molecules bridging the target cell and the scar expressing t cell , mccars are fully activated only in the presence of the small - molecule drug , such as rapamycin . the switch approach has been used to achieve reversible control of scar t cell activity in immunocompetent mouse model of cd19 targeting . the scars principle further allows for simultaneous targeting of several tumor antigens simply by infusion of switch molecules conferring two or more specificities , for example , cd19 and cd22 . the severity of chronic toxicities can be mitigated by introducing suicide genes in the vector used for car gene transfer [ 107109 ] or allow surface coexpression of binding epitopes for depleting antibodies already in clinical use , for example , egfr and cd20 [ 110 , 111 ] . other approaches rely on the use of self - limiting , transiently expressed cars [ 56 , 112 , 113 ] or administration of blocking antibodies and steroids . finally , integrating vectors used to facilitate the car gene transfer into t cells might constitute a safety risk in the clinical setting as it raises the theoretical possibility of insertional mutagenesis as demonstrated in stem cell gene therapy studies in primary immunodeficiencies . despite the fact that numerous studies with more than 500 patient - year follow - up have demonstrated the safety of retroviral gene transfer into mature t cells [ 116 , 117 ] , it is too early to conclude that integration is safe in a larger patient population and effective strategies are needed to eliminate gene modified t cells . the adoptive transfer of gene modified t cells is a rapidly evolving innovative treatment for cancer . car redirected t cells are renewable drugs with the capacity to proliferate in the patient after infusion and further to persist and provide sustained functional immunity . the efficacy has been demonstrated in a range of hematological cancers including all , cll , dlbcl , fl , and multiple myeloma and further by some encouraging clinical data reported in early phase i trials in solid tumors , including neuroblastoma , and tumors overexpressing mesothelin , her2 , and egfr [ 46 , 50 , 51 , 56 ] . the clinical successes with cd19 car t cells in leukemia and lymphomas have boosted the field and led to significant pharmaceutical and venture capital funding of the biotech sector , as well as promoting innovative academic - industrial partnerships to explore new discoveries in basic research that may translate into clinical and commercial development . this rapidly developing field meets with considerable challenges which have to be addressed to realize the promise of the car t cell therapy for a broader use . while car t cell therapies have provided encouraging preliminary signs of efficacy in solid tumors , clinical data so far fail by a large margin to meet expectations for game - changing cell therapy . a major focus of translational research is to improve specificity , efficacy , and safety of car t cells to be used in cancers beyond leukemia . truly tumor specific surface antigens are hardly identified , and the implementation of effective mechanisms to mitigate life threatening and unexpected off - target toxicities is crucial . further , issues regarding tumor heterogeneity , tumor immunosuppression , and lack of t cell trafficking and persistence are being addressed to improve efficacy of solid tumor therapy . combining t cell therapies with immunomodulatory agents , for example , checkpoint inhibitors and cytokines , and/or small - molecular antagonists that block biochemical pathways crucial for tumor growth , constitute exciting opportunities that may have synergistic effects in augmenting antitumor responses . pilot - scale processes for car t cell generation were originally developed in academic centers for early phase i clinical research , requiring small numbers of t cell products . these processes are based on manual and open - handling steps in safety cabinets and are not suited for commercial manufacturing of thousands of therapeutic t cell doses needed for a future approved therapy . industrialized t cell processing can only be achieved with significant investments in automation and the establishment of a fully closed process . current industrial commercialization strategies are based on centralized t cell manufacturing facilities and a coordinated infrastructure to provide cost - effective cell - drug distribution . an alternative strategy is based on a decentralized model where t cell manufacturing is performed within the treatment centers . whether a centralized car t cell manufacturing will be more cost - efficient than utilizing the existing infrastructure ( equipment , facilities , and competencies ) in blood banks and clinics depends largely on successful process automation as well as on economics of scale and on the other hand on the regulatory approach of the developing companies . improvements in gene modification , t cell selection , and expansion techniques , as well as the development of safe and more effective viral and nonviral vectors , will further enhance the integration of t cell gene therapies . finally , to overcome the constraints associated with complicated logistics and manufacturing of the individualized t cell therapy in the autologous setting , significant efforts are under way to develop universal and off - the - shelf , allogeneic t cell drugs . while off - the - shelf t cells might allow more efficient manufacturing and reduce lead time for the administration of the t cell drug , there are some concerns regarding their use , including their potential to drive gvhd and their limited life span after transfer .

in complete denture prosthetics , there are four fundamental requirements that every satisfactory denture should fulfill . they are esthetics , phonetics , mastication and comfort.1 these requirements are achieved by applying proper techniques in complete denture construction . thus , the correct determinations of the artificial occlusal plane in the upper occlusal rim during jaw registration procedures play a vital role in achieving this objective . the proper height and width of the occlusal plane is essential for the adequate buccolingual exchange and control of food , speech articulation contacts , tongue space , esthetics and buccal soft tissue support . the occlusal table is a milling surface and strategically placed so that the tongue on the lingual side and the buccinator muscle on the buccal side are able to position the food bolus on to it and hold it in place while mastication takes place . faulty orientation of the occlusal plane will jeopardize this interaction between tongue and buccinator muscle . if the occlusal table is too high , it will cause food collection in the sulci . if it is too low it will result in biting of the cheek or tongue.2 occlusal plane should be oriented in such a way as to leave enough space for the tongue , as it plays a major role in speech . the posterior level of the occlusal plane is important for mandibular function and maintenance of the temporomandibular joint . there is a strong clinical indication that tmj problems occur when the posterior position of the occlusal plane is farthest from center of the ramus.3 boucher4 states that the teeth must be placed in exactly the same position as the natural teeth , which they are to replace . it is generally agreed that in the anterior region , the vertical height of the occlusal plane is governed by esthetics and less frequently by functional requirement . on the other hand , there are contrasting views in regard to the orientation of the occlusal plane in posterior region.5 many investigations have been carried out to study its orientation and various conflicting reports published . a common concept is that the occlusal plane should be parallel to a line drawn from the lowest point of ala of the nose to the external auditory meatus or tragus . this line is known as the camper 's line after petrus camper , a dutch anatomist,6 who in 1786 located on skulls and living heads a line passing from the " ala of nose to the center of the external auditory meatus " . reliance upon this line is based upon a considerable number of years of clinical observation . some dentists position the occlusal plane parallel to and mid way between the residual ridges.4,7,8 still other dentists recommend placing the occlusal plane so that it terminates posteriorly at the medial 2/3 of the retromolar pad.4,7,9 thus , the differences of opinion exist today regarding the most appropriate location of the occlusal plane and its relation to the camper 's plane . thus the aim of this study is to , to determine accurately the part of the tragus to be used to form the ala - tragal line or camper 's line in orthog - nathic profile patients.to establish the relation between the ala - tragal line and the occlusal plane in orthognathic profile patients . to determine accurately the part of the tragus to be used to form the ala - tragal line or camper 's line in orthog - nathic profile patients . to establish the relation between the ala - tragal line and the occlusal plane in orthognathic profile patients different workers have used different methods to determine the occlusal plane and the ala - tragal line . in this study photography was used to determine the occlusal plane in dentulous patients with orthognathic profile . to fulfill the objective of this study and simplify the procedures , well - established landmarks , terminology and equipment have been used . landmarks used for this study ( fig . 1 ) are described briefly below : orbitale ( o ) : the lowest point on the inferior border of bony orbit.tragion ( t1 ) : the rounded eminence anterior to external auditory meatus , the superior border of which is approximately on the level with the superior margin of tragus.t2 : the middle of tragus.t3 : the inferior margin of tragus.gnathion ( gn ) : the lowest and most anterior point of the body of the mandible.nasion ( n ) : the deepest point of the bridge of the nose.subnasion ( sn ) : point of junction between the nasal septum and the upper lip.ala : the lowest point of the ala of the nose.eye-ear plane ( eep ) : the plane passing through the orbital points and the tragion ; comparable to the frankfort plane.orbital plane ( o - plane ) : a plane passing through the orbital point ( o ) at right angles with eye- ear plane.nasion line ( nl ) : a line dropped from the nasion ( n ) that runs parallel to the orbital plane ( o - plane).occlusal plane ( op ) : a plane through the incisal edges of the upper first incisors and the cusps of the upper first molars . orbitale ( o ) : the lowest point on the inferior border of bony orbit . tragion ( t1 ) : the rounded eminence anterior to external auditory meatus , the superior border of which is approximately on the level with the superior margin of tragus . gnathion ( gn ) : the lowest and most anterior point of the body of the mandible . nasion ( n ) : the deepest point of the bridge of the nose . subnasion ( sn ) : point of junction between the nasal septum and the upper lip . eye - ear plane ( eep ) : the plane passing through the orbital points and the tragion ; comparable to the frankfort plane . orbital plane ( o - plane ) : a plane passing through the orbital point ( o ) at right angles with eye- ear plane . nasion line ( nl ) : a line dropped from the nasion ( n ) that runs parallel to the orbital plane ( o - plane ) . occlusal plane ( op ) : a plane through the incisal edges of the upper first incisors and the cusps of the upper first molars . simon 's classification10 of maxillomandibular relations based on anthropometric landmarks was used to analyze facial profile from a structural standpoint . this classification is of value to prosthodontist because the landmarks are situated outside the area of changes , which occur following the extraction of natural teeth . the simon 's classification in sagittal view is measured from the orbital plane and is divided into the protraction type - where the part of the jaw is too far forward and retraction type - where the part of the jaw is two far posterior . to determine the deviation of the maxillae , the nasion line ( nl ) is of great importance . the normal type , as proposed by simon is a straight or flat type in which the orbital plane passes through the cheilion ( corner of the mouth ) and gnathion ( fig . the subnasion lies between the orbital plane and nasion line , or coincides with the nasion line . in this study this study was conducted on subjects who were out patients and students of manipal college of dental sciences , manipal . a total of 150 indian subjects within the age group of 18 - 40 years were selected for the study . selection criterias were as follows : straight or orthognathic profile.no previous history of orthodontic treatment.no congenitally missing or extracted teeth.subjects had complete dentition without crowns , fixed or removable partial dentures or supernumerary teeth or retained teeth.no deciduous teeth.subjects had regular alignment of teeth without any supra - eruption or drifting i.e. well formed occlusion.no congenital or acquired defects in the head region.absence of advanced periodontal diseases and associated tooth mobility.exclusion of tmj disorder if any.a minimum of conservative treatment and that too not in incisors and molars . straight or orthognathic profile . subjects had complete dentition without crowns , fixed or removable partial dentures or supernumerary teeth or retained teeth . subjects had regular alignment of teeth without any supra - eruption or drifting i.e. well formed occlusion . the objectives and method of obtaining the photographs were explained to each subject and an informed consent was obtained from them . in this study , a sony digital camera model no . p200 with 3 optical zoom was used which stores the photographs digitally that can be later transferred to the computer . the camera has resolution of 7.2 mega pixels , which is more than adequate for computer analysis . the in - built zoom lens with an auto focus range to infinity ensured that the image were of high quality . the arms and adjustable plates of the tripod stand were set so that camera was parallel to the horizontal . an adhesive strip , 1 mm wide and 12 mm long was placed horizontally on the face , with its mesial end coinciding with the right orbital point . a modified trubyte occlusal plane plate ( fox bite plane ) was placed in the mouth in such a position that it touched the incisal edges of the first upper incisors , and the cusps of the left and right upper first molar . the plane was thus located in a position that is the equivalent of the occlusal plane of orientation used in the construction of complete dentures . the outer wings of the plate indicate the position of the occlusal plane and these are readily seen in the photograph . the dots on superior , middle and inferior margins of the right tragus and lower point of ala of nose were directly placed on the photo in computer ( fig . 2 ) . each subject was asked to stand one meter away from the mirror . photographs were taken with the subject standing and in their natural head position.11,12 walking slightly on the spot and tilting the head backward and forward with decreasing amplitude , before standing still , helped the subject assume the natural head position . to prevent the subjects from swaying , it was found necessary to also define the feet position as " a comfortable distance apart and slightly diverging " . the subject was then requested to look into the reflection of their eyes in the mirror ( fig . a plumb line was suspended in front of the subject , which was used to " bisect " the facial reflection and to minimize lateral head rotations ( fig . the perpendicular distance between the subject 's sagittal plane and photographic film was 1.5 meters . a life - size lateral digital photograph of the face with fox bite plane in mouth and adhesive strip with mesial end on right orbital point and patient holding the fox plane in position by pressure from the opposing teeth was taken . the following points were then digitized on all the photographs on the computer ( fig . 2 ) : the superior margin of the tragus ( t1)the middle margin of the tragus ( t2)the lower margin of the tragus ( t3)lowest part of the ala ( a ) of nose . the superior margin of the tragus ( t1 ) the middle margin of the tragus ( t2 ) the lower margin of the tragus ( t3 ) lowest part of the ala ( a ) of nose . 4 ) : the eye - ear plane ( eep ) was marked as a line connecting the orbital point ( o ) ( the strip ) to tragion , rounded eminence anterior to external auditory meatus , superior border of which is approximately on the level with superior margin of the tragus ( t1 ) i.e. ot1 . it is comparable to the frankfort plane.camper's plane or the ala - tragus line is a line drawn from the lowest part of the ala ( a ) to the tragus . three points on the tragus were marked and three lines were drawn accordingly i.e. - from ala ( a ) to upper margin of tragus ( t1 ) i.e. at1- from ala ( a ) to middle margin of tragus ( t2 ) i.e. at2- from ala ( a ) to lower margin of tragus ( t3 ) i.e. at3 a line is drawn extending from the outer wing of fox plane , which is comparable to occlusal plane i.e. op . 4).between eye - ear plane ( ot1 ) and occlusal plane ( op ) i.e. ot1-opbetween eye - ear plane ( ot1 ) and ala - upper border of tragus ( at1 ) i.e. ot1-at1between eye - ear plane ( ot1 ) and ala - middle border of tragus ( at2 ) i.e. ot1-at2between eye - ear plane ( ot1 ) and ala - lower border of tragus ( at3 ) i.e. ot1-at3 the eye - ear plane ( eep ) was marked as a line connecting the orbital point ( o ) ( the strip ) to tragion , rounded eminence anterior to external auditory meatus , superior border of which is approximately on the level with superior margin of the tragus ( t1 ) i.e. ot1 . camper 's plane or the ala - tragus line is a line drawn from the lowest part of the ala ( a ) to the tragus . three points on the tragus were marked and three lines were drawn accordingly i.e. - from ala ( a ) to upper margin of tragus ( t1 ) i.e. at1- from ala ( a ) to middle margin of tragus ( t2 ) i.e. at2- from ala ( a ) to lower margin of tragus ( t3 ) i.e. at3 - from ala ( a ) to upper margin of tragus ( t1 ) i.e. at1 - from ala ( a ) to middle margin of tragus ( t2 ) i.e. at2 - from ala ( a ) to lower margin of tragus ( t3 ) i.e. at3 a line is drawn extending from the outer wing of fox plane , which is comparable to occlusal plane i.e. op . occlusal plane ( op ) i.e. ot1-op between eye - ear plane ( ot1 ) and ala - upper border of tragus ( at1 ) i.e. ot1-at1 between eye - ear plane ( ot1 ) and ala - middle border of tragus ( at2 ) i.e. ot1-at2 between eye - ear plane ( ot1 ) and ala - lower border of tragus ( at3 ) i.e. ot1-at3 of the three angles formed by the eye - ear plane ( ot1 ) and the ala - tragal lines , the one closest to the angle formed between eye - ear plane ( ot1 ) and occlusal plane ( op ) was used to determine the occlusal plane of orientation . the above points were digitized two times and the averages of the two readings were calculated . comparison among the groups was done by anova ( analysis of variance ) fisher ' f ' test . the correlation between the groups was found out by using karal pearson coefficient of correlation test . p value was used to find out level of statistically significance where p<.05-significant , p<.01-highly significant and p<.001-very highly significant . table 1 shows that mean of base line angle i.e. ot1-op was found to be close to ot1-at2 angle and ot1-at3 angle but the ot1-op angle was found to be more closer to ot1-at3 angle . table 2 shows that there was very highly significant ( vhs ) difference ( p<.001 ) between the values but it is found that mean difference between ot1-op and ot1-at3 was least among the others , which is 1.6484 and the correlation value ( ' r ' ) was more between ot1-op and ot1-at3 . table 3 shows the frequency and percentage of three angles coming closer to ot1-op angle and it was found that ot1-at3 had highest percentage . it was found that angle ot1-op in both males and females is close to angle ot1-at3 . this study is a photographic evaluation of the border of the tragus to be used to form ala - tragal line in orthognathic dentate subjects . the photographic technique used in this study is non - invasive and simple and the entire technique was standardized . the subject - to - camera distance ( 1.5 m ) was set at approximately 10 times the maximum breadth of the subject ( approximately 15 cm from ear to nose ) reduces photographic distortion to less than 1%.13 with respect to the angular measurements from 2-dimensional image of a 3-dimensional object , 3 types of errors may arise.,14 namely ; errors of projection , mechanical errors in drawing lines between points and errors of land mark location . projection error is reduced by the use of angular measurements because the values of angular measurement remain constant regardless of the enlargement factor . errors introduced in drawing and measuring lengths and angles by hand can easily be eliminated by machine computation , as done in this study , provided that the reproducibility of digitization of individual points is high . precise positioning of the subject , especially with no external device is very difficult , resulting in a situation in which the true anatomic mid - sagittal plane coincides with the nominal mid sagittal plane at the focusing plane only rarely and by chance . to minimize this error , in the study , a plumb line was suspended in front of the mirror that was used to bisect the facial refection and to minimize lateral head rotations . the points that have to be digitized on the photographs are clearly defined to minimize the intraexaminer location error . photographs were taken with the subjects positioned in the natural head posture ( nhp ) . nhp is a logical orientation adopted for assessing facial profile as it relates to the patient 's head posture in daily life . subjects ' natural posture was used as against a cephalostat to position the patients , as insertion of ear posts could itself be argued as positioning the subject unnaturally . sutcher & eliasson had concluded that insertion of ear posts altered the position of the condyle within the fossa and perhaps this could result in proprioceptive feedback altering the action of the muscles maintaining head posture.15 the eye - ear plane ( eep ) i.e. ot1 which is comparable to frankfort horizontal plane ( fh plane ) is taken as a standard reference plane as it is ( fh plane ) stable and is not affected by tooth loss . also it is universally accepted as a fixed cranial plane.16 the subjects were selected between the age group of 18 - 40 years . by 18 years growth of the face ceases and there is no change in the relationship of camper 's plane to the occlusal plane . the upper age limit was restricted to 40 years as at this age a dentition can be expected to remain normal without tooth loss and excessive attrition . for the ease of the comparison of the angulations , only orthognathic subjects were selected in this study.10 the angulation of the occlusal plane to the fh plane ( ot1 ) is known as " ca nt of the occlusal plane " and was first enunciated by downs.17 the mean ca nt of the occlusal plane ( ot1-op ) as determined in this study is 11.96 , which is comparable to the study done by hartono18 who in case of normal type found to be 12. table - i shows that mean angle of ot1-at3 ( 10.3167 ) is close to mean angle of ot1-op ( 11.9651 ) i.e. the angle formed between fh plane and occlusal plane is closer to the angle between fh plane and ala - lower border of the tragus . this means that the occlusal plane is more parallel to the line drawn from the ala to the lower border of the tragus . this is in accordance with the studies done by clapp6 ( 1910 ) , dalby6 ( 1912 ) , wilson6 ( 1917 ) , hartono18 ( 1967 ) , van niekerk19 ( 1985 ) and karkazis and polyzois5,20 ( 1986 ) . they found out that the occlusal plane is parallel to the line drawn from the lowest point of the ala of the nose to the lower border of the tragus . the occlusal plane , as established by tooth arrangement should be located according to mechanical requirement for stability of denture and preservation of the supporting structures . it has been found ( nagle and sears8 - 1962 & swenson21 - 1947 ) in case of excessive resorption , the plane should be placed closer to the resorbed ridge to reduce the leverage . it should be perpendicular to the forces of mastication and should be developed parallel to the lower ridge . as the occlusal plane is parallel to the lower border of the tragus than the middle and superior borders the forces of mastication will be perpendicular to the occlusal plane and there will be less leverage on the lower residual ridge which is most commonly involved in resorption process ( jacobson and karol6 - 1983 ) and results in denture stability . the occlusal plane placed high in relation to lower ridge result in additional leverage and denture instability ( mcgee22 - 1960 ) . in this study comparison between angles ot1-op ( fh plane and occlusal plane ) and ot1-at3 ( fh plane and ala to lower border of tragus ) which is 1.6484 , found to be close to the comparison between angles ot1-op and ot1-at2 ( i.e. between fh - plane and occlusal plane angle and fh - plane and ala - to middle border of tragus angle ) 1.7093 ( table 1 ) . in the subjects with short tragus there was not much distance between lower and middle border of the tragus thus making both the lower and middle border almost parallel to occlusal plane . it was found that out of the 26% subjects showing occlusal plane parallel to line connecting ala to the middle of the tragus , in comparison 16% of the subjects had small tragus with very small distance between middle and lower border of tragus . thus , these 16% subjects can also be included in subjects showing occlusal plane parallel to the line joining the ala to the lower border of tragus . it is found that there is no influence of the sex on the level of occlusal plane i.e. both males and females showed the occlusal plane parallel to the line joining the ala to the lower border of tragus . in this study it was found that in 20.7% of the subjects ' upper border of the tragus is parallel to the occlusal plane , in 26% the middle border of the tragus and in 53.3% the lower border of the tragus ( table 3 ) . this might be due to the anteroposterior dimensions of the maxillary base , which governs angulation of the occlusal plane . the greater the distance between ans ( anterior nasal spine ) and the hamular notch i.e. wider anterior cranial base , the more acute the angulation of the occlusal plane and conversely , the smaller the distance the more obtuse the angle will be . this is given by sloane and cook.23 this tendency has been confirmed by the cephalometric studies of l ' estrange and vig24 and represents a phenomenon that may be explained by the " denture glass effect " . it might also be due to the fact the steepness of the curvature of occlusal plane varies in different individuals and frequently a noticeable difference may be observed in the plane on the two sides of the arch in the same individual.25 as the prosthodontic intervention imposes most of its influence of the denture stability , due importance must be given in analyzing the occlusal plane level , which is the main contributing factor in denture stability . the position of the occlusal plane of orientation also forms the basis for ideal tooth arrangement and fulfills the necessary mechanical , esthetic and phonetic requirements and aid respiration and deglutition . standard facial measurements are essential for establishing the level of occlusal plane . however , occlusal plane level analysis data apply to the ethnic group from which they are obtained . data from one ethnic group may be misleading when applied to other ethnic group as different racial groups have different facial characteristics . therefore , care must be taken when the norms found in standard textbooks are applied to non - caucasian racial groups . following conclusions were drawn from this study , the line joining from ala to the lower border of the tragus was parallel to the occlusal plane in 53.3% of the subjects . in 26% occlusal plane was parallel to the ala to middle border of tragus and in 20.7% occlusal plane was parallel to the ala to upper border of tragus.there was no influence of the sex on the level of occlusal plane i.e. both males and females showed the occlusal plane parallel to the line joining the ala to the lower border of tragus.in subjects with small tragus either middle or lower border of the tragus may be used to determine the level of occlusal plane . the line joining from ala to the lower border of the tragus was parallel to the occlusal plane in 53.3% of the subjects . in 26% occlusal plane was parallel to the ala to middle border of tragus and in 20.7% occlusal plane was parallel to the ala to upper border of tragus . there was no influence of the sex on the level of occlusal plane i.e. both males and females showed the occlusal plane parallel to the line joining the ala to the lower border of tragus . in subjects with small tragus either middle or lower border of the tragus

as rising health care costs become an area of increasing focus , length of stay ( los ) after routine surgical procedures has become an important consideration . with over $ 1.5 billion dollars spent each year on the surgical management of lumbar stenosis alone,1 the identification of factors that affect the associated health care costs could have an outsized impact on the field . preoperative anemia has been shown to be a significant risk factor for mortality and morbidity in a wide variety of surgical procedures,2 3 and it has been shown to have an effect on los in the colorectal and urologic surgery populations.4 5 none of the studies that have included preoperative anemia among the factors identified as predictors of los in lumbar spine surgery in the past have investigated this factor specifically across multiple procedure types.6 7 to better understand the impact of preoperative anemia in this patient population , we examined the effect of low hematocrit ( hct ) on los in patients undergoing spinal procedures for lumbar stenosis , symptomatic and recurrent lumbar disk herniation , lumbar spondylolisthesis , and lumbar adjacent segment disease . after obtaining institutional review board approval , we retrospectively reviewed the medical records of patients enrolled in a national quality registry ( the national neurosurgery quality and outcomes database ) who underwent routine lumbar spinal procedures at our tertiary care center from november 2012 through september 2013 . patients with the diagnosis of lumbar stenosis , symptomatic lumbar disk herniation , lumbar spondylolisthesis , lumbar adjacent segment disease , or symptomatic recurrent lumbar disk herniation were identified . patients were included if they had both a baseline hct drawn within 3 weeks of the surgery and hospital los recorded . data collected included age , sex , preoperative diagnosis , surgery type , preoperative hct , postoperative hct , los , and complications . the preoperative hct was defined by the most recent hct value prior to surgery drawn within 2 weeks of the operative date . the postoperative hct was defined as the first hct value postoperatively drawn within 48 hours of the procedure . los was defined as the period from the time of admission to the time of discharge . complications tracked included deep vein thrombosis , new neurologic deficit due to magnetic resonance imaging confirmed stroke , myocardial infarction , urinary tract infection , surgical site infection , surgical site hematoma , new lower extremity deficit , readmission within 31 days postoperatively , readmission between 31 days and 3 months postoperatively , and return to the operating room during the same stay . surgery type was divided into three categories : microdiskectomy ( one- or two - level ) , laminectomy / decompression , and fusion . the centers for disease control guidelines for anemia use an hct level of 40% based on normative laboratory values as a threshold.8 for the evaluation of the effect of preoperative hct , we divided the patients into two groups using this threshold . student t test was used to compare los as well as other parametric variables in the anemic ( < 40% ) and nonanemic ( > 40% ) groups , with a level of p < 0.05 considered significant . linear and multivariate regression analysis was performed on hct change data , with significance defined as p < 0.05 . all calculations were performed using spss ( ibm , armonk , new york , united states ) . after obtaining institutional review board approval , we retrospectively reviewed the medical records of patients enrolled in a national quality registry ( the national neurosurgery quality and outcomes database ) who underwent routine lumbar spinal procedures at our tertiary care center from november 2012 through september 2013 . patients with the diagnosis of lumbar stenosis , symptomatic lumbar disk herniation , lumbar spondylolisthesis , lumbar adjacent segment disease , or symptomatic recurrent lumbar disk herniation were identified . patients were included if they had both a baseline hct drawn within 3 weeks of the surgery and hospital los recorded . data collected included age , sex , preoperative diagnosis , surgery type , preoperative hct , postoperative hct , los , and complications . the preoperative hct was defined by the most recent hct value prior to surgery drawn within 2 weeks of the operative date . the postoperative hct was defined as the first hct value postoperatively drawn within 48 hours of the procedure . los was defined as the period from the time of admission to the time of discharge . complications tracked included deep vein thrombosis , new neurologic deficit due to magnetic resonance imaging confirmed stroke , myocardial infarction , urinary tract infection , surgical site infection , surgical site hematoma , new lower extremity deficit , readmission within 31 days postoperatively , readmission between 31 days and 3 months postoperatively , and return to the operating room during the same stay . surgery type was divided into three categories : microdiskectomy ( one- or two - level ) , laminectomy / decompression , and fusion . the centers for disease control guidelines for anemia use an hct level of 40% based on normative laboratory values as a threshold.8 for the evaluation of the effect of preoperative hct , we divided the patients into two groups using this threshold . student t test was used to compare los as well as other parametric variables in the anemic ( < 40% ) and nonanemic ( > 40% ) groups , with a level of p < 0.05 considered significant . linear and multivariate regression analysis was performed on hct change data , with significance defined as p < 0.05 . all calculations were performed using spss ( ibm , armonk , new york , united states ) . we analyzed 117 patients in this study , including 65 men ( 56% ) and 52 women ( 44% ) with an average age of 57.8 years ( table 1 ) . the average preoperative hct for all patients was 43.2% , with a range of 29.8 to 51.6% ; the mean change in hct from pre- to postoperatively was 6.2% . twenty - seven subjects were anemic preoperatively ; these patients had a mean preoperative hct of 37% ( table 2 ) . in the 90 patients who were not anemic preoperatively , the mean preoperative hct value was 45.3% . there was no significant difference in the preoperative diagnosis or type of surgery performed for these groups , and women were significantly more likely to fall into the anemic category ( p = 0.001 ) . in addition , anemic patients were more likely to be older ( p = 0.05 ) . there was a significant difference ( p = 0.02 ) in los for the patients in the anemic group ( 3.3 days ) compared with those in the nonanemic group ( 2.3 days ) . there were no significant differences in the rates of deep vein thrombosis , new stroke confirmed on magnetic resonance imaging , myocardial infarction , urinary tract infection , spinal cord injury , new lower extremity deficit , readmission , or return to the operating room between the anemic and nonanemic groups . there was no significant difference in los in the anemic patients when analyzed within the surgical groups ( data not shown ) . abbreviations : hct , hematocrit ; mri , magnetic resonance imaging ; sd , standard deviation . fifty - one patients had postoperative hct drawn and were included in hct change calculations ( fig . 1 ) . the linear regression analysis demonstrated a significant correlation of hct change and the surgery type with increased los , with a decrease of 3.47% predicting a 1-day increase in los ( r = 0.145 , p = 0.002 ) . this effect was maintained in the multivariate analysis after accounting for sex , age , surgery type , and complications ( r = 0.522 , p = 0.001 , table 3 ) . graph showing linear regression analysis of hematocrit ( hct ) change ( as a percent of blood ) and length of stay ( days ) . linear regression demonstrated a significant correlation between greater change in hematocrit and length of stay ( = 3.465 , r = 0.381 , r = 0.145 , p = 0.002 ) . the aim of this study was to determine whether preoperative hct level had a significant effect on the los in patients undergoing routine lumbar spinal procedures . anemia has been shown to be a predictor of poor outcome across multiple surgical procedures.2 3 with the high blood loss often associated with lumbar spinal procedures,9 it stands to reason that this population may be especially vulnerable to baseline anemia . our study suggests that preoperative anemia is indeed associated with a longer hospital stay , with the average los 1 day ( 30% ) longer for patients who were anemic preoperatively . considering that the cost of hospitalization itself , without considering surgeon fees , now approaches $ 14,000 for patients undergoing lumbar laminectomy,10 a reduction in los by any amount could have significant benefits to both the patient and the health care system as a whole . our study also found that a decrease in hct from preoperative to postoperative had a significant effect on los , which is in agreement with other studies that suggest that higher blood loss intraoperatively has a negative effect on time to discharge.6 these studies , however , tend to use estimated blood loss as recorded intraoperatively for their calculations , which can often be difficult to objectively quantify.11 although hct can itself be an inaccurate assessment of hematologic status because of subjective factors such as amount of blood loss and perspective of the evaluator ( anesthesiologist versus surgeon),12 our results suggest that hct could provide an objective measure for surgical and postoperative planning . we believe our study supports the hypothesis that preoperative hct level has a significant effect on los ; however , the study was limited by several factors . although the anemic and nonanemic groups in this study were comparable in regard to many factors including the diagnosis , type of surgery performed , hct change , and evaluable complication rates , women were significantly more likely to be in the anemic group than men and there was a strong but nonsignificant trend toward higher age in the anemic group . some studies do suggest that women and older individuals tend to have longer hospitalizations postoperatively,1 although these increases are generally modest and are not seen in all investigations.6 nevertheless , there could be some interaction between these variables and the effect of hct on los . there was no significant difference in the complication rates between the two groups , but complications overall were rare . as a result , only urinary tract infection and deep vein thrombosis occurred frequently enough to be included in statistical analysis . when broken down into surgery types , no individual category demonstrated a significant difference in los for anemic patients . we believe , however , that this result is likely secondary to the relatively small number of patients in each subgroup . larger patient cohorts could help evaluate whether the preoperative hct level has an effect on the complication rates and what impact anemia has on the los for specific lumbar surgeries . with the myriad risks that preoperative anemia has been shown to augment in the surgical population , future studies in the modification of this risk factor would be beneficial . some studies have evaluated the benefits of preoperative administration of agents such as erythropoietin and iron in anemic patients,13 although the transfusion requirements rather than the hospitalization duration have usually been the primary focus . a 2004 study by colomina et al considered the impact of preoperative erythropoietin administration on patients undergoing posterior spinal fusion with instrumentation and posterolateral interbody fusion.14 these authors found no significant difference in los between the patients receiving erythropoietin and those who did not , but the erythropoietin group had a significantly higher intraoperative blood loss than the control group , which may have interfered with the los analysis . we found that the patients who presented for lumbar spinal procedures with preoperative anemia and those who experienced a large drop in hct postoperatively were at greater risk for prolonged hospitalizations .

stress - induced gastroduodenal erosions are a frequent occurrence in critically ill patients , but it is the incidence of clinically important complications resulting from these erosions that is important in deciding which patients should receive prophylaxis . clinically important complications include bleeding that requires transfusion , bleeding associated with hemodynamic instability , and gastrointestinal perforations . failure to document these complications in published studies limits the conclusions that can be drawn from much of the available literature . there have been inconsistent results in those studies that did record clinically important bleeding , depending on severity of illness or injury , and concomitant or underlying disease states . because the results of clinical investigations have led to different recommendations concerning stress ulcer prophylaxis , cook et al performed a meta - analysis of randomized trials to resolve the controversies associated with previous research in this area . they concluded that there was no clear agent of choice for prophylaxis based on efficacy considerations ( ie ability to prevent clinically important bleeding ) , but sucralfate might have advantages in terms of adverse effects because it was associated with a lower incidence of pneumonia compared with histamine - blocking medications . within 2 years of the publication of this meta - analysis , cook et al reported their findings from the largest randomized study conducted to date concerning stress ulcer prophylaxis . in that study , intravenous ranitidine 50 mg/8 h ( with dose decreased for renal dysfunction ) was associated with a lower incidence of clinically important bleeding compared with sucralfate 1 g/6 h ( relative risk 0.44 , 95% confidence interval 0.210.92 , p = 0.02 ) . there were no significant differences between the medications with respect to pneumonia or mortality . given the recent publication of these important results , the present survey was conducted by members of the research committee of the section of pharmacy and pharmacology of the society of critical care medicine . the survey was mailed to section members who are well versed in medications used in the critical care area . the purpose of the survey was to determine current prescribing practices in light of recent publications concerning stress ulcer prophylaxis . it is hoped that the results of this survey will provide clinicians with information as to how their prescribing and evaluation practices compare with those of practitioners in other institutions . additionally , the survey might uncover institutional practices that are inconsistent with the available literature and that deserve further consideration . a survey was developed that contained questions regarding institutional prescribing and evaluation of stress ulcer prophylaxis . there were 11 questions on the survey , although several of the questions asked for additional information , depending on the initial response . the length of the survey was a compromise between asking enough questions to determine patterns of medication use and evaluation without discouraging completion of the survey by unnecessary length . the majority of questions were in a ' yes / no ' format with further information required on the basis of the initial response . for example , one question was ' does your institution have written guidelines for stress ulcer prophylaxis ? ' if the answer to this question was ' yes ' , then the responder was asked an additional series of questions concerning the details of these guidelines . for example , ' what percentage of patients discharged from the intensive care unit to non - intensive care unit settings remain on stress ulcer prophylaxis ? ' for this type of question , the responder was requested to select from a range of percentages , such as 025% , 2650% , 5175% , or 76100% . most of the remaining questions allowed answers in either a check box or free text format . a series of steps were taken in order to improve the validity and reliability of the instrument . after the initial survey construction at one site , the instrument was distributed to selected members of the section of pharmacy and pharmacology of the society of critical care medicine for pretesting of the instrument . additionally , a physician who practices in the critical care setting ( but is not a member of the section ) was asked to review the instrument . changes were made to the document on the basis of this input . the survey was sent to all members of the section of pharmacy and pharmacology of the society of critical care medicine in the fall of 1998 . a stamped , self - addressed envelope was included in the mailing for returning the completed surveys . descriptive statistics were used to analyze and report the data , because the answers were not amenable to inferential testing . data were recorded and analyzed using microsoft excel version 4.0 ( microsoft corporation ) . a total of 368 surveys were distributed and 153 were returned , yielding a response rate of 42% . of the hospitals surveyed 62% had more than 400 beds , and 32% had between 200 and 399 beds . sixty - one per cent of institutions had more than 40 intensive care unit ( icu ) beds and 29% had between 20 and 39 beds . it is difficult to comment on the focus of the icus ( ie surgical , medical , mixed or special ) because of many respondents checking more than one item . sixty - one per cent were classified as level i trauma centers . of institutions 86% stated that medications for stress ulcer prophylaxis are used in a vast majority ( > 90% ) of patients admitted to the icu . twenty - two per cent have recommendations for both icu and non - icu settings . the majority of questions on the survey pertained to stress ulcer prophylaxis from an overall institutional standpoint . there were a few questions , however , that attempted to define specialized populations at the institutions that might be at particular risk for stress ulceration and related complications . with the exception of multiple trauma , the number of institutions that routinely institute stress ulcer prophylaxis in these specialized populations is listed in table 2 . twenty - seven per cent of institutions have written guidelines for stress ulcer prophylaxis , with approximately half of those stating that their guidelines have been reviewed or updated within the past 2 years . of responders 40% are either considering or developing guidelines for their respective institutions . fifty - eight per cent of institutions stated that there is one preferred medication for stress ulcer prophylaxis . sucralfate was the agent of choice in 20% , whereas omeprazole was preferred in 3% . a breakdown of the route of administration for each agent is listed in table 3 . ten per cent of institutions evaluated the incidence of clinically important bleeding , which was defined as the need for transfusion or hemodynamic changes that are associated with bleeding . it is unclear whether these institutions limited their evaluation to patients receiving stress ulcer prophylaxis due to the limited number of respondents who answered that question ( n = 13 ) . twenty - three per cent routinely used gastric ph measurements ( ie ph paper , ph sensor , gastric tonometry ) for monitoring ph - altering agents when such measurements were feasible . as indicated by the results of this survey , stress ulcer prophylaxis is used in the majority ( 86% ) of critically ill patients . although it is difficult ( if not impossible ) for any survey to elucidate the reasons why physicians prescribe the way they do , it is possible to hypothesize from the results of our questionnaire . for most clinicians , it appears that the presumed benefits of prophylaxis outweigh its associated risks and costs . consistent with a small percentage of individuals returning the surveys , however , there are clinicians who believe the value of prophylaxis is overstated and question its widespread use . this opinion is based on the perception that the incidence of bleeding is rare , and when it does occur it is readily amenable to endoscopic or medical therapies . the number of patients receiving stress ulcer prophylaxis in non - icu settings is concerning . of institutions surveyed 22% stated that stress ulcer prophylaxis is given to patients in non - icu settings more than 50% of the time . also , patients discharged from icu to non - icu settings remain on stress ulcer prophylaxis more than 50% of the time in 33% of institutions . given the lack of published literature in non - icu settings , along with the low risk of clinically important bleeding , many experts believe that routine prophylaxis is not warranted . the incidence of stress - induced bleeding has varied considerably , depending on the definition of bleeding and the population under study . both microscopic and macroscopic ( ie overt ) bleeding are relatively common findings in published studies , but there is no well documented relationship between such bleeding and the incidence of clinically important bleeding complications ( eg hemodynamic instability , perforation , need for transfusion ) . unfortunately , the actual incidence of clinically important bleeding associated with many published investigations is not available , particularly in those published before 1990 . in randomized trials conducted since 1990 that enrolled at least 100 general medical / surgical icu patients , the incidence of clinically important bleeding associated with no prophylaxis has ranged from 3.5 to 22.9% . in this survey , only 10% of the surveyed institutions evaluated the incidence of clinically important bleeding . certain types of defined or single - system injuries appear to be associated with a higher incidence of bleeding , on the basis of retrospective data . in the present study , the great majority of patients with head , spinal cord , thermal , or hepatic injuries were routinely given prophylaxis . using thermal injury as an example , however , only one randomized trial has been conducted , the results of which were published in 1976 . in that trial , 29.2% of patients not receiving prophylaxis had clinically important bleeding , compared with 4.2% of patients receiving antacid prophylaxis ( p < 0.02 ) . using adult patients with head injuries ( glasgow coma scores 10 ) as another example , one trial published in 1993 ( n = 167 ) found no instances of clinically important bleeding with either saline placebo or ranitidine , whereas another trial published in 1995 ( n = 34 ) found that 27.8% of patients receiving no prophylaxis had clinically important bleeding compared with none of the patients in the ranitidine group ( p 0.05 ) . some of the variation in bleeding rates in published studies may be attributable to the definition used for delineating patients at risk for stress - induced complications . two risk factors have been found to be predictive of clinically important bleeding using multivariate analytic techniques in a large sample of mixed medical / surgical patients . it is unknown whether these findings are applicable to more homogeneous , specialized populations ( eg patients with burns or trauma , or patients undergoing central nervous system surgery ) because of lack of study inclusion or insufficient enrolment numbers . once the decision is made to use prophylaxis , there are several medications available . in the present investigation , 77% of the institutions surveyed used histamine-2-antagonists as the agent of choice , whereas 20% used sucralfate . these percentages are similar to the findings in another survey of stress ulcer prophylaxis in which histamine-2-antagonists were used in 67% of patients compared with 24% of patients receiving sucralfate . the majority of published studies using clinically important bleeding as an end point have involved histamine-2-antagonists and sucralfate . the most comprehensive meta - analysis found no substantial differences in clinically important bleeding between the latter agents , whereas the most recent and largest randomized trial suggested that ranitidine was more efficacious than sucralfate ( at least with the doses used in the trial ) . trials involving other agents such as the proton pump inhibitor omeprazole have either not used clinically important bleeding as an end point or lacked sufficient power to detect potential differences in bleeding between other agents or when compared with placebo . given the similar type of action ( inhibition of acid release ) between histamine-2-antagonists and proton pump inhibitors , it seems likely that the pump inhibitors would have similar efficacy . given the inconsistent results of published investigations , it is perhaps not surprising that almost all aspects of stress ulcer prophylaxis remain controversial . until some of the issues are resolved through further study , there are a few recommendations that seem in order . first , it seems that clinicians should aim for some form of consistency based on intra - institutional guidelines using the most current , best evidence of prophylactic benefit with histamine-2-receptor antagonists . a majority of institutions surveyed ( 73% ) had no guidelines in place . of those that did have guidelines , almost half ( 48% ) had not been updated in the 2 years before receiving the survey . this finding is of concern , because the most comprehensive meta - analysis and largest randomized study to date concerning stress ulcer prophylaxis were published in the 2 years preceding the survey . this finding could be misleading , however , because it is possible that the results of these recent publications did not require an alteration in the institution 's guidelines . institutions contemplating the development of stress ulcer prophylaxis guidelines should take advantage of existing information . one organization , the american society of health - system pharmacists , has recently promulgated guidelines for stress ulcer prophylaxis that could be used as a template for the intra - institutional development process . the american society of health - system pharmacists guidelines have an economic model that can be modified using local efficacy , toxicity , and cost information . that survey , however , was conducted in october 1995 , which was before the publication of the largest meta - analysis and largest randomized controlled trial to date . the present survey was conducted in the fall of 1998 , with one intention of determining how those reports may have influenced prescribing habits . the previous study selected a random sample of the members of the society of critical care medicine who identified anesthesiology , surgery , or internal medicine as their specialty area . our survey was sent to the entire section of pharmacy and pharmacology of the society of critical care medicine , and had a response rate of 42% . another recommendation is to review stress ulcer prophylaxis prescribing periodically , as well as any guidelines that are in place . both published literature and local evaluations may necessitate a change in the guidelines . there are examples in the literature of where guideline changes relative to stress ulcer prophylaxis have resulted in lowered institutional costs without compromising the quality of patient care . a final recommendation applies to those individuals who have the capabilities of performing clinical studies concerning stress ulcer prophylaxis . although it seems unlikely that another study involving general medical / surgical patients would resolve the debate concerning the need for prophylaxis , randomized studies involving specialized populations ( eg trauma patients ) could be of potential value , given the relative lack of controlled investigations . also , comparative studies involving newer medications and different routes of administration are needed that use clinically important bleeding as an end point . although the results of this survey describe some of the current prescribing practices of physicians in the usa relative to stress ulcer prophylaxis , there are important limitations to the information presented . if the instrument contains an excessive number of questions , the responder may be less willing to complete and return the material . this survey was limited to one page , front and back , in an attempt to increase compliance . another concern in common with all questionnaires relates to the reliability and validity of the instrument , although attempts were made to reduce such problems during the instrument construction process . other limitations of these results pertain to the topic at hand ( ie stress ulcer prophylaxis ) . physician prescribing and guideline development are affected at different times and to varying degrees by published trials . the largest randomized trial comparing ranitidine and sucralfate for stress ulcer prophylaxis was published in march 1998 . therefore , physician prescribing and institutional guidelines may not have changed as a result of that trial at the time of the present survey . additionally , the responses to the survey questions are a function of the person completing the survey . because the individuals completing the survey were members of the section of pharmacy and pharmacology of the society of critical care medicine , it was presumed that they were well versed in the area of stress ulcer prophylaxis issues at their institutions . there are wide variations in prescribing practices with regard to stress ulcer prophylaxis , although such prophylaxis is used in the majority of icu patients . histamine-2-antagonists , sucralfate , and proton pump inhibitors are commonly used agents , with histamine-2-antagonists being the most commonly preferred agent among the institutions surveyed . published literature and available guidelines should be used as a template for institutions that are constructing their own guidelines . the authors would like to acknowledge the support of the society of critical care medicine and members of the section of pharmacy and pharmacology in the conduction of this survey . stress ulcer prophylaxis in icu and non - icu settings icu , intensive care unit . specialized populations where stress ulcer prophylaxis is routinely administered data are expressed as number of institutions responding to the question ( not percentages ) . description of the route of administration for each institutions preferred agent responders were permitted to check more than one administration route for their institution 's preferred agent .

we report the case of a 64-year - old man , who had been under immunosuppressive treatment for many years after a pulmonary transplant , who presented with diffuse viral warts on the neck and chin that had been present for 11 months ( fig . cryotherapy sessions were conducted over the course of 9 months without success but with increasing intolerance to the related pain . imiquimod had not been suggested due to its theoretical contraindications relating to the risk of a graft rejection and a graft - versus - host disease . a photodynamic therapy ( pdt ) test session was carried out on the most prominent warts in the submental region , with a very clear improvement after 1 week ( fig . two more sessions were conducted within a 10-day interval , using 2 fields of light each time , thus covering the entire surface of the neck ( right and left sides ) . three hours after an application of 5-aminolevulinic acid ( metvix ) under an occlusive and opaque dressing , a red light of 634 nm was delivered , with a 37 j / cm light intensity for the duration of 9 min . a spray bottle filled with spring water , in combination with an integrated cooling fan , was used to decrease pain during illumination . the painful sensation lasted 12 h after illumination , whereas erythema and swelling decreased after 23 days . viral wart treatments include local keratolytic application , topical retinoids , cryotherapy , intralesional injection of bleomycin , imiquimod , laser co2 , pulsed dye laser and intralesional immunotherapy . the benefit - risk ratio in organ - transplanted patients is currently being evaluated . pdt has proven to be successful in the treatment of actinic keratosis and basocellular carcinoma . at present several studies show that protoporphyrin ix accumulation after 5-aminolevulinic acid application is not specific to tumour cells . hpv - infected cells also accumulate protoporphyrin ix in a specific manner , as compared to the surrounding healthy cells [ 4 , 5 ] , as demonstrated by in vivo fluorescence spectroscopy . pdt therapeutic effects are due to anti - inflammatory and anti - proliferative properties activated through the release of cytotoxic radicals that destroy keratinocytes via selective apoptosis . numerous clinical studies have demonstrated the efficiency of pdt in the treatment of viral warts of the hands and feet , ( recalcitrant [ 9 , 10 , 11 , 12 , 13 ] or not ) , including periungual warts . several studies have shown that pdt is efficient in treating plane warts [ 14 , 15 ] , including those on the face . treated verrucae vulgares on the hands and feet with a clear clinical improvement in 68.3% of the patients . this improvement was confirmed by a placebo - controlled study led by bastuji - garin et al . . in addition , wang et al . successfully treated 42% of recalcitrant viral warts , and chong and kang reported complete healing of recalcitrant foot verrucae vulgares after only 3 pdt sessions . schroeter et al . treated periungual warts with full clinical success in 90% of patients after a mean of 4.7 sessions . some authors suggested the use of a keratolytic pre - treatment ( urea 10% , salicylic acid 10% , for 1 week ) to enhance the treatment 's efficiency , with complete healing in 75% of viral warts . in the immunosuppressed subject , granel - brocard et al . reported the therapeutic effect of pdt on recalcitrant warts . it is a safe , noninvasive technique , which yields effective therapeutic results in multiple series of patients [ 17 , 23 ] . the risk of secondary infection after pdt is insignificant , and the cosmetic results are excellent . the technique is particularly interesting in slow - healing subjects and acts selectively , allowing healthy surrounding skin to remain intact and functional . the use of one or several fields of light enables treatment of many lesions at the same time , thus limiting the risk of wart spread and recurrence between sessions . the drawbacks are pain and local side effects such as erythema and swelling , which is generally mild and well tolerated ( table 1 , table 2 , table 3 ) . immunosuppressed patients often present with extensive viral warts . controlling the spead of these warts is of great importance because they can potentially be a source of neoplasia . our case report shows that pdt can be very efficient in the treatment of verrucae vulgares in immunosuppressed organ - transplanted patients . the technique is easy to implement , resulting in minimal side effects and reproducible results . we think that pdt should be considered as a gold standard in the treatment of facial verrucae vulgares in immunodepressed patients . all authors certify that they have no conflicts of interest , including specific financial interests and relationships and affiliations relevant to the subject of this manuscript .

a majority of the world 's hiv infections occur in generalized epidemic countries in sub - saharan africa , where hiv transmission is thought to be sustained by sexual behavior in the general population and would persist despite effective programs for high - risk sub - populations . in contrast , concentrated epidemics are those in which high - risk sub - populations are essential to sustaining transmission . in india , programs targeting sex workers have successfully reduced the spread of hiv in the general population . buoyed by these signs of success in india , hiv prevention researchers have begun to ask whether such approaches could be translated to generalized epidemic settings , where efficient strategies for hiv prevention are desperately needed . recent studies have underscored the continuing role of concentrated epidemics embedded within generalized epidemics based on behavioral , biological and spatial heterogeneities in hiv transmission seen in sub - saharan africa well after aggregate hiv incidence rates have declined from their peak . these findings raise hope that focusing hiv interventions to those most at risk of propagating infections could produce a disproportionately large reduction in hiv incidence in the general population . the patterns of migration with periodic visits to the home community , dubbed circular or oscillating migration , contributed to the early spread of hiv . in this analysis , we chose to focus on migrant mine workers as a potential target group for intensified hiv services . mine workers have been identified as an important group to target with hiv prevention and treatment for multiple reasons . migration itself is associated with elevated hiv prevalence among migrant individuals and their non - migrant partners even after hiv had spread in their home communities . in addition , migrant mine workers are at especially high risk of aids because of tb associated with dense housing and work conditions in mines . further , mine workers are predominantly male , and in the era of widespread availability of antiretroviral therapy ( art ) , males have lagged behind females in access to hiv testing and art . increased private - sector involvement in hiv care in the mining sector speaks to the feasibility of intensifying hiv services for migrant mine workers beyond the scope of available public health care . a recent analysis of coal mining in south africa revealed that providing hiv testing and treatment services for employees was cost - saving for coal companies due to reduced absenteeism and employee turnover . because of the precedent for workplace hiv programs for mine workers and the ongoing research on prevention of hiv and tb for mine workers , we designed our model scenarios around the relevant target population of male migrant mine workers . we used an individual - based network model of hiv transmission in rural south africa to estimate the impact of targeting hiv prevention and treatment to male migrant workers on hiv incidence and mortality in the migrant population and the rural community from which they migrate . though the term migration is used for brevity , this study focuses on mine migration by males who comprise less than 1% of the south african resident population . in lesotho , mine workers comprised approximately 10% of the adult population in the mid-1990s , most of whom were international migrants working in south africa 's gold mines , but the number of mine workers has since declined to less than 5% of the adult population , paralleling contraction of the gold mining industry . we augmented an individual - based network model , emod - hiv v0.8 , to include a migrant population that imports the initial source of hiv infections that initiate simulated epidemic . the patterns of heterosexual partnerships used to construct the contact network were modeled after a rural hyperendemic setting in kwazulu - natal , south africa . the model was calibrated to the south african national hiv epidemics , including age- and gender - disaggregated hiv prevalence , population size , distribution of cd4 count at treatment initiation , and proportion of the population tested for hiv . the baseline scenario ( without targeting of services to migrants ) includes art expansion as well as hiv prevention services such as male circumcision and provision of condoms . model assumptions , parameter values , data sources , and methods of model fitting are available as open - access publications and model assumptions , parameters , and sources most relevant to this study are listed in supplementary table 1 . the baseline model trajectories and projections for general - population treatment scale - up have been compared to those of 11 other mathematical models of hiv in south africa as part of a series of projects by the hiv modelling consortium . emod - hiv v0.8 was modified in several ways to enable the analysis described here . first , a configurable percentage of males in the model were labeled as eligible to become migrants , as illustrated in figure 1 . these males began to exhibit migratory behavior at a specified age , which was configured to match the age distribution of migrants observed in a rural community in south africa . the age to begin migration was chosen randomly for each migrant - eligible individual from the distribution shown in figure 2a . because not all males began migration at age 15 , the proportion of adult males migrating at any time was approximately half the percentage of males who would eventually begin migration ( figure 2b ) . for example , if the model was configured so that 20% of males would eventually migrate sometime after the age of 15 , approximately 10% of males age 15 would be migratory at a given time , because some wait until older ages to begin migration . the proportion migrating fluctuated over the course of the epidemic due to elevated aids mortality among migrants , followed by reduced mortality due to increasing art availability . figure 1.schematic of migration in the emod - hiv v0.8 individual - based model . the network of sexual contacts ( dashed lines ) is explicitly modeled for the home community ( left box encircled by gray line ) , whereas hiv acquisition at the workplace ( right box ) is represented as an external incidence rate ( dark box with virus symbol ) . whether infected at home or in the workplace , the model tracks the hiv status of individual migrants ( dark : infected , light : uninfected ) as well as their current location ( horizontal arrows ) . migrants can potentially infect home partners with hiv , and vice versa , during visits home ( cross - hatched figure at workplace location ) . visits were assumed to occur monthly for 3 days per visit , but in sensitivity analysis we made visits perpetual ( without reducing externally - acquired infections ) to test the maximum possible role of migrants . when at the workplace location ( cross - hatched figure at the home location ) , migrants do not expose or acquire hiv from home partners . this figure is available in black and white in print and in color at international health online . figure 2.age at the start of migration and proportion of adults who are targetable migrants in the emod - hiv v0.8 model . ( a ) histogram showing the age distribution at which males began mining , according to the age distribution of migrants in agincourt , south africa . a fixed proportion of males ( 5 or 20% ) were labeled as destined to migrate , and the age at which their migratory behavior began was sampled from this histogram . ( b ) because males had to reach the specified age to begin migrating , the proportion of males actively migrating was approximately half of the proportion of males who would eventually migrate ( dark curves ) . the proportion fluctuates over the course of the epidemic due to elevated aids mortality among migrants , followed by reduced mortality due to increasing art availability . including adult women in the denominator halved the proportion the proportion , so that the proportion of all adults who were migrating was one - quarter the proportion of males who would migrate , and fluctuated with the same trend ( light curves ) . this figure is available in black and white in print and in color at international health online . the network of sexual contacts ( dashed lines ) is explicitly modeled for the home community ( left box encircled by gray line ) , whereas hiv acquisition at the workplace ( right box ) is represented as an external incidence rate ( dark box with virus symbol ) . whether infected at home or in the workplace , the model tracks the hiv status of individual migrants ( dark : infected , light : uninfected ) as well as their current location ( horizontal arrows ) . migrants can potentially infect home partners with hiv , and vice versa , during visits home ( cross - hatched figure at workplace location ) . visits were assumed to occur monthly for 3 days per visit , but in sensitivity analysis we made visits perpetual ( without reducing externally - acquired infections ) to test the maximum possible role of migrants . when at the workplace location ( cross - hatched figure at the home location ) , migrants do not expose or acquire hiv from home partners . this figure is available in black and white in print and in color at international health online . age at the start of migration and proportion of adults who are targetable migrants in the emod - hiv v0.8 model . ( a ) histogram showing the age distribution at which males began mining , according to the age distribution of migrants in agincourt , south africa . a fixed proportion of males ( 5 or 20% ) were labeled as destined to migrate , and the age at which their migratory behavior began was sampled from this histogram . ( b ) because males had to reach the specified age to begin migrating , the proportion of males actively migrating was approximately half of the proportion of males who would eventually migrate ( dark curves ) . the proportion fluctuates over the course of the epidemic due to elevated aids mortality among migrants , followed by reduced mortality due to increasing art availability . including adult women in the denominator halved the proportion the proportion , so that the proportion of all adults who were migrating was one - quarter the proportion of males who would migrate , and fluctuated with the same trend ( light curves ) . this figure is available in black and white in print and in color at international health online . the network of sexual partnerships in the community was only explicitly modeled for the home location ; to represent the workplace location , the migrants were exposed to a configurable and time - variable incidence rate . this external incidence rate was allowed to vary over time to modulate the timing of introduction of hiv into the population , and was held at 1.2% per person - year after 2006 unless altered by the workplace prevention intervention . we simulated two hypothetical interventions targeted to male migrant workers : primary prevention directed at sexual contacts at the workplace location , and secondary prevention in the form of antiretroviral treatment for infected migrants ( which also provides a direct health benefit to the recipients ) . primary prevention was operationalized in the model by removing the source of externally - acquired hiv incidence . because the relationships and risk behaviors outside the home community were not modeled explicitly , this approach does not specify which modality of primary prevention would be used , e.g. , behavior change , condoms , sti prevention , circumcision , and/or hiv prophylaxis . the external source of hiv incidence in migrants constituted the sole source of initial hiv infections in the model , initiating the early hiv epidemic . the true distribution of the sources of initial hiv infections introduced into rural communities is not known , but ours was an extreme assumption made to maximize the hypothetical impact of migrant - targeted interventions on the home community . as we will see , the impact on the home community is modest , so pushing this assumption to its extreme provides confidence that our results are robust to unknowns such as the proportion of infections brought into the community by the specific sub - population targeted with intensified hiv services . the rates of relationship formation and dissolution of migrants not present in the community were assumed to be the same as for non - migrants . however , migrants were assumed to put their home partners at risk only while visiting the home community . active relationships in the home community were consummated at least once and an average of two times per home visit . in sensitivity analysis , we experimented with lengthening the duration of home visits without attenuating the rate of incidence coming from the workplace . flags that prevent uptake of additional partnerships when engaged in an existing partnership of a given type . individuals could uptake additional concurrent partners as long as this was not prohibited by their flags and as long as they did not exceed a maximum of one marital , two informal , and three transitory partnerships . to simulate increases in risk behavior among partners of migrants , we modified this concurrency model such that migrants would not count against the limitations on partnership concurrency . for example , a home partner whose flags prohibit additional partnerships could nonetheless acquire one additional non - migrant partner after her existing partner begins a pattern of circular migration . we estimated the impact of workplace hiv prevention , which protects migrants from externally acquired infections but not infections from partners in the home community , as well as a test - and - treat strategy targeting migrants . both interventions were assumed to start in 2015 , during a mature epidemic that had already spread in the general population . other intervention start years are also explored , including years in the past when hiv had not yet spread through the general population . table 1 summarizes three outcome measures accumulated over a 5-year and 20 time period ( 20152020 and 20152035 , respectively ) : the number of infections averted in the entire community ( both migrants and non - migrants ) , all - cause deaths averted in the entire community , and all - cause deaths averted among migrants . table 1 .impact of targeting hiv prevention or treatment to migrantsproportion of males who migrate5%20%5%monthly 3-day visits to home communityyesyesno perpetual visitshiv prevention at workplace locationyesnoyesyesnoyesyesnoyeshiv treatment uptake by 80% of migrantsnoyesyesnoyesyesnoyesyesover 5 years new hiv infections averted2.5%0.1%2.6%12.6%1.3%13.4%3.1%1.3%4.0% total deaths averted ( all - cause)0.1%0.1%0.2%0.6%0.4%0.8%0.1%0.0%0.2% migrant deaths averted ( all - cause)1.3%4.6%4.5%1.2%4.3%4.9%0.0%4.1%5.6%over 20 yearsno new hiv infections averted3.5%0.1%3.9%16.2%1.1%17.1%4.6%2.1%5.6% total deaths averted ( all - cause)0.3%0.1%0.4%1.5%0.7%1.8%0.3%0.2%0.5% migrant deaths averted ( all - cause)6.8%8.9%12.1%6.9%8.5%11.6%4.9%10.4%13.1% impact of targeting hiv prevention or treatment to migrants we first examined a scenario in which 5% of males in the community would become eligible to migrate between ages 15 and 35 , such that approximately 23% of males aged 15 and older were targetable migrants at any point in time ( figure 2b ) . we examined the impact of workplace hiv prevention programs for migrants , which had the effect of preventing workplace - acquired hiv infections , but not community - acquired hiv infections . in the model , this amounted to shutting off the externally - acquired incidence of infections , but still allowing migrants to potentially become infected during visits to the home community . this was compared to a baseline scenario in which migrants ' externally - acquired hiv incidence rate was maintained at 1.2% per person year . complete prevention of new hiv infections at the workplace averted 80.3% of infections among migrants over 5 years and 77.9% of infections among migrants over 20 years . not all infections by migrants were averted by workplace prevention because migrants could still become infected by partners in the home community , and were put at increased risk of hiv acquisition from home partners due to their increased propensity to have a concurrent partner . hiv prevention at the workplace averted 1.3% of all - cause deaths among migrants over 5 years , and 6.8% of all - cause deaths among migrants over 20 years ( table 1 , left section ) . because the mean survival time with untreated hiv infection is approximately a decade far longer than the 5-year time horizon the proportion of deaths averted by prevention was much greater when examined over a 20-year time horizon . the health benefit to the migrant population of hiv prevention at the workplace underscores the potential benefits of such programs to employees and their employers , consistent with a recent analysis that hiv services provided by private coal mining companies in south africa are cost - saving to the employers due to reduced absenteeism and employee turnover caused by illness and death . in the whole home community ( including non - migrants and migrants ) , prevention services for migrants at the workplace averted 2.5% of infections and 0.2% of deaths ( from any cause ) over five years , and 3.5% of all hiv infections in the 0.3% of deaths over 20 years ( table 1 , left section ) . we next examined the impact of providing treatment as prevention for migrants beginning in 2015 , assuming that 80% of migrants are tested for hiv at an average rate of once per year , and that all those testing positive through this program initiate treatment that reduces infectiousness by 92% . this intervention reduced all - cause deaths among migrants by 8.5% over 20 years , but had no significant impact on infections or deaths in the community . a combination of workplace prevention and treatment for migrants had more impact than prevention or treatment alone , averting 12.1% of deaths among migrants , 0.4% of deaths in the community , and 3.9% of infections in the community over 20 years . however , the effect at the community level was still small compared to the effect on the target group . to test whether the impact of targeting migrants could be greater under assumptions that exaggerate the role of this population , we increased the proportion of males who migrate to 20% ( table 1 , middle section ) or increased the duration of visits home to its maximum ( perpetual visits ) without reducing workplace - acquired hiv incidence ( table 1 , right section ) . the assumption that 20% of males begin migratory behavior between ages 15 and 35 meant that , at any time , approximately 10% of males age 15 + ( or approximately 5% of all adults age 15 + ) were migrants who could be targeted by the intervention . the impact of treatment and prevention on the migrant sub - population remained similar , but the impact on the community became more exaggerated . over 20 years , workplace prevention averted 16.2% of infections in the community ( migrant and non - migrants ) , and a combination of workplace prevention and treatment averted 17.1% of infections in the community . only 24.8% and 23.6% of these infections , respectively , were among the migrants themselves . treatment as prevention targeted to migrants averted 1.1% of community infections and 0.7% of community deaths over 20 years when 20% of males were eligible to migrate , compared to only 0.1% or infections and deaths when only 5% of males were eligible to migrate . the effect of the intervention was magnified by more than four fold because the increased risk behaviors of the home partners of migrants caused them to play a disproportionately large role in transmission at the home community . extending the duration of migrants ' visits home to its theoretical maximum ( perpetual visits ) increased the rate of transfer of new infections between migrants and their partners in the home community . in this extreme example , migrants effectively did not migrate , but nonetheless retained the externally - acquired incidence and the increased risk behavior of home partners that would normally be associated with migration . the purpose of turning the duration of visits to their maximum value was to explore the extent to which the decoupling of migrants from the home community , due to their reduced presence in the community , could have modulated their impact on the ongoing epidemic and thus attenuated the impacts observed in the previous analysis . this increased coupling between the migrant and home communities amplified the impact of treatment as prevention for migrants , so that 2.1% of community infections were averted by treatment when migrants had perpetual visits , compared to only 0.1% of infections when migrants had monthly 3-day visits to the home community . the increased exposure to hiv from home partners meant that prevention of workplace - derived infections averted more infections at the community level , but it also made workplace prevention less beneficial to the migrants themselves . deaths among migrants did not drop significantly in the first 5 years of prevention , and dropped by only 4.9% over 20 years , compared to 6.8% when migrants had monthly 3-day visits to the home community . the reduced benefit to migrants with frequent visits reflects that hiv prevention at the workplace did not reduce the migrants ' hiv exposure from home partners . a limitation of the scenario is that it did not capture potential behavior change associated with increasing the proportion of time migrants spend in the home community . if home partners reduced their risk behavior in the perpetual presence of the migrant partner , we would have expected greater benefits to migrants . although our model assumptions were optimistic about the uptake and efficacy of a hypothetical migrant - targeted prevention or treatment intervention , the impact of this intervention was modest on a community level . even after stretching the assumptions of the model to further exaggerate the role of migrants in the community , the optimistic interventions were a far cry from reversing the generalized epidemic at the community level . workplace prevention and test - and - treat for migrants starting in 2015 were unable to reverse the generalized epidemic in the home community within 20 years . to understand why targeting migrants had so little impact at the community level , we experimented with the timing of the migrant - targeted interventions compared to the growth and stabilization of the generalized epidemic . rather than starting workplace hiv prevention in 2015 , we experimented with start dates in earlier years , moving back the start date in one - year increments as far back as the year 1984 , when it was assumed that the first migrants introduced hiv into the community ( figure 3 ) . figure 3.hiv incidence rates among adults age 15 + in the home community after prevention of workplace - acquired hiv infection begins in different years throughout the history of the hiv epidemic . this method of representing of hypothetical past interventions is analogous to johnson and white 's 2011 analysis of hypothetical reductions in concurrency over the history of the hiv epidemic . dots represent the year that workplace prevention begins , and lines of the same shading emanating from these dots represent the impact of sustained workplace prevention on future hiv incidence . targeting migrants in present or future years would fail to collapse generalized epidemics in their home communities . this figure is available in black and white in print and in color at international health online . hiv incidence rates among adults age 15 + in the home community after prevention of workplace - acquired hiv infection begins in different years throughout the history of the hiv epidemic . this method of representing of hypothetical past interventions is analogous to johnson and white 's 2011 analysis of hypothetical reductions in concurrency over the history of the hiv epidemic . dots represent the year that workplace prevention begins , and lines of the same shading emanating from these dots represent the impact of sustained workplace prevention on future hiv incidence . targeting migrants in present or future years would fail to collapse generalized epidemics in their home communities . this figure is available in black and white in print and in color at international health online . beginning workplace prevention in 1984 or earlier would , by definition , prevent the epidemic in our model , because it was assumed that the workplace - derived hiv infections were introduced into the community by migrants beginning in this year . however , delaying the intervention by even a few years after hiv introduction into the community would have failed to avoid a generalized epidemic in the model . to halve the incidence rate in 2020 , prevention would have had to begin in 1989 . intervening in 2015 with workplace prevention provided too little , too late to reverse the generalized epidemic in the home community . an important caveat to the analysis in figure 3 is that it does not capture the changing role of migrant labor over the history of south africa . the frequency of return visits , percentage of community involved in migrant economy , and the proportion of women having migrant and non - migrant partners likely underwent dramatic changes during the dismantling of apartheid . thus , model estimates pertaining to the early hiv epidemic , including year of intervention required to halve incidence ( figure 3 ) , should be interpreted with caution . if these changes had been accounted for , the year of intervention required to halve incidence would likely have been later than suggested by our simplified model . we first examined a scenario in which 5% of males in the community would become eligible to migrate between ages 15 and 35 , such that approximately 23% of males aged 15 and older were targetable migrants at any point in time ( figure 2b ) . we examined the impact of workplace hiv prevention programs for migrants , which had the effect of preventing workplace - acquired hiv infections , but not community - acquired hiv infections . in the model , this amounted to shutting off the externally - acquired incidence of infections , but still allowing migrants to potentially become infected during visits to the home community . this was compared to a baseline scenario in which migrants ' externally - acquired hiv incidence rate was maintained at 1.2% per person year . complete prevention of new hiv infections at the workplace averted 80.3% of infections among migrants over 5 years and 77.9% of infections among migrants over 20 years . not all infections by migrants were averted by workplace prevention because migrants could still become infected by partners in the home community , and were put at increased risk of hiv acquisition from home partners due to their increased propensity to have a concurrent partner . hiv prevention at the workplace averted 1.3% of all - cause deaths among migrants over 5 years , and 6.8% of all - cause deaths among migrants over 20 years ( table 1 , left section ) . because the mean survival time with untreated hiv infection is approximately a decade far longer than the 5-year time horizon the proportion of deaths averted by prevention was much greater when examined over a 20-year time horizon . the health benefit to the migrant population of hiv prevention at the workplace underscores the potential benefits of such programs to employees and their employers , consistent with a recent analysis that hiv services provided by private coal mining companies in south africa are cost - saving to the employers due to reduced absenteeism and employee turnover caused by illness and death . in the whole home community ( including non - migrants and migrants ) , prevention services for migrants at the workplace averted 2.5% of infections and 0.2% of deaths ( from any cause ) over five years , and 3.5% of all hiv infections in the 0.3% of deaths over 20 years ( table 1 , left section ) . we next examined the impact of providing treatment as prevention for migrants beginning in 2015 , assuming that 80% of migrants are tested for hiv at an average rate of once per year , and that all those testing positive through this program initiate treatment that reduces infectiousness by 92% . this intervention reduced all - cause deaths among migrants by 8.5% over 20 years , but had no significant impact on infections or deaths in the community . a combination of workplace prevention and treatment for migrants had more impact than prevention or treatment alone , averting 12.1% of deaths among migrants , 0.4% of deaths in the community , and 3.9% of infections in the community over 20 years . however , the effect at the community level was still small compared to the effect on the target group . to test whether the impact of targeting migrants could be greater under assumptions that exaggerate the role of this population , we increased the proportion of males who migrate to 20% ( table 1 , middle section ) or increased the duration of visits home to its maximum ( perpetual visits ) without reducing workplace - acquired hiv incidence ( table 1 , right section ) . the assumption that 20% of males begin migratory behavior between ages 15 and 35 meant that , at any time , approximately 10% of males age 15 + ( or approximately 5% of all adults age 15 + ) were migrants who could be targeted by the intervention . the impact of treatment and prevention on the migrant sub - population remained similar , but the impact on the community became more exaggerated . over 20 years , workplace prevention averted 16.2% of infections in the community ( migrant and non - migrants ) , and a combination of workplace prevention and treatment averted 17.1% of infections in the community . only 24.8% and 23.6% of these infections , respectively , were among the migrants themselves . treatment as prevention targeted to migrants averted 1.1% of community infections and 0.7% of community deaths over 20 years when 20% of males were eligible to migrate , compared to only 0.1% or infections and deaths when only 5% of males were eligible to migrate . the effect of the intervention was magnified by more than four fold because the increased risk behaviors of the home partners of migrants caused them to play a disproportionately large role in transmission at the home community . extending the duration of migrants ' visits home to its theoretical maximum ( perpetual visits ) increased the rate of transfer of new infections between migrants and their partners in the home community . in this extreme example , migrants effectively did not migrate , but nonetheless retained the externally - acquired incidence and the increased risk behavior of home partners that would normally be associated with migration . the purpose of turning the duration of visits to their maximum value was to explore the extent to which the decoupling of migrants from the home community , due to their reduced presence in the community , could have modulated their impact on the ongoing epidemic and thus attenuated the impacts observed in the previous analysis . this increased coupling between the migrant and home communities amplified the impact of treatment as prevention for migrants , so that 2.1% of community infections were averted by treatment when migrants had perpetual visits , compared to only 0.1% of infections when migrants had monthly 3-day visits to the home community . the increased exposure to hiv from home partners meant that prevention of workplace - derived infections averted more infections at the community level , but it also made workplace prevention less beneficial to the migrants themselves . deaths among migrants did not drop significantly in the first 5 years of prevention , and dropped by only 4.9% over 20 years , compared to 6.8% when migrants had monthly 3-day visits to the home community . the reduced benefit to migrants with frequent visits reflects that hiv prevention at the workplace did not reduce the migrants ' hiv exposure from home partners . a limitation of the scenario is that it did not capture potential behavior change associated with increasing the proportion of time migrants spend in the home community . if home partners reduced their risk behavior in the perpetual presence of the migrant partner , we would have expected greater benefits to migrants . although our model assumptions were optimistic about the uptake and efficacy of a hypothetical migrant - targeted prevention or treatment intervention , the impact of this intervention was modest on a community level . even after stretching the assumptions of the model to further exaggerate the role of migrants in the community , the optimistic interventions were a far cry from reversing the generalized epidemic at the community level . workplace prevention and test - and - treat for migrants starting in 2015 were unable to reverse the generalized epidemic in the home community within 20 years . to understand why targeting migrants had so little impact at the community level , we experimented with the timing of the migrant - targeted interventions compared to the growth and stabilization of the generalized epidemic . rather than starting workplace hiv prevention in 2015 , we experimented with start dates in earlier years , moving back the start date in one - year increments as far back as the year 1984 , when it was assumed that the first migrants introduced hiv into the community ( figure 3 ) . figure 3.hiv incidence rates among adults age 15 + in the home community after prevention of workplace - acquired hiv infection begins in different years throughout the history of the hiv epidemic . this method of representing of hypothetical past interventions is analogous to johnson and white 's 2011 analysis of hypothetical reductions in concurrency over the history of the hiv epidemic . dots represent the year that workplace prevention begins , and lines of the same shading emanating from these dots represent the impact of sustained workplace prevention on future hiv incidence . targeting migrants in present or future years would fail to collapse generalized epidemics in their home communities . this figure is available in black and white in print and in color at international health online . hiv incidence rates among adults age 15 + in the home community after prevention of workplace - acquired hiv infection begins in different years throughout the history of the hiv epidemic . this method of representing of hypothetical past interventions is analogous to johnson and white 's 2011 analysis of hypothetical reductions in concurrency over the history of the hiv epidemic . dots represent the year that workplace prevention begins , and lines of the same shading emanating from these dots represent the impact of sustained workplace prevention on future hiv incidence . targeting migrants in present or future years would fail to collapse generalized epidemics in their home communities . this figure is available in black and white in print and in color at international health online . beginning workplace prevention in 1984 or earlier would , by definition , prevent the epidemic in our model , because it was assumed that the workplace - derived hiv infections were introduced into the community by migrants beginning in this year . however , delaying the intervention by even a few years after hiv introduction into the community would have failed to avoid a generalized epidemic in the model . to halve the incidence rate in 2020 , intervening in 2015 with workplace prevention provided too little , too late to reverse the generalized epidemic in the home community . an important caveat to the analysis in figure 3 is that it does not capture the changing role of migrant labor over the history of south africa . the frequency of return visits , percentage of community involved in migrant economy , and the proportion of women having migrant and non - migrant partners likely underwent dramatic changes during the dismantling of apartheid . thus , model estimates pertaining to the early hiv epidemic , including year of intervention required to halve incidence ( figure 3 ) , should be interpreted with caution . if these changes had been accounted for , the year of intervention required to halve incidence would likely have been later than suggested by our simplified model . we have modeled the impact of a targeted intervention on a generalized hiv epidemic that had already spread and stabilized in a population . the model scenarios were inspired by research in southern africa analyzing the circular migration patterns of mine workers between rural home communities and dormitories or , increasingly , dense settlements proximal to places of employment . we found that migrant - targeted interventions would have been transformative in the 1980s to 1990s , but post-2015 impacts were modest from the point of view of the hyper - endemic home community . even under extreme assumptions that targetable migrants constituted 10% of the communities ' males ( with 20% of males destined to become migrant workers ) ; that these males constituted the sole external source of hiv into the community ; and that primary prevention could eliminate all workplace - acquired infections , a combination of primary prevention and test - and - treat for migrants averted less than 20% of infections in the community . these extreme assumptions were designed to exaggerate the possible role of male migrant mine workers , to explore whether an extreme assumption could be found in which targeting migrants could collapse the home community 's hiv epidemic . for example , we assumed that male migrant workers constituted the sole source of hiv infections brought into the home community , and that primary hiv prevention could completely eliminate externally - acquired hiv infections . attenuating these assumptions would have reduced the impact of the interventions , which we already found to be modest at the population level in the home community . thus , the extreme assumptions lend confidence to the robustness of our main finding . another way in which we exaggerated the role of migrants was by increasing the proportion of males destined to migrate four - fold : from 5 to 20% . in the 20% scenario , approximately 5% of adults would be employed in mining at any point in time an estimate that may have been reasonable for lesotho at the height of south african gold mining operations , but that is not representative across southern africa . however , demographic surveillance studies in rural south africa have found that the proportion of individuals migrating away from the home can be much higher ( 20% ) especially among older males . the potential impact of a broad migrant - targeting intervention that is not industry - specific is therefore beyond the scope of this analysis . a shortcoming of this analysis is its focus on the home community to which migrants belong , and not on the network of transmission outside the home community . workplace - acquired hiv was modeled as an external source of hiv incidence in migrants , and we assumed that workplace hiv prevention programs could modulate this incidence rate . we did not estimate the role of migrants in the spread of hiv at the workplace site . intensified hiv services for migrant workers and their partners away from home could potentially have a great impact on hiv transmission in settlements proximal to places of employment , but much remains to be learned about the networks of transmission that sustain such epidemics . another shortcoming of the historical analysis is that it did not account for political or historical changes influencing the population or behavior of migrants and their partners . thus , the model can only coarsely approximate the historical timing of a hypothetical intervention that could have interrupted hiv transmission . targeting hiv acquisition by migrants in their place of work provides too little , too late to reverse the hiv epidemic in the home community . however , our model did not capture the network of transmission at the workplace , and therefore does not estimate potential benefits to those put at risk outside the home community . our findings are consistent with the notion that targeting high - risk groups late in the course of a generalized epidemic would yield health benefits to both the risk groups and their home community , but would fail to reverse the generalized epidemic in the home community . such a targeted intervention would have been impactful during the early spread of hiv , but now provides too little , too late . targeting hiv acquisition by migrants in their place of work provides too little , too late to reverse the hiv epidemic in the home community . however , our model did not capture the network of transmission at the workplace , and therefore does not estimate potential benefits to those put at risk outside the home community . our findings are consistent with the notion that targeting high - risk groups late in the course of a generalized epidemic would yield health benefits to both the risk groups and their home community , but would fail to reverse the generalized epidemic in the home community . such a targeted intervention would have been impactful during the early spread of hiv , but now provides too little , too late .

disturbances in cell adhesion and cytoskeleton dynamics could signal an early event in oral carcinogenesis . these alterations , including loss of cell - cell adhesion and increase in cell motility , occur in the epithelial - mesenchymal transition ( emt ) process . emt transition is a biological process characterized by changes in cellular phenotype and function , undergone by cells from epithelial phenotype to motile mesenchymal phenotype . emt is activated by wide - ranging stimuli provided by growing factors and hypoxia , as well as by transcription factors such as snail , slug and twist . twist is an important negative regulator of the transmembrane adhesion protein e - cadherin ; it is believed that the downregulation of e - cadherin is the central event of emt . e - cadherin is located in the epithelial cell regions of cell - cell adhesion known as adherens junctions . e - cadherin loss leads to the disassembly of adherens junctions , increased tumor cell mobility and invasiveness . -catenin is a bifunctional protein that acts in cell adhesion and as a transcription factor activated by the wnt pathway . e - cadherin interacts with -catenin through intercellular connections to form stable adhesions ; the dissociation of this complex is involved in malignant progression . downregulation of membranous e - cadherin and cytoplasmic or nuclear accumulation of -catenin have been previously implicated in the loss of differentiation and more aggressive phenotypes , in a variety of different cancers . recently , it was suggested that the altered expression of e - cadherin/-catenin complex is involved in growth regulation and phenotype changes of both dysplastic oral epithelia and malignant oral epithelia . according to kaur , et al . ( 2013 ) , losses of e - cadherin and -catenin altered expressions are considered early events in oral carcinogenesis . moreover , an aberrant expression of -catenin was also found in actinic cheilitis cases and in oscc of the lip , indicating that altered patterns of this protein are also present in oral lesions with actinic etiology . ( 2009 ) observed an altered expression of catenin in a large group of dysplastic lesions of the oral mucosa . however , they suggest that the role of catenin expression as a prognostic marker in dysplastic oral lesions seems to be restricted . in our previous study , we observed that the downregulation of e - cadherin promoted by twist could be involved in oral carcinogenesis through the wnt pathway . accordingly , the current study aimed at testing this hypothesis by investigating the -catenin immunohistochemical expression in oral leukoplakia ( ol ) with different degrees of epithelial dysplasia and normal oral mucosa . this study was approved by the human ethics committee of the institutional review board ( committee approval no . formalin - fixed , paraffin - embedded tissue samples of 39 ol ( mild dysplasia n=19 , moderate dysplasia n=13 , and severe dysplasia n=7 ) and 10 normal oral mucosa from 18 males and 21 females were collected from the laboratory of oral pathology of the federal university of gois and from the laboratory of oral pathology of the university of so paulo . all the biopsed specimens were collected in the period of 1998 - 2012 . the samples were submitted to 5 m histological sections for routine staining with hematoxylin eosin ( h&e ) and analyzed under light microscopy . the histological grades of oral dysplasia were reviewed by two independent oral pathologists in blind fashion , according to the world health organization ( who ) . any disagreement in the findings was discussed among the pathologists to render a final evaluation . figure 1clinical and pathological characteristics of the oral leukoplakia sample the immunohistochemical reactions were performed using 3 m 4% formalin - fixed slides followed by dewaxing and rehydration in an ethanol series . antigen retrieval consisted of immersing the sections in a solution of 10 mm monohydrated citrate buffer solution ( ph 6.0 ) and heating them in a water bath at 95c for 30 minutes . endogenous peroxidase activity was blocked with 6% hydrogen peroxide and a methanol solution , in two baths of 15 minutes each at room temperature . after washing with tris buffer ( ph 7.4 ) , the slides were incubated with anti--catenin ( e-5 ; santa cruz biotechnology , santa cruz , ca , us , dilution 1:100 ) primary antibody overnight at 4c . the slides were then exposed to avidin - biotin complex ( lsab - kit + hrp ; dakocytomation , carpinteria , ca , usa ) and to 3,3-diaminobenzidine chromogen ( dab+ ; dakocytomation , carpinteria , ca , usa ) . the sections were counterstained with meyer hematoxylin , dehydrated in ethanol , cleared in xylene , and mounted . a qualitative -catenin analysis was performed based on the percentage of positive cells , considering positive only those specimens that presented 25% or more cells presenting -catenin expression . the cellular location ( cytoplasmic membrane , cytoplasm and nucleus ) and the epithelial layer ( basal , parabasal and spinous cell layers ) were also considered . -catenin immunohistochemical expressions were analyzed by two independent blind and calibrated observers under light microscopy at 200-fold magnification . the data was tabulated with microsoft excel software , and statistical analysis was performed by statistical package for social sciences software ( spss 16 , headquarters , usa ) . the chi - square test and the fisher s exact test formalin - fixed , paraffin - embedded tissue samples of 39 ol ( mild dysplasia n=19 , moderate dysplasia n=13 , and severe dysplasia n=7 ) and 10 normal oral mucosa from 18 males and 21 females were collected from the laboratory of oral pathology of the federal university of gois and from the laboratory of oral pathology of the university of so paulo . all the biopsed specimens were collected in the period of 1998 - 2012 . the samples were submitted to 5 m histological sections for routine staining with hematoxylin eosin ( h&e ) and analyzed under light microscopy . the histological grades of oral dysplasia were reviewed by two independent oral pathologists in blind fashion , according to the world health organization ( who ) . any disagreement in the findings was discussed among the pathologists to render a final evaluation . the immunohistochemical reactions were performed using 3 m 4% formalin - fixed slides followed by dewaxing and rehydration in an ethanol series . antigen retrieval consisted of immersing the sections in a solution of 10 mm monohydrated citrate buffer solution ( ph 6.0 ) and heating them in a water bath at 95c for 30 minutes . endogenous peroxidase activity was blocked with 6% hydrogen peroxide and a methanol solution , in two baths of 15 minutes each at room temperature . after washing with tris buffer ( ph 7.4 ) , the slides were incubated with anti--catenin ( e-5 ; santa cruz biotechnology , santa cruz , ca , us , dilution 1:100 ) primary antibody overnight at 4c . the slides were then exposed to avidin - biotin complex ( lsab - kit + hrp ; dakocytomation , carpinteria , ca , usa ) and to 3,3-diaminobenzidine chromogen ( dab+ ; dakocytomation , carpinteria , ca , usa ) . the sections were counterstained with meyer hematoxylin , dehydrated in ethanol , cleared in xylene , and mounted . a qualitative -catenin analysis was performed based on the percentage of positive cells , considering positive only those specimens that presented 25% or more cells presenting -catenin expression . the cellular location ( cytoplasmic membrane , cytoplasm and nucleus ) and the epithelial layer ( basal , parabasal and spinous cell layers ) were also considered . -catenin immunohistochemical expressions were analyzed by two independent blind and calibrated observers under light microscopy at 200-fold magnification . the data was tabulated with microsoft excel software , and statistical analysis was performed by statistical package for social sciences software ( spss 16 , headquarters , usa ) . the chi - square test and the fisher s exact test in general , -catenin immunohistochemical staining was observed in the cytoplasmic membrane in all ol dysplastic groups ( n=39 ; mild , moderate and severe dysplasia ) ( figure 2 ) . in mild , moderate and severe dysplasia , -catenin staining was also detected in the cytoplasm in 51.2% ( n=20 ) of ol cases ( figure 2 , a - f ) . in addition , membranous expression of -catenin in parabasal and basal layers was gradually lost in the higher degrees of epithelial dysplasia ( figure 2 , b , d , f , h ) . figure 2-catenin immunohistochemical expression in oral leukoplakia ( ol ) ( mild , moderate and severe dysplasia ) and normal oral mucosa . ( a ) -catenin cytoplasmic membrane staining , in all three layers of mild dysplasia ( x100 ) , and ( b ) in the cytoplasm of basal and parabasal cells . ( c , d ) illustrations of the -catenin cytoplasmic membrane ( cm ) expression in the upper layers of moderate dysplasia , showing a decrease in cytoplasmic membrane expression , with more evident cytoplasmic localization in basal and parabasal cells ( arrows head ) ( x100 - x400 ) . ( e , f ) weak membranous expression of -catenin in parabasal and basal layers of severe dysplasia , with a significant increase in its expression , in the cytoplasm ( arrows head ) of cells of basaloid appearance ( x100 - x400 ) . ( g , h ) -catenin in normal oral mucosa ( x100 - x400 ) in normal oral mucosa , -catenin was detected only in the cytoplasmic membrane ( figure 2 , g - h ) . on the other hand , a significant difference in -catenin cytoplasmic staining was identified among all the ol groups ( chi square test p<0.001 ) ( table 1 ) . when specifying these differences in the -catenin expression , a significant increase in cytoplasmic -catenin could be observed between mild and moderate dysplasia ( fisher exact test - p<0.001 ) , mild and severe dysplasia ( p<0.001 ) , normal oral mucosa and moderate dysplasia ( p<0.001 ) , and oral normal mucosa and severe dysplasia ( p<0.001 ) ( table 1 ) . table 1differences in -catenin expression in mild , moderate and severe oral dysplasia , and normal oral mucosa ( control)a , bcytoplasmic localizationmildmoderateseverecontrolp n%n%n%n% basal layerab , ac , ad , b , c negative1789.5215.4010100 positive210.51184.671000<0.001total1910013100710010100 basal and parabasal layersab , ac , ad , b , c negative19100430.8114.310100 positive0969.2685.70<0.001total1910013100710010100 chi - square test equal letters indicate statistical difference by fisher 's exact test equal letters indicate statistical difference by fisher 's exact test analyzing the cytoplasmic -catenin distribution among epithelial layers , a predominance of basal and parabasal localization of this protein was noted in the highest grades of dysplasia ( moderate and severe dysplasia ) ( figure 2 , c - f ) . in mild dysplasia , cytoplasmic -catenin staining was found only in the basal layer ( figure 2 , a - b ; table 1 ) . -catenin is an adhesion molecule that interacts with e - cadherin through its cytoplasmic domain . the e - cadherin - catenin complex disruption from cell membrane seems to be important in malignant transformation , and interferences in this complex could lead to -catenin cytoplasmic accumulation and consequent nuclear translocation . this altered localization is related to the activation of some genes involved in cell proliferative activities , malignant transformation and tumor progression . accordingly , the twist protein seems to play an important role in e - cadherin repression , also linked to -catenin altered expression through the wnt pathway . the altered expression of e - cadherin immunoexpression found in epithelial dysplasia , and the possible role of twist in oral malignant transformation , found in our previous reports , led us to investigate the -catenin immunohistochemical in oral leukoplakia ( ol ) with different degrees of epithelial dysplasia . in this study , we observed an altered ( cytoplasmic ) -catenin immunoexpression among ol dysplastic groups . in our previous report , we showed a gradual decrease in e - cadherin immunoexpression in the basal and parabasal cell layers , as the degree of dysplasia increased . interestingly , in the present investigation we found a similar inverse pattern , with a predominance of basal and parabasal localization of cytoplasmic -catenin , and with an intensification of its expression concomitantly with ol progression to a more severe grade of dysplasia . this could indicate the presence of disturbances in the e - cadherin - catenin complex in ol , thus indicating that losses of e - cadherin and -catenin abnormal expressions are early events of oral carcinogenesis . in this case , it is plausible to assume that cytoplasmic -catenin could participate in oral malignant transformation , insofar as its cytoplasmic accumulation has been demonstrated in different tumours and also in oral epithelium with dysplastic changes . although nuclear -catenin is considered a solid sign of pathway deregulation , it is reasonable to presume that the cytoplasmic -catenin localization found in the present study is an event that precedes -catenin translocation to the nucleus . theoretically , this may be attributed to activation of the wnt pathway that inhibits phosphorylation and degradation of -catenin , and that induces its cytoplasmic accumulation . additionally , downregulation of membranous e - cadherin with cytoplasmic accumulation of -catenin has been previously reported in several tumors . recently , a few studies have also found increased -catenin cytoplasmic accumulation in oral dysplasia . nevertheless , the exact role of catenin expression in oral malignant transformation is still uncertain . ( 2007 ) observed -catenin expression in the cell membrane and the cytoplasm of 24% of basal and spinous cells of oral leukoplakia without dysplasia . however , they also found significant nuclear -catenin expression in more than 80% of epithelial cells of oral leukoplakia with dysplasia . additionally , it was noted that the nuclear expression of -catenin in epithelia increased depending on the grade of dysplasia . ( 2009 ) evaluated the immunohistochemical staining of -catenin and -catenin in 49 cases of oral epithelial dysplasia and in 10 samples of normal oral mucosa . as in the present study , they described that when the catenin expression was lost , a cytoplasmic delocalization occurred . however , they were not able to find significant differences in the catenin expression between cases that progressed to oral squamous cell carcinoma ( oscc ) and cases that did not . in cases of carcinoma in situ , ( 2011 ) observed -catenin in the nucleus of cells with a basaloid appearance and a diffusely -catenin expression in the cytoplasm of lower - half basaloid cells . although they considered the nuclear expression of -catenin a sign of its nuclear translocation , they also mentioned that -catenin had been previously found restricted to the cytoplasm in oscc samples . in the present investigation , we found a similar cytoplasmic expression in basaloid cells in lower - half of ol dysplastic epithelia . this could indicate that cytoplasmic accumulation of -catenin participates in the acquisition of a more motile phenotype . in a recent study , schussel , et al . ( 2011 ) evaluated cases of actinic cheilitis ( ac ) and squamous cell carcinoma ( scc ) of the lip , and observed that most cases of ac showed both membrane and cytoplasmic expression of -catenin , with only 22% expressing -catenin in the nucleus . our data showed that membranous expression of -catenin in parabasal and basal layers was gradually lost in the higher degrees of epithelial dysplasia . in addition , a significant difference in -catenin cytoplasmic staining was identified among all the ol groups . the -catenin cytoplasmic expression observed in this study may represent the initial stage of modifications in the e - cadherin - catenin complex , along with morphological cellular changes . we suggest that this cellular mechanism could be associated with twist overexpression through the wnt pathway .

the role of steroid hormones in the pathogenesis of periodontal diseases is well established . oral contraceptives ( ocs ) may enhance periodontal breakdown by reducing the resistance to dental plaque and may induce gingival enlargement ( ge ) in otherwise healthy females.1,2 ocs accentuate the gingival response to local irritants similar to that seen in pregnancy.3 the incidence and severity of gingival diseases are positively correlated with plasma sex hormone concentrations and duration of use.4 the long term use of oc may cause increased gingival inflammation , clinical attachment loss ( cal ) and gingival enlargement.2,4,5 in contrast , a clinical study was unable to demonstrate any effect of low dose ocs on gingival tissue.6 human gingiva contains estrogen and progesterone receptors . the latter influence the periodontal tissues to act as target organ for sex hormones.2 in most cases , the ge was reversed when oc was discontinued or the dosage reduced.2 we report here a case of successfully treated oc induced periodontal endocrinopathies ( ocipe ) . in may 2007 , a 32-year - old , otherwise healthy woman reported in our periodontal clinic , with chief complaint of gum bleeding followed by swelling of gingiva for the last four years . the condition was first noticed by the patient after two years of combined pill ( lynestrenol 2.5 mg plus ethinyl oestradiol 50 g - sukhi , famy care ltd , india ) intake whereas tooth mobility appeared after 3.5 years . she underwent phase - i therapy ( scaling & root planning - srp ) twice by her dentist following withdrawal of oc six months ago that resulted in improvement of bleeding tendency only . the estimated value of plasma estradiol and progesterone level at the stage of oc use was 81pg / ml and 16ng / ml respectively . the plasma estradiol and progesterone level was decreased to 75pg / ml and 12ng / ml respectively after withdrawal of oc . family history of ge , other drug histories and menstrual history were non - contributory . periodontal examination revealed painless , reddish - pink , soft , diffuse ge over severely compromised periodontium , mild to severe generalized cal in spite of fair oral hygiene , insufficient attached gingiva ( ag ) in second and third quadrant along with multiple mobile ( miller s degree 2 ) teeth . the recorded pocket depth and tooth mobility of diseased periodontium after thorough history taking and clinical examination , the patient was advised to do necessary blood examinations and orthopantomogram ( opg ) ( figure 1 ) . patient education , motivation and oral hygiene instructions ( ohis ) were explained to her . considering patient s history , oral examination and evaluating the reports of investigations ( i.e. , normal blood picture , normal plasma estrogen - progesterone level , generalized horizontal bone loss in opg ) , the case was provisionally misdiagnosed as generalized chronic periodontitis ( ignoring patient s drug history ) and traditional phase - i therapy was performed twice at six weeks interval . gingival response was re - evaluated three months thereafter ; when inflammatory condition of gingiva was improved enough but ge was not reversed ( figure 2 ) . when the lesion was not reversed following withdrawal of the pill or by repeated non - surgical measures , incisional biopsies were performed at keratinized gingival tissues , disto - buccal to second molars of each quadrant and submitted for microscopic examination . tissue sections revealed variably thick hyper - keratinized stratified squamous epithelium and elongated , broad retepegs . the connective tissue stroma was thick , edematous but fibrous in nature , containing mature fibroblasts , mild degree of chronic inflammatory infiltrates and numerous , small blood vessels . these characteristic microscopic findings ( figure 3a , b ) were very similar to ge in pregnancy or long standing pyogenic granuloma . extensive patient s history , clinical , radiographic and especially microscopic findings were interpreted as diagnostically consistent with oc induced periodontal endocrinopathies ( i.e. , attachment loss , gingival enlargement ) . surgical intervention was planned for correction of enlarged gingiva to prevent progressive periodontal breakdown and to maintain better access for plaque control . each quadrant was treated according to criteria for surgical method selection [ i.e. , probing pocket depth ( ppd ) , remaining ag , pattern of bone loss , furcation defects in opg ] . periodontal surgical procedures were planned in the following manner for each quadrant : ( a ) right maxillary canine to second molar - modified widman flap surgery ( i.e. , ppd > 4 mm , ag > 2 mm ) . ( b ) left maxillary canine to second molar apically repositioned flap ( arf ) surgery with modification buccally ( designed to preserve adequate width of ag ) , internal bevel gingivectomy palatally , along with excision of localised gingival excess over maxillary tuberosity . ( c ) left mandibular lateral incisor to second molar - similar arf surgery ( ppd 5 mm , cal 5 mm , ag < 2 mm , severe ge buccally ) with modification . ( d ) right mandibular canine to second molar - internal bevel gingivectomy was designed to remove moderate amount of enlarged gingiva ( ppd 4 mm , remaining ag 3 mm , cal 3 mm ) bucco - lingually . standard surgical procedures were performed according to treatment plan.7 basic surgical procedures were modified at second and third quadrant . in either area , split - thickness flap was prepared by sharp dissection up to the level of mucogingival junction to create a thin flap outside as well as to sacrifice entire gingival excess internally ( figure 4a , b ) . then full - thickness flap was elevated apically to facilitate repositioning of flap towards mucobuccal fold . close monthly follow up for first postoperative ( p.o ) year and three monthly thereafter , were scheduled to assess possible relapse , progressive attachment loss and to provide comprehensive maintenance care . pocket depth ( figure 5 ) , tooth mobility and gingival enlargement were reduced remarkably ( table 1 ) but attachment gain was minimal . although periodontal surgery was satisfactory but p.o plaque control and patient compliance provided excellent response to therapy . the patient has been closely followed for over 3 years and to date reveals no evidence of recurrence of ge ( figure6 ) and progressive attachment loss . combined pill is the most popular , most efficacious oc agent and one of the most widely used classes of drugs in the world.8 nonetheless , ocipe are relatively scarce in recent decades , perhaps due to current low dose oc formulations , alternate withdraw / choice of contraception methods , good plaque control and nst . an understanding of the etiology of periodontal endocrinopathies is essential for the prevention and/or treatment of sex steroid hormone induced periodontal diseases . gingival changes are related to the stimulation of specific populations of fibroblasts by estrogen , increased vascular permeability and proliferation.2 both the sex hormones decrease gingival immune response to plaque bacteria.9 inflamed gingival tissues are capable of metabolizing sex hormones to active metabolites at higher rate;10 thus , local irritants may exaggerate oc induced gingival changes . therefore , the response of the periodontium in ocipe is probably multifactorial in nature where dose , duration of pill usage , dental plaque and sex hormone - sensitive cells are the key modifying factors.2,5 literatures reported gingival changes with the use of high - dose oc compositions ( 50 g / day estrogen and 4 mg progesterone / day ) prior to the 1980s but rare with current low dose formulations.4,11 in our case , patient received low dose oc formulation over 5 years . lynestrenol is strong synthetic progesterone , which has additional weak estrogenic effect.12 so gingival changes observed in our case are assumed to be related with additional estrogenic and strong progestational effects of the pill . the periodontium would appear to be an odd target of ocs.2 in gingival tissues , estrogen is responsible for keratinization and proliferative changes in epithelium and increased fibroblastic activity.2 progesterone increases proliferation , dilatation , tortuosity and permeability of gingival microvasculatures , facilitates bone resorption , decreases collagen production ; thus promoting tissue catabolism and delaying repair.2,13,14 hence , estrogen and especially progesterone in oc can contribute to periodontal changes similar to pregnancy.3,5 our reported case was in excellent agreement with previous study which demonstrated the possibility of gingival changes with low dose oc formulations.15 an interesting aspect of this case relates to the fact that the ge was not reversed either on discontinuing oc or by repeated srp , though literatures revealed complete disappearance in most cases.6 physiological concentrations of estradiol were found to stimulate gingival fibroblast proliferation in vitro.2 in our case , persistence of ge even after withdrawal of oc questions the role of physiologically fluctuating level of sex hormones related to menstrual cycle on presensitized gingival cells . moreover , presence of deep pockets and ge hinder the adequacy of oral hygiene measures which may be another cause of persistence of ge . therefore , it was necessary to determine the nature of lesion or to rule out diverse causes such as idiopathic ge , and hemopoetic malignancies by incisional biopsies of gingiva prior to surgery . although long standing history limits the possibility of malignant involvement but clinical findings ( gum bleeding , non - reversibility of ge ) led us to consider it for differential diagnosis . light microscopy revealed consistent spectrum of findings similar to that seen in pregnancy and so most likely related to oc use . in retrospect , there was initially a hint of underlying ocipe in patient s history . thus , composite evidences ( i.e. , history , clinical - radiological - histological findings ) led us to interpret the case finally as ocipe . soft , vascular gingival tissues were difficult to manage during surgery but p.o healing was uneventful . osseous resection and regenerative surgery were decided not to be performed in the presence of mobile teeth . curettage and debridement of involved furcations alone were sufficient to maintain the function of those compromised teeth . she remains free of recurrence to date and continues to be monitored on a regular basis . periodontists are in a prime position to counsel the effects of ocs in oral health and to treat unhealthy periodontal conditions . this case reaffirms the fact that periodontal surgery , patient compliance and comprehensive maintenance care are essential to return to healthy periodontal status in such conditions .

colonoscopy is regarded as the most effective tool for colorectal screening in older patients ( > 50 years of age ) with an average risk of colorectal cancer and in younger patients with a high risk of colorectal cancer . decreased incidence of colon cancer is associated with optimal colonoscopic examination of the entire colon . regardless of indication , however , it has been reported that inadequate bowel cleaning is observed in approximately 25% of all colonoscopies . adverse results of insufficient colon cleaning include decreased adenoma detection and cecal intubation rates , prolonged procedural times , and shortened surveillance intervals [ 3 - 6 ] . numerous studies have investigated the risk factors of inadequate bowel cleaning [ 7 - 9 ] and found that it occurs more frequently in patients with a history of insufficient colon cleaning , polypharmacy ( due to the effect of constipating medication ) , obesity , old age , male patients , and in those with combined medical diseases such as diabetes mellitus , stroke , dementia , and parkinson s disease [ 10 - 12 ] . in addition , poor compliance with bowel cleaning procedures , inadequate administration of bowel preparation agent , and prolonged pre - procedure waiting times have been shown to result in poor colon cleaning . it is crucial that physicians bear these numerous modifiable factors in mind , with the aim of reducing the incidence of failed colonoscopies and to improve results . in this section , patient - associated risk factors for inadequate colon cleaning and salvage methods will be discussed . several studies have reported that advanced age is a predictive factor for inadequate bowel cleaning in colonoscopy . one retrospective study showed that patients aged older than 66 years were associated with insufficient bowel cleaning for colonoscopy . in two recent studies in asia , patients aged older than 60 years were found to be closely associated with inadequate colon cleaning . it is recognized that advanced age is associated with decreased colon transit , increased comorbidity , and polypharmacy ; all of which are known risk factors for poor colon cleansing [ 15 - 19 ] . however , a large - scale prospective study found that age was not likely to affect the quality of bowel cleaning for colonoscopy , although patient mean age ( 56 years ) was significantly lower than that reported by other studies . studies conducted in both the west and the east have previously reported that male sex is an independent risk factor for inadequate bowel cleaning . in a study of 649 patients , 141 patients were shown to have undergone poor bowel preparation and male sex was found to be a significant predictive factor for poor bowel cleaning . the relationship of comorbidities with optimal bowel preparation has previously been investigated in several studies . in a recent study of 300 outpatients who underwent colonoscopies , polypharmacy ( defined as more than eight active medications available by prescription ) , which is an indicator of comorbidities , was found to be a risk factor for inadequate bowel cleaning . among frequent chronic diseases , diabetes in particular has been consistently associated with inadequate bowel cleaning . in a study of 367 korean patients , it was demonstrated that the risk of poor bowel cleaning was higher in diabetic patients when compared with non - diabetic patients ( odds ratio , 8.6 ) . taylor and schubert used a standard polyethylene glycol ( peg ) bowel preparation and showed that the optimal bowel cleaning rate was 97% in non - diabetic patients compared to 62% in diabetic patients . diabetes is associated with reduced colonic and general gastrointestinal transit , resulting in a higher occurrence of inadequate bowel cleaning . in addition , stroke and dementia are known to be high risk factors for inadequate bowel cleaning , possibly associated with decreased gastrointestinal motility and the patients capacity to follow bowel cleaning instructions . one study further revealed that previous surgery of the abdominal or pelvic organs was a risk factor for poor bowel cleaning . in both inpatients and outpatients referred from other clinic , bowel preparation for previous studies have shown that inpatient status is associated with increased inadequate bowel cleaning , which is further associated with prolonged immobility and low compliance with preparation procedures , due to underlying disease . in colon surgery , outpatient bowel cleaning has been associated with a better result than that of inpatients , who have increased comorbidities . however , a model based on the aforementioned risk factors for inadequate bowel preparation has been shown to have a prediction rate of just 60% . therefore , in patients undergoing their first colonoscopy , the european society of gastrointestinal endoscopy ( esge ) guidelines do not recommend the use of this model for identifying those with a high risk of poor colon cleaning and modifying the colon preparation . in patients with insufficient bowel preparation , the use of endoscopic irrigation pumps or repeated colonoscopy on the following day ( after further colon cleaning ) is recommended by the esge guidelines , although evidence supporting these approaches is weak . if patients with a high risk of inadequate preparation can be identified before colonoscopy , salvage options to improve the quality of bowel preparation could be used before sedation . in patients with brown liquid or solid effluent , the probability of inadequate bowel preparation has been reported to be 54% . in such cases , additional bowel cleaning using large - volume enemas or extra oral purgatives could be performed . the usefulness of an endoscopic enema as a salvage method at colonoscopy has been previously described . in those studies , one study investigated the method in 21 adults ( mean age , 66 years ) with insufficient bowel preparation . after inserting the colonoscope as proximally as possible , enemas of either sodium phosphate ( 133 ml/19 g ) followed by bisacodyl ( 37 ml/10 mg ) , or two bisacodyl , another study evaluated 26 adults ( median age , 59 years ) using the aronchick scale for assessment of preparation quality on the rectosigmoid colon . in those patients with insufficient bowel preparation , a salvage enema with peg ( 500 ml ) was applied on the area of hepatic flexure through an accessory channel of the colonoscope . by adapting the method , 25 patients ( 96% ) the main cause of failure at second colonoscopy was insufficient colon preparation ( 23% ) among patients undergoing a second examination due to inadequate cleaning at first colonoscopy . in such cases , examination on the following day could improve bowel preparation as opposed to examination at any other time . in a study of adult patients with a previous inadequate preparation for colonoscopy , an intensive bowel preparation method was performed before the second examination . using the boston bowel preparation scale ( bbps ) , a score of 0 or 1 on any segment was regarded as inadequate preparation at first colonoscopy . in such cases , the intensive preparation method included a low - fiber diet for 3 days , followed by a liquid diet the day before colonoscopy . on the evening of the colonoscopy , bisacodyl ( 10 mg ) with peg - electrolyte lavage solution ( els ; 1.5 l ) was administered . a second dose of peg - els ( 1.5 l ) was provided on the day of the examination . using this method , 90% of patients were scored as having optimal cleaning on the bbps ( 2 for each segment ) . adequate bowel preparation is crucial to the efficacy and safety of the colonoscopy procedure . however , bowel preparation is limited by the patient s special conditions ; such as age , sex , and underlying diseases that can prevent compliance with bowel preparation orders . therefore , it is essential that the endoscopy team identifies the patient s special situation and selects a proper cleaning agent and regimen , including supplemental measures , in order to improve the efficacy and safety of bowel preparation and hence colonoscopy .

the aim of this study was to review and describe the ct findings in patients diagnosed with xgn from our institution in the past 5 years . eleven patients underwent preoperative ct and 13 studies ( 2 patients had two preoperative scans each ) were available and retrieved from the digital image archive . ten studies were performed on a 16-slice multidetector ( mdct ) machine ( somatom sensation 16 , siemens ag , erlangen , germany ; tube voltage 120 kv , tube current 250 ma , section thickness 3 mm , and reconstruction interval of 1.5 mm ) . two studies were performed on a single - slice helical machine ( philips secura , amsterdam , the netherlands ; tube voltage 130 kv , tube current 30 ma , 95 ma , section thickness 10 mm , reconstruction interval 8 mm , and pitch of 1.5 ) . one study was on a 64-slice mdct machine ( toshiba aquilion , tokyo , japan ; renal colic low dose protocol tube voltage 120 kv , tube current 180 ma , section thickness 5 mm , and reconstruction interval 5 mm ) . nonionic contrast medium ( 1.5 ml / kg ; 300 mg iodine / ml ) was administered via a pump injector ( stellant , medrad , warrendale , pennsylvania , usa ) at a rate of 3 ml / sec with images obtained after a 60-sec delay in the portal venous phase of enhancement . the images were retrospectively reviewed on a workstation ( agfa impax 5.1 , morstel , belgium ) by two consultant uroradiologists ( ar and km ) . the kidneys were assessed for parenchymal inflammation and destruction , enlargement , calyceal dilatation , the presence of an obstructing renal calculus , demonstrable focal fat deposits , and any evidence of extrarenal extension . the renal size was estimated by measuring the maximum renal length on coronal images , and the anteroposterior diameter at the interpolar level of the renal hilum on the axial images . extrarenal extension was defined as the presence of inflammatory changes in the perinephric tissues as evidenced by perinephric fat stranding , pararenal fascial thickening , the presence of related collections / abscesses or inflammation in the retroperitoneum , and adjacent abdominal organs . thirteen ct studies of 11 patients ( 6 females and 5 males ) were analyzed . the mean age of the study population was 61.8 years ( range 3986 years ) . ten patients had diffuse xgn changes on histology , while one patient had focal disease . renal enlargement was demonstrable on ct in all patients as an increase in either the ap dimension or renal length on the affected side [ table 1 ] . six patients ( 55% ) had a renal pelvis or upper ureter calculus causing obstruction . three patients ( 27% ) had focal fat deposits identifiable within the inflamed renal parenchyma . ten patients ( 91% ) had extrarenal extension of the inflammatory changes , with perinephric and pararenal space stranding and associated perirenal fascial thickening . three patients ( 27% ) demonstrated more extensive retroperitoneal inflammation , with abscesses within the ipsilateral psoas muscle and extension of inflammation to the abdominal wall . the etiology of xgn remains unclear , but patients are typically middle aged and diabetic female patients , who commonly present with recurrent urinary tract infections , flank pain , hematuria , and occasionally sepsis and weight loss.[26 ] the main predisposing renal factor appears to be obstruction , and an obstructing renal calculus is present in up to 75% of cases . it is postulated that renal obstruction promotes recurrent renal tract infections that lead to an abnormal immune response that is responsible for the chronic changes and parenchymal destruction that ensues . the nonspecific clinical presentation of patients with xgn was responsible for the difficult preoperative diagnosis of the condition , and as a result , a significant number of cases were diagnosed on histology after radical nephrectomy was performed for presumed renal cancer . an example of this difficulty in diagnosis before the advent of ct was highlighted in a retrospective analysis by malek et al , in which the diagnosis of xgn was correctly made preoperatively in only 1 of 26 patients . histologically , the inflammatory foci typically display a central nidus of active inflammation and debris surrounded by a granulomatous reaction in which foamy macrophages are prominent , the latter containing abundant cytoplasmic lipid that imparts a yellowish color grossly . ( a ) gross nephrectomy specimen showing characteristic lobulated xanthomatous lesions confined to the renal parenchyma ( double arrowhead ) caused by an obstructing staghorn calculus ( white arrowhead ) within the renal pelvis which has caused secondary hydronephrosis the dilated upper pole calyces contain purulent green colored fluid ( single black arrowhead ) . note the wedge - shaped area of cortical inflammation ( arrowhead ) in continuity with a larger nodular area extending into perinephric fat ( double arrowhead ) . ( c ) renal parenchymal granulomatous inflammation with multinucleate giant cells and focal necrosis ( far right ) . the inflammatory infiltrate is rich in histiocytes , some of which have a foamy appearance reflecting high intracellular fat content . ( d ) the inflammatory reaction extends into perinephric fat ( represented by the clear spaces ) and with time will undergo organization and fibrosis . when present , the ct equivalents of the typical pathology findings are quite characteristic , and as a result , ct has considerably improved the ability to diagnose xgn preoperatively . multiple areas of low attenuation are visualized within the kidney , representing dilated renal calyces and pus - filled cavities replacing destroyed renal parenchyma . on contrast - enhanced studies , the walls of the dilated calyces demonstrate enhancement due to the vascularity of the surrounding granulation tissue and compressed normal renal parenchyma [ figures 2 and 3 ] . contrast - enhanced ct shows multiple low attenuation areas ( arrow ) in right kidney surrounded by intensely enhancing walls . ( a ) xgn in an 82-year - old female with known renal stones who presented with obstructive uropathy and hyperkalemia . noncontrast ct image shows right renal enlargement and dilated calyces with an obstructing renal calculus ( black arrow ) . ( b ) dmsa image shows no uptake in right kidney and 100% function in left kidney . calyceal dilatation is commonly due to obstruction from a renal or upper ureteric calculus . in the present case series , an obstructing calculus was present in only six cases ( 55% ) [ figures 3 and 4 ] . recent work by loffroy et al demonstrated hydronephrosis in 90% of cases , with staghorn calculi present in 6 of 13 ( 46% ) cases . ( a ) xgn in a 40-year - old female with chronic pancreatitis , fever , and weight loss . ultrasound image showed an enlarged kidney with focal cystic areas ( stars ) , reported as likely renal abscesses . ( b ) selected axial ct image shows multiple enhancing dilated calyces ( black arrowheads ) and an obstructing renal calculus ( white arrow ) . in the present series , unilateral renal inflammation and enlargement were the most consistent findings demonstrated on ct and were present in all patients . this suggests that comparative estimation of renal size should always be performed in the ct evaluation of every patient with suspected xgn . this can be accurately done on ct as supported by a recent study by kang et al which compared the accuracy of various imaging modalities in estimating renal size . in their study , the authors conclude that the measurement of the renal length on coronal ct sections provides the most accurate estimation of renal size . extrarenal extension was characterized by stranding and inflammatory changes in the perinephric fat and associated thickening of the pararenal fascia [ figure 4 ] . a number of patients had more extensive extrarenal inflammation with abscess formation and variable involvement of the adjacent abdominal organs and retroperitoneum [ figure 5 ] . there are literature reports of extensive extra renal disease that extends posterolaterally to the abdominal wall . in these circumstances , there is perinephric stranding and thickening of the posterior pararenal fascia ( white arrows ) . the pathologically distinguishing feature of xanthomas was infrequently observed , as only three patients ( 29% ) had demonstrable focal fat deposits representing discrete xanthomas . whether it is a useful distinguishing finding is debatable as there are other renal masses that may contain focal fat deposits within them , notably liposarcomas and angiomyolipomas . to the best of our knowledge , there are no previous studies in the literature documenting the incidence of this finding . summary of findings in xgn focal xgn presents a particular diagnostic challenge as focal xgn changes may be misreported as renal cell carcinoma or lymphoma [ figure 6 ] . focal xgn may be indistinguishable from other renal pseudotumors that include focal pyelonephritis and renal abscesses . in these cases , it is interesting to note that in the present series , perinephric stranding and pararenal fascial thickening were demonstrable in the single case of focal xgn . conversely , one patient with histologically diffuse disease had no ct evidence of extrarenal extension . the evolving role of magnetic resonance imaging ( mri ) in characterizing focal renal masses may prove useful in these cases , but mri findings of xgn are nonspecific , and more work is needed to assess the diagnostic utility of this modality . low attenuation lesion ( 23 hu ) in lower pole of left kidney ( black arrow ) note associated inflammation in the posterior perinephric space and thickened pararenal fascia ( white arrows ) . the limitations of this study were that it was a retrospective review of a small sample size . with increasing use of ct in the diagnosis of the condition , larger prospective series the most typical features of xgn on ct are unilateral renal enlargement and extrarenal extension of inflammatory changes . their presence in a patient with constitutional symptoms and urinary tract infection should alert the radiologist to the possibility of this uncommon condition . demonstrable focal fat deposits representing the pathologically distinguishing feature of xanthomas are an infrequent finding on ct .

it has many clinical and socio - economic impacts on patients , families and the community . in areas where mycetoma is endemic , local health care facilities and health education mycetoma is a hard - to - treat disease in many tropical and subtropical regions due to multifactorial reasons . although such infections rarely cause disseminated or invasive disease , they have an important impact on public health , and timely diagnosis and appropriate treatment remain important . although some implantation mycoses are found in immunocompromised persons , the immunocompetent population is the principal target in iran . mycetoma appear as inflammatory pseudotumors , and chronic granulomatous infection of the skin and subcutaneous tissue due to bacterial or fungal agent . it has many clinical and socio - economic impacts on patients , families and the community . in areas where mycetoma is endemic , local health care facilities and health education mycetoma is a hard - to - treat disease in many tropical and subtropical regions due to multifactorial reasons . mycetoma is a common health problem in the tropical and subtropical regions of asia , africa , sudan , central and south america . disease is unique from other cutaneous or subcutaneous diseases in its triad of localized swelling , underlying sinus tracts and production of grains or granules ( comprised of aggregations of the causative organism ) within the sinus tracts . the most common fungi which are responsible for eumycetoma include : acremonium ( cephalosporium ) falciforme , exophiala ( phialophora ) jeanselmei , madurella grisea , and pseudallescheria boydii , as well as others . actinomycetoma are caused by filamentous bacteria such as : actinomyces israelii , streptomyces somaliensis , and nocardia asteroides and brasiliensis . mycetoma is categorized according to etiology : those caused by filamentous aerobic actinomyces , such as nocardia , actinomadura , and streptomyces , are referred to as actinomycetoma . response to medical treatment is usually better in actinomycetoma than eumycetoma , which is difficult to treat with current therapies . the present report focuses on the etiologic agents and distribution of mycetoma infections in iran from 1994 to 2009 . the present report focuses the etiologic agents and distribution of mycetoma infections in iran during 16 years and highlights the benefits of using observational studies as a form of research . this is a retrospective review of records selected from patients records at the medical mycology department , pasteur institute of iran in tehran , during a period 16 years from 1994 to 2009 . all the cases were categorized depending upon the age , sex , duration of onset , site of involvement , radiological features , histopathology and culture . the material for investigations was collected from scrapings , crusts , pus from subcutaneous abscesses or exudation from sinus tracts , surgical debridement and biopsy specimens . specimens were cultured on sabouraud 's dextrose agar , blood agar and brain heart infusion agar ( b.b.l ) , and fluid thioglycolate , anaerobic culture media , and biochemical properties . duplicate cultures on each medium were incubated at 35 and 25c regularly examined up to four weeks and identified using standard methods . we also used of the czapek 's agar for aspergillus species identification . for diagnosis of nocardia and biochemical tests were performed at the actinomyces reference laboratory of the centers for disease control and prevention ( cdc ) by the methods of berd . of 168 clinically suspected cases of mycetoma , 35 were confirmed by cultural and histopathological methods . they occurred in 22 ( 62.9% ) male and 13 ( 37.1% ) females with a male to female ratio of 5:3 . the majority of the patients were from central and states in south of iran ( khuzestan , bushehr and bandar abbas ) ( 57.1% ) . most patients in urban area were housewives ( 28.6% ) , and in rural area were farmers ( 20% ) [ table 1 ] . frequency of mycetoma respect to occupation infections mainly occur among low socioeconomic groups , methods data were measured from socioeconomic position using education , household income , occupational class and area deprivation . in this study , actinomycetoma ( 54.3% ) were found more often than eumycetoma ( 45.7% ) . there was a past history of reasons to caused the mycetoma in patients in this study included : thistle accidental , hit the rocks , trauma after falling from the roof , cutting through by biting gums , accidental fish bone in the parotid , gum surgery , burn , tattoo removal , electric shock , knee surgery , war veteran , accidental glass palm , artificial joints , skin graft surgery for stumble , accidental needle , tooth infection , and contact with soil ( constructor worker or farmer ) . in this study , 10 patients ( 28.6% ) had concomitant medical problems , including diabetes ( 1_2.9% ) , renal translation and antibacterial and immunotherapy after that ( 2_5 . 7% ) , chronic granulomatosis diseases cgd ( 1_2.9% ) , myasthenia gravis ( 1_2.9% ) , and colon cancer ( 1_2.9% ) . concomitant medical problem in patients with mycetoma the feet were found to be affected in 62.8% of the cases , followed by hands ( 25.7% ) [ figures 12 ] , face ( 2.9% ) , and other affected sit were trunk ( 2.9% ) , neck ( 2.9% ) , and buttocks ( 2.9% ) . note the swelling , deformity and sinuses mix mycetoma in palm and back of hand due to nocardia asteroides and pseudallescheria boydii in the brass worker woman , resident in north of iran out of 35 cases of mycetoma identified , fifteen were actinomyces species [ figures 4 and 5 ] , four nocardia species ( n = 4 ) , and others included aspergillus species ( n = 3 ) [ figures 68 ] , pseudallescheria boydii ( n = 3 ) [ figure 9 ] , fusarium species ( n = 2 ) , acremonium species ( n = 2 ) , paecilomyces species ( n = 2 ) [ figures 1012 ] , and fonsecaea pedrosoi ( n = 1 ) , and candida species ( n = 3 ) [ figure 13 ] , show in table 3 . actinomadura madurae revealing the numerous , delicate ( 1m ) gram positive filaments at the periphery of the granule higher magnification of actinomycetoma granule showing details of granule embedded in purulent exudates h and e stained tissue section of mycetoma showing branched , septate hyphae of aspergillus fumigatus microscopic morphology of aspergillus fumigatus showing typical columnar , uniseriate conidial heads and conidia histopathology of mycetoma showing branched , septate hyphae of aspergillus flavus ( h and e , stain ) microscopic morphology of petriellidium boydii , in the imperfect state , ovoid or pyriform , is produced singly at the tip of conidiophores macroscopic characteristic of paecilomyces lilacinus showing colony pigmentation microscopic morphology of paecilomyces lilacinus showing divergent phialides and chains of ellipsoidal conidia histopathology of paecilomyces lilacinus stained by hematoxylin and eosin colonies of c. albicans , sabouraud glucose agar , 25c distribution of causative agents of mycetoma in iranian patients this paper has highlighted that there is significant benefits of using observational studies in answering questions where large sample sizes of patient groups would be impossible to be accumulated in a reasonable length of time . mycetoma is a slowly progressive , local chronic , granulomatous , inflammatory cutaneous and subcutaneous tissue , fascia , muscle , and bone . infection caused by various genera of fungi ( eumycetoma ) or filamentous bacteria ( actinomycetoma ) organism . mycetoma usually affecting the lower extremities , and is found mostly in india , the middle east , africa and south america in tropical and subtropical climate zones . the majority of the patients reported from iran , were from north and states in south of iran ( khuzestan , bushehr and bandar abbas ) ( 57.1% ) , which has high temperature and humid climate . it may be attributed to subtropical and humid climates in north of iran , so hot and humid climates predispose to fungal , skin diseases . it is similar to survey by zarei et al . in tropical countries , where local health care facilities and health education are disease occurs sporadically throughout most areas of the world , and some postulate that the increased numbers in tropical regions may also be in part the result of decreased use of protective clothing , chiefly shoes , in the warmer , poorer endemic regions . the infection occurs by inoculation as a result of minor injury to the skin , usually on the foot [ figure 1 ] . in this study , it is a slowly progressing disease affecting the deep dermis and subcutaneous tissues that can extent to the underlying bones . the incidence of mycetoma is highest in men , farmers , animal herders , field workers , nomads , those who walk barefoot , and in the third and fourth decades of life . in current study , mycetoma was found to be abundant among housewives , in urban areas and farmers in rural areas of iran [ table 1 ] . however , the disease has also been found in individuals who work in the city in various occupations [ table 1 ] . mycetoma occurs most commonly in people who work in rural areas where they are exposed to soil and plants . in this study male to female ratio were 5:3 . the male predominance in mycetoma was attributed to the greater risk of exposure to organisms in the soil during outdoor activities of men . on the other hand , sex hormones have shown to have a direct influence on the development of the fungus . mycetoma is an infrequent disease in iran and is infrequently reported in the literature . in mycetoma , deformity and disability are common complications and it is difficult to know from this retrospective study whether they were due to disease . furthermore , only a few of the patients recall history of local trauma at the mycetoma site in this series . in one of our patient observed mix infection due to pseudallescheria boydii [ figure 9 ] and nocardia asteroides in palm of hand . she was a 58-year - old women , brass work , and resident in north of iran [ figures 2 and 3 ] . in north of iran , women even take a more active part in agricultural activities and still there is a local male predominance in mycetoma . therefore , the chance of contacting mycetoma is similar for both males and females . the foot was the most common affected location involvement in the present study ( 62.8% ) ; however zarei et al . reported 66.8% in iran . the most common anatomical site affected by this disease is the upper and lower limbs , particularly the feet and the lower legs . in this study , the next most commonly affected sites were hands ( 25.7% ) , face ( 2.9% ) , neck ( 2.9% ) , trunk ( 2.9% ) and buttock ( 2.9% ) areas , but this varies from country to country . rarely , mycetoma can be observed on the buttocks , the groin area the head , and the neck . in current study , 10 patients ( 28.6% ) had concomitant medical problems , it may attributed that among immunocompromised persons , post - traumatic fungal infections are frequent . in the presence of severe underlying immunodeficiency , traumatic inoculation with any fungus may result in rapid local spread and systemic disease , often with fatal outcome . in current study a 78-year - old woman residing in damghan , central of iran , diagnosed with chronic renal failure and diabetes mellitus for a long time . organisms had inoculated in the left hand in the insulin induction site [ figure 14 ] . she had chronic renal failure over a period of 25 years and diabetes mellitus for over 14 years . clinical appearance view of irregular , draining subcutaneous nodules of hand mycetoma due to paecilomyces in the insulin induction site a large variety of microorganisms are capable of producing mycetoma . candida sp . was the causative agents of 8.6% of all cases , and all of them had underlying diseases . underlying diseases for mycetoma due to candida sp . were insulin dependent diabetes , in finger ulcer after electric shock , foot mycetoma in a patient under immunosuppressive therapy for colon cancer and burn , and foot mycetoma following leave mortar wound in a war veteran . although such infections rarely cause disseminated or invasive disease , they have an important impact on public health , and timely diagnosis and appropriate treatment remain important . infections primarily occur among low socioeconomic groups and those living in rural areas or involved in farming , housewife , or other outdoor activities , and particularly among adult men . mycetoma is seen most often in persons , who live in hot , humid climates , therefore it is important for physicians everywhere to be familiar with the mucocutaneous signs and symptoms of tropical mycoses and to be able to perform the proper diagnosis and initiate the appropriate therapy . diseases were abundant among farmers in rural areas of iran , housewives in urban area , northern and southern provinces . if mycetoma is not diagnosed early on , it can cause functional and esthetical impairment . if left untreated , mycetoma can affect the underlying bones , joints , or adjacent organs . the infection occurs by inoculation as a result of minor injury to the skin , usually on the foot . in the patients with severe immunosuppression , cgd , high - dose corticosteroids , and diabetes , if there are risk factors for invasive fungal infections traumatic inoculation with any fungus may result in rapid local spread and systemic disease , with fatal outcome . this article reported selected emerging less common agents of mycetoma ( e.g. candida species and paecilomyces lilacinus ) . paecilomyces lilacinus , a new etiologic agent agent was demonstrated in two cases of eumycotic mycetoma . the global frequency of p.lilacinus infections appears to be increasing , and it is considered as an emerging pathogen , not only in patients with a compromised immune system , but also in apparently healthy people . this study highlights the benefits of using observational studies as a valuable tool in answering questions where large sample size of patient groups would be impossible to be accumulated in a reasonable length of time . infections primarily occur ( 1 ) among low socioeconomic groups , ( 2 ) among those living in rural areas or involved in farming , or other outdoor activities , and ( 3 ) particularly among adult men . this article focuses on microbiology and clinical feature of the most clinically significant implantation mycoses in iran . in this article reported selected emerging less common agents of mycetoma ( e.g. , candida species and paecilomyces lilacinus ) . paecilomyces lilacinus , a new mycetoma agent was demonstrated to be the etiologic agent in two cases of eumycotic mycetoma . this study highlights the benefits of using observational studies as a valuable tool in answering questions where large sample sizes of patient groups would be impossible to be accumulated in a reasonable length of time .

gabaergic striatal projection neurons ( spns ) and gabaergic and cholinergic interneurons are the target of corticostriatal afferents . acetylcholine ( ach ) plays a role in the processes that modulate cortical inputs onto spns [ 26 ] since cholinergic interneurons respond earlier than spns after a cortical command . however , few electrophysiological studies have explored cholinergic modulation during synaptic suprathreshold responses , whose synaptic convergence and integration are the basis of spns firing during presynaptic m24 type receptors modulate glutamatergic afferents to the striatum [ 1013 ] and muscarinic m1 and m4 postsynaptic receptors are expressed in spns [ 1417 ] where an array of intrinsic voltage dependent channels are regulated by them : calcium activated potassium channels , inward rectifying channels , transient k channels , cationic and sodium channels [ 12 , 21 , 22 ] , and calcium channels [ 18 , 2325 ] . currents carried by many of these channels have been shown to participate in the regulation of spns firing properties , but very few have been tested during synaptic responses [ 2631 ] . one question is whether muscarinic g - protein coupled receptors and associated signaling are fast enough to intervene during the whole duration of corticostriatal suprathreshold responses . the channels that greatly modify the firing properties of spns are modulated by muscarinic receptors , and one of those channels are the m - channels ( encoded by kv7.2kv7.5/kcnq2kcnq5 genes ) controlled by membrane voltage . in spite of their relatively small contribution at the soma compartment , these channels modulate membrane potential from subthreshold to suprathreshold ranges and control input resistance , action potential threshold , and excitability [ 3235 ] . one hypothesis is that many of these actions can be manifested during corticostriatal responses and regulate firing properties during synaptic integration , but this has not been shown . therefore , here , we investigated the role of kv7/m channels in the corticostriatal synaptic integration of gabaergic spns in vitro by using selective agonist and antagonist ( retigabine and xe991 , resp . ) . we found that current carried by kv7 channels and regulated by muscarinic receptors greatly modifies the firing properties of gabaergic projection neurons during suprathreshold responses . the protocols followed the national university of mexico guide for the care and use of laboratory animals ( cicual - egp41 - 14 ) including minimizing the number of animals to achieve statistical significance and the avoidance of animal suffering . d1 and d2 dopamine receptor egfp bac transgenic mice were used , between postnatal days 2035 ( developed by the gensat ) . wild mice and nonfluorescent cells of bac - mice were also recorded to detect possible inconsistencies due to transgenes expression . their brains were quickly removed and placed into ice cold bath saline containing ( in mm ) : 126 nacl , 3 kcl , 25 nahco3 , 1 mgcl2 , 2 cacl2 , 11 glucose , 300 mosm / l , ph 7.4 with 95% o2 , and 5% co2 . hemispheres were separated and parasagittal corticostriatal slices ( 250300 m thick ) were cut using a vibratome and stored in oxygenated bath saline at room temperature . stimulation was performed with concentric bipolar electrodes ( tip = 50 m ) located in the cortex , as previously described . after recordings , neurons were injected with biocytin and merged with egfp - positive visualization or else , immunoreacted for chat to observe on a confocal microscope as previously described . slices were submerged in an iced saline solution containing ( in mm ) : 124 nacl , 2.5 kcl , 1.3 mgcl2 , 2 cacl2 , 26 nahco3 , 1.2 nah2po4 , and 15 glucose ( ph = 7.4 , 300 mosm / l , saturated with 95% o2 and 5% co2 ) . they were left for equilibration in this saline at room temperature for about 1 h. single slices were transferred to a submerged recording chamber and superfused continuously with oxygenated saline ( 2 - 3 ml / min ) . current - clamp recordings were performed with the patch clamp technique in the whole cell configuration in spns from the dorsal striatum . the slices were visualized using infrared differential interference contrast ( ir - dic ) microscopy with an upright microscope and a digital camera . data acquisition used software designed in the labview environment ( national instruments , austin tx ) . patch pipettes ( 36 m ) were filled with internal saline containing ( in mm ) : 115 kh2po4 , 2 mgcl2 , 10 hepes , 1.1 egta , 0.2 atp , 0.2 gtp , and 5% biocytin ( ph = 7.2 ; 285 no substantial differences between these configurations and previous recordings obtained with intracellular recordings were noted . internal solution containing ( in mm ) : 150 kcl , 10 hepes , and final ph 7.2 and 280 mosm / l was used . stock solution of amphotericin b ( 66 g / ml ) in dimethyl sulfoxide was diluted in the perforated patch internal solution for a final concentration of 180 g / ml . transmembrane current was monitored continuously by applying a 1020 mv pulse , from a holding potential of 80 mv . corticostriatal suprathreshold responses were evoked and recorded by stimulating sensory - motor cortical areas with concentric bipolar electrodes ( 50 m at the tip ; fhc , bowdoinham , me ) . synaptic responses were evoked by a series of current pulses of increasing intensities until eliciting suprathreshold responses , with or without the firing of repetitive action potentials . the stimuli were produced by the program but controlled by an isolation unit ( digitimer ltd . , the membrane potential was held at about 80 mv ( near the down-state or resting membrane potential ; 81 5 mv ; n = 24 ) while polysynaptic corticostriatal responses , lasting hundreds of milliseconds [ 1 , 8 ] , were induced . the field electrode was positioned in the cortex : a bipolar concentric tungsten electrode ( 50 m at the tip ) . paired stimuli were used to test the interference of presynaptic muscarinic receptors ( 20 ms of interstimulus interval ; 0.20.4 ms duration ; 140 v delivered through the stimulating electrode ; at a frequency of 0.1 hz ) . traces shown are the average of 2 min recordings ( 10 traces ) taken once the amplitude had been stabilized in a given condition . a small hyperpolarizing voltage command ( 10 mv ) was constantly given during the experiment to monitor input conductance . briefly , mice were transcardially perfused with an ice - cold solution containing ( in mm ) : 234 sucrose , 2.5 kcl , 7 mgcl2 , 0.4 cacl2 , 28 nahco3 , 1.44 nah2po4 , 7 glucose , 0.28 ascorbic acid , and 4.5 pyruvate ( ph = 7.4 with naoh , saturated with 95% o2 - 5% co2 ) before decapitation . they were incubated in the dark for 40 min with 6.5 m fluo-4 am ( invitrogen , life technologies ) and equilibrated with 95% o2 - 5% co2 . slices were then superfused with control saline in a chamber located on the stage of an upright microscope equipped with a 20x water - immersion objective ( olympus xlumplanfi ; olympus america inc . ) . excitation at 565 nm was performed with a lambda ls illuminator ( sutter instruments , novato , ca ) . images were acquired with a cooled digital camera ( coolsnap k4 , photometrics ; roper scientific , tucson , az ) at 100250 ms / frame . short movies ( 180 s and 20 ms exposure ) were taken at different pharmacological conditions . all active neurons in a field were automatically identified and their mean fluorescence was measured as a function of time . calcium dependent fluorescence signals were computed as ( fi fo / fo ) , where fi is fluorescence intensity at any frame and fo is resting fluorescence . calcium signals elicited by action potentials were detected based on a threshold value given by the first time derivative of their calcium transients ( 2.5 sd of the noise ) . calcium transients were signaled by dots in a raster plot where each row represented the activity of one neuron and the x - axis represents time . 10,000 monte carlo simulations were used to find the significance of neurons being active together . in this way we could follow the activity of dozens of neurons with single cell resolution . for current clamp and calcium imaging recordings drugs muscarinic toxin mamba toxin 7 ( mt-7 ) and the kcnq agonist retigabine were obtained from peptides international ( cat . muscarine , bicuculline , and biocytin were obtained from sigma - aldrich - rbi ( st . louis , mo , usa ) . digitized data was imported for analysis and graphing into commercial software ( origin 7 , microcal , northampton , ma , usa ; ridd : rid_000069 ) . representative mean s.e.m . of the areas under synaptic responses was measured and compared . paired or unpaired student t - tests or one way anova plus post hoc bonferroni tests were mostly used upon repeated measurements ( systat 11 , rrid : nlx_157643 and graphpad prism 5 , rrid : rid_000081 ; san jose ca , usa ) . upon small samples , distribution - free statistics were also performed : friedman or kruskal - wallis anova tests with post hoc dunnette 's , wilcoxon 's or mann - whitney 's tests ( depending on paired or nonpaired samples ) when comparing several treatments . the striatum is mainly composed of gabaergic neurons : about 9095% are striatal projection neurons ( spns ) and about 510% are interneurons , most of them being gabaergic . in addition , this nucleus is extremely rich in acetylcholine ( ach ) , cholinergic receptors , and cholinergic interneurons [ 16 , 17 , 3941 ] . several classes of striatal interneurons activate slightly before or in correlation with spns following a cortical stimulus . a suprathreshold stimulus may activate spns directly and indirectly through the polysynaptic activation of interneurons and other spns [ 1 , 42 ] . besides activating glutamatergic and gabaergic receptors , polysynaptic responses last hundreds of milliseconds and include the activation of muscarinic receptors as well as several classes of intrinsic voltage dependent currents [ 24 , 26 , 43 , 44 ] . this multisynaptic and convergent activation is one origin of down- to up-states voltage transitions . figure 1 shows typical firing modes of three double labeled and identified striatal neurons upon cortical stimulation : cholinergic ( figure 1(a ) ) , a d1-receptor expressing direct pathway striatal projection neuron ( dspn ) ( figure 1(b ) ) , and a d2-receptor expressing indirect pathway striatal projection neuron ( ispn ) . it has been shown that cholinergic neurons respond with a slightly briefer latency than the responses of spns [ 1 , 24 ] . in addition , continuous firing of cholinergic interneurons maintains a tonic level of ach in the striatum [ 7 , 24 , 45 ] , muscarinic m1 receptors are expressed in all spns , and kv7 channels have been shown to compose a minor but functionally important part of the intrinsic voltage gated currents that are present in all spns . here , we show evidence ( figure 2 ) that the response of spns to the same cortical stimulus is affected by activating muscarinic receptors . the same results can be obtained with perforated or nonperforated whole - cell recordings as well as with intracellular recordings . thus , figures 2(a ) and 2(b ) show that the depolarization evoked by cortical stimulation was reduced in both classes of spns by blocking the activation of m1 receptors by the very selective mamba toxin 7 ( 50 nm mt-7 ) [ 46 , 47 ] ; indicating that g - protein coupled signaling activated by endogenous ach was necessary to attain the level of depolarization to achieve repetitive firing . after blockade of muscarinic m1 class receptors the area under the synaptic response of dspns decreased by 23% ( from 16,510 1,495 mvms to 12,690 1,218 ( mvms ) ; p < 0.0005 ; n = 12 ; figure 2(e ) ) and the same actions were revealed for ispns : mt-7 decreased the area under the synaptic response by 22% ( from 11,360 809 mvms to 8,891 853 mvms ; p < 0.0005 ; n = 9 ; figure 2(e ) ) . in both cases , firing was severely affected . the reverse experiments are shown in figures 2(c ) and 2(d ) : muscarinic m1 class receptors were activated by using the agonist muscarine ( 110 m ) : in dspns the response implied a larger depolarization reflected by the area under the synaptic response that increased 14% ( from 17,290 1,155 mvms to 19,690 1,811 mvms ; p < 0.008 ; n = 8 ; figure 2(f ) ) . the synaptic response of ispn also increased for the same stimulation intensity by 32% ( from 11,360 983 mvms to 15,010 1,203 mvms ; p < 0.002 ; n = 10 ; figure 2(f ) ) . modulation lasted the whole duration of the responses and it does not appear to be saturated since muscarinic actions could add to the endogenous ach actions . apparently , the activation of muscarinic receptors may produce changes in passive properties ( e.g. , electrotonic decay and membrane resistance ) in the membrane compartment where most synaptic inputs are generated ( mostly secondary and tertiary dendrites ) and on intrinsic currents that become activated during synaptic suprathreshold depolarization [ 24 , 26 ] to explain the changes in amplitude of these responses . thus , previously , we have reported other muscarinic actions on the corticostriatal responses , for instance , the boosting of synaptic responses by facilitating ca - currents . but these actions were due to muscarinic m4 class receptors that appeared to act only in dspns . in addition , modulation of ca - activated k - currents shunts the trains of action potentials generated in ispns making them briefer than those generated in dspns . therefore , the responses now described are the first to affect both classes of spns in the same way and with the same relative magnitude , affecting their whole duration . the obvious candidates to explain these responses are the kv7/kcnq channels classical effectors of muscarinic receptors , because it has been demonstrated that activation of muscarinic receptors closes kv7 channels in these cells . moreover , single - cell reverse transcriptase - pcr confirmed the expression of kcnq2,3,5 mrnas in spns , although their contribution to whole cell k - current is relatively small . therefore , we next evaluated the action of these channels on the suprathreshold response . to test the consequences of activating kv7 channels in both classes of spns we used very selective pharmacological tools ( figures 3 and 4 ) . first , we tested the response of ispns after single pulses of increasing intensity to evoke subthreshold , threshold , and suprathreshold responses , before ( green traces are control records ) and during 1020 m xe991 , a kv7 channel antagonist . similarly to the case of muscarinic m1 class receptor blockade , the closing of kv7 channels enhanced the evoked depolarization at all tested strengths of stimulation ( black traces during xe991 ; figure 3(a ) ) . this is expected since xe991 is a kv7 channel blocker that decreases membrane conductance thus boosting synaptic responses . in the inset of figure 3(a ) it is shown that autoregenerative calcium potentials ( n = 9 out of 11 neurons ) could be evoked after xe991 facilitation of the synaptic response [ 8 , 48 , 49 ] , suggesting that these channels are necessary to control this outcome . figure 3(b ) shows that increases in the areas under the responses occurred at all intensities as seen at the soma , confirming that even at subthreshold responses muscarinic receptors are activated . on the other hand , the use of a channel agonist ( opener ) , retigabine ( 1020 m ) had the opposite action : it reduced the responses at all intensities ( figure 3(c ) ; green traces are the controls ; black traces were recorded during retigabine ) suggesting that membrane conductance in the region where synaptic inputs arrive is increased . the curve depicting the areas under the responses indicated that action occurred at all stimulus strengths . the statistical analysis of this sample of neurons used suprathreshold responses and is summarized in figure 3(e ) . in ispns , xe991 increased the area under suprathreshold synaptic responses by 50% ( from 10,210 709 mvms to 15,360 1,529 mvms ; p < 0.001 ; n = 11 ) . in contrast , retigabine reduced the area under the response to 9,712 1387 mvms ( p < 0.05 ; n = 6 ; using one way anova with dunnett 's pos hoc test comparing xe991 with controls and retigabine with controls ) . ( 1020 m ) enhanced the area under the synaptic response at all stimulus strengths , in particular during suprathreshold responses by 23% ( from 15,440 826 mvms to 18,930 1,123 mvms ; p < 0.0012 ; n = 13 ; figures 4(a ) and 4(b ) ) . the kv7 agonist , retigabine ( 1020 m ) , had opposite effects : area under suprathreshold responses decreased by 32% ( from 16,910 743 mvms to 11,370 1,238 mvms ; p < 0.031 ; n = 6 ; figures 4(c ) and 4(d ) ) . sample summary is illustrated in figure 4(e ) : one way anova with dunnett 's multiple comparison test indicated that differences between xe991 and retigabine with the controls were significant ( p < 0.05 ) . during single recordings in cell - focused studies there are often sources of variation such as the position of the electrodes in each experiment , whether the recorded cell was a main target of the cortical afferents being activated , and the activity of the microcircuit itself when each neuron has a role in a reverberant type of activity . therefore , to reinforce the statistical value of this findings we performed experiments where the activity of several of neurons were recorded by means of ca imaging using fluo-4 . figure 5(a ) illustrates one example of how cortically evoked intracellular ca transients augmented by the presence of xe991 in one cell . figure 5(b ) shows a raster type of plot where dots represent intracellular ca transients as those in figure 5(a ) ( cell activity ) , the x - axis denotes time , and each row of the y - axis represents activity of a single neuron . there was more evoked activity during xe991 than in the control ( n = 6 slices from different animals ) . the histogram of figure 5(c ) illustrates the summed activity of neurons in the raster plot where each gray column denotes the times of stimulation . cortical stimulus evoked more peaks of significant coactive neurons in the presence of xe991 , suggesting that the action of the cortex was facilitated by activating more neurons when kv7 channels were blocked . tukey plots in figure 5(d ) summarizes the statistics of this sample ( p < 0.02 ; mann whitney 's u test ) . the action mediated by kv7 channels in the suprathreshold responses ( according to pharmacological tools ) is the first one that affected both classes of neurons during the whole duration of their responses . these responses are the most similar to those shown for m1 receptors ( figure 2 ) in sharp contrast with previous reports of muscarinic involvement in the synaptic corticostriatal response of spns , while m4-receptor action is only present in dspns and ca - activated k - currents act differentially in dspns and ispns . it is known that m1 muscarinic receptors close kv7 channels through the phosphorylation of pip2 . and although differences reported for each type of spns remained ( enhanced regenerative events in ispns ; figure 3(a ) ; and more prolonged trains of spikes in dspns ) , the closing of kv7 channels , acting on both cell classes , augments the circuit activity after a cortical command . ispns have been posited as more excitable than dspns . surprisingly , however , kv7 blockade with xe991 evoked down- and up-state voltage transitions more readily in dspns than in ispns as recorded in whole cell . figure 6(a ) shows that xe991 ( 1020 m ) enhanced the depolarization and duration of action potentials trains in dspns ( red control ; black with xe991 ) . commonly , these cells are silent without stimulation ( figure 5(b ) ) . however , in the absence of any overt stimulus , addition of xe991 into the bath saline evoked transitions between down- and up-states ( figure 6(c ) ) , many of them sustaining trains of action potentials . this behavior was observed in 23% of recorded cells ( 3 out of 13 ) and could be observed for up to 45 min . this oscillatory behavior was similar to that evoked with nmda in vitro . by recording in small samples of cells , one can not be sure that this action of xe991 is significant for the microcircuit . therefore , in figure 7 we show a representative experiment with ca imaging and simultaneous recordings of a population of spns . clearly , intracellular ca transients increased in several cells ( figure 7(a ) ) , and the raster plot ( as that in figure 5 but without cortical stimulation ; figure 7(b ) ) shows more neurons active during xe991 ( neurons were sorted in ascending order to separate spontaneously active neurons from those recruited after xe991 ) . histogram of summed activity shows significant peaks of coactive cells only after xe991 ( figure 7(c ) ; n = 6 slices from different animals ) . moreover , when the areas under the histogram are summed through time there is clearly more cumulative activity during xe991 ( figure 7(d ) ; slope estimation errors : control : 12.96 0.67 ; xe991 : 32.58 0.93 ; p < 0.001 ; n = 8) . total numbers of active cells were also significantly different ( figure 7(e ) ; p < 0.003 ; mann - whitney 's u test ) . to conclude , these experiments demonstrate that the closing of a single class of k channels , kv7 , not only affects scattered cells but the behavior of the circuit as a whole , even if they comprise a small fraction of whole cell k current . analysis of the resultant circuit is out of the scope of the present work . but evidences that kv7 channels are involved in the control of correlated firing exist [ 35 , 52 ] . these results suggest that the great increase in circuit activity during parkinson 's disease may be in part due to hypercholinergia . to see whether these effects on the synaptic corticostriatal response of spns had a presynaptic component or if all of them had a postsynaptic origin , we evoked pairs of epscs in control conditions in the presence of 10 m bicuculline and these were compared to responses obtained in the presence of xe991 . figures 8(a ) and 8(b ) show a control recording in a dspn ( average in color and quantal variation in thin grey lines ) and a recording in the presence of xe991 , respectively . there was a small decrease in current amplitude during the experiment as observed from the soma , suggesting again a decrease in membrane conductance in the region where the synaptic responses are generated ( figure 8(d ) ) ; however , there was no change in the paired pulse ratio ( ppr ; figure 8(e ) ) . lack of significance in ppr changes is summarized in figure 8(f ) ( n = 8) . a similar experiment was performed in a sample of ispns ( figures 8(g)8(l ) ) . here , the decrease in epsc amplitude was larger suggesting that propagation in ispns dendrites is more important than in dspns dendrites , given that dendrites form the cell compartment where most synaptic inputs are generated [ 48 , 50 ] . nonetheless , changes in ppr were not significant ( figures 8(k ) and 8(l ) ) . it was concluded that xe991 reduced epscs amplitude in both spns without changing ppr and therefore , most actions observed were postsynaptic . in addition , it is known that m24 receptors , not m1 receptors , are located on presynaptic cortical glutamatergic terminals [ 1013 , 53 ] . as said before , it is known that most excitatory synapses in spns target the dendritic / spines compartment [ 48 , 50 , 5456 ] . therefore , the suprathreshold corticostriatal responses described here were most probably generated in the dendritic compartment and recorded in the somatic compartment . but are kv7 channels distributed equally in all neuronal membrane ? to answer this question we asked what would be the influence of kv7 channels in responses evoked at the somatic compartment . figures 9(a)9(d ) show that there were changes in excitability produced in spns by xe991 after somatic current injection , although it was more effective at ispns . however , actions of ca - activated k - currents can also be seen on suprathreshold synaptic responses . then , point somatic voltage - clamp current - voltage relationships ( i - v plots ) were explored in the voltage - clamp mode ( figures 9(e)9(h ) ; unclamped action currents were clipped ) . black dots in figures 9(i ) and 9(j ) show control i - v plots in both classes of dspns and ispns , respectively , while white dots show the i - v plots in the same cells after xe991 ( 1020 m ) . the superposition is almost complete and the subtraction of curves before and after the drug is negligible . in fact , measurements of whole - cell input resistance ( rn ) in samples of both classes of spns had no significant differences ( figure 9(k ) ) measured at 60 mv . thus , dspns controls had ( mean sem ) 287 22 m and in the presence of xe991 , 265 33 m ( n = 11 ; ns ) ; ispns had 300 33 m and changed to 381 74 m ( n = 8 ; ns ) . thus , although it is well established that dendrites of spns express multiple types of potassium channels that contribute to the complexity of neuronal discharge , the functional role of kv7 channels during the suprathreshold corticostriatal response of spns had not been demonstrated before . here multiple neurotransmitters have been shown to down- or up - modulate kv7 channels [ 57 , 58 ] . therefore , this may be a way in which cholinergic innervation controls spns firing and circuits . in contrast to these results , kv7 channels selectively influence somatic but not dendritic synaptic integration in pyramidal cells from the hippocampus [ 49 , 5961 ] , although they control synaptic integration in pyramidal cortical neurons . however , in similarity with pyramidal cells , sk - channels also play an important role in spns and their interaction needs further study , for example , . up to now we have shown that kv7 channels may influence synaptic integration because their selective blocker and opener acted on suprathreshold synaptic responses . also , experiments in figure 2 showed that a m1 muscarinic receptor antagonist and agonist had very similar actions , respectively ; they acted similarly in both classes of projection neurons , influenced firing , and their actions lasted during the whole response . actions such as these had not been observed for other muscarinic effects [ 24 , 26 ] . to further show these similarities we performed occlusion experiments ( figure 10 ) . however , as mentioned before , muscarinic receptors have many actions on spns , on all classes of membrane currents : na , ca , and k [ 12 , 1721 , 2326 , 30 , 34 , 44 ] . . however , if occlusion of these actions is large enough and differences can have a reasonably explanation that could be confirmed experimentally in the future , it could become very suggestive . figure 10(a ) shows that muscarine ( 1 m ) had an additional action after xe991 ( 20 m ) , but this does not happen in ispns where occlusion is complete ( figure 10(b ) ) . this can be easily explained by the actions of m4-receptors in dspns which are not present in ispns . on the other hand , addition of xe991 in a response of a dspn that provoked a few action potentials after muscarine obtained only a small additional depolarization . this increased number of action potentials fired shows that actions do not need to be large to influence firing ( figure 10(c ) ) . it is rare that a receptor action saturates any effector , but comparing panels ( a ) and ( c ) reinforces the argument of this work and of a previous one . a similar phenomenon occurred in an ispn whose depolarization did not evoke an autorregenerative response after muscarine but attained it after addition of xe991 ( figure 10(d ) ) . while these experiments ( n = 6 for each sample ) confirmed that muscarinic receptors have various actions on spns , the amount of depolarization added to the responses after sequential activation with muscarine and xe991 in either order suggests that a great part of the action may be due to kv7 channels . since kv7 channels are modulated by a variety of neurotransmitters and intracellular signaling molecules [ 6466 ] , they provide an exquisite mechanism to fine - tune synaptic convergent integration from the sub- to suprathreshold ranges . down- to up-states voltage transitions [ 7 , 50 , 51 , 64 ] characteristic of spns firing . it is also known that during these transitions spns become involved in correlated firing and network activity such as cell - assembly reverberations . finally , previous work had shown that a cortical stimulus may provoke prolonged synaptic responses in cholinergic interneurons and spns quasisimultaneously . but to respond to released ach , the receptors expressed by spns are g - protein coupled ( muscarinic ) . in particular , modulation of kv7 channels involves phosphatidylinositol 4 , 5 biphosphate depletion [ 58 , 6769 ] . thus , whether the signaling cascades involved are fast enough to modulate these complex synaptic responses during their whole duration was an open question . in this work we demonstrate that muscarinic signaling is definitively involved in the synaptic integration of spns and that this modulation affects the firing of these gabaergic neurons . by activating spns and cholinergic interneurons almost simultaneously , acetylcholine modulates , through muscarinic receptors , the suprathreshold synaptic integration in striatal projection neurons . in a similar way , kv7 channels act as gain control regulators of the synaptic response during its whole duration , in both classes of spns . thus , blocking of m1 class of muscarinic receptors decreases the responses and greatly abolishes firing , disclosing the action of endogenous acetylcholine : the regulated closing of these channels during the response . addition of the agonist muscarine does the opposite ; it facilitates synaptic depolarization and firing . this last action is potently reproduced by the kv7 channel blocker xe991 in both classes of neurons . conversely , the kv7 channel opener , retigabine , mimicked the action of the m1 class receptor antagonist ; it reduced the responses in both classes of spns . calcium imaging experiments showed that the efficiency of a cortical stimulus to recruit sets of coactive spns is increased when kv7 channels are closed . therefore , modulation of these channels not only enhances the response of scattered spns but facilitates their working together . this action was not a random occurrence since it generated a definite increase in microcircuit activity . by inference , we show that the actions of kv7 channels are postsynaptic and that they may occur in the dendritic compartment where most synaptic inputs are generated , since their action in somatically evoked responses were minimal . finally , occlusion was almost complete when xe991 and muscarine are given together in spite of the various muscarinic actions , except when muscarine was given after xe991 , suggesting the action of m4 receptors . in summary , the present results suggest that antimuscarinic therapy in parkinson 's disease and l - dopa induced dyskinesia should be more selective and focused on m1-class receptors and clinical assays of parkinsonian - dyskinetic patients using retigabine are scarce .

a recent analysis of hospital glucometry data by bersoux and cook from january to december 2012 was conducted on 51.4 million measurements from 2.6 million inpatients . the authors found that the prevalence of hypoglycaemia ( < 4 mmol / l or 70 mg / dl ) was 6.1% in non - icu patients and 5.6% in icu patients , while the prevalence of hyperglycaemia ( > 10 mmol / l or 180 mg / dl ) was substantially higher at 32% in non - icu patients and 28% in icu patients . the mean point - of - care blood glucose ( poc - bg ) was 167 mg / dl for non - icu patients and 170 mg / dl for icu patients . the authors concluded that increased hospital participation in data collection was needed for the development of optimal practices to manage inpatient dysglycaemia . numerous studies have shown that improvement in glycemic control results in lower rates of hospital complications in general medicine and surgery patients [ 26 ] . in one study , newly discovered hyperglycaemia was associated with a higher in - hospital mortality rate ( 16% ) compared with those patients with a prior history of diabetes ( 3% ) and subjects with normoglycaemia ( 1.7% ; both p < 0.01 ) . at the opposite end of the glycaemic scale , studies have shown that in - hospital secondary hypoglycaemia increases inpatient mortality , likelihood of readmission , and length of stay [ 79 ] . certain clinical situations increase the risk of dysglycaemia during a hospital admission . these include changes in caloric or carbohydrate intake especially nil by mouth status or total parenteral nutrition ; use of diabetogenic medications like corticosteroids ; failure of medical staff to make adjustments to glycemic therapy based on daily blood glucose ( bg ) patterns ; prolonged use of sliding scale insulin regimens ; lack of coordination between insulin therapy , blood glucose monitoring , and meals ; issues relating to patient transfer from one ward location to another ; and medical transcription and dispensing errors . there is evidence that poor inpatient glycaemic control is underrecognized , underreported , and suboptimally managed and that proactive assessment of inpatients ' glycaemic status and aggressive treatment approaches are required [ 1619 ] . the american association of clinical endocrinologists / american diabetes association ( aace / ada ) recommendations stress five key facets : identification of inpatient dysglycaemia ; establishing a multidisciplinary team approach to diabetes management in all hospitals ; implementation of structured protocols for aggressive control of bg in both icus and other hospital settings ; educational programs for all hospital personnel caring for people with diabetes ; and planning for a smooth transition to outpatient care with appropriate diabetes management [ 20 , 21 ] . current networked point - of - care technology offers a novel way to address the problem of inpatient dysglycaemia and clinical inertia . our hospital conducted an audit of inpatient glucometry results from our accu - chek inform ii meters and cobas it in october 2012 in order to review the identification and management of patients with hypoglycaemia ( < 4 mmol / l ) and with moderate ( 1520 mmol / l ) in - hospital hyperglycaemia ( see supplementary appendix 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/807310 ) . 3.4% of readings were in the hypoglycaemic range and 10% of readings were in either moderate or severe hyperglycaemic ranges . on average 12 patients per day had poc - bg results in the moderate - severe hyperglycaemic range , with more than 4 times that number having values > 10 the mean time - to - next poc - bg test in a patient with a dysglycaemic value was almost 6 hours with a range of 2 minutes to 33 hours and the mean time - to - normalization of blood glucose after a dysglycaemic result was approximately 10 hours with a range of 1 to 76 hours . we aimed to develop an alert system where all poc - bg measurements within the moderate - severe hyperglycaemic and hypoglycaemic ranges would be reviewed and notified to the relevant ward teams , nursing staff , and diabetes consult service . the metric chosen to analyse glucometry data was the patient - day model , which has been shown to most faithfully reflect the quality of inpatient glycemic control . we aimed to reduce the percentage of patient - day weighted poc - bg levels above 15 mmol / l by at least 20% with a less than 5% increase in levels less than 4 we also aimed to reduce the time - to - next - reading and the time - to - normalization after a dysglycaemic result by 20% . the glucometers used in this study were the accu - chek inform ii system ( roche diagnostics , basel , switzerland ) . all hospital glucometers are connected via wlan to cobas it 1000 ( roche diagnostics , basel , switzerland ) , allowing storage of all information and central management of all meters and data in line with laboratory regulations . microsoft excel version 2013 ( microsoft , wa , usa ) and visual basic version 13 ( microsoft , wa , usa ) were used to develop excel macros for processing of glucometry results from the adelaide and meath hospital , dublin , ireland . an explanation of the visual basic code for the macros is available in the supplementary appendix . a sample anonymised data file and a working version of the macro - enabled workbook is also available online ( https://app.box.com/s/kk0ka29wmuwk855hdbq4yfqvh7nshfnp ) . poc - bg data were classified based on local hospital standards : hypoglycaemia ( < 4 mmol / l ) , normoglycaemia ( 410 mmol / l ) , mild hyperglycaemia ( 1015 mmol / l ) , moderate hyperglycaemia ( 1520 mmol / l ) , and severe hyperglycaemia ( > 20 mmol / l ) . alerts were generated for any hypoglycaemic result and for any result in the moderate - severe hyperglycaemia range . this study was a 60-day prospective study on the impact of a glucometry alert system on hospital dysglycaemia , started on 11 april 2014 . there was no diabetes registrar rostered to the project for a 14-day period from 05 may 2014 to 18 may 2014 ; care proceeded as per the preimplementation phase during this period . approval was granted by the hospital diabetes consult team , hospital management board , laboratory manager , and information technology department . this project did not require submission to the ethics committee since it was aiming to improve the use of routine clinical data . our diabetes consult service requested that the cutoff for review of a patient be 15 mmol / l rather than the ada / aace recommendation of 12 mmol / l since their capacity for reviewing patients was limited to 1215 patients per day . there are many cutoffs used for classifying a glucose result as hypoglycaemic . based on audit data showing that only 3.4% of our hospital 's results were less than 4 the touchscreen tablet was used by the diabetes consult registrar to highlight the hospital patients with poor glycaemic control . the consult registrar reviewed the patient 's history , hospital stay , and insulin regimen . the alert system was used on weekdays only since there was no consult service on weekends . the point - of - care manager , chemical pathology trainee , or another member of the biochemistry staff performed daily uploads of dysglycaemic results to winpath ( clinisys group , surrey , uk ) , our laboratory information system . a glucose alert ( ga ) was added to winpath for every dysglycaemic result with the following comment : please review this patient 's in - hospital glycaemic control . we have noted episodes of hypoglycaemia ( < 4 mmol / l ) and/or hyperglycaemia ( > 15 refer to the hospital guidelines on glycaemic management and/or request a consult from the hospital diabetes team . we have noted episodes of hypoglycaemia ( < 4 mmol / l ) and/or hyperglycaemia ( > 15 refer to the hospital guidelines on glycaemic management and/or request a consult from the hospital diabetes team . the glucose alert uploads to the lis were performed only on weekdays during the study period . data downloaded from the cobas it 1000 database were analysed using stata version 13 ( statacorp , tx , usa ) . poc - bg results were analysed for the pre- and postimplementation periods , from 10 february 2014 to 10 april 2014 and from 11 april 2014 to 9 june 2014 , respectively . results from the acute care wards , emergency department , and pediatrics and outpatient wards were omitted because these have a substantially different patient demographic and/or are not representative of inpatient glycaemic control . summary statistics were obtained for the number of poc - bg results every day and the number and percentage of results < 4 mmol / l and > 15 the percentage of patient - day weighted mean blood glucoses < 4 mmol / l and > 15 mmol / l was calculated . unequal variance one - sided t - tests were done to compare mean percentages of hypoglycaemia , hyperglycaemia , hypoglycaemic patient - days , and hyperglycaemic patient - days pre- and postpractice change . the daily mean patient - day weighted poc - bg values were displayed using line graphs with lowess ( locally weighted scatterplot smoothing ) lines to show trends over time . for any poc - bg value < 4 mmol / l or > 15 mmol / l , the time - to - next - reading and the time - to - normalization of glucose were calculated . if the time between measurements was found to be greater than 72 hours , the patient was assumed to have been either discharged , admitted to itu , or had serum blood glucoses analysed in the laboratory or on a blood gas analyzer ; the time - to - next - reading was taken to be 72 hours in these cases . comparisons of pre- and postpractice change were made using unequal variance one - sided t - tests , histograms , and normal density plots . the proportions of time values greater than 6 hours and 12 hours ( time - to - next - reading ) or greater than 12 hours and 24 hours ( time - to - normalization ) were also compared . line graphs of the number of poc - bg tests performed per day and the percentage of mean patient - day weighted poc - bg values > 15 mmol / l were plotted to investigate trends in glycaemic control and glucometry use over weekends . the health information technical standards of the irish health information and quality authority ( hiqa ) were reviewed and followed closely to ensure data security and patient confidentiality . the head of the information and communications technology department was also consulted on issues relating to data security . in total , 45929 poc - bg results were downloaded from the cobas it database for the 120-day analysis period . after removing results from outpatient , paediatric and emergency departments , a total of 13992 results were analyzed for the preimplementation period compared to 14249 in the postimplementation period . there was no statistically significant difference between the numbers of poc - bg values , patient - day values , or patients for the two periods ( see table 1 ) . in total , there were 2023 dysglycaemic values and 272 patients reviewed by the diabetes consult registrar after implementation . this corresponded to approximately 4 new patients and 10 known patients ( from consults or from prior review ) per day . the frequency distributions of poc - bg values and mean patient - day poc - bg values by glycaemic level for the pre- and postimplementation phases are shown in figure 1 . compared to the preimplementation phase , the percentage of poc - bg values in the moderate - severe hyperglycemia range ( > 15 mmol / l ) decreased by 6.25% ( p = 0.123 ) . there was a 22.6% reduction in the percentage of patient - day weighted poc - bg values > 15 mmol / l ( p < 0.001 ) , as shown in figure 2 . the percentage of hypoglycaemic values and hypoglycaemic patient - day weighted values did not change significantly . while there was a reduction in the percentage of moderate and severe hyperglycaemic values , there was an increase in the percentage of mild hyperglycaemic values but not to the same degree . a supplementary analysis was performed after omitting the 14-day period from 05 may to 18 may when no registrar cover was available to review patients flagged by the alert system . after correcting for this protocol deviation , there was a reduction in poc - bg values > 15 mmol / l from 11.2% to 10.4% ( p = 0.103 ) and in the percentage of patient - day weighted poc - bg values > 15 mmol / l from 5.3% to 4.0% ( 31% relative reduction , p < 0.001 ) with no change in the percentage of hypoglycaemic values and hypoglycaemic patient - day weighted values ( p = 0.309 and p = 0.176 ) . furthermore , there was a greater reduction in the mean hospital patient - day weighted poc - bg from 8.22 mmol / figure 3 shows the daily change in mean patient - day weighted poc - bg values for the entire study . during the preimplementation phase , mmol / l after the alert system was implemented ( p < 0.01 ) , as shown in table 1 . the mean patient - day weighted poc - bg value for the hospital plateaued between 05 may and 19 may when the registrar was not available to review patients . there was a similar trend in mean poc - bg value but this was not statistically significant ( not shown here ) . the x in figure 3 marks the time period when new guidelines were implemented for the management of inpatient dysglycaemia . this coincided with a 1 - 2-week reduction in the mean patient - day weighted poc - bg value for the hospital ; however , the hospital mean reached its previous baseline after this short - lived change . there was a significant 14% reduction in the mean time - to - next - reading , from 5.1 hours to 4.4 hours ( p < 0.01 ) . the density histogram shows a reduction in values over 6 hours , with a shift of the probability density plot to the left ( see figure 4 ) . 25.2% of all times were greater than 6 hours prior to implementation compared to 20.8% after implementation ( p < 0.001 ) . the mean time - to - normalization of a dysglycaemic poc - bg result decreased by 19% from 10.2 hours to 8.3 hours ( p < 0.01 ) . the density histogram shows a fall in the number of values greater than 12 hours for this parameter compared to preimplementation . as shown in table 2 , prior to implementation , 25.0% of time - to - normalization values were greater than 12 hours with 7.4% greater than 24 hours compared to 21.5% and 5.1% , respectively , after implementation ( p < 0.05 ) . there was a clear trend towards a lower number of tests on weekends with 240 32 tests performed on weekdays compared to 223 33 tests performed on weekends ( p = 0.008 ) , highlighted by the red bars on figure 5 . towards the end of the implementation period , there was a rise in the total number of poc - bg tests performed above the previous hospital average . a trend towards increased proportions of dysglycaemic results on weekends was also noted ( indicated by the red bars on figure 6 ) ; this trend was exaggerated in the postimplementation phase . however , there was no statistically significant difference in the proportion of hyperglycaemic results on weekends compared to weekdays . there was also a significant reduction in the coefficient of variation of the percentage of hyperglycaemic results from 40% to 35% ; this is visually evident by the stabilization of postimplementation values . a comprehensive alert system was devised using visual basic code and microsoft excel macros to process data and provide charts and tables representing daily glycaemic control for inpatient wards in the hospital . this data was used to provide alerts to hospital teams via the laboratory information system and to alert the diabetes consult service about patients requiring urgent review . data from the preimplementation period agreed with results from our audit in 2012 , showing that the percentage of hypoglycaemic results was between 3 and 4% , the percentage of hyperglycaemic results in the mild range was ~20% , and the percentage of results in the moderate - severe hyperglycaemic was approximately 12% . the implementation of the glucometric alert system achieved our target of a 20% reduction in the percentage of patient - day weighted poc - bg values above 15 one of the known complications of strict glycaemic control is an increase in secondary hypoglycaemic events . while addressing the problem of hyperglycaemia , a related goal was to ensure that the proportion of hypoglycaemic results either reduced or remained unchanged and this was achieved by the alert system . hypoglycaemic events tend to be managed more proactively in hospital compared to hyperglycaemia for a couple of reasons . when blood glucose levels fall below 3 mmol / l unless they have had frequent hypoglycaemic events in the past or are on beta - blocker therapy , rendering them hypoglycaemia unaware . secondly , the management of hypoglycaemia is much simpler in the initial stages with oral or intravenous glucose formulations or intramuscular glucagon , with an almost immediate rise in blood glucose levels . hospital and nursing staff have a tendency to be more permissive of mild - moderate hyperglycaemia , employing a watch and wait approach allowing time for the patient 's own insulin or hypoglycaemic regimen to work and waiting for consecutive results to be above some arbitrary threshold before alerting hospital teams . the most important benefit of the alert system seems to be the improvement in the time - to - normalization of a dysglycaemic result . this coincided with more frequent poc - bg testing if a result was dysglycaemic , manifested by an increased number of poc - bg tests performed after implementation and a reduction in the time - to - next - reading . the 19% reduction in time - to - normalization and the 14% reduction in mean time - to - next - reading fell short of our 20% target ; however , there was a 31% relative reduction in time - to - normalization values greater than 24 hours and a 30% relative reduction in time - to - next - reading values greater than 12 hours . this means that the alert system successfully reduced significant outliers seen in the preimplementation phase . likely explanations are that the diabetes consult service reviewed patients in a more timely fashion and also that more physiological insulin regimens were utilized to normalize dysglycaemic results . during our 2012 audit , we noticed that the weekend glycaemic control was worse than that seen on weekdays , with higher levels of moderate - severe hyperglycaemia . this problem was inadequately addressed in this study because of a lack of staff coverage on the diabetes consult service on weekends . our results show a trend towards lower numbers of poc - bg tests on weekends ; the number of tests performed increased towards the end of the implementation period for unknown reasons . there were also frequent spikes in the percentage of patient - day weighted hyperglycaemic results on weekends and this trend was exaggerated during the implementation phase , likely due to the fact that weekday glycaemic control was improved significantly . the trends observed were not statistically significant ; however , they do mirror the trends seen during our previous audit and warrant further investigation and action plans . figure 6 shows that the variability in the percentage of hyperglycaemic values was reduced . before implementation , two peaks in hyperglycaemia were noted ; these peaks may be due to the patient population in the hospital at the time . on 21 march 2014 , new guidelines for management of dysglycaemia were launched in the hospital and a presentation was given to general medical and surgical teams outlining these guidelines . it is likely that glycaemic control improved in the week following the launch of these new guidelines and that the baseline rate of dysglycaemia in the preimplementation period would have been higher than what was witnessed . the major limitations of this study related to personnel , financial , and technical issues . the diabetes consult service was run by a team of one consultant and one registrar and the number of patients that could be reviewed on a daily basis was limited to 1015 . also , a consult service based on flagged dysglycaemic results was not provided on weekends and public holidays . it is likely that the percentage of dysglycaemic patient - days would have been significantly lower with more staffing cover . funding for specialized software development was not available and all technical expertise was local and limited in scope . uploads to the laboratory information system and to the tablets were done twice daily , meaning that there was a significant lag between the time when the glucometry test was performed and the time when the result was uploaded or reviewed by the diabetes consult registrar . further integration with the current it framework would allow for instantaneous uploads to the lis and updates to the interactive reports and charts on the tablets in a push notification fashion . while this study showed an improvement in glycaemic control , no clinical correlations could be made . determining changes in length of stay , inpatient mortality , and cost of care by using the alert system was outside the scope of the study and would require significant input by hospital administration . the number of patients in hospital with either a primary or secondary diagnosis of diabetes would be a key metric to monitor over time and control for . estimates of dysglycaemia could then be corrected for the number of diabetics in each ward location . additionally , the alert system was only implemented for a 60-day period in this pilot study . due to fluctuations in the patient profile admitted to hospital , it is possible that the improvements in glycaemic control are artefactual . potential areas for improvement would be in the user interface and alert software as well as in the current networking infrastructure . direct access to the cobas it webserver would allow more frequent automatic downloads of data to a network shared folder , which can be accessed on demand by the tablets or any computer in the hospital . measurement of ketones using point - of - care devices has become more important since the joint british diabetes society ( jbds ) issued guidelines in march 2010 recommending ketone ( beta - hydroxybutyrate ) measurement in the management of dka . ketone results from point - of - care devices should also form part of a comprehensive alert system geared especially towards type 1 diabetics . to determine whether there is a reduction in hospital cost , length of stay , and improved outcomes associated with improved glycaemic control due to the alert system , a six - month to one - year study is needed , with comparison to the previous year . key metrics like length of stay and inpatient mortality , as well as perioperative outcomes for patients with a primary or secondary diagnosis of diabetes , will need to be recorded rigorously . the longer timeframe of the study will negate the effect of artefactual fluctuations in glycaemic control that are caused by the number of diabetics in hospital and other factors . an automated alert system that allowed the use of site - specific level and time - based criteria for the identification of dysglycaemic results and generation of alerts was successfully developed and deployed in our medium - large sized tertiary care facility . there was a significant improvement in our hospital 's glycaemic control , with a reduction in the proportion of hyperglycaemic patient - days and no rebound increase in secondary hypoglycaemia . the alert system also improved the frequency with which glucometry tests were performed in patients with recognized out - of - control glucose results and improved the time - to - normalization of dysglycaemic results . the percentage of patient - day weighted results > 15 mmol / l was reduced by greater than 20% and while the reduction in the time - to - normalization of dysglycaemic poc - bg results fell short of our 20% target , we successfully reduced the proportion of values greater than 12 hours by more than 20% . certain trends in glucometry testing and glycaemic control were also observed , with lower numbers of tests performed and spikes in hyperglycaemia on weekends . longer - term studies will enable us to determine whether improvements in glycaemic control correlate with improvements in in - hospital morbidity and mortality and reductions in length of stay and hospital costs .

the online version of this article ( doi:10.1007/s00125 - 011 - 2311 - 5 ) contains peer - reviewed but unedited supplementary material , which is available to authorised users . metformin is one of the most widely used glucose - lowering agents to treat type 2 diabetes and is now recommended as the first - line drug therapy by a recent joint consensus statement . this unique survivor of the biguanides family is prescribed for its effective anti - hyperglycaemic action , achieving a potent reduction of hepatic glucose production through inhibition of gluconeogenesis . an increase in peripheral glucose uptake by the drug has also been reported , although the extent and significance of this effect in humans is still being discussed . metformin also exerts beneficial effects on circulating lipids and exhibits cardio - protective features in obese patients treated with the drug compared with conventional hypoglycaemic agents . more recently , epidemiological studies have shown a decrease in cancer incidence in metformin - treated patients , suggesting a new potential application of the drug as an anti - cancer agent . however , although prescribed since the end of the 1950s and despite extensive effort during the last years , the precise molecular ( or biochemical ) mechanism or mechanisms of action of metformin remain as yet incompletely understood . at the beginning of the millennium , a remarkable study by zhou et al . provided a new mechanistic insight by showing for the first time that metformin activates the amp - activated protein kinase ( ampk ) in hepatocytes ; however , they did not provide an underlying mechanism for this activation . more recently , shaw et al . reported that activation of the hepatic lkb1/ampk axis in mice could be involved in the inhibitory effect of metformin on gluconeogenesis , highlighting the putative role of these kinases in the therapeutic action of the drug . ampk is a well conserved serine / threonine - protein kinase , which acts as a cellular energy and nutrient sensor , and plays a crucial role in the regulation of metabolic pathways [ 8 , 9 ] . ampk consists of a heterotrimeric complex containing a catalytic subunit and two regulatory and subunits . each subunit has several isoforms ( 1 , 2 , 1 , 2 , 1 , 2 , 3 ) , which are encoded by distinct genes , giving multiple combinations of holoenzyme with different tissue distribution and cellular localisation [ 8 , 9 ] . the subunit contains a threonine residue ( thr 172 ) whose phosphorylation by upstream kinases ( ampk kinase [ ampkk ] ) , such as the serine / threonine - protein kinase lkb1 or calmodulin - dependent protein kinase kinase ii ( camkkii ) , is sufficient and necessary for ampk activation to occur . the subunit acts as a scaffold to which the two other subunits are bound , and also allows ampk to sense energy reserves in the form of glycogen [ 8 , 9 ] . binding of amp to the subunit activates ampk via a complex mechanism involving direct allosteric activation , phosphorylation on thr172 by ampkk and inhibition of dephosphorylation of this residue by specific protein phosphatases that remain to be identified [ 8 , 9 ] . thus , any increase in the intracellular amp : atp ratio activates ampk , which results , through phosphorylation of various downstream targets , in concomitant inhibition of energy - consuming processes and stimulation of atp - generating pathways in order to restore energy balance [ 8 , 9 ] . finally , it has recently been shown that adp , and therefore the adp : atp ratio , could also play a regulatory role in ampk activities by binding to selective bateman domains on the subunit . while metformin has been previously shown to decrease cellular atp levels in hepatocytes owing to its specific inhibition of the mitochondrial respiratory - chain complex 1 [ 1113 ] , some of the early works suggested that the drug activates ampk without increasing the amp : atp ratio [ 14 , 15 ] . although these initial conclusions were later refuted by the authors , the absence of clear data linking the mitochondrial effect of metformin to activation of hepatic ampk still nurtures confusion . thus , an alternative amp - independent hypothesis involving mitochondrial - derived peroxynitrite was recently proposed , prolonging the controversy . taken together , a clarification of the mechanism by which metformin activates hepatic ampk is required , especially in humans . the aim of this study was to test the hypothesis that activation of ampk by metformin in primary hepatocytes is consecutive to change in cellular energy status owing to metformin s mitochondrial inhibitory effect on the respiratory - chain complex 1 . materials all chemicals were purchased from sigma - aldrich ( st louis , mo , usa ) . ethics all experiments performed in animals were done in accordance with the institute for laboratory animal research guide for the care and use of laboratory animals . all procedures on human tissues have received approval from the university and hospital ethical review boards ( st luc hospital , brussels , belgium ) . generation of liver - specific ampk1/2 knockout mice the generation of liver - specific ampk1/2 ( also known as prkaa1/2 ) mice has been described previously . isolation and primary culture of murine and human hepatocytes for rodent experiments , liver cells were prepared by the collagenase method of berry and friend , modified by groen et al . , from male wistar rats ( 200300 g ) or from male mice ( 2530 g ) after anaesthesia with sodium pentobarbital ( 6 mg/100 g body weight ) or ketamin / xylazin ( 8/1 mg/100 g body weight ) , respectively . for human experiments , hepatocytes were isolated from whole livers or liver segments not used for transplantation , using collagenase p ( roche , mijdrecht , the netherlands ) . for primary culture , rat or human hepatocytes were first seeded for 3 to 4 h on type i collagen - coated dishes ( 2 10 cells / cm ) and then cultured in m199 medium ( invitrogen , leek , the netherlands ) supplemented with antibiotics in the presence of the indicated concentrations of metformin . western blot analysis hepatocytes or liver samples were lysed in ice - cold buffer containing : 50 mmol / l hepes ( ph 7.6 ) , 50 mmol / l naf , 50 mmol / l kcl , 5 mmol / l nappi , 1 mmol / l edta , 1 mmol / l egta , 1 mmol / l dithiothreitol , 5 mmol / l -glycerophosphate , 1 mmol / l sodium vanadate , 1% np40 ( vol./vol . ) and protease inhibitors cocktail ( complete ; roche ) . homogenates were centrifuged ( 16,000 g ; 15 min , 4c ) and the protein content of the supernatant fraction was determined using a kit ( bca protein assay kit ; pierce , rockford , il , usa ) . proteins ( 1050 g ) were separated by 710% sds - page , followed by transfer to a polyvinylidene fluoride transfer membrane . membranes were blocked for 1 h at room temperature in tris - buffered saline tween-20 buffer with 5% non - fat dry milk , followed by overnight incubation with phospho - specific or total antibodies ( all of them cross - reacting with human , rat and mouse forms , see electronic supplementary material [ esm ] table 1 ) . blots were then incubated for 1 h with horseradish peroxidase - conjugated secondary antibodies at room temperature . bands were visualised by enhanced chemiluminescence and quantified using image j ( nih , bethesda , md , usa ) . ampk assays ampk activity was assayed either after precipitation with 10% ( wt / vol . ) polyethylene glycol 6000 or after immunoprecipitation with specific antibodies directed against 1- or 2-ampk catalytic subunits ( kinasource , dundee , uk ) , as described . determination of adenine nucleotide concentrations samples of the cell suspension or cultured hepatocytes were lysed in ice - cold hclo4-edta ( 5% wt / vol . , 25 mmol / l ) and centrifuged ( 13000 g , 2 min ) . the supernatant fractions were immediately neutralised and determination of adenine nucleotides was performed by high - performance liquid chromatography , as previously described . rna purification and quantitative reverse transcription - coupled real - time pcr rna was extracted from isolated hepatocytes using an rna isolation reagent ( tripure ; roche ) . total rna ( 2 g ) was reverse - transcribed and quantitative real - time pcr then performed with a kit ( sybr green core ; bio - rad , veenendaal , the netherlands ) on a thermal cycler ( myiq ; bio - rad ) . all the primer sets used were designed to span an exon ( avoiding eventual amplification of gdna ) and have an efficiency of 100 5% ( esm table 2 ) . determination of mitochondrial oxygen consumption rate in intact and permeabilised hepatocytes mouse or human hepatocytes ( 78 mg dry cells per ml ) were incubated in a shaking water bath at 37c in closed vials containing 2 ml krebs ringer bicarbonate - calcium buffer ( 120 mmol / l nacl , 4.8 mmol / l kcl , 1.2 mmol / l kh2po4 , 1.2 mmol / l mgso4 , 24 mmol / l nahco3 , 1.3 mmol / l cacl2 , ph 7.4 ) in equilibrium with a gas phase containing o2/co2 ( 19:1 ) and supplemented with lactate / pyruvate / octanoate ( 20/2/4 mmol / l ) in the presence or not of 5 mmol / l metformin . after 30 min , the cell suspension was saturated again with o2/co2 for 1 min and immediately transferred into a stirred oxygraph chamber equipped with a clark oxygen electrode ( heito , paris , france ) . the mitochondrial oxygen consumption rate ( jo2 ) was measured at 37c before and after successive addition of 0.5 mol / l oligomycin and 150 mol / l 2,4-dinitrophenol ( dnp ) . to permeabilise hepatocytes , intact cells were first incubated for 30 min as described above , then collected by centrifugation and resuspended in kcl medium ( 125 mmol / l kcl , 20 mmol / l tris - hcl , 1 mmol / l egta and 5 mmol / l pi - tris , ph 7.2 ) containing 200 g / ml digitonin . after 3 min at 37c , the permeabilised hepatocytes were transferred to the oxygraph . as indicated , 5 mmol / l glutamate - tris plus 2.5 mmol / l malate - tris , or 5 mmol / l succinate - tris plus 0.5 mmol / l malate - tris plus 1.25 mol / l rotenone were added . jo2 was measured before and after the successive addition of 1 mmol / l adp - tris , 0.5 g / ml oligomycin and 50 mol / l dnp . all the results are expressed in percentage of the maximum activity of cytochrome oxidase , after addition of 0.15 g / ml antimycin and 1 mmol / l n , n , n,n-tetramethyl-1,4-phenylenediamine ( tmpd ) plus 5 mmol / l ascorbate to normalise the results according to respective mitochondrial content in wild - type and liver - specific ampk1/2 mice . statistics all data are expressed as mean sem . statistical analysis was performed using spss 17.0 software package for windows ( spss , chicago , il , usa ) with two - tailed unpaired student s test or one - way / two - way anova , followed by a tukey s post hoc test for multiple comparisons . effects of metformin on ampk activity and cellular energy status in rat hepatocytes in a first set of experiments , the effects of metformin on ampk activity and amp : atp ratio were studied in primary rat hepatocytes . as shown in fig . 1a , metformin induced a significant time- and dose - dependent activation of ampk , which was already detectable at 0.5 mmol / l after 3 h. this dose - dependent effect persisted after 24 h and was paralleled by a concomitant decrease in atp and increase in amp intracellular levels ( fig . 1b , c ) , resulting in a significant increase of the amp : atp ratio ( fig . dose - dependent effects of metformin on ampk activity and intracellular adenine nucleotide levels in primary rat hepatocytes . primary cultured rat hepatocytes were incubated for 0 , 0.5 , 3 , 6 , 9 , 18 and 24 h in m199 medium with different concentrations of metformin ( white triangle , 0.5 mmol / l ; white diamond , 5 mmol / l ) or vehicle ( black dots ) . b intracellular atp and ( c ) amp concentrations were determined by hplc , and the amp : atp ratios ( d ) calculated . results are expressed as means sem ; n = 34 ; * p < 0.05 compared with control - vehicle time- and dose - dependent effects of metformin on ampk activity and intracellular adenine nucleotide levels in primary rat hepatocytes . primary cultured rat hepatocytes were incubated for 0 , 0.5 , 3 , 6 , 9 , 18 and 24 h in m199 medium with different concentrations of metformin ( white triangle , 0.5 mmol / l ; white diamond , 5 mmol / l ) or vehicle ( black dots ) . b intracellular atp and ( c ) amp concentrations were determined by hplc , and the amp : atp ratios ( d ) calculated . results are expressed as means sem ; n = 34 ; * p < 0.05 compared with control - vehicle species - specific activation of ampk by metformin we next assessed whether the effects of metformin on ampk activity and the amp : atp ratio were similar in rat and human primary hepatocytes . as shown in fig . 2 , metformin increased the amp : atp ratio , ampk activity and ser79-acetyl - coa carboxylase ( acc ) phosphorylation at concentrations higher than 100 mol / l in rat and human hepatocytes . however , the extent of ampk activation by metformin was higher in human than in rat hepatocytes at intermediate concentrations of the drug ( 472% versus 66% at 500 mol / l , respectively ) ( fig . 2a , d ) , although the increase in the amp : atp ratio was similar ( 69% versus 54% , respectively ) ( fig . 2b , e ) , suggesting a species - specific difference in ampk sensitivity toward amp , adp and/or atp . strikingly , the determination of isoform - specific ampk activities after immunoprecipitation of the 1 or 2 ampk catalytic subunits revealed that ampk2 activity was undetectable in human compared with rat hepatocytes , while ampk1 activity was comparable in the basal condition ( fig . 3 ) . accordingly , metformin only increased ampk1 activity in human hepatocytes , although both ampk isoforms were activated by the drug in rat hepatocytes . the apparent species - specific difference in ampk2 activity was confirmed by the absence of protein and mrna expression of this catalytic subunit in human hepatocytes ( fig . interestingly , protein levels and mrna hepatic expression of the and regulatory subunits also significantly differed between species , showing that the 2 , 1 and truncated 2 forms are expressed in human hepatocytes , whereas the 1 , 1 and 2 forms are mostly present in rat and mouse hepatocytes ( fig . 4 ) . we confirmed that these species - specific differences in ampk isoform levels is also found in whole liver ( esm fig . 1 ) , excluding experimental bias induced by hepatocytes isolation.fig . 2dose - dependent effects of metformin on ampk activity and the amp : atp ratio in primary rat and human hepatocytes . a c primary cultured hepatocytes isolated from rats or ( d f ) human liver segments were incubated for 24 h in m199 medium with increasing concentrations of metformin ( white bars ) or vehicle ( black bars ) . a , d ampk activity was measured after polyethylene glycol fractionation and the amp : atp ratios ( b , e ) were calculated after determination of intracellular adenine nucleotides by hplc . c , f the phosphorylation states ( p ) of thr172-ampk and ser79-acc , and the abundance of ampk were assessed by western blot . results ( a , b , d , e ) are expressed as means sem ; n = 34 ; * p < 0.05 compared with control - vehiclefig . a primary cultured hepatocytes isolated from rats or ( b ) human liver segments were incubated for 24 h in m199 medium in the presence of 500 mol / l metformin ( white bars ) or vehicle ( black bars ) . results are expressed as means sem ; n = 34 ; * p < 0.05 compared with control - vehiclefig . 4a protein levels of ampk subunits and ( b ) the corresponding mrna gene expression were determined in hepatocytes isolated from human ( black bars ) , rat ( hatched bars ) or mouse ( white bars ) livers by western blot and rt quantitative pcr , respectively . western blot analysis ( a ) is representative of three separate experiments and shows that ampk subunits migrated to their expected molecular mass ( 1 , 62 kda ; 2 , 62 kda ; 1 , 38 kda ; 2 , 30 kda ; 1 , 38 kda ; 2full - length , 75 kda ; 2truncated , 55 kda ; 3 , 55 kda ) . the western blots for ampk2 were performed using three different primary antibodies cross - reacting with human , rat and mouse forms ( see esm table 1 ) . b the results from rt quantitative pcr were corrected for gapdh and are expressed as means sem ( n = 3 ) . a.u . , arbitrary unitstaken together , the fact that ampk activation by metformin is associated with an elevated amp : atp ratio in hepatocytes strongly suggests that inhibition of the mitochondrial machinery by the drug might be the main underlying mechanism for hepatic activation of the kinase . dose - dependent effects of metformin on ampk activity and the amp : atp ratio in primary rat and human hepatocytes . a f ) human liver segments were incubated for 24 h in m199 medium with increasing concentrations of metformin ( white bars ) or vehicle ( black bars ) . a , d ampk activity was measured after polyethylene glycol fractionation and the amp : atp ratios ( b , e ) were calculated after determination of intracellular adenine nucleotides by hplc . c , f the phosphorylation states ( p ) of thr172-ampk and ser79-acc , and the abundance of ampk were assessed by western blot . results ( a , b , d , e ) are expressed as means sem ; n = 34 ; * p < 0.05 compared with control - vehicle effects of metformin on ampk1 and 2 activities . a primary cultured hepatocytes isolated from rats or ( b ) human liver segments were incubated for 24 h in m199 medium in the presence of 500 mol / l metformin ( white bars ) or vehicle ( black bars ) . results are expressed as means sem ; n = 34 ; * p < 0.05 compared with control - vehicle a protein levels of ampk subunits and ( b ) the corresponding mrna gene expression were determined in hepatocytes isolated from human ( black bars ) , rat ( hatched bars ) or mouse ( white bars ) livers by western blot and rt quantitative pcr , respectively . western blot analysis ( a ) is representative of three separate experiments and shows that ampk subunits migrated to their expected molecular mass ( 1 , 62 kda ; 2 , 62 kda ; 1 , 38 kda ; 2 , 30 kda ; 1 , 38 kda ; 2full - length , 75 kda ; 2truncated , 55 kda ; 3 , 55 kda ) . the western blots for ampk2 were performed using three different primary antibodies cross - reacting with human , rat and mouse forms ( see esm table 1 ) . b the results from rt quantitative pcr were corrected for gapdh and are expressed as means sem ( n = 3 ) . a.u . , arbitrary units mechanism(s ) of ampk activation by metformin to investigate the mechanisms by which metformin affects the cellular energy state , together with the putative involvement of ampk in this process , we used hepatocytes from wild - type and liver - specific ampk1/2 mice . freshly isolated hepatocytes were incubated with metformin , and ampk activity and expression , as well as the amp : atp ratio and jo2 were measured . as expected , metformin increased the amp : atp ratio , ampk activity and ser79-acc phosphorylation in hepatocytes from wild - type mice ( fig . 5a c ) . in hepatocytes from liver - specific ampk1/2 mice , ampk expression , activity and activation 5a , b ) , but the increase in the amp : atp ratio induced by metformin was still present and even significantly higher than in hepatocytes from wild - type mice ( fig . metformin induced a similar inhibition of jo2 in wild - type and liver - specific ampk1/2 mice , an effect that persisted after addition of the mitochondrial oxidative phosphorylation ( oxphos ) uncoupler dnp ( fig . this clearly indicates that the inhibitory effect of metformin on jo2 was exerted on the electron transfer chain rather than on downstream step(s ) linked to atp synthesis . the effect of metformin in intact cells from wild - type and liver - specific ampk1/2 mice was further investigated after permeabilisation of the plasma membrane by digitonin , allowing the mitochondrial oxphos pathway to be investigated in situ . in the presence of glutamate / malate , a substrate for the respiratory - chain complex 1 , a significant decrease in mitochondrial respiratory rates could be detected after metformin pre - treatment of cells from wild - type and liver - specific ampk1/2 mice , occurring regardless of the mitochondrial energy state ( fig . by contrast , no differences were observed with succinate / malate , a substrate for the respiratory - chain complex 2 ( fig . importantly , a similar specific inhibition of the mitochondrial respiratory - chain complex 1 by metformin was found in freshly isolated human hepatocytes incubated in the same conditions ( fig . 5effects of metformin on ampk activity , amp : atp ratio , and cellular and mitochondrial jo2 in intact or permeabilised hepatocytes from wild - type and liver - specific ampk1/2 mice . hepatocytes from wild - type or ampk1/2 mice were incubated at 37c in a krebs / bicarbonate medium containing lactate / pyruvate / octanoate ( 20 , 2 , 4 mmol / l ) in the presence of vehicle ( black bars ) or 5 mmol / l metformin ( white bars ) . after 30 min incubation , ampk activity in u / g of dry cells ( a ) , isoform - specific ampk abundance and ser79-acc phosphorylation ( p ) state ( b ) , and the amp : atp ratio ( c ) were determined . d i oligomycin - sensitive jo2 was measured after the successive addition of 6 g / ml oligomycin ( basal ) and 100 mol / l dnp in separate experiments , after hepatocytes from wild - type ( d , f , h ) and liver - specific ampk1/2 ( e , g , i ) mice had been incubated as described above and permeabilised in a kcl medium containing 200 g / ml digitonine . jo2 was measured in the presence of glutamate / malate ( 5 mmol / l ; 2.5 mmol / l ) ( f , g ) or succinate / malate / rotenone ( 5 mmol / l ; 0.5 mmol / l ; 1.25 mol / l ) ( h , i ) after the successive addition of 1 mmol / l adp ( state 3 ) , 6 g / ml oligomycin ( state 4 ) and 75 mol / l dnp . all jo2 results are expressed as percentage of the maximum activity of cytochrome oxidase ( cyt.ox ) determined after the final addition of 0.15 g / ml antimycin and tmpd / ascorbate ( 1 mmol / l , 5 mmol / l ) . results are expressed as means sem ; n = 3 ; * p < 0.05 compared with control - vehicle ; p < 0.05 compared with wild - type micefig . hepatocytes isolated from human liver segments were incubated in the presence of vehicle ( black bars ) or 5 mmol / l metformin ( white bars ) , and the jo2 was measured in the presence of ( a ) glutamate / malate ( 5 mmol / l , 2.5 mmol / l ) or ( b ) succinate / malate / rotenone ( 5 mmol / l ; 0.5 mmol / l ; 1.25 mol / l ) as described ( fig . 5 ) . the results are expressed as means sem ; n = 3 ; * p < 0.05 compared with control - vehiclecollectively , these results demonstrate that the inhibition of jo2 and resultant increase in the amp : atp ratio induced by metformin in hepatocytes is due to a specific and ampk - independent inhibition of the mitochondrial respiratory - chain complex 1 . effects of metformin on ampk activity , amp : atp ratio , and cellular and mitochondrial jo2 in intact or permeabilised hepatocytes from wild - type and liver - specific ampk1/2 mice . hepatocytes from wild - type or ampk1/2 mice were incubated at 37c in a krebs / bicarbonate medium containing lactate / pyruvate / octanoate ( 20 , 2 , 4 mmol / l ) in the presence of vehicle ( black bars ) or 5 mmol / l metformin ( white bars ) . after 30 min incubation , ampk activity in u / g of dry cells ( a ) , isoform - specific ampk abundance and ser79-acc phosphorylation ( p ) state ( b ) , and the amp : atp ratio ( c ) were determined . d i oligomycin - sensitive jo2 was measured after the successive addition of 6 g / ml oligomycin ( basal ) and 100 mol / l dnp in separate experiments , after hepatocytes from wild - type ( d , f , h ) and liver - specific ampk1/2 ( e , g , i ) mice had been incubated as described above and permeabilised in a kcl medium containing 200 g / ml digitonine . jo2 was measured in the presence of glutamate / malate ( 5 mmol / l ; 2.5 mmol / l ) ( f , g ) or succinate / malate / rotenone ( 5 mmol / l ; 0.5 mmol / l ; 1.25 mol / l ) ( h , i ) after the successive addition of 1 mmol / l adp ( state 3 ) , 6 g / ml oligomycin ( state 4 ) and 75 mol / l dnp . all jo2 results are expressed as percentage of the maximum activity of cytochrome oxidase ( cyt.ox ) determined after the final addition of 0.15 g / ml antimycin and tmpd / ascorbate ( 1 mmol / l , 5 mmol / l ) . results are expressed as means sem ; n = 3 ; * p < 0.05 compared with control - vehicle ; p < 0.05 compared with wild - type mice effects of metformin on jo2 in permeabilised human hepatocytes . hepatocytes isolated from human liver segments were incubated in the presence of vehicle ( black bars ) or 5 mmol / l metformin ( white bars ) , and the jo2 was measured in the presence of ( a ) glutamate / malate ( 5 mmol / l , 2.5 mmol / l ) or ( b ) succinate / malate / rotenone ( 5 mmol / l ; 0.5 mmol / l ; 1.25 mol / l ) as described ( fig . 5 ) . the results are expressed as means sem ; n = 3 ; * p < 0.05 compared with control - vehicle collectively , our results show that activation of ampk by metformin in primary hepatocytes from rodents and humans is due to a decrease in cellular energy status resulting from metformin s ampk - independent and specific inhibition of mitochondrial respiratory - chain complex 1 . strikingly , we report here for the first time that the distribution of ampk catalytic and regulatory subunits in hepatocytes differs between rodents and humans . this new important finding suggests possible consequences for pharmaceutical strategies focusing on the development of ampk activators for the treatment of metabolic diseases . the mitochondrial respiratory - chain complex 1 is the primary target of metformin the inhibition of the mitochondrial respiratory - chain complex 1 by metformin was first reported in perfused livers and isolated rat hepatocytes by leverve s group and later confirmed in various other cellular models by us [ 2125 ] and others [ 11 , 13 , 26 , 27 ] . due to its weaker lipophilic property , metformin , in contrast to the other biguanides , induces only mild and specific inhibition of the respiratory - chain complex 1 and does not affect oxphos downstream machinery ( figs 5 and 6 ; b. guigas , unpublished results ) . in the present manuscript , we show for the first time that this mitochondrial effect of metformin is also present in human hepatocytes , confirming that the respiratory - chain complex 1 constitutes the primary target of the drug , whatever the species.although the exact mechanisms by which metformin decreases complex 1 activity remains unknown to date , it has been shown that this effect requires intact cells [ 12 , 22 ] and , at least in hepatocytes , is not prevented by inhibition of nitric oxide synthase or by various reactive oxygen species scavengers . on the other hand , the mechanism by which metformin activates ampk is still being discussed . despite the indisputable mitochondrial effect of the drug , fryer et al . and hawley et al . initially reported that metformin activated ampk in muscle and rat hepatoma cells without affecting the amp : atp ratio [ 14 , 15 ] . in the present study , we clearly demonstrate that the activation of ampk by metformin is associated with an increased amp : atp ratio resulting from inhibition of the respiratory - chain complex 1 . these discrepancies may be explained by technical differences in nucleotide measurement and subcellular amp compartmentalisation , or by the fact that immortalised cell lines are highly glycolytic and therefore much less sensitive to impairment of mitochondrial oxphos for atp supply . in addition , the involvement of complex 1 in the activation of ampk by metformin has also been elegantly demonstrated in pancreatic min6 cells , by showing that methyl succinate , a substrate of complex 2 that bypasses the inhibition of complex 1 by the drug , prevented ampk activation . finally , two recent publications also support the finding that metformin activates ampk via changes in cellular energy status . thus hawley et al . showed that the activation of ampk by metformin is abolished in a cell line stably expressing ampk complexes that contain an amp - insensitive 2 mutant ; this indicates that increased cytosolic amp triggers activation of the kinase by the drug . on the other hand , foretz et al . also demonstrated that , contrary to what was initially suggested by others , metformin inhibits hepatic gluconeogenesis by an lkb1- and ampk - independent mechanism involving an acute decrease in the hepatic energy state . ampk is not required for the inhibitory effect of metformin on respiratory - chain complex 1 in mammalian mitochondria , the respiratory - chain complex 1 is made up of 45 subunits , of which several can be phosphorylated by various ser / thr protein kinases , thus affecting respiratory - chain complex 1 activity . to rule out the possibility that the mitochondrial effect of metformin is secondary to ampk activation via some putative amp - independent mechanism , we used ampk - null hepatocytes isolated from liver - specific ampk1/2 mice [ 18 , 30 ] . by showing that metformin inhibited the respiratory - chain complex 1 in hepatocytes from wild - type and liver - specific ampk1/2 mice , we can clearly rule out the notion that a primary effect of the drug is mediated by ampk through phosphorylation of some subunits of the respiratory - chain complex 1 and/or other mitochondrial proteins regulating oxphos . the more pronounced effect of metformin on the amp : atp ratio in primary hepatocytes from liver - specific ampk1/2 compared with wild - type mice ( fig . 5 ) could be explained by a decrease in atp synthesis secondary to impaired mitochondrial biogenesis and/or by a lack of ampk - mediated inhibition of atp consumption , as previously reported [ 18 , 30 ] . species - specific differences in hepatic abundance of ampk subunits the ampk protein is a heterotrimer composed of a catalytic subunit and two regulatory and subunits , in a ratio of 1:1:1 , all of which are required for the formation of a stable and fully functional ampk complex [ 8 , 9 ] . while some minor differences could be shown , depending on the fibre types , for the regulatory subunit , it is well established that the 1 and 2 catalytic subunits are both expressed in human and rodent skeletal muscle , and that the 221 complex constitutes the majority of ampk heterotrimers in this metabolic tissue , showing a high degree of consistency between species [ 3337 ] . in the present study , the mrna expression pattern and protein levels of the ampk subunits found in rodent livers is in agreement with those previously reported [ 35 , 38 ] , leading to many possible combinations of heterotrimers containing either 1 or 2 catalytic subunits , and 1 , 1 and 2 regulatory subunits . as far as we know , our finding showing that the abundance of hepatic ampk subunits differs in humans compared with rodents is unprecedented . thus , it might be speculated that the resulting differences in heterotrimeric composition of ampk could affect the regulation of kinase activity , notably its sensitivity toward amp . indeed , it is striking that the activation of ampk by metformin seemed more potent , although the increase of the amp : atp ratio in humans compared with rat primary hepatocytes was similar ( fig . 2 ) , suggesting that the human ampk 121 or 122 truncated complexes could be more sensitive to subtle changes in cellular energy status . however , this is in contradiction with previous in vitro results showing that , in rat liver extract , ampk complexes containing the 2/2 isoforms had a greater dependence on amp [ 35 , 39 ] . interestingly , it has been very recently shown that adp , like amp , could also bind to the subunit , leading to modulation of the amp - triggered phosphorylation of ampk on thr172 . it seems therefore possible that subtle species - specific differences in the metformin - induced increase of the adp : atp ratio could also be involved . unfortunately , the determination of intracellular adp levels by hplc was technically not possible in our conditions , so further investigations are required to clarify this point . it is worth mentioning that ampk has also been reported to have a differential and tissue - specific localisation pattern in mammalian cells , with the ampk1 subunit being mainly localised in the cytosol , and the ampk2 and 2 subunits being localised to the nucleus and cytosolic fractions [ 3942 ] . while not as yet clarified , the subcellular localisation of the kinase might have an important functional role , such as regulation of gene expression by phosphorylation of nuclear targets of ampk this would therefore suggest that differences in the composition of ampk complexes between rodents and human hepatocytes could result in different physiological outcomes , including putative nuclear regulatory functions.taken together , the species - specific differences shown in ampk complexes in the liver imply that pharmaceutical activation of hepatic ampk could have different effects in rodents and humans . therapeutic relevance of the metformin concentrations used in vitro as shown in fig . 1 , the key determinant of ampk activation by metformin is a balance between the concentration and the time of exposure to the drug . it is worth noting that most of the in vitro experiments reporting activation of ampk by metformin were generally performed with drug concentrations far above those found in tissues from rodents after oral administration of metformin [ 43 , 44 ] . in the present study , we show that hepatic ampk is activated by metformin at concentrations higher than 100 mol / l , i.e. about five times the highest plasma level reported in humans after a single oral drug administration [ 45 , 46 ] . however , the liver is one of the few organs that can accumulate significant amounts of metformin , with tissue concentrations that reached hundreds of mol / l in the periportal area [ 43 , 44 ] . in addition , the intracellular transport of metformin is mediated by the organic cation transporter 1 ( oct1 ) , the deletion of which in hepatocytes resulted in impairment of metformin - induced ampk activation . interestingly , increased oct1 levels and metformin concentrations were recently reported in the liver of mice on a high - fat diet , suggesting that hepatic accumulation of the drug could be even higher in diabetic patients . we have demonstrated here that the primary target of metformin in rodent and human hepatocytes is the mitochondrial machinery . the specific inhibition of the respiratory - chain complex 1 by the drug leads to a dose- and time - dependent decrease in atp levels , which results in a concomitant increase in cytosolic amp concentrations ( and the amp : atp ratio ) , triggering the activation of ampk . one of the important new findings of this study is the species - specific differences in the profile of ampk subunits , suggesting that regulation of the kinase , which is well characterised in rodents , could differ significantly in humans . further investigations are still required , but this point should certainly be considered when developing new pharmacological agents that target ampk .

the inheritance of various traits or diseases from parent to offspring occurs primarily through dna . when comparing two random human individuals , their dna is approximately 99.9 % identical . the remaining 0.1 % of dna is responsible for their differences ( variations ) . the dna of an individual can change or become mutated in several ways , ranging from small - scale variants that affect just one or a few nucleotides ( small substitutions , insertions and deletions ) to large - scale alterations affecting the chromosome structure , for example with copy number variations or translocations . in the case of a nucleotide change , the term variant often refers to a mere difference compared with a reference genome ( which is publically accessible online ) . mutation is more used for changes which cause impairment of protein function and lead to disease . types that generally produce large effects are for example stop - gain ( also called nonsense ) , essential splice site and frameshift mutations , which usually cause early stops , thereby impairing protein formation , leading to an incomplete or excessively large protein . though not necessarily damaging , these types of mutations understandably have the potential to severely impair biological function . other so - called missense mutations more subtly change one amino acid ( which are the building blocks of proteins ) , while leaving the rest of the protein intact . constitutions of nucleotides at a certain place in a gene are called alleles : for example at a certain place in a chromosome , one individual has allele a and the other individual has allele t. since , in humans , two copies exist of every chromosome , individuals can be homozygous for an allele ( existing on both chromosomes , e.g. aa , cc , gg , tt ) or heterozygous ( existing on one chromosome , e.g. ac , ag , at , cg , ct , gt ) . individuals carrying only one copy of an allele or chromosome are hemizygous ( for example the x - chromosome in males ) . the first basic genetic inheritance models date back from the nineteenth century , when gregor mendel , an augustinian monk , posed rules for dominant and recessive inheritance . these rules still constitute the basis of current views on certain inheritance models of human diseases , which are nowadays referred to as mendelian models . another present - day example reflecting mendel s merits is the online mendelian inheritance in man website ( omim , via http://www.omim.org ) , which is a widely used online catalogue of human genes and genetic disorders . clinical examples in this article will be provided with a so - called mim number , which can be used to access more related information on the omim website . mendel s theory on inheritance mainly comprised two models : dominant and recessive . in an autosomal dominant inheritance pattern , a certain phenotype is caused in a heterozygous individual by a single , dominantly acting allele . this allele can be transferred to the offspring with a 50 % chance for both females and males ( e.g. myh7 mutations in dilated cardiomyopathy , mim#613426 ) . in autosomal recessive diseases , this can be either at the same position in a gene in homozygous individuals ( often caused by related , consanguineous parents ) or at two different positions in a gene , in so - called compound heterozygous individuals ( with one allele maternally , the other allele paternally inherited ) . since males receive only one maternal x - chromosome ( and therefore are hemizygous ) they are more likely to be affected by a mutation on the x - chromosome . females have two x - chromosome copies , so mutations in one chromosome can be ( partially ) compensated by the healthy allele on the other x - chromosome . the inheritance of various traits or diseases from parent to offspring occurs primarily through dna . when comparing two random human individuals , their dna is approximately 99.9 % identical . the remaining 0.1 % of dna is responsible for their differences ( variations ) . the dna of an individual can change or become mutated in several ways , ranging from small - scale variants that affect just one or a few nucleotides ( small substitutions , insertions and deletions ) to large - scale alterations affecting the chromosome structure , for example with copy number variations or translocations . in the case of a nucleotide change , the term variant often refers to a mere difference compared with a reference genome ( which is publically accessible online ) . mutation is more used for changes which cause impairment of protein function and lead to disease . types that generally produce large effects are for example stop - gain ( also called nonsense ) , essential splice site and frameshift mutations , which usually cause early stops , thereby impairing protein formation , leading to an incomplete or excessively large protein . though not necessarily damaging , these types of mutations understandably have the potential to severely impair biological function . other so - called missense mutations more subtly change one amino acid ( which are the building blocks of proteins ) , while leaving the rest of the protein intact . constitutions of nucleotides at a certain place in a gene are called alleles : for example at a certain place in a chromosome , one individual has allele a and the other individual has allele t. since , in humans , two copies exist of every chromosome , individuals can be homozygous for an allele ( existing on both chromosomes , e.g. aa , cc , gg , tt ) or heterozygous ( existing on one chromosome , e.g. ac , ag , at , cg , ct , gt ) . individuals carrying only one copy of an allele or chromosome are hemizygous ( for example the x - chromosome in males ) . the first basic genetic inheritance models date back from the nineteenth century , when gregor mendel , an augustinian monk , posed rules for dominant and recessive inheritance . these rules still constitute the basis of current views on certain inheritance models of human diseases , which are nowadays referred to as mendelian models . another present - day example reflecting mendel s merits is the online mendelian inheritance in man website ( omim , via http://www.omim.org ) , which is a widely used online catalogue of human genes and genetic disorders . clinical examples in this article will be provided with a so - called mim number , which can be used to access more related information on the omim website . mendel s theory on inheritance mainly comprised two models : dominant and recessive . in an autosomal dominant inheritance pattern , a certain phenotype is caused in a heterozygous individual by a single , dominantly acting allele . this allele can be transferred to the offspring with a 50 % chance for both females and males ( e.g. myh7 mutations in dilated cardiomyopathy , mim#613426 ) . in autosomal recessive diseases , this can be either at the same position in a gene in homozygous individuals ( often caused by related , consanguineous parents ) or at two different positions in a gene , in so - called compound heterozygous individuals ( with one allele maternally , the other allele paternally inherited ) . since males receive only one maternal x - chromosome ( and therefore are hemizygous ) they are more likely to be affected by a mutation on the x - chromosome . females have two x - chromosome copies , so mutations in one chromosome can be ( partially ) compensated by the healthy allele on the other x - chromosome . clinical genetics comprises the diagnostic process of , and adaptation to the medical , psychological and familial implications of genetic disease . various medical specialists refer a paediatric or adult patient ( proband / index ) with a suspected genetic disease to outpatient genetics clinics for evaluation . medical history ( including prenatal , neonatal period ) of motor and intellectual development , physical examination for growth parameters , dysmorphic features ( unusual morphology of the face and body ) and pedigree construction ( diagram representing how a trait or disease is segregating in a family ) are important factors to assess the possibility for a genetic cause of the disease . these contain medical photos and extensive phenotypic information to provide assistance in pinpointing the right diagnosis in the jungle of rare genetic diseases ( e.g. omim , london medical database lmd ) . examples of genetic tests are dna sequencing ( reading parts of dna ) of candidate genes ( e.g. mybpc3 in dilated cardiomyopathy , mim#615396 ) , karyotyping and array analysis ( e.g. for investigating chromosomal abnormalities , such as down syndrome or 22q11 deletion syndrome ) . if family members of the index patient are concerned about the risk of developing the same disease themselves or in a second child , genetic counselling with risk assessment , presymptomatic testing , prenatal diagnostics or sometimes even preimplantation genetic screening ( genetic profiling of embryos ) can be offered . clinical geneticists often collaborate with research groups when they are unable to identify the underlying genetic defect of the patient s disease . genetic counselling can be relevant for dilated cardiomyopathy ( dcm ) patients , since the disease has been demonstrated to frequently have a genetic origin , even in seemingly sporadic cases that is , dcm patients with no self - reported family history of cardiomyopathy . in 1992 , michels et al . showed by screening family members of dcm patients with echocardiography that dcm is heritable in at least one in five patients . the majority of family members were asymptomatic with only a dilated left ventricle , and some developed symptoms in the following years . since dcm can have such presymptomatic stages whereby index patients appear to be sporadic , routine family screening with echocardiography of family members of dcm patients is recommended ( fig . 1 ) . in the case of familial dcm , genetic testing can subsequently be considered , particularly with accompanying conduction disorder(s ) and/or arrhythmia . the beneficial role of genetic diagnostics in truly sporadic idiopathic dcm has not been empirically substantiated yet . in general , cardiac genetic disorders are characterised by a heterogeneous background , with variable penetrance and expressivity . this means that clinical phenotypes can vary within families , even when pedigrees share the same mutation . hence , one can find mutation carriers having no clinical manifestations of the disease to having severe disease with various manifestations .fig . 1examples of inheritance in pedigrees with seemingly sporadic cases : a de novo , b / c autosomal dominant with reduced penetrance (= a mutation does not consequently cause disease ) , d : autosomal recessive , e : compound heterozygous ( two mutations in one gene , yet in two different alleles , collectively constituting an effect ) , f x - linked inheritance examples of inheritance in pedigrees with seemingly sporadic cases : a de novo , b / c autosomal dominant with reduced penetrance (= a mutation does not consequently cause disease ) , d : autosomal recessive , e : compound heterozygous ( two mutations in one gene , yet in two different alleles , collectively constituting an effect ) , f x - linked inheritance the diagnosis of genetic cardiomyopathies can be beneficial at multiple clinical levels . in diagnostics and therapy , presymptomatic investigation ( mainly for family members ) could lead to possible health benefit by early treatment of disease . the potential of early treatment for mutation carriers is currently being assessed by the precardia trial . here , an angiotensin - converting enzyme inhibitor ( ace inhibitor ) is administered to family members of dcm patients that carry a ( presumed ) pathogenic mutation , to see if this can delay or prevent the occurrence of dcm . in 2006 , meune et al . performed implantable cardiac defibrillator ( icd ) implantation in patients with a lamin a / c ( lmna ) mutation , who were only in need of a pacemaker . they showed effectiveness in treating possibly lethal tachyarrhythmias in 42 % of the patients , with an appropriate shock percentage of 89 % . of note , improvement of survival could not be assessed , since the study did not contain a control group . another example of therapeutic consequences is lifestyle recommendations for patients with hypertrophic cardiomyopathy , such as abstinence from top sports . also patients with arrhythmogenic right ventricular dysplasia / cardiomyopathy are advised against practising competitive and endurance sports , for arrhythmia prevention . in prognostics , van spaendonck - zwarts et al . demonstrated that the prevalence of mortality , heart transplantation and malignant ventricular arrhythmias was higher among dcm patients with a mutation in the phospholamban ( pln ) or lmna gene , compared with dcm patients who did not carry a mutation in diagnostically screened genes . a deletion of arginine 14 in the pln gene can , for example , cause dilated cardiomyopathy with attenuated electrocardiographic ( ecg ) r amplitudes or low voltages in multiple leads on the ecg [ 24 , 25 ] . lmna mutations in turn , typically show a low amplitude p wave and prolongation of the pr interval with a narrow qrs complex on the ecg . furthermore , patients with these gene mutations are at higher risk to develop conduction disorders and/or arrhythmias . in the last decade , dna sequencing in genetic diagnostics has undergone some tremendous changes . due to technological advancements with next - generation sequencing ( ngs ) , the capacity and cost efficiency of dna sequencing has grown enormously by creating the ability to screen multiple genes simultaneously . before ngs , though very reliable , this method has smaller throughput , meaning that usually one gene was screened at a time , and that the maximum number of genes to be screened was also practically limited . since many genes are involved in the pathogenesis of cardiomyopathies ( dcm for example has more than 45 implicated genes ) , ngs subsequently provides an enormous potential for improvement in terms of efficiency in cardiovascular genetic testing , when compared with sanger sequencing . the discovery rate in cardiovascular genetics has correspondingly grown rapidly . in 2012 , for example , using ngs , herman et al . discovered the important role of the titin ( ttn ) gene in the disease aetiology of dilated cardiomyopathy . after its successful debut in research , ngs has been implemented over the last years in multiple diagnostic centres . here , multiple genes can be screened simultaneously in multiple patients on a single chip ( so - called gene panel ) . these genes are implicated in highly diverse biological structures and pathways , among which sarcomere integrity , ion channels , metabolism , calcium regulation and transcriptional control [ 3032 ] . alongside its application in diagnostics , ngs is sometimes deployed in research settings to screen for mutations in any desired combination of genes , or even all genes simultaneously . the latter is called whole exome sequencing and is mainly suitable for cases with large families available for genetic screening , or for patients in which de novo ( arose in the genome after fertilisation ) mutations are expected based on the pedigree . in that case , trio analysis is performed , in which the whole exome sequence of a patient is compared with that of the ( healthy ) parents . with ngs , earlier shortcomings of sanger sequencing in terms of throughput and cost efficiency now the genetic community is facing a whole new challenge though , which is adequately interpreting the significance of identified variants . the more genes are investigated , the more variants one will find . with the capacity of ngs to harvest so many variants , effective means to differentiate between innocent and pathogenic variants are essential . besides the obvious optimisation of data quality to ensure actual presence of a variant , the likelihood of variants to be pathogenic is assessed in various ways ( fig . 2 ) . first , one can assess the frequency of a certain variant in the general population in order to distinguish rare from common variants , by comparison with online reference genomes . the underlying idea here is that common variants can not be causal for rare diseases .fig . 2global overview of genetic data analysis , by filtering for multiple criteria : ( i ) rare variants ( by comparison with online reference genomes such as the single nucleotide polymorphism database ( dbsnp ) , or exome sequencing project ( esp ) ) , ( ii ) mutation effect ( previously explained ) ( iii ) functional prediction ( sift sorting intolerant from tolerant ) , the likelihood of variants to be damaging is assessed global overview of genetic data analysis , by filtering for multiple criteria : ( i ) rare variants ( by comparison with online reference genomes such as the single nucleotide polymorphism database ( dbsnp ) , or exome sequencing project ( esp ) ) , ( ii ) mutation effect ( previously explained ) ( iii ) functional prediction ( sift sorting intolerant from tolerant ) , the likelihood of variants to be damaging is assessed second is mutation effect assessment . here only variants that potentially impair protein structure and/or function are selected ( these mutation types are explained above , under third , the likelihood of missense and splice - site variants to be damaging is assessed with software programmes ( sift and polyphen ) that predict possible impact on the structure and function of a human protein using straightforward physical and comparative considerations . fourth , after this initial workup of identified variants , an important analysis step is family segregation , which is considered the cornerstone of genetic counselling . it basically comprises genetic screening of affected family members , to see if a mutation segregates with disease . the stronger a mutation segregates with disease , fifth is functional follow - up , where mutations are investigated , in for example animal models , to assess their biological effect . due to time and cost constraints , functional tests are unfortunately not available for diagnostics , and therefore are only occasionally deployed in genetic research . the analysis methods described above can reduce the number of suspicious variants to a great extent . nonetheless we are often left with a high number of so - called variants of uncertain significance ( vus ) , impeding effective diagnostics . hence , for patients with idiopathic dilated cardiomyopathy , the advent of ngs has cleared up the genetic cause for some patients , while generating tremendous uncertainty for many patients with its high number of vusses . this means that , in the anticipation of genetic screening , one must consider carefully how many genes are to be screened . the principle applies that when fewer genes are screened ( with a so - called targeted approach ) , less variants will likely be detected , thus facilitating their interpretation at the same time though , sensitivity diminishes , meaning that finding no variant in a subset of genes does not exclude a genetic cause . inversely , simply choosing a broad approach with whole exome sequencing will often result in an unsolvable wealth of variants , with a low specificity . the uncertain role of variants and their pathogenicity is even shown to extend to variants previously deemed to be causal for dcm . in 2013 , andreasen et al . showed , by using online mutation databases and large publicly available reference genome datasets , that known dcm - causing variants were in fact more prevalent than estimates of dcm prevalence . this justly questioned the pathogenicity of these variants and even raised the question whether the prevalence of dcm is higher than previously estimated . clinical genetics comprises the diagnostic process of , and adaptation to the medical , psychological and familial implications of genetic disease . various medical specialists refer a paediatric or adult patient ( proband / index ) with a suspected genetic disease to outpatient genetics clinics for evaluation . medical history ( including prenatal , neonatal period ) of motor and intellectual development , physical examination for growth parameters , dysmorphic features ( unusual morphology of the face and body ) and pedigree construction ( diagram representing how a trait or disease is segregating in a family ) are important factors to assess the possibility for a genetic cause of the disease . these contain medical photos and extensive phenotypic information to provide assistance in pinpointing the right diagnosis in the jungle of rare genetic diseases ( e.g. omim , london medical database lmd ) . examples of genetic tests are dna sequencing ( reading parts of dna ) of candidate genes ( e.g. mybpc3 in dilated cardiomyopathy , mim#615396 ) , karyotyping and array analysis ( e.g. for investigating chromosomal abnormalities , such as down syndrome or 22q11 deletion syndrome ) . if family members of the index patient are concerned about the risk of developing the same disease themselves or in a second child , genetic counselling with risk assessment , presymptomatic testing , prenatal diagnostics or sometimes even preimplantation genetic screening ( genetic profiling of embryos ) can be offered . clinical geneticists often collaborate with research groups when they are unable to identify the underlying genetic defect of the patient s disease . genetic counselling can be relevant for dilated cardiomyopathy ( dcm ) patients , since the disease has been demonstrated to frequently have a genetic origin , even in seemingly sporadic cases that is , dcm patients with no self - reported family history of cardiomyopathy . in 1992 , michels et al . showed by screening family members of dcm patients with echocardiography that dcm is heritable in at least one in five patients . the majority of family members were asymptomatic with only a dilated left ventricle , and some developed symptoms in the following years . since dcm can have such presymptomatic stages whereby index patients appear to be sporadic , routine family screening with echocardiography of family members of dcm patients is recommended ( fig . 1 ) . in the case of familial dcm , genetic testing can subsequently be considered , particularly with accompanying conduction disorder(s ) and/or arrhythmia . the beneficial role of genetic diagnostics in truly sporadic idiopathic dcm has not been empirically substantiated yet . in general , cardiac genetic disorders are characterised by a heterogeneous background , with variable penetrance and expressivity . this means that clinical phenotypes can vary within families , even when pedigrees share the same mutation . hence , one can find mutation carriers having no clinical manifestations of the disease to having severe disease with various manifestations .fig . 1examples of inheritance in pedigrees with seemingly sporadic cases : a de novo , b / c autosomal dominant with reduced penetrance (= a mutation does not consequently cause disease ) , d : autosomal recessive , e : compound heterozygous ( two mutations in one gene , yet in two different alleles , collectively constituting an effect ) , f x - linked inheritance examples of inheritance in pedigrees with seemingly sporadic cases : a de novo , b / c autosomal dominant with reduced penetrance (= a mutation does not consequently cause disease ) , d : autosomal recessive , e : compound heterozygous ( two mutations in one gene , yet in two different alleles , collectively constituting an effect ) , f x - linked inheritance the diagnosis of genetic cardiomyopathies can be beneficial at multiple clinical levels . in diagnostics and therapy , presymptomatic investigation ( mainly for family members ) could lead to possible health benefit by early treatment of disease . the potential of early treatment for mutation carriers is currently being assessed by the precardia trial . here , an angiotensin - converting enzyme inhibitor ( ace inhibitor ) is administered to family members of dcm patients that carry a ( presumed ) pathogenic mutation , to see if this can delay or prevent the occurrence of dcm . in 2006 , meune et al . performed implantable cardiac defibrillator ( icd ) implantation in patients with a lamin a / c ( lmna ) mutation , who were only in need of a pacemaker . they showed effectiveness in treating possibly lethal tachyarrhythmias in 42 % of the patients , with an appropriate shock percentage of 89 % . of note , improvement of survival could not be assessed , since the study did not contain a control group . another example of therapeutic consequences is lifestyle recommendations for patients with hypertrophic cardiomyopathy , such as abstinence from top sports . also patients with arrhythmogenic right ventricular dysplasia / cardiomyopathy are advised against practising competitive and endurance sports , for arrhythmia prevention . in prognostics , van spaendonck - zwarts et al . demonstrated that the prevalence of mortality , heart transplantation and malignant ventricular arrhythmias was higher among dcm patients with a mutation in the phospholamban ( pln ) or lmna gene , compared with dcm patients who did not carry a mutation in diagnostically screened genes . a deletion of arginine 14 in the pln gene can , for example , cause dilated cardiomyopathy with attenuated electrocardiographic ( ecg ) r amplitudes or low voltages in multiple leads on the ecg [ 24 , 25 ] . lmna mutations in turn , typically show a low amplitude p wave and prolongation of the pr interval with a narrow qrs complex on the ecg . furthermore , patients with these gene mutations are at higher risk to develop conduction disorders and/or arrhythmias . in the last decade , dna sequencing in genetic diagnostics has undergone some tremendous changes . due to technological advancements with next - generation sequencing ( ngs ) , the capacity and cost efficiency of dna sequencing has grown enormously by creating the ability to screen multiple genes simultaneously . before ngs , though very reliable , this method has smaller throughput , meaning that usually one gene was screened at a time , and that the maximum number of genes to be screened was also practically limited . since many genes are involved in the pathogenesis of cardiomyopathies ( dcm for example has more than 45 implicated genes ) , ngs subsequently provides an enormous potential for improvement in terms of efficiency in cardiovascular genetic testing , when compared with sanger sequencing . the discovery rate in cardiovascular genetics has correspondingly grown rapidly . in 2012 , for example , using ngs , herman et al . discovered the important role of the titin ( ttn ) gene in the disease aetiology of dilated cardiomyopathy . after its successful debut in research , ngs has been implemented over the last years in multiple diagnostic centres . here , multiple genes can be screened simultaneously in multiple patients on a single chip ( so - called gene panel ) . these genes are implicated in highly diverse biological structures and pathways , among which sarcomere integrity , ion channels , metabolism , calcium regulation and transcriptional control [ 3032 ] . alongside its application in diagnostics , ngs is sometimes deployed in research settings to screen for mutations in any desired combination of genes , or even all genes simultaneously . the latter is called whole exome sequencing and is mainly suitable for cases with large families available for genetic screening , or for patients in which de novo ( arose in the genome after fertilisation ) mutations are expected based on the pedigree . in that case , trio analysis is performed , in which the whole exome sequence of a patient is compared with that of the ( healthy ) parents . with ngs , earlier shortcomings of sanger sequencing in terms of throughput and cost efficiency have certainly been overcome . now the genetic community is facing a whole new challenge though , which is adequately interpreting the significance of identified variants . the more genes are investigated , the more variants one will find . with the capacity of ngs to harvest so many variants , effective means to differentiate between innocent and pathogenic variants are essential . besides the obvious optimisation of data quality to ensure actual presence of a variant , the likelihood of variants to be pathogenic is assessed in various ways ( fig . 2 ) . first , one can assess the frequency of a certain variant in the general population in order to distinguish rare from common variants , by comparison with online reference genomes . the underlying idea here is that common variants can not be causal for rare diseases .fig . 2global overview of genetic data analysis , by filtering for multiple criteria : ( i ) rare variants ( by comparison with online reference genomes such as the single nucleotide polymorphism database ( dbsnp ) , or exome sequencing project ( esp ) ) , ( ii ) mutation effect ( previously explained ) ( iii ) functional prediction ( sift sorting intolerant from tolerant ) , the likelihood of variants to be damaging is assessed global overview of genetic data analysis , by filtering for multiple criteria : ( i ) rare variants ( by comparison with online reference genomes such as the single nucleotide polymorphism database ( dbsnp ) , or exome sequencing project ( esp ) ) , ( ii ) mutation effect ( previously explained ) ( iii ) functional prediction ( sift sorting intolerant from tolerant ) , the likelihood of variants to be damaging is assessed second is mutation effect assessment . here only variants that potentially impair protein structure and/or function are selected ( these mutation types are explained above , under third , the likelihood of missense and splice - site variants to be damaging is assessed with software programmes ( sift and polyphen ) that predict possible impact on the structure and function of a human protein using straightforward physical and comparative considerations . fourth , after this initial workup of identified variants , an important analysis step is family segregation , which is considered the cornerstone of genetic counselling . it basically comprises genetic screening of affected family members , to see if a mutation segregates with disease . the stronger a mutation segregates with disease , fifth is functional follow - up , where mutations are investigated , in for example animal models , to assess their biological effect . due to time and cost constraints , functional tests are unfortunately not available for diagnostics , and therefore are only occasionally deployed in genetic research . the analysis methods described above can reduce the number of suspicious variants to a great extent . nonetheless we are often left with a high number of so - called variants of uncertain significance ( vus ) , impeding effective diagnostics . hence , for patients with idiopathic dilated cardiomyopathy , the advent of ngs has cleared up the genetic cause for some patients , while generating tremendous uncertainty for many patients with its high number of vusses . this means that , in the anticipation of genetic screening , one must consider carefully how many genes are to be screened . the principle applies that when fewer genes are screened ( with a so - called targeted approach ) , less variants will likely be detected , thus facilitating their interpretation at the same time though , sensitivity diminishes , meaning that finding no variant in a subset of genes does not exclude a genetic cause . inversely , simply choosing a broad approach with whole exome sequencing will often result in an unsolvable wealth of variants , with a low specificity . the uncertain role of variants and their pathogenicity is even shown to extend to variants previously deemed to be causal for dcm . in 2013 , andreasen et al . showed , by using online mutation databases and large publicly available reference genome datasets , that known dcm - causing variants were in fact more prevalent than estimates of dcm prevalence . this justly questioned the pathogenicity of these variants and even raised the question whether the prevalence of dcm is higher than previously estimated . regarding current developments in the field of cardiovascular genetics , several issues will likely be addressed more adequately in the foreseeable future , of which a selection will be highlighted here . in diagnostics , an important strategy to tackle this is data sharing . by sharing variants with their associated phenotypes on publicly accessible databases ( e.g. gencor , via http://www.durrercenter.nl/catalogue ) , the mass of cardiogenetic evidence will be more accessible . this will allow an efficient gain of knowledge and better interpretation of variants in the future . another important development in disputing the numerous vusses is enhanced data interpretation with multi - variant analysis . here , distinction is made between disease causing variants and so - called effect modifiers , which enables a more adequate , nuanced interpretation of the role of variants in pathogenesis of dcm . this was recently shown by , for example , roncarati et al . , who discovered in an extended family with dcm the causal role of a lmna mutation , with a disease - aggravating mutation in ttn . another development in diagnostics is preimplantation genetic diagnostics , a technique which allows for genetic testing of an embryo , before its implant ( e.g. in - vitro fertilisation or intracytoplasmatic sperm injection ) . for therapy , numerous efforts are being undertaken in the field of genetics to treat or prevent cardiac disease . in pharmacogenetics , genetic profiling is used as a determinant for genotype - guided personalised medicine . in the rapid gene trial ( reassessment of anti - platelet therapy using an individualized strategy based on genetic evaluation ) , point - of - care genetic testing was used to identify cyp2c19 * 2 carriers , which is an allele associated with increased rates of major adverse events . after randomisation , genetic testing proved to be an effective deciding factor to reduce high on - treatment platelet reactivity which , in turn , is associated with a lower complication rate . several studies have demonstrated a decrease of sarco - endoplasmic reticulum calcium - atpase 2a ( serca2a ) expression and function in heart failure patients . in phase ii of the calcium upregulation by percutaneous administration of gene therapy in cardiac disease ( cupid ) trial , an adeno - associated virus is used to deliver serca2a to the cardiomyocytes . after 12 months , patients with high dose showed a decrease in heart failure symptoms , increased functional status and reversal of the negative left ventricle remodelling . in another trial involving serca2a gene expression modification in a mouse model , wahlquist et al . described how they improved survival for heart failure in a mouse model by injecting an antagonist for micro - rna 25 . potentially in 2015 , the first gene therapy approved for clinical use will be rolled out ( glybera , for treatment of lipoprotein lipase deficiency ) . further , research will ultimately tell to what extent gene therapies are suitable as a treatment for heart failure or dcm , and if cardiogenetics will live up to its potential promise in the context of personalised medicine . in the last decade , cardiovascular genetics has undergone tremendous progression , mainly thanks to the implementation of ngs . hence , the pathophysiological insight into , among other diseases , dilated cardiomyopathy is increasing and modernised genetic testing has quickly been integrated in clinical practice . the main challenges currently reside on the area of improving variant interpretation and possibly , the application of gene ( regulation ) therapy to treat and prevent dilated cardiomyopathy and other cardiovascular disorders . with its boosted discovery rate and increasingly prominent clinical role , this quickly emerging field of medicine

zinc oxide ( zno ) is a ii vi semiconductor material with a wide bandgap of about ( 3.37 ev ) together with a high exciton binding energy of ( 60 mev ) both at room temperature rendering zno to receive global attention especially in connection with the emerging nanotechnology paces toward functionality . zno nanostructures family has gained substantial interest due to their simple fabrication routes , along with low cost and self organization growth behavior enabling the growth of zno nanostructures on any substrate material regardless of lattice matching issues . many groups have fabricated and studied zno nanorod - based devices including leds e.g. by our group recently [ 2 - 7 ] , random laser based on zno nanorods has also been demonstrated and showed a potential of zno for photonics applications . the most challenging problem of zno - based photonic devices is the lack of stable and reliable p - type doping ; mainly due to the self compensation property of zno . therefore , using heterojunction strategy for photonic devices based on zno nanorods ( nrs ) has been a feasible way to obtain good performance led based on zno nrs [ 2 - 7 ] . organic polymers light - emitting diodes ( pled ) have been intensively investigated for optoelectronic applications such as flat panel displays and solar cell , to name a few . the main advantageous features of polymer - based devices are low cost , low power consumption , and simple processability etc . due to the self organized growth property of zno , it is possible to grow zno nanorods on polymeric substrates . the combination of zno nrs and polymers to form hybrid junction will add the advantage of achieving large area leds using a single contact , which is an advantage not possible to gain by using pled configuration . the first hybrid organic / zno nrs led has been reported by knenkamp et al . , their led composed of electrodeposited zno nrs on f - doped sno2 glass substrate acting as a cathode and applying pedot : pss as a p - type contact . white light emitting diodes based on organic / zno nrs have also been studied by our group different multilayer and blended polymers were utilized to fabricate leds on glass substrates . in those studies , zno nrs were grown at a temperature of 95c , and the emitted light was dominated by the polymer emissions ( mainly the blue line ) leading to bluish white emission leds . fabrication of white organic / inorganic leds on flexible substrates on the other hand represents an additional step toward the realization of zno / polymer hybrid heterojunctions leds . nevertheless , there are many issues to be solved to achieve this goal . for instance , the growth temperature of zno nrs has to be lowered to a large extent to permit the fabrication of leds on flexible substrates . it is important to mention that all published results on hybrid organic / zno nrs heterojunctions white electroluminescence ( el ) were obtained for cases where the growth was performed at 80c or higher [ 4,6,7,9 - 11 ] . moreover , it is of interest to demonstrate a white el from such hybrid heterojunctions at lower temperatures , to enable the use of a variety of flexible plastic as a substrate . such achievement will lead to the possibility of integrating this class of white leds with existing glass bulbs , tubes , and armature technologies . in this paper , a novel stable white light emitting diode fabricated on highly flexible plastic substrate is reported . emitting diode ( fwled ) was fabricated on commercial pedot : pss flexible plastic and composed of a vertically aligned zno nrs grown by chemical bath deposition route at a low temperature of 50c , on multi - layered blue emitting polymer poly(9,9-dioctyl - fluorene ) ( pfo ) and hole transporting polymer poly(9,9-dioctylfluorene - co the highly flexible and stretchable light - emitting diode yielded a stable white broad emission band covering the entire visible spectrum . all materials used in the growth of zno nanorods were purchased from ( sigma aldrich ) and were applied as - received without further purification . a commercial pedot : pss on plastic foil was chosen as a substrate in the subsequent fabrication of the hybrid led due to the facts that the pedot : pss on plastic is flexible , transparent to the visible light with reasonable electrical properties and can be used for large - scale production . the led fabrication started by thoroughly cleaning the pedot : pss substrate with acetone and iso - propanol under sonication for 3 min . then , the tfb hole transporting solution was spun coated at 1,500 rpm for 30 s , followed by baking for 10 min at 75c to evaporate the residual toluene . the pfo which is a blue luminescent polymer was then spun coated on top of the tfb layer at spin speed of 2,000 rpm for 30 s and cured for 15 min at 75c . after that , the growth of the zno nanorods was carried out by spin coating zno nanoparticles ( nps ) solution prepared following the method developed by pacholski et al . . the deposition of zno nanorods was conducted through a chemical bath deposition method at 50c temperature . in brief , zinc nitrate hexahydrate ( zn(no3)2 6h2o ) was dissolved in 100 ml di - water to achieve 0.15 m concentration , and ( 0.1 m ) of hexamethylenetetramine ( hmt , c6h12n4 ) in 100 ml di - water . the pre - coated substrates were transferred to the aqueous solution and the whole pyrex beaker was kept for several hours at 50c in traditional laboratory oven . after growth , the samples were thoroughly soaked in di - water under ultrasonic agitation to remove the un - reacted salts , and then left to dry at room temperature . prior to the contact deposition , a photoresist ( s1818 ) was spun coated to insulate the zno nrs from each other at spin speed of 3,000 rpm for 30 s and then cured at 90c for 2 min . standard oxygen reactive ion etching ( rie ) was then employed to partly etch the upper part of the photoresist that covers zno nrs tips . the last step in the fabrication of the hybrid led was to utilize a metal contact to both parts of the hybrid junction . for the zno , ohmic contact was achieved by thermally evaporating ( au / ti 20 nm/10 nm ) on top of the fabricated device . a simple silver paste was used to act as a bottom contact to the pedot : pss substrate . a a schematic diagram of the flexible white light emitting diode ( fwled ) showing the different parts of the device , and in b a digital photograph of the flexible pedot : pss substrate containing 20 fwleds bent at large angle of around 60 all measurements on the fabricated hybrid led device were performed at room ambient conditions , only in the case of temperature stability the measurements were carried out at different temperatures . field emission scanning electron microscopy ( sem ) was used to study the morphology of the grown zno nrs . room temperature photoluminescence ( pl ) was investigated using ( coherent mbd 266 ) with = 266 nm as excitation source , and the pl spectra were collected with a ccd detector . the current voltage ( i the el behavior of the fabricated fwled device was examined with keithley 2400 source meter , while the el spectra were assembled via andor shamrock 303ib spectrometer supported with andor - newton du-790n ccd . temperature - dependent stability el measurements of the fabricated hybrid fwled was determined with thorlab ted 200c temperature controller . a schematic diagram of the fwled is shown in fig . 1a , along with the photograph of the substrate containing 20 active fwleds bent at a large angle of about 60 , while the fwleds remained robustly unaffected . the top view of the grown zno nanorods on the pfo / tfb / pedot : pss flexible substrate is depicted in fig . as can be clearly seen , a well - aligned zno nrs were successfully grown along their c - axial preferential growth direction . the growth of the zno nrs at 50c was proved to be favorable for obtaining excellent quality zno nrs since this temperature is influencing both the axial length and the overall optical properties of the zno nrs as is discussed elsewhere . figure 2b depicts the grown zno nrs after the photoresist was etched way . the nanorod tip in the inset of fig . 2b is covered by photoresist with a thickness of around 40 nm , while the space between the nanorods is solidly filled by photoresist . to completely remove the photoresist coverage on the nanorods tips , the substrate was further subjected to the rie process . field emission scanning electron micrographs ( sem ) of a zno nanorods grown at 50c on tfb / pfo polymer layers on top of pedot : pss / plastic flexible substrate , and in b sem of the samples after photoresist processing and etching , the inset shows single zno nanorod covered by a thin photoresist film after a reactive ion etch step the room temperature pl spectra for the zno nrs grown at 50c on bare pedot : pss and on pedot : pss / tfb / pfo containing multi - layers polymer hybrid inorganic / organic structure are shown in fig . the uv near band edge ( nbe ) emission of the zno nrs is clearly seen at a wavelength of about 389 nm . it is worth mentioning that the dle frequently observed in zno nanostructures as well as bulk material is very weak in our 50c grown zno nrs . the origin of the dle band(s ) is a controversial issue , since different defects - related transitions were assigned to be the cause of these bands e.g. the green band appeared centered around 520 nm has been attributed to various defect sources that is either point defects such as oxygen vacancies vo , zinc vacancies vzn , or due to recombination of electrons with surface defects . for more details regarding the dle and its origin in zno , the red / orange band appeared around 640 nm has been also a subject of debate by many groups . the pl of the pfo / tfb polymer layer on pedot : pss substrate ( not shown here ) demonstrating multi - peak emission , centered at 430 , 456 , and 478 nm . the pl spectrum of the fabricated heterojunction structure of this flexible fwled is shown in fig . it is evident that the dle emission has been strongly enhanced in the fabricated fwled compared to zno nrs grown on bare pedot substrate . 3 is reported to be due to the 02 interchain singlet transition in the pfo . room temperature photoluminescence ( pl ) spectra from zno nanorods grown at 50c on pedot : pss flexible substrate ( black ) and on tfb / pfo layers coated pedot : pss ( blue ) substrate , the inset shows a featured blue peak attribution to the pfo polymer layer figure 4 shows the current voltage ( i v ) characteristics of the fabricated fwled consisting of ag / pedot : pss / tfb / pfo / zno / ti / au . the i v characteristics show clear diode behavior with a rectifying ratio of 6 at 5 v , and the reverse leakage current was found to be 5 a at 15 v. the semi - log plot in fig . v characteristic is ohmic , above that voltage and up to ~1v the carriers tunnel through the junction and an exponential behavior becomes dominant . at v retains the linear behavior again due to space charge limited current ( sclc ) . the general conclusion from these iv curves is that this hybrid junction possesses the normal diode behavior . conductive pedot - pss ( ionization potential of 5.2 ev ) is used as an anode and silver is used as hole injection contact . the purpose of using the tfb layer is to act as a hole transporting layer and to reduce the energy barrier between the pedot : pss and the pfo molecular levels , together with blocking electrons hopping from the zno into the pedot : pps lower unoccupied molecular orbit ( lumo ) . this will lead to improve the device life time since hopping of carriers between large offsets will rapidly deteriorate the device performance due to generated heat . the holes under positive applied voltage tunnel across the barrier into the highest occupied molecular orbital ( homo ) levels of the pedot : pss and then transported through the tfb layer that is enabling the holes to reach the pfo layer without detrimental loss as mentioned above . the potential barrier from the ag to the homo level of the pedot : pss and from the homo level of the pfo to the valence band of the zno nrs are 0.9 and 2.1 ev , respectively . the electron injection barriers between the fermi level of the ti / au electrode and the conduction band of the zno nanorods and from the conduction band of the zno nrs and the lumo of the pfo are 0.1 and 1.8 ev , respectively [ 5 - 7 ] . due to energy band bending process the formation of sub bands take place and consequently , electrons and holes under forward bias voltages accumulate , at the pfo / zno interface . the electrons existing at the interface between the lumo level of the pfo and the conduction band edge of the zno nrs continuously drop to the lower states and during the electron transitions continuous recombination between the electrons and holes happens leading to the emission of visible light . in addition , many radiative recombinations in the bulk of the nrs and in the bulk of the pfo also exist . the fwled device was stored for several months and twisted in large curvatures many times as seen in fig . interestingly , no increase in the turn on voltage or decrease in the output current with time and bending process were observed . voltage ( i v ) characteristics of the fabricated fwled , in a a linear plot of the i the inset shows the band structure diagram with offset values reported in the literature [ 5 - 7 ] and in b a semi - log plot of the iv characteristics of the device the room temperature electroluminescence of the fwled is depicted on fig . the device was biased at different driving voltages , and the corresponding el spectra were recorded . the el spectrum started to emerge at a bias voltage of 12 v along with injection current of 0.15 ma , and at 24 v a current of 1.2 ma was achieved , as can be seen in fig . the intrinsic white light is covering the whole visible region from 420 to 800 nm as a broad peak centered at ~560 nm having a full width at half maximum ( fwhm ) of around 158 nm . figure the intrinsic white light was clearly seen by the naked eye at a voltage of 14 v and above . it is important to mention that the tfb / pfo blue peaks are completely intermixed with the dles of the zno nrs resulting in the observed single broad band emission . on the other hand , the nbe of the zno nrs was not detected in the el spectra probably due to the self - absorption of the uv light by the zno direct bandgap or as a result of the absorption of the 389 nm nbe of the zno by the pfo at the pfo / zno nrs interface . since the pfs polymers show a sharp absorption peak max ~ 385390 nm of the * electronic transition . the intermixing of the blue light generated by the pfo layer with the green and red / orange bands produced by the dle emissions in zno have led to the observed broad band . the effect of the pfo polymer concentration together with their processing parameters is critical in determining the overall electro - optical efficiencies and light quality of the fwled . intrinsic white light electroluminescence ( el ) spectra of the fabricated fwled collected at different dc - bias as indicated , in a a linear - scale plot of the intensity with wavelength , and in b with a logarithmic scale the device stability operation over a wide range of temperature variation is very important for real life applications in lighting and under harsh conditions . this was conducted inside an insulating chamber controlled via a temperature controller at temperature range 2060c under constant dc - bias of 20 v. the measurements were carried out 10 min after the chamber has reached the desired temperature to ensure that the fwled also stabilized at that temperature . 6b ( logarithmic plot ) . a gradual decrease in the el intensity was recorded . it is worth mentioning that no significant shift in the intrinsic white peak center position was observed as shown in fig . 6b nevertheless , the fwhm started to shrink at 40 and at 60c it was reduced to ~23% of the original value . the reduction in the el intensity along with the effect of the temperature on the light emission fwhm is summarized in fig . 7 ; the emission intensity was suppressed to ~80% by changing the device temperature from 20 to 60c as shown in fig . the results demonstrate that our fwled is reasonably stable over moderate temperatures , and the output light emission is unaffected by this temperature variations ( 2060c ) . the possible explanation of the fwled heterojunction stability could be assigned to the low current density injection through the junction in the device . because at higher current densities , the junction temperature will rapidly increase due to the electrons passage resulting in a faster depreciation of the device compared to ambient temperatures . electroluminescence ( el ) spectra of the fwled at different ambient temperatures at a bias voltage of 20 v in a linear plot , and in b logarithmic scale plot , showing the depreciation of the intrinsic white light intensity with increasing the ambient temperature the effect of the ambient temperature variations on the white light emission characteristics of the fabricated fwled in summery , an intrinsic white - emitting diode was fabricated by growing well - aligned zno nrs at a temperature as low as 50c following chemical bath deposition strategy . the zno nrs were grown on multi - layered polymers spun coated on commercially available flexible pedot : pss / plastic substrate . the fwled showed excellent i v characteristics combined with single intrinsic white light extending from 420 to 800 nm . the light emission was clearly observed by the naked eye at a bias voltage of 14 v. the blue light emission from the pfo polymer layer was completely intermixed with the deep level emissions from zno nrs to generate single broad white light emission band . the influence of the ambient temperature on the fabricated fwled was investigated , and the results demonstrated that the device is quite stable at elevated temperatures without showing any severe depreciation of the output light characteristics . the fabricated device was bent at large angles ( > 60 ) and still retained its electro - optical characteristics . this fwled can fit well to a wide varieties of lighting applications , for instance as the substrate is highly flexible , the use of the fwled in decoration and in - door lighting using existing armature technologies become feasible to achieve . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .

arginine vasopressin ( avp ) is increasingly used in the management of refractory vasodilatory shock . indeed , it was recently incorporated into the recommendations ( grade iib ) proposed by the american heart association for treatment of refractory septic shock and the guidelines of the surviving sepsis campaign ( grade e ) . however , although the global haemodynamic effects of avp are relatively well described , its effects on the microcirculation are still largely unknown . in this issue of critical care , luckner and coworkers present an original study in which they evaluated skin micro - vascular blood flow , using laser doppler fluxmetry , before and after avp infusion in patients with refractory septic shock . they report that avp infusion did not impair forearm skin perfusion compared with norepinephrine alone . the authors intended to explore further the results of two of their previous studies : a retrospective analysis , in which they reported a 30.2% rate of ischaemic skin lesions with avp infusion ; and a prospective controlled trial that found no difference in the incidence of such lesions between a group of patients treated with avp plus norepinephrine and patients treated with norepinephrine alone . of note , it is difficult to draw conclusions regarding the safety of avp administration on the basis of the latter study because the dose of norepinephrine received by the patients in the avp / norepinephrine group was half that in the other group . as mentioned by the authors , their results presented in this issue are in striking contrast to those of several published physiological experiments on the topic . indeed , animal and human studies [ 6 - 9 ] have revealed significant dose - dependant impairment in skin blood flow with avp . indeed , the skin microvasculature is considered to be a vascular bed that is rather sensitive to avp . accordingly , the results of the study presented by luckner and coworkers are somewhat unexpected , and some methodological issues might account for the discrepancies . laser doppler fluxmetry only provides an estimate of the average blood flow in a given volume of tissue ; this volume can vary according to its intrinsic refractive properties . multiple individual and environmental factors , including haemoglobin level and temperature , can also influence the results of laser doppler fluxmetry . moreover , laser doppler fluxmetry does not take into account the type of microvessels under study , their morphology , the direction of flow and , more importantly , the heterogeneity of perfusion ; the latter is a key component in the study of microcirculation , especially in sepsis . more specifically , the biological zero , which can represent up to 80% of the total laser doppler fluxmetry signal , can be modified during ischaemia / reperfusion procedures because it is influenced by vasodilatation . therefore , various authors have suggested that the biological zero should always be taken into account when red blood cell flux is measured in the skin using laser doppler fluxmetry . finally , measurement of differential perfusion is impeded by the rather small signal and oscillatory pattern of basal cutaneous microcirculation . in addition , it is worth noting that vasomotion patterns are highly dependant on probe location relative to the tissue of interest . this could explain , to some extent , the considerable difference reported in baseline vasomotion between groups . these technical issues account for the substantial short - term variability in laser doppler fluxmetry measurements . hence , it is apparent that relatively large observed changes or large sample sizes are needed to detect statistically significant differences between groups . the power of a study is a measure of its ability to detect a statistical difference when it truly exists ; it is particularly important to bear this in mind when interpreting studies that return negative findings . the calculated power of the study reported by luckner and coworkers is approximately 40% , considering the observed difference in primary outcome ( area under the curve of the laser doppler fluxmetry signal ) between the two groups . this means that there is a 60% chance that a true difference will remained undetected . with only three additional patients in each group ( assuming the same difference in variance between groups ) the study would identify a significant difference in microvascular blood flow perfusion and lead to the conclusion that avp has , in fact , a considerable deleterious impact on skin microcirculation . finally , the important variance in avp response ( 8.56 in the avp group versus 3.25 in the norepinephrine group ; data provided by luckner and coworkers ) suggests that avp had rather heterogeneous effects from patient to patient and that other factors ( e.g. interindividual variability in sensitivity to avp stimulation , endogenous avp level , relative adrenal insufficiency , among others ) could have played a role . luckner and colleagues are to be commended for their pioneering work on the microcirculatory effects of avp . such studies are essential if we are to understand better the micro - circulatory consequences of our resuscitation strategies . however , this work should be duplicated , and we should exercise caution interpreting these results as reassurance that avp is devoid of adverse microcirculatory side effects . further work examining different microcirculatory beds and using different measurement tools to assess microcirculation will improve our knowledge of the role of avp in resuscitation .

acute liver failure ( alf ) , characterized by massive necrosis , is a syndrome defined by the onset of coagulopathy and hepatic encephalopathy and has a mortality rate ranging from 50% to 70% [ 16 ] . the prognosis of this disease has not significantly improved , despite the introduction of supporting treatments such as plasma exchange , dialysis , and antibiotics [ 710 ] . although liver transplantation is an effective treatment , it is not universally applicable . with the limited understanding of the pathogenesis , no effective therapy is available to prevent or treat this disease . recently , several authors have reported the increased serum levels of macrophagederived factors in patients with alf , irrespective of the trigger , which suggests that activated macrophages play an important role in the progression of alf [ 1113 ] . indeed , activation of macrophages and the subsequent release of proinflammatory mediators such as cytokines ( e.g. , tumor necrosis factor ( tnf)- ) , reactive oxygen species ( ros ) , and eicosanoids are considered to be an early step in the pathogenesis of liver damage , because they stimulate hepatic inflammation . moreover , in the animal model of liver disease , the number of macrophages increases consistently and correlates closely with the degree of hepatic injury . thus , selective inactivation of macrophages might be a potential approach for the treatment of alf . in the liver , macrophages are the only cell type endowed with a metabolically active 5-lipoxygenase ( 5-lo ) pathway ( i.e. , 5-lo , 5-lo - activating protein ( flap ) , leukotriene ( lt ) c4 synthase , and generated ltb4 and cysteinyl - lts ) , which is necessary for the biosynthesis of lts . lts are metabolites of the 5-lo pathway and have been shown to enhance injury to organs during endotoxemia . in addition , ltb4 is a chemoattractant for leukocytes and plays a pivotal role in the pathogenesis of inflammatory and immune diseases . thus , the 5-lo pathway leading to the production of lts is a major proinflammatory pathway in macrophages . the expression of 5-lo in the liver is restricted to macrophages and 5-lo is necessary for the progression of alf . we hypothesize that the mechanism of blocking the 5-lo pathway protects the liver from necroinflammatory damage and may be related to inhibiting activation of macrophages . therefore , 5-lo inhibitors may have a therapeutic effect on alf by inhibiting macrophage activation . using aa-861 as a specific 5-lo inhibitor , the present study investigated the role of 5-lo in alf in rats and changes in activation of macrophages by blocking it . male wistar rats ( weighing 150180 g ) were obtained from the academy of military medical sciences , china . they were acclimatized to animal house conditions and were fed a standard pellet diet and water ad libitum for 1 week . the experiments were conducted according to the ethical norms approved by the ministry of social justices and empowerment , china , and institutional animal ethics committee guidelines . this study was also approved by ethics committee of beijing youan hospital ( review number 2012 - 58 ) . d - galactosamine ( d - galn ) , lipopolysaccharide ( lps ) , aa-861 , dimethyl sulfoxide ( dmso ) , tween , and phenylmethylsulfonyl fluoride ( pmsf ) were purchased from sigma ( st . louis , mo , usa ) . dulbecco - vogt phosphate - buffered saline ( dpbs ) , ltb4 elisa kit , and sep - pak c18 cartridges were obtained from cayman chemical co. ( ann , arbor , mi , usa ) . -mercaptoethanol , tetramethylethylenediamine ( temed ) , and diethypyrocarbonate ( depc ) were purchased from amresco biochemical co. ( solon , oh , usa ) . ripa and trizol rna were purchased from invitrogen ( carlsbad , ca , usa ) . the microbicinchoninic acid ( bca ) protein assay reagent kit was from pierce ( rockford , il , usa ) . immobilon - p transfer membranes were from millipore ( bedford , ma , usa ) . mouse anti - rat monoclonal ed1 antibody and rabbit anti - rat polyclonal 5-lo antibody were provided by abcam ( cambridge , ma , usa ) . rabbit anti - rat monoclonal -actin antibody was purchased from epitomics ( burlingame , ca , usa ) . the superscript ii reverse transcriptase kit , taqman gene expression assay , and universal taqman 2x polymerase chain reaction ( pcr ) master mix were from takara bio ( dalian , china ) . ( 1 ) control group ( 6 rats ) : dmso ( 1.5 ml ) was injected intraperitoneally . after 12 hr , the rats were fasted for a further 12 hr and 0.9% nacl ( 2 ml ) was injected intraperitoneally . twenty - four hours after saline injection , the rats were killed and the liver tissues and serum were collected for further analysis . ( 2 ) alf group ( 35 rats ) : dmso ( 1.5 ml ) was injected intraperitoneally . after 12 hr , the rats were fasted for a further 12 hr and d - galn / lps ( 1200 mg / kg six rats were killed randomly 8 and 24 hr , respectively , after d - galn / lps administration and the liver tissue and serum were collected for further analysis . ( 3 ) aa-861 prophylactic group ( 35 rats ) : aa-861 ( 60 mg / kg ) was injected intraperitoneally 12 hr later , the rats were fasted for a further 12 hr , and d - galn / lps ( 1200 mg / kg d - galn , 100 g / kg lps ) was administrated intraperitoneally . six rats were killed randomly after 8 and 24 hr , respectively , after d - galn / lps administration and the liver tissue and serum were collected for further analysis . serum alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , and total bilirubin ( tbil ) levels were measured with an autoanalyzer ( au 5400 ; olympus optical co. , japan ) . liver samples were cut into 5-mm sections , fixed in 4% formaldehyde and embedded in paraffin , and stained with hematoxylin and eosin for histological analysis . parts of modified histological activity index were performed to evaluate the necroinflammatory degree ( confluent necrosis score and spotty lytic necrosis , apoptosis , and focal inflammation score ) . liver samples were cut into 1-mm sections and fixed in 2.5% glutaraldehyde with 2% paraformaldehyde for 2 hr at 4c . the liver samples were washed three times for 10 min each with sodium dimethyl arsenic acid buffer ( ph 7.2 ) and fixed in 1% osmic acid for 2 hr at 4c . two hours later , tissues were washed three times for 10 min each with double - distilled water . the samples were dehydrated through an ethanol gradient ( 50% , 70% , and 90% , 10 min each ) , anhydrous alcohol , and epoxy propane twice for 15 min each . polymerization conditions were 30c ( 5 hr ) , 50c ( 5 hr ) , and 80c ( 5 hr ) . semithin sections were made and dyed with azure - meilan and positioned under light microscope . the sections were observed under a transmission electron microscope ( h-7650 , hitachi , japan ) . ed1-positive or 5-lo - positive cells were detected immunohistochemically by the avidin - biotin complex method using a vectastain elite abc kit as described previously , with modifications . liver sections were deparaffinized and incubated with preheated ( 37c ) 0.1% trypsin solution for 15 min and then with 3% h2o2 for 10 min to quench endogenous peroxidase . to block nonspecific reactions , sections were incubated with goat blocking serum for 30 min and then with avidin - biotin blocking solution according to the manufacturer 's instructions . following blocking , sections were incubated overnight at 4c with mouse anti - rat monoclonal ed1 antibody ( 1 : 150 ) or rabbit anti - rat polyclonal 5-lo antibody ( 1 : 100 ) as the primary antibody and then incubated for 30 min with a biotinylated goat anti - mouse antibody or a biotinylated goat anti - rabbit antibody . sections were incubated for 30 min with the avidin - horseradish peroxidase ( hrp ) complex , then treated with dab ( 3,3n - diaminobenzidine tetrahydrochloride ) horseradish peroxidase color development kit for 5 min , and finally counterstained with hematoxylin . for quantitative analysis , the number of ed1-positive or 5-lo - positive cells was counted in a total of 25 high - power fields ( hpfs ) per tissue section under a light microscope ( bh-2 ; olympus optical co. , japan ) at 100 , 200 , and 400x magnification , and results were presented as number of positive cells / hpf . liver tissue ( 120 mg ) was homogenized with an ultra - turrax basic homogenizer ( biospec , bartlesville , ok , usa ) in 4 ml dpbs and kept with 2 vol . ice - cold methanol . homogenates were centrifuged at 2000 rpm for 10 min at 4c , and eicosanoids present in the supernatants were extracted with sep - pak c18 cartridges . the eluted methyl formate and methanol fractions were taken for further analysis of ltb4 levels , by specific enzyme immunoassay kit . blood collected from the inferior vena cava was centrifuged at 1500 rpm for 10 min , and the supernatant was used for tnf- analysis . total rna ( 2.5 g ) was isolated from rat liver tissue and reverse - transcribed into cdna with the superscript iii first - strand synthesis system ( invitrogen ) . the rt reaction mixture ( in a final reaction volume of 20 l ) contained the following : 10 l 1x supermix ( sybr premix ex taq ; takara ) , 2 l cdna , 0.4 l 50x rox reference dye i , 6.8 l dh2o2 , and 0.4 l each primer . real - time quantitative pcr was performed with an abi prism 7900 sequence detection system ( applied biosystems , foster city , ca , usa ) . 5-lo primer sequence is as follows : forward : 5-acgtttatggcatgcggggc-3 ; reverse : 5-attgcgctcggcaatcacgc-3 , using -actin as an endogenous control . amplification conditions were 50c for 2 min and 95c for 10 min , followed by 40 cycles of 95c for 15 s and 60c for 1 min . pcr results were analyzed with the sequence detector software version 2.1 ( applied biosystems ) . 10 mm hepes / koh , ph 7.4 , containing 0.25% ( w / v ) sucrose , 2 mm edta , aprotinin ( 1 g / ml ) , leupeptin ( 1 g / ml ) , pepstatin a ( 1 g / ml ) , and 10 m pmsf . after centrifugation at 1200 rpm for 15 min at 4c , the supernatant was collected and the protein concentration was measured spectrophotometrically using the bca method ( protein assay ) following the pierce co. 's protocol . ( 160 g ) was subjected to 12% sds - page and transferred to pvdf nitrocellulose membranes . antibodies against phosphorylated and total 5-lo , as well as -actin , were used for western blot analysis . membranes were probed with primary antibody ( 1 : 750 ) in 10 ml blocking buffer overnight at 4c . after washing , membranes were further probed with appropriate hrp - conjugated secondary antibody ( 1 : 3000 ) in 10 ml blocking buffer for 1 h at room temperature . supersignal west pico chemiluminescent substrates from bio - rad chemidoc mp ( shanghai , prc ) were used for chemiluminescence development . statistical analysis was performed by analysis of variance ( one - way or two - way ) or unpaired student 's t - test . results are expressed as the mean standard error of the mean ( sem ) . d - galn / lps - treated rats showed massive hepatocyte necrosis at the centrilobular zone and bridging necrosis severely disrupted the sinusoidal and lobular architecture of the liver ( necroinflammatory score ; control versus d - galn / lps versus aa-861 : 0.33 0.21 versus 8.50 0.22 versus 3.2 0.3 , p < 0.01 ; figure 1 ) . serum alt , ast , and tbil levels of d - galn / lps - treated rats were significantly elevated compared with controls 8 hr after administering d - galn / lps ( 2104.3 124.3 versus 27.3 1 3.2 u / l , and 19.7 1.3 versus 2.2 0.3 mmol / l , resp . these liver damage markers reached peak value 24 hr after administering d - galn / lps ( 3992 290.7 u / l , and 32.9 2.0 mmol / l , resp . ) . 5-lo inhibitor aa-861 significantly alleviated the hepatocellular necrosis ( figure 1 ) and the serum aminotransferases ( figure 2 ) . moreover , 80 hr after d - galn / lps injection , 14 rats were dead , and 13/20 rats survived in the aa-861-treated group ( figure 3 ) . our previous study demonstrated that expression of total 5-lo protein reached its peak value 24 hr after administration of d - galn / lps , while the expression of 5-lo mrna reached the highest level 8 hr . aa-861 significantly decreased intrahepatic 5-lo total protein ( figure 4(a ) ) ( 5-lo - positive cells : 12.3 0.7/hpf versus 2.5 0.4/hpf , p < 0.01 ; figure 4(b ) ) 24 hr after administration of d - galn / lps and 5-lo mrna expression ( figure 4(c ) ) compared with the alf group ( 5-lo/-actin iod : 9.6 10 1.9 10 versus 2.3 10 1.2 10 , p < 0.01 ) 8 hr after administration of d - galn / lps . in addition , 24 hr after d - galn / lps injection , ltb4 , one of the 5-lo products , was significantly elevated in the liver tissue compared with controls ( 84.1 8.1 versus 355.4 22.2 pg / ml , p < 0.01 ; figure 4(d ) ) , while aa-861 treatment significantly decreased ltb4 ( 355.4 22.2 versus 176.5 18.5 pg / ml , p < 0.01 ; figure 4(d ) ) . in parallel with 5-lo , the macrophage density , stained with the ed1 monoclonal antibody , was significantly higher 8 hr after d - galn / lps administration ( 9.2 0.7 versus 45.7 1.3 , p < 0.01 ; figure 5(b ) ) , and inhibition of 5-lo significantly decreased the macrophage density ( 24.6 1.0 versus 45.7 1.3 , p < 0.01 ; figure 5(b ) ) in liver tissue . tnf- , mainly produced by macrophages , was significantly increased in d - galn / lps - treated rats compared with controls ( 40.2 3.8 versus 5.2 0.5 , p < 0.01 ; figure 5(c ) ) . aa-861 inhibited 5-lo , decreased macrophages in the liver of rats with d - galn / lps - induced alf , and mitigated the increase in tnf- concentration in the liver ( 40.2 3.8 versus 14.4 0.9 , p < 0.01 ; figure 5(c ) ) . transmission electron microscopy showed that the inactivated macrophages in liver tissue had an irregular round oval shape and small volume , the membrane surface had flat microvilli , and there were no obvious lysosomes or endoplasmic reticulum . the macrophages from the liver of rats with d - galn / lps - induced alf showed a marked increase in size . their outline was more regular and round , and the core of macrophages moved close to the membrane . the volume of chondriosomes increased significantly , and both lysosomes and ribosomal particles were seen , in addition to more microvilli and wrinkles on the cell surface . aa-861 treatment reversed the morphological changes in the macrophages , the cells were smaller , and the numbers of lysosomes and ribosomes in the cytoplasm were reduced ( figure 6 ) . to the best of our knowledge , the present study is the first to show that macrophages play a critical role in d - galn / lps - induced alf via the 5-lo pathway . it also showed that 5-lo inhibitor significantly alleviated d - galn / lps - induced alf and that the mechanism of action may be related to inhibition of macrophage activation . peritoneal injection of d - galn with lps induces liver damage that closely resembles human viral hepatitis [ 2022 ] . thus , we chose to use this method to construct a rat model to imitate alf caused by viral hepatitis in humans . we showed that d - galn / lps administration caused alf , which was manifested as massive liver necrosis and significantly increased serum alt , ast , and tbil . our previous study indicated that the 5-lo / lt pathway was involved in the initiation and progress of alf induced by d - galn / lps . so , in the present study , we investigated the relationship between 5-lo formation and macrophage activation . in addition , flap is also an integral component of the 5-lo pathway and its expression is crucial for the formation of lts from arachidonic acid . thus , we focused on 5-lo individually . the first part of our study showed that aa-861 ( a 5-lo inhibitor ) alleviated the necroinflammatory damage to the liver in rats induced by d - galn / lps and improved the survival rate . from other researches , we selected the dose of aa-861 as 2060 mg / kg [ 23 , 24 ] . thus , before the present study , we used the dose of 30 mg / kg and 60 mg / kg to do the previous experiment , respectively , and the results showed that a dose of 60 mg / kg was better . the present study proved that the 5-lo / lt pathway was involved in the progress of alf induced by d - galn / lps . blocking this pathway reduced the severity of the damage in alf , which may offer us a new approach in the treatment of alf by inhibition of this pathway in the future . the level of the main metabolite of the 5-lo pathway , ltb4 , a potent chemotactic agent for leukocytes , was decreased . our results also confirmed that 5-lo products , as mediators of inflammation and cell damage , play important roles in the pathogenesis of hepatocellular injury [ 2630 ] . the protective effects of aa-861 on alf were mediated by downregulation of 5-lo and its products . it is well known that macrophages are one of the major cell types involved in initiating specific immune responses . in alf , macrophages take part in the process of the first hit and play an important role in the process of the second hit . some researchers have found that the expression of 5-lo in the liver is restricted to macrophages . so , the second part of our study focused on the relationship between 5-lo formation and macrophage activation . using transmission electron microscopy , our previous study showed the morphological changes in the macrophages in d - galn / lps - induced inflammation . we found that , 8 hr after d - galn / lps injection , the microstructural changes in the macrophages were obvious . the expression of 5-lo mrna in liver tissue also reached a peak 8 hr after administration of d - galn / lps ; therefore , we assumed that the synthesis of 5-lo is related to macrophage activation . to further evaluate the potential relationship between synthesis of 5-lo and macrophage activation in the progression of d - galn / lps - induced alf , we took aa-861 and found that it inhibited 5-lo formation in partially depleted ed1-positive cells ( macrophages ) . the large increase in the number of ed1-positive cells reflected macrophage activation ; therefore , we concluded that blocking the activity of 5-lo impeded macrophage activation . in addition , the prevention of hepatic necroinflammation may be associated with depletion of macrophages , which are increased in response to d - galn / lps injection . some studies have demonstrated that macrophage depletion can alleviate the inflammatory response , such as endotoxin - induced lung inflammation and ccl4-induced liver injury . in addition , the anti - inflammatory effect of aa-861 on d - galn / lps - induced alf in rats was also mediated through inhibition of tnf- , which is mainly produced by macrophages and considered to be one of the main cytokines involved in hepatocellular damage . moreover , 5-lo inhibition changed the microstructure of the macrophages , which included the size of macrophages and the number of lysosomes and ribosomes in the cytoplasm . all of these findings implied that blocking the activity of 5-lo downregulated macrophage proliferation and inhibited macrophages ' function . in conclusion , 5-lo inhibition decreased the density of macrophages and proinflammatory cytokines and alleviated d - galn / lps - induced liver damage . these data may help us design further studies in the treatment of alf via inhibition of macrophage activation in the future .

organic micropollutants such as pesticides will only cause detrimental effects to organisms if they are taken up by the organism and can reach a target site where they can do harm . the processes of uptake , biotransformation , and elimination , also termed bioaccumulation or toxicokinetics , modify the concentration of organic chemicals in organisms , and kinetic rate constant models of these processes quantify and yield the time course of internal concentrations . bioaccumulation and biotransformation are key factors modifying toxicity , and bioaccumulation itself is one of the assessment end points in risk assessment of chemicals . bioaccumulation based on total radioactivity measurements of c - labeled compounds varies greatly among species and compounds , but the causes remain partially unresolved because the contribution of biotransformation can not be quantified with these methods . biotransformation in freshwater arthropods has been shown to greatly modify internal concentrations of organic chemicals for various biological species and chemical compounds . however , there are no studies that investigate the uptake , biotransformation , and elimination kinetics of larger sets of chemicals ( n > 4 ) with diverse properties in freshwater invertebrates . in this study , we investigated the uptake , biotransformation , and elimination kinetics of 15 organic chemicals from diverse chemical classes and physicochemical properties ( octanol water partition coefficient log kow from 0.33 to 5.18 , including acids and bases ) that exhibit a wide range of modes of toxic action in the freshwater amphipod gammarus pulex . g. pulex are of ecological importance due to their role as shredders in the detritus processing in streams , are used extensively in ecotoxicological research , and are suitable for bioaccumulation studies due to their slow growth and relatively large size . in a previous study of bioaccumulation kinetics in g. pulex , several organic compounds exhibited unexpectedly slow apparent elimination kinetics , but the cause of these could not be elucidated because only total radioactivity of c - labeled compounds was measured and biotransformation was not investigated . in order to understand the role of biotransformation for the kinetics of bioaccumulation , we measured and modeled not only the uptake and elimination of the parent compounds but also biotransformation and , if applicable , tried to identify the biotransformation products ( metabolites ) . we carried out metabolite screening and identification tests with a 24 h exposure period as well as biotransformation kinetics experiments consisting of a 24 h uptake phase followed by a depuration phase of variable length ( adapted from refs ( 11 , 17 , 21 , and 22 ) ) . further , toxicokinetic rate constant models were parametrized for each compound to facilitate process - based modeling of toxicity . kinetic rate constants were derived for all relevant processes : uptake , biotransformation , and elimination of parent compound as well as formation and elimination of the metabolites . the uptake and elimination rate constants comprise uptake via food , respiratory surfaces , and dermal absorption and elimination via excretion and through respiratory or dermal surfaces ; i.e. , we measured and modeled bioaccumulation sensu mackay and fraser . the terms metabolism , xenobiotic metabolism , or biotransformation have been used to describe the biochemical modification and transformation of chemicals in an organism . in the following , we will use the term biotransformation for the process , because it emphasizes the transformation aspect and can not be confused with energy metabolism in organisms . for the biotransformation products , adult g. pulex were collected during 2008 to 2010 from a small headwater stream in the itziker ried , ca . 20 km southeast of zrich , switzerland ( e 702150 , n 2360850 ) , and acclimatized to the test conditions ( 13 c , 12 h:12 h light / dark ) for at least 3 days prior to experiments . experiments generally followed previous studies conditions and were carried out in beakers with 500 ml of preaerated artificial pond water , where organisms were fed ad libitum with horse - chestnut leaf discs ( 20 mm diameter , 3 to 5 discs per beaker , replaced when necessary ) that were inoculated with cladosporium herbarum . experiments were carried out with c - labeled compounds ( see table 1 for compounds and log kow values , figures 14 for positions of the c - label , and the supporting information , text si-1 , for further details).table 1parent compounds ( p ) and metabolites ( m1 , m2 and m3 ) as well as metabolite enrichment factors ( mefs ) for metabolites and bioaccumulation factors ( bafs ) for parent compoundsparent compound(cas number)log kowa and pka values [ -]molecules ( in order of increasing retentiontime for each compound)method of detection and identificationmef or baf[l / kgwet weight]imidacloprid(cas 138261 - 41 - 3)0.33 ( pka = 11.12)no metabolites detectedradio - hplcbafp = 7fethylacrylate(cas 140 - 88 - 5)1.32no metabolites detecteddradio - hplcbafp = 87f4,6-dinitro - o - cresol(cas 534 - 52 - 1)2.22 ( pka = 4.46)no metabolites detectedradio - hplcbafp = 37f1,2,3-trichlorobenzene(cas 87 - 61 - 6)4.05no metabolites detectedradio - hplcbafp = 191fmalathion(121 - 75 - 5)2.36m1 : not identifiedradio - hplcmefm1 = 5p : malathion + malaoxonehplc - radio / uvbafp = 3chlorpyrifos(cas 2921 - 88 - 2)4.96m1 : not identifiedradio - hplcmefm1 = 492m2 : chlorpyrifos - oxonhplc - radio / uvmefm2 = 183p : chlorpyrifoshplc - radio / uvbafp = 412aldicarb(cas 116 - 06 - 3)1.13m1 : aldicarb - sulfonehplc - radio / uvmefm1 = 0.3p : aldicarbhplc - radio / uvbafp = 0.9carbofuran(cas 1563 - 66 - 2)2.32m1 : hydroxy - carbofuranhplc - radio / uvmefm1 = 69p : carbofuranhplc - radio / uvbafp = 0.7carbaryl(cas 63 - 25 - 2)2.36m1 : naphtol - sulfateradio - hplc , orbitrapmefm1 = 153p : carbaryl + naphtolchplc - radio / uvbafp = 42,4-dichlorophenol(cas 120 - 83 - 2)3.17 ( pka = 7.97)m1 : 2,4-dichlorophenol - sulfatebradio - hplc , orbitrapmefm1 = 195m2 : not identifiedradio - hplcmefm2 = 14p : 2,4-dichlorophenolhplc - radio / uvbafp = 42,4,5-trichlorophenol(cas 95 - 95 - 4)3.72 ( pka = 6.94)m1 : 2,4,5-trichlorophenol - sulfateradio - hplc , orbitrapmefm1 = 1454m2 : not identifiedradio - hplcmefm2 = 109p : 2,4,5-trichlorophenolhplc - radio / uvbafp = 82pentachlorophenol(cas 87 - 86 - 5)5.18 ( pka = 4.72)m1 : not identifiedradio - hplcmefm1 = 318p : pentachlorophenolradio - hplcbafp = 2024-nitrobenzyl - chloride(cas 100 - 14 - 1)2.61m1 : not identifiedradio - hplcmefm1 = 15m2 : 4-nitrobenzyl - alcoholhplc - radio / uvmefm2 = 50m3 : not identifiedradio - hplcmefm3 = 87p : 4-nitrobenzyl - chloridehplc - radio / uvbafp = 52,4-dichloroaniline(cas 554 - 00 - 7)2.78m1 : not identifiedradio - hplcmefm1 = 58m2 : not identifiedradio - hplcmefm2 = 22p : 2,4-dichloroanilinehplc - radio / uvbafp = 29sea - nine(cas 64359 - 81 - 5)2.8m1 : not identifiedradio - hplcmefm1 = 35m2 : not identifiedradio - hplcmefm2 = 316p : sea - nineradio - hplcbafp = 272m3 : not identifiedradio - hplcmefm3 = 37aexperimental log kow values from sangster s database and from jacobson and williams for sea - nine . for 4-nitrobenzyl - chloride , no experimental value was available ; thus , we calculated it with the epi suite kowwin software ( http://epa.gov/oppt/exposure/pubs/episuite.htm ) . the pka values were also taken from sangster s database ( http://logkow.cisti.nrc.ca/logkow/).bsulfate must be metabolite 1 because orbitrap likely detected the largest peak only.cpeaks of carbaryl and naphtol can not be separated ; naphtol was likely formed during sample preparation.dethylacrylate reacts with methanol during sample preparation ( spiked samples ) . we did not observe any peaks of potential biotransformation products that were distinguishable from the artifact peaks of this adduct.ethe peaks of malathion and malaoxon could not be clearly separated in the biotransformation kinetics experiment . both peaks also come closely after each other in the hplc - uv chromatogram.fbioaccumulation factors for compounds that were not biotransformed are taken from ref ( 11).figure 1molecular structures and label positions of compounds that are not biotransformed in gammarus pulex ( a ) or where biotransformation could not be quantified ( b).figure 2molecular structures , label positions , exposure concentration ( left ) , bioaccumulation , biotransformation , and elimination kinetics ( right , transfer to fresh media indicated by dashed line ) and model structure ( middle ) for malathion , chlorpyrifos , aldicarb , carbofuran , and carbaryl . experimental log kow values from sangster s database and from jacobson and williams for sea - nine . for 4-nitrobenzyl - chloride , no experimental value was available ; thus , we calculated it with the epi suite kowwin software ( http://epa.gov/oppt/exposure/pubs/episuite.htm ) . peaks of carbaryl and naphtol can not be separated ; naphtol was likely formed during sample preparation . we did not observe any peaks of potential biotransformation products that were distinguishable from the artifact peaks of this adduct . the peaks of malathion and malaoxon could not be clearly separated in the biotransformation kinetics experiment . bioaccumulation factors for compounds that were not biotransformed are taken from ref ( 11 ) . molecular structures and label positions of compounds that are not biotransformed in gammarus pulex ( a ) or where biotransformation could not be quantified ( b ) . molecular structures , label positions , exposure concentration ( left ) , bioaccumulation , biotransformation , and elimination kinetics ( right , transfer to fresh media indicated by dashed line ) and model structure ( middle ) for malathion , chlorpyrifos , aldicarb , carbofuran , and carbaryl . adult g. pulex were exposed to c radio - labeled compounds for 24 h and then sampled , blotted dry , weighed , and frozen in glass vials at 20 c until analysis . in each experiment , four organisms composed one sample ( in one vial ) and four samples per experiment were taken ( 16 organisms total ) . two of those four samples were later pooled for carbofuran and malathion to raise the limit of detection , because exposure to those two compounds had to be at very low concentrations due to their toxicity . experimental details can be found in the text si-2 and table s1 , supporting information . for those compounds , which showed biotransformation in the metabolite screening experiments ( table 1 ) , we carried out biotransformation kinetics experiments ( design adapted from ref ( 22 ) , details in text si-3 , supporting information ) . organisms were exposed to c radio - labeled compounds for 24 h and then removed from the test solution , rinsed , and transferred to fresh media . eight replicate beakers of 500 ml of preaerated artificial pond water and one solvent control beaker each contained 10 , 15 , or 20 adult g. pulex ( see table s2 , supporting information ) , depending on the length of the depuration phase . the length of the depuration phase depended on the previously measured elimination times for total radioactivity . during the experiment , the concentration of the parent compound and its metabolite(s ) in the organisms one organism was sampled from each beaker at each time and blotted dry , and four organisms from different beakers were combined in one glass vial , weighed , and frozen at 20 c until analysis . compounds with slow elimination required more sampling time points , hence , the different numbers of organisms per beaker . each beaker also contained five leaf discs as food and shelter , which were renewed during the depuration phase if needed . g. pulex were sampled frequently throughout the experiment ( see figures 2 to 4 and data file in supporting information for timing ) . immediately after dosing ( time 0 h ) and at each sampling time , we also sampled 1 ml of test solution to quantify exposure concentrations . initial exposure concentrations were chosen so that organisms would not be strongly affected by toxic effects , while still being close enough to toxic levels to be meaningful for toxicity modeling purposes and maximizing the limit of quantification for internal concentrations of parent compounds and biotransformation products ( see text si-3 , supporting information , for more details ) . concentrations of the test compounds in the exposure medium were quantified by liquid scintillation counting ( lsc , see text si-4 , supporting information , for details ) . samples were ground with a glass rod , while methanol was added to extract the compounds . then , filtered samples were concentrated to about 1 ml using a genevac ( ez-2 plus , genevac , uk ) and under nitrogen flow to 90 l . subsequently , 210 l of distilled water were added to obtain a ratio of 30/70 ( v / v ) methanol to water . subsequently , samples were split : 100 l were analyzed by lsc and another 100 l were analyzed by high - performance liquid chromatography ( hplc , hp 1100 , agilent ) with a radio - detector ( 500 tr , packard ) to quantify amounts of parent compound and metabolites ( details in text si-5 , supporting information ) . blank organism samples were spiked with a known amount of parent compound at the beginning of the extraction method . comparison of the spiked radioactivity with the radioactivity measured by lsc yielded recovery of the extraction steps and comparison with the radioactivity measured on the hplc yields overall recovery ( table s1 , supporting information ) . known metabolites as well as the parent compound were identified by spiking unlabeled standard material of these to samples of control organisms during the grinding step and identification of these peaks via uv - detection . peaks with corresponding retention times in chromatograms of the uv - detector and the radio - detector were assumed to originate from identical compounds . in case no reference standards were available or biotransformation products were unknown , extracts were analyzed after hplc separation and electrospray ionization in either positive or negative mode with high resolution mass spectrometry using a ltq - orbitrap ( thermo , waltham , ma ) . the analytical method was adopted from a method for ultratrace level screening of organic micropollutants . data - dependent ms / ms acquisition was triggered at masses of possible transformation products and the most intensive masses . screening for possible metabolites was carried out either by extracting the high - resolution , full - scan ms data at the exact mass of known metabolites from literature or by postacquisition data processing using the metworks software ( thermo , waltham , ma ) . with this software , we predicted the masses of possible metabolites produced by phase i and phase ii reactions and compared high - resolution , full - scan ms data from the g. pulex control and the treatment extract to identify the metabolite masses that occur only in the treatment ( or only to a much higher extent ) . candidate metabolites identified by this procedure were confirmed or rejected following manual extraction of the respective c - masses from full - scan chromatograms as well as interpretation of ms and ms / ms spectra if available ( comparison of peak shape and relative intensities of c and c peaks of parent and metabolite ) . extracts of 1,2,3-trichlorobenzene , imidacloprid , and 4,6-dinitro - o - cresol , for which no or minor biotransformation was found , as well as malathion and chlorpyrifos , for which the known oxon - metabolites could be purchased , were not analyzed with hplc - ms . compounds that are not subject to biotransformation ( figure 1 ) can be modeled with a simple one - compartment model . the structures of the toxicokinetic models for compounds that are subject to biotransformation are shown in figures 24 , and metabolites are labeled m1 , m2 , and m3 . we do not differentiate between passive and active uptake and elimination mechanisms , but assume , as an approximation , first - order kinetics for all toxicokinetic processes and that biotransformation products were formed from parent compounds in separate , independent pathways . the model structure differs depending on the number of metabolites:1234where cinternal , parent(t ) is the time course of the concentration of parent compound in g. pulex [ nmol kg wet weight ] , cwater(t ) is the time course of parent compound in the medium [ nmol l ] , kin_parent is the uptake rate constant for parent compound [ l kg wet weight d ] , kout_parent is the elimination rate constant for parent compound [ d ] , kmet1 , kmet2 , and kmet3 are the biotransformation rate constants for biotransformation of parent compound to metabolites m1 , m2 , and m3 , respectively , [ d ] , cinternal , m1(t ) , cinternal , m2(t ) , and cinternal , m3(t ) are the time courses of the concentrations of metabolites m1 , m2 , and m3 in g. pulex , respectively , [ nmol kg wet weight ] , and kloss_m1 , kloss_m2 , and kloss_m3 are the elimination rate constants of the metabolites m1 , m2 , and m3 , respectively , [ d ] . the elimination rate constants of the metabolites represent direct elimination or elimination after further biotransformation . for compounds with only one or two metabolites , the model reduces to eqs 1 and 2 or eqs 1 to 3 , respectively . model parameter values , constrained to positive values , were found by least - squares minimization ( levenberg marquardt algorithm ) without weighting of data . asymptotic standard errors of parameters were derived from the covariance matrix followed by calculation of confidence intervals . all parameters of a given compound were fitted simultaneously , except for carbaryl and 4-nitro - benzyl - chloride where the uptake rate constant needed to be kept fixed at the value from a previous study in order to achieve a good fit . simulations and parameter estimation were carried out in modelmaker ( v4.0 , cherwell scientific ltd . , metabolite enrichment factors ( mefs ) were calculated by fixing the aqueous concentration of the parent at a constant concentration of 1 nmol / l and running the model for 730 days , the maximum life - span of g. pulex , which is beyond the time to approach steady - state for all compounds here . thus , in steady - state , the mef of metabolite i is defined as the ratio of the internal concentration of the metabolite cinternal , mi [ nmol kg wet weight ] to the external concentration of the parent cwater , parent [ nmol l]:5where mefmi is the metabolite enrichment factor of metabolite i , [ l kg wet weight ] . the same method was used to calculate the corresponding factors for the parent compounds , which in this case are bioaccumulation factors ( bafparent ) because the organisms were fed during the experiments . the total bioaccumulation of parent and metabolites is described by6where baftotal , [ l kg wet weight ] , is equal to the apparent bioaccumulation factor that is measured by quantifying internal concentrations as total c - radioactivity . the parent compounds 4-nitrobenzyl - chloride , sea - nine , ethylacrylate , and aldicarb were not detected in the lc - ms analysis even after purification of the extracts by solid phase extraction . this can be explained by insufficient ionization , low sensitivity , or interference with the g. pulex matrix and , in case of 4-nitrobenzylchloride , sea - nine and ethylacrylate also by rapid hydrolysis of these reactive electrophiles . since metabolites usually show similar behavior during electrospray ionization and ms detection as their parent compounds , we did not screen for metabolites in those extracts . furthermore , some metabolites were likely not detected , because of their low molecular weight , because they are not easily ionized , and because the matrix of the g. pulex extract prevented detection in the lc - ms analysis . in some cases , new masses were detected in g. pulex samples , but these masses could not be assigned with certainty to a possible metabolite of phase i or phase ii reactions . we measured the concentrations of the chemicals adsorbed to the leaf discs that were used for feeding the test organisms and approximated the dietary uptake of the chemicals by calculating the intake via food using the feeding rate and assimilation efficiency ( see text - si 7 , supporting information , for details ) . the assumptions needed for modeling dietary uptake , such as the assimilation efficiency , are highly uncertain ; thus , the dietary uptake data needs to be interpreted with caution . the percentage of dietary uptake of total uptake was less than 1% for ten out of twelve compounds ( table s7 , supporting information ) . the exceptions , carbaryl and malathion ( 8% and 9% , respectively ) , can be explained with the fixed uptake rate constant for carbaryl and the zero elimination rate ( leading to a relatively small uptake rate ) for malathion . overall , it appears that dietary uptake contributed much less than uptake via water in our bioaccumulation experiments . thus , the bioaccumulation factors measured here could also be viewed as bioconcentration factors . no biotransformation products were found in g. pulex for 1,2,3-trichlorobenzene and imidacloprid using hplc with radiodetector ( figure 1 , table 1 ) . in one out of four samples of 4,6-dinitro - o - cresol , we detected a small peak ( 4% of total radioactivity ) , which we considered negligible . in case of ethylacrylate , parent compound and possible metabolites could not be distinguished or identified because these compounds are not stable during extraction and analysis ( text si-8 , supporting information ) , also indicated by very low recovery ( table s1 , supporting information ) . bioaccumulation kinetics of the three nonmetabolized compounds ( 1,2,3-trichlorobenzene , imidacloprid , 4,6-dinitro - o - cresol ) and ethylacrylate are assumed to be well captured by toxicokinetic studies based on total radioactivity . thus , previously measured rate - constants and the corresponding one - compartment model characterize toxicokinetics of these compounds . note , that for the insecticide imidacloprid this means that the very slow elimination measured previously ( time for 95% elimination > 11 d ) must be interpreted as accumulation of the parent and could lead to carry - over toxicity from repeated pulsed exposure . we observed oxidative desulfuration of chlorpyrifos to chlorpyrifos - oxon , a common pathway in aquatic organisms . previously , we found that g. pulex biotransformed diazinon to 2-isopropyl-6-methyl-4-pyrimidinol and a major metabolite of chlorpyrifos in fish and other species is 3,5,6-trichloro-2-pyridinol ; however , this can not be our m1 , because the label positions of chlorpyrifos ( figure 2 ) are such that 3,5,6-trichloro-2-pyridinol would not be radioactive . thus , it is likely that the m1 of chlorpyrifos is the hydrolyzed ester of chlorpyrifos , but we could not confirm that with standards or accurate mass measurements . also , if the kinetics of malaoxon formation and elimination are similar to those of chlorpyrifos - oxon ( figure 2 ) and diazoxon , then the malaoxon concentrations would be close to the limit of quantification . hydrolysis of malathion would result in the metabolite m1 being one or both of the malathion monoacids , the dicarboxylic acid or the carboxylic acid esters , although further possible metabolites have been found in insects and fish . we could identify the metabolite of each carbamate ( table 1 , figure 2 ) . for carbaryl , the sulfate conjugate of the transformation product naphtol was tentatively identified by the exact mass of the molecular ion ( m : 0.9 ppm ) , the c - isotope ( m : 3.1 ppm ) , naphthol as specific fragment in the ms / ms spectrum , and the retention time ( 1.3 min less than carbaryl ) . the oxidation product of carbofuran , hydroxy - carbofuran was identified with radio - hplc . oxidation of carbofuran to hydroxy - carbofuran has also been found in various species , and hydrolysis of carbaryl to 1-naphtol and subsequent conjugation to napthol - sulfate is also a very common pathway in a range of organisms . like hydroxy - carbofuran , this is the product of a phase i reaction , whereas naphtol - sulfate is the product of phase i and subsequent phase ii reaction of carbaryl . biotransformation of the chlorinated phenols resulted in sulfate conjugates after phase ii reactions directly from the parent molecule ( table 1 , figure 3 ) . in case of 2,4-dichlorophenol and 2,4,5-trichlorophenol but not for pcp , the sulfate conjugate could be tentatively identified as metabolites in g. pulex . identification was based on detecting the exact mass of the molecular ion ( m : 0.8 ppm ( dcp ) , 1.8 ppm ( tcp ) ) , the pattern of the mass spectrum with c and cl isotopes , and the occurrence of di- and trichlorophenol as a specific fragment of the sulfate conjugate in the ms / ms spectrum ( m : 3 ppm ( dcp ) , 1.5 ppm ( tcp ) ) as well as a shorter retention time compared to the parent compound ( 2 min ( dcp ) and 3.5 min ( tcp ) less ) . m1 is likely the pcp - sulfate , based on the retention time of m1 and the fact that the two other chlorinated phenols were sulfate conjugated , although it could not be identified , presumably because the concentration was below the limit of detection of the orbitrap.figure 3molecular structures , label positions , exposure concentration ( left ) , bioaccumulation , biotransformation , and elimination kinetics ( right , transfer to fresh media indicated by dashed line ) and model structure ( middle ) for 2,4-dichlorophenol , 2,4,5-trichlorophenol , and pentachlorophenol . molecular structures , label positions , exposure concentration ( left ) , bioaccumulation , biotransformation , and elimination kinetics ( right , transfer to fresh media indicated by dashed line ) and model structure ( middle ) for 2,4-dichlorophenol , 2,4,5-trichlorophenol , and pentachlorophenol . sea - nine and 4-nitrobenzyl - chloride had three biotransformation products each , and 2,4-dichloroaniline had one ( table 1 , figure 4 ) . we identified m2 of 4-nitrobenzyl - chloride as the alcohol , and on the basis of retention times and possible pathways , m3 very likely is the conjugate even though we could not confirm that with standards or accurate mass measurements . we could not identify the metabolites of sea - nine and 2,4-dichloroaniline.figure 4molecular structures , label positions , exposure concentration ( left ) , bioaccumulation , biotransformation , and elimination kinetics ( right , transfer to fresh media indicated by dashed line ) and model structure ( middle ) for 4-nitrobenzyl - chloride , sea - nine , and 2,4-dichloroaniline . molecular structures , label positions , exposure concentration ( left ) , bioaccumulation , biotransformation , and elimination kinetics ( right , transfer to fresh media indicated by dashed line ) and model structure ( middle ) for 4-nitrobenzyl - chloride , sea - nine , and 2,4-dichloroaniline . we observed products of phase i reactions ( aldicarb - sulfone , chlorpyrifos - oxon , hydroxy - carbofuran ) , the products of phase i and subsequent phase ii reactions ( naphtol - sulfate ) and products of phase ii reactions directly from the parent molecule ( 2,4-dichlorophenol - sulfate , 2,4,5-trichlorophenol - sulfate , 4-nitrobenzyl - alcohol , 4-nitrobenzyl - conjugate , and pentachlorophenol - conjugate ) . generally , biotransformation in g. pulex appears to follow similar routes as in other aquatic organisms . conjugation with sulfate was observed for three compounds ( naphtol - sulfate , 2,4-dichlorophenol - sulfate , 2,4,5-trichlorophenol - sulfate ) and seems to be a dominant phase ii pathway in g. pulex . quantification of aqueous concentrations yields a combined measure of parent compound and any metabolite in the water . we assumed that degradation of the parent compounds in the water during the one day exposure phase was negligible and that reuptake of metabolites excreted by the organisms during the exposure phase is negligible because the ratio of water to organisms is very large . radioactivity in the water during the depuration phase can consist of parent compound and metabolites that were excreted by the organisms . we simplify and assume that the radioactivity in the water represents the parent compound and only model uptake of the parent . this assumption is justified because ( a ) the radioactivity levels were very small compared to the exposure phase and ( b ) we did not observe raised levels of radioactivity during the depuration phase for aldicarb , carbofuran , carbaryl , and 2,4-dichloroaniline ruling out the possibility for reuptake of metabolites ( figures 2 and 4 ) . slightly increasing levels of radioactivity during the depuration phase were observed for malathion , chlorpyrifos , 4-nitrobenzyl - chloride , and sea - nine ( figures 2 and 4 ) . however , reuptake of metabolites from water can also be neglected for these compounds because the radioactivity levels were very small compared to the exposure phase ( < 10% ) . furthermore , some proportion of that radioactivity can also be attributed to the parent compound because measured internal concentrations indicate that a mix of parent and metabolites would be excreted into the water ( figures 2 and 4 ) . the chlorinated phenols ( figure 3 ) exhibited raised levels of radioactivity during the depuration phase . for pentachlorophenol , approximately half of that radioactivity can be attributed to the parent assuming a similar ratio between parent and metabolite as for the internal concentrations , thus reducing the potential error by not including reuptake of metabolites into model equations . for 2,4-dichlorophenol and 2,4,5-trichlorophenol , our method is likely to overestimate parent concentrations in the water phase and thus underestimate uptake rates . therefore , these uptake rates must be considered uncertain , even more so as other factors cause large confidence intervals of the uptake rate constants for these two compounds ( explanation below ) . some compounds , in particular carbofuran , 2,4-dichlorophenol , and 2,4,5-trichlorophenol , exhibit large confidence intervals for their uptake and elimination rate constants . these large confidence intervals can be explained by very fast uptake so that steady - state concentrations were reached fast and experimental values did not capture well the shape of the internal concentration curve . thus , the data contained insufficient information to narrow down the confidence intervals for the corresponding model parameters . further , there is systematic uncertainty in the model because we had to assume that all metabolites were directly formed from their parents . of course , alternative pathways are possible but can not be inferred from our data . the time course of internal concentrations of the parent compounds and their biotransformation in g. pulex can be simulated for any exposure pattern , including pulsed or fluctuating exposures using the models and parameter values derived in this study ( table 2 ) . toxicokinetics of compounds without biotransformation could be simulated with the model and parameter values from our previous study , because in those cases all the radioactivity in the organism can be attributed to the parent compound . in addition , the parameter values can be used to compare among chemicals to find those that are more or less susceptible to biotransformation . however , the parameter values must be interpreted with care , especially those of carbaryl and 4-nitrobenzyl - chloride , where the uptake rate constants were kept fixed to previously measured values as well as the parameters of malathion , pentachlorophenol , chlorpyrifos , 2,4,5-trichlorophenol , and sea - nine , where the elimination rate constant of the parent compound converged to its lower boundary zero ( table 2 ) . nevertheless , we conclude that biotransformation of xenobiotics in g. pulex occurs for a wide range of compounds and results in a variety of metabolites and the kinetics differ widely among compounds ( first - order biotransformation rate constants range from 0.13 to 44 d , table 2).table 2uptake , elimination , and biotransformation rate constants with 95% confidence intervals ( ci)a parentm1m2m3compound ( n = # of internalconcentration datapoints , df = degreesof freedom)bkin_parent[95% ci]l kg dkout_parent[95% ci]dkmet1[95% ci]dkloss_m1[95% ci]dkmet2[95% ci]dkloss_m2[95% ci]dkmet3[95% ci]dkloss_m3[95% ci]daldicarb(n = 28 , df = 24)9.86[6.8 ; 12.9]9.31[5.1 ; 13.6]2.05[0.8 ; 3.3]6.19[2.3 ; 10.0 ] carbofuran(n = 36 , df = 32)4930[0 ; 595904]7063[0 ; 878858]16.22[0 ; 32.6]0.16[0.12 ; 0.20 ] carbaryl(n = 40 , df = 37)23.4[n.a.]c2.258[1.4 ; 3.1]3.36[2.4 ; 4.4]0.09[0.05 ; 0.13 ] malathion(n = 36 , df = 32)8.86[4.4 ; 13.3]0[0 ; 3.1]2.99[1.1 ; 4.9]1.91[0.5 ; 3.3 ] pentachlorophenol(n = 40 , df = 36)646[143 ; 1149]0[0 ; 5.5]3.19[0 ; 6.7]2.03[0 ; 4.6 ] chlorpyrifos(n = 45 , df = 39)1499[1072 ; 1926]0[0 ; 2.4]3.50[1.9 ; 5.1]2.93[1.5 ; 4.4]0.132[0 ; 0.4]0.298[0 ; 1.8 ] 2,4-dichloroaniline(n = 42 , df = 36)293[82 ; 504]8.23[0.4 ; 16.0]0.949[0.6 ; 1.3]0.478[0.05 ; 0.90]0.799[0.2 ; 1.4]1.07[0 ; 2.2 ] 2,4-dichlorophenol(n = 60 , df = 54)723[0 ; 6343]153[0 ; 1478]19.62[0 ; 43]0.413[0.34 ; 0.49]3.17 [ 0 ; 8.2]0.911[0 ; 2.3 ] 2,4,5-trichlorophenol(n = 54 , df = 48)1389[0 ; 4073]0[0 ; 36]14.52[1.1 ; 28.0]0.822[0.42 ; 1.23]2.35[0 ; 9.7]1.78[0 ; 9 ] 4-nitrobenzyl - chloride(n = 56 , df = 49)576[n.a.]c31.23[0 ; 90]0.86[0 ; 4.2]0.278[0 ; 3.4]42.5[0 ; 111]4.13[2.2 ; 6.1]44.3[0 ; 115]2.46[1.8 ; 3.2]sea - nine(n = 80 , df = 72)345[295 ; 395]0[0 ; 1.1]0.349[0 ; 1.2]2.70[0 ; 9.8]0.623[0.5 ; 0.8]0.536[0.34 ; 0.73]0.299[0 ; 0.9]2.18[0 ; 7.4]aconfidence intervals extending below zero were truncated at zero.bthe raw data used for modeling is available as supporting information.cthe uptake rate constants kin for carbaryl and 4-nitrobenzyl - chloride were kept fixed to previously measured values . the uptake rate constants kin for carbaryl and 4-nitrobenzyl - chloride were kept fixed to previously measured values . comparison of rate constants and baftotal derived in this study ( eq 6 ) with those from our previous study based on total c measurements was undertaken for ten compounds where biotransformation occurred ( carbofuran and 2,4-dichlorophenol were excluded because of large uncertainty ; diazinon was added from another study ) . the uptake rate is independent of biotransformation , which is confirmed by good agreement between the uptake rate constants derived with both experimental methods ( figure 5a , excluding data for carbaryl and 4-nitrobenzyl - chloride , see supporting information ) . the variability of 1 order of magnitude is due to interexperimental variability , different amounts of data in the two studies , and possible influences of elimination and biotransformation on the fitted uptake rates in this study because all parameters were fitted simultaneously.figure 5correlation of rate constants ( top ) and bioaccumulation factors ( bottom ) from studies based on total c internal concentrations ( y - axis ) compared to this study where metabolites were measured and modeled explicitly ( x - axis ) . correlation of rate constants ( top ) and bioaccumulation factors ( bottom ) from studies based on total c internal concentrations ( y - axis ) compared to this study where metabolites were measured and modeled explicitly ( x - axis ) . the elimination rates ( parent compounds from this study ) fell into two groups ( figure 5b ) . one group contains compounds , which were biotransformed very fast and had a negligible elimination rate in this study , but had very different elimination rates in the total c - based study , because there the elimination rate reflects elimination of the biotransformation products . thus , total c - studies overestimate parent compound elimination , unless elimination is explicitly defined as the sum of parent and biotransformation products . the second group contains those compounds where the elimination rate differs from zero . here , parameter values from the total c - based study are consistently lower . that means elimination in the total c - based study is slower than in this study , because there metabolites are also counted toward internal concentrations and the sum of parent and metabolites in the organism declines slower than the parent alone . when apparent bioaccumulation factors from a study based on total c internal concentrations ( i.e. , baftotal values ) are compared to the baftotal values from this study , i.e. , the sum of bafparent and mefs for each compound , they correlate and scatter around the line of unity ( figure 5c , text si-9 , supporting information ) . in the study based on total c internal concentrations , approximating bafparent values with apparent bioaccumulation factors from a total c - study ( i.e. , baftotal values ) consistently overestimates bafparent values , with the exception of pentachlorophenol ( figure 5d , see also table s8 and text si-9 , supporting information ) . we calculated mefs ( eq 5 ) for the metabolites and compared them to the bafs of their parent compounds ( table 1 ) . for all compounds with biotransformation , except aldicarb , the baf of the parent was smaller than the mef of one or more of its metabolites , illustrating that biotransformation products generally achieve larger internal concentrations in g. pulex than the parent compounds . note , however , that further metabolites may have been formed with smaller bioaccumulation factors , but we would not have detected those . other studies with crustaceans also found higher internal concentrations of some metabolites than the respective parent compounds , for example , in daphnia magna , hyalella azteca , gammarus fossarum , and gammarus pulex . together with our result that 14 out of 19 mefs are larger than the bafs of their parent compounds , there is enough evidence to suggest that field biomonitoring studies using crustaceans may also need to look for metabolites and confirms that assessment of toxic effects may need to include metabolites . out of the 19 metabolites that we observed in the radio - chromatograms , we could only identify seven with standards or accurate mass measurements . the mefs of 14 metabolites were larger than the bafs of their parents , indicating that metabolites could be found more often in field biomonitoring studies than their parent compounds , if they are being looked for . we found that biotransformation dominated toxicokinetics and strongly affected internal concentrations of parent compounds and metabolites . many metabolites reached higher internal concentrations than their parents , characterized by large metabolite enrichment factors . thus , comparing toxicokinetics across organisms and chemicals without explicit consideration of biotransformation has limited explanatory power . extensive biotransformation , as observed in this study , also implies that the development of quantitative - structure activity relationships can not rely on descriptors for partitioning alone but must also include descriptors for susceptibility to biotransformation . we conclude that mechanistic understanding of differences in species sensitivity or toxic potency of chemicals is more likely to succeed if biotransformation kinetics are considered .

as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .

mouse behaviors vary across the light / dark cycle ( kopp , 2001 ; refinetti , 2006 ) . in mammals , ambient light is the best known factor that regulates circadian timing , primarily through neurons in the suprachiasmatic nuclei ( scn ) of the anterior hypothalamus ( menaker et al . , 1997 ; redlin and mrosovsky , 2004 ; reppert and weaver , 2002 ) . non - photic environmental cues such as social milieu , sights , sounds , smell , and other habitat factors also contribute to circadian variations in behaviors ( mistlberger and skene , 2004 ; zisapel et al . , 1999 ) . findings obtained from several species suggest that the ability to adjust behavioral activities according to non - photic factors offers adaptive advantages , such as reducing predation risk and conspecific competitions ( daily and ehrlich , 1996 ; mistlberger and skene , 2004 ; mrosovsky , 2003 ) . inbred strains of mice maintained for laboratory research are mostly derived from several sub - species of mus musculus ( petkov et al . , 2004 ; silver , 1995).in the wild , mus musculus are generally nocturnal , displaying most of their activity during the night ( mclennan and taylor - jeffs , 2004 ; refinetti , 2004 ; whishaw et al . , 1999 ) . however , in practice , it is common for research laboratories to conduct mouse behavioral experiments during the light phase . although this approach has been criticized as ethologi - cally incorrect ( beeler et al . , 2006 ; hossain et al . , 2004 ; jennings et al . , 1998 ; roedel et al . , 2006 ) , existing data on effects of testing phase and lighting conditions on mouse behaviors are limited . roedel et al . ( 2006 ) found that , in a modified hole board test , dba mice tested in the light phase showed lower levels of exploratory activities and risk assessment than those tested in the dark phase . the same study also demonstrated that cognitive performance was compromised in mice tested in the light phase . dawley rats tested in the dark phase exhibited lower levels of escape behaviors in the forced swim test compared to those tested in the light phase . ( 2004 ) found that strain differences ( 129s1/svimj , b6 , and their f1 off - spring ) in the open field test were more detectable in the dark phase , and strain differences in the tail flick test were detectable only in the light phase . rats and mice tend to exhibit lower levels of social interactions in a brightly lit versus dimly lit open field arena , reflecting higher levels of anxiety - like behaviors in the former condition ( file and seth , 2003 ) . other reports indicate that testing phase does not have a significant impact on behavioral tests . circadian testing phase did not affect the outcomes of a social interaction test and a social recognition test in mice ( hossain et al . , 2004 ) . in a study comparing b6 and 129s1/svimj mice tested in opposite circadian cycles , beeler et al . ( 2006 ) found no significant effect of testing phase on a number of commonly used behavioral paradigms including open field , elevated plus - maze , morris water maze , novel object exploration , and motor response to amphetamine . in sum , it remains unclear to what extent circadian phase influences the scores obtained when mice are tested on various behavioral paradigms designated to evaluate emotional responses , cognitive performances , and social behaviors . our laboratory has begun to characterize social approach behaviors in transgenic , knockout , and inbred strains of mice , toward establishing relevant mouse models for human disorders defined by profound deficits in social interactions , such as autism . mice tend to engage in high levels of social interaction in the dark phase ( arakawa et al . , 2007 ; laviola et al . , 1994 ; panksepp and lahvis , 2006 ; terranova et al . , 1998 ) , raising the question of whether light phase testing is appropriate for studying social approach behaviors in laboratory mice . existing data regarding this issue are few ( hossain et al . , 2004 ; paterson and vickers , 1984 ) , and not sufficient to provide clear guidance . the main goal of the present experiments was to compare scores on social behavior tests conducted during the light phase , under white light illumination , versus those conducted during the dark phase , under dim red light illumination , in two inbred strains and three genotypes of a line of neuropeptide receptor mutant mice . c57bl/6j ( b6 ) and btbr t+ tf / j ( btbr ) are two inbred strains with distinctly contrasting social behavior phenotypes ( bolivar et al . , 2007 ; mcfarlane et al . , 2007 ; moy et al . , 2007 ) . vasopressin is a hypothalamic neuropeptide that has been shown to mediate social recognition , sexual , parental , and aggressive interactions ( ferris , 2005 ; hammock and young , 2006 ; nair and young , 2006 ; wang et al . , 1998 ) . null mutation of the vasopressin receptor subtype 1b gene ( avpr1b ) produces deficits in social recognition and reduced aggression in male mice ( wersinger et al . , 2002 , 2006 ) . a second goal of this study is to address the related question of replicability of mouse behavioral findings ( crabbe et al . , 1999 ; we conducted social approach testing with five independent cohorts of avpr1b null mutants , heterozygotes , and wildtype littermate controls , two during the light phase and three during the dark phase . finally , effects of circadian phase on juvenile play behaviors were evaluated in avpr1b mice . all breeding , housing , and behavioral testing was conducted in strict compliance with the nih guide for the care and use of laboratory animals and approved by the national institute of mental health animal care and use committee . mice were weaned at postnatal day 21 , then group housed by gender in standard mouse cages containing 24 mice per cage . for the avpr1b experiments , each home cage consisted of 24 littermate mice of mixed genotypes . cages were housed in ventilated racks in temperature ( 20c ) and humidity ( 55% ) controlled colony rooms . in addition to standard bedding , a nestlet square and a cardboard tube were provided in each cage . the two colony rooms used for breeding and housing subjects were both on 12:12 light / dark cycles , one with lights on from 6:00 am to 6:00 pm , and the other with lights on from 9:00 pm to 9:00 am . red lights were turned on if staff or experimenters need to enter the room during the dark cycle . dark phase testing was conducted under the illumination of a single 25-watt incandescent red light bulb desk lamp . red light was used to simulate darkness , since murine eyes are insensitive to red light ( mclennan and taylor - jeffs , 2004 ) . at the beginning of each test day , light intensity was tested and adjusted to achieve lighting homogeneity in and around the apparatus . the light level was approximately 2 lux for dark phase experiments and 30 lux for light phase experiments . subjects used for the b6 versus btbr comparison experiments were male mice born and raised at nimh in bethesda , md , from original breeding pairs purchased from the jackson laboratory ( bar harbor , me ) . these strains were chosen for their divergent social behaviors , allowing the circadian questions to be addressed in mice with high social approach and with low social approach , and also to evaluate the replicability of previous findings ( mcfarlane et al . light phase testing : b6 , n = 11 ; btbr , n = 12 . dark phase testing : b6 , n = 12 ; btbr , n = 12 . targeted disruption of the avpr1b gene was described previously ( wersinger et al . , 2002 ) . avpr1b null mutants ( / ) , heterozygotes ( + / ) , and wildtype littermates ( + /+ ) were bred from the offspring of non - sibling heterozygous . subjects of the current experiments were on an approximately equal mix of c57bl/6j and 129x1/svj background strains ( wersinger et al . , 2004 ) . to evaluate replicability of findings in mutant mice , four different investigators from our laboratory tested avpr1b mutant mice in the automated three - chambered social approach task . each investigator bred and tested his / her own cohort(s ) in the same vivarium and test rooms . the series of experiments was conducted during different seasons over the course of 1 year . investigator t. c. performed light phase testing only ( + /+ , n = 13 ; + / , n = 16 ; / , n = 15 ) . investigator m. l. s. conducted dark phase testing only ( + /+ , n = 10 ; + / , n = 12 ; / , n = 12 ) . investigator h. g. m. conducted dark phase testing only ( + /+ , n = 12 ; + / , n = 12 ; / , n = 8) . investigator m. y. conducted light and dark phase experiments simultaneously ( dark phase : + /+ , n = 9 ; + / , n = 11 ; / , n = 9 ; light phase : + /+ , n = 10 ; + / , n = 13 ; / , n = 9 ) . each mouse from the b6 and btbr strain was used only once , as an adult in the social approach test . mice from the vasopressin receptor 1b mutant line that were used for the juvenile play test was subsequently used for the adult social approach test ( m. y. ) . adult vasopressin receptor 1b mutant mice used by other investigators had been tested in other experiments including maternal separation induced ultrasonic vocalizations ( m. l. s. ) and open field ( h. g. m. ) . social approach behaviors were tested in an automated three - chambered apparatus using methods similar to those previously described ( crawley et al . briefly , the apparatus was a rectangular , three - chambered box made from clear polycarbonate . quantification of number of entries and time spent in the chambers was automatically measured by photocells embedded in the doorways . strangers were male c57bl/6j ( t. c. , m. s. l. , h. g. m. ) or 129sv / imj and aj mice ( m. y. ) , aged 814 weeks old , bred in the nimh vivarium from breeding pairs originally obtained from the jackson laboratory . stranger mice were habituated to the apparatus and to the wire cup enclosure before the start of experiments , for 10 minutes per day for three consecutive days . the subject mouse was allowed to acclimate to the apparatus for 20 minutes before the sociability test , 10 minutes in the central chamber with the doors closed , followed by 10 minutes in the entire empty arena with the doors open . the subject was then briefly confined to the center chamber while a novel object ( inverted wire cup , galaxy cup , kitchen plus , http://www.kitchen-plus.com ) was introduced into one of the side chambers . a stranger mouse enclosed in an identical wire cup an upright plastic drinking cup , held in place by a lead weight in the cup , was placed on the top of each inverted wire cup to prevent the subject from climbing onto the top of the wire cup . side chamber location of the novel object and the stranger mouse alternated between the left and right chambers across subjects . lack of innate side preference was confirmed in previous experiments and during the 10 minutes habituation to the entire arena in the present experiments . after both stimuli were positioned , the doors were simultaneously re - opened and the subject was allowed access to all three chambers for 10 minutes . measures taken included time spent in each chamber , time spent sniffing each cup , and the number of entries . for the b6 and btbr circadian comparison experiments , similar numbers of subjects from each strain were alternately tested on any test day . for the avpr1b mice experiments , subjects of all genotypes from a home cage were tested in randomized order . when light and dark phase experiments were conducted simultaneously in a parallel design , light and dark tests were randomly alternated across days , but not within a single test day , due to the time - consuming procedure of properly rearranging lighting . juvenile play was analyzed in the noldus phenotyper arena ( noldus , leesburg va , usa ) as previously described ( mcfarlane et al . , 2007 ; terranova and laviola , 2005 ) . the juvenile play test was carried out at postnatal day 21 1 . one day before the play test , and 1-hour after being singly housed in a clean cage , each subject was allowed to acclimate to the entire empty arena for 10 minutes . the arena was cleaned with 70% ethanol and water between subjects . on the day of the play test , subjects were housed individually in the experimental room for 1 hour prior to the play test . two non - sibling males of the same genotype were placed in the testing arena and their interactions were recorded for 30 minutes . behaviors were subsequently scored from digital videotapes using the noldus observer 5.0 system , by a highly trained scorer unaware of the group assignment . behaviors analyzed included nose sniffing , push past / crawl over and under , huddling together , and follow , using definitions similar to previously described ( mcfarlane et al . , 2007 , supplementary information ) . all behaviors were analyzed for frequency of occurrence , with the exception of huddling , for which duration was analyzed . for the automated social approach task , repeated measures analysis of variance ( anova ) was used to compare time spent in the chamber in the sociability test . since times spent in each of the three chambers were not independent , the test condition factor compared time spent only in the right versus left chambers . time spent sniffing the novel object versus the stranger and entries to side chambers were similarly analyzed . keuls test was used for post - hoc pairwise comparisons following a significant overall f - value . all breeding , housing , and behavioral testing was conducted in strict compliance with the nih guide for the care and use of laboratory animals and approved by the national institute of mental health animal care and use committee . mice were weaned at postnatal day 21 , then group housed by gender in standard mouse cages containing 24 mice per cage . for the avpr1b experiments , each home cage consisted of 24 littermate mice of mixed genotypes . cages were housed in ventilated racks in temperature ( 20c ) and humidity ( 55% ) controlled colony rooms . in addition to standard bedding , a nestlet square and a cardboard tube were provided in each cage . the two colony rooms used for breeding and housing subjects were both on 12:12 light / dark cycles , one with lights on from 6:00 am to 6:00 pm , and the other with lights on from 9:00 pm to 9:00 am . red lights were turned on if staff or experimenters need to enter the room during the dark cycle . dark phase testing was conducted under the illumination of a single 25-watt incandescent red light bulb desk lamp . red light was used to simulate darkness , since murine eyes are insensitive to red light ( mclennan and taylor - jeffs , 2004 ) . at the beginning of each test day , light intensity was tested and adjusted to achieve lighting homogeneity in and around the apparatus . the light level was approximately 2 lux for dark phase experiments and 30 lux for light phase experiments . subjects used for the b6 versus btbr comparison experiments were male mice born and raised at nimh in bethesda , md , from original breeding pairs purchased from the jackson laboratory ( bar harbor , me ) . these strains were chosen for their divergent social behaviors , allowing the circadian questions to be addressed in mice with high social approach and with low social approach , and also to evaluate the replicability of previous findings ( mcfarlane et al . light phase testing : b6 , n = 11 ; btbr , n = 12 . dark phase testing : b6 , n = 12 ; btbr , n = 12 . targeted disruption of the avpr1b gene was described previously ( wersinger et al . , 2002 ) . avpr1b null mutants ( / ) , heterozygotes ( + / ) , and wildtype littermates ( + /+ ) were bred from the offspring of non - sibling heterozygous . subjects of the current experiments were on an approximately equal mix of c57bl/6j and 129x1/svj background strains ( wersinger et al . , 2004 ) . to evaluate replicability of findings in mutant mice , four different investigators from our laboratory tested avpr1b mutant mice in the automated three - chambered social approach task . each investigator bred and tested his / her own cohort(s ) in the same vivarium and test rooms . the series of experiments was conducted during different seasons over the course of 1 year . investigator t. c. performed light phase testing only ( + /+ , n = 13 ; + / , n = 16 ; / , n = 15 ) . investigator m. l. s. conducted dark phase testing only ( + /+ , n = 10 ; + / , n = 12 ; / , n = 12 ) . investigator h. g. m. conducted dark phase testing only ( + /+ , n = 12 ; + / , n = 12 ; / , n = 8) . investigator m. y. conducted light and dark phase experiments simultaneously ( dark phase : + /+ , n = 9 ; + / , n = 11 ; / , n = 9 ; light phase : + /+ , n = 10 ; + / , n = 13 ; / , n = 9 ) . each mouse from the b6 and btbr strain was used only once , as an adult in the social approach test . mice from the vasopressin receptor 1b mutant line that were used for the juvenile play test was subsequently used for the adult social approach test ( m. y. ) . adult vasopressin receptor 1b mutant mice used by other investigators had been tested in other experiments including maternal separation induced ultrasonic vocalizations ( m. l. s. ) and open field ( h. g. m. ) . social approach behaviors were tested in an automated three - chambered apparatus using methods similar to those previously described ( crawley et al . , 2007 ; mcfarlane et al . , 2007 ; moy et al . , 2004 , 2007 ; nadler et al . , briefly , the apparatus was a rectangular , three - chambered box made from clear polycarbonate . quantification of number of entries and time spent in the chambers was automatically measured by photocells embedded in the doorways . strangers were male c57bl/6j ( t. c. , m. s. l. , h. g. m. ) or 129sv / imj and aj mice ( m. y. ) , aged 814 weeks old , bred in the nimh vivarium from breeding pairs originally obtained from the jackson laboratory . stranger mice were habituated to the apparatus and to the wire cup enclosure before the start of experiments , for 10 minutes per day for three consecutive days . the subject mouse was allowed to acclimate to the apparatus for 20 minutes before the sociability test , 10 minutes in the central chamber with the doors closed , followed by 10 minutes in the entire empty arena with the doors open . the subject was then briefly confined to the center chamber while a novel object ( inverted wire cup , galaxy cup , kitchen plus , http://www.kitchen-plus.com ) was introduced into one of the side chambers . a stranger mouse enclosed in an identical wire cup an upright plastic drinking cup , held in place by a lead weight in the cup , was placed on the top of each inverted wire cup to prevent the subject from climbing onto the top of the wire cup . side chamber location of the novel object and the stranger mouse alternated between the left and right chambers across subjects . lack of innate side preference was confirmed in previous experiments and during the 10 minutes habituation to the entire arena in the present experiments . after both stimuli were positioned , the doors were simultaneously re - opened and the subject was allowed access to all three chambers for 10 minutes . measures taken included time spent in each chamber , time spent sniffing each cup , and the number of entries . the b6 and btbr circadian comparison experiments , similar numbers of subjects from each strain were alternately tested on any test day . for the avpr1b mice experiments , subjects of all genotypes from a home cage were tested in randomized order . when light and dark phase experiments were conducted simultaneously in a parallel design , light and dark tests were randomly alternated across days , but not within a single test day , due to the time - consuming procedure of properly rearranging lighting . juvenile play was analyzed in the noldus phenotyper arena ( noldus , leesburg va , usa ) as previously described ( mcfarlane et al . the juvenile play test was carried out at postnatal day 21 1 . one day before the play test , and 1-hour after being singly housed in a clean cage , each subject was allowed to acclimate to the entire empty arena for 10 minutes . the arena was cleaned with 70% ethanol and water between subjects . on the day of the play test , subjects were housed individually in the experimental room for 1 hour prior to the play test . two non - sibling males of the same genotype were placed in the testing arena and their interactions were recorded for 30 minutes . behaviors were subsequently scored from digital videotapes using the noldus observer 5.0 system , by a highly trained scorer unaware of the group assignment . behaviors analyzed included nose sniffing , push past / crawl over and under , huddling together , and follow , using definitions similar to previously described ( mcfarlane et al . all behaviors were analyzed for frequency of occurrence , with the exception of huddling , for which duration was analyzed . for the automated social approach task , repeated measures analysis of variance ( anova ) was used to compare time spent in the chamber in the sociability test . since times spent in each of the three chambers were not independent , the test condition factor compared time spent only in the right versus left chambers . time spent sniffing the novel object versus the stranger and entries to side chambers were similarly analyzed . keuls test was used for post - hoc pairwise comparisons following a significant overall f - value . c illustrate social approach behaviors of adult male b6 and btbr mice housed on a reverse light cycle and tested in the dark phase . b6 spent significantly more time in the side chamber containing the stranger than in the side chamber containing the novel object ( figure 1a , f1,10 = 28.17 , p < 0.001 ) . btbr failed to spend more time in the side chamber containing the stranger ( figure 1a , f1,11 = 0.37 , ns ) . b6 spent more time sniffing the stranger than the novel object ( figure 1b , f1,10 = 74.65 , p < 0.0001 ) . btbr failed to spend more time sniffing the stranger ( figure 1b , f1,11 = 4.44 , p = 0.06 ) . b6 and btbr mice made similar numbers of entries between compartments ( figure 1c , p = 0.388 ) , indicating normal exploratory locomotion . figure 1 panels d f illustrate social approach behaviors of adult male b6 and btbr mice housed on a conventional light cycle and tested in the light phase . b6 spent significantly more time in the side chamber containing the stranger than mice display normal social behaviours in the light phase in the side chamber containing the novel object ( figure 1d , f1,11 = 9.11 , p < 0.01 ) . btbr failed to spend more time in the side chamber containing the stranger ( figure 1e , f1,11 = 0.20 , ns ) . b6 spent more time sniffing the stranger than the novel object ( figure 1e , f1,11 = 31.64 , p < 0.001 ) , btbr failed to spend more time sniffing the stranger ( figure 1e , f1,11 = 2.89 , p = 0.12 ) . b6 and btbr mice made similar numbers of entries between compartments ( figure 1f , p = 0.225 ) , indicating normal exploratory locomotion . anova analysis indicated that , overall , mice tested in the dark phase made more total entries than mice tested in the light phase ( f1,90 = 21.24 , p < 0.001 ) . circadian phase did not influence overall chamber time ( f1,90 = 0.64 , ns ) or overall sniff time ( f1,90 = 3.56 , ns ) . b6 mice displayed high levels of sociability while btbr mice displayed low levels of sociability , when tested in either circadian phase . left panels : dark phase testing of mice raised on a reverse light cycle ; right panels : light phase testing of mice raised on a conventional light cycle . ( a ) and ( d ) b6 spent significantly more time in the side chamber containing a stranger mouse than in the side chamber containing a novel object . btbr spent approximately equal amounts of time in the side chambers containing a novel object and a stranger mouse ; ( b ) and ( e ) b6 spent significantly more time sniffing the stranger than the novel object . btbr did not ; ( c ) and ( f ) number of entries into the side chambers was not significantly different between b6 and btbr , indicating comparable levels of locomotor activity and exploratory tendencies . c57bl/6j ( b6 ) , n = 11 ( dark ) , n = 12 ( light ) ; btbr t + tf / j ( btbr ) , n = 12 ( dark ) , n = 12 ( light ) . * * p < 0.01 for comparisons of the stranger mouse and novel object . figure 2 illustrates normal social approach to a stranger mouse in two cohorts of avpr1b mice that were bred at the same time , one on a reverse light cycle and tested in the dark , and the other on a conventional light cycle and tested in the light . all three genotypes tested in the dark phase spent significantly more time in the chamber containing the stranger than in the chamber containing the novel object : ( figure 2a , + /+ , f1,8 = 55.64 , p < 0.0001 ; + / , f1,10 = 12.66 , p < 0.05 ; / f1,8 = 6.82 , p < 0.05 ) , spent more time sniffing the stranger than sniffing the novel object : ( figure 2b , + /+ , f1,8 = 100.12 , p < 0.0001 ; + / , f1,10 = 29.25 , p < 0.001 ; f1,8 = 9.69 , p < 0.01 ) , and showed similar numbers of entries between compartments ( figure 2c , p = 0.29 ) . social approach behaviors of all three genotypes of avpr1b mice tested in the light phase showed significantly more time in the chamber containing the stranger than in the chamber containing the novel object : ( figure 2d , + /+ , f1,9 = 14.48 , p < 0.01 ; + / f1,12 = 30.30 , p < 0.0001 ; / , f1,8 = 50.05 , p < 0.0001 ) . all three genotypes spent more time sniffing the stranger than sniffing the novel object : ( figure 2e , + /+ 0.0001 ; f1,8 = 95.27 , p < 0.0001 ) , and showed similar numbers of entries between compartments ( figure 2f , p = 0.83 ) . vasopressin receptor subtype 1b ( avpr1b ) null mutant ( / ) , heterozygous ( + / ) , and wildtype littermate controls ( + /+ ) displayed normal sociability . left panels : dark phase testing of mice raised on a reverse light cycle ; right panels : light phase testing of mice raised on a conventional light cycle . ( a ) and ( d ) all three genotypes spent significantly more time in the chamber containing a stranger mouse than in the chamber containing a novel object ; ( b ) and ( e ) all three genotypes spent significantly more time sniffing a stranger mouse than a novel object ; ( c ) and ( f ) number of entries into the side chambers was not significantly different across genotypes , indicating similar locomotor activity and exploratory tendencies . + /+ n = 9 ( dark ) , n = 10 ( light ) ; + / n = 11(dark ) , n = 13 ( light ) ; / n = 9 ( dark ) , n = 9 ( light ) , * p < 0.05 , * * p < 0.01 , within - group comparison between the stranger mouse and the novel object . figure 3 displays sociability data obtained from five separate experiments conducted with independent cohorts of avpr1b mice . f ; light phase testing is shown in panels g j . panels a and b , taken from the experiments shown in figures 2a and 2b , and panels g and h , taken from figures 2d and 2e , are re - illustrated for comparison purposes . all three dark phase experiments and one light phase experiment revealed that all three genotypes spent more time in the chamber containing the stranger mouse than in the chamber containing the novel object . all three dark phase experiments and both light phase experiments showed that all three genotypes spent more time sniffing the stranger mouse than the novel object . repeated measure anova results of the five replications were : ( a ) cohort 1 , dark phase time in chamber , + /+ , f1,8 = 55.64 , p < 0.0001 ; + / , f1,10 = 12.66 , p < 0.05 ; / f1,8 = 6.82 , p < 0.05 ; ( b ) cohort 1 , dark phase time spent sniffing , + /+ , f1,8 = 100.12 , p < 0.0001 ; + /f1,10 = 29.25 , p < 0.001 ; f1,8 = 9.69 , p < 0.01 ; ( c ) cohort 2 , dark phase time in chamber + / + , f1,9 = 20.10 , p < 0.001 ; + / f1,11 = 24.61 , p < 0.001 ; / , f1,11 = 24.89 , p < 0.001 ; ( d ) cohort 2 , dark phase time spent sniffing , + /+ , f1,9 = 29.92 , p < 0.001 ; + / f1,11 = 23.34 , p < 0.001 ; / , f1,11 = 74.69 , p < 0.001 ; ( e ) cohort 3 , dark phase time in chamber , + /+ , f1,11 = 5.91 , p < 0.05 + / f1,11 = 6.35 , p < 0.05 ; / , f1,7 = 23.93 , p < 0.01 ; ( f ) cohort 3 , dark phase time spent sniffing , + /+ , f1,11 = 17.34 , p < 0.01 ; + / f1,11 = 13.30 , p < 0.01 ; / , f1,7 = 45.74 , one light phase experiment demonstrated all three genotypes spent more time in the chamber containing the stranger mouse than the one containing the novel object : ( g ) cohort 4 , light phase time in chamber , + /+ f1,12 = 30.30 , p < 0.0001 ; / , f1,8 = 50.05 , p < 0.0001 . f1,12 = 38.77 , p < 0.0001 ; f1,8 = 95.27 , p < 0.0001 . ( i ) cohort 5 , light phase time in chamber , + /+ , f1,12 = 15.56 , p < 0.01 ; + / f1,15 = 0.72 , ns ; / , f1,14 = 0.001 , ns . ( j ) cohort 5 , light phase time spent sniffing , + /+ , f1,12 = 12.58 , p < 0.01 ; + / f1,15 = 21.91 , p < 0.001 ; / , f1,14 = 11.08 , p < 0.01 ) . all five replications found all three genotypes made similar numbers of entries to the side chambers ( data not shown ) , indicating normal locomotor activity and exploratory tendencies . normal sociability of vasopressin receptor subtype 1b ( avpr1b ) null mutants ( / ) , heterozygotes ( + / ) , and wildtype littermate controls ( + /+ ) was seen in four out of five experiments , conducted by different investigators using independent cohorts of mice across a 1 year time span . ( a f ) dark phase testing of mice raised on a reverse light cycle ; ( g j ) light phase testing of mice raised on a conventional light cycle ; ( a , c , e , g ) all three genotypes spent significantly more time in the chamber containing a stranger mouse than in the chamber containing a novel object ; ( i ) in one cohort , the wildtype group spent more time in the chamber containing a stranger mouse than in the chamber containing a novel object , while the heterozygous and null mutant mice failed to spend more time in the side chamber containing the stranger ; ( b , d , f , h , j ) all three genotypes spent significantly more time sniffing the stranger mouse than the novel object . ns for each cohort were as listed in the text . * p < 0.05 ; * * p < 0.01 , within - group comparison between the stranger mouse side and the novel object side . figure 4 illustrates juvenile play behaviors in avpr1b mice housed on a reverse light cycle and tested in the dark versus housed on a standard light cycle and tested in the light . juvenile male play data were compared with manova for phase , genotype , and phase genotype interaction . no significant main effect of genotype was detected for nose sniff , f1,46 = 2.39 , ns . p < 0.01 , with animals tested in the dark phase tending to display more nose sniffs than mice tested in the light phase . however , the interaction between testing phase and genotype was not significant . no significant effect of genotype or testing phase was detected for the number of push / crawl ( genotype , f2,46 = 0.19 , ns ; phase , f1,46 = 2.69 , ns ) or follow ( genotype , f2,46 = 0.77 , ns ; phase , f1,46 = 1.40 , ns ) . the main effect of testing phase was significant for total duration of huddling , f1,46 = 20.84 , p < 0.0001 . the main effect of genotype was significant , f1,46 = 5.48 , p < 0.01 . phase genotype interaction was not significant , f2,46 = 2.21 , ns . post - hoc newman - keuls test showed that avpr1b + / and / groups spent less time in physical contact , compared to + /+ groups . juvenile male vasopressin receptor subtype 1b ( avpr1b ) null mutant ( / ) , heterozygous ( + / ) , and wildtype littermate controls ( + /+ ) exhibited similar levels of active push / crawl ( play soliciting behaviors ) and nose sniff ( social investigative behaviors ) at pnd 21 1 . significant genotype differences were found for huddling , with heterozygotes null mutant pups spending less time huddling compared to wildtype pups . ( a ) nose sniff ; ( b ) push and crawl ; ( c ) huddling together ; ( d ) following . + /+ , n = 8 ( dark ) , n = 10 ( light ) ; + / , n = 8 ( dark ) , n = 10 ( light ) ; / , n = 8 ( dark ) , n = 8 ( light ) . mice are social animals with rich behavior repertoires , suitable for modeling human disorders characterized by social behavior deficits ( crawley , 2004 , 2007 ; panksepp and lahvis , 2006 ; terranova et al . , 1993 ) . methods for analyzing social behaviors in mice require an understanding of test conditions that influence the results obtained . since mice are more active at night ( mclennan and taylor - jeffs , 2004 ; refinetti , 2004 ; whishaw et al . , 1999 ) , the influence of circadian phase on social interactions is a critical parameter to understand when developing robust , replicable , high throughput assays of mouse social behaviors . in the present experiments , we evaluated social behaviors of three lines of mice , each with a cohort raised and tested in both the light and dark phases of the circadian cycle . our primary finding is that testing phase does not have a strong impact on levels of social approach and interaction in two inbred strains of mice and in three genotypes of a knockout line of mice . both dark and light phase testing revealed marked differences in sociability between adult b6 and btbr mice . b6 displayed clear tendencies to spend more time with a stranger mouse than with a novel object . the present findings , within a systematic comparison conducted simultaneously in the same laboratory , are consistent with previous findings of high sociability in b6 and low sociability in btbr that were conducted in different laboratories with slightly different methods ( mcfarlane et al . , 2007 ; the two strains exhibited similar levels of locomotor activities and exploratory tendencies in the social apparatus , confirming previous reports of normal procedural abilities relevant to social interaction in both strains ( mcfarlane et al . , 2007 ; moy et al . , 2007 ) . of note , b6 tested in both phases spent similar amounts of time actively sniffing the stranger , indicating that animals tested in the light phase are fully alert and direct as much attention to a social stimulus as those tested in the dark phase . these findings demonstrated that testing phase and lighting levels do not have significant influences on the expression of sociability in the automated three - chambered social approach task , at least in the two inbred strains tested . mice tested in the dark phase made more entries to the side chambers than those tested in the light phase , indicating that general exploratory activity is influenced by circadian phase . nevertheless , neither the absolute levels of social approach behaviors nor strain differences in sociability was affected by variations in exploratory activities . replicability of btbr and b6 phenotypes on the social approach task , under different circadian conditions , in different laboratories , and across different cohorts of mice , thus appears to be robust . sociability tests in avpr1b null mutants ( / ) , heterozygotes ( + / ) , and wildtype littermates ( + /+ ) tested in opposite circadian phases yielded similar results . one light phase and three dark phase experiments found that all three genotypes spent more time in the side chamber containing the stranger mouse than in the side chamber containing the novel object , and more time sniffing the stranger mouse than sniffing the novel object . one experiment , carried out in the light phase , revealed that heterozygotes and null mutants failed to spend more time in the chamber containing the stranger mouse than in the chamber containing the novel object . in this experiment , mice of all three genotypes did spend more time sniffing the stranger than the novel object . all five experiments yielded similar number of entries across genotypes , indicating normal exploratory locomotion . therefore , as summarized in table 1 , similar results were obtained in five out of five independent cohorts of avpr1b mice , tested by different investigators at different times of the year , on two parameters in our social approach task , time spent sniffing the stranger mouse versus the novel object and entries into the side chambers . four out of five independent cohorts yielded similar results on one parameter , time spent in the chamber containing the stranger versus the novel object . in addition , the absolute values for time spent in the side chambers and time spent sniffing were quite similar across experiments . these five datasets represent a reasonably high level of replicability within a line of mice tested on the social approach task . summary of general lack of effect of circadian phase on social approach behaviors in avpr1b mice , from five independent experiments conducted by four different investigators using different cohorts of mice . three representative behaviors were chosen to characterize active social interactions in male juvenile avpr1b mice tested in opposite circadian phases . the best recognized play soliciting behaviors are pushing past , pushing under , and crawling over the other mouse ( terranova et al . , 1993 , 1998 ) , which are combined in a single category labeled push / crawl in the present study . nose - to - nose sniff , an investigative behavior potentially analogous to eye contact in humans , has been postulated as a useful behavioral index in an animal model of autism ( mcfarlane et al . , 2007 ) . following , in which one mouse follows the other for a short amount of time , is commonly considered a social investigative behavior ( file and seth , 2003 ; terranova et al . , 1998 ) . our findings that genotype and testing phase had no significant effect on these juvenile avpr1b behaviors are consistent with our social approach results obtained from the five cohorts of adult avpr1b mutant mice . huddling is a measure of inactivity that reflects two pups in physical contact , usually sitting quietly in a corner of the arena . we observed that huddling tends to increase toward the end of the 30-minute test session , probably reflecting that sufficient time has elapsed for pups to familiarize with each other , and for the competing behavior of exploring the novel environment to decrease , thus producing more sitting quietly in the corner . our finding that huddling was higher in the light phase than in the dark phase is consistent with the tendency of mice to rest more in the light phase ( refinetti , 2004 ) . note that the adult sociability test was only 10 minutes , whereas the juvenile play test 30 minutes , when arena exploration and active social interactions dominate . a genotype difference was detected , with avpr1b + / and avpr1b / mice spending less time huddling compared to wildtype controls . since huddling is the only behavior for which the genotype effect was significant , it is premature to interpret juvenile sociability with reference to the function of the avpr1b gene . the present overall negative finding of the lack of effect of avpr1b mutation on social interactions in mice is in contrast to a previous study which demonstrated that the same line of mice null for avpr1b failed to spend more time sniffing soiled mice bedding as compared to clean bedding ( wersinger et al . , 2004 ) . the discrepancy might be understood in light of the fact that live animals , which could be more potent social stimuli than soiled bedding , were used in the present study . issues of replicability of behavioral findings have been raised , even in extremely rigorously controlled studies ( crabbe et al . , 1999 ; it has been recommended that mouse behavior assays be standardized across laboratories to improve inter - laboratory replicability ( cryan and mombereau , 2004 ) . another view , perhaps more realistic , is that research environments can never be made similar enough to guarantee identical results ( wahlsten et al . , 2003 ) . in our laboratory , investigators are trained to follow exactly the same experimental protocols for conducting the automated three - chambered social approach task . great attention is given to procedural and environmental details to minimize inter - experimenter variability . the present results on social approach in five cohorts of avpr1b mice show that the large majority of findings replicated very well , but even with such rigorous controls , identical results were not obtained for every measure in every cohort . the level of replicability for these social behavior parameters appears to be comparable to the level of replicability seen in other areas of biological research . our findings support the recommendation that when a significant main effect of genotype is discovered , it is necessary to replicate the initial finding , as with other biological assays ( crabbe et al . , 1999 ; crawley , 2007 ) . the present finding that sociability was equally high when mice were tested in the light phase versus in the dark phase of the circa - dian cycle is interesting and unexpected . one possible explanation is that environmental factors in the vivarium and test facility may act as cir - cadian entrainers . field studies have shown that many species are not strictly nocturnal or diurnal , being able to adjust their behaviors according to environmental pressures ( mrosovsky , 2003 ) . standard vivarium operations typically require routine cleaning , feeding , cage changes , and inspection of mice to be conducted during the light phase . consequently , mice living under conventional light / dark cycles , that is , the standard condition in most commercial and research facilities , are unavoidably disturbed during their normal resting phase . it is conceivable that animals that are better at adapting to such daily disruption have enjoyed superior reproductive success than those unable to adapt well . as a result , commonly used strains of laboratory mice might have been selected as useful research resources because they had evolved to be less strictly nocturnal , being able to adjust physiologically and behaviorally to the demands of the vivarium environment . further , the ethological importance of investigating a novel conspecific may override the tendency of mice to sleep during the light phase . thus , social interaction assays may be among the least sensitive to circadian phase , at least for laboratory mice . in conclusion , the present data provide strong evidence that mice display qualitatively and quantitatively similar levels of social behaviors when raised on a conventional lighting cycle and tested during the light phase , as when raised on a reverse light cycle and tested during their dark phase . high sociability in b6 , low sociability in btbr , and the lack of genotype differences in avpr1b mice , were generally unaffected by testing phase . based on these findings , we suggest that it is methodologically appropriate to test mouse social approach behaviors in either circadian phase . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

photochemical reactions induced by irradiation with ultraviolet ( uv ) light are utilized in a large variety of applications such as surface cleaning , antiviral and bactericidal surface disinfection , air and water purification , photochemical surface modification , wettability alteration , material deposition , surface charging , photolithography , and the patterning of self - assembled monolayers . the photopatterning of polymer layers due to photoisomerization reactions of azobenzene groups has been studied intensively . chowdhury et al . reported on experiments regarding uv - induced photopolymerization reactions of aniline films floating on water . golovin and volpert studied the marangoni instability of a thin liquid layer subject to uniform illumination that triggers a reversible photochemical reaction . they performed a linear stability analysis as well as numerical simulations of the evolution equations for the height and reactant concentration profiles . dun et al . studied the laser - pulse - induced deformation of 50-nm - thick sb2te3 films due to a competition between thermocapillary and solutocapillary effects . a displacement of material out of the laser spot was observed for low powers , whereas material accumulation in the laser spot occurred for higher powers . verma et al . irradiated polystyrene and poly(methyl methacrylate ) layers with intense near - uv radiation at 355 nm , which caused local melting of the polymer . using various apertures , they were able to induce relief patterns in the polymer films with a single laser pulse ( 100 ns ) . katzenstein et al . studied pattern formation after uv illumination of a solid polymer through a mask and subsequent heating above the glass - transition temperature . presented a perturbation analysis of a coupled convection - diffusion model for uv - induced polymer surface deformations and achieved good agreement with experimental results using polystyrene layers . kim et al . used a photosensitizer to enhance the uv - photopatterning effect and concluded that an endoperoxide of the photosensitizer is a critical reaction intermediate . adding a photobase generator to a polymer film , kim et al . demonstrated that uv - induced material redistribution could be directed toward either the irradiated or the nonilluminated regions depending on the mode of exposure using either low - intensity and wavelength - selective or high - intensity and broad - band illumination the authors identified decarboxylation and dehydrogenation reactions as the chemical processes driving the flow . in this article , we report on the irradiation of aliphatic , liquid hydrocarbon films on stationary substrates with deep - uv light through a mask ( figure 1a ) . because of photochemical reactions , the chemical composition of the liquid and thus its surface tension are altered and become spatially nonuniform . as a consequence , so - called solutocapillary marangoni flows are induced that redistribute the liquid film . we demonstrate that measuring the liquid deformation is a sensitive means of monitoring minute composition changes . we developed a numerical model that quantitatively reproduces the morphological and dynamical features observed in the experiments . moreover , we determined self - similar solutions that illustrate the mechanisms governing different stages of the dynamics and their parametric dependence . ( a ) deep - uv radiation from a deuterium lamp is partially blocked by a metal mask and partially transmitted to an aliphatic liquid hydrocarbon film . because of photochemical reactions , the surface tension increases , which induces flow toward the illuminated regions and the formation of a film thickness maximum underneath the unmasked areas . ( b ) example of thin liquid film deformation induced by deep - uv irradiation through a rectangular aperture of dimensions 0.9 10 mm ( indicated by the red dashed line ) . the light and dark optical interference fringes allow monitoring of the film thickness distribution . we deposited a thin liquid film of the essentially nonvolatile liquid squalane ( purity 99% , aldrich , product number 234311 ) onto flat and rigid substrates using spin - coating ( brewer scientific , model cee200 ) . the initial film thickness was varied in the range from 2 to 5 m . the substrates consisted of sapphire wafers ( precision micro - optics , product number pwsp-113112 ) of thickness dsub = 430 m and diameter 5 cm . sapphire is optically transparent and exhibits a high thermal conductivity of k 25 w/(mk ) , which helps to suppress the potential occurrence of temperature gradients that might mask the effects of concentration gradients . the viscosity of squalane at 23 c is liq = 31.9 mpa s , the surface tension is = 28.15 mn / m , the density is = 805 kg / m , and the refractive index is nd = 1.452 . the self - diffusion coefficient of squalane is ds 3 10 m / s . deep - uv irradiation was performed with a 30 w deuterium lamp ( newport , model number 63163 ) . the effective source diameter is approximately 0.5 mm and is located approximately 20 mm above the squalane film . the exit window is made from synthetic quartz in order to minimize the absorption of deep - uv radiation . the lamp output does not exhibit any significant start - up effects for illumination times of less than 1 min . a steady - state value of the intensity is reached within 0.25 s of switching it on , after which the intensity remains constant to within 2% . the experiments were performed in either an air environment or a chamber flushed with either dry nitrogen or ar gas . the aperture consisted of a rectangular slit approximately 1 mm wide and 10 mm long in a 2-mm - thick al plate . the separation between the underside of the al plate and the squalane film was approximately 0.5 mm . the effective path length of the deep - uv light from the exit window of the lamp to the surface of the squalane film was approximately 7.5 mm . the illumination time tuv was varied between 10 and 60 s. a video of a typical experiment is part of the supporting information . for live visualization of the time evolution of the liquid height profile h(x , y , t ) during and after uv exposure , we used optical interferometry in a transmission geometry . a high - speed camera ( photron sa-4 ) fitted with protective optical filters , a lens system , and a microscope objective ( leitz wetzlar npl 5 , na = 0.09 ) was mounted underneath the substrate . because the camera was blinded by the broadband illumination , we introduced a chopper ( thorlabs , model number mc2000 ) with its blade ( thorlabs , model number mc1f2 ) rotating at a frequency of 2 rps . when the illumination was blocked by the blade , interferometry images were recorded using an led light source ( roithner , center wavelength = 625 nm ) . the height difference represented by two consecutive constructive or destructive interference fringes corresponds to hint = /(2nd ) 215 nm . the total film thickness modulation is then determined by evaluating the number of interference fringes between the maximum and minimum positions indicated by the solid lines in figure 1b and multiplication by hint . interferometry using a single wavelength allows only the determination of changes in film thickness , not absolute values . therefore , we measured the initial film thickness h0 using a home - built spectral reflectance system comprising a spectrometer ( ocean optics , model usb4000 ) and a tungsten - halogen broadband light source ( ocean optics , model ls-1-ll ) . it is likely that a number of different chemical species result from the reaction . in the following text , however , we account for the photogenerated species by means of a single concentration variable c and assume that surface tension has a linear dependence1with a constant coefficient of /c > 0 . this is typically a realistic assumption for nonaqueous systems as long as the total photochemical conversion is low . furthermore , we assume that the photoreaction leads to an increase in the photoproduct concentration at a constant rate proportional to the local light intensity . this may occur at the liquid air interface , z = h , if the absorption depth is small , h0 , or homogeneously throughout the thickness of the thin liquid film if h0 . here , the time scale of the experiments typically ranges from 10 to 600 s , which by far exceeds the diffusive time scale s. consequently , in both cases the concentration distribution can be assumed to be vertically equilibrated . thus , we need to consider only the height - averaged concentration defined as2which depends only on the lateral coordinates x and y. the flow of thin , nonvolatile liquid films is governed by the so - called lubrication equation3where4are the volumetric flow rates,5are the marangoni stresses along the x and y directions and6is the augmented pressure , representing capillary and hydrostatic pressure contributions . here , g = 9.81 m / s is the gravitational acceleration . the terms containing x and y represent marangoni fluxes in response to surface tension gradients , which are caused by gradients in concentration c of the photoproducts owing to eq 1 . generally , the direction of marangoni flow in thin liquid films is from regions of lower toward regions of higher surface tension . the nonuniform species distribution that sets up the surface tension gradients , however , changes continuously because of diffusion and convection . therefore , eq 3 is coupled to a convection diffusion - reaction equation that governs the dynamics of c(x , y , t)7the term rreact(x , y , t ) is the height - integrated photochemical conversion rate with units of length concentration / time . we distinguish two different cases : surface - dominated and bulk - dominated reactions . in the case of a bulk - dominated reaction , we set rreact = hjbulki(x , y , t ) , where the factor h stems from the height integration . here , jbulk is a constant and i(x , y , t ) is the scaled uv intensity distribution on the substrate . this implicitly requires the film to be optically thin ( h0 1 ) . in the case of a surface - dominated reaction , the conversion occurs only in a thin layer adjacent to the liquid gas interface . the integration of the reaction rate across the film thickness is therefore independent of h , and we set rreact = jsurfi(x , y , t ) , where jsurf is assumed to be constant . this includes the cases of optically thick films ( h0 1 ) and reactions that are truly interface - driven . in both cases , we assume the reaction rate to be proportional to the light intensity , which is known as the bunsen roscoe law of reciprocity , which holds for many systems . by approximation , the reactant and photoproduct concentrations do not enter into rreact because at low conversion the former essentially remains constant and the latter remains very small . the parameters jbulk and jsurf contain the intrinsic rate constant of the photochemical reaction . we note that these expressions for rreact with constant parameters jbulk and jsurf are valid only for conversions far below 100% , which is appropriate for our experiments . the shape function i(x , y , t ) of the uv intensity distribution depends on the beam profile as well as the aperture shape . we assume that it is time - independent during the illumination period of 0 t tuv and zero afterward . this means that in the model we neglect the presence of the chopper in the illumination system . given that the effective illumination frequency is 4 hz and the time scale of typical experiments by far exceeds 1 s , such a time - averaging procedure is permissible ( supporting information ) . we approximated the shape function as8where denotes a smoothed heaviside function , wx and wy are the aperture widths in the x and y directions , and t = 1 ms . we solved the set of eqs 37 numerically using the finite element software comsol 3.5a . the dimensions of the computational domain ( 0 x lx , 0 y ly ) are typically 10 times the aperture width . the boundary conditions were chosen as9at x = 0 and x = lx and10at y = 0 and y = ly , all of which represent mirror symmetries . the boundaries at x = lx and y = ly are sufficiently remote from the aperture such that the surface deformation does not reach it within the typical duration of an experiment . the initial conditions are a film of uniform thickness h(x , y , t = 0 ) = h0 and a uniform photoproduct concentration c(x , y , t = 0 ) = 0 . figure 2a shows a typical intensity profile i(x ) corresponding to an infinitely long and 1-mm - wide aperture , i.e. , for wy and wx = 1 mm . figure 2b shows the corresponding film thickness profiles at different times after commencing deep - uv irradiation . the initially flat film develops two dimples just outside and two local maxima just inside the illuminated region . as time progresses , the dimples deepen and the maxima grow . at t 80 s , the two maxima coalesce into a single maximum located at x = 0 . figure 2b also contains the definitions of various parameters that quantify the film thickness modulation : the maximum film thickness increase hmax max[h ] h0 , the maximum film thickness reduction hmin h0 min[h ] , the total film thickness modulation htot |hmax| + |hmin| , and the peak - to - peak film thickness modulation hpp . ( a ) intensity distribution i(x ) for wx = 1 mm and w = 0.2 mm . ( b ) numerical simulations of film thickness profiles h(x , t ) at different times t = 0 , 20 , 50 , 80 , 120 , and 325 s for parameters h0 = 3 m , wx = 1 mm , wy = , w = 0.2 mm , tuv = 60 s , d = 5 10 m / s , and jbulk(/c ) = 6 10 n/(m s ) . ( c , d ) numerical simulations of the maximum film thickness increase hmax(t ) max[h ] h0 as a function of time for the same parameters as in panel b. panels c and d contain the same data in logarithmic and linear representations , respectively . figure 2c shows numerical simulations of hmax(t ) as a function of time . for t < tuv , we observe to good approximation a power law time dependence of hmax t ( dashed line ) . the coalescence of the two maxima at t 80 s manifests itself in a steeper increase in hmax . at later times , the rate of increase of hmax slows down and a peak is reached , after which hmax slowly decreases . this is primarily due to lateral diffusion , which eventually leads to the disappearance of the concentration gradients that drive marangoni flow . in figure 3 , we present experimental data for the dependence of the total film thickness modulation htot on the exposure time tuv . the film thickness modulation htot was evaluated between the central maximum and one of the minima indicated in figure 1b . a higher value of tuv generally leads to a higher concentration of reaction products and hence to a larger film deformation . the experimental data for tuv = 10 and 20 s are generally very well reproduced by the two - dimensional model calculations , but those for 40 s are slightly overestimated . there is a striking difference between experiments performed in a dry nitrogen environment ( filled circles in figure 3 ) or in an air atmosphere ( open diamonds ) , with the latter case resulting in a much smaller thickness modulation . we have also repeated the experiments in an ar atmosphere and found that the thickness modulation is comparable to the experiments in air . we have also done experiments with the liquid film facing down , i.e. , where the uv light is transmitted through the sapphire substrate before it interacts with squalane . this small difference is most likely due to absorption losses in the substrate and increased reflection losses at its two surfaces . total film thickness modulation htot as a function of time for h0 = 3.6 m and three different values of tuv = 10 , 20 , and 40 s. filled circles correspond to experimental data obtained in a nitrogen atmosphere , and the solid lines correspond to two - dimensional numerical simulations using d = 3 10 m / s , wx = 0.9 mm , wy = 10 mm , w = 0.28 mm , and jsurf(/c ) = 3.6 10 n / s . open diamonds correspond to experimental data obtained in an air atmosphere for tuv = 60 s , and the dotted line corresponds to two - dimensional numerical simulations using d = 3 10 m / s , wx = 0.9 mm , wy = 10 mm , w = 0.28 mm , and jsurf(/c ) = 1.2 10 n / s . in figure 4 , we present experimental data for the separation of the film thickness minima xmin as a function of time . for larger values of h0 and shorter values of tuv , xmin tends to increase in time , whereas it decreases for thin films and longer irradiation times . the reason for the narrowing in the latter case is that marangoni stresses are then strong enough to further contract the film thickness maximum against opposing capillary pressure gradients . for sufficiently long times , lateral diffusion removes concentration gradients and xmin increases as a result of capillary pressure relaxation . the solid lines correspond to numerical 2d simulations using the surface - dominated reaction model , which reproduce the experimental data quite well . separation of the film thickness minima xmin as a function of time for three different values of h0 = 2.3 , 3.6 , and 4.8 m and of tuv = 10 , 20 , or 40 s. symbols correspond to experimental data obtained in a nitrogen atmosphere , and the solid lines correspond to two - dimensional numerical simulations using the surface - dominated reaction model and parameter values d = 3 10 m / s , wx = 0.9 mm , wy = 10 mm , w = 0.28 mm , and jsurf(/c ) = 3.6 10 n / s . experimental data for the dependence of the deformation amplitude on the initial film thickness are depicted in figure 5a . numerical data for the film thickness modulation as a function of h0 evaluated at fixed times are plotted in figure 5b , c on the basis of the surface- and bulk - dominated reaction models , respectively . , a greater film thickness translates to a higher mobility of the liquid and thus less resistance to deformation , thereby promoting an increase in modulation . moreover , for bulk - dominated reactions , a greater film thickness implies a larger quantity of reaction products in the irradiated region . thus , we expect that a larger value of h0 thus tends to amplify the deformation amplitude . this expectation is confirmed in figure 5c , where hmax increases monotonically with h0 . the wiggles are due to the coalescence phenomenon discussed in the context of figure 2b , c , which occurs at later times for thinner films . the dotted line in figure 5c corresponds to a power law of hmax h02/3 . ( a ) peak - to - peak film thickness modulation hpp as a function of time for tuv = 10 s and h0 = 2.3 , 3.6 , and 4.8 m . symbols represent experimental data obtained in a nitrogen atmosphere , and solid lines represent 2d numerical simulations using the same parameters as in figure 4 . ( b , c ) one - dimensional simulations of the film thickness modulation as a function of h0 for surface- ( b ) and bulk - dominated ( c ) reactions . the parameters that were not varied in panel b were wx = 1 mm , wy = , w = 0.4 mm , tuv = 60 s , d = 3 10 m / s , and jsurf(/c ) = 1.8 10 n / s . the parameters that were not varied in panel c were wx = 1 mm , wy = , w = 0.2 mm , tuv = 60 s , d = 5 10 m / s , and jbulk(/c ) = 6 10 n/(m s ) . on the other hand , in the context of the surface - dominated model , the photochemical reaction occurs only in a surface layer much thinner than h0 , and the liquid underneath it serves only to dilute the reaction products . in this case , we expect a higher value of h0 to reduce the effective concentration and contribute to a decrease in hmax . this behavior is observed in figure 5b for initial film thicknesses above approximately 3 m . for h0 3 m , the marangoni stresses are so strong that the film thins almost completely , i.e. , |hmin| approaches its maximum possible value h0 . dotted line in figure 5b corresponds to a power law of htot h01/2 . the solid lines in figure 5a corresponding to 2d simulations according to the surface - dominated reaction model reproduce the experimental data well . we conclude that the surface - dominated model is relevant to our experimental system of squalane irradiated by a deuterium lamp . this could mean that the penetration depth of the photoactive wavelengths is much smaller than h0 or that the reaction is governed by processes primarily occurring at the interface , after which the reaction products diffuse into the bulk . figure 6a c illustrates the sensitivity of the main experimental observable hmax(t ) with respect to variations in three key parameters : the photochemically induced rate of change of surface tension jbulk(/c ) , the diffusion coefficient d , and the aperture width wx . a larger surface tension increase will lead to a higher marangoni flow and thus a higher film thickness increase . the dashed line in figure 6a corresponds to a proportionality relation hmax jbulk(/c ) , whereas the dotted line corresponds to the power law hmax [ jbulk(/c ) ] . ( a ) numerical simulations of hmax as a function of the rate of increase of surface tension jbulk(/c ) at different times t = 20 , 40 , 80 , 130 , 300 , and 1000 s. ( b ) hmax as a function of the diffusion coefficient d at different times t = 20 , 40 , 80 , 130 , and 1000 s. the dashed vertical line indicates the self - diffusion coefficient of squalane . ( c ) hmax as a function of aperture width wx at different times t = 20 , 40 , 80 , 130 , 300 , and 1000 s. the parameters that were not varied in panel a c were h0 = 3 m , wx = 1 mm , wy = , w = 0.2 mm , tuv = 60 s , d = 5 10 m / s , and jbulk(/c ) = 6 10 n/(m s ) . the bulk - dominated reaction model was used . a larger diffusion coefficient leads to a faster broadening of the concentration profile , which reduces the marangoni stress and tends to decrease hmax . the effect of d on hmax depicted in figure 6b is relatively weak , especially for short times t 100 s and small values of d 5 10 m/s . the diffusion coefficient becomes more important for times t comparable to the diffusive time scale wx2/d 2 10s . a larger value of wx leads to a longer coalescence time tcoa of the initially separate film thickness maxima ( about 80 s in figure 2b ) . this implies that for a fixed instance of time t tcoa , the local height profile near the perimeter of the aperture essentially corresponds to that of an infinitely wide aperture . thus , hmax becomes independent of wx in figure 6c for sufficiently large wx . for very small values of wx , the overall quantity of photogenerated species decreases , leading to a decrease in hmax with decreasing wx . the dashed dotted line in figure 6c corresponds to the power law relation hmax wx1/2 . there is little qualitative difference between the two reaction models as far as the dependencies on /c , d , and wx are concerned . data analogous to that presented in figure 6a c but obtained with the surface - dominated model are presented as part of the supporting information . to elucidate the dominant mechanisms that govern different stages of the redistribution process , we derived self - similar solutions of the governing equations ( eqs 3 and 7 ) . a finite value of the aperture width wx constitutes an imposed length scale , which leads to the coalescence phenomenon discussed in the context of figure 2b and precludes self - similar behavior . therefore , we consider here the local dynamics at the perimeter of very wide ( i.e. , semi - infinite ) apertures . although we can eliminate wx from the problem in this fashion , we do have the other ( imposed ) length scale w to consider . consequently , we can identify only self - similar solutions that are restricted in their validity to certain time intervals , when the solution is either no longer or not yet affected by the value of w . we assume that locally11holds and first consider shallow transitions , i.e. , large values of w . in this case , the concentration gradients are small , and species redistribution due to both marangoni convection and diffusion in eq 7 can be neglected compared to the photochemical production . thus , for the bulk - dominated reaction model , one expects c to increase linearly in time with a rate equal to jbulk12figure 7a compares the prediction of eq 12 with full numerical solutions of c c/(jbulkt ) as a function of x/w for 1 10 t 4 10 s , i.e. , more than 4 orders of magnitude in time . the curves indeed all collapse , indicating that eq 12 is an excellent approximation . consequently , the surface tension gradient can be written in the form13for large values of w , flow due to capillary pressure gradients can be neglected compared to marangoni flow in the illuminated region . moreover , for the initially small deformation amplitudes h h h0 , flow due to hydrostatic pressure gradients can also be neglected . in this case , eq 3 becomes separable and the ansatz yields14 in the limit of h h0 . this solution is represented by the black solid line in figure 7b , which is an excellent approximation to the full numerical solution of the full equations ( eqs 3 and 7 ) . ( a ) comparison of eq 12 ( red solid line ) with corresponding numerical solutions of the full nonlinear equations ( eqs 3 and 7 ) ( blue symbols ) for times 10 t 40 s. for the latter , the relevant parameter values were h0 = 3 m , w = 2 mm , tuv = 600 s , d = 5 10 m / s , and jbulk(/c ) = 6 10 n/(m s ) . ( b ) film thickness modulation hmax(t ) for two examples of a very shallow ( w = 2 mm , tuv = 600 s , d = 5 10 m/s ) and a very abrupt ( w = 2 m , tuv = 10 s , d = 5 10 m/s ) transition . the other parameter values were h0 = 3 m and jbulk(/c ) = 6 10 n/(m s ) . ( c ) self - similar solution of eq 17 ( solid line ) as well as corresponding numerical solutions ( symbols ) of the full nonlinear equations ( eqs 3 and 7 ) for times 0.01 t 10 s. for the latter , the relevant parameter values were h0 = 3 m , w = 2 m , tuv = 60 s , d = 5 10 m / s , and jbulk(/c ) = 6 10 n/(m s ) . ( d ) self - similar solutions on ( = 1 , solid line ) and off ( = 0 , dashed line ) of eq a5 as well as corresponding numerical solutions ( symbols ) of the full nonlinear equations ( eqs 3 and 7 ) for times 10 t 10 s ( green circles ) and 40 t 1000 s ( red squares ) , respectively . for the latter , the relevant parameter values were h0 = 3 m , w = 2 m , tuv = 10 s , d = 5 10 m / s , and jbulk(/c ) = 6 10 n/(m s ) . for a sharp transition in the reaction rate , i.e. , for small values of w , the pressure - driven flow is locked onto the marangoni flow because of the phenomenon of capillary choking ( appendix a ) . , quadratically with time t. consequently , both convective terms are negligible compared to the diffusive term scaling as djbulkt/(w ) , i.e. , linearly with t , at early times . this corresponds to the limit of a large convective damkhler number and a diffusive damkhler number of order 1 . thus , in the limit of h h0 or equivalently h h0 , the 1d reaction convection diffusion equation can be simplified to16for an abrupt transition , the intensity distribution i(x ) and thus the reaction rate term are scale - invariant , i.e. , i(x ) = i(kx ) , for arbitrary positive numbers k. introducing the reduced concentration c c/(jbulkt ) allows us to derive ( appendix a ) the following ordinary differential equation ( ode ) in the self - similar coordinate x/(dt)17the corresponding self - similar solution for c( ) is plotted as the solid line in figure 7c alongside numerical solutions of the full set of equations ( eqs 3 and 7 ) for three decades in time 0.01 t 10 s ( symbols ) . next , we determine a similarity solution for the evolution of the height profile h(x , t ) . a small value of w implies that initially the marangoni stress driving the film deformation is present only in an exceedingly narrow interval , outside of which the only driving force is given by capillary pressure gradients . consequently , at the borders of this interval , a flux continuity condition must hold , which provides the above - mentioned linkage between capillary and marangoni fluxes . if we set x at (x ) and seek a self - similar solution in the variable ( ) h/(dt ) , where x/(et ) is the self - similarity coordinate , then its validity in the region outside the narrow interval implies the capillary scaling = 1/4 . here , d and e are constants that render and dimensionless . we refer the reader to appendix a. the self - similar solution for c tc( ) is decoupled from h(x , t ) because at early times convective mass fluxes can be neglected compared to the reactive and diffusive contributions . consequently , the effective concentration difference between illuminated and unilluminated regions scales as c ( t tuv ) t or c ( t > tuv ) = const t before and after switching off the uv light , respectively . if the width of the transition zone of the concentration distribution can be considered to be an exceedingly narrow interval despite its diffusive broadening ( as far as the flow field is concerned ) , then the exponents in the relation x = at(x ) have values of on = 1 and off = 0 . the dashed and dotted lines figure 7b correspond to power law relations h t and h t , respectively , which reproduce the behavior of the full numerical solutions ( symbols ) very well . also , the time exponent of 1.57 in figure 2c is close to 3/2 , and the origin of the deviation is that w = 0.2 mm is not sufficiently abrupt . we have also compared the full numerical solutions of eqs 3 and 7 for w = 2 m depicted in figure 7b with the self - similar height profiles ( ) determined from solving eq a5 . the solid line in figure 7d represents on , i.e. , the on stage ( = 3/2 ) , which is an excellent approximation to the numerical data ( symbols ) for 5 decades in time 10 t 10 s. the dashed line represents off , i.e. , the off stage ( = 1/2 ) , which approximates the amplitude and shape of the numerical data ( symbols ) very well for 40 t 1000 s. we inverted the sign of off merely to avoid excessive overlap between the curves . the apparent lateral shift between off and the numerical data is caused by the progressive convection of the concentration distribution , which eq a5 does not account for . finally , we note that in the limit of small deformations the self - similar solutions derived above are equally relevant to the surface- and bulk - dominated reaction models because the structure of eq 7 is identical in the limit of h h0 . deep uv irradiation in an air environment can lead to ozone formation and the partial oxidation of hydrocarbon surfaces as exploited technologically for surface cleaning . thus , our initial expectation was that ozone generation and the subsequent oxidation of squalane are likely candidates for the dominant reaction pathway . in striking contrast , the experimental results obtained in air and nitrogen atmospheres shown in figure 3 indicate that oxygen plays more the role of an inhibitor rather than a promotor of the reaction . state that the presence of oxygen may become a rate - limiting factor because of its reactivity with short - lived hydrogen and carbon radicals . generally , photochemical reactions are complex and require sophisticated experimental instrumentation for the elucidation of reaction mechanisms , rates , and product distributions . yang et al . studied the photolysis of liquid cyclohexane at 147 nm , with the primary product being cyclohexene . they concluded that the presence of benzene caused a drastic reduction in the rate of cyclohexane decomposition due to the scavenging of hydrogen atoms . holroyd determined the principal primary process at 147 nm in n - pentane to be h2 elimination and the formation of hydrogen atoms and pentyl radicals . nurmukhametov et al . exposed polystyrene films and solutions to 248 nm radiation and concluded that the uv - induced reaction includes the dehydrogenation of the molecular chain and the subsequent formation of polyconjugated polyene chains . developed and validated a kinetic model for methane ice photochemistry upon irradiation with uv light in the 120200 nm wavelength range . consistent with this hypothesis , birdi found that the surface tension values of n - alkenes are systematically higher than those of corresponding n - alkanes by approximately 0.51% . one possible conclusion from figure 5a was that squalane is an optically thick material for deep - uv radiation . moreover , we mentioned that the measured thickness modulation is comparable for the liquid film facing up or facing down . this may suggest that the crucial requirement for the reaction is not so much the presence or absence of ambient gases but rather the presence or absence of dissolved gases in the liquid . given the small liquid film thickness , the diffusion of gases into squalane after spin - coating requires less than 1 s , which is much shorter than the time required for mounting the sample . the experimentally adjustable parameters of this technique are the initial film thickness h0 , the aperture size wx , and the illumination time tuv . the extractable parameters are the surface tension change = 0 and the diffusion coefficient d. our experiments were restricted to a constant aperture width wx 1 mm , which implied that they had a low sensitivity toward variations in d. according to our simulations , however , which are well validated by the gathered experimental data , we expect that smaller slit widths allow more conclusive information regarding the value of d. the achievable time resolution is determined by how quickly a measurable grayscale modulation is observed in the interferometry images . on the basis of the numerical results and a required minimum thickness modulation htot 50 nm , we estimate that a time resolution of several seconds is feasible for the relatively weak surface tension changes occurring in squalane . we have specifically selected squalane in order to demonstrate that relatively subtle chemical composition changes can be detected conveniently . according to eq 14 , the response time will be faster for more intense irradiation , e.g. , by using laser sources , for reactions that exhibit higher conversion rates or more surface - active reaction products , for thicker films , lower viscosities , and smaller values of w . we note that the oblong geometry of the aperture ( wx = 1 mm wy = 10 mm < ) enhances the sensitivity of the method compared to a 1d geometry ( wy ) by up to approximately 30% for wx 1 mm because the end effect increases the height of the maximum . the maximum is free to stretch along the y direction , thereby minimizing reductions of hmax induced by capillary confinement . by comparison , for a square aperture ( wx = wy = 1 mm ) , the enhancement compared to the 1d geometry is only a few percent for typical parameter values . we note further that in the dilute regime considered in this article the method is sensitive only to products jbulk(/c ) and jsurf(/c ) but not independently to jsurf and /c . this is a consequence of the fact that the concentration of the reaction product scales with the production rate constants jbulk and jsurf . the lubrication equation is coupled to the concentration field via the marangoni stresses , e.g. , which thus depend only on the above - mentioned products . consequently , the height profile h and fluxes qx and qy , which enter into eq 7 , depend only on products jbulk(/c ) and jsurf(/c ) . the same , therefore , holds for the peclet number inherent in eq 7 . we have studied broadband deep - uv irradiation of thin liquid films of the aliphatic hydrocarbon squalane through a slit aperture . this served as a model system for monitoring photochemical reactions based on the interferometric detection of film thickness deformations . the mechanism driving material redistribution is solutocapillary marangoni flow as a consequence of surface tension changes induced by the reaction products . because of the differential nature of marangoni flows , surface tension changes of as small as = 10 n / m can be detected , and time resolutions below 1 s can be achieved . interestingly , experiments performed in a nitrogen atmosphere resulted in a significantly stronger film deformation than experiments performed in either air or ar environments . we also developed a model of the photochemical reaction and the convection and diffusion of the reaction products . although the model takes into account only a single photoproduct species , it reproduces the experimental results almost quantitatively , if we assume that the reaction occurs primarily in a region close to the liquid surface that is much smaller than the film thickness . the main output parameter of the numerical simulations is the product of the reaction rate and the rate of change of surface tension with the photoproduct concentration . by using narrower aperture widths , information on the diffusion coefficient of the photoproduct species could also be gathered . besides performing numerical simulations , we also derived and numerically validated self - similar solutions of the governing equations for the concentration and the height profiles , which characterize the early time response .

the brain is particularly susceptible to oxidative stress due to its high rate of oxygen consumption , its high proportion of polyunsaturated fatty acids and its low levels of antioxidant defense enzymes . consequently , the brain is a first - class target in situations in which free radicals are implicated such as ageing , neurodegenerative diseases , and xenobiotic metabolism . this organ is thus a major target for ethanol , and its consumption has long been associated with severe damage . the adverse effect of ethanol on different functions of the central nervous system has been well documented . numerous experimental studies and necropsy examinations have shown a wide range of structural and functional alterations in neurons as well as in astrocytes . astrocytes were chosen as a model for cerebral intoxication because their deleterious implication has considerable potential consequences . besides providing nutrients and neurotrophic factors to neurons , these cells are immune - active and actively participate in host defense mechanisms [ 2 , 3 ] . in addition , specific enzyme systems allow astrocytes to metabolize xenobiotics , free radicals , and metals , thus protecting the brain from the toxicity of these agents [ 4 , 5 ] . the advantage of primary cultures lies in their closer resemblance to cells found in vivo . the drawbacks of this choice are their limited survival time and the continual need to prepare new cells in culture . this can explain why very few reports are found in the literature on this subject . there is strong evidence showing that chronic or excessive ethanol consumption enhances oxidative damage to brain . this is due to the ability of ethanol to increase oxidative stress , leading to enhanced production of oxidative species including reactive oxygen species ( ros ) and in the formation of lipid peroxidation products [ 6 , 7 ] . using the spin - trapping technique , we previously detected hydroxyethyl - free radical formation following ethanol exposure of various biological systems such as rat liver or brain microsomes and primary culture of rat astrocytes or c6 glioma cell line . ros are produced during normal cell metabolism as well as after exposure to various xenobiotics including alcohol . although gsh and various antioxidant enzymes ( sod , gpx , catalase , etc . ) prevent cells from attack by these ros , massive or chronic exposure to a toxic substance may induce an oxidant / antioxidant imbalance , leading to cellular oxidative damage . the literature has reported that antioxidant micronutrients such as vitamin c , vitamin e , and -carotene in fruits and vegetables contribute in part to protecting cells against the damaging effects of ros . 3,5,4-trihydroxy - trans - stilbene , so called resveratrol , is a naturally occurring stilbene found in the skin of red grapes and certain medicinal plants , where it is believed to provide protection against various infections and stresses . in addition , this red wine constituent may be implicated in the so - called french paradox , a phenomenon relating the low incidence of coronary heart disease in southern france despite a high dietary intake of saturated fats . numerous beneficial health effects have been reported such as anticancer , antiviral , antiinflammatory , antiageing and neuroprotective effects [ 1215 ] . indeed , neuroprotective effects have been related in cerebral ischemia models as well as in neurodegenerative diseases such as alzheimer 's disease , huntington 's disease , and parkinson 's disease [ 16 , 17 ] . moreover , most of the protective biological actions associated with resveratrol have been related to its intrinsic radical scavenger properties [ 1821 ] . de almeida et al . demonstrated the protective effect of resveratrol against acute h2o2-induced oxidative stress in astrocyte cultures . since a free radical pathway is implicated in the cellular damage observed after ethanol exposure , we studied resveratrol pretreatment of astrocytes because this antioxidant might be able to promote the survival of brain cells exposed to ethanol stress . the aim of this study was to evaluate the ability of resveratrol to protect primary culture of rat astrocytes against ethanol - induced cellular damage in a single model of long - term exposed cells through in vitro experiments . animal care and use and all procedures involving animals were carried out in accordance with french national regulations . the primary astrocyte cultures were prepared aseptically from cerebral hemispheres of 1- or 2-day - old pups , according to previously described methods with a few modifications . the dissociated cells were plated either in poly - l - lysine - coated 35-mm - diameter petri dishes or in 75 cm plastic flasks at a density of 500 000 viable cells / ml in the usual d - mem medium containing 10% fcs , 100 u / ml penicillin , 0.1 mg / ml streptomycin , and 2.5 g / ml amphotericin b. the cultures were maintained at 37c in a 5% co2-humidified atmosphere . after 12 days in vitro ( div ) , the monolayers were confluent and composed of 95% astrocytes , as demonstrated by positive immunostaining with antiserum to -gfap , an astrocyte marker . for confocal microscopy experiments , ten days after plating , cells in flasks were trypsinized and reseeded in the same medium at a density of 250 000 viable cells / ml , onto poly - l - lysine - coated 40-mm diameter glass coverslips . cells were used 48 hours after seeding when culture reached 8090% confluence . all experiments were conducted in culture medium and in an air / co2 incubator between 12 and 15 days in vitro . trans - resveratrol was purchased from sigma - aldrich chemical ( saint louis , mo , usa ) . two 100-mm solutions of trans - resveratrol were prepared in h2o / dmso ( 50/50 ) . one aliquot was kept in the dark and the other placed to laboratory light , in order to induce the trans - cis isomerization . finally , samples were analyzed by gas chromatography coupled to mass spectrometry ( gc / ms ) . trans - resveratrol was dissolved in h2o / dmso ( 50/50 ) so as to obtain a 100-mm stock solution which was filtered , then aliquoted and stored at 20c until use . just before the beginning of experiments , the trans - cis isomerization was realized by exposing an aliquot to laboratory light . different intermediate dilutions of these two isomers were then prepared in the same mixture in order to preserve the same final h2o / dmso / culture medium ratio for each resveratrol concentration tested . cells were preincubated for 1 hour in the culture medium containing various concentrations of cis- or trans - resveratrol ranging from 0.1 to 100 m . then , medium was replaced by a new one containing the same resveratrol concentration and 20 mm ethanol for three days . , we used a previously described compensating system , which provided a constant concentration of alcohol in the culture medium for 3 days . the analyses were performed on an agilent technologies 6890n network gc system combined with an agilent technologies 5975 network mass selective detector and an agilent technologies 7683 series injector . the entire process , including data collection , was controlled by the agilent technologies chem station version rev.d.02.00.275 . we injected 2 l of each sample on to a db-5 ms column ( 30 0.25 mm i.d . ; temperature conditions were as follows : initial temperature of 100c for 1 min , increased to 300c at 20c / min , and held for 11 min . the flow of the carrier gas ( helium ) was maintained at 1 ml / min in constant flow mode . electron impact ionization was performed at 70 ev , with an ion source temperature of 230c and mass spectra collected from 40 to 600 m / z . growth medium was replaced by d - mem containing 0.5 mg / ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) . after 2 h of incubation , cell medium was removed and replaced by 1 ml of dimethylsulfoxide to solubilise the precipitated formazan . cell viability was quantified spectrophotometrically at 540 nm , and 100% viability was assigned to the absorbance of control . the mtt assay , measuring the mitochondrial dehydrogenase activity , reflects the metabolic activity of the cells and is a helpful indicator of cell viability . dna damage was evaluated using single cell gel electrophoresis , also called the comet assay . this technique was realized using an electrophoresis power supply ( consort ev265 ) and a submarine horizontal electrophoresis system ( model hu25 ) . this assay was performed either immediately after the stress to evidence damage generated by ethanol or after a 1- or 3-h recovery period with the aim of studying repair mechanisms . therefore , the effects on dna observed in these conditions reflect the initial dna damage in terms of strand breaks and oxidatively damaged bases generating alkali - labile sites in dna . the procedure used was a modification of the protocol described by singh et al . . frosted microscope slides were first covered with 150 l of 1% normal agarose in ca- and mg - free phosphate - buffered saline ( pbs ) and immediately covered with a 22 50 mm coverslip and kept at room temperature to allow the agarose to solidify . approximately 20 000 cells were suspended in 80 l of 0.8% low - melting - point agarose in pbs kept at 37c and transferred onto the first agarose layer . after having been covered with a coverslip , the slides were left on ice for 5 min . then the coverslips were removed and the slides were placed in freshly prepared lysing solution at 4c for 1 h in the dark ( 2.5 m nacl , 100 mm na2edta , 10 mm tris , 1% sodium sarcosinate , ph set to 10 with naoh , supplemented with 10% dmso and 1% after lysis , the slides were gently transferred to a horizontal gel electrophoresis tank filled with freshly prepared electrophoresis solution ( 0.3 m naoh , 1 mm na2edta ) at room temperature in the dark . the dna was allowed to unwind for 20 min , and electrophoresis was carried out by adjusting the voltage to 25 v and the current to 300 ma ( ~0.7 v / cm ) for 15 min . after electrophoresis , the slides were washed gently to remove any alkali and detergents that would interfere with ethidium bromide staining , using neutralisation buffer ( 0.4 m tris - hcl , ph 7.4 ) three times for 5 min . after neutralization , the slides were stained with 50 l of 3.3 g / ml ethidium bromide in distilled water and covered with a coverslip . the slides were placed in a humidified air - tight container , to keep the gel from drying , until analysis . slides were examined using an epifluorescence microscope , zeiss axioskop 20 ( carl zeiss , microscope division , oberkochen , germany ) , equipped with a short arc mercury lamp hbo ( 50 w , 516560 nm , zeiss ) , using a 20x dry objective . fifty randomly selected comets on each triplicate slide were scored with a pulmix tm 765 camera ( kinetic imaging , liverpool , uk ) connected to a komet 3.0 image analysis system ( kinetic imaging ) . this software defined different parameters for image processing . among these parameters , we chose the percentage of dna in the tail for the evaluation of dna damage . apoptotic cell death was assessed by evidencing nuclear morphology alterations . at the end of various cell treatments , growth medium was supplied with 1.6 m hoechst 33258 ( final concentration ) for 15 min at 37c . coverslips were then rinsed twice with pbs , fixed for 15 min with 70% ethanol , and stored at 4c in pbs until analysis . cells were imaged using a confocal laser - scanning microscope leica tcs sp2 aobs ( leica , heidelberg , germany ) . for fluorescence excitation , an uv laser at 351364 images were collected in the 512 512 pixel format and processed by leica confocal software . controls corresponded to astrocytes not exposed to ethanol and grown in culture under the same conditions as those in the experimental series . the kolgomorov - smirnov test was employed to compare the distribution of the percentages of dna in the tail . in the literature , several authors dissolved resveratrol in dmso and did not observe any cytotoxicity with this solvent [ 15 , 20 , 21 , 30 ] . unfortunately , with our experimental conditions , that is , long - term exposure and the fragility of cerebral cells in primary culture , a moderate decrease in cell viability ( 15% ) was observed when astrocytes were exposed to this vehicle . finally , we tested an h2o / dmso ( 50/50 , v / v ) mixture to solubilize resveratrol , as described by olas et al . . in these conditions , the ratio dmso / culture medium was 0.0005% , and no toxicity was detected for astrocytes in primary culture ( data not shown ) . resveratrol was only commercially available as the trans - isomer , the pharmacologically active form of this polyphenol . resveratrol is a photosensitive compound , but only little information was available in the literature concerning precautionary measures against light exposure in order to avoid its cis - trans photoconversion and a possible inactivation of its protective action [ 10 , 32 ] . it has been demonstrated that trans - resveratrol is susceptible to uv - induced isomerization in the cis - form , but only a few authors noted that they worked in darkness [ 10 , 33 , 34 ] . is the cis - form active in protection against ethanol - induced damage ? to answer this question , we induced a trans - cis isomerization of resveratrol by exposing an aliquot to laboratory light . the sample was then analyzed using gc - ms and the chromatogram obtained was compared to the one recorded with an identical aliquot placed in the dark . with our gc / ms analysis conditions , the peak observed for the aliquot placed in the dark has a retention time of 11.87 min ( figure 1(c ) ) whereas , with the light - exposed sample , the peak corresponding to the cis - isomer has a retention time of 10.47 min ( figure 1(a ) ) . to assess the neuroprotection offered by these two isomers , we tested the effects of a pretreatment of astrocytes with cis- or trans - resveratrol on the toxicity induced by a long - term exposure to ethanol ( 20 mm , 3 days ) . no effect was observed when cis - resveratrol was added to cell culture , whatever the concentrations tested ( figure 2(a ) ) , whereas the trans - isoform induced a slight decrease in ethanol toxicity ( figure 2(b ) ) . to determine which doses were most efficient against cellular damage induced by a long - term exposure to ethanol , a wide range of trans - resveratrol concentrations ( from 0.1 to 100 m ) astrocytes were pre- ( 1 h ) and coincubated with these various concentrations of trans - resveratrol in the presence or absence of 20 mm ethanol for 3 days . after exposure , astrocytes were replaced in fresh medium for 24 h to evaluate cell recovery . as previously described and shown in figure 2(b ) , viability of cultured astrocytes exposed to ethanol was significantly reduced by approximately 30% when compared to control without ethanol ( p < 0.001 , mann - whitney u test ) . moreover , no change in viability was observed after the recovery period ( figure 2(b ) ) . treatment of astrocytes with low concentrations of trans - resveratrol ( 0.15 m ) did not induce any change in cell viability when compared to control without trans - resveratrol ( figure 2(b ) ) . while a slight decrease in cell viability was observed with trans - resveratrol 10 m , a loss of viability of 25% was observed with a 50 m treatment ( figure 2(b ) , p < 0.01 mann - whitney u test ) which reached to 70% when astrocytes were treated with trans - resveratrol 100 m ( data not shown ) . no significant toxicity was observed for the lowest concentration of trans - resveratrol tested ( 0.1 m ) , but unfortunately no protection towards ethanol damage was offered at this concentration ( figure 2(b ) ) . moreover , significant protection was provided with 1- to 10-m concentration of trans - resveratrol ( res1 or 5 or 10 + ethanol versus ethanol , p < 0.05 , mann - whitney u test , figure 2(b ) ) . indeed , in presence of ethanol the best protective effect was observed with a 5-m concentration of trans - resveratrol , and this concentration provided the best cell recovery ( figure 2(b ) ) . in conclusion , a dose - dependent protection against ethanol - induced neurotoxicity was offered by trans - resveratrol at concentrations from 0.1 to 5 m . in the same manner , this polyphenol provided dose - dependent cell recovery after 24 h in fresh medium . for concentrations of trans - resveratrol higher than 5 m , protective effects against ethanol - induced toxicity were decreased in a dose - dependent manner . for example , in presence of ethanol , 50 m trans - resveratrol induced a substantial decrease in the viability percentage , which was nearly identical to those observed for ethanol alone , whether immediately after the stress or after a 24-h recovery period ( figure 2(b ) ) . considering results previously obtained with the mtt assay , the protective effects offered by trans - resveratrol against dna damage were only studied for concentrations from 0.1 to 5 m . according to the results of the comet assay , the percentage of dna in the tail was significantly increased after a 3-day exposure to ethanol when compared to control cells without ethanol . the percentage of tail dna in the cells exposed to ethanol was more than twice as high as the control values ( 25.2 versus 9.7 , p < 0.0001 , mann - whitney u test , figure 3 ) . nevertheless , contrary to results observed with the mtt test , the comet assay showed a slight decrease in the dna strand breaks during the recovery periods , when compared to the exposed conditions with no recovery , particularly for the 3 h recovery time where values were significantly different ( 25.2 for cells exposed to ethanol versus 20.0 for cells with a 3 h recovery period , p < 0.05 , mann - whitney u test , figure 3 ) . no genotoxicity was observed when trans - resveratrol was added to culture medium at concentrations ranging from 0.1 to 5 m ( figure 3 ) . in addition , when cells were exposed to ethanol in presence of trans - resveratrol , a significant and dose - dependent decrease in dna damage was observed for the 1-m and 5-m concentrations ( 25.2 for cells exposed to ethanol versus 19.4 for cells exposed to res1 + ethanol , p < 0.05 , and 25.2 for cells exposed to ethanol versus 15.1 for cells exposed to res5 + ethanol , p < 0.001 , mann - whithney u test , figure 3 ) . moreover , replacing cells in fresh medium after the stress enhanced cell recovery when trans - resveratrol was present in the intoxication medium . after a 3 h recovery period , nearly complete recovery was observed for cells pretreated with 1 m and 5 m trans - resveratrol when compared to control ( figure 3 ) . figure 4 showed interesting changes in the distribution of tail dna : in control conditions , more than 85% of cells had tail dna between 0% and 10% ( figure 4(a ) ) , whereas significant modifications in the distribution of tail dna were observed after a 3-day exposure to ethanol ( figure 4(c ) ) , with a progressive distribution towards higher percentages of tail dna ( control versus ethanol , p < 0.0001 , kolgomorov - smirnov test ) . when cells were replaced in fresh medium without ethanol for a 1 or 3 h recovery period , the previously described decrease in dna strand breaks was confirmed . this recovery process was time dependant but incomplete since only 69.1% of cells had tail dna between 0% and 10% after 3 h of recovery ( figure 4(g ) ) compared to 88.2% of cells in control conditions ( ethanol + 3 h recovery versus control , p < 0.0001 , kolgomorov - smirnov test , figure 4(a ) ) . when cells were pretreated with 5 m trans - resveratrol , no toxicity was observed for these astrocytes ( figure 4(b ) ) when compared to control ( figure 4(a ) ) . moreover , there was less dna damage after 3 day exposure to ethanol and in presence of trans - resveratrol ( figure 4(d ) ) since 78.2% of cells had tail dna between 0% and 10% compared to 50.4% for cells exposed to ethanol alone ( res5 + ethanol versus ethanol , p < 0.0001 , kolgomorov - smirnov test , figure 4(c ) ) . in addition , the recovery process was also improved ; after 1h of recovery , 80% of cells had tail dna between 0% and 10% ( figure 4(f ) ) , whereas without trans - resveratrol only 65% of cells had tail dna between 0% and 10% ( figure 4(e ) ) , ( res5 + ethanol + 1 h recovery versus ethanol + 1 h recovery , p < 0.0001 , kolgomorov - smirnov test ) . after 3 h of recovery , it could be considered that the recovery was complete when cells were pretreated with 5 m trans - resveratrol ( 88.2% and 85.3% of cells with tail dna between 0% and 10% , for control ( figure 4(a ) ) and res5 + ethanol + 3 h recovery ( figure 4(h ) ) , respectively . indeed the histograms of distribution are not only not statistically different , but also nearly identical for these two conditions . in contrast to regular , blue nuclei observed in viable astrocytes of the control group ( figure 5(a ) ) , nuclei with membrane blebbings , irregular shapes , and apoptotic bodies were evidenced in cells exposed to 20 mm ethanol for 3 days ( figure 5(c ) ) . these deleterious effects lasted after the recovery period since blebs of the nuclear membranes were always detectable ( figure 5(e ) ) . astrocytes pretreatment with 5 m trans - resveratrol did not induce any toxicity ( figure 5(b ) ) . moreover , the treatment with this trans - resveratrol concentration decreased damaged nuclei induced by ethanol , particularly after the recovery period where no abnormal nuclear morphology was evidenced ( figures 5(d ) and 5(f ) , resp . ) . normal cell metabolism results in a continuous generation of reactive oxygen species ( ros ) that is strictly controlled by antioxidant mechanisms . however , in some circumstances , oxidative stress can occur as a result of increased exposure to normal metabolites of oxidative metabolism . this can happen when ros production is stimulated by the metabolism of certain toxicants and/or when the production or the bioavailability of antioxidants is affected by such agents . consequently , the physiological balance between oxidants and antioxidants can be directly or indirectly modified by a toxicant . among these toxicants , ethanol is known to produce free radicals during its metabolism [ 4 , 9 , 35 ] . particularly , chronic exposure to ethanol is known to induce cellular and nuclear damage in cerebral cells , mediated by a free radical pathway [ 5 , 6 , 36 , 37 ] . the role of polyphenol obtained from diet in protection against oxidative stress is a topic of continuing interest and some controversy . several in vivo and in vitro studies have reported measurable concentrations of trans - resveratrol after administration to animals or exposure to cells . for instance , bertelli et al . showed that single or prolonged administration to rats of red wine with a known trans - resveratrol content led to its accumulation in blood and various organs . in addition , vitrac et al . demonstrated that c - labeled trans - resveratrol is absorbed , metabolized and distributed in the whole body of mice orally treated with this polyphenol . moreover , because of its high lipid solubility , resveratrol might be deposited in tissues with high lipid content such as brain and the nervous system , making this polyphenol a first - class compound for neuroprotective studies . resveratrol transport from plasma to intracellular targets seems to involve both passive diffusion and a carrier - mediated process [ 41 , 42 ] . . described useful protection offered in vivo by a large range of resveratrol concentrations against genotoxicity induced by acute and chronic ethanol exposure . on the contrary , several authors pointed the importance of resveratrol concentrations towards cellular protection . thus , they described a neuroprotective effect for low concentrations of resveratrol when high doses of this polyphenol induced cell toxicity [ 4446 ] . recently , quincozes - santos et al . evidenced that the nature of the stress could be more important than the resveratrol concentration . they demonstrated that under intense but short oxidative conditions resveratrol was able to protect c6 glioma cells against h2o2 insult while under less intense but lasting oxidative insult , resveratrol had an opposite effect , potentiating the h2o2-induced damage and resulting in a prooxidant effect . in this study , brain protection offered by trans - resveratrol , against ethanol - induced toxicity , was investigated . in order to avoid its photoisomerization leading to an inactive isomer ( figure 2(a ) ) , trans - resveratrol has to be carefully kept in the dark throughout the experiments , from sample preparation to cell treatment . large variations in experimental systems such as cellular models , resveratrol concentrations , incubation durations , and so forth could explain these differences . therefore , it seems important to test a large range of resveratrol concentrations to define the optimal concentration offering cellular protection with our own experimental system . the concentrations used for evidencing the protective effects of resveratrol against cellular damage induced by ethanol have been the subject of preliminary investigations . in our experimental conditions , treatment of astrocytes for 3 days with low concentrations of resveratrol ( from 0.1 to 10 m ) did not induce any change in viability , whereas a toxic effect was observed when the highest concentrations of resveratrol ( 50 and 100 m ) were added to cells , characterized by a dose - dependent cell mortality rate higher than 30% . these results are in accordance with those reported by quincozes - santos et al . . as previously described , a chronic exposure of astrocytes to ethanol led to a significant loss of viability , as evidenced by the mtt assay . moreover , when cells were replaced in fresh medium for a 24 h poststress period , no recovery was observed . these results revealed durable alterations in the normal functioning of astrocytes , particularly for the respiratory and energetic process measured by the mtt assay . the protection offered by trans - resveratrol against ethanol cytotoxicity was dose - dependent and only observed for the lowest concentrations , but the most valuable result concerned the effect of this polyphenol on the recovery of astrocytes ; cell recovery was dose dependent and complete for 5 m resveratrol . the potential genotoxicity of long - term ethanol administration to astrocytes was investigated using comet assay . this method provides fast results and requires only a few cells , so it seems suitable for analysis in primary culture , which requires continual new preparations . the percentage of tail dna was increased 2.5-fold after long - term exposure to ethanol . moreover , after a 1 or 3 h recovery period in fresh medium , these dna strand breaks were only partially self - repaired . in addition , it is generally considered that dna damage caused by chemicals increased the risk of mutation and cancer , even though the dna damage may be self - repaired . when astrocytes were exposed to ethanol for 3 days , trans - resveratrol treatment induced both a decrease in dna damage and an enhancement of cell recovery in a dose - dependent manner . the effective concentration of trans - resveratrol that both reduced dna strand break formation and enhanced dna repair was 5 m . consistent with these results , confocal laser microscopy images of astrocytes stained with hoechst 33342 allowed visualization of apoptotic nuclei when cells are exposed for 3 days to 20 mm ethanol . interestingly , treatment with 5 m resveratrol completely prevented nuclear morphology alterations induced by ethanol treatment since neither membrane blebbings nor apoptotic bodies were evidenced in these conditions . several mechanisms may underlie trans - resveratrol - induced protection of astrocytes against ethanol neurotoxicity . trans - resveratrol has been shown to possess helpful free - radical scavenging properties [ 19 , 20 , 4951 ] , and ethanol exposure is known to induce the generation of reactive free radicals in vitro [ 8 , 9 , 52 ] as well as in vivo [ 53 , 54 ] . therefore , it is reasonable to assume that trans - resveratrol might have protective effects on ethanol - induced oxidative dna damage , by quenching free radicals generated during its brain metabolism . in conclusion , we clearly evidenced that trans - resveratrol could markedly decrease cell mortality and levels of dna strand breaks induced by long - term ethanol exposure of astrocytes in primary culture . nevertheless , this expected significant protection should be weighted against the restrictive conditions of resveratrol treatment since elevated levels and/or long - term exposure with this compound could contribute to enhance cerebral damage . although the relevance of our findings to in vivo clinical situations remains to be demonstrated , our results suggest that caution is necessary with therapeutic use of trans - resveratrol since high level of this compound could lead to the appearance of adverse effects on the brain .

atherosclerosis is an inflammatory disease which may be the outcome of responses to microbial antigens [ 1 , 2 ] . several conserved components of the bacterial cell wall have been shown to bind to receptors on the cell surface of monocyte and macrophages which may induce production of proinflammatory cytokines . the role of chronic low - grade infection of the arterial wall with chlamydia pneumoniae ( c. pneumoniae ) in the pathogenesis of atherosclerosis has been suggested in a series of epidemiological and pathological studies and may induce innate immunity , molecular mimicry , and autoimmunity as well as direct infection of tissues [ 48 ] . earlier prospective studies have shown crp to be a strong independent predictor of coronary events . it seems that the macrophages deactivating cytokines il-4 and il-13 display proinflammatory activities in the vascular system and that il-8 may have a role as a leukocyte chemoattractant during atherogenesis . intercellular adhesion molecule-1 ( icam-1 ) , a major adhesion receptor expressed on the endothelium , is involved in monocyte adhesion to endothelial cells . the vascular adhesion molecule ( vcam-1 ) has been reported to bind particularly to those classes of leukocytes found in nascent atheroma consisting of the monocyte and the t lymphocyte . we reported earlier association of hscrp and il-6 with c. pneumoniae iga serology in cad patients [ 14 , 15 ] , however , there is no study where levels of these plasma circulatory markers in c. pneumoniae iga positive and hscrp positive groups of cad patients have been evaluated which is required for understanding pathogenesis of cad . hence the aim of this study was to perceive the levels of plasma circulatory inflammatory markers in cad patients in the presence of well established cad markers , namely , c. pneumoniae iga and hscrp in indian population . a total of 192 patients ( 148 males and 44 females ) attending the cardiology outpatient department of safdarjung hospital from march 2005 to june 2007 for angiographically confirmed cad were enrolled for the study after prior written consent . in addition , 192 age and sex matched healthy controls with no evidence of cad ( 142 males and 50 females ) were also included in the study . evidence of cad required at least one of the following : ( 1 ) significant stenosis ( 70% of luminal diameter ) in at least one major coronary artery proved by angiography and had undertaken either percutaneous coronary intervention or coronary artery bypass graft ( cabg ) ; ( 2 ) positive stress myocardial perfusion imaging studies for ischemia . patients were not included if any of the following was present myocardial infarction or cabg in the preceding 3 months , unstable angina , significant valvular heart disease , blood pressure 180/100 mm . venous blood ( 5 ml ) was collected in nonheparinized tubes from cad patients and controls . serum was separated within 2 hours of blood collection and kept at 80c until used for detection of hscrp , il-4 , il-8 , il-10 , il-13 , ifn- , icam-1 and vcam-1 , and antibodies against c. pneumoniae iga . detection of antibodies for c. pneumoniae specific iga was performed using commercially available elisa kit ( r - biopharm ag , germany ) , as mentioned earlier . for detection of antibodies to hscrp , elisa was performed using kits ( calibiotech inc . , calif , usa ) as per manufacturer 's instructions and level of the hscrp ( > 3 detection of concentration of interleukins ( il-4 , il-8 , il-10 , il-13 , and ifn- ) , adhesive molecules ( icam-1 and vcam-1 ) was performed using commercially available elisa kit ( e - biosciences , san diego , calif , usa ) and ( diaclone , france ) as , respectively , manufacturer 's instructions . differences between two groups were evaluated using mann - whitney u - test . for comparing binary related characteristics -square test , three age groups of cad patients and controls were included in this study , however , none of the groups were found to be significantly different . males and females were also not found to be significantly different when cad patients and controls were compared ( table 1 ) . levels of plasma circulatory markers viz il-4 , il-8 , il-13 , icam-1 and vcam-1 were significantly higher ( p < .001 , < .001 , .004 , < .001 , < .001 ) in contrast to , levels of il-10 and ifn- which were significantly lower ( p < .001 ) in cad pts as compared to controls ( table 2 ) . mean levels of il-4 , il-8 , and icam-1 were significantly higher ( p = .007 , .015 , < .001 , < .001 , and .048 ) in c. pneumoniae iga positive cad pts as compared to c. pneumoniae iga negative cad pts , whereas the levels of il-10 and ifn- were significantly lower ( p < .001 , < mean levels of il-4 were significantly higher ( p < .001 ) and ifn- was significantly lower ( p = .006 ) in c. pneumoniae iga positive controls as compared to c. pneumoniae iga negative controls ( table 3 ) . mean levels of plasma circulatory markers il-4 , il-8 , il-13 , icam-1 , and vcam-1 were higher but not significant while levels of il-10 and ifn- were significantly lower ( p < .001 ) in hscrp positive cad pts as compared to hscrp negative cad pts . additionally , similar results were found in hscrp positive controls as compared to hscrp negative controls ( table 4 ) . a variety of plasma inflammatory markers have been shown to predict future cardiovascular risk and is useful for risk stratification and also for identifying those patients who may benefit from targeted interventional therapy . it has been reported that c. pneumoniae induces much more il-6 and il-8 and lower levels of ifn- compared to other gram - positive bacteria [ 3 , 17 ] . the induction of monocyte procoagulant activity with either il-6 or il-8 has been proposed as a possible link between inflammation and thrombosis in patients with cad . il-8 has also been reported to play a minor role in mediating monocyte recruitment and adhesion associated with neutrophil chemotaxis . increased expression of cell adhesion molecules in response to infection with c. pneumoniae has also been reported [ 20 , 21 ] . in our study levels of cytokines il-4 , il-8 , and icam-1 were detected higher and levels of il-10 and ifn- were lower in c. pneumoniae positive compared to c. pneumoniae negative cad patients . moreover , levels of il-4 , il-8 , il-13 , icam-1 , and vcam-1 were detected higher but not significant in hscrp positive cad pts compared to hscrp negative cad patients . it has been earlier reported that crp clearly enhances il-8 production at 8 to 24 hours of incubation , although a considerably less potent than crp [ 22 , 23 ] . however , gabay et al . showed that il-4 and il-13 decreased the levels of crp in primary hepatocytes and hepatoma hepg2 cells . kieda et al . reported that leukocyte recruitment to the endothelium is mediated by the interaction of adhesion molecule receptors expressed on the surface of endothelium cells for effective host defense against bacteria . also it is reported that very late antigen-4 ( vla-4 ) , a major adhesion receptor is expressed by t lymphocytes , mediates t - cell adhesion in the microvasculature via an interaction with vcam-1 on activated endothelial cells . kawanami et al . showed that crp induces vcam-1 gene expression through nf-b activation in vascular endothelial cells , which is parallel to our findings where elevated hscrp was detected in serum of cad patients . in our study among different age groups , levels of c. pneumoniae iga were not significantly different ( data not shown ) . similar results were reported by masato et al . whereas it is contradictory to that reported by hahn et al . and nishimura et al . . overall , our study suggested that circulatory cytokines , namely , il-4 , il-8 and adhesive molecules like icam-1 were enhanced in cad patients infected with c. pneumoniae whereas in contrast to this il-10 and ifn- were lowered . additionally , these cytokines were also enhanced in hscrp positive cad - pts , suggesting the important role of these cytokines in progression of cad .

a total of 780 nondiabetic caucasian subjects , consecutively recruited in the university of rome and the university of catanzaro areas , participated in this cross - sectional study for assessment of cardiometabolic risk factors according to a previously described protocol ( 17,18 ) . the inclusion criteria were age 20 years , absence of diabetes mellitus , defined as a1c 6.5% , fpg 126 mg / dl , or 2-h postchallenge plasma glucose 200 mg / dl , and presence of one or more cardiometabolic risk factors , including elevated blood pressure ( bp ) , dyslipidemia , overweight / obesity , and family history of diabetes . subjects were excluded if they had gastrointestinal diseases associated with bleeding or malabsorption , chronic pancreatitis , history of any malignant disease , history of drug abuse , positivity for antibodies to hepatitis c virus or hepatitis b surface antigen , and anemia , defined according to the world health organization criteria as a hemoglobin concentration < 13 g / dl in men and < 12 g / dl in women . after a 12-h fast , all subjects underwent an anthropometric evaluation , including assessment of bmi and waist circumference . readings of clinic bp were obtained in the left arm of supine patients , after 5 minutes of quiet rest , with a mercury sphygmomanometer . an ogtt was performed with sampling of plasma glucose at 0 , 30 , 60 , 90 , and 120 min for insulin determination . intima media thickness ( imt ) of the common carotid artery was measured by an atl hdi 3000 ultrasound system ( advanced technology laboratories , bothell , wa ) equipped with a 5-mhz linear array transducer , as previously described ( 19 ) . manual measurements were conducted in plaque - free portions of the 10-mm linear segment proximal to the carotid bulb . two measurements were performed bilaterally for each patient , and the values were averaged , which presented the mean of imt of the common carotid artery . the ultrasound study was performed by an experienced examiner who was unaware of the subjects clinical and laboratory findings . the individual 10-year risk of coronary heart disease ( chd ) was estimated using the framingham heart study prediction score sheet for 659 subjects in aged 3074 years ( 20 ) . the protocol was approved by the institutional ethics committees and informed written consent was obtained from each participant in accordance with principles of the declaration of helsinki . a1c was measured with high - performance liquid chromatography using a national glycohemoglobin standardization program ( ngsp ) certified automated analyzer ( adams ha-8160 hba1c analyzer , menarini , italy ; normal reference range , 4.35.9% ) . plasma insulin concentration was determined by a chemiluminescence - based assay ( immulite , siemens , italy ) . variables with skewed distribution , including triglyceride , high - sensitive c - reactive protein ( hs - crp ) , and fasting and 2-h insulin , were log transformed for analyses . phenotypic differences between groups were tested after adjusting for age and sex using a general linear model with post hoc bonferroni correction for multiple comparisons . the statistic was calculated as a measure of agreement between a1c and fpg or 2-h postchallenge diagnoses for individuals at high risk of type 2 diabetes . relationships between variables were sought by multivariate linear regression analysis to assess their independent contribution to imt . all analyses were performed using spss 16.0 software ( spss inc , chicago , il ) . a1c was measured with high - performance liquid chromatography using a national glycohemoglobin standardization program ( ngsp ) certified automated analyzer ( adams ha-8160 hba1c analyzer , menarini , italy ; normal reference range , 4.35.9% ) . plasma insulin concentration was determined by a chemiluminescence - based assay ( immulite , siemens , italy ) . variables with skewed distribution , including triglyceride , high - sensitive c - reactive protein ( hs - crp ) , and fasting and 2-h insulin , were log transformed for analyses . phenotypic differences between groups were tested after adjusting for age and sex using a general linear model with post hoc bonferroni correction for multiple comparisons . the statistic was calculated as a measure of agreement between a1c and fpg or 2-h postchallenge diagnoses for individuals at high risk of type 2 diabetes . relationships between variables were sought by multivariate linear regression analysis to assess their independent contribution to imt . all analyses were performed using spss 16.0 software ( spss inc , chicago , il ) . the mean age of the whole study sample was 45 13 years , 326 ( 41.8% ) were men , and the mean bmi was 29.8 6.8 kg / m . according to ada criteria ( a1c 5.76.4% , ifg , or igt ) , 421 of 780 subjects ( 53.9% ) were at high risk for diabetes ( prediabetes ) . the proportion of these subjects identified by a1c 5.76.4% , ifg , and igt , was 31.5% ( n = 245 ) , 28.1% ( n = 219 ) , and 31.7% ( n = 247 ) , respectively . poor agreement existed for a1c and fpg criteria for identification of subjects with prediabetes ( coefficient = 0.332 ) , with 56.3% of individuals without prediabetes by both a1c and fpg criteria , and 15.8% classified as prediabetic by both a1c and fpg criteria ( table 1 ) . discordant classifications occurred for 12.3% of individuals who had an a1c < 5.7% and ifg , and for 15.6% who had a1c 5.76.4% and fpg < 100 mg / dl . table 1 reports the clinical characteristics and laboratory findings of the four groups identified by fpg only , by a1c only , or by both criteria . the only differences in cardiometabolic risk profile observed among the three groups with prediabetes identified by a1c only , fpg only , and both a1c and fpg were waist circumference , which was higher in individuals with prediabetes identified by both a1c only and by fpg and a1c ; fpg , which , by design , was lower in individuals with prediabetes identified by a1c only ; a1c , which , by design , was lower in individuals with prediabetes identified by fpg only and both a1c and fpg ; and 2-h postchallenge glucose , which was increased in individuals with prediabetes identified by both a1c and fpg . cardiometabolic characteristics of subjects with prediabetes defined by fpg only , by a1c only , and by both fpg and a1c poor agreement existed for a1c and 2-h postchallenge glucose criteria for identification of individuals with prediabetes ( coefficient = 0.299 ) , with 53.3% of individuals not having prediabetes by both a1c and 2-h postchallenge glucose criteria and 16.4% classified as having prediabetes by both a1c and 2-h postchallenge glucose criteria ( table 2 ) . discordant classifications occurred for 15.3% of individuals who had an a1c < 5.7% and igt and for 15.0% who had an a1c 5.76.4% and cardiometabolic characteristics of subjects with prediabetes defined by 2-h postchallenge glucose ( 2-hpg ) only , by a1c only , and by both 2-hpg and a1c the worst cardiometabolic risk profile was observed in the two groups identified by 2-h postchallenge glucose criterion ( table 2 ) . no significant differences in cardiometabolic risk factors were observed between igt - only subjects and individuals with prediabetes by both a1c and 2-h postchallenge glucose , with the exception of waist circumference , and fpg , which were increased in the latter individuals . compared with subjects with prediabetes identified by a1c only , igt - only individuals exhibited significantly higher systolic bp , pulse pressure , 2-h postchallenge insulin , triglycerides , hs - crp , and carotid imt , and lower hdl cholesterol levels and insulin sensitivity . these differences remained significant after adjusting for age and sex using a general linear model with post hoc bonferroni correction for multiple comparisons . igt - only individuals also exhibited a significantly higher framingham risk score compared with subjects with prediabetes identified by a1c only . no significant differences in cardiometabolic risk factors were observed between normal individuals and subjects with prediabetes identified by a1c only , with the exception of age , bmi , waist circumference , and fpg , which were significantly increased in the latter individuals . in univariate analyses adjusted for sex and age , carotid imt was significantly correlated with waist circumference , systolic and diastolic bp , and 2-h postchallenge glucose ( supplementary table 1 ) . of the three glycemic parameters , 2-h postchallenge glucose only was significantly correlated with carotid imt . to estimate the independent contribution of a1c , fpg , or 2-h postchallenge plasma glucose to carotid imt , we conducted a multivariate regression analysis in a model also including age , sex , and components of the metabolic syndrome ( i.e. , waist circumference , systolic and diastolic blood pressure , triglycerides , and hdl cholesterol ) . the two variables that remained significantly associated with carotid imt were age ( = 0.223 ; p < 0.0001 ) , and 2-h postchallenge plasma glucose ( = 0.199 ; p < 0.0001 ) , accounting for 18.1% of its variation . poor agreement existed for a1c and fpg criteria for identification of subjects with prediabetes ( coefficient = 0.332 ) , with 56.3% of individuals without prediabetes by both a1c and fpg criteria , and 15.8% classified as prediabetic by both a1c and fpg criteria ( table 1 ) . discordant classifications occurred for 12.3% of individuals who had an a1c < 5.7% and ifg , and for 15.6% who had a1c 5.76.4% and fpg < 100 mg / dl . table 1 reports the clinical characteristics and laboratory findings of the four groups identified by fpg only , by a1c only , or by both criteria . the only differences in cardiometabolic risk profile observed among the three groups with prediabetes identified by a1c only , fpg only , and both a1c and fpg were waist circumference , which was higher in individuals with prediabetes identified by both a1c only and by fpg and a1c ; fpg , which , by design , was lower in individuals with prediabetes identified by a1c only ; a1c , which , by design , was lower in individuals with prediabetes identified by fpg only and both a1c and fpg ; and 2-h postchallenge glucose , which was increased in individuals with prediabetes identified by both a1c and fpg . cardiometabolic characteristics of subjects with prediabetes defined by fpg only , by a1c only , and by both fpg and a1c poor agreement existed for a1c and 2-h postchallenge glucose criteria for identification of individuals with prediabetes ( coefficient = 0.299 ) , with 53.3% of individuals not having prediabetes by both a1c and 2-h postchallenge glucose criteria and 16.4% classified as having prediabetes by both a1c and 2-h postchallenge glucose criteria ( table 2 ) . discordant classifications occurred for 15.3% of individuals who had an a1c < 5.7% and igt and for 15.0% who had an a1c 5.76.4% and cardiometabolic characteristics of subjects with prediabetes defined by 2-h postchallenge glucose ( 2-hpg ) only , by a1c only , and by both 2-hpg and a1c the worst cardiometabolic risk profile was observed in the two groups identified by 2-h postchallenge glucose criterion ( table 2 ) . no significant differences in cardiometabolic risk factors were observed between igt - only subjects and individuals with prediabetes by both a1c and 2-h postchallenge glucose , with the exception of waist circumference , and fpg , which were increased in the latter individuals . compared with subjects with prediabetes identified by a1c only , igt - only individuals exhibited significantly higher systolic bp , pulse pressure , 2-h postchallenge insulin , triglycerides , hs - crp , and carotid imt , and lower hdl cholesterol levels and insulin sensitivity . these differences remained significant after adjusting for age and sex using a general linear model with post hoc bonferroni correction for multiple comparisons . igt - only individuals also exhibited a significantly higher framingham risk score compared with subjects with prediabetes identified by a1c only . no significant differences in cardiometabolic risk factors were observed between normal individuals and subjects with prediabetes identified by a1c only , with the exception of age , bmi , waist circumference , and fpg , which were significantly increased in the latter individuals . in univariate analyses adjusted for sex and age , carotid imt was significantly correlated with waist circumference , systolic and diastolic bp , and 2-h postchallenge glucose ( supplementary table 1 ) . of the three glycemic parameters , 2-h postchallenge glucose only was significantly correlated with carotid imt . to estimate the independent contribution of a1c , fpg , or 2-h postchallenge plasma glucose to carotid imt , we conducted a multivariate regression analysis in a model also including age , sex , and components of the metabolic syndrome ( i.e. , waist circumference , systolic and diastolic blood pressure , triglycerides , and hdl cholesterol ) . the two variables that remained significantly associated with carotid imt were age ( = 0.223 ; p < 0.0001 ) , and 2-h postchallenge plasma glucose ( = 0.199 ; p < 0.0001 ) , accounting for 18.1% of its variation . increasing evidence suggests a low agreement between a prediabetes diagnosis made by a1c and one obtained using fpg and 2-h postchallenge criteria ( 410 ) . as pointed out by the ada , the characterization of subjects discordantly categorized by the three tests is now pending ( 2 ) . in the current study , we show that different subjects are identified as having prediabetes using the three glucose tests , demonstrating for the first time that individuals with prediabetes identified by the 2-h postchallenge glucose criterion have a worse cardiovascular risk profile that is not explained by the other features of the metabolic syndrome concurrently observed in these subjects . in our cohort of adult italian caucasians , there was low agreement between the diagnosis of high risk for type 2 diabetes ( prediabetes ) made by a1c and fpg or 2-h postchallenge ada criteria . we observed that 55.1% of the individuals with a1c 5.76.4% were not classified as being at high risk by fpg criterion and that 46.4% of the individuals at high risk by fpg criterion would be classified as not being at high risk by a1c criterion . using 2-h postchallenge glucose as the criterion , 49.7% of the individuals with a1c 5.76.4% were not classified as being at high risk by 2-h postchallenge glucose , and 52.3% of the individuals at high risk by 2-h postchallenge glucose would be classified as not being at high risk by the a1c criterion . the present results are in agreement with those recently reported in studies of adults from the u.s . national health and nutrition examination survey ( nhanes ) ( 4,6,7 ) , from the screening for impaired glucose tolerance ( sigt ) study ( 6 ) , from the insulin resistance atherosclerosis study ( iras ) ( 8) , from a cohort of asian indians ( 5 ) , and from a cohort of arab ancestry ( 10 ) . higher a1c levels at any given level of fpg have been reported in hispanics , american indians , blacks , and asian americans compared with their caucasian counterparts , even after adjustment for confounding factors affecting glycemia ( 22 ) . these disparities are likely due to differences in hemoglobin glycation or erythrocyte turnover among ethnic groups . because previous studies have included cohorts of different ethnicities , the current results , which are based only on a cohort of caucasian individuals , provides important information to help clinicians and patients of european ancestry understand the advantages and shortcomings of each test used alone or in combination . notably , multiple nonglucose factors , such as hemoglobinopathies and anemia , can influence the accuracy of a1c measurement . although individuals with undiagnosed anemia might possibly have been included in previous studies comparing the concordance of a1c , fpg , or 2-h postchallenge glucose tests for the identification of prediabetes , in the current study , we excluded individuals with conditions that affect red cell turnover , such as anemia and major blood loss , thus increasing the accuracy in the a1c measurement of the present results . the discordance in the identification of individuals at high risk for type 2 diabetes using different metabolic parameters is not entirely unexpected given that measurements of fpg , 2-h postchallenge glucose , and a1c are likely to reflect different aspects of glucose metabolism , and a diagnosis of prediabetes based on ifg , igt , and a1c highlights the different pathophysiologic mechanisms underlying abnormal glucose homeostasis ( 23 ) . in fact , ifg is characterized by a combination of hepatic insulin resistance and defective early - phase insulin secretion resulting in excessive fasting hepatic glucose production that accounts for fasting hyperglycemia . by contrast , igt is characterized by nearly normal hepatic insulin sensitivity and marked muscle insulin resistance combined with defective late insulin secretion thus resulting in prolonged hyperglycemia after a glucose load ( 23 ) . in contrast to the daily glucose picture offered by ifg and igt , a1c is an indicator of the average blood glucose concentrations over the preceding 23 months , accounting for chronic exposure to both basal and postprandial hyperglycemia and , therefore , may reflect a combination of pathophysiologic defects underlying both ifg and igt . taken together , the different pathophysiologic mechanisms underlying each glycemic marker help explain the discordant diagnoses of prediabetes based on fpg , 2-h postchallenge glucose , and a1c . however , it is likely that as overt diabetes develops , each underlying mechanism is active , which may help explain the fair concordance between fpg , 2-h postchallenge , and a1c tests to diagnose diabetes ( 2427 ) . a central question is whether individuals with prediabetes diagnosed by fpg , 2-h postchallenge glucose , and a1c are at equivalent risk of cardiovascular disease . elevation in plasma glucose at the prediabetic levels has been shown to be associated with increased risk of subsequent cardiovascular disease ( 28,29 ) . longitudinal data on cardiovascular risk comparing fpg , 2-h postchallenge glucose , and a1c in the prediabetic range are sparse , have been focused on mortality , and have reached controversial results ( 1115 ) . in this study , we observed no differences in cardiometabolic risk profile among the three groups with prediabetes diagnosed by fpg only , a1c only , and both a1c and fpg . by contrast , compared with individuals with prediabetes by a1c only , prediabetic individuals identified by 2-h postchallenge glucose ( igt only and combined igt / a1c ) had a worse cardiovascular risk profile , resulting in a higher framingham score for 10-year chd risk and subclinical atherosclerosis as determined by imt . the latter differences remained significant after adjusting for age and sex using a general linear model with the conservative post hoc bonferroni correction for multiple comparisons . to the best of our knowledge , this is the first study comparing the effect of the recently proposed ada criteria of elevated a1c ( 5.76.4% ) with both fpg and 2-h postchallenge glucose on subclinical atherosclerosis , a well - validated proxy of cardiovascular disease . notably , we observed that the 2-h postchallenge glucose value showed a stronger correlation with imt than fpg or a1c , and was the only glycemic parameter independently associated with imt in a multivariate regression analysis in a model including components of metabolic syndrome . the present data are in agreement with those of a prospective population - based study showing that the 2-h postchallenge glucose , at variance with fpg and a1c , was the only glycemic marker in the prediabetic range significantly associated with incident cardiovascular disease in women ( 30 ) . it is important to note that only subjects who converted from ifg to diabetes ( 31 ) or from a1c of 5.76.4% to a1c 6.5% have an increased risk for cardiovascular disease . by contrast , igt individuals are at increased risk for cardiovascular disease independently of the conversion to diabetes ( 31 ) . taken together with the present findings showing that igt - only individuals have signs of early atherosclerosis independently from elevated a1c , we can suggest that additional information on cardiovascular disease risk , that may be clinically useful for the identification of subjects at increased risk , is embedded in the 2-h postchallenge glucose level . these findings showing a link between postchallenge hyperglycemia and cardiovascular risk may have clinical implications . because lifestyle changes and pharmacologic interventions in individuals at high - risk for type 2 diabetes have been consistently demonstrated to be successful in reducing the incidence of the disease and its associated cardiovascular complications ( 32,33 ) , it would be important to identify individuals at increased risk for both clinical outcomes , such as those with igt , who could benefit from lifestyle change interventions , and , possibly , pharmacotherapy . the mechanism by which elevated 2-h postchallenge glucose levels are associated with an increased risk of atherosclerosis is not settled . a greater degree of insulin resistance in igt individuals is one possibility accounting for development of atherosclerosis . accordingly , we observed that prediabetic individuals identified by 2-h postchallenge glucose ( igt only and combined igt / a1c ) had lower insulin sensitivity than normal individuals and prediabetic individuals identified by a1c only . in addition , chronic subclinical inflammation could be a unifying mechanistic factor because it predicts the development of both type 2 diabetes ( 34 ) and cardiovascular disease ( 35 ) . among markers of subclinical inflammation , we found that igt - only and combined igt / a1c subjects had increased hs - crp levels compared with normal individuals and prediabetic individuals identified by a1c only . increased levels of hs - crp may reflect systemic inflammation but may be also directly involved in the pathogenesis of both type 2 diabetes ( 36 ) and vascular atherosclerosis ( 37 ) . overall , these findings suggest a greater contribution of postprandial glucose to both insulin resistance and subclinical inflammation compared with a1c levels , thus reinforcing the idea that performing ogtt may be useful to identify individuals at high - risk for type 2 diabetes and cardiovascular complications . the current study has several strengths , including the broad range of demographic , clinical , and biochemical data collected by trained staff following a standardized protocol , the centralization of laboratory analyses , the inclusion of well - validated risk factors for cardiovascular disease ( lipids , blood pressure , insulin sensitivity , and hs - crp ) , and the use of ogtt data instead of fasting glucose alone , as reported in other studies . nevertheless , the current study needs to be interpreted in the context of certain potential limitations . a first limitation of our study is that each test ( fpg , a1c , and ogtt ) was only performed once . although such an approach reflects clinical practice and is a common limitation to most large epidemiologic studies , the day - to - day variability of fpg and 2-h postchallenge glucose results can not be taken into account in the current study . a second limitation of the current study is the cross - sectional design , making causal interpretations of associations between diagnostic criteria and risk of cardiovascular disease difficult . indeed , the current results reflect only an association with early atherosclerosis and not incident cardiovascular disease . although carotid imt is a well - established index of early atherosclerosis and is widely used as surrogate marker of cardiovascular disease , further prospective studies with incident cases of cardiovascular events are needed to draw such conclusions . in conclusion , the results of the current study suggest that considerable discordance between a1c , fpg , 2-h postchallenge glucose exists to identify individuals with prediabetes and that the cardiometabolic risk profile of these individuals varies by metabolic parameter , with 2-h postchallenge glucose showing stronger associations with cardiometabolic risk factors and subclinical atherosclerosis than fpg or a1c .

the reported prevalence of gestational diabetes mellitus ( gdm ) varies widely between 1 and 14% of all pregnancies ( 1 ) . this wide variation may be explained in part by ethnic differences , and also by a lack of consensus in screening for gdm ( 3 , 4 ) . universal screening for gdm , for example , is practiced by 84% of obstetricians in canada and by 94%97% in the united states of america , but only in 17% of obstetric units in britain ( 5 , 6 ) . there are also wide variations nationally and internationally about the criteria for selective screening , the type of glucose load testing , the criteria for the diagnosis of gdm and the timing of the glucose load testing . a systematic review found that the odds ratio for gdm in obese women with a body mass index ( bmi ) 30.0 kg / m was 3.8 ( 95% ci , 3.34.3 ) compared with normal weight women ( 1 ) . in another meta - analysis including studies involving selective screening , the risk of developing gdm was estimated to be about two , four and eight times higher among overweight , obese and severely obese women , respectively compared with normal - weight pregnant women ( 9 ) . the recent nice guidelines on diabetes in pregnancy lists a bmi 30.0 kg / m as one of five independent risk factors for the development of gdm ( 10 ) . in previous studies estimating the risk of gdm according to bmi , the calculation of bmi was often self - reported or the methodology unstated ( 1 ) . self - reporting , however , is unreliable and the degree of unreliability differs according to ethnicity , gender and obesity category ( 11 , 12 ) . in a canadian study , women under - reported their weight by an average of 2.5 kg and discrepancies increased in obese bmi categories ( 13 ) . we have reported that 22% of women were categorised in the wrong category if bmi calculations were based on self - reporting ( 14 ) . the aim of this study was to determine the risk of glucose intolerance and gdm by both bmi categories and bmi centiles in a population where bmi was measured accurately and selective screening for gdm was practiced . this prospective observational study was conducted in a large university teaching hospital between july 2008 and march 2010 . women were recruited at their convenience after an ultrasound confirmed an ongoing singleton pregnancy in early pregnancy . the study was confined to white european women to avoid ethnicity as a confounding variable . women with a diagnosis of diabetes mellitus in the prepregnancy period , women under the age of 18 years and women who could not give consent were excluded . at recruitment , height was measured in centimetres to one decimal point using a wall - mounted meter stick ( seca 242 ) . the women were asked to remove their footwear and to stand barefoot with their back against the measuring rod . maternal weight was measured in kilograms to the nearest decimal point in a standardized way using a tanita mc 180 ma ( tokyo , japan ) . they were also asked to remove any heavy clothing items . to account for the weight of the clothes during the measurement 0.5 kg women with either a historical risk factor ( previous macrosomic infant , first degree relative with diabetes mellitus , previous unexplained stillbirth , maternal age > 40 years or maternal weight > 90 kg ) or a risk unique to the current pregnancy ( confirmed glycosuria , polyhydramnios or suspected macrosomia ) were screened . a normal glucose response in pregnancy was defined as a fasting value of < 5.3 mmol / l , a 1-hour postprandial value of < 10.0 mmol / l , a 2-hour postprandial value of < 8.6 mmol / l and a 3-hour postprandial value of < 7.8 mmol / l after a 3-hour 100 g ogtt at around 28th gestational week ( 15 ) . one abnormal level was classified as glucose intolerance , while two or more abnormal levels were classified as gdm . a chi - square test was used to evaluate differences in categorical variables between the groups . the study was approved by the hospital 's research ethics committee in june 2008 and an informed consent was obtained . of the 2000 women enrolled into the study , 41 ( 2.0% ) subsequently miscarried and 24 ( 1.2% ) transferred elsewhere for antenatal care . screening was more likely to occur in the obese categories because maternal weight > 90 kg was used as an indication for screening . characteristics of study population ( n = 1935 ) table 2 shows the abnormal ogtts analysed by bmi category as a percentage of ogtts done . this shows that the prevalence of an abnormal ogtt was higher in women with class 2 and 3 obesity ( bmi 35.0 kg / m ) compared to women with class 1 obesity ( bmi 30.0 and < 35.0 kg / m ) ( 23.3% vs. 10.1% , respectively ; p = 0.008 ) . the frequency of an abnormal ogtt was not higher in women with class 1 obesity compared to women who were overweight ( 10.1% vs. 14.1% , respectively ) . oral glucose tolerance test ( ogtt ) results analysed by body mass index ( bmi ) category ( n = 547 ) table 3 shows the abnormal ogtts analysed by bmi centiles for the study population . the frequency of an abnormal ogtt was higher in women with a bmi 90th centile ( 33.1 kg / m ) compared to women with a bmi between the 80th and 90th centiles ( 29.3 and < 33.1 kg / m ) ( 21.5% vs. 8.1% ; p = 0.005 ) . oral glucose tolerance test ( ogtt ) results analysed by body mass index ( bmi ) centiles ( n = 547 ) we found that pregnant women with class 1 obesity at their first antenatal visit did not have an increased risk for abnormal ogtt compared to women in the normal weight or overweight bmi categories . however , about one in five pregnant women with a bmi 35.0 kg / m had an abnormal ogtt . we also found that when analysis was done by bmi centiles rather than by who bmi categories the incidence of abnormal ogtt was 21.5% in 90th centile compared with 8.1% in women with a bmi between the 80th and 90th centiles ( p = 0.005 ) . our findings indicate that the recommended cut - off point for selective screening for gdm of a bmi 30.0 kg / m may need to be revisited when bmi is measured , and not self - reported . a weakness in our study is that the screening was selective rather than universal ; therefore , some cases of abnormal glucose tolerance were inevitably missed . however , screening of low risk women for gdm is likely to have only missed 0.50.6% of cases , particularly in a white european population ( 16 ) . also , all women in our study were screened with a diagnostic ogtt , rather than as a two step process starting with 50 g glucose loads , which improves diagnostic specificity ( 17 ) . another weakness in our study was that we were not able to control for other risk factors for gdm in our analysis . outside pregnancy , it has been reported that the association between obesity and health conditions generally may be overestimated if self - reported bmi is used ( 18 ) . in particular , misclassification due to under - reporting bmi levels results in an exaggerated association between obesity and type 2 diabetes mellitus ( 19 ) . a canadian analysis based on a sample of 2667 respondents revealed that for diabetes , hypertension and cardiac disease , the odds ratio for the overweight and obese categories were substantially higher for models based on self - reported values rather than those based on measured ones ( 13 ) . for example , based on self - reported bmi the adjusted odds ratio for diabetes was 3.2 in class 1 obesity and 11.8 in class 2 and 3 obesity . however , when based on measured bmi , the adjusted odds ratio for diabetes was lower at 2.2 in class 1 obesity and 7.0 in class 2 and 3 obesity ( 13 ) . if subjects are 13 kg / m above the bmi cut - off for the obese category on measurement are categorised as overweight due to under - reporting of bmi , this may potentially lead to an exaggeration of risk in the class 1 obesity bmi groups because subjects with a bmi 33.0 kg / m are over presented . previous studies on gdm and the risk of obesity often used prepregnancy bmi ( 1 ) . however , half of pregnancies are unintended and this is a potential source of bias . contrary to previous studies , we have recently reported that maternal weight or adiposity on average does not change in the first trimester ( 20 ) . moreover , the early ultrasound dating of pregnancy in our study means that the timing of measurements , including the ogtt , was standardized by gestational age . analysis of the risk of gdm by bmi centiles suggests that the risk starts to escalate above the 90th centile ( a measured bmi 33.1 kg / m ) . the recent meta - analysis used the midpoint for each bmi category which may also have led to imprecision about the true mean bmi within any category and thus , an over - estimation of the true relationship between gdm and , for example , class 1 maternal obesity ( 1 ) . our findings show that the current practices on selective screening for gdm based on bmi need to be re - evaluated . the accurate calculation of bmi means that women who should be screened for gdm should not be missed , and thus , potential adverse lifelong consequences of gdm for the woman and her offspring can be avoided . increasing the cut - off point for screening from 30.0 to 33.0 kg / m can substantially reduce the number of screening tests , may avoid unnecessary obstetric interventions and may reduce maternal anxiety . to our knowledge , this is the first study that examined the risk of gdm based on bmi centiles as well as bmi category and further studies are required to confirm our results in a population where other confounding variables for gdm are controlled .

interventionalists have recently experienced success in closing these defects using devices designed to close atrial septal defects or a patent ductus . several complications of this procedure , including embolization of the devices to the descending aorta , are well documented . we report a case of embolisation of a device used to close a rsov into the left pulmonary artery with concomitant unmasking of a hidden ventricular septal defect ( vsd ) , which had not been identified before the procedure . a 44-year - old man presented with complaints of dyspnoea and palpitation on exertion . a colour doppler examination showed a high - velocity jet originating from the right coronary sinus ( rcs ) of the aorta and entering the right ventricular outflow tract ( rvot ) ( fig . 1 ) . when cardiac catheterisation was performed , the aortogram showed the contrast passing freely from the rcs into the rvot . an attempt was made to close the defect with a 16/14 size lifetech patent ductus arteriosus closure device ( lifetech scientific co. ltd . , after successful deployment , accurate positioning of the device was confirmed by an aortogram ( fig . three days after the procedure , the patient began to experience cough and dyspnoea . a chest x - ray ( fig . fluoroscopy - guided percutaneous device retrieval was unsuccessful , and the patient was taken for emergency surgical retrieval of the displaced prosthesis . at surgery , the pulmonary artery was noticed to be tense and dilated to twice the size of the aorta . the rcs was aneurysmal , had ruptured , and was prolapsing through a 15-mm vsd into the rvot . the device was palpable , wedged in the left pulmonary artery just beyond the origin of the anterior artery branch . the aneurysm was excised and both this defect and the vsd were closed using a patch of dacron fabric . the patient recovered uneventfully from the operation and was discharged on the seventh postoperative day . the sinuses of valsalva at the root of the aorta may become aneurysmal , forming thin - walled saccular or tubular outpouchings . . they are usually located in the right coronary sinus ( 75%90% ) or the noncoronary sinus ( 10%25% ) , and rarely in the left coronary sinus . these aneurysms have been shown to develop in a weak area between the aortic annulus fibrosa and media , which emerges due to the failure of the distal bulbar septum to fuse with the truncal ridges . in addition to a congenital aetiology , these aneurysms may occur secondary to trauma , infective endocarditis , or tertiary syphilis . iatrogenic injuries to the sinuses during vsd closure or during debridement of a calcified aortic or mitral valve may also result in aneurysm formation . sinus of valsalva aneurysms ( sva ) are often associated with other congenital defects , most commonly vsd and aortic regurgitation . other anomalies are also known to co - occur with sva , such as pulmonary stenosis , atrial septal defects , bicuspid aortic valve , patent ductus arteriosus , coarctation of the aorta , and sub - aortic stenosis . the aneurysm and rupture of the coronary sinuses may occur at any age , with a male preponderance . the aneurysmal pouch usually has an intra - cardiac course , but may protrude into the pericardial space . most rcs aneurysms rupture into the right ventricle ( 73% ) , while most non - coronary sinus aneurysms rupture into the right atrium ( 86% ) ( fig . aneurysms can rarely rupture into the left ventricle , left atrium , pulmonary artery , or the pericardial cavity . clinical symptoms of rsov include the sudden onset of dyspnoea , chest pain , palpitation , fatigue , or orthopnoea due to a significant left - to - right shunt . echocardiography is the gold standard for the diagnosis of rsov and the identification of other co - existing congenital anomalies . catheterisation is carried out in patients who require an evaluation of their coronary artery anatomy or if an interventional procedure is planned . in this patient , a vsd was missed on an echocardiogram and on cardiac catheterisation , probably due to the large aneurysmal rcs that completely obstructed the vsd . surgery is the conventional method of treatment , having a < 4% mortality rate and good long - term results . non - ruptured svas requiring surgical intervention include those in patients with vsd , ventricular arrhythmia , infection , coronary ostial obstruction , rvot obstruction , severe ar , and extra - cardiac sva . the era of catheter - based device closure of rsov began in 1994 with cullen et al . successfully deploying a modified rashkind umbrella device to close an rsov . since then , many other occluder devices have been utilised , with overwhelmingly favourable results . interventional procedures are particularly beneficial in the presence of previous sternotomy , recurrence , or severe co - morbidities . the size of the device used for rsov closure must be accurately assessed , since a large device may interfere with coronary blood flow or aortic valve cusp movement . however , a device of suboptimal size might dislodge and embolise , or result in a significant residual shunt . complications , although rare , include cardiac perforation , fistula formation , thrombosis , and device embolisation into the systemic or pulmonary circulation . post - deployment follow - up includes the assessment of coronary blood flow , aortic valve function , and the presence of thromboembolism . after the deployment of a device , a short course of anticoagulants or antiplatelet drugs is recommended to prevent thromboembolism until the endothelialisation of the device occurs . the risk of infective endocarditis is unknown , and hence the need for life - long antibiotic prophylaxis is debatable . in conclusion , rsov , which is conventionally treated by surgery , is currently being successfully treated using occluder devices . as more centres take up such interventional procedures , varied complications are being reported . despite the rapidly growing enthusiasm for the catheter - based device closure of rsov , we should be aware of the fact that vsds can be missed before the procedure . we report a case of the embolisation of a device used to close a rsov into the left pulmonary artery .

the population in korea is rapidly aging ; the proportion of people aged 65 yr and older increased from 7.2% in 2000 to 11% in 2010 ( 1 ) . according to an official prediction based on the population dynamics of fertility and mortality , 14.5% of koreans will be over the age of 65 in 2018 , increasing to 20.8% by 2026 . the economic and psychosocial burden imposed on older adults and their caregivers is increasingly being recognized as a major social problem , with wide political implications , given the rapid increase in the korean elderly population . against this challenge , the korean government implemented mandatory public long - term care insurance for older adults on august 1 , 2008 . the purpose of the long - term care insurance ( ltci ) is to preserve and improve the quality of senior citizens ' and their caregivers ' lives , promote better health and stable livelihoods , and reduce the burden of care on family members . the elderly aged 65 yr and older or persons less than 65 who have geriatric diseases are eligible for benefits through an assessment process certifying the presence of disability in physical and cognitive functioning . the level of certification determines the amount of services covered and the fee for each service . seniors with certified needs can use covered services from public and private providers based on their preference . despite its early adoption and introduction of novel services for older people , ltci has often been criticized for failing to take into account the healthcare needs of older beneficiaries because of its emphasis on the provision of social and support services . establishment of a separate scheme from the national health insurance program has further engendered difficulties in the coordination between healthcare and long - term care services ( 2 ) . delivery of healthcare in long - term care settings has consequently been fragmented and unorganized . in this paper , we introduce the key components of the korean ltci system by presenting an overview of its operation involving the certification process , benefits and coverage , and financing . healthcare needs of long - term care beneficiaries are then examined by analyzing their health and functional status and healthcare use . challenges both unique to the korean ltci and shared among countries with a public ltci are discussed in the context of addressing the healthcare needs of older beneficiaries navigating through the complex long - term care environment . eligibility for services under the ltci program is determined by the older person 's physical and mental status , irrespective of their financial status or family support . to use services covered by the ltci , the elderly person or his / her caregiver has to contact the national health insurance corporation ( nhic ) to have the applicant 's care needs officially certified . to evaluate the applicant 's care needs , well - trained assessors in the local branch of the nhic visit the applicant 's home and interview the applicant or his / her primary caregivers . primary caregivers have often been shown to be accurate reporters of medical and social information of the elderly ( 3 ) . this questionnaire includes the government - certified disability index ( 4 , 5 ) , a 52-item assessment instrument containing 5 domains of function and conditions ( table 1 ) . results of the assessment are entered into the computer to calculate the applicant 's standardized scores for the five domains , for which activities of daily living ( adls ) have been found to contribute significantly to the overall score . these scores are then used to estimate the service time , with a care need level assigned based on the total estimated time . each local branch of the long - term care center , under the jurisdiction of the nhic , operates the needs assessment committee , consisting of physicians , nurses , and other experts in health and social services . the needs assessment committee reviews the assigned scores of the applicant , taking into account the medical statement of the primary care physician and specified comments by the assessors . usually the committee upgrades the care level in consideration of special needs not captured in the computer - based assessment . the applicant who is determined to be in care levels 1 through 3 - level 1 being the most severely disabled - will be eligible to receive ltc benefits . the number of people applying for long - term care certification was 402,815 persons in 2009 . among them , 286,907 ( 71.2% ) were assigned to levels 1 , 2 , and 3 ( table 2 ) . more than half of those certified to receive benefits were in level 3 , and 70.7% were women . the type of long - term care benefits consists of community - based home care and institutional care . home care includes home - visit care , home - visit bathing , home - visit nursing , day / night care , and short - term respite care . for example , home - visit care includes physical support and household work provided by trained personnel in the beneficiary 's home . institutional care includes services provided to beneficiaries admitted to long - term care facilities for the elderly ( excluding geriatric hospitals ) , with nursing care and assistance to maintain and enhance physical or mental functions . long - term care benefits are provided in an amount that is subject to a monthly limit . monthly limits are calculated according to the care need levels and type of benefits provided . the beneficiary can use more services than covered as long as one pays all the costs for the services beyond the maximum level . table 3 shows the monthly limit and service benefits of ltci by each care level . . per diem rates depend on the person 's care need level and the type of facility . services are paid for with 15%-20% co - payment , and the remainder is paid for by premiums . the total expenditure of ltci was 1.7 trillion won ( about 1.5 billion dollars , $ us 1 = krw 1,125 ) in 2009 . of the total expenditure , 56% was for home care benefits and 43% for institutional care ( 6 ) . the ltci premium is linked to the health insurance premium of the national health insurance , set at a specified rate under the ltci act . while korea has a universal health insurance system , the newly introduced ltci is an elective beneficial coverage . those who have reduced functional status due to geriatric conditions or related problems and need physical support or assistance for household works receive medical services through the national health insurance system ( 7 ) . table 4 indicates the functional status of long - term care insurance beneficiaries from april 2006 to april 2007 , during which the demonstration program to introduce the long - term care system was in operation ( 8) . on average , the beneficiaries ' functional status was worse than the applicants . the average score of adls among the applicants was 15.1 and that of the beneficiaries was 23.8 . overall , those in level 1 appear to have more problems with functioning than those in levels 2 or 3 . dementia and cerebrovascular disease were found to be highly prevalent , with 28.9% having dementia and 32.1% with cerebrovascular disease ( 8) . healthcare needs among long - term care beneficiaries may be inferred indirectly from data on their healthcare utilization . table 6 shows diagnosed comorbidities of ltci beneficiaries using national health insurance claims data ( 8) . of the ltci beneficiaries , 2,006 ( 25.9% ) used medical services for hypertension in 2006 . hypertension , cerebral infarction , arthrosis of the knee , and dementia were common conditions requiring health services . 1 exhibits the 4-yr trend in healthcare expenditure by those who were certified as beneficiaries in 2006 . the beneficiaries spent , on average , 4.3 million won per person in 2006 , almost double the amount ( 2.8 million won ) expended in the previous year and a steep rise from the 1.4 million won spent in 2003 ( 9 ) . during this period , the number of individuals comprising the older population has rapidly grown , with older adults using a disproportionate amount of medical services due to high morbidity . ltci beneficiaries , compared with the total older population , used more medical services and demonstrated a higher rate of increase in healthcare costs . while korea has a universal health insurance system , the newly introduced ltci is an elective beneficial coverage . those who have reduced functional status due to geriatric conditions or related problems and need physical support or assistance for household works receive medical services through the national health insurance system ( 7 ) . table 4 indicates the functional status of long - term care insurance beneficiaries from april 2006 to april 2007 , during which the demonstration program to introduce the long - term care system was in operation ( 8) . on average , the beneficiaries ' functional status was worse than the applicants . the average score of adls among the applicants was 15.1 and that of the beneficiaries was 23.8 . overall , those in level 1 appear to have more problems with functioning than those in levels 2 or 3 . dementia and cerebrovascular disease were found to be highly prevalent , with 28.9% having dementia and 32.1% with cerebrovascular disease ( 8) . healthcare needs among long - term care beneficiaries may be inferred indirectly from data on their healthcare utilization . table 6 shows diagnosed comorbidities of ltci beneficiaries using national health insurance claims data ( 8) . of the ltci beneficiaries , 2,006 ( 25.9% ) used medical services for hypertension in 2006 . hypertension , cerebral infarction , arthrosis of the knee , and dementia were common conditions requiring health services . 1 exhibits the 4-yr trend in healthcare expenditure by those who were certified as beneficiaries in 2006 . the beneficiaries spent , on average , 4.3 million won per person in 2006 , almost double the amount ( 2.8 million won ) expended in the previous year and a steep rise from the 1.4 million won spent in 2003 ( 9 ) . during this period , the number of individuals comprising the older population has rapidly grown , with older adults using a disproportionate amount of medical services due to high morbidity . ltci beneficiaries , compared with the total older population , used more medical services and demonstrated a higher rate of increase in healthcare costs . they develop slowly at first , then progress and become clinically evident once a certain symptomatic threshold has been reached , usually quite late in life . the presence of multiple chronic conditions , quite common in older people , increases their risk of developing disability and dependence ( 10 , 11 ) . the elderly often have concomitant needs for both healthcare and long - term care ( 7 ) . traditionally , medical care for the elderly was provided by hospitals , but a more complex picture has evolved with the development of an array of medical and social services over the years ( 12 ) . long - term care facilities have emerged that accommodate older adults who are not only disabled but also have a number of chronic conditions . in korea , 92% of long - term care beneficiaries suffer from chronic diseases , and 74.2% of them utilize medical services ( 8) . in spite of entering into the long - term care system , the need for disease management of these beneficiaries is not diminished ( 13 ) . one of the challenges of the present health and long - term care insurance program is how to meet the complex medical needs of those residing in long - term care facilities or using community long - term care services . in principle , health insurance is designed to provide medical services benefits , whereas long - term care insurance provides for care services that go beyond acute medical needs to include social services and personal support . however , it is difficult to distinguish between the two needs in older people because they often exhibit needs that require both health and long - term care simultaneously . as older people 's needs for both health and long - term care increase , excessive or even redundant use and provision of services may arise due to the current disconnection between the two systems . moreover , the disabled elderly may not be able to identify and express their needs explicitly such that selection of and linkage with the appropriate combination of health and long - term care services may not be feasible . it is , therefore , important to construct an integrated delivery system that provides coordination between long - term and healthcare services ( 7 ) . an efficient integrated system would require that appropriate services are matched according to the older person 's health and functional status . the first stage in which healthcare 's role comes into play in long - term care is in determining eligibility and designating care levels of the beneficiary . during the formal review process by the needs assessment committee , this is to ensure that complex medical conditions of the applicant are accurately reflected in the review process with proper designation of the care level needed by the long term care beneficiary . the physician 's statement can be issued by practicing physicians in either western or korean traditional medicine and is not limited to a certain specialty ( enforcement decree for the act on long - term care insurance for senior citizens , article 2 ) . there remains , however , some doubt as to the proper functioning of the physician 's statement in the designation of beneficiaries ' care levels . physicians are not satisfied with the reimbursement for their assessment and are suspicious of the long - term care system , regarding it as a separate entity initially created to exclude active physician involvement . these have , in part , also resulted in long - term care applicants ' dissatisfaction with the certification process . healthcare plays an essential role in several aspects of the delivery of long - term care services . first , among the community long - term care services , home - visit nursing service involves active medical care . it is , however , often difficult to obtain the physician 's instructions for home - visit nursing care in cases where the physician is not affiliated with the provider or is hired on a contract basis . home - visit nursing remains the least utilized service among the community long - term care services . this is in part due to the lack of a systematic assessment of the need for home - visit nursing care of the beneficiary . moreover , although the individual patient 's current health status is noted in the physician 's statement for long - term care applicants , the type and amount of prescribed or recommended medical and nursing care are not specified . contracted physicians , however , are usually not able to properly manage the elderly in long - term care facilities because of their duty at their affiliated hospitals or clinics . moreover , no economic incentives are available for the hospital or clinics in having physicians who contract out their time to long - term care . third , a cooperative agreement between medical and long - term care institutions was introduced to complement the problems with contracted physicians . because long - term care facilities have difficulty acquiring an adequate physician workforce , long - term care facilities have forged formal collaborative ties with local hospitals . this has facilitated residents in long - term care facilities to seek consultations from physicians in other hospitals . satisfaction with these services , however , is not high . in a survey of long - term care facilities , 31.1% of providers were not satisfied with the level of cooperation with hospitals , and 36.9% viewed management of medical conditions as being inadequate ( 14 ) . one of major organizational barriers in linking services between long - term care and healthcare is the indistinct role between geriatric hospitals and long - term care facilities ( nursing homes ) . over the past decade , there has been a steep rise in the number of geriatric hospitals , also known as long - term care hospitals . these provide inpatient chronic care and rehabilitative services for geriatric patients who have conditions such as stroke and dementia . geriatric hospitals are managed through the national health insurance system , while long - term care facilities operate under the ltci . the unclear role between the two institutions is manifested in their similar patient composition , with dementia and stroke being the most prevalent conditions ( 14 ) . a study on geriatric hospitals and long - term care facilities has revealed that 38.6% of patients in geriatric hospitals would be better served in long - term care facilities , whereas 13.9% of long - term care facility residents should be admitted to geriatric hospitals ( 15 ) . this shows the inadequacy in the functional division between the two institutions and an inefficient use of care resources . over time , the inappropriate utilization behavior of older people may have a negative impact on the financing of the two insurance systems . it is important to establish a clear role and delineate the function of the two institutions by developing an appropriate payment and delivery system ( 13 ) . healthcare professionals may play a vital role in guiding older people to use appropriate health and long - term care services . the personal physician may serve to assess the patient 's health status and direct the coordination of services to meet the older person 's various care needs . nurses and social workers can then provide and link specific services according to the individual person 's needs . working as a team , healthcare providers can use their professional expertise to guide the older patient through the maze of the long - term care system to receive quality healthcare ( 16 , 17 ) . provision of effective and efficient delivery of comprehensive health services to older people in the evolving long - term care environment would require an active participation on the part of healthcare professionals . older long - term care beneficiaries have complex healthcare needs that make delivery of long - term care services particularly challenging . the lack of coordination between health and long - term care services , inadequate consideration of physician 's assessments in the ltci certification process , insufficient provision of health services in long - term care facilities , and overlapping and inefficient use of health and long - term care resources , further , act as barriers . healthcare professionals need to take a more active role in guiding older patients navigate through the long - term care terrain to access appropriate health services .

most dorsal dislocation of the carpal scaphoid has been reported with axial dissociation of carpus or without other carpal injury.1234 complete dorsal dislocation of the carpal scaphoid associated with dorsal perilunate dislocation without axial dissociation of carpus is unique carpal injury which have not been reported until now to the best of our knowledge . we report such a case and discuss the injury mechanism , management , and outcome . a 23 year old man presented with painful swelling in his right wrist after falling forward from 3 m height . on clinical examination , the wrist was found to be swollen , bruised and deformed . multiple abrasions on the thenar area of the hand suggested that the suspected injury mechanism was an extension , supination and ulnar deviation force on the outstretched wrist . radiographs and three - dimensional computed tomography scan ( ct ) revealed complete dorsal dislocation of the carpal scaphoid and dorsal dislocation of the other carpal bones over the lunate . the scaphoid dislocation from the other carpal bones resulted in the complete loss of normal intercarpal connections and articulations around scaphoid . in other words , wide separations among the carpal bones indicated complete and simultaneous ruptures of the scapholunate , lunotriquetral , and scaphotrapezial ligaments including dislocations of scaphotrapezial , scapholunate , lunotriquetral , scaphocapitate , and radioscaphoid joint [ figure 1 ] . preoperative ( a ) lateral radiograph , ( b ) mid - sagittal image of computed tomography ( ct ) , and ( c ) three - dimensional ct image of the wrist showing the complete dorsal scaphoid dislocation and the dorsal perilunate dislocation . the congruency of radiolunate joint was preserved , but the other carpal bones of distal carpal row , including the capitate , were dislocated dorsally ( sc : scaphoid , lu : lunate , ca : capitate , ra : radius ) the patient was taken up for surgical intervention and perioperative findings revealed complete dorsal dislocation of the scaphoid without any adjacent soft tissue connections and perilunate dorsal dislocation with lunotriquetral ligament rupture . during the surgery , the scapholunate ligament was carefully repaired using suture anchors and the midsubstance tear of the lunotriquetral ligament was repaired with simple sutures after the reduction of dislocated carpal bones [ figure 2 ] . ( a ) complete dorsal scaphoid dislocation was observed at the dorsum of the wrist , ( b ) after reduction of dislocated carpal bone , the ruptured scapholunate and lunotriquetral ligament were repaired ( sc : scaphoid , lu : lunate , tr : triquetrum , ca : capitate , ra : radius ) the reduced carpal bones were fixed with 4 k - wires to maintain their anatomical relationships and correct intercarpal articulations ( three k - wires were inserted to maintain the scapholunate , lunotriquetral , and scaphocapitate joint articulations and the last one was inserted between trapeziocapitate joint to maintain the scaphotrapezial joint indirectly ) and supplemental dorsal capsulodesis was performed with the scaphoid to prevent ulnar shifting of carpal bones [ figure 3 ] . following the surgery , the k - wires were removed 8 weeks after the surgery and the patient began range of motion physiotherapy . postoperative ( a ) antero - posterior and ( b ) lateral radiographs of wrist joint showing reduced carpal bones were fixed with 4 k - wires to maintain their anatomical relationships at 4 years followup , the patient did not have any pain or limitation of motion in his wrist . the range of wrist motion was 91% of contralateral normal wrist ( the wrist extension , flexion , radial deviation , and ulnar deviation angle was 60 , 35 , 24 , 38 , respectively ) . the grip and pinch strength were 85% and 87% of the normal side , respectively . the radiographs also showed maintenance of the carpal alignment and a magnetic resonance image scan of the scaphoid did not show any evidence of avascular necrosis [ figure 4 ] . four years after the surgery , ( a ) antero - posterior , ( b ) lateral radiographs , and ( c ) the magnetic resonance t1-weighted image showing the normal alignment of the carpus without any evidence of avascular necrosis of the scaphoid , ( d ) clinical photographs showing there are no limitations of wrist motion dorsal scaphoid dislocations are the rarest injury among scaphoid dislocations , and only four cases have been previously reported until now.1234 two of them are isolated dorsal dislocation of scaphoid without other carpal injuries , and another two cases are dorsal dislocation of scaphoid associated with axial dislocation of carpus.1234 complete dorsal dislocation of the scaphoid associated with dorsal perilunate dislocation without axial dissociation of carpus have not been reported until now to the best of our knowledge . the mechanism of injury in this patient was a fall from 3 m height but the patient did not remember the exact wrist position at the time of impact . nevertheless , the abrasion and ecchymosis of the thenar area of the injured hand indicated that the area of impact was the thenar area of the hand with the wrist in a hyperextended position . actually , this mechanism has been known to result in a transscaphoid perilunate dorsal dislocation.56 however , one difference between transscaphoid perilunate dorsal dislocation and this case is that the scaphoid dislocated dorsally without fracture . described that the injury involved a disruption of the distal carpus at the capitohamate joint and then extended proximally with disruption of the radioscaphocapitate , capitolunate and long radiolunate ligaments allowing the proximal scaphoid dislocation ( type ii scaphoid dislocation).7 they suggested that the mechanisms of injury attributed to both scaphoid dislocation and axial carpal dissociation include hyperextension injury with axial compression of the wrist.7 therefore , we suggested that the severe axial compression force combined with wrist hyperextension and midcarpal supination induced complete scaphoid dorsal dislocation with perilunate dislocation rather than the scaphoid fracture . this suggested mechanism was also partially agreed with the others who reported that the dorsal scaphoid dislocation may be induced with the force of hyperextension and supination.568 occasionally , this type of complex injury may be overlooked in the emergency room ; therefore , careful diagnostic evaluation is essential . initial diagnostic evaluation modalities are recommended to include anteroposterior , lateral , oblique and radioulnar deviation radiographs , as well as three - dimensional ct.9 however , standard radiographs and three - dimensional ct were sufficient to diagnose and determine a treatment option , in this case . most reports of scaphoid dislocations , with or without complex carpal injuries , indicated that the patients returned to their previous activities with minimal loss of motion after proper treatment.1011 proper treatment has been described as either closed or open reductions , regardless of the alignment achieved at the time of the reduction.37 interestingly , in cases where the scaphoid was completely dislocated and migrated out of the wrist area ( a bare scaphoid ) , the clinical treatment results have been free of complications , including avascular necrosis ; only one case of avascular necrosis of the scaphoid has been presented . these good outcomes may be the result of the rapid revascularization of the preserved intraosseous vascular supplies from the surrounding soft tissues.9 similarly , in less severe volar dislocations , the vascularity of the scaphoid was partly maintained by the intact soft tissue attachments , especially the scaphotrapezial ligament and dorsal capsular ligament.9 conclusively , in complex carpal injuries including complete carpal bone dislocation , the proper treatment option is open reduction and percutaneous k - wire fixation for maintaining carpal alignment . especially , in order to achieve rapid revascularization of dislocated carpal bone , repair of intercarpal ligament structures is essential .

acute kidney injury ( aki ) is a common condition among critically ill patients in the intensive care unit ( icu ) . acute kidney injury results in rapid loss of kidney function and worsens the patient 's prognosis . when severe , aki may necessitate the provision of renal replacement therapy ( rrt ) ; rrt can be applied through two main modalities : continuous rrt ( crrt ) or intermittent rrt ( irrt ) . both modalities provide satisfactory metabolic control and neither has been found superior in terms of survival [ 14 ] . however , among those who survive critical illness requiring rrt , failure to recover kidney function and progression to end - stage kidney disease ( eskd ) leading to dialysis dependence remains a significant medical and economic issue . a recent systematic review and meta - analysis suggested that among aki survivors , initial treatment with irrt might be associated with higher rates of dialysis dependence than initial crrt . pooled analyses from seven randomized controlled trials comparing 240 irrt patients with 232 crrt patients did not show a statistically significant difference in the risk of dialysis dependence between irrt and crrt . however , the point estimate was in the direction of better long - term renal outcomes with crrt ( relative risk 1.15 [ 95% ci : 0.781.68 ] ) . in addition , pooled analyses from 16 observational studies enrolling 1476 irrt patients and 2023 crrt patients demonstrated a significantly higher rate of dialysis dependence among survivors who initially received irrt as compared with crrt ( relative risk 1.99 [ 95% ci : 1.532.59 ] ) . these results were confirmed in a large retrospective cohort study including 2315 crrt recipients of whom 2004 ( 87% ) were 1 : 1 matched to 2004 irrt recipients . the matching was comprehensive and based on the history of chronic kidney disease , receipt of mechanical ventilation within 7 days of the initiation of rrt and logit of the propensity score for receipt of crrt ( within 0.2 sd ) . this study also showed that the risk of chronic dialysis was significantly lower among patients who initially received crrt versus irrt ( hazard ratio 0.75 [ 95% ci : 0.620.87 ] ) . based on these recent findings , we hypothesized that initial crrt might be economically superior compared with irrt and performed a cost - effectiveness analysis of crrt versus irrt in critically ill aki patients . we assumed a cohort of aki patients who would potentially be eligible for either irrt or crrt in the icu setting . we then modeled potential health gains and cost savings , comparing patients receiving irrt as the initial modality with those receiving crrt as the initial modality , all else being the same . using microsoft excel , we designed a decision analytic markov model . a markov model is a recursive modeling approach that spreads a cohort of patients through a series of transition probabilities across multiple health states [ 9 , 10 ] . health outcomes and healthcare costs are accumulated cyclically as the cohort evolves over time through the different health states . our model had two health states for aki survivors in the icu ( crrt and irrt ) and two health states for aki survivors discharged from the hospital ( dd : dialysis dependence and di : dialysis independence ) ( figure 1 ) . daily cycle was used over the 5 first years after rrt initiation in the icu and yearly cycle afterward . health outcomes were expressed in terms of life year gained ( lyg ) and quality - adjusted life years ( qalys ) . health outcomes and healthcare costs were simulated and averaged for a cohort of 1000 patients initiated on crrt and a cohort of 1000 patients initiated on irrt . the icu and hospital lengths of stay are supposed to be the same between both modalities . the model assumed that once patients become dialysis dependent , they can not recover their renal function and can only remain dialysis dependent or die . the icu and hospital lengths of stay are supposed to be the same between both modalities . the model assumed that once patients become dialysis dependent , they can not recover their renal function and can only remain dialysis dependent or die . as there is no evidence of survival differences between crrt and irrt [ 14 ] , we stipulated the same survival pattern would apply for both initial crrt and irrt . they were modeled with a single survival curve for both modalities using a weibull regression on three survival proportions , assumed to be 60% at discharge [ 11 , 12 ] , 46% at day 60 [ 11 , 12 ] and 37% at day 180 ( table 1 and figure 2a ) . table 1.continuous renal replacement therapy and irrt input valuescrrtirrtreferenceicu stay icu los ( days)1212 rrt duration ( days)77 switch from crrt to irrt ( % ) 30assumptionsurvival ( all cause death ) discharged alive from icu ( % ) 60.060.0[11 , 12 ] alive at 60 days ( % ) 46.046.0 alive at 180 days ( % ) 37.037.0dd among aki survivors dd at 90 days ( % ) 16.420.8 dd at 3 years ( % ) 21.726.6cost of implementing rrt acute rrt cost / day$858$226[14 , 15]health utilities icu stay0.130.13 di0.840.84 dd0.620.62healthcare costs di cost / day$31$31 dd cost / day$211$211los , length of stay ; icu , intensive care unit ; crrt / irrt , continuous / intermittent renal replacement therapy ; di , dialysis independence ; dd , dialysis dependence.this corresponds to a risk ratio of 0.80 for the base case ( 16.4/20.8% = 0.79 and 21.7/26.6% = 0.82 ) . figure 2:survival and cumulative risk of dialysis dependence assumptions per initial rrt modality in the icu . continuous renal replacement therapy and irrt input values los , length of stay ; icu , intensive care unit ; crrt / irrt , continuous / intermittent renal replacement therapy ; di , dialysis independence ; dd , dialysis dependence . this corresponds to a risk ratio of 0.80 for the base case ( 16.4/20.8% = 0.79 and 21.7/26.6% = 0.82 ) . survival and cumulative risk of dialysis dependence assumptions per initial rrt modality in the icu . , the time - dependent proportion of aki survivors becoming dialysis dependent was fitted from the study by wald et al . using a weibull regression on two data points : at day 90 and at the median follow - up of 3 years , i.e. day 1095 ( table 1 and figure 1b ) . continuous renal replacement therapy dialysis independence estimates were then obtained by applying a risk ratio to irrt estimates . in the base case , this risk ratio was 0.80 ( 16.4/20.8% = 0.79 and 21.7/26.6 = 0.82 ) . we accounted for the fact that it is relatively common practice to switch aki patients initiated on crrt to irrt as their hemodynamic status evolves favorably . in doing so , we assumed that switches from crrt to irrt will not alter the subsequent risk of dialysis dependence but would reduce the rrt daily implementation cost . in other words indeed , most of the studies retrieved in the literature compared initial rrt modalities only . we varied this proportion of crrt patients being switched to irrt over the icu stay from 0 to 60% , with a base case at 30% and assuming a constant daily rate of switch over the icu stay . all health state utilities and costs were assumed to be the same between crrt and irrt except the daily cost of the rrt implementation in the icu . therefore , the model only accounted for the cost of implementing crrt or irrt in the icu , the daily cost of dialysis independence and the daily cost of dialysis dependence in the outpatient setting . health utilities and costs assigned to each health state were taken from literature [ 5 , 1417 ] ( table 1 ) . all costs were inflated to 2013 $ us using the consumer price index for medical care services from the us bureau of labor statistics . all values were the same for both modalities , crrt and irrt , except the daily implementation cost [ 14 , 15 ] and the cumulative risk for dialysis dependence among survivors ( figure 2b ) . the daily cost of crrt was set at $ 858 , and the daily cost of irrt at $ 226 based on estimates from manns et al . converted and inflated to us$ 2013 . for the cost of crrt , we used conservatively the high estimate reported by manns et al . in lieu of the low one ( $ 586 ) . the resulting cost difference of $ 632 between the two rrt modalities falls within the interquartile range of the cost difference reported by srisawat et al . from $ 134 to $ 950 with a median at $ 331 ( $ us 2013 ) . in the base case analysis , we used a 5-year time horizon to compute the icer of initial crrt versus initial irrt and to compare the 5-year cumulative total cost and cost of dialysis dependence between the two initial rrt modalities . table 2.five-year cost - effectiveness analysis of initial crrt versus initial irrt ( undiscounted)crrtirrthealth outcomes lyg1.3871.387 qalys1.0931.078costs rrt modality$4046$1423 dialysis independence ( di)$12 380$11 642 dialysis dependence ( dd)$21 354$26 383 total$37 780$39 448cost - effectiveness analysis cost / lyg$27 248$28 451 cost / qalys$34 578$36 586 icer crrt versus irrt$116 121(crrt dominates)icer : incremental cost - effectiveness ratio = ( costcrrt costirrt)/(qalycrrt qalyirrt).crrt dominates irrt as qalycrrt > qalyirrt and costcrrt < costirrt . five - year cost - effectiveness analysis of initial crrt versus initial irrt ( undiscounted ) icer : incremental cost - effectiveness ratio = ( costcrrt costirrt)/(qalycrrt qalyirrt ) . first , we conducted a series of one - way sensitivity analysis and presented results as tornado diagram . second , we ran a two - way deterministic sensitivity analysis by varying the two key model parameters distinguishing crrt from irrt : the daily implementation cost difference and the cumulative risk of dialysis dependence . the daily implementation cost difference between crrt and irrt varied from $ 200 to $ 1000 ( base case at $ 632 ) and the risk ratio for dialysis dependence between crrt and irrt varied from 0.65 to 0.95 ( base case around 0.80 ) . finally , we re - ran all analyses twice , with a 1-year time horizon and a lifetime time horizon . we assumed a cohort of aki patients who would potentially be eligible for either irrt or crrt in the icu setting . we then modeled potential health gains and cost savings , comparing patients receiving irrt as the initial modality with those receiving crrt as the initial modality , all else being the same . using microsoft excel , we designed a decision analytic markov model . a markov model is a recursive modeling approach that spreads a cohort of patients through a series of transition probabilities across multiple health states [ 9 , 10 ] . health outcomes and healthcare costs are accumulated cyclically as the cohort evolves over time through the different health states . our model had two health states for aki survivors in the icu ( crrt and irrt ) and two health states for aki survivors discharged from the hospital ( dd : dialysis dependence and di : dialysis independence ) ( figure 1 ) . daily cycle was used over the 5 first years after rrt initiation in the icu and yearly cycle afterward . health outcomes were expressed in terms of life year gained ( lyg ) and quality - adjusted life years ( qalys ) . health outcomes and healthcare costs were simulated and averaged for a cohort of 1000 patients initiated on crrt and a cohort of 1000 patients initiated on irrt . the icu and hospital lengths of stay are supposed to be the same between both modalities . the model assumed that once patients become dialysis dependent , they can not recover their renal function and can only remain dialysis dependent or die . the icu and hospital lengths of stay are supposed to be the same between both modalities . the model assumed that once patients become dialysis dependent , they can not recover their renal function and can only remain dialysis dependent or die . as there is no evidence of survival differences between crrt and irrt [ 14 ] , we stipulated the same survival pattern would apply for both initial crrt and irrt . they were modeled with a single survival curve for both modalities using a weibull regression on three survival proportions , assumed to be 60% at discharge [ 11 , 12 ] , 46% at day 60 [ 11 , 12 ] and 37% at day 180 ( table 1 and figure 2a ) . table 1.continuous renal replacement therapy and irrt input valuescrrtirrtreferenceicu stay icu los ( days)1212 rrt duration ( days)77 switch from crrt to irrt ( % ) 30assumptionsurvival ( all cause death ) discharged alive from icu ( % ) 60.060.0[11 , 12 ] alive at 60 days ( % ) 46.046.0 alive at 180 days ( % ) 37.037.0dd among aki survivors dd at 90 days ( % ) 16.420.8 dd at 3 years ( % ) 21.726.6cost of implementing rrt acute rrt cost / day$858$226[14 , 15]health utilities icu stay0.130.13 di0.840.84 dd0.620.62healthcare costs di cost / day$31$31 dd cost / day$211$211los , length of stay ; icu , intensive care unit ; crrt / irrt , continuous / intermittent renal replacement therapy ; di , dialysis independence ; dd , dialysis dependence.this corresponds to a risk ratio of 0.80 for the base case ( 16.4/20.8% = 0.79 and 21.7/26.6% = 0.82 ) . figure 2:survival and cumulative risk of dialysis dependence assumptions per initial rrt modality in the icu . continuous renal replacement therapy and irrt input values los , length of stay ; icu , intensive care unit ; crrt / irrt , continuous / intermittent renal replacement therapy ; di , dialysis independence ; dd , dialysis dependence . this corresponds to a risk ratio of 0.80 for the base case ( 16.4/20.8% = 0.79 and 21.7/26.6% = 0.82 ) . survival and cumulative risk of dialysis dependence assumptions per initial rrt modality in the icu . for both initial crrt and irrt , the time - dependent proportion of aki survivors becoming dialysis dependent was fitted from the study by wald et al . using a weibull regression on two data points : at day 90 and at the median follow - up of 3 years , i.e. day 1095 ( table 1 and figure 1b ) . continuous renal replacement therapy dialysis independence estimates were then obtained by applying a risk ratio to irrt estimates . in the base case , this risk ratio was 0.80 ( 16.4/20.8% = 0.79 and 21.7/26.6 = 0.82 ) . we accounted for the fact that it is relatively common practice to switch aki patients initiated on crrt to irrt as their hemodynamic status evolves favorably . in doing so , we assumed that switches from crrt to irrt will not alter the subsequent risk of dialysis dependence but would reduce the rrt daily implementation cost . in other words , initial crrt patients switched to irrt were applied the initial crrt outcomes . indeed , most of the studies retrieved in the literature compared initial rrt modalities only . we varied this proportion of crrt patients being switched to irrt over the icu stay from 0 to 60% , with a base case at 30% and assuming a constant daily rate of switch over the icu stay . all health state utilities and costs were assumed to be the same between crrt and irrt except the daily cost of the rrt implementation in the icu . therefore , the model only accounted for the cost of implementing crrt or irrt in the icu , the daily cost of dialysis independence and the daily cost of dialysis dependence in the outpatient setting . health utilities and costs assigned to each health state were taken from literature [ 5 , 1417 ] ( table 1 ) . all costs were inflated to 2013 $ us using the consumer price index for medical care services from the us bureau of labor statistics . all values were the same for both modalities , crrt and irrt , except the daily implementation cost [ 14 , 15 ] and the cumulative risk for dialysis dependence among survivors ( figure 2b ) . the daily cost of crrt was set at $ 858 , and the daily cost of irrt at $ 226 based on estimates from manns et al . converted and inflated to us$ 2013 . for the cost of crrt , we used conservatively the high estimate reported by manns et al . in lieu of the low one ( $ 586 ) . the resulting cost difference of $ 632 between the two rrt modalities falls within the interquartile range of the cost difference reported by srisawat et al . from $ 134 to $ 950 with a median at $ 331 ( $ us 2013 ) . in the base case analysis , we used a 5-year time horizon to compute the icer of initial crrt versus initial irrt and to compare the 5-year cumulative total cost and cost of dialysis dependence between the two initial rrt modalities . table 2.five-year cost - effectiveness analysis of initial crrt versus initial irrt ( undiscounted)crrtirrthealth outcomes lyg1.3871.387 qalys1.0931.078costs rrt modality$4046$1423 dialysis independence ( di)$12 380$11 642 dialysis dependence ( dd)$21 354$26 383 total$37 780$39 448cost - effectiveness analysis cost / lyg$27 248$28 451 cost / qalys$34 578$36 586 icer crrt versus irrt$116 121(crrt dominates)icer : incremental cost - effectiveness ratio = ( costcrrt costirrt)/(qalycrrt qalyirrt).crrt dominates irrt as qalycrrt > qalyirrt and costcrrt < costirrt . five - year cost - effectiveness analysis of initial crrt versus initial irrt ( undiscounted ) icer : incremental cost - effectiveness ratio = ( costcrrt costirrt)/(qalycrrt qalyirrt ) . first , we conducted a series of one - way sensitivity analysis and presented results as tornado diagram . second , we ran a two - way deterministic sensitivity analysis by varying the two key model parameters distinguishing crrt from irrt : the daily implementation cost difference and the cumulative risk of dialysis dependence . the daily implementation cost difference between crrt and irrt varied from $ 200 to $ 1000 ( base case at $ 632 ) and the risk ratio for dialysis dependence between crrt and irrt varied from 0.65 to 0.95 ( base case around 0.80 ) . finally , we re - ran all analyses twice , with a 1-year time horizon and a lifetime time horizon . continuous renal replacement therapy was associated with a marginally greater gain in qaly as compared with irrt ( 1.093 versus 1.078 ) . despite higher upfront average costs for crrt patients in the icu ( $ 4046 for crrt versus $ 1423 for irrt ) , the 5-year total cost including the cost of dialysis dependence was lower for a crrt patient ( $ 37 780 for crrt versus $ 39 448 for irrt on average ) . the 5-year undiscounted cumulative total cost of the initial irrt cohort exceeded that of the initial crrt cohort within 2-year post - rrt initiation ( figure 3 ) . the cost of dialysis dependence in the initial crrt cohort was constantly lower than that for the initial irrt cohort ( figure 3 ) . figure 3:five - year cumulative cost difference between initial crrt and initial irrt ( undiscounted ) . five - year cumulative cost difference between initial crrt and initial irrt ( undiscounted ) . the icer of crrt versus irrt was negative ( $116 121 ) , meaning that crrt dominated irrt ( qalycrrt > qalyirrt and costcrrt < costirrt ) and was thus cost - saving ( table 2 ) . this dominance was confirmed in the 5-year discounted analysis ( icer = $106 527 ) and the lifetime discounted analysis ( icer = $196 956 ) but not in the 1-year analysis ( icer = $ 400 701 ) . figure 4 shows the tornado diagrams obtained by varying seven parameters from low to high base . the risk ratio of dialysis dependence of initial crrt as compared with initial irrt and the health utility attributed to the dialysis independence state contributed the most to the variability of the icer . the latter is explained by the fact that as this utility ( low case at 0.67 ) gets closer to one of the dialysis dependence states ( base case at 0.62 ) , the denominator of the icer approaches zero ( i.e. nearly identical qaly gained between initial crrt and initial irrt ) . the other key parameter contributing the most to the variability of the icer was the daily cost difference between crrt and irrt . the risk of dialysis dependence was the only parameter that noticeably resulted in an icer of > 0 ( qalycrrt > qalyirrt and costcrrt > costirrt ) . figure 5 presents a two - way sensitivity analysis , varying the risk ratio for dialysis dependence and the daily implementation cost at the same time . initial crrt was predominantly cost - effective as compared with initial irrt at the generally prevailing $ 50 000/qaly threshold . continuous renal replacement therapy was associated with a marginally greater gain in qaly as compared with irrt ( 1.093 versus 1.078 ) . despite higher upfront average costs for crrt patients in the icu ( $ 4046 for crrt versus $ 1423 for irrt ) , the 5-year total cost including the cost of dialysis dependence was lower for a crrt patient ( $ 37 780 for crrt versus $ 39 448 for irrt on average ) . the 5-year undiscounted cumulative total cost of the initial irrt cohort exceeded that of the initial crrt cohort within 2-year post - rrt initiation ( figure 3 ) . the cost of dialysis dependence in the initial crrt cohort was constantly lower than that for the initial irrt cohort ( figure 3 ) . figure 3:five - year cumulative cost difference between initial crrt and initial irrt ( undiscounted ) . five - year cumulative cost difference between initial crrt and initial irrt ( undiscounted ) . the icer of crrt versus irrt was negative ( $116 121 ) , meaning that crrt dominated irrt ( qalycrrt > qalyirrt and costcrrt < costirrt ) and was thus cost - saving ( table 2 ) . this dominance was confirmed in the 5-year discounted analysis ( icer = $106 527 ) and the lifetime discounted analysis ( icer = $196 956 ) but not in the 1-year analysis ( icer = $ 400 701 ) . figure 4 shows the tornado diagrams obtained by varying seven parameters from low to high base . the risk ratio of dialysis dependence of initial crrt as compared with initial irrt and the health utility attributed to the dialysis independence state contributed the most to the variability of the icer . the latter is explained by the fact that as this utility ( low case at 0.67 ) gets closer to one of the dialysis dependence states ( base case at 0.62 ) , the denominator of the icer approaches zero ( i.e. nearly identical qaly gained between initial crrt and initial irrt ) . the other key parameter contributing the most to the variability of the icer was the daily cost difference between crrt and irrt . the risk of dialysis dependence was the only parameter that noticeably resulted in an icer of > 0 ( qalycrrt > qalyirrt and costcrrt > costirrt ) . figure 5 presents a two - way sensitivity analysis , varying the risk ratio for dialysis dependence and the daily implementation cost at the same time . initial crrt was predominantly cost - effective as compared with initial irrt at the generally prevailing $ 50 000/qaly threshold . figure 5:two - way deterministic sensitivity analysis . initial treatment with crrt is cost - effective when compared with irrt among critically ill patients with aki by reducing the costs associated with the greater rate of long - term dialysis dependence . to our knowledge , this is the first economic analysis focusing on dialysis dependence among aki survivors . in the light of a recent large observational cohort study , confirming previous meta - analytic findings , we demonstrated through a comprehensive model the potential economic advantage of crrt compared with irrt , despite the higher crrt upfront cost in the icu . de smedt et al . concluded that crrt presented neither health nor economic advantage over irrt . using a lifetime horizon , klarenbach et al . reported that crrt resulted in equivalent health outcomes with irrt but was can$3679 ( $3309 ) more costly due to the higher direct costs of providing crrt . using a 2-year life time horizon , de smedt et al . reported that the supplementary cost per additional qaly associated with crrt reached 114 012 /qaly ( $156 600 ) , far exceeding the willingness to pay a threshold of 30 000 /qaly ( $41 200 ) . in contrast , we found that crrt dominated irrt . in our analysis , only the 1-year time horizon yielded an icer above the 50 000 $ /qaly threshold , but both the 5-year and the lifetime horizons resulted in crrt dominance over irrt . at 400 701 $ /qaly in the 1-year analysis , the icer reached the 50 000 $ /qaly threshold a day 821 ( 2.2 years ) and then became negative from day 990 ( 2.7 years ) indicating crrt dominance over irrt . continuous renal replacement therapy was associated with a marginally greater gain in qalys as compared with irrt . in addition , and despite higher icu costs for crrt , the cumulative total cost including the cost of dialysis dependence was lower for crrt . our model explicitly includes the effect of both initial modalities on renal recovery among survivors . to model the risk of chronic dialysis between the two initial modalities , we used latest observational estimates as obtained by robust propensity score matching methodology on a large sample of patients . this research confirmed previous meta - analysis findings and consolidated the fact that initial crrt may actually lead to less dialysis dependence as compared with initial irrt . we translated this important clinical outcome into an economic assessment and reported an economic advantage of initial crrt over irrt . several reasons have led us to use the large observational study instead of the meta - analysis to document the risk of chronic dialysis between initial irrt and initial crrt in our model . first , the study is to our knowledge the only original study addressing the issue with direct data rather than derived data . second , the study is of high quality , using propensity matching for treatment allocation and running multiple sensitivity analyses to evaluate the robustness of the data . propensity matching for treatment allocation is precisely meant to minimize the risk of allocation bias , one of the principal limitations of observational studies on which the meta - analysis is largely based . third , the effect seen in the large observational study is less than that in the meta - analysis , allowing our analysis to be more conservative . finally , the meta - analysis included only papers published before 2012 and thus omitted the study by wald et al . , which is by far the largest and most recent study published to date on the topic . our analysis assumed a cohort of aki patients who would potentially be eligible for either irrt or crrt in the icu . as such , our findings do not apply to those clinical circumstances where a specific rrt modality is particularly recommended or preferable . the post - aki dialysis - dependent and dialysis - independent patients ' quality - of - life and costs , we used as surrogates eskd patients and non - eskd patients who otherwise share similar characteristics . we have used these surrogates to compute the ongoing costs of dialysis dependence and independence . however , post - aki patients may actually have worse quality - of - life than standard eskd patients . therefore , they may possibly have higher medical costs as well . for reasons of clarity , we only accounted for the costs driven by the choice of rrt in the icu and by the subsequent daily medical costs for dialysis dependence and dialysis independence for outpatients , as all other costs were assumed to be the same between both modalities . as health economics investigates the incremental ratio between multiple strategies , those costs were not indispensable . their inclusion in the icer computation would not have changed the conclusion of the model . with regard to the cost difference between crrt and irrt in the icu , we used the estimates reported by srisawat et al . from the best kidney investigators , probably one of the most complete and global cost assessments of acute rrt . a number of other cost studies have been done over the years , but they were all consistent with the best study , as summarized elsewhere . costs of chronic dialysis for outpatients encompassed only direct medical costs from an us third - party public payer perspective . it should be noted that these costs are similar to and consistent with public sector costs in germany and in australia . patients initiated on crrt can be switched to irrt when clinical conditions permit , in particular once patients become hemodynamically stable while acute rrt is still required . therefore , switching from initial crrt to irrt during the icu stay is relatively common in settings where both modalities are available . as there is a paucity of data on that specific issue , we modeled the possibility of switch from initial crrt to irrt over the icu stay as sensitivity analysis . we applied the same renal outcome of those patients receiving initial crrt only to those initial crrt patients being switched to irrt . in effect , the results presented in the literature compared initial modalities only . this has only enhanced the economic attractiveness of crrt versus irrt , proving similar renal and health outcomes but at a slightly decreased cost of acute rrt , irrt being less expensive than crrt . we assumed a constant daily rate of switch from crrt to irrt but varying the overall switch rate during the icu stay from 0 to 60% . in all likelihood , the switch rate from crrt to irrt during the icu stay greatly depends on the local setting as well as the availability of modalities and staff . in some countries , no crrt patient will be switched to irrt before the patient is ready for discharge whereas in others , crrt patients will be transitioned to irrt when hemodynamically stable , generally close to discharge but not necessarily . the data from the atn trial suggest switching rates from initial crrt to irrt between 20 and 40% . our findings put a figure on recent observational studies that showed the potential protective effect of initial crrt against dialysis dependence among aki survivors . we also echo a recent editorial , challenging the economic case for using initial conventional irrt in the icu . we show that crrt might be less costly in the long run by diminishing the necessity of chronic dialysis among survivors . this also translates into quality - of - life benefits for survivors knowing the psychosocial burden of chronic dialysis . in conclusion , our analysis suggests that initial crrt is cost - effective compared with initial irrt by reducing the rate of long - term dialysis dependence among critically ill aki survivors . knowledge of such economic advantages has implications for public health planning , resource allocation and physician choices .

a supernumerary tooth is a development anomaly of number characterized by the presence of tooth in addition to the normal series . its prevalence rates of reported in the literature vary between 0.1% and 3.6% in the permanent dentition depending on the respective population . supernumerary teeth can occur as singles , multiples , unilaterally , or bilaterally and in the maxilla , the mandible , or both . according to alberti , only 25% of all mesiodentes spontaneously erupt into the oral cavity . in general , they remain impacted and asymptomatic ; and are commonly discovered during the routine radiographic examination . there are several hypotheses which have been proposed to explain the occurrence of supernumerary teeth , and their etiology remains unclear . a combination of environmental and genetic factors has been proposed to explain supernumerary tooth occurrence . a range of complications varying from crowding to cyst formation can be caused by supernumerary tooth . several studies have applied cone - beam computed tomography ( cbct ) to accurately diagnose supernumerary teeth with the potential to overcome most of the technical limitations of the plain film projection and the capability of providing a high - resolution three - dimensional ( 3d ) representation of the maxillofacial tissues in a cost and dose efficient manner . for the treatment , it depends on the type , position of supernumerary teeth , and the possibility to produce complications which are identified both clinically and radiographically . the aim of this article was to describe a rare case of palatal placed , inverted , and impacted mesiodens associated to two supernumerary teeth delaying the eruption of permanent central incisors in the case of a healthy 8-year - old girl monitored at the oral surgery service while discussing the outcomes of using cbct to diagnose the accurately position of supernumerary teeth and to choose the appropriate management technique . an 8-year - old female patient visited the university hospital due to delayed eruption of her right permanent maxillary central incisor . her medical history revealed no systemic diseases , and the dental history proved no facial trauma or other tooth abnormalities have occurred . she avowed that she was operated on , at the age of seven years , for a supernumerary tooth delaying the eruption of the left permanent maxillary central incisor . a previous panoramic radiograph ( one year ago ) revealed the presence of a mesiodens associated to two supernumerary teeth [ figure 1 ] . panoramic radiograph shows the impacted permanent upper central incisors and the presence of two supernumerary teeth and a mesiodens clinical examination revealed a mixed dentition and the absence of the right maxillary permanent central and lateral incisors [ figure 2 ] . intraoral photograph shows mixed dentition , clinical absence of the maxillary right central and lateral incisors the patient was referred to cbct examination of the maxilla to assist the localization and orientation of the mesiodens . cbct images were requested for diagnosing accurately the morphology and exact location of the mesiodens and the radicular formation of the permanent maxillary central incisors . the images were created and viewed interactively using a dental computed tomography ( ct ) software program . the 3d cbct panorex showed the impaction of the right permanent maxillary incisor and the presence of a supernumerary tooth ; moreover , the axial slice image of cbct revealed the palatal position of the impacted and inverted mesiodens and the sagittal slices showed that the supernumerary tooth was in palatal position over the impacted permanent maxillary central incisor [ figure 3 ] . the panoramic reconstruction ( a ) , axial ( b ) and sagittal ( c ) slices of cone beam computed tomography show an impacted , palatal placed , and inverted mesiodens associated to a supernumerary tooth a comprehensive treatment plan was formulated , which included surgical extraction of the mesiodens and the supernumerary tooth [ figure 4 ] . the patient was administered local anesthesia . using a mucoperiosteal elevator , hemostasis was achieved and the flap was replaced back and sutured . for the mesiodens , a simple palatal anteroposterior incision was done and the extraction followed . postchirurgical instructions were explained to the patient along a prescription of antibiotic and analgesic treatment . the recall visits were scheduled for the following week to remove suture and evaluate the healing process . the patient was kept under the observation until the successful eruption of permanent central and lateral incisors . ( a ) a palatal mucoperiostal flap was reflected and the bone overlying the impacted supernumerary tooth was removed . supernumerary teeth or hyperdontia can be defined as teeth that exceed the normal dental complement , regardless of their locations and morphologies . it is more common in the central region of the upper or lower jaw ; however , its occurrence in the mandible is rare . mesiodens is the most common type of supernumerary teeth and is located in the midline between the two upper central incisors . its prevalence in general population ranges between 0.15% and 1.9% and it is reported to be more common in males rather than females . the frequency of mesiodens has been estimated to be 0.45% in caucasians , 0.4% in finnish , 1.43% in norwegians , and 2.2% in hispanic populations . variations due to differences in demographic and environmental susceptibilities may have an impact on the reported prevalence . supernumerary teeth are classified based on morphology ( conical , tuberculate , and supplemental ) , location ( mesiodens , paramolar , distomolar , and parapremolar ) , position ( buccal , palatal , and transverse ) , and orientation ( vertical or normal , inverted , transverse , or horizontal ) . in our case the present case is unique in several aspects : first , the occurrence of mesiodens is very rare in the mid palatal region . it seems that due to the erupting force of the central incisor the tooth might have shifted to the mid - palatal region . second , the presence of two supernumerary teeth delaying the eruption of upper permanent central incisors . although the abundant information is available on normal tooth development , the genetic etiology and molecular mechanisms that lead to congenital deviations in tooth number have not been clearly understood . the literature reports three theories concerning the cause of mesiodentes , but this subject remains controversial . the first one was a phylogenetic relic of extinct ancestors who had three central incisors known as phylogenetic reversion ( atavism ) . the second theory known as dichotomy suggests that the tooth bud is split to create two teeth , one of which is the mesiodens . although no investigation proved the hereditary condition of mesiodens , genetics are also thought to contribute to its development , as such occurrence has been diagnosed in twins , siblings , and sequential generations of a single family . sedano and gorlin proposed a genetic theory in which mesiodens is an autosomal dominant trait with the lack of penetrance in some generations . it has been suggested that the environmental factors might have an influence on genetic susceptibility which could probably be a cause for negative family history in our case . a sex - linked pattern has also been proposed , as males are affected twice as frequently as females . mesiodens is frequently associated with several craniofacial disturbances , including cleft lip and palate , and cleidocranial dysostosis ; and to a lesser extent with gardner 's syndrome or chondroectodermal dysplasia . however , various complications might occur as a result of the presence of supernumerary teeth . in addition , the supernumerary tooth is the common reason for the delayed or failure of eruption of permanent teeth in the premaxillary region . it can cause also crowding , displacement , and rotation of the adjacent teeth ( 2860% ) . secondary alveolar bone grafting may be compromised due to the supernumerary teeth in patients with cleft lip and palate . moreover occasionally , dentigerous cyst formation may occur ( 11% of the cases in an 11-year retrospective study of asaumi et al . ) or the extra tooth might erupt into the nasal cavity . in our case , the presence of supernumerary teeth had caused the failure of eruption of maxillary central incisors . for preoperative examination , intraoral and panoramic radiography has been used . however , alone , they are insufficient for determining the exact location of supernumerary and impacted teeth , due to the image superimposition . in the present case , cbct provided valuable information that helped us to determine the morphology and the exact 3d position of the mesiodens , supernumerary tooth , and the permanent maxillary impacted right central incisor . in fact , standard radiographs ( periapical radiograph and orthopantomograph ) could not provide information about the 3d relationship of these supernumeraries to the associated teeth and neighboring structures , which is important in making decisions about treatment options . in the past decade , detailed information has been obtained by ct which can provide highly detailed 3d information either directly or with the aid of dental software , avoiding superposition of bony and dental structures . however , the disadvantages of its relatively high cost and high radiation dose outweigh these advantages in the context of impacted and supernumerary teeth . furthermore , cbct provides a picture of supernumeraries in 3 planes and in relation to neighboring structures at a significantly lower radiation dose when compared with traditional spiral ct . therefore , we recommend that cbct be used routinely for the treatment of supernumerary teeth , especially for those cases with multiple impaction , those with local malocclusions , or with high - situated supernumeraries . for those supernumeraries that should be removed , the comprehensive pictures in 3 planes provided by cbct can assist surgeons in choosing the appropriate surgical approach , identifying the tooth that should be extracted , and reducing the amount of surgical trauma on the adjacent hard and soft tissues . for the treatment , it depends on the type and location of the supernumerary teeth and on its potential effect on the adjacent hard and soft tissue structures . the management of a supernumerary tooth should form part of a comprehensive treatment plan and should not be considered in isolation . first , to remove the supernumerary tooth as soon as it has been diagnosed and the second to leave the supernumerary tooth as such till the root development of adjacent teeth is complete in order to prevent damage to their root apices . if teeth are causing no complications and are not likely to interfere with orthodontic tooth movement , they can be monitored with the yearly radiographic review . the patient should be warned of complications , such as cystic change and migration with damage to nearby roots . if the patient does not wish to risk such complications , it is acceptable to remove supernumerary teeth . however , if supernumerary teeth are associated with complications , it is usual to extract such teeth , which usually involves a surgical procedure . early extraction of supernumeraries , causing incisor impaction , may have the benefit of minimizing loss of eruptive potential , space loss , and centerline displacement . rotberg recommended the removal of the supernumerary tooth as soon as it has been discovered and ideally before the age of 5 years so that root formation of the associated permanent incisors is incomplete . however , koch stated that no immediate removal of supernumerary teeth is necessary if no pathology is present , no orthodontic treatment involving the region of supernumerary tooth is planned , and the child is seen regularly by a dentist : wait and see behavior . reported based on a retrospective analysis the ideal age of removal of a supernumerary tooth is 67 years . hogstrom and andersson suggested two different opinions where the supernumerary tooth should be removed as early as upon identification or should wait until complete root formation of adjacent teeth . however , the potential disadvantages associated with this deferred surgical plan include loss of eruptive force of adjacent teeth , loss of space and crowding of the affected arch , and possible midline shifts . in the present case , surgical extraction of supernumerary teeth and mesiodens was made as soon as it was diagnosed , without any damage to adjacent teeth . the majority of delayed permanent incisors erupt spontaneously if sufficient space is created at the time of removal of the supernumerary tooth and maintenance of postoperative space is needed . however , if there was not space for delayed tooth , we have to re - establish it by orthodontic treatment . a spontaneous eruption of the impacted permanent maxillary central incisor following supernumerary removal is suggested to be in the range of 5475% and within 1618 months of the removal of the supernumerary tooth . smailiene et al . have suggested that spontaneous eruption of impacted maxillary incisor has an advantage over its surgical - orthodontic treatment . a recent study revealed that if the supernumerary tooth was of conical form then the associated permanent incisor was almost twice as likely to erupt spontaneously as when the supernumerary was of the tuberculate form . a retrospective analysis of factors influencing the eruption of delayed permanent incisors after supernumerary tooth removal revealed that spontaneous eruption occurred in 89.4% of delayed permanent teeth . the mean time to eruption was 9.2 months ( median = 7 months ) . however , there was no statistically significant association between tooth eruption and root maturity or the degree of vertical impaction . there was an association between eruption and the degree of the angle of impaction of the permanent incisor . research data indicate that the spontaneous eruption of impacted maxillary incisor may take up to 3 years and sometimes orthodontic treatment is necessary to achieve adequate alignment of the erupted tooth in the dental arch . in the present case since the root was not completely formed it was desirable to wait for a spontaneous eruption . because children are more prone to vagal stimulation , bradycardia should be a consideration when palatal flaps are reflected for procedures such as removal of a mesiodens . it is caused by the stimulation of the trigeminovagal reflex : the afferent impulses are caused by the stimulation of the nasoplatine nerve and the efferent pathway is the vagus nerve . therefore , the infiltration with local anesthesia of the nasopalatine nerve should block the response . management includes halting the procedure until normal sinus rhythm returns and administration of atropine and/or glycopyrrolate . supernumerary teeth may occur unilaterally or bilaterally , single or multiple , and at any region of the dental arch . a variety of complications was associated with their presence which range from crowding to cyst formation . cbct yielded accurate 3d information relative to the orientation , sagittal position , local disorders , and neighboring anatomic structures . therefore , we suggest routine use of cbct in cases of supernumeraries to choose the accurate diagnosis and management

asthma affects up to 12% of adults and 25% of children in australia and there is a significant undiagnosed cohort . although we have a range of medications that are effective in their own right , there is a need to further improve the management of this disease . this involves better clinical programs and an improved understanding of the basic mechanisms of asthma so that new ways can be introduced which work synergistically with conventional asthma medications to modify airway inflammation . asthma is a disease characterized by both bronchiolar smooth muscle constriction and a chronic airway inflammation . some of the features of the disease are modelled in the well - characterized acute and chronic models of ova - induced allergic airway inflammation in mice [ 2 , 3 ] . the inflammatory component of asthma is generally thought of as a th2-driven process , involving eosinophil recruitment to the airways and consequent damage , including airway epithelial cell death . damage and repair eventually lead to a remodelling of the airways which increases the sensitivity of the airway muscle to cholinergic agonists and further restricts airflow . however , other inflammatory signalling pathways may also play a significant role in the pathogenesis and progression of the disease . of particular interest is the role of the il-1 family of cytokines that are key components of the innate immune response . il-1 and il-18 are activated by cytosolic multiprotein complexes called inflammasomes [ 6 , 7 ] . inflammasomes have been best characterized in the monocyte - macrophage cell lineage , but recent evidence indicates that gingival ( and perhaps other ) types of epithelial cells may also contain these structures . their generic structure includes ( i ) a member of the nucleotide - binding oligomerization domain- ( nod- ) like receptor ( nlr ) family of pattern recognition molecules specific for each type of inflammasome , ( ii ) apoptosis - associated speck - like protein containing a caspase - recruitment domain ( asc ) , and ( iii ) caspase-1 . other inflammatory caspases or caspase - regulatory molecules such as x - linked or neuronal inhibitor of apoptosis proteins , xiap and niap , respectively , may also be recruited . different types of inflammasome ( e.g. , nlrp1 , nlrp3 , ipaf , and aim2 ) have been identified based on the nlr component ( or the non - nlr equivalent ) which forms the complex . of these the best characterized is the nlrp3 inflammasome which plays a predominant role in il-1 and il-18 production . in macrophages , binding of ligands such as lipopolysaccharide ( lps ) to membrane toll - like receptor 4 ( tlr-4 ) triggers the synthesis of pro - il-1 while a number of danger signals including molecules released from necrotic cells ( e.g. , atp and uric acid ) promote assembly of the nlrp3 inflammasome complex , activation of caspase-1 from its precursor , processing of il-1 to its active form , and release of il-1 from the cells . an early protective role for inflammasomes might be predicted by the hygiene hypothesis , whereby exposure to microbes and their products ( such as lps ) early in life is thought to protect against development of asthma , perhaps by a skewing of the immune response away from one dominated by th2 cytokines . however , current evidence would favour a proinflammatory role for il-1 since ( i ) there are increased levels of serum , balf , and bronchial epithelial il-1 in human asthmatics , compared to healthy subjects [ 1012 ] , ( ii ) increase in serum il-1 has also been reported in primates , ( iii ) il-1 levels were decreased 2-fold in the bronchial epithelium following inhalation of beclomethasone dipropionate ( as measured by an immunohistological technique ) , and ( iv ) administration of tnf- and il-1 induces airway hyper - reactivity , a feature of asthma [ 15 , 16 ] . il-18 , another potent pro - inflammatory cytokine whose maturation requires activation of caspase-1 on the inflammasome , is typically considered as a th1 cytokine due to its effects associated with ifn-. increased serum il-18 has also been described in asthmatics [ 1719 ] . finally , danger signal molecules such as uric acid and extracellular atp have been shown to mediate inflammasome - dependent inflammation in experimental rodent models of lung injury and asthma , respectively . in addition to providing a physical barrier to inhaled pathogens , allergens , and other foreign agents , the airway mucosa ( epithelium and secretions ) has a number of potential mechanisms by which it can contribute to innate immune defences in the lung . loss of the integrity of the airway epithelium is widely thought to be a critical component in the pathogenesis of asthma . to our knowledge , there has been no systematic study of the inflammasome in airway epithelium . in this study , we have looked for evidence of nlrp3 inflammasome involvement in ova - induced airway inflammation in mice , as a model of human asthma , as well as in primary bronchial epithelial cultures . rabbit polyclonal antibodies ( abs ) to il-1 , nlrp3 , total caspase-1 ; goat abs to caspase-1 p10 and p20 active subunits ; and mouse monoclonal ab ( mab ) to sp - d were from santa cruz biotechnology ( santa cruz , ca , usa ) . other rabbit abs were asc from abcam ( cambridge , uk ) , ccr3 from epitomics ( burlingame , cl , usa ) , and il-18 from rockland ( gilbertsville , pennsylvania , usa ) . secondary abs were sheep f(ab)2 anti - rabbit igg ( cy3 ) , goat f(ab)2 anti - rabbit igg ( fitc ) , rabbit anti - goat igg ( cy3 ) , sheep f(ab)2 anti - mouse igg ( cy3 ) , ( sigma - aldrich chemicals , st louis , mo , usa ) , and a donkey f(ab)2 anti - mouse igg dylight594 ( jackson immunoresearch , west grove , pa , usa ) . a classical mouse model that induces strong eosinophilic inflammation , airway hyper - responsiveness , and vascular and parenchymal changes after sensitisation and challenge with ova was used to induce inflammation . all experiments were performed under the university of adelaide animal ethics committee approval number m-57 - 2007 , and in compliance with principles of animal care publication number 86 - 23 of the national institute of health and the australian code of practice for the care and use of animals for scientific purposes , 6th edition . female balb / c mice ( age 46 weeks ; specific pathogen free ) were purchased from the university of adelaide , adelaide , australia . three mice were set aside for analysis of inflammasome components in the absence of any stimulus . the remaining mice were divided into two experimental groups ( n = 8 in each group ) and housed in plastic cages ( 38 25 cm ) at 21c with a 14 h light/10-h dark cycle . ova - treated mice received 50 g of chicken ova in 1 ml of alhydrogel ( csl , parkville , australia ) in 0.9% sterile saline , i.p . on days 0 and 14 . mice sensitized to ova were then aerochallenged with 10 mg / ml ova in 0.9% saline from day 22 to day 32 , for 30 min , three times a day , every 2nd day , using a side - stream nebulizer , which produced particles of 13 m ( fisher and paykel , sydney , australia ) . dose of pentobarbitone sodium ( 50 mg kg ) , 22 h after the last nebulization . the trachea was cannulated with a blunted 19-gauge needle and bronchoalveolar lavage fluid ( balf ) was collected by lavaging the lungs three times by instilling and withdrawing the same volume ( 1 ml ) of ice - cold hanks buffered salt solution ( hbss , ph 7.4 ) . one part of the balf sample was immediately cytospun onto slides and the other part was centrifuged to obtain supernatant for cytokine and uric acid assay . tissue samples were archived as appropriate for various downstream measurements , including standard assessments of airway and tissue eosinophilia and lung histopathology . samples of mouse lung tissue were immediately placed into rna later ( applied biosystems / ambion , usa ) . tissue was homogenized using a tissueruptor ( qiagen pty ltd , australia ) and rna extracted using an rneasy mini kit ( qiagen pty ltd , australia ) . an on - column dnase treatment was performed using an rnase - free dnase set ( qiagen pty ltd , australia ) . rna quality was checked using an experion rna stdsens kit on the experion electrophoresis station ( biorad laboratories inc , australia ) . mouse rna samples obtaining rqi of 710 ( green ) were used in the subsequent array analysis . rna content was quantified using a nano drop 1000 spectrophotometer ( thermo scientific , usa ) . 1000 ng of rna was reverse transcribed into cdna using the rt first strand kit ( qiagen pty ltd , australia ) . the incubation steps for the reaction were performed on a mycycler thermal cycler ( biorad laboratories inc , australia ) . mouse cdna samples were combined with rt sybr green / fluorescein qpcr master mix with nuclease - free sterile h2o ( qiagen pty ltd , australia ) and then added across an entire rt2 profiler pcr mouse inflammasome array ( pamm-097a ) 96-well plate . each mouse sample ( n = 8 from each group ) was tested on a separate 96-well array plate containing a panel of 84 wells pertaining to different genes of the inflammasome pathway , 5 house keeping control wells , 1 genomic dna control well , 3 reverse transcription control wells , and three positive pcr control wells . pcr was performed using an icycler with iq5 software ( biorad laboratories inc , australia ) and cq data was then analysed by the ct method using the rt profilier array data spreadsheet ( qiagen pty ltd , australia ) . serum cytokines were measured by bioplex as per the manufacturer 's instructions ( biorad laboratories inc , australia ) . in brief , the concentration of total protein per sample was determined by mini bradford assay ( biorad laboratories inc , australia ) using standards of bovine serum albumin ( sigma - aldrich chemicals , st louis , mo , usa ) . samples were normalised to 100 g total protein and analysed in duplicate using a bioplex promouse cytokine 8 plex magnetic bead array . plate data was collected using a bioplex 200 suspension array system and analysed using the bioplex manager 5 software ( biorad laboratories inc , australia ) . paraffin tissue sections of 5 m thickness were treated for antigen retrieval by microwave heating in 10 mm citrate buffer ph 6.0 unless otherwise stated . tissue sections were also heated in 10 mm tris edta buffer ph 9.0 for costaining of sp - d with caspase-1 , and digested with 1 mg / ml proteinase k ( promega , fitchburg , wisconsin , usa ) for staining of p10 and p20 caspase-1 subunits . sections were blocked with a serum - free protein blocking solution ( dakocytomation inc . , carpinteria , ca , usa ) , incubated overnight at 4c with primary abs , and 1 h at room temperature with secondary abs . immunofluorescence was detected and imaged with a zeiss microscope equipped with hbo 100 illuminating system , axiocam mrn digital camera and axiovision 4.8.1 software ( carl zeiss gmbh , goettingen , germany ) . cell death was detected in situ using a fluorescence tunel kit from promega ( fitchburg , wisconsin , usa ) following the manufacturer 's protocol . uric acid was measured in balf according to manufacturer 's instructions using the amplex red uric acid / uricase assay kit ( a22181 , invitrogen aust pty ltd , mulgrave , australia ) . fluorescence measurements were made using a fluorescence plate reader ( optima fluostar , bmg labtech , gmbh , offenburg , germany ) with excitation at 530 nm and emission read at 590 nm . normal human bronchial epithelial ( nhbe ) cells and bronchial epithelial growth medium ( begm ) were obtained from lonza ( lonza australia pty ltd , mt waverley , vic , australia ) . cells at 6070% confluence were stimulated for 18 h with e. coli lps ( 5 g / ml , sigma - aldrich chemicals , st louis , mo , usa ) , ifn- ( 50 ng / ml , sigma - aldrich chemicals , st louis , mo , usa ) , or combination of these two , in 8-well chamber slides ( bd biosciences , franklin lakes , nj , usa ) . cells were washed twice with phosphate - buffered saline ( pbs ) and then fixed with 2.5% formalin / pbs for 10 minutes . cells were washed 4 times with tbst ( tris - buffered saline , ph7.5 added with 0.05% tween-20 ) , air - dried overnight at room temperature , and stored at 20c until use . sds / pbs at room temperature , then washed 5 times with tbst to remove sds . following 1 h blocking incubation with a serum - free protein blocker ( dakocytomation inc . , carpinteria , ca , usa ) , cells were incubated with a mixture of primary antibodies ( see antibody section of methods ) including mouse monoclonal antibody to human nlrp3 and a rabbit polyclonal anti - human il-1 , overnight at 4c . next , following 5 washes with tbst , cells were incubated 1 h at room temperature with a mixture of secondary antibodies including a donkey f(ab)2 anti - mouse igg dylight594 and goat f(ab)2 anti - rabbit igg - fitc . for quantitation of fluorescence intensity , multiple microphotos were acquired randomly under a 20x objective . images were then blinded and analysed using a morphometric software package ( imagej , nih , bethesda , md , usa ) . in keeping with previous descriptions of the acute allergic airway inflammation model [ 2 , 23 ] , the airway inflammation in ova - challenged mice was characterized by dense peribronchial and perivascular infiltrates of leucocytes ( mostly eosinophils ) and oedema of bronchial epithelium . epithelial swelling was more prominent in large bronchi that were sometimes occluded by thickened epithelium . typically , there was a 7-fold increase in total balf cell count from 15.6 11.1 10 ( median 2.5% ci ) cells / ml in sal controls to 117.7 82.7 10 cells / ml in ova - treated mice ( p < 0.0001 ) . this was largely due to eosinophilia ( > 85% ) , although numbers of neutrophils , monocytes , and lymphocytes were also significantly increased ( p < 0.05 , data not shown ) . to test the hypothesis that the normal airway epithelium possesses the ability to assemble inflammasome complexes , we used immunofluorescence to analyse formalin - fixed lung tissue sections obtained from healthy balb / c mice for expression of inflammasome common components nlrp3 , asc and caspase-1 , and the substrate cytokines il-1 and il-18 . n = 3 ) and sal mice ( n = 8) that were sham - treated with saline i.p . injections and saline nebulisation and used as controls in the experimental murine airway inflammation model . serial sections of control mouse lungs ( n = 8) were examined by immunohistological labelling for caspase-1 and various other inflammasome - related proteins . figures 1(a)1(c ) show colocalization of caspase-1 and nlrp3 in the epithelia of three bronchioles . the fluorescence staining for caspase-1 however , omission of primary antibody or section incubation with normal rabbit igg ( at matched igg concentrations ) resulted in negligible fluorescence ( figure 1(f ) ) . colocalization of caspase-1 and nlrp3 with il-1 , il-18 , and asc in bronchiolar epithelia was shown ( figures 1(d)1(k ) ) . it should be noted that the antibodies to caspase-1 , il-1 , and il-18 did not distinguish between their precursor and mature forms . after performing immunofluorescence , some sections were washed and restained with hematoxylin and eosin ( h&e ) to examine morphology . figures 2(a ) and 2(b ) show low and high magnification images of a section of the normal mouse lung immunolabelled for caspase-1 , while figures 2(c ) and 2(d ) show the corresponding h&e restaining . the caspase-1 positive - staining cells around the alveoli were identified as both alveolar macrophages localised in the alveolar air space ( e.g. , arrowed cell in figure 2(d1 ) ) and type 2 alveolar cells ( atii ) typically seen at alveolar junctions and showing lamellar bodies in the cytoplasm ( figures 2(d2 ) and 2(d3 ) ) . the identity of these two cell types was confirmed by dual labelling of caspase-1 with either f4/80 ( a marker of mouse macrophages , figure 2(e ) ) or sp - d ( a marker of atii , figure 2(f ) ) . thus , the normal murine airway epithelium ( bronchial epithelium and atii ) expresses , at the protein level , inflammasome components nlrp3 , asc , and caspase-1 , as well as the substrate cytokines il-1 and il-18 . the antibody for caspase-1 used in the previous series of experiments did not differentiate between the inactive precursor and active form . using antibodies specific for the cleaved ends of p10 and p20 subunits of caspase-1 , we were able to demonstrate very low levels or absence of active caspase-1 in the control mouse lung epithelium ( figure 3(a ) ) . in contrast , distinct patterns of active caspase-1 staining were detected in the epithelium of the inflamed airways of ova - treated animals ( figures 3(b)3(d ) ) . in adjacent serial sections of inflamed lung , the two different antibodies p10 and p20 revealed the same punctate patterns of caspase-1 activation near the epithelial apical surface ( figures 3(c ) and 3(d ) ) . preabsorption with the relevant immunogen peptides reduced the labelling of active caspase-1 in the inflamed airway epithelium to a level comparable to that of the conjugate alone ( figures 3(e)3(g ) ) . because there are inherent problems in trying to quantify actual changes in fluorescence intensity where there is a redistribution of the label within the treatment accompanying the induction of inflammation , we have not attempted to quantify changes in intensity of immunofluorescence for the various proteins in these sections . these results suggest that inflammation of the airways in mice is accompanied by conversion of zymogen caspase 1 to its active form and a more apical distribution of inflammasome proteins . as mentioned earlier , our antibody panel did not differentiate between the inactive precursors and the mature ( active ) forms of il-1 and il-18 cytokines . however , there were different patterns of il-1 and il-18 distribution demonstrated by immunofluorescence between the epithelia of ova - treated and control mice ( figure 4 ) . in the healthy epithelium , both cytokines distributed more or less homogeneously in the cytoplasm ( figures 4(a ) and 4(b ) ) . in contrast , in the inflamed airways , the immunofluorescence of the il-1 cytokines had a more speckled appearance at the apical surface of the epithelium ( figures 4(c ) and 4(d ) arrows ) . furthermore , immunofluorescence of both il-1 and il-18 could be detected in the lumen ( figures 4(c ) and 4(d ) , arrowheads ) . similarly , luminal staining near the apical surface was also detected for caspase-1 ( figures 4(e ) and 4(k ) ) , nlrp3 ( figure 4(i ) ) , and asc ( not shown ) . when labelled sections of inflamed mouse lungs were restained with h&e ( figures 4(g)4(l ) ) , part of the luminal fluorescence of the cytokines and inflammasome proteins was localized to infiltrating leukocytes ( mostly eosinophils ) or well preserved cell bodies ( ~610 m in diameter ) often seen embedded in the mucus near the epithelial apex ( figure 4(h ) and 4(l ) insets ) . tissues were immediately fixed in formalin for paraffin embedding and the luminal staining was consistently observed in tissue sections , including serial adjacent sections ( e.g. , figures 3(c ) and 3(d ) , figures 4(c)4(e ) , with figure 4(f ) as negative control ) , in all of the mice tissues analysed . immunostaining of consecutive adjacent tissue sections with caspase-1 and ccr3 , a marker of eosinophils , showed colocalization of ccr3 with caspase-1 , detected by antibodies to either the total or the active forms of the caspase ( not shown ) . as ccr3 is not a specific marker of eosinophils but can also be expressed in some other cell types , immunolabelled sections were restained by h&e to identify the type of infiltrating cells positively stained for inflammasome components . in accordance with our previous results > 80% of these cells were eosinophils which infiltrated both the submucosal tissue and the airway lumen ( figures 4(h)4(l ) ) . another cell type which might contribute to inflammasome activation in the ova - induced airway inflammation model is the vascular endothelium . whereas in saline - treated mice the vascular endothelium stained weakly for total caspase-1 , it often stained strongly in the lungs of ova - treated mice ( data not shown ) . unfortunately , we could not apply the antibodies to active subunits of caspase-1 to study activation of endothelial caspase-1 , due to the nonspecific binding of these antibodies to red blood cells , which was not blocked by the specific peptides ( data not shown ) . the expression of total caspase-1 protein in inflamed but not healthy endothelium was completely removed by blocking with specific peptide ( data not shown ) . to look at the effect of airway inflammation on expression of gene products with relevance to the inflammasome , we analysed mrna from lungs of sal and ova - treated mice by superarray ( table 1 ) . typically , there were large increases ( 810 fold ) in chemokines ( ccl12 , ccl7 , and cxcl3 ) known to be important in the mouse airway inflammation model . there were also significant increases with ova - treatment in expression of a th2 cytokine il-6 . for the il-1-like family members , there was a 2.5-fold increase in gene expression for il-33 and 2- and 11-fold decreases in those for il-1 and il-18 , respectively . of the gene products involved in inflammasome regulation , the largest change was an 8-fold increase in the neuronal inhibitor of apoptosis protein naip , followed by an almost 4-fold decrease in nlrp3 expression . there were no significant changes in expression of nlrp1 and nlrp4 ( table 1 ) . in accordance with our previous data , using the tunel assay we confirmed an increased cell death in the lung sections of ova- versus sal - treated animals ( data not shown ) . an analysis of balf in the asthmatic mice demonstrated a significant increase in uric acid ( figure 5(a ) ) , which is known as both a product of nucleic acid catabolism in dead cells and a stimulus for nlrp3 inflammasome activation . we were unable to detect il-1 and il-18 in the balf of either saline- or ova - treated mice ( data not shown ) . this may be due to excessive dilution of the balf during the lavage or choosing the wrong time - point ( 22 hr after final challenge ) for lavaging . analysis of the sera showed high levels ( > 200 pg / ml ) of il-1 in 4 of the 8 ova - treated mice but in none of the 8 saline - treated control mice . the serum levels of il-1 were tightly correlated with those of tnf- ( r = 0.95 ) , suggesting systemic effects in this model of allergic airway inflammation ( figure 5(b ) ) . commercially available passage 4 primary cultured normal human bronchial epithelial ( nhbe ) cells were studied for expression of the nlrp3 and il-1 proteins , before and after priming with lps ( 5 ug / ml ) or ifn- ( 50 ng / ml ) . nlrp3 and il-1 proteins were quantified in the same cell by dual - labelling with the respective antibodies ( see methods ) and using imagej software to quantify fluorescence intensities . between 26 and 51 cells ( pooled from three randomly acquired images for each treatment ) were analysed simultaneously for both proteins . cells grown either in the absence of both agents or with ifn- alone expressed low levels of intracellular nlrp3 and il-1 as detected by immunofluorescence ( and quantified using imagej software ) . overnight stimulation with lps or lps plus ifn- resulted in significant increase ( p < 0.05 ) of both nlrp3 ( ~2 fold ) and il-1 ( 4 - 5 fold , figure 6 ) . this study provides the first evidence for presence of precursor components of the nrlp3 inflammasome in normal murine airway epithelium and some other resident or inflammatory airway cells . it also shows qualitative changes in the distribution of these markers , including appearance of active caspase-1 , during airway inflammation in the acute mouse ova model . further studies are warranted to establish the functional significance of inflammasome activation as well as links between inflammasome regulation and other known mechanisms in asthma such as th2 responses , ige production , and its fixation on innate immune cell surfaces , eosinophilia , and airway tissue remodelling . our findings suggest a role for inflammasomes in innate immune responses of the airway epithelium and reinforce the hypothesis that airway epithelium plays a sentinel role in the innate immune response to inhaled microbes , allergens , and other pathogens . in particular , we have shown that the components necessary for mounting of a rapid protective inflammatory response via inflammasome activation are all expressed in the murine airway epithelium prior to inflammatory stimulation . of interest , il-1 and il-18 a similar expression of il-1 was detected in rat lung epithelium tissue ( data not shown ) . the failure to detect il-1 in the circulation of the control mice suggests either that airway epithelium contributes very little to blood il-1 levels or that signals leading to release of il-1 ( and probably also il-18 ) are absent from normal airway epithelium . our finding of intracellular il-1 and il-18 is therefore in keeping with the hypothesis that the airway epithelium is an important sentinel in the innate immune response and is primed for a rapid response when exposed to danger signals but has yet to undergo inflammasome activation . studies in cells of monocytic lineage have shown that to mount a proinflammatory response , the inflammasome pathway works in synergy with receptors for pathogen - associated molecular patterns ( pamps ) and danger - associated molecular patterns ( damps ) , the best characterized of which are tlrs . thus , cell lines in their normal state usually do not express precursors of il-1 and il-18 ; production , maturation , and extracellular release of these potent proinflammatory cytokines require at least two signals . ligation of tlrs leads to enhanced transcription of the il-1 gene and accumulation of an immature form of il-1 in the cytoplasm . stimulation with substances such as extracellular atp or uric acid leads to a second signal that results in caspase-1 activation , processing of pro - il-1 , and release of the mature cytokine . using antibodies that detect the presence of neoepitopes in the caspase-1 subunits which become accessible only upon cleavage / activation of the proenzyme and a blocking peptide , we were able to provide qualitative evidence for presence of active caspase-1 in the airway epithelium of the ova - treated mice . we also found , in these ova - treated mice , a potentially interesting and novel phenomenon of subcellular translocation for epithelial il-1 , il-18 , and caspase-1 , whereby these molecules were seen to be concentrated at the epithelial apical surface and apparently shed into the airway lumen in the form of cell bodies . the significance of this is unclear but may provide a mechanism for release of inflammasome - relevant molecules into the mucosa . il-1 and il-18 are proteins without a signal sequence . the precursors accumulate in the cytosol following translation and a second signal is required for caspase-1-mediated cleavage of the precursors to the mature form that is released from the cell . various mechanisms for release of the active il-1 cytokines ( and caspase-1 , itself ) have been postulated , including preexport into secretory lysosomes or encapsulation in microvesicles or exosomes . evidence for release as cell bodies or smaller vesicles has been provided by studies in monocytes [ 24 , 26 ] , microglia , and dendritic cells . the clinical relevance of the luminal shedding of the il-1 cytokines is yet to be explored . our findings support the notion that the airway epithelium can itself mount a proinflammatory response via activation of its inflammasome complexes and consequent release of il-1 and il-18 . we were able to detect high levels of il-1 in the circulation but not in the balf . the reason for failure to detect the il-1-like cytokines in balf may be a consequence of dilution of apical secretions during our lavage procedure ( total wash volume was 3 ml ) or may be because the time interval between final ova challenge and balf collection ( 22 hr ) resulted in missing the peak cytokine response . relevant to this , 4 of the 8 ova - treated mice had high levels of il-1 and tnf- in their serum while the other 4 mice ( like all of the control mice ) had very low levels of both cytokines , despite all 8 ova - treated mice having high levels of airway inflammation as evidenced by eosinophilia in balf and tissues as well as epithelial swelling and cell death . our immunofluorescence studies also suggested that other potential sources of il-1-like cytokines are eosinophils , alveolar macrophages , type ii alveolar cells , and endothelium . relevant to our finding of nrlp3 in the normal mouse bronchiolar epithelium is the recent observation reporting nrlp3 and two other nlrs ( nod1 and nod2 ) in upper airway human tissues including normal nasal mucosa , nasal polyps , tonsils , and adenoids . it is likely therefore that inflammasome components are present along the entire length of the airways and constitute a front - line defence . their involvement in allergic and inflammatory diseases of the airways such as chronic rhinosinusitis , rhinitis , and asthma warrants further study . a major limitation with studies of the whole lung is that the lung is a complex organ comprising a number of tissues . during airway inflammation it is therefore difficult to interpret changes in gene expression at the level of a single cell type in the lung . because of this we were driven from the start at establishing the techniques to show the presence of inflammasome components in specific cell types of the lung at a histochemical level . our initial attempt to look at changes in expression of inflammasome - related genes in the context of murine airway inflammation showed a large increase in expression of the caspase inhibitor and inflammasome - binding protein naip as well as decreases in expression of il-18 and nrlp3 . decreases in nrlp3 and il18 gene expression during airway inflammation may indicate the existence of a negative feedback mechanism . since naip is also able to substitute for nrlp3 and other nrls in formation of the inflammasome complex , there may be a switch from nrlp3 to naip as a result of the inflammation . discordance between mrna and protein expression of p2x7 receptor , an important up - stream regulator of the nrlp3 inflammasome , has also been reported in inflamed intestinal epithelium from patients with inflammatory bowel disease . in that study , in which p2x7 receptor engagement was required for production and release of il-1 , mrna levels for p2x7 receptor were increased while protein levels were strongly decreased . the decrease in protein levels was much greater in patients with active disease compared to those with quiescent disease and correlated with the degree of polymorphonuclear infiltration into the epithelium ( transepithelial migration ) . the authors speculated that the decrease in protein expression may help to protect the intestinal epithelial cells from excessive activation of p2x7 receptor and subsequent cell death during the neutrophil transmigration . downregulation of nrlp3 protein may have a similar protective role against inflammation - associated cell death during episodes of asthma . dissection of the mechanisms involved in airway epithelial inflammasome regulation and activation will require the use of in vitro airway epithelial cultures . we have shown that the presence of nrlp3 and il-1 proteins in the commercially available normal human bronchial epithelial primary cells and the 25-fold upregulation of these proteins following priming with lps indicates involvement of tlr4 in the priming . another proinflammatory stimulus inf which acts via a distinct signalling pathway was ineffective . in conclusion , we have demonstrated the presence of precursor components of the nrlp3 inflammasome in healthy murine airway epithelium as well as changes in the subcellular distribution of these components and appearance of active caspase-1 in the epithelium of inflamed airways . at this stage we know little about the extent to which the innate immune system and inflammasome activation in particular exert protective or detrimental effects in asthma . further studies using both lung biopsies from patients and mechanistic studies in polarized cultures of human airway epithelium are warranted and may reveal new insight into the disease mechanism and additional targets for therapeutic and/or diagnostic applications in asthma .

the percentage of overweight and obese children and adolescents has increased and it is globally recognized as a serious health problem . overweight and obese adolescents are at risk of getting chronic illnesses , and their mental health and self - esteem are affected as well . during adolescence , the frequency of participation in physical activity and sports declines remarkably and the amount of sedentary time increases [ 5 , 6 ] . less than 20% of adolescents meet physical activity guidelines [ 6 , 7 ] , which suggest that they should engage in at least 60 minutes of moderate to vigorous physical activity ( mvpa ) daily . physical activity in adolescence has many health benefits and it is indicative of higher levels of adult physical activity . in adulthood , physical inactivity or sedentary behaviour is associated with higher mortality rates and several common diseases , such as coronary heart disease , diabetes , certain types of cancers , and mental health problems . sedentary behaviours ( waking activities with an energy expenditure of 1.5 metabolic equivalents ) , such as too much sitting or time spent in front of the tv and computer screens , are one reason for obesity . sedentary behaviour and its negative impact on health have been recognized in health promotion campaigns . it is important that health promotion among overweight and obese adolescents includes both physical activity promotion and reducing sedentary time and not just weight control . lifestyle counselling for adolescents and their parents about healthy lifestyles is provided by school health care services [ 17 , 18 ] . lifestyle counselling interventions for obese and overweight adolescents include multiple components , such as providing ( 1 ) information about physical activity , sedentary behaviour , and nutrition , ( 2 ) social support , and ( 3 ) tools for enhancing behavioural management skills . sources of social support include support from peers , friends , school nurses or health care experts , and parents [ 20 , 21 ] . parent participation increases the effectiveness of school - based counselling with respect to adolescent physical activity [ 22 , 23 ] . behavioural management skills include reinforcing behaviours through self - rewarding mechanisms , goal setting [ 2527 ] , and problem solving [ 27 , 28 ] , as well as self - monitoring physical activity , to increase physical activity levels and reduce sedentary behaviour and bmi . however , school health care services are not providing effective lifestyle counselling due to insufficient time and a lack of evidence - based knowledge and counselling skills . novel interventions for promoting physical activity among adolescents are needed for school health care services . online social networks that promote health are widely and publicly available . conducting interventions via the internet has a high potential for success because use of the internet between the years 2000 and 2014 has increased by more than 400% in europe . in finland , adolescents spend a great deal of time engaging in sedentary behaviour , with social media in particular . hence , lifestyle counselling could be made more readily available for them via social media . providing counselling via social media could also free up valuable time for the school nurse to address other matters . social media - based interventions can provide an alternative means for promoting health care , especially in rural areas , like the northern part of finland , where distances are great . while computer- and web - based interventions can promote physical activity among adolescents , according to a review by hamel et al . freely accessible physical activity intervention websites should include the opportunity for self - monitoring , goal setting , and providing feedback . social media like facebook , twitter , youtube , and smartphone applications are widely used on physical activity intervention websites , even though many social media have yet to be tested . besides social media pedometers increase physical activity and decrease bmi among adults , and pedometers have been used successfully with adolescents in a variety of ways to promote activity . with overweight or obese adolescents , however , the effectiveness of promoting physical activity in these ways remains unclear . in the present study , we developed a 12-week facebook - delivered lifestyle counselling intervention to promote physical activity and reduce sedentary time and bmi among overweight and obese adolescents . as far as we can tell , this is the first such study to assess the effects of such an intervention on objectively measured levels of physical activity . this study evaluates the effects of a facebook - delivered lifestyle counselling intervention , with or without the monitoring of physical activity , on physical activity among overweight and obese adolescents ( sedentary time or very light physical activity , as well as light , moderate , and vigorous physical activity ) and bmi . we hypothesized that ( 1 ) the facebook - delivered lifestyle counselling intervention and self - monitoring of physical activity ( fb + act ) would be more effective at improving physical activity and reducing sedentary time and bmi compared to a facebook - delivered lifestyle counselling intervention without physical activity self - monitoring or a control group ; and ( 2 ) the facebook - delivered lifestyle counselling intervention would be more effective at improving physical activity and decreasing sedentary time and bmi compared to a control group . we used a three - arm randomized controlled trial design with two intervention groups and a control group . one of the intervention groups received facebook - delivered lifestyle counselling and the polar active physical activity monitor ( fb + act ) to help participants self - monitor their daily physical activity , while another experimental group received facebook - delivered lifestyle counselling without physical activity monitoring ( fb ) and the third group served as a control group ( cg ) . adolescents and their parents were familiarized with the study and had a chance to present questions or thoughts to the researchers . those who were willing to take part in the study received a consent form to sign . written informed consent was obtained from the study participants before the baseline examinations . for adolescents under 15 years of age , written informed consent was obtained from their parents . the facebook - delivered lifestyle counselling intervention for overweight and obese 1316-year - old adolescents was developed using the medical research council 's development - evaluation - implementation process framework [ 41 , 42 ] . the facebook - delivered counselling intervention was evaluated for feasibility via an expert panel , which consisted of health science experts ( n = 4 ) , 1517-year - old assistant nursing students ( n = 5 ) , and one 13-year - old adolescent . the intervention was targeted primarily at promoting physical activity among adolescents and reducing their sedentary time and secondarily at reducing their bmi . the theoretical basis for the counselling intervention was based on ( 1 ) the theory of compliance , ( 2 ) a systematic review of earlier physical activity interventions , and ( 3 ) interviews . according to the theory of compliance , an adolescent 's role in this intervention is as an active , intentional , and responsible participant who works to maintain his / her healthy lifestyle in collaboration with health care experts . a systematic review of earlier interventions showed that counselling could be effective at increasing physical activity . we modelled the informational themes of the lifestyle counselling intervention and delivery method by interviewing obese adolescents , their parents , and nursing staff about the barriers to and opportunities for being physically active . the intervention period was during the school term in the spring of 2012 and the duration was 12 weeks . two closed facebook groups were established : one for the adolescents and one for their parents . a physiotherapist acted as the tutor every weekday and a dietitian visited the group once a week . the tutor shared material and read posts , commented on them , and answered questions . the facebook - delivered lifestyle counselling intervention included the following components : ( 1 ) informational support , ( 2 ) social support , ( 3 ) behavioural management skills , and ( 4 ) menu and tailored exercise programme suggestions . while physical activity played a major role in the intervention , we also included dietary tips and advice to supply the content . the informational support themes were published on facebook fan pages ( one for adolescents and a separate one for parents ) once every two weeks , and it was shared with parents and adolescents at the same time . the informational support themes were as follows : ( 1 ) general information about physical activity and dietary recommendations , ( 2 ) sedentary behaviour and changes in adolescents ' cultural environment , ( 3 ) social support , ( 4 ) adolescents ' living environment and their ability to be physically active , ( 5 ) adolescents ' functional ability , and ( 6 ) their ability to maintain a physically active lifestyle . social support included emotional and material support and social support from the tutor , dietitian , parents , peers , and friends . they dealt with how to motivate adolescents to change their habits regarding a physically active lifestyle and reduce their daily sedentary time . parents were encouraged to give emotional and material support to adolescents to change their physical activity patterns . participants were encouraged to discuss the related issues with each other in the social media environment and discussion channels . behavioural management skills included problem solving related to the barriers to being physically active ; motivating questions and ideas were shared via posts . tools for posting comments , using questionnaires , and sharing materials ( news , videos ) were used in the adolescent and parent facebook groups . adolescents and their parents also had the opportunity to make tailored exercise programme suggestions ranging from expressing the need for a physiotherapist to making menu suggestions from dieticians via facebook . the tailoring adopted a client - centred approach based on discussions with adolescents and their parents . another experimental ( fb + act , n = 15 ) group received the same facebook - delivered lifestyle counselling and received the polar active physical activity monitor to self - monitor their daily physical activity . the monitor continuously measured their daily activity at different activity levels ( sedentary or very light , light , moderate , vigorous , and vigorous plus ) . instructions on how to use monitor and measure their daily physical activity levels were given to adolescents . adolescents could monitor their daily physical activity with the device , which had a screen that displayed daily minutes of physical activity ( at least moderate intensity ) and a bar showing the amount of activity in relation to a recommended level . the activity monitor tracked the intensity and duration of their daily physical activity as well as their sedentary time in minutes per day ( sitting , walking with very low intensity ) . the monitor showed the user 's individual daily steps and total daily energy consumption in calories ( kcal ) . the polar active physical activity monitor has been used to activate children and scholars have found the device to be quite beneficial . the control group ( n = 15 ) participated in measurements at the baseline and after intervention at postintervention measurements . the control group as well as the intervention groups received counselling from the school nurse regarding their health problems , if they so required it . the sample was collected from health care services for a school district in northern finland and participants were recruited from nine schools . there were three groups ( fb + act group , fb group , and the control group ) with data collected at two different time periods : at the baseline and during postintervention measurements 12 weeks later . the eligibility criteria for the participants were that they must be between 13 and 16 years of age , be overweight or obese ( weight - for - height 20% beyond the mean , finnish national overweight and obesity cut - off point for 2010 ) , and not have any diagnosed mental health problems or any other health issues and that they would be willing to take part in the study . ( n = 9 ) screened all 1316-year - old students ( n = 2270 ) , and invitation letters to participate in the study were sent to those adolescents ( n = 504 ) and their parents who were eligible based on the inclusion criteria . to obtain a larger number of participants , altogether , 50 adolescents and their parents participated in an information event , which was held at the local schools in january of 2012 . forty - six of them ultimately were willing to take part in the study and enrolled for the baseline examinations . two adolescents and their parents from the control group and from the fb + act group dropped out after the baseline measurements ( figure 1 ) . adolescents were motivated to complete the study when it was promised that 36 polar active physical activity monitors would be awarded via a raffle after the study . data collection was performed in february 2012 ( baseline ) and may - june 2012 ( postintervention measurements ) . the researcher 's assistant collected the baseline data using questionnaires and during face - to - face weight and height measurements as a part of information events held at the participants ' schools . the researcher gave the polar activity monitors to the participants for 21 days to objectively measure their daily physical activity . the physical activity monitor was blinded during the measurement period , so it essentially worked as a watch and the subjects were not able to self - monitor their physical activity during the measurement period . after the baseline measurement , blocks were formed using nuisance factors of age , gender , and self - evaluated physical activity ( days out of the past seven with at least 60 minutes mvpa ) . , participants were randomized into the intervention groups ( fb + act , fb ) or the control group ( 1 : 1 : 1 ) . sealed envelopes were sent to the participants with the information about which group they belonged to after the baseline measurements . blinding data collection was performed at the postintervention measurements in the same way as it was at the baseline assessment . physical activity was assessed using the polar active physical activity monitor ( polar electro kempele oy , kempele , finland ) . the polar active physical activity monitor is a uniaxial accelerometer worn on the wrist that determines the physical activity of children and adolescents . the device integrates the total amount of acceleration in one dimension while also measuring the duration and intensity of physical activity . the intensity of physical activity is defined by the metabolic equivalent of tasks ( met ) , which are divided into five levels of physical activity : sedentary time or very light physical activity ( < to 2 met ) , light physical activity ( 23.49 met ) , moderate physical activity ( 3.54.99 met ) , vigorous physical activity ( 58 met ) , and vigorous plus physical activity ( > 8 met ) . activity measurements were taken for 21 days , and the adolescents were asked to wear the activity monitor for 21 consecutive days and nights , even during water - based activities . the wearing time shows the valid days in this study , and one valid day required at least 500 minutes / day . the data from the activity monitor were downloaded to a computer program ( polar gofit ) , where it was then transferred to a statistics program ( excel ) . the data were transformed so that every participant was given their own average values ( minutes ) according to the different physical activity level during weekdays and weekends and in total . an objectively measured mvpa was calculated by combining moderate , vigorous , and vigorous plus physical activity . objectively measured sedentary time or a very light percentage ( % ) of physical activity of wearing time was calculated based on the daily levels of very light physical activity in relation to the daily wearing time for the daily physical activity monitor because the wearing time is related to very light levels of physical activity . we used a physical activity questionnaire to assess adolescents ' self - reports of their physical activity and screen time . the adolescents also self - evaluated their physical activity and screen time by answering questions used earlier in the who health behaviors in school - aged children study . self - reported moderate - to - vigorous physical activity ( mvpa ) was measured via the following question : over the past 7 days , on how many days were you physically active for a total of at least 60 minutes per day ? the response alternatives varied from 0 to 7 days . the question included a description of what kinds of physical activity should be taken into account and examples of mvpa were also given . the test - retest agreement for self - reported mvpa has been very good ( icc = 0.82 ) . self - reported screen time was measured via the following question : how many hours a day do you usually ( a ) watch television ( including dvds and videos ) , ( b ) play computer or video / console games , and ( c ) use a computer ( for purposes other than playing games , e.g. , e - mailing , chatting or surfing the internet or doing homework ) ? there were separate response options for weekdays and weekend days and the response alternatives varied from 0 to 5 hours or more . the test - retest agreement for watching television ( icc = 0.720.74 ) and for playing computer or video / console games ( icc = 0.540.69 ) was significant , while it was fair to moderate for using a computer ( icc = 0.330.50 ) . self - reported daily screen time during weekdays and on weekend days was calculated by adding these three questions together . body mass index . height was measured using a wall - mounted stadiometer and weight was measured with a floor scale . the body mass index was calculated according to the following formula : bmi = weight ( kg)/(height ( m ) ) . the baseline age was expressed as a decimal and calculated from the reported birthdate to the date when the baseline survey was completed . all variables were evaluated for normality using the kolmogorov - smirnov test , and the variables were nonparametric . changes in objectively measured and self - reported physical activity and bmi from baseline to the 12-week postintervention measurements between groups were analysed using kruskal - wallis test . differences between the groups in terms of objectively measured and self - reported physical activity , bmi , gender , and age at baseline and during the postintervention measurements were tested using the kruskal - wallis test for continuous variables and fischer 's exact test for categorical variables . if a statistical significance was found between the groups during the postintervention measurements , we performed a mann - whitney u test to assess the pair of groups for which the difference was significant and then carried out a bonferroni correction for the p value . all analyses were performed using ibm spss statistics version 20.0 ( spss , chicago , il ) , with the significance level set at < 0.05 . two subjects did not wear the activity monitor long enough to reach a valid time during the baseline measurements and one subject did not wear it long enough for the postintervention measurements . in this case , the missing data were replaced using the means from all participants ' physical activity data from the postintervention measurements . for those who withdrew ( n = 2 ) , we analysed the data only at the baseline and included them in the results for the baseline ; therefore , they were not considered when reporting the changes . table 1 presents a summary of the participants ' background characteristics at the baseline assessment . there was no difference in objectively measured physical activity or in self - reported mvpa , screen time , or bmi between the study groups . the mean age of the adolescents was 14.7 years ( sd 0.8 ) , with a mean bmi of 28.1 ( sd 5.7 ) . most of the adolescents lived with both of their parents ( conjugal family 70% ) , who in most cases had attended college or a vocational college ( 62% of mothers and 58% of fathers ) or had received a bachelor 's level degree from the university ( 22% of mothers and 20% of fathers ) . the adolescents wore the polar activity monitor for , on average , 13 weekdays and 5 weekend days at the baseline and for 12 weekdays and 5 weekend days at the posttest . the changes in objectively measured and self - reported physical activity and bmi from baseline to the 12-week postintervention measurement are reported in table 2 . there were no significant differences between the intervention group and control group in terms of the changes in objectively measured ( sedentary time or very light physical activity , light , moderate , and vigorous physical activity ) or self - reported physical activity , screen time , or bmi from the baseline to the 12-week postintervention measurements . sedentary time or the percentage ( % ) of very light physical activity during wearing time on weekdays was statistically different between groups during the postintervention measurements ( p = 0.025 ) . the difference between the fb + act group and control group ( p = 0.021 , 95% ci : 0.72 , 17.6 ) was significant at the postintervention measurements ( figure 2 ) . the fb + act group had lower amounts of sedentary time or a lower percentage of very light physical activity during wearing time on weekdays . we did not find statistically significant differences between the groups during postintervention measurements for very light , light , moderate , vigorous , and vigorous + or moderate - to - vigorous physical activity . the mean values and standard deviations for physical activity and bmi measurements at baseline and after 12 weeks and the overall changes are reported in table 2 . for self - reported physical activity , the number of days out of the past seven with at least 60 minutes of mvpa and screen time ( total or divided into different modes or weekdays / weekends ) did not differ between groups during the postintervention measurements and we did not observe any significant changes between the groups . mean values and standard deviations for self - reported physical activity and screen time are reported in table 3 . the 12-week facebook - delivered lifestyle counselling intervention with or without the self - monitoring of physical activity did not have an effect on the objectively measured or self - reported physical activity or bmi among the overweight or obese adolescents . however , the facebook - delivered lifestyle counselling intervention with self - monitoring of physical activity decreased the time that adolescents spent engaged in sedentary or very light physical activity on weekdays by more than 11% , but compared to the control or fb groups the change was not significant . reducing sedentary behaviour and daily sedentary time may positively influence adolescent health . studies have demonstrated associations between sedentary behaviour and health outcomes , such as cardiovascular diseases , an adverse metabolic profile , and obesity [ 50 , 51 ] . however , the associations between sedentary behaviour and health outcomes are complex . lifestyle counselling for overweight and obese adolescents should not only recommend that adolescents be sufficiently physically active , but also discuss overall daily physical activity and adhering to healthy lifestyles . the facebook - delivered lifestyle counselling intervention included information for adolescents and their parents about sedentary behaviour and changes in modern adolescent 's cultural contexts , such as screen time , too much sitting , gaming , and communications with friends only via social media . the tutor persuaded adolescents to change their sedentary behaviour through problem solving and searching for opportunities to be physically active and challenged them to reduce their daily sedentary time . the physical activity monitor could motivate overweight and obese adolescents to track their daily physical activity and sedentary time and make changes in their daily life if what they currently do is not sufficient . however the evidence that the monitor actually helps reduce sedentary time needs to be further studied . physical activity counselling and exercise interventions with overweight and obese adolescents have only impacted their levels of physical activity to a minor extent . likewise , health behaviour interventions delivered via the internet have only had a limited impact on participants ' level of physical activity . in the current study , the total increase in mvpa in the fb + act group was 2.6 min / day , whereas for the fb group it was 3.0 min / day and for the control group it was 1.3 minutes / day . an earlier meta - analysis observed on average approximately a four - minute increase in mvpa per day among adolescents , which is insufficient for reducing the bmi and the effect on , for example , blood pressure is minimal . in an earlier rct study , the use of a pedometer with behavioural skill management counselling did not affect overweight adolescents ' physical activity either . trials targeted exclusively at overweight or obese adolescents have been slightly more effective at increasing total physical activity than trials targeted at normal weight adolescents , and mvpa improvements have been about six minutes . in this study , the lifestyle counselling intervention with or without the monitoring of physical activity did not affect adolescent 's bmi . we observed a decrease in bmi in the fb group among 12 out of the 16 participants who received the facebook - delivered lifestyle counselling intervention . these results are encouraging and the facebook - delivered lifestyle counselling intervention should be used to test a larger number of participants . it would also be beneficial to do a follow - up assessment to evaluate whether the bmi remains the same later . interventions delivered via the internet have positively affected obese adolescents ' bmi [ 58 , 59 ] . in facebook - delivered counselling interventions , a tutor persuades adolescents to maintain healthy lifestyles at the end of the intervention period . the follow - up assessment is important for evaluating how long the positive changes will last and whether the adolescents need some supporting interventions to maintain their lifestyle change . when developing interventions for obese and overweight adolescents , it is necessary to remember that obese and overweight adolescents may not consider physical activity important , or their attitudes towards physical activity may be more negative than in their normal weight counterparts . obese adolescents ' knowledge about physical activity does not differ from that of normal weight adolescents . however , their attitudes may be the reason why increasing physical activity among obese and overweight adolescents is challenging . there can also be unique barriers to being physically active with overweight adolescents , for example , their motor skills . therefore , we recommend that obese adolescents could start to become more physically active by first reducing their daily sedentary time instead of starting immediately with high - intensity physical activity . we found that adolescents participating in this study were sufficiently physically active already at baseline according to our baseline measurements ( mvpa mean > 60 minutes / day ) . so perhaps the adolescents who participated could have been interested in exercising , sports , and maintaining a healthy lifestyle even at the baseline . more specific counselling should have been done to promote physical activity among the adolescents and we should have asked them about the usefulness of this kind of intervention . additionally , information on the themes should be more specific and more tailored information should be given to the participants to help them change their physical activity patterns . the adolescents in this study still spent most of their days ( 60% ) engaged in sedentary or very light physical activities ( > 10 hours / day ) . overweight and obese adolescents tend to be more sedentary than normal weight adolescents , and their attitudes towards physical activity are less positive . approximately 10% of obese and 16% of overweight adolescents are sufficiently physically active . compared to their normal weight counterparts , who were studied in another finnish study with the same physical activity monitor , the adolescents in this study were less physically active . whereas the average mvpa time for normal weight adolescents was 99 ( sd 40 ) minutes per day , in this study the mvpa for all adolescents was 70 ( sd 28 ) minutes at baseline . when evaluating complex interventions in nursing , it would also be important to evaluate the effectiveness of the process , for example , participants ' adherence in the programme . in this study , we did not measure the extent to which participants continued to use the activity monitor , so we do not know for sure whether the adolescents in the fb + act group used the activity monitor or not during the intervention period . in this study , we also did not evaluate participants ' usage of the internet for the purpose of counselling ( posting , sharing , or visiting in group ) . however , 12 out of the 31 adolescents who received the lifestyle counselling intervention ordered physical exercise programmes . the tutor felt that some of the adolescents adhered to the programme and others did not . the low participation rate in this study ( 9% ) may partly explain why there was no significant difference between the experimental and control groups , even though we did notice small changes within the groups ( e.g. , bmi ) . in the recruitment process for intervention studies , it is important to know the correct size for a study population so that the study will have the necessary statistical power . power and sample size calculation could be done to estimate the correct sample size for the study . in this study , we decided to invite all adolescents who were overweight or obese ( n = 504 ) because we knew that it would be difficult to get enough adolescents involved otherwise . however , we obtained a smaller than expected number of participants ( n = 46 ) . participation loss may also explain the fact that obese and overweight adolescents have less positive attitudes towards physical activity than normal weight adolescents . marketing and promoting this type of intervention should have been done more effectively . during the recruitment phase , cooperation with school nurses is important in order to gain contact with the adolescents . in this study , the school nurses recruited adolescents for the study because of ethical reasons , but they did not receive any extra compensation for doing so . also , conducting multicenter trials could be a solution in the future for obtaining sufficient numbers of participants from among the study population in this kind of study . we sent out written information about the study and we tried to be as sensitive as possible by not using words like overweight or obese because of issues of sensitivity and stigmatization . the adolescents ' own motivation as well as their parents ' motivation may also have affected whether or not they chose to sign up for this study . common problems in evaluating complex interventions are small participation rates and staffing - issues . that could have been predicted by thoroughly piloting an intervention with the target group . according to the mrc it is possible with the intervention development process to take steps backwards from the evaluating phase to the developing phase in this case , we could technically call this study a feasibility study , but we do not consider that to be ethically correct . because we did the feasibility assessment beforehand , the aim of this study was to evaluate effectiveness . ten experts from the field of health sciences and information technology , several nursing students , and one adolescent evaluated the intervention informational content themes and how to deliver them before the intervention began . we wanted to make sure that the informational content was readable , clear , and appropriate . after the expert review , we made a few changes to spelling and we shortened the text based on results from the expert panel . as it turned out , the facebook - delivered lifestyle counselling intervention was easy to conduct , cheap , and easy to use . thus , the intervention did not require expensive programmes . however , when evaluating its effectiveness , we faced challenges during the recruitment process , in collecting data and in motivating participants to take part in the discussions and share posts . the theoretical basis of the intervention was systematic review and the theory of compliance , and the informational content themes were based on interviews with obese adolescents . when evaluating the effectiveness of the intervention with lager numbers of subjects , these aspects should be taken into account . its effectiveness , process , and overall cost - effectiveness should be evaluated before implementing it as part of school health care services . the findings reported in this paper suggest that a facebook - delivered lifestyle counselling intervention targeted primarily at promoting physical activity among adolescents was not effective in increasing physical activity or decreasing bmi for those participating in the study . for future interventions , we suggest that lifestyle counselling for overweight and obese adolescents should not only encourage them to increase their mvpa but also encourage adolescents and their parents to reduce the amount of sedentary time , such as too much sitting , watching television , and other low intensity habits . when using activity monitors as a part of physical activity interventions with overweight and obese adolescents , we suggest that experts take the time to evaluate whether or not adolescents use the device . a facebook - delivered lifestyle counselling intervention is , according to our experiences and knowledge , easy to use and it does not require expensive programmes or devices to promote physical activity among overweight and obese adolescents and reduce their sedentary time . before the implementation process , however , more evaluation research is needed with larger numbers of overweight and obese adolescents who are sedentary at the baseline assessment . likewise , the participant recruitment process should employ more staff to obtain larger number of participants , or perhaps a multicenter trial could be a solution .

benign paroxysmal positional vertigo ( bppv ) is the most common vertiginous disorder in the community . the cardinal symptom is sudden vertigo induced by a change in head position : turning over in bed , lying down in bed ( or at the dentist or hairdresser ) , looking up , stooping , or any sudden change in head position . when severe , vertigo is provoked by most head movements , giving an impression of continuous vertigo . the symptoms can last for days , weeks , months , or years , or be recurrent over many years . the earliest reference to it may have been by shakespeare in romeo and juliet one pain is lessen'd by another 's anguish ; turn giddy , and be holp by backwards turning . in the medical literature the first descriptions of positionally induced vertigo are attributed to adler and later barany , who believed it was a disorder of the otolith organs . barany elicited vertigo in a 27-year - old woman by turning her head from side to side in a supine position and noted there appeared a strong rotatory nystagmus to the right with a vertical component upwards , which when looking to the right was purely rotatory , and when looking to the left was purely vertical . in 1952 margaret dix ( 19111981 ) and charles hallpike ( 19001979 ) at queen square hospital , based on 100 patients , presented a symptomatological definition and a provocative positional test for what they called positional nystagmus of the benign positional type . for symptoms they note : the story given by the patient is characteristically that the giddiness comes on when he lies down in bed or when he turns over in bed , or when such a position is taken up during the day ; for instance lying down beneath a car or in throwing the head backward to paint a ceiling . their diagnostic test : .the patient is first seated upon the couch with the head turned to one side and the gaze fixed firmly on the examiner 's forehead . the examiner then grasps the patient 's forehead firmly between his hands and briskly pushes the patient back into the critical position [ 30 degrees below the level of the couch and turned some 30 to 45 degrees to one side ] . the reaction which results calls for some detailed description . as did barany they noted a torsional nystagmus with the upper pole of the eye beating ( fast phase ) toward the ground and that it additionally , they observed a response latency of approximately 5 seconds , a crescendo and decline of nystagmus , and a reversal of the nystagmus as the patient sits up . to eliminate the possibility that the response could be induced by vascular occlusion from rotation of the neck they tested patients on an apparatus which avoided it the right temporal bone of 40-year - old woman with positional nystagmus of the benign positional type to the right with the right ear undermost was examined . in the macula of the utricle , the general picture is one of chronic tissue changes resulting either from infection or trauma and we are thus directed to the conclusion that the lesion is a peripheral one and in the labyrinth towards which , when undermost , the nystagmus is directed . hallpike provided further evidence for a peripheral cause by abolishing symptoms in two patients with a chemical labyrinthectomy of an acoustically dead ear and in one patient by an eight nerve section . positional nystagmus of the benign positional type was caused by disorder of the utricular macula . by the early 19th century the bony and some membranous structure of the inner ear were anatomically well described but their functions unproven . the cochlea was responsible for mediating the nature and pitch of sound ; the saccule and utricle were for perception of loudness , and the semicircular canals for transmission of bone - conducted sound and perception of sound direction . marie - jean flourens ( 17941867 ) was a professor of comparative anatomy in paris , and in 1824 he published his experimental results on pigeon semicircular canals : if the membranous ducts are injured , a painful sensitivity to tones is observed , accompanied by abrupt and violent movements of the head . if the horizontal canals are severed , the animal turns on its vertical axis ; if the posterior vertical canal is severed the animal rolls over backward , and if the anterior vertical canal is severed the animal falls forward . flourens concluded that the semicircular canals inhibited motion ( forces moderatrices ) and influenced direction of motion , rather than having a role in balance . flourens ' work had been largely ignored but was known to prosper meniere and acknowledged in his final paper in 1861 . according to adam politzer ( 18351920 ) in his history of otology the realization that the vestibular and semicircular canal structures are not organs of sound perception , that sound perception is transmitted solely through the cochlea , is the single most important result of flourens ' experiments . however it was another sixty years until a more sophisticated understanding of semicircular canal functions and their generated nystagmus was achieved by julius ewald ( 18551921 ) who was later professor of physiology at the university of strassburg ( now strasbourg ) . in pigeons , he cannulated each semicircular canal and applied negative and positive pressures and observed the directions and intensity of the induced nystagmus . the two major findings have become known as ewalds ' laws : ( 1 ) the direction of the induced nystagmus is in the plane of the canal being stimulated , and ( 2 ) in the horizontal canal an ampullopetal ( towards the vestibule ) movement of endolymph causes the greatest response where as in the posterior and superior canals an ampullofugal ( away from the vestibule ) endolymph movement causes the greatest response . at the time the differences were perplexing , as expressed by a writer in 1920 : it is , however , difficult to imagine how the same endolymph current can be stimulating for the one endorgan and hindering for the other . thirty years later the advent of the electron microscope allowed a more detailed view of inner ear ultrastructure . in 1954 wersall showed that each vestibular sensory cell has one kinocilium and many stereocilia . the finding of morphological polarization of kinocilia on vestibular sensor cells [ 14 , 15 ] explained ewald 's paradox . in horizontal canal cristae the kinocilium is on the vestibule side of the stereocilia ; in the posterior and superior canals the kinocilium is on the canal side of the stereocilia ( figure 1 ) . in the 1960s , experiments in cats clarified the relationship between canal receptors and extraocular muscles . each receptor is connected to one ipsilateral and one contralateral muscle . the second order neurones are either excitatory ( to the agonist muscles ) or inhibitory ( to the antagonist muscles ) ( figures 2 , 3 , 4 , and 5 ) . in 1962 harold schuknecht ( 19171996 ) at harvard university in boston proposed that bppv might be caused by detached utricular otoconia , acting upon the cupula of the posterior semicircular canal . although at that time there were no confirming human pathological studies , the concept seemed plausible from a purely theoretical point of view . in 1969 schuknecht [ 18 , 19 ] confirmed finding basophilic staining masses attached to the posterior canal cupula in patients who had had bppv symptoms . he called this cupulolithiasis ( heavy cupula ) and assumed the masses were detached utricular otoliths which were removed by decalcification in preparation . this was supported by gacek 's report of five patients where the selective resection of the posterior ampullary nerve abolished bppv symptoms . cupulothiasis became the dominant theory for nearly thirty years , although it did not explain the variable and often long latency and fatiguability of the nystagmus . treatment had been by cawthorne 's exercises in which the patient was instructed to repeat continually any movement which caused the vertigo until it ceased , on the assumption that central adaption was occurring . based on the cupulolithiasis theory brandt and daroff devised an inpatient treatment where subjects lay down to the provocative side , sat up for thirty seconds , and then lay to the other side every three hours . after seven to ten days , 61 of 67 subjects were free of symptoms . the assumed aim was detachment of the particle from the posterior canal cupula . in france semont ( a physiotherapist ) and sterkers [ 23 , 24 ] modified this to a logical physician - controlled treatment they called the liberatory maneuver , now known as the semont maneuver ( figure 6 ) . the patient is lain down to the side of the symptomatic ear , facing down . when the nystagmus ceases , the patient is moved rapidly through 90 degrees to the opposite side ( where the symptomatic ear becomes uppermost ) . either immediately or up to 15 seconds later the patient experiences vertigo and has nystagmus identical to the symptomatic side . the technique was little known outside france . in attempting to explain the latency and fatiguability of bppv nystagmus , hall et al . ( at the university of london , ontario ) and later epley ( a solo private practice otologist in portland , oregon ) made models of the semicircular canals and proposed that they were better explained by free - floating particles in the posterior canal , which epley called canalithiasis . also at the university of london , ontario , parnes and mcclure , in attempting a surgical posterior canal occlusion , observed and photographed free otoconia in the endolymphatic compartment . based on his models epley proposed a controlled set of head movements he called the canalith repositioning procedure ( crp ) ( figure 7 ) . epley had presented this as an instruction course at the american academy of otolaryngology , head and neck surgery meetings since 1980 and endured considerable derision because he used a heavy massage vibrator over the mastoid process . after seeing canaliths at operation , parnes described an almost identical particle repositioning maneuver ( prm ) ( often known as the modified epley maneuver ) whose main difference is its slower pace . bppv ( 85% posterior canal ) is now recognized as the most common cause of vertigo in adults . it is estimated that 2.4% of people experience at least episode in their life . 9% of residents in a home for the elderly were found to have bbpv . it is the most common cause of vertigo after a head injury [ 33 , 34 ] . an episode of vestibular neuritis and a period of bed rest are common antecedents . omission of a simple clinical test can result in patients undergoing unnecessary , expensive investigations . previously nontypical forms of positionally induced nystagmus were assumed to always have a central cause . while performing crps , epley observed a sudden change of typical torsional posterior canal nystagmus to horizontal direction - changing nystagmus and deduced the nystagmus that would be caused by otoconia in the horizontal and even the superior canal . without clinical proof epley predicted the logical treatment for horizontal canal bppv would be a 360 degree horizontal plane rotation away from the symptomatic ear . in 1985 mcclure had published the electronystagmographic ( eng ) traces of seven subjects who had intense positional vertigo and direction - changing horizontal nystagmus when supine . mcclure suspected a viscous plug in the horizontal canal which was causing a piston effect on the horizontal canal receptor . as discovered by ewald , an ampullopetal ( towards the vestibule ) cupula deflection horizontal canal bppv was then reported by others [ 4043 ] and its particularly intense vertigo confirmed . these simple horizontal repositioning techniques remain the usual way of treating the horizontal variant of bppv ( figure 10 ) . occasionally the most intense nystagmus is away ( apogeotropic ) from the undermost ear , implying a particle or particles attached to the cupula , or close to it , on its canal or utricular side [ 43 , 4547 ] . the cupula becomes heavy and is ampullofugal when the symptomatic ear is undermost and ampullopetal when it is uppermost . it can be difficult to ascertain which is the symptomatic ear , but it is likely to be the undermost ear which initiates the least nystagmus ( figure 4 ) . it can occur de novo , after mild head injury or by canal conversion during posterior canal repositioning [ 45 , 46 ] . it is likely that patients with horizontal canal bppv inadvertently treat themselves by rolling over in their sleep , if it is in the desirable direction . direction they trigger and awake with vertigo . although brandt et al . in 1994 had alluded to the rare anterior [ superior ] canal bppv , the spontaneous symptoms occur when the affected ear is uppermost , the first detailed description of superior canal bppv is usually attributed to herdman and tusa who documented two patients whose positionally induced nystagmus was accompanied by downbeat and torsional nystagmus likely to be caused by a superior canal receptor and which ceased after repositioning treatment , implying it was rare form of bppv . subsequently superior canal bppv was recognized and reported by others [ 5056 ] in whose series it accounts for approximately 1% of all bppv diagnoses . in a review of 50 consecutive patients with positionally induced nystagmus , 75% had a central cause : multiple system atrophy , cerebellar degeneration , and other miscellaneous causes with immediate onset of downbeat nystagmus on a dix hallpike test . in 25% ( idiopathic ) a dix hallpike test or a head - hanging test elicited downbeat nystagmus with a short latency . in half the subjects a torsional nystagmus could be seen through frenzel glasses , but in one it was only discernible by video imaging . aw et al . studied forty - four patients whose bppv had not responded to conventional repositioning , using 3-dimensional research coils and a 2-axis whole - body rotator . seven had downbeat nystagmus with a small torsional component , and all responded to a head - over - heels forward rotation in the plane of the superior canal . differences in the ampullary segments of the posterior and superior canals most likely explain why superior canal bppv downbeat nystagmus can be triggered by a dix hallpike test to either side and for its small ( or absent ) torsional component . in most cases older patients with neck , back , and hip problems require special care , and the test can be more simply done over a pillow ( figures 2 and 5 ) . occasionally an initial negative test may become strongly positive after the patient does vigorous headshaking . the most common repositioning treatment is epley 's crp as modified by parnes with one - minute pauses between head positions ( figure 7 ) . following the crp a repeat dix hallpike test if positive , the crp is repeated with mastoid vibration ( hitachi magic wand 250 hz massage vibrator ) . if the test is negative , no further repositioning is done . however it is not confirmation of treatment success , and retesting should be done . younger , agile patients can be shown how to conduct their own follow - up test at home by lying down over a cushion on the floor ( figure 8) . however , older patients , who often report success by avoiding provocative positions , must be seen and formally retested . if at followup the dix hallpike test is positive , repeat treatment can be by a further crp with mastoid vibration or by the semont maneuver . descriptions of the semont maneuver typically show the patient held and moved by two hands around the neck . this is extremely inappropriate for many individuals who are larger , obese , or who have neck problems . a safer technique is for the physician to rapidly move the patient from side to side by a hand under the downmost shoulder ( symptomatic ear ) and the other supporting the neck ( figure 9 ) . a cochrane collaboration review of the epley crp and 5 subsequent random controlled trials found a significant success compared with nontreated controls [ 57 , 58 ] . comparison of trials is confounded by variation in the number of crp cycles used per treatment , clinician experience , and the treatment setting . there have been relatively few trials [ 59 , 60 ] confirming the efficacy of the semont maneuver compared with sham treatment . the semont maneuver is the most logical first treatment for a patient with posterior canal cupulithiasis ( immediate nystagmus onset ) with attached otoconia more likely to be dislodged by a centrifugal force . epley initially recommended that after a crp the patient should sleep propped up for two nights to prevent repositioned particles from returning . however , numerous studies have not shown any advantage from posttreatment restrictions [ 61 , 62 ] . the use of adjunctive mastoid vibration has remained contentious , probably because of the power range of the devices used . the vast majority of bppv treatment studies have been performed in specialist practice settings . while very few patients can or even wish to administer self - treatment , it is an understandable goal . self - administered crp at home after initial office crp achieved a slightly greater improvement . as an adjunct to self - treatment dynamic visual device ( clearwater clinical ) significantly improved the performance of volunteers learning parnes ' modification of the crp ( figure 10 ) . it is a useful teaching tool on correct crp technique for patients and health professionals . horizontal canal bpv is most likely to be discovered as the patient is undergoing a dix hallpike provocative test [ 46 , 47 ] . occasionally it suddenly becomes apparent ( canal conversion ) after a crp , with brisk horizontal - rotatory nystagmus . if there is pillow under the shoulders , it is removed and the patient is moved down the examination couch so that the head is midline and in the horizontal plane . then the head is gently turned to one side and then the other ( head roll test ) . usually there is a clear , repeatable pattern of brisk nystagmus towards one undermost ear ( maximum geotropic ) and then weaker nystagmus ( apogeotropic ) when the opposite ear is down . if a the vertigo tends to be more intense than for posterior canal bppv , and some patients become nauseated and require an antiemetic . once the symptomatic ear has been identified , the mechanism and its different repositioning in the horizontal plane ( barbecue repositioning ) are explained to the patient ( figure 11 ) . with the examiner seated at the head of the examination couch the patient is asked to rotate 360 degrees in four stages , a minute apart . at the third position the patient should be resting on the elbows with the neck flexed , so that the horizontal canal is vertical , which is where the particle will exit the canal if it has been successfully moved . the head roll test is repeated and , if negative , treatment ceases . if on the head roll test the nystagmus is apogeotropic , the likely mechanism is cupulolithiasis in the undermost ear with the least nystagmus . on the presumption it is on the canal side the standard direction rotation is carried out . if unsuccessful ( likely vestibule side ) rotation is done in the opposite direction . sometimes apogeotropic nystagmus reverses to geotropic , implying that an attached particle(s ) has become free . if there is not a clear pattern , or if the patient becomes very nauseated , it is advisable to retest on another day . if the cause is central , the nystagmus onset is immediate , and the patient does not experience vertigo . if it is bppv , there will be a latency of onset and the patient must experience vertigo . any torsional component may be imperceptible to the naked eye . repeating the test with the head lower ( head - hanging the particle may be in either ear but most likely in the uppermost ear . on these assumptions the second is the li maneuver where the patient is moved rapidly from a supine ( midline ) head - hanging position to a face - down position at the opposite end of the couch ( figure 12 ) . reported rates of spontaneous complete resolution of bppv at a month range from 20% to 80% . the american academy of otolaryngology , head and neck surgery clinical practice guideline , benign paroxysmal positional vertigo recommends that physician retesting at one month after repositioning treatment should be the standard interval after treatment . followup the recurrence rate at one year is estimated at 15% and 37%50% at 5 years on the kaplan - meier curve [ 66 , 67 ] . the most common complication of bppv repositioning treatment is canal conversion . considering the population age in which it is usually performed central nervous system disorders can masquerade as bppv , in particular intracranial tumours [ 52 , 70 , 71 ] and migraine . nystagmus features which strongly suggest a neurological cause are downbeat nystagmus , direction - changing nystagmus without a change in head position , nausea with up or downbeating nystagmus , and preexisting and continuing nystagmus . the cardinal distinguishing feature from bppv nystagmus is that the patient does not experience brief rotational vertigo . therefore patients with such nystagmus or symptoms of bppv not showing resolution after repositioning require neurological examination and mri scanning of the brain and posterior fossa . migraine is now a well - recognised cause of recurrent vertigo . during an episode positional testing can elicit upbeat torsional or horizontal nystagmus similar to bppv [ 73 , 74 ] . features supporting migraine as a cause are headache , absence of brief acute vertigo induced by the dix hallpike test , disappearance of all nystagmus within days , and a recurrent pattern . currently epley 's canalith theory explains most of the features of bppv : the latency and type of nystagmus , according to the involved canal , and the logic and efficacy of repositioning treatments . however , as for many other inner ear disorders , certain details of its pathophysiology , in particular spontaneous recovery , remain elusive , largely due to the inability to internally image the inner ear in enough detail and the prior reliance on histological techniques as episodes of bppv recover without treatment , it is reasonable to assume that otoconia exit a canal during normal head movement , particularly in horizontal canal and superior canal bppv . it has been demonstrated that frog otoconia rapidly dissolve in endolymph with physiologic calcium levels , but more slowly if the calcium level is raised . therefore a major reason for spontaneous recovery is the ability of normal endolymph to dissolve otoconia if they do not return to the utricle . in mammals otoconia are calcite crystals of calcium carbonate . in rats scanning electron microscopy ( em ) shows a progressive degeneration of otoconial structure in the oldest rats , a phenomenon consistent with the common age range in bppv . in female rats made artificially oesteopenic / osteoporotic , scanning em shows ultrastructural changes in otoliths suggesting that there could be relationship between bone biochemistry and recurrent bppv in older women . seventy - five percent of thirty - two women aged been 50 and 85 years who had bppv were shown to have osteopenia or osteoporosis compared with eighty - three healthy controls . measurement of vestibular - evoked myogenic potentials ( vemps ) is new electro - physiological technqiue for measuring saccule and otolith function . in some patients with vestibular neuritis absence of the cervical vemps(c - vemp ) on the side neurolabyrinthitis predicted the nondevelopment of bppv which only occurred if the cvemp was present . more recent studies on the health of the otolith organs using c - vemps [ 79 , 80 ] have shown significantly large number of prolonged responses in patients with bppv compared with healthy controls , suggesting neuronal degeneration of the saccule . in contrast newer ocular vemps ( o - vemp ) also measure utricular function and are likely to be more relevant in establishing otolith dysfunction and recovery in bppv . distortion of the visual horizontal due to ocular torsion occurs in utricular dysfunction , as in vestibular neuritis . measurement of the visual horizontal in bppv patients was abnormal in 42% before - treatment , 15% after repositioning and in 8% two weeks later suggesting initial utricular dysfunction and its possible restoration from the return of otoliths . three - dimensional t2-weighted 3-dimensional fast mri imaging with steady - state acquisition sequences can now show some reliable detail of semicircular structure such as narrowed areas and filling defects . in patients with bppv 89% had abnormal canals compared with healthy controls , but there was no correlation between the affected canal and nystagmus type . subtle variations in canal diameter , length , and width may correlate with a predisposition to bppv and to treatment failures . finally , the american academy of otolaryngology , head and neck surgery clinical practice guideline on bppv has recommended sixteen aspects meriting further research , including the true prevalence and burden of untreated bppv in older adults , the natural history of untreated bppv , agreed endpoints for clinical trials , and importantly the functional impact of bppv on work safety and the rates of falls it may account for in the elderly .

his best - corrected visual acuity ( bcva ) was 20/125 od and 20/20 os . fundus examination od revealed prepapillary vascular loops with superotemporal macular branch vein occlusion ( appearing as the sheathed vessel ) and cystoid macular edema ( cme ) od [ fig . 1 ] . the occlusion of branch retinal arteries was not obvious : superotemporal branch retinal artery showed subtle beading at the first branching [ asterisk in fig . the occluded macular branch retinal artery was veiled by the tissue edema [ double asterisk , fig . fluorescein angiogram od in the early arteriovenous phase confirmed the arterial origin of the prepapillary loop ( filling simultaneously with arteries ; no lamellar flow ) and also revealed capillary nonperfusion extending into the foveal avascular zone [ fig . optical coherence tomography ( oct ) ( time - domain oct ; vertical 10 mm scan ) quantified the central macular thickening ( 506 m ) and also revealed inner retinal opacification , typical of arterial occlusion [ fig . systemic evaluation , cardiovascular workup , and referral to a neurophysician revealed no additional pathologies . after obtaining approval of the institutional review board and informed consent of the patient , he received intravitreal triamcinolone acetate ( ivta , 4 mg/0.1 ml ) od , followed by grid laser photocoagulation after 4 weeks . the cme resolved completely ( central macular thickness : 172 m ) ; bcva improved to 20/80 over 6 weeks . the occluded macular artery ( double asterisk ) was attenuated , and the corresponding vein ( arrow ) was sheathed ; inner retinal atrophy ( darker area ) in the superotemporal area was also well - evident [ fig . a repeat fluorescein angiogram revealed better details of the retinal vasculature ; delayed filling was clearly evident in the major superotemporal branch artery ( asterisk ) , the macular artery ( double asterisk ) as well as the prepapillary loop [ fig . the late phase angiogram showed that the sheathed macular vein ( white arrow ) was completely obliterated ( no flow ) [ fig . 2c ] . a stable retinal and functional status were maintained over the next 18 months [ fig . there was a transient rise in intraocular pressure after ivta , which was managed by topical antiglaucoma medication . clinical picture at presentation ( a ) prepapillary loops with branch vein occlusion ( arrow ) , beaded major branch artery * and macular artery hidden by the retinal edema**. ( b and c ) mid - phase fluorescein angiogram reveals the attenuated macular artery and vein and prolonged arteriovenous transit superotemporally . ( d ) optical coherence tomography ( vertical scan ) shows superior macular thickening , full - thickness cysts , and inner - retinal hyper - reflectivity clinical profile 10 weeks posttreatment ( a ) the occluded macular artery * * and vein ( arrow ) are attenuated . ( b and c ) early - phase fluorescein angiogram : no dye in superotemporal artery * and vein ; delayed filling of macular artery * * and loop . late phase shows obliterated macular vein ( white arrow ) and retrograde flow in superotemporal vein ( black arrow ) from perfused areas . prepapillary vascular loops are embryologically derived from the retinal arterial system in 95% of the cases and are vulnerable to occlusion due to reduced blood flow and increased turbulence . they can be differentiated from arteriovenous malformation which fill rapidly before arterial filling , and from venous loops which display slower , lamellar filling of the dye . since the patient presented to us 8 weeks after the visual decline , cilioretinal anastomoses secondary to vascular occlusions were also a possibility , which could be excluded by the size , elevation , location and filling pattern of the loops . cilioretinal anastomoses tend to be smaller , flatter , circumpapillary , and fill at a slower rate . in view of the patient 's age and systemic hypertension , a coexistence of primary arteriosclerotic branch vein occlusion with the prepapillary loop was another possibility . the absence of arteriosclerotic and arteriovenous crossing changes elsewhere in the fundus of the affected or in the fellow eye made this possibility unlikely . there are several reports of prepapillary loops causing arterial occlusions , which are essentially untreatable . we are not aware of any previous report of combined occlusion of branch retinal vein and two branch arteries due to prepapillary arterial loops . mechanical endothelial damage by hemodynamic turbulence in the convoluted arteries of the loop probably precipitated the intra - arterial clot formation , aggravated by systemic hypertension and diabetes . the macular branch vein was either directly compressed by the loop , or shared with sclerosed macular artery a common adventitial sheath , hidden by the loop . we attempted treatment in spite of the arterial component because the visual loss was moderate , and could be explained by cme , which showed a predominance of macular thickening ( venous component ) over retinal opacification ( arterial component ) on oct . the macular edema responded well to ivta and laser treatment with significant and stable visual improvement . venous occlusions can also occur following prepapillary arterial loops , and when present , may be amenable to laser photocoagulation and pharmacotherapy .

management of multiple sclerosis ( ms ) and decision - making surrounding pregnancy are complex subjects which includes the risk of relapse during pregnancy and post - partum , the use of disease modifying therapies ( dmts ) before / during pregnancy and breastfeeding , and the impact of breastfeeding on the course of ms . for years , pregnancy was believed to have a negative effect on multiple sclerosis , and while this has not been supported by evidence , women with ms continue to report experiencing negative attitudes about pregnancy and ms from their healthcare providers , often reporting feeling pressured into making a decision regarding child - bearing prior to the age of 30 or before their ms has progressed . there has been a well - documented decrease in ms relapses during pregnancy [ 1 , 35 ] ; however the risk of relapse post - partum increases significantly for women with ms [ 1 , 5 ] . while there is emerging data on the use of dmts during pregnancy for women with ms , this information remains limited in size and scope [ 610 ] and formal studies are missing , for obvious reasons . analyses of data on whether or not breastfeeding reduces the risk of ms relapse provide mixed conclusions [ 35 , 1114 ] and there is little to no empirical data on the impact of the use of dmt during breastfeeding . extended periods off dmts though are contrary to general recommendations of early treatment with dmt and may potentially have a negative impact on women 's ms disease . the purpose of this study was to examine what specific advice healthcare providers ( hcps ) typically offer patients with ms who are planning on becoming pregnant , are currently pregnant , or have given birth . an anonymous survey was developed and administered to hcps who work with individuals with ms in various clinical settings . the survey was distributed to seventy - two hcps in the united states who were attending the 6th annual regional multiple sclerosis summit in seattle , wa , in may 2011 . the national multiple sclerosis society sponsored this regional , one - day , continuing medical education conference on clinical ms management . attendees were invited to participate in an anonymous survey on clinical practices regarding their experience with and management of pregnancy in ms . the 66-question survey was developed by the first and third authors , one an ms - fellowship trained neurologist and the other a health outcomes researcher with training in measurement . the questions were formulated using the current literature on pregnancy and breastfeeding in ms including a prior related study on this topic as well as professional experience . the survey was revised based on feedback by several physicians experienced in treating ms patients . participating hcps were asked about their recommendations regarding pregnancy , breastfeeding , and post - partum periods for women with ms , focusing on how these topics relate to dmts . the institutional review board of the university of washington approved all procedures . to analyze the data from this survey , twenty - six of the 28 healthcare providers surveyed for this study provided demographic information . over half of the sample was female , and a majority ( n = 18 , 64% ) were between the ages of 41 and 60 . the majority of respondents were medical doctors ( n = 20 , 72% ) , three - fourths of whom were neurologists ( n = 15 ) . about one - third of each had been in practice for less than 10 years ( n = 10 , 36% ) or 11 to 20 years ( n = 8 , 29% ) , and their most common practice setting was in private practice ( n = 12 , 43% ) . participants reported a considerable ms patient load , with 58% ( n = 16 ) seeing more than 5 ms patients per week and with one - fourth ( n = 7 , 25% ) seeing between one and five ms patients per week , one participant ( 4% ) seeing one ms patient per week and four ( 14% ) not reporting . in response to questions about their approach to family planning when working with women with ms , less than half of the healthcare providers ( n = 13 , 46% ) encouraged pregnancy if a patient desired it , but almost all ( n = 27 , 97% ) reported that they would not discourage pregnancy because of a patient 's ms diagnosis . less than one - fifth ( n = 5 , 18% ) of the healthcare providers reported that their recommendations regarding pregnancy might depend on their patient 's clinical course of ms . when asked about their recommendations regarding dmt , over half of the participants ( n = 16 , 57% ) reported that they always and 29% ( n = 8) that they sometimes initiate a discussion about family planning when women of childbearing age begin taking dmts . nearly two - thirds ( n = 17 , 61% ) always recommend that patients stop dmt prior to pregnancy , that is , discourage use of dmts for patients desiring to conceive . about one - third ( n = 10 , 36% ) reported recommending that patients stop taking dmt as soon as they find out that they are pregnant . for some ( n = 5 , 18% ) , these recommendations depended on which dmt the patient was taking . five hcps ( 18% ) reported that the patient 's clinical course dictated whether or not they would recommend ceasing dmts . less than half of the hcps surveyed ( n = 12 , 43% ) recommended that patients not spend long periods of time without taking dmts while trying to become pregnant . finally , 10 of the hcps surveyed ( 36% ) reported that they had at least one patient with ms become pregnant while on a dmt they considered potentially harmful to the fetus . thus , while previous reports indicated that women with ms report receiving negative messages about pregnancy and ms , hcps in this study overwhelmingly reported that they are supportive or even encouraging of women with ms wanting to have children . it is possible that the lack of active encouragement by the hcp might be perceived by women with ms as lack of support of their desire to become pregnant . most hcps recommended that women stop using dmt prior to becoming pregnant , or at least once they have conceived , which is consistent with previous research . for many of these hcps , recommendations depended both on the clinical course of ms as well as which dmt the patient was taking . . these inconsistent recommendations probably reflect the limited evidence related to the effects of dmt in regards to pregnancy . most data is available for glatiramer acetate ( pregnancy category b ) and interferon beta 1a/1b ( pregnancy category c ) [ 7 , 8 , 10 ] . concerns of the use of interferon beta 1a/1b leading to an increased risk of spontaneous abortion are not supported by data from several registries [ 7 , 8 ] and it has been found to be safe in follow - up studies when used for up to 4 weeks after conception . limited human pregnancy outcome data is available for natalizumab ( pregnancy category c ) and even less for the newer , oral agents which raise concern regarding their potential for greater placental transmission and because of the existence of some negative animal data ( fingolimod and dimethyl fumarate pregnancy category c and terflunomide pregnancy category x ) . over half of the participants ( n = 15 , 54% ) reported that they discuss breastfeeding risks and benefits with their patients , and nearly two - thirds ( n = 17 , 61% ) reported that they inform patients about the increased risk of relapse during the post - partum period . three - fourths of the hcps ( n = 21 , 75% ) inform their patients that dmts are not recommended during breastfeeding . no one reported that they would counsel against breastfeeding due to the risk of relapse during the post - partum period , yet two hcps ( 7% ) would recommend foregoing breastfeeding in order to start taking dmts . twenty - five percent ( n = 7 ) advised that patients breastfeed , believing that benefits likely outweigh the risk of relapse . a majority ( n = 19 , 68% ) of the hcps did not support breastfeeding as long as possible though , likely to limit the women 's time off dmts . questions specific to recommended duration of breastfeeding were not asked . over one - third of hcps ( n = 11 , 39% ) discussed with their patients that breastfeeding may decrease the risk of post - partum relapse . about a third of the sample ( n = 9 , 32% ) reported that their recommendations regarding breastfeeding depended on the clinical course of the disease , that is , suggesting that patients limit breastfeeding if they have a more aggressive disease course . eighteen percent of the hcps ( n = 5 ) may recommend starting dmt despite breastfeeding due to the increased risk of relapses , and 21% ( n = 6 ) actually advise that their patients restart dmt because they believe that the risk of relapse outweighs the potential risks associated with breastfeeding while taking dmts . the majority of hpcs ( n = 21 , 75% ) typically recommended restarting dmt after breastfeeding while 21% ( n = 6 ) recommended that dmts be resumed immediately after pregnancy regardless of whether or not the patient was breastfeeding . thus , overall , the hcp response to breastfeeding was positive , with most recommending that women with ms breastfeed but perceptions of risk / benefit assessments varied . this may be due to the inconsistent data concerning the effect of breastfeeding on ms relapse and insufficient data regarding the risks of dmts during lactation . some studies found a reduced post - partum relapse rate with exclusive breastfeeding for 2 months , though other studies fail to support this correlation [ 35 , 1114 ] . additionally , hcps preferred to have the discussion about breastfeeding with their patients , as opposed to referring them to their obgyn or primary care physician ( n = 24 , 86% ) . this could be related to concerns that those providers may not be prepared to discuss the benefits and risks of dmt use , breastfeeding , and ms disease activity in the post - partum setting . healthcare providers were asked about the importance of resources that can help with decision - making . most indicated that fda product labeling and recommendations from other neurologists / colleagues were important sources of information for the management of ms during pregnancy and/or breastfeeding compared to animal data , case reports , and postmarketing pregnancy registries which are held by pharmaceutical companies . the personal experience of the hcp was found to be a somewhat important resource . finally , most hcps noted that there are no evidence - based guidelines for patient management of pregnancy and breastfeeding . the results of this study document the need for evidence - based recommendations related to the effect of dmt on pregnancy and breastfeeding , as well as the need for better guidelines on ms management related to family planning , pregnancy , and breastfeeding . while a randomized study of pregnant women taking dmts is not to be expected in the future for ethical reasons , the independent and consistent use of a public registry of women with ms who become pregnant while taking dmts or who utilized dmts while breastfeeding would be beneficial as it could lead to more information about the effect of dmt use during pregnancy and breastfeeding . in the interim , providers may find a recently published review on updated reproductive safety information from available preclinical and clinical data for dmts helpful in guiding decision - making in this critical area of ms management . research on what advice hcps give women with ms about pregnancy , breastfeeding , and dmt is limited . this study included a small sample , possibly nonrepresentative of the hcps treating women with ms . nevertheless , the study documents the need for more research and better evidence - based guidelines that hcps need in order to provide the best care to their patients with ms who are pregnant or planning on conceiving .

the aging process is typically characterized by a loss of muscular strength , reduction in joint mobility , reduction in cardiovascular capacity , and a decline in cognitive capacity.1 these physiological changes become more pronounced in postmenopausal women due to the development of osteoporosis and sarcopenia.24 these age - related declines can be assessed using health - related measures of fitness.5,6 health - related fitness comprises several dimensions , including body composition , cardiorespiratory endurance , muscular strength , muscle endurance , agility , balance , and flexibility.5,7 each dimension can be enhanced by using specific training regimens.813 health - related quality of life ( qol ) has been used to assess the overall status of patients ; qol has also been shown to be negatively correlated with age.14,15 specifically , scores on physical functioning , physical role limitation , general health , and social functioning have been shown to decrease significantly with age in postmenopausal women.16 an inferior self - perceived qol is associated with poor exercise adherence , which has been proposed to further jeopardize health - related fitness.17 regular physical activity and/or exercise training programs are beneficial in minimizing the physiological alterations that occur with aging and contribute to improvements in overall health and well - being.18,19 it remains unclear how the various dimensions of health - related fitness are associated with qol in postmenopausal women . understanding which dimensions of health - related fitness impact qol in the elderly could have significant implications in the prescription of exercise in this population , since different dimensions of health - related fitness can be enhanced using specific exercise training programs.813,1923 the purpose of the current study was to investigate the relationship between different dimensions of health - related fitness and qol in elderly postmenopausal women from taiwan . we hypothesized an age - related decrease in health - related fitness and that reduced health - related fitness would be predictive of qol in postmenopausal women . a total of 408 postmenopausal women from chia yi area and yunlin county of taiwan were enrolled in the current investigation between august 2010 and december 2012 . postmenopausal women were defined as having had no menstruation in the previous 12 months.24,25 the inclusion criteria of this study were : 1 ) postmenopausal women who were 2 ) healthy and 3 ) physically independent . the exclusion criteria were symptomatic cardiorespiratory disease , cognitive impairment or progressive and debilitating conditions , recent bone fractures , or any other medical contraindications to performing the fitness assessment . participants were divided into three groups stratified by age ( group a : 50.059.9 years ; group b : 60.069.9 years ; group c : > 70.0 years ) . the following anthropometric parameters were measured : height , body weight , health - related fitness , and qol . this study was approved by the institutional review board of chang gung foundation ( irb102 - 2419c ) , tao yuan , taiwan . fitness of all subjects was evaluated using the helmas physical fitness management system ( o2run , co. , ltd . , seoul , korea ) at the sports medicine center , chang gung memorial hospital at chia yi . several dimensions of health - related fitness were evaluated , including muscular strength ( grip strength and back strength ) ; balance ( closed - eye foot balance ) ; cardiorespiratory endurance ( step test ) ; flexibility ( sitting trunk flexion and trunk extension ) ; muscle endurance ( sit - ups ) ; and agility ( reaction time and side steps).2629 grip strength and back strength were evaluated using a ( dominant ) hand and back dynamometer ( helmas nh-3000d and nh-3000e ) . the better of two measurements was recorded . subjects were asked to step at a pace of 24 cycles per minute ( metronome = 96 beats per minute ) using a 35 cm step box . after 3 minutes of stepping , subjects immediately sat down , and heart rate was recorded from 1 to 1.5 minutes posttest , 2 to 2.5 minutes posttest , and 3 to 3.5 minutes posttest ( acc-750b ; accuratus , new taipei city , taiwan ) . the results were recorded as time until exhaustion ( seconds ) and total heartbeats ; these data were then plotted into a fitness index equation ( fie ) : to assess balance , subjects closed their eyes and stood on their dominant leg on a balance - measuring instrument ( helmas nh-3000h ) . , subjects sat on a flexibility measuring instrument ( helmas nh-3000 g ) with their heels positioned at the edge of the device . patients then bent forward at the waist with their hands outstretched in front of them to push the measuring instrument as far as possible past their feet . trunk extension was evaluated with the patient in a prone position on a flexibility - measuring instrument ( helmas nh-3000r ) . the number of sit - ups performed in a 30-second period was recorded for subjects lying on a sit - up board with their knees bent at right angles and both hands positioned behind their necks ( helmas nh-3000n ) . a subject s reaction time was measured with both their feet on a measuring instrument ( helmas nh-3000i ) . subjects were asked to jump vertically using both feet in response to a visual cue . the board was labeled at midline , with a parallel line 100 cm away ( peripheral line ) on either side of the midline . in alternating fashion , subjects were asked to perform lateral side steps to the left and right , touching the peripheral line with their feet . the total number of steps over the right or left peripheral line in 20 seconds was recorded . qol was assessed using the short form health survey ( sf-36 , taiwan version).30 the sf-36 questionnaire is a multipurpose and short - form health survey , which is commonly used to evaluate patients qol in clinical practice . a total of eight domains were evaluated in this questionnaire , including physical functioning , role limitation due to physical problems , bodily pain , general health , vitality , social functioning , role limitation due to emotional problem , and mental health . additionally , the eight health domains can be used to provide a physical component summary and a mental component summary score . all data analyses were performed using the statistical package for the social sciences for windows ( v 17.0 ; spss inc . , differences between groups based on age were calculated using a one - way analysis of variance ( anova ) and multiple comparisons using a scheff test . a p - value of < 0.05 was considered statistically significant . multiple linear regressions with forced - entry procedure were performed to determine the predictors for qol . a total of 408 postmenopausal women from chia yi area and yunlin county of taiwan were enrolled in the current investigation between august 2010 and december 2012 . postmenopausal women were defined as having had no menstruation in the previous 12 months.24,25 the inclusion criteria of this study were : 1 ) postmenopausal women who were 2 ) healthy and 3 ) physically independent . the exclusion criteria were symptomatic cardiorespiratory disease , cognitive impairment or progressive and debilitating conditions , recent bone fractures , or any other medical contraindications to performing the fitness assessment . participants were divided into three groups stratified by age ( group a : 50.059.9 years ; group b : 60.069.9 years ; group c : > 70.0 years ) . the following anthropometric parameters were measured : height , body weight , health - related fitness , and qol . this study was approved by the institutional review board of chang gung foundation ( irb102 - 2419c ) , tao yuan , taiwan . fitness of all subjects was evaluated using the helmas physical fitness management system ( o2run , co. , ltd . , seoul , korea ) at the sports medicine center , chang gung memorial hospital at chia yi . several dimensions of health - related fitness were evaluated , including muscular strength ( grip strength and back strength ) ; balance ( closed - eye foot balance ) ; cardiorespiratory endurance ( step test ) ; flexibility ( sitting trunk flexion and trunk extension ) ; muscle endurance ( sit - ups ) ; and agility ( reaction time and side steps).2629 grip strength and back strength were evaluated using a ( dominant ) hand and back dynamometer ( helmas nh-3000d and nh-3000e ) . the better of two measurements was recorded . subjects were asked to step at a pace of 24 cycles per minute ( metronome = 96 beats per minute ) using a 35 cm step box . after 3 minutes of stepping , subjects immediately sat down , and heart rate was recorded from 1 to 1.5 minutes posttest , 2 to 2.5 minutes posttest , and 3 to 3.5 minutes posttest ( acc-750b ; accuratus , new taipei city , taiwan ) . the results were recorded as time until exhaustion ( seconds ) and total heartbeats ; these data were then plotted into a fitness index equation ( fie ) : to assess balance , subjects closed their eyes and stood on their dominant leg on a balance - measuring instrument ( helmas nh-3000h ) . flexion , subjects sat on a flexibility measuring instrument ( helmas nh-3000 g ) with their heels positioned at the edge of the device . patients then bent forward at the waist with their hands outstretched in front of them to push the measuring instrument as far as possible past their feet . trunk extension was evaluated with the patient in a prone position on a flexibility - measuring instrument ( helmas nh-3000r ) . the number of sit - ups performed in a 30-second period was recorded for subjects lying on a sit - up board with their knees bent at right angles and both hands positioned behind their necks ( helmas nh-3000n ) . a subject s reaction time was measured with both their feet on a measuring instrument ( helmas nh-3000i ) . subjects were asked to jump vertically using both feet in response to a visual cue . the board was labeled at midline , with a parallel line 100 cm away ( peripheral line ) on either side of the midline . in alternating fashion , subjects were asked to perform lateral side steps to the left and right , touching the peripheral line with their feet . the total number of steps over the right or left peripheral line in 20 seconds was recorded . grip strength and back strength were evaluated using a ( dominant ) hand and back dynamometer ( helmas nh-3000d and nh-3000e ) . the better of two measurements was recorded . subjects were asked to step at a pace of 24 cycles per minute ( metronome = 96 beats per minute ) using a 35 cm step box . after 3 minutes of stepping , subjects immediately sat down , and heart rate was recorded from 1 to 1.5 minutes posttest , 2 to 2.5 minutes posttest , and 3 to 3.5 minutes posttest ( acc-750b ; accuratus , new taipei city , taiwan ) . the results were recorded as time until exhaustion ( seconds ) and total heartbeats ; these data were then plotted into a fitness index equation ( fie ) : to assess balance , subjects closed their eyes and stood on their dominant leg on a balance - measuring instrument ( helmas nh-3000h ) . for sitting trunk flexion , subjects sat on a flexibility measuring instrument ( helmas nh-3000 g ) with their heels positioned at the edge of the device . patients then bent forward at the waist with their hands outstretched in front of them to push the measuring instrument as far as possible past their feet . trunk extension was evaluated with the patient in a prone position on a flexibility - measuring instrument ( helmas nh-3000r ) . the number of sit - ups performed in a 30-second period was recorded for subjects lying on a sit - up board with their knees bent at right angles and both hands positioned behind their necks ( helmas nh-3000n ) . a subject s reaction time was measured with both their feet on a measuring instrument ( helmas nh-3000i ) . subjects were asked to jump vertically using both feet in response to a visual cue . the board was labeled at midline , with a parallel line 100 cm away ( peripheral line ) on either side of the midline . in alternating fashion , subjects were asked to perform lateral side steps to the left and right , touching the peripheral line with their feet . the total number of steps over the right or left peripheral line in 20 seconds was recorded . qol was assessed using the short form health survey ( sf-36 , taiwan version).30 the sf-36 questionnaire is a multipurpose and short - form health survey , which is commonly used to evaluate patients qol in clinical practice . a total of eight domains were evaluated in this questionnaire , including physical functioning , role limitation due to physical problems , bodily pain , general health , vitality , social functioning , role limitation due to emotional problem , and mental health . additionally , the eight health domains can be used to provide a physical component summary and a mental component summary score . all data analyses were performed using the statistical package for the social sciences for windows ( v 17.0 ; spss inc . , differences between groups based on age were calculated using a one - way analysis of variance ( anova ) and multiple comparisons using a scheff test . a p - value of < 0.05 was considered statistically significant . multiple linear regressions with forced - entry procedure were performed to determine the predictors for qol . the mean age of enrolled subjects was 64 years ( range : 5089 years ) . mean subject body mass index was 25 kg / m ( range : 1638 ) . an age - related decrease in body height ( p<0.05 ) was observed ( table 1 ) . with aging , dimensions of health - related fitness were reduced , including sit - ups , back and grip strength , side - step assessment , trunk extension , and agility ( p<0.05 ) ( table 2 ) . no differences were observed in the closed - eye balance test , sitting trunk flexion assessment , and step test between age - ranked groups . in qol assessment , physical functioning , role limitation due to physical problems , and physical component score were also decreased in aged groups ( p<0.05 ) ( table 3 ) . in order to determine the relationship between each dimension of health - related fitness and qol ( physical and mental component scores ) , pearson s correlation analysis was performed ( table 4 ) . a positive correlation between the physical component score of qol and fitness was observed , specifically for sit - ups ( correlation coefficient = 0.177 ) , back strength ( 0.334 ) , grip strength ( 0.286 ) , side steps ( 0.255 ) , sitting trunk flexion ( 0.145 ) , and trunk extension ( 0.297 ) ( p<0.01 for all ) . a negative correlation between the mental component score of qol and fitness was observed for closed - eye foot balance ( r=0.100 , p<0.01 ) . the different domains of fitness were also shown to be interrelated , specifically back strength correlated with grip strength , side steps , and trunk extension ( r=0.603 , 0.506 , and 0.490 , respectively , p<0.01 ) . to identify potential predictive factors for the physical and mental components of qol , multiple linear regression analyses were performed using forced - entry procedure , adjusted for age . all dimensions of health - related fitness were selected and represented as independent factors in the multiple linear regression analysis . results demonstrated that back strength significantly contributed to the physical component of qol with an adjusted beta of 0.268 ( p<0.05 ) ( table 5 ) . the most important finding of the current study was that back strength was the best predictor of the physical component of qol among the dimensions of health - related fitness in postmenopausal women ( figure 1 ) . the current results are consistent with previous reports describing back strength as an important contributing factor for improved qol in women with postmenopausal osteoporosis15 as well as the pivotal role of back strength in the improvement of qol in the elderly.3133 an increase in back strength resulting from exercise could improve qol in postmenopausal women.31 therefore , improved back strength is an important target for exercise training in an effort to enhance the physical components of qol . increased back strength , and any associated improvement in the physical component of qol , may encourage adherence to prescribed exercise training regimens . the remaining dimensions of health - related fitness could be improved to achieve postural alignment , dynamic balance , functional mobility , and back extensor strength , which are associated with mobility limitations and an increased risk of falling in older adults.3436 in the present study , we also demonstrated that back strength was positively correlated with grip strength , and that these domains probably share a common feature reflecting muscle strength . trunk strength and endurance are important factors in the rehabilitation of ambulatory elderly patients.32 recently , exercises specific for the abdominal core muscles have received attention for injury prevention , relief of lower back pain , and enhancing qol.37,38 the current findings suggest that further strategies for improving muscle strength and endurance are needed . in the current study , health - related fitness and the physical component of qol declined with increasing age , while the mental component of qol increased with aging . furthermore , participants aged 5059 years had greater fitness compared with their 60-year - old counterparts , consistent with previous reports wherein an age - related decline was observed in health - related fitness , including in muscular strength , flexibility , agility , and endurance.5,37 age - related decreases in health - related fitness are important , since the resulting postural misalignment , balance deficits , and strength / power loss are associated with impaired functional mobility and an increased risk of falling.32,34,38 therefore , muscle strengthening intervention may provide improved qol and thus motivate the elderly to continue exercises that could minimize the age - related decline of fitness . regarding the assessment of qol , the current results are consistent with previous reports of the physical component of qol being negatively correlated with age,16,33 whereas the association between the mental component of qol and age remains controversial.16,33,39 some studies have indicated that the mental component of qol is not correlated with age;16,33 however , in subjects from rural taiwan , we found an increase in the mental component of qol with aging . these findings may be partially explained by reduced physical health and improved mental health among women living in rural areas compared with those women from an urban setting.39 although an appropriate sample size and the homogeneity of subjects provided some strength in the present study , it was still limited by its cross - sectional design in terms of selection bias , ie , only associations were shown , not causality or temporal relationships . further , this study was performed in a rural area in southern taiwan , where most participants performed agricultural work and had strong community support , factors that contribute to a lesser impact of hypokinetics and loneliness , which may result in a reduction in the mental component of qol . further studies should be performed to validate the current findings , with interventional studies performed to test the hypothesis put forward by the current study . back strength was an important contributor for the physical component of qol among the dimensions of health - related fitness in postmenopausal women . further investigation is warranted to delineate the effect of exercise intervention through targeted activities for back strength , such as pilates , yoga , or core muscle strengthening exercises .

patients presenting to the emergency department ( ed ) with undifferentiated chest pain or other symptoms suggestive of acute coronary syndromes ( acs ) account for 10% of all ed visits and present a diagnostic challenge . acs , an umbrella term used to denote the spectrum of myocardial ischemia , includes unstable angina , nonstelevation myocardial infarction , and stelevation myocardial infarction . rapid triage for this potentially lifethreatening condition is paramount for effective timedependent reperfusion therapies that reduce mortality and morbidity . though a missed acs diagnosis is rare ( 2.1% to 5.3% ) , consequences are serious with a 2fold higher risk of 30day mortality for patients with acs inappropriately discharged from the ed . selfreported symptoms are the primary method by which patients communicate to clinicians the nature of their problem . therefore , symptoms have the potential to augment traditional clinical features and risk stratification tools in predicting the likelihood of acs the classic symptoms of acs , as endorsed by the american heart association ( aha ) and the american college of cardiology ( acc ) , are chest discomfort , discomfort in other areas of the upper body , shortness of breath , cold sweat , nausea , and lightheadedness . these symptoms have traditionally been used to aid in risk stratification and acceleration of care for patients presenting to the ed with symptoms suggestive of acs . findings from studies using predictive models to assess the value of symptoms for a diagnosis of acute myocardial infarction ( ami ) or acs have varied . some studies found that chest pain , shoulder pain , arm pain , sweating , nausea , and vomiting are predictive of ami / acs , but findings are not uniform across studies . attention to classic symptoms , in particular chest pain , may disadvantage women , the elderly , and individuals with diabetes , who may experience lesstypical symptoms or suffer from silent ischemia . however , identification of symptoms that are sensitive and specific to acs has the potential to reduce treatmentseeking delay and potentially expedite triage and diagnostic testing . most studies examining the sensitivity of symptoms associated with acs solely recruited patients with a confirmed diagnosis , limiting the ability to assess specificity . specificity of acs symptoms has been assumed to be low in women , but has not been confirmed . in addition , the predictive value of symptoms is more useful than sensitivity from a clinical perspective because it is the probability that a person with the symptom actually has the associated illness . the objective of this analysis was to determine the sensitivity , specificity , and predictive values of 13 previously validated symptoms for a diagnosis of acs in women and men presenting to the ed . this analysis is part of a larger prospective , multicenter study examining the influence of sex on symptom characteristics during acs . patients were enrolled at 4 large medical centers ; 1 in the midwest , 2 in the pacific northwest , and 1 in the west regions of the united states . three were academic medical centers , and the second northwest site was a large community medical center . approval from all 4 institutional review boards was received before the start of the study , and all participants gave written informed consent . each institutional review board approved a waiver of initial consent for electronic screening of patients at triage and to collect initial symptom data before enrollment . a waiver of initial consent was granted because the main study aim was to evaluate symptoms on presentation to the ed and because the emergent nature of patients presenting with possible acs precluded the provision of immediate informed consent . all patients were enrolled when they were deemed to be stable by the primary nurse or physician and had been transferred to a private examination room in either the ed or hospital . individuals presenting to the ed between january 2011 and march 2013 with symptoms triggering an acs evaluation and who were 21 years , fluent in english , and arrived by emergency medical services , private , or public transportation were eligible . patients were excluded if they had an underlying exacerbation of heart failure ( defined as bnp 500 pg / ml ) , were transferred from a hemodialysis facility , were being evaluated for a dysrhythmia , were nonenglish speaking , or had cognitive impairment ( defined as the inability to understand and provide written informed consent for the study ) . because most patients presenting to the ed for symptoms suggestive of acs will be ruled out , a targeted sampling plan was implemented for this study . patients most likely to be ruled in were identified before enrollment based on standard ecg and troponin criteria . those patients with any ecg changes suggestive of ischemia and/or with a troponin level outside the referenced norm for the institution were approached for enrollment . ischemia was defined as new st elevation at the j point 0.1 mv in 2 contiguous leads and/or new horizontal or downsloping st depression 0.05 mv in 2 contiguous leads and/or t inversion 0.1 mv in 2 contiguous leads with prominent r wave . discharge diagnoses ( acs versus nonacs ) were based on the clinical judgment of the ed physician for patients discharged from the ed and the attending physician for patients who were admitted . discharge diagnoses were abstracted from the medical record by trained research associates who were clinical experts and were also blinded to the research data . clinical data on selfreported comorbid factors , such as diabetes and hypertension , were confirmed from the medical record . if there were discrepancies , only the data from the medical record were used for the analyses . symptoms not appearing on the checklist can be recorded in a blank space marked other . the acs symptom checklist is derived from the symptoms of acute coronary syndromes index ( sacsi ) . the sacsi , a reliable and valid instrument , has been tested in previous studies . symptoms not listed on the checklist were recorded in a blank space marked other . a content validity index of 1.00 ( p<0.05 ) using lynn 's formula was calculated based on responses from 11 experts . one item , heat sensation , was judged irrelevant and removed from the original 14item checklist . this demographic and clinical questionnaire was designed using the standardized reporting guidelines recommended for studies evaluating risk stratification of ed patients with potential acs . these guidelines were established by the multidisciplinary standardized reporting criteria task force and are supported by the society for academic emergency medicine , the american college of emergency physicians , the aha , and the acc . the purpose of the questionnaire is to establish standardized reporting criteria that will allow for easier comparisons across studies and also facilitate metaanalyses . the items on the scale are weighted to reflect metabolic energy expenditure and correlate highly with peak vo2 ( r=0.80 ; p<0.0001 ) in patients with acs , ischemic heart disease , heart failure , and revascularization procedures . a trained member of the study research team completed the acs symptom checklist shortly after the patient was triaged in the ed . patients were then formally approached by the research staff for enrollment after they were deemed stable and placed in an ed examination room or in their hospital room . the study purpose was then explained , and once the patient provided written informed consent , additional clinical and individual characteristics were recorded . to address power concerns for differences in symptoms between patients ruled in and ruled out for acs , a sample size of 261 per group ( n=522 ) was needed for 80% power to detect a small effect size ( d=0.25 ) using anova with a 0.05 2sided level of significance . because the primary purpose of the study was sex differences in symptoms , we aimed to enroll an equal amount of women and men . demographic and clinical characteristics were described for the total sample and also compared by groups defined by acs diagnosis and sex using chisquare tests for independence , independent samples t tests , and wilcoxon rank sums tests . sensitivity was defined as the probability of the presence of a symptom among patients with a confirmed diagnosis of acs . specificity was defined as the probability of the absence of a symptom among patients ruled out for acs . sensitivity and specificity are usually calculated as simple proportions using a 22 crosstabulation of symptom ( present , absent ) versus diagnosis ( acs , no acs ) ; however , data collection sites varied on the proportion of patients ruled in for acs ( p<0.0001 ) . therefore , mixedeffects logistic regression models , including random intercepts to control for site differences , were used to estimate the sensitivity and specificity of each symptom for a confirmed acs diagnosis . models were tested for the entire sample and then stratified by sex . a sensitivity and specificity of 60% were considered to be moderately high for this sample based on previous studies of the sensitivity and specificity of symptoms for a diagnosis in a variety of conditions . similar logistic regression models were used to estimate the odds ratios ( ors ) of each symptom as a predictor of an acs diagnosis controlling for age , obesity , diabetes , functional status , and sex . a sex by symptom interaction term was evaluated to determine whether the relationship between symptoms and diagnosis varied between women and men . potential covariates were chosen based on sex differences in previous studies and because age , obesity , functional status , and diabetes can confound the symptom experience . individuals presenting to the ed between january 2011 and march 2013 with symptoms triggering an acs evaluation and who were 21 years , fluent in english , and arrived by emergency medical services , private , or public transportation were eligible . patients were excluded if they had an underlying exacerbation of heart failure ( defined as bnp 500 pg / ml ) , were transferred from a hemodialysis facility , were being evaluated for a dysrhythmia , were nonenglish speaking , or had cognitive impairment ( defined as the inability to understand and provide written informed consent for the study ) . because most patients presenting to the ed for symptoms suggestive of acs will be ruled out , a targeted sampling plan was implemented for this study . patients most likely to be ruled in were identified before enrollment based on standard ecg and troponin criteria . those patients with any ecg changes suggestive of ischemia and/or with a troponin level outside the referenced norm for the institution were approached for enrollment . ischemia was defined as new st elevation at the j point 0.1 mv in 2 contiguous leads and/or new horizontal or downsloping st depression 0.05 mv in 2 contiguous leads and/or t inversion 0.1 mv in 2 contiguous leads with prominent r wave . discharge diagnoses ( acs versus nonacs ) were based on the clinical judgment of the ed physician for patients discharged from the ed and the attending physician for patients who were admitted . discharge diagnoses were abstracted from the medical record by trained research associates who were clinical experts and were also blinded to the research data . clinical data on selfreported comorbid factors , such as diabetes and hypertension , were confirmed from the medical record . if there were discrepancies , only the data from the medical record were used for the analyses . symptoms not appearing on the checklist can be recorded in a blank space marked other . the acs symptom checklist is derived from the symptoms of acute coronary syndromes index ( sacsi ) . the sacsi , a reliable and valid instrument , has been tested in previous studies . symptoms not listed on the checklist were recorded in a blank space marked other . a content validity index of 1.00 ( p<0.05 ) using lynn 's formula was calculated based on responses from 11 experts . one item , heat sensation , was judged irrelevant and removed from the original 14item checklist . this demographic and clinical questionnaire was designed using the standardized reporting guidelines recommended for studies evaluating risk stratification of ed patients with potential acs . these guidelines were established by the multidisciplinary standardized reporting criteria task force and are supported by the society for academic emergency medicine , the american college of emergency physicians , the aha , and the acc . the purpose of the questionnaire is to establish standardized reporting criteria that will allow for easier comparisons across studies and also facilitate metaanalyses . the items on the scale are weighted to reflect metabolic energy expenditure and correlate highly with peak vo2 ( r=0.80 ; p<0.0001 ) in patients with acs , ischemic heart disease , heart failure , and revascularization procedures . a trained member of the study research team completed the acs symptom checklist shortly after the patient was triaged in the ed . patients were then formally approached by the research staff for enrollment after they were deemed stable and placed in an ed examination room or in their hospital room . the study purpose was then explained , and once the patient provided written informed consent , additional clinical and individual characteristics were recorded . to address power concerns for differences in symptoms between patients ruled in and ruled out for acs , a sample size of 261 per group ( n=522 ) was needed for 80% power to detect a small effect size ( d=0.25 ) using anova with a 0.05 2sided level of significance . because the primary purpose of the study was sex differences in symptoms , we aimed to enroll an equal amount of women and men . demographic and clinical characteristics were described for the total sample and also compared by groups defined by acs diagnosis and sex using chisquare tests for independence , independent samples t tests , and wilcoxon rank sums tests . sensitivity was defined as the probability of the presence of a symptom among patients with a confirmed diagnosis of acs . specificity was defined as the probability of the absence of a symptom among patients ruled out for acs . sensitivity and specificity are usually calculated as simple proportions using a 22 crosstabulation of symptom ( present , absent ) versus diagnosis ( acs , no acs ) ; however , data collection sites varied on the proportion of patients ruled in for acs ( p<0.0001 ) . therefore , mixedeffects logistic regression models , including random intercepts to control for site differences , were used to estimate the sensitivity and specificity of each symptom for a confirmed acs diagnosis . models were tested for the entire sample and then stratified by sex . a sensitivity and specificity of 60% were considered to be moderately high for this sample based on previous studies of the sensitivity and specificity of symptoms for a diagnosis in a variety of conditions . similar logistic regression models were used to estimate the odds ratios ( ors ) of each symptom as a predictor of an acs diagnosis controlling for age , obesity , diabetes , functional status , and sex . a sex by symptom interaction term was evaluated to determine whether the relationship between symptoms and diagnosis varied between women and men . potential covariates were chosen based on sex differences in previous studies and because age , obesity , functional status , and diabetes can confound the symptom experience . the sample ( n=736 ) included 301 patients ( 40.9% ) ruled in and 435 ( 59.1% ) ruled out for acs . of the 1005 patients eligible to participate , 269 ( 26.8% ) declined ( figure ) . of the 301 patients who ruled in for acs , 9.6% had normal troponins and a normal ecg , 24.9% had normal troponins and an abnormal ecg , 12.6% had elevated troponins and a normal ecg , and 52.9% had elevated troponins and an abnormal ecg . patients were predominantly caucasian ( 70.6% ) and had a mean age of 59.714.2 years . overall , participants ruled in for acs were older than those ruled out for acs ( 61.312.2 versus 58.615.4 years , p=0.013 ; range 21 to 98 ) , were more likely to have diabetes ( 31.8% versus 24.6% ; p=0.034 ) , more often male ( 74.4% versus 55.2% ; p=<0.0001 ) , and more likely to be in the middleincome ranges . acs was more common among the income group , ranging from $ 20 000 to $ 49 999 , whereas a plurality of patients without acs were in the lowest income group ( p=0.001 ) . men had higher rates of current smoking than women ( 23.3% versus 14.7% ; p=0.003 ) . other race / ethnicity includes native hawaiian or other pacific islander , american indian / alaska native . sample clinical characteristics by diagnosis and sex acs indicates acute coronary syndrome ; bmi , body mass index ; sd , standard deviation . patients ruled in for acs were more likely to experience chest pain ( 71% versus 61% ; p=0.006 ) , but less likely to experience palpitations ( 19% versus 28% ; p=0.008 ) , upper back pain ( 19% versus 29% ; p=0.001 ) , shortness of breath ( 46% versus 60% ; p<0.0001 ) , unusual fatigue ( 34% versus 49% ; p<0.0001 ) , and lightheadedness ( 36% versus 46% ; p=0.006 ) , compared to patients ruled out for acs ( table 3 ) . women ruled in for acs were more likely to report arm pain ( 47% versus 32% ; p=0.021 ) , compared to women ruled out for acs . men ruled in for acs were more likely to report chest pressure ( 63% versus 54% ; p=0.035 ) and chest pain ( 72% versus 60% ; p=0.005 ) and less likely to report upper back pain ( 13% versus 24% ; p=0.004 ) , shortness of breath ( 41% versus 59% ; p<0.0001 ) , and unusual fatigue ( 32% versus 48% ; p=<0.001 ) . the mean number of symptoms ranged from 5 to 6 across groups , and patients in each group reported the full range of symptoms ( 1 to 13 ) . there were no differences between patients ruled in for acs and those ruled out for acs or between women and men for mean number of symptoms . sensitivities for individual symptoms on the checklist ranged from 27% to 67% for women and 14% to 72% for men chest pain demonstrated the highest sensitivity for acs in both women ( 66% , 66% , and 67% , respectively ) and men ( 63% , 69% , and 72% , respectively ) . six symptoms in particular shoulder pain , sweating , palpitations , upper back pain , arm pain , and indigestion had higher specificities ( > 60% ) , indicating that those patients who did not experience those symptoms were likely to be ruled out for acs . sensitivity and specificity of symptoms for a diagnosis by sex bolded values are considered sensitive and/or specific . each symptom was tested as a predictor of acs diagnosis in models adjusted for data collection site , age , obesity , diabetes , and functional status . a symptom by sex interaction term was also tested because there have been previous reports of sex differences in symptoms . there were significant interactions for sex and shoulder pain ( p=0.034 ) and shortness of breath ( p=0.004 ) ( table 5 ) , meaning that the relationship between the symptom and acs diagnosis differed by sex . analyses of symptoms stratified by sex indicated that shoulder pain ( or=2.53 ; 95% ci=1.29 to 4.96 ) and arm pain ( or=2.15 ; 95% ci=1.10 to 4.20 ) were predictive of an acs diagnosis for women , but not men ( or=1.11 ; 95% ci=0.67 to 1.85 ; or=1.21 ; 95% ci=0.74 to 1.99 , respectively ) . shortness of breath was predictive of a nonacs diagnosis for men ( or=0.49 ; 95% ci=0.30 to 0.79 ) , but was not predictive of a diagnosis for women ( or=1.36 ; 95% ci=0.68 to 2.70 ) . models were adjusted for data collection site , age , obesity , diabetes , and functional status . the sample ( n=736 ) included 301 patients ( 40.9% ) ruled in and 435 ( 59.1% ) ruled out for acs . of the 1005 patients eligible to participate , 269 ( 26.8% ) declined ( figure ) . of the 301 patients who ruled in for acs , 9.6% had normal troponins and a normal ecg , 24.9% had normal troponins and an abnormal ecg , 12.6% had elevated troponins and a normal ecg , and 52.9% had elevated troponins and an abnormal ecg . patients were predominantly caucasian ( 70.6% ) and had a mean age of 59.714.2 years . overall , participants ruled in for acs were older than those ruled out for acs ( 61.312.2 versus 58.615.4 years , p=0.013 ; range 21 to 98 ) , were more likely to have diabetes ( 31.8% versus 24.6% ; p=0.034 ) , more often male ( 74.4% versus 55.2% ; p=<0.0001 ) , and more likely to be in the middleincome ranges . acs was more common among the income group , ranging from $ 20 000 to $ 49 999 , whereas a plurality of patients without acs were in the lowest income group ( p=0.001 ) . men had higher rates of current smoking than women ( 23.3% versus 14.7% ; p=0.003 ) . other race / ethnicity includes native hawaiian or other pacific islander , american indian / alaska native . sample clinical characteristics by diagnosis and sex acs indicates acute coronary syndrome ; bmi , body mass index ; sd , standard deviation . patients ruled in for acs were more likely to experience chest pain ( 71% versus 61% ; p=0.006 ) , but less likely to experience palpitations ( 19% versus 28% ; p=0.008 ) , upper back pain ( 19% versus 29% ; p=0.001 ) , shortness of breath ( 46% versus 60% ; p<0.0001 ) , unusual fatigue ( 34% versus 49% ; p<0.0001 ) , and lightheadedness ( 36% versus 46% ; p=0.006 ) , compared to patients ruled out for acs ( table 3 ) . women ruled in for acs were more likely to report arm pain ( 47% versus 32% ; p=0.021 ) , compared to women ruled out for acs . men ruled in for acs were more likely to report chest pressure ( 63% versus 54% ; p=0.035 ) and chest pain ( 72% versus 60% ; p=0.005 ) and less likely to report upper back pain ( 13% versus 24% ; p=0.004 ) , shortness of breath ( 41% versus 59% ; p<0.0001 ) , and unusual fatigue ( 32% versus 48% ; p=<0.001 ) . the mean number of symptoms ranged from 5 to 6 across groups , and patients in each group reported the full range of symptoms ( 1 to 13 ) . there were no differences between patients ruled in for acs and those ruled out for acs or between women and men for mean number of symptoms . sensitivities for individual symptoms on the checklist ranged from 27% to 67% for women and 14% to 72% for men ( table 4 ) . chest pressure , discomfort , and chest pain demonstrated the highest sensitivity for acs in both women ( 66% , 66% , and 67% , respectively ) and men ( 63% , 69% , and 72% , respectively ) . six symptoms in particular shoulder pain , sweating , palpitations , upper back pain , arm pain , and indigestion had higher specificities ( > 60% ) , indicating that those patients who did not experience those symptoms were likely to be ruled out for acs . sensitivity and specificity of symptoms for a diagnosis by sex bolded values are considered sensitive and/or specific . each symptom was tested as a predictor of acs diagnosis in models adjusted for data collection site , age , obesity , diabetes , and functional status . a symptom by sex interaction term was also tested because there have been previous reports of sex differences in symptoms . there were significant interactions for sex and shoulder pain ( p=0.034 ) and shortness of breath ( p=0.004 ) ( table 5 ) , meaning that the relationship between the symptom and acs diagnosis differed by sex . analyses of symptoms stratified by sex indicated that shoulder pain ( or=2.53 ; 95% ci=1.29 to 4.96 ) and arm pain ( or=2.15 ; 95% ci=1.10 to 4.20 ) were predictive of an acs diagnosis for women , but not men ( or=1.11 ; 95% ci=0.67 to 1.85 ; or=1.21 ; 95% ci=0.74 to 1.99 , respectively ) . shortness of breath was predictive of a nonacs diagnosis for men ( or=0.49 ; 95% ci=0.30 to 0.79 ) , but was not predictive of a diagnosis for women ( or=1.36 ; 95% ci=0.68 to 2.70 ) . models were adjusted for data collection site , age , obesity , diabetes , and functional status . the findings that all 3 chest symptoms ( pressure , discomfort , and pain ) were sensitive , but not specific , for a diagnosis of acs , whereas shoulder and arm pain were predictive of an acs diagnosis for women only , are important findings . goodacre et al also found that pain radiating to either arm was predictive of acs . swap and nagurney also found that chest pain radiating to one or both shoulders or arms increased the likelihood of an acs diagnosis . lack of sexstratified analysis has been a continuing problem in understanding the influence of sex on acs symptoms . earlier findings have demonstrated that older patients and patients with diabetes report less chest pain during acs . because women are , on average , 10 years older than men when they develop acs , shoulder and arm pain ( particularly in women ) may serve as additional prompts that aid emergency medical services and triage personnel in identifying patients with acs particularly in the absence of chest symptoms . whether these findings apply to women under age 55 who are at higher risk for mortality and morbidity , but at lower risk for development of acs , requires further study . as expected , chest pressure , discomfort , and pain were sensitive for a diagnosis of acs in both women and men . patients ruled in for acs were older than those ruled out for acs , more likely to have diabetes , and more often male . this is consistent with herlitz et al ( or=1.97 ; 95% ci=1.30 to 2.99 ) and edwards et al ( relative ratio=1.48 ; 95% ci=1.00 to 2.18 ) , who found male sex to be an independent predictor of an acs diagnosis . in a large metaanalysis , haasenritter et al found that age ( likelihood ratio [ lr]=1.44 ; 95% ci=1.19 to 1.73 ) , diabetes ( lr=1.68 ; 95% ci=1.35 to 2.09 ) , and male sex ( lr=1.17 ; 95% ci=1.08 to 1.27 ) were associated with an acs diagnosis . income also differed significantly between the acs and nonacs groups , but in an unanticipated way ; patients in the middleincome levels were more likely to have acs than those in the lowerincome levels . it is unknown why individuals in the middleincome ranges were more likely to be ruled in for acs . shoulder pain , sweating , palpitations , upper back pain , arm pain , and indigestion had moderately high specificities for a nonacs diagnosis ( 60% ) in both women and men . these findings support the editorial by canto et al suggesting that it is time to standardize the collection of acs symptoms in patients presenting to the ed in order to determine the significance of sex differences in symptoms of acs . lack of specificity of chest symptoms for a diagnosis of acs requires further study , and use of a standardized tool would facilitate comparisons across studies . in addition , lack of specificity for chest symptoms could contribute to delays in patient decisions and in diagnosis because noncardiac chest pain is a common and costly occurrence . specificities in the 60% to 70% range are not high enough to preclude the evaluation of ecgs and troponins in patients presenting to the ed with symptoms suggestive of acs , but they may be high enough to design evidencebased public health messages for the public and especially for patients at risk for acs . this further creates a diagnostic conundrum in the ed because most patients are undifferentiated on presentation , and streamlined care is an expectation for potentially lifethreatening conditions such as acs . although there were no sex differences in reports of chest pain , men with acs were more likely to experience chest pain , compared to men without acs . reports of sex differences in chest pain have varied in large database studies and smaller cohort studies . some investigators have found that women are less likely to report chest pain and some have reported no differences between women and men . our results suggest that low specificities of symptoms are also likely to impact ed symptombased triage . the current approach , in which a wide net is cast for acs , appears necessary to avoid missing a true acs diagnosis . the mean number of symptoms experienced by participants was high , which is important when planning public health messaging . being knowledgeable about , and alert for , a single symptom such as chest pain is not sufficient to make an informed decision about proper care seeking when experiencing possible acs . the public should be informed that multiple symptoms are likely during acs . because the mean number of reported symptoms exceeded 5 for both women and men , it is likely that the assessment of individual symptoms is not sufficient to improve clinical assessment and decision making . this prospective study was well powered , and symptoms reported directly by the patients were recorded shortly after presentation to the ed . the availability of realtime selfreport of dynamic symptoms effectively eliminates recall bias and increases the internal validity of the findings , which has been a limitation of previous acs studies . our 13item validated checklist contains symptoms that are empirically derived from large heterogeneous samples of patients , takes < 1 minute to complete , and is suitable for research and clinical practice . the demographic and clinical characteristics of our patients suggest that this sample was representative of the us population and that there were minimal baseline differences between patients with and without acs . finally , we adjusted for factors well known to affect symptoms as reported in the literature . we enrolled only patients whom ed nurses and physicians deemed to be at risk for acs . therefore , true acs patients may have been missed if an acs diagnosis was not considered . also , in order to enroll a sufficient number of patients with confirmed acs , the sample was enriched by targeting patients with an abnormal ecg or troponin and thus may not be representative of the individuals presenting to triage . further , though an abnormal ecg and troponin were part of the sampling plan , in the final adjudication ( discharge diagnosis ) clinicians felt that nearly 10% of patients with normal ecg and troponin levels did have acs . our 13item validated checklist may have missed other symptoms ; however , patients were asked if they were experiencing any other symptoms not contained on the list . whereas canto has called for the use of a more comprehensive symptom instrument , our goal was to use a validated symptom tool that was suitable for use as a clinical assessment tool in prehospital and hospital triage as well as in primary care and research . hence , findings may not be generalizable to patients that presented between 2300 and 0700 . whereas we believe selfreport to be strength of the study , some have considered it a limitation because there is no way to externally validate the symptom event . however , justice et al noted that patients , not providers , experience symptoms and so are best able to describe them . selfreported symptoms have been independently associated with quality of life and activities of daily living in patients with acquired immunodeficiency virus . selfreport of symptoms may be considered superior to symptoms abstracted from the medical record because there is no way of knowing how accurate the medical record is or to independently validate which symptoms were actually reported by patients . in addition , prudence is called for in generalizing these findings outside of the ed . patients presenting to the ed are a select group that made a conscious choice to seek care for symptoms judged to be potentially serious . therefore , sex differences in symptoms may be attributable to selection bias in behaviors associated with a decision to seek assistance , rather than true pathophysiologic or psychosocial difference in symptoms . a considerable number of patients with undifferentiated chest pain were excluded from the study by design because the main aim was to evaluate sex differences in symptoms among patients with confirmed acs . finally , the predictive power of ors between 1.0 and 2.0 may be limited and does not support discharging lowrisk patients on the basis of symptoms alone without further testing , such as ecg and cardiac biomarkers . this prospective study was well powered , and symptoms reported directly by the patients were recorded shortly after presentation to the ed . the availability of realtime selfreport of dynamic symptoms effectively eliminates recall bias and increases the internal validity of the findings , which has been a limitation of previous acs studies . our 13item validated checklist contains symptoms that are empirically derived from large heterogeneous samples of patients , takes < 1 minute to complete , and is suitable for research and clinical practice . the demographic and clinical characteristics of our patients suggest that this sample was representative of the us population and that there were minimal baseline differences between patients with and without acs . finally , we adjusted for factors well known to affect symptoms as reported in the literature . we enrolled only patients whom ed nurses and physicians deemed to be at risk for acs . therefore , true acs patients may have been missed if an acs diagnosis was not considered . also , in order to enroll a sufficient number of patients with confirmed acs , the sample was enriched by targeting patients with an abnormal ecg or troponin and thus may not be representative of the individuals presenting to triage . further , though an abnormal ecg and troponin were part of the sampling plan , in the final adjudication ( discharge diagnosis ) clinicians felt that nearly 10% of patients with normal ecg and troponin levels did have acs . our 13item validated checklist may have missed other symptoms ; however , patients were asked if they were experiencing any other symptoms not contained on the list . whereas canto has called for the use of a more comprehensive symptom instrument , our goal was to use a validated symptom tool that was suitable for use as a clinical assessment tool in prehospital and hospital triage as well as in primary care and research . hence , findings may not be generalizable to patients that presented between 2300 and 0700 . whereas we believe selfreport to be strength of the study , some have considered it a limitation because there is no way to externally validate the symptom event . however , justice et al noted that patients , not providers , experience symptoms and so are best able to describe them . selfreported symptoms have been independently associated with quality of life and activities of daily living in patients with acquired immunodeficiency virus . selfreport of symptoms may be considered superior to symptoms abstracted from the medical record because there is no way of knowing how accurate the medical record is or to independently validate which symptoms were actually reported by patients . in addition , prudence is called for in generalizing these findings outside of the ed . patients presenting to the ed are a select group that made a conscious choice to seek care for symptoms judged to be potentially serious . therefore , sex differences in symptoms may be attributable to selection bias in behaviors associated with a decision to seek assistance , rather than true pathophysiologic or psychosocial difference in symptoms . a considerable number of patients with undifferentiated chest pain were excluded from the study by design because the main aim was to evaluate sex differences in symptoms among patients with confirmed acs . finally , the predictive power of ors between 1.0 and 2.0 may be limited and does not support discharging lowrisk patients on the basis of symptoms alone without further testing , such as ecg and cardiac biomarkers . there were more similarities than differences in symptom predictors of acs for women and men . women were twice as likely to report arm and shoulder pain , compared to men . although sex differences were minimal , shoulder pain and arm pain may be key symptoms that improve clinical prediction of acs in women . the authors thank kevin grandfield , publication manager of the uic department of biobehavioral health science , for editorial assistance .

chrysanthemi flos ( cf ) , the flowers of chrysanthemum indicum or c. morifolium , is rich in volatile oils , flavonoids and so on . macrophages are main players in the immune function as antigen - presenting cells in initiating adaptive immune responses and in the innate immune response . many studies have demonstrated that chrysanthemum cinerariaefolium , same genus as chrysanthemum , increases innate immunity . these immune responses are reported to be stimulated not only by intact bacterial cells but also by their components , including peptidoglycan , lipoteichoic acids , and intra - extracellular polysaccharide products , and cell wall ( cw ) and cell free extract ( cfe ) fractions [ 5 - 8 ] . much evidence exists that herbs have effective immunomodulatory activities in both preclinical and clinical researches [ 9 - 13 ] , and studies of the modulatory effects on nitricoxide ( no ) production have been conducted [ 14 - 16 ] . also , medicinal herbs , compositae , have been studied for immune regulation , but few studies have addressed chrysanyhemi flos regulating the production of nitric - oxide ( no ) . therefore , the aim of this study was to use the lipopolysaccharide ( lps)-treated raw 264.7 murine macrophage model to further explore the potential immunomodulation of cf , especially for the regulation of no production . cf was prepared as follows : chrysanthemi flos , 100 g , was added to 2,000 ml of distilled water and boiled in a heating extractor for 3 hours . the extract was filtered and concentrated by using a rotary evaporator and was lyophilized by using a freeze dryer ( 17.9 g ) . the lyophilized extract was dissolved in water and filtered three times through microfilter paper ( whatman no . 2 , 0.45 - 0.2 m ) . then , it was placed in a disinfected vial and sealed for further study . mouse monocyte / macrophage cell line raw 264.7 ( atcc tib- 71 ) was grown in dulbecco 's modified eagle 's medium ( dmem ) , supplemented with 10% fetal bovine serum ( fbs ) , streptomycin ( 100 mg / ml ) and penicillin ( 100 u / ml ) , at 37c with 5% co2 . cells were transferred to 96-well culture plates at a density of 1 x 10 cells / well and were allowed to adhere for 24 hours prior to sample treatment . the culture supernatant was collected and stored at -80c until it was analyzed for nitric - oxide ( no ) , interleukin-6 ( il-6 ) and tumor necrosis factor - alpha ( tnf- ) . samples were incubated with cells for 24 hours , and cells cultured with lps from escherichia coli serotype o127:b8 ( sigma - aldrich , missouri , usa ) at a concentration of 1 g / ml were used as a control . the general viability of cultured cells was determined by reduction of 3-(4 , 5-dimethylthiazol-2-yl)-2 , 5-diphenyltetrazolium bromide ( mtt ) to formazan . mtt in living cells is reduced to formazan crystals , and the amount of formazan dissolved in dimethyl sulfoxide ( dmso ) , as measured by using the by spectroscopic method , shows the growth of cells . the cell were seeded in 96-well plates at a density of 1 x 10 cells/ well and were cultured at 37c in 5% co2 . cells were pretreated with the sample at concentration , of 0 , 50 , 100 and 200 g / ml with or without 1 g / ml of lps for 24 hours . then , cells were treated with 0.05 mg / ml ( final concentration ) of mtt and incubated at 37c for an additional 4 hours . the medium containing mtt was discarded , and the mtt formazan that had been produced was dissolved in 200 l of dmso . the cell viability was calculated as follows : cell viability ( % ) = [ ( optical density595 of sample)/(optical density595 of control)]100 . raw 264.7 cells were seeded in triplicates at a density of 5 x 10 cells / well in 96-well plates with complete dmem and were allowed to adhere for 24 hours . after that , the cells were washed three times with phosphate buffered saline , ( ph 7.2 ) , and the phagocytic ability of the macrophages was measured by using a phagocytosis assay kit ( cayman chemical , michigan , usa ) according to the procedure described by the manufacturer . the no concentration was determined by measuring the amount of released nitrite with griess reagent ( sigma - aldrich , missouri , usa ) according to the griess reaction . griess reagent produced a chemical reaction with nitrite and formed a purple azo salt that was consistent with the no concentration . briefly , 50 l of cell culture supernatant was added to new 96- well plates and mixed with 50 l of modified griess reagent . after incubation at room temperature for 15 min , the absorbance was measured in a plate reader at 540 nm . the concentrations of il-6 and tnf- in the culture supernatant were measured by using a il-6 kit ( thermo scientific , illinois , usa ) and a tnf- kit ( r&d systems , minnesota , usa ) , respectively , according to the procedure described by the manufacturer . significant changes were evaluated by using the one - way anova with dunnett s post - hoc test . cf was prepared as follows : chrysanthemi flos , 100 g , was added to 2,000 ml of distilled water and boiled in a heating extractor for 3 hours . the extract was filtered and concentrated by using a rotary evaporator and was lyophilized by using a freeze dryer ( 17.9 g ) . the lyophilized extract was dissolved in water and filtered three times through microfilter paper ( whatman no . 2 , 0.45 - 0.2 m ) . then , it was placed in a disinfected vial and sealed for further study . mouse monocyte / macrophage cell line raw 264.7 ( atcc tib- 71 ) was grown in dulbecco 's modified eagle 's medium ( dmem ) , supplemented with 10% fetal bovine serum ( fbs ) , streptomycin ( 100 mg / ml ) and penicillin ( 100 u / ml ) , at 37c with 5% co2 . cells were transferred to 96-well culture plates at a density of 1 x 10 cells / well and were allowed to adhere for 24 hours prior to sample treatment . the culture supernatant was collected and stored at -80c until it was analyzed for nitric - oxide ( no ) , interleukin-6 ( il-6 ) and tumor necrosis factor - alpha ( tnf- ) . samples were incubated with cells for 24 hours , and cells cultured with lps from escherichia coli serotype o127:b8 ( sigma - aldrich , missouri , usa ) at a concentration of 1 g / ml were used as a control . the general viability of cultured cells was determined by reduction of 3-(4 , 5-dimethylthiazol-2-yl)-2 , 5-diphenyltetrazolium bromide ( mtt ) to formazan . mtt in living cells is reduced to formazan crystals , and the amount of formazan dissolved in dimethyl sulfoxide ( dmso ) , as measured by using the by spectroscopic method , shows the growth of cells . the cell were seeded in 96-well plates at a density of 1 x 10 cells/ well and were cultured at 37c in 5% co2 . cells were pretreated with the sample at concentration , of 0 , 50 , 100 and 200 g / ml with or without 1 g / ml of lps for 24 hours . then , cells were treated with 0.05 mg / ml ( final concentration ) of mtt and incubated at 37c for an additional 4 hours . the medium containing mtt was discarded , and the mtt formazan that had been produced was dissolved in 200 l of dmso . the cell viability was calculated as follows : cell viability ( % ) = [ ( optical density595 of sample)/(optical density595 of control)]100 . raw 264.7 cells were seeded in triplicates at a density of 5 x 10 cells / well in 96-well plates with complete dmem and were allowed to adhere for 24 hours . after that , the cells were washed three times with phosphate buffered saline , ( ph 7.2 ) , and the phagocytic ability of the macrophages was measured by using a phagocytosis assay kit ( cayman chemical , michigan , usa ) according to the procedure described by the manufacturer . the no concentration was determined by measuring the amount of released nitrite with griess reagent ( sigma - aldrich , missouri , usa ) according to the griess reaction . griess reagent produced a chemical reaction with nitrite and formed a purple azo salt that was consistent with the no concentration . briefly , 50 l of cell culture supernatant was added to new 96- well plates and mixed with 50 l of modified griess reagent . after incubation at room temperature for 15 min , the absorbance was measured in a plate reader at 540 nm . the concentrations of il-6 and tnf- in the culture supernatant were measured by using a il-6 kit ( thermo scientific , illinois , usa ) and a tnf- kit ( r&d systems , minnesota , usa ) , respectively , according to the procedure described by the manufacturer . significant changes were evaluated by using the one - way anova with dunnett s post - hoc test . in order to evaluate the cytotoxicity of cf , samples were prepared at various concentrations and used to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 1 ) at concentrations of 50 , 100 and 200 g / ml . the cell viability was recalculated into 100 % of lps - treated control group . the cell 's viabilities treated with lps , both lps and cf 50 g / ml , both lps and cf 100 g / ml , both lps and cf 200 g / ml , vehicle , cf 50 , cf 100 and cf 200 g / ml were respectively 100.0 1.6 , 126.7 1.0 , 128.5 2.7 , 136.7 5.5 , 75.3 2.2 , 78.0 3.2 , 87.3 1.3 and 75.2 2.6 % . lps with or without cf treatments significantly increased the cell 's viabilities compared to vehicle with or without cf treatments . moreover all groups treated with both lps and cf ( lps(+ ) cf(50 , 100 and 200 ) ) showed significantly increased cell viabilities compared to control group treated with lps . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the phagocytic activity of cf , we prepared samples at various concentrations and used them to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 2 ) at concentrations of 50 , 100 and 200 g / ml . the phagocytic activity was normalized to 100% for the lps - treated control group . the phagocytic activities treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 100.0 6.4 , 99.4 2.1 , 106.7 8.2 , 119.0 6.7 , 92.0 3.4 , 92.3 3.0 , 93.8 2.5 and 86.5 5.9 % . both lps and cf treatments increased the phagocytic activities compared to lps treatments in a dose - dependent manner . especially both lps and cf ( 200 g / ml ) treatments showed statistical difference compared to the lps - treated control group ( p 0.05 , fig 2 ) . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 and 200 g / m ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the no production of cf , we prepared samples at various concentrations and used them to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 3 ) at concentrations of 50 , 100 and 200 g / ml . the no productions treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 14.6 0.4 , 14.8 0.2 , 14.8 0.2 , 13.0 0.4 , 1.2 0.0 , 1.3 0.0 , 1.2 0.1 and 2.8 1.9 m . lps treatment significantly increased the no production compared to vehicle treatment ( p 0.05 ) , but both lps and cf ( 200 g / ml ) treatment could significantly reduce the no production induced by lps treatment ( p 0.05 , fig 3 ) lps(+ ) cf(- ) : control group treated with lps . lps(+ ) cf ( 50 , 100 , and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf(50 , 100 and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the il-6 production of cf , we prepared samples at various concentrations and used them to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 4 ) at concentrations of 50 , 100 and 200 g / ml . the il-6 production treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 1097.1 88.0 , 1045.7 0.3 , 1185.7 1.4 , 1081.4 0.3 , 5.1 3.3 , 6.2 55.0 , 3.9 95.0 and 3.2 14.3 pg / ml . lps treatment significantly increased the il-6 production compared to vehicle treatment ( p 0.05 ) . however , cf treatment did not change the il-6 production induced by lps treatment ( fig 4 ) lps(+ ) cf(- ) : control group treated with lps . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the tnf-production of cf , we prepared samples at various concentrations and used to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 5 ) at concentrations of 50 , 100 and 200 g / ml . the tnf-production treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 452.7 3.0 , 448.3 2.5 , 441.3 3.4 , 440.7 5.4 , 1.9 1.1 , 1.5 0.7 , 1.0 0.6 and 2.4 0.6 pg / ml . however , cf treatment did not change the tnf-production induced by lps treatment ( fig 5 ) lps treatment significantly increased the tnf-production compared to vehicle treatment ( p 0.05 ) . however , cf treatment did not change the tnf-production induced by lps treatment ( fig 5 ) lps(+ ) cf(- ) : control group treated with lps . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 , and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 in order to evaluate the cytotoxicity of cf , samples were prepared at various concentrations and used to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 1 ) at concentrations of 50 , 100 and 200 g / ml . the cell viability was recalculated into 100 % of lps - treated control group . the cell 's viabilities treated with lps , both lps and cf 50 g / ml , both lps and cf 100 g / ml , both lps and cf 200 g / ml , vehicle , cf 50 , cf 100 and cf 200 g / ml were respectively 100.0 1.6 , 126.7 1.0 , 128.5 2.7 , 136.7 5.5 , 75.3 2.2 , 78.0 3.2 , 87.3 1.3 and 75.2 2.6 % . lps with or without cf treatments significantly increased the cell 's viabilities compared to vehicle with or without cf treatments . moreover all groups treated with both lps and cf ( lps(+ ) cf(50 , 100 and 200 ) ) showed significantly increased cell viabilities compared to control group treated with lps . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the phagocytic activity of cf , we prepared samples at various concentrations and used them to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 2 ) at concentrations of 50 , 100 and 200 g / ml . the phagocytic activity was normalized to 100% for the lps - treated control group . the phagocytic activities treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 100.0 6.4 , 99.4 2.1 , 106.7 8.2 , 119.0 6.7 , 92.0 3.4 , 92.3 3.0 , 93.8 2.5 and 86.5 5.9 % . both lps and cf treatments increased the phagocytic activities compared to lps treatments in a dose - dependent manner . especially both lps and cf ( 200 g / ml ) treatments showed statistical difference compared to the lps - treated control group ( p 0.05 , fig 2 ) . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 and 200 g / m ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the no production of cf , we prepared samples at various concentrations and used them to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 3 ) at concentrations of 50 , 100 and 200 g / ml . the no productions treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 14.6 0.4 , 14.8 0.2 , 14.8 0.2 , 13.0 0.4 , 1.2 0.0 , 1.3 0.0 , 1.2 0.1 and 2.8 1.9 m . lps treatment significantly increased the no production compared to vehicle treatment ( p 0.05 ) , but both lps and cf ( 200 g / ml ) treatment could significantly reduce the no production induced by lps treatment ( p 0.05 , fig 3 ) lps(+ ) cf(- ) : control group treated with lps . lps(+ ) cf ( 50 , 100 , and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf(50 , 100 and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the il-6 production of cf , we prepared samples at various concentrations and used them to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 4 ) at concentrations of 50 , 100 and 200 g / ml . the il-6 production treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 1097.1 88.0 , 1045.7 0.3 , 1185.7 1.4 , 1081.4 0.3 , 5.1 3.3 , 6.2 55.0 , 3.9 95.0 and 3.2 14.3 pg / ml . lps treatment significantly increased the il-6 production compared to vehicle treatment ( p 0.05 ) . however , cf treatment did not change the il-6 production induced by lps treatment ( fig 4 ) lps(+ ) cf(- ) : control group treated with lps . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 . in order to evaluate the tnf-production of cf , we prepared samples at various concentrations and used to treat raw 264.7 cells . the results of this evaluation are shown in ( fig 5 ) at concentrations of 50 , 100 and 200 g / ml . the tnf-production treated with lps , both lps and cf ( 50 g / ml ) , both lps and cf ( 100 g / ml ) , both lps and cf ( 200 g / ml ) , vehicle , cf ( 50 g / ml ) , cf ( 100 g / ml ) and cf ( 200 g / ml ) were , respectively , 452.7 3.0 , 448.3 2.5 , 441.3 3.4 , 440.7 5.4 , 1.9 1.1 , 1.5 0.7 , 1.0 0.6 and 2.4 0.6 pg / ml . however , cf treatment did not change the tnf-production induced by lps treatment ( fig 5 ) lps treatment significantly increased the tnf-production compared to vehicle treatment ( p 0.05 ) . however , cf treatment did not change the tnf-production induced by lps treatment ( fig 5 ) lps(+ ) cf(- ) : control group treated with lps . lps(+ ) cf ( 50 , 100 and 200 g / ml ) : experimental groups treated with both lps and cf ( 50 , 100 and 200 g / ml ) . lps(- ) cf ( 50 , 100 , and 200 g / ml ) : experimental groups treated with cf ( 50 , 100 and 200 g / ml ) . data are expressed as the mean sd of the three experiments . * significantly different from lps(+ ) cf(- ) , p 0.05 chrysanthemi flos , the flowers of chrysanthemum indicum or c. morifolium , is rich in borneol , camphor , chrysanthenone , cosmosiin , apigenin , quercitrin , luteolin , thymol , heneicosane , tricosane and hexacosane . it is traditionally used to disperse wind and clear heat . also , it is used clinically for elimination of wind - heat patterns associated with a common cold or warm pathogen disease with fever and headache . it is also used to calm the liver and extinguish wind , whose symptoms are dizziness , headache and deafness due to ascendant liver yang . in addition , it is effective in clearing red , swollen , dry and painful eyes from wind - heat in the liver channel or ascendant liver yang . it can be used for spots in front of the eyes , blurry vision , or dizziness due to liver and kidney yin deficiency [ 1 , 2 , 20 ] . lps is present in the cell 's outer membrane of gram negative bacteria and augments pro - inflammatory cytokines , such as tnf- , il-6 and il-1 , at macrophages or monocytes . one important role of the macrophage is the phagocytosis of pathogens and necrotic cellular debris . when a macrophage ingests a pathogen , the pathogen becomes trapped in a phagosome , which then fuses with a lysosome . within the phagolysosome macrophages can digest more than 100 bacteria before they finally die due to their own digestive compounds . lps as endotoxin causes an immune response , but excessive production of inflammatory mediators can destroy normal tissues and cause shock . many studies concerning the immunomodulatory effects of herbs , such as immunomodulatory effects on healthy volunteers , anti - tumor immune response , splenocyte proliferation , macrophage function , nk anti - tumor activities and so on [ 9 - 13 ] , have been performed . to investigate the in this study , cf on lps - stimulated raw 264.7 macrophages were examined immunomodulatory effects by measuring the cytotoxicity , the phagocytic activity and the amount of no , il-6 and tnf-. no cytotoxicity was observed for all cf - treated concentrations . however , lps treatment increased the cell viability , and both lps and cf treatment augmented the cell viability which was increased by lps treatment . although a high - concentration lps treatment ( e.g. , 100 g / ml ) showed cytotoxicity in raw 264.7 cells , the low concentration used in this study could stimulate the proliferation of macrophage cells . cf treatment could significantly augment the stimulation of proliferation only in the presence of lps . for the phagocytic activity of cf , although cf treatment without lps did not change the phagocytic activity compared to the vehicletreated group , cf treatment with lps could significantly augment the phagocytic activity compared to the lps - treated control group in a dose - dependent manner . the immune system may regulate the armamentarium of the phagocytes that play a role in the inflammation and the immune responses with no . no secreted as an immune response acts as a free radical and is toxic to bacteria . the mechanisms for this include dna damage [ 26 - 28 ] and degradation of iron - sulfur centers into iron ions and iron - nitrosyl compounds . no shows an anti - cancer or an anti - microbial effect , but excessive secretion can kill normal cells or promote inflammation . in this study , lps treatment significantly increased the no production compared to vehicle treatment ( p 0.05 ) . however , both lps and cf ( 200 g / ml ) treatment significantly reduced the no production induced by lps treatment ( p 0.05 ) . il-6 is an interleukin that acts as both a pro - inflammatory and an anti - inflammatory cytokine . it is secreted by macrophages and t cells to stimulate immune response , e.g. , during infection , but excessive secretion causes rheumatoid arthritis and inflammatory diseases , such as crohn 's disease . tnf-is a cytokine involved in systemic inflammation and is a member of cytokine groups that stimulate an acute phase reaction . it is produced chiefly by activated macrophages . the effect of tnf- is to stimulate phagocytosis of macrophages , but excessive secretion causes decreased myocardial contractility , low blood pressure and metabolic process damage . lps treatment significantly increased the il-6 and the tnf- productions compared to vehicle treatment ( p 0.05 ) . however , cf treatment did not change the il-6 and the tnf-productions induced by lps treatment . the results for il-6 and tnf-may reveal the characteristics of that cf immunomodulatory effect ; that is , it does not affect il-6 and tnf--induced immune responses . in conclusion , cf regulates the production of no and can prevent the pathological phenomena caused by excessive production of no , such as expansion of blood vessels , mutation and damage to organization and nerve by inflammation . cf may play an important role in intensity modulated no - induced immune responses and may have potential for use as an immunoenhancing pharmacopuncture . further studies will be needed to unravel the characteristics of the effects of cf and the mechanisms of its functions .

we have previously shown that c. elegans rab-11.1 , a homolog of human rab11a , dynamically changes its localization and performs essential functions during the oocyte - to - embryo transition . to investigate the molecular mechanism by which rab-11.1 is activated , we searched for rab-11.1 binding proteins using a mutant form of rab-11.1 ( s25n ) , which mimics gdp - bound rab-11.1 , and successfully identified rab-11-interacting protein-1 ( rei-1 ) in c. elegans ( fig . the c. elegans genome also contains a rei-1 homolog , namely rei-2 , and its gene product , rei-2 , was also found to interact with rab-11.1 ( fig . rei-1 and rei-2 also strongly interacted with a nucleotide - free mutant of rab-11.1 ( n124i ) . these binding patterns were reminiscent of the properties of known rab gef proteins . based on this , we hypothesized that rei-1 is a gef for rab-11.1 . consistent with this hypothesis , rei-1 showed a strong gdp - gtp exchange activity toward rab-11.1 in vitro . we also found that rei-1 has the ability to bind liposomes , suggesting that the interaction of rei-1 with membranes modulates its gef activity . our results show that almost full - length rei-1 ( 1 - 228 aa ) is required for rab-11.1 binding . ( b ) a model describing the role of rei-1 in rab-11 activation and translocation . rei-1 activates rab-11 , by exchange of gdp with gtp , principally at late - golgi membranes . rab-11-positive post - golgi vesicles or compartments are then targeted to the cell cortex and cleavage furrow to regulate cytokinesis and membrane traffic . ( a ) domain structure of the rei-1 family of proteins . our results show that almost full - length rei-1 ( 1 - 228 aa ) is required for rab-11.1 binding . ( b ) a model describing the role of rei-1 in rab-11 activation and translocation . rei-1 activates rab-11 , by exchange of gdp with gtp , principally at late - golgi membranes . rab-11-positive post - golgi vesicles or compartments are then targeted to the cell cortex and cleavage furrow to regulate cytokinesis and membrane traffic . since rei-1 and rei-2 form a protein family that is well conserved in metazoans , including drosophila and human ( fig . 1a ) , we further examined whether the molecular function of rei-1 is conserved in its mammalian homolog , namely sh3-binding protein 5 ( sh3bp5 ) . as expected , sh3bp5 interacted with the gdp - bound and nucleotide - free forms of human rab11a and possessed a strong gef activity toward human rab11a . interestingly , the rei-1 family proteins do not possess any domains with sequence similarity to known rab - gef domains , such as the denn and vps9 domains . however , rei-2 and sh3bp5 do exhibit a sequence similarity to bar and f - bar domains , respectively . these domains potentially function as modules for dimerization , lipid binding , and membrane - curvature sensing . in fact , rei-1 interacts with itself in a homophilic manner and directly binds to membranes . these observations suggest that the bar / f - bar domains may function to target rei-1 family proteins to a specific compartment where they activate rab11 . we further addressed the mechanism by which rei-1 regulates the diverse functions of rab-11.1 in vivo . in growing oocytes , rab-11.1 is found to localize on res as well as on the golgi and it regulates yolk receptor recycling . when oocytes mature , rab-11.1 is targeted to the cortical granules ( cgs ) and regulates cg exocytosis after fertilization , contributing to proper egg shell formation . in embryos , rab-11.1 redistributes to the golgi and re . our results show that rei-1 is expressed in germline cells and co - localizes with rab-11.1 on late - golgi membranes . the deletion of the rei-1 and rei-2 genes did not strongly affect rab-11.1 localization in oocytes , yolk uptake by oocytes or cg exocytosis in zygotes . in contrast , in early embryos , targeting of rab-11.1 to the late - golgi compartment and recycling endosomes was significantly impaired in rei-1 mutants and this defect was enhanced by rei-2 mutation . these results suggest that rei-1 and rei-2 specifically regulate rab-11.1 localization in early embryos . in c. elegans embryos , rab-11.1 also localizes to the cleavage furrow during cell division , and plays an essential role in cytokinesis , a phenomenon that has also been previously shown in mammals . rnai - treated rab-11.1 embryos fail to complete cytokinesis . in rei-1 mutant embryos , ingression occurred but rab-11.1 was not targeted to the late - golgi or the cleavage furrow , which resulted in delayed cytokinesis , and this defect was enhanced by rei-2 mutation . in wild - type embryos , rei-1 itself and a late - golgi marker syn-16 were not recruited to the cleavage furrow . based on this , we propose a model whereby rei-1-dependent activation of rab-11.1 on the late - golgi compartment is a prerequisite for the targeting of rab-11.1 to the cleavage furrow thereby facilitating its involvement in cytokinesis ( fig . our results also indicate that rab-11.1 is able to bind membranes even in the absence of its gefs , rei-1 and rei-2 . this is consistent with a previous report on a yeast rab - gef mutant . this observation could potentially explain why the phenotypes of rei-1 and rei-2 mutants are milder than that of the rab-11.1 rnai . alternatively , another unidentified potential gef could partially activate rab-11.1 even in rei-1 and rei-2 mutants . additional analysis using a deletion series of the rei-1 protein suggests that almost full - length of rei-1 is required for its rab11-binding ability ( fig . it has been reported that human rab11 is involved in a variety of disease settings including cancer progression . therefore , as rei-1 family proteins regulate the activation of rab11 , the actions of these gefs may present novel targets for therapeutic invention . more extensive studies of the rei / sh3bp5 family proteins could uncover molecular mechanisms of tissue - specific and spatiotemporal regulation of rab11 and will likely prompt further research in the field of membrane trafficking .

asthma disproportionately burdens low - income african - american and hispanic children residing in inner cities such as the bronx , new york . the bronx , which is predominately hispanic , is the new york city ( nyc ) borough with the highest overall rates of asthma hospitalizations , deaths , and prevalence among children and adults . daily use of inhaled corticosteroid ( ics ) medications , the most effective long - term therapy available for patients with persistent asthma , controls symptoms and reduces asthma morbidity . however , adherence to ics is about 50% for children with asthma [ 47 ] . poor adherence to ics medications contributes to asthma morbidity and has been associated with increased health - care use and decreased treatment effectiveness . improving adherence in clinical practice setting is difficult because health - care providers do not know if patients are adherent without the use of objective monitoring . electronic devices attached to inhalers record date and time of medication use and provide objective documentation of adherence . however , these devices are costly and prone to mechanical failure [ 11 , 12 ] , making them impractical for office or clinic practices . in turn , many pediatricians rely on parental report of ics adherence to guide asthma management in children with persistent asthma . subjective measures are easily administered and cost - effective , yet often provide overestimated adherence data that may result in unnecessary escalation of treatment . national guidelines recommend that clinicians assess and encourage adherence to recommended therapy during all asthma visits ; however , no single successful method of objectively measuring medication adherence in clinical practice has been identified due to a lack of evidence . recently , several manufacturers have begun to incorporate dose counters into their inhalation delivery devices . phase iii open - label studies in children and adults with asthma and chronic obstructive pulmonary disease ( copd ) established clinical functionality , patient satisfaction , and relative accuracy of inhalers with integrated dose counters [ 1518 ] . these studies enrolled patients who were at least 90% compliant with study medication during the screening period [ 1518 ] . there is a lack of literature comparing ics adherence measured by parental report to that measured by the integrated dose counter in a clinical practice setting . thus , the objective of our study was to compare two methods of measuring ics adherence from which clinicians may choose when assessing patient adherence : parental report and dose counter measurements of metered - dose inhaler ( mdi ) actuation . we conducted a one - month prospective observational study of 50 low - income , minority children aged 2 to 9 years with physician - diagnosed medically treated persistent asthma who have been prescribed ics with an integrated dose counter ( such as fluticasone propionate hydrofluoroalkane ( hfa ) inhalation aerosol ( flovent hfa ) or fluticasone propionate / salmeterol hfa inhalation aerosol ( advair hfa ) and their parents or primary caregivers . thirty - four ( 68% ) of children have been prescribed flovent hfa 44 mcg two puffs twice daily , 14 ( 28% ) flovent hfa 110 mcg two puffs twice daily , 1 ( 2% ) advair hfa 115/21 2 puffs twice daily , and 1 ( 2% ) advair hfa 230/21 2 puffs twice daily by their physician prior to the study enrollment . twenty - five ( 50% ) of children were also prescribed leukotriene receptor antagonist ( such as montelukast ( singulair ) 4 mg or 5 mg daily ) prior to the study enrollment . children remained on the prescribed medication regimen , including the dose and preparation , for the duration of the study . other study eligibility criteria included : ( 1 ) children with at least one acute or same day clinic visit for asthma , emergency department ( ed ) visit , or a hospitalization for asthma in the past 12 months ; ( 2 ) if the child is 2 years of age at the time of the recruitment , he / she must have at least two prior episodes of wheezing treated and reversible with beta - agonists ; ( 3 ) primary caregiver speaks english or spanish ; ( 4 ) family has a phone . primary caregiver was defined as an adult who has primary custody of a child and with whom the child spends at least 75% of the week . although primary caregiver may not be the subject 's parent , we used these terms interchangeably . children with other chronic pulmonary diseases ( e.g , cystic fibrosis , bronchopulmonary dysplasia ) or presence of tracheostomy were excluded . study was approved by the montefiore medical center institutional review board ( irb ) . written caregiver consent and child assent were obtained as per irb guidelines . families were recruited from two federally qualified montefiore comprehensive health care centers located in the poorest section of the bronx , ny where 27.9% of individuals are below the us poverty level and asthma hospitalization rate is almost twice the rate for nyc [ 2 , 19 ] . at baseline , we collected sociodemographic information and data about asthma control using current national asthma education and prevention program guidelines for the diagnosis and management of asthma . we reviewed child 's medical records to determine if additional diagnoses of seasonal allergies and/or eczema have been made by the physician . all children have been prescribed ics with an integrated dose counter by their physician prior to study enrollment . at enrollment , children received a new , marked ics at the physician - prescribed dose . four subjects had a problem with their health insurance at the time of enrollment , and their ics was provided by the project . parents were instructed to administer marked ics as per physicians ' orders ( 2 puffs twice a day ) . if used as directed , 120 actuations in the new inhaler suffice for 30 days of treatment . parents were asked to use only the marked ics inhaler for the duration of the study . approximately thirty days after enrollment ( range 2737 days , average 31 days ) , we visited families at their homes where we administered a survey to measure adherence by parental report and retrieved a marked ics inhaler that the child received at enrollment . during the home visit parents were asked the following questions . during the past 4 weeks , did your child use the marked inhaled corticosteroid pump ( controller medication ) for his / her asthma ? ; how many puffs and how many times a day did the child use the marked inhaled corticosteroid pump in the past 4 weeks ? ; during the past 4 weeks , how often did your child take marked inhaled corticosteroid ( controller medication ) ? ( answer choices included every day , almost every day , several times a week , once a week , and the integrated dose counter is designed to count downward to zero from the recommended number of actuations and displays the number of actuations remaining in the inhaler . we randomly tested 10% of the canisters that we retrieved from the participants ( after the data on number of puffs were recorded ) and found 0% incidence of the mdi firing but the counter not advancing . to facilitate validity of dose counter data , parents were asked about medication sharing or use of another unmarked ics at inhaler retrieval . ics adherence reported by parents was coded as continuous variable : 100% when parents administered ics to their child every day ; 75% almost every day ; 50% several times a week ; 25% once a week ; 0% less than once a week . dose counter - measured adherence was calculated as the number of puffs used relative to the number of puffs expected to have been used at 30-day followup . descriptive statistics , including means , ranges , and standard deviations ( sd ) were calculated for all variables . wilcoxon signed - rank test , a nonparametric test for paired data , was used to compare the two adherence methods . the spearman rank correlation coefficient , a nonparametric measure of statistical dependence between two variables , was used to test for association between objectively measured adherence and parental or child age and parental level of education . the data were analyzed using spss v.19 ( spss inc . , chicago , illinois ) . a total of 50 children ( mean age = 5.6 years ( sd 1.9 ) , mean duration of asthma diagnosis 3.9 years ( median 4 years ) ) and their parents ( n = 50 , 96% mothers , mean age = 32.6 ( sd 6.9 ) , 64% unemployed ) participated . asthma was not well controlled or very poorly controlled in most children ( n = 42 ) ( table 1 ) . parental report revealed that only 17 ( 34% ) children have ever been evaluated by a pulmonologist ( table 1 ) . mean ics adherence as measured by a dose counter was 57.8% ( sd 31 ) , ( median 60.7% , range 0%100% ) . parental report overestimated complete ics adherence : 42% ( n = 21 ) of parents reported being 100% adherent as compared to 10% ( n = 5 ) being 100% adherent as per dose counter ( figure 1 ) . parental report of nonadherence was accurate : 4% ( n = 2 ) of parents reported 0% adherence as compared to 6% ( n = 3 ) having 0% adherence as per dose counter ( figure 2 ) . wilcoxon signed - rank test revealed a statistically significant overall difference between parental report and objectively measured adherence ( p < .0001 ) . no relationship was found between dose counter - measured adherence and parental or child age ( p = .732 and p = .639 , resp . ) and parental level of education ( p = .834 ) . the impact of poor ics adherence on asthma treatment outcomes and morbidity has been well documented . the national heart , lung , and blood institute ( nhlbi ) expert panel report 3 ( epr-3 ) recommends that clinicians assess and encourage adherence to medications using parental or self - report . the accuracy of self - report of medication treatment adherence has been examined in many diseases and found to be highly variable and often inaccurate [ 4 , 20 , 21 ] . for example , electronic monitoring revealed that children with asthma used only 50% of prescribed ics over 6 months , whereas the patients and their parents reported over 80% adherence . our finding of dose counter - measured ics adherence of 57.8% supports this earlier report . in addition to self - report , several other adherence assessment methods exist and have been used in clinical trials . these methods differ in the degree of accuracy and objectivity with which patient adherence can be evaluated . however , no single successful method has been recommended for use in clinical practice . as a result , physicians rely on parental or self - report of medication adherence often leading to inappropriate diagnostic and therapeutic decisions . integrated dose counter has recently been incorporated in several ics inhalers and found to be reliable . the dose counter not only provides patients with a reliable method for determining the remaining number of puffs , but also may provide clinicians with an objective means of assessing adherence to medication . however , there are no published reports that compared the two adherence methods in a clinical practice setting : adherence measured by parental self - report and adherence measured objectively with a dose counter . first , our study population was composed of inner - city , minority , poor , and mainly latino children and parents recruited from two community health centers in the bronx , ny and may not be representative of all latino families or minority families in general . however , our study population is representative of the bronx , ny general population , whose racial distribution in 2010 was about 54% hispanic or latino and 36% black or african american . second , proportion of children who have been evaluated by an allergist and/or pulmonologist was obtained by parental self - report and does not represent the true number of children who have ever been referred to these specialists by the child 's physician but never kept the appointment . third , integrated dose counters do not provide date and time of mdi use which more expensive , electronic monitors that attach externally to the canister provide . several studies have documented problems with accuracy of these externally attached electronic devices , including loss of data due to battery drain and recording of nonexistent doses [ 11 , 2224 ] . evidence from our study indicates that parental report was a nonreliable method for assessing ics adherence . physicians who care for patients with persistent asthma need to have easy - to - use , cost - effective , and objective tool to measure medication adherence in a clinical setting . accuracy of parental report in clinical practice is of concern in light of findings from this study and prior studies revealing that inner - city parents of children with asthma frequently overestimate medication adherence . a dose counter that most ics inhalers are equipped with may be a more reliable alternative measure of ics adherence in clinical practice .

stable and transient phenoxyl radical species are important in chemical processes spanning a large range of applications . examples include tyrosine / tyrosyl radical mediated enzymatic electron transfers and hydrogen atom transfers , food preservation ( such as butylated hydroxytoluene or bht ) , and fundamental studies of proton - coupled electron transfer ( pcet)/hydrogen atom transfer ( hat ) reactions . while most phenoxyl radicals are transient , sufficiently sterically encumbered phenoxyl radicals can be stable in solution under anaerobic conditions . the 2,6-di - tert - butyl-4-phenylphenoxyl radical ( bu2pharo ) , for instance , was prepared by mller and co - workers in 1959 , and isolated in 7888% purity . our laboratory has reported the clean isolation and structural characterization of the 2,4,6-tri - tert - butylphenoxyl radical ( bu3aro ) and the 4,4 coupled dimer of the 2,6-di - tert - butyl-4-methoxyphenoxyl radical ( bu2meoaro ) . the latter has a very weak c c bond and is primarily dissociated in solution . h bond dissociation free energies ( bdfes ) of the 2,6-di - tert - butyl-6-r - phenols are significantly modulated by the r substituent . the h atom affinities of the corresponding phenoxyl radicals ( described by phenolic o h bdfes ) range from 73.8 kcal mol for the isolable r = ome species to 80.4 kcal mol for the transiently lived r = no2 species ( bdfes in toluene ) , with the r = bu and ph derivatives being the same within error . the isolable r = bu and ome derivatives have proved to be useful hydrogen atom accepting reagents , complementary due to their different hydrogen atom affinities . with the goal of preparing an isolable phenoxyl radical with a higher h atom affinity , we report here the preparation , full characterization , and thermochemistry of 2,6-di - tert - butyl-4-(4-nitrophenyl)phenoxyl radical , or bu2nparo . bu2nparo was prepared by treating a benzene solution of 2,6-di - tert - butyl-4-(4-nitrophenyl)phenol , bu2nparo - h , with aqueous 1 m sodium hydroxide and potassium ferricyanide under anaerobic conditions . after 30 min , removal of the solvent under vacuum , extraction of the dark green material with pentane , and crystallization at 30 c over 24 h yielded black crystals . these were found to be of high purity from elemental analysis and the h nmr spectra showed only minor diamagnetic impurities ( < 5% ; see the supporting information ) . high - quality x - ray crystal structures of bu2nparo and its parent phenol were collected for structural comparison ( figure 1 , table 1 ) . this type of direct structural comparison of a phenoxyl radical / phenol has previously not been possible . the parent phenol of the only previously structurally characterized phenoxyl radical , bu3aro - h , was found to be disordered over three positions in its crystals . the largest difference between the phenoxyl and phenol structures is in the o1c1 bond distance , 1.251 vs 1.379 . this bond shortening of 0.128 is consistent with previous conclusions that phenoxyl radicals have significant ketone character , as suggested by the resonance forms in scheme 1 . the changes in the phenolic aromatic bond lengths support this model , as the c1c2 and c1c6 bond lengthen ( avg 0.062 ) more than the c3c4 and c4c5 bonds ( avg 0.027 ) while the c2c3 and c5c6 bonds shorten ( avg 0.024 ) . ortep drawing of bu2nparo showing 50% probability thermal ellipsoids and labels for select atoms . aryl torsion angle ( deg ) refers to the average dihedral angle measured for c5c4c7c12 and c3c4c7c8 . aryl linkage is slightly shorter in the radical , by 0.0075(22 ) , suggesting a small quinomethide component ( scheme 1 ) . this is also suggested by the 0.0400(21 ) shortening of the c10n1 bond to the nitro group , and the smaller average aryl aryl torsion angle , of 17.5 in the radical vs 31.9 observed in the phenol . the x - band cw epr spectrum of bu2nparo in toluene displays a multiline pattern centered at g = 2.007(2 ) that is well modeled by simulation ( figure 2 ) . hyperfine coupling constants were assigned by comparison to previously reported phenoxyl radical data and from the structural changes observed in the crystal structure : a3,5(2h ) = 1.80 g , a8,12(2h ) = 1.61 g , a9,11(2h ) = 0.74 g and ano2(1n ) = 0.50 g. the n hyperfine coupling indicates spin density on the nitro group , as depicted in the bottom of scheme 1 . the observed spin density onto the nitro group suggests that the thermochemistry of bu2nparo should be perturbed from that of the unsubstitued bu2pharo . x - band epr spectrum of 1 mm bu2nparo in toluene recorded at 25 c ( top ) and simulation ( bottom ) . the o h bdfe of bu2nparo - h , was determined by equilibration with the thermochemically well - establishedbu3aro radical . in either acetonitrile - d3 or toluene - d8 , a known concentration of bu2nparo - h was combined with several different concentrations of bu3aro ( eq 1).1 integration of the h nmr signals of these solutions gave equilibrium concentrations from which equilibrium constants were determined : keq(acetonitrile ) = 0.25 0.03 , keq(toluene ) = 0.26 0.03 . thus , the o h bond in bu2nparo - h is 0.8 0.1 kcal mol stronger than that in bu3aro - h in both acetonitrile and toluene . using the known bdfe values of bu3aro - h and eq 2 gives bdfe(bu2nparo - hmecn ) = 77.8 0.5 kcal mol and bdfe(bu2nparo - htol ) = 77.5 0.5 kcal mol . while this is a small increase , bu2nparo is to our knowledge the thermodynamically strongest isolable , reagent quality organic hydrogen atom abstractor available.2 pedulli and co - workers have previously reported an empirical correlation between the o h bond strengths of 2,6-tert - butyl - substituted phenols with the epr hyperfine coupling constants , a3,5 , of the corresponding phenoxyl radicals . figure 3 shows a slightly modified version of this correlation using revised bdfe values . h bond dissociation free energies ( bdfes ) vs 3,5 hyperfine coupling constant for 2,6-bu2 - 4-x - aro radicals . data in red are part of the correlation reported in ref ( 9a ) ( revised to use updated bdfe values ) ; blue data point is bu2nparo(-h ) . cyclic voltammetry of bu2nparo in acetonitrile with 0.1 m [ bu4n]pf6 as a supporting electrolyte displayed a reversible couple with e1/2 = 0.436 0.010 v vs fc . this value is 0.26 v less negative than the related bu3aro potential of 0.70 v vs fc . this is much larger than the reported potential difference of only 0.045 v between bu2pharo and bu3aro in 9:1 mecn / h2o , illustrating the effect of the nitro substituent on the phenoxyl / phenol thermochemistry . the cyclic voltammogram of bu2nparo - h displayed an irreversible anodic peak centered at 0.975 0.010 v vs fc . it is presumably irreversible due to loss of the proton from the highly acidic radical cation . the reduction potential of bu2nparo and the bdfe(bu2nparo - h ) imply that in acetonitrile the pka of bu2nparoh is 24 0.4 by hess law ( eq 3 ) . compared to its parent phenylphenol , the ( nitrophenyl)phenol has a significantly higher acidity and more positive reduction potential . these are both due to the stabilization of the phenoxide anion by the 4-substituted nitrobenzene group . the higher bdfe of bu2nparo - h is due to the shifts in pka and e not exactly offsetting each other , with the nitro group affecting the pka less in free energy terms.3 these values can be assembled into a square scheme that describes the pcet thermochemistry of bu2nparo - h ( scheme 2 ) . we have included the irreversible anodic peak potential , ea , p , even though it is not a thermochemical value . using this value to crudely estimate e(bu2nparo - h ) + 0.95 v would imply that the pka of the radical cation is about 9 units lower than that of the phenol . ea , p is bracketed since it refers to an irreversible anodic peak potential and is not a thermochemical value . in conclusion , the 4-(nitrophenyl)phenoxyl radical bu2nparo is a previously unreported phenoxyl radical that is easily prepared in high purity and reasonable yield . equilibrium studies show that the bu2nparo - h bdfe is modestly stronger than that of its unsubstituted isolable relative , bu2pharo ( bdfetoluene = 0.8 kcal mol ) . bu2nparo - h has the highest reported bdfe of any isolable organic hydrogen atom acceptor : 77.8 0.5 kcal mol in acetonitrile and 77.5 0.5 kcal mol in toluene . the combination of easy isolation of the phenoxyl radical in pure form and its relatively high hydrogen atom affinity should make this a useful reagent for studying hydrogen atom transfer reactions . unless otherwise noted , all chemicals were purchased from commercial sources and used without purification . acetonitrile was purchased from burdick & jackson ( low - water brand ) and stored in an argon - pressurized glovebox plumbed directly into the glovebox . toluene - d8 and acetonitrile - d3 were dried over nak and cah2 , respectively , and vacuum distilled . all nmr spectra were collected on 500 mhz spectrometers and chemical shifts referenced to tms using residual solvent peaks . the reported epr spectrum was collected using an x - band spectrometer at room temperature in toluene . a 100 ml two neck round - bottom flask was charged with 467 mg ( 1.43 mmol ) of bu2nparoh dissolved in 15 ml of benzene , 5 ml of 1 m naoh and a stir bar . the flask was fitted with a 180 schlenk adapter on one neck and a solid addition funnel containing 1.20 g ( 3.64 mmol ) of solid k3fe(cn)6 on the other neck . the frozen mixture was allowed to thaw at room temperature and left to stir . after 1 h of stirring , the solvents were removed in vacuo and extracted with pentane . calcd for c20h24no3 : c , 73.59 ; h , 7.41 ; n , 4.29 . found : c , 73.88 ; h , 7.60 ; n , 4.34 .

salmonellosis is a common foodborne disease caused by salmonella spp . and is of global significance . it is a significant pathogen of food producing animals and remains a primary source of salmonellosis 1 . salmonella spp . has been frequently reported in environmental samples since they find their way to the environment through the excreta of humans and animals . in 2004 , the european union ( eu ) alone recorded 192,703 human cases of salmonellosis 2 . the majority of seafood associated illness is due to the consumption of shellfish harvested from sewage polluted waters . it is well known that fish / shellfish normally do not harbour microorganism like salmonella but acquire it from contaminated water from which they have been harvested 3 . the work of koonse et al . ( 2005 ) 4 showed s. weltevreden to be the most frequent serovar at 21 % prevalence of the total serovars reported from aquaculture shrimp farms in three different countries . ( 2008 ) 5 who confirmed s. weltevreden as the most important serovar among the 64 different serovars isolated from seafood . it has been the predominant serovar in seafood in the asian region reported in several studies 6 - 8 . in this report the availability of draft genome sequence of s. weltevreden ( sw9 ) isolated from seafood in india has been announced . s. weltevreden ( sw9 ) was isolated from seafood ( fish ) obtained from the fish landing centre in mangalore , located in the southwest coast of india . culture based technique for the isolation and phenotypic identification of the isolate using a battery of biochemical tests was performed as per fda bacteriological analytical manual . the isolate was resistant to 6 antimicrobials including tetracycline , chloramphenicol , nalidixic acid , ampicillin , co - trimoxazole and erythromycin . genomic dna was extracted from s. weltevreden ( sw9 ) using a qiaamp dna minikit ( qiagen , germany ) . the raw sequence data was generated after library preparation on the ion torrent pgm platform and assembled using clc genomics workbench version 6 . structural gene prediction and functional annotation was performed using the rapid annotations subsystems technology ( rast ) server ( http://rast.nmpdr.org/ ) as it was shown to work exceedingly well in our previous studies 9 . a total of 2 , 64,365 reads with a mean read length of 150.2 bp for 200 bp fragmentation chemistry obtained from the ion pgm was assembled into 716 contigs . the draft genome had a length of 3,825,753 bp , with 6239 coding sequences and a gc content of 51.8% . the annotated genome had 109 genes responsible for resistance to antibiotics and toxic compounds , including 17 genes for multidrug resistance efflux pumps and 18 genes for mdtabcd multidrug resistance cluster and 8 fluoroquinolone resistant genes . the multidrug resistant isolate ( sw9 ) harbored the resistance genes to antibiotics like tetracycline , chloramphenicol , co - trimoxazole , florfenicol and presented point mutation in the quinolone resistance determining region ( qrdr ) responsible for resistance to nalidixic acid . the isolate was found to carry resistant genes such as tetb , cata1 for tetracycline and chloramphenicol respectively 10 . this whole - genome shotgun project has been deposited at ddbj / embl / genbank under the accession number jpio00000000.1 .

the classically described presentation is of insulin - dependent diabetes , followed by optic atrophy , central diabetes insipidus , and sensory neural deafness . a 15-year - old boy with insulin - dependent diabetes was presented for evaluation of depressive symptoms associated with suicidal tendency . neuropsychiatric manifestations are described with wolframs syndrome , and wolframin gene , in recessive inheritance , is associated with psychiatric illnesses without other manifestations of wolframs syndrome . a 17-year - old diabetic boy on insulin with good control of blood sugar presented for evaluation of delayed puberty . central hypogonadism and other anterior pituitary hormone dysfunctions are the less publicized hormone dysfunctions in wolframs syndrome . a 23-year - old female who was on insulin for diabetes for the past 14 years , got admitted for evaluation of sudden loss of vision . this patient had developed a vitreous hemorrhage and , on evaluation , was found to have optic atrophy , sensory neural hearing loss , and diabetes insipidus , and presented differently from the gradual loss of vision described in wolframs syndrome . wolframs syndrome being a multisystem degenerative disorder can have myriad other manifestations than the classically described features . neuropsychiatric manifestations , depression with suicidal risk , central hypogonadism , and secondary adrenal insufficiency are among the less well - described manifestations of this syndrome . rare genetic or sporadic forms of diabetes can present as insulin - dependent diabetes in children and can mimic type-1 diabetes . very early onset of symptoms and associated features help in differentiating these forms of diabetes from type-1 diabetes . one of the rare forms of diabetes is wolfram syndrome , which is an inherited or sporadic neuro - degenerative disorder , presenting as insulin - dependent diabetes , diabetes insipidus , optic atrophy , and deafness ( didmoad ) . but there are less well - known manifestations of this syndrome , which includes neuropsychiatric manifestations , reproductive abnormalities , limited joint mobility , and cardiovascular and gastrointestinal autonomic neuropathy , any of which can be the presenting feature . a 15-year - old diabetic boy was admitted in our hospital for evaluation of depressive symptoms . he was diagnosed to have diabetes at the age of 4 years and is on insulin . he had a history of decreased vision for the past 4 years and decreased hearing for the past 2 years . his blood glucose values were relatively under control until 6 months previously , but the last 2 hba1c levels were above target . examination revealed that he had a significant loss of vision with b / l optic atrophy , and audiometry revealed significant sensory neural hearing loss . the 24 hour urine output , urine osmolality , serum osmolality , and urine sodium levels were suggestive of diabetes insipidus and mri of the brain was suggestive of central diabetes insipidus . neuropsychiatric manifestations are described with wolframs syndrome and are associated with recessively inherited wolframin gene , without other manifestations of wolframs syndrome . a 17-year - old diabetic boy was admitted in our hospital for evaluation of delayed puberty . he had a history of polyuria for past 2 years and decreased vision for the past 1 year . on examination , he was of a short stature , his pubic and axillary hairs were absent , and testicular volume was < 4 ml . fundus examination revealed b / l optic atrophy , and audiometry revealed significant sensory neural hearing loss . on evaluation of reason for delayed puberty , he was found to have low serum testosterone along with low fsh and lh . the 24 hour urine output , urine osmolality , serum osmolality , and urine sodium levels were suggestive of diabetes insipidus , and mri brain showed absence of posterior pituitary bright spot . central hypogonadism and other anterior pituitary hormone dysfunctions are the less known hormone dysfunctions in wolframs syndrome . audiometry revealed sensory neural hearing loss , and urine volume , urine osmolality , serum osmolality , and urine sodium levels were suggestive of diabetes insipidus . this patient had developed a vitreous hemorrhage and , on evaluation , was found to have optic atrophy , sensory neural hearing loss , and diabetes insipidus , and he presented differently from the gradual loss of vision described in wolframs syndrome . wolfram syndrome is a rare neurodegenerative disorder that may be sporadic or autosomal recessively inherited . first described in 1938 by wolfram and wagener , wolfram syndrome manifests as a combination of young onset non - immune insulin - dependent diabetes mellitus and progressive optic atrophy in all patients with added diabetes insipidus and sensory neural deafness in 70% of the patients ; hence , referred to as didmoad ( diabetes insipidus , diabetes mellitus , optic atrophy , deafness ) syndrome . this syndrome is due to the defective synthesis of wolframin ( a 100-kd transmembrane protein encoded by wfs1 , a gene located at 4p16.1.116 ) , found in the endoplasmic reticulum and in the neuronal and neuroendocrine tissues . wolframin induces ion channel activity with a resultant increase in intracellular calcium and it may play an important role in intracellular calcium homeostasis . due to variable expression of the protein , the phenotype of the disease varies , with diabetes mellitus manifesting early , followed by optic atrophy in all patients . other manifestations such as diabetes insipidus , deafness , neurological manifestations , and hormonal deficiencies ( e.g. , acth deficiency and growth hormone deficiency , and thiamine responsive sideroblastic anaemia ) have variable penetrance . the major manifestations include severe depression , suicidal risk , poor scholastic performance , temper tantrums , and adjustment disorder . moreover , heterozygous carriers of the gene for wolfram syndrome , which constitutes about 1% of the general population , are at a higher risk of developing psychiatric illness and have 26-fold more chances of having a psychiatric hospitalization . signs of hypogonadism have also been found in association with wolfram syndrome . hypogonadism in wolfram syndrome has been attributed to hypothalamic dysfunction , and serum gonadotropin levels have been consistently low or normal .

glaucoma drainage implants ( gdi ) are a useful modality in the management of intractable glaucoma cases . late exposure of the implant tube through the overlying conjunctiva is a known complication of the surgical procedure . untreated tube exposure seems to be a risk factor for endophthalmitis.1 gedde et al . recommended prophylactic surgical revision with patch graft in all cases of tube exposure.1 we describe the novel use of fibrin sealant for the surgical revision of tube exposure . a 42-year - old male had retinal detachment repair with placement of an episcleral encircling band in right eye . an ahmed glaucoma valve ( agv ; model fp7 , new world medical , rancho cucamonga , la ) was placed to treat his intractable secondary open - angle glaucoma . the plate of the agv was placed above the encircling band in the supero - temporal quadrant and the donor scleral patch graft covering the limbal portion of the tube was sutured with non - absorbable sutures to the underlying sclera . the scleral patch graft overlying the agv tube had retracted posteriorly by about 3 mm . the dashed line outlines the scleral patch graft , ( b ) schematic demonstrating layering of scleral and conjunctival grafts during revision surgery . the arrow heads denote sticking of lateral edges of the conjunctival auto - graft to the edges of the reflected conjunctiva and the underlying episcleral surface , ( c ) slit - lamp photograph at 4-month post - revision surgery shows well - integrated patch grafts we performed revision surgery of the exposed tube under peribulbar anesthesia . the conjunctiva was incised in a parallel fashion on either side of the exposed tube . a lateral flap of the conjunctiva was undermined in the episcleral plane on either side of the exposed tube . a 5 3-mm human donor scleral patch graft was stuck on the episcleral bed over the exposed segment of the tube using fibrin sealant ( tisseel kit ; baxter ag , vienna , austria ) . adequate care was taken to avoid capture of the conjunctiva under the scleral patch graft to reduce the chances of epithelial entrapment and epithelial inclusion cyst formation.2 a 7 4-mm - free conjunctival autograft was obtained from the inferior fornix and was stuck over the scleral patch graft . the lateral edges of the conjunctival graft were stuck to the edges of the conjunctival flap as well as to the episcleral surface beyond the scleral graft using the fibrin sealant [ figure 1b ] . amniotic membrane was fixed with the fibrin sealant to cover the denuded conjunctival surface in the inferior fornix . the grafts were well integrated and iop was in the target range at the 4-month post - revision follow - up visit [ figure 1c ] . tube exposure occurs in patients with drainage devices despite the use of patch grafts that are covered with the patient 's conjunctiva . an inflammatory and/or immune mediated melting of the patch graft and mechanical breakdown of the overlying conjunctiva appears to be a prominent mechanism.3 in our case , the scleral patch graft , though intact , was retracted posteriorly . conjunctival scarring and retraction following agv implantation above the pre - existing episcleral encircling element may be responsible for retraction of the scleral patch graft , and thereby , might have predisposed to exposure of the tube . the surgical repair of exposed tube involves replacing a patch and covering this patch by conjunctiva . a graft of collagenous human tissue is necessary as conjunctiva does not reliably remain closed over immediately underlying synthetic material e.g. silicone as in this case.2 in a study comparing donor sclera , pericardium , and dura as materials for gdi tube coverage , no material was found to be associated with a reduced rate of tube exposure.4 we chose human donor sclera as it is readily available and most affordable . some methods to cover the patch by conjunctiva include conjunctival advancement,3 vascularized flap5 or grafting . our patient had limited mobility of the superior conjunctiva and either conjunctival advancement , or vascularized conjunctival flap was not possible . buccal mucous membrane graft6 and amniotic membrane transplantation7 have been described as conjunctival substitutes to cover exposed gdi tubes . moreover , the suture material may act as a source of inflammation and localized tissue melt . this was reported to be the cause of failure of repaired tube exposure.7 on the other hand , fibrin sealant has been shown to be safe and effective suture substitute for conjunctival and scleral wound closure in glaucoma surgery8 and for placement of a human donor scleral patch graft covering the sub - conjunctival portion of agv tube.910 in addition to saving suturing time , the fibrin sealant did allow sticking of the conjunctival graft to the edges of the conjunctiva on either side as well as to the underlying episcleral surface beyond the extent of the revision scleral patch graft in our case . since our patient was relatively young and had a thick tenon 's capsule , the adhesion was expected to be strong . the intention of this surgical modification was to gain maximum possible blood supply to the grafted conjunctiva . in our opinion , this novel use of the fibrin sealant and the technique used help in better integration of the patch grafts in the revision of an often difficult problem of exposed agv tube .

the muenke syndrome ( ms ) is an autosomal dominant craniosynostosis syndrome associated with a mutation in the fibroblast growth factor receptor 3 ( fgfr3 ) gene located on chromosome 4p . the mutation , involving the fgfr3 gene , consists of a heterozygous nucleotide transversion , c.749c > g , encoding the amino acid substitution pro250arg . this syndrome is characterized by variable expressivity with unilateral or bilateral coronal craniosynostosis , midface hypoplasia , proptosis , downslanting palpebral fissures , hearing loss , developmental delay , and specific bone anomalies of the hands and feet ( 1 - 3 ) . the frequency of ms has been estimated as 0.8 - 1.0 in 10,000 live births , with 61% thought to be sporadic cases ( 4 ) . the mutation rate , at this nucleotide , is one of the most frequently described in the human genome ( 5 ) . because of reduced penetrance and variable expressivity with a wide spectrum of clinical findings among patients with ms , in some cases , the typical cephalo - facial anomalies are not present . therefore , not all family members of affected patients have had molecular evaluation for confirmation of the diagnosis . however , the molecular confirmation of ms is essential for the prediction of risk in affected family members and for the identification of associated anomalies ( 6 ) . here , we report the case of a girl with ms confirmed by molecular diagnosis of the pro250arg mutation . the patient was a 24 month old korean girl , born at 40 weeks gestation by vaginal delivery at a regional general hospital . the birth weight was 2,900 gm ; she was the second child in the family with one female sibling . the mother was 29 yr old and the father was 31 yr old at the time of her birth . the patient showed mild midfacial hypoplasia , hypertelorism , downslanting palpebral fissures , strabismus , a beak shaped nose , and plagio - brachycephaly ( fig . the mother and two of the mother 's unmarried sisters and the maternal grandfather had a similar phenotype , strabismus and short stature ( fig . three - dimensional reconstruction computed tomography ( 3d - ct ) and magnetic resonance imaging studies of the cranium revealed bilateral coronal craniosynostosis , palgio - brachycephaly , bilateral lateral ventricle dilatation , proptosis , and a small cerebellum ( fig . the patient underwent an expansion cranioplasty to correct the brachycephaly at 25 months of age and a second - step surgical procedure was then performed in order to correct the residual posterior plagiocephaly at 5 yr of age . after informed consent was obtained from the parents and other maternal family members , dna was extracted from the peripheral blood lymphocytes using a standard method with the qiaamp dna blood mini kit ( qiagen ) . the primer pairs used for fgfr3 exon 7 were forward : gacgtacacgctggacgtgct , and reverse : acgcagctgcctatggccctga . the sequences were analyzed by searching for similarities using the blastn and blastx program at the national center for biotechnology information . the pro250arg mutation of exon 7 ( igii - igiii linker domain ) in fgfr3 was detected in the patient with the ms . the same mutation was found in the patient 's mother , two maternal aunts and the maternal grandfather ( fig . after informed consent was obtained from the parents and other maternal family members , dna was extracted from the peripheral blood lymphocytes using a standard method with the qiaamp dna blood mini kit ( qiagen ) . the primer pairs used for fgfr3 exon 7 were forward : gacgtacacgctggacgtgct , and reverse : acgcagctgcctatggccctga . the sequences were analyzed by searching for similarities using the blastn and blastx program at the national center for biotechnology information . the pro250arg mutation of exon 7 ( igii - igiii linker domain ) in fgfr3 was detected in the patient with the ms . the same mutation was found in the patient 's mother , two maternal aunts and the maternal grandfather ( fig . craniosynostosis syndromes are associated extracranial anomalies of the limbs , heart , central nervous system ( cns ) and/or tracheal malformations . the craniosynostosis syndromes have been reported to be associated with mutations of several genes including : fgfr1 , fgfr2 , fgfr3 , fbn1 , twist , and msx2 . among these mutations , the mutations of the fibroblast growth factor receptor gene ( fgfr1 - 3 ) are the most common and have been implicated in craniosynostosis syndromes ( 7 - 10 ) . the ms is characterized by an extremely variable clinical presentation with unicoronal or bicoronal craniosynostosis , midfacial hypoplasia , ocular hypertelorism , brachydactyly , thimble - like middle phalanges , coned epiphyses , carpal and tarsal fusion , sensorineural hearing loss , and infrequent cognitive impairment ( 1 - 3 ) . the pro250arg mutation located between the second and third immunoglobulin - like domains of the fgfr3 gene is commonly found in the autosomal dominant form of craniosynostosis referred to as the ms ( 11 , 12 ) . different phenotypes have been described in patients carrying the same mutation , pro250arg , of the fgfr3 gene ( 2 , 3 ) . the ms phenotype ranges from no detectable isolated craniosynostosis or macrocephaly to more complex findings that overlap with other classic craniosynostosis syndromes ( e.g. , crouzon , pfeiffer , and saethre - chotzen syndromes ) . bicoronal synostosis is most common ; however , some cases have unilateral coronal , lambdoid , and metopic suture synostosis ( 1 - 4 ) . a previous report showed that females are more likely to have craniosynostosis with bicoronal synostosis than males ( 11 , 12 ) . hearing loss has been reported in 25 - 40% of patients with the ms and a sensorineural impairment is the most common type of hearing loss ( 65% ) ( 13 ) . the craniofacial phenotype includes facial asymmetry , midface hypoplasia , downslanting palpebral fissures , proptosis , hypertelorism , and a high arched palate ( 2 , 3 , 14 ) . extracranial skeletal anomalies occur in 26 - 42% of patients , including thimble - like middle phalanges , coned epiphysis , carpal and tarsal fusion with fused calcaneocuboid bones , and brachydactyly with broad great toes ( 11 ) . developmental delay and learning disabilities have been reported in some of the cases ( 15 , 16 ) . primary brain anomalies with bilateral dysgenesis of the medial temporal lobe structures have been reported in patients with confirmed ms with typical cranial morphology and molecular testing ( 17 ) . clinical genetic evaluation of patients with the ms should include the following : complete genetic and dysmorphology examination , genetic counseling , referral to a craniofacial team with early intervention , dental assessment for malocclusion , assessment of cognitive function , hearing testing , and ophthalmology assessment . in addition , a newborn hearing screening should be considered in affected families ( 3 ) . the corresponding residues of the two other fgfrs involved in craniosynostosis syndromes have mutations ; the pro252arg mutation of fgfr1 in pfeiffer syndrome and the pro253arg mutation of fgfr2 in apert syndrome . in addition , the heterozygous pro250leu mutation of fgfr3 has been associated with a phenotype similar to ms ( 12 ) . the pro250arg mutation is often familial and associated with a more severe phenotype in females than in males ( 11 , 12 ) . the majority of molecularly defined craniosynostosis syndromes have been shown to have autosomal dominant inheritance . however , unexpected recurrence sometimes occurs due to variable expression ; in addition , craniosynostosis can occur in sporadic forms ( 7 , 10 ) . sporadic cases of the ms have been reported to be associated with advanced paternal age ( 8) . the patient with ms in this report with the mutation associated with the ms had a phenotype similar to previously reported cases of the ms ( fig . 1 ) . pedigree analysis demonstrated an autosomal dominant inheritance involving the maternal grandfather , mother and the patient ( fig . radiological examination of the skeleton and hearing testing was not performed in the other affected family members . the cranial sutures are the major sites of bone formation during the embryonic morphogenic period and postnatal skull growth ( 18 ) . the human fgfrs play an important role in bone and cartilage morphogenesis during the development of vertebrates . some growth factors ( fgfr1 - 3 , and tgf ) and transcription factors ( twist , and msx2 ) are transiently expressed on the developing surface of the sutures and the ossification regions of primary bones ( 19 - 21 ) . mutations in the fgfr1 , fgfr2 , fgfr3 , fbn1 , twist , and msx2 genes have been demonstrated in craniosynostosis syndromes ( 7 - 10 ) . more than 89 mutations have been described on the web site of the human genome mutation database ( www.hgmd.cf.ac.uk ) . the most frequent type of mutation is a missense mutation and the next most common type is splicing errors . premature closure of the cranial sutures , associated with the previously described mutations , can affect the cns and increase the intracranial pressure . secondary effects due to cns involvement include impaired vision , hearing , and severe neurodevelopmental delay ( 7 , 8) . therefore , molecular confirmation of the associated mutation is important for appropriate genetic counseling and proper patient management . especially , molecular confirmation of affected family members , so that the correlation between phenotype and genotype can be understood . the pro250arg mutation was confirmed in phenotypically suspicious family members on the maternal side , and the phenotype and genotype correlation in a koran ms patient were described .

tularemia has been a notifiable disease under the communicable diseases act in sweden since 1968 . physicians who diagnose a case , either clinically or by microbiologic means , report to the county medical officer and the swedish institute for infectious disease control ( smi ) . cases were defined as tularemia in all persons ages > 18 whose illness was reported to smi from august 1 ( week number 31 ) to november 21 , 2000 ( week number 47 ) and who resided in any of seven counties in central sweden , representing both disease - endemic and emergent areas ( figure 1 ) . the cases from these seven counties represented 60% of all cases reported in sweden during the study period ; the rest were sporadic cases from other areas or infection acquired abroad ( figure 2 ) . heavy shade marks tularemia - endemic area , medium shade the border area , and light shade the emergent area , where many cases occurred during the 2000 outbreak , but few cases were reported during the previous decade . week of onset of illness for cases in the tularemia outbreak in sweden , 2000 . controls matched for age , sex , and place of residence were drawn from the computerized swedish national population register , in which the name , date of birth , personal identifying number , and address of all citizens and residents are stored . matching for place of residence was done on the first three digits of the five - digit postal code , since this three - digit area corresponds to a small town , village , or municipality . we chose controls whose date of birth was as close as possible to that of the patient , with a difference < 12 months . a questionnaire was mailed to the two controls ; if neither responded within 2 weeks , a third control was chosen in the same way . if a control reported having had fever during the period of investigation and no diagnosis other than tularemia was made , he or she was excluded from the analysis . on the standardized questionnaire mailed to both case - patients and controls were questions on whether they had had an elevated temperature during the 4-week period 2 weeks before and 2 weeks after onset of symptoms in the patient . participants were also asked about number of persons in the household and symptoms in other household members during the defined period . the second part of the questionnaire contained questions on exposure to presumed risk factors for acquiring tularemia during the 4-week period preceding the reported day of onset of illness . the following exposures were recorded : owning cats , dogs , or other animals ; visiting golf courses and forests ; participating in farming procedures of different kinds ; having contact with dead animals , with or without wearing gloves ; visiting or swimming in lakes or rivers ; drinking water from lakes or wells ; picking berries or mushrooms ; and being bitten by mosquitoes , mites , ticks , deer flies , or other insects . visits to areas other than place of residence during the defined period of exposure were also recorded . in the 2000 epidemic , cases occurred in places where tularemia had rarely been reported . to evaluate whether this spread was connected to any new risk factors , the seven counties in the study area were divided into three categories ( figure 1 ) : the disease - endemic area , county of gvleborg , from which cases were reported every year during the 1990s ; the border area , county of dalarna , where occasional cases and small outbreaks have been reported during the last decade ; and the emergent area , which consists of the counties of stockholm , sdermanland , vstmanland , vrmland , and rebro , from which only one or two cases have been reported in isolated years during the 1990s , but where a large part of the cases occurred in 2000 . this division was done by actual place of exposure , as could be judged by routine notifications from the period 199099 , and not by place of residence . the endemic group consisted of 84 case - patients and 159 controls , a total of 243 persons , while 300 persons were in the emergent group ( 105 case - patients and 195 controls ) . we chose to analyze these two groups separately for symptoms and exposures as above , but to improve the discrimination between the old and new tularemia areas , we excluded the third group , consisting of 29 case - patients and 60 controls from the border area , from this part of the analysis . a matched univariate analysis , with calculation of odds ratios ( or ) and 95% confidence intervals ( ci ) by the mantel - haenszel method , was done in epiinfo 6.04 ( centers for disease control , atlanta , georgia , usa ) and the stata program ( stata corp . , college station , texas ) . multivariable analysis was done by conditional logistic regression for matched data in the stata program . tularemia has been a notifiable disease under the communicable diseases act in sweden since 1968 . physicians who diagnose a case , either clinically or by microbiologic means , report to the county medical officer and the swedish institute for infectious disease control ( smi ) . cases were defined as tularemia in all persons ages > 18 whose illness was reported to smi from august 1 ( week number 31 ) to november 21 , 2000 ( week number 47 ) and who resided in any of seven counties in central sweden , representing both disease - endemic and emergent areas ( figure 1 ) . the cases from these seven counties represented 60% of all cases reported in sweden during the study period ; the rest were sporadic cases from other areas or infection acquired abroad ( figure 2 ) . heavy shade marks tularemia - endemic area , medium shade the border area , and light shade the emergent area , where many cases occurred during the 2000 outbreak , but few cases were reported during the previous decade . week of onset of illness for cases in the tularemia outbreak in sweden , 2000 . controls matched for age , sex , and place of residence were drawn from the computerized swedish national population register , in which the name , date of birth , personal identifying number , and address of all citizens and residents are stored . matching for place of residence was done on the first three digits of the five - digit postal code , since this three - digit area corresponds to a small town , village , or municipality . we chose controls whose date of birth was as close as possible to that of the patient , with a difference < 12 months . a questionnaire was mailed to the two controls ; if neither responded within 2 weeks , a third control was chosen in the same way . if a control reported having had fever during the period of investigation and no diagnosis other than tularemia was made , he or she was excluded from the analysis . on the standardized questionnaire mailed to both case - patients and controls were questions on whether they had had an elevated temperature during the 4-week period 2 weeks before and 2 weeks after onset of symptoms in the patient . participants were also asked about number of persons in the household and symptoms in other household members during the defined period . the second part of the questionnaire contained questions on exposure to presumed risk factors for acquiring tularemia during the 4-week period preceding the reported day of onset of illness . the following exposures were recorded : owning cats , dogs , or other animals ; visiting golf courses and forests ; participating in farming procedures of different kinds ; having contact with dead animals , with or without wearing gloves ; visiting or swimming in lakes or rivers ; drinking water from lakes or wells ; picking berries or mushrooms ; and being bitten by mosquitoes , mites , ticks , deer flies , or other insects . visits to areas other than place of residence during the defined period of exposure were also recorded . in the 2000 epidemic , cases occurred in places where tularemia had rarely been reported . to evaluate whether this spread was connected to any new risk factors , the seven counties in the study area were divided into three categories ( figure 1 ) : the disease - endemic area , county of gvleborg , from which cases were reported every year during the 1990s ; the border area , county of dalarna , where occasional cases and small outbreaks have been reported during the last decade ; and the emergent area , which consists of the counties of stockholm , sdermanland , vstmanland , vrmland , and rebro , from which only one or two cases have been reported in isolated years during the 1990s , but where a large part of the cases occurred in 2000 . this division was done by actual place of exposure , as could be judged by routine notifications from the period 199099 , and not by place of residence . the endemic group consisted of 84 case - patients and 159 controls , a total of 243 persons , while 300 persons were in the emergent group ( 105 case - patients and 195 controls ) . we chose to analyze these two groups separately for symptoms and exposures as above , but to improve the discrimination between the old and new tularemia areas , we excluded the third group , consisting of 29 case - patients and 60 controls from the border area , from this part of the analysis . a matched univariate analysis , with calculation of odds ratios ( or ) and 95% confidence intervals ( ci ) by the mantel - haenszel method , was done in epiinfo 6.04 ( centers for disease control , atlanta , georgia , usa ) and the stata program ( stata corp . , college station , texas ) . multivariable analysis was done by conditional logistic regression for matched data in the stata program . all the case - patients were ill during the summer or in the early autumn . no cases were reported during 2000 before the start of the study period on august 1 . of cases , replies were received from 243 ( 90% ) of 270 case - patients and 438 ( 65% ) of 670 controls , for a total of 681 ( 72% ) of 940 . twenty - five cases and 21 controls were excluded because of confusion about the time periods used in the questionnaires . one control was excluded because of a documented episode of tularemia , one control was excluded because of an episode of febrile illness that could have been tularemia , and another control was excluded because the wrong person filled out the questionnaire . thus , 218 cases and 414 controls , from which 202 matched pairs or triplets could be arranged , remained for further analysis . with regard to symptoms , 198 ( 95% ) of 209 of these , 147 ( 86% ) of 171 reported swollen lymph nodes , 143 ( 79% ) of 180 wound infection , 26 ( 20% ) of 132 sore throat , 39 ( 28% ) of 138 cough , and 10 ( 5.2 % ) of 193 pneumonia diagnosed by a physician . as a measure of severity of disease , 34 ( 16% ) of 212 were hospitalized . no deaths were reported . the matched univariate analysis ( table 1 ) gave statistically significant results for the following exposures : owning a cat , farming , visiting wooded areas , and being bitten by mosquitoes . after multivariate analysis , owning a cat , farming , and being bitten by mosquitoes remained as independent risk factors . having had swollen lymph nodes ( 47 [ 78% ] of 60 vs. 85 [ 96% ] of 89 [ p=0.001 ] ) or a wound infection ( 48 [ 72% ] of 67 vs. 78 [ 89% ] of 88 [ p=0.007 ] ) was significantly more common in the emergent group , while having had pneumonia ( 7 [ 9.3% ] of 75 vs. 1 [ 1.1% ] of 94 [ p=0.02 ] ) , was significantly more common in the endemic group . the matched univariate analysis in the endemic group showed significant results for the following exposures : owning a cat , farming , and being bitten by mosquitoes . in the emergent group , being bitten by mosquitoes and visiting woods or forests appeared as risk factors ( table 2 ) . after multivariate analysis , owning a cat and being bitten by mosquitoes were shown to be independent risk factors for acquiring tularemia in both groups , while farming was a risk factor only in the endemic group . we report results from a study of a tularemia outbreak in sweden , with a spread of the disease into new geographic areas . the use of a mailed questionnaire with matched controls from the population register had a high response rate even among controls . frequency of reported symptoms from case - patients are consistent with earlier data , showing ulceroglandular tularemia to be the dominant form in sweden ( 10 ) . pulmonary tularemia was seen in only 10 ( 5.2% ) of 193 cases , in contrast to the outbreak in the winter of 196667 , when 11% had pneumonia symptoms . statistically significant independent associations were found between acquiring tularemia and the following exposures : being bitten by a mosquito , doing farm work , and owning a cat . the results for mosquito bites could have been influenced by recall bias , since this transmission route has always been thought to be the most common in sweden and many patients might thus have been told by their physician that mosquitoes caused the infection . however , the predominance of the ulceroglandular form of tularemia and the seasonal variation of the disease support the theory that mosquito bites are the major route of transmission in sweden . farming has not been connected with tularemia in sweden since the outbreak in 196667 . however , about pulmonary tularemia was reported among farmers in finland in 1982 ( 11 ) . in spite of detailed questions about different farming activities , no specific practice could be implicated in our study , perhaps because relatively few of the persons studied were involved in farming . holarctica , has been described from north america , from both sick and healthy cats , and with or without the patient s being bitten by the cat ( 1217 ) . furthermore , scheel et al . reported a case of tularemia in a veterinary surgeon in norway who cut himself while spaying a cat ( 18 ) . the increased risk in cat owners could be due to direct transmission from infected cats or exposure to dead animals brought home by the cat . we found no increased exposure to dead animals among case - patients who were cat owners . the connection between cats and tularemia needs to be studied further , and a seroepidemiologic study of cats in affected areas would be of interest . the risk for acquiring tularemia , however , is relatively small even in the disease - endemic areas , where the overall incidence in this outbreak was approximately 66 per 100,000 population . on the basis of these findings , recommendations to the population in general about not owning a cat therefore seem unwarranted . however , informing the public about the risk of spread of tularemia from cats to humans seems reasonable . in the separate analysis of risk factors , owning a cat and being bitten by mosquitoes appeared as independent risk factors in both groups . one explanation could be different farming practices , since the disease - endemic areas are heavily forested with small plots of arable land interspersed , but the emergent areas have more open , continuous farmland . no new risk factors were found in the emergent group that could explain the spread of tularemia into new areas . however , mosquito bites and spending time in the forest play a relatively bigger role in the emergent areas , but farming and contact with cats were relatively more important in the disease - endemic area ( tables 1 and 2 ) . this finding may suggest that reservoirs in the new areas have not yet come into close contact with human settlements . the higher proportion of pneumonia in the disease - endemic area , which can not fully be explained by greater diagnostic acumen among clinicians more familiar with the disease , could also indicate some kind of environmental contamination in areas where tularemia has long been established . the parallel of our findings with the recently described small outbreak of pneumonic tularemia in landscapers on martha 's vineyard is intriguing ( 19 ) . what is the interaction between infection in different wild species ? and what triggers an outbreak in humans ? a follow - up field study with collection of samples from mosquitoes , water , and rodents is planned .

the major components of chromatin are dna and histone proteins , although many other chromosomal proteins have prominent roles , too . the functions of chromatin are to package dna into a smaller volume to fit in the cell , to strengthen the dna to allow mitosis and meiosis , and to serve as a mechanism to control expression and dna replication . changes in chromatin structure are affected by chemical modifications of histone proteins and by non - histone dna - binding proteins . the non - histone proteins that are found associated with isolated chromatin fall into several functional categories such as chromatin - bound enzymes , high mobility group proteins ( hmg ) , transcription factors , and scaffold proteins . thus , acetylation of histone and non - histone chromosomal proteins by histone acetyl transferases ( hats ) leads to decondensation of the chromatin . chromatin remodeling and gene expression is simultaneously regulated by histone deacetylases ( hdacs ) that condense the chromatin structure by deacetylating histones . hdacs comprise a group of enzymes that are responsible for the removal of acetyl groups from a e - n - acetyl lysine amino acids . as the organization and packaging of eukaryotic dna is achieved through the addition of core histones h2a , h2b , h3 , and h4 , which form the chromatin , the modification of core histones is of fundamental importance to conformational changes in chromatin . the level of acetylation influences transcription activity . the acetylation of histones results in the formation of shapes of dna that will serve as specific recruitment platforms for other protein and enzyme complexes . by contrast , hdacs present in a repressor complex deacetylate histone proteins , leading to the recruitment of histone methyltransferase and resulting in subsequent methylation of histones . ultimately , proteins such as heterochromatin protein 1 ( hp1 ) are recruited to the repressor complex , leading to the formation of condensed heterochromatin . thus , hdac activities are a prerequisite step allowing further modification of histone proteins that promote the final heterochromatin formation . in mammals , a total of 18 hdacs have been identified and grouped into four classes , i.e. , class i ( hdacs 1 , 2 , 3 , 8) , class ii ( hdacs 4 , 5 , 6 , 7 , 9 , 10 ) , class iii ( sirt1sirt7 ) , and class iv ( hdac11 ) ( table 1 ) . the members of class i hdacs contain a deacetylase domain and are the homologs of yeast rpd3 . they exhibit 45% to 93% amino acid sequence identity and localize in the nucleus , except for hdac3 . class ii hdacs are homologs of yeast hda1 and are present in both the nucleus and the cytoplasm ( martin et al . hdac6 is an exception which contains two deacetylase domains , at both the n- and c - terminus . the members of class iii , sirtuins , are homologs of yeast sir2 and form a structurally distinct class of nad - dependent enzymes found in both the nucleus and cytoplasm . hdac11 has properties of both class i and class ii hdacs and represent class iv . table 1hdac classification depending on sequence identity and domain organizationhistone classesmemberslocalizationtarget proteins ( partial list)class ihdac1nucleusar , p53 , e2f-1 , shp , stat3 , myodhdac2nucleusstat3 , bcl6 , glucocorticoid receptor gata-1 , stat-3,shp , rela , yy-1hdac3nucleus / cytoplasmhdac8nucleus class iihdac4nucleus / cytoplasmgcma , gata-1 , hp-1hdac5nucleus / cytoplasmgcma , smad7 , hp-1hdac6mostly cytoplasmhsp70 , smad7 , shp , -tubulinhdac7nucleus / cytoplasmplag1 , plag2hdac9nucleus / cytoplasm hdac10mostly cytoplasm class iiisirt1nucleusnf-b , p53 , foxosirt2cytoplasm-tubulin , h4sirt3nucleus / mitochondriaacetyl coa synthetasessirt4mitochondriaglutamate dehydrogenatesirt5mitochondria sirt6nucleusdna polymerase bsirt7nucleusrna polymerase 1class ivhdac11nucleus / cytoplasm hdac classification depending on sequence identity and domain organization hdacs work in multi - subunit transcriptional co - repressor complexes that are recruited by sequence - specific transcription factors to promoter regions . there are several co - repressor complexes for distinct promoters , which recruit specific hdac isoforms for silencing of target genes ( miska et al . for example , hdacs 1 , 2 , and 3 are majorly responsible for catalytic core for different co - repressor complexes to achieve efficient transcriptional repression . hdac1 and hdac2 are present in the corest , mi2/nurd , and sin3 complexes , whereas hdac3 is responsible for the catalytic activity of the n - cor and smrt co - repressor complexes ( cress and seto 2000 ; mahlknecht et al . hdacs cooperate with various other transcriptional regulators such as hdac1 and hdac2 associate with dna methyltransferases ( burgers et al . 2001 ) and histone methyltransferases ( hmts ) ( czermin et al . 2001 ) . furthermore , hdac1 interacts with topoisomerase ii enzyme that is responsible for chromosome condensation ( tsai et al . however , little is known about the specificity of a particular histone deacetylase enzyme for a specific lysine residue . the preferential acetylation of h3k18 and h3k9 following knockdown of hdac1 and hdac3 , respectively , has been reported ( zhang et al . 2004 ) . non - histone deacetylation - based gene expression involves the deacetylation of various transcription factors by hdacs . deacetylation of sequence - specific transcription factors can decrease their dna binding activity and subsequently may repress transcription . the covalent modifications of several transcriptional factors , including e2f , sp3 , p53 , gata1 , and tfiif , have been reported ( ammanamanchi et al . 2003 ; boyes et al . 1998 ; braun et al . the specificity of hdac1 for p53 deacetylation , resulting in the degradation of deacetylated p53 has been reported ( ito et al . 2002 ) . hdac2 deacetylates the glucocorticoid receptor and hdac3 is needed for the deacetylation of myocyte enhancer factor-2 ( mef-2 ) ( gregoire et al . 2007 hdacs are also involved in the deacetylation of non - nuclear proteins like tubulin45 and hsp90 ( hubbert et al . hdacs are involved in the regulation of the replication of numerous viruses ( table 2 ) . we will described here the role of hdacs in viral diseases including hepatitis b and c , hiv and hpv infections , and infections with herpesviridae ( hsv , hcmv , ebv ) and paramyxoviridae ( rsv ) . table 2role of hdacs in viral infectionsvirushdacmolecular mechanismclinical effectreferencesdna viruseshbvhdac1 , 2hbx forms a multiprotein complex hdac1/2 , mta1 , hif-1angiogenesis and metastasis of hbv - associated hccsemenza 2004 ; yoo et al . icp0 inhibits the hdac1/corest complex and favor the hsv reactivationcontrol of hsv-1 latency and reactivation in neuronswysocka et al . 2003 , everett et al . 2009ebvhdac1 , 2 , 7histone deacetylation in response to phosphorylated mef-2d transcription factor . hdac1/2 represses the trf2 promoter bindingcontrol of ebv latencygruffat et al . 2002 ; bryant and farrell 2002 ; zhou et al . 2009hpvhdac1e7 viral oncoprotein disrupts the rb / e2f / hdac1 repressor complexes and favors cdc25a transcription . e7 recruits hdac and blocks the irf-1 transactivation function , a tumor suppressore7 hpv favors carcinogenesis through binding to cellular factors involved in cell cycle regulation and differentiationnguyen et al . 2000rna viruseshcvhdachdac favors the expression of hif , a hepcidin regulatorhcv - induced oxidative stress suppresses hepcidin expressionmiura et al . 2008hivhdac class i & class ii & class iiihdac represses the hiv-1 ltr transcription through the formation of inhibitory complexes including hdacs and several transcription factors and repressor proteins . sirt1 regulates hiv transcription via tat deacetylationformation of hiv cellular reservoirs in both myeloid and lymphoid cells resulting in viral persistencevan lint et al . ; reuse et al . 2009 ; imai & okamoto 2006 ; jiang et al . 2009rsvhdac1hdac1 associates with stat1 and bcl-3 on the il-8 promoterdecreased il-8 production during airway inflammation to favor rsv replicationjamaluddin et al . 2005 role of hdacs in viral infections the hepatitis b virus x ( hbx ) protein plays a critical role in liver carcinogenesis . hbx induces the expression of metastasis - associated protein 1 ( mta1 ) , a protein closely related to tumor growth and metastasis in various cancers , especially in hepatocellular carcinoma ( hcc ) . in addition , hbx has been reported to modulate hypoxia - inducible factor-1 alpha ( hif-1 alpha ) expression and activity , and hif-1 alpha increased expression has been correlated with tumor growth and poor patient prognosis ( semenza 2004 ) . under conditions of normoxia , post - translational modifications including the hydroxylation of proline residues and acetylation of a lysine residue within the oxygen - dependent degradation domain promote hif-1 interaction with von hipple lindau ( pvhl ) ubiquitin e3 ligase complex . this occurs concurrently with the hydroxylation of an asparagine residue by the aparaginyl hydroxylase fih-1 and inhibits the binding of transcriptional co - activators p300 and cbp to hif-1. these events result in polyubiquitination and the proteosomal degradation of hif-1. in contrast , conditions of cellular hypoxia result in hif-1-stabilized expression by remaining unhydroxylated and deacetylated , especially via class ii hdac activation ( qian et al . 2006 ) . stabilized hif-1 escapes pvhl - mediated degradation and is able to bind p300 and cbp where it translocates to the nucleus from the cytoplasm and heterodimerizes with hif-1 to initiate the transcription of its target genes . during hbv infection , especially at the stage of hcc , hypoxia occurs , resulting in hif-1alpha overexpression parallel to hbx upregulation . in the presence of hbx , hdac1/2 and mta1 physically associate with hif-1 alpha in vivo . thus , a positive cross - talk between hbx and the mta1/hdac complex in stabilizing hif-1 alpha may play a critical role in angiogenesis and metastasis of hbv - associated hcc ( yoo et al . 2008 ) . hcv - induced oxidative stress suppresses the expression of hepcidin , a negative regulator of iron absorption . hypoxia and chemical stabilizers of the hif-1 alpha have also been shown to suppress hepcidin expression ( volke et al . expression of hepcidin inhibitor , hif , is increased by hdac , suggesting that hcv - induced oxidative stress suppresses hepcidin expression through increased hdac activity resulting in increased hif-1 alpha activity ( miura et al . after entry into the target cell and reverse transcription , hiv-1 genes are integrated into the host genome . it is now well established that the viral promoter activity is directly governed by its chromatin environment ( van lint 2000 ) . epigenetic modifications and disruption of nuc-1 , a nucleosome located immediately downstream of the transcriptional initiation site that directly impedes ltr activity , are a prerequisite to the activation of ltr - driven transcription and viral expression ( van lint 2000 ; van lint et al . 1996 ; verdin et al . 1993 ) . the compaction of chromatin and its permissiveness for transcription are directly dependent on the post - translational modifications of histones such as acetylation , methylation , phosphorylation , and ubiquitination ( fischle et al . in contrast to productively infected cells , latently infected cells frequently harbor hiv-1 genomes integrated in heterochromatic structures , which allows the viral persistence of silenced integrated proviruses ( jordan et al . 2003 ) . these observations might at least partially explain how the virus can form viral reservoirs in some target cells and thereby fuel the progression of the disease ( finzi et al . some transcription factors , such as yy1 and lsf , repress the transcription from the hiv-1 ltr by recruiting hdac1 to the repressor complex ( coull et al . 2000 ) . in agreement with these data , hiv-1 gene transcription has been shown to be activated by trichostatin a ( tsa ) treatment , and several transcription factors bound to the viral ltr recruit class i or ii hdac ( coull et al . 2000 ; van lint et al . hp1 is a transcriptional repressor that directly binds to the methylated lysine 9 residue of histone h3 ( h3k9me ) , which is a hallmark histone modification for transcriptionally silenced heterochromatin ( zeng et al . the levels of trimethylated histone h3 and hp1-alpha associated with hiv proviruses have been reported to fall rapidly after tnf alpha activation , indicating that epigenetic mechanisms targeting chromatin structures selectively restrict hiv transcription ( pearson et al . coup - tf interacting protein 2 ( ctip2 ) is a recently cloned transcriptional repressor that can associate with members of the coup - tf family ( avram et al . ctip2 has been reported to inhibit hiv-1 replication in human microglial cells ( marban et al . microglial cells constitute the central nervous system resident macrophages and have been described as latently hiv-1-infected cellular reservoirs ( barber et al . however , contrary to cd4 + t lymphocyte reservoirs ( marcello 2006 ) , within macrophages and microglial cells ctip2 inhibits hiv-1 gene transcription ( reviewed in redel et al . ctip2 recruits hdac1 and hdac2 to promote local histone h3 deacetylation at the hiv-1 promoter region and also associates with the histone methyltransferase suv39h1 , which increases local histone h3 lysine 9 methylation . thereafter , hp1 proteins are recruited to the viral promoter , leading to the formation of local heterochromatin and subsequently to hiv-1 silencing ( marban et al . p21waf1 is a major cell cycle regulator of the response to dna damage , senescence , and tumor suppression and its induction upon hiv-1 infection favors hiv-1 replication in macrophages . ctip2 is recruited to the p21 gene promoter , resulting in the silencing of p21 gene transcription through interactions with histone deacetylases and methyltransferases suv39h1 , and therefore could abolish vpr - mediated stimulation of p21 , thereby indirectly contributing to hiv-1 latency ( cherrier et al . the ap-4 site within the hiv-1 ltr represses hiv-1 gene expression by recruiting hdac1 ( imai and okamoto 2006 ) . also , c - myc and sp1 transcription factors contribute to proviral latency by recruiting hdac1 to the hiv-1 ltr ( jiang et al . hiv-1 integrase and ini1/hsnf5 , a component of the swi / snf complex , bind sap18 ( sin3a - associated protein , 18 kda ) , a component of the sin3a - hdac1 complex , and selectively recruit components of sin3a hdac1 complex into hiv-1 virions ( sorin et al . thus , hiv-1 virion - associated hdac1 is required for efficient early post - entry events . hiv tat is involved in binding to the cbp / p300 and cdk9/cyclin t1 complexes , resulting in tat acetylation by the transcriptional coactivator p300 , thereby facilitating transcription initiation . acetylated tat dissociates from the tar rna structure and recruits bromodomain - binding chromatin - modifying complexes such as p / caf and swi / snf to facilitate transcription elongation ( agbottah et al . by contrast , tat is deacetylated by human sirtuin 1 ( sirt1 ) , a nicotinamide adenine dinucleotide - dependent class iii protein deacetylase in vitro and in vivo ( pagans et al . 2009 ) , supporting a model in which cycles of tat acetylation and deacetylation regulate hiv-1 transcription ( blazek and peterlin 2008 ; kwon et al . 2008 ) . upon infection of permissive cells such as fibroblasts , epithelial cells , endothelial cells , and macrophages , human cytomegalovirus ( hcmv ) the major immediate early ( ie ) genes are the first transcribed , resulting in two abundant proteins , ie1 p72 and ie2 p86 ( stenberg et al . 1989 ) , which are able to autoregulate the major immediate early promoter ( miep ) ( cherrington and mocarski 1989 ; pizzorno et al . it is known that expression from the miep is at least partly determined by cellular factors such as nf - kb / rel , creb / atf , sp-1 , ap-1 , bcl-3 , serum response factor , and elk-1 , which all promote activity by binding one or more sites in the enhancer ( chan et al . ; liu and stinski 1992 ; sambucetti et al . 1989 ; wade et al . 1992 ; khan et al . 2009 ) . in contrast , the miep is also regulated by cellular repressors , such as mbfs , yy1 , mrf and gfi-1 , which bind to the miep and all are preferentially expressed in undifferentiated cells ( huang et al . the chromatin structure around the miep changes with cellular differentiation and thus may play a role in controlling hcmv latency and reactivation . t2 cells are normally non - permissive for hcmv infection ; however , following treatment with tsa , t2 cells can be rendered transiently permissive for hcmv ( meier 2001 ) , suggesting that hdacs play a role in the repression of viral replication . hdacs have been reported as limiting hcmv infection as the relatively high levels of hdac3 in t2 cells and monocytes correlate with non - permissiveness for hcmv ( murphy et al . furthermore , fibroblasts , which are fully permissive for hcmv , contain little hdac3 , implying that the relative level of hdac may be important for hcmv permissiveness in a range of cell types . hdac3 acts as a repressor of the hcmv miep since superexpression of hdac3 appeared most effective at inhibiting viral infection in permissive t2ra cells ( murphy et al . latent herpes simplex virus type 1 ( hsv-1 ) dna is associated with nucleosomes in vivo ( deshmane and fraser 1989 ) . following tsa treatment of neurons latently infected with a recombinant hsv-1 , the activity of the viral immediate early promoter increased significantly ( arthur et al . the abundant and chromatin - associated protein hcf-1 is a critical player in hsv transcription . hcf-1 associates with the sin3 hdac and human trithorax - related set1/ash2 histone methyltransferase ( wysocka et al . 2003 ) . hcf-1 tethers the sin3 and set1/ash2 transcriptional regulatory complexes together even though they are generally associated with opposite transcriptional outcomes : repression and activation of transcription , respectively . nevertheless , this tethering is context - dependent because the transcriptional activator vp16 selectively binds hcf-1 associated with the set1/ash2 hmt complex in the absence of the sin3 hdac complex ( wysocka et al . these results suggest that hcf-1 can broadly regulate transcription , both positively and negatively , through selective modulation of chromatin structure . immediate early regulatory protein icp0 is important for stimulating the initiation of the lytic cycle and efficient reactivation of latent or quiescent infection . icp0 inhibits cellular hdac activity through an interaction with the hdac-1 binding partner corest ( everett et al . barr virus ( ebv ) , dna is organized in nucleosomes ( dyson and farrell 1985 ; jenkins et al . 2000 ; shaw et al . 1979 ) and the switch to productive ebv infection is believed to involve the activation of the ie gene bzlf1 ( countryman and miller 1985 ) . although it was proposed that hdacs 4 and 5 are the hdacs which might mediate the repression of zp ( gruffat et al . 2002 ) , direct measurement of the expression of class ii hdacs has shown that hdacs 4 and 5 are undetectable but hdac7 is the most readily detected class ii hdac in raji cells , suggesting that it may be involved in the repression of the zp promoter of the ebv bzlf1 gene during latency ( bryant and farrell 2002 ) . moreover , the promoter of bzlf1 is more associated with acetylated histones following activation of ebv - positive ak6 cells ( jenkins et al . 2000 ) . during ebv latency , latent membrane protein ( lmp)-1 expression induces several b lymphocyte activation markers , including intercellular adhesion molecule ( icam)-1 . hdac inhibition induces the latent form of lmp-1 expression in ebv - positive cell lines , resulting in icam-1 expression upregulation and homotypic adhesion ( park and faller 2002 ) . dephosphorylation of mef-2d is known to be associated with histone acetylase recruitment ( bryant and farrell 2002 ) . histone deacetylation in response to phosphorylated mef-2d can be mediated by class i or class ii hdacs ( gruffat et al . telomere repeat factor 2 ( trf2 ) binding at the ebv origin of plasmid replication ( orip ) represses ebv replication . hdac1 and hdac2 form a stable complex with trf2 at orip and enhance ebv episome stability by providing a checkpoint that delays replication initiation at orip ( zhou et al . 2009 ) . respiratory syncytial virus ( rsv ) is a paramyxovirus that produces airway inflammation , in part by inducing interleukin-8 ( il-8 ) expression , a cxc - type chemokine , via the nf - kb / rela and stat / irf signaling pathways . in rsv - infected a549 cells , il-8 transcription attenuates after 24 h in spite of ongoing viral replication and persistence of nuclear rela , suggesting a mechanism for transcriptional attenuation ( jamaluddin et al . 2005 ) . rsv infection induces bcl-3 expression 6 to 12 h after viral infection , at times when il-8 transcription is inhibited . nuclear bcl-3 associates with stat1 and hdac1 , increasing hdac1 recruitment to the il-8 promoter . treatment with tsa blocks the attenuation of il-8 transcription ( jamaluddin et al . 2005 ) . thus , bcl-3 is a rsv - inducible inhibitor of il-8 transcription by interfering with the nf - kb and stat / irf signaling pathways by complexing with them and recruiting hdac1 to attenuate target promoter activity . the activities encoded by the early gene product e7 are essential to the oncogenic properties of human papillomavirus type 16 ( hpv-16 ) ( longworth et al . 2005 ) . the cdc25a tyrosine phosphatase is required for g(1)/s transition , and its deregulation is associated with carcinogenesis . e7 can directly target cdc25a transcription and maintains cdc25a gene expression by disrupting rb / e2f / hdac1 repressor complexes ( nguyen et al . the interaction of e7 with hdacs is essential for extending the life span of keratinocytes and for stable maintenance of viral genomes ( longworth and laimins 2004 ) . e7 activates the e2f2 transcription in suprabasal keratinocytes through its ability to bind hdacs ( longworth et al . other studies have found that growth arrest of hpv - positive cells after hdac inhibition is independent of e6/e7 oncogene expression ( finzer et al . hpv e7 protein is functionally associated with the interferon regulatory factor ( irf)-1 tumor suppressor in cervical carcinogenesis . under tsa treatment , the repressing activity of e7 is released in a dose - dependent manner ( park et al . 2000 ) , suggesting that hpv e7 interferes with the transactivation function of irf-1 by recruiting hdac to the promoter . hdac inhibitors act exclusively on class i and class ii hdacs by binding to the zinc - containing catalytic domain of the hdacs . these classical hdac inhibitors fall into several groupings : hydroxamic acids , such as trichostatin acyclic tetrapeptides ( such as trapoxin b ) and the depsipeptidesbenzamideselectrophilic ketonesthe aliphatic acid compounds such as phenylbutyrate and valproic acid hydroxamic acids , such as trichostatin a cyclic tetrapeptides ( such as trapoxin b ) and the depsipeptides electrophilic ketones the aliphatic acid compounds such as phenylbutyrate and valproic acid the second - generation hdac inhibitors include the hydroxamic acids vorinostat ( saha ) , belinostat ( pxd101 ) , laq824 , and panobinostat(lbh589 ) and the benzamides entinostat ( ms275 ) , ci994 , and mocetinostat ( mgcd0103 ) . the sirtuin class iii hdacs are nad+ dependent and are therefore inhibited by nicotinamide , as well derivatives of nad , dihydrocoumarin , naphthopyranone , and 2-hydroxynaphaldehydes . hdac inhibitors ( hdaci ) could potentially be used as new therapeutic tools in several viral infections . first , hdaci could reactivate the latent virus present in infected cells and thereby favor the clearance of the virus from cellular reservoirs such as in hiv and hcmv infections . second , hdaci could favor the apoptosis of infected cells and also could thereby lead to the elimination of infected cells . this mechanism could be used to kill transformed cells infected by viruses such as hpv and ebv . the ability of hiv to establish a latent infection causes life - long virus persistence , even after long - term highly active antiretroviral therapy ( haart ) . the role that latency is playing in preventing the clearance of the virus infection has become evident in recent years . patients who have been successfully treated with haart , having undetectable levels of viral rna ( below 40 copies / ml ) in the plasma for years , experience rapid virus rebound on withdrawal of therapy . activation of latent proviruses from the infected cells in combination with haart is a therapeutic strategy that may lead to the complete elimination of hiv infection ( colin and van lint 2009 ) . combination therapy with an hdac inhibitor such as tsa and intensified haart has been shown to safely accelerate the clearance of hiv from resting cd4 + t cells in vivo , suggesting a new and practical approach to eliminate hiv infection in this persistent reservoir ( lehrman et al . by contrast , more recent data indicate that the stability of the latent reservoir despite intensive therapy requires new strategies to eradicate hiv-1 from this reservoir ( gandhi et al . hdacs act on histones within the nucleosome - bound promoter of hiv-1 to maintain proviral latency . imidazole polyamides that specifically block hdac1 recruitment by the transcription factor lsf to the hiv promoter , replication - competent hiv is recovered from the cultures of resting cd4 + t cells in hiv - infected patients whose viremia had been suppressed by therapy ( ylisastigui et al . class i hdac inhibitors such as suberoylanilide hydroxamic acid ( saha , vorinostat ) have been tested ex vivo on hiv-1-infected cells isolated from the peripheral blood of patients ( quivy et al . 2007 ) . in the resting cd4 + t cells of antiretroviral - treated aviremic hiv - infected patients , clinically achievable exposures to saha induced virus outgrowth ex vivo ( archin et al . 2009a ; edelstein et al . 2009 ) . valproic acid ( vpa ) induces acetylation at the integrated hiv proviral promoter , but cd4 cells exposed to vpa do not become activated or more permissive for de novo hiv infection . vpa induces outgrowth of hiv from the resting cd4 + t cells of aviremic patients at concentrations achievable in vivo ( ylisastigui et al . in addition , combination therapy with oral vpa ( 500750 mg , twice daily ) added to intensified haart for 3 months safely accelerates the clearance of hiv from resting cd4 + t cells in vivo , suggesting a way to eliminate hiv infection in the persistent reservoir ( lehrman et al . 2005 ) . class i hdaci are a strikingly efficient inducer of virus outgrowth from resting cd4 + t cells of aviremic patients , whereas hiv is rarely recovered from patient s cells exposed to class ii hdaci ( archin et al . since global hdac inhibition can induce host cytotoxicity , the rna expression and protein expression and compartmentalization of hdac1 to hdac11 in the resting cd4 + t cells of hiv-1-positive aviremic patients were recently assessed . although all hdacs were detected in resting cd4 + t cells , targeted inhibition of hdacs by small - interfering rna demonstrated that mostly hdac2 and hdac3 contribute to the repression of hiv-1 ltr expression ( keedy et al . 2009 ) . therefore , hdaci specific for a limited number of class i hdacs may offer a targeted approach to the disruption of persistent hiv-1 infection . thus , potent selective hdaci may allow improved targeting of persistent proviral infection in hiv - infected patients . recently , a strong synergistic activation of hiv-1 production by clinically used histone deacetylase inhibitors ( hdacis ) combined with prostratin , a non - tumor - promoting nuclear factor ( nf)- b inducer , was shown using the latently infected u1 monocytic cell line and latently infected j - lat t cell clones ( reuse et al . mechanistically , hdacis increased prostratin - induced dna - binding activity of nuclear nf-b and degradation of cytoplasmic nf-b inhibitor , ib. moreover , the combined treatment prostratin+hdaci caused a more pronounced nucleosomal remodeling in the u1 viral promoter region than the treatments with the compounds alone . this more pronounced remodeling correlated with a synergistic reactivation of hiv-1 transcription following the combined treatment prostratin+hdaci . the physiological relevance of the prostratin+hdaci synergism has been shown in cd8-depleted peripheral blood mononuclear cells from haart - treated patients with undetectable viral load ( reuse et al . moreover , this combined treatment reactivated viral replication in resting cd4 t cells isolated from similar patients . viral reactivation assays have shown in cell cultures prepared from haart - treated hiv-1-infected individuals with undetectable viral load that a combination prostratin+vpa or prostratin+saha can induce hiv-1 recovery in cd8-depleted pbmc cultures tested . moreover , the combination prostratin+saha can reactivate viral replication in hla dr cd4 t cell cultures prepared from additional patients ( reuse et al 2009 ) . altogether , these results suggest that combinations of different kinds of proviral activators may have important implications for reducing the size of latent hiv-1 reservoirs in haart - treated patients , not only in cd4 + t cells but also in monocytes / macrophages . interestingly , resveratrol , a sirt1 activator , has been recently reported to inhibit in vitro tat - induced hiv-1 ltr transactivation via nad(+)-dependent sirt1 activity ( zhang et al . 2009 ) . besides hdaci , resveratrol and related compounds may represent as potential candidates for novel anti - hiv therapeutics . beside hiv , other viruses hcmv has been reported to replicate at low levels in infected cells and to be reactivated upon immune suppression , especially in transplant recipients ( coaquette et al . recently , we reported that the activation of p52/bcl-3 nf - kb complexes in primary macrophages and p50/p65 nf - kb complexes in fibroblasts in response to hcmv infection could explain the low - level growth of the virus in macrophages versus efficient growth in fibroblasts ( khan et al . the low level sustained replication of hcmv in macrophages could favor the formation of reservoirs of virions , and the use of hdaci could reactivate the virus which could be targeted with antiviral compounds such as ganciclovir . thus , the use of hdaci in addition to antiviral treatment could be a new promising approach in several viral infections including hiv-1 , but also herpesviruses such as hcmv and others . cervical cancer cells are addicted to the expression of the hpv oncoproteins e6 and e7 . the oncogenicity of e6 is mediated in part by targeting p53 and pdz - family tumor suppressor proteins for rapid proteosomal degradation , whereas the e7 oncoprotein acts in part by coopting hdac1/2 . immunohistochemical analysis reveals elevated hdac1/hdac2 expression in cervical dysplasia and cervical carcinoma versus normal cervical epithelium . hdaci sodium butyrate and tsa arrest hpv - positive carcinoma cells in g1 to s transition of the cell cycle , which is paralleled by an upregulation of the cyclin - dependent kinase inhibitors ( ckis ) p21cip1 and p27kip1 as well as the complete loss of cdk2 activity . hdac inhibition triggered an e7-dependent degradation of prb , while the levels of e2f remained unaffected . the presence of free intracellular e2f and the concomitant upregulation of ckis during g1 arrest render the cells to undergo apoptosis ( finzer et al . 2001 ) . in addition , hdaci induce an intrinsic type of apoptosis in hpv - positive cells by disrupting the mitochondrial transmembrane potential ( finzer et al . the hpv oncogenic proteins e6 and e7 are able to inactivate p53 and prb proteins , which results in malignant transformation . apicidin hdaci significantly reduces hpv16-e6 and -e7 protein levels in cervical cancer cells ( luczak and jagodzinski 2008 ) . the combination of bortezomib , a proteosome inhibitor , and hdaci tsa or saha shows the synergistic killing of hpv - positive , but not hpv - negative , cervical cancer cell lines ( lin et al . thus , a combination of hdac and proteosome inhibitors , including saha and bortezomib , respectively , warrants exploration for the treatment of cervical cancer . latent infection of the ebv is strongly associated with the pathogenesis of several tumor types . the restricted expression of the latent ebv antigens is critical for ebv - associated tumors to escape from immune surveillance . tsa causes cell cycle arrest at low concentrations and induces apoptosis at higher ( > 300 nm ) concentrations in the ebv - transformed lymphoblastoid cell lines ( lcls ) ( seo et al . following tsa treatment , a reduced expression of cyclin d2 and an induction of p21 may play an essential role for g1 arrest in lcls . in addition , tsa induces ebv lytic replication cycle in lcl cells ( seo et al . thus , tsa may exert an enhanced anti - tumor effect for ebv - associated tumors not only by inducing a cell cycle arrest and apoptosis but also by triggering an ebv lytic cycle . finally , combining the use of a chemotherapeutic agent with oncolytic virotherapy is a useful way to increase the efficiency of the treatment of cancer . replication - conditional ( oncolytic ) mutants of hsv are considering promising therapeutic alternatives for human malignancies . vpa pretreatment improves the propagation and therapeutic efficacy of oncolytic hsv in a human glioma xenograft model in vivo ( otsuki et al . tsa can be used as an enhancing agent for oncolytic virotherapy for oral squamous cell carcinoma with gamma(1)34.5 gene - deficient hsv-1 ( katsura et al . hepatitis b oncoprotein , hbx , estrogen receptor ( er ) alpha , and hdac1 form a ternary complex ( han et al . since estrogen , which exerts its biological function through er , can inhibit hbv replication , eralpha agonists may be developed for hcc therapy . proof - of - concept in oncology , additional experiments have to be performed to determine if this approach is translatable to patients without malignancy and/or if it will succeed in the absence of a second drug and/or an alternative treatment . the ability of hiv to establish a latent infection causes life - long virus persistence , even after long - term highly active antiretroviral therapy ( haart ) . the role that latency is playing in preventing the clearance of the virus infection has become evident in recent years . patients who have been successfully treated with haart , having undetectable levels of viral rna ( below 40 copies / ml ) in the plasma for years , experience rapid virus rebound on withdrawal of therapy . activation of latent proviruses from the infected cells in combination with haart is a therapeutic strategy that may lead to the complete elimination of hiv infection ( colin and van lint 2009 ) . combination therapy with an hdac inhibitor such as tsa and intensified haart has been shown to safely accelerate the clearance of hiv from resting cd4 + t cells in vivo , suggesting a new and practical approach to eliminate hiv infection in this persistent reservoir ( lehrman et al . by contrast , more recent data indicate that the stability of the latent reservoir despite intensive therapy requires new strategies to eradicate hiv-1 from this reservoir ( gandhi et al . hdacs act on histones within the nucleosome - bound promoter of hiv-1 to maintain proviral latency . imidazole polyamides that specifically block hdac1 recruitment by the transcription factor lsf to the hiv promoter , replication - competent hiv is recovered from the cultures of resting cd4 + t cells in hiv - infected patients whose viremia had been suppressed by therapy ( ylisastigui et al . class i hdac inhibitors such as suberoylanilide hydroxamic acid ( saha , vorinostat ) have been tested ex vivo on hiv-1-infected cells isolated from the peripheral blood of patients ( quivy et al . 2007 ) . in the resting cd4 + t cells of antiretroviral - treated aviremic hiv - infected patients , clinically achievable exposures to saha induced virus outgrowth ex vivo ( archin et al . valproic acid ( vpa ) induces acetylation at the integrated hiv proviral promoter , but cd4 cells exposed to vpa do not become activated or more permissive for de novo hiv infection . vpa induces outgrowth of hiv from the resting cd4 + t cells of aviremic patients at concentrations achievable in vivo ( ylisastigui et al . in addition , combination therapy with oral vpa ( 500750 mg , twice daily ) added to intensified haart for 3 months safely accelerates the clearance of hiv from resting cd4 + t cells in vivo , suggesting a way to eliminate hiv infection in the persistent reservoir ( lehrman et al . class i hdaci are a strikingly efficient inducer of virus outgrowth from resting cd4 + t cells of aviremic patients , whereas hiv is rarely recovered from patient s cells exposed to class ii hdaci ( archin et al . can induce host cytotoxicity , the rna expression and protein expression and compartmentalization of hdac1 to hdac11 in the resting cd4 + t cells of hiv-1-positive aviremic patients were recently assessed . although all hdacs were detected in resting cd4 + t cells , targeted inhibition of hdacs by small - interfering rna demonstrated that mostly hdac2 and hdac3 contribute to the repression of hiv-1 ltr expression ( keedy et al . therefore , hdaci specific for a limited number of class i hdacs may offer a targeted approach to the disruption of persistent hiv-1 infection . thus , potent selective hdaci may allow improved targeting of persistent proviral infection in hiv - infected patients . recently , a strong synergistic activation of hiv-1 production by clinically used histone deacetylase inhibitors ( hdacis ) combined with prostratin , a non - tumor - promoting nuclear factor ( nf)- b inducer , was shown using the latently infected u1 monocytic cell line and latently infected j - lat t cell clones ( reuse et al . mechanistically , hdacis increased prostratin - induced dna - binding activity of nuclear nf-b and degradation of cytoplasmic nf-b inhibitor , ib. moreover , the combined treatment prostratin+hdaci caused a more pronounced nucleosomal remodeling in the u1 viral promoter region than the treatments with the compounds alone . this more pronounced remodeling correlated with a synergistic reactivation of hiv-1 transcription following the combined treatment prostratin+hdaci . the physiological relevance of the prostratin+hdaci synergism has been shown in cd8-depleted peripheral blood mononuclear cells from haart - treated patients with undetectable viral load ( reuse et al . moreover , this combined treatment reactivated viral replication in resting cd4 t cells isolated from similar patients . viral reactivation assays have shown in cell cultures prepared from haart - treated hiv-1-infected individuals with undetectable viral load that a combination prostratin+vpa or prostratin+saha can induce hiv-1 recovery in cd8-depleted pbmc cultures tested . moreover , the combination prostratin+saha can reactivate viral replication in hla dr cd4 t cell cultures prepared from additional patients ( reuse et al 2009 ) . altogether , these results suggest that combinations of different kinds of proviral activators may have important implications for reducing the size of latent hiv-1 reservoirs in haart - treated patients , not only in cd4 + t cells but also in monocytes / macrophages . interestingly , resveratrol , a sirt1 activator , has been recently reported to inhibit in vitro tat - induced hiv-1 ltr transactivation via nad(+)-dependent sirt1 activity ( zhang et al . 2009 ) . besides hdaci , resveratrol and related compounds may represent as potential candidates for novel anti - hiv therapeutics . beside hiv , other viruses hcmv has been reported to replicate at low levels in infected cells and to be reactivated upon immune suppression , especially in transplant recipients ( coaquette et al . recently , we reported that the activation of p52/bcl-3 nf - kb complexes in primary macrophages and p50/p65 nf - kb complexes in fibroblasts in response to hcmv infection could explain the low - level growth of the virus in macrophages versus efficient growth in fibroblasts ( khan et al . the low level sustained replication of hcmv in macrophages could favor the formation of reservoirs of virions , and the use of hdaci could reactivate the virus which could be targeted with antiviral compounds such as ganciclovir . thus , the use of hdaci in addition to antiviral treatment could be a new promising approach in several viral infections including hiv-1 , but also herpesviruses such as hcmv and others . cervical cancer cells are addicted to the expression of the hpv oncoproteins e6 and e7 . the oncogenicity of e6 is mediated in part by targeting p53 and pdz - family tumor suppressor proteins for rapid proteosomal degradation , whereas the e7 oncoprotein acts in part by coopting hdac1/2 . immunohistochemical analysis reveals elevated hdac1/hdac2 expression in cervical dysplasia and cervical carcinoma versus normal cervical epithelium . hdaci sodium butyrate and tsa arrest hpv - positive carcinoma cells in g1 to s transition of the cell cycle , which is paralleled by an upregulation of the cyclin - dependent kinase inhibitors ( ckis ) p21cip1 and p27kip1 as well as the complete loss of cdk2 activity . hdac inhibition triggered an e7-dependent degradation of prb , while the levels of e2f remained unaffected . the presence of free intracellular e2f and the concomitant upregulation of ckis during g1 arrest render the cells to undergo apoptosis ( finzer et al . 2001 ) . in addition , hdaci induce an intrinsic type of apoptosis in hpv - positive cells by disrupting the mitochondrial transmembrane potential ( finzer et al . the hpv oncogenic proteins e6 and e7 are able to inactivate p53 and prb proteins , which results in malignant transformation . apicidin hdaci significantly reduces hpv16-e6 and -e7 protein levels in cervical cancer cells ( luczak and jagodzinski 2008 ) . the combination of bortezomib , a proteosome inhibitor , and hdaci tsa or saha shows the synergistic killing of hpv - positive , but not hpv - negative , cervical cancer cell lines ( lin et al . thus , a combination of hdac and proteosome inhibitors , including saha and bortezomib , respectively , warrants exploration for the treatment of cervical cancer . latent infection of the ebv is strongly associated with the pathogenesis of several tumor types . the restricted expression of the latent ebv antigens is critical for ebv - associated tumors to escape from immune surveillance . tsa causes cell cycle arrest at low concentrations and induces apoptosis at higher ( > 300 nm ) concentrations in the ebv - transformed lymphoblastoid cell lines ( lcls ) ( seo et al . following tsa treatment , a reduced expression of cyclin d2 and an induction of p21 may play an essential role for g1 arrest in lcls . in addition , tsa induces ebv lytic replication cycle in lcl cells ( seo et al . thus , tsa may exert an enhanced anti - tumor effect for ebv - associated tumors not only by inducing a cell cycle arrest and apoptosis but also by triggering an ebv lytic cycle . finally , combining the use of a chemotherapeutic agent with oncolytic virotherapy is a useful way to increase the efficiency of the treatment of cancer . replication - conditional ( oncolytic ) mutants of hsv are considering promising therapeutic alternatives for human malignancies . vpa pretreatment improves the propagation and therapeutic efficacy of oncolytic hsv in a human glioma xenograft model in vivo ( otsuki et al . 2008 ) . tsa can be used as an enhancing agent for oncolytic virotherapy for oral squamous cell carcinoma with gamma(1)34.5 gene - deficient hsv-1 ( katsura et al . hepatitis b oncoprotein , hbx , estrogen receptor ( er ) alpha , and hdac1 form a ternary complex ( han et al . since estrogen , which exerts its biological function through er , can inhibit hbv replication , eralpha agonists may be developed for hcc therapy . proof - of - concept in oncology , additional experiments have to be performed to determine if this approach is translatable to patients without malignancy and/or if it will succeed in the absence of a second drug and/or an alternative treatment . the molecular mechanisms underlying the role of hdacs in viral latency , viral reactivation , and carcinogenesis are progressively unveiled . the use of hdac inhibitors as therapeutic tools to reactivate latent virus from cellular reservoirs may have important implications for reducing the size of latent viral reservoirs in patients infected with hiv and herpesviruses ( hcmv , hsv , ebv ) . in addition , hdaci could be promising drugs which will kill virus - induced transformed cells especially in hpv and ebv infections . a better understanding of the role of hdacs in viral diseases will lead to the development of new drugs , especially hdac inhibitors that will target cellular and viral proteins actively involved in numerous viral diseases .

in this work , e. coli wm2949 ( 23 ) with plasmid pjat8-arae ( 24 ) was used except when stated otherwise . in this strain , the chromosomal arafgh and arae genes were deleted and arae expression is controlled by a constitutive promoter on the pjat8 plasmid , thereby allowing homogeneous expression from the pbad promoter ( 23 , 24 ) . single - gene knockouts of yohj and yohk were constructed in e. coli wm2949 pjat8-arae by transducing the corresponding knockouts from the keio collection ( 25 ) as described previously ( 15 ) . deletion of the correct gene was confirmed by pcr with primers spi10966 ( gcgctgatttcttaatgtga ) and spi10967 ( atcaatgtcagcggtaatga ) for the deletion of yohj and primers spi10968 ( cgtaggtcagaaaggatcag ) and spi10969 ( cgcgtgaaacatacatcaaa ) for the deletion of yohk . to investigate obge*-mediated effects , strains were transformed with pbad / his a ( invitrogen ) , pbad / his a - obge ( pcmpg13901 ) , or pbad / his a - obge * ( pcmpg13828 ) . the influence of the n - terminal his tag present in these constructs was investigated by additionally expressing obge and obge * in their native forms from the pbad33 vector . the presence or absence of for all phenotypic and toxicity tests , overnight cultures were diluted 100 times in lysogeny broth ( lb ) containing the appropriate antibiotics , incubated for 2 h at 37c with continuous shaking at 200 rpm , and induced with 0.2% arabinose for 2 h under the same conditions . 1a ) , the number of cfu per milliliter was determined at several time points before and after induction by plating out serial dilutions on lb containing the appropriate antibiotics and 1.5% agar . for all other toxicity tests , the number of cfu per milliliter was determined analogously after 2 h of induction of either obge or obge*. the percent survival was calculated by dividing the number of cells surviving obge * expression by the number of cells present after obge expression under the same conditions . loss of membrane potential was determined using the membrane potential - sensitive dye dibac4(3 ) ( life technologies ) , as described previously ( 21 ) . fluorescence was measured using a bd influx cell sorter equipped with 488-nm ( green ) and 561-nm ( red ) lasers and standard filter sets . dna fragmentation was quantified by the tunel assay ( apo - direct kit ; bd biosciences ) as described previously ( 7 ) . for dapi ( sigma - aldrich ) and fm4 - 64 ( life technologies ) staining , cultures were washed and dissolved in 10 mm mgso4 . the dyes were added simultaneously at a concentration of 10 g / ml , and cultures were incubated for 10 min in the dark at room temperature . exposure of phosphatidylserine at the cell surface was measured by the fitc - annexin v / dead cell apoptosis kit ( molecular probes ) as described previously ( 7 ) . cultures were fixed overnight at 4c in 2.5% glutaraldehyde in 0.1 m cacodylate buffer ( ph 7.2 ) and postfixed in 2% oso4 in the same buffer . after serial dehydration , samples were dried at critical point and coated with platinum by standard procedures . observations were made in a tecnai feg esem quanta 200 microscope ( fei ) , and images were processed by sis item ( olympus ) software . to measure activation of the sos response , cultures were induced with 0.2% arabinose for 3 h prior to sample collection . the -galactosidase assay and the calculation of miller units as a measure of expression level live / dead staining with the live / dead baclight bacterial viability kit ( thermofisher scientific ) was performed at 0 , 2 , and 4 h after induction of obge * expression in an exponential - phase culture . one milliliter of each culture was washed and resuspended in 500 l phosphate - buffered saline ( pbs ) . the solution was incubated for 15 min in the dark at room temperature before visualization with a zeiss axio imager z1 . download figure s1 , pdf file , 0.1 mb exposure of phosphatidylserine on the cell surface . ( a ) concomitant staining of e. coli wm2949 pjat8-arae carrying pbad / his a , pbad / his a - obge , or pbad / his a - obge * with fitc - conjugated annexin v and pi . ( b ) concomitant staining of e. coli wm2949 reca pjat8-arae carrying pbad / his a , pbad / his a - obge , or pbad / his a - obge * with fitc - conjugated annexin v and pi . download figure s2 , pdf file , 0.3 mb expression of obge * triggers pcd in a reca strain . ( b ) microscopic analysis of induced cells stained with the blue dna dye dapi and the red membrane - specific dye fm4 - 64 . ( d ) staining of externalized phosphatidylserine by fitc - conjugated annexin v. percentages shown represent the fraction of the population that displays phosphatidylserine on the cell surface .

prepare a substrate for fruit fly eggs to be parasitized by preparing agar ( alternatively , gelcarin gp812 , fmc biopolymer , ewing nj ; a more cost effective option ) filled dishes , 10 cm in length per side and 1.5 cm depth . fill dishes to the rim with liquid agar ( approximately 70ml ) , and allow them to cool and solidify ( at least 45 minutes ) . once the agar blocks are solid , apply a single layer of tissue paper ( a single ply of georgia pacific ' preference ' batch tissue ) , covering the top of each block . apply a 0.5 ml volume fruit fly eggs suspended in water to the tissue covered surface of the agar blocks . in our insectary , this is equivalent to about 6000 eggs of bactrocera dorsalis ( 12000 eggs per ml ) . use a clean 2.5 cm wide brush dipped in water to spread the fruit fly eggs evenly over the tissue surface . place the fruit fly eggs under the bottom screen of the parasitoid cages to allow oviposition . tap the underside of the bottom screen to remove dead parasites which may obstruct the eggs . it is best if the bottom screen does not touch the eggs . allow the parasites to oviposit overnight and into the next day , approximately 21 hours . prepare rearing container by placing 3 to 3.5 prepared agar blocks of parasitized eggs per 1.25 liters of fruit fly diet with eggs facing upward . place the diet container with eggs on a riser over a 1.5 cm deep layer of fine grade vermiculite or washed sand in a larger pupation container . cover the pupation container with a lid and tape the edges of the with masking tape . ensure that there is sufficient space between the top of the diet container and the pupation container lid for fruit fly larvae to crawl out and ' pop ' into the vemiculite below . move pupation containers to a room at 27c and 80 % relative humidity ( rh ) for one week . cover containers with a dark cloth for the first four days then remove the cloth for the remaining days . remove larval diet after one week , once larvae have popped and entered the vermiculite for pupation . start with a coarse sieve ( approximately 3 mm ) then use a hand sieve to remove any remaining clumps of vermiculite . collect pupa between 1.65 and 2.26 mm in diameter , as these will be enriched for parasitized flies . puparia which are smaller contain mostly undersized parasitoids , larger pupa contain mostly flies . note also that for the parasitized pupae the percentage of females correlates positively with size . place pupae in the funnel at the top of a vibration feeder which slowly feeds the size sorter . feed the pupae into the size sorter , which consists of a pair of slightly divergent rolling bars at a 30 angle . the pupae drop individually by size into an array of slots that empty into ten separate containers through a funnel . collect pupae from the cups in the size range of 1.65 to 2.26 mm and place them in an emergence cage for 7 more days until most flies have emerged from the unparasitized pupae . next , use a fan to separate empty puparia from those still containing insects . to maintain the colony of f. arisanus use a parasitoid holding cage with a removable glass front , approximately 25 cm in length per side . the back of the cage is covered in a rubber sheet with a 9 cm hole for access . the bottom of the cage has a cut out covered on the inside with 1 - 2 mm screen large enough to allow placement of two agar blocks with fruit fly eggs for parasitoid oviposition . the holding cages should also have a tinted portion along the bottom quarter of the glass front to minimize light which can create parasitoid crowding along the front of the cage , resulting in elevated mortality . place approximately 11 g of these selected pupae into plastic containers approximately 9 cm in diameter . the lids should be covered with 2 mm screening , which will allow adult f. arsianus to leave the containers upon emergence but , will contain any remaining fruit flies . maintain the parasites at 24c and about 45% rh with a 12:12 photoperiod and good ventilation . if high mortality is observed , moving the cages outdoors for a few hours a day or increasing ventilation may reduce it . parasites should be ready to oviposit in one additional week and should be productive for two more weeks . streak undiluted spun honey along the top of the cages at least three times per week or whenever the available honey is dry . apply the spun honey in narrow streaks using a fingertip . note that if the streaks are too heavy the honey will drip into the cage place agar blocks ( 10 cm x 10 cm x 4 cm ) on the tops of the cages to provide moisture to the parasites . we report here results from quality control procedures conducted on the usda - ars f. arisanus rearing operation in hilo , hawaii between january 5 and june 22 , 2010 . rearing at the hilo location on the scale described in this video article and protocol was initiated in august 2009 , and initial problems and adjustments with the new location had been mostly resolved by january . therefore , these data are representative of the results other researchers might obtain starting their colony if they follow the protocol as described and have experience rearing insects generally . during this period we were maintaining a small colony of f. arisanus : 4 parasitoid holding cages produced per week , equivalent to about 3600 f. arisanus . an initial check of enriched parasitization rates was conducted by taking a 2 g sample of pupae in the size range of 1.65 2.26 mm ( enriched ) before an additional week of development in a holding cage ( i.e. immediately after the larval diet was removed and the pupae sifted and size sorted . we refer to these as ' early pupae ' ) . during the first three months of 2010 the mean proportion parasites in the enriched sample was 0.46 ( sd=0.18 ) . during the following quarter this mean was 0.58 ( sd=0.08 ) , reflecting stabilization of the colony and rearing procedures at the new location . note that the enriched pupae which were not successfully parasitized include those which did not produce emergents and those that produced flies . after an additional week in the holding cage removal of empty puparia the low percentage of fruit flies is partially due to to the earlier emergence of flies compared with parasites , so most flies remained in the holding container . finally , figure 1 gives the yield in pupal mass from january to june 2010 . the yields are measured from pupae enriched in the size range of interest , 1.65 - 2.26 mm . the large mass of ' early pupae ' at the beginning of the year indicates a high proportion of fruit flies and unemerged pupae at that time , while adjustments were being made to the new facility . yield of enriched ( pupal diameter 1.65 - 2.26 mm ) early ( immediately after size selection ) and ' late ' ( after holding for one week and removing empty casings ) pupae at the ars - usda f. ariasnus colony in hilo , hawaii , january june 2010 prepare a substrate for fruit fly eggs to be parasitized by preparing agar ( alternatively , gelcarin gp812 , fmc biopolymer , ewing nj ; a more cost effective option ) filled dishes , 10 cm in length per side and 1.5 cm depth . fill dishes to the rim with liquid agar ( approximately 70ml ) , and allow them to cool and solidify ( at least 45 minutes ) . once the agar blocks are solid , apply a single layer of tissue paper ( a single ply of georgia pacific ' preference ' batch tissue ) , covering the top of each block . apply a 0.5 ml volume fruit fly eggs suspended in water to the tissue covered surface of the agar blocks . in our insectary , this is equivalent to about 6000 eggs of bactrocera dorsalis ( 12000 eggs per ml ) . use a clean 2.5 cm wide brush dipped in water to spread the fruit fly eggs evenly over the tissue surface . place the fruit fly eggs under the bottom screen of the parasitoid cages to allow oviposition . tap the underside of the bottom screen to remove dead parasites which may obstruct the eggs . it is best if the bottom screen does not touch the eggs . allow the parasites to oviposit overnight and into the next day , approximately 21 hours . prepare rearing container by placing 3 to 3.5 prepared agar blocks of parasitized eggs per 1.25 liters of fruit fly diet with eggs facing upward . place the diet container with eggs on a riser over a 1.5 cm deep layer of fine grade vermiculite or washed sand in a larger pupation container . cover the pupation container with a lid and tape the edges of the with masking tape . ensure that there is sufficient space between the top of the diet container and the pupation container lid for fruit fly larvae to crawl out and ' pop ' into the vemiculite below . move pupation containers to a room at 27c and 80 % relative humidity ( rh ) for one week . cover containers with a dark cloth for the first four days then remove the cloth for the remaining days . remove larval diet after one week , once larvae have popped and entered the vermiculite for pupation . if there are larvae in the vermiculite , allow them to pupate overnight start with a coarse sieve ( approximately 3 mm ) then use a hand sieve to remove any remaining clumps of vermiculite . collect pupa between 1.65 and 2.26 mm in diameter , as these will be enriched for parasitized flies . puparia which are smaller contain mostly undersized parasitoids , larger pupa contain mostly flies . note also that for the parasitized pupae the percentage of females correlates positively with size . place pupae in the funnel at the top of a vibration feeder which slowly feeds the size sorter . feed the pupae into the size sorter , which consists of a pair of slightly divergent rolling bars at a 30 angle . the pupae drop individually by size into an array of slots that empty into ten separate containers through a funnel . collect pupae from the cups in the size range of 1.65 to 2.26 mm and place them in an emergence cage for 7 more days until most flies have emerged from the unparasitized pupae . to maintain the colony of f. arisanus use a parasitoid holding cage with a removable glass front , approximately 25 cm in length per side . the back of the cage is covered in a rubber sheet with a 9 cm hole for access . the bottom of the cage has a cut out covered on the inside with 1 - 2 mm screen large enough to allow placement of two agar blocks with fruit fly eggs for parasitoid oviposition . the holding cages should also have a tinted portion along the bottom quarter of the glass front to minimize light which can create parasitoid crowding along the front of the cage , resulting in elevated mortality . place approximately 11 g of these selected pupae into plastic containers approximately 9 cm in diameter . the lids should be covered with 2 mm screening , which will allow adult f. arsianus to leave the containers upon emergence but , will contain any remaining fruit flies . maintain the parasites at 24c and about 45% rh with a 12:12 photoperiod and good ventilation . if high mortality is observed , moving the cages outdoors for a few hours a day or increasing ventilation may reduce it . parasites should be ready to oviposit in one additional week and should be productive for two more weeks . streak undiluted spun honey along the top of the cages at least three times per week or whenever the available honey is dry . apply the spun honey in narrow streaks using a fingertip . note that if the streaks are too heavy the honey will drip into the cage place agar blocks ( 10 cm x 10 cm x 4 cm ) on the tops of the cages to provide moisture to the parasites . we report here results from quality control procedures conducted on the usda - ars f. arisanus rearing operation in hilo , hawaii between january 5 and june 22 , 2010 . rearing at the hilo location on the scale described in this video article and protocol was initiated in august 2009 , and initial problems and adjustments with the new location had been mostly resolved by january . therefore , these data are representative of the results other researchers might obtain starting their colony if they follow the protocol as described and have experience rearing insects generally . during this period we were maintaining a small colony of f. arisanus : 4 parasitoid holding cages produced per week , equivalent to about 3600 f. arisanus . an initial check of enriched parasitization rates was conducted by taking a 2 g sample of pupae in the size range of 1.65 2.26 mm ( enriched ) before an additional week of development in a holding cage ( i.e. immediately after the larval diet was removed and the pupae sifted and size sorted . we refer to these as ' early pupae ' ) . during the first three months of 2010 the mean proportion parasites in the enriched sample was 0.46 ( sd=0.18 ) . during the following quarter this mean was 0.58 ( sd=0.08 ) , reflecting stabilization of the colony and rearing procedures at the new location . note that the enriched pupae which were not successfully parasitized include those which did not produce emergents and those that produced flies . after an additional week in the holding cage removal of empty puparia another two gram sample was taken ( ' late pupae ' ) . the low percentage of fruit flies is partially due to to the earlier emergence of flies compared with parasites , so most flies remained in the holding container . finally , figure 1 gives the yield in pupal mass from january to june 2010 . the yields are measured from pupae enriched in the size range of interest , 1.65 - 2.26 mm . the large mass of ' early pupae ' at the beginning of the year indicates a high proportion of fruit flies and unemerged pupae at that time , while adjustments were being made to the new facility . yield of enriched ( pupal diameter 1.65 - 2.26 mm ) early ( immediately after size selection ) and ' late ' ( after holding for one week and removing empty casings ) pupae at the ars - usda f. ariasnus colony in hilo , hawaii , january june 2010 in this protocol and accompanying video article we have described and demonstrated an optimized protocol for rearing f. ariasnus , a parasitoid of tephritid fruit flies , in a laboratory setting . this protocol has been refined over the years to minimize the amount of labor and specialized equipment needed to maintain a colony . we note that a well established , productive and stable colony of host fruit flies is required for any attempt at rearing parasitoids . in our insectary we use bactrocera dorsalis as a host fruit fly , but other species have been shown to be competent hosts as well . these include the rate of laboratory adaptation in this species , mechanisms of learning and the genetic changes that might occur with adaptation and mechanisms which may be involved in host fruit fly plasticity . over the last ten years there have been multiple examples of the spread of dacine flies throughout the world , particularly those in the genus bactrocera : b. dorsalis in french polynesia , b. carambolae in parts of south america , b. invadens in africa and b. zonata in africa and northern mediterranean . testing the effectiveness of biological control agents such as f. arisanus against other bactrocera species should be a high priority , and it is our hope that application of the methods described in this protocol and accompanying video article , will accelerate research on f. arisanus in a wider variety of locations . finally , further research using this method as a starting point may also provide important information to the colonization of novel egg parasitoids

according to traditional chinese medicine ( tcm ) theory , certain points on the body are linked together in a network of channels called tcm theory asserts that a smooth and adequate flow of qi defines health and suggests that the various characteristics of qi are determined by a complex set of interactions between external and internal factors ( e.g. genetic predisposition , nutrition , physical and emotional influences ) ( 2 ) . tcm practitioners believe that acupuncture may facilitate normal flow of qi , thus maintaining or restoring health to the body and mind . various forms and styles of acupuncture a typical acupuncture session includes an initial assessment according to which acupoints are selected and needled . patients usually lie with needles in place for 2030 min . the mechanisms by which acupuncture elicits its effects are believed to be the result of three factors ( 3 ) : specific physiological effects that are believed to be directly related to the needling of particular acupoints;nonspecific physiological effects that arise from the micro trauma resulting from piercing the skin , a procedure that has been shown to induce a variety of physiological responses involving the microcirculation , local immune function , and neurally mediated analgesia andnonspecific psychological effects that arise concomitantly with the treatment and emanate from a variety of sources including , but not limited to , treatment environment , patient expectations , practitioner intention , patient - provider rapport , and the natural history of the condition ( 4 ) . specific physiological effects that are believed to be directly related to the needling of particular acupoints ; nonspecific physiological effects that arise from the micro trauma resulting from piercing the skin , a procedure that has been shown to induce a variety of physiological responses involving the microcirculation , local immune function , and neurally mediated analgesia and nonspecific psychological effects that arise concomitantly with the treatment and emanate from a variety of sources including , but not limited to , treatment environment , patient expectations , practitioner intention , patient - provider rapport , and the natural history of the condition ( 4 ) . medical hypnosis or hypnotherapy , on the other hand , is the clinical application of hypnosis to medical disorders and procedures . according to the american psychological association , a hypnotic procedure is used to encourage and evaluate responses to suggestions ( 5 ) . kihlstrom described hypnosis as a set of procedures in which a person designated as the hypnotherapist suggests that another person ( the patient or subject ) experience various changes in sensation , perception , cognition , or control over behavior ( 6 ) . others , such as kirsch and lynn ( 7 ) , simply described hypnosis as a heightened state of relaxation or a state of focused attention. more recently , the behavioral aspects of hypnosis have been emphasized ( 8) . in that sense , many contemporary scholars consider hypnosis not as a therapeutic treatment modality per se , but rather as a set of behavioral techniques ( 9 ) . classifying hypnosis as a behavioral technique emphasizes its operational components and avoids perpetuation of the myth that hypnosis is a magical experience ( 10 ) . a hypnotic session is usually constructed to have an induction phase and an application phase . during the induction phase , the individual begins to enter a hypnotic state , at which time the conscious mind is believed to become less and less vigilant to the immediate surroundings . it is thought that during the hypnotic state there are few competing cognitive demands and less self - reflective thought ( 11 ) . this allows suggestibility , which is defined as communication that is accepted uncritically ( 12 ) . the hypnotic state can vary between and within sessions from very light to profound , and have different cognitive , emotional and motivational qualities . hypnotized individuals can display a dissociation of content with complete absorption of attention to immediate narrow experience and temporary inaccessibility of peripheral consciousness , and/or a dissociation of context where the narrowing of attention and increased absorption temporarily suspends higher order reflective cognitive structures and processes ( 13 ) . logistically , hypnosis can be done either as a live session with a hypnotherapist facilitating the process or it can be taught so that individuals can learn how to enter the hypnotic state on their own . to achieve this latter goal , sessions are commonly audiotaped for the client 's regular home practice ( 14 ) . whether facilitated by a hypnotherapist or done by the subjects themselves it is generally agreed that all hypnosis is , in fact , self - hypnosis . eeg studies of hypnotic state show very slow high - range theta waves ( 57 hz ) , which are typically associated with loss of executive control and reflect massive cortical inhibition ( 15,16 ) . on the other hand , when the hypnotic state involves specific stimulatory sensory or motor suggestions , the appropriate sensory and motor areas of the brain , respectively , may be activated even more so than during non - hypnotic condition ( 17 ) . recent research suggests that the sensory distortion that is often experienced during hypnosis is associated with altered amplitude of the event - related potentials to somatosensory or visual stimuli . interestingly , when hypnotized individuals imagine that a stimulus is blocked , their cortical response to those stimuli is reduced ( 18 ) . one of the most important tenets of tcm is the unity between mind and body . the health of the mind , according to this viewpoint , is affected by the health of the body and vice versa , reflecting complex bi - directional interactive relationships . this non - duality between psyche and soma means that mental and emotional processes have somatic representations , while somatic processes have mental - emotional equivalents . since acupuncture is said to manipulate qi , it is possible that it can affect not only the health of the physical body , but also more energetically subtle manifestations of qi those of the mind . indeed , practitioners of tcm often contend that the mental / emotional processes are often the first aspects of qi to be influenced by acupuncture ( 19 ) . from a conceptual point of view of tcm , mind / body interventions such as qigong and meditation serve as adjuncts to herbal treatments , acupuncture , or other traditional forms of physical therapies , such as tuina . the integration of both physical and mental practices in tcm was always considered superior to either practice alone . this viewpoint is illustrated well in one of the earliest tcm texts , the nei ching su wen ( dated back to around the 3rd century bc ) : in order to make acupuncture effective , one must first cure the mind ( 20 ) . of notice , the capacity to enter hypnotic states was attributed to the hun ( translated as the ethereal soul ) , which is one of the five aspects of the mind ( 21 ) . however , to the best of our knowledge , the concomitant administration of acupuncture and mental practices such as qigong was not discussed in tcm texts . could simultaneous administration of both hypnosis and acupuncture ( i.e. hypno - acupuncture ) augment each ? in other words , could acupuncture boost mind - related healing process , and hypnosis enhance the effect of acupuncture ? these are certainly intriguing questions , but what empirical evidence exists that supports the synergism hypothesis between hypnosis and acupuncture when administered simultaneously ? a comprehensive attempt to find empirical evidence that supports the synergism hypothesis between hypnosis and acupuncture in peer - reviewed journals in english resulted in the retrieval of only one uncontrolled study and a few case reports . both zeltzer et al . ( 23 ) reported in two separate occasions on the same study that looked at the feasibility and acceptability of a hypno - acupuncture intervention for chronic pain in pediatric patients . they found that the combined package of hypno - acupuncture was highly acceptable and tolerable and that following treatment , there was significant improvement in pain with no side effects . samuels described two case reports where both treatments were used together effectively : one showing how hypnosis can help in the treatment of painful acupoints , the other how the response to acupuncture may be augmented by hypnosis in the treatment of headache ( 24 ) . 25 ) described in detail their experience with a patient having a severe gag reflex who was successfully treated by the hypno - acupuncture approach , after administration of each of the two modalities separately failed to achieve a desirable response . all other studies that we could identify through an extensive literature search only compared the effects of acupuncture to hypnosis , each administered alone , for a variety of symptomatic conditions ( 2629 ) . no other trials that we know of assessed yet the synergism hypothesis between acupuncture and hypnosis . in the absence of established empirical data from efficacy or explanatory research that either supports the synergism hypothesis or refutes it , we are charged with the task of postulating how , if indeed true , acupuncture and hypnosis may interact ( fig . the roles of rituals numerous socioanthropological studies across many cultures and conditions have shown the power of rituals to affect healing ( 30 ) . although not a prerequisite for hypnotic state , rituals are accepted means to facilitate hypnotic state induction . indeed , frank and frank postulated that all effective therapies are based , at least in part , on a ritual or procedure that requires the active participation of both patient and therapist , which is believed by both to be the means of restoring the patient 's health ( 31 ) . in fact , it has been proposed that acupuncture may to some extent do exactly that ( 32 ) . double - dose priming effect as a result of which expectations of healing may be boosted and healing can take place more effectively . indeed , there have been scattered discussions in the past of the possibility of a conditioned healing response that results from the combination of electro - acupuncture and guided imagery ( 34).expectancy of healing in a famous line of research , bandura ( 35 ) demonstrated how self - efficacy and outcome expectations ( common targets of hypnosis ) affect healing , and kirsch ( 36 ) showed how response expectancy shapes experience . 's systematic review of expectation effects in medicine proves that expectancy of healing is an important way by which treatments exert their effects ( 37 ) . as mentioned above internal processes occur autonomously. it is believed that this phenomenon leads individuals to be more susceptible to hypnotic suggestions . interestingly enough , acupuncturists commonly inform patients that the treatment exerts its effects by triggering internal healing processes . creating the expectancy that acupuncture will activate internal , autonomous processes , may facilitate dissociation of context , enhance hypnotic susceptibility , and trigger healing ( 13 ) . increased expectancy of healing is a common confluence for both hypnosis and acupuncture , and one that may result in enhanced placebo effects through the meaning response ( 38 ) . we believe it is possible that a synergistic effect of hypno - acupuncture , if it indeed exists , might be mediated to a large extent by this phenomenon . indeed , lu et al . ( 28 ) found that outcome of hypnosis or acupuncture was affected by patient 's preferences , which reflect also expectations.shock and awewhen asked about any concerns they might have regarding acupuncture , many patients who are nave to acupuncture report being anxious about the possibility of experiencing pain as a result of the needling . and yet , contrary to previous experience with other needles that are used in medicine , when acupuncture needles are inserted and left in place many of those patients report different or even opposite sensation ( relaxation ) . the contrast between expectancy and experience is known to trigger an attentive state that is common to all hypnoidal phenomena ( 39 ) . furthermore , the confusing physical experience may be analogous to the confusional suggestions used during the induction phase of hypnosis . shock and surprise may be used in hypnosis to facilitate creative moments or hypersuggestibiltiy , and to direct the patient 's attention to suggested goals ( 40 ) . we postulate that the confusional experience with acupuncture may facilitate and augment the hypnotic state thus contributing to the synergistic effect of hypno-acupuncture.de qi as a form of hypnotic state ratification this realization typically increases patients ' sense of self - efficacy and confidence in their capacity to change . by removing skepticism , we believe that acupuncture may have its own form of proof that something is happening in the form of the de qi phenomenon . de qi refers to sensations described as tingling , heaviness and/or dull ache at or around the area of needle insertion . interestingly enough , acupuncturists often explain to patients that a de qi sensation is a sign that their qi is responding to needling . de qi , thus , may serve as an acupuncture analogue of hypnotic state ratification . experiencing the de qi phenomenon may serve as confirmation that the unique healing processes , triggered by acupuncture , are truly taking place . as suggested above , enhancing patients ' belief in the intervention increases their responsiveness to that intervention ( 8,31).state of relaxation following needle insertion , several characteristics associated with light ( hypnoidal ) hypnotic state such as slow , deeper breathing , progressive feelings of lethargy and relaxation are often observed ( 41 ) . it has been postulated that even at this light level of hypnotic state and relaxation , suggestibility is already enhanced ( 42 ) . thus , acupuncture may facilitate a process in which the hypnotic state experience may occur . first , in cases where patients subconsciously display resistance to hypnosis and have a hard time entering a hypnotic state ( 43 ) , acupuncture may help to bypass that resistance by facilitating a state of relaxation . second , it is generally agreed that the deeper the hypnotic state the more suggestible the subject is ( 44 ) . furthermore , certain hypnotic phenomena such as hypnoanalgesia are believed to occur primarily in a deeper hypnotic state ( 42 ) . after overcoming the initial resistance and entering hypnotic state , it would be less difficult to deepen that state , for various applications , using the hypno - acupuncture combination . we suggest that the relaxation state that hypno - acupuncture induces may help patients reach and maintain a deep hypnotic state , which is needed for the hypnotic work.complementary mechanisms although acupuncture is a mechanical technique and hypnosis is a psychological technique , the two modalities share conceptually much in common ( as discussed above ) and therefore should not be considered apples and oranges , but rather complementary ( 45 ) . furthermore , research suggests that the extent to which one responds to hypnosis does not correlate with responsiveness to acupuncture and vice versa ( 26,46 ) . this distinct response pattern might reflect the fact that acupuncture and hypnosis rely on different mechanisms of action to execute their therapeutic effects . whereas the effects of acupuncture are often reversed by the opiate antagonist naloxone , ( 47 ) induced experimental pain by cold pressor test in volunteers in a prospective , cross - over study in order to test whether the mechanisms of analgesia induced by hypnosis and acupuncture are different . they measured the analgesic effect of hypnosis and acupuncture before and after double - blind administration of placebo or naloxone and found that pain intensity was significantly lower with hypnosis as compared with acupuncture , both with naloxone ( p < 0.001 ) and placebo ( p < 0.001 ) . during acupuncture , but not during hypnosis however , pain scores were similar to control values when naloxone was given ( p = 0.05 ) but decreased significantly with placebo ( p < 0.002 ) . thus , it is possible that the combination of acupuncture and hypnosis may have superior effectiveness to either one alone due , in part , to complementary mechanisms.complementary effectiveness it has been suggested that acupuncture alone can not always deal effectively with the major psychosocial aspects that are often associated with complex medical conditions . for example , in situations of severe pain , many patients experience a heightened state of sympathetic arousal ( anxiety ) and hypersuggestibilty . concurrent administration of hypnosis along with acupuncture in those situations has the potential to decrease excitation level , provide effective means of relaxation and enhance self - efficacy . eitner ( 25 ) , for example , described how after initiation of hypno - acupuncture , root canal therapy could be completed successfully for the first time ever in a patient who previously feared the dentist , and samuels ( 24 ) emphasized the potential role of hypnosis in improving the efficacy of acupuncture in needle - phobic patients . thus , it seems that co - administration of the both hypnosis and acupuncture may at times not only make the impossible possible , but also may even result in a more robust effect than with either alone . drawing analogy from pharmacotherapy , combining drugs that work through different mechanisms may improve efficacy and reduce side effects ( 48,49 ) . moreover , the combination of pharmacological and behavioral interventions often results in improved outcomes ( 5052 ) . figure 1.some possible ways by which acupuncture and hypnosis may interact ( see text for explanation ) . the roles of rituals numerous socioanthropological studies across many cultures and conditions have shown the power of rituals to affect healing ( 30 ) . although not a prerequisite for hypnotic state , rituals are accepted means to facilitate hypnotic state induction . indeed , frank and frank postulated that all effective therapies are based , at least in part , on a ritual or procedure that requires the active participation of both patient and therapist , which is believed by both to be the means of restoring the patient 's health ( 31 ) . in fact , it has been proposed that acupuncture may to some extent do exactly that ( 32 ) . double - dose priming effect as a result of which expectations of healing may be boosted and healing can take place more effectively . indeed , there have been scattered discussions in the past of the possibility of a conditioned healing response that results from the combination of electro - acupuncture and guided imagery ( 34 ) . expectancy of healing in a famous line of research , bandura ( 35 ) demonstrated how self - efficacy and outcome expectations ( common targets of hypnosis ) affect healing , and kirsch ( 36 ) showed how response expectancy shapes experience . 's systematic review of expectation effects in medicine proves that expectancy of healing is an important way by which treatments exert their effects ( 37 ) . as mentioned above internal processes occur autonomously. it is believed that this phenomenon leads individuals to be more susceptible to hypnotic suggestions . interestingly enough , acupuncturists commonly inform patients that the treatment exerts its effects by triggering internal healing processes . creating the expectancy that acupuncture will activate internal , autonomous processes , may facilitate dissociation of context , enhance hypnotic susceptibility , and trigger healing ( 13 ) . increased expectancy of healing is a common confluence for both hypnosis and acupuncture , and one that may result in enhanced placebo effects through the meaning response ( 38 ) . we believe it is possible that a synergistic effect of hypno - acupuncture , if it indeed exists , might be mediated to a large extent by this phenomenon . indeed , lu et al . ( 28 ) found that outcome of hypnosis or acupuncture was affected by patient 's preferences , which reflect also expectations . shock and awewhen asked about any concerns they might have regarding acupuncture , many patients who are nave to acupuncture report being anxious about the possibility of experiencing pain as a result of the needling . and yet , contrary to previous experience with other needles that are used in medicine , when acupuncture needles are inserted and left in place many of those patients report different or even opposite sensation ( relaxation ) . the contrast between expectancy and experience is known to trigger an attentive state that is common to all hypnoidal phenomena ( 39 ) . furthermore , the confusing physical experience may be analogous to the confusional suggestions used during the induction phase of hypnosis . shock and surprise may be used in hypnosis to facilitate creative moments or hypersuggestibiltiy , and to direct the patient 's attention to suggested goals ( 40 ) . we postulate that the confusional experience with acupuncture may facilitate and augment the hypnotic state thus contributing to the synergistic effect of hypno - acupuncture . this realization typically increases patients ' sense of self - efficacy and confidence in their capacity to change . by removing skepticism , we believe that acupuncture may have its own form of proof that something is happening in the form of the de qi phenomenon . de qi refers to sensations described as tingling , heaviness and/or dull ache at or around the area of needle insertion . interestingly enough , acupuncturists often explain to patients that a de qi sensation is a sign that their qi is responding to needling . de qi , the de qi phenomenon may serve as confirmation that the unique healing processes , triggered by acupuncture , are truly taking place . as suggested above , enhancing patients ' belief in the intervention increases their responsiveness to that intervention ( 8,31 ) . state of relaxation following needle insertion , several characteristics associated with light ( hypnoidal ) hypnotic state such as slow , deeper breathing , progressive feelings of lethargy and relaxation are often observed ( 41 ) . it has been postulated that even at this light level of hypnotic state and relaxation , suggestibility is already enhanced ( 42 ) . thus , acupuncture may facilitate a process in which the hypnotic state experience may occur . first , in cases where patients subconsciously display resistance to hypnosis and have a hard time entering a hypnotic state ( 43 ) , acupuncture may help to bypass that resistance by facilitating a state of relaxation . second , it is generally agreed that the deeper the hypnotic state the more suggestible the subject is ( 44 ) . furthermore , certain hypnotic phenomena such as hypnoanalgesia are believed to occur primarily in a deeper hypnotic state ( 42 ) . after overcoming the initial resistance and entering hypnotic state , it would be less difficult to deepen that state , for various applications , using the hypno - acupuncture combination . we suggest that the relaxation state that hypno - acupuncture induces may help patients reach and maintain a deep hypnotic state , which is needed for the hypnotic work . complementary mechanisms although acupuncture is a mechanical technique and hypnosis is a psychological technique , the two modalities share conceptually much in common ( as discussed above ) and therefore should not be considered apples and oranges , but rather complementary ( 45 ) . furthermore , research suggests that the extent to which one responds to hypnosis does not correlate with responsiveness to acupuncture and vice versa ( 26,46 ) . this distinct response pattern might reflect the fact that acupuncture and hypnosis rely on different mechanisms of action to execute their therapeutic effects . whereas the effects of acupuncture are often reversed by the opiate antagonist naloxone , in an interesting study , moret et al . ( 47 ) induced experimental pain by cold pressor test in volunteers in a prospective , cross - over study in order to test whether the mechanisms of analgesia induced by hypnosis and acupuncture are different . they measured the analgesic effect of hypnosis and acupuncture before and after double - blind administration of placebo or naloxone and found that pain intensity was significantly lower with hypnosis as compared with acupuncture , both with naloxone ( p < 0.001 ) and placebo ( p < 0.001 ) . during acupuncture , but not during hypnosis however , pain scores were similar to control values when naloxone was given ( p = 0.05 ) but decreased significantly with placebo ( p < 0.002 ) . thus , it is possible that the combination of acupuncture and hypnosis may have superior effectiveness to either one alone due , in part , to complementary mechanisms . it has been suggested that acupuncture alone can not always deal effectively with the major psychosocial aspects that are often associated with complex medical conditions . for example , in situations of severe pain , many patients experience a heightened state of sympathetic arousal ( anxiety ) and hypersuggestibilty . concurrent administration of hypnosis along with acupuncture in those situations has the potential to decrease excitation level , provide effective means of relaxation and enhance self - efficacy . eitner ( 25 ) , for example , described how after initiation of hypno - acupuncture , root canal therapy could be completed successfully for the first time ever in a patient who previously feared the dentist , and samuels ( 24 ) emphasized the potential role of hypnosis in improving the efficacy of acupuncture in needle - phobic patients . thus , it seems that co - administration of the both hypnosis and acupuncture may at times not only make the impossible possible , but also may even result in a more robust effect than with either alone . drawing analogy from pharmacotherapy , combining drugs that work through different mechanisms may improve efficacy and reduce side effects ( 48,49 ) . moreover , the combination of pharmacological and behavioral interventions often results in improved outcomes ( 5052 ) . some possible ways by which acupuncture and hypnosis may interact ( see text for explanation ) . in our experience , the idea of hypno - acupuncture may not only be scientifically plausible , but is also practically feasible . once inserted , it is mainly during that relative downtime period that we suggest that patients would enjoy the hypnotic component of hypno - acupuncture . we propose that this time could be utilized to empower patients by providing them with hypnotic suggestions related to their disease condition , the healing power of both hypnosis and acupuncture , and the importance of health and well - being . from a pragmatic point of view , three possibilities exist as to how to administer hypnosis simultaneously with acupuncture . hypnosis could be administered live by either the acupuncturist himself ( if also certified as a hypnotherapist ) or by another certified hypnotherapist who would team up with the acupuncturist to deliver the combined package of care . since both these options are likely to be too costly and require much logistic coordination on the part of the providers , we think that realistically the most efficient way to deliver hypno - acupuncture is through pre - recorded , individually tailored or generic tapes , or cds . that is , we suggest that patients would meet individually with a hypnotherapist who would create a personal tape / cd for them to use during the acupuncture sessions and at home at their leisure ( for treatment intensification ) , or that there would be a library of generic tapes / cds addressing different topics from which patients and providers would be able to choose the most appropriate program . for example , a patient may choose a tape / cd according to her needs libraries such as this one that have generic hypnotic suggestions for various health conditions are already available from various sources ( 53 ) . in actually choosing a hypnotic tape / cd it is possible that patients would sense a better fit with the overall strategy to their disease condition , be more satisfied and motivated , and most importantly shift from having a relatively passive role in their care into a more active and empowered pursuant of health . indeed , recent research into the decision - making processes that underlie patients use of complementary and alternative medicine suggests that matching between the patient and the modality , satisfaction , motivation , and tendency toward active participation in healthcare , are all important factors that shape not only patterns of healthcare utilization , but also patients outcomes ( 54 ) . synergism is defined as the interaction of discrete agents ( as drugs ) , or conditions such that the total effect is greater than the sum of the individual effects ( 55 ) . additivity that , briefly stated , means that each therapeutic constituent contributes to the total effect in accord with its own potency . a typical example of synergism is the deadly combination of alcohol and narcotics , which in most instances is clearly more harmful than either alone . a classical study design that would set out to test whether acupuncture and hypnosis act synergistically , would follow evidence - based research guidelines , as stated by chiappelli and colleagues ( 56,57 ) and include a parallel multi - arm randomized controlled trial ( rct ) where hypno - acupuncture would be compared to both acupuncture and hypnosis , each administered alone , to the standard of care ( often a drug ) , and , when ethically feasible , to no treatment ( the counterfactual natural history ) . the dose - schedule - response relationships of hypno - acupuncture in such trials may be assessed by using standardized measures . an example of such a trial would be a multi - arm rct of hypno - acupuncture compared to each alone for chemotherapy induced nausea and vomiting ( cinv ) . a set of quantitative statistical analyses that are based on the assessment of interactions and main effects would then be set at the end of the trial to test the additivity / synergism hypothesis ( 58,59 ) . such analysis , when done appropriately ( for example , when the study has enough statistical power to test for synergism ) , could reveal one of four possibilities : that hypno - acupuncture is not superior ( or even inferior ) to either acupuncture and/or hypnosis , each administered alone;that the effect of hypno - acupuncture is equivalent to the combined effect of acupuncture and hypnosis , each administered alone ( cf . additivity);that hypno - acupuncture is superior to acupuncture and/or hypnosis , each administered alone , across all administration protocols and all subjects ; orthat hypno - acupuncture is superior to acupuncture and/or hypnosis , each administered alone , under some conditions but not others . that hypno - acupuncture is not superior ( or even inferior ) to either acupuncture and/or hypnosis , each administered alone ; that the effect of hypno - acupuncture is equivalent to the combined effect of acupuncture and hypnosis , each administered alone ( cf . additivity ) ; that hypno - acupuncture is superior to acupuncture and/or hypnosis , each administered alone , across all administration protocols and all subjects ; or that hypno - acupuncture is superior to acupuncture and/or hypnosis , each administered alone , under some conditions but not others . the latter interpretation is especially important because the relative potency of either acupuncture or hypnosis when administered alone may not necessarily be constant at all effect levels . for example , different subjects may benefit from different protocols ( in terms of dose and schedule ) of the intervention , a concept known as aptitude x treatment interaction ( ati ) ( 60,61 ) . if this is indeed true , then the interesting question is not just , which of those treatments ( acupuncture , hypnosis , or the combination of both ) is the best? but more importantly , best or better for whom , when , and why? the combination of ati research and practical ( or pragmatic ) clinical trials ( also known as pct ) ( 62 ) , which are trails that focus on decision - making at the point of care , can provide robust means so as to maximize treatment safety , efficiency , and effectiveness . furthermore , we advocate that all future hypno - acupuncture research would include a cost - effectiveness component so as to support therapeutic management decision - making at the policy level ( 63 ) . an important methodological challenge in all hypno - acupuncture research has to do with the choice of reference or control . in efficacy research , it would be important for both ethical and pragmatic reasons ( e.g. recruitment capacity ) to consider current standards of care . if , for example , one would want to assess the relative benefit of hypno - acupuncture for the prevention and control of cinv , where established guidelines exist as to what standard of care should be ( 64 ) , the study would need to compare hypno - acupuncture in addition to , rather than in lieu of , antiemetic medications , to both acupuncture and hypnosis , each administered alone in addition to , rather than in lieu of , antiemetic medications if , on the other hand , one would want to assess the relative benefit of hypno - acupuncture for the prevention and control of nausea and vomiting of pregnancy ( nvp ) , where established guidelines as to what standard of care should be do not yet exist , the study would simply compare hypno - acupuncture to both acupuncture and hypnosis , each administered alone , and to a natural history arm . in explanatory research , where the emphasis is on understanding how a treatment works , rather than on whether it works , the choice of control would have to take into consideration the many placebo - like mechanisms by which hypno - acupuncture might elicit its effects ( see above ) . as much as we believe in the scientific plausibility and practical viability of hypno - acupuncture we would like to exercise caution and suggest a stepwise approach toward testing the synergism hypothesis . this is because there are a number of feasibility and developmental issues that need to be addressed first before a definitive study could be conducted . for example , in the absence of reliable data on the optimal intervention protocol and the exact procedures for hypno - acupuncture , there is a very real risk that a premature trial would result in either type i or type ii errors , just as block et al . although this type of research will not immediately establish whether the combination of hypnosis and acupuncture is efficacious , it will provide the data necessary to optimally design and conduct efficacy , effectiveness and explanatory trials that would rigorously document the range of potential benefits and harm resulting from hypno - acupuncture . three important goals for this exploratory - developmental research would be as follows : to establish a dose response curve differs across different individuals and disease conditions , as suggested by the ati paradigm ; andto examine the nature of the effect that the timing of the administration of acupuncture in relation to the timing of the administration of hypnosis may have on patients outcomes . to establish a response curve for the hypno - acupuncture intervention ; to determine whether this dose response curve differs across different individuals and disease conditions , as suggested by the ati paradigm ; and to examine the nature of the effect that the timing of the administration of acupuncture in relation to the timing of the administration of hypnosis may have on patients outcomes . we believe that if and when definitive clinical trials lend support to the efficacy and effectiveness of hypno - acupuncture this unique package of care might be an important addition to the present armamentarium of care , which many consider suboptimal . for one , both hypnosis and acupuncture have an excellent safety profile ( 66,67 ) . it is possible , therefore , that by using hypno - acupuncture , either instead of , or in addition to standard of care , some of the side effects associated with current treatments might be averted . second , hypno - acupuncture may better match the therapeutic preferences of some patients ( 68 ) , a phenomenon which may increase compliance and satisfaction with treatment . and lastly , both acupuncture and hypnosis are relatively inexpensive compared to many other treatments . in conclusion , we present a new hypothesis that suggests synergism between two relatively safe and inexpensive modalities hypnosis and acupuncture . we call for rigorous testing of that hypothesis through a new line of research that will inform clinical practice guidelines and health policy decision - making regarding the potential integration of hypno - acupuncture into healthcare .

obstructive sleep apnea syndrome ( osas ) is characterized by episodes of obstruction ( partial or total ) of the upper airway during sleep secondary to a collapse of the structures of the upper airway during inspiration . osas manifests itself as a reduction ( hypopnea ) or complete cessation ( apnea ) of airflow despite continued respiratory efforts . osas is defined by an apnea - hypopnea index ( ahi ) > 15 or an ahi > 5 with daytime and nighttime symptoms . the apnea severity is classified as mild ( ahi 5 to 15 ) , moderate ( ahi 15.01 to 30 ) , or severe ( ahi > 30.1 ) . it is estimated that 45% of men and 30% of women over 65 snore . other usual symptoms associated with osas are excessive daytime sleepiness , nocturnal awakenings , fatigue , and headache upon waking in the morning.1 a lack of adequate ventilation results in an oxyhemoglobin desaturation and , in severe cases , hypercapnia . osas is associated with a variety of pathophysiological changes that impair cardiovascular function including increased inflammatory markers and blood pressure peaks during sleep . there is increasing evidence that osas increases the incidence of hypertension , stroke , myocardial infarction , and premature death.2 3 the prevalence of osas varies depending on the population studied and the diagnostic criteria used . young et al4 found that population prevalence was 9% in women and 24% men ( using as criterion only ahi > however , the prevalence drops to 4% in men and 2% in women when taking into account the complaint of excessive daytime sleepiness with ahi > 5 . another study by young and colleagues55 estimated that the prevalence of mild osas may vary from 3 to 28% of the adult population , whereas moderate to severe osas ( ahi 15 ) may range from 1 to 14% . importantly , the authors argued that osas is underdiagnosed in a high percentage of cases in which there is no complaint of excessive daytime sleepiness . this study also demonstrated that osas is more prevalent in men than women ( ratio of 2 to 3:1 ) , that there is an increased prevalence among the elderly ( especially those over 65 years ) , and that pregnancy is a risk factor for osas . bixler et al6 found that the prevalence of osas was 3.9% among men and 1.2% among women ( 3.3:1 ) considering an ahi 10 . the prevalence in women before menopause ( or use of hormone replacement therapy ) was 0.6 versus 2.7% in women after menopause ( and without hormone replacement therapy ) . clearly other factors that increase the risk for osas , including age , structural abnormalities in the upper airway , use of sedatives and alcohol , and probably familial history.1 it is also the consensus that the prevalence of osas increases in the obese population ( bmi > 30 ) . in a study published in japan7 involving 275 men , the prevalence of severe osas ( ahi > 30 ) was 1 in 6 individuals with metabolic syndrome ( bmi > 30 associated with dyslipidemia and/or hyperglycemia ) , whereas the prevalence was only 1 in 40 individuals without the metabolic syndrome . tufik et al8 in his study of 1,042 volunteers undergoing overnight polysomnography showed that 32.8% of residents of so paulo presented the criteria for osas according to the american academy of sleep medicine ( ahi > 15 or ahi > 5 with daytime and nighttime symptoms ) . this same study showed that 55% of the population suffer from drowsiness , 38.9% from fatigue , and 20.5% reported snoring . ahi below 5 was present in 61.8% of patients , 21.3% presented with aih between 5 to 14.9 and 16.9% had an ahi 15 . overweight and obese men and women were also more likely to have an ahi > 15 , and men with high socioeconomic status and women are less likely to have a aih > 15 . some studies , for instance , were conducted in groups of preselected populations ( e.g. , industrial workers or clinically referred patients ) and included a large number of individuals with suspected osas due to the frequency of snoring . the vast majority of osas studies are dedicated to assessing the prevalence of osas in the population , and this has great value for understanding the disease . the aim of this study is to analyze the epidemiologic profile of patients referred to the sleep medicine clinic who were previously selected in the otorhinolaryngology ward of a university hospital , as well as the treatment determined for each patient . this is a cross - sectional and individualized study covering 57 patients who were referred from the general ear , nose , and throat ( ent ) clinic to the sleep medicine clinic between april 2007 and january 2012 . all patients signed an informed consent and the study was approved by the ethics committee ( protocol number 0807/11 ) . all patients came to the clinic with their respective roommates and their polysomnography report , were questioned about the possible symptoms , and had a complete ent examination . in addition , patients completed the epworth scale of daytime sleepiness and a specific protocol for patients with snoring and sleep apnea . it was found that 68% of patients were men ( n = 39 ) and 32% were women ( the higher incidence in males is consistent with the literature1 2 3 4 5 6 7 8 ( fig . 2 ) , 16% of patients had primary snoring , 14% mild osas , 18% moderate osas , and 52% severe osas . the highest prevalence of moderate and severe osas can be attributed to the fact that these patients tend to be more symptomatic , so they are more likely to seek medical help . the higher incidence of moderate and severe osas explains the high incidence of symptoms indicative of impaired sleep quality and excessive daytime sleepiness ( reported in 69% of patients ) , nighttime awakenings ( 66% of patients ) , and morning headache ( 49% of patients ) . only 7% of patients had normal weight ( bmi 18 to 25 ) , 2% were overweight ( bmi 25 to 30 ) , 37% had grade i obesity ( bmi 25.1 to 30 ) , 9% grade ii obesity ( bmi 30.1 to 35 ) , and 45% grade iii obesity ( bmi > 35 ; ( fig . 3 ) . distribution according to body mass index ( bmi ) . according to friedmann stage ( fig . 4 ) , only 9% of the patients were classified as grade i , 35% were considered grade ii , 54% as grade iii , and 2% as grade iv . distribution according to the friedmann stage . in this study , we analyzed the treatment adopted in each case ( fig . the majority of patients ( 46% ) were treated with continuous positive airway pressure ( cpap ) . surgery ( uvulopalatopharyngoplasty [ uppp ] or lateral pharyngoplasty ) was given to 19% of patients , the mandibular advancement oral applience was designed for 14% patients , 7% were given roncoplastic injection , and 7% received positional therapy . the oral appliance was given to 2% of the patients because of roncoplastic injection treatment failure . sleep medicine is a new science , and knowledge has evolved exponentially in recent years . within this concept , the study of osas , the most common sleep disturbance in the general population including all age groups , is of utmost importance . therefore , knowing that most patients are undiagnosed , we decided to determine and analyze the epidemiologic profile of patients with snoring and sleep apnea in the database of a university hospital . when analyzing the sex distribution of patients studied , there is a predominance of males , with a similar distribution to most studies ( 2:1).3 - 5 snoring was the most common patient complaint ( 90% ) , which corroborates the need to consider it as a factor for investigating respiratory sleep disorders.8 excessive daytime sleepiness , unrefreshing sleep , fatigue on waking , morning headaches , and irritability were markedly common in our patients , confirming the significant interference of osas on quality of life , social relationships , family , labor , and the risk of accidents.1 these data alert health professionals to intensify efforts in the diagnosis and treatment of this important disease . taking into account the classification of severity of osas , we found the following distribution : 16% primary snoring , 14% mild osas , 18% moderate osas , and 52% severe osas . moderate and severe osas makes up 70% of this population , an alarming percentage considering the pronounced proven mortality in patients with moderate and severe osas.2 the high prevalence of moderate and severe cases may be due to the fact that these patients are more symptomatic , and therefore seek medical attention more often . a minority of patients ( 7% ) were within the normal bmi ( bmi < 25 ) , which highlights the association between obesity and severe osas.7 8 we found that most patients ( 46% ) were treated with cpap , which is considered the gold standard for treatment of osas.4 5 intraoral device was indicated for 14% of patients and only 19% of patients were treated surgically ; of these , 64% underwent the lateral pharyngoplasty . there were no indications of any surgical procedure in patients with a bmi > 35 ( obesity class ii or iii ) due to success rates in this group decreasing mainly due to a sharp narrowing pharyngeal and fat accumulation in pharyngeal tissues . however , 93% of patients included in this study were overweight or obese , indicating a high incidence of osas in this group people.7 8 in the group of patients undergoing roncoplastic injection , 2 ( 40% ) had mild osas and 3 ( 60% ) had primary snoring , which is consistent with the indication in the literature for palatal procedures for the treatment of this pathology . no patient in this group was classified as grade i friedmann , which would indicate uppp.9 10 11 12 roncoplastic injection is a procedure with a mechanism of action similar to palatal implants and radiofrequency ablation , which cause sclerosis ( hardening ) of the soft palate , which prevents vibration.11 12 in the group of patients who underwent uppp , none were classified as grade iii friedmann ( due to low success rates in this group ) . this procedure was performed in five patients , two of whom were classified as grade i and two as grade ii . in this group of patients , two had severe osas , one had moderate osas , one had mild osas , and one had primary snoring . this heterogeneous distribution shows that the ahi is less important than the friedmann classification to indicate a uppp.9 10 11 12 patients classified as friedmann ii who underwent uppp also underwent nasal surgery ( septoplasty and turbinectomy ) and suffered from primary snoring or mild osas . the main complaint of these patients regarding sleeping was social embarrassment caused by snoring , and none reported excessive daytime sleepiness or fatigue on awakening . nasal obstructions did not influence the pathophysiology of osas , and there was no contraindication to nasal and pharyngeal procedures being performed at the same time.8 9 10 regarding the lateral pharyngoplasty , patients who underwent this procedure had higher ahi and were classified as having moderate or severe osas . in this group of six patients , regarding the friedmann classification , only one patient in this group was classified as grade i. the lateral pharyngoplasty surgical option was used when the patient had moderate or severe osas , bulky rear pillar , or larynx position cranial to nasofibrolaryngoscopy and when the anatomy was not favorable for the realization of uppp.10 11 12 the maxillomandibular advancement was not performed because there was no formal indication.10 from the data analyzed in this study , we conclude that the epidemiologic profile of patients seen at the sleep medicine clinic in a university hospital are mostly obese menwith moderate or severe osas . the surgical procedures employed in this service ( roncoplastic injection , uppp , and lateral pharyngoplasty ) were given following the recommendations of the available literature . we also noted the reduced indication of surgical treatment , especially uppp , which is directly related to the fact that most patients were not classified as grade i in the friedmann scale .

temporary crown and fixed partial dentures are subjected to heavy and consistent loading by the mastication , and failure of the restoration frequently occurs . one of the common failure modes of the restorations which may lead to severe economic loss and patient discomfort is fracture.1 the materials used for temporary restoration must be strong particularly for long term use.2,3 the mechanical strength properties of the material are an important factor for the clinical success of temporary crown and fixed partial dentures.1 although the mechanical properties of polymer - based crown and fixed partial denture materials have been reported previously by many researchers in terms of flexural strength , hardness and edge strength,1,4 - 11 there are few papers concerning their diametral tensile strength . although , the diametral tensile strength is a critical requirement , because many clinical failures are due to tensile stress.18 the diametral tensile strength test provides a simple method for measurement of the tensile strength of brittle materials . as it is not possible to measure the tensile strength of brittle materials directly , the british standards institution adopted the diametral tensile strength test.19 in this test , a compressive force is applied to a cylindrical specimen across the diameter by compression plates . while the stresses in the contact regions are indeterminate , there is evidence of a compressive component that hinders the propagation of the tensile crack . large shear stresses that exist locally under the contact area may also induce a shear failure before tensile failure at the center of the specimen.7 the objectives of this study were to investigate the diametral tensile strength of polymer - based crown and fixed partial denture materials and to investigate the change of the diametral tensile strength with time . the null hypothesis to be tested was that there was no difference in the diametral tensile strength between monomethacrylate - based and dimethacrylated - based crown and fixed partial denture materials . polymer - based crown and fixed partial denture materials used in this study are presented in table i. specimens of the four materials were prepared in a cylindrical stainless steel mould which could be split so that no force would be required to remove the set specimen from the mould . the specimens had a size of 4 mm in diameter and 6 mm in length ( fig . protemp 3 garant ( pt3 ) , fast set temphase ( tmp ) and luxatemp ( lxt ) were injected into the mould with the automixing gun applicator , while trim ( trm ) was mixed with a clean plastic spatula for 30 seconds and immediately placed into the mould . the mould was covered with a glass slab and a plastic strip to prevent the inhibition of polymerization by oxygen , and hand pressure was applied to create flat end surfaces . after setting of the material , the mould was disassembled and the specimen was removed gently from the mould . for each material , twenty specimens were fabricated and randomly divided into two groups of ten according to the measurement time after completion of mixing . group i : immediatelygroup ii : 1 hour the specimens of group i were tested immediately ( circa 5 min after completion of mixing ) . specimens of group ii were prepared in the same method described above , and stored at 23 in a dry state for 1 hour before mechanical testing . diametral tensile strength of the specimens was investigated through a diametral compression test ( indirect tensile test ) in which a cylinder of material was compressed diametrically to failure . the diametral compression test was conducted using a howden universal testing machine ( rdp howden ltd . , southam , warks , uk ) at 23 1 operated at a compression rate of 0.5 mm / min . specimens were placed with the flat ends perpendicular to the platens of the apparatus so that load was applied to the diameter of the specimens . the maximum load applied till the diametral tensile strength was calculated from the following equation . where = the diametral tensile strength ( mpa ) p = the maximum fracture load ( n ) d = the diameter ( mm ) of the specimen t = the length ( mm ) of the specimen the mean values and standard deviations of the results were computed . the data were statistically analyzed using one - way anova and the multiple comparison scheff test to determine whether statistically significant differences existed among the materials . independent sample t test was also performed for each material to compare the diametral tensile strength between immediate and 1 hour specimens . for all statistical analyses , a significance level of 0.05 was used ( spss , version 10.1 , spss inc . , the mean strength values and standard deviations of each material are presented in table ii . statistical analyses are presented in tables iii to v. trm showed severe permanent deformation without an obvious fracture during loading at both times . thus , the data for trm were not presented ( table ii ) . at 5 minutes , pt3 showed the highest value ( 23.16 mpa ) , followed by tmp ( 22.27 mpa ) and lxt ( 14.46 mpa ) . pt3 and tmp were significantly higher than lxt ( p < .05 ) ( table ii ) . the value of pt3 ( 37.6 mpa ) was also the highest , followed by tmp ( 28.08 mpa ) and lxt ( 20.59 mpa ) . there were significant differences among them ( p < .05 ) ( table ii ) . the values for pt3 , tmp and lxt at 1 hour were higher than those at 5 minutes . the strength was improved by 62.3% for pt3 , 42.4% for lxt and 26.1% for tmp . those increases in diametral tensile strength of pt3 , tmp and lxt were significant with time ( p < a pure tensile test is problematic as brittle materials are liable to fracture at their gripped ends rather than show a single fracture along the midline of the specimen.12 one way to overcome this problem is to use dumbbell - shaped specimens , but the production of specimens of such geometry may not be easy in some materials such as dental amalgam . an alternative method is a diametral compression test which is a common method for measuring tensile strength of brittle materials.13 the diametral compression test is simple and offers good information about internal coherence of a material.14 although the diametral compression test is applicable only for brittle materials , the test is appropriate for polymer - based materials and frequently used.13 however , if a specimen deforms excessively at the point of loading before fracture , the test may not be suitable for the specimen as it could lead to an invalid test result.15 some polymer specimens do not show complete brittleness . test on the specimens will give a type of flow test or early compressive strength rather than a proper diametral tensile strength.14 however , if a near - vertical fracture occurred and if the contact width is less than 20% of the specimen diameter , the test result can be accepted.16 all specimens tested in this study failed with vertical diametral cracks . they fractured into two pieces of approximately the same size along the midline of the specimen . they showed no measurable permanent deformation at the contact areas except trm with an eye inspection . it was suggested that the water storage of resins at 37 has a tendency to lower the strength of the resins.17 therefore , all specimens in this study were stored dry to eliminate any effects of water sorption . the observed diametral tensile strengths ranged from 14.46 mpa to 23.16 mpa at 5 minutes and from 20.59 mpa to 37.59 mpa at 1 hour . these values are similar to those of resin core materials.12 it was found that diametral tensile strengths for chemically - cured core materials were 21.1 mpa - 31.6 mpa.12 pt3 showed significantly higher strength than the other materials investigated at both times . pt3 was 1.6 times stronger than the weakest material at 5 minutes after mixing , and 1.8 times stronger at 1 hour after mixing . all test materials showed a uniform increase in strength from 5 minutes to 1 hour ( p < .05 ) . this increase can be explained by the setting reaction of polymer - based crown and fixed partial denture materials due to polymerization of thin type of polymer , what continues for several hours . according to the results , it can be concluded that the dimethacrylate - based materials ( pt3 , lxt and tmp ) showed higher values in the diametral tensile strength than monomethacrylate - based material ( trm ) as trm exhibited such severe deformation that the strengths could not be measured under this test condition . thus , the null hypothesis that there was no difference in the diametral tensile strength between monomethacrylate - based and dimethacrylate - based crown and fixed partial denture materials could be rejected . the extent to which chain scission takes place depends upon the structure and morphology of the molecules . the dimethacrylate - based materials have a network structure which resists forces , while monomethacrylate - based materials allow movement of the molecules with relative ease under stress . this study has shown that in dimethacrylate - based materials , the highest diametral tensile strength was shown by pt3 . the different values between the materials shown in this study may be explained by different composition of the material , different filler type , different filler size , different filler distribution and different quantity of remaining double bonds , etc.11 when the test results were compared with the results by kim and watts , a generally positive correlation was observed between the edge strength at 0.5 mm from the edge and the diametral tensile strength at 1 hour after completion of the mixing ( r = 0.92).1 the edge strength tended to be larger when the diametral tensile strength was large . this also means that these two properties tend to be determined by the same characteristics of the materials . the diametral tensile strength of a polymer - based material is an important factor to be taken into account in selecting suitable materials for clinical use . these findings show that the monomethacrylate - based temporary restorations would be expected to be more susceptible to mechanical failure and less durable than the dimethacrylate - based temporary restorations when they are exposed to masticatory stresses . 1 . the dimethacrylate - based crown and fixed partial denture materials ( pt3 , tmp and lxt ) tested were stronger in diametral tensile strength than the monomethacrylate - based one ( trm ) which showed severe deformation without fracture under the test conditions . the diametral tensile strengths of all materials at 1 hour were about 1.3 - 1.6 times higher than those at 5 minutes after completion of mixing .

it has been proven that interferon -1a can reduce relapse rate , disease activity [ measured by magnetic resonance imaging ( mri ) scanning ] , and prevent disease progression [ 1 , 2 , 3 ] . common side effects of interferon -1a include flu - like symptoms , headache , depression , insomnia , inflammation or cutaneous necrosis at the injection site [ 1 , 2 , 3 ] . laboratory abnormalities , including liver function impairment , were also commonly observed in patients receiving interferon treatment [ 1 , 2 , 3 , 4 , 5 , 6 ] . the incidence of abnormal liver function tests ranged from 1 to 67% in different studies [ 2 , 3 , 4 , 5 , 6 ] . in most cases , liver enzyme elevation developed during the first 6 months after receiving interferon ; therefore , regular liver function monitoring in the first 6 months is recommended [ 2 , 4 , 5 , 6 ] . here , we report 2 multiple sclerosis patients with interferon -1a treatment who developed delayed liver function impairment around 5 years after interferon -1a treatment . a 56-year - old taiwanese woman was diagnosed as having multiple sclerosis in may 2000 . her first attack presented as left optic neuritis in december 1998 . her second attack , with brain stem encephalitis , developed in may 2000 . cranial mri studies showed t2-weighted hyperintense lesions in the inferior medulla and upper cervical spinal cord at c1 level at that time . her igg index was 0.77 ( reference < 0.5 ) , but oligoclonal bands were not found in the cerebrospinal fluid . autoimmune factors such as anti - ssa / ssb antibody , antinuclear antibody , and rheumatoid factor were within the normal ranges . she was diagnosed as having multiple sclerosis and received interferon -1a ( rebif 44 g subcutaneous injection 3 times a week ) starting in october 2002 . she had sensations of chill after interferon use at first , but could tolerate it . the results of liver function tests in march 2005 were still within the normal range : alanine transaminase ( alt ) 13 u / l [ upper limit of normal ( ulm ) the thoracic mri studies showed t2-weighted hyperintense lesions in the central gray matter around the t5t6 level ( two segments ) . however , her anti - aquaporin 4 ( aqp4 ) antibody test result was negative ( the manufacturer 's recommended level for seropositivity was 5 u / ml ; assessed by elisa rsr aqp4 ab kits ; provided by kronus , ltd . ) . she was still diagnosed as having multiple sclerosis rather than neuromyelitis optica ( nmo ) according to wingerchuk et al . 's criteria for nmo in 2006 and mcdonald 's diagnostic criteria for multiple sclerosis in 2010 , and she continued to receive interferon therapy . after the thoracic myelitis , mycophenolate prednisolone and cyclophosphamide were also used to control her disease . her medications were changed to azathioprine 50 mg daily in december 2006 . during this period follow - up liver function tests in october 2007 then showed impaired liver function : aspartate transaminase ( ast ) 93 u / l [ 2.7 ulm ( < 34 u / l ) ] and alt 100 u / l ( 2.8 ulm ) . she did not consume any alcohol and denied taking any over - the - counter medication . initially , azathioprine was suspected to induce liver function impairment , and the dose was reduced to 25 mg daily in december 2007 and further reduced to 25 mg every other day in january 2008 . however , her liver function gradually worsened in the next few months . in may 2008 , the results of her liver function tests were as follows : ast 213 u / l ( 6.3 ulm ) ; alt 282 u / l ( 7.8 ulm ) ; alkaline phosphatase ( alk - p ) 145 u / l [ 1.5 ulm ( < 94 u / l ) ] ; total bilirubin 0.7 mg / dl ( ulm < 1.3 mg / dl ) . results of hepatitis markers ( hbsag and anti - hcv antibody ) and autoimmune titers ( antinuclear antibody , anti - smooth muscle antibody , and anti - mitochondrial antibody ) were all within the normal ranges . in addition , she did not have any other drug reactions such as renal insufficiency , hemolytic anemia , leucopenia , and thrombocytopenia besides liver function impairment . interferon -1a was reduced to 44 g twice a week ; carbamazepine and azathioprine were discontinued in may 2008 . her liver function improved after reducing the interferon dose and discontinuing other concomitant medications [ july 2008 : ast 51 u / l ( 1.5 ulm ) ; alt 80 u / l ( 2.2 ulm ) ; r - glutamyl transpeptidase ( r - gt ) 110 , her liver function returned into normal ranges after interferon was discontinued in august 2008 [ january 2009 : ast 23 u / l ; alt 27 u / l ; r - gt 75 u / l ( 1.06 ulm ) ] . after a period of follow - up , interferon -1a ( 22 g twice a week ) and carbamazepine ( 100 mg twice a day ) were added again in march 2009 . however , her liver enzymes were elevated again [ april 2009 : ast 43 u / l ( 1.3 ulm ) ; alt 69 u / l ( 1.9 ulm ) ; r - gt 436 u / l ( 6.1 ulm ) ] a month later . so , interferon was discontinued , while carbamazepine treatment was continued ( 100 mg twice daily ) . her liver enzymes returned to normal ranges [ ast 24 u / l ; alt 31 u / l ; r - gt 150 u / the results of her liver function test remained in the normal ranges at follow - up ( november 2010 : ast 18 u / l ; alt 19 u / l ) . the roussel uclaf causality assessment method ( rucam ) scale for this patient after receiving interferon treatment is 8 . cranial mri studies at that time showed multiple periventricular and right paramedian pontine white matter lesions which fitted the criteria of dissemination in space according to the mcdonald criteria . her igg index was 0.65 ; oligoclonal bands were not found in the cerebrospinal fluid . autoimmune factors such as anti - ssa / ssb antibody , antinuclear antibody , and rheumatoid factor were within the normal ranges . since she did not have acute myelitis , which is one of the absolute diagnostic criteria of nmo she received interferon -1a ( rebif 44 g subcutaneous injection 3 times a week ) under the diagnosis of multiple sclerosis starting in january 2007 . results of liver function tests in november 2007 were within the normal ranges : alt 33 u / l and ast 22 u / l . concomitant medications during this period were baclofen 10 mg twice a day and zolpidem 10 mg before sleep . however , follow - up liver function tests in july 2012 showed impaired liver function : ast 93 u / l ( 6.8 ulm ) ; alt 251 u / l ( 7.4 ulm ) ; amylase 636 [ 6.4 ulm ( < 100 u / l ) ] ; r - gt 73 u / l , and total bilirubin 0.8 mg / dl . results of hepatitis markers ( hbsag and anti - hcv antibody ) and autoimmune titers ( antinuclear antibody and anti - mitochondrial antibody ) were within normal ranges . further abdominal computed tomography scan studies only showed a slight predominance of periportal fat raising suspicion of inflammatory change . her liver function improved a little after reducing the interferon dose [ november 2012 : ast 84 u / l ( 2.5 ulm ) ; alt 92 u / l ( 2.6 ulm ) ] . the results of her liver function test then returned into normal ranges ( february 2013 : ast 35 u / l ; alt 36 u / l ) , and interferon treatment was not resumed this time . a 56-year - old taiwanese woman was diagnosed as having multiple sclerosis in may 2000 . her first attack presented as left optic neuritis in december 1998 . her second attack , with brain stem encephalitis , developed in may 2000 . cranial mri studies showed t2-weighted hyperintense lesions in the inferior medulla and upper cervical spinal cord at c1 level at that time . her igg index was 0.77 ( reference < 0.5 ) , but oligoclonal bands were not found in the cerebrospinal fluid . autoimmune factors such as anti - ssa / ssb antibody , antinuclear antibody , and rheumatoid factor were within the normal ranges . she was diagnosed as having multiple sclerosis and received interferon -1a ( rebif 44 g subcutaneous injection 3 times a week ) starting in october 2002 . she had sensations of chill after interferon use at first , but could tolerate it . the results of liver function tests in march 2005 were still within the normal range : alanine transaminase ( alt ) 13 u / l [ upper limit of normal ( ulm ) the thoracic mri studies showed t2-weighted hyperintense lesions in the central gray matter around the t5t6 level ( two segments ) . however , her anti - aquaporin 4 ( aqp4 ) antibody test result was negative ( the manufacturer 's recommended level for seropositivity was 5 u / ml ; assessed by elisa rsr aqp4 ab kits ; provided by kronus , ltd . ) . she was still diagnosed as having multiple sclerosis rather than neuromyelitis optica ( nmo ) according to wingerchuk et al . 's criteria for nmo in 2006 and mcdonald 's diagnostic criteria for multiple sclerosis in 2010 , and she continued to receive interferon therapy . after the thoracic myelitis , mycophenolate prednisolone and cyclophosphamide were also used to control her disease . her medications were changed to azathioprine 50 mg daily in december 2006 . during this period follow - up liver function tests in october 2007 then showed impaired liver function : aspartate transaminase ( ast ) 93 u / l [ 2.7 ulm ( < 34 u / l ) ] and alt 100 u / l ( 2.8 ulm ) . she did not consume any alcohol and denied taking any over - the - counter medication . initially , azathioprine was suspected to induce liver function impairment , and the dose was reduced to 25 mg daily in december 2007 and further reduced to 25 mg every other day in january 2008 . however , her liver function gradually worsened in the next few months . in may 2008 , the results of her liver function tests were as follows : ast 213 u / l ( 6.3 ulm ) ; alt 282 u / l ( 7.8 ulm ) ; alkaline phosphatase ( alk - p ) 145 u / l [ 1.5 ulm ( < 94 u / l ) ] ; total bilirubin 0.7 mg / dl ( ulm < 1.3 mg / dl ) . results of hepatitis markers ( hbsag and anti - hcv antibody ) and autoimmune titers ( antinuclear antibody , anti - smooth muscle antibody , and anti - mitochondrial antibody ) were all within the normal ranges . in addition , she did not have any other drug reactions such as renal insufficiency , hemolytic anemia , leucopenia , and thrombocytopenia besides liver function impairment . interferon -1a was reduced to 44 g twice a week ; carbamazepine and azathioprine were discontinued in may 2008 . her liver function improved after reducing the interferon dose and discontinuing other concomitant medications [ july 2008 : ast 51 u / l ( 1.5 ulm ) ; alt 80 u / l ( 2.2 ulm ) ; r - glutamyl transpeptidase ( r - gt ) 110 , her liver function returned into normal ranges after interferon was discontinued in august 2008 [ january 2009 : ast 23 u / l ; alt 27 u / l ; r - gt 75 u / l ( 1.06 ulm ) ] . after a period of follow - up , interferon -1a ( 22 g twice a week ) and carbamazepine ( 100 mg twice a day ) were added again in march 2009 . however , her liver enzymes were elevated again [ april 2009 : ast 43 u / l ( 1.3 ulm ) ; alt 69 u / l ( 1.9 ulm ) ; r - gt 436 u / l ( 6.1 ulm ) ] a month later . so , interferon was discontinued , while carbamazepine treatment was continued ( 100 mg twice daily ) . her liver enzymes returned to normal ranges [ ast 24 u / l ; alt 31 u / l ; r - gt 150 u / the results of her liver function test remained in the normal ranges at follow - up ( november 2010 : ast 18 u / l ; alt 19 u / l ) . the roussel uclaf causality assessment method ( rucam ) scale for this patient after receiving interferon treatment is 8 . a 43-year - old taiwanese woman had right optic neuritis in 2001 . her second attack , with brain stem encephalitis , developed in april 2007 . cranial mri studies at that time showed multiple periventricular and right paramedian pontine white matter lesions which fitted the criteria of dissemination in space according to the mcdonald criteria . her igg index was 0.65 ; oligoclonal bands were not found in the cerebrospinal fluid . autoimmune factors such as anti - ssa / ssb antibody , antinuclear antibody , and rheumatoid factor were within the normal ranges . since she did not have acute myelitis , which is one of the absolute diagnostic criteria of nmo , she did not receive an anti - aqp4 antibody test . she received interferon -1a ( rebif 44 g subcutaneous injection 3 times a week ) under the diagnosis of multiple sclerosis starting in january 2007 . results of liver function tests in november 2007 were within the normal ranges : alt 33 u / l and ast 22 u / l . concomitant medications during this period were baclofen 10 mg twice a day and zolpidem 10 mg before sleep . however , follow - up liver function tests in july 2012 showed impaired liver function : ast 93 u / l ( 6.8 ulm ) ; alt 251 u / l ( 7.4 ulm ) ; amylase 636 [ 6.4 ulm ( < 100 u / l ) ] ; r - gt 73 results of hepatitis markers ( hbsag and anti - hcv antibody ) and autoimmune titers ( antinuclear antibody and anti - mitochondrial antibody ) were within normal ranges . further abdominal computed tomography scan studies only showed a slight predominance of periportal fat raising suspicion of inflammatory change . her liver function improved a little after reducing the interferon dose [ november 2012 : ast 84 u / l ( 2.5 ulm ) ; alt 92 u / l ( 2.6 ulm ) ] . interferon was discontinued in january 2013 due to the persistently elevated liver function tests . the results of her liver function test then returned into normal ranges ( february 2013 : ast 35 u / l ; alt 36 u / l ) , and interferon treatment was not resumed this time . both our patients were diagnosed as having multiple sclerosis and both had elevated liver function tests around 5 years after starting interferon -1a treatment . her liver function improved after reducing the interferon dose , turning back into normal ranges after discontinuing interferon and concomitant medications . since the liver function impairment after interferon use is dose dependent [ 4 , 6 ] , we monitored liver function tests after re - challenge with low - dose interferon . liver function impairment developed again after re - challenge with low - dose interferon , and liver function became normal again after discontinuation of interferon . detailed laboratory tests excluded any other etiology of liver function impairment ; other concomitant drug effects were excluded by the secondary low - dose interferon re - challenge test . her liver function tests improved after reducing interferon dose , returning into normal ranges after discontinuing interferon treatment . although we did not initiate re - challenge with low - dose interferon , detailed laboratory tests also excluded any other etiology of liver function impairment . the rucam scales after interferon treatment in these two patients are 8 and 7 , respectively , which indicated that liver function impairment caused by interferon -1a was probable . most studies showed that abnormal liver function after interferon -1a treatment developed in the first 6 months after receiving interferon [ 2 , 4 , 6 ] . in a study of 1,000 patients who received interferon -1a treatment , 75% of liver function impairment developed within the first 6 months after starting therapy , and regular liver function monitoring is suggested only during the first 6 months of treatment . only christopher et al . report a multiple sclerosis patient with delayed liver function impairment 3 years after interferon treatment . most multiple sclerosis patients on interferon treatment who had elevated liver function tests were usually asymptomatic and mild cases . the liver enzymes usually return into normal ranges gradually after dose reduction or interruption of therapy [ 3 , 4 ] . a high dose and high frequency of interferon use may increase the risk of liver function impairment in patients with multiple sclerosis [ 4 , 6 ] . liver biopsies of these patients usually reveal portal inflammation with centrivenular hemorrhage and mononuclear cell infiltration , which is consistent with acute hepatitis . if extreme liver enzyme elevation ( > 20 ulm ) or jaundice develops , interferon should be discontinued immediately ; if liver enzyme elevation is mild ( > 5 and < 20 ulm ) , the interferon dose should be reduced . however , they still had liver enzyme elevation even on low - dose interferon . therefore , interferon treatment was discontinued , and the liver enzymes returned into normal ranges . concomitant medications with interferon therapy , including acetaminophen , propionic acid derivatives like ibuprofen , non - selective monoamine oxidase inhibitors , selective serotonin re - uptake inhibitors , baclofen , opioid , anti - epileptic medications , and cyclooxygenase inhibitors , have been studied ; there was no evidence that concomitant use of these medications will increase the risk of liver function impairment . however , patient 1 had taken azathioprine , which has potential hepatic toxicity , at the same time . a previous report showed that 33% ( 5/15 ) of patients who received interferon -1b and azathioprine had elevated liver function tests which responded to a dose reduction , but none had serious complications . on the other hand , in 2 other studies with 23 and 181 patients , respectively , who received interferon -1a and azathioprine therapy , no abnormal liver function test was reported [ 14 , 15 ] . although the results of previous studies remain controversial , it is still possible that concomitant use of azathioprine and interferon might have caused liver function impairment in patient 1 . in conclusion , our case reports show that interferon -1a treatment in multiple sclerosis may lead to delayed liver function impairment several years later . delayed interferon -1a - induced liver function abnormality is probably an idiosyncratic reaction and concomitant use of liver - toxic medication might play a role . regular liver function test monitoring in multiple sclerosis patients who receive interferon treatment is necessary even after the first 6 months , especially in patients with concomitant use of liver - toxic medication .

the rotator cuff disease is known as one of the most common causes of chronic shoulder pain in adults , and its treatment is considered important because of the increased geriatric population and the advances made in medical diagnosis and treatment since the rotator cuff tear repair was first reported by codman in 1911 . the goal of the rotator cuff surgery is to relieve shoulder pain and to improve function ( 1 - 6 ) . the repair of the rotator cuff tear has been carried out via open repair ( 6 , 7 ) , mini - open repair ( 8 - 11 ) and , more recently , arthroscopic repair ( 12 - 16 ) . the arthroscopic technique is a less invasive approach and causes less injury to the deltoid muscle , which may prove advantageous for postoperative rehabilitation and outcome ( 14 - 17 ) . in developing countries , the high price of instruments and devices sometimes prompts the use of the open technique . previously , we employed the deltoid splitting technique for open rotator cuff repair , but the disadvantage of this approach lies in its severe postoperative pain and high rate of shoulder stiffness . therefore , we decided to treat our new series of patients through the deltopectoral approach , in which the sparing of the deltoid muscle confers less potential risk of adhesion and probably less postoperative pain . the purpose of this study was to evaluate the outcome of open repair rotator cuff tears using the deltopectoral approach in a group of patients who could not afford the costs of arthroscopic surgery . we determined the effectiveness of this technique , severity of postoperative pain , and incidence of complications such as shoulder stiffness . this study was performed on patients referred to orthopedic clinic of imam khomeini hospital , tehran , iran during 2008 - 2012 . all the patients had a physical examination and an imaging study including magnetic resonance imaging ( mri ) , yielding results that were consistent with the rotator cuff tear . the patients were given a preoperative questionnaire , which comprised demographic information , history of the present illness , social history , detailed medical history , and surgical history . of the 88 patients included in the study , 80 patients completed the follow - up period from 2008 to 2012 . the average follow - up was 30.6 months ( range , 18 - 48 months ) . the study population was comprised of 48 ( 60% ) men and 32 ( 40% ) women . the mean duration of symptoms before surgery was 27 months ( 14- 42 months ) . the rotator cuff tear types consisted of 26 ( 32.5% ) cases of supraspinatus and subscapularis tear , 6 ( 7.5% ) cases of isolated subscapularis tear , and 48 ( 60% ) cases of supraspinatus tear only . in terms of size , there were 8 ( 10% ) small , 18 ( 22.5% ) medium , 21 ( 26.5% ) large , and 33 ( 41.2% ) massive rotator cuff tears . the inclusion criteria for the present study were inability of any patient to cover the costs of arthroscopy . the exclusion criteria were as follows : infraspinatus tear considered not to be accessible via the deltopectoral approach;a partial - thickness or irreparable full - thickness tear , labral pathology amenable to surgical repair , degenerative arthritis of the glenohumeral joint , symptomatic arthritis of the acromioclavicular joint , rotator cuff arthropathy , previous surgery in the same shoulder , lack of compliance during the rehabilitation period ; andinsufficient follow - up . infraspinatus tear considered not to be accessible via the deltopectoral approach ; a partial - thickness or irreparable full - thickness tear , labral pathology amenable to surgical repair , degenerative arthritis of the glenohumeral joint , symptomatic arthritis of the acromioclavicular joint , rotator cuff arthropathy , previous surgery in the same shoulder , lack of compliance during the rehabilitation period ; and insufficient follow - up . after the administration of an interscalene block and induction of general anesthesia , all the patients were placed into the beach - chair position . a 5-cm skin incision was made in the line of the anterior axillary skin crease and the deltopectoral interval was exposed . the coracoacromial ligament was cut routinely , except in cases with massive chronic anterosuperior tears that repair were not considered satisfactory . two hohmann retractors were thereafter placed : one above the humeral head ( below the acromion ) and the other laterally . internal rotation of the shoulder exposed the posterior part of the cuff ( with the exception of the most distal part ) . the footprint having been prepared , the torn tendon was repaired by the modified mason - allen stitches using transosseous suture . in the cases with type iii acromions or when rotator cuff impinged with the acromion intraoperatively , acromioplasty was performed anteriorly and laterally with a high - speed burr . in this method , acromioplasty is slightly more difficult than the deltoid splitting approach insofar as a retractor must be placed over the humeral head to completely expose the underneath of the acromion . for postoperative pain control , acetaminophen and a cyclooxy - genase-2 selective inhibitor were administered orally until the second postoperative day . from postoperative days 3 to 5 , a tablet containing a combination of 25 mg of tramadol and 325 mg of acetaminophen was prescribed , along with a cyclooxy - genase-2 inhibitor . for additional postoperative pain control beyond that provided by the authors regular regimen pendulum exercises were performed immediately postoperatively ; passive exercises were performed under supervision of a physiotherapist . evaluations were performed with the constant score , american shoulder and elbow surgeons ( ases ) score , modified university of california los angeles ( ucla ) score , and pain visual analog scale by an independent observer ( shoulder physiotherapist ) ( table 1 ) . the patients rated their pain using a visual analog scale ( vas ) - ranging from 0 ( no pain ) to 10 ( unbearable pain ) - preoperatively , during the first 48 hours postoperatively , and at 6 weeks and 6 months postoperativel . after the administration of an interscalene block and induction of general anesthesia , all the patients were placed into the beach - chair position . a 5-cm skin incision was made in the line of the anterior axillary skin crease and the deltopectoral interval was exposed . the coracoacromial ligament was cut routinely , except in cases with massive chronic anterosuperior tears that repair were not considered satisfactory . two hohmann retractors were thereafter placed : one above the humeral head ( below the acromion ) and the other laterally . internal rotation of the shoulder exposed the posterior part of the cuff ( with the exception of the most distal part ) . the footprint having been prepared , the torn tendon was repaired by the modified mason - allen stitches using transosseous suture . in the cases with type iii acromions or when rotator cuff impinged with the acromion intraoperatively , acromioplasty was performed anteriorly and laterally with a high - speed burr . in this method , acromioplasty is slightly more difficult than the deltoid splitting approach insofar as a retractor must be placed over the humeral head to completely expose the underneath of the acromion . for postoperative pain control , acetaminophen and a cyclooxy - genase-2 selective inhibitor were administered orally until the second postoperative day . from postoperative days 3 to 5 , a tablet containing a combination of 25 mg of tramadol and 325 mg of acetaminophen was prescribed , along with a cyclooxy - genase-2 inhibitor . for additional postoperative pain control beyond that provided by the authors regular regimen , intramuscular diclofenac was added if required . pendulum exercises were performed immediately postoperatively ; passive exercises were performed under supervision of a physiotherapist . evaluations were performed with the constant score , american shoulder and elbow surgeons ( ases ) score , modified university of california los angeles ( ucla ) score , and pain visual analog scale by an independent observer ( shoulder physiotherapist ) ( table 1 ) . the patients rated their pain using a visual analog scale ( vas ) - ranging from 0 ( no pain ) to 10 ( unbearable pain ) - preoperatively , during the first 48 hours postoperatively , and at 6 weeks and 6 months postoperativel . the mean vas score in the immediate postoperative pain ( at 48 hours ) was 6.10 1.87 and the mean vas score at the 6 weeks was 4.35 1.02 . the mean follow - up period was 30.6 months ( range , 18 - 48 months ) . two ( 2.5% ) patients with diabetes mellitus developed stiffness , which necessitated 6 months of physiotherapy . the mean ases score improved from 33.56 14.31 preoperatively to 85.64 10.54 postoperatively ( at the final follow up ) ( p < .01 ) , and the mean constant score improved from 39.24 18.61 preoperatively to 81.46 11.67 postoperatively ( at the final follow up ) ( p < .01 ) . follow - up evaluation using the ucla scores showed that 89% of the patients had good and excellent postoperative scores , with 44 ( 55% ) excellent , 27(34% ) good , 7 ( 9% ) fair , and 2 ( 2% ) poor results . overall , the mean ucla score rose significantly from 13.0 2.1 preoperatively to 32.2 4.1 postoperatively ( p < .01 ) ( table 2 ) . pain , as measured on the vas , was improved from 6.15 2.33 preoperatively to 1.21 1.05 postoperatively ( at 6 months ) ( p < .01 ) ( table 3 ) . comparisons of clinical scores before and after operation ( at the final follow up ) . * po 1 = postoperative , during first 48 hours , po 2 = postoperative , at 6 weeks , po 3 = postoperative , at 6 months comparisons of pvas before and after operation ( at the final follow up ) no intraoperative complications were noted . none of the patients who showed unsatisfactory outcomes on the ucla scale chose to undergo repeat surgery . no intraoperative complications were noted . no neurologic compromise was detected in any patient . none of the patients who showed unsatisfactory outcomes on the ucla scale chose to undergo repeat surgery . the most important goals of the rotator cuff surgery are to protect the deltoid , provide adequate subacromial decompression , confer adequate tendon mobilization , and secure the repair of the rotator cuff . these goals can all be achieved via the deltopectoral approach ; this modality is easy to perform technically and easy to teach and requires no special equipment . this study is not reported hitherto . despite the improvement in surgical techniques and arthroscopic instruments , the cost of arthroscopic shoulder surgery is still high and not affordable by all patients in underdeveloped countries . therefore , open rotator cuff repair still has a significant place in these situations . published series of open rotator cuff repair of full - thickness tears have reported good results in 71% to 92% of patients improving pain , function , and strength ( 4 - 12 ) . one disadvantage of the traditional open and mini - open repair is that they may result in shoulder stiffness after surgery , with the incidence ranging between 11% and 20% ( 1 , 4 , 16 ) . in our study , however , postoperative shoulder stiffness was reported by 2.5% the patients , both of whom had diabetic mellitus . another disadvantage of the traditional open and mini - open repair is postoperative pain resulting from the detachment of the deltoid from the acromion . although rare , damage to the deltoid origin remains a problem with open rotator cuff repair by deltoid splitting technique . deltoid pull - off has no good surgical solution and results in permanent weakness to the shoulder . this can be avoided by using techniques that do not require the deltoid origin to be taken down . the traditional open rotator cuff repair can also be more painful than the deltopectoral approach . this fact combined with the potential risk of subdeltoid adhesions can result in postsurgical stiffness . our method appears to confer successful outcomes because of the preservation of the deltoid muscle attachment via the deltopectoral approach . liu and baker ( 17 ) repaired 35 full - thickness rotator cuff defects with arthroscopic assistance and a deltoid splitting incision with 85% good and excellent results and 92% patient satisfaction . in a second study by the same authors , no difference in results outcome studies of the open repair of the rotator cuff display an 88% to 90% success rate ( 18 - 20 ) . it has been reported that the preservation of the deltoid muscle attachment is critical to success , and separation of the deltoid insertion from the acromion results in significant deficits in motion and strength ( 18 , 22 , 23 ) . pain in this study was lower than that reported in the study of cho et al . the deltopectoral approach has its own drawbacks , first and foremost among them are insufficient exposure for posterosuperior rotator cuff tears and difficulty for performing acromioplasty . at final follow - up visits in the present study , the ases , constant score , and ucla score were found to have improved significantly . our results indicate that this approach might be a more reliable alternative to most arthroscopic rotator cuff repairs . it is worthy of note that our objective was simply to assess the clinical results of and patient satisfaction with the use of the deltopectoral approach , and we did not seek to evaluate repair integrity . the authors are liable for its content and for having participated in writing and reviewing the text , as well as approving the final version to be submitted . likewise , we accept the introduction of changes to the content , if necessary subsequent to review , and of changes to the style of the manuscript by the journal s editorial staff . the authors are liable for its content and for having participated in writing and reviewing the text , as well as approving the final version to be submitted . likewise , we accept the introduction of changes to the content , if necessary subsequent to review , and of changes to the style of the manuscript by the journal s editorial staff .

cannabis sativa l. has been widely utilized by humans for thousands of years for the relief of a wide range of physiological ailments . in the united states , there are currently 18 different states and the district of columbia that legally allow for the medical use of cannabis , and most recently the states of colorado and washington have legalized the use of cannabis by adults for recreational purposes . state lawmakers and regulatory departments are now being tasked to best enact appropriate laws , rules , and regulations on the use of cannabis for both medicinal and recreational purposes . while medicinal use of cannabis in a smoked form may be widely debated as an effective delivery form , rapidity of effect and ease of titration of dose lend it to be extensively used by many patients as their preferred delivery method today . undoubtedly , recreational use will see considerable consumption via smoking of dried cannabis flowers . in an effort to help aid patients , lawmakers , regulators , and the general public understand the potential harms of contaminated cannabis we sought to determine to what extent pesticide residues may transfer into the mainstream smoke , produced from cannabis , when inhaled through various smoking devices currently being used by medical cannabis patients . mainstream smoke consists of the smoke inhaled from a smoking device directly while sidestream smoke refers to smoke that otherwise escapes the device and is not directly inhaled . the ubiquitous use of pesticides in agriculture has earned itself a long history in the united states from the outset of the insecticide act passed in 1910 to the now heavily engaged us environmental protection agency ( us epa ) , federal department of agriculture ( fda ) , and united states department of agriculture ( usda ) along with individual state regulators . according to a report issued by the us general accounting office ( gao ) in 2003 , the use of pesticides on tobacco crops was limited to 37 pesticides , which included various organochlorides , organophosphates , and other classes of pesticides . allowable pesticides and residue levels on food crops are determined by the us epa , while the testing and monitoring of the presence and levels of residues are conducted by the fda and usda . however , since tobacco is not a food crop , the us epa has not set tolerances on the residue levels on tobacco crops . consequently , tobacco is only monitored for compliance with us epa approved pesticides while the residue levels are not federally regulated . to date , there are no approved pesticides or application limits established for use on cannabis crops by the us epa ; therefore , all pesticide use on this crop is currently illegal . the use of pesticides and plant growth regulators in medicinal cannabis cultivation has been found to be quite prevalent by both testing laboratories and authority laboratories alike . many commercially available pesticide containing products or nutrient systems , some only approved for use on ornamental crops , are widely available from a variety of sources including hardware stores , specialty indoor hydroponic shops , and various , sometimes unscrupulous , online vendors . while 18 states allow cannabis for medicinal use , the majority of the current medical cannabis supply lacks regulations and enforcement related to the quality and safety of the plant material for consumption . laboratories operating within california have reported that cannabis samples contaminated with residual pesticides are frequently encountered . in 2009 the los angeles city attorney 's office covertly acquired and then tested three medical cannabis samples available to patients through dispensaries and found that in two of the samples exceedingly high levels of bifenthrin were found . in one sample , 1600 times the legal digestible amount was measured , and in the other , 85 times the legal limit was measured , although the exact quantities were not stated . many medical cannabis products are currently cultivated , processed , and prepared by private entities that are not regulated by external agencies . the lack of quality control results in patients potentially being exposed to cannabis contaminated with toxic levels of pesticides . although not yet directly quantified , additional health complications in patients may become a contingency of pesticide exposure and may also interfere with long - term cannabis use studies . regardless , pesticide toxicity is well documented and more importantly can pose substantial threats to immunocompromised patients or patients with other conditions , such as diseases of the liver , that may intensify the toxicological effects of pesticide exposure . additionally , during heating pyrolysis products from the plant material form a highly complex mixture of products , many of which may interact with the pesticides or pyrolysis products of the pesticides forming more toxic materials , or highly toxic pyrolysis products may form from the pesticide residues alone . as stated in the review by us general accounting office ( gao ) in 2003 , exposure to organophosphate pesticides through inhalation causes the most rapid appearance of toxic symptoms , and the primary cause of death from organophosphate pesticides is respiratory failure . considering these issues , evaluation of the exposure from contaminated cannabis needs to be urgently addressed so that new regulations can be properly guided . a previous pesticide study conducted with filtered tobacco cigarettes had positively identified the recovery of pesticides in the mainstream smoke to range from 2 to 16% . additionally , the distributions of volatilized pesticides and pyrolysis products in tobacco cigarette mainstream smoke and sidestream smoke were found to differ . the mainstream smoke pesticide residues consist primarily of unpyrolized pesticides carried over by distillation characteristics related to steam volatility , while in the sidestream smoke , a larger portion of pyrolysis products are found . in the same study , it was determined that about one half of c - labeled pesticides were retained in a cotton cigarette filter in a nonselective manner . for the most part , since cigarette filters absorb a significant portion of the volatilized residues and a substantial toxicological threat is already associated with smoking tobacco , little concern for pesticide exposure to tobacco smokers has been considered [ 2 , 7 ] . cannabis smoking devices often do not include filtration processes and because of this the potential quantities of pesticide residues that may be consumed increases dramatically when compared with tobacco smoking . in the present study , we chose to evaluate both filtered and nonfiltered smoking devices to better understand this effect with cannabis and commonly employed medical cannabis consumption methods . while it is known that combustion of plant material causes the formation of carcinogens , there has been no direct correlation in the formation of lung cancers to the inhalation of combusted cannabis . the presence of pesticide residues is therefore critical to be monitored , and furthermore , those individuals seeking to use cannabis for medicinal purposes may also be more physiologically susceptible to negative impacts caused by the presence of these residues . to prevent overtreatment of tobacco with pesticides , certain application limits on crop treatment have been imposed to minimize exposure to tobacco smokers , but these are not fully federally regulated [ 2 , 9 , 10 ] . industrial and other laboratories have attempted to quantify the levels at which pesticide residues transfer into the smoke stream in order to validate what quantities of pesticides may safely be applied to crops , and these values have been used to help moderate the levels of pesticide exposure of the public [ 5 , 11 ] . considering that there currently exists a significant lack of analogous regulations set in place for the medical cannabis supply , it is important that the potential for pesticide exposure is evaluated under conditions commonly employed by the medicinal user . in order to determine the existence of pesticide and chemical residues in the cannabis smoke stream , a number of pesticides and a plant growth regulator which are readily available to cannabis cultivators and have been measured in high frequency in various medical cannabis products ( unpublished data , the werc shop , inc . , 4 ) were selected for the study . three different smoking devices , chosen to provide a broad overview , were used in the study ; a small glass pipe , a water pipe , and an identical water pipe outfitted with activated carbon filters and cotton filters . acetonitrile , methanol , and water of analytical grade as well as washing acetone and methanol of laboratory grade were purchased from sigma aldrich , st . louis , mo , usa . bifenthrin and diazinon were purchased from chem service , west chester , pa , usa . paclobutrazol and permethrin were purchased from sigma aldrich , st . virgin coconut carbon and cotton were obtained from scientific inhalations , grass valley , ca , usa . the water pipe was manufactured by scientific inhalations , inc . and is named the mcfinn triple filtered water pipe having a vapor flow path consisting of first a 2.5 cm cup for placement of the flower material , followed by a 2.5 cm connector , flowing in to a 10 cm filter , down further into a 15 cm water chamber having a 3.1 cm inner diameter and a water fill line 3.8 cm from the base . the water chamber also has a second 12.5 cm filter chamber connected at a 45 angle through a 5 cm fitting that is located 12.5 cm above the base of the water chamber , and the second arm then further connects to a mouth - piece . a special mouth - piece was custom made by scientific inhalations to allow for easy connection to the gas - wash bottle apparatus . the glass pipe was custom made by scientific inhalations to be 10.5 cm long with a 3.1 cm chamber diameter and 1.1 cm inner diameter that included a special mouth - piece configuration for easy adaption to the gas - wash bottle apparatus . analysis was conducted with a gcms - qp2010 plus ( shimadzu , japan ) gas chromatograph - mass spectrometer . separations were performed using a shimadzu shrxi-5ms 30 meter , 0.25 mm i.d . , and 0.25 um film thickness column . gas chromatography parameters were as follows : injector temperature 250.0c , splitless injection mode , column oven temp . 50.0c held for one minute , followed by an increase to 125c by 25c / min , and finally increased to 300c for 15 minutes by 10c / min . ms scan was carried out in selected ion monitoring ( sim ) mode with two reference ions for each pesticide to avoid false positives from the complex matrixes . pesticide calibration curves were prepared in matched matrixes , which were prepared from unspiked plant material using the same smoking procedure used for all the experiments as described in section 2.6 . plant material was prepared by first placing approximately 8 grams of homogenized cannabis flower material into a 250 ml round bottom flask and vortexed at 1200 rpm until the small non - leafy material fell to the bottom . this material was then separated and sifted over a rough screen to further remove small non - leafy material . this process was repeated five times until the plant material was sufficiently cleared of fine material that might otherwise incur poor homogeneity of pesticide distribution in the bulk of the material . to the sifted plant material , a concentrated solution of pesticide mixture in methanol , prepared to contain 0.730 mg / ml bifenthrin , 7.41 mg / ml diazinon , 4.37 mg / ml paclobutrazol , and 6.18 mg / ml permethrin , was then added incrementally to the plant material . these concentrations were selected to allow for full quantification of residues captured in the gas wash bottle solutions . a total of 8.30 ml of the pesticide mixture solution was added to 7.4860 g of the material incrementally . each increment was carried out by adding 1 ml of the solution drop - wise into a 250 ml round bottom flask containing the plant material that was then vortexed at 1300 rpm over a 2 minute period . after each ml was added , the flask was then placed on a rotary evaporator and rotated at 50 rpm for 3 minutes while under vacuum . the flask was then covered in a dark encasing and stored at 20c until further used . from the spiked plant material , the measured values were averaged and this value was used for the recovery calculations in the smoke condensate . the smoke stream was collected by being directed through two gas washing bottles which were placed in tandem cold methanol traps both held at 48c . the gas wash bottles were filled with 100 ml of analytical grade methanol each . the gas wash bottles were then connected with a 6 inch tube in tandem to a vacuum pump intermediated by a gas flow regulator . the end of the system was then fixed to the smoking devices via a frosted glass fitting or direct connection via tygon tubing . a vacuum was applied to the system using a diaphragm vacuum pump ( md 4c , vacuubrand , essex , ct , usa ) in order to pull smoke from the smoking device and through both of the gas wash bottles . in order to ensure that the draw rate and vacuum pressure were constant throughout all experiments , a long glass column was placed upright in a water vessel filled with a constant volume of water . to the top end of the glass column , a tubing fitting was fixed and vacuum tubing connected . to the tubing , a valve at a constant setting was opened slightly to allow air to enter and prevent the water from being pulled into the vacuum . after having twelve different current medical cannabis patients inhale through the end of a tube attached to the valve while instructed to emulate the draw strength they typically use for these smoking devices , it was determined that the draw rate of an average smoking device user was approximately 1.2 l / min . this draw rate was then used for all of the experiments by ensuring that the vacuum was set to draw at a rate that yielded height in the water column corresponding to 1.2 l / min . this process was performed before , during , and after each experiment to ensure the simulated inhalation flow rate was as consistent as possible . the smoking procedure was carried out by passing the flame of a disposable lighter over the plant material for three seconds at 15-second intervals while the vacuum was applied at 1.2 l / min . aliquots from the gas wash bottles were taken after being shaken and agitated to capture any condensate on the walls and stems of the wash bottles and measured with gc - ms . all glassware , tubing , and smoking devices were then washed thoroughly with methanol and acetone between experiments . in the case of the water pipe , water was used in the water chamber as per manufacturer 's specifications , and when applicable , 7.5 g of virgin coconut carbon was used in the carbon filter cartridge , while 0.7 g of cotton was used in the cotton filter cartridge . after each experiment using the filtered device , the cotton and carbon were extracted with 15 ml of analytical grade methanol and measured by gc - ms . three sets of calibration curves were prepared , each in different matrixes that consisted of smoked plant material solutions in order to account for possible ion suppression from the matrixes . all matrixes and plant material samples were ensured to be free of the pesticides of interest before use and further analysis . for the preparation of the raw plant material matrix , approximately 4 g of unspiked cannabis plant material from the same source as that which was spiked was extracted with 100 ml of analytical grade methanol and stirred with a stir bar for 20 minutes , followed by filtration through a buchner funnel . smoke condensate matrixes from the glass pipe and the water pipe were prepared by running the experiment with each device as described in section 2.6 and storing the solutions in a dark container at 20c before analysis . each of these matrix solutions was then used to dilute the stock solutions of pesticides for generating calibration curves in each matrix . the calibration solutions of chemical residues were prepared in the three separate matrixes and the calibration curves generated are tabulated in table 1 . chemical residues recovered from the smoking devices are tabulated in table 3 , as well as the percent recovery with respect to the spiked plant material . it should be noted that 97% of the recovered residue in the gas wash bottles was found in the first wash bottle , representing excellent recovery capabilities . in all three experiments , the recovery of chemical residues from the activated charcoal was below the lowest calibration level and is therefore not reported . figure 1 illustrates the comparative recovery of chemical residues from each of the smoking devices . the relative amounts of pesticide residues present in other smoked plant material , most notably tobacco , have been studied to determine the amount present in raw plant material , as well as the levels of transfer into the smoke stream . these results have been used to help guide regulations on pesticide application on tobacco crops and reduce the potentials of pesticide toxicity in consumers [ 9 , 12 , 13 ] . as medical cannabis patients already possess negative health complications , exposure to pesticides may create additional health complications and interfere with other health care approaches . in addition , the awareness of proper and safe pesticide use and application is very important to any crop that will be consumed , especially one that will be inhaled . understanding to what extent chemical residues may be consumed by the user of the final product is important , but also improper applications of pesticides on cannabis crops may lead to other contingencies such as applicator exposure and environmental contamination . to bring attention to the importance of pesticide awareness and to further the regulatory efforts for both the medical cannabis and impending recreational cannabis supplies , the present study demonstrates quantitatively the potential for pesticides to be transferred into the smoke stream under the conditions often encountered by cannabis users . while the variance between triplicate samples was notable , when considering the vast number of variables including heating conditions , and other inherent variations , the overall variation was fairly minimal . from the data presented here , the recoveries of pesticide residues in the smoke stream are very significant in relation to the potential of exposure by the end consumer . a previous study with filtered tobacco cigarettes published by cai et al . noted that the range of pesticide recovery from the smoke stream was 2 to 16% . the range of pesticide residue recovery in that study was comparable to the water pipe with filters ( 0.0810.9% ) used in the present study , but without filters the recovery from the present study was much higher as evident in table 3 and figure 1 . this suggests that the cotton filters in a cigarette or water pipe are critical in capturing and reducing pesticide residues in the mainstream smoke . also , extractions of the cotton filters ( table 3 ) contained a significant portion of the pesticides passed through the device . the carbon filter retained an insignificant amount of pesticides , but this may have been due to heating and desorption of retained compounds during each use as this portion is closest to the plant material combustion point . between the glass pipe and the water pipe with no filters , the relative pesticide recovery was greater when the glass pipe was used . this difference may be attributed to the comparable levels of surface area for the residues to accumulate inside the device by condensation , as well as factors such as total path length , smoke stream total flow rate velocity , and the absolute temperatures achieved in situ . additionally , the water pipe contained room temperature water that aids in cooling the smoke stream before exiting the device . comparative recoveries between individual pesticides ( figure 1 ) show significant differences in the recovery of each pesticide . these differences may be attributed to the variations in stability of each compound , volatilization characteristics , and to what extent degradation occurs during heating and combustion of the plant material surface . it should be noted that different levels of pesticides present on different varietals of cannabis flowers present different matrixes that may impact the amount of pesticides potentially being inhaled . different user behaviors including depth of breath , length of inhalation hold time , and choice of heating method may also impact overall individual exposure amounts . in our lab we use validated methods to detect pesticides above epa - based acceptable daily intake levels for a 40 kg individual consuming 10 g of flower material per day . while these limits represent residues on plant material at levels lower than the levels utilized in this study , a number of samples seen have failed considerably further supporting previous findings by local authorities . additional efforts are ongoing to quantify the amount of pesticides being detected in contaminated medical cannabis products . the present study clearly demonstrates that chemical residues present on cannabis will directly transfer into the mainstream smoke and ultimately the end user . recoveries occurred in the highest quantity with the hand - held glass pipe , ranging between 60.3% and 69.5% . recovery from the unfiltered water pipe ranged between 42.2% and 59.9% , and recovery from the filtered water pipe ranged between 0.08% and 10.9% . as mentioned previously , the effects of filtration have a significant impact on the total residues consumed . while there are differences between the devices , in general the portion of pesticide recovery is alarmingly high and is a serious concern . although pesticides are designed to degrade fairly quickly in the environment , it is evident from this study that some are highly resistant to pyrolysis and volatilize easily into the smoke stream in agreement with previous studies noting the distillation behavior of pesticides in mainstream smoke . considering these results , high pesticide exposure through cannabis smoking is a significant possibility , which may lead to further health complications in cannabis consumers . this revelation certainly confounds previous metastudies seeking to determine the possible negative consequences associated with long - term cannabis use , as our experience with a breadth of samples indicates a significant possibility that the negative consequences reported in these studies could have been the result from various chemical residue exposures resulting from the use of unregulated product supply chains . as more states legislate and regulate cannabis products , a strong regulatory approach will help to reduce the potential public health and safety consequences from pesticide exposure . while it is fortunate that chemical residue recovery may be minimized with smoke filtering , this only serves to improve consumer safety today with no adequate regulations , as there is no better way to avoid pesticide and other chemical residue consumption than to assure it is not present on the product in the first place . active sampling and analytical monitoring of the cannabis supply , along with collaborative efforts between current patients and state regulatory authorities , are needed to help further guide the development and implementation of proper application methods and testing standards that will avoid environmental contamination and consumer threats to public health and safety .

liver dysfunction in a patient with triple - negative ( estrogen , progesterone receptor - negative and her-2 neu negative ) breast cancer due to liver metastases represents a potentially serious situation , especially when the patient is anthracycline resistant . breast cancer in the setting of liver of liver metastases and/ or hepatic dysfunction is a complex therapeutic dilemma . not only is the prognosis poor , but toxicity related to therapy may be unpredictable due to altered drug clearance . it is often accompanied by a sharp decline in performance status ( ps ) and a rapidly progressive disease course . administration of paclitaxel is contraindicated once the liver functions are more than 10-times the upper limit of normal ( > 10 uln).[16 ] serious toxicity can be seen even with lesser degrees of liver dysfunction . weekly paclitaxel has not been studied in the setting of severe liver dysfunction.[16 ] we present the report of one such case who had a gratifying response to escalating doses of weekly paclitaxel thus suggesting that patients with severe liver dysfunction can derive benefits from such a strategy . the patient , a 54-year - old lady , was diagnosed with breast cancer 6 months back . the metastatic work - up , including a chest radiograph ( x - ray ) , ultrasound of the abdomen ( usg ) and a bone scan , was negative . immunohistochemistry revealed the tumor to be triple negative ( estrogen , progesterone receptor negative and her-2 neu negative ) . she was then started on chemotherapy - fec ( fluorouracil 500 mg / m , epirubicin 75 mg / m and cyclophosphamide 500 mg / m ) . after three cycles , she complained of appearance of nodules at the incision site as well as backache . physical examination revealed local recurrence with the presence of multiple skin nodules at the mrm incision site . the contrast - enhanced computerized tomography of the abdomen revealed multiple liver metastases , one large metastases in the right lobe 8 cm in dimension as well as five lesions 12 cm in size . a magnetic resonance imaging of the spine and pelvis revealed multiple skeletal metastases in the lumbar , sacral and left illiac regions . her liver functions ( lfts ) were deranged [ table 1 ] , and were as follows : serum bilirubin ( s. bil ) 2.2 mg% ( normal range 0.31.1 mg% ) , aspartate aminotransferase ( ast ) 375 iu / l ( normal range 025 iu / l ) , alanine aminotransferase ( alt ) 369 iu / l ( normal range 035 iu / l ) and alkaline phosphatase ( alp ) 363 iu / l ( normal range the prothrombin time was mildly deranged , 17 ( test)/12 ( control ) s. there was no history of preceding liver disease . blood tests for presence of hepatitis b surface antigen and serology for hepatitis c , a and e were noncontributory . drug administration , dosage and liver function tests she was started on weekly paclitaxel 20 mg / m and zoledronate 4 mg every 4 weekly . s.bil rose to 3.81 mg% , ast to 446 iu / l , alt to 373 iu / l and alp to 1338 iu / l . steady improvements in the clinical status and lfts were noted and dose increments of 10 mg/ m were made with each successive dose . hence , the dose was modified to 40 mg/ m [ table 1 ] . at the end of the 10 week all the five lesions 12 cm in size initially had become less than i cm in dimension . there was no toxicity except grade 1 anemia hemoglobin ( hb ) 9.5 gm% ( normal range 1215 g / dl ) . however , 5 days after the administration of the week 13 dose ( 40 mg / m ) , the skin lesions reappeared . ultrasound of the liver revealed that the lesion had increased in size from 3.5 cm to 4.5 cm . in view of progressive disease , paclitaxel was discontinued and the patient was placed on single - agent carboplatin . . studies of paclitaxel pharmacokinetics in patients with normal or mildly impaired liver function suggested a negative correlation between total bilirubin concentrations and paclitaxel elimination.[16 ] venook et al . described higher hematological toxicities in patients with liver dysfunction receiving paclitaxel every 3-weekly over 24 h and over 3 h , and suggested dose reductions as a means of overcoming this toxicity . wilson et al . , in a combined phase i / ii study , studied the pharmacokinetics involved in a 96-h infusion of paclitaxel and found correlations between tumor involvement of the liver , aspartate aminotransferase and total bilirubin concentrations and reduced paclitaxel clearance in patients with advanced breast cancer . they suggested suitable dose adjustments : reduction of dose from 140 mg / m to 105 mg / m in such patients . joerger et al . found a direct relationship between liver impairment , paclitaxel elimination and susceptibility to neutropenia / thrombocytopenia , and suggested the need for further dose adaptations for patients with more severe liver impairment ( approximately 6080% cycles were complicated with grade hematological toxicity in patients with higher grades of liver dysfunction ) . huizing and colleagues studied nine patients with advanced breast cancer receiving paclitaxel 250 mg/ m as a 3-h infusion with subsequent granulocyte colony stimulating factor support . two patients with liver function disturbances showed a tendency to higher paclitaxel and 6-alfa hydroxypaclitaxel auc levels , with more pronounced neuropathy . because the recommended dose of the 3-weekly regimen in hepatic dysfunction is lower than the standard dose , we started with lower doses of the weekly regimen in our case than the standard dose of weekly paclitaxel and then escalated them according to patient tolerance and hepatic dysfunction , as revealed by the lfts . overall , the incidence of serious adverse events , neutropenia and neutropenic fever are significantly lower in the weekly taxanes schedules than in the three - weekly schedules and , hence , represent a safer treatment option . use of taxanes in the face of liver dysfunction and deteriorating ps is severely limited , and administration is contraindicated once the transminase levels are more than 10-times the uln . we suggest that it is possible to provide significant palliation with minimal side - effects with escalating doses of weekly paclitaxel in such patients .

, many studies were undertaken to evaluate the short term changes , but in recent years the stability of orthognathic surgical procedures has been questioned on a long - term evaluation . therefore , this study is intended to evaluate the stability and relapse of soft and hard tissues following mandibular advancement and mandibular setback surgeries.3,4 pre - surgical ( t1 ) , immediate post - surgical ( t2 ) and long - term post - surgical ( t3 ) cephalograms of 16 adult patients out of which 8 were mandibular advancement , and 8 were mandibular setback , treated with bsso procedure was taken . long term post - surgical cephalograms were taken , minimum of 12 months after surgery . standardized pre - surgical , immediate post - surgical and long term post - surgical profile cephalograms were taken in occlusion under standardized conditions with a cephalostat . various angular and linear parameters of different cephalometric analysis such as burstone s hard and soft tissue , steiner s , mcnamara , holdaway and rakosi jarabak analysis were employed in this study ( tables 1 and 2).5 - 10 hard tissue evaluation . soft tissue evaluation . after cephalometric measurements were made the quantity of changes between t1-t2 and t1-t3 were determined for each patient . the mean difference between t1-t2 and t1-t3 was compared with assess the long - term changes and stability ( figures 1 and 2 ) . superimposition mandibular advancement ( t1 : pre - treatment , t2 : post - surgical , t3 : long term post - surgical ) . pre - surgical ( t1 ) , immediate post - surgical ( t2 ) and long - term post - surgical ( t3 ) cephalograms of 16 adult patients out of which 8 were mandibular advancement , and 8 were mandibular setback , treated with bsso procedure was taken . long term post - surgical cephalograms were taken , minimum of 12 months after surgery . standardized pre - surgical , immediate post - surgical and long term post - surgical profile cephalograms were taken in occlusion under standardized conditions with a cephalostat . various angular and linear parameters of different cephalometric analysis such as burstone s hard and soft tissue , steiner s , mcnamara , holdaway and rakosi jarabak analysis were employed in this study ( tables 1 and 2).5 - 10 hard tissue evaluation . soft tissue evaluation . all radiographs were hand traced on acetate paper and measured by the same person . linear and angular parameters which are mentioned in tables 1 and 2 were used . after cephalometric measurements were made the quantity of changes between t1-t2 and t1-t3 were determined for each patient . the mean difference between t1-t2 and t1-t3 was compared with assess the long - term changes and stability ( figures 1 and 2 ) . superimposition mandibular advancement ( t1 : pre - treatment , t2 : post - surgical , t3 : long term post - surgical ) . long term post - surgical changes compared to pre - surgical changes , and immediate post - surgical changes were compared by paired - t test for mandibular advancement and mandibular setback . further , the amount of relapse in both types of surgeries was compared and analyzed using unpaired t - test . the results are shown as follows in ( graphs 1 - 4 and tables 3 - 7 ) . the interdigitation of the dentition in all three planes determines the positioning of the jaws at surgery and helps in attaining stable results . according to the hierarchy of stability , the most stable surgical procedure was superior repositioning of the maxilla , closely followed by mandibular advancement in patients with decreased or normal anterior facial height . forward movement of the maxilla was reasonably stable , but mandibular setback often was unstable and transverse widening of the maxilla was the least stable procedure . in mandibular advancement as expected , the anb angle showed a significant decrease immediately following surgery and was found to be stable in the long term.9,10 the mean sagittal relapse at hard tissue pogonion was 10% of the sagittal correction which was not significant . vertically , in the short term , the lower anterior facial height increased as evident by an increase in linear measurement given by the parameter ans - gn . this was found to be stable as there was no significant change in the variable in the long - term.7,8 in mandibular setback , there was increase in the anb angle following surgery , but in a long run it showed significant relapse , which is similar to a study reported by mobarak et al . this could be because of several factors that have been cited as responsible for relapse following mandibular setback surgery , including altered activity and failure of masticatory muscles to adapt to the repositioned segment , altered condylar position secondary to rotation or distraction of the proximal segment during fixation , positional change of the tongue with reduced space after setback . lower anterior facial height remained the same from pre - surgical to immediate post - surgical and long term post - surgical , indicating a pure setback of the mandible without any rotation . this was similar to the findings obtained by robinson et al.3 within the mandible : in mandibular advancement in the short term the gonial angle and mandibular plane showed mild opening , which gradually decreased though the amount of change is not clinically significant over the long - term evaluation.11 - 14 in mandibular setback gonial angle and mandible plane remained the same from pre - surgical to immediate post - surgical and , long term post - surgical , indicating a pure setback of the mandible without any rotation . this observed mean stability is most likely due to careful surgical technique in which the muscles were stretched minimally . the bony interface was well - prepared for a close union , and control of the proximal segments was maintained in order to minimize any distal or clockwise rotation as suggested by sorokolit and nanda . although the observed mean vertical changes were not statistically significant , but individual data indicated there was considerable variability of post - surgical vertical changes.15,16 change of 2.0 mm has been accepted as a cutoff value at which post - operative changes begin to be of clinical significance as stated by proffit.17 - 20 several studies have drawn particular attention to the lack of control of the proximal segment , which has 2 aspects : change in the condyle / fossa relationship and rotation of the segment as a whole . schatz and tsimas proposed that the surgeon may seat the condyles too far posteriorly and , since rigid fixation maintains the proximal segment in an upright position , the post - surgical changes are expressed horizontally . in mandibular advancement , the present study showed that in the short term , there were significant changes in the angle of facial convexity and lower face throat angle . there was no change in the nasiolabial angle in the short term and long term , and demonstrated a reduction in lower lip thickness , as well as lengthening and straightening with an accompanying decrease of the mentolabial fold . in relation to chin the area , the soft tissue pogonion , menton and gnathion followed their hard tissue counter parts in the ratio of 1:1 in short and long term , similar to the findings of hunt and rudge ( 1984).11 in mandibular setback , significant variations were found in the angular parameters of n-pog/pog-ls and throat angle . although , the anterior face height was not altered , upper lip flattened similarly to reports by kajikawa . the results of the current study indicate a definite improvement in the facial profile and lip competence from pre - surgical to immediate post - surgical and there are no significant changes from post - surgical to long - term evaluation , which is supported by gjorup and athanasiou ( 1991)17 and suckiel and kohn ( 1978).6 in general , skeletal class iii patients who were treated with surgery experienced minimum change in the soft tissues with a follow - up period of two to three years . however as age advances there is a tendency to have an increase in soft tissue thickness at chin , thinning of the lips and downward sag of the soft tissue profile , which has to be evaluated critically.18 - 20 in mandibular advancement , the present study showed that in the short term , there were significant changes in the angle of facial convexity and lower face throat angle . there was no change in the nasiolabial angle in the short term and long term , and demonstrated a reduction in lower lip thickness , as well as lengthening and straightening with an accompanying decrease of the mentolabial fold . in relation to chin the area , the soft tissue pogonion , menton and gnathion followed their hard tissue counter parts in the ratio of 1:1 in short and long term , similar to the findings of hunt and rudge ( 1984).11 in mandibular setback , significant variations were found in the angular parameters of n-pog/pog-ls and throat angle . although , the anterior face height was not altered , upper lip flattened similarly to reports by kajikawa . the results of the current study indicate a definite improvement in the facial profile and lip competence from pre - surgical to immediate post - surgical and there are no significant changes from post - surgical to long - term evaluation , which is supported by gjorup and athanasiou ( 1991)17 and suckiel and kohn ( 1978).6 in general , skeletal class iii patients who were treated with surgery experienced minimum change in the soft tissues with a follow - up period of two to three years . however as age advances there is a tendency to have an increase in soft tissue thickness at chin , thinning of the lips and downward sag of the soft tissue profile , which has to be evaluated critically.18 - 20 in mandibular advancement the mean difference between pre - surgical and immediate post - surgical is 62% and between pre - surgical and long - term post - surgical is 55% , between immediate post - surgical and long - term post - surgical is 7% , which accounts for a relapse of 7% . the reasons for relapse can be linked to condylar position in the glenoid fossa during internal fixation , lack of proximal segment control at the time of surgery , paramandibular connective tissue tension , advancements more than 7 mm , is associated with the increased tendency of relapse . most of these changes were found to be stable in the long - term . in mandibular setback , the mean difference between pre - surgical and immediate post - surgical is 39% and between pre - surgical and long - term post - surgical is 10% , between immediate post - surgical and long - term post - surgical is 29% , which accounts for a relapse of 29% . the reasons for relapse can be linked to post - surgical pull of the pterygomassetric sling . in the case of mandibular excess , the lever arm of the mandible is shortened with retrusion , increasing mechanical advantage while chewing or biting . on the other hand , muscle fiber length of the pterygomassetric sling this fact probably accounts for the greater relapse tendency of failure of the other masticatory muscles to adapt to the new environment , positional change of the tongue with reduced space after setback , magnitude of setback .

the most rapidly fatal and serious perforation of the gastrointestinal tract . patients with esophageal perforations will often present with vague complaints , making the condition difficult to diagnose and potentially delaying the onset of treatment . even with timely intervention , morbidity and mortality rates remain high perforations detected and treated within 24 hours have seen mortality rates reported as high as 20% . delays in treatment initiation , however , have seen mortality rates approaching 50% . confounding the issue further is the lack of consensus on the management of these injuries a number of different treatment options have been reported with varied results . lately , urgent primary debridement and repair has begun to emerge as having the greatest rate of successful outcomes . in this article , esophageal anatomy , the prevalence of esophageal injury during anterior cervical surgery , clues to diagnose these injuries , and management strategies used in the treatment of esophageal injuries following anterior cervical spine surgery are addressed . case reports and a review of the literature are presented here as part of aospine s rare complication articles . a retrospective , multicenter , case series was performed involving 21 high - volume surgical centers from the aospine north america clinical research network . the charts of 17 625 patients who underwent cervical spine surgery ( from c2 to c7 ) between january 1 , 2005 , and december 31 , 2011 , were examined for the occurrence of predefined surgical complications . the complications included reintubation , esophageal perforation , epidural hematoma , c5 nerve root palsy , recurrent laryngeal nerve palsy , superior laryngeal nerve palsy , hypoglossal or glossopharyngeal nerve palsy , durotomy , brachial plexopathy , blindness , graft extrusion , malpositioned screws requiring reoperation , anterior cervical infection , carotid artery injury or cerebrovascular accident , vertebral artery injuries , horner s syndrome , thoracic duct injury , tetraplegia , intraoperative death , revision of arthroplasty , and pseudomeningocele . data were abstracted by trained research staff at each institution and then transcribed into study - specific case report forms . the case report forms were then transferred to the aospine north america research network methodological core for processing and data entry . of the 17 625 patients who underwent cervical spine surgery during the assigned time period , 9591 were identified as having had an anterior cervical procedure . charts , images , operative reports , notes , and narratives were then examined to identify esophageal perforations . only 2 cases ( 0.02% ) were noted both occurred at the time of the index procedure and both were addressed in the acute postoperative period . the first patient who sustained an esophageal perforation was a 52-year - old male who presented with right deltoid weakness . he underwent a corpectomy of c5 ; a small esophageal tear was noted intraoperatively and otolaryngology was called in to perform a repair . after 3 weeks , a liquid diet was started and was advanced to a full diet as tolerated . the patient healed uneventfully from that point forward ; however , his deltoid weakness persisted . the second case occurred in a 61-year - old male with ankylosing spondylitis who sustained a fracture of c6 and c7 . he was treated with a multilevel anterior discectomy and fusion with supplemental posterior fixation incorporating the upper thoracic spine . he awoke paraplegic and was noted to have erythema and drainage of the anterior incision postoperatively . on postoperative day 14 , an upper endoscopy was performed , which detected an esophageal injury . the patient was taken to the operating room where a primary repair and pectoralis flap were performed . subsequently , he continued to deteriorate and the wound was noted to be colonized with a multidrug resistant pseudomonas species ; he went on to develop sepsis and multi - organ system failure . after 72 days in the hospital , the family elected to withdraw care and the patient expired . the first patient who sustained an esophageal perforation was a 52-year - old male who presented with right deltoid weakness . he underwent a corpectomy of c5 ; a small esophageal tear was noted intraoperatively and otolaryngology was called in to perform a repair . after 3 weeks , a liquid diet was started and was advanced to a full diet as tolerated . the patient healed uneventfully from that point forward ; however , his deltoid weakness persisted . the second case occurred in a 61-year - old male with ankylosing spondylitis who sustained a fracture of c6 and c7 . he was treated with a multilevel anterior discectomy and fusion with supplemental posterior fixation incorporating the upper thoracic spine . he awoke paraplegic and was noted to have erythema and drainage of the anterior incision postoperatively . on postoperative day 14 , an upper endoscopy was performed , which detected an esophageal injury . the patient was taken to the operating room where a primary repair and pectoralis flap were performed . subsequently , he continued to deteriorate and the wound was noted to be colonized with a multidrug resistant pseudomonas species ; he went on to develop sepsis and multi - organ system failure . after 72 days in the hospital , the family elected to withdraw care and the patient expired . the esophagus , lying directly anterior to the cervical spine , requires mobilization during anterior cervical spine surgery . though its precarious position makes the esophagus somewhat vulnerable to injury , several anatomic layers must be disrupted in order to introduce the contents of the esophageal lumen to the retropharyngeal and prevertebral spaces . adventitia overlies the outermost esophageal layer , thereby protecting the longitudinal and circular muscle underneath , as well as the submucosal and mucosal layers , respectively . aggressive or improper retraction of the esophagus may result in injury of these layers during anterior cervical surgery . the area of the esophagus most vulnerable to injury is known as killian s triangle , which is formed by the junction of the paired inferior constrictor pharyngeus muscles , and the cricopharyngeus . this region , which usually lies anterior to the c5/c6 disc but is occasionally found more caudally , is particularly susceptible to injury since the posterior esophageal mucosa lacks muscular protection . here , only the thin buccopharyngeal fascia separates the esophagus from the retroesophageal space . a second area of esophageal weakness is located laterally at the level of the thyrohyoid membrane . esophageal injuries are more likely to occur at these 2 specific locations . esophageal perforations located in the cervical spine are generally considered less dangerous than esophageal injuries located in the thoracic region cervical injuries tend to have a slower spread into the mediastinum , in part because thoracic injuries are subject to the negative pressures generated during inspiration . the majority of esophageal injuries are found to be iatrogenic , though lesions secondary to foreign bodies , trauma , and spontaneous perforations have all been reported in the literature . inadvertent contact with a knife , high speed burr , and misuse of electrocautery have also been cited as potential sources of esophageal injury . caution during the initial exposure coupled with judicious retractor placement has been suggested to help minimize esophageal injury . furthermore , placing the retractor blades under the longus colli muscle can help prevent inadvertent esophageal escape during the procedure , thereby minimizing injury . in our series , only 2 cases of esophageal injury were reported in 9591 patients . this is somewhat lower ( 0.02% ) than previously described in the literature but is consistent with others findings of an overall very low incidence . first , surgeons contributing to the aospine north america clinical research network represent some of the most experienced surgeons in the country . combining this experience with the advanced facilities available at the large academic institutions where these data were collected may have served to lower the prevalence of esophageal injury seen in our cohort . second , our study design retrospectively identified these injuries based on medical record and chart review . though these injuries are rare and likely to be remembered by most surgeons , collecting these data prospectively may have detected more cases . the literature reveals that most cases of esophageal perforation are discovered at the time of surgery , or during the acute or subacute postoperative period ( table 1 ) . fountas et al reviewed 1015 primary anterior cervical surgeries performed at their institution and reported 3 esophageal perforations . the third patient was diagnosed on the second postoperative day and underwent primary repair along with mediastinal irrigation and debridement . unfortunately , the patient expired 10 days after surgery , emphasizing the importance of early recognition . in the largest series described in the literature , gaudinez s group reported 44 esophageal perforations seen in 2946 patients treated at a single regional spinal cord injury referral center over a 25-year period ; all patients had undergone surgery for cervical fractures at other institutions . they found that 77% of the esophageal injuries were at least in part related to patients anterior cervical spine surgery . forty - two of the 44 patients ( 95% ) underwent repair of the esophagus , with 4 patients requiring 2 or more procedures . they also noted that the length of hospital stay averaged 253 days in patients with esophageal perforations . abbreviations : abx , antibiotics ; npo , nil per os ( nothing by mouth ) . lu and colleagues reported their experience over a 10-year period during that time , 6 esophageal perforations were discovered in 1045 anterior cervical surgeries ; only one of those perforations was noted intraoperatively . three of the cases were diagnosed between 7 and 18 days after surgery , and the remaining 2 cases presented years after the index procedure . of note , 4 of the perforations occurred at c5/c6 , and 2 at c6/c7 , highlighting the aforementioned areas of esophageal anatomic vulnerability . with the help of the cervical spine research society , newhouse s group retrospectively collected data on 22 cases of esophageal perforation from multiple institutions . in that series , they noted that 6 of 22 cases of esophageal perforation were diagnosed at the time of surgery . an additional 6 cases were found during the acute postoperative period , and another 10 were discovered over a period of weeks to months . only 1 of the 22 cases resulted in a fatality . the location of the tear was reported in 16 of the 22 cases11 tears ( 68.8% ) were found between c5 and c7 . also of note , less than a third of reported cases were noted to have occurred intraoperatively ; more than two thirds of the cases presented in a delayed fashion and were felt to be due to prominence of metal , bone , or cement ( figures 1 and 2 ) . the esophagus is retracted medially exposing the cervical instrumentation . patel et al reviewed the prevalence of esophageal perforations in 3000 patients who had undergone anterior cervical surgery performed by 5 surgeons over a 30-year period . all 3 cases were diagnosed during the acute postoperative period , and all 3 perforations occurred on the posterior portion of the esophagus at the c5/c6 interspace . their report noted that 2 of the 3 patients had predisposing risk factors antecedent cervical spine trauma and diverticulae . a 20-year retrospective cohort study detailing 1097 cases was conducted by zhong et al . his group identified 5 patients with esophageal perforations that occurred at their institution , as well as one that occurred elsewhere but was managed at their facility . all the patients in their series were diagnosed in the early postoperative period , and all but one survived the 6 patients were all treated with a nasogastric tube , intravenous antibiotics , enteral and parenteral nutrition , and surgical irrigation and debridement . recently , a number of reports have highlighted the incidence of esophageal perforations presenting in a delayed fashion . many of these delayed presentations happen within the first 18 months after surgery ; however some groups have reported perforations occurring many years following the index procedure . gazzeri et al described the migration of a screw that caused perforation 11 years after the index procedure . in their report , they found initial screw pull out , followed by complete expulsion and entry into the digestive tract occurring over a period of just 6 days . though uncommon , other reports of patients presenting after many years is not unheard of : kim and colleagues reported an esophageal perforation that developed 8 years after the index procedure ; lu , tian , and solerio each described a perforation at 7 years after the index procedure ; and woolley reported a perforation seen 5 years postoperatively . patients may present with anything from no signs or symptoms at all , to florid sepsis and respiratory distress . yee reported an asymptomatic individual who was found to have a screw missing from his anterior cervical construct on a postoperative radiograph 3 months after surgery ; further imaging located the screw in the intestinal tract . the patient did not recall any symptoms related to dysphagia , odynophagia , neck pain , or cough . a similar case was reported by pompili et al his group described an asymptomatic patient who presented after 1 year with a screw seen backing out of the anterior cervical construct . the patient was followed with serial radiographs , which revealed the disappearance of the screw 6 months later . further imaging failed to locate the hardware and it was presumed to have entered the gastrointestinal tract and exited the patient . this situation is rare however , as most patients typically complain of dysphagia , neck pain or fullness , pharyngeal pain , odynophagia , or present with fever or subcutaneous emphysema . a clinical triad consisting of vomiting , chest pain , and subcutaneous emphysema is seen in about 25% of patients with esophageal perforation this is known as mackler s triad ; this triad is less commonly seen in patients with tears in the cervical esophagus than those occurring in the thoracic esophagus . early diagnosis and intervention has been shown to reduce morbidity and mortality , so any intraoperative suspicion should warrant immediate further investigation . taylor et al examined the use of methylene blue administered directly into the esophagus to detect perforations intraoperatively . this method was found to have an unacceptably high rate of false negatives when using just a single nasogastric tube ; their group described a technique whereby one or more foley catheters are inflated proximal and distal to the area in question in order to improve the detection rates . this technique improved the rates of detection but failed to identify many of the lesions , leading to the conclusion that a negative exam can not rule out an esophageal perforation . if a tear is suspected intraoperatively , but not visualized using methylene blue , postoperative imaging and otolaryngology consultation is recommended . postoperatively , a number of imaging modalities have been used to help determine the presence of an esophageal disruption . computed tomography , magnetic resonance imaging , plain radiographs , esophagoscopy , contrast esophagram , endoscopy , and sinugram are just some of the tools that have been used to diagnose a perforated esophagus . plain radiographs may reveal subcutaneous emphysema or prevertebral air ; however , this finding is not ubiquitous and is therefore not reliable . contrast swallow studies have been utilized with some success ; others , however , have failed to demonstrate consistent detection of esophageal defects . they noted that a tear was visualized on at least one modality in only 32 of the 44 patients ( 72.7% ) and that 10 of the 44 patients ( 22.7% ) had imaging studies that were read as negative for perforation . in their series , endoscopic exams were performed on 40 of the 44 patients a firm diagnosis of esophageal perforation was made in only 28 of the 40 ( 63.6% ) . though often recommended and performed , esophagoscopy remains controversial as it can exacerbate a small perforation and may miss perforations hidden in mucosal folds . computed tomography and magnetic resonance imaging may reveal brooding infections or subcutaneous air but will often fail to detect acute injuries . lu s group recommended contrast swallow studies , noting that 4 of the 6 patients in their cohort were diagnosed using contrast esophagrams ; the 2 other patients were seen to have food residue leaking from the surgical incision , obviating the need for further diagnostic workup . many different treatment modalities have been utilized in the management of esophageal perforations occurring during anterior cervical surgery . nonoperative management with antibiotics , nasogastric placement , and esophageal diversion has a very limited role ; the general consensus is that surgical debridement and an attempt at closure is warranted . rueth and colleagues described their experience treating 6 esophageal perforations resulting from anterior cervical spine surgery . their group proposed an algorithm beginning with early neck exploration and wide surgical debridement ( see figure 3 ) . they stated that an attempt should be made at a primary closure , but did not find this to be critical . they reported a high rate of resolution when leaving the wound open to facilitate drainage , whereas closed wound management led to recurrence . none of their 6 patients required flaps , though one patient expired secondary to respiratory failure which was present upon initial transfer to their institution . proposed algorithm in the management of esophageal injuries following anterior cervical spine surgery . benazzo et al reported the results of using a sternocleidomastoid flap for esophageal repair following injuries incurred during anterior cervical spine surgery . three patients sustained an intraoperative esophageal perforation in their series . the mean time to diagnosis was 4 days , and all patients underwent subsequent irrigation and debridement , and treatment with antibiotics . a plan for definitive reconstruction with a sternocleidomastoid muscle flap was made , and the mean time from diagnosis to definitive treatment was 44.3 days . oral feeding resumed at an average of 17.6 days after flap reconstruction , and the mean hospital stay was 19 days . no recurrences were seen . despite the successful outcomes with sternocleidomastoid flaps noted in some studies , there has been some concern regarding the flaps vascular reliability . for this reason and others , recently , hanwright et al examined their experience over an 18-year period performing flap reconstruction for patients with esophageal injuries secondary to anterior cervical spine surgery . five different types of flaps were attempted ; altogether 13 flaps were performed in 11 patients . they concluded that using a free omentum flap was associated with a significantly faster functional recovery in comparison to several other types of flaps ; resumption to oral feeding averaged 22.5 days in the omental flap group versus 268 days in the group receiving other types of flaps ( p < .05 ) . bhatia et al reported their management of esophageal perforations due to varying etiologies over a 27-year period . of 119 patients with esophageal tears , 15 were found in the cervical region , and 14 of the 15 were iatrogenic ( this includes those caused by endoscopy as well as anterior cervical surgery ) . contrary to previous reports , their group found that the overall mortality rate was more closely related to the preoperative morbidity of the patient rather than the time to diagnosis or the time to treatment of the perforation . in their report , the average time from diagnosis of the esophageal tear to treatment was 37 hours in the cervical group ; 2 of the 15 patients in that group died . they found the average length of hospital stay was 25.1 days , and 7 of those days were spent in the intensive care unit . they concluded that patients with preoperative sepsis , ventilator dependency , and multiple medical comorbidities ( especially pulmonary ) were found to have significantly worse outcomes . the esophagus , lying directly anterior to the cervical spine , requires mobilization during anterior cervical spine surgery . though its precarious position makes the esophagus somewhat vulnerable to injury , several anatomic layers must be disrupted in order to introduce the contents of the esophageal lumen to the retropharyngeal and prevertebral spaces . adventitia overlies the outermost esophageal layer , thereby protecting the longitudinal and circular muscle underneath , as well as the submucosal and mucosal layers , respectively . aggressive or improper retraction of the esophagus may result in injury of these layers during anterior cervical surgery . the area of the esophagus most vulnerable to injury is known as killian s triangle , which is formed by the junction of the paired inferior constrictor pharyngeus muscles , and the cricopharyngeus . this region , which usually lies anterior to the c5/c6 disc but is occasionally found more caudally , is particularly susceptible to injury since the posterior esophageal mucosa lacks muscular protection . here , only the thin buccopharyngeal fascia separates the esophagus from the retroesophageal space . a second area of esophageal weakness is located laterally at the level of the thyrohyoid membrane . esophageal injuries are more likely to occur at these 2 specific locations . esophageal perforations located in the cervical spine are generally considered less dangerous than esophageal injuries located in the thoracic region cervical injuries tend to have a slower spread into the mediastinum , in part because thoracic injuries are subject to the negative pressures generated during inspiration . the majority of esophageal injuries are found to be iatrogenic , though lesions secondary to foreign bodies , trauma , and spontaneous perforations have all been reported in the literature . inadvertent contact with a knife , high speed burr , and misuse of electrocautery have also been cited as potential sources of esophageal injury . caution during the initial exposure coupled with judicious retractor placement has been suggested to help minimize esophageal injury . furthermore , placing the retractor blades under the longus colli muscle can help prevent inadvertent esophageal escape during the procedure , thereby minimizing injury . in our series , only 2 cases of esophageal injury were reported in 9591 patients . this is somewhat lower ( 0.02% ) than previously described in the literature but is consistent with others findings of an overall very low incidence . first , surgeons contributing to the aospine north america clinical research network represent some of the most experienced surgeons in the country . combining this experience with the advanced facilities available at the large academic institutions where these data were collected may have served to lower the prevalence of esophageal injury seen in our cohort . second , our study design retrospectively identified these injuries based on medical record and chart review . though these injuries are rare and likely to be remembered by most surgeons , collecting these data prospectively may have detected more cases . the literature reveals that most cases of esophageal perforation are discovered at the time of surgery , or during the acute or subacute postoperative period ( table 1 ) . fountas et al reviewed 1015 primary anterior cervical surgeries performed at their institution and reported 3 esophageal perforations . the third patient was diagnosed on the second postoperative day and underwent primary repair along with mediastinal irrigation and debridement . unfortunately , the patient expired 10 days after surgery , emphasizing the importance of early recognition . in the largest series described in the literature , gaudinez s group reported 44 esophageal perforations seen in 2946 patients treated at a single regional spinal cord injury referral center over a 25-year period ; all patients had undergone surgery for cervical fractures at other institutions . they found that 77% of the esophageal injuries were at least in part related to patients anterior cervical spine surgery . forty - two of the 44 patients ( 95% ) underwent repair of the esophagus , with 4 patients requiring 2 or more procedures . they also noted that the length of hospital stay averaged 253 days in patients with esophageal perforations . abbreviations : abx , antibiotics ; npo , nil per os ( nothing by mouth ) . lu and colleagues reported their experience over a 10-year period during that time , 6 esophageal perforations were discovered in 1045 anterior cervical surgeries ; only one of those perforations was noted intraoperatively . three of the cases were diagnosed between 7 and 18 days after surgery , and the remaining 2 cases presented years after the index procedure . of note , 4 of the perforations occurred at c5/c6 , and 2 at c6/c7 , highlighting the aforementioned areas of esophageal anatomic vulnerability . with the help of the cervical spine research society , newhouse s group retrospectively collected data on 22 cases of esophageal perforation from multiple institutions . in that series , they noted that 6 of 22 cases of esophageal perforation were diagnosed at the time of surgery . an additional 6 cases were found during the acute postoperative period , and another 10 were discovered over a period of weeks to months . only 1 of the 22 cases resulted in a fatality . the location of the tear was reported in 16 of the 22 cases11 tears ( 68.8% ) were found between c5 and c7 . also of note , less than a third of reported cases were noted to have occurred intraoperatively ; more than two thirds of the cases presented in a delayed fashion and were felt to be due to prominence of metal , bone , or cement ( figures 1 and 2 ) . patel et al reviewed the prevalence of esophageal perforations in 3000 patients who had undergone anterior cervical surgery performed by 5 surgeons over a 30-year period . all 3 cases were diagnosed during the acute postoperative period , and all 3 perforations occurred on the posterior portion of the esophagus at the c5/c6 interspace . their report noted that 2 of the 3 patients had predisposing risk factors antecedent cervical spine trauma and diverticulae . a 20-year retrospective cohort study detailing 1097 cases was conducted by zhong et al . his group identified 5 patients with esophageal perforations that occurred at their institution , as well as one that occurred elsewhere but was managed at their facility . all the patients in their series were diagnosed in the early postoperative period , and all but one survived the 6 patients were all treated with a nasogastric tube , intravenous antibiotics , enteral and parenteral nutrition , and surgical irrigation and debridement . recently , a number of reports have highlighted the incidence of esophageal perforations presenting in a delayed fashion . many of these delayed presentations happen within the first 18 months after surgery ; however some groups have reported perforations occurring many years following the index procedure . gazzeri et al described the migration of a screw that caused perforation 11 years after the index procedure . in their report , they found initial screw pull out , followed by complete expulsion and entry into the digestive tract occurring over a period of just 6 days . though uncommon , other reports of patients presenting after many years is not unheard of : kim and colleagues reported an esophageal perforation that developed 8 years after the index procedure ; lu , tian , and solerio each described a perforation at 7 years after the index procedure ; and woolley reported a perforation seen 5 years postoperatively . patients may present with anything from no signs or symptoms at all , to florid sepsis and respiratory distress . yee reported an asymptomatic individual who was found to have a screw missing from his anterior cervical construct on a postoperative radiograph 3 months after surgery ; further imaging located the screw in the intestinal tract . the patient did not recall any symptoms related to dysphagia , odynophagia , neck pain , or cough . a similar case was reported by pompili et al his group described an asymptomatic patient who presented after 1 year with a screw seen backing out of the anterior cervical construct . the patient was followed with serial radiographs , which revealed the disappearance of the screw 6 months later . further imaging failed to locate the hardware and it was presumed to have entered the gastrointestinal tract and exited the patient . this situation is rare however , as most patients typically complain of dysphagia , neck pain or fullness , pharyngeal pain , odynophagia , or present with fever or subcutaneous emphysema . a clinical triad consisting of vomiting , chest pain , and subcutaneous emphysema is seen in about 25% of patients with esophageal perforation this is known as mackler s triad ; this triad is less commonly seen in patients with tears in the cervical esophagus than those occurring in the thoracic esophagus . early diagnosis and intervention has been shown to reduce morbidity and mortality , so any intraoperative suspicion should warrant immediate further investigation . taylor et al examined the use of methylene blue administered directly into the esophagus to detect perforations intraoperatively . this method was found to have an unacceptably high rate of false negatives when using just a single nasogastric tube ; their group described a technique whereby one or more foley catheters are inflated proximal and distal to the area in question in order to improve the detection rates . this technique improved the rates of detection but failed to identify many of the lesions , leading to the conclusion that a negative exam can not rule out an esophageal perforation . if a tear is suspected intraoperatively , but not visualized using methylene blue , postoperative imaging and otolaryngology consultation is recommended . postoperatively , a number of imaging modalities have been used to help determine the presence of an esophageal disruption . computed tomography , magnetic resonance imaging , plain radiographs , esophagoscopy , contrast esophagram , endoscopy , and sinugram are just some of the tools that have been used to diagnose a perforated esophagus . plain radiographs may reveal subcutaneous emphysema or prevertebral air ; however , this finding is not ubiquitous and is therefore not reliable . contrast swallow studies have been utilized with some success ; others , however , have failed to demonstrate consistent detection of esophageal defects . they noted that a tear was visualized on at least one modality in only 32 of the 44 patients ( 72.7% ) and that 10 of the 44 patients ( 22.7% ) had imaging studies that were read as negative for perforation . in their series , endoscopic exams were performed on 40 of the 44 patients a firm diagnosis of esophageal perforation was made in only 28 of the 40 ( 63.6% ) . eight of the 44 patients were diagnosed only during surgical exploration of the neck . though often recommended and performed , esophagoscopy remains controversial as it can exacerbate a small perforation and may miss perforations hidden in mucosal folds . computed tomography and magnetic resonance imaging may reveal brooding infections or subcutaneous air but will often fail to detect acute injuries . lu s group recommended contrast swallow studies , noting that 4 of the 6 patients in their cohort were diagnosed using contrast esophagrams ; the 2 other patients were seen to have food residue leaking from the surgical incision , obviating the need for further diagnostic workup . many different treatment modalities have been utilized in the management of esophageal perforations occurring during anterior cervical surgery . nonoperative management with antibiotics , nasogastric placement , and esophageal diversion has a very limited role ; the general consensus is that surgical debridement and an attempt at closure is warranted . rueth and colleagues described their experience treating 6 esophageal perforations resulting from anterior cervical spine surgery . their group proposed an algorithm beginning with early neck exploration and wide surgical debridement ( see figure 3 ) . they stated that an attempt should be made at a primary closure , but did not find this to be critical . they reported a high rate of resolution when leaving the wound open to facilitate drainage , whereas closed wound management led to recurrence . none of their 6 patients required flaps , though one patient expired secondary to respiratory failure which was present upon initial transfer to their institution . proposed algorithm in the management of esophageal injuries following anterior cervical spine surgery . benazzo et al reported the results of using a sternocleidomastoid flap for esophageal repair following injuries incurred during anterior cervical spine surgery . three patients sustained an intraoperative esophageal perforation in their series . the mean time to diagnosis was 4 days , and all patients underwent subsequent irrigation and debridement , and treatment with antibiotics . a plan for definitive reconstruction with a sternocleidomastoid muscle flap was made , and the mean time from diagnosis to definitive treatment was 44.3 days . oral feeding resumed at an average of 17.6 days after flap reconstruction , and the mean hospital stay was 19 days . no recurrences were seen . despite the successful outcomes with sternocleidomastoid flaps noted in some studies , there has been some concern regarding the flaps vascular reliability . for this reason and others , recently , hanwright et al examined their experience over an 18-year period performing flap reconstruction for patients with esophageal injuries secondary to anterior cervical spine surgery . five different types of flaps were attempted ; altogether 13 flaps were performed in 11 patients . they concluded that using a free omentum flap was associated with a significantly faster functional recovery in comparison to several other types of flaps ; resumption to oral feeding averaged 22.5 days in the omental flap group versus 268 days in the group receiving other types of flaps ( p < .05 ) . bhatia et al reported their management of esophageal perforations due to varying etiologies over a 27-year period . of 119 patients with esophageal tears , 15 were found in the cervical region , and 14 of the 15 were iatrogenic ( this includes those caused by endoscopy as well as anterior cervical surgery ) . contrary to previous reports , their group found that the overall mortality rate was more closely related to the preoperative morbidity of the patient rather than the time to diagnosis or the time to treatment of the perforation . in their report , the average time from diagnosis of the esophageal tear to treatment was 37 hours in the cervical group ; 2 of the 15 patients in that group died . they found the average length of hospital stay was 25.1 days , and 7 of those days were spent in the intensive care unit . they concluded that patients with preoperative sepsis , ventilator dependency , and multiple medical comorbidities ( especially pulmonary ) were found to have significantly worse outcomes . most esophageal perforations occur at portions of the esophagus that are known to be structurally vulnerable . meticulous surgical dissection , judicious retractor placement , and cautious use of electrocautery and high - speed drills can minimize intraoperative esophageal injury . a small percentage of esophageal perforations will present months or even years after anterior cervical surgery , and the surgeon must remain aware of this possibility . the majority of patients with esophageal perforations will present with symptoms of dysphagia , neck pain , odynophagia , or drainage . imaging studies such as contrast esophagraphy can be helpful but are often unreliable a high clinical suspicion despite negative imaging studies may warrant surgical exploration . the presence of subcutaneous emphysema is concerning for an esophageal perforation . if a perforation is detected , aggressive management should be taken and many strategies have been employed . broad spectrum antibiotics , esophageal diversion ( with consideration for percutaneous endoscopic gastrotomy tube placement ) , and surgical exploration with irrigation and debridement are all considerations in the acute management of an esophageal tear . primary repair has been successful , and multiple flap options exist to aid in the closure of a defect . with prompt , aggressive management , long - term morbidity and mortality from these injuries can be reduced .

in order to isolate neuraminidase inhibitors , the fruiting bodies of p. igniarius were extracted using methanol for 2 days at room temperature . the methanolic extract was concentrated under reduced pressure , and the resultant residue was partitioned twice with ethyl acetate . the ethyl acetate - soluble layer was subjected to sephadex lh-20 column chromatography ( pharmacia , uppsala , sweden ) eluted with methanol to yield two active fractions . one active fraction was further purified by sephadex lh-20 column chromatography eluted with 70% aqueous methanol to provide compound 1 . the other fraction was subjected to sephadex lh-20 column chromatography with 70% aqueous methanol as the eluting solvent to yield compound 2 . the chemical structures of compounds 1 and 2 were determined via electrospray ionization ( esi)-mass and proton nuclear magnetic resonance ( h nmr ) spectrum measurements . the molecular weight of compound 1 was 474 on esi - mass measurement , where it exhibited a quasimolecular ion peak at m / z 475 [ m+h ] . the h nmr spectrum of 1 in dmso - d6 demonstrated seven methine protons at 8.24 , 7.85 , 7.47 , 6.97 , 6.61 , 6.15 , and 6.09 and one methyl signal at 2.50 . based on literature review , compound 1 was identified as phelligridin e ; the molecular weight and h chemical shift values were in good agreement with those previously reported for phelligridin e . the chemical structure of compound 2 was also determined via esi - mass and h nmr spectrum measurements . the molecular weight of compound 2 was 594 on esi - mass measurement , and it demonstrated a quasi - molecular ion peak at m / z 595 [ m+h ] . the h nmr spectrum of compound 2 in dmso - d6 showed three aromatic methine signals assignable to a 1,2,4-trisubstituted benzene moiety at 7.17 ( d , j = 2.1 hz ) , 7.10 ( dd , j = 8.2 , 2.1 hz ) , and 6.79 ( d , j = 8.2 hz ) , two olefinic methine peaks attributable to a trans-1,2-disubstituted double bond at 7.54 ( d , j = 16.2 hz ) and 7.10 ( d , j = 16.2 hz ) , and seven methine singlets at 8.28 , 7.86 , 7.48 , 7.01 , 6.64 , 6.25 , and 6.02 . these spectral data were consistent with those of phelligridin g previously reported in the literature . therefore , compounds 1 and 2 were identified as phelligridin e and phelligridin g , respectively , as shown in fig . 1 . the inhibitory activity of compounds 1 and 2 against neuraminidases from recombinant rvh1n1 , h3n2 , and h5n1 influenza viruses was evaluated . neuraminidase inhibition assay was performed in 96-well plates as previously described , with some modifications . briefly , the substrate , 50 l of 0.2 mm munana ( 2-(4-methylumbelliferyl)--d - n - acetylneuraminic acid sodium salt ; sigma , st . louis , mo , usa ) , was mixed with 90 l of 50 mm tris buffer ( containing 200 mm nacl , 5 mm cacl2 , ph 7.5 ) at room temperature . ten microliters of the sample and 50 l of h1n1 neuraminidase ( 50 ng / ml ) were added to each well . the mixture was then recorded at the excitation and emission wavelengths of 365 nm and 445 nm , respectively , using a polar optima ( bmg labtech , ortenberg , germany ) . in the case of h3n2 and h5n1 neuraminidases , 25 mm mes buffer ( containing 500 mm nacl , 5 mm cacl2 , ph 6.5 ) and 50 mm mes buffer ( containing 500 mm nacl , 5 mm cacl2 , ph 6.5 ) were used , respectively , and h5n1 required an activation period of 24 hr at 37 before assay . compounds 1 and 2 showed h3n2 neuraminidase inhibition activity with an ic50 value of 6.7 m , respectively , in a dose - dependent manner . inhibitory activity of compounds 1 and 2 against h1n1 and h5n1 neuramanidases were also evaluated . these compounds significantly inhibited the h1n1 and h5n1 neuramanidases with ic50 values in the range of 8.0~1.0 m in a dose - dependent manner ( table 1 ) . to study the mode of inhibition , dixon plots were used to distinguish the mechanism of neuraminidase enzyme action and to confirm the inhibition constant ( ki ) . compounds 1 and 2 displayed noncompetitive inhibitory activity , as indicated by a decrease in vmax while km remained stable at increasing inhibitor concentrations . the inhibition constant ( ki ) values of compounds 1 and 2 were 7.1 0.3 and 6.9 0.3 , respectively ( fig .

the current classification of periodontal diseases includes accidental , iatrogenic , and factitious traumatic lesions . traumatic lesions , whether chemical , physical , or thermal induced , are seen very common in the oral cavity . although the prevalence of traumatic lesion on the gingiva is not known , it has been suggested that gingival presentations are rare for traumatic lesions . rawal concluded that a detailed and accurate history is critical for the diagnosis of traumatic injuries . the severity and extent of lesions caused by chemical agents depends on the concentration , type , and quantity of the substance , as well as the time of contact with the oral soft tissues . they are a group of antibiotics produced naturally from certain species of streptomyces or semi synthetically derived . there are a few case reports in the dental literature on chemical burns induced due to aspirin ; hydrogen peroxide ; sodium hypochlorite ; silver nitrate . but the purpose of this case report was to illustrate the destructive nature of the self - inflicted mucogingival chemical burn and to describe its successful management . a male patient aged 65 years reported to the department of periodontics , k. v. g dental college and hospital , sullia , on september 29 , 2011 complaining of bleeding and swollen upper and lower gums with pain since six months . on clinical examination , the gingiva was red in color , soft , and edematous in consistency with spontaneous bleeding on probing . the size of the gingiva was enlarged with severe calculus deposit and probing pocket depth measuring 6 mm with exudation on digital pressure . the patient was advised to rinse his mouth with chlorhexidine 0.12% mouth wash and was advised to carry out the following hematological investigation like fasting blood sugar , bleeding time , clotting time , differential count , and total count . the test was advised prior to the treatment so as to rule out any systemic condition and patient was advised to report to the department for the necessary periodontal treatment next day . on september 30 , 2011 , the patient reported as per the scheduled appointment . on extraoral examination , face was symmetrical with no palpable lymph nodes . on clinical examination , gingiva was covered with a loosely adherent yellowish white slough on the attached gingiva extending from lower canine to canine on the labial surface [ figure 2 ] . the lesion extended apically to the alveolar mucosa up to the vestibule with erythematous margins . history about placement of any tablet or medicine or application of any medicament was elicited . on detailed questioning , the patient disclosed that he had visited a local physician for the routine general check up on the previous day . he also casually mentioned about mild pain and suppuration of the gums and his appointment with dentist for scaling next day . the overzealous physician prescribed tetracycline hydrochloride capsule , 250 mg four times a day for three days . the patient was instructed to ingest the medicine with water . instead of consuming with water , the patient had opened the capsule and placed its content directly in the vestibule for 10 minutes , anticipating rapid relief . the chemical burn involving the mucogingival area was managed with periogard 0.12% chlorhexidine gluconate to rinse twice daily for seven days and non - steroidal anti - inflammatory drug , diclofenac sodium 50 mg twice daily for three days . the patient was asked to report to the department after seven days for follow up . but the patient reported after fifteen days with severity of the burn and pain reducing significantly [ figure 3 ] . the lesion was cleaned with cotton soaked in saline to facilitate faster healing and to induce bleeding . the patient was asked to report the department the very next week . on clinical examination , gingiva , alveolar mucosa , and the vestibule returned to normal [ figures 4 and 5 ] tetracycline hydrochloride burn partial healing after 15 days healing after 1 month complete healing after 45 days this is due to the placement of tetracycline hydrochloride 250 mg in direct contact with the soft tissue due to misconception by the patient , believing that placement of medicine in direct proximity with the tissue will result rapid pain relief . in the oral cavity , chemical substances cause diffuse erosive lesions ranging from simple desquamation ( slough of mucosa ) to complete obliteration of the oral mucosa with extension past the basement membrane into the submucosa . in this patient , the intraoral examination revealed severe gingival and mucosal burn with diffuse sloughing of the lower anterior mucosa extending from canine to canine . although the prevalence of traumatic lesions on gingiva is not known , clinical reports have singled out certain chemical substances causing oral mucosal burn . among the commonly implicated substances are the aspirin ; hydrogen peroxide ; garlic ; silver nitrate ; phenol ; and endodontic materials such as sodium hypochlorite and calcium hydroxide.[69 ] chemical damage to oral tissue is dependent on a variety of factors which include the strength ( ph ) or concentration of the material , the quantity ingested , the manner and duration of tissue contact , the extent of penetration into tissue , and the mechanism of action . aspirin also known as acetylsalicylic acid is a salicylate drug often used as an analgesic . glick et al . stated that aspirin burn is caused by the acetyl salicylic acid 's ph of 3.3 . due to the acidic nature of the salicylic acid , when the drug comes in direct contact with the oral soft tissue , it might lead to aspirin burn . the case was managed by gently cleansing the area and rinsing with chlorhexidine 0.12% and analgesic . according to rees et al . , improper use of hydrogen peroxide at a concentration greater than 3% can lead to epithelial necrosis . in such case , the patient is asked to discontinue undiluted hydrogen peroxide and the area is gently rinsed with saline to remove the necrotic tissue . the management of this case was by local application of topical anesthetic and antibacterial agent . silver nitrate is commonly used as a chemical cautery agent for the treatment of aphthous ulcer . according to frost , it brings about almost instantaneous relief of the symptom by burning the nerve endings at the site of ulcer . silver nitrate often destroys tissue around the immediate area of application and may result in delayed healing or ( rarely ) severe necrosis at the application site . reported that improper use of sodium hypochlorite or dental bleach which is commonly used as a root canal irrigant may cause serious ulcerations due to accidental contact with oral soft tissue . the proper use of rubber dam during endodontic procedure can reduce the risk of chemical or iatrogenic injuries . reported an unusual chemical burn confined to the masticatory mucosa produced by the abusive ingestion of fresh fruit and by the concomitant excessive use of mouth wash . baruchin et al . reported that a protective emollient agent such as a film of methyl cellulose may provide relief . according to yano et al . , irrigation is the emergency treatment of choice to minimize the product effect and current therapy with steroids results in a very favorable prognosis . patient may be unaware of the significance of the potentially injurious habits , practices , or agents . the present report illustrates that tetracycline hydrochloride 250 mg placed in close proximity to tissue lead to severe caustic burns of the oral mucosa in that area . in this particular case , acidic ph of tetracycline hydrochloride might have caused extensive tissue damage , which was managed effectively using saline and betadine irrigation , chlorhexidine gluconate 0.12% mouth rinse , and systemic analgesics . the early detection by the patient and the immediate institution of therapeutic measures ensured a rapid relief and possibly prevented further mucosal damage . in addition , we believe that guidance and proper counseling before prescribing any drug , its method of ingestion should be explained to the patient . this will prove to be an important prophylactic tool in preventing from these local self - inflicting injuries . this article illustrates a rare case of tetracycline hydrochloride burn in the oral cavity . this case presents oral soft tissue burn caused by inappropriate use of tetracycline hydrochloride prescribed by overzealous physician . this case highlights one more differential diagnosis in considering mucosal burn in the oral cavity if the burn is not found to be associated with other commonly caused chemical agents . this lesion share clinical features of aspirin burn and hydrogen peroxide burn . from this case report , it is evident that casual prescriptions are rampant amongst physicians , even the case would have been treated by scaling and root planing . awareness regarding the adverse effects or interactions of these medications is also important along with knowledge of their beneficial effects .

patients with heart failure symptoms due to severe left ventricular ( lv ) dysfunction and coronary heart disease face a poor prognosis with limited functional improvement and medical treatment only leading to limited survival . some of the causes of heart failure are myocardial infarction and other forms of ischemic heart disease , hypertension , valvular heart disease and cardiomyopathy . these causes may lead to a reduced lv ejection fraction ( ef ) , with the impaired heart not providing sufficient blood pumping action to meet the needs of the body . commonly a reduced left ventricular ejection fraction ( lvef ) is found in end - stage heart failure patients ; this may be below 20% . in these patients with viable ischemic myocardium , revascularization surgery is not a new but an established treatment concept.to identify patients with viable ischemic myocardium , which means patients who can benefit from revascularization surgery , modern diagnostics are based on dobutamine stress echocardiography and nuclear imaging ( positron emission tomography and cardiovascular magnetic resonance ) . these are the mainstays of viability testing and provide information on contractile function , cellular metabolism and myocardial fibrosis . as early as 1983 the superiority of coronary artery revascularization in patients with poor lv function was documented in the cass study . aldermann and co - workers identified 420 medically treated and 231 surgically treated patients who had severe lv dysfunction ( lvef < 0.36 ) . multivariate regression analysis of survival , adjusted for co - variabilities , showed that surgical treatment prolonged survival ( p<0.05 ) , although it ranked below severity of heart failure symptoms , age , ejection fraction and left main stenosis > 70% in determining prognosis . surgical benefit was most apparent for patients with ef < 0.25 who had a 43% 5-year survival with medical treatment vs 63% with surgery . surgically treated patients experienced substantially more symptomatic benefit than treated patients if their presenting symptoms were predominantly angina ; however , there was no relief for symptoms caused primarily by heart failure . concerning the assessment of viability , it is of utmost importance to predict regional functional recovery . for this purpose , the new gold standard is late gadolinium enhancement cardiovascular magnetic resonance ( lge - cmr ) . pegg and co - workers examined 50 patients with reduced lvef referred for coronary artery bypass grafting ( cabg ) and included 33 patients in their analysis . patients underwent cmr to assess lv function and viability pre - operatively at 6 days and 6 months . twenty - one of the 33 patients had ef improvement of at least 0.3 ( ef before 0.380.13 , after 0.470.13 ) ; 12/33 did not ( ef before 0.390.6 , after 0.370.8 ) . the only independent predictor for global functional recovery after revascularization was a number of viable + normal segments . based on a segmental transmural viability cut - off of < 50% , receiver operating characteristic ( roc ) analysis demonstrated that 10 viable + normal segments predicted 3% improvement of lvef with a sensitivity of 95% and specificity of 75% ( area under the curve ( auc ) = 0.9 , p<0.001 ) . transmural viability cut - offs of < 25 and 75% and a cut - off of 4 viable segments were less useful predictors of global lv recovery . their findings are important and may provide a simple approach to identify those patients who derive functional and prognostic benefit from cabg . pocar and co - workers analyzed the 17-year follow - up results for surgical revascularization in patients with ischemic cardiomyopathy . they retrospectively analyzed 45 consecutive angina free patients with ischemic left ventricular dysfunction ( ef < 0.35 ) , heart failure and new york heart association ( nyha ) functional class iii - iv , who were selected for cabg between 1988 and 1995 . the 30-day mortality was 4.4% at a medium follow - up of 117 months ( maximum 205 months ) and probability of survival at 1 , 5 , 10 and 15 years after cabg was 93.3% , 84% , 65% , and 44% respectively . left ventricular end diastolic pressure ( lvedp ) of 25 mm hg or more predicted a threefold increase of hazard of death ( p=0.02 ) , whereas a lvedp of 20 mm hg or more correlated with the requirement of intraaortic balloon pump use perioperatively . as could be expected , independent predictors of survival were age > 70 years and peripheral vascular disease . cardiac events accounted for 88% of late deaths , which were primarily related to sudden death or progressive heart failure . indication and impact of medical and antiarrhythmic treatment lytle pointed out the impact of progress of pharmacologic and electric treatment for patients with heart failure . angiotensin - converting enzyme inhibitors , beta - blockers and diuretics better the symptoms of heart failure . in some studies implantable defibrillators decrease the risk of death due to sudden arrhythmias in certain patient cohorts . according to lytle , in patients with ischemic cardiomyopathy there are three situations where surgery might not improve patient longevity : if the perioperative risk is greater than the long - term benefit , in patients where probable complications and death are unrelated to ischemia , e.g. in those with a high rate of death from non - ischemic arrhythmias , and if ischemia is not preventable by revascularization , e.g. in patients with diffuse disease . in order to analyze the choice of conduit for coronary artery bypass grafting in poor ventricles , attaran and co - workers analyzed the outcome and survival rates of different conduits in patients with lvef < 0.30 . in a 10-year period 979 patients were divided into three groups , a : total arterial grafts ( n=257 ) , b : total vein grafts ( n=76 ) and c : left internal mammary artery and vein grafts ( n=610 ) . multivariate logistic regression was used to assess the effect of graft type on mortality , while adjusting for patient and disease characteristics . hospital mortality was 8.9% ( group a ) , 11.8% ( group b ) and 5.7% ( group c ) . after risk adjustment , hospital mortality and mid- and long - term mortality showed no significant differences among the groups . contrary to knowledge concerning the long - term superiority of complete arterial revascularization the authors concluded that patients with poor ventricular function have a high mortality rate in both the short and long term , with any type of conduit . mortality rates with total arterial grafts and vein plus arterial grafts were comparable before and after risk adjustment . conventional revascularization in order to evaluate the importance of completeness of revascularization during long - term follow - up after coronary artery operation , jones and co - worker analyzed 2057 patients with multi - vessel disease with complete revascularization and 803 with incomplete revascularization ; mean age was 579 years . they found out that the complications of perioperative infarction and stroke did not differ but that there were more prior myocardial infarctions , worse left ventricular function and more triple - vessel disease in the incomplete revascularization group . completeness of revascularization correlated with improved overall patient survival , as well as survival in patients with normal left ventricular function . the survival curves continued to separate over time , such that the difference was greater at 8 years than at 4 years , although by 12 years the curves started to converge . concerning decision - making in end - stage coronary artery disease , hausmann et al . compared revascularization and heart transplantation . for this purpose they analyzed 514 patients between april 1986 and december 1994 with end - stage coronary artery disease and lvef of between 0.10 and 0.30 who underwent coronary artery bypass grafting . of these patients the prime criterion for bypass grafting at that time was ischemia diagnosed by myocardial scintigraphy and echocardiography ( hibernating myocardium ) . left heart catheterizations performed 1 year after the operation showed that lvef increased from a mean of 0.240.03 preoperatively to 0.390.06 postoperatively ( p<0.0001 ) . six months postoperatively 90.2% of the surviving patients were in nyha class i or ii . a total of 231 patients with end - stage coronary artery disease and predominant heart failure underwent heart transplantation . their actual survival rate was 74.9% after 2 years , 73.22% after 4 years and 68.9% after 6 years . all of the patients could be re - categorized into nyha class i or ii postoperatively . the authors concluded that both coronary artery bypass grafting and heart transplantation can be used successfully to improve the life expectancy of patients with end - stage coronary artery disease . coronary artery grafting leads to an excellent prognosis of these high - risk patients where the myocardium is preoperatively identified as being viable . for definition of the preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting , hamad et al . in 10285 patients the results of multivariate logistic regression and cox regression analysis identified the ejection fraction as a predictor of early and late mortality . comparing long - term survival and expected survival they found a relatively poorer outcome in all subjects with an ejection fraction of < 50% . in patients with an ejection fraction of between 35 and 50% , 1-year mortality was 90% , 2-year mortality 781.2% and 10-year mortality 50.76.8% . in patients with an ef < 0.35 a prospective 10-year follow - up study was performed to prospectively analyze all - cause mortality predictors of survival and late functional results after myocardial revascularization for ischemic cardiomyopathy over a 10-year follow - up . for this purpose shah and colleagues studied 57% with stable coronary artery disease and poor lvef ( < 0.35 ) enrolled between 1989 and 1994 . to avoid patients with stunned myocardium , those with unstable angina or myocardial infarction within the previous 4 weeks were excluded . the mean lvef ( 0.30 ) at 15 months postoperatively did not change from before operation ( 0.28 ) . there were eight deaths at 1 year and 42 deaths over the course of the study , producing a survival of 82.5% at 1 year , 55.7% at 5 years and multivariate analysis showed that large reversible defects identified by the thallium stress test were associated with improved lvef at 1 year , but only male sex was associated with improved long - term survival . the authors concluded that myocardial revascularization for ischemic cardiomyopathy is associated with good functional relief from symptoms of angina initially and , to a lesser extent , of heart failure . the predictors of long - term outcome in patients with left ventricular dysfunction following coronary artery bypass grafting were described by rybicka - musialik and co - workers . they pointed out that the prognostic significance of clinical non - invasive risk markers in patients after surgical revascularization remains unclear , especially in post - infarction patients with left ventricular dysfunction . for this purpose they followed a cohort of 61 patients ( age 599 years , 49 males , lvef 0.330.6 ) 6 - 12 months after cabg . demographics , clinical data , medication , lvef , qrs > 120 ms or presence of late potentials , qt dispersion > 180 ms , premature ventricular contractions ( pvc ) > 10/h , non - sustained ventricular tachycardia and standard deviation of normal to normal intervals ( sdnn ) > 70 ms in ambulatory were analyzed . univariable cox analysis showed that incomplete revascularization , history of angina , heart failure , low lvef , use of nitrates , digitalis or diuretics in presence of late potentials or prolongation of qrs complex were predictors of poor outcome . combination of angina and low lvef was the best model in a multivariable cox analysis for the prediction of both types of death . main predictors of all - cause and cardiovascular mortality were lv dysfunction , angina class and low lvef . a combination of lvef < 30% with qrs > 120 ms or late potentials may also be helpful in the identification of high - risk subjects . carr and colleagues analyzed the potential for long - term survival in patients with severe left ventricular dysfunction after coronary bypass . between 01/1990 and 11/1999 , 86 patients with severe left ventricular dysfunction ( mean ejection fraction 0.180.03 ; range , 0.20 ) underwent coronary artery bypass grafting ; 10 perioperative deaths ( 11% mortality ) occurred . the mean survival was 55 months with an extra 5-year survival rate of 59% ( actuarial 5-year 65% , 10-year 33% ) . postoperatively they were able to document an improvement of the ejection fraction as shown in echocardiography with unchanged diastolic left ventricular dimension . the systolic left ventricular dimension decreased significantly from 5.020.77 cm to 4.260.91 cm ( 6 months ) , 3.981.43 cm ( 1 year ) and 4.101.14 cm ( 2 years ) . the preoperative nyha classification for all patients improved from 2.80.8 to 1.60.6 after a mean of 53 months ( standard deviation 34 months ) . the authors concluded that patients with left ventricular dysfunction can derive long - term benefit from coronary bypass through improved left ventricular contractility as documented by a significantly decreased systolic left ventricular dimension and increased ejection fraction . off - pump , minimal extracorporeal circulation and hybrid revascularization the potential effect of off - pump beating heart ( opbh ) surgery with the help of minimized extracorporeal circulation for cabg was analyzed by munos and co - workers in patients with a high - risk euroscore to compare the strategy to other procedures , including off - pump coronary artery bypass ( opcab ) and minimal extracorporeal circulation ( mecc ) or conventional extracorporeal circulation ( cecc ) with cardiac arrest . two hundred fourteen patients ( mean age 74.268.5 years , 68.7% male ) were operated upon . mean euroscore was 12.12.9 , left ventricular function 0.3740.123 , recent myocardial infarction ( mi ) was present in 49.5% , renal failure in 48.1% , chronic obstructive pulmonary disease ( copd ) in 42.2% and peripheral vascular disease ( pvd ) in 55.6% . the study showed that it was possible , in very high - risk patients , to carry out revascularization with opbh similar to that using mecc or cecc under cardiac arrest . this technique reduces troponin release ( 3.23 vs 6.56 ( u / l ) , p<0.01 ) . postoperative myocardial complications ( 2% vs 8% , p<0.01 ) , cardiotonic drug prescription ( 15.7% vs 31.3% , p<0.01 ) , ventilation time ( 4.57 h vs 6.48 h , p<0.01 ) and length of stay ( los ) in icu ( 2.16 vs 2.53 days , p=0.02 ) . the authors concluded that opbh surgery combining mecc without aortic cross - clamping makes it possible to perform complete revascularization and is an interesting alternative to cabg in high - risk patients . the effect of off - pump coronary artery revascularization in terms of the long - term survival in patients with ventricular dysfunction was analyzed by attaran and co - workers . in a 10-year period , a total of 934 patients with poor left ventricular function ( ef < 30% ) undergoing isolated first - time coronary artery bypass graft surgery were studied . two groups were analyzed : the oncab group ( 528 patients ) and the opcab group ( 406 patients ) . mid - term survival rate ( 5 years ) and long - term survival rate ( 10 years ) were compared after adjusting for preoperative characteristics , postoperative complications and in - hospital mortality . postoperative complications of both groups , such as atrial fibrillation ( 29.6% vs 28.6% ) , renal failure ( 9.3% vs 9.6% ) , stroke ( 2.3% vs 0.7% ) and perioperative myocardial infarction ( 3.8% vs 2.0% ) were comparable between oncab and opcab patients . the average number of grafts was oncab : 3.7 and opcab : 3.1 ( p<0.01 ) . in the opcab group , length of intensive care stay , hospital stay and ventilation time were considerably shorter ( p<0.01 ) . in opcab patients after adjusting for preoperative characteristics , only mitral infarction was lower in the opcab group ( p<0.04 ) while most other postoperative complications remained the same in both groups . the same holds for the rate of stroke ( opcab : 0.09% ; oncab : 1.6% ) . in - hospital mortality was higher in oncab compared to opcab ( 7.8% vs 5.7% ) , but it was not statistically significant ( p=0.21 ) . the survival rate for each group was ( 30-day survival , 5-year survival , 10-year survival ) opcab : 94.7% , 75.4% ; 71.8% , oncab : 93.0% , 76.5% , 69.5% . the authors concluded that , despite the reported benefits of opcab , there was no statistically significant influence on in - hospital mortality , mid - term survival or long - term survival in patients with left ventricular dysfunction . with adequate myocardial protection in oncab and complete revascularization in opcab , similar results are achievable . in a meta - analysis jarral and co - workers searched 17 studies that dealt with the question of whether off - pump coronary artery bypass surgery has a beneficial effect on mortality in patients with left ventricular dysfunction . by comprising 7 studies and 1512 patients , the meta - analysis showed no significant difference in terms of operative mortality . the authors concluded that there is limited evidence to associate the opcab technique with improved short - term mortality . the lack of high - quality data indicates that prospective randomized trials are needed . hybrid coronary revascularization is combining minimally invasive coronary artery surgery and percutaneous coronary intervention , thus allowing sternal preservation for the treatment of patients with multi - vessel coronary artery disease . revascularization of the left anterior descending coronary artery can be achieved by a robotically assisted endoscopic approach or conventional minimally invasive direct coronary artery bypass ( midcab ) surgery . early experience demonstrates the safety of the procedure , with perioperative clinical results comparable to those of conventional coronary artery revascularization . however , leacche et al . reported that in high risk patients with complex coronary artery disease ( syntax score greater than or equivalent to 33 , euroscore 5 ) coronary artery bypass grafting is superior to hybrid coronary revascularization . special publications addressing the role of hybrid revascularization procedures in patients with ischemic cardiomyopathy are not listed in the literature currently . analyzed the results of coronary artery bypass grafting alone and combined with surgical ventricular reconstruction for ischemic heart failure . they included 236 patients with ischemic heart failure and ejection fraction < 35% who underwent surgical treatment . patients were randomized in two cohorts : 120 patients underwent cabg alone and 116 patients underwent cabg with surgical ventricular reconstruction ( svr ) . the survivors had a follow - up ranging between 4 months and 5 years with a mean follow - up time of 3113 months . mean new york heart association functional class decreased from 2.90.5 to 2.20.7 one year after cabg and from 3.10.4 to 2.00.6 one year after cabg plus svr . the authors were able to demonstrate that svr significantly decreased end diastolic volume from 23752 to 17630 ml and correspondingly increased ef from 0.320.6 to 0.390.9 . after isolated cabg , ef did not increase significantly ( 0.320.7 preoperatively and 0.340.11 postoperatively ) . one and 3-year survival rates were 95% and 78% after svr with cabg versus 83% and 78% after cabg alone . the authors concluded that the combined procedure did not prolong longevity and reduce mortality in patients with ischemic cardiomyopathy . two years ago , a paper in the the new england journal of medicine by velazquez and co - workers addressed also the question of coronary artery bypass surgery in patients with left ventricular dysfunction . they enrolled 1212 patients with an ef of < 35% or less and coronary artery disease amenable to cabg . the patients were randomly assigned to medical therapy alone ( 602 patients ) or medical therapy plus cabg ( 610 patients ) . major secondary outcomes included death from cardiovascular causes and death from any cause or hospitalization for cardiovascular causes . the primary outcome occurred in 244 patients ( 41% ) in the medical - therapy group and 218 ( 36% ) in the cabg group ( hazard ratio with cabg , 0.86 ; 95% confidence interval [ ci ] 0.72 to 1.04 ; p=0.12 ) . a total of 201 patients ( 33% ) in the medical - therapy group and 168 ( 28% ) in the cabg group died from an adjusted cardiovascular cause ( hazard ratio with cabg , 0.81 ; 95% ci , 0.66 to 1.00 ; p=0.05 ) . death from any cause or hospitalization for cardiovascular causes occurred in 411 patients ( 68% ) in the medical - therapy group and 351 ( 58% ) in the cabg group ( hazard ratio with cabg , 0.74 ; 95% ci , 0.64 to 0.85 ; p<0.001 ) . by the end of the follow - up period ( median , 56 months ) , 100 patients in the medical - therapy group ( 17% ) underwent cabg , and 555 patients in the cabg group ( 91% ) underwent cabg . the authors concluded that in this randomized trial there was no significant difference between medical therapy alone and medical therapy plus cabg with respect to the primary end - point of death from any cause . however , patients assigned to cabg , as compared with those assigned to medical therapy alone , had lower rates of death from cardiovascular causes and of death from any cause or hospitalization for cardiovascular causes in comparison to those patients assigned to medical therapy alone . the authors commented that clinical circumstances led to crossover in the case of 70% of patients who had been randomly assigned to medical therapy and 9% who had been randomly assigned to cabg . the treatment analysis suggests that this imbalance in crossover rates between groups modified the results of the primary intention - to - treat analyses by diminishing the effect of cabg relative to medical therapy . in patients with ischemic cardiomyopathy and with viable ischemic myocardium , revascularization surgery is not a new but an established treatment concept . concerning the assessment of viability , it is of utmost importance to predict regional functional recovery . patients with ischemic cardiomyopathy will remain the recipients of on- and off - pump cabg as surgical techniques and medical therapies continue to improve . the future of revascularization in these patients will focus on improving results and making cabg for elective revascularization less invasive and safer . promising techniques that have to be employed on a larger scale are minimally invasive techniques including the use of robotics and anastomotic connectors , intraoperative imaging , hybrid procedures and protein enzyme therapies .

cystic disease of the spleen is relatively rare , with an incidence of 0.07%.1 the splenic cysts categorized either as primary ( true cysts ) or as secondary ( pseudocysts ) . the latter is mostly caused by abdominal trauma and has no epithelial lining in the cystic lumen . additinoally , primary splenic cysts are further subdivided into parasitic and non - parasitic cyst . non - parasitic primary splenic cyst is considered congenital and comprise of about 10% of all splenic cysts.2 we present here a rare case of primary non - parasitic splenic cyst that is confirmed by pathologic diagnosis after partial splenectomy . a 20-year - old female immigrant worker with a dull abdominal pain of several days duration was referred to our hospital from a local clinic , where an abdominal ultrasonography ( us ) had revealed a large cystic mass in the spleen . on abdominal examination , her vital signs were stable and all laboratory findings were within the normal range . abdominal computed tomography ( ct ) scan revealed the splenic cyst to measure 14 cm in diameter with scoliosis most likely due to mass effect ( fig . the patient was offered open or laparoscopic partial resection of the spleen , and the patient opted for open surgery for economic reasons . it was adhered to the left lateral side of the liver and left stomach wall ( fig . the result of serologic hydatid antibody test had been notified several days after the operation and was negative . both carbohydronic antigen 19 - 9 ( ca 19 - 9 ) and carcinoembryonic antigen ( cea ) of the cystic fluid were over 1,000 u / ml respectively . the pathologic report indicated a primary splenic cyst with cystwalls containing stratified squamous epithelial cells ( fig . cystic diseases of the spleen are relatively rare with an incidence of 0.07%1 and are categorized as either primary or secondary cysts.3 secondary splenic cysts are usually results from previous abdominal trauma . these have no epithelial lining of the cystic lumen and , as such , are peudocysts . conversely , primary splenic cysts contain epithelial lining , and these true cysts are subdivided into parasitic and non - parasitic cyst . parasitic splenic cysts , or splenic hydatid disease ( shd ) , results from infection by echinococcus species . it must be excluded before invasive procedure because spillage of the cystic contents may lead to anaphylactic shock or intraperitoneal dissemination of echinococcus species.4 although echinococcus is not endemic to south korea , we had performed the serologic hydatid antibody test because the patient herself had come from an endemic country . however , the result was negative . during the operation , we took special care not to rupture the cystic fluid into the peritoneum , as the result of the serologic hydatid antibody test had not been made reported . primary non - parasitic splenic cysts are considered congenital and are lined by mesothelial , squamous , or transitional epithelium . the serum or cystic fluid is often positive for ca 19 - 9 and cea , although these cysts do not have malignant potential.5 - 8 one hypothesis is that the inner epithelial cells produce these tumor markers , and these can circulate systematically by stoma - like channel between the lumen of the cyst and sinus of the adjacent splenic tissue.7 in our case , ca 19 - 9 and cea levels from cystic fluid were high but pathologic report revealed no malignant changes . moreover , preoperative us and ct scan are useful in understanding the size and relationship of the cystic lesions to surrounding structures.3 this information is helpful in the differential diagnosis and management . the conventional approach to splenic cysts has been complete total splenectomy . however , overwhelming post - splenectomy syndrome ( opss ) is a serious concern after total splenectomy , and partial splenectomy is increasingly considered as the treatment of choice.9 additionally , laparoscopic approach has been performed successfully.6,9 - 11 percutaneous drainage or injection of sclerosing agents have been used in limited cases for small cysts , but these procedures are associated with high recurrence rates.12,13 in summary , splenic non - parasitic true cyst is a rare disease . it can be detected by ultrasonography or ct scan and are confirmed by pathologic findings . the serologic hydatid antibody is checked prior to an invasive procedure to exclude parasitic infection . cystic tumor markers can be elevated in the serum , but it has no malignant potential . partial or total splenectomy is the treatment of choice , and percutaneous drainage can be considered for small cysts or as bridges to surgery .