Datasets:

ewhfef

/

mix_cpt

like 1

a full - term baby girl of 3.5 kg was born with massive right proptosis [ fig . 1 ] . she was otherwise well and the delivery was unremarkable . on examination , there was complete right globe prolapse associated with restrictive ophthalmoparesis . the globe was surrounded by a nonpulsatile , cystic mass which transilluminated [ fig . 1 ] . b - scan ultrasound demonstrated a heterogeneous , multicystic mass . computerized tomography ( ct ) demonstrated calcification of the lesion and globe displacement anteriorly and the optic nerve laterally [ fig . 2 ] . an incisional biopsy revealed fibroadipose tissue with areas of differentiated colonic mucosa with goblet cells and submucosal lymphocyte aggregates ( peyer 's patch ) . preoperative image demonstrating large , cystic mass with nonviable eye computerized tomography ( ct ) of the orbit showing punctate calcification of the lesion and anterior globe displacement at 7 weeks , the baby was transferred to adelaide , australia for further management . while awaiting transfers , the cystic component grew in size and required aspiration of the anterior cysts . magnetic resonance imaging and ct angiography confirmed no intracranial or sinus extension and no major vascular connection apart from a normal caliber ophthalmic artery [ fig . she underwent a lid - sparing exenteration with frozen section control of the apical margin . a dermis fat graft from the groin was placed beneath the lid skin to provide volume [ fig . 4 ] . the teratomatous elements include salivary gland , thyroid , cerebellum , gastrointestinal mucosa , skin , bone , cartilage , adipose tissue , and skin adnexal structures [ fig . 5 ] . some of the epithelial tissues had formed variably dilated cystic spaces . magnetic resonance imaging of the head and orbits showing an irregular , heterogeneous mass encasing the optic nerve and the globe exenterated orbit with dermis fat graft in situ micrograph of representative mature tissues derived from the three embryonic germ cell layers : small intestine derived from endoderm ( far left ) bone and cartilage derived from mesoderm ( centre ) and cerebellum derived from the ectoderm ( far right ) the patient returned to fiji 2 weeks following surgery [ fig . yearly follow - up was planned to assess for the growth of socket and to ensure there are no recurrence . to the authors knowledge , this is the first reported case in fiji . the surgical expertise and investigations required lead to transfer of the baby to from fiji to australia . orbital teratoma is a rare but important differential for proptosis in a newborn . by definition , to make the diagnosis of congenital orbital teratoma , tissues from all three embryonic germ cell layers , i.e. ectoderm , mesoderm and endoderm must be present . teratoma are considered mature if the tissue present in the teratoma are fully differentiated and does not contain evidence of immature embryonal tissue . teratoma is distinct from dermoids which consists of a single germ cell layer and teratoid which consists of 2 germ cell layers . complication of teratoma includes cranio - orbital invasion that can be fatal and if incompletely excised , recurrence or even malignant transformation may occur . it is well described that removal of the eye or orbital contents in an infant will lead to impaired bony development of the orbit and ipsilateral facial bones . hence , a dermis fat graft was used to provide volume and the stimulus to bony growth . as the orbital volume was 50% larger compared with the contralateral side , it is anticipated that there will not be a significant asymmetry in the long term . alternatives would have included a ball implant , a temporalis flap or a free flap . as preoperative embolization has been utilized in orbital teratomas to decrease intraoperative blood loss , the patient underwent a ct angiogram but this did not show significant vascularity it was felt that exenteration could proceed without embolization . although preservation of the globe has been successfully performed for selected cases of teratoma , the extent of tumor , severe compression of the globe , and the inability to reliably isolate the recti and globe from the tumor lead to an eyelid - sparing exenteration . intraoperatively , it was also apparent that the majority of the conjunctiva could not be dissected free of the tumor excluding the possibility of a conjunctiva sparing exenteration . in summary , we present a case of mature congenital orbital teratoma managed with lid - sparing exenteration and a dermis fat graft .

neuroendocrine ( ne ) cells are derived embryologically from the gut and are widely distributed in various tissues , such as the tracheobronchial tree , liver , pancreas and genitourinary system . in humans , ne tumors ( so - called carcinoids ) have been found in a wide range of organs , the gastrointestinal and pulmonary tracts being the most common sites . 1 3 in domestic animals , ne tumors have occasionally been reported in the intestine , liver , bile duct , lungs , gall bladder , esophagus , skin and nasal cavity . 4 13 ne tumors usually have histopathological features forming sheets , nests or cords of small to medium - sized cells separated by delicate fibrovascular stroma to give an endocrine - type pocketing . 3 , 13 both immunohistochemical examination with antibody specific for neuropeptides and electron microscopical examination are useful for the differential diagnosis of these neoplasms in human patients and animals . 14 this report describes the histopathological and immunohistochemical characteristics of a metastatic ne carcinoma of undetermined origin in a 12-year - old castrated male irish setter . this dog developed generalized dermatitis accompanying pruritus , redness , alopecia and bloating of the skin , palpebra and ear canal and had received steroid chemotherapy for 11 years since one year of age . at 11 years of age , one year later , bladder stones were again found and surgically removed . during administration of post - surgical medication , necropsy revealed scattered white or grayish - white nodules measuring from 5 to 10 mm in diameter in the lung and a 2.5 cm - sized nodule occupying the parapancreatic lymph node . in addition , the mucous membrane of the urinary bladder showed scattered petechia in the pale surface . tissue samples from tumors and all organs except for the brain , pituitary , and nasal cavity were fixed in 10% neutrally - buffered formalin ( ph 7.4 ) , routinely processed for paraffin embedding , sectioned at 4 m and stained with hematoxylin and eosin ( he ) . tissue samples from tumors were also stained by the grimelius silver impregnation method using a dog adrenal medulla as a positive control . histopathologically , neoplastic nodules in the lungs and parapancreatic lymph node showed a similar histological pattern , with neoplastic cells being arranged in diffusely proliferating sheet - like cellular nests ( fig . 1a ) . neoplastic cells were separated by variable amounts of fibrous stroma , but they were invasive to the stroma and lymphatic vessels ( fig . the neoplastic cells were largely polygonal with round to oval - shaped nuclei and abundant eosinophilic cytoplasm and prominent nucleoli with indistinct cellular borders sometimes forming rosettes and duct - like structures ( fig . they were positive for grimelius staining with a weak to moderate distribution of tiny argyrophilic granules within the cytoplasm ( fig . a scattered distribution of neoplastic cell aggregation of various sizes was evident , as well as larger discrete nodules . in the parapancreatic lymph node , the lymphoid tissue was mostly replaced by neoplastic cells forming a large tumor mass , without invasion to the pancreatic parenchyma . in the pancreas , there were no other microscopically apparent neoplastic lesions in the organs / tissues examined in this case . sections from neoplastic tissues of the lungs and the parapancreatic lymph node were immunohistochemically stained by the avidin - biotin - peroxidase complex ( abc ) procedure ( vectastain elite abc kit ; vector laboratories , burlingame , ca , u.s.a . ) and examined microscopically . details of the specific primary antibodies used and the staining results for the neoplastic tissues are summarized in table 1 . deparaffinized sections were blocked for endogenous peroxidase in 0.3% h2o2 with methanol for 30 min . incubation of sections with the primary antibody was performed at 4c for 16 h , followed by incubation with the biotinylated secondary antibody for 30 min , and with avidin peroxidase conjugate for 30 min at room temperature . as positive control for each immunoreactivity , jejunum , pancreas and brain tissues from a normal dog were used . jejunal tissue was used for confirmation of the immunoreactivity for cytokeratin ( ck ) , synaptophysin ( syn ) , vasoactive intestinal peptide ( vip ) , chromogranin a ( cga ) , neuron - specific enolase ( nse ) , desmin , vimentin and serotonin . pancreas was used for confirmation of glucagon , insulin and somatostatin , and brain tissue was used for s100 protein , glial fibrillary acid protein ( gfap ) , nestin and neurofilament ( nf)-68 kda . all of these positive immunoreactivities were observed in the cytoplasm ; among them , syn and ck showed intense immunoreactivity . on the other hand , neoplastic cells were exclusively negative for nse , gfap , nestin , nf-68 kda , s100 protein , vimentin , desmin , somatostatin , glucagon , insulin and serotonin . immunohistochemical estimation of neuropeptides is useful in confirming neoplasms of ne - cell origin in human patients and animals . 12 , 13 , 15 ck , syn , nse and cga are usually expressed in neoplastic cells of ne cell tumors ( carcinoids ) that develop in the nasal cavity , lung or gastrointestinal tract . 13 , 16 , 17 in addition , such neoplastic cells sometimes express serotonin , substance p , vip , neuropeptide y and protein gene product 9.5 . 18 , 19 therefore , the positive immunoreactivity for ck , syn , vip and cga in the present case strongly suggested that the ne cell was the origin of this tumor . argyrophilic fine granular staining by the grimelius silver impregnation method also supported this suggestion . moreover , negative immunoreactivity for neuronal cytoskeletal proteins , such as nf-68 kda , class iii -tubulin and microtubule - associated protein-2 , is often a feature of ne carcinomas . 3 , 20 22 also , in both human and animal cases , pulmonary , gastrointestinal and other carcinoids usually lack expression of s100 protein . 23 these observations do not conflict with our negative findings of immunoreactivity for nf and s100 in the present case . the tumor in the present case formed scattered nodular lesions in the bilateral lungs without accompanying focal cicatricial contraction which is often considered to be the primary site of cancer development . histopathologically , we only observed neoplastic cell infiltration into local lymphatics without formation of prominent lymphangiosis carcinomatosa , which is the typical pattern of tumor cell growth suggestive of advanced stage of lymphogenous metastases in the lung . although we did not observe tumor emboli in the branches of the pulmonary artery , scattered multiple solitary nodules in the lungs were suggestive of hematogenous metastases from a distant origin . with regard to parapancreatic lymph node metastasis , we did not observe any visceral tumor in the abdominal cavity except for acinar cell hyperplasias and adenomas of the exocrine pancreas . these results may suggest that there is no proper candidate primary site in either the thoracic or abdominal cavities . while there were no accompanying clinical signs , the nasal mucosa and pituitary , which we did not examine at necropsy , could be candidates for the primary site . these unexamined organs / tissues contain neuroendocrine cells , and ne carcinomas with metastases have also been reported in dogs or humans . 24 , 25 in summary , we report here a case of malignant tumor of undetermined origin in a dog . because of typical histological and immunohistochemical features of neoplastic cells , this tumor was diagnosed as ne carcinoma . because of the scattered distribution pattern of neoplastic nodules , the involvement of the lungs and parapancreatic lymph node is considered to be metastatic ; however , there was no candidate visceral organ / tissue for the primary site of this tumor in the thoracic or abdominal cavities . although there were no accompanying clinical signs , the cranial or nasal cavity could be considered as the origin in the present case .

the ebb and flow of lipid precursors through competing biosynthetic pathways largely controls the generation of secretory vesicles emanating from the golgi ( fig . 1 ) . the structural changes in the golgi bilayer that initiate membrane curvature for vesicle budding are dictated in part by the dynamic balance between diacylglycerol ( dag ) production and dag consumption in the production of phosphatidylcholine ( pc ) . inclusion of membrane proteins into nascent vesicles is partly dependent on the balance of phosphatidylinositol ( pi ) incorporation into complex sphingolipids vs. the generation of pi4p and other pips . the pi / pc transfer protein sec14p plays a pivotal role acting as a traffic cop directing lipid flux through these metabolic pathways . at the golgi , sec14p integrates pi , pc , dag and complex sphingolipid metabolism , and as a result sec14p inactivation blocks exocytosis during post - golgi vesicle biogenesis ( fig . 1 ) . lipid - dependent events in yeast polarized exocytosis . during vesicle biogenesis ( left ) sec14p - dependent regulation of lipid metabolism both stimulates dag synthesis and inhibits dag consumption as a precursor in pc production . as a precursor for the synthesis of pi - containing complex sphingolipids , concentrated with sterols , de novo synthesized sphingolipids form membrane microdomains that recruit membrane proteins for exocytosis . in transit between the golgi and pm ( center ) , vesicles move along actin filaments propelled by a type v myosin ( myo2p ) . myo2p interactions with vesicles is dependent in part on pi4p as is the reconfiguration of small gtpases ( yellow ) required for the assembly of vesicle - associated exocyst complex subunits ( light red ) . at the interface between the pm and vesicle membrane ( right ) , rho gtpases and exocyst complex subunits associated with the pm ( dark red ) via pi(4,5)p2 assemble with the vesicle - bound exocyst complex subunits to facilitate vesicle docking at sites of polarized growth . membrane fusion follows after v - snares ( tan ) and t - snares ( blue ) interactions . sec14p , which is essential for exocytosis and yeast growth , is dispensable if dag is exogenously supplemented to cells . this result suggests that sec14p increases levels of dag , but this simple outcome belies the complexity of sec14p - dependent regulation . sec14p is proposed to have a dual function in dag production depending on whether it is bound to pi or pc ( fig . 1 ) . when bound to pc , sec14p appears to inhibit choline - phosphate cytidyl transferase ( pct1p ) , the rate - limiting enzyme in pc biosynthetic pathway that consumes dag as a precursor for pc synthesis . in this way pro - secretory lipid , while at the same time decreasing pc , an anti - secretory lipid . due to its small head - group and long hydrophobic acyl chains , the cone - shape of dag is predicted to affect the local curvature of the golgi bilayer in proximity to dag - enriched domains . in contrast , the cylindrical shape of pc is hypothesized to resist membrane deformation and inhibit vesicle formation . when bound to pi , sec14p appears to stimulate the pi 4-kinase pik1p to generate more pi4p for conversion into pi(4,5)p2 . pi(4,5)p2 activates spo14p , phospholipase d , which represents another mechanism for decreasing pc and its potentially anti - secretory effects . spo14p hydrolyzes pc to form choline and phosphatidic acid ( pa ) , which can be metabolized into dag . thus , it is possible that sec14p - pc and sec14p - pi both tilt the dynamic balance of lipids toward dag at the expense of pc . an alternative mechanism by which dag might affect vesicle formation is through the recruitment and activation of gcs1p , an arf - gap ( adp - ribosylation factor gtpase - activating protein ) implicated in vesicle scission from the golgi . gcs1p acts together with other arf - gaps , age1p and age2p , to regulate the small gtpase arf1p , which in turn primes vesicle formation by recruiting cargo and other regulators of vesicle transport . dag stimulates the gap activity of age1p and gcs1p in vitro , and exocytosis defects in gcs1 and age2 mutant cells are rescued by the exogenous addition of dag . based on these findings , it is proposed that dag - induced membrane curvature might recruit and activate arf - gap activity at the golgi . although it might appear that dag is a key lipid regulator of sec14p - dependent vesicle formation , other reports suggest that the essential requirement for sec14 can be bypassed without increasing cellular dag levels . in addition , pi4p levels are reduced by ~45% when sec14 cells are cultured at elevated temperature . this result suggests that pi4p is an important lipid species for sec14p - dependent vesicle biogenesis . consistent with this suggestion , the deletion of sac1 , which encodes an er / golgi pi4p phosphatase , rescues the lethality of sec14-inactivating mutations . in sec14-defective cells , the elimination of sac1 results in elevated pi4p levels but , unexpectedly , cellular dag levels are unchanged suggesting rescue of sec14 mutants is dag - independent . ( although this finding does not preclude the possibility that localized increases in dag levels within the golgi membrane induce vesicle biogenesis ) . pi4p levels might also affect the arf - gaps gcs1p and age1p , which contain general lipid - binding domains that bind pips including pi4p ; a homologous domain can also be found within age2p . in addition to pi4p , sec14-defective cells accumulate ~3-fold more complex sphingolipid precursors , in which levels of very long chain ceramides are particularly elevated . given the broad changes in lipid composition in cells lacking sec14 function , it is probable the observed defects in vesicle formation is the collective effect of changes to the distribution and synthesis of several lipids . in addition to regulated changes in lipid metabolism and membrane composition within specific membrane domains at the golgi , vesicle formation also depends on the maintenance of transbilayer lipid asymmetry . phosphatidylserine ( ps ) is synthesized within one leaflet of the er bilayer but it equilibrates between leaflets . when ps arrives at the golgi membrane , it is restricted to the cytoplasmic membrane leaflet by the p - type atpase phospholipid flippase drs2p and its cdc50p chaperone . drs2p thereby maintains golgi bilayer asymmetry , which is functionally linked to arf1p - dependent vesicle budding ; mutations in either cdc50 or drs2 are synthetically lethal with arf1 mutations . disruption of drs2p or cdc50p results in exocytosis and polarization defects and the accumulation of aberrant membrane structures . a possible mechanism for how ps asymmetry affects vesicle biogenesis involves the induction of localized membrane curvature , as predicted by the bilayer couple hypothesis . consistent with this model , the deletion of drs2 is synthetically lethal with gcs1 , perhaps indicating a functional interaction required for post - golgi vesicle formation . the involvement of a lipid flippase in the initial stages of exocytosis suggests that vesicle formation requires modulations in both cis and trans organization of the lipid bilayer . apart from the structural changes in membrane organization that initiate vesicle budding , specific lipids are also sorted as cargo into nascent vesicles . complex sphingolipids and ergosterol ( the fungal equivalent of cholesterol ) are enriched in secretory vesicles compared with the golgi membrane from whence they came . together , sphingolipids and sterol can be isolated as detergent resistant membranes ( drms ) corresponding to specific membrane microdomains that are sorting platforms for specific membrane proteins . the synthesis of the lipid components of these microdomains appears to be integrated with vesicle formation at the golgi in order to sort and concentrate specific membrane proteins ( fig . 1 ) . in budding yeast , the biosynthesis of sphingolipids is simple as compared with metazoans and only three complex species of inositol phosphate - containing sphingolipids are made . after its synthesis in the er , ceramide passes to the golgi where mannose and inositol phosphates are sequentially added to produce all complex sphingolipids . pi serves as a precursor of inositol phosphate in the golgi making the maintenance of pi pools extremely important for complex sphingolipid synthesis . in the golgi , pi is generated by pis1p ( phosphatidyl inositol synthase 1 ) , which couples a phosphatidyl moiety from cdp - dag ( cdp - diacylglycerol ) to inositol , and by sac1p - mediated dephosphorylation of pi4p . for the latter , inositol phosphate - containing sphingolipids are generated at the expense of pi4p used in dag production ( fig . 1 ) . the coordinated regulation of pi and sphingolipid metabolism therefore appears to be important for integrating membrane sorting with vesicle formation . the generation of sterol / sphingolipid microdomains in the golgi membrane promotes the exocytosis of several well - defined pm transporters as well as glycosylphosphatidylinositol ( gpi)-anchored proteins like gas1p . unlike other membrane proteins transported to the cell cortex , mutations that perturb ergosterol or sphingolipid metabolism disrupt the trafficking and distribution of the h - atpase pma1p , the tat2p tryptophan permease , the arginine permease can1p , the gap1p general amino acid permease and the uracil permease fur4p . gas1p and pma1p are sorted into membrane microdomains in the er before reaching the golgi , but the other transporters are concentrated into drms within the golgi membrane . the original site of sorting into drms roughly correlates with the lateral segregation of these proteins within different membrane domains once at the pm . in s. cerevisiae , eisosomes or mcc ( membrane compartment of can1p ) domains are stable and relatively immobile 300 nm - sized patches on the pm containing can1p , fur4p and tat2p . mcp ( membrane compartment occupied by pma1p ) domains contain pma1p and represent pm regions containing readily diffusible proteins that are excluded from the mcc . the third membrane domain , mct ( membrane compartment containing torc2 ) , consists of punctuate patches containing the torc2 complex that regulates the actin cytoskeleton and ceramide synthesis . because the resident proteins are stably contained within these membrane domains , the lateral segregation of these proteins at the pm appears to be predetermined at the er or the golgi , depending on where the membrane domain originally formed . even before their release from the golgi , nascent vesicles are attached to the type v myosin myo2p , which is recruited via the rab gtpases ypt31p/32p and by pi4p ( fig . 1 ) . as myo2p - dependent transport proceeds and vesicles are moved along actin filaments to the bud , the small gtpase sec4p displaces ypt31p/32p . although important for the proper regulation of actomyosin transport , this gtpase cascade is dispensable if the interaction between myo2p and pi4p is augmented . by replacing the gtpase - binding c - terminal tail of myo2p with an additional pi4p - binding ph domain , small gtpases consistent with these results , increased pi4p levels can also negate the inhibitory effects of overexpressing the c - terminal tail of myo2p . this tail region competes for sec4p and ypt31p/32p binding with the endogenous wild - type myo2p , but increasing pik1p production of pi4p restores myo2p association with vesicles . in addition to the recruitment of myo2p to vesicles , pi4p affects the protein interactions of ypt31p/32p and sec4p during the priming of the vesicle - associated subunits of the exocyst complex , which is required for subsequent vesicle docking with the pm . a critical event in this priming occurs when the sec2p gef ( guanine - nucleotide exchange factor ) , originally recruited to vesicles and bound by ypt31p/32p , switches its binding to the exocyst subunit sec15p . with this exchange of binding partners , the sec2p gef is then free to activate sec4p - gtp for the assembly of the other vesicle - associated exocyst complex subunits . although it is not fully understood , a drop in vesicle pi4p levels triggers ypt31p/32p release of sec2p , and the subsequent sec4p - dependent gtpase signaling cascade then ensues . here again , the recruitment and assembly of regulatory protein complexes required for transport seems ultimately to be controlled by a lipid pi4p . at sites of polarized growth , vesicle docking and membrane fusion with the pm completes exocytosis and the relevant regulatory lipid involved is pi(4,5)p2 . the polarized localization of the pm - associated exocyst complex subunits , exo70p and sec3p , is dependent on direct interactions with pi(4,5)p2 . sec3p and exo70p polarization is also dependent on the rho gtpase cdc42p ( fig . 1 ) . overexpression of the pi4p 5-kinase mss4p increases pi(4,5)p2 levels and partially rescues the temperature - sensitive growth defects of cdc426 cells at elevated temperatures , suggesting that pi(4,5)p2 and cdc42p define two independent mechanisms for recruiting exocyst complex subunits to the pm . however , it is not known if increased pi(4,5)p2 levels can completely bypass the cdc42p requirement for recruiting sec3p and/or exo70p to the pm . in addition , the sec14p - related pi - transfer protein sfh5p promotes cdc42p activity at the pm by extracting pi from exocytic vesicles then presenting it to stt4p ( pi 4-kinase ) and mss4p for conversion into pi(4,5)p2 at the pm . the pi(4,5)p2 generated in this way is required for cdc42p localization to sites of polarized exocytosis , though the exact mechanism is unclear . in addition , pi(4,5)p2 is required for localization of both cdc24p , the ph domain - containing gef that activates cdc42p , and the cdc42p effector gic2p . another rho gtpase , rho1p , also binds and promotes sec3p polarized localization , whereas both rho3p and cdc42p bind exo70p to mediate its polarization . rom2p , the gef for rho1p , also binds pi(4,5)p2 through a ph domain that is essential for rom2p localization to sites of polarized growth and downstream activation of rho1p . pi(4,5)p2 is therefore a requirement for multiple different regulators and effectors for vesicle docking at the pm . like bilayer asymmetries in the golgi membrane , lipid asymmetry across the pm bilayer ps is localized to incipient bud sites where it promotes cdc42p - dependent bud formation . deletion of cho1 , encoding ps synthase , results in cdc42p depolarized localization that is partially rescued by addition of lysops into the medium . ps , pi and pe ( phosphatidylethanolamine ) are also required to initiate changes in the sites of polarized exocytosis during the yeast cell cycle , which are needed to support growth of the daughter bud . ps , pi and pe stimulate cdc42p - gtp turn - over by the gaps ( gtpase - activating proteins ) rga1p/2p , which cause cdc42p - gdp reorganization at the bud cortex to alter the direction of polarized growth and exocytosis . the lem3p - dnf1p and lem3p - dnf2p flippase complexes facilitate cdc42p reorganization by flipping pe into the cytoplasmic leaflet of the pm bilayer , where pe activates cdc42p gaps . the flipping of pe into the cytoplasmic leaflet is also proposed to disrupt electrostatic interactions between a cationic region near the c - terminal end of cdc42p and the negatively charged ps in the pm , thus aiding both cdc42p extraction and its recycling from polarized membrane sites . in contrast , pi(4,5)p2 in the cytoplasmic leaflet of the pm bilayer appears to inactivate the rga1p/2p gaps , though it is not understood how . the final event in polarized exocytosis involves snare - mediated membrane fusion between the exocytic vesicle and its target at the pm . fusion requires interactions between snc1p/2p on vesicles with sso1p/2p and sec9p on the pm ( fig . 1 ) . although in vitro assays show that the snare syntaxins , sso1p/2p , bind pa and pi(4,5)p2 containing liposomes with high specificity , the importance of these lipid interactions during vegetative growth is unclear . membrane trafficking at the pm was proposed to be restricted to , or influenced by , the eisosome / mcc domains within the pm . however , it was recently shown that sites of exocytosis or endocytosis are largely found outside the mcc . based on this result , the distribution of snare proteins during exocytosis is predicted to be independent of the mcc lateral domains within the pm , though snc1p appears to reside in drms when at the pm . lipid composition and distribution within membranes is clearly important , but lipids are also covalently attached to small gtpases and thereby directly affect their activities . arf- , rab- and rho - family gtpases are modified by different lipids , which impart differences in gtpase localization and regulation . most rab gtpases are prenylated at their c - terminal ends with two geranylgeranyl groups by the cytoplasmic geranylgeranyl transferase ( ggtase ) ii complex . most rho gtpases are prenylated on their c - terminal end with a single geranylgeranyl group by the cytoplasmic ggtase i complex . these lipid modifications are of course required for gtpase membrane attachment , but the lipid attachments also confer targeting specificity sometimes through interactions with escort proteins . several proteins that recognize and bind to the di - geranylgeranyl modification determine the targeting of sec4p and ypt31p/32p to membranes . mrs6p is a ggtase ii complex chaperone that recognizes newly synthesized rab gtpases for prenylation and then delivers them to membranes . as a rab escort protein ( rep ) , mrs6p can not retrieve sec4p or other rab gtpases after membrane delivery . in contrast , gdi1p , the yeast rab guanine - nucleotide dissociation inhibitor ( gdi ) , removes rab gtpases from membranes after they complete gtp hydrolysis . for example , gdi1p extracts prenylated gdp - bound sec4p from membranes for recycling back to re - initialize post - golgi vesicle transport . gdi1p - sec4p and gdi1p - ypt31p/32p complexes are found in inactive cytoplasmic pools and to be activated they require membrane recruitment . yip1p is an integral membrane protein that appears to recruit gdi1p - gdp - rab gtpase complexes to the golgi . yip1 genetically interacts with both gdi1 and with genes that encode golgi - specific rab gtpases , though in vitro yip1p has a broad affinity for other rab gtpases with di - geranylgeranyl modification . sec4p is functional if its prenylation motif is replaced with a transmembrane ( tm)-spanning domain , but only if the tm domain targets sec4p to the correct location . based on these findings , the di - geranylgeranyl modification of sec4p not only imparts general membrane association but also appears to be recognized by receptor complexes that confer compartment specificity . because correct membrane targeting is necessary for subsequent interactions with effectors , di - geranylgeranyl modification has an important but indirect effect on rab gtpase activities . like the rab gtpases , prenylated rho gtpases rdi1p , the sole rho gdi in yeast , in part binds the single geranylgeranyl tail attached to cdc42p and rho1p to remove them from the pm . oddly enough , the elimination of rdi1p neither affects cell growth nor the gross cytoplasmic / pm distribution of cdc42p or rho1p . the apparent solution to this puzzle is that cdc42p recycling involves parallel mechanisms requiring both rdi1p and endocytosis , and the elimination of both pathways leads to a rapid loss in cdc42p polarization . it should be noted that c - terminal prenylation of cdc42p and rho3p is important for protein - protein interactions with the exocyst complex subunit exo70p . in vitro purified constitutively activated cdc42p and rho3p bind exo70p only if an intact c - terminal prenylation motif is present . the geranylgeranyl modification is therefore important for rho gtpase signaling despite some functional redundancy with other mechanisms . rho3p lipid modification differs from other rho gtpases in that it is prenylated at its c - terminus with farnesyl , and the fatty acid palmitate is attached in a region near its n - terminus . cdc42p is particularly important during early events in bud formation whereas rho3p plays a greater role later when the bud is larger . a fusion protein where the palmitoylated n - terminal region of rho3p is added onto cdc42p was sufficient to rescue growth defects seen in rho3 cells . these results suggest that rho3p and cdc42p perform similar functions but palmitoylation directs that activity to slightly different locations on the pm , which is particularly important in large - budded cells . palmitate is also covalently attached to the vesicle snares snc1p/2p , but the lipid addition does not affect their association with vesicles and a mutation that renders snc1p incapable of palmitoylation does not affect snare function . in short , the regulatory role of palmitoylation in exocytosis is clearly important but still not fully understood . unlike rho or rab gtpases , arf1p is n - myristoylated and nucleotide exchange is directly coupled with its membrane association . in the arf1p gdp / gtp cycle , arf1p - gdp is mainly cytoplasmic but its myristoylated n - terminal amphipathic helix causes arf1-gdp translocation into membranes wherein gdp exchange for gtp occurs . apart from promoting protein complex assembly , the membrane - associated myristoylated arf1p - gtp induces positive membrane curvature , which is proposed to be critical for the formation of nascent transport vesicles . together these findings suggest that myristoylation couples arf1p activation and signaling to structural changes in the golgi membrane for vesicle biogenesis . pi4p is perhaps the most important lipid in exocytosis , not only as a precursor for other pips but also for membrane targeting and activation of regulatory proteins . pi4p phosphorylation to pi(4,5)p2 is the regulatory modification most pertinent to the final events of exocytosis at the pm , whereas in the golgi pi4p turn - over appears to be important for vesicle biogenesis . even during vesicle transit , the reconfiguration of rab gtpase complexes needed for subsequent events in exocytosis is dependent on vesicle pi4p levels . the regulation of yeast exocytosis is ultimately tied to the fate of pi4p as dictated by the opposing activities of the pi4p phosphatases and the pi 4-kinases , pik1p and stt4p . in the golgi , the fate of pi4p is mainly governed by the pi4p phosphatase sac1p and the pi 4-p kinase pik1p ( fig . 1 ) . although sac1p is an er protein , it shuttles in - and - out of the golgi and in nutrient - deprived cells , sac1p remains in the golgi . sac1p and pik1p ( in a complex with its non - catalytic subunit frq1p ) have a reciprocal relationship : pik1p / frq1p is released into the cytoplasm when sac1p is present and , when sac1p is retained in the er , pik1p although sac1p inhibits pi4p - dependent activation of vesicle biogenesis by pik1p and sec14p , sac1p - dependent production of pi promotes complex sphingolipid biosynthesis and membrane sorting into nascent vesicles . these sphingolipids together with associated sterols are generically enriched in all exocytic vesicles , whether targeted to sites of polarized growth or to the pm in general . to reconcile how sac1p might repress vesicle formation while also facilitating lipid and protein sorting into vesicles , it is proposed that the osbp homolog osh4p integrates these opposing sac1p activities as part of a negative feedback loop . osh4 ( also known as kes1 ) is one of seven yeast osh genes ( osh1osh7 ) that share overlapping essential functions , including a specific role in polarized exocytosis . osh4p is a lipid - binding protein that contains mutually exclusive binding sites for a sterol and pi4p . a mutation that specifically inhibits sterol binding by osh4p results in its activation , causing growth defects that can be suppressed by deleting sac1 . in fact , osh4p induces sac1p phosphatase activity in vitro . these findings suggest that pi4p - bound osh4p is an upstream activator of sac1p , but osh4p is inhibited when in the sterol - bound form . in the negative feedback model , osh4p promotes sac1p dephosphorylation of pi4p to produce pi pools for complex sphingolipid synthesis . within the golgi membrane , newly synthesized sphingolipids concentrate with sterols , which might trigger the inhibitory exchange wherein a sterol replaces pi4p for osh4p binding . as a result , sac1p activity is reduced and pi4p levels in the golgi increase , which is an initiating event for vesicle formation . vesicle biogenesis is thereby delayed until sphingolipid / sterol microdomains can be generated for cargo sorting . this model is supported by multiple lines of evidence : ( 1 ) complex sphingolipid levels are reduced in osh4 cells ( leblanc et al . , submitted ) ; ( 2 ) similar to that observed in sac1 cells , the deletion of osh4 also causes missorting of proteins associated with sterol / sphingolipid membrane domains ; ( 3 ) like sac1 , the deletion of osh4 restores pi4p levels in cells with conditional pik1 or sec14 mutations ; ( 4 ) the deletion of either osh4 or sac1 bypasses the essential requirement for sec14 , because increases in golgi pi4p levels might induce vesicle biogenesis with associated decreases in pc or increased levels of dag and/or sphingolipids . thus , pi4p turn - over during vesicle biogenesis is in part controlled by osh4p and its downstream effector sac1p . it has been proposed that osh4p transfers sterols and pi4p between membranes in opposite directions , and pi4p hydrolysis is suggested to drive this vectorial exchange of lipids to generate a sterol gradient between membranes . however , sterol transport in both yeast and mammalian cells is not a directed mechanism but rather a process of equilibration , resulting in the steady - state concentration of sterols within cellular membranes enriched in sphingolipid membrane domains ( rafts ) . based in part on these findings , and in vivo sterol transport assays , whether or not osh4p sequesters or transfers pi4p in vivo , is not yet clear but it is another interesting possibility . osh proteins and sac1p are also implicated in pi4p turn - over later in vesicle transport well after post - golgi vesicle formation . despite its importance in regulating vesicle budding from the golgi rather , all proteins of the osh family must be inactivated to inhibit polarized transport , and the block is manifested only when vesicles dock with the pm but not earlier in exocytosis . because pi4p turn - over in vesicles regulates rab gtpase interactions with both myo2p and exocyst complex subunits , and osh4p travels along with exocytic vesicles to the cell cortex , it is proposed that osh proteins might regulate pi4p sequestration and/or dephosphorylation events even after vesicle release from the golgi . multiple findings support this proposed role for osh proteins during vesicle docking : ( 1 ) osh proteins associate in vivo with exocyst complex subunits and their gtpase regulators ( but not myo2p ) ; ( 2 ) genetic interactions reveal functional interactions between osh proteins and the exocyst complex ; ( 3 ) osh proteins are required for cdc42p and rho1p polarized localization at the pm ; ( 4 ) sec4p association with exocytic vesicles is not osh - dependent , but the docking of sec4p - containing vesicles with the pm is osh - dependent ; ( 5 ) both osh4 and sac1 overexpression cause severe growth defects in conditional myo2 mutants , potentially due to reductions in pi4p levels . with the complexity of lipid interactions required at every event during polarized exocytosis however , the status of pi4p is particularly important not only for vesicle formation at the golgi , but during each subsequent step in transport to the pm . clearly pi4p , along with its protein regulators , is now the focal point for understanding how these different steps during exocytosis are so seamlessly integrated .

miriam and sheldon g. adelson medical research foundation , the us - israel binational science foundation , and the melanoma research alliance , as well as members of the fisher lab , for useful discussions .

over the past decades , the incidence of obesity in the population has increased severely , and it has become a public health challenge . its etiology is multifactorial , encompassing environmental , dietary , physical inactivity , and genetic factors . obesity is a complex disease associated with a high - calorie diet , which contributes to the development of several other chronic noncommunicable diseases . obesity is also associated with increased plasma endotoxin ( lipopolysaccharide - lps ) , saturated fatty acids [ 2 , 3 ] , and proinflammatory cytokines all intricately involved in the development of comorbidities such as diabetes mellitus , hypertension , dyslipidemia , and metabolic syndrome . the fat tissue is not merely an energy storage organ , as it plays crucial endocrine and immune roles . white adipose tissue ( wat ) is an endocrine organ secreting pro- and anti - inflammatory adipokines such as tumor necrosis factor alpha ( tnf- ) and interleukin-6 ( il-6 ) , which are important inflammatory markers that stimulate the production of several proteins and proinflammatory cytokines in different cell types , via nuclear factor b activation ( nf-b ) . in addition many studies have shown that lps ( endotoxin ) can activate these proteins in adipocytes , thereby increasing the gene expression of proinflammatory adipokines [ 57 ] . the main role of adipose lipolytic enzymes is to provide other tissues with fas in case of energy demand . triglyceride stored in the lipid droplet is first hydrolyzed by the adipose triglyceride lipase enzyme ( atgl ) , also known as desnutrin , releasing a diacylglycerol moiety and fa , which requires an abhydrolase domain containing 5 ( abhd-5 ) promoter to be activated . after hydrolysis by atgl , diacylglycerols are then hydrolyzed sequentially by hormone - sensitive lipase ( hsl ) and monoglyceride lipase ( mgl ) , producing nonesterified fatty acids ( nefas ) and glycerol . different lipases gain access to the lipid droplet when the proteins coating the vesicle ( perilipins ) are phosphorylated . perilipin a normally prevents lipolysis of triglyceride by surrounding the lipid droplet , thus preventing the access of lipases . whey protein ( wp ) has been found to be an excellent prophylactic against obesity , because of the high biological value mediated by bioactive peptides . these act as antimicrobial agents , antihypertensive , and regulators of immune function , reducing body fat as well as a variety of related beneficial mechanisms for human health . they also have additional functions ; for example , they have appetite suppressant effects , stimulate muscle protein synthesis , and regulate of body energy homeostasis . there is plenty of evidence indicating the potential of the wp in anti - inflammatory and antioxidant effects of exercise [ 9 , 1113 ] . chitosan complex coacervation with wp is composed of by - products from the processing of shrimp , crab ( chitosan ) , and cheese , adding an environmental benefit to the product , as these by - products may be reused and not disposed of in landfill sites or released into rivers by producers . in view of the above , together with the development of fractionation technique and whey protein preservation , employing the method may contribute to the recovery of this valuable nutrient and increase the expression of the functional properties . this phenomenon occurs by the formation of a system of balance between colloids and the diluted supernatant [ 16 , 17 ] . thus , the purpose of the present study was to investigate the prospect of a biotechnological process of complexation and separation of cheese whey proteins in chitosan and test their antiobesogenic potential through the modulation of inflammatory markers and lipolytic pathway present in obesity . in this study we used sweet cheese whey ( sw 1108 bag 25 kg ) with 1.5% fat marketed by company alibra - pr . dissolving 10 g of the whey powder in 100 ml of distilled water . chitosan was used for the coacervation medium molar mass with 7585% degree of deacetylation and viscosity of 200800 cps ( sigma - aldrich 44887 - 7 ) . chitosan was dissolved in citric acid ( 208 mmol / l ) and , after this step , added to the cheese whey in a proportion of 1 : 1 under stirring at room temperature for 1 h. the ph of the solution of chitosan and wp was adjusted to 6 with naoh ( 250 mmol / l ) and solubilized at room temperature ( 25c ) with stirring . solids coagulated with chitosan known as coacervate ( cwp ) were collected by centrifugation ( 1300 g ) . in order to obtain on average 30% of the protein coacervate 3 l cheese whey was used . thus , samples of cwp were obtained for their chemical analysis of total lipids , total protein , and lactose . finally , for measurements of samples of mineral micronutrients , ca , k , mg , and p , of cheese whey , cwp , and chitosan , 100 g was subjected to an optical emission spectrometer for inductively coupled plasma ( icp oes , perkin elmer optima 3000 dv , norwalk , ct , usa ) . to determine the existing protein fractions in cwp the electrophoretic profile with reducing buffer containing 62.5 mm tris - hcl , 20% glycerol , 2% sodium dodecyl sulfate(sds ) ( 10% ) , 5% -mercaptoethanol , and bromophenol blue at ph 6.8 was performed . this study was approved by the research ethics committee of the universidade federalde so paulo , escola paulista de medicina ( unifespepm ) , as the search protocol number 0473/10 . experimental procedures are in accordance with principles of laboratory animal care formulated by the national institutes of health ( national institutes of health publication number 96 - 23 , revised 1996 ) . forty - nine male swiss mice twelve - week - old from cedeme ( centro de desenvolvimento de modelos experimentais da universidade federal de so paulo ) were housed five in a cage in a standard experimental animal laboratory and kept under controlled conditions of light ( 12 h light - dark cycle with lights on at 6 am ) and temperature ( 24 1c ) . all mice received water and food ad libitum . the animals were divided as follows : control diet plus tap water ( c - w ) ; control diet plus coacervate ( c - cwp ) ; high fat diet plus coacervate ( hf - cwp ) ; and high fat diet plus tap water ( hf - w ) . all diets were prepared according to the recommendations of the american institute of nutrition ( table 1 ) . figure 1(a ) shows the protein profile of the coacervate by the presence of the major proteins of larger fractions , namely , alpha - lactalbumin ( -la-14 kda ) , beta - lactoglobulin ( -lg18 kda monomer and 34 kda dimer form ) , bovine serum albumin ( bsa66 kd ) , and lactoferrin ( lacf86 kda ) . the cwp has a flocculation aspect ( figure 1(b ) ) consisting of proteins and micronutrients such as calcium , potassium , magnesium , phosphorus , and sodium ( table 2 ) . for total lipid extraction , diet samples were homogenized in chloroform and methanol 2 : 1 ( v / v ) , mixed , and incubated at room temperature for 5 min . then , additional volumes of 1.25 ml chloroform and 1.25 ml deionized h2o were added , and finally , following being vigorously homogenized for 3 min , samples were centrifuged at 1000 rpm for 5 min at room temperature . the chloroform layer was dried under n2 , and the total extract was converted into methyl esters and was analyzed in gas chromatography ( gc ) , coupled with a flame ionizer detector ( fid ) , ( varian gc 3900 ) and fatty acid profile was determined by calculating the retention time , using a pattern of fatty acids with known retention time ( supelco , 37 components ) . the addition was initiated at a temperature of 170c maintained for 1 minute and then a ramp of 2.5c / min to a final temperature of 240c , which was maintained for 5 minutes . we used a column cp wax 52cb , with a thickness of 0.25 mm , internal diameter of 0.25 m , and length of 30 m , with hydrogen as the carrier gas at a linear velocity of 22 cm s. after 12 hours of fasting , blood was collected from the tail vein to assess basal glucose concentration . then , a glucose ( merck ) solution ( 1.4 g / kg ) was administrated by gavage . blood samples were collected after 15 , 30 , 45 , 60 , and 120 minutes to measure glucose concentration using a glucose analyzer ( accucheck roche ) . at the end of the experimental period , trunk blood was collected and immediately centrifuged ( 1125 g/15 min at 4c ) . the adipose tissue depots , retroperitoneal ( ret ) , mesenteric ( mes ) , and epididymal ( epi ) , were dissected , weighed , immediately frozen in liquid nitrogen , and stored at 80c . serum concentrations of glucose , total cholesterol , triglycerides , and hdl - c were measured by an enzymatic colorimetric method using commercial kits ( labtest , brazil ) . concentrations of insulin and adiponectin were measured using specific enzyme - linked immunosorbent assay ( elisa ) kits ( milipore and r&d systems ) . mesenteric adipose tissue was removed , homogenized into a specific total protein extraction buffer [ 1% triton x-100 , 100 mm tris - hcl ( ph 7.4 ) , 100 mm sodium pyrophosphate , 100 mm sodium fluoride , 10 mm edta , 10 mm sodium orthovanadate , 2.0 mm phenylmethylsulfonyl fluoride , and 0.1 mg aprotinin / ml ] , and centrifuged at 12,000 g for 30 min at 4c . the supernatant was saved , and the protein concentration was determined using the bca assay ( bio - rad , hercules , california ) with bovine serum albumin ( bsa ) as a reference . quantitative assessment of tnf- , il-6 , and il-10 proteins was carried out by elisa ( duoset elisa , r&d systems , minneapolis , mn ) following the recommendations of the manufacturer . after euthanasia , the mesenteric adipose tissue was dissected and homogenized in 1.0 ml of solubilization buffer at 4c [ 1% triton x-100 , 100 mm tris - hcl ( ph 7.4 ) , 100 mm sodium pyrophosphate , 100 mm sodium fluoride , 10 mm edta , 10 mm sodium orthovanadate , 2.0 mm phenylmethylsulfonyl fluoride , and 0.1 mg aprotinin / ml ] . insoluble material was removed by centrifugation for 30 min at 9000 g in a 70 ti rotor ( beckman , fullerton , ca , usa ) at 4c . the protein concentration of the supernatants was determined using the bca assay ( bio - rad , hercules , ca , usa ) . proteins were denatured by boiling ( 5 min ) in a laemmli sample buffer containing 100 mm dtt and were run on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis in a bio - rad miniature slab gel apparatus . the proteins were electrotransferred from gels to nitrocellulose membranes for ~1.30 h/4 gels at 15 v ( constant ) in a bio - rad semidry transfer apparatus . nonspecific protein binding to the nitrocellulose was reduced by preincubation for 2 h at 22c in blocking buffer ( 1% bsa , 10 mm tris , 150 mm nacl , and 0.02% tween 20 ) . the nitrocellulose membranes were incubated overnight at 4c with antibodies against hormone - sensitive lipase ( hsl ) , adipose triglyceride lipase ( atgl ) , abhydrolase domain containing protein 5 ( abhd-5 ) , perilipin a , phospho 5 amp - activated protein kinase ( p - ampk 1 e 2 - thr 172 ) , and alpha - tubulin obtained from santa cruz biotechnology ( santa cruz , ca , usa ) diluted 1 : 1000 with blocking buffer supplemented with 1% bsa and then washed for 30 min in blocking buffer without bsa . the blots were subsequently incubated with peroxidase - conjugated secondary antibody for 1 h at 22c . to evaluate protein loading , the membranes were stripped and reblotted with an anti - alpha - tubulin antibody as appropriate . specific bands were detected by chemiluminescence , and visualization / capture was performed by uvitec gel - documentation system . band intensities were quantified by optical densitometry of developed autoradiographs ( scion image software , scion corporation , frederick , md , usa ) . all results are presented as mean standard error of the mean ( sem ) . statistical significances were assessed using two - way analysis of variance ( anova ) followed by tukey 's post hoc analysis to identify significant differences among the groups . after six weeks of treatment , the hyperlipidic diet promoted an increase in the body weight when compared to the control ( c - w versus hf - w ) . on the other hand , hf - cwp showed a lower body weight when compared to hf - w ( figure 2 ) . the hyperlipid diet increased the relative mass of epididymal and mesenteric depot and adiposity ( of epididymal , retroperitoneal , and mesenteric relative weight ) when compared to control group ( c - w versus hf - w ) , while the association with coacervate reduced these parameters ( hf - w versus hf - cwp ) . the retroperitoneal depot was increased in the hf - w group when compared to c - w one ( table 3 ) . the hyperlipid diet increased the triacylglycerol ( tag ) and vldl when compared to control group ( c - w versus hf - w ) , while the association with coacervate reduced these parameters ( hf - w versus hf - cwp ) . insulin level and homa index were increased in the animals fed with hyperlipidic diet ( c - w versus hf - w ) . when associated with coacervate , the hyperlipid diet promoted an increase in the adiponectin and a decrease in lps concentrations ( hf - w versus hf - cwp ) ( table 4 ) . the oral glucose tolerance test showed that the hyperlipidic diet promoted an increase at 15 minutes when compared to control ( hf - w versus c - w ) . the auc ( area under the curve ) analysis increased hf - w compared with c - w ( figure 3 ) . there was a significant decrease in il-10 concentrations in the animal fed with high fat diet when compared to animals fed the control diet ( hf - w versus c - w ) . the concentration of il-6 in c - cwp group was lower when compared to c - w group . figures 4(a ) , 4(b ) , 4(c ) , 4(d ) , and 4(e ) show the data of protein expression of hsl , atgl , perilipin a , and abhd-5 and ampk activity , respectively , in mesenteric adipose tissue . hsl protein expressions were reduced in c - cwp and hf - w when compared to the c - w group ( figure 4(a ) ) . there was an increase in atgl in hf - cwp group when compared to hf - w group ( figure 4(b ) ) . perilipin a was significantly higher in the hf - w group when compared to the c - w and hf - cwp groups ( figure 4(c ) ) . there was a significant decrease in the protein expression of abdh-5 in c - cwp when compared to c - w and hf - cwp groups ( figure 4(d ) ) . the phosphorylation of ampk ( figure 4(e ) ) was higher in hf - cwp compared to hf - w group . a positive correlation between auc and tag ( r = 0.86 p < 0.05 ) figure 5(b ) shows a positive correlation between insulin levels and sta in hf - w ( r = 0.96 p = 0.006 ) group . figures 5(c ) and 5(d ) show an inverse correlation between insulin ( r = 0.85 p = 0.02 ) ( figure 5(c ) ) and glucose ( r = 0.88 p = 0.01 ) levels with il-10 in the mesenteric adipose tissue in hf - cwp group ( figure 5(d ) ) . the functional , physical , and chemical characteristics vary according to the procedures used to obtain these proteins . in our study , it was possible to recover an average of 30% in wp ( table 2 ) . if we compare these numbers with published data ( which often use conventional techniques such as ultrafiltration ( uf ) ) , our method seems to be a low efficiency process . for example , the uf method is expensive not only in terms of deployment but also in terms of operation . in addition to being cost - effective , the coacervation process promotes the separation of wp and obtains a low - calorie product . the emergence of food compounds with health benefits may eventually become a good strategy to improve public health . in recent years , functional food has attracted the attention from scientific community , consumers , and food manufacturers . the list of nutraceuticals compounds ( vitamins , probiotics , bioactive peptides , and antioxidants among others ) is extensive , and scientific evidence seems to increasingly support the concept of health promotion through food ingredients [ 20 , 21 ] . functional foods are usually marketed as food containing ingredients technologically manipulated to perform a benefit for health . our study lends support to previous studies showing the effectiveness of cwp as a nutraceutical able to stabilize fat mass gain in animals fed with high fat diet . our findings agree with the wp intake benefits extensively reported in literature [ 2327 ] . as demonstrated , there was a decrease in body weight in the hf - cwp group when compared to the hf - w group , accompanied by a reduction in the adiposity . it is now well established that excessive consumption of saturated fat is related to the development of dyslipidemias [ 28 , 29 ] , and this study further corroborates it , as the animals fed with high fat diet increased tag and vldl . studies have demonstrated the insulinotropic effect of wp [ 9 , 11 , 30 ] . in this study , we did not find any significant difference in blood glucose between the groups assessed . regarding insulin and homa index , however , cwp treatment promoted improved glucose and insulin tolerance . a study undertaken by huang et al . utilizing different protein sources ( cheese whey , soy , red meat , and milk ) in obese mice ( induced by high fat diet ) has found increased adiponectin concentration and reduced insulin when the animals were fed with whey protein cheese . in the present study , we also detected the critical role of cwp in modulating adiponectin , as the values were higher for the hf - cwp group when compared to hf - w group . yamauchi et al . have demonstrated the potential of adiponectin in reducing insulin resistance by enhancing fatty acid oxidation , leading to a reduction in tag content in obese diabetic rats . studies have shown that wp promotes improvement in the treatment of gastrointestinal symptoms of infant mice with rotavirus - induced diarrhea , a protective role in colorectal cancer in rats , reduced release of il-6 in blood of rats undergoing transient ischemia / intestinal reperfusion and may provide protective effects against experimentally induced breast cancer in animals [ 25 , 34 , 35 ] . most of the more recent studies in the literature , both in vivo and in vitro , have focused on the possible effects of these proteins in macrophages and lymphocytes . although most proteins are degraded during the gastric digestion , certain cheese whey proteins , such as -lg , -la , or gmp , are resistant to digestion and remain intact . thus , it is important to understand the mechanisms underlying the impact of these proteins on immunity , stimulating anti - inflammatory processes in the body . the il-10 is a pleiotropic cytokine that controls inflammatory processes by eliminating the proinflammatory cytokines production such as il-1 , il-6 , and il-8 , and tnf- is produced mainly by monocytes , macrophages , lymphocytes , mast cells , and mature adipocytes [ 14 , 36 ] . the il-10/tnf- ratio has been considered an important indicator of inflammatory status as low values are often associated with increased morbidity and mortality risk . we did not observe an increase of the il-10/tnf- ratio in mes of group hf - cwp . we believe that because of the short period of the treatment the animals may not have developed their proinflammatory state . with increased length of treatment , we believe find results more expressive . another possibility is that the coacervate may have protected the mice from a proinflammatory state triggered by the treatment diet , leading to the counterbalance of il-10 unnecessary in hf - cwp group . however , a study involving a longer treatment period may be required to discern this possible effect . in this sense , there is an immunomodulatory mechanism underlying cwp , most likely the il-10 cytokine , which has a homeostatic metabolic effect in the mesenteric adipose tissue . our result suggests that il-10 may be a positive regulator of insulin sensitivity and increased glucose uptake . although the precise origin of the unchecked inflammatory response in obesity is still unclear , it is well known that in obesity the overproduction of proinflammatory cytokines affects metabolism . for example , tnf- contributes to the inability of cells to respond to insulin and to increased levels of insulin , and il-10 was associated with other variables closely linked to insulin sensitivity , such as fasting and postload insulin concentrations , hdl cholesterol , and triglyceride levels . besides the tissue - specific effect of cwp , we showed a systemic effect in the decrease in the lps serum level . regarding the composition of the cwp , we may highlight the presence of -la and -lg protein , the major protein present in the coacervate , which has been proven effective in suppressing the release of proinflammatory cytokines [ 27 , 38 ] . the presence of these proteins is a great indication that the coacervate components are able to modulate the proinflammatory milieu promoted by hyperlipidic diet . in another study by our group , mice , previously treated with high fat diet and fed with a supplementation of cwp ( gavage , 36 mg protein / kg of body weight ) , showed a positive correlation between il-10 and tnf - alpha in mesenteric adipose tissue , retroperitoneal adipose tissue , and liver tissue . therefore , pretreatment with high fat diet promoted metabolic alterations and inflammation , and cwp modulated the inflammatory milieu . evidence suggests that eating wp causes the decrease in calorie intake , increased basal energy expenditure , and modulates insulin sensitivity and glucose homeostasis , leading to changes in lipid metabolism in adipose tissue , liver , and muscle [ 3942 ] . the ampk and adiponectin are key molecules to metabolic responses in different tissues [ 43 , 44 ] ; they are involved in the preventive response against negative physiological processes caused by the consumption of a diet high in saturated fatty acids . the activation of ampk by bioactive components of foods or medicines has been regarded as goal , since it may reverse the metabolic changes associated with obesity and type 2 diabetes . the animals treated with coacervate showed an increase in ampk activation associated with the decrease in hsl and increase in atgl protein expression in mesenteric adipose tissue . a study conducted by gaidhu et al . showed that ampk activation stimulated by aicar ( 5-aminoimidazol-4-carboxamida ribonucleotdeo ) initially promoted inhibition of lipolysis in adipocytes isolated as in vivo , reflecting a decrease in free fatty acid in serum . on the other hand , prolonged treatment with aicar promoted an increase in lipolysis , which the authors attributed to an increase in the content of atgl and reduced activity of hsl . however , clear - cut conclusions are difficult to arrive at , due to a lack of tools for manipulating assays using specific ampk . furthermore , the overall effect of ampk activation of lipolysis is still controversial . the duration and mode of activation of ampk may be of particular importance when it comes to a process aimed at reducing the proinflammatory state caused by increased lipolysis . in addition , adiponectin can suppress the activation of hsl , without changing atgl and abhd-5 in adipocytes in order to modulate a homeostatic control of lipolysis to avoid lipotoxicity . lipolysis does seem to play a crucial physiological role by recruiting a source of energy mobilized in times of stress and/or energy deprivation . moreover , the very significant reduction in lipolysis is clearly harmful , as demonstrated in the clinical domain by the syndromes resulting from deficiencies in the lipolytic apparatus . given that , it is reasonable to question whether the inhibition of lipolysis , via hsl induced by cwp , is helpful or harmful , since enhanced lipolytic activity and concomitant increase of free fatty acid in the circulation is clearly deleterious and leads to several comorbidities . to clearly determine this , however , an analysis of free fatty acid and endogenous glycerol concentrations would need to be carried out . another interesting finding was the significantly higher protein expression of perilipin a ( 52% ) in hf - w group , which also refers to larger deposits of triglycerides , since this protein is primarily anchored around the droplets of neutral lipids in adipocytes . this is in line with studies showing that increased protein expression perilipin a leads to increased storage of triglycerides by reducing its hydrolytic rate . . finally , there is plenty of evidence suggesting that the intake of wp may lower consumption of calories , increase baseline energy expenditure , and improve insulin sensitivity and glucose homeostasis , thus leading to changes in lipid metabolism in adipose tissue , liver , and muscle [ 3942 ] . cwp were able to promote nutritional and physiological improvements in hf - cwp group , such as reduction in body mass and decreased serum lipid levels followed by decreased serum insulin and lps . in addition , intervention with cwp resulted in higher adiponectin contents and attenuated processes that would lead to glucose intolerance . therefore , cwp could play a beneficial role , in some way , in modulating lipolysis in animals treated with hyperlipidic diet .

hydroxychloroquine is a commonly used immunosuppressive agent in the treatment of various autoimmune diseases . despite lesser systemic toxicity compared to other drugs dosage > 5.0 mg / kg dramatically increases both population risk and annual incremental risk , and extreme doses can be exceedingly dangerous . other major factors are concomitant renal disease or use of tamoxifen [ 1 , 2 ] . those who advocate universal screening for hydroxychloroquine retinopathy do so because they believe that the best estimate for prevalence of hydroxychloroquine toxicity is greater than 1% among all users of these drugs for more than 5 years . although hydroxychloroquine retinopathy can be asymptomatic in early stages , patients with more advanced toxicity progress to having night vision problems and paracentral scotomas . this change has been characterized typically as photoreceptor thinning that begins in a parafoveal ring and progresses over time to become a visible bull's - eye retinopathy when the retinal pigment epithelium ( rpe ) becomes damaged . the progression of damage of structural and functional deficits can occur even after the cessation of drug therapy . discontinuing the drug in the early stages can prevent permanent damage ; therefore , the screening of patients for the early detection of asymptomatic retinal structural changes is important . in 2016 , the american academy of ophthalmology published recommendations on screening for chloroquine and hydroxychloroquine retinopathy . the primary screening tests are automated visual fields plus spectral - domain optical coherence tomography ( sd - oct ) . the multifocal electroretinogram ( mferg ) can provide objective corroboration for visual fields , and fundus autofluorescence ( faf ) can show damage topographically . of these tests , sd - oct is the most commonly used device for the detection of retinal structural changes . therefore , in our design of this study to investigate the early signs of retinal toxicity , we aimed to detect early abnormalities of the photoreceptor inner segment ( is ) , outer segment ( os ) , and rpe - bruch 's membrane complex thicknesses using sd - oct image segmentation algorithms . this prospective case - control study was performed at the ophthalmology department of fatih university medical faculty hospital and conducted according to the principles of the declaration of helsinki . the study was approved by the institutional review board of the university of fatih , and informed consent was obtained from all participants . participants were divided into two groups : group 1 ( hydroxychloroquine use ) and group 2 ( control ) . participants in the hydroxychloroquine use group were chosen from patients being treated for rheumatic diseases , including rheumatoid arthritis , systemic lupus erythematosus , and sjgren 's disease . additionally , group 1 was divided into two subgroups based on the duration of hydroxychloroquine treatment as follows : 26 patients with hydroxychloroquine use < 5 years and 25 patients with hydroxychloroquine use 5 years . all subjects were excluded if they had histories of glaucoma or glaucoma suspects , uveitis , optic neuropathy , or retinal or choroidal vascular disease ; refractive error of more than 4 d sphere or 2 d cylinder ; or had undergone previous ocular surgery . clinical information included adjusted daily dose of drug , duration of drug exposure , and cumulative dose of drug . adjusted daily dose was calculated as described by browning ( daily dose divided by the lesser of the ideal body weight ( ibw ) associated with the patient 's height or the actual body weight ( abw ) ) . the hydroxychloroquine cumulative dose ( g ) was calculated by multiplying the current daily dose ( g / day ) with the duration of hydroxychloroquine treatment ( month ) . all participants underwent a comprehensive ocular examination , including visual acuity , slit - lamp biomicroscopy , intraocular pressure ( iop ) measurement with goldmann applanation tonometry , central corneal thickness ( cct ) measurement with a pentacam scheimpflug ( oculus inc . , wetzlar , germany ) , axial length ( al ) measurement with the iolmaster ( carl zeiss , jena , germany ) , and pupil - dilated fundus examination . in addition , subjects with hydroxychloroquine use underwent white - on - white visual field ( vf ) testing using the humphrey macular threshold program ( zeiss humphrey systems , dublin , ca ) . the cirrus hd - oct 4000 , version 6.0 , ganglion cell analyzer ( gca ) algorithm was used to detect the gcipl and to measure the thickness of the elliptical annulus area ( vertical outer radius 2.0 mm , horizontal outer radius 2.4 mm ) centered on the fovea . the gca reports the average , minimum , and sectoral ( superotemporal , superior , superonasal , inferonasal , inferior , and inferotemporal ) thicknesses of the gcipl . the scan lengths were 6 mm for the horizontal scans and 6 mm for the vertical scans . the thicknesses were measured at the fovea and at 0.5 mm nasal , temporal , inferior , and superior to the fovea . the thicknesses were manually measured using the software loaded in the system by the examiner who was unaware of the hydroxychloroquine history of the subjects . the thicknesses of the photoreceptor is and os and is + os at the fovea were analyzed . is thickness is the distance between the lower border of the external limiting membrane ( elm ) and the middle of the ellipsoid zone ( ez ) . os thickness refers to the distance between the middle of the ez and the anterior surface of the rpe . is + os thickness accounts for the distance between the lower border of the elm and the anterior surface of the rpe . rpe - bruch 's membrane complex thickness refers to the distance between the lower border of bruch 's membrane and the anterior surface of the rpe . is thickness is the distance between the lower border of the external limiting membrane ( elm ) and the middle of the ellipsoid zone ( ez ) . os thickness refers to the distance between the middle of the ez and the anterior surface of the rpe . is + os thickness accounts for the distance between the lower border of the elm and the anterior surface of the rpe . rpe - bruch 's membrane complex thickness refers to the distance between the lower border of bruch 's membrane and the anterior surface of the rpe . statistical analysis was performed with spss software for windows , version 18 ( spss inc . , thickness measurements in the central macular areas obtained from images in group 1 ( hydroxychloroquine patients ) were compared to those obtained in group 2 ( controls ) . the correlation between the exposure time , cumulative dose , and sd - oct parameters was evaluated using pearson 's correlation coefficient . we performed a multiple - adjusted testing analysis ( bonferroni method ) to evaluate the influence of the photoreceptor is and os , is + os , and rpe - bruch 's membrane complex thicknesses . the demographic characteristics and clinical data of the patients receiving hydroxychloroquine and the control subjects are shown in table 1 . the mean age of the 51 patients was 45.0 13.16 years in hydroxychloroquine patients and 42.1 14.3 years in the controls ( p = 0.35 ) . the mean cumulative dose of hydroxychloroquine was 648.41 g , and the mean duration of hydroxychloroquine use was 34.85 months . there were no statistically significant differences in iop , al , cct , and bmi between the groups ( p = 0.18 , p = 0.95 , p = 0.25 , and p = 0.58 , resp . ) . indications for hydroxychloroquine use included 20 cases for rheumatoid arthritis , 19 cases for systemic lupus erythematosus , and 12 cases for sjgren 's syndrome . the os and is + os thicknesses of hydroxychloroquine patients were lower than those of the control subjects and were significantly different at all five locations that were assessed ( p < 0.003 ) . the is thicknesses were not significantly different between the patients with hydroxychloroquine use and the control subjects ( p > 0.05 ) . rpe - bruch 's membrane complex thicknesses for using hydroxychloroquine were also significantly higher than for those of the control subjects ( table 2 ) . the gcipl thickness values of the hydroxychloroquine and control groups are compared in table 3 . minimum and temporal - inferior macular gcipl thicknesses were 79.73 5.07 and 81.78 5.44 m in hydroxychloroquine patients , and 81.97 4.44 and 84.50 5.15 m in the controls , respectively ( p = 0.04 and p = 0.03 , resp . ) . the other gcipl thicknesses were not significantly different between the hydroxychloroquine patients and the control subjects ( both p > 0.05 ) . in the subgroup receiving hydroxychloroquine treatment 5 years , the is + os and os thicknesses ( except temporal ) in the five measurement points were found to be lower and significantly different ( p < 0.003 ) than in the subgroup treated with hydroxychloroquine < 5 years . however , the is thicknesses ( except temporal ) were not significantly different ( p > 0.003 ) . rpe - bruch 's membrane thicknesses for the group treated with hydroxychloroquine < 5 years were also significantly higher than in the group receiving hydroxychloroquine 5 years ( table 4 , figure 2 ) . the gcipl thickness values of the hydroxychloroquine patients are compared in table 5 . according to the results , the gcipl thicknesses were not significantly different ( p > 0.05 ) . however , the subgroup treated with hydroxychloroquine 5 years had thinner mean gcipl thicknesses than the subgroup receiving hydroxychloroquine treatment < 5 years in all subfields . the cumulative dose values were negatively correlated with the is + os thicknesses and positively correlated with rpe - bruch 's membrane complex thicknesses . these values are found to be statistically significant ( p < 0.05 ) ( table 6 ) . hydroxychloroquine retinopathy has been well described and is one of the serious side effects associated with the use of hydroxychloroquine . ocular screening tests have an important role in the early diagnosis and the prevention of drug toxicity . the american academy of ophthalmology recommendations for screening that were published in 2016 recommended the use of both automated visual fields and sd - oct for routine primary screening . if signs of damage are uncertain and drug exposure continues , retinal degeneration and ultimately functional blindness may occur . in these conditions , early recognition and cessation of exposure clearly reduce the risk of later functional visual loss . cessation of the use of hydroxychloroquine at an early stage of damage might prevent functional loss ; however , after maculopathy has developed , cessation of the drug does not show clinical recovery . because discontinuation of therapy may reverse retinal toxicity , the risk factors for hydroxychloroquine retinopathy include daily dose adjusted for the lesser of ibw and abw , duration of use more than 5 years , more than 1000 g total hydroxychloroquine consumption , increased age , concomitant renal or liver disease , and preexisting maculopathy [ 12 , 13 ] . therefore , 6.5 mg / kg / d based on ibw has been transformed from the threshold for safe dosing to the threshold for toxic dosing . although hydroxychloroquine dosing should be based on the lesser of ibw and abw , there is no consensus about the definition of ibw . in our study , the given usual 400 mg / d dose of hydroxychloroquine would exceed the toxic dose threshold based on adjusted daily dose . our calculated dose of hydroxychloroquine based on adjusted daily dosing , 8.75 mg / kg / d , is now considered too high . the practical purpose of screening is to determine the earliest signs at a stage where visual loss is minimal or even asymptomatic . although vf testing is subjective and variable , sd - oct is objective and specific in providing retinal images [ 9 , 15 ] . more certain diagnostic methods or the combination of objective and subjective tests can allow early - stage detection of retinal toxicity . sd - oct was emphasized as one of the recommended screening methods for the early detection of hydroxychloroquine toxicity , according to the revised american academy of ophthalmology guidelines . in a study , paracentral ring scotoma is documented in a few patients with early hydroxychloroquine retinal toxicity who had ring scotomas on vf testing but normal sd - oct scans . the other patients in the same study had evident , parafoveal damage on sd - oct images , accompanied by vf abnormalities . in our study , quantitative analysis with segmentation presented significant thinning of the os layers but vf testing did not show changes consistent with any retinopathy . it has been indicated that oct findings include loss of the external limiting membrane , disruption of the outer ez , parafoveal thinning of the outer nuclear layer , and rpe damage [ 11 , 16 ] . our study is similar to previous reports and finds a significant decrease of the os and is + os thicknesses in the patients using hydroxychloroquine . moreover , the obtained data indicated a negative correlation with exposure time and cumulative dose . likewise , in the subgroup receiving hydroxychloroquine treatment 5 years , the is + os and os thicknesses ( except temporal ) in the five measurement points were found to be lower and significantly different than in the subgroup treated with hydroxychloroquine < 5 years . another observation in our study was that the minimum and temporal - inferior gcipl thicknesses are significantly thinner in the group of patients using hydroxychloroquine compared to the control group . there was a slight decrease in the other gcipl measurements , though this was not statistically significant . more specifically , korah and kuriakose described these changes as anatomical evidence of loss of ganglion cell layers , causing marked thinning of the parafoveal region , especially in inferior and temporal quadrants . previous histopathological studies reported that the initial dramatic changes of hydroxychloroquine toxicity were observed in the retinal ganglion cell layer [ 18 , 19 ] . on the other hand , recent oct studies have suggested that selective thinning of perifoveal inner plexiform and ganglion cell layers was found in patients treated with long - term hydroxychloroquine . these reported findings are in agreement with our observations [ 6 , 20 , 21 ] . we also observed that there was increased thickness of rpe - bruch 's membrane complex in hydroxychloroquine patients . additionally , a positive correlation was found between exposure time and cumulative dose and an increase in thickness in rpe - bruch 's membrane . similarly , rpe - bruch 's membrane thicknesses for the group treated with hydroxychloroquine < 5 years were also significantly higher than in the group receiving hydroxychloroquine 5 years . these changes in rpe metabolism result in a deterioration of the phagocytic function in the outer segments of the photoreceptor cells [ 22 , 23 ] . mahon et al . reported an apparent accumulation of autophagic granules in cone photoreceptor cells exposed to chloroquine in an animal model . indicated increased thicknesses of the outer band of the retina in the macular area in patients who were treated with hydroxychloroquine , compared to the control subjects . they supposed that the thickening of the outer band observed in patients resulted from thickening of bruch 's membrane . we think that an increase in rpe - bruch 's membrane complex thickness does not necessarily mean that the patient is experiencing toxicity therefore , we offer that a follow - up study examining patients who develop toxicity over time is needed . in the literature , the central thickness is affected only at the late stage to the fovea , while in patients with hydroxychloroquine toxicity , retinal thinning begins in a parafoveal ring and progresses over time to the outer parafoveal ring . have noted that elm integrity in or around the fovea on sd - oct is associated with the preservation and possibility of ez regeneration . in addition , they detected that patients with clinically visible disruption of the elm during the initial examination had evidence of progressive outer retinal remodeling on sd - oct after discontinuing hydroxychloroquine therapy . specifically , the improvement in appearance of the outer retina and the partial regeneration of photoreceptors were limited to areas with elm preservation at the time of diagnosis . finally , they concluded that elm preservation may carry a positive prognostic value for restorating the outer retinal layers in the setting of toxic effects . first , this study did not have a normal control group composed of patients with rheumatological disease not taking hydroxychloroquine . our results may be reexamined in a future investigation involving more age - matched , untreated rheumatic of subjects as a control group . second , we did not evaluate additional useful screening tests as the mferg and fundus autofluorescence ( faf ) . in the previous studies , mferg has been shown to be abnormal in retinal function even earlier than other modalities in patients with otherwise normal clinical examinations . it may be able to detect subtle changes in earlier stages of hydroxychloroquine toxicity [ 27 , 28 ] . currently , the american academy of ophthalmology recommendations for screening reported that the mferg can provide objective corroboration for visual fields , and fundus autofluorescence ( faf ) can show damage topographically . however , mferg testing is not available in most ophthalmology practices and requires specialized training to perform and analyze the test results . the present study would support the need for further analysis of the purported benefits of use as routine oct and 10 - 2 vf testing . finally , the thicknesses were measured at 0.5 mm diameter , centered on the fovea . the segmentation was found to be rather poor because the oct images were not clear to identify the origin of the outer retinal layers outside of the fovea . therefore , we can not measure at 1 or 1.5 mm from the fovea . despite significant study results , there is the need for further studies to ascertain the relationship between changes in this photoreceptor segment and rpe - bruch membrane thicknesses and the long - term risk of retinal toxicity with hydroxychloroquine treatment . we hope that future studies would improve our understanding of the value of this evaluation . in conclusion , this study indicated that the foveal photoreceptor os thinning , loss of gcipl , and rpe - bruch 's membrane thickening were detected in patients with hydroxychloroquine therapy , using sd - oct . we suppose that this quantitative approach using sd - oct images may have important implications to use as an early indicator of hydroxychloroquine toxicity without any visible signs of hydroxychloroquine retinopathy .

atmospheric aerosols play an important role in the climate system by scattering and absorbing solar radiation and by affecting cloud properties and lifetimes through their ability to act as cloud condensation nuclei [ stocker et al . , 2013 ] . aerosols also deteriorate air quality causing decreased visibility and adverse health effects [ dockery and pope , 1994 ] . a large fraction of atmospheric particulate material consists of secondary organic aerosol ( soa ) which is formed when volatile organic compounds ( vocs ) oxidize and form condensable trace gases [ hallquist et al . , the volatile soa precursor gases comprise emissions from both biogenic and anthropogenic sources , and their oxidation products include diverse compounds with a large variety in saturation concentrations , functional groups , and other properties [ hallquist et al . , 2009 ; goldstein and galbally , 2007 ; kroll and seinfeld , 2008 ] . the complexity and unknown properties of soa set a great challenge for understanding atmospheric aerosol effects [ kanakidou et al . , dynamics of soa systems are especially sensitive to compounds ' properties such as volatility , chemical reactivity , and diffusivity . to overcome the daunting complexity of atmospheric soa , simplified approaches are used to represent the vast number of different organic compounds in models . one approach , widely used in soa studies , is the volatility basis set ( vbs ) approach [ donahue et al . , 2006 ] , which lumps the compounds based on their saturation concentration ( c * ) . it is typically applied together with equilibrium gasparticle partitioning theory [ pankow , 1994 ] for determining the particle and/or gas phase compositions of soa systems with different precursor gases . such approaches typically assume either instantaneous gasparticle equilibration and/or instantaneous mixing within the particle phase . in both cases they omit mass transport limitations inside particles and , often , also omit particle phase chemical transformations . pinene is among the main atmospheric soa precursor vocs , and the soa derived from oxidation of pinene is often used as a replica of atmospheric soa [ hallquist et al . , the volatility of soa derived from pinene ozonolysis has a vbs with c * between 10 and 10 g m [ pathak et al . , 2007 ] . in addition to the c * of the soa constituents , also the physical phase state of the soa particles can affect their growth and evaporation . within a viscous semisolid particle , the diffusion of molecules proceeds slower than in a liquid particle , which affects their ability to evaporate . . reported slower evaporation of pinene ozonolysis soa under dry conditions compared to the expected evaporation rate based on the vbs parameterization derived from the soa growth experiments . additionally , the anomalously slow evaporation rate did not exhibit similar size dependence as expected for vapor pressuredriven evaporation . it has been suggested that the slow evaporation is due to diffusional mass transport limitations in the particle phase arising from the viscous phase of the particles [ vaden et al . , 2011 ] or due to a combination of oligomer degradation and mass transfer limitations [ roldin et al . , 2014 ] . these hypotheses are supported by the unchanged composition of pinene soa particles upon heating [ cappa and wilson , 2011 ] . there is some variability in measured evaporation rates of pinene soa depending on humidity conditions . wilson et al . reported faster evaporation for soa particles from pinene ozonolysis at 90% relative humidity ( rh ) compared to rh < 5% and at 50% rh they observed evaporation kinetics similar to the low rh conditions . the reduced diffusivity within the particles , and consequently , slower evaporation rate , as the rh decreases is consistent with particle viscosity measurements that report pinene soa viscosities ranging from those of semisolid or solid material to liquid over the rh range up to 90% [ rembaumwolff et al . , 2013 ; zhang et al . , also , a decrease in the bouncing of pinene soa particles with increasing rh indicates changes in particles ' viscosity [ kidd et al . , 2014 ; the bouncing of freshly formed atmospheric secondary particles suggests that the viscosity observations of pinene soa have atmospheric relevance , at least in the boreal forest environment [ virtanen et al . , mass transfer limitations have been the primary explanation for slow particle evaporation rates , but there are other possibilities . uncertainty in the vbs parameterizations may also affect the interpretation of the soa evaporation experiments . the slow evaporation could be consistent with pinene soa that contains compounds with lower c * than what is reported in the previous vbs studies . in fact , highly oxidized , and likely very lowvolatile , organics have been observed in the gas phase both in laboratorygenerated pinene soa systems and in the atmosphere [ ehn et al . , 2014 ; jokinen et al . , such lowvolatile compounds are not represented in existing vbs parameterizations which are derived from soa growth chamber experiments where organic aerosol mass loadings are orders of magnitude higher than the c * of these compounds . these newly identified compounds have not been included in detailed gas chemical models [ roldin et al . , further , vapor losses on the chambers ' walls would be amplified for lowervolatility compounds and would distort laboratoryderived vbs toward higher volatilities if not accounted for appropriately [ kokkola et al . , 2014 ; mcvay et al . , 2014 ; matsunaga and ziemann , 2010 ] . in this study , we explore the roles of both volatility and viscosity in determining evaporation rates of pinene ozonolysis soa particles under both dry and atmospherically relevant humidity conditions . the measured data are interpreted using an evaporation model with a description of particle phase diffusion in order to determine the role of diffusion limitations at atmospherically relevant rh and timescales . , 2011 ; wilson et al . , 2015 ] and support the conclusion of particle phase diffusivity limiting the evaporation . in contrast , at atmospherically relevant rh and time scales , our results demonstrate that the diffusion limitations have a minor effect on evaporation of pinene soa particles . soa was formed by ozone oxidation of pinene in a continuous flow tube reactor at dry condition . the used relative humidities ( rhs ) inside the flow tube did not affect the evaporation rate . mixing ratios of pinene and ozone at the flow tube inlet were 500800 ppb and 600 ppb , respectively . the o : c of the soa , which describes the degree of oxidation , was 0.55 corresponding well with values reported for fresh soa in a monoterpenerich environment [ pennington et al . , the aerosol was led through an ozone scrubber , and then a monodisperse particle population was selected with a differential mobility analyzer ( dma ) using clean air as sheath air . the dma was operated in an open loop configuration in order to dilute the remaining gas phase compounds . the dma flows and the short tube length ensured that the mixing of the sheath and sample flows were minimal resulting in high dilution ratios at the outlet of the dma driving the particle evaporation [ li and chen , 2005 ] . the size selected ( mobility diameter 80 nm ) particle population was led to a clean 100 l polished stainless steel chamber until particles were detected at the outlet ( approximately 3060 min filling time ) , after which the chamber was closed . short residence time data ( 2130 s ) were obtained when the evaporation chamber was bypassed , and instead , the soa was sampled after size selection through varying lengths of stainless steel tubing . intermediate residence time data ( ~30 min ) were obtained by sampling at the end of the evaporation chamber during filling . at various times throughout the experiment , sampling from the evaporation chamber this method was repeated providing long residence time data for each evaporation experiment ( 24 h ) . the sample ( at the dma ) and the evaporation chamber humidities were conditioned either with dry air or with air humidified to 40% or 80% rh . particle composition was measured with an aerodyne highresolution timeoffight aerosol mass spectrometer ( hereafter ams ) [ decarlo et al . , 2006 ; aiken et al . the measured particle evaporation was analyzed using two evaporation models for a monodisperse particle population . one model was based on evaporation mass flux due to gas phase diffusion and assumes a wellmixed liquidlike particle phase [ vesala et al . , 1997 ; models were initialized with the measured particle size at the dma and an assumption of the initial particle composition . the organic compounds were represented with a 1d vbs [ donahue et al . , 2006 ] using eight c * bins with decadal difference between 10 and 10 g m. all organic compounds were assumed to have molar mass of 150 g mol , gas phase diffusivity of 0.058 cm s , density of 1.2 g cm , mass accommodation coefficient of 1 , and desorption lifetime of 10 s. simulations were performed at 298.15 k. in simulations for humid conditions , water was assumed to constantly reach instantaneous gasparticle surface equilibrium , and the aqueous solution was assumed ideal for calculating water molar fraction . use of measured hygroscopic growth factors instead of the ideal solution assumption was also tested for the liquidlike model ( see supporting information ) . unless otherwise stated , an instantaneous complete wall loss was assumed for the evaporated vapors ( see supporting information ) . the initial particle composition was optimized with the wellmixed particle evaporation model using a genetic algorithm [ goldberg , 1989 ] to determine a vbs that would reproduce observed evaporation rates . we ran 20 genetic algorithm simulations resulting into 20 different initial particle volatility basis sets ( vbss ) that captured the observed evaporation well . among these 20 cases the one with best fitness was selected as the best fit composition . during the fitting procedure , initial volatility distributions that suggested unreasonably high oxidized organic mass compared to reacted pinene mass in the flow tube were disregarded ( see supporting information ) . this restriction affected mainly to the highest c * bin . as reacted pinene mass was used only as an upper limit for organic mass , the resulted vbss were not sensitive for vapor wall losses in the flow tube . the multilayer model was modified from the kmgap model by allowing for the surface layer to combine with the outermost bulk layer when the surface layer thickness has reduced to < 0.5 nm . composition dependence of particle viscosity ( ) was assumed to have the form ( 1)log10=ixilog10biwhere xi is the dry particle molar fraction of the volatility bin i and bi is a coefficient that describes the effect of bin i on the viscosity [ o'meara et al . values of bi were varied independently for dry and 40% rh conditions to find matches between model simulations and measurements . the particle phase diffusivities were equal for all organic compounds as we assigned equal molar masses for them . soa was formed by ozone oxidation of pinene in a continuous flow tube reactor at dry condition . the used relative humidities ( rhs ) inside the flow tube did not affect the evaporation rate . mixing ratios of pinene and ozone at the flow tube inlet were 500800 ppb and 600 ppb , respectively . the o : c of the soa , which describes the degree of oxidation , was 0.55 corresponding well with values reported for fresh soa in a monoterpenerich environment [ pennington et al . , the aerosol was led through an ozone scrubber , and then a monodisperse particle population was selected with a differential mobility analyzer ( dma ) using clean air as sheath air . the dma was operated in an open loop configuration in order to dilute the remaining gas phase compounds . the dma flows and the short tube length ensured that the mixing of the sheath and sample flows were minimal resulting in high dilution ratios at the outlet of the dma driving the particle evaporation [ li and chen , 2005 ] . the size selected ( mobility diameter 80 nm ) particle population was led to a clean 100 l polished stainless steel chamber until particles were detected at the outlet ( approximately 3060 min filling time ) , after which the chamber was closed . short residence time data ( 2130 s ) were obtained when the evaporation chamber was bypassed , and instead , the soa was sampled after size selection through varying lengths of stainless steel tubing . intermediate residence time data ( ~30 min ) were obtained by sampling at the end of the evaporation chamber during filling . at various times throughout the experiment , sampling from the evaporation chamber this method was repeated providing long residence time data for each evaporation experiment ( 24 h ) . the sample ( at the dma ) and the evaporation chamber humidities were conditioned either with dry air or with air humidified to 40% or 80% rh . particle composition was measured with an aerodyne highresolution timeoffight aerosol mass spectrometer ( hereafter ams ) [ decarlo et al . , 2006 ; aiken et al . the measured particle evaporation was analyzed using two evaporation models for a monodisperse particle population . one model was based on evaporation mass flux due to gas phase diffusion and assumes a wellmixed liquidlike particle phase [ vesala et al . , 1997 ; models were initialized with the measured particle size at the dma and an assumption of the initial particle composition . the organic compounds were represented with a 1d vbs [ donahue et al . , 2006 ] using eight c * bins with decadal difference between 10 and 10 g m. all organic compounds were assumed to have molar mass of 150 g mol , gas phase diffusivity of 0.058 cm s , density of 1.2 g cm , mass accommodation coefficient of 1 , and desorption lifetime of 10 s. simulations were performed at 298.15 k. in simulations for humid conditions , water was assumed to constantly reach instantaneous gasparticle surface equilibrium , and the aqueous solution was assumed ideal for calculating water molar fraction . use of measured hygroscopic growth factors instead of the ideal solution assumption was also tested for the liquidlike model ( see supporting information ) . unless otherwise stated , an instantaneous complete wall loss was assumed for the evaporated vapors ( see supporting information ) . the initial particle composition was optimized with the wellmixed particle evaporation model using a genetic algorithm [ goldberg , 1989 ] to determine a vbs that would reproduce observed evaporation rates . we ran 20 genetic algorithm simulations resulting into 20 different initial particle volatility basis sets ( vbss ) that captured the observed evaporation well . among these 20 cases the one with best fitness was selected as the best fit composition . during the fitting procedure , initial volatility distributions that suggested unreasonably high oxidized organic mass compared to reacted pinene mass in the flow tube were disregarded ( see supporting information ) . this restriction affected mainly to the highest c * bin . as reacted pinene mass was used only as an upper limit for organic mass , the resulted vbss were not sensitive for vapor wall losses in the flow tube . the multilayer model was modified from the kmgap model by allowing for the surface layer to combine with the outermost bulk layer when the surface layer thickness has reduced to < 0.5 nm . composition dependence of particle viscosity ( ) was assumed to have the form ( 1)log10=ixilog10biwhere xi is the dry particle molar fraction of the volatility bin i and bi is a coefficient that describes the effect of bin i on the viscosity [ o'meara et al . , values of bi were varied independently for dry and 40% rh conditions to find matches between model simulations and measurements . the particle phase diffusivities were equal for all organic compounds as we assigned equal molar masses for them . the particle evaporation at each rh was considerably slower than expected based on the vbs previously determined for pinene dry ozonolysis soa from growth experiments [ pathak et al . , 2007 ] and assuming perfectly mixed liquid particles ( figure 1a ) . in addition , the measurements clearly show that particles evaporated faster at humid conditions ( 40% and 80% rh ) compared to dry conditions ( figure 1a ) . the observations of slow evaporation under all humidity conditions and the slower evaporation under dry conditions compared to high rh ( 80% ) are consistent with previous studies , where particles were formed in a teflon bag and their evaporation was measured in a separate chamber [ vaden et al . , 2011 ; wilson et al . , interestingly , in our case the evaporation at 40% rh was similar to 80% rh , while wilson et al . observed similar evaporation kinetics at 50% rh compared to dry conditions . the reason for this difference between the studies at moderate rh may be due to different soa formation conditions : wilson et al . used a teflon chamber with an oh scavenger , while our experiments were conducted in a flow tube without an oh scavenger . the overall evaporation rates of the 80 nm particles in our study were close to those observed previously for 125414 nm particles [ vaden et al . , 2011 ; wilson et al . , 2015 ] ( figure s4 ) . measured evaporation of particles with initial size 80 nm and model simulations at 80% rh . wellmixed particle model simulations at 80% rh : size evolution with the best fit initial volatility distribution for 80% rh ( red line in figure 1a ) , and size evolution for the best fits from 20 genetic algorithm simulations ( gray lines in figure 1a ) . size evolution with the initial volatility distribution calculated based on the flow tube mass loading and the pathak et al . vbs parameterization and assuming varying vapor wall loss rate from complete instantaneous wall loss to no wall loss ( light red shaded area in figure 1a ) . ( be ) best fit initial particle volatility distribution for 80% rh and the evolution of particle composition . variability in the initial volatility distribution ( minimum and maximum as error bars ) within the 20 genetic algorithm simulations is also shown in figure 1b . based on current literature , it can be assumed that pinene soa particles have relatively low viscosity at 80% rh [ rembaumwolff et al . , 2013 ] and higher viscosity at dry conditions ( rh ~ 0% ) [ zhang et al . , 2015 ] . hence , we started our model simulations from the 80% rh where we can assume that the diffusion timescales in particle bulk were short compared to the gas phase and that the traditional evaporation model assuming fully mixed liquidlike particles was valid for simulating the evaporation . results shown later demonstrate that the assumption is valid up to viscosity values as high as 1010 pa s. it should be noted that the evaporation modeling is sensitive to the treatment of vapor wall losses when particle number concentration is high . to qualitatively resolve the best treatment for wall losses in our system , we performed two experiments at dry conditions with particle number concentrations differing by approximately an order of magnitude . the evaporation rate was similar for both cases ( figure 1a ) indicating that the vapor wall loss rates were fast , faster than approximately 10 s , and that the instantaneous wall loss assumption in the model was reasonable ( figure s2 ) . we modeled the evaporation at 80% rh by optimizing the vbs at the beginning of the evaporation so that the model matched the measured evaporation curve ( red curve in figure 1 and red bars in figure 1b ) . this optimized vbs is referred to as the initial vbs hereon . with eight c * bins the experimental curve can be reproduced almost perfectly with several different initial volatility distributions ( figures 1a and 1b ; see supporting information ) . the sensitivity to the initial mass fractions of the bins with c * 10 g m was especially low . the simulations , however , clearly demonstrated that a considerable fraction ( > 36% ) of mass was needed in the two least volatile bins of the vbs ( c * 10 g m ) to replicate the experimental results at 80% rh ( figure 1b ) . these two volatility bins are the main contributors in the particle phase at the end of the evaporation experiment ( figure 1e ; see movie s1 representing the evolution of particle phase composition ) . as the c * range extended down to only 10 g m , this bin includes all compounds with c * 10 g m , i.e. , compounds with low volatility relative to the experiment time scale . also of particular note is that a large fraction ( > 25% ) of the mass was required to be initially in the c * bins of 1010 g m. the evaporation rate was clearly lower at dry conditions compared to humid conditions ( figure 1 ) . the particles were generated in similar conditions in the flow tube in all three humidity cases shown in figure 1 , and therefore , drastically different initial organic compositions between the dry and the wet experiments were unlikely . the observed differences in evaporation rates between dry and humid conditions can not be explained by raoult 's effect resulting from the water uptake at elevated rhs because the solution effect would slow down the evaporation of wet particles compared to dry particles . the difference in evaporation rates between dry and wet conditions could be due to two factors : ( 1 ) the particle phase diffusional limitations slow down the evaporation of the semisolid dry particles as suggested by vaden et al . and/or ( 2 ) particle phase chemical reactions take place in the evaporating particles changing the volatility of their constituents . in the latter case the presence of water should either catalyze reactions that increase the volatility ( e.g. , fragmentation ) or inhibit reactions that lower the volatility ( e.g. , oligomerization ) . we analyzed the data from dry and 40% rh experiments according to these two scenarios and present the results below . to investigate the role of particle phase state in the evaporation process of soa , and to define the viscosity of the evaporating particles , we focused first on the experiments conducted under dry conditions , where particle phase influences would be the highest . this was done by simulating the evaporation with a multilayer evaporation model including a description of particle phase diffusion . the composition of the particles was represented in the model with the initial vbs determined from the 80% rh experiment . the initial vbs corresponds to the composition at the dma , and until there the particles had been under same conditions in each experiment . to capture the shape of the dry evaporation curve required a strong composition dependence in the particles ' viscosity , with viscosity values varying approximately from 10 pa s to 10 pa s as the evaporation occurred ( figures 2a and 2c ) . these values are comparable with published viscosity values for pinene soa considering the associated large uncertainties [ rembaumwolff et al . , 2013 ; particle evaporation and changing composition during earlier viscosity measurements is highly possible complicating direct comparison of the results . the increase in viscosity as the particle evaporates and the particle composition shifts toward lower volatility is in agreement with the recent study , which reported lower viscosity when pinene soa was formed under high mass concentration compared to lower mass concentration conditions [ grayson et al . , model simulations for evaporation of particles with initial size 80 nm under dry and 40% rh conditions . time evolution of particle diameter normalized with the initial diameter ( figures 2a and 2b ) . ( a ) simulations for dry conditions : multilayer model using the initial vbs from the 80% rh experiment and assuming constant ( dashed lines ) or a compositiondependent particle viscosity ( black line ) and wellmixed particle model with the best fit initial composition for the dry 2 experiment ( blue solid line ) . ( b ) simulations for 40% rh : wellmixed particle model with the initial vbs from 80% rh assuming an ideal solution ( red dashed line ) and with water uptake calculated based on hgf ( blue dashed line ; see figure s3 ) , multilayer model with the initial vbs from 80% rh and assuming a compositiondependent particle viscosity ( black line ) and wellmixed particle model simulation with the best fit initial composition at 40% rh . ( c ) particle viscosities correspond to the model simulations shown with black lines in figures 2a and 2b . effective vbss show the best fit initial vbs ( bars ) and variability within 20 genetic algorithm simulations ( error bars ) from the optimization of the wellmixed particle model for ( d ) the dry and ( e ) 40% rh cases . our results indicate that the least volatile constituents remaining at the end of the evaporation have a larger molar mass resulting in increased viscosity [ koop et al . , according to our simulations assuming constant viscosity , the particle phase diffusivity already limits the early evaporation period ( i.e. , first few minutes ) with particle viscosity of 10 pa s. the overall evaporation behavior ( e.g. , the shape of the curve ) is affected considerably when the viscosity is higher than 10 pa s ( compare blue and green dashed lines to the red dashed line in figure 2a ) . it should be noted that our model calculations provide only an order of magnitude estimate of the particle viscosity , although the model predictions are sensitive to the choice of viscosity . this is because there are relatively large uncertainties in the mass fractions of the highestvolatility bins at the beginning of the evaporation . particle evaporation at 40% and 80% rh were almost identical , with the 40% rh experiment showing slightly faster evaporation at the beginning ( figure 2b ) . due to raoult 's effect , a clearly faster evaporation at 40% compared to 80% rh is expected for wellmixed solution droplets having the same initial organic composition with different water mole fractions , as demonstrated in figure 2b . the unexpectedly small difference in the evaporation rates between 40% and 80% rh may be related to diffusion limitations at 40% rh or to uncertainties in calculating water uptake of pinene soa in the model and/or experiments . the basic version of the model calculated particle water content assuming an ideal solution . to study the uncertainty concerning the water uptake description , model simulations were also performed using experimentally determined hygroscopic growth factors ( hgf ) of pinene soa at 80% rh ( hgf = 1.05 ) and 40% rh ( hgf = 1.01 ) [ pajunoja et al . , 2015 ; varutbangkul et al . , the experimentally determined hgf predict a smaller difference in evaporation between the two rh cases compared to the ideal solution assumption and bring the simulation results at 40% rh closer to the observations ( blue dashed line in figure 2b ; see also figure s3 ) . still , even with the experimental hgf the wellmixed particle evaporation model predicts slightly faster evaporation than observed at 40% rh . however , the predicted differences in evaporation rates between 40% and 80% rh are rather small , and we can not eliminate the possibility that the deviation between measured and simulated evaporation rates at 40% rh is due to experimental uncertainties . to study the possible effect of particle phase diffusion limitations at 40% rh , we used the vbs determined at 80% rh and simulated the evaporation at 40% rh with the multilayer evaporation model . similar to the dry condition , reproducing the observed slowing evaporation at 40% rh with the model required an increase in viscosity as evaporation proceeded , with values reaching approximately 10 pa s ( figures 2b and 2c ) . the required viscosity values are in agreement with previously published values for pinene soa [ rembaumwolff et al . , 2013 ; zhang et al . , 2015 ] and notably are approximately an order of magnitude lower than in the dry condition . as 40% rh represents the lower end of typical humidity in the atmospheric boundary layer , our results suggest that particle phase diffusion limitations in the evaporation of pinene type soa are possible in drier atmospheric conditions . however , the effect may be small even if the viscosity values are relatively high at the end of the evaporation where only low vapor pressure compounds remain in the particle phase . in our approach we make this distinction because the evaporation could also be affected significantly by chemical reactions that are dependent on water content and could influence soa composition and volatility , such as oligomer decomposition rates . the chemistry of oligomer decomposition was not simulated in our model . however , the effective vbs is fit to the observations and thus includes any effects on the evaporation rate controlled by oligomer decomposition rates which would influence compound volatility . although , it should be noted that the effective vbs does not provide any information about the decomposition processes itself ; it only provides information on the initial volatility distribution required to reproduce the measurements . we repeated the analysis from the 80% rh ( assuming wellmixed particles ) with data from the dry and the 40% rh experiment to compare the effective vbss ( figures 2d and 2e ) . the resulting effective vbs at dry conditions showed a shift of mass toward the lowest two volatility bins ( > 61% by mass in the bins c * 10 g m ) ( figure 2d ) compared to the 80% rh case . for 40% rh the difference compared to 80% rh was less pronounced ( figure 2e ) . such differences in the effective vbs derived at varying rh could be explained by increase in oligomer decomposition rate with rh . the effective vbs derived at dry conditions ( figure 2e ) qualitatively agrees with the vbs derived from the previous dry condition evaporation experiments [ shrivastava et al . , 2013 ] although quantitative differences exist in accordance with the somewhat faster evaporation in the previous experiments [ vaden et al . simulation of soa particle evaporation based on a vbs previously determined from soa growth experiments failed to capture the size evolution of both wet and dry particles . instead , a volatility distribution with mass shifted toward lower volatility was required to capture the evaporation . this result is consistent with recently reported atmospheric and laboratory observations of condensable lowvolatile organic compounds in the gas phase [ ehn et al . , 2014 ; jokinen et al . , interestingly , the o : c of the evaporating particles was constant throughout the evaporation process ( approximately 0.55 ) suggesting that the variation of o : c between vbs bins was small . such a constant and relatively low o : c is not expected if the compounds in the least volatile vbs bins whose relative abundance in the particles increases as the evaporation proceeds had clearly higher o : c than the more volatile constituents . instead , we hypothesize that the lowvolatile compounds were oligomers , having o : c values comparable to more volatile monomers . such dimers have been detected in pinene ozonolysis [ ehn et al . , 2014 ; kristensen et al . , this is also in agreement with the model results showing increase in particle viscosity with proceeding evaporation . the constant o : c ratio is consistent with the unchanged mass spectra of pinene soa upon heating reported by cappa and wilson , who hypothesized this to be either due to diffusion limitations within the particle phase causing the evaporation to proceed layer by layer or due to high particle mass fraction consisting of oligomers whose decomposition controls the evaporation . in the lowest rh condition , our results demonstrating that particle evaporation is influenced by viscosity effects are in agreement with a previous study by vaden et al . . we can not rule out the possibility that particle phase chemical reactions , such as oligomer decomposition , are also limiting the evaporation . in this case , to explain our experimental observations , particle phase water should accelerate reactions that lead to more volatile composition . such reactions relate to changes in the effective vbs as comparison of our results at dry and 80% rh conditions demonstrate . at 40% rh that represents the lower limit of atmospheric humidity , this difference between studies suggests that factors limiting particle evaporation are sensitive to the conditions and thus highlights challenges in applying laboratory results to simulations and interpretations of atmospheric soa . for example , the fraction of semivolatiles in particles at the beginning of the evaporation may depend on soa generation methodology ( e.g. , organic mass loading ) and also on sample treatment prior to size detection . the semivolatiles evaporate during the first few minutes , so their particle mass fraction affects the overall evaporation rate and measured shape of the evaporation curve . in the flow tube experiments the organic mass loadings are higher and particle composition is likely shifted toward higher volatility compared to typical atmospheric conditions . evaporation of the more volatile compounds is likely more prone to exhibit particle phase diffusivity effects upon evaporation as their evaporation time scales are shorter compared to less volatile compounds . recognizing limitations of laboratory experiments , we still highlight that our soa had o : c comparable to monoterpenerich environments . while further investigation of particle viscosity at the lower limit of atmospheric rh is still necessary , our results suggest that integrating the viscosity effect into regional or global models would be of less importance for improving soa evaporation descriptions in warm , biogenicdominated environments when considering ( 1 ) the sensitivity of particles ' evaporation rates to assumed vbs distribution and ( 2 ) the uncertainties in the current vbs descriptions , particularly regarding recently measured low volatility compounds [ ehn et al . , in addition , considering recent results showing that atmospheric organic aerosols are liquid in most cases in a pristine amazonian environment and also in an isoprene and terpene rich environment in southeast u.s . [ bateman et al . , 2016 ; pajunoja et al . , 2016 ] , we conclude that higher scientific priority for future investigations is to decrease uncertainties in vbs representations of the organic compounds contributing to soa production . supporting information s1 click here for additional data file . click here for additional data file .

we performed an extensive search for unknown viruses in 55 german vespertilionid bats based on both generic pcr assays and virus isolation techniques , as part of a broader study investigating histopathologic changes in german bats in association with infectious pathogens . dead or moribund bats of 12 species ( barbastella barbastellus , eptesicus nilssoni , e. serotinus , myotis daubentonii , m. mystacinus , nyctalus leisleri , n. noctula , pipistrellus kuhli , p. nathusii , p. pipistrellus , plecotus auritus , and vespertilio murinus ) were collected at certified bat rehabilitation centers in southern germany and were investigated macroscopically , bacteriologically , and histologically . for virologic examination , homogenized organ tissue was inoculated onto veroe6/7 cells and monitored daily for cytopathic effects . remaining tissue material was used for rna / dna extraction and further molecular analysis by generic pcr assays to detect members of several virus families including flaviviruses , hantaviruses , coronaviruses , orthomyxoviruses , and paramyxoviruses . the species of bat involved was determined by amplification and sequencing of the cytochrome b ( cytb ) gene , a standard technique for species identification ( 9 ) . of the tested samples from 55 bats , virus was initially detected in only 2 adult common pipistrelles ( p. pipistrellus , nos . a cytopathic effect was detected in vero e6/7 cells after the second passage , indicating the presence of virus in the cell culture . purified supernatant of these cell cultures was subjected to negative - staining electron microscopy , which showed numerous adenovirus - like particles ( figure 1 , panel a ) . the family adenoviridae was verified by the first reaction of a generic adenovirus - specific nested pcr ( 10 ) . the obtained sequence of a fragment of the dna polymerase gene ( 550 bp ) indicated that the viruses were a novel virus type within the genus mastadenovirus and was tentatively named bat adenovirus 2 ( bat adv-2 ) strain p. pipistrellus virus 1 ( ppv1 ) . a ) electron micrograph of adenovirus particles isolated from pipistrellus pipistrellus bat 199/07 , germany . b ) schematic representation of the genomic fragments obtained from bat adenovirus 2 ( genbank accession no . fj983127 ) in correspondence to canine adenovirus 2 strain toronto a26/61 ( genbank accession no . genomic fragments were generated by generic adenovirus - specific pcr ( 10 ) and a virus discovery based on cdna amplified fragment length polymorphism pcr method ( 11 ) . purified pcr products were directly sequenced by using the bigdye terminator cycle sequencing ready reaction kit ( applied biosystems , foster city , ca , usa ) and analyzed on an abi 3770 automatic sequencer ( applied biosytems ) . c , clone ; p , 550-bp nested pcr product . to obtain additional sequence information of bat adv-2 , a random pcr method ( virus discovery based on cdna amplified fragment length polymorphism ) ( 11 ) was applied , which showed > 20 adenovirus sequences distributed over the genome ( figure 1 , panel b ) . the partial sequence of the bat adv-2 dna polymerase ( 3,408 bp ; genbank accession no . fj983127 ) was obtained after longrange pcr by using the expand long range dntpack ( roche , mannheim , germany ) according to the manufacturer s directions and the following 2 primers : abs f1-b ( 5-aaaagaggcaaagcaagacagtgg-3 ) and abs r2-b ( 5-ggcgggcaacaaagacctca-3 ) . after repeated sequence analysis of the partial dna polymerase gene for validation , we found that the identities of bat adv-2 ppv1 to closely related adenoviruses ranged from 68% to 74% on nucleic acid level ( table 1 ) , with the closest relationship found to canine adenoviruses 1 and 2 . so far , the only other adenovirus in bats has been accidentally isolated from primary bat kidney cells of a healthy ryukyu flying fox ( pteropus dasymallus yayeyamae ) ( 12 ) , which proved to have a rather distant phylogenetic relationship to bat adv-2 ( figure 2 ) . phylogenetic tree constructed by using a multiple alignment of 550-bp amplicons , consisting of the partial dna polymerase gene of the novel bat adenovirus 2 strain pipistrellus pipistrellus virus 1 ( in boldface ; genbank accession no . alignment was analyzed with the neighbor - joining method and p - distance model in mega4 ( www.megasoftware.net ) . on the basis of newly acquired sequence information , we designed a specific real - time taqman pcr to detect bat adv-2 ( abs forward 5-cacaagtggtgtctttgagagca-3 , abs reverse 5-agagggatacaaactgatggaaaca-3 , abs tm 6fam - ctaacttggctggtggagtgcgaaac - q ) . cycler conditions were as follows : predenaturation ( 95c for 10 min ) , 45 amplification cycles ( 95c for 30 s , 61c for 30 s , 72c for 30 s ) , and final extension ( 72c for 10 min ) . after screening all 55 bats from germany of 12 species , comprising an additional 11 common pipistrelles , an identical adenovirus was detected in 1 additional common pipistrelle . moreover , the tissue tropism of bat adv-2 was investigated in all 3 infected bats ( table 2 ) . of all tested organs , bat adv-2 was detected in high dna copy numbers in the intestine of all 3 bats with lesser dna copy numbers in liver and kidneys , whereas the other organs contained little or no adenovirus dna . unfortunately , due to advanced tissue decomposition in most of the organs , including liver , kidneys , and intestines , thorough histopathologic examination of the 3 bats was markedly impaired . * adv , adenovirus ; + , positive ; , negative ; nd , not determined . analyzed by bat adv-2 ppv1specific taqman pcr . increasing virus dna copy numbers are indicated by the number of plus signs , which are equivalent to multiples of 3 cycle threshold values , starting with values from 37.0 to 40.0 in contrast to maeda et al . ( 12 ) , who postulated the necessity of primary bat cells to isolate dna virus from chiroptera , our isolation of a dna virus from an european bat in a permanent cell line ( monkey kidney cells ) proved the opposite . we believe that the rare detection and isolation of viruses might be attributed to the fast natural degradation of bats of the suborder microchiroptera in comparison to that of other animal carcasses , most likely due to their extremely low weight ( 210 g ) . although viruses were not detected by various generic pcr assays from homogenized frozen tissue samples , we isolated a novel virus from a hibernating insectivorous bat species . this virus was detected in high dna copy numbers in the intestine of 3 bats that died of natural causes . the fact that no other viral or bacterial agents were detected in these animals suggests a clinical correlation to the isolated adenovirus . moreover , all 3 bats belonged to the same species and were of similar age . several days before their death , they were found moribund and subsequently admitted together to the rehabilitation center , which highlights the strong likelihood of infection in the colony of origin . cross - contamination during tissue preparation can be excluded because sterilized instruments were used for each animal , and after every incision , instruments were cleaned with 70% ethanol and a bunsen burner flame to destroy adhering tissue remnants . various adenovirus types of the genus mastdenovirus infect a range of different mammals and cause respiratory , ocular , and gastrointestinal diseases . here , in all 3 infected bats , the highest copy number of adenovirus dna was detected in the intestine , which suggests a correlation with a gastrointestinal disease . the host range of mastadenoviruses is known to be limited to a single ( or a few closely related ) mammalian species ( 13 ) with a probable co - evolution between virus and their hosts ( 14 ) . the acquired partial sequence of the bat adv-2 dna polymerase with the closest relation to canine adenovirus ( only 74% at the nucleic acid level ) and the isolation from a new animal host suggests that this virus is a new adenovirus species within the genus mastadenovirus . a comparison to the only other adenovirus found in a bat ( flying fox , order megachiroptera ) with the available sequence information of a 550-bp fragment of the dna polymerase gene showed their distant relationship . this strict separation reflects either the co - evolutionary development between the 2 adenoviruses ( bat adv-1 fbv1 , bat adv-2 ppv1 ) and their host families pteropodidae and vespertilionidae or a host switch of the virus originating from a yet - undetermined vertebrate host . to elucidate this problem , we isolated a new virus from free - ranging vespertilionid bats , which represents the only chiropteran virus isolate besides lyssavirus ( rabies ) found in europe . moreover , the detection of this chiropteran virus can be connected with its transmission between individual bats living in close proximity to other bats .

window of opportunity ( also called phase 0 ) trials can provide insight into biological effects and potential therapeutic efficacy of novel therapeutic strategies [ 14 ] . one example of window of opportunity trial is for women with newly diagnosed breast cancer to receive a study drug between the diagnostic breast biopsy and planned surgical resection . the advantage of window of opportunity trials is that they allow short - term testing of novel agents in patients who already have surgery planned as their primary therapy ; and therefore agents may be tested in patients who are not pretreated . window of opportunity trials differ from the more traditional neoadjuvant trials in that no therapeutic benefit is envisaged , whereas in neoadjuvant trials an investigational agent is given preoperatively along with chemotherapy or endocrine therapy for a longer duration ( usually months ) and surgery is delayed to allow for a therapeutic response in the tumor . ultimately , window studies have the potential to expedite drug development process by improving the understanding of an agent 's biologic effect early in its development through monitoring tissue samples obtained before and after drug exposure . these trials may assess target or pharmacodynamic effects of an intervention , allowing for greater potential to select for subsets of patients who might benefit from a therapy in clinical trials that are powered to detect changes in clinical outcome [ 24 ] . despite the short duration of window studies , they are challenging to perform as they require close collaboration between multiple disciplines , including surgeons , oncologists , pathologists , radiologists , and laboratory scientists [ 2 , 411 ] . in addition , one common concern of the preoperative window of opportunity model for patients and investigators is that it can lead to treatment delays if these evaluations can not be completed within the standard normal surgical wait times [ 412 ] . as a result , we undertook a one - year , pilot , window of opportunity trial using anastrozole to assess the feasibility of performing such trials at our institution . feasibility was assessed through several endpoints , including the proportion of eligible patients , patient compliance , patient acceptability of additional research biopsies , and the ability to assess change in tumor ki67 ( marker of proliferation ) and cleaved caspase 3 ( cc3 , marker of apoptosis ) . this study was a single center , single arm , prospective study to assess the feasibility of performing a window of opportunity study at our center . the design was deliberately pragmatic and was designed to investigate the use of anastrozole in newly diagnosed postmenopausal , hormone receptor positive breast cancer patients awaiting primary surgery in the time from diagnostic tissue biopsy to surgery . eligibility criteria for the study included ( 1 ) postmenopausal status ; ( 2 ) histologically confirmed estrogen receptor positive invasive carcinoma on diagnostic core biopsy ; ( 3 ) the invasive cancer which was clinically and/or radiologically 2 cm in size ; ( 4 ) patients who did not have any contraindications to take anastrozole ; and ( 5 ) surgery date which was planned for 28 weeks after initial consultation . all patients had to be stage ii or operable stage iii as the practice in our institution is such that only inoperable stage iii as well as stage iv patients went on to primary chemotherapy treatment . patients could not have received hormone replacement therapy , tamoxifen , or an aromatase inhibitor within the previous 6 months or have known metastatic or recurrent breast cancer . institutional research ethics board and health canada approval all potential study patients with a core biopsy confirmed invasive breast cancer were evaluated at initial consultation by one surgeon ( aa ) . the surgeon decided whether the patient was potentially eligible based on tumor size and postmenopausal status . if the patient was interested in the study she was then approached for study screening by a research nurse for study eligibility ( see figure 1 study schema ) . those patients who were screened and deemed potentially eligible had a formal request made to a pathologist ( sr ) for assessment of estrogen receptor ( er ) , progesterone receptor ( pr ) , and human epidermal growth factor receptor 2 ( her2 ) on the diagnostic specimen . at the time of the study , routine biomarker analysis on initial diagnostic core biopsies was not performed at our institution and therefore could only be requested once the patient had consented to participate in the study . if er and/or pr staining was greater than or equal to 1% they were considered positive and the patient was then eligible of the study . all qualifying patients were referred to a medical oncologist ( mc , ik , and ds ) for assessment prior to starting anastrozole ( 1 mg po od ) . the time between starting anastrozole and surgery had to be a minimum of 2 weeks , and the last dose was to be taken the night before surgery . toxicity assessments ( common terminology criteria for adverse events ( ctcae ) version 3.0 ) were performed prior to starting anastrozole , just before surgery , and 3 - 4 weeks after surgery . patients with insufficient tissue in the initial diagnostic core biopsy for study analyses underwent an additional tumor biopsy . even if there was sufficient initial core biopsy material for study analyses , at the time of the initial consent process , patients were also given the choice to undergo additional optional tissue biopsies and collection of blood and urine samples for use in the future as yet unplanned research . all tumor biopsies were immediately fixed in 10% neutral buffered formalin and excisional specimens were sliced and exposed to formalin within 1 hour with the majority having 2472 hours of fixation time and less than 1/2 hour ischemic time . after standard tissue processing and embedding in paraffin wax sections were cut and were stained with hematoxylin and eosin or left unstained for immunohistochemistry . ki67 and cc3 were assessed on tissue sections cut from the ffpe diagnostic core biopsy ( i.e. , before anastrozole ) and compared with expression in sections of surgical specimens as determined on selected representative tissue blocks ( i.e. , after anastrozole ) . the core biopsy specimens were generally 5 - 6 samples obtained with a 14 g needle . a minority of patients who were planned for surgery , and thus eligible for the study , were found to have medical comorbidities delaying their primary surgical treatment . for these patients , they continued on anastrozole while waiting for their surgery and a mandatory further core biopsy at 6 weeks was performed and used for the postanastrozole specimen . immunohistochemistry for ki67 was performed using leica pa0118 clone mm1 using the refine detection kit from leica . ( percentage of nuclei showing nuclear immunoreactivity of any intensity ) was determined by computer image assisted count by a single pathologist ( sr ) . in each case , after a low - power scan of the entire tissue section , hot spot regions of highest activity were selected and from these 1,000 tumor nuclei were counted at 400600x magnification . for cc3 immunohistochemical analysis , serial sections were reacted with cleaved caspase 3 ( asp175 ) specific antibody , new england technology , using the refine detection kit from leica . five hundred cells from each specimen under 400 magnification in the best - stained tumor area of each section were counted by a single pathologist ( sr ) for each specimen . the following criteria were established by the trial investigators as being required in order to demonstrate a meaningful success of feasibility for the group : ( 1 ) accrual of > 50% of patients who were approached and ( 2 ) successful completion of > 50% of patients who initially received anastrozole . descriptive statistics were used to summarize the ki67 values at baseline , at time of surgery , and the relative change from baseline to surgery . the percentage ki67 change is defined as [ surgical ki67 baseline ki67]/[baseline ki67 100% ] for each patient and the absolute change is defined as surgical ki67 baseline ki67 . hence , a negative value indicates a decrease in ki67 from baseline to surgery . spearman was calculated to evaluate the association between caspase and ki67 , the change between these measures , and the association between the duration of drug and the change in these measures . all tests were two - sided , and p < 0.05 was considered statistically significant in all cases . between september 2012 and september 2013 , a total of 131 newly diagnosed breast cancer patients underwent initial surgical consultation ( consort diagram , figure 2 ) . a total of 32 ( 24.4% of all patients ) patients were deemed as being potentially eligible based on tumor size and menopausal status and thus were screened for the study . of the 32 patients that were approached , all ( 100% ) consented to participate in the study . there were 10 screen failures , seven were due to estrogen receptor negative status on the diagnostic core biopsy , one patient was found to have distant metastatic disease , and two patients did not qualify to take anastrozole due to medical comorbidities . 20/22 ( 91% ) patients were therefore confirmed to be eligible for the study . two patients withdrew from the study prior to taking anastrozole . of the 20 remaining patients who received anastrozole patient characteristics of the 20 patients that started anastrozole and completed the study are shown in table 1 . mean patient age was 66.3 ( range 5289 ) , and 80% of the patients had invasive ductal carcinoma . the majority of patients had pathological stage ii ( t2n0 ) invasive ductal carcinoma and breast conserving surgery . the mean duration of drug intake was 24.7 days ( sd 6.4 days ; range 1435 days ) , while the mean wait time from surgical decision to actual surgery date was 32.3 days ( sd 8 days ; range 1544 days ) . the duration from the consent date to the patients ' medical oncology appointment was a mean of 8.1 days ( sd 4.6 days ; range 119 days ) . all surgeries proceeded according to plan and scheduled date which was decided at the initial surgical consultation . of the 20 patients that completed the study , 18/20 experienced mild to moderate adverse effects ( grades 1 - 2 ) including hot flashes , joint pains , fatigue , and nausea . one patient had insufficient diagnostic tissue for baseline ki67 and cc3 assessment and an additional tumor biopsy was performed prior to starting anastrozole . another patient had sufficient core biopsy for pretreatment ki67 but not cc3 analysis and also required an additional biopsy . one patient did not proceed to surgery as planned within the 8-week time frame as she had ongoing cardiac comorbidities and more time was needed to better optimize her perioperative morbidity . she had a repeat biopsy 4 weeks after anastrozole treatment used for repeat ki67 and cc3 analyses . after the additional biopsies , ki67 and cc3 were assessable in all 20 patients from pre- and postanastrozole tumor tissue . one patient was excluded for analysis involving ki67 , as their postanastrozole ki67 value increased by > 1200% , which was an extreme outlier result and suggested technical inaccuracy ; this patient was included for cc3 analyses . baseline pretreatment ki67 mean was 33.2% ( standard deviation 17.6% ) , compared to posttreatment ki67 mean of 19.1% ( standard deviation 21.2% ) resulting in an absolute decline of 14.1% ( p < 0.001 ) and relative decline of 48.8% ( p = 0.001 ) . baseline pretreatment cc3 mean value was 7.7 ( standard deviation 7.4 ) compared to posttreatment cc3 mean of 4.8 ( standard deviation 3.6 ) . this results in a statistically significant absolute decline of 2.9 points ( p = 0.007 ) and a 10.5% relative decline that did not reach statistical significance ( p = 0.17 ) . there was a weak - to - none association ( r < |0.30| and p value > 0.05 for all ) between ki67 and cc3 , at baseline , posttreatment , and for the change scores . however , for cc3 , longer drug duration was moderately associated with a greater reduction in value , with a statistically significant association ( r = 0.50 , p value = 0.026 ) for relative percent change , and a trend towards significance for ( r = 0.43 , p value = 0.060 ) absolute change . results of any changes to ki67 or cc3 as a result of the anastrozole treatment were blinded to the oncologist such that decisions regarding adjuvant chemotherapy or hormonal therapy decisions would not be affected . all 20 patients were approached to have additional optional breast tumor biopsies , additional blood sample retrieval , and urine collection for future research studies and 19/20 ( 95% ) agreed to all three types of additional sample acquisition . while exciting for drug development strategies , performing window of opportunity trials faces multiple logistical and system barriers [ 413 ] . this albeit small pilot study demonstrated that performing such studies was possible at our cancer center . our study did meet our established criteria for feasibility : we exceeded our target accrual of 50% of patients approached ( 32/32 patients approached consented to the study ) and exceeded our 50% target completion rate in patients who received anastrozole ( 20/20 patients who received anastrozole complete the study ) . the results of our study demonstrated that women are willing to participate in such trials and undergo additional biopsies and give additional blood and urine samples for future research . combined and closely coordinated efforts among the different disciplines involved in the patient 's care ( surgery , pathology , and radiology ) meant that it was possible to conduct such trials without delaying surgery . as feasibility to accrue patients involves a range of issues including eligibility criteria , patient compliance , and study mandated procedures we decided to use a number of feasibility measures . at our center er , pr , and her2 are not routinely performed on diagnostic core specimens . therefore , in order to test for these potential patients had to sign consent before they were screened by a study research associate for eligibility . clearly , depending on the eligibility criteria , the number of patients which must be approached to identify those likely meeting eligibility criteria for any given study will vary considerably . even with our pragmatic design ( newly diagnosed breast cancer , postmenopausal , > 2 cm clinical or radiological confirmed , subsequently identified hormone receptor positive disease ) 197 patients had to be approached or screened in order to identify the 32 potentially eligible patients who consented to the study . subsequently , 69% ( 22/32 ) of the consented were eligible for the study , and 91% ( 20/22 ) ultimately completed the study . these numbers are similar to overall accrual rates in other window of opportunity studies [ 1216 ] . we recognize that most of centers now routinely perform biomarkers on the diagnostic core biopsy specimens already , a process that was not in effect at our institution at the time of the study . the additional few days it took to obtain these results certainly may have helped allow for more time to enroll these patients without delay of their set surgical date , without which our accrual rate may have potentially been further reduced . our study also demonstrated that patient willingness to participate in such studies does not appear to be a barrier to accrual , as we were able to realize a high accrual rate . the fact that 19/20 ( 95% ) patients enrolled agreed to undergo additional biopsies and blood and urine storage for future research studies reflected high patient enthusiasm for this type of research . this high rate of accrual likely reflects the fact that anastrozole , in addition to being a relatively safe and well tolerated drug , is already an established treatment for breast cancer , therefore making it a simple and easy drug to use for a pilot feasibility study [ 17 , 18 ] . its side effects did not preclude the patient from surgery which made it an acceptable agent for surgeons to consider . in the current study , the recognized therapeutic benefit of anastrozole likely helped patient compliance as all 20 patients who commenced anastrozole completed the study . time will tell whether the use of agents that could interfere with surgical intervention ( e.g. , through effects on cardiac , neurological , marrow , coagulopathic , or thromboembolic events ) would receive the same enthusiasm [ 1 , 12 ] . clearly , we do not know if a window of opportunity trial with an agent with no implied therapeutic advantage and unknown side effects will become more of an issue for patient compliance . changes in tumor ki67 expression is a well - recognized surrogate endpoint for treatment response [ 1821 ] and predictor of clinical outcome [ 22 , 23 ] . variability in ki67 staining can occur as a result of a number of factors , including the duration of tissue ischemia , formalin quality , duration of fixation , immunohistochemical technique used , and assessor differences . further , when comparing pretreatment biopsy to posttreatment excision or posttreatment biopsy , there may be effects of tumor heterogeneity on biomarker scores and at least a theoretical risk of alteration induced by the first biopsy procedure . we were able to have one pathologist ( sr ) perform all the analyses with the hope that variability in the assessor was reduced . many anticancer drugs induce apoptosis by molecular mechanisms mediated through mitochondrial dysfunction [ 2426 ] . release of cytochrome c from the internal part of the mitochondrial membrane into the cytosol results in the activation of caspase cascades , in particular caspase 9 , caspase 3 , caspase 6 , and caspase 7 . because caspase 3 is the main executioner of apoptosis , immunohistochemical analysis to the active form of caspase 3 , known as cleaved caspase 3 ( cc3 ) , has been used as an indicator of apoptosis in paraffin sections from various tissue sites [ 2730 ] . compared to the traditional tunel assay , whose interpretation and specificity have been reported as being difficult and controversial , cc3 immunohistochemistry is an easy , sensitive , and reliable method for detecting and quantifying apoptosis in tissues , with good correlation reported ( r = 0.75 ) between it and the tunel assay . few studies have used it as a marker of response to treatment in breast cancer . while the results may be counterintuitive in that cc3 ( and therefore apoptosis ) declined with anastrozole treatment , and a greater reduction was seen with longer duration of treatment , these results mirror what has been demonstrated with the tunel assay in anastrozole treated patients [ 20 , 31 , 32 ] . unlike what is observed with cytotoxic chemotherapy , patients in the impact study and others have demonstrated a decrease in apoptosis with endocrine therapy [ 20 , 32 ] . it is possible that the capacity of breast cancer cells to pass into apoptosis is retarded by the profound antiproliferative effects of antiestrogenic therapy . it has been observed that c - myc is a determinant of both proliferation and apoptosis , and its expression is enhanced by estrogen and suppressed by antiestrogens . this data suggests that estrogen may not be important for cell survival in breast cancers . further difficulties may additionally be encountered if a novel agent with no known therapeutic benefit was used instead of anastrozole or if the biomarker was experimental and pathologists had little prior experience with measuring it . additionally , the authors of this paper acknowledge that the involvement of a single dedicated surgeon and few medical oncologists would have potentially allowed for greater accrual . the success of the accrual may be less generalizable to larger group practices where it may be more difficult to overcome logistical hurdles . finally , the authors recognize that the effect of presurgical hormonal therapy on ki67 has already been demonstrated previously in studies such as impact and poetic [ 18 , 20 , 33 ] . the main objective of our study was to assess feasibility of such window trials at our institution . in summary , this study demonstrates that accrual to nontherapeutic protocols is feasible in a single large academic cancer center and is acceptable to patients . the success achieved with this trial has been used as a strategy to convince other surgeons and patients to be involved in future research ( nct01948128 ) .

although o6-methylguanine ( o6meg ) is a minor component of methylated dna lesions produced by various endogenous ( e.g. , s - adenosylmethionine ) and exogenous ( e.g. , n - methyl - n - nitrosourea ) alkylating agents , it is a highly mutagenic lesion . the genotoxic o6meg lesion is also generated by anticancer methylating agents such as temozolomide and is believed to be responsible for the cytotoxicity of various methylating anticancer agents . o6meg is directly repaired in an error - free manner by a sacrificial protein called methylguanine methyltransferase ( mgmt ) . if not repaired by mgmt , the persistent o6meg in templating dna causes g to a transition mutations . since mgmt activity is impaired in many cancer cells , the treatment of such cells with methylating anticancer agents can promote the formation of o6megt mismatch , which can trigger a futile cytotoxic repair by the mismatch repair system ( mmr ) . cells deficient in mmr are resistant to the cytotoxicity induced by temozolomide - mediated methylation . in mmr - deficient cells thymine in o6megt mismatch can be removed by thymine dna glycosylase and methyl - cpg - binding domain protein 4 , and the resulting abasic sites can be further processed by downstream base - excision repair ( ber ) proteins such as dna polymerase ( pol ) . therefore , elucidating the mechanism of the replication across o6meg by pol could potentially further our understanding of the mutagenicity and the cytotoxicity of o6meg . the x - family dna polymerase pol is a short - nucleotide - gap filling ber enzyme and has been shown to replicate across o6meg in vitro . pol is mutated and overexpressed in many cancer cells and has been implicated to play a role in resistance to various anticancer agents such as cisplatin , bleomycin , and methylating agents . inhibition of pol has been shown to sensitize temozolomide activity , implicating pol s potential role in the repair of temozolomide - induced dna lesions . the o6meg mutagenicity mainly results from the preferential incorporation of t opposite templating o6meg by dna polymerases . although thermodynamic and nmr studies on duplex dna indicate that o6megc base pair is more stable than o6megt base pair ( figure 1 ) , many dna polymerases preferentially insert t over c opposite o6meg . for example , the y - family dna polymerase pol and replicative dna polymerases such as t7 dna polymerase and bacillus stearothermophilus dna polymerase i fragment ( bf ) incorporate t opposite o6meg with insertion efficiency 10-fold greater than that for c. in addition , the x - family dna polymerase pol inserts t opposite o6meg 30-fold more efficiently than c in vitro , while the rate of replication across the lesion is decreased 100-fold . structures of ( a ) o6megc base pair and ( b ) o6megt base pair . currently , although structures of various dna polymerases in complex with o6meg - containing dna have provided important insights into the mutagenic potential of o6meg , the structural basis underlying the observed preferential misincorporation of t opposite o6meg by several dna polymerases remains elusive . for example , x - ray structures of bf have shown that structural differences among bf ternary complexes bearing the newly incorporated o6megdctp and o6megdttp base pairs are not prominent , with both o6megc and o6megt forming isosteric watson crick - type base pairings in the confines of the bf active site . to gain deeper insight into the mutagenic replication across o6meg conducted by several dna polymerases , we solved x - ray structures of o6meg - containing dna bound to pol , which highly inaccurately replicates across o6meg . herein , we report five x - ray structures of pol bound to o6meg - containing dna , representing varying stages of nucleotide insertion opposite o6meg ; a binary structure with a single - nucleotide gap opposite o6meg and four ternary structures with an incoming dctp or dttp analogue paired with o6meg in the presence of active - site mg or mn . in addition , to evaluate the effects of the active - site metal ion on the pol catalysis , we have determined steady - state kinetic parameters for the insertion of dctp / dttp opposite templating o6meg by the enzyme in the presence of mg or mn . our x - ray structures reveal that pol slows nucleotide incorporation opposite o6meg by inducing an altered conformation suboptimal for catalysis and that pol discriminates o6megt against o6megc in the nascent base - pair binding pocket . our structural studies not only provide the basis for the promutagenic replication across o6meg by pol but also provide new insights into the replication fidelity of pol. all oligonucleotides used for crystallographic studies were purchased from midland certified reagent company ( midland , tx ) . the dna sequence for template dna is 5-ccgac(o6meg)tcgcatcagc-3. the dna sequence for upstream primer is 5-gctgatgcga-3 , and the sequence for the downstream primer is 5-phosphate / gtcgg-3. pol was expressed and purified as described previously . pol binary complex with a single - nucleotide gap opposite templating o6meg was prepared using the same conditions described previously . pol ternary complex was prepared by adding nonhydrolyzable dcmpnpp or dtmpnpp ( 5.0 mm , jena biosciences ) to the mixture of the pol gapped binary complex . pol ternary complex crystals with nonhydrolyzable dcmpnpp or dtmpnpp opposite templating o6meg were grown over 24 weeks in a buffer solution containing 50 mm imidazole , ph 7.5 , 14%23% peg3400 , and 350 mm naoac . the pol binary and ternary complex crystals were cryo - protected with 12% ethylene glycol and flash - frozen in liquid nitrogen . diffraction data were collected at the beamline 5.0.3 at the advanced light source , lawrence berkeley national laboratory and were processed using the hk-2000 program . the pol gapped binary complex structure and the ternary complex structures were solved by molecular replacement using published binary ( pdb i d 1bpx ) and ternary ( pdb i d 1bpy ) structures as the search models , respectively . the model building and structure refinement were conducted using coot , phenix , and molprobity , and all the crystallographic figures were generated using pymol . steady - state kinetic parameters for nucleotide incorporation opposite o6meg by pol were determined as described . oligonucleotides used for kinetic assays ( primer , 5-fam / ctgcagctgatgcg-3 ; downstream primer , 5-phosphate / cgtacggatccccgggtac-3 ; and template , 5-gtacccggggatccgtacg ( o6meg)cgcatcagcgcag-3 ) were purchased from midland certified reagent company . dna substrate containing a single - nucleotide gap opposite templating o6meg was prepared by annealing the template oligonucleotide with the upstream and the downstream primers at 95 c for 3 min followed by slow cooling to room temperature . polymerase activities were determined using the reaction mixture containing 50 mm tris - hcl ph 7.4 , 100 mm kcl , 5 mm mgcl2 or mncl2 , 80 nm single - nucleotide gapped dna , and varying concentrations of incoming nucleotide . the phosphoryl transfer reactions were initiated by adding pol and stopped by adding 95% formamide solution containing 20 mm edta , 45 mm tris - borate , 0.1% bromophenol blue , and 0.1% xylene cyanol . the polymerase reaction mixtures were separated on 1820% denaturing polyacrylamide gels , and the product formation was analyzed using a phosphorimager ( molecular dynamics ) . the efficiency and the relative efficiency of nucleotide incorporation opposite templating o6meg by pol were calculated as kcat / km and f = ( kcat / km ) [ dc or dt : o6meg]/(kcat / km ) [ dc : dg ] , respectively . using steady - state kinetic methods , we determined kinetic parameters for nucleotide incorporation opposite o6meg by pol ( table 1 ) . in the presence of mg , nucleotide insertion efficiency for t opposite o6meg is 20-fold higher than that for c opposite o6meg , and 300-fold lower than that for c opposite g. in the presence of mn , the insertion efficiency for t opposite o6meg is 100-fold higher than that for c opposite o6meg , and 30-fold lower than that for c opposite g. substituting mn for mg increases the c and t insertion efficiencies 2-fold and 10-fold , respectively . we determined a binary complex structure of pol bound to dna containing a single - nucleotide gap opposite o6meg ( a and b of figure 2 ) . the o6meg gapped binary structure was solved by molecular replacement using a published gapped structure ( pdb i d 1bpx ) , and refined to 2.4 resolution ( table 2 ) . the overall structure is similar to that of the published gapped binary structure ( pdb i d 1bpx ; rmsd = 0.65 ) , with the protein in an open conformation and a 90 kink in the dna . comparison of the o6meg gapped structure with published g gapped structure ( pdb i d 1bpx ) shows a minor conformational difference in templating base and primer terminus base pair ( figure 2e ) . the -helix n containing asn279 and arg283 , the minor - groove recognition motifs , is in an open conformation . structure of pol bound to dna containing a single - nucleotide gap opposite templating o6meg ( pdb i d 4mf2 ) . the o6megc / t ternary complex structures have dctp or dttp analogue opposite templating o6meg . the three aspartic acid residues as well as tyr271 , asn279 , and arg283 are indicated . ( d ) a 2fo fc map contoured at 1 around o6meg lesion . ( e ) structural overlay of the templating base and primer terminus in the o6meg gapped binary complex and published g gapped binary complex ( pdb i d 1bpx ) . to gain structural insight into how pol performs accurate replication across o6meg , we determined a ternary structure of pol incorporating a dctp analogue opposite templating o6meg in the presence of active - site mg ( a and b of figure 3 ) . nonhydrolyzable dcmpnpp ( dctp * hereafter ) was used because it retains binding affinity with pol , while preventing the nucleotidyl transfer catalyzed by the enzyme . the o6megc mg ternary structure was refined to 2.3 resolution ( figure 3a ) . since all published ternary structures of pol with base pair mismatch involve either active - site mn or mutations in the minor - groove recognition motif ( arg283lys ) , our structure represents the first structure of wild - type pol with base pair mismatch and active - site mg . surprisingly , the o6megc mg ternary complex shows an open protein conformation , a staggered o6megc base pair conformation . the overall structure of the o6megc mg ternary complex is almost indistinguishable from that of the o6meg binary gapped structure ( rmsd = 0.265 , figure 3b ) , indicating that binding of dctp * does not readily induce an open - to - closed conformational activation of the enzyme . pol ternary structure with an open protein conformation has only been observed with the enzyme with arg283lys mutation , and has not been observed with the wild - type enzyme . published pol ternary structures with the wild - type enzyme show a closed protein conformation for correct insertion and an intermediate protein conformation for incorrect insertion . the o6megc mg ternary structure most likely represents a ground - state conformation , which is suboptimal for nucleotidyl transfer reaction . the distance between the 3-oh of the primer terminus and the p of dctp * is 2.6 longer than the distance typically observed for correct insertion ( 6.0 vs 3.4 ) . the -helix n - containing minor - groove recognition motifs , which typically move 10 toward a nascent base pair for correct insertion , have not moved from the positions observed in the o6meg gapped binary complex structure with an open conformation ( figure 3b ) . overall , the o6megc mg ternary complex does not adopt a catalytically competent conformation , which is consistent with the observed slow dctp insertion opposite o6meg in the presence of mg ( table 1 ) . ternary structure of pol incorporating nonhydrolyzable dctp analogue ( dctp * , shown in green ) opposite templating o6meg in the presence of mg ( pdb i d 4mfc ) . ( b ) structural overlay of the o6megc mg ternary complex and the o6meg binary gapped complex . ( c ) active - site view of the o6megc mg ternary structure . the distance between the 3-oh of the primer terminus and p of dttp * is indicated as a red double - headed arrow . ( d ) a 2fo fc map contoured at 1 around o6meg and dctp*. ( e ) close - up view of the active - site metal ion binding site . only the nucleotide - binding metal ion is present in this structure , and the metal ion is not coordinated to asp192 . ( f ) overlay of the o6megc mg ternary structure with published ca mn ternary structure ( pdb i d 3c2l(42 ) ) . ( g ) overlay of the o6megc mg ternary structure with published ag ternary structure with arg283lys mutation ( pdb i d 4f5p(43 ) ) . the o6megc mg ternary complex structure explains why accurate replication across o6meg is greatly inhibited by pol ( table 1 ) . the structure reveals that pol slows the accurate replication across o6meg by inducing a novel catalytically incompetent conformation . first , pol prevents dctp incorporation opposite o6meg by inducing an open protein conformation rather than a closed conformation required for chemistry . second , pol deters the dctp incorporation by inducing a staggered o6megc base pair conformation , which lacks h - bonding and base - stacking interactions typically observed for the correct insertion ( figures 3a and 3c ) . the staggered base pair conformation has been observed with pol ternary structures with base pair mismatch . last , pol precludes dctp incorporation opposite o6meg by altering the coordination state of the active - site metal ions . the o6megc mg ternary structure shows only one active - site metal ion , rather than the two active - site metal ions required for catalysis . furthermore , the coordination sphere of the nucleotide - binding metal ion is only partially completed . taken together , the combined effects of the open protein conformation , staggered base pair , and one active - site metal ion greatly distort the active - site conformation , thereby hampering the incorporation of dctp opposite o6meg by pol. the active - site structure of the o6megc mg ternary complex is very different from that of published ternary complex with ca mismatch and active - site mn ( figure 3f , rmsd = 1.565 ) . these structures differ in the conformations of protein and dna , the number of active - site metal ions , and position of incoming nucleotide . the distance between the o3 of primer terminus and the p of incoming nucleotide for the o6megc mg structure is 2.7 longer than that for the ca mn structure ( e and f of figure 3 ) . in addition , the distance between the c1 of primer terminus and the c1 of incoming nucleotide for the o6megc mg structure is 4.0 longer than that for the ca mn structure . in stark contrast , the active - site structure of the o6megc mg ternary complex is very similar to that of published ga mg ternary complex with arg283lys mutation ( rmsd = 0.274 , figure 3 g ) , which was introduced to capture pol ternary structure with an open protein conformation . a minor structural difference between the wild - type pol:o6megc mg and the arg283lys pol:ga mg complexes is the presence / absence of asn279-mediated minor - groove edge recognition of incoming nucleotide ( 3.0 vs 4.8 , figure 3 g ) . the structural similarity among the o6meg gapped binary , the o6megc mg ternary , and the arg283lys pol:ga mg ternary complexes suggests that ground - state structures of pol ternary complex with base pair mismatch adopt open protein conformation and staggered base pair conformation , which would be suboptimal for catalysis . pol appears to discourage nucleotide misincorporation by preventing an open - to - closed conformational activation and inducing noncoplanar base pair conformation in the presence of a mismatched incoming nucleotide . to gain structural insight into the highly promutagenic replication across o6meg by pol , we solved a ternary structure of pol with an incoming nonhydrolyzable dtmpnpp ( dttp * hereafter ) paired with o6meg in the presence of active - site mg . the x - ray structure of the o6megt mg ternary complex was solved to 2.3 resolution . the overall structure of the o6megt mg ternary complex is essentially identical to that of the o6megc mg ternary complex , with assuming an open protein conformation , a staggered base pair , and one active - site metal ion ( a c of figure 4 ) . therefore , the o6megt mg ternary structure most likely represents a ground - state conformation , which is suboptimal for polymerase reaction . ternary structure of pol incorporating a nonhydrolyzable dttp analogue ( dttp * , shown in cyan ) opposite templating o6meg in the presence of mg ( pdb i d 4mff ) . ordered water - mediated h - bondings not observed in the o6megc mg ternary structure are indicated in red dotted lines . ( c ) close - up view of the metal - ion - binding site . an ordered water molecule that bridges asp256 , asp190 , and primer terminus 3-oh replaces the catalytic metal ion observed in pol ternary structure . ( d ) overlay of the metal - ion - binding site of the o6megc mg structure ( green ) and the o6megc mg structure ( blue ) . note differences in the positions of the primer terminus 3-ohs and ordered water molecules . comparison of the o6megc / t mg ternary structures suggests that a water - mediated h - bond network may contribute the promutagenic replication of o6meg by the enzyme ( figure 4d ) . since both the o6megc mg and the o6megt mg ternary complexes adopt a staggered base pair , the preferential t insertion opposite o6meg by the enzyme is unlikely , due to a difference in base pairing stabilities of their ground - state structures . interestingly , the distance between o3 of the primer terminus and p of the incoming nucleotide seen in the o6megt mg ternary structure ( 3.7 , figure 4c ) is 2.3 shorter than that seen in the o6megc mg ternary structure , indicating that the o6megt mg ternary complex adopts more favorable conformation for nucleotidyl transfer than the o6megc mg ternary complex . the favorable conformation of the o6megt mg ternary complex appears to be triggered by a water - mediated h - bond network present in the o6megt mg ternary structure ( figure 4d ) , but not in the o6megc mg ternary structure . more specifically , in the active site of the o6megt mg ternary complex , an ordered water molecule is h - bonded to asp190 , asp256 , and primer terminus 3-oh , which is reminiscent of the catalytic metal ion s coordination with asp190 , asp192 , asp256 , primer terminus 3-oh , and p of an incoming nucleotide . this water - mediated h - bond network brings the 3-oh of the primer terminus closer to the p of the incoming nucleotide with a distance comparable to that observed in ternary structures with correct insertion ( 3.7 vs 3.4 ) . to reach a catalytically competent state , the o6megt mg complex would thus require a conformational reorganization of the protein to a lesser extent than the o6megc mg complex . in other words , the o6megt mg complex will have a lower energy barrier for chemistry than the o6megc mg complex , resulting in faster t insertion opposite o6meg relative to c insertion opposite o6meg . as mentioned above , the o6megc mg ternary structure likely represent a ground state structure with a catalytically incompetent conformation . to gain insight into precatalytic state of pol incorporating dctp opposite o6meg , we determined ternary structure of pol with dctp * paired with templating o6meg in the presence of mn . the use of mn has been shown to enhance the binding affinity of the incoming mismatched nucleotide , facilitate the formation of an intermediate protein conformation during misincorporation , and significantly increase ( > 10-fold ) the rate of misincorporation . the o6megc mn ternary structure was refined to 2.25 ( figure 5 ) . the o6megc mn ternary structure indicates that , even in the presence of mn , pol strongly discourages the accurate replication across o6meg by inducing a catalytically imcompetent conformation ( figure 5a ) . the active - site of the o6megc mn ternary structure is significantly different from those of published pol ternary structures with base pair mismatch and active - site mn ( figure s1 in si ) . whereas published structures with ca or ag mismatch show a partially closed protein conformation , our o6megc mn structure shows an open protein conformation ( figure s1 in si ) . in addition , positions of templating base and incoming nucleotide in those complexes are quite different . interestingly , the overall structure of the o6megc mn ternary complex is essentially identical to that of the o6megc mg ternary complex with an open protein conformation ( rmsd = 0.165 , figure 5d ) . like the o6megc mg ternary complex , the o6megc mn ternary complex adopts an open protein conformation and staggered base pair , indicating that the substitution of mn for mg does not significantly facilitate the open - to - closed conformational activation of the o6megc ternary complex ( figure 5a ) . the only notable difference between the o6megc mg / mn complexes is the absence and the presence of the catalytic metal ion , respectively ( figure 5b and c ) . the structural similarity between the o6megc mg / mn complexes is consistent with our kinetic data showing only a modest ( 2-fold ) increase in insertion efficiency by the metal - ion substitution ( table 1 ) . the distance between the o3 of primer terminus and the p of incoming nucleotide in the o6megc mn structure is 1.6 longer than that observed in pol structure with correct insertion . in addition , the catalytic metal ion is not coordinated to catalytic asp256 ( 4.5 ) and is weakly coordinated to the primer terminus 3-oh ( 3.1 ) ( figure 5c ) . molecular dynamics studies have suggested that the reaction pathway for pol-catalyzed misincorporation involves an open - to - closed conformational change of protein and proton transfer from primer o3-h to asp256 . recent computational and structural studies with asp256glu pol support that proton transfer from primer o3 to nearby asp256 is important for catalysis . the formation of open protein conformation , the lack of the coordination of asp256 to the catalytic metal ion , and the longer o3-p and o3mn distances observed in the o6megc mn ternary structure thus suggest that this structure most likely represents a conformational intermediate that requires a further conformational adjustment of the active site to reach a catalytically competent state . overall , both the o6megc mg / mn ternary structures with open protein conformation explain the inefficient incorporation of dctp opposite o6meg by the enzyme ( table 1 ) . ternary structure of pol incorporating dctp * opposite templating o6meg in the presence of mn ( pdb i d 4ny8 ) . ( b ) active - site view of the o6megc mn ternary structure . protein is in an open conformation . o6meg and dctp * form a staggered base pair . ( c ) close - up view of the metal - ion - binding site . both the nucleotide - binding and the catalytic metal ions are present , yet the critical coordination of asp256 to the catalytic metal ion is lacking . the o3(primer terminus)-p(dctp * ) ( 5.0 ) and the c1(primer terminus)-c1(dctp * ) ( 9.0 ) distances are longer than those for correct insertion ( 3.4 and 5.0 , respectively ) . ( d ) overlay of the active - site structure of the o6megc mg / mn complexes ( rmsd = 0.165 ) . to gain insight into the precatalytic state of pol performing the mutagenic replication across o6meg , we determined a ternary structure of pol with dttp * paired with templating o6meg in the presence of mn . the o6megt mn ternary structure was solved to 2.56 ( figure 6 ) . remarkably , unlike the o6megc mn ternary complex , the o6megt mn ternary complex shows a catalytically competent state with a closed protein conformation , watson crick - like base pair , and the two active - site metal ions ( a and b of figure 6 ) , which have not been observed in any published pol structures with base pair mismatch . the overall structure of the o6megt mn ternary complex is essentially identical to that of published au mg ternary complex ( pdb i d 2fms , rmsd = 0.270 , figure 6f and figure s2 in si ) . the o6megt mn ternary structure shows the signature conformational reorganization of a closed pol conformation , where -helix n shifts 10 toward a nascent base pair ( figure 6b ) . o6meg forms coplanar pseudo - watson crick base pairing with dttp * by forming two h - bonds ; n1 and n2 of o6meg are h - bonded to n3 and o2 of dttp * , respectively ( figure 6c ) . unlike the o6megt mg and the o6megc mn ternary structures , the o6megt mn ternary structure shows completion of the coordination spheres of the both metal ions ( figure 6d ) . the distance between p of dttp * and o3 of primer terminus is 3.7 , which is comparable to that for correct insertion ( 3.4 ) . ternary structure of pol incorporating dttp * opposite templating o6meg in the presence of mn ( pdb i d 4nxz ) . ( b ) active - site view of the o6megt mn ternary structure . ( c ) h - bonding interactions and geometry of o6megdttp * base pair . a 2fo fc map is contoured at 1 around o6meg and dttp*. ( d ) close - up view of the active - site metal ion binding site . the distance between the 3-oh of the primer terminus and p of dttp * is comparable to that for correct insertion ( 3.4 ) . the c1(primer terminus)c1(dttp * ) distance is similar to that observed for correct insertion ( 5.0 ) . ( e ) overlay of the active - site structure of the o6megt mn ternary complex ( shown in blue ) with that of published ga mn ternary complex ( pdb i d 4lvs , shown in yellow green , rmsd = 0.655 ) . ( f ) overlay of the active - site structure of the o6megt mn ternary complex ( shown in blue ) with that of published au mg ternary complex ( pdb i d 2fms , shown in cyan , rmsd = 0.270 ) . whereas the o6megt mn ternary complex and recently published ga mn ternary complex are found to be similar in overall structure ( pdb i d 4lvs , rmsd = 0.655 ) , the active - site conformations of protein and dna in both complexes are quite different ( figure 6e and figure s3 in si ) . our o6megt mn structure shows a 2 shift of both -helix n and the template strand bases and a 4 shift of the phosphate backbone of template strand from their positions observed in the ga mn structure . published ga mn mismatched structure shows that the nascent dgdatp base pair forms a buckled conformation ( angle = 140 ) and lacks the minor - groove edge interactions with asn279 and arg283 . in addition , the primer terminus 3-oh is not coordinated to the catalytic metal ion ( 4.8 ) , is distant from p of the incoming nucleotide ( 4.7 ) , and is suboptimally positioned for in - line nucleophilic attack on the p. in stark contrast , our o6megt mn mismatched structure shows protein and dna conformations that are nearly indistinguishable from those observed in published au mg matched structure ( pdb i d 2fms , rmsd = 0.270 , figure 6f ) . the structural differences between the ga mn and the o6megt mn complexes suggest that pol allows coplanar conformation only when the base pair can adopt watson crick - mode conformation in the nascent base pair binding pocket . structural comparison of the o6megc mg / mn and the o6megt mg / mn complexes provides insights into the observed kinetic differences among the o6meg complexes ( table 1 ) . in the case of the o6megc complexes , substituting mn for mg induces only a modest conformational change such as binding of the catalytic metal ion ( figure 5d ) . on the contrary , substituting mn for mg in the o6megt ternary complex induces an open - to - closed conformational transition of protein , staggered - to - coplanar conformational change of base pair , and the completion of the coordination spheres of two metal ions . the difference in the degree of conformational change among the o6meg complexes indicates that the substitution of the active - site metal ion has a greater effect on the o6megt ternary complexes than the o6megc ternary complexes , which is consistent with our kinetic studies showing that substituting mn for mg increases insertion efficiency for dttp and dctp opposite o6meg by 10-fold and 2-fold , respectively ( table 1 ) . the analysis of the crystallographic thermal b - factors of the active sites of the o6meg ternary structures and published au mg ternary structure also provides insights into the observed kinetic differences ( figure 7 ) . the crystallographic temperature factors have been used to analyze the active sites of various enzymes including pol. the b - factors analysis of the active sites of published pol ternary structures shows that the nascent and the primer terminus base pairs of ternary complex with a matched base pair ( e.g. , au ( pdb i d 2fms , 2.0 resolution ) , at ( 3lk9 , 2.5 ) , gc ( 2fmp , 1.7 ) , oxogc ( 1mq3 , 2.8 ) ) are ordered with an average b - factor range of 2030 , while those of ternary complex with a mismatched base pair ( e.g. , ca ( 3c2l , 2.6 ) , ga ( 3c2 m , 2.2 ) , ga ( 4lvs , 2.0 ) ) are disordered with an average b - factor range of 4060 , suggesting that the low mobility of the nascent and the primer terminus base pairs is preferred for the formation of a catalytically optimal conformation . in the case of our o6megc / t mg structures , the nascent and the primer terminus base pairs and the nucleotide - binding metal ion in the o6megc mg complex are more fluctuating than those in the o6megt mg complex ( figures 7a and 7b and table 2 ) , implying that the active site of the o6megt mg complex is more ordered and thus more favorable for catalysis than that of the o6megc mg complex , which is consistent with the observed higher efficiency for dttp insertion than dctp insertion opposite o6meg ( table 1 ) . the b - factors analysis also indicates that the templating o6meg and the catalytic metal ion of the o6megt mn complex are more resolved than those of the o6megc mn complex ( figures 7c and 7d ) , which would attribute to the higher insertion efficiency for dttp over dctp opposite o6meg . interestingly , whereas the o6megt mn complex and published au mg complex are structurally very similar , the catalytic metal ion in the o6megt mn complex is more fluctuating than that in the au mg complex ( figures 7d and 7e ) , which partially explains 30-fold lower insertion efficiency for the o6megt mn complex than that for the gc mg complex ( table 1 ) . the b - factors analysis of the nascent and the primer terminus base pairs of the o6meg ternary structures and published au mg ternary structure ( pdb i d 2fms ) . the structural differences between the o6megt mn and the o6megc mn complexes strongly indicate that the o6megt complex has higher accessibility to the catalytically competent state than the o6megc complex , which is consistent with the preferential insertion of t over c opposite o6meg by pol. the o6megt mn ternary structure is consistent with the 100-fold higher insertion efficiency for t over c opposite o6meg in the presence of mn ( table 1 ) . we conclude that the o6megt mn ternary structure represents a precatalytic state competent for nucleotidyl transfer . our structural studies provide important insights into the slow , yet highly promutagenic replication across o6meg by pol. the o6megc / t mg ternary structures with the open protein conformation , staggered base pair , and one active - site metal ion suggest that pol slows nucleotide incorporation opposite o6meg by inducing an altered conformation incompetent for catalysis . the striking conformational difference between the o6megt mn ternary complex ( a closed protein conformation and coplanar watson crick - mode base pair ) and the o6megc mn ternary complex ( an open protein conformation and staggered base pair ) explains the preferential insertion of dttp over dctp opposite o6meg during pol catalysis . in addition to these , our studies provide insights into the replication fidelity mechanism of pol. our o6megc / t mn ternary structures indicate that pol allows coplanar o6megt , but not coplanar o6megc , in the enzyme active site , thereby promoting the mutagenic replication across o6meg ( figure 8) . these structures also indicate that pol allows only a watson crick - mode base pair in the nascent base - pair binding pocket , and strongly discourages non - watson crick - mode base pairs ( e.g. , wobble o6megc , one h - bonded o6megt ; figure 1 ) in the binding pocket . effect of the active - site metal ion on the conformational activation of pol. ( a ) the o6megc mg ternary structure with the nucleotide - binding metal ion . ( b ) the o6megc mn ternary structure with the two active - site metal ions . ( c ) the o6megt mg ternary structure with the nucleotide - binding metal ion . the complex adopts a closed protein conformation and pseudo - watson crick base pair . as described above , the o6megt mn ternary structure shows coplanar watson crick - like base pair and a closed protein conformation ( figure 8d ) , whereas the o6megc mn ternary structure shows staggered base pair and an open protein conformation ( figure 8b ) . published pol ternary structures with correct insertion show coplanar base pair and a closed protein conformation , whereas structures with base pair mismatch ( e.g. , tc , ac ) show a staggered base pair and an intermediate protein conformation . our o6megt mn ternary structure , which represents the first pol mismatched ternary structure with coplanar base pair and a closed protein conformation , thus suggests that the closed pol conformation is allowed only when a base pair can form coplanar watson crick - type pairing in the enzyme active site . whereas o6megt can form two h - bonds via pseudo - watson crick base pairing , o6megc can not readily form watson crick - like pairing at physiological ph ( figure 1 ) . pol appears to suppress the formation of coplanar o6megc base pair in the nascent base - pair binding pocket , which is in contrast with a high fidelity dna polymerase bf that allows relaxed isosteric watson crick - mode for both o6megc and o6megt in its active site ( figure s4 in si ) . the difference in o6megc / t base pairing modes in the pol and bf structures may result from more strict base - pair geometry constraints of pol relative to those of bf ; duplex dnas in the active site of pol and bf have been shown to adopt b - form and a - form , respectively . in addition , x - ray structures of bf with ac mismatch have shown that bf induces watson crick datpdc base pair in the presence of mn , which is in contrast to pol inducing staggered datpdc base pair in the presence of mn . crick and non - watson crick - mode base pairs in the binding step , allowing watson crick - mode o6megt base pair , but not wobble o6megc base pair , in the nascent base - pair binding pocket . the pol:dna : dntp ternary complex with an open protein conformation has been suggested to form at the initial stages of open - to - closed conformational transition of the enzyme , yet capturing such complex has been difficult . our o6megc / t mg ternary structures with an open protein conformation and the nucleotide - binding metal ion may represent a close approximation of a conformational intermediate captured prior to open - to - closed conformational change , thereby providing insights into the enzyme s conformational transition . first , these structures indicate that binding of the nucleotide - binding metal ion occurs prior to that of the catalytic metal ion , which is consistent with kinetic studies that indicate a fast nucleotide - binding metal ion followed by a slow catalytic - ion - induced conformational transition . second , our results illustrate that binding of an incoming nucleotide is not sufficient to trigger the open - to - closed conformational transition ( a and c of figure 8) . third , the structural differences between the o6megt mg ternary structure ( an open protein conformation and the nucleotide - binding metal ion ) and the o6megt mn ternary structure ( a closed protein conformation and the two metal ions ) suggest that binding of the catalytic metal ion is important for the open - to - closed conformational activation . lastly , the observation of the open protein conformation for both o6megc / t mg structures implies that the formation of the closed protein conformation is discouraged when a base pair does not adopt a coplanar watson crick geometry in the enzyme active site , which could provide a kinetic checkpoint prior to catalysis . the observation of the pol ternary complexes with an open protein conformation and base pair mismatch supports an induced - fit mechanism , whereas a closed protein conformation , which is the optimal conformation for nucleotidyl transfer reaction , is readily accessible for correct insertion but not for incorrect insertion . the open protein conformation would also facilitate diffusion of an incorrect nucleotide from the active site and thus lower binding affinity of the incorrect nucleotide , which will enhance replication fidelity of the enzyme . large variation in the catalytic metal - ion coordination state among our o6megc / t mg and o6megc / t mn ternary structures and previous pol ternary structures suggests that pol utilizes the catalytic metal - ion coordination to deter nucleotide misincorporation ( figure s5 in si ) . the coordination state of the catalytic metal ion appears to greatly affect conformations of poldna complexes . in pol ternary structures with correct insertion , the catalytic metal ion is typically coordinated to three asp residues , p oxygen of incoming nucleotide , and the 3-oh of primer terminus . these matched ternary structures adopt a closed protein conformation and coplanar base pair . in published polmn ternary structures with ca and ag mismatches , the two active - site metal ions are observed , yet primer terminus 3-oh is not liganded to the catalytic metal ion . the o6megc / t mg ternary structures with an open protein conformation and staggered base pair show only the nucleotide - binding metal - ion coordination . the o6megc mn ternary structure with an open protein conformation and staggered base pair shows the presence of the two active - site metal ions , yet asp256 is not liganded to the catalytic metal ion . lastly , the o6megt mn ternary structure shows completion of the coordination sphere of the catalytic metal ion , and adopts the closed protein conformation and coplanar base pair . taken together , the observed large variation in the catalytic metal - ion coordination state among pol structures suggests that the coordination state of the catalytic metal ion dictates the conformation of the poldna complex , that the completion of the coordination sphere of the catalytic metal ion is crucial for the conformational activation of the enzyme , and that the completion of the catalytic metal - ion coordination is achieved in the presence of only watson crick - mode base pair in the nascent base - pair binding pocket . the observation of only the nucleotide - binding metal ion in the o6megc / t mg ternary structures with an open protein conformation supports that pol deters the coordination of the catalytic metal ion for non - watson we conclude that pol may use the catalytic metal - ion coordination as a kinetic checkpoint to increase its replication fidelity . the o6megt mn ternary structure represents the first pol structure with coplanar mismatched base pair , which is in contrast to published mismatched pol structures with staggered base pair . the observation of the coplanar mismatched o6megt base pair in the nascent base pair binding pocket suggests that some mismatched base pairs , for example gt base pair which comprises 60% of the base substitution mutations produced by pol , could also form the similar coplanar conformation during dna replication by pol , and that mismatched base pairs with coplanar conformation would be preferentially formed over mismatched base pairs with staggered conformation during pol catalysis . the o6megt mn ternary structure also represents the first structure of pseudo - watson crick o6megt base pair formed in the nascent base - pair binding pocket of a dna polymerase . whereas the pseudo - watson crick o6megt base pair has been observed in an x - ray structure of duplex dna , nmr studies have indicated the formation of one h - bonded o6megt base pair rather than the two h - bonded pseudo - watson crick base pair ( figure 1 ) . in the nascent base - pair binding pocket of bf , o6megt forms an isosteric watson crick o6megt base pair ( figure s4 in si ) . crick o6megt suggests that some dna polymerases with the base - pair geometry constraints similar to those of pol , for example pol , may also induce pseudo - watson the pol:o6megt mn ternary structure represents , to our knowledge , the first example of a dna polymerase structure with a drastic mn - induced conformational transition of protein and nascent base pair . the x - family dna polymerase pol does not undergo a conformational transition during nucleotide incorporation . the y - family dna polymerase dpo4 and the b - family dna polymerase rb69pol structures with active - site mg show that the protein conformations of ternary complexes with base pair mismatch vs match are almost the same , so substituting mn for mg is unlikely to induce an open - to - closed conformational activation of those enzymes . published bf - ac mismatched structures with the active - site mg vs mn show a wobble - to - watson crick conformational change of base pair , yet conformational change of protein is not prominent . interestingly , bf : tg mg ternary structure shows wobble tg base pair and an ajar protein conformation . it would be interesting to know whether substitution of the active - site metal ion will induce watson crick - mode tg base pair and an ajar - to - closed conformational change of protein . taken together , pol is a rare dna polymerase that can induce a drastic metal - dependent conformational change in both protein and base pair during nucleotide misincorporation . in vitro studies with various dna polymerases substituting mn for mg increases misincorporation rate and reduces replication fidelity of several dna polymerases , such as pol , dpo4 , pol , pol,escherichia coli dna polymerase i , and t7 dna polymerase . although several dna polymerase structures with base pair mismatch have been reported , the structural basis for mn - promoted replication infidelity of dna polymerase is poorly understood due in significant part to the scarcity of mismatched dna polymerase structures with mg / mn and wild - type active site . for example , dpo4 structure with tg mismatch lacks the active - site mn , and published pol structures with mismatch either lack active - site mg or have arg283lys mutation . bf structures with ac mg / mn lack the primer terminus 3-oh and the catalytic metal ion . our pol structures with mg / mn and wild - type active site thus provide new insight into the mn - promoted replication infidelity . whereas the o6megc / t mg ternary complexes contain only the nucleotide - binding metal ion ( figure 7 and figure s5 in si ) , the o6megc / t mn ternary complexes contain both the catalytic and the nucleotide - binding metal ions , indicating that substituting mn for mg promotes binding and coordination of the catalytic metal ion during misincorporation . the coordination of the catalytic metal ion in the active site of dna polymerase has been suggested to lower the pka of the 3-oh of primer terminus , place the 3-oh of primer terminus in an optimal position for in - line nucleophilic attack on the p of incoming nucleotide , and promote proton transfer from the 3-oh of primer terminus to nearby catalytic carboxylate or water molecule , thereby lowering the activation energy barrier for nucleotidyl transfer and facilating the chemical reaction . the catalytic metal ion may sense the presence of abnormal substrates in the nascent base pair binding pocket and play an important role in deterring nucleotide misincorporation by preventing its proper coordination , which has been suggested to be the rate - limiting step of the nucleotidyl transfer . dna polymerases probably utilize the catalytic mg , which is highly sensitive to the presence of active - site mutations , base pair mismatch , and suboptimal substrates , to increase substrate specificity and replication fidelity . the replacement of mg with mn , which is more tolerant of active - site distortions and abnormal substrates than mg , could stimulate the binding and the subsequent coordination of the catalytic metal ion during nucleotide misincorporation , thereby faciliating the incorporation of otherwise unfavorable substrates and decreasing replication fidelity of dna polymerase . in summary , we have reported the first structures of wild - type pol ternary complex with an open protein conformation and one active - site metal ion ( the o6megc / t mg complex ) , pol ternary complex with base pair mismatch and a closed protein conformation ( the o6megt mn complex ) , pseudo - watson crick o6megt base pair formed in the nascent base - pair binding pocket of a dna polymerase , and a metal - dependent conformational activation of a dna polymerase . our studies presented here provide structural basis for the pol catalysis across the carcinogenic o6meg lesion . our results indicate that pol slows noncomplementary nucleotide incorporation by inducing an alternate conformation suboptimal for chemistry , and that pol promotes mutagenic replication by allowing watson crick - mode for o6megt , but not for o6megc , in the nascent base - pair binding pocket . our studies also suggest that pol increases its replication fidelity by utiziling the catalytic metal - ion coordination state as a kinetic checkpoint prior to catalysis , and that the completion of the catalytic - metal ion coordination is crucial for the open - to - closed conformational activation of the enzyme .

a 41-year - old man presented with terminal gross hematuria that was noted one month earlier . his past medical history was unremarkable except that he had suffered with prostatitis . the serum markers for prostate cancer , prostate - specific antigen ( psa ) and prostatic acid phosphatase ( pap ) were normal . transrectal ultrasonography showed a well - demarcated , pear - shaped cystic lesion that included an echogenic papillary solid mass in his left seminal vesicle ( fig . contrast - enhanced pelvic ct showed that the papillary solid mass originated from the wall of the left seminal vesicle cyst and it was mildly enhanced ( fig . 1b ) . a dilated ectopic ureter opening into the dilated left seminal vesicle was also seen . contrast enhanced abdominal ct at the level of the l4 vertebra demonstrated a small abnormal soft tissue density in the aorta 's left lateral aspect , suggesting a dysgenetic or atrophic kidney ( fig . the axial t1-weighted ( tr / te : 540/12 ms ) mr image showed high signal - intensity fluid in the seminal vesicle cyst ( fig . the coronal t2-weighted ( tr / te : 5500/136 ms ) mr image demonstrated an approximately 7.8 6 5.2 cm papillary mass in the left seminal vesicle cyst ( fig . the sagittal t2-weighted image showed a markedly dilated ectopic ureter draining into the cyst ( fig . the cystoscopic findings showed bulging of the left hemitrigone on the left side of the bladder . radical excision of the left agenetic kidney , left ureter and seminal vesicle cyst and a partial cystectomy were done . photomicrography showed a papillary glandular configuration covered with carcinoma cells and mucinous materials in the cystic space without any muscular invasion ( fig . the histopathologic diagnosis was a well - differentiated primary mucinous adenocarcinoma of the left seminal vesicle cyst ( fig . the specimen we labeled " agenetic kidney " showed only a vestigial remnant of the ureteric buds . five years later , the follow - up ct and whole body bone scanning revealed no evidence of tumor recurrence or distant metastasis . primary tumors of the seminal vesicles , such as adenocarcinoma , sarcoma or lymphoma , are rare findings , and secondary tumors are more common . most often , the patients present late in their disease course with nonspecific symptoms ( 2 ) , so a late diagnosis of primary adenocarcinoma in the seminal vesicle is rather typical . our patient had a previous history of prostatitis seven years ago . elevated serum levels of psa and pap helped us to identify the prostate as the site of primary malignancy . on the other hand , the serum psa and pap levels are normal in patients with primary seminal vesicle adenocarcinoma , but the serum cea may be elevated ( 3 ) . in our patient , all of these serum markers were normal . the mesonephric duct extends caudally to the cloaca and it gives raise to the ureteric bud . if the ureteric bud originates more cranially than normal in the mesonephric duct , then the ureter may insert into seminal vesicle , the posterior urethra , the ejaculatory duct and the vas deferens ( 2 ) . ectopia in these areas may be associated with reflux or obstruction , and this is the suggested cause of renal functional impairment or absence ( 4 ) . so , seminal vesicle cysts are commonly associated with renal agenesis or dysgenesis on the ipsilateral side ( 6 ) . incomplete development between wolffian 's duct and the urogenital sinus in males results in an accumulation of secretions and the subsequent formation of seminal vesicle cysts during puberty ( 7 ) . we suggest that the cause of large seminal vesicle cysts is not only the ectopic ureter opening into the cyst , but also a mucin producing tumor . secondary involvement of the seminal vesicle is more common than primary seminal vesicle cancer for carcinoma in situ of the bladder , adenocarcinoma of the prostate , lymphoma or rectal carcinoma . the diagnosis of primary adenocarcinoma within the seminal vesicle is difficult to arrive at with using just the image findings . but in our patient , the intraluminal protruding papillary mass in the seminal vesicle cyst was easily identified on imaging study . we suggest that primary seminal vesicle cancer should be considered in the differential diagnosis of papillary mass in the cyst . okada et al . have reported a case of papillary adenocarcinoma in a seminal vesicle cyst associated with ipsilateral renal agenesis ; however , an ectopic ureter opening was not described ( 8) . a few cases of ectopic ureter associated with cancer have been previously reported ( 8 , 9 ) . most patients with seminal vesicle cysts combined with ipsilateral renal agenesis or dysgenesis are asymptomatic until the condition 's second or third decade ( 1 , 2 ) . our patient was younger than the patients in the previously reported cases who had primary seminal vesicle adenocarcinoma discovered , and he was older than the patients who had seminal vesicle cysts combined with ipsilateral renal agenesis or dysgenesis . so , we suggest the possibility that the development of seminal vesicle adenocarcinoma is due to chronic stimulation of the ectopic ureter 's secretion . in this clinical setting with a papillary mass of a seminal vesicle cyst with an ectopic ureter , primary mucinous adenocarcinoma arising from the seminal vesicle cyst should be considered as part of the differential diagnosis , even though the patient was young . in conclusion , we report here on a case of primary mucinous adenocarcinoma arising from a seminal vesicle cyst that was associated with an ectopic ureter opening and ipsilateral renal agenesis , which is a very rare condition indeed . the lesion was depicted on transrectal ultrasonography , contrast enhanced ct and mri as a papillary solid mass originating from the wall of the left seminal vesicle cyst .

characterizing the dynamics of rare events is vital to the understanding of large - scale structural changes that occur in many complex systems in nature and technology . rare events typically involve many cooperative parts that act together in a complicated way along a transition from one long - lived state to another , and the determination of the collective variables responsible for the reaction dynamics can provide much insight into the physical mechanism underlying a transition . in the best circumstance , a reaction coordinate is found , a function of these collective variables that alone is sufficient to track the progress of a reaction . unfortunately , finding an adequate description of the reaction in terms of a reaction coordinate or even only identifying the collective variables is a challenging task : not only is sampling computationally demanding due to the rare nature of the transition , but the reaction also proceeds through a high - dimensional phase space and so it is often difficult to discern which variables promote the transition . despite many novel techniques for reaction analysis , finding a good reaction coordinate remains a challenge for many processes occurring in complex systems . in this paper , we investigate the kinetic pathways leading to ionic dissociation , in particular the dissociation of nacl in water . microscopically , this system contains metastable associated and dissociated states , separated by a free energy barrier preventing frequent transitions . along a reaction in which the ion pair transitions between associated and dissociated states , a number of system rearrangements must take place which crucially involve the surrounding solvent molecules . the first simulations of this system were performed by mccammon et al . and rey et al . who used umbrella sampling and constrained solute simulations , respectively , to investigate solvent structure and thermodynamic properties as the interionic distance rion = |rna rcl| is varied . employed transition path sampling to study the reaction , showing under careful statistical analysis that rion alone is a poor reaction coordinate in describing dissociation , and that the surrounding solvent must be taken into account in a good reaction coordinate . despite this work and others , a complete description of the solvent motion leading to dissociation is missing . while the ultimate goal is to find a reaction coordinate for the event , even a complete set of solvent variables that jointly account for the dissociation process is still unknown , and hence further investigation is needed . in the current study , we shed some more light on water s unique role by investigating the thermodynamic and dynamical properties of the dissociation reaction . , we present a thermodynamic description of the reaction in terms of competing thermodynamic driving forces , showing that dissociation is an energetically favorable but entropically unfavorable process . we argue that the decrease in solvent entropy upon dissociation is due to an increasingly larger number of highly coordinated solvent molecules in the first hydration shell as the ions move apart . we then investigate the relative importance of various system variables in promoting dissociation . as with previous studies , we employ statistical analysis of dissociation ( committor ) probabilities on data from various constrained ensembles : for data with constrained rion , we verify that rion is indeed important in the reaction but does not capture the entire mechanism , in confirmation with earlier studies . various solvent degrees of freedom are then constrained to pinpoint the range over which the solvent influences the dissociation event . we then investigate various dynamical aspects of dissociation , highlighting time scales under which solvent rearrangements occur which drive dissociation , and the importance of inertial effects near the transition state . the system we studied consists of one na ion and one cl ion immersed in a bath of nw = 216 water molecules . the ion pair and ion water interactions were modeled using the opls force field , which includes short - ranged lennard - jones and long - ranged coulomb terms . more specifically , the ion ion interaction is given by1where e is the elementary charge , 0 is the permittivity of free space , and lennard - jones parameters for the ion pair are ion = 3.8355 and = 0.075 603 420 1 kj / mol . calculations of the long - ranged electrostatic forces from periodic boundary conditions were handled with particle mesh ewald summation . the simulations were performed at a constant temperature of t = 300 k and constant volume of v = ( 18.64 ) , which was chosen from an equilibrated constant - pressure simulation under ambient conditions . to sample the nvt ensemble , the system evolved under langevin dynamics with a friction coefficient corresponding to a time scale of 0.1 ps . our simulations were performed with the program gromacs , with a time step of t = 2 fs and integration performed via a stochastic leapfrog algorithm . to begin our analysis , we generated 10 trajectories sampling the canonical ensemble , totaling 80 ns , that involved 227 transitions between associated and dissociated states . initial conditions for each of the 10 trajectories were taken from a previous simulation run using the same langevin dynamics . each of the 10 points were separated by 400 ps from their neighbors , such that they can be considered statistically independent . we calculate the free energy along the interionic distance rion as2by histogramming rion from the concatenated trajectories . here , we see that f(rion ) contains a metastable associated state with a corresponding free energy minimum at rion = 2.7 . this minimum is separated from the solvent - separated state , centered around 5 , by a barrier of 5 kbt . for future reference , we identify the associated state as all configurations for which rion < 3.2 , the dissociated state as rion > 4.4 , and the transition region to be 3.2 rion 4.4 . to gain an understanding of ionic dissociation , we first investigate the thermodynamics of the process along the order parameter rion . in the nvt ensemble , the helmholtz free energy f contains energetic and entropic contributions , which we calculate as a function of the ion pair separation ( see figure 1 ) . the energy profile is computed from a number of simulations , in each of which rion is constrained to a value between 2.47 and 7.51 . for each simulation , the potential energy e was averaged over a 100-ns - long trajectory . plotted in green is u(rion ) = erion e , the average energy , after subtracting the asymptotic value . the entropy s , plotted in blue , is identified from3note that the errors on u and s are due to the large energy fluctuations of the many solvent solvent interactions in the bulk . we see , in figure 1 , that the associated state is stabilized energetically , with a 3 kbt barrier to overcome before energetically favorable dissociation occurs . the entropy s leads to an attractive contribution to the free energy opposing dissociation in the range rion < 4.0 , a behavior familiar from entropy - driven hydrophobic association . thus , the energy and entropy shown in figure 1 show markedly different behavior than in the implicit solvent case , where the solvent is modeled simply by a dielectric constant = 80 which screens the electrostatic interaction of the ion pair by rescaling the coulomb term in eq 1 by a factor of 1/. in this case , the energy has only one minimum at the associated state , and the driving force to dissociation is entirely entropic , due to an available configuration space that grows as rion2 . this confirms that the solvent plays a nontrivial role in the dissociation process . we note that this thermodynamic picture is contrary to the behavior of a model protein ligand complex in water , as found in recent simulation studies by mccammon . for oppositely charged protein and ligands , the dissociation is an enthalpically unfavorable and entropically favorable process . to further investigate the influence of the solvent on the system entropy , we plot in figure 2 the average numbers nna and ncl of water molecules within the first solvation shell of na and cl , respectively . [ the solvation shell radii for each ion correspond to the respective minimum in the ion - oxygen radial distribution function , 3.34 for na and 3.74 for cl ( data not shown ) . ] during the dissociation process , the solvation numbers of the na and cl ions increase by about 2 and 1 , respectively . in figure 2 , we also plot in blue the average number of water molecules simultaneously in the solvation shells of both ions . while for the associated state there is one shared molecule , the number of such molecules starts to increase at about rion = 3.3 and reach 2 at rion = 4 , where the solvation number of the ions saturate . the number of shared water molecules then falls to 1 as the solvent - separated state is reached around rion = 5 and finally to 0 around rion = 6 . since the number of shared water molecules is constant for rion 3.3 , the increase in the average solvation numbers nna and ncl is due to additional water molecules entering the respective solvation shells from the bulk . in the range 3.3 rion 4.0 , however , the total number of water molecules in the combined solvation shells of na and cl grows only slowly , while the solvation numbers in the individual shells increase by a total of about 1 water molecule due to a solvent reorganization that creates an additional shared water molecule . this is consistent with early work of mccammon and others on ionic dissociation , who found that dissociation is preceded by solvent reorganization in the first solvation shell , leading to the addition of a shared water molecule as the transition state is approached . as the interionic distance grows further , the solvation numbers of the individual ions stay roughly constant , while the number of shared water molecules decreases to 0 for sufficiently separated ions . during this final stage of the dissociation , 2 water molecules enter the solvation shell of the ions from the bulk to compensate for the loss of shared water molecules . during the entire dissociation process , the total number of water molecules in the combined solvation shells of na and cl increases by about 4 on average . the free energy ( red ) as a function of rion displays a stable associated state at rion = 2.7 , separated from the dissociated state by a free energy barrier of 5 kbt . also plotted are the average energy ( green ) and negative entropy ( blue ) as a function of rion . the inset shows the free energy , the energy , and the entropic contribution for an implicit solvent model , in which the electrostatic interaction between the two ions is reduced by a factor of = 80 . top : average number nna and ncl of water molecules in the first solvation shell of na and cl . shown in blue is the number ns of waters common to the solvation shells of both ions . bottom : sum n = nna + ncl of the number of water molecules in the first solvation shells of na and cl and total number of water molecules m as shown in figure 2 , the solvation numbers nna and ncl show the same roughly linear increase with interionic distance as the entropy ( see figure 1 ) , suggesting that the entropy change during dissociation is due to the reduced freedom of motion of water molecules tightly bound to the ions . indeed , water molecules in the first solvation shell of ions have been observed in simulations to be orientationally highly restricted , reducing the configurational space available to the molecules compared to the bulk . the orientational restraints acting on first solvation shell molecules are particularly pronounced for water molecules shared by both ions . as the ions dissociate , the number of such low entropy solvent molecules increases , leading to a net entropy decrease in the system . for interionic distances of rion 4 and larger , the entropy is approximately constant even though the number of total water molecules in the combined first solvation shells of the two ions continues to increase ( see green line in the bottom panel of figure 2 ) . in this regime , the sum nna and ncl , which double counts shared water molecules and equals the number of close constacts of water molecules with one of the ions , remains constant . this indicates that the entropy is related to the number of such close contacts rather than the total number of solvating water molecules . this conclusion is confirmed by the linear behavior of the entropy in the 3.3 rion 4.0 , where the total number of solvating water molecules grows only slowly but the number of close contacts increases due to the increase of shared water molecules . for rion 3.3 , on the other hand , the number of close contacts increases due to water molecules entering the first solvation shells of the ions from the bulk . thus , as shown in figure 3 , overall there is a roughly linear relationship between the number of close contacts and the entropy , where each close contact contributes an entropy decrease of s 1.9 kb . entropy s as a function the number n = nna + ncl of close contacts between the ions and water molecules in the first solvation shell . , however , provides only a partial picture of ionic dissociation : as shown previously , the interionic distance rion can be used as an order parameter to distinguish between the associated and dissociated states but fails in describing the progress of the dissociation . in other words , rion is a poor reaction coordinate implying that solvent degrees of freedom must be explicitly taken into account . in the next section , we corroborate this finding and carry out a new type of statistical analysis to identify the range within which solvent degrees of freedom affect the dissociation process . one of the major goals of characterizing a reaction pathway is the determination of the system variables that are important for the reaction to proceed . this set of variables , if known , provides a basis for understanding the physical mechanism underlying a complex transition . a good reaction coordinate r will in general be a function of a number of such collective variables , which together completely specify the progress of a reaction . in this section , we employ committor analysis first to test the quality of rion as a reaction coordinate , confirming results of previous studies , and then to examine the influence of various solvent degrees of freedom on the dissociation process . in searching for the important collective variables , or optimally a reaction coordinate , we ultimately seek a projection of phase space that preserves the dynamical information pertaining to the reaction . this dynamical information is captured by the committor probability , pb(x ) , a key tool in determining these collective variables . for a system containing two long - lived stable states , labeled a and b , pb(x ) is defined as the probability that a trajectory initiated from configuration x will relax to state b before reaching state a. as such , pb is a statistical measure of the progress of a reaction . in particular , configurations with pb = 1/2 can be considered to be transition states , as they have equal probability to relax into a or b. while the perfect reaction coordinate is the committor itself , r(x ) = pb(x ) , a good reaction coordinate r(x ) will to a good accuracy specify pb(x ) , in the sense that the committor can be written as pb(x ) pb[r(x ) ] and the reaction information is contained in the variables in r(x ) . thus , for a good reaction coordinate , the distribution of pb values for configurations restricted to a particular value of r should be sharply peaked around some characteristic value . the quality of a trial reaction coordinate can then be investigated by probing this distribution of committor values . for a trial reaction coordinate r , one calculates pb values for configurations in the constrained equilibrium ensemble with r(x ) = const . a distribution pr(pb ) is estimated by histogramming the pb values of the constrained ensemble , and the quality of r is assessed from the shape of pr(pb ) : if pr(pb ) is a sharply peaked function of pb , then the degrees of freedom specified by r(x ) determine to a good approximation the fate of the reaction . if however pr(pb ) is not sharply peaked , then other degrees of freedom not included in r(x ) play a role in specifying how the reaction will proceed , and thus r(x ) is an insufficient reaction coordinate . in the following sections , we assess the relative importance of various system variables in nacl dissociation by applying committor analysis to various constrained ensembles . in our solvated nacl system , we define b as the dissociated state , for which rion > 4.4 , and a as the associated state , rion < 3.2 . for our committor calculations , pb(x ) is estimated by shooting off ns independent trajectories starting from x , with initial velocities drawn from the corresponding maxwell the estimate for pb(x ) is given by the fraction of these trajectories that reach the dissociated state before associating , with an error4for our calculations , ns = 100 shots were performed for each pb estimate such that 0.05 . note that this statistical error of the estimated committor leads to a broadening of the committor distribution that can be statistically quantified and needs to be taken into account in the interpretation of committor distributions . in investigating the thermodynamics of dissociation above , the sampling of the canonical nvt ensemble and constrained ensembles was performed with langevin dynamics . for the following dynamical studies , hence , the shooting trajectories for calculation of pb values will be performed by integrating hamilton s equations of motion . in characterizing the kinetic pathways to ionic dissociation , we first test the performance of the interionic distance rion as a reaction coordinate . such a calculation for rion has been done previously , but we repeat it here , because we use a slightly different force field for the ion whether rion alone is a good reaction coordinate , we apply committor analysis on configurations with constrained rion . committor values were estimated for 665 configurations having 3.45 rion 3.75 ( narrowing the width of rion * did not qualitatively change the behavior of our results ) taken from the equilibrium run used to generate figure 1 , which involved many transitions between associated and dissociated states . the constraint range of rion was chosen around the position of the top of the free energy barrier ( see figure 1 ) . because this range of rion corresponds to the top of the free energy barrier , one would expect for a good reaction coordinate a sharp unimodal distribution centered at pb = 0.5 . what one sees , however , is a bimodal distribution peaked at pb 0 and 1 and relatively low population at 0.5 . hence , there are structures with the same interionic distance rion but very different relaxation behavior , indicating that the solvent degrees of freedom are important in the system committing to associate or dissociate . as this behavior was observed previously by geissler et al . for a different force field , these findings highlight that the solvent s role in dissociation is robust and of general importance in describing the reaction . since the interionic distance rion alone is an insufficient reaction coordinate , the surrounding solvent must play a crucial role in the system committing to associate or dissociate . to study the role of the solvent more closely , we seek to identify which water molecules are important in the reaction , with the specific goal of finding a length scale over which the water molecules influence the reaction . specifically , we perform committor analysis , on a constrained system as above , where in addition to a fixed interionic distance rion , we also constrain or committor analysis applied to this system in which a part of the water molecules is held at fixed positions will guide us in finding the length scale that determines the range of solvent influence on dissociation : if the distribution of pb values on these constrained configurations is sharply peaked , then the dissociation event is only sensitive to the frozen molecules within the given probe range ; if , however , the remaining unfrozen molecules in the periphery of the simulation box strongly influence the reaction , then the pb distribution will not show a single pronounced peak . a similar strategy has been used to deduce the role of the solvent in protein folding . distribution of pb values for equilibrium configurations x restricted to rion(x ) = rion * , corresponding to the top of the free energy barrier shown in figure 1 . we wish to find the probe range over which the peripheral variable solvent molecules cease to influence pb . in the limit of a very small probe range , only the ions are restrained , and we expect to see a distribution of pb values like figure 4 , where the other unfrozen molecules are clearly influencing the fate of the ion pair . in the opposite limit of a very large probe range , the entire simulation box is frozen and we expect a pb distribution that is very sharply peaked about some characteristic value . we seek the smallest probe range over which the variability of pb becomes small enough that we are confident the molecules within the probe range specify the fate of the reaction . to this end , three separate probe ranges were considered , set by the hydration structure of the ion pair : either all molecules up through the first , second , or third hydration shells were frozen ( see figure 5 ) . depiction of the first three solvation shells of the ion pair , which were selectively constrained to investigate solvent influence on ionic dissociation . the solvation shell radii of the three shells were defined by the respective minima in the ion oxygen radial distribution function , calculated as 3.34 , 5.47 , and 7.80 for na and 3.74 , 6.20 , and 8.18 for cl . to begin the analysis , one of the three probe ranges is chosen , centered around the ion pair , within which all waters are constrained . a representative initial configuration is selected , from which 125 new configurations are generated by evolving the system dynamically , each with identical solvent positions within the probe range but variable positions outside . we enforced these constraints on the dynamics by simply not allowing the positions of the relevant waters to be updated during the integration of the langevin equation of motion . this dynamical scheme samples a constrained equilibrium state that is equivalent to a reduced system ( the solvent outside the probe region ) , in the presence of a static external field ( imposed by the frozen solvent molecules and ion pair within the probe region ) . committor analysis is then performed on this constrained state by calculating pb values for each of the 125 configurations and histogramming the obtained committor values . note that in the trajectories generated for the committor calculation all constraints used to prepare the initial conditions were released . the results of the committor analysis are shown in figure 6 , where each subfigure corresponds to a given probe range . plotted within a given probe range are three distributions , colored red , green , and blue , which correspond to three distinct sets of 125 configurations with frozen solvent having pb values near 0 , 0.5 , and 1 , respectively . for the smallest probe range , where the solvent is constrained only in the first hydration shell ( part a ) , there is a very wide distribution of pb values for each of the three configuration sets . in part b , where the first two solvation shells are constrained , the distributions are not as broad as in part a but still show rather large pb variability , implying that molecules farther out are of importance . finally , when all three solvation shells are constrained , in part c , we see a much tighter distribution of pb values , which suggests that the commitment to associate or dissociate is , to a fair degree , determined by the solvent molecules within the first three solvation shells . these results are consistent with studies of geissler et al . , who found that the dissociation couples to solvent motion between the second and third solvation shells . interestingly , the pb = 0.5 configuration set ( green ) shows the broadest distribution for all three probe ranges , implying that pb is particularly sensitive to long - ranged solvent motion near the transition state . this is consistent with previous studies , who came to the same conclusion from studies of the mean solvent force on the ion pair at the transition state . solvent coordinates in ( a ) the first , ( b ) the first two , and ( c ) the first three solvation shells , and properly equilibrated outer shells . in each figure , the colors distinguish between different sets of frozen solvents , chosen near the associated state ( red ) , transition region ( green ) , and dissociated state ( blue ) . when freezing the first three solvation shells on a larger system of n = 905 water molecules , the committor distributions are not as tight ( inset of panel ) , further demonstrating that solvent effects on dissociation are long - ranged . the committor results of figure 6c , with three frozen solvation shells , correspond to freezing roughly one - half of the nw = 216 water molecules . to check the effect of system size on our results , we performed the same committor analysis on a system of 905 waters , with identical frozen positions as the smaller system but with a much larger number of peripheral water molecules . for this larger system , we observe a weaker tightening of the committor distribution as compared to the small system ( see the inset of figure 6c ) , further indication that solvent effects for this system are indeed long - ranged . as pointed out recently , a reduction of the number of degrees of freedom arising from additional constraints leads to a narrowing of the committor distribution p(pb ) , even if the constraints are not related to the reaction coordinate . to verify that the tightening of the committor distribution observed for frozen solvation shells is not caused by the dimensionality loss of the constrained system , we carried out additional simulations in which the frozen water molecules were chosen at random rather than based on their distance to the ion pair . specifically , we performed committor calculations analogous to those described in the previous paragraphs but on a constrained ensemble , in which in addition to the ion pair roughly 100 randomly chosen water molecules were kept at fixed positions . the total number of water molecules was nw = 216 and the number of fixed water molecules was chosen to correspond with the number of molecules in the first three solvation shells , which also contain roughly 100 molecules . the results of these calculations , shown in figure 7 , yielded committor distributions that are much broader than those obtained with the frozen solvation shells . thus , the narrowing of the committor distributions observed in the latter case is due to the importance of water molecules close to the ion pair rather than to the reduced dimensionality caused by constraining the position and orientation of water molecules . committor distributions for configurations containing roughly 100 frozen water molecules chosen at random ( solid lines ) together with committor distributions for three frozen solvation shells ( dashed lines ) . results are shown for configurations close to the associated state ( red ) , the transition region ( green ) , and the dissociated state ( blue ) . whether one considers the smaller or larger system , the waters within the first three hydration shells seem to capture the reaction to a good degree . specifically , what is the relative importance of steric forces to electrostatics ? because of the long - ranged influence of solvent on pb , we would expect electrostatics to play an important role . to test this conjecture , we generated a set of 125 configurations having identical oxygen positions within the first three solvation shells but variable hydrogen and dummy atom positions for our 4-point tip4p model . because the lennard - jones forces are specified by the oxygen position alone , the only variable forces within the three solvation shells are due to electrostatic interactions . the resulting committor distributions , shown in figure 8 , are still somewhat broad both for the smaller system ( main figure ) and the larger system ( inset ) . this indicates that the charge distribution of the waters is of general importance , and that the pb is determined by a combination of steric and electrostatic effects . all configurations within each color contain identical oxygen coordinates but have varying orientations of the water molecules in the first three solvation shells . we analyzed three sets of oxygen positions , chosen near the associated ( red ) , transition ( green ) , and dissociated ( blue ) states . the inset displays results of the analogous calculation performed for n = 905 water molecules . in this section , we investigate the time fluctuations of pb , with the goal of finding the relevant time scales under which the solvent rearranges itself to promote dissociation . we capture the dynamics of the entire solvent by calculating pb along a trajectory with constraint rion = 3.73 , near the peak of the free energy barrier , which we plot in figure 9a . this is contrasted with figure 9b , where our trajectory contains a constrained first solvation shell as well as constrained rion = 3.73 . we see qualitatively that the pb fluctuations are somewhat suppressed when the first solvation shell is fixed in addition to rion , consistent with committor analysis of previous sections ( compare figures 4 and 6a ) . in figure 9a where all solvent is free , we observe two time scales : on a large time scale of roughly 5 ps , we observe large pb fluctuations between 0 and 1 , and on a shorter time scale of roughly 0.5 ps , we see oscillatory - like fluctuations of a much smaller magnitude . because this smaller time scale persists in figure 9b , when we freeze the first solvation shell , it is tempting to conclude that the smaller fluctuations are due to solvent rearrangements outside the first solvation shell , and the larger pb fluctuations are due to the water rearrangements in the first solvation shell , which occur on time scales 10 times as large . time dependence of pb[x(t ) ] for trajectories generated from langevin dynamics with ( a ) constrained rion and ( b ) constrained rion and first solvation shell . the reaction pathways characterizing rare events will ultimately depend upon the system dynamics . observables such as kinetic rate constants , committor values , and transition probabilities are generally properties of the underlying dynamics governing the time evolution of the system . by analyzing transition pathways for various types of dynamics , one can then learn something about the relative importance of certain dynamical features in facilitating a rare transition . in this section , we will compare our calculations for hamiltonian dynamics to analytic results for diffusive dynamics , highlighting the importance of inertial effects in enhancing reaction probability . to track the differences that arise in these two dynamical regimes , we compare the committor probability pb to the transition path probability ptp . while pb(x ) is the probability that a trajectory passing through x relaxes into b , ptp(x ) quantifies the probability that a trajectory passing through x is a transition pathway . for a given configuration x , ptp(x ) is estimated by generating ntp = 100 trajectories from x by integrating hamilton s equations forward and backward in time with initial velocities sampled from the maxwell boltzmann distribution . in the diffusive regime , hummer showed that ptp is determined solely by pb:5we compare this analytic result to correlations we observe between ptp and pb when using hamiltonian dynamics ( i.e. , deterministic frictionless dynamics described by hamilton s equations of motion ) . in figure 10 , we display a scatter plot of ptp vs pb for equilibrium configurations constrained to rion = rion * ( data from figure 4 ) , plotted against the analytic result , eq 5 , for diffusive dynamics . while for configurations close to pb = 0 and 1 we see similar behavior between the two regimes , near the transition state , ptp is enhanced relative to diffusive behavior . hence , for hamiltonian dynamics , inertial effects enhance the reaction probability near the transition state by up to 4050% . this is intuitive : under hamiltonian dynamics , when the system evolves from a and up to the transition state , the probability to complete the transition by moving down to the reactant region b will be influenced by the instantaneous value of the momenta at the top of the free energy barrier . however , under diffusive dynamics , this enhancement is not present simply because the momenta are equilibrated instantaneously , providing no means to help push the system to the other side . the calculated transition path probability ptp is plotted against the committor probability pb for configurations constrained to rion = rion*. our results under hamiltonian dynamics , shown in red , show a deviation of the observed ptp from the analytic result under diffusive dynamics . in this study , we investigated the dissociation pathways of nacl in water . we showed that the thermodynamics of dissociation is driven energetically , and opposed entropically , with the loss of entropy explained by an increasing number of highly coordinated solvent molecules in the first solvation shell as the ions separate . by performing committor analysis on the system with various constraints , we showed that ( a ) the interionic distance is an insufficient reaction coordinate , in accordance with previous findings , ( b ) the influence of the solvent on ionic dissociation is long - ranged , extending out into the third solvation shell , and ( c ) both steric effects and electrostatics contribute to the system s commitment to dissociation . we also highlighted the time scales under which solvent fluctuations influence dissociation , as well as the importance of inertial effects near the transition state . in characterizing the kinetic pathway to dissociation , the ultimate goal is to find a good reaction coordinate for the system . despite the seeming simplicity of the solute , two atoms , finding previous attempts have shown correlations between nacl dissociation and solvation numbers and other orientational indicators of local solvent density . geissler et al . have suggested a mechanism whereby dissociation is accompanied by insertion of a water molecule from the bulk into the first solvation shell , preceded by a buildup of water density in the second solvation shell and a depletion between the second and third shells at the transition state . this picture is consistent with our findings that dissociation is sensitive to solvent rearrangements at these ranges . we have applied , with little success , a maximum likelihood approach to find an optimal reaction coordinate that depends on these and other solvent variables sensitive to solvent density rearrangements . we have also found weak correlations between pb and ( a ) the net solvent dipole along the interionic axis as well as ( b ) the net solvent force along the interionic axis . the microscopic mechanism leading to ionic dissociation , however , is still not completely known , and more study is needed .

the immune and endocrine systems interact directly to maintain the homeostasis of the organism in face of aggressions such as stress , infectious diseases , or inflammatory processes . in this context , chronic stress may represent a potential risk factor for the development of autoimmune and inflammatory disorders such as inflammatory bowel diseases ( ibd ) . ibd that comprise crohn 's disease ( cd ) and ulcerative colitis ( uc ) are characterized by their chronic course with alternating episodes of disease activity , severity , and clinical remission [ 2 , 3 ] . uc and cd are believed to be multifactorial disorders triggered by disturbances in environmental factors ( microbiota and stress ) [ 3 , 5 ] , genetic susceptibility , and immunological imbalance . hence , gut dysbiosis , defects in the population of effector t cells that react against normal microbial antigens in the intestine , and a decrease in the population of regulatory t cells ( tregs ) may account for the breakdown of mucosal tolerance in this scenario . the endocrine system may also play an important immune regulatory role in inflammatory diseases by production of mediators such as the adrenal - derived hormones . during homeostasis disturbance , the secretion of proinflammatory cytokines by immune cells stimulates the hypothalamus to synthesize corticotropin - releasing hormone ( crh ) , which in turn acts on the anterior pituitary promoting the production and release of adrenocorticotropin hormone ( acth ) . the subsequent activation of the adrenal glands by acth limits inflammatory responses by systemic release of endogenous glucocorticoids ( gcs ) [ 810 ] . gcs are steroid hormones with potent anti - inflammatory activity , produced mainly by the adrenal glands after activation of the hypothalamic - pituitary - adrenal ( hpa ) axis , in response to various stimuli such as emotional , physical , and/or immune stress . in this context , the removal of the adrenal glands or the systemic pharmacological inhibition of gcs synthesis can result in shock and death after induction of a strong immune response . moreover , hyporesponsiveness of the hpa axis to stress has been related to the development and perpetuation of inflammation [ 13 , 14 ] . furthermore , besides the variable efficacy of exogenous gcs in the treatment of ibd , the effect of adrenal - derived gcs in the modulation of immune effector responses during gut inflammation is still unknown , as well as the relationship between these steroid hormones with regulatory or tolerogenic profiles in the disease , especially in the intestine . thus , since the mechanisms by which the adrenal glands modulate inflammatory responses have not been fully elucidated yet , in this study we evaluated the role of these glands and endogenous gc in the regulation of the exacerbated inflammation during experimental colitis . all studies were performed in accordance with the guide for the care and use of laboratory animals ( 2011 ( 8th ed . ) , washington , dc : national research council , national academies press ) and approved by the institutional animal care and use committee of the university of so paulo ( brazil ) , under protocol 11.1.522.53.0 . male c57bl/6 mice , aged 68 weeks , weight 2025 g , were maintained under controlled temperature ( 25c ) , in specific pathogen - free and standard controlled environmental conditions with a 12 h light / dark cycle , with food and water ad libitum in the animal housing facility of the school of pharmaceutical sciences of ribeiro preto , university of so paulo . the experiments were performed with 5 mice / group , and groups were arranged as follows : control : healthy mice without colitis ; dss , animals exposed to water containing dextran sulfate sodium ( dss ) to colitis induction ; adx , adrenalectomized mice , without induction of colitis ; adx + dss , adrenalectomized mice , exposed to dss ; adx + dss + gc , adrenalectomized mice , exposed to dss and treated with 1 mg of dexamethasone / kg / day , from the 3rd to 5th day of dss exposure and sham , sham operated mice . as the main results of the groups control , adx and sham did not differ significantly from each other in the main assays ; we used data of control mice for comparisons in all figures . bilateral adrenalectomy was performed via a dorsolateral surgery after anesthesia with ketamine ( 100 mg / kg ) and xylazine ( 10 mg / kg ) ( agener unio sade animal , sp , brazil ) . the incisions were closed with absorbable suture thread ( chrome catgut absorbable , 5 - 0 , bioline fios cirrgicos ltda . , after surgery , in order to compensate loss of mineralocorticoid hormones because of adrenal glands removal , mice received daily saline solution 0.9% by gavage until the time of euthanasia . on the first 48 hours after surgery animals were also given the nonsteroidal anti - inflammatory drug meglumine flunixin ( banamine , schering - plough animal health , nj , usa ) at 1 mg / kg 12/12 hours , subcutaneously . colitis was induced by 3% dextran sodium sulfate ( dss - mp biomedicals , illkirch , france . molecular weight : 36,00050,000 kda ) added to the drinking water during 6 days for sample collection . mice were evaluated daily for body weight change and clinical signs of disease to summarize a clinical disease score , as previously described . the macroscopic analysis of the colon at the day of euthanasia was performed to quantify the postmortem score , as described by sales - campos et al . , 2015 . dexamethasone ( azium soluo , coopers sade animal , rj , brazil ) was dissolved in saline and administered by intraperitoneal ( i.p . ) route at a dose of 1 mg / kg / day , according to previous dose - response experiments performed by our group . the treatment with gc was held from the 3rd to the 5th day of dss exposure and euthanasia was performed on the 6th day of colitis . to note , gc treatment began when at least one mouse / cage displayed clinical signs of disease , which means day 3 after dss exposure . the large intestine samples were fixed in pbs/10% formaldehyde followed by standard histology procedures and paraffin embedding . microtomy was performed to obtain 5 micrometers ' ( m ) thick sections that were later stained by hematoxylin and eosin ( h&e ) for microscopic analysis of tissue inflammation . the criteria for the diagnosis of inflammatory bowel disease were adapted from guidelines of the british society of gastroenterology . the presence of the cytokines il-6 and ifn- was assessed by elisa according to the manufacturer 's instructions ( bd biosciences , san jose , ca , usa ) on sera or gut homogenates containing protease inhibitors ( complete , roche , pharmaceuticals , mannheim , germany ) . fasl dosage in homogenates of colon samples was performed according to the manufacturer 's instructions ( r&d systems , inc . , quantikine , elisa mouse fas ligand / tnfsf6 immunoassay , usa and canada ) . in specific experiments , colon fragments were removed and cultured for quantification of tissue corticosterone as described by noti et al . [ 18 , 19 ] . the culture supernatant was assayed by competition elisa according to the manufacturer 's instructions ( corticosterone eia kit , cayman chemical company , ann arbor , mi , usa ) . results were expressed as nanograms of corticosterone per gram of tissue and were shown as the difference of samples cultured without metyrapone and samples cultured with metyrapone to correct for putative contamination with serum gc . similarly , the plasma concentration of corticosterone was determined by the competitive elisa in blood samples collected in edta tubes . the results were expressed as picograms of corticosterone per milliliter ( pg / ml ) . spleen and mlns were removed and macerated through a 70 m cell strainer ( bd biosciences , heidelberg , germany ) . red blood cells were lysed using ack ( ammonium - chloride - potassium ) buffer . all cell suspensions were tested for viability by trypan blue dye at 0.2% in a neubauer chamber before being used in the culture and/or immunophenotyping experiments . for phenotypic characterization of the population of leukocytes from spleen , mln , lp , or iel , monoclonal antibodies ( bd pharmingen , san diego , usa ) conjugated to fluorochromes were used , according to the manufacturer 's instructions . cells were acquired on diva flow cytometer ( bd biosciences , san jose , ca ) and data obtained was analyzed using flowjo version 7.6.3 software ( treestar , san carlos , ca ) . serum lps was quantified with a commercially available limulus amebocyte lysate assay ( qcl-1000 , lonza , walkersville , md ) , according to the manufacturer 's protocol . the results were expressed as eu / ml ( endotoxin units / milliliter ) . in all variables when the distribution was normal and there was homogeneous variance we used the parametric tests anova with tukey 's multiple comparison . in case of non - gaussian distribution we used the nonparametric tests kruskal - wallis , followed by dunn 's multiple comparison test . all analyses were performed using the graphpad prism 5.0 software ( san diego , ca ) . first , to verify if the adrenals or their products could influence colitis clinical outcome , we evaluated mice after dss exposure in the presence or absence of the glands . the results showed that the clinical signs that peaked on day 6 in nonadrenalectomized mice ( data not shown ) were accompanied by increased plasma corticosterone levels ( figure 1(a ) ) , which probably resulted from adrenal glands activation during the development of intestinal inflammation . however , as expected , there was a reduction in circulating corticosterone after adrenalectomy ( figure 1(a ) ) , simultaneously to an increased overall disease score ( figure 1(b ) ) with no significant augmented postmortem score ( figure 1(c ) ) . in addition , since intestinal disruption with dss leads to bacteria translocation and systemic inflammation , we detected elevated il-6 cytokine in serum ( figure 1(d ) ) , together with a significant reduced endotoxemia in adrenalectomized mice exposed to dss on day 6 ( figure 1(e ) ) , suggesting an opposite role between systemic inflammatory responses and reduced lps levels during colitis induction , in the absence of adrenal glands . once adrenal - derived hormones , including glucocorticoids , are associated with suppression of immune responses , we next evaluated if the systemic inflammation was accompanied by alterations in the pool of regulatory t cells ( tregs ) in colitis adrenalectomized mice . indeed , most of the regulatory markers such as pd-1 ( figure 2(b ) ) , cd73 ( figure 2(c ) ) , and fr4 ( figure 2(d ) ) were reduced in both cd4cd25 and cd4cd25 populations of these mice , in the spleen and mesenteric lymph nodes ( mln ) , except for cd4cd25cd73 in the mln . the cd4cd25foxp3 cells , which characterize the main natural treg population , were also reduced by adrenalectomy ( figure 2(e ) ) , along with an increase in the cd4 lymphocytes expressing foxp3 in the absence of cd25 . most interestingly , there was a clear reduction in the mean fluorescence intensity ( mfi ) of foxp3 in the spleen ( figure 2(f ) ) , indicating that the systemic inflammation in the absence of adrenals could be the result of a lack of natural suppressive mechanisms in the host . it is of note that these mice also had reduced frequency of cd3cd49b lymphocytes ( supposedly nkt cells ) in the spleen ( and not in the mln ) , corroborating the findings of compromised systemic regulation following adrenalectomy ( data not shown ) . since the lack of adrenals clearly affected the pool of regulatory cells in the mln but especially in the central compartment , the spleen , we aimed to investigate if the adrenal - derived mediators could differentially modulate the systemic and the local responses in the intestine during colitis induction . histological analysis demonstrated that , in spite of the presence of adrenals , colitis mice had erosion areas of varying sizes in the colon , with injured surface epithelium and crypts , along with a loss of mucin and the presence of cuboid epithelial cells in the lesion borders . a predominance of mononuclear cells was found in the lamina propria of both colitis and colitis adrenalectomized groups . in the presence of adrenal glands mice showed mixed infiltrates of moderate - severe intensity in the submucosa and , surprisingly , the cellular infiltrate was of mild to moderate intensity in the absence of adrenals ( figure 3(a ) ) , despite the systemic inflammation . therefore , we characterized some innate immune cells that could be associated with the constrained immune response in the gut after adrenalectomy ( supplementary figure 1s in supplementary material available online at http://dx.doi.org/10.1155/2016/4936370 ) . the diminished infiltrate in the absence of adrenals was related to a reduction in the frequency of cd11b leukocytes ( figure 3(b ) ) and cd11bcd11ccd103 proinflammatory population of dendritic cells ( figure 3(c ) ) [ 22 , 23 ] . most interestingly , there was augmented frequency of the putative tolerogenic cd11bcd11ccd103 dendritic cells in the gut of adrenalectomized mice exposed to dss ( figure 3(d ) ) , indicating a potential role for these antigen presenting cells in the constrained local response . on the other hand , there was no difference in the detection of myeloperoxidase and eosinophil peroxidase enzymes , which account for the activity of neutrophils and eosinophils , respectively , in these tissues ( figures 3(e ) and 3(f ) ) . next , to further investigate if the adrenal - derived mediators also affected the accumulation of lymphocytes in the intestine , we quantified these populations in both lamina propria ( lp ) and intraepithelial lymphocytes ( iel ) compartments of the colon ( supplementary figure 2s ) . in fact , in accordance with histopathological data , there was a remarkable decrease in total leukocyte counts in the colon lp in the absence of adrenal glands ( figure 4(a ) ) . nevertheless , this reduced tissue infiltrate was composed by augmented frequency of t helper ( cd3cd4 ) , t cytolytic ( cd3cd8 ) , and nkt cells ( cd3cd49b ) after exposure to the colitis trigger , dss ( figure 4(a ) ) . in addition , the immunophenotypic analysis of iel showed that absence of adrenals could be associated with a reduction in nk cells when compared to dss nonadrenalectomized group , in contrast to augmented frequency of cd8 t cells in this gut compartment ( figure 4(b ) ) . altogether , these results suggested a role for adrenal glands and adrenal - derived hormones in the modulation of different cell populations that could influence inflammation control in the gut mucosa . adrenals are responsible for the production of a series of hormones and neuroendocrine mediators , in special glucocorticoids ( gc ) , which can modify the ongoing immune responses . then , since removal of adrenal glands differentially impacted the mucosal immunity in the gut , we investigated the role of gc in this scenario , by treating adrenalectomized mice with corticoids . the frequency of mice with erosion areas after dss exposure in the absence of adrenals was initially reduced but augmented after treatment with gc ( figure 5(a ) ) . most interestingly , the overall histological score that was diminished in adrenalectomized mice was restored to the same degree of that observed in dss group , after gc replacement ( figure 5(b ) ) , indicating that the main gut tissue alterations after adrenalectomy were dependent on the adrenal - derived gc . in fact , there was no compensatory local production of gc after adrenal removal ( figure 5(c ) ) . in addition , there was augmented local ifn- production ( figure 5(d ) ) , along with elevated proapoptotic fasl molecule on tissue homogenates , which were also dependent on adrenal gc ( figure 5(e ) ) . these data suggested that the constrained gut inflammatory infiltrate after adrenalectomy could be a consequence of cytokine ( ifn- ) induced cell death mechanisms , such as fasl , aimed at reestablishing the gut homeostasis after barrier disruption and colitis induction . taking together , these results pointed to gc as one of the key adrenal - derived hormones able to modulate intestinal inflammation . the results presented here showed that adrenal glands play divergent roles in the modulation of immune responses after triggering of intestinal inflammation . the main influence of these glands in experimental colitis seemed to be related to the activity of gc . this hypothesis was reinforced by the fact that mice treated with gc , in the absence of adrenal glands , had the local hallmarks triggered by colitis restored to the levels observed in adrenal - intact group . in our study , gut inflammation led to the activation of adrenal glands , with a consequent increase in plasma levels of corticosterone , possibly in an attempt to constrain the exacerbated systemic inflammatory response . the adrenalectomized mice with colitis had increased il-6 levels in contrast to lower lps in serum . il-6 is a proinflammatory cytokine produced by macrophages , t lymphocytes , and fibroblasts in response to bacterial infection . this molecule is also one of the main inflammatory mediators able to stimulate adrenal glands for gc production and subsequent inhibition of an ongoing immune response . most importantly , il-6 may induce gc production by the hypothalamic - pituitary - adrenal axis or directly stimulate the adrenocortical cells with a later dampening of the inflammation . so we suggested that disease worsening observed in adrenalectomized mice exposed to dss could be related to higher levels of circulating il-6 together with the absence of a counter regulation mediated by endogenous gc . in fact , it is of note that the clinical score depicted in our study comprised the sum of local and systemic signs that together contributed to the overall evaluation of mice . therefore , while some parameters are specific to gut inflammation , such as wet anus , diarrhea , and bleeding stools , others may point to additional systemic dysfunctions , indicating further disease complication in mice without the adrenal glands . the resulting immune reaction in pathophysiological conditions usually depends on the balance between effector cells producing inflammation and its modulation by regulatory mechanisms . therefore , the failure observed in the control of systemic inflammation and disease worsening could be attributed to the reduced frequency of tregs during exposure of adrenalectomized mice to dss or to deficiencies in other regulatory mechanisms dependent on the adrenal glands . in this context , there was an overall decrease in the expression of several markers related to tregs , which are known to have a significant ability to modulate the pathogenesis of many immune - mediated diseases . the suppressive mechanisms of these cells may involve surface molecules such as ctla-4 and pd-1 , which are receptors that act synergistically and negatively regulate t cell activation . cd73 is expressed on the surface of t lymphocytes and converts extracellular 5-amp to adenosine . thus , the adenosine inhibits the proliferation of effector cells and secretion of th1 and th2 cytokines . natural regulatory t cells or those induced by tgf- express high levels of fr4 and the blockade of this receptor promotes the depletion of the regulatory cells [ 29 , 30 ] . on the other hand , pd-1 is a cell surface receptor that triggers cd28 superfamily inhibitory pathways in order to attenuate the responses and promote t cell tolerance . dexamethasone increases pd1 expression in a dose - dependent manner and this effect may be completely inhibited by glucocorticoid receptor antagonist , indicating that the effect of gc on pd1 expression is mediated by the glucocorticoid receptor . likewise , foxp3 is the master transcription factor of tregs and its low expression or the absence of a functional molecule may lead to reduced suppression of exacerbated inflammatory responses , such as in ibd [ 33 , 34 ] . hence , the reduced frequency of regulatory cells in our study may be associated with the disease worsening in the absence of endogenous gc , since this hormone drives tregs differentiation in vivo and in vitro [ 35 , 36 ] . interestingly , despite the overall anti - inflammatory potential of gc , adrenalectomized mice had reduced intestinal lesions , which could be due to the development of local regulatory mechanisms in an attempt to counteract the inflammation induced by dss . this was evidenced by the increase of cd11ccd11bcd103 dendritic cells ( dc ) , which have a potentially tolerogenic profile , in contrast to a significant decrease of cd11ccd11bcd103 proinflammatory dc . similarly , c57bl/6 mice deficient for crh ( crh ko - knockout ) exposed to tnbs had significant reduction of the intestinal inflammatory responses , lower levels of glucocorticoids , and increased il-6 in the blood . we also hypothesized that the local production of gc could be involved in the regulation of gut inflammation in mice with disrupted adrenal function . however , the extra adrenal production of this hormone was only detected in cultures of gut fragments obtained from mice with adrenal glands . therefore , although the intestinal steroid genesis and gc synthesis may be induced by lps in a tnf--dependent manner and suppress intestinal inflammation , this phenomena did not seem to occur in our adrenalectomized mice , which presented low serum lps on the time point evaluated . on the contrary , the local gc increase was dependent on adrenal - derived mediators , as observed in dss group . the severity of bowel inflammation is usually associated with elevated production of proinflammatory cytokines . here , the absence of adrenals led to levels of ifn- still higher than those observed in mice with colitis and intact adrenal glands , despite a diminished inflammatory infiltrate in the colon . in addition , the elevated levels of ifn- returned to normality after gc treatment , indicating that the regulation of the production of this inflammatory molecule in the gut is dependent on gc derived from adrenal glands . in accordance , mice that underwent tnbs - induced colitis followed by adrenalectomy had a marked increase in ifn- and il-10 levels in serum . though similarities were observed between ours and shibolet et al 's study , this is the first time , to the best of our knowledge , that the impact of adrenal glands removal in colitis outcome was associated with the differential local modulation of the gut infiltrate , resulting in fewer intestinal lesions . furthermore , our work also pointed to a relationship between adrenalectomy and the absence of systemic regulatory markers , which may elucidate the mechanisms that dictates the disease outcome . accordingly , animals subjected to sepsis in the absence of the adrenals had much higher mortality and elevated concentrations of the other inflammatory cytokine il-17 . it is largely known that the excessive production of both cytokines , il-17 and ifn- by th1 and th17 cells , respectively , is involved in the pathogenesis of ibd [ 41 , 42 ] . therefore , besides their inflammatory potential , we suggested that the th1 or cd3cd8 cells in the inflamed mucosa of adx + dss mice may act as one of the main players protecting them against pathogens translocation to the mucosa after barrier disruption . ifn- is the major physiological activator of macrophages , which , when activated , produce cytokines such as il-1 , tnf , and il-6 that contribute to inflammation . ifn- is also capable of inducing the expression of mhc - ii molecule in intestinal epithelial cells ( iec ) , allowing the presentation of microbial antigens to immune competent cells . this increase in mhc - ii expression in response to ifn- may be markedly inhibited by dexamethasone . in addition , in our study , the decreased cellularity in the intestinal mucosa of adrenalectomized mice exposed to dss was associated with fasl - mediated apoptosis in parallel to the increase of ifn- , in a gc - dependent manner . the binding of fasl to its receptor ( fasr or cd95 ) induces apoptosis in sensitive cells . apoptosis induced by fas plays a fundamental role in the maintenance of immunological tolerance and is involved in cytotoxic activity of t cells and nk cells . likewise , after the elimination of invading pathogens , apoptosis controls innate and adaptive immune responses in order to reestablish immune homeostasis , thus preventing host tissue damage caused by excessive inflammation [ 48 , 49 ] . then , we suggested that ifn- may have been produced to control local microbiota translocation and , together with infection control , may have induced fasl with a consequent reduction of gut cellularity by apoptosis mechanisms . indeed , ifn- plays an important role in apoptosis induction or reduction of cd4 t cells during infectious diseases [ 50 , 51 ] , in response to tumors and in the experimental autoimmune encephalomyelitis . on the other hand , gcs present an outstanding anti - inflammatory potential and the control of immune responses in mice submitted to adrenalectomy and treated with exogenous gc may have facilitated bacteria translocation from the gut , once the inflammation is essential to control the local microbiota . it is possible that , in adrenalectomized mice ( adx + dss group ) , which are devoid of systemic regulation by gc , the immune response in the gut was strong and fast enough to control bacteria translocation from the lumen , thus avoiding a continuing or chronic inflammation . although future studies are still necessary to prove this hypothesis , we believe that these mice might have developed local mechanisms ( such as fasl production ) , raised in an attempt to constrain the triggered immune response and finalize the local reaction , which probably peaked previously in the absence of adrenals ( data not investigated in this paper ) . furthermore , it is essential to emphasize that the responses in the gut mucosa must be always fine - tuned to avoid excessive inflammation while still being able to control invading pathogens . then , any disturbance in this homeostasis may facilitate the development of inflammatory bowel diseases . historically , it is known that the mortality rate of patients with adrenal insufficiency was considerably high before the use of gc . the deficiency in gc production is clinically associated with impaired resistance to stress , lymphoid tissue hypertrophy , weight loss , and hypoglycemia [ 5557 ] . then , in addition to suppressing the inflammatory response , the gc is also responsible for increased blood glucose concentration and various effects on the metabolism of carbohydrates , proteins , and lipids [ 5860 ] . based on this , we can not exclude the involvement of metabolic alterations in disease worsening in the absence of adrenals nor the role of other mediators than gc commonly produced by these glands . in summary , our results showed that the adrenal glands play divergent roles in the control of local and systemic inflammation during breakdown of mucosal tolerance . the lack of a counter regulatory hormone together with reduced frequency of tregs probably led to impaired control of systemic inflammatory reaction . on the other hand , in the absence of endogenous gc , the intestine developed specific modulatory mechanisms able to control the local cytokine production and leukocyte accumulation , which culminated in more constrained tissue damage . nevertheless , although this local response is enough to control gut commitment in colitis , it is not sufficient to prevent host susceptibility to systemic inflammation raised in the absence of adrenal glands . finally , this study brings new features for a better understanding of the relationship between the immune and endocrine systems , providing basis for development of future therapies for patients with crohn 's disease or ulcerative colitis .

kidney enlargement resulting from the expansion of cysts in patients with adpkd is continuous and quantifiable and is associated with a reduction in renal function . a baseline total kidney volume above 1500 ml is associated with an increase in total kidney volume of 6.76 3.78% per year and a decrease in the glomerular filtration rate of 5.04 5.86 ml / min / year . higher rates of kidney enlargement are associated with a more rapid decrease in renal function . adpkd may become symptomatic with acute complications such as cyst haemorrhage , rupture and infection . adpkd subjects with more episodes of gross haematuria have a larger renal size and higher serum creatinine levels than those with fewer episodes . currently , apart from invasive interventions such as embolization or removal of the entire kidney , no medical treatment for adpkd patients with severe bleeding from the polycystic kidney is available . however , the observation that renal size correlates with the risk of cyst haemorrhage suggests that pharmacotherapy that reduces renal size may reduce the risk of bleeding . rapamycin , an inhibitor of the mammalian target of rapamycin ( mtor ) , has proven highly effective in reducing renal cystogenesis and loss of renal function in animal models of polycystic kidney disease ( pkd ) [ 35 ] . in addition , using rapamycin to treat transplant recipients suffering from adpkd has resulted in a significant reduction in native polycystic kidney size . however , the effect of low - dose rapamycin in kidney volume and renal function of nontransplanted adpkd patients with chronic renal failure has not been established . a 42-year - old man with adpkd presented in october 2004 with persistent severe macroscopic haematuria . computerized tomography ( ct ) of the abdomen showed bleeding from the right kidney . he underwent nephrectomy of the right polycystic kidney ( weight 700 g ) and his postoperative serum creatinine level remained stable at 2.6 mg / dl . in june 2006 , the patient presented with persistent macroscopic haematuria from his left kidney . magnetic resonance imaging ( mri ) of the abdomen showed a left kidney ( size , 17 11.5 10 cm ) with multiple cysts of different sizes scattered throughout the parenchyma . . the haematuria could not be controlled by intensive conservative treatment , and an emergency nephrectomy was proposed when the bleeding became life threatening . we tried treatment with four doses of recombinant factor vii ( novoseven , novo nordisk , spain ) , although this was unsuccessful . since local and systemic hyperfibrinolysis play a role in bleeding in adpkd patients , we administered intravenous txa ( amchafibrin , rottapharm , spain ) at a dose of 1 g/8 h. the massive bleeding promptly stopped , and haematuria gradually ceased . the haemoglobin level and renal function subsequently stabilized with serum creatinine at about 4.8 mg / dl and creatinine clearance of 13 ml / min . because animal and human trials of pkd have shown an effect of rapamycin on renal cysts , our patient was administered rapamycin ( 1 to 2 mg / day ) orally for 8 months . informed consent for off - label therapy ( compassionate use ) with rapamycin during this period was obtained . renal function , haemoglobin level , blood rapamycin levels and total kidney volume measured by mri were monitored throughout the treatment phase . the initial renal volume was 1026 ml and the final renal volume 785 ml , that is , a volume change of 241 ml ( 23.5% ) within 6 months ( figure 1a and b ) . during this time , renal function and haemoglobin level improved and remained stable ( table 1 ) . according to the study protocol , in february the restoration of rapamycin was refused by the patient . in january 2008 , 4 months after hd was started , the patient presented with persistent severe haematuria . by january 2008 , the kidney volume had increased to 1409 ml ( volume change + 624 ml , + 44% ) showing multiple cysts with evidence of bleeding . in february 2008 , the haematuria became life threatening and the kidney was removed ( weight 1309 g ) ( figure 1c ) . coronal mri of a patient with adpkd , before ( a ) and after ( b ) 6-months treatment with low - dose rapamycin . currently , there is no effective treatment available to retard cyst growth and to prevent progression to end - stage renal failure in patients with adpkd . evidence has recently been obtained from animal experiments that activation of the mtor signaling pathway plays a crucial role in cyst growth and increase in renal volume , and that the inhibition of mtor with rapamycin markedly slows cyst development and deterioration of renal function [ 35 ] . on the other hand , several clinical trials are now testing a host of therapeutic interventions in patients with adpkd . their results may improve our therapeutic approach to this disease and allow us to confirm its effect on cyst growth and on renal function . although a reduction in end - stage kidney volume of 24.8 9.7% has previously been reported in adpkd renal transplant recipients receiving rapamycin as an immunosuppressive agent , to our knowledge , this is the first case of a reduction in kidney volume associated with preservation of renal function in a nontransplanted adpkd patient with chronic renal failure receiving rapamycin . in addition , removal of a solitary kidney was prevented and initiation of hd was delayed for 16 months . the therapeutic options to control severe bleeding from the polycystic kidney are limited . we show that it is reasonable to try antifibrinolytic treatment with txa in such devastating uncontrolled bleeding . moreover , low - dose rapamycin reduced the total kidney volume and delayed the loss of renal function in our patient . the fact that there were no further episodes of bleeding during treatment reinforces the concept that rapamycin affects cyst growth and its consequences . thus , the absence of further episodes of cystic bleeding could partly account for the observed efficacy of rapamycin in a kidney volume reduction . an antiproliferative and antiangiogenic role has been suggested , although its ability to reduce the risk of haemorrhagic complications from renal cysts has not been established . these findings are preliminary and do not in themselves prove the efficacy of mtor inhibition for the treatment of adpkd - associated cystic bleeding . however , the increase in kidney volume when treatment was discontinued , followed by recurrence of cystic bleeding when hd was initiated , provides compelling circumstantial evidence . in conclusion , severe persistent bleeding from a solitary kidney in a patient with adpkd was successfully treated with txa . moreover , treatment with a low dose of rapamycin for 8 months resulted in a decrease in kidney volume and preservation of renal function in this nontransplanted adpkd patient with chronic renal failure . these results , although encouraging , require confirmation and further elucidation by subsequent prospective trials .

that the hippocampus plays a critical role in memory has been clear since the documenting of severe amnesia following temporal lobe resection in patient h.m . , an extraordinary amount of research has been directed at characterizing the functional role the hippocampus plays in memory , leading various authors to emphasize , among other things , spatial memory or cognitive mapping ( o'keefe and nadel , 1978 ) , declarative memory ( cohen , 1984 ; cohen and eichenbaum , 1993 ; squire et al . , 2004 ) , explicit memory ( graf and schacter , 1985 ) , recollection ( aggleton and brown , 2006 ; ranganath et al . , 2004 ) , and relational memory ( cohen and eichenbaum , 1993 ; eichenbaum and cohen , 2001 ) . our own work has focused on the profound deficits observed on tests of relational memory in amnesia consequent to hippocampal damage ( cohen and eichenbaum , 1993 ; eichenbaum and cohen , 2001 ; hannula et al . , 2006 , 2007 ; , 2008 ; ryan and cohen , 2003 ; ryan et al . , 2000 ) . we tested the idea that the hippocampus is critical in memory for all manner of relations among the perceptually distinct elements of experience , providing evidence for this claim in the finding that hippocampal amnesia was associated with deficits in memory for spatial , sequence ( temporal ) , and associative ( co - occurrence ) relations among items . this finding is noteworthy because prior studies of hippocampal - dependent memory have tended either to examine memory for only a single type of relation or conflated multiple kinds of relations . only by employing a procedure in which each of several kinds of relational memory could be tested separately , using the same materials , were we able to examine fairly whether the hippocampal role extended to all types of relations or whether instead some types are special . in contrast to a view emphasizing all manner of relations , some limited - domain accounts ( see cohen and eichenbaum , 1993 ) have focused exclusively or primarily on one or another particular type of relations . perhaps the best example is the spatial memory or cognitive mapping theory of hippocampus ( o'keefe and nadel , 1978 ) , based initially on the discovery in the hippocampus of what were called place cells ( cells that fire preferentially when the animal is in one or another particular location ) ( o'keefe and dostrovsky , 1971 ) . many studies have gone on to report spatial correlates of hippocampal activity or hippocampal dependence of spatial memory performance , based on allocentric spatial relations , not only in animals but also in humans ( see bird and burgess , 2008 ; table 1 ) . but both the animal and human literatures are now filled with numerous findings from other studies documenting hippocampal involvement in relational tasks with no critical spatial component ( see cohen et al . , 1999 ; eichenbaum and cohen , 2001 ; table 1 ) , making it difficult to reconcile a solely spatial account of hippocampal function . this also applies to other limited - domain accounts ; any evidence that supports a given limited account ( e.g. spatial maps ) contradicts a different limited account ( e.g. associative memory ) while evidence for the latter similarly contradicts the former . a selection of neuroimaging and mtl lesion studies that tested memory for associations , spatial locations , sequences , or some combination thereof . for neuroimaging studies , the result column lists the active mtl regions for the listed contrast ( or reduction in activity as noted ) . sm , subsequent memory ; sc , source correct ; si , source incorrect ; ret , retrieval time ; enc , encoding time ; h , hippocampus ; ph , parahippocampus ; pr , perirhinal cortex ; c , correct ; i , incorrect ; wm , working memory . more modern variants have shifted the debate to whether one particular type of relation is special or critical in hippocampal function . for the spatial mapping hypothesis , for example , bird and burgess ( 2008 ) have suggested that spatial maps represented in the hippocampus allow for the construction / reconstruction of mental images which , the authors believe , mediate episodic recollection . it is extraordinarily difficult to assess whether spatial or some other type of representation is somehow more fundamental , providing the basis for gaining access to the full range of relational information for which the hippocampus is involved . but it is entirely feasible to assess whether there are any functional implications of the specialness hypothesis , i.e. , any differences manifested in the relationship of hippocampus to performance . that is , moving beyond the question of whether the hippocampus is engaged by and critical for all manner of relations , we can ask whether memory for one or another type of relations is disproportionately dependent on the hippocampus , and whether memory for various relations is statistically dependent on any particular type of relational memory . critical tests and advancement of theories in this area require assessing multiple kinds of relations , or multiple sources of information about the to - be - remembered items ( or source memory ) , in order to determine whether there are meaningful distinctions to be drawn among them . the most powerful way to test this is through comparison of multiple types of relations within a single paradigm for the same participants . but this criterion has rarely been met . a small number of studies ( see table 1 ) have tested multiple types of relational memory in either the same paradigm or the same subjects . some fmri studies have expressly attempted to compare spatial memory to other types of relations . while some ( e.g. kumaran and maguire , 2005 ; ryan et al . , 2009 ) have found more hippocampal activity in the spatial than other putatively relational conditions , others ( e.g. kohler et al . , 2005 ; uncapher et al . , 2006 ) have not . but , critically , of all the studies attempting direct comparisons , only those by staresina and davachi ( 2008 ) , uncapher et al . ( 2008 ) compared more than one type of relational memory or association to memory for the items themselves within the same paradigm and subjects . staresina and davachi ( 2008 ) showed participants nouns on a colored background and asked them to make a mental image of the object in that color and make one of two different judgments about the image while fmri activity was recorded . at test , participants made an old / new item judgment followed by forced - choice decisions about the color in which the item was presented and the type of judgment they made at the time they generated an image . findings showed that the hippocampus exhibited little activity when only the item was remembered , more activity when in addition the color or task judgment was remembered , and the most activity when both color and task judgments were remembered for the item . by contrast , the perirhinal cortex , thought to be involved in memory for items and for intra - item binding ( binding within items ) , showed activity both for trials when the item alone was later correctly remembered and when the item and color were later correctly remembered . also using a subsequent memory analysis with yes / no item recognition and forced - choice source judgments , uncapher et al . ( 2006 ) had participants make a living / non - living judgment on words in one of four colors located in one of four quadrants on the screen . they found that the hippocampus was more active when both sources were later remembered than if only one were remembered , whereas the perirhinal cortex was equally active regardless of whether any source was remembered so long as the item was correctly remembered . ( 2008 ) tested the necessity of the hippocampus for a variety of relations by showing patients with hippocampal amnesia triplets of computer - generated patterns presented sequentially in one of three screen locations . after each study block , participants were tested either on the spatial locations of a triplet , the temporal sequence of a triplet , or the co - occurrence of items in a triplet ( associative memory ) , each tested in a manner independent of the other forms of relational information , and were tested for memory of the items themselves . we found that patients with damage limited primarily to the hippocampus showed disproportionately impaired memory for each kind of relation , compared to that of comparison participants , despite relatively intact item memory . patients with more extensive damage , extending into mtl cortical regions , performed at floor levels on the item task as well . moreover , correlational analyses performed on the various relational memory performances of comparison participants showed statistical interdependencies , with no special dependency on any particular type of relation . thus , in none of these studies was there evidence for any particular type of relation being special . in contrast to a view emphasizing all manner of relations , some limited - domain accounts ( see cohen and eichenbaum , 1993 ) have focused exclusively or primarily on one or another particular type of relations . perhaps the best example is the spatial memory or cognitive mapping theory of hippocampus ( o'keefe and nadel , 1978 ) , based initially on the discovery in the hippocampus of what were called place cells ( cells that fire preferentially when the animal is in one or another particular location ) ( o'keefe and dostrovsky , 1971 ) . many studies have gone on to report spatial correlates of hippocampal activity or hippocampal dependence of spatial memory performance , based on allocentric spatial relations , not only in animals but also in humans ( see bird and burgess , 2008 ; table 1 ) . but both the animal and human literatures are now filled with numerous findings from other studies documenting hippocampal involvement in relational tasks with no critical spatial component ( see cohen et al . , 1999 ; eichenbaum and cohen , 2001 ; table 1 ) , making it difficult to reconcile a solely spatial account of hippocampal function . this also applies to other limited - domain accounts ; any evidence that supports a given limited account ( e.g. spatial maps ) contradicts a different limited account ( e.g. associative memory ) while evidence for the latter similarly contradicts the former . a selection of neuroimaging and mtl lesion studies that tested memory for associations , spatial locations , sequences , or some combination thereof . for neuroimaging studies , the result column lists the active mtl regions for the listed contrast ( or reduction in activity as noted ) . sm , subsequent memory ; sc , source correct ; si , source incorrect ; ret , retrieval time ; enc , encoding time ; h , hippocampus ; ph , parahippocampus ; pr , perirhinal cortex ; c , correct ; i , incorrect ; wm , working memory . more modern variants have shifted the debate to whether one particular type of relation is special or critical in hippocampal function . for the spatial mapping hypothesis , for example , bird and burgess ( 2008 ) have suggested that spatial maps represented in the hippocampus allow for the construction / reconstruction of mental images which , the authors believe , mediate episodic recollection . it is extraordinarily difficult to assess whether spatial or some other type of representation is somehow more fundamental , providing the basis for gaining access to the full range of relational information for which the hippocampus is involved . but it is entirely feasible to assess whether there are any functional implications of the specialness hypothesis , i.e. , any differences manifested in the relationship of hippocampus to performance . that is , moving beyond the question of whether the hippocampus is engaged by and critical for all manner of relations , we can ask whether memory for one or another type of relations is disproportionately dependent on the hippocampus , and whether memory for various relations is statistically dependent on any particular type of relational memory . critical tests and advancement of theories in this area require assessing multiple kinds of relations , or multiple sources of information about the to - be - remembered items ( or source memory ) , in order to determine whether there are meaningful distinctions to be drawn among them . the most powerful way to test this is through comparison of multiple types of relations within a single paradigm for the same participants . but this criterion has rarely been met . a small number of studies ( see table 1 ) have tested multiple types of relational memory in either the same paradigm or the same subjects . some fmri studies have expressly attempted to compare spatial memory to other types of relations . while some ( e.g. kumaran and maguire , 2005 ; ryan et al . , 2009 ) have found more hippocampal activity in the spatial than other putatively relational conditions , others ( e.g. kohler et al . , 2005 ; uncapher et al . , 2006 ) have not . but , critically , of all the studies attempting direct comparisons , only those by staresina and davachi ( 2008 ) , uncapher et al . ( 2008 ) compared more than one type of relational memory or association to memory for the items themselves within the same paradigm and subjects . staresina and davachi ( 2008 ) showed participants nouns on a colored background and asked them to make a mental image of the object in that color and make one of two different judgments about the image while fmri activity was recorded . at test , participants made an old / new item judgment followed by forced - choice decisions about the color in which the item was presented and the type of judgment they made at the time they generated an image . findings showed that the hippocampus exhibited little activity when only the item was remembered , more activity when in addition the color or task judgment was remembered , and the most activity when both color and task judgments were remembered for the item . by contrast , the perirhinal cortex , thought to be involved in memory for items and for intra - item binding ( binding within items ) , showed activity both for trials when the item alone was later correctly remembered and when the item and color were later correctly remembered . also using a subsequent memory analysis with yes / no item recognition and forced - choice source judgments , uncapher et al . ( 2006 ) had participants make a living / non - living judgment on words in one of four colors located in one of four quadrants on the screen . they found that the hippocampus was more active when both sources were later remembered than if only one were remembered , whereas the perirhinal cortex was equally active regardless of whether any source was remembered so long as the item was correctly remembered . ( 2008 ) tested the necessity of the hippocampus for a variety of relations by showing patients with hippocampal amnesia triplets of computer - generated patterns presented sequentially in one of three screen locations . after each study block , participants were tested either on the spatial locations of a triplet , the temporal sequence of a triplet , or the co - occurrence of items in a triplet ( associative memory ) , each tested in a manner independent of the other forms of relational information , and were tested for memory of the items themselves . we found that patients with damage limited primarily to the hippocampus showed disproportionately impaired memory for each kind of relation , compared to that of comparison participants , despite relatively intact item memory . patients with more extensive damage , extending into mtl cortical regions , performed at floor levels on the item task as well . moreover , correlational analyses performed on the various relational memory performances of comparison participants showed statistical interdependencies , with no special dependency on any particular type of relation . thus , in none of these studies was there evidence for any particular type of relation being special . some accounts of the hippocampus have emphasized the nature of the processing it supports in the act of remembering , such as recollection ( aggleton and brown , 2006 ; ranganath et al . , 2004 ; see reviews by diana et al . , 2007 ; eichenbaum et al . , 2007 ) ; this focus is particularly apparent in the neuroimaging literature , where the ability to image active processes in the brain may encourage such an approach . our own work has instead focused on the representations of experience that the hippocampus supports . our earliest proposals about declarative memory ( cohen , 1984 ; cohen and eichenbaum , 1993 ) emphasized the storage of the outcomes of processing , representing facts and events in highly linked , flexible networks . our subsequent proposals , describing relational memory theory , characterized declarative memory as being fundamentally relational , representing all the various arbitrary or accidentally occurring relations among the ( perceptually distinct ) constituent elements of experience , again in highly flexible networks ( cohen and eichenbaum , 1993 ; cohen et al . , 1997 ; eichenbaum and cohen , 2001 ; ryan and cohen , 2003 ) . the long - lived appeal of the spatial memory / cognitive mapping theory of hippocampus ( o'keefe and nadel , 1978 ) may be the clarity of its proposal about hippocampal representation it is an allocentric map of the environment , representing the relations among the various stimuli in the environment , with flexible navigable links among the elements in the map ( see bird and burgess , 2008 for an up - to - date version ) . in our view the hippocampus represents experience as nodes within a multi - dimensional representation space ( also see eichenbaum , 2004 ) , with each axis or dimension representing a different domain of information ( not just x , y space , or just space and time ) . various relations among items ( spatial , sequential / temporal , etc . ) are captured within the n - dimensional space . information from the various processing streams arrives via inputs from earlier cortical areas ( such as perirhinal and parahippocampal cortex ) , activating relevant nodes within the representational space ( shown as several distinct representation planes in figure 1 ) . inputs to the hippocampus also cause reactivation of related information via relational links with associated nodes . to the extent that the model is reflective of physiology , place cell activity can be understood as reflecting a subset of the more general , relational memory space where the critical dimensions are the axes of space . not only are the places to which hippocampal neurons preferentially fire represented relationally , but when tested under circumstances that emphasize things other than spatial navigation these neurons represent other types of relations . thus the nodes that were thought to reflect spatial memory under one testing condition can reflect various types and combinations of relational information , including expressly non - spatial relations , reflecting the different aspects of the n - dimensional space . this view was captured by eichenbaum and cohen ( 1988 ) in their suggestion that these hippocampal neurons should be called relational cells rather than the narrower construal of place cells . this framework offers an account of why patients with hippocampal amnesia still have access to the products of sensory processing , and exhibit memory for and priming of individual items , but are unable to place these products in the multi - dimensional space that allows the items to be relationally bound to one another and flexibly connected to previously existing memories . and , critically , it explains why their relational memory is impaired for all manner of relations without any special 2008 ) , items are encoded into a multi - dimensional representational space according to aspects such as time and location , thereby capturing all the various types of relations among items . ( b ) when relational or source memory is tested via recognition ( e.g. , where was this item studied ? ) , the item together with the source probe constrains or limits the space to be searched , aiding retrieval of the relevant information ( i.e. , activation of the relevant node ) . ( c ) activation of a given node in the space may also lead to reactivation of related nodes ( here , retrieving the next item and location in the sequence ) . many other important issues about memory and the mtl , not covered by this review , warrant further research . one important issue is the potential division of labor in memory within the mtl ( see aggleton and brown , 2006 ; davachi , 2006 ; diana et al . , 2007 ; eichenbaum et al . , 2007 ; mayes et al . , 2007 ; squire et al . , 2004 there is considerable empirical support for differential functions of the hippocampus versus surrounding mtl cortices , for relational memory versus item memory respectively , but their exact roles and their interactions remain underspecified . another important issue that complicates work in this area concerns the definition of items as opposed to for example , the same stimulus information could be seen as the item or as the context depending on instructions and allocation of attention ( see diana et al . , 2007 ) . moreover , two portions of the sensory array might be considered part of the same one object or as part of multiple separate objects . we ( cohen et al . , 1997 ; eichenbaum et al . , 1994 ) and others ( diana et al . , 2007 ; mayes et al . , 2007 ; moses and ryan , 2006 ) have noted that multiple sensory features can be fused , blended , configured , or unitized into a single item representation by structures outside of the hippocampus , such as the mtl cortices , obviating the need for hippocampal - dependent relational memory . however , it is difficult to know a priori when fused or unitized representations might be in play , although such representations are thought to be less flexible than relational representations ( cohen et al . , 1997 ; it will be critical to develop methods for acquiring independent evidence of such representations in action . finally , hippocampal representations themselves require further exploration : are the various dimensions in the hippocampal representation independent , or do they covary ? what determines the strengths of various links in the multi - dimensional space ? these and other questions will keep memory research focused on the hippocampus for years to come . the authors declare that the work was carried out in the absence of any financial relationships that could be construed as a conflict of interest .

endophthalmitis is an uncommon but sight - threatening intraocular inflammation that may be due to a noninfectious process or may be caused by an infectious organism . it is a term used to describe intraocular inflammation that involves the vitreous cavity and the anterior chamber of the eye and can involve other adjacent ocular tissues such as the choroid or retina , sclera or cornea . in infectious endophthalmitis , the organism might reach the eye from other infected sites in the body through hematologic seeding and in these cases it is labeled endogenous endophthalmitis . more commonly , the organism is exogenous and gains access to the intraocular environment . according to the endophthalmitis vitrectomy study , postoperative endophthalmitis is divided generally into two types : acute and chronic . acute postoperative endophthalmitis is defined as infections within 6 weeks of surgery ; on the other hand , chronic postoperative endophthalmitis is defined as infections after 6 weeks of surgery . the term chronic postoperative endophthalmitis ( cpe ) was first coined in 1986 in a case series of 15 patients by meisler et al . . it is often misdiagnosed as noninfectious iritis where it improves initially with topical corticosteroid therapy while flaring whenever corticosteroids are tapered or stopped . this is in contrast to acute postoperative endophthalmitis , which presents as a single episode of severe inflammation with an acute onset that usually follows surgery by a few days but can be delayed more than a week in some cases . as such , acute and chronic postoperative endophthalmitis are two clearly different clinical entities [ 2 , 4 , 5 ] . the reported incidence of postoperative endophthalmitis ranges from 0.01% to 0.367% , with incidence varying among different surgical procedures and across studies and different countries [ 1 , 611 ] . most of postoperative endophthalmitis studies were conducted on cases after cataract surgery , being the most commonly performed surgery in ophthalmology . in a large meta - analysis , 3 140 650 cataract extraction cases were reviewed for the incidence of endophthalmitis after cataract surgery worldwide in the period between 1964 and 2003 . the analysis showed an increase in the incidence of postsurgical endophthalmitis from 0.087% in the 1990s to 0.265% in the 2000s , and this was attributed to the change in surgical technique towards clear corneal sutureless wounds that allow exogenous organisms easy access to the intraocular space . furthermore , postoperative endophthalmitis has been reported after pars plana vitrectomy , penetrating keratoplasty , trabeculectomy , and glaucoma drainage device surgeries . endophthalmitis also has been reported following external ocular surgeries such as scleral buckle , pterygium excision , and strabismus surgeries . the highest endophthalmitis rate was found in surgical procedures associated with cataract extraction reaching 0.367% ; on the other hand , pars plana vitrectomy was found to have the lowest incidence rate with only 0.04% especially after using microincision technique [ 11 , 13 ] . some reports estimated the ratio of acute to chronic postoperative endophthalmitis to be between 5 : 1 and 2 : 1 , indicating that the incidence rate of chronic postoperative endophthalmitis can be 5 per 10000 . in one single - center study , the reported rate of chronic onset endophthalmitis following cataract surgery was 0.017% . the organisms causing chronic postoperative endophthalmitis tend to be different from the acute form pathogens . cpe was originally considered to be a reaction to the remaining native lens tissue and was consequently called toxic lens syndrome or phacoanaphylactic endophthalmitis . however , studies of removed lens capsules revealed small gram - positive rods , consistent with propionibacterium acnes , adherent to the capsular remnants . a variety of organisms have been implicated in chronic postoperative endophthalmitis ( table 1 ) , with propionibacterium species accounting for the majority of cases ( 41 to 63% ) followed by coagulase - negative staphylococcus and fungus [ 5 , 16 , 18 ] . propionibacterium acnes , formerly known as corynebacterium parvum , is a variably staining , gram - positive , pleomorphic , and anaerobic bacillus . as its name suggests , p. acnes is associated with chronic skin infections and with the contamination of a variety of prosthetic devices [ 19 , 20 ] . despite being a potent stimulant of the immune system , p. acnes is largely resistant to the killing mechanisms of monocytes and neutrophils , which enables it to persist intra - cellularly after phagocytosis . reviewing the largest three case series of cpe revealed that 48% of the cases are caused by p. acnes , followed by fungal organisms in 21% of the cases and gram - positive species in 16% of the cases ( table 2 ) . some case reports have also isolated actinomyces , nocardia , achromobacter , cephalosporium , acremonium , paecilomyces , ochrobactrum and aspergillus species as causes of cpe [ 22 , 2931 ] . in some of these organisms such as staphylococcus epidermidis , and propionibacterium acnes , the clinical course of the disease may be affected by factors such as host characteristics or inoculum size [ 2 , 5 ] . routes of bacterial entry are believed to include intraoperative irrigation fluids , surgical instruments , and inadvertently placing the intra - ocular lens on external ocular surfaces [ 32 , 33 ] . the anterior chamber possesses an efficient mechanism of clearing small bacterial loads , so the currently unexplainable failure of this mechanism may be one of a multitude of unknown factors in postoperative bacterial endophthalmitis [ 32 , 34 ] . known risk factors include vitreous communication ( e.g. , through a posterior capsular tear or yag capsulotomy ) , certain iol prosthetics , and diabetes [ 3538 ] . fungal endophthalmitis is uncommon in the postoperative setting , with most of the cases being attributable to candida species . as such , most fungal endophthalmitis cases are the result of infection by filamentous fungi , and a minority is the result of molds . fungi possess resistant cell walls that enable them to flourish in the eye indefinitely shielded from immune attack and antibiotic therapy making the management of these cases particularly challenging [ 40 , 41 ] . the clinical picture of cpe is that of a recurrent and often low - grade uveitis occurring months or even years after the inciting surgical event . uveitis typically starts two to three months postoperatively and involves the anterior chamber initially with progression to the vitreous as the disease advances . pain or discomfort may or may not be present in cpe , while decreased vision is found in nearly all patients . inflammation is usually steroid responsive initially but recurs after medication tapering , while it paradoxically worsens with steroids in the case of some fungal infections . the clinical course in cpe is similar to that of phaeoantigenic uveitis and has been suggested to be a result of an immune reaction to the presence of both residual lens material and bacteria [ 43 , 44 ] . . the uveitis may be granulomatous with large precipitates on the cornea or intraocular lens and often without a frank hypopyon , but a microhypopyon may be visible by gonioscopy . a white intracapsular plaque representing retained lens particles and sequestered organisms is highly suspicious of an infectious process . the plaque is commonly observed especially in association with propionibacterium species and less frequently with other bacterial or fungal infections [ 16 , 29 , 45 , 46 ] . vitreous activity is usually mild but can be dense and diffuse particularly with staphylococcus epidermidis . pearls - on - a - string or fluff balls near the capsular remnant and also with stringy white infiltrates although both are not pathognomonic [ 5 , 14 ] . the diagnosis of cpe is challenging given the difficulties faced in isolating the causative organism . it is based on clinical suspicion supported by cultures of the aqueous or posterior lens capsule or vitreous biopsy . when cpe is suspected , aqueous and/or vitreous samples should be obtained for analysis . the sampling could be performed using needle aspiration of 0.01 ml of the aqueous fluid or 0.02 ml of the vitreous . in case the vitreous needle aspiration was not successful ( dry tap ) , mechanical biopsy of the vitreous through a pars plana vitrectomy could be performed . the obtained sample should be analyzed with gram stain , culture , and identification of antimicrobial sensitivities . the appropriate anaerobic medium should be used when necessary and giemsa and fungal cultures should be obtained in case a fungus is suspected . the highest diagnostic yield is achieved by sampling the white plaque in the posterior lens capsule if present , utilizing a special culture medium , as well as prolonging the culture time to several weeks to cover the slow - growing organisms implicated in cpe [ 14 , 48 ] . in culture negative cases , the additional use of polymerase chain reaction was reported to aid in the identification of the organism . cpe differential diagnosis spectrum includes noninfectious causes such as lens - induced uveitis secondary to retained cortical material , iol - induced uveitis secondary to implant malposition causing iris chafing and chronic inflammation , and sympathetic ophthalmia or other causes of uveitis unrelated to surgery [ 50 , 51 ] . the indolent nature of the organisms and their sequestration within the capsule protected from host defenses along with their different virulence factors make it hard to define a treatment protocol for cpe or extrapolate the guidelines set for acute postoperative endophthalmitis . different modalities of treatment approaches have been reported , and they range from ( 1 ) intraocular antibiotics injection ( ioab ) only to , ( 2 ) pars plana vitrectomy ( ppv ) with ioab to , ( 3 ) ppv with ioab and partial capsulectomy to , ( 4 ) ppv with ioab and total capsulectomy with iol removal or exchange [ 5 , 16 , 18 , 28 ] . in addition , some advocate waiting for culture , gram stain , and sensitivity data to allow for directed therapy in cases where the inflammation is not considered severe . two intraocular antibiotics injection approaches have been described either into the capsular bag or simultaneously into the aqueous and the vitreous [ 52 , 53 ] . some reports suggest tailoring treatment options to the severity of presenting signs and symptoms where mild cases are to be managed with intraocular cultures followed by intravitreal antibiotics while using repeated intraocular antibiotic and pars plana vitrectomy with partial capsulectomy in recurrent cases . another approach depends on the type of the isolated organism whereby s. epidermidis could be treated with intraocular antibiotic injections alone while p. acnes would require surgical intervention with pars plana vitrectomy , capsulectomy and possible removal or exchange of the iol in addition to intraocular antibiotic injection [ 13 , 20 , 44 ] . this is based on the fact that multiple reports described high rate of recurrence when p. acnes cpe was treated with intravitreal antibiotics alone [ 20 , 44 ] . since at the time of the initial antibiotic injection the organism is usually unknown , the initial approach to consider in the empiric treatment of chronic postoperative endophthalmitis , when fungal infection is not suspected , is intravitreal vancomycin ( 1 mg/0.1 ml ) owing to its broad coverage of gram - positive bacteria and methicillin - resistant staphylococci . p. acnes , the most commonly described causative organism of cpe , is also sensitive to vancomycin but not to aminoglycosides [ 14 , 15 ] . it has also been reported to have good susceptibility to carbapenems ( meropenem and ertapenem ) in vitro . accordingly , the treatment should be modified as sensitivity studies become available .on the other hand , the benefit of systemic and topical antibiotic use remains controversial in cpe . a cross - sectional review of four of the biggest case series on delayed - onset endophthalmitis revealed differences in outcomes that can be attributed to causative organism , initial treatment modality , as well as the extent of intervention [ 5 , 16 , 18 , 28 ] . the overall visual outcome is calculated to be 20/40 or better in about 46% of the cases while 54% ended up with varying degrees of visual impairment , all irrespective of the stratifying factors mentioned above ( table 3 ) . all four case series indicate that an infection with p. acnes or gram - positive organisms was associated with a better visual outcome ( better than 20/40 in 54.5% and 50% of the overall cases , resp . ) fungal infection was associated with a more unfavorable prognosis where visual impairment was precipitated in more than 60% , and more than 20% had severe visual impairment ( worse than 5/200 ) . in the same pool of patients , the recurrence rate differed in relation to the initial treatment modality ( table 5 ) . the highest recurrence was seen in cases where the initial treatment consisted of antibiotics alone ( 90% ) . starting therapy with pars plana vitrectomy and antibiotics decreased the recurrence in all series , while adding posterior capsulectomy to pars plana vitrectomy and antibiotics as an initial management further decreased the recurrence rate to 42% . as a trend , all case series showed that recurrence rate decreased uniformly in correlation with a more aggressive management strategy ( table 6 ) , whereby the overall calculated recurrence rate , when combined ppv , ioab , total capsulectomy , and removal or exchange of the iol was performed at any time during followup , decreased to as low as 5% compared to 68% recurrence rate when ppv was combined with ioab alone ( table 6 ) . chronic fungal postoperative endophthalmitis carries a poor prognosis and there is no standard management available for treating this very rare condition . current approach includes pars plana vitrectomy , intravitreal amphotericin ( 510 mg/0.1 ml ) or voriconazole , and a systemic antifungal drug [ 5557 ] . the indolent course of the chronic fungal postoperative endophthalmitis might benefit from prolonged systemic treatment with an antifungal ( 6 weeks6 months ) . topical antifungal agents ( natamycin 5% ) are started when required , especially in cases of corneal involvement . in conclusion , chronic postoperative endophthalmitis should always be in the differential of recurrent inflammation in a previously operated eye . effort should be directed towards finding a definitive diagnosis in this setting through obtaining intraocular samples for analysis early enough to institute aggressive treatment and avoid recurrence and poor outcome .

this prospective observational study was conducted by the department of pediatric community ophthalmology of a tertiary teaching pediatric eye centre of urban india . two masked investigators ( a pediatrician and a pediatric ophthalmologist ) performed ebt in a semi - darkened room of a municipal school . both eyes of the subject were simultaneously illuminated using a direct ophthalmoscope ( heine , beta 200 , optotechnik , germany ) with the subject looking directly into the ophthalmoscope light . the observer looked through the peephole of the direct ophthalmoscope and adjusted the lens dial until the pupillary reflex was sharply focused . the size and location of the pupillary crescent were noted and reported as ametropic ( inferior crescent or decentered crescent or > 2 mm size superior crescent ) or emmetropic ( 2 mm superior well centered to 12 oclock position ) crescent [ fig . 1 ] . all the children > 5 years age , from the first standard of the school class were included . children with any ocular comorbidity , namely , media opacities , the pediatric ophthalmologist first described the optical principle of photorefraction ( ebt ) to the pediatrician followed by a demonstration of pupillary crescents in different refractive conditions using + 3.0d lens , 3.0d lens , and + 3.0d cylinder held in front of an emmetropic eye and using standard photographs [ fig . 1 ] . the pediatrician then performed the test ( ebt ) on ten consecutive children , verified by the pediatric ophthalmologist . this exercise of teaching was immediately followed by examination of the study population , first by the pediatrician and then followed immediately by the pediatric ophthalmologist ( masked to the observations of the pediatrician ) using a direct ophthalmoscope ( heine beta 200 , herrsching , germany ) . the data were categorized in a 2 2 bayesian table [ table 1 ] and analyzed to get the prevalence , sensitivity , specificity , and predictive values . two hundred and thirty - six eyes of 118 subjects , mean age 6.8 0.5 years ( range , 5.47.8 years ) , were examined . the time taken to complete this test was < 10 s per subject . the ophthalmologist identified 59 eyes as ametropic ( 12 hyperopic and 47 myopic eyes ) and 177 as emmetropic compared to 61 eyes as ametropic and 175 emmetropic by the pediatrician [ table 2 ] . at the prevalence of 25.9% , the sensitivity of the ebt [ table 1 ] by the pediatrician was 90.2% , specificity was 97.7% , predictive value of the positive test was 93.2% , and predictive value of the negative test was 96.6% . the clinical agreement ( kappa ) between the ophthalmologist and 22 bayesian table comparing the results of enhanced brckner test performed by the pediatrician in comparison to the gold standard ( pediatric ophthalmologist ) this study from urban india demonstrated a high prevalence of significant refractive errors using a screening test that was reported to have high negative predictive value and specificity . the clinical agreement , specificity , and negative predictive value of the test when compared between a pediatrician and a trained pediatric ophthalmologist were very high . the pediatrician understood the principle and learned how to perform and record the results of the ebt rapidly . since childhood myopia has a trend of increasing prevalence and rapid progression in the asian children living in urban area , this is particularly important when a pharmacological and environmental modification can potentially prevent or slow down the progression of myopia . it is well known that myopia is an important cause of visual impairment in children , especially in the urban area of asian countries . an unchecked progression of myopia can be associated with myopia of more than 6.0d which is associated with multiple long - term ocular morbidities in the lifetime of a child as well as high spectacle dependence [ table 3 ] . vision - threatening ocular morbidity associated with high myopia in children a red reflex testing is an essential component of the neonatal , infant , and child physical examination by a pediatrician using an ophthalmoscope . it is prudent to teach them to do an ebt for an easy and early referral of the child suspected to have a refractive error . in fact , this approach of case detection which is called opportunistic screening has many advantages over a population - based screening ( using photo screeners ) in children [ table 4 ] and it can be adopted as a first step toward the elimination of childhood visual impairment due to refractive errors . training in performing the ebt should be included as a part of the curriculum in the pediatric residency program and should be considered a mandatory examination in the pediatrician 's office . advantages of opportunistic screening versus population - based screening of refractive errors in preverbal children as opposed to population - based screening , case detection relies on detection of disease in patients who present to physicians for various complaints or for routine immunization as in this case . population - based screening for refractive errors is especially inappropriate for developing countries without an adequate infrastructure , especially when the screening tests are expensive , difficult to administer , and disease prevalence and associated visual disability are low as seen with most refractive errors in preverbal age group . currently , one of the methods for detection of refractive errors in preverbal children is to perform an ebt during a routine comprehensive pediatric examination . the feasibility of this would , however , depend on the willingness of pediatrician and the performance of the ebt . although , in this study , we have not performed cycloplegic refraction of the children , the sensitivity , specificity , and predictive values of the ebt in comparison to cycloplegic refraction are already reported in the literature . the sole purpose of this study was to compare the screening of children with ebt by a pediatrician with a trained pediatric ophthalmologist who was very well versed with the ebt . we found that the results of the ebt performed by pediatrician were comparable to that of an experienced pediatric ophthalmologist . future studies are required to assess the effect of opportunistic screening of refractive errors in preverbal children by the pediatricians on the rate of reduction of the visual impairment due to ametropia in children . studies are also required to evaluate the validity of ebt in children < 1 year when the fixation to distance target is poor . opportunistic screening of refractive errors using ebt by pediatrician can be an important approach in the detection of ametropia in children .

breast cancer , a global health concern , is the most common cancer worldwide , and ranks as the fifth leading cause of cancer - related death . approximately 232 670 new cases and 40 000 death are expected to occur in 2014 among women in the united states . the incidence rates in more developed countries and less developed countries were 71.7 and 29.3 per 100 000 persons per year , respectively , and the corresponding mortality rates were 17.1 and 11.8 , with 5-year relative survival rate ranging from 12% to 90% . the introduction of population - based screening using mammography and the systemic use of adjuvant therapies contribute to observed improvements in breast cancer survival . a meta - analysis showed that identification of risk factors for breast cancer might be useful for personalized mammography screening . thus , it is important to discuss the risk factors , explore the mechanism underlying this disease , and identify the best diagnostic marker to diagnose early - stage breast carcinogenesis . in recent decades , gene mutations were shown to be risk factors for breast cancer occurrence and an independent prognostic marker for patients who received adjuvant therapy . matrix metalloproteinase ( mmps ) are a multifunctional family of endopeptidases participating in the degradation of extracellular matrix and basement membrane barriers and also play key roles in separating the tumor cells from normal surrounding tissues . mmp-9 , also known as 92-kd type iv collagenase or gelatinase b , is a member of the mmps family and is a zinc - dependent peptidase . differential expression in breast cancer cells of mmp-9 affects the degree of cellular differentiation and is closely correlated with the most aggressive subtypes . several single - nucleotide polymorphisms ( snps ) have been reported to be associated with tumor progression . mmp-9 - 1562 c / t polymorphism ( rs3918242 ) , a c to t substitution at 1562bp , was the most studied and is associated with increased risk of deep vein thrombosis and colorectal cancer in cancer patients . mmp-9 p574r ( rs2250889 , a c to g substitution in exon 10 ) and r279q ( rs17576 , a g to a substitution in exon 6 ) functional polymorphisms are biomarkers for the occurrence and metastasis of primary lung cancer . mmp-9 rs3787268 , a g to a substitution , was shown to have strongest association with breast cancer among the native american women . although research has been performed to explore the effect of mmp-9 polymorphisms in breast cancer susceptibility , results are inconclusive . grieu et al . found that patients with mmp-91562 ct or tt genotypes showed marginally better prognosis compared to cc homozygotes but roehe et al . therefore , we conducted this meta - analysis to investigate the relationship between mmp-9 polymorphisms and breast cancer risk . we conducted a literature search using the online electronic databases of ebsco ( pubmed and medline ) and china ( china national knowledge internet and wanfang ) to retrieve related articles published between 2000 and 2014 . the mesh ( medical subject headings ) search terms were breast cancer or carcinoma or neoplasms , matrix metalloproteinase 9 or mmp-9 or gelatinase b , and polymorphism or variant or mutation , as well as their combinations . when the same authors or laboratory reported several publications on the same issue , only the most recent study was included . eligibility criteria were : 1 ) case - control study ; 2 ) cases were histopathologically confirmed and the controls were age - matched ; 3 ) evaluating the association between mmp-9 polymorphisms and breast cancer risk ; 4 ) results presented as odds ratio ( ors ) with 95% confidence intervals ( cis ) ; and 5 ) genotype information of patients and controls can be extracted . two experts independently assessed the extracted data of the included studies . the following items from each study were extracted : first author name , publication year , country , ethnicity , total number of breast cancer cases and controls , genotyping method , study design ( hospital - based or population - based case - control studies ) , and the genotype information . pooled ors with associated 95% cis were employed to assess the strength of the association between mmp-9 polymorphisms and breast cancer susceptibility . four genetic models were calculated to evaluate this association : the allele model , the homozygous model , the dominant model , and the recessive model . a random - effects model was used when the p value was less than 0.1 or i more than 50% , which was considered statistically significant ; otherwise , a fixed - effects model was used . review manager 5.2 ( the cochrane collaboration , oxford ) was used for conducting the statistical analyses . we conducted a literature search using the online electronic databases of ebsco ( pubmed and medline ) and china ( china national knowledge internet and wanfang ) to retrieve related articles published between 2000 and 2014 . the mesh ( medical subject headings ) search terms were breast cancer or carcinoma or neoplasms , matrix metalloproteinase 9 or mmp-9 or gelatinase b , and polymorphism or variant or mutation , as well as their combinations . when the same authors or laboratory reported several publications on the same issue , only the most recent study was included . eligibility criteria were : 1 ) case - control study ; 2 ) cases were histopathologically confirmed and the controls were age - matched ; 3 ) evaluating the association between mmp-9 polymorphisms and breast cancer risk ; 4 ) results presented as odds ratio ( ors ) with 95% confidence intervals ( cis ) ; and 5 ) genotype information of patients and controls can be extracted . the following items from each study were extracted : first author name , publication year , country , ethnicity , total number of breast cancer cases and controls , genotyping method , study design ( hospital - based or population - based case - control studies ) , and the genotype information . pooled ors with associated 95% cis were employed to assess the strength of the association between mmp-9 polymorphisms and breast cancer susceptibility . four genetic models were calculated to evaluate this association : the allele model , the homozygous model , the dominant model , and the recessive model . a random - effects model was used when the p value was less than 0.1 or i more than 50% , which was considered statistically significant ; otherwise , a fixed - effects model was used . review manager 5.2 ( the cochrane collaboration , oxford ) was used for conducting the statistical analyses . we identified 42 articles that contained our key words . after applying the inclusion and exclusion criteria , we selected 10 articles , including 6177 breast cancer cases and 6726 matched controls . four polymorphisms of mmp-9 were assessed in the present meta - analysis : rs3918242 , rs17576 , rs2250889 , and rs3787268 . table 2 lists the distribution of allele and genotype information for each variant in the included studies . table 3 shows the results of statistical analysis for each polymorphism of mmp-9 . for rs3918242 , the results showed that the frequency of risk allele c was higher in breast cancer patients than in controls ( 20.8% vs. 17.7% ) ; however , the c allele was not associated with breast cancer risk ( t vs. c : or=1.36 , 95% ci=0.911.30 , p=0.13 ) . this insignificant association was also found in the homozygous model ( tt vs. cc : or=1.43 , 95% ci=0.722.86 , p=0.30 ) and the dominant model ( tt+ct vs. cc : or=1.38 , 95% ci=0.882.16 , p=0.16 ) . tt genotype in the recessive model significantly increased the risk of breast cancer ( tt vs. ct+cc : or=1.55 , 95% ci=1.122.16 , p=0.009 ) in a fixed - effects model . for rs17576 , 3 articles , containing 1176 patients and 1142 controls , were included . overall , no significant association was found between rs17576 of mmp-9 and breast cancer susceptibility under any genetic model ( a vs. g : or=0.88 , 95% ci=0.581.34 , p=0.55 ; aa vs. gg : or=0.71 , 95% ci=0.271.89 , p=0.49 ; aa+ga vs. gg : or=0.96 , 95% ci=0.641.43 , p=0.84 ; aa vs. ga+gg : or=0.72 , 95% ci=0.311.71 , p=0.46 ) in a random - effects model ( figure 3 ) . for rs2250889 , we identified 2 articles , including 331 cases and 335 controls . there was no evidence of an association between mmp-9 rs2250889 and breast cancer susceptibility in different genetic models ( g vs. c : or=0.61 , 95% ci=0.271.36 , p=0.23 ; gg vs. cc : or=1.96 , 95% ci=0.0945.03 , p=0.67 ; gg+cg vs. cc : or=2.28 , 95% ci=0.2718.95 , p=0.45 ; gg vs. cg+cc : or=1.10 , 95% ci=0.215.72 , p=0.91 ) ( figure 4 ) . no significant relationship was found between gg+ga genotype and breast cancer risk in the dominant model ( aa+ga vs. gg : or=0.95 , 95% ci=0.711.27 , p=0.74 ) ( figure 5 ) . we deleted each included study 1 at a time to observe whether the single study influenced the overall results . we found that the significance of pooled ors was not changed when any individual study was omitted , indicating no bias was present . a funnel plot showed no obvious asymmetry ( figure 6 ) , further indicating that there was no possible publication bias . we identified 42 articles that contained our key words . after applying the inclusion and exclusion criteria , we selected 10 articles , including 6177 breast cancer cases and 6726 matched controls . four polymorphisms of mmp-9 were assessed in the present meta - analysis : rs3918242 , rs17576 , rs2250889 , and rs3787268 . table 2 lists the distribution of allele and genotype information for each variant in the included studies . table 3 shows the results of statistical analysis for each polymorphism of mmp-9 . for rs3918242 , the results showed that the frequency of risk allele c was higher in breast cancer patients than in controls ( 20.8% vs. 17.7% ) ; however , the c allele was not associated with breast cancer risk ( t vs. c : or=1.36 , 95% ci=0.911.30 , p=0.13 ) . this insignificant association was also found in the homozygous model ( tt vs. cc : or=1.43 , 95% ci=0.722.86 , p=0.30 ) and the dominant model ( tt+ct vs. cc : or=1.38 , 95% ci=0.882.16 , p=0.16 ) . tt genotype in the recessive model significantly increased the risk of breast cancer ( tt vs. ct+cc : or=1.55 , 95% ci=1.122.16 , p=0.009 ) in a fixed - effects model . for rs17576 , 3 articles , containing 1176 patients and 1142 controls , were included . overall , no significant association was found between rs17576 of mmp-9 and breast cancer susceptibility under any genetic model ( a vs. g : or=0.88 , 95% ci=0.581.34 , p=0.55 ; aa vs. gg : or=0.71 , 95% ci=0.271.89 , p=0.49 ; aa+ga vs. gg : or=0.96 , 95% ci=0.641.43 , p=0.84 ; aa vs. ga+gg : or=0.72 , 95% ci=0.311.71 , p=0.46 ) in a random - effects model ( figure 3 ) . for rs2250889 there was no evidence of an association between mmp-9 rs2250889 and breast cancer susceptibility in different genetic models ( g vs. c : or=0.61 , 95% ci=0.271.36 , p=0.23 ; gg vs. cc : or=1.96 , 95% ci=0.0945.03 , p=0.67 ; gg+cg vs. cc : or=2.28 , 95% ci=0.2718.95 , p=0.45 ; gg vs. cg+cc : or=1.10 , 95% ci=0.215.72 , p=0.91 ) ( figure 4 ) . for rs3787268 , no significant relationship was found between gg+ga genotype and breast cancer risk in the dominant model ( aa+ga vs. gg : or=0.95 , 95% ci=0.711.27 , p=0.74 ) ( figure 5 ) . we deleted each included study 1 at a time to observe whether the single study influenced the overall results . we found that the significance of pooled ors was not changed when any individual study was omitted , indicating no bias was present . a funnel plot showed no obvious asymmetry ( figure 6 ) , further indicating that there was no possible publication bias . in the present meta - analysis we explored the relationship between mmp-9 polymorphisms and breast cancer susceptibility . our results suggest that tt genotype in mmp-9 rs3918242 ( 1562 c / t polymorphism ) had a significant association with increased risk of breast cancer , but other genotypes or variants were not associated with breast cancer risk . this result was in contrast to a meta - analysis conducted by zhou et al . , which found no significant association between any genotype of mmp-91562 c / t polymorphism and breast cancer risk . mmp-9 plays an important role in the malignancy and the growth of the tumor , and has been linked to cancer cell proliferation , tumor invasion , and epithelial - to - mesenchymal transformation . rosella et al . summarized and analyzed the role of mmp-9 in different phases of the tumorigenic process , and found that mmp-9 has vital tumor - suppressing functions , promoting inflammatory anti - tumor activity , producing endogenous angiogenesis inhibitors , and inducing apoptosis . studies have demonstrated that mmp-9 is involved in breast cancer progression and metastasis due to its ability to degrade denatured collagens and type iv collagen , which is associated with the disruption of basement membranes . merdad et al . showed that mmp-9 is a reliable potential candidate diagnostic biomarker and drug target in breast cancer . expression of mmp-9 is up - regulated in breast cancer , and higher concentrations of mmp-9 proteins were detected in breast cancer tissue compared to normal breast tissue . mmp-9 was also constitutively expressed in some breast tumor cell lines but not in normal breast epithelial cells . mmp-9 expression has prognostic value of overall survival and relapse - free survival in breast cancer patients . johanna et al . reported that positive stromal mmp-9 expression indicates poor survival in hormone - responsive small tumors , but that mmp-9 expression favors survival in carcinoma cells . a meta - analysis by song et al . suggested that positive mmp-9 expression confers a higher risk of relapse and worse survival in patients with breast cancer . the -1562 c / t variant was shown to play a functional role in gene transcription , resulting in the loss of binding of a nuclear protein to this region and an increase in transcriptional activity in macrophages . przybylowska et al . showed that the t allele of mmp-91562 c / t was associated with the malignance and the growth of the tumor . mmp-9 r279q polymorphism was shown to influence the malignant potential of renal cell carcinoma in a japanese population . however , beeghly - fadiel et al . suggested that common genetic variation of mmp-9 was not significantly associated with breast cancer susceptibility among participants of the shanghai breast cancer genetics study . first , the number of eligible articles was small , which may affect the reliability of the results . thirdly , we only analyzed studies from a few populations , so future research needs to include more ethnic groups . our results found that tt genotype of mmp-91562 c / t polymorphism in the recessive model was significantly associated with increased the risk of breast cancer . however , no significant association was found between other mmp-9 polymorphisms and breast cancer risk . further well - designed studies with larger populations are needed to further explore the role of mmp-9 polymorphism in breast cancer risk .

xanthomonas citri subsp . citri ( xcc ) is a gram - negative plant pathogenic bacteria that causes severe disease in many economically important citrus plants . the citrus canker induced by xcc is a destructive disease characterized by canker lesions on leaves , stems , and fruits ; furthermore the pathogen induces defoliation , which results in reduced yield and premature fruit drop . control is difficult in areas where the disease is already established , and plant eradication is the only effective way to control and prevent the disease spread . recurrent and severe attacks of the pathogen are responsible for serious economic losses in citrus groves around the world . the focus of the present study is aimed at understanding the role of bacterial secretory systems , specifically the type iv secretory system ( t4ss ) . seven secretory systems are known and described in prokaryotic organisms , and each one is related to a physiological process [ 35 ] . of these , the best studied is the type iii secretory system ( t3ss ) , which enables bacterial pathogens to deliver effector proteins into eukaryotic cells . some bacterial pathogens , including species from chlamydia , xanthomonas , pseudomonas , ralstonia , shigella , salmonella , escherichia , and yersinia , depend on the t3ss to induce damage to the host . in contrast , other organisms including agrobacterium tumefaciens , helicobacter pylori , and legionella pneumophila depend on the type iv secretory system ( t4ss ) for virulence induction . the t3ss contains at least twenty distinct proteins , which are subdivided into three parts . the basal body of the system [ 811 ] is associated with an atpase and likely facilitates the entry of substrates into the secretion apparatus . this basal body is also associated with a protein needle ( the second part of the t3ss ) , which binds the bacterium to host cells and acts as a conduit for effectors secretion . the third part of the t3ss is composed of three proteins that are exported through the bacterial needle and form a pore on the surface of the host cell , which facilitates the export of toxins into the target cytoplasm . on the other hand , the t4ss is a multiprotein complex that consists of a protein channel ( encoded by virb and vird ) through which proteins or protein - dna complexes can be translocated between bacteria ( cell - to - cell communication ) and into host cells . translocation is driven by a number of cytoplasmic atpases that potentially energize large conformational changes in the translocation complex . the first type , found in many gram - positive and gram - negative bacteria and some archaea , functions in conjugation and in the transfer of t - dna into plant cells by a. tumefaciens . a second type of t4ss mediates dna uptake in the transformation process ( found in h. pylori ) . a third type of t4ss is used to transfer toxic effector proteins or protein complexes into the cytoplasm of host cells ( found in bordetella pertussis , legionella pneumophila , pseudomonas aeruginosa , and xcc ) . substrates transported by the t4ss modulate various cellular processes including apoptosis , vesicular traffic , and ubiquitination ; furthermore , the number of type iv effector proteins continues to increase [ 1619 ] . however , most of these substrates have not been functionally characterized , and their role in bacterial pathogenesis remains unknown . in many bacteria , only the t3ss has been intensively studied , in contrast to the limited number of studies involving the t4ss [ 21 , 22 ] . in xcc the t4ss deserves more attention , especially since the genome contains two copies of this system ( chromosomal and plasmid - borne ) . the plasmid copy is homologous to others xanthomonads that contain the t4ss on extrachromosomal dna . to understand the conditions that stimulate expression of t4ss genes in xcc we used qpcr to analyze the in vitro and in planta expression of 18 orfs from the t4ss ( both chromosomal and plasmid copies ) and 7 hypothetical orfs flanking the t4ss . to validate the qpcr data , we compared expression of 29 orfs from the t3ss , which are known to be expressed in planta our results showed that the t4ss is not induced during the infection process in xcc , but may be very important in cell - to - cell communication . xcc was maintained in sterile tap water and grown on nutrient agar ( na ) medium containing 3 g beef extract , 5 g peptone , and 15 g agar in 1 l of distilled water at 28c . after 24 h , three single colonies were transferred to new na plates and incubated for 12 h at 28c . these xcc solid cultures were used as pre - inoculum for in planta and in vitro studies . for in planta studies , pre - inoculum cultures were aseptically transferred to sterile flasks containing 50 ml of nutrient broth ( nb ) and the bacterial concentration was adjusted to 10 cfu / ml ( od600 = 0.3 ) . this bacterial suspension was taken up in a 1 ml needleless syringe and used to infiltrate orange leaves ( citrus sinensis cv . a total of nine plants were inoculated ( 20 leaves per plant ) and maintained for 72 h in a growth room at 28c , with a 12 h photoperiod and light intensity ~2,000 lux . after multiplication , inoculated leaves were collected , sliced into thin strips with a razor blade , and placed in a beakers with sterile distilled water in an ice bath with gentle agitation . after 5 min , leaf debris was removed by filtration through gauze , and bacterial cells were recovered by centrifugation at 5,000 g for 5 min at 4c . total rna was extracted immediately , as described below . for in vitro studies , 1 ml of each xcc suspension at 10 cfu / ml were aseptically transferred to three erlenmeyer flasks and incubated for 12 h at 28c with shaking ( 200 rpm ) . after incubation , bacterial cells were harvested by centrifugation at 5,000 g for 5 min . thus , we obtained three independent biological replicates for xcc growth in vitro and in planta . all cultivation media were obtained from difco chemical co. , detroit , usa . for confirmatory rt - qpcr , the same procedures were followed except the plant incubation period was only 72 h , due to rna quality and concentration sufficient to yield reliable results . the time point 72 hours was the shortest period to allow obtaining satisfactory bacterial mass to the proposed analyzes involving gene expression . the bacterial cells concentration in short time ( 12 or 24 hours ) do n't allows this study . for this reason , some works are using culture media that mimic vegetable conditions to investigate the infectious process under these time scales [ 24 , 25 ] . rna was extracted using an illustra - rnaspin mini rna isolation kit ( amersham biosciences ) following the manufacturer 's instructions . to ensure that samples did not contain dna , pcr conditions consisted of an initial denaturing step of 94c for 3 min , followed by 35 cycles of a denaturation at 94c for 30 s , annealing at 60c for 30 s , and elongation at 72c for 2 min . a final elongation step of 72c for 4 min was performed , and then samples were maintained at 4c until needed . the amplification reaction was conducted in a total volume of 25 l containing 200 ng rna in 2.5 l , pcr buffer ( 2.5 l , invitrogen ) , 1.5 mm mgcl2 , 0.2 mm dntp , 300 nm 16s rrna primer , and 1 u taq dna polymerase ( invitrogen ) . the products were electrophoresed in a 1% agarose gel with tae buffer , stained with ethidium bromide , and visualized using a uv transilluminator . no products were observed ( data not shown ) . to verify the quality of extracted rna , the samples were analyzed by electrophoresis in a 1% agarose gel using tae buffer followed by ethidium bromide staining . the a260/280 ratio of rna samples was measured , and rna was quantified using a nanodrop nd-1000 spectrophotometer ( nanodrop technologies , wilmington , de , usa ) . first strand cdna synthesis and all rt - qpcr reactions were done using the superscript iii first - strand synthesis supermix for rt - qpcr ( invitrogen ) as recommended by the manufacturer 's specifications except for the amount of cdna in each reaction , which was 20 ng . all pcr was performed with sybr green on a 7500 real - time pcr instrument ( applied biosystems ) using three biological replicates and three technical replicates ( one for each biological replicate ) . pcr was for 2 min at 50c , 10 min at 95c , followed by 40 cycles of 15 s at 95c , and 1 min at 60c . to determine pcr efficiency , rpob , atpd , and gyrb were used as reference genes in all experiments . to perform relative expression analysis the results obtained from xcc growing in planta or in vitro are presented in figure 1 . from the 29 t3ss genes analyzed by qpcr , only hrpa was downregulated at 72 h after inoculation ( figure 1(b ) ) . hpa1 , hpab , hrpd6 , hrpe , and hrpf showed the highest rates of expression , whereas phae , hrpg , hrpx , and hrca showed the lowest levels of expression . interestingly , hrpb4 and hrpxct , which were shown to be necessary for xcc pathogenesis , were not among the most upregulated genes in this study . the results for the expression levels of t4ss genes in planta and in vitro are shown in figure 2 . all genes associated with the t4ss were downregulated on citrus leaves 72 h after inoculation ( figure 2(c ) ) . we also analyzed the expression of hypothetical genes located near virb in chromosomal dna ( xac2606 , xac2611 , xac2613 , and xac2622 ) and in plasmid pxac64 ( xacb0035 , xacb0042 , xacb0043 , xacb0048 , and xacb0049 ) ( figure 2(d ) and table 1 ) . orfs representing hypothetical genes in both the chromosome and plasmid were down - regulated when xcc was cultivated in citrus sinensis for 72 h. an exception was xac2611 , where expression was similar when xcc was cultivated in culture medium or in planta ( figure 2(d ) ) . our results clearly show different gene expression profiles for the t3ss and t4ss in xcc during citrus infection . the t4ss was previously described in a. tumefaciens , where it mediates the transfer of dna and protein substrates to plants and other organisms via a cell contact - dependent mechanism . in xcc , the genome sequence revealed the presence of two virb operons , one on the chromosome and a second copy in the 64 kb plasmid pxac64 . the chromosomal genes virb1 , virb3 , virb4 , virb8 , virb9 , and virb11 and the plasmid - encoded genes virb1 , virb2 , virb4 , virb6 , virb9 , and virb11 were all down - regulated in planta ( figure 2(c ) ) . this was somewhat surprising because the t4ss is essential for a successful infection in many gram - negative pathogenic bacteria . the fact that orfs representing hypothetical genes in both the chromosome and plasmid near the virb genes were also down - regulated under the same condition ( figure 2(d ) ) indicates that they could be related to the t4ss system in xcc . recent studies in brucella suis and in a. tumefaciens showed that alterations in virb8 result in protein dimerization , a process that modifies the t4ss structure and affects bacterial virulence . in streptococcus suis , the knockout of the vird4 - 89k and virb4 - 89k of the t4ss eliminated the lethality of a highly virulent strain and impaired its ability to trigger host immune responses in mice . recent studies continue to demonstrate the importance of the t4ss and its components in virulence ; thus the lack of induction of xcc t4ss genes in the present study is intriguing . campestris t4ss - deletion mutant displayed the same virulence as wild type and authors conclude that t4ss is not involved in pathogenicity in that xanthomonas . wang et al . presented evidence that in planta transfer of a 37 kb plasmid ( pxcb ) from xanthomonas aurantifolii to xanthomonas citri can occur via t4ss . thus , at least the t4ss copy present in xcc plasmid can play a hole in horizontal gene transfer . all but one of the twenty - nine genes from the t3ss of xcc were up - regulated in planta . . showed that xcc mutants containing mutations in hrpb4 or hrpxct failed to cause disease and growth in citrus leaves was lower than the wild - type xcc strain 306 . these two genes , which are not among the most up - regulated genes in the present study , are part of the hrp ( hypersensitive reaction and pathogenicity ) system and comprise part of the t3ss . in the related pathogen , xanthomonas campestris pv . vesicatoria ( xcv ) , a hrpb4 mutant was unable to cause disease in susceptible pepper plants or the hypersensitive reaction in pepper plants carrying the respective compatible r gene . previously , hrpxv was shown to be necessary for transcriptional activation of five hrp genes ( loci hrpb to hrpf ) , and hrpb4 was required for complete functionality of the t3ss in xcv . thus it is apparent that a gene does not have to be strongly up - regulated during infection to play an important role in virulence . multiple genes , including hpaa , hpae , hpaf , hpap , hrpb , hrpb1 , hrpb2 , hrpb7 , hrpd5 , hrpm , hrpw , hrcc , hrcq , hrcs , hrct , and hrcv , were expressed at levels similar to hrpxct and hrpb4 and are good candidates for further studies into their roles in citrus canker disease . among the most up - regulated genes , hrpd6 warrants further attention . a hrpd6 mutant of xanthomonas oryzae pv . oryzae ( xoo ) failed to trigger a hypersensitive response in tobacco and was nonpathogenic in rice because the mutation in hrpd6 impacts the secretion of t3ss effectors , such as hpa1 , which is translocated through the t3ss . our qpcr data showed that hpa1 was the most up - regulated gene during citrus sinensis infection by xcc , followed by hrpd6 ( figure 1(b ) ) . conversely , hrpa , which encodes an important component of the t3ss pilus , was down - regulated in our study . . showed that soluble plant cell signals induce the expression of hrp / hrc genes and specifically upregulate hrpa . interestingly , they found that hrpa does not accumulate to high levels intracellularly , suggesting that some kind of feedback regulation takes place between secretion and production of hrpa , perhaps through degradation of intracellular hrpa . our work shows that this may also be applicable to hrpa gene in xcc : its mrna may be degraded faster , just as happen with hrpa in pseudomonas syringae . our finds confirm that the t3ss genes are induced in the successful infection of citrus sinensis by xcc , and therefore are excellent targets to help control or decrease the severity of citrus canker , whereas t4ss seems not have any relation with virulence . on the other hand , our results show that t4ss is not induced under the same infection conditions , which could indicate that it is not necessary for infection but only for cell - to - cell communication .

the selection of a probiotic strain requires the evaluation of a number of characteristics which enable the strain to cause beneficial effects after its administration . probiotics are administered orally and need to survive through the complex physical chemical environment of the gi tract . since probiotic bacteria only transiently colonize the intestinal tract , large populations have to be ingested on a daily basis to obtain beneficial effects ( reid et al . , 2001,2003 ) and 10 viable cells per serving is the minimal dose recommended ( fao / who , 2001,2002 ; maukonen et al . , 2006 ; health canada , 2009 ) . each new proposed probiotic strain must be characterized since it is widely recognized that probiotic features are strictly strain - specific and can not be considered as typical characteristics of a bacterial species . the ability of a strain to survive passage through the gi tract is generally the first evaluated aspect in the selection of a probiotic strain and can be mainly attributed to its acid and bile tolerance . moreover , the adhesion to intestinal mucosa is relevant as it seems to be related to the ability of a bacterial strain to persist in the gut ( servin and coconnier , 2003 ) . a number of in vitro tests of simulated digestion and adhesion have been proposed and used to preliminarily evaluate the ability of a probiotic strain to survive the passage through and to colonize the gi tract ; however , in a next phase these characteristics have to be ascertained by in vivo experiments . in vivo tests are very important also because strain survival partially depends on the potential protective action of the associated carrier food which is due in some way to its chemical composition . in fact , charalampopoulos et al . ( 2003 ) demonstrated that the presence of wheat , barley , and malt extracts increased the viability of l. plantarum , l. acidophilus , and l. reuteri strains under acidic conditions simulating the gastric tract . the authors attributed this result to the composition of cereal extracts and mainly to the presence of soluble sugars . ( 2005 ) who found that the presence of glucose and fructose highly increased the survival of some strains of l. rhamnosus , l. gasseri , and l. paracasei treated with simulated gastric juice and that viability varied among species . these results demonstrate that , when the final aim is the formulation of a new probiotic food , the interaction between the probiotic strain and the carrier food has to be taken into account in evaluating the compatibility between the strain and the carrier food as well as the potential protective action of the carrier under gi conditions . in the case of the selection of l. paracasei impc 2.1 its characteristics were compared with those of three strains of l. rhamnosus ( including the well - characterized probiotic strain gg ) , five strains of l. plantarum , and one strain of the species l. paracasei , l. alimentarius , and l. fermentum . it was preliminarily ascertained by in vitro tests its resistance to simulated gastric juice and to bile salts as well as its adhesion to pig mucus . strain impc 2.1 was also demonstrated to be strongly adhesive to enterocyte - like caco-2 cells ( lavermicocca et al . , 2003,2008 ) as it showed a better adhesion than the probiotic strain l. rhamnosus gg , which has strong adhesive properties to human intestinal epithelial cells ( elo et al . , 1991 ) . the survival on table olives of strain impc 2.1 was also evaluated and compared with that of strains of the species l. rhamnosus , l. paracasei , bifidobacterium bifidum , and b. longum . the results clearly indicated the compatibility between table olives and strain impc 2.1 which showed the highest viability , with more than 10 cfu / g , throughout the 3-month experiment ; the adhesion of strain impc 2.1 to olive surface was also demonstrated by scanning electron microscopy ( lavermicocca et al . moreover , in vitro experiments demonstrated that the presence of olive fruits had a protective effect on strain impc 2.1 during simulated gastric and intestinal digestion since the survival of strain impc 2.1 was markedly increased ( valerio et al . , 2006 ) . although the above - described results suggested that table olives are a suitable biological carrier for delivering strain impc 2.1 in the gi tract , actually a definitive evidence was obtained only by an in vivo study . in fact , populations of strain impc 2.1 were detected in fecal samples of human volunteers fed with 1015 olives / day carrying about 10 to 10 viable cells per serving of strain impc 2.1 for 10 days ( lavermicocca et al . , 2005 ) . adhesion of lactobacillus paracasei impc 2.1 cells to the surface of an olive fruit ( scanning electron microscopy observation by maria luisa callegari ) . in this regard , detection of a probiotic strain within a complex microbiota , such as those of fecal or vegetable samples , requires the development of a strain - specific method of identification . the identifications of a probiotic strain at the species as well as at the strain levels are important aspects which need to be considered also because both identification and strain recognition are required to obtain the authorization , from national or international health authorities , to use a probiotic strain for human feeding . nowadays , a strain - specific identification can be obtained using a wide range of molecular tools which also need to obtain a certain identification at the species level . l. paracasei strain impc 2.1 was identified and characterized at molecular level by using methods such as 16s rrna gene sequencing , rep pcr , and the amplified fragment length polymorphism ( aflp ) analysis . moreover , based on a strain - specific aflp molecular marker , a strain - specific pcr test was developed allowing differentiation of strain impc 2.1 also from other strains belonging to the same bacterial species ( sisto et al . , 2009 ) . in fact , the development of new probiotic foods requires a frequent monitoring of the probiotic strain s survival in those products within an ecosystem characterized by a complex microbiota . an approach similar to the one used for strain impc 2.1 could be adopted to develop easy and rapid detection methods for monitoring also other probiotic bacteria in complex microbiota , mainly when frequent evaluations are required . beneficial effects of probiotic bacteria are the results of the complex interactions occurring among probiotic bacteria , human host and its intestinal microbiota ( lebeer et al . , 2008 ) . generally , the health promoting capacities of probiotic bacteria are based on one of the following , sometimes overlapping , mechanisms : ( i ) pathogen inhibition , ( ii ) restoration of microbial homeostasis through microbe microbe interactions , ( iii ) enhancement of epithelial barrier function , and ( iv ) modulation of immune responses . taking into account the complexity of these mechanisms it is not unexpected that each probiotic strain can determine a different response in the host . therefore , results with one specific strain can not be generalized and the strain - specific properties must be studied and ascertained . in the case of l. paracasei impc 2.1 , the ability of this strain to antagonize the growth of the food - borne human pathogen yersinia enterocolitica was demonstrated as well as its ability to inhibit the pathogen ureolytic activity leading to the production of ammonia ( lavermicocca et al . , 2008 ) . studies also showed that strain impc 2.1 , administered with artichokes to volunteers suffering from constipation , gave rise to an overall positive effect on symptom profile of the participants . moreover , strain impc 2.1 successfully colonized the human gut and positively influenced fecal biochemical parameters and bacteria . in fact , this probiotic strain caused the inhibition of potentially harmful bacteria ( escherichia coli and clostridium spp . ) and stimulated the growth of lab and of lactobacilli and bifidobacteria . the human trials also confirmed that the introduction of vegetables enriched with probiotics such as artichokes , likewise olives , represents a way to achieve the target functional diet ( valerio et al . , 2010,2011 ; riezzo et al . , 2012 ) . among the other mechanisms by which probiotic bacteria cause beneficial effects on the host , modulation of immune responses has been particularly studied and extensively reviewed ( delcenserie et al . , 2008 ; borchers et al . immunomodulatory properties of strain impc 2.1 were evaluated in two studies which highlighted its interesting characteristics . in particular , the first study ( darienzo et al . , 2009 ) was carried out to analyze immunomodulatory approaches potentially useful for celiac disease , a common food - sensitive enteropathy with an autoimmune basis caused by the lack of oral tolerance to wheat gluten and related prolamines ( maki et al . , 2003 ) . in this regard , the effects of different bacterial strains were evaluated on transgenic mice sensitive to gluten ( gliadin ) , which represent a well - characterized model of sensitivity to food antigen useful to study in vivo the influence of probiotics on intestinal antigen - specific immune responses ( black et al . , 2002 ; senger et al . , 2005 ) . the results of in vivo challenge with strain impc 2.1 indicated its ability in enhancing the gliadin - specific production of the pro - inflammatory cytokine tnf- , thus highlighting the ability of the probiotic to exert inductive rather than suppressive effects . in a second study ( darienzo et al . , 2011 ) , the immunomodulatory properties of strain impc 2.1 were compared with those of other strains belonging to the same species l. paracasei . in this study , the interactions between those bacterial strains and cells of the immune system were considered , in particular evaluating the ability of the strains to cause cytokine secretion by dendritic cells , which play an essential role in both innate and adaptive immunity ( borchers et al . , 2009 ) and are important in earliest bacterial recognition and in determining the subsequent t cell responses . the results revealed the different immunomodulatory properties of strains belonging to the same bacterial species . probiotic strains impc 2.1 and lmg p-17806 (= f19 ; crittenden et al . , 2002 ; ohlson et al . , 2002 in fact , they induced a low pro - inflammatory response , not resulting in an inflammatory outcome ( but enough to induce a state of host immune system alertness ) and were clearly differentiated from the non - probiotic strain lmg 23554 (= ys8866441 ; daniel et al . , 2006 ) which showed a low ability to stimulate cytokine secretion . therefore , for each new potential probiotic strain , the profiles of the cytokines whose secretion is induced should be established to define its pro- or anti - inflammatory properties and the more appropriate clinical use . although olive fermentation can be carried out by the spontaneous microflora , since the natural microflora of olives is mainly destroyed by the lye treatment that precedes the fermentation step , the use of lab as starter cultures is an advisable practice that offers the advantage to induce a suitable development of the fermentation process allowing a faster ph decrease with respect to the spontaneous process . moreover , the use of a starter favors a better standardization of the organoleptic properties of the final product . from the technological point of view , an efficient starter strain should possess some physiological characteristics including : ( i ) good resistance to high levels of salt as well as to extreme alkaline or acidic ph values , ( ii ) the ability to utilize completely the fermentable substrates causing a rapid ph decrease due to organic acid production , ( iii ) ability to compete with the spontaneous microbiota , ( iv ) potential inhibitory effects against spoilage ( or pathogenic ) microorganisms , and ( v ) good characteristics of survival and revitalization after storage as a freeze - dried culture . generally , the starter microorganism is a selected strain which belong to a lactobacillus species component of the spontaneous microbiota . pentosus species successfully improved green olive processing hampering the effect of spoilage microorganisms ( garrido - fernndez et al . , 1997 ; moreover , strains of the species l. paracasei have been isolated from olive fermentations ( van den berg et al . , 1993 ) and to our knowledge , at least experimentally , a strain of l. paracasei from dairy origin was successfully used in green olive fermentation ( panagou et al . , 2007 ) . probiotic strain l. paracasei impc 2.1 is of human origin , therefore , it is better adapted than strains isolated from different environments to colonize the human intestine . this strain was originally selected on the basis of its probiotic properties ; then , its suitability as a starter was first studied at a laboratory level and then in an industrial plant ( de bellis et al . , 2010 ) . the study allowed to assess the persistence and the efficacy of strain impc 2.1 as a starter throughout the fermentation process , and to ascertain the dynamics of microbial populations associated with olive surface in industrial fermentation sets at 4 or 8% nacl and at room temperature or 4c . the results indicated that the probiotic strain successfully colonized the olive surface and persisted in high numbers allowing the reduction of ph of brines to values lower than 5.0 after 30 days and until the end of fermentation . the dynamics of microbial populations associated with olive surface and belonging to different groups indicated that olives inoculated with the probiotic did not host enterobacteriaceae at the end of fermentation , while yeast populations were present in a low number throughout the process . the results also revealed a considerable genetic diversity of lab species colonizing the olive surface and the effect of the probiotic strain on lab populations . in fact , species of the enterococcus casseliflavus group , mainly forming lab populations before the fermentation process , were not identified in sets inoculated with the probiotic strain already at the beginning of fermentation . moreover , in inoculated sets the number of l. pentosus was significantly reduced during the process , while it was the dominant species from 20 days up to the end of the process in control sets . although our results indicate that , at the end of fermentation , probiotic olives host a significant genetic diversity of lab species on their surface together with probiotic strain imcp 2.1 , they are considered a natural probiotic product as they provide to the consumer more than 10 cfu / serving of a probiotic strain as required by recognized standards for probiotic foods . with regard to the organoleptic profile , the process for preparing probiotic table olives allows to obtain a final low - salt product with improved flesh texture and flavors that meets commercial and functional requirements throughout its shelf - life of several months . technological aspects approached for the development of probiotic table olives demonstrated that the human isolate l. paracasei impc 2.1 is a good example of a probiotic strain suitable for industrial fermentation of de - bittered table olives . in fact , it combines the positive characteristics of a probiotic culture with the efficacy of a starter culture which can control the fermentation process and protect table olives during storage even under adverse conditions of temperature and salt concentration , leading to a final low - salt - probiotic product with functional appeal and high organoleptic quality . probiotic table olives are part of a new probiotic vegetable line of food products which was successfully developed and patented ( lavermicocca et al . , 2004 ) by cooperative actions between research institution and food industry , providing a concrete opportunity to convey in the gastronomy sector probiotic benefits already appreciated by consumers in other market sectors ( yogurt and dairy ) . probiotic vegetable preparations will have the potential to attract more consumers to functional products including also individuals who are intolerant to milk and its derivatives or require low - cholesterol diets . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

caffeic acid phenethyl ester ( cape ) has been used all over the world , especially in asian and other geographical areas as a traditional medicine since ancient times . it is an active phenolic component of propolis ( figure 1 ) of honeybee hives and possesses a plethora of important biological activities . cape is thought to be responsible for various well - known effects of propolis , including antibacterial , antioxidant , anti - inflammatory , immunomodulatory , and anticancer activities [ 1 - 3 ] . it is a well - documented inhibitor of nuclear factor kappa b ( nf-b ) , which may be an action mechanism for cape - mediated anti - inflammatory and antineoplastic effects . classically , cape reduces prostaglandins and leukotriene synthesis , acting as a potent anti - inflammatory agent . cape down - regulates inflammation by blocking nf-b and influences some mediators including adhesion molecules , cytokines , and inducible nitric oxide synthase . additionally , cape used as an antioxidant and anti - inflammatory agent in a number of studies about human diseases . its beneficial effects have been reported in the treatment of cancer , diabetes , kidney , liver , and neurological diseases [ 4,7 - 9 ] . on the other hand , recent findings provide new insights into the molecular mechanisms involved in the antiviral effect and activities of this natural compound . therefore , the aim of this mini - review article is to highlight the antiviral properties of cape , focusing on the mechanisms of action . the commercial form of cape is a white powder , which is soluble in ethanol , dimethyl sulfoxide , and ethyl acetate ( 50 mg ml ) . . it can be either extracted from propolis by using extraction methods or be synthesized by several methods such as response surface methodology from caffeic acid and phenethyl alcohols . the molar conversion ratio was found to be 96% and 91.2% . according to the current literature the pharmacokinetics of cape has been characterized ; the body clearance values were ranged from 42.1 to 172 ml minkgdecreasing with the higher dose of cape . the calculated volume distributions were ranged between 1,555 and 5,209 ml kg , which decreases with dose . the estimated elimination half - life was ranged from 21.2 to 26.7 min showing independence from the dose . from this point of view , it can be suggested that cape is distributed extensively into the tissues , eliminated very rapidly from the tissue , and has a high volume of distribution and short elimination half - life . cape is hydrolyzed to caffeic acid after 6 h within rat plasma in vitro and is hydrolyzed to caffeic acid as the major metabolite in vivo . although fewer drugs were licensed for the treatment of viral infections up to now , the current antiviral drugs repertoire has been increasing . antiviral drugs are generally divided into four classes ; ( i ) drugs that inhibit uncoating of viral rna ( amantadine , rimantadine , and gamma globulins ) ; ( ii ) drugs that inhibit viral nucleic acid synthesis ( dna polymerase inhibitors ; entecavir , acyclovir , idoxouridine , vidarabine , etc . ) ; ( iii ) drugs that inhibit late protein synthesis and processing ( protease inhibitors ) ; and ( iv ) immunomodulators ( interferons ) . there are various strategies for antiviral drug development including inhibition of virus adsorption , virus - cell fusion , viral dna or rna synthesis ( viral dna polymerase , reverse transcriptase ) , imp dehydrogenase , s - adenosylhomocysteine hydrolase , and inhibition of viral enzymes such as protease and neuraminidase . at the earliest , sudina et al . suggested various activities and molecular targets of cape including antiviral effect inhibiting hiv-1 integrase . therefore , cape is believed to have a potential for anti - hiv therapy . at the same time frame , fesen et al . reported that the integration step is efficiently inhibited by cape than the initial cleavage step by hiv-1 integrase ( figure 2 ) . according to their results , cape was the only compound that inhibited the integration step to a substantially greater degree than the initial cleavage step of the enzyme . it was confirmed by another study that cape had been found to inhibit the activity of hiv-1 . the mechanism of this inhibition is attributed to the unique molecular structure of cape which inhibited the reaction involved by nf-b , and interrupted the method of the treatment of multiple growing points in the life cycle of hiv . cape was demonstrated to inhibit the integration step relative to the cleavage step of integration reaction selectively . moreover , it is reported that the effect of cape derivatives on hepatitis c virus ( hcv ) proliferation has been investigated to develop more effective anti - hcv compounds . as it was mentioned before , cape inhibits the enzyme activity of some endogenous and viral proteins as well as a transcription of nf-b . shen et al . examined chemical structure and antiviral activity suggested that the length of the n - alkyl side chain and catechol moiety is responsible for the anti - hcv activity of cape . their study revealed that cape and its analog possess a significant inhibitory effect on hcv replication . hcv ns3 , which is a viral protease , was decreased at the protein level by treatment with cape in a dose - dependent manner , corresponding to the viral replication . in addition , cape and its esters , in a concentration range of 1.0 to 109.6 mm , have also been tested in an hcv replicon cell line of genotype 1b and found effective against replication of hcv . these studies suggest that cape and cape - like esters are promising therapeutic reagents for hcv treatment . on the other hand , htlv-1 is an etiologic agent for aggressive , the lethal malignancy of cd4 t - lymphocytes called adult t - cell leukemia and some other clinical disorders . shvarzbeyn and huleihel found that cape strongly prevented both tax binding to inhibitor of b and its induced degradation by tax , whereas it did not interfere in the nuclear transport of tax or nf-b proteins ( figure 2 ) . featured two hypothetical opinions about the antiviral effects of caffeic acid phenethyl ester ( cape ) . integration step is efficiently inhibited by cape than the initial cleavage step by hiv-1 integrase ( on the left ) , and cape strongly prevents both tax binding to ib and its induced degradation by tax ( on the right ) cape and four cape - like compounds ( methyl caffeate ; ethyl 3-(3,4-dihydroxyphenyl)acrylate ; phenethyl dimethyl caffeate , and phenethyl 3-(4-bromophenyl)acrylic ) synthesized from commercial caffeic acid were investigated for their anti - hiv replication in vitro and immune modulation effects in vivo . in these studies , cape and other derivatives significantly inhibited hiv replication although the mechanism was unknown . the different effects of treatment on hiv replication and cytokine modulation are guided that the compounds had a virological and immunological response by different mechanisms . among them , cape can selectively inhibit virus - transformed and oncogene - transformed rodent cells and human tumor cells . two decades ago , it was found that the integrase is essential for viral replication and a possible target for antiviral agents . however , most of these compounds possess little or no activities in tissue cultures and have no selectivity in their action mechanisms . these results indicate that cape - like compounds do not selectivity eliminate the activation of hiv integrases or the compounds inhibiting hiv integrase do not enter the cells . in a study , 30 different compounds have been tested as hiv integrase inhibitors based on the structural lead provided by cape . all of them were designed to test specific properties of the parent cape structure , which might be important for activity . the examined properties that have a potential to inhibit integrase were side chain length and composition , rigs substitution , and phenyl ring conformational orientation . dinucleotide cleavage and strand transfer , which were two sequential steps in the measured combined effects , were found to be lower in the analogs than those of cape . additionally , in literature , there are other studies on other viral agents including influenza and adenovirus . reported that cape at 8.8 m inhibited the growth of type a and b influenza virus by 95% and 92% , respectively . in the other study , treatment of the cells with an anti - il-6 receptor antibody and cape reduced the detached cell number , viral titers , and improved cell viability after infection with the pandemic influenza virs . modern medicines currently available for antiviral treatment are very expensive and sometimes ineffective ; therefore , the alternative agents from natural sources need to be extensively investigated . cape seems to be one of such promising agents for antiviral treatment because of accumulating in vivo and in vitro data . in this regard , clinical trials are needed to test the availability of cape alone and in combination with existing regimens .

in developed countries , postmenopausal osteoporosis is currently a serious problem that will only escalate in the future . multiple prognoses and aging populations indicate that there will be a significant increase ( more than 100% ) in typical osteoporotic fractures , such as proximal femur fractures , over the next several decades . the main cause of postmenopausal osteoporosis is estrogen deficiency , which increases bone resorption and accelerates bone loss . unfortunately , hormone replacement therapy ( hrt ) , which prevents hip and spinal fractures , is no longer recommended following the 2002 women 's health initiative ( whi ) study that revealed its life - threatening side effects , including the increased risk of cancer , stroke , and arteriosclerosis . phytoestrogens are hormonally active plant - derived compounds with estrogen - like effects on estrogen - dependent tissues . more specifically , phytoestrogens interact directly with the and estrogen receptors ( ers ) . both of these receptors are expressed in bone cells , including osteoclasts , osteoblasts , osteocytes , and chondrocytes . er- acts on cells by stimulating target gene transcription through two activation functions ( af1 and af2 ) . unlike er--af2 , the er--af1 pathway is tissue - specific and essential for trabecular bone growth . additionally , er- only minimally influences cortical bone in mice , as reported previously . unfortunately , most of the known phytoestrogens primarily interact with er-. examples of mild osteoprotective phytoestrogens are soy , genistein , daidzein , equol , and 8-prenylnaringenin ( 8-pn ) [ 4 , 9 , 10 ] . genistein , daidzein , and equol demonstrate higher affinities for er- , whereas 8-pn has a higher affinity for er- . 8-pn is a component of female hop cones , as well as of a crude thai drug , and is therefore a component of beer . recently , the beneficial effects of 8-pn as an herbal alternative for menopausal vasomotor complaints have been described . of all of the phytoestrogens , 8-pn has the highest affinity for the er- receptor and is therefore an attractive molecule for osteoporosis research . previous evidence has demonstrated the osteoprotective effects of 8-pn [ 4 , 15 , 16 ] . there are no data on the osteoprotective effects of 8-pn in vertebrae or femora , which have a main role in osteoporosis . furthermore , in these former studies , the dosage of 8-pn varied considerably . in some , this dosage is not advisable because the risk for endometrial cancer is increased via an er- receptor - driven mechanism [ 17 , 18 ] . from the oncological point of view an osteoprotective treatment with 8-pn is only reasonable if there is no increased risk of cancer . thus , we wanted to investigate the effects of 8-pn on femora and vertebrae at a safe dose . whole - body vibration is a safe and successful treatment . according to the mechanostat model described by frost mechanical stress stimulates osteocytes , osteoblasts , and other cells of the bone lining to produce bone matrix via multiple pathways . the use of vibration has been shown to increase both cortical and trabecular bone in animals . the aim of this study was to evaluate the combined effects of 8-pn , an er- agonist , and whole - body vertical vibration ( wbvv ) as an osteoporosis treatment for the first time . we used the ovariectomized rat , which is a standard animal model for osteoporosis research . osteoporosis predominantly affects trabecular bones , such as the distal radius , femoral neck , and vertebral body . because vertebral and femoral fractures are an important indicator of the progression of osteoporosis , lumbar vertebrae and femora were analyzed . all of the procedures were approved by the local institutional animal care and use committee ( permission number 33.9 - 42502 - 04 - 12/0854 , district authorities of oldenburg , germany ) . consistent with recommendations in previous studies , experiments were performed on 64 three - month - old female sprague - dawley rats weighing 230290 g ( fa . the rats were maintained according to german animal protection laws and fed a soy - free diet ( ssniff special diet , soest , germany ) . a total of 52 rats were ovariectomized ( n = 52 ) at the age of three months . the other 12 rats were not subjected to surgery ( non - ovx , n = 12 ) . the rats not operated on were placed in group 1 ( non - ovx ) . group 3 ( ovx + vib ) contained ovariectomized rats treated with low - magnitude , high - frequency wbvv . groups 4 ( ovx-8-pn ) and 5 ( ovx-8-pn + vib ) received injections of 8-pn ( orgentis chemicals gmbh , gatersleben , germany ) five weeks after ovariectomy . rats in group 5 ( ovx-8-pn + vib ) were treated with both 8-pn and wbvv . for wbvv treatment , the rats were placed on a vibration platform twice daily for 15 min each , 5 days per week for 10 weeks beginning five weeks after ovariectomy . the vibration motor was constructed by schultheis ( vibra drehstrom - vibrationsmotor typ hvl / hve , offenbach , germany ) , and it vibrated at a frequency of 35 hz with a mean amplitude of 0.47 mm . transmitted acceleration rate measured at the back of the rat was 0.2 g. rats treated with 8-pn received daily subcutaneous injections of 8-pn at a concentration of 1.77 mg / kg for ten weeks beginning five weeks after ovariectomy . 98% by hplc ) was diluted in 30% hydroxypropyl--cyclodextrin ( applichem gmbh , darmstadt , germany ) . the lumbar vertebrae were removed for ashing for mineral content analysis ( second lumbar vertebrae ) , biomechanical testing ( third lumbar vertebrae ) , microcomputed tomography ( fourth lumbar vertebrae ) , and gene expression analysis ( sixth lumbar vertebrae ) . the vertebrae were stored in tubes at 20c until the analyses were performed . for gene expression analysis , biomechanical tests were performed according to the protocol standardized by sehmisch et al . . a mechanical testing machine ( zwick , type 145 660 z020/tnd , ulm , germany ) was used to measure the resistance of the lumbar vertebrae to force . the thawed vertebrae were fixed to the aluminum base ( figure 1(a ) ) , and the stamp was lowered at a speed of 50 mm / min with a primary force of 1 n to fix the upper body plate . measurements were obtained with a relative accuracy of 0.20.4% over the range of 2500 n. the measurements were automatically stopped when the linear increase of the curve declined more than 10 n. strength admission was recorded using testxpert software ( zwick , ulm , germany ) . we tested the femora in a similar way as described by tezval et al . we quantified the maximum load ( fmax ) , yield load ( yl ) , and stiffness ( s ) as described by sehmisch et al . the maximum load ( fmax ) is the most force that the ground plate can withstand . the yield load ( yl ) is the inflection point from elastic deformation to plastic deformation . an explore locus sp microcomputed tomography scanner ( ge healthcare , chalfont st giles , uk ) was used to analyze bone mineral density and other structural bone properties . each scan included six vertebrae simultaneously . to compare the different scans , a test block was integrated into every scan . the test block consisted of five different materials with known mineral densities . to generate 3d models , gehc micro view v. 2.1.2 ( ge healthcare , chalfont st giles , uk ) was used . we measured the following properties consistent with asbmr nomenclature : trabecular thickness ( tb.th ) , trabecular number ( tb.n ) , cortical thickness ( ct.th ) , number of trabecular nodes ( n.nd ) , and bone volume fraction ( bv / tv ) [ 27 , 28 ] . the vertebral body volume was calculated using the formula for a cylinder . for this calculation , the 2 cranial and 2 caudal perpendicular diameters and the dorsal and ventral heights were measured on the 3d images . for these tests , 150 m thick sagittal sections of femoral heads were used . the sections were cut out between the epiphyseal and intertrochanteric line . a leica microscope ( leica - systems mz 7.5 , wetzlar , germany ) we measured trabecular nodes ( n.nd ) , trabecular connectivity [ n.nd/mm ] , trabecular bone area , trabecular thickness ( tb.wi ) , trabecular density , and cortical density . the second lumbar vertebrae were heated in a muffle oven at 750c for 30 min , and the bones were weighed to the nearest 0.00001 g before and after ashing . the mineral content ( ash weight ) is expressed relative to the wet weight of each vertebra ( % ) . the calcium content was assessed using an atomic absorption spectrometer ( 4100 , perkinelmer , waltham , usa ) according to cen . the orthophosphate content was measured using a colorimetric method ( zeissdm4 spectrophotometer , oberkochen , germany ) according to cen . alkaline phosphatase ( alp ) activity was measured in blood samples using an electrochemiluminescence immunoassay ( roche diagnostics , mannheim , germany ) . the immunoassay was performed according to the manufacturer 's instructions ( roche diagnostics , mannheim , germany ) . for gene expression analyses , the sixth lumbar vertebrae were homogenized using a micro - dismembrator s ( sartorius , gttingen , germany ) . the rneasy mini kit ( qiagen , hilden , germany ) was used to extract the rna , and the rna was reverse - transcribed using superscript rnase h - reverse transcriptase ( promega , mannheim , germany ) . the expression levels of alkaline phosphatase ( alp ) , receptor activator of nuclear factor b ligand ( rankl ) , osteocalcin , tartrate - resistant acid phosphatase ( trap ) , and osteoprotegerin ( opg ) were measured using quantitative real - time polymerase chain reaction ( qrt - pcr ) based on sybr green detection ( quantitect sybr green pcr kit , qiagen ) in an icycler ( cfx96 , bio - rad laboratories , munich , germany ) . primers from qiagen ( quantitect primer assays , qiagen ) were used , and quantitative real - time pcr was performed according to the manufacturer 's instructions . gene expression was calculated using the 2 method , and the results shown are normalized to the gene expression in untreated female rats ( non - ovx ) . significant differences were analyzed by one - way anova with a tukey - kramer post hoc test ( graph pad prism , san diego , usa ) . at the beginning of the study , the rats had approximately the same weights ( 260 12.2 g ) . . the non - ovx rats also increased in body weight by the end of the evaluation period ( 15 weeks ) , which is consistent with normal growth . however , the non - ovx rats gained significantly less weight than the ovariectomized rats ( table 1 ) . only ovariectomized rats treated with 8-pn and wbvv ( ovx-8-pn + vib ) demonstrated no significant increase compared with non - ovx rats . as expected , the uterine wet weight was highest in the non - ovx rats . ovariectomized rats treated with 8-pn tended to have higher uterine wet weights than those of the other ovariectomized rats ( figure 2 ) . to exclude the effects of different vertebral body sizes and volumes , all fmax , yl , and stiffness measurements were normalized to the bone volume determined in the micro - ct analysis . in our study , treatment with 8-pn did not improve the biomechanical properties of vertebrae ( figure 3 ) . in contrast , single therapy using 8-pn significantly worsened the biomechanical properties compared with those of non - ovx rats and tended to worsen these properties compared with untreated ovariectomized rats . single therapy with wbvv did not significantly affect the fmax , yl , or stiffness compared with those of ovariectomized rats that received no treatment ( figure 3 ) . in contrast to the results for the vertebrae , treatment with 8-pn as a single therapy caused no significant decrease in the biomechanical properties in the femora compared with those of non - ovx rats and a slight but nonsignificant increase compared with those of untreated ovariectomized rats ( figure 4 ) . dual therapy with wbvv and 8-pn caused no significant improvements in ovariectomized rats . altogether , the results in the femora are consistent with the results shown in the vertebrae . the bone mineral density ( bmd ) significantly decreased after treatment with wbvv compared with that in untreated ovariectomized rats ( figure 5 ) . neither treatment with 8-pn alone nor dual therapy with wbvv and 8-pn showed improving effects on the bmd of ovariectomized rats . non - ovx rats had significantly higher bmd than that of all ovariectomized rats irrespective of any therapy . in the bv / tv of trabecular bone , treatment with 8-pn alone and as adjunctive therapy showed a slight increase but with no statistical effect . for the trabecular thickness ( tb.th ) , trabecular number ( tb.n ) , and cortical thickness ( ct.th ) , no improving effects of 8-pn or wbvv were observed compared with the values in untreated ovariectomized rats . neither vibration therapy nor treatment with 8-pn or adjunctive therapy had a significant effect on the structural bone properties in the femoral neck . the non - ovx rats had significantly higher mineral content than that of the ovariectomized rats . compared with untreated rats , rats treated with wbvv ( ovx + vib , ovx-8-pn + vib ) had lower mineral contents ( table 1 ) . ovariectomized rats treated with wbvv alone had significantly higher concentrations of alkaline phosphatase ( alp ) ( ovx + vib 149.6 33.8 u / i ) than that of ovariectomized rats that received no treatment ( ovx 113.4 18.3 u / i ) ( table 1 ) . treatment with 8-pn alone ( ovx-8-pn 137.4 28.1 u / i ) and dual therapy with wbvv ( ovx - pn + wbvv 135.9 8.4 ) also caused significantly increased alp levels compared with that in non - ovx rats but with no statistical effects compared with untreated ovariectomized rats . the mrna - expression of the bone - resorptive enzyme alp significantly increased in the rats treated with wbvv and 8-pn as dual therapy compared with untreated ovariectomized rats ( table 1 ) . single treatment with 8-pn and wbvv resulted in a nonsignificant increase in alp - mrna . the non - ovx rats had the lowest expression of rankl - mrna . a nonsignificant increase in opg expression several recent studies have investigated vibration or phytoestrogen treatment as potential new therapies for osteoporosis [ 4 , 9 , 19 , 30 , 31 ] . almost all phytoestrogens tested in previous studies predominately acted via the estrogen receptor er- [ 4 , 10 , 11 , 32 ] . in contrast to er- , the estrogen receptor er- exerts crucial effects on trabecular and cortical bone . of all of the phytoestrogens however , to date , there has only been limited research into the effects of 8-pn on osteoporosis and on bones in general [ 4 , 15 , 16 ] . osteoprotective effects were only shown in tibia and not in femora or spine , which are predominately affected by osteoporosis . from the authors ' point of view , conclusive data supporting the benefits of 8-pn as an osteoprotective drug in the case of osteoporosis are still lacking . in the present study , we could not demonstrate fundamental improvements in osteoporotic vertebrae and femora after treatment with 8-pn . neither the biomechanical nor the morphological properties improved significantly in our study . instead , we could demonstrate that 8-pn nonsignificantly worsened the biomechanical properties and bmd in the vertebrae . in contrast to the bone data , a slight increase in uterine weight confirmed the systemic estrogen - like effects . our results for the biomechanical and structural bone parameters in femora and vertebrae differ from those of previous studies . in 2008 , sehmisch et al . however , only minimal improvements in bone structure were observed . in 1998 , miyamoto et al . showed an increase in bmd after the administration of 8-pn . however , none of these studies tested femora or spine parameters . additionally , the rates and methods of 8-pn administration differed considerably . the dosages in these previous studies differed from 1.77 mg / kg per day to 68 mg / kg per day [ 4 , 15 , 16 ] . even the 1.77 mg / kg dosage demonstrated a weak stimulation of endometrial luminal epithelial cells due to an er--driven mechanism . in the present study , we administered 8-pn subcutaneously at a dose of 1.77 mg / kg to determine whether a cancer - safe dose has beneficial effects on an osteoporotic spine and femora neck . , the administration of a higher 8-pn concentration to improve osteoprotective effects is not advisable due to safety reasons . mechanical stimulation by vibration therapy has shown beneficial effects on the structure and biomechanical properties of bones , including vertebrae , in several animal studies of osteoporosis [ 19 , 22 , 30 , 33 , 34 ] . a systemic meta - analysis in 2010 showed significant but small effects in postmenopausal women . in the present study , we could not demonstrate significant improvements in the biomechanical properties and bone structure after wbvv . the effects of wbvv as a single or adjunctive therapy were more pronounced in previous studies [ 19 , 22 , 30 , 31 ] . however , all of these studies were performed on different bones ( tibia , femur , and lumbar vertebrae ) and at varying frequencies . we used a frequency of 35 hz and amplitude of 0.47 mm in our study based on our own previous and external studies [ 3436 ] . compared with ovariectomized rats that received no treatment , rats that received wbvv treatment showed higher bone turnover , as demonstrated by increased rankl , alp , and osteocalcin expression . however , overall , we could not confirm that beneficial effects were exerted on bones in our setting . in our opinion , the optimal setting including frequency , amplitude , and acceleration for wbvv has not yet been determined , and data in the literature for the rat osteopenia model are contradictory [ 31 , 34 , 35 ] . in the present study , only bone parameters were investigated . it is reasonable that muscle status can be improved by wbvv . increased muscle strength is beneficial for preventing falls and maintaining bone mass . further studies are needed to study the integral effects of vibration therapy in the case of osteoporosis . the present study is the first to investigate a dual treatment using wbvv and 8-pn . according to our results , adjunctive therapy with 8-pn and wbvv at 35 hz has no effects on bones , which are predominately affected by osteoporosis . in conclusion , we can not confirm the osteoprotective effects of 8-pn at a cancer - safe dose in primary affected osteoporotic bones . in our opinion , higher concentrations of 8-pn are not advisable due to safety reasons . further studies are needed to investigate the integral effects and best setting of wbvv in the case of osteoporosis .

carcinoid tumors are rare neuroendocrine tumors arising from enterochromaffin cells typically located in the lungs or gastrointestinal tract . the tumors release serotonin and other vasoactive substances which are classically associated with carcinoid syndrome , characterized by episodic vasomotor flushing , secretory diarrhea , bronchospasm and hypotension . upon diagnosis up to 30% once released , the active serotonin is metabolized by monoamine oxidases in the liver , lungs and brain to metabolically inactive 5-hydroxyindoleacetic acid ( 5-hiaa ) , which is renally cleared . when liver metastasis occurs , the heart is exposed to intermittently high levels of vasoactive substances , which is believed to result in endocardial damage . cardiac involvement is characterized by endocardial plaque - like deposits found predominantly on right - sided heart valves , resulting in thickening , retraction and fixation of the right heart valves , valvular dysfunction and , eventually , right - sided heart failure , determined as carcinoid heart disease . although serotonin levels in patients with carcinoid heart disease are generally higher than in those without cardiac involvement , it is unclear what factors are involved in the progression of the cardiac lesions . in rare cases , exposure of the heart follows a route through the thoracic duct , bypassing the liver . right ventricular failure remains a major cause of morbidity and mortality in patients with carcinoid heart disease . left - sided cardiac involvement can also occur in < 10% of patients and is frequently associated with a patent foramen ovale ( pfo ) [ 6 , 7 ] . in addition , pfo could be a result of progressive right - sided cardiac dilatation secondary to valve insufficiency . we present a case with severe tricuspid valve regurgitation as a result of persistent serotonin load due to a mid - gut carcinoid tumor metastasized to the liver and illustrate the perioperative risks involving right - sided heart failure during liver surgery . a 66-year - old woman was analyzed for a changed defecation pattern characterized by diarrhea . her medical history revealed ductal carcinoma in situ for which breast - conserving surgery had been performed 3 years earlier . there was a holosystolic murmur ( grade 4/6 ) radiating to the right side of the chest , suggestive of tricuspid valve regurgitation . colonoscopy showed a benign cecal polyp and a focal lesion in the terminal ileum clinically suggestive for neuroendocrine tumor or lipoma . additional computed tomography of the abdomen showed a mass in relation to the terminal ileum with locoregional deposition and hepatic metastasis with a 3 cm lesion in segment 3 and a 12 cm lesion in segment 6 ( fig . 1 ) . laboratory values revealed increased levels of serum chromogranin a ( 444 g / l , normal 0120 g / l ) and urinary 5-hiaa ( 798.3 mol/24 h , normal 10.547.1 mol/24 h ) . preoperative cardiac analysis showed severe tricuspid valve regurgitation due to malcoaptation of the valve slips with a pressure gradient of 22 mm hg and concomitant systolic blood flow reversal in the hepatic veins . the patient was found eligible for right hemicolectomy and metastasectomy from segments 3 and 6 . despite selective occlusion of arterial and portal inflow of the liver and low central venous pressure , serious blood loss occurred during dissection of the liver due to a pulsatile systolic blood flow reversal in the hepatic veins with concomitant systolic peaks on the central venous pressure curve ( fig . pathologic analysis of the resected tissue showed low - grade carcinoid with liver metastasis with clear margins . postoperatively the patient developed electrocardiography ( ecg ) changes in relation to sinus tachycardia consisting of diffuse st elevation and negative t waves in the inferior leads ( fig . 3 ) . echocardiography at that moment showed no changes in myocardial motility and troponin - i levels remained negative . the patient recovered without complications after surgery and was discharged from hospital after 8 days . the tumor as well as the metastases turned out to be resected completely . at follow - up clinical manifestations of carcinoid syndrome echocardiography done at follow - up 3 months postoperatively showed significant recovery of the tricuspid valve regurgitation and recovery from right - sided heart failure . these findings are in line with the known literature , where echocardiographic features include thickening of valve leaflets that become retracted and eventually immobile , resulting in a combination of valvular regurgitation and stenosis . in a report describing clinical and echocardiographic features in a group of patients with carcinoid heart disease , in addition , doppler examination of the hepatic veins may also show a systolic flow reversal , consistent with severe tricuspid regurgitation as shown in our patient . the severity of pulmonary stenosis may be underestimated because of a low cardiac output and severe tricuspid regurgitation . furthermore , pfo is an important marker for carcinoid disease progression and is advised to be systematically assessed during echocardiography . tricuspid valve regurgitation is shown to be reversed if exposure of the heart to high serotonin levels is discontinued . this phenomenon was already seen 3 months postoperatively with echocardiography during follow - up in our patient . in this respect , resection of the hepatic metastasis is the primary treatment for tricuspid valve regurgitation , whereas valve replacement should only be considered after insufficient valve recovery . the event in our patient , noticed by marked ecg findings , seems to be rare , with only two reports describing ecg changes in relation to serotonin - producing carcinoid tumors [ 9 , 10 ] . it is believed that serotonin may affect coronary spasms , mimicking acute coronary syndrome with typical ecg changes , which may even lead to coronary stent placement and balloon dilatation . however , in our patient these ecg changes only occurred in the direct aftermath of the surgery , which could be caused by temporarily occurring coronary vasospasm due to high circulating serotonin levels caused by manipulation of the tumor and the metastases during surgery . the absence of elevated serum troponin - i levels , normal myocardial function and complete spontaneous recovery of ecg changes are supporting evidence for this hypothesis ( fig . 3 ) . metastasized carcinoid tumors have a relatively benign prognosis since these tumors grow slowly . however , when carcinoid heart disease is involved , median survival is only 14 years , referring to the latest numbers . combinations of cytotoxic agents , somatostatin analogues or hepatic artery embolization have neither been shown to be effective in patients with metastatic mid - gut carcinoid tumors , nor have these modalities been shown to have any effect on carcinoid heart disease . the only effective treatment known is hepatic resection , which is associated with decreased progression and an improved prognosis in patients with carcinoid heart disease . hence , resection of the primary tumor as well as hepatic metastases should be considered as primary treatment if preoperative evaluation reveals that over 90% of primary and regional disease can be resected [ 13 , 14 ] . however , a potential hazard for surgery and anesthesia is right - sided cardiac impairment , which is highly related to hepatic metastases . therefore , patients with high carcinoid burden who are planned for surgical resection should be analyzed systematically for their cardiac condition . adequate preparations should be planned in order to avoid peri- as well as postoperative cardiac complications .

however , it is an insertion element for muscles , ligaments , and fasciae attached to the mandible , clavicle , sternum , cranium , and cervical vertebrae . the hyoid bone is an important part of the musculoskeletal apparatus of the craniofacial complex and factors affecting this system might have not only local but systemic effects as well.1 mandibular repositioning by advancement or setback surgeries reportedly changes the position of the hyoid bone by causing alterations in the tension of the suprahyoid and infrahyoid muscles , neck extensor muscles , and cervical fasciae.2 - 4 its position also changes in relation to postural changes of the head and tongue , malocclusion , and facial type.1,5 - 9 several authors reported that the position of the hyoid bone is affected by the biomechanics of the suprahyoid and infrahyoid muscles and the elastic membranes of the larynx and trachea.10,11 andersen,12 subtelny and sakuda,13 and haralabakis et al.9 studied the position of the hyoid bone in patients with open bite and observed the stability of its vertical position . however , haralabakis et al.,9 who also evaluated the horizontal position of the hyoid bone according to a vertical line drawn from the frankfort horizontal ( fh ) plane at porion , reported that it is positioned more posteriorly in patients with open bite . yet the horizontal distance of the hyoid bone from the cervical spine , pharynx , and mandibular plane ( mp ) is not influenced by open bite . in most previous studies , cephalometric measurements were used to determine hyoid bone positioning . however , as this bone moves forward and upward during swallowing , evaluation of its movements during deglutition is more important than investigating its static position . mays et al.14 evaluated the influence of craniofacial morphology on hyoid bone movements by videofluoroscopy and demonstrated that the forward displacement of the hyoid bone during liquid swallowing is significantly related to craniofacial morphology . for instance , as the fh - mp angle ( fma ) increases , the forward displacement of the hyoid bone decreases . these authors suggested that the observed effects are related to the biomechanics of the suprahyoid musculature . sloan et al.15 also analyzed hyoid bone behavior during deglutition by cinefluorography and detected two distinct movement patterns : a circular pattern and an oblique , elliptical pattern . postural changes in the mandible and tongue affect the position of the hyoid bone.5 - 8 open bite is usually associated with posterior rotation of the mandible and changes in the tongue posture and deglutitive tongue movements.16 - 18 therefore , open bite may also affect the position and movements of the hyoid bone during deglutition . the aim of this retrospective study was to assess the position and movements of the hyoid bone during deglutition in patients with open bite by real - time balanced turbo field echo ( b - tfe ) cine magnetic resonance imaging ( cine mri ) . the cine mri images used in this study were selected from records obtained to evaluate deglutitive tongue movements in patients with open bite and class ii malocclusions.18,19 this study was initiated after obtaining institutional approval from gulhane military medical academy 's ethics committee ( 1491 - 373 - 07 ) . images of 36 patients with normal overjet ( 1 - 3 mm ) were selected . g*power software ( v3.1.3 ; franz faul , universitat kiel , germany ) was used to determine the power of the sample size.20 a sample size of 36 patients was considered sufficient to provide more than 60% power for detecting significant differences with an effect size of 0.30 between groups at a 0.05 significance level . two groups were formed according to the presence of anterior open bite ( at least -2 mm ) . the open bite group ( obg ) included 18 patients ( 14 girls and 4 boys ) with a mean age of 14.5 2.7 years and mean overbite of -4.9 1.9 mm . the control group ( cg ) comprised 18 patients ( 11 girls and 7 boys ) with a mean age of 16.4 0.9 years and mean overbite of 1.9 0.7 mm . cephalometric analyses revealed that 4 patients in the obg and 2 patients in the cg had mild skeletal class ii malocclusions with an anb angle of 5 , although their overjet was in the normal range . other patients had skeletal class i malocclusions and anb angles ranging from 1 to 4. in the obg , the mp angle ( sn - gogn ) was 35.56 1.69 , fma was 28.17 1.62 , and the palatal plane ( pp ) angle ( sn - pp ) was 5.72 1.28 , revealing posterior rotation of the mandible and anterior rotation of the pp . in the cg , these measurements were 32.61 1.33 , 23.83 1.29 , and 7.28 1.32 , respectively . none of the patients had complaints related to masticatory difficulty , dysphasia , or swallowing disorders . a detailed description of the dynamic images obtained by b - tfe cine mri ( new intera nova ; philips medical systems , best , the netherlands ) has been presented in our previous reports.18,19 figure 1 shows the anatomical structures visible on these images . for each patient , images of the following 4 stages of deglutition during water swallowing were determined by a consensus of 3 specialists and printed on radiographs . stage 1 ( oral preparatory stage ) : the tongue tip contacts the maxillary incisors and/or the palatal mucosa ( figure 2a ) . stage 2 ( oral stage ) : the dorsum of the tongue loses contact with the soft palate ( figure 2b ) . stage 3 ( pharyngeal stage ) : the bolus crosses the posterior or inferior margin of the mandibular ramus ( figure 2c ) . stage 4 ( esophageal stage ) : the bolus enters the esophageal opening ( figure 2d ) . to determine the position and movements of the hyoid bone during deglutition , linear measurements were obtained from the printed radiographs by the same investigator ( sg ) to avoid inter - examiner variability . the distance between the hyoid bone and point sella ( h - s ) , the vertical distance between the hyoid bone and pp ( h - pp ) , and the vertical distance between the hyoid bone and a line connecting the most anteroinferior point of the third cervical vertebra and retrognathion ( h - c3rgn ) were used to evaluate the vertical movement of the hyoid bone . the horizontal movement was evaluated by measuring the distances between the hyoid bone and the most anteroinferior point of the third cervical vertebra ( h - c3 ) as well as the distance between the hyoid bone and retrognathion ( h - rgn ) ( figure 3 ) . the measurements of 10 patients were repeated 1 month later , and reliability was evaluated by using intraclass correlation coefficients ( iccs ) and bland - altman plots . all statistical analyses were performed with spss for windows ( version 15 , ibm spss inc . , the shapiro - wilks and levene tests were applied to the data and mean ages , which were both found to be normally distributed and showed homogeneity of variance between groups . within - group differences in the stages of deglutition were analyzed with the paired - samples t - test . repeated - measures analysis of variance ( anova ) was used to evaluate the differences between groups and the significance of the interaction between stages and groups . the cine mri images used in this study were selected from records obtained to evaluate deglutitive tongue movements in patients with open bite and class ii malocclusions.18,19 this study was initiated after obtaining institutional approval from gulhane military medical academy 's ethics committee ( 1491 - 373 - 07 ) . images of 36 patients with normal overjet ( 1 - 3 mm ) were selected . g*power software ( v3.1.3 ; franz faul , universitat kiel , germany ) was used to determine the power of the sample size.20 a sample size of 36 patients was considered sufficient to provide more than 60% power for detecting significant differences with an effect size of 0.30 between groups at a 0.05 significance level . two groups were formed according to the presence of anterior open bite ( at least -2 mm ) . the open bite group ( obg ) included 18 patients ( 14 girls and 4 boys ) with a mean age of 14.5 2.7 years and mean overbite of -4.9 1.9 mm . the control group ( cg ) comprised 18 patients ( 11 girls and 7 boys ) with a mean age of 16.4 0.9 years and mean overbite of 1.9 0.7 mm . cephalometric analyses revealed that 4 patients in the obg and 2 patients in the cg had mild skeletal class ii malocclusions with an anb angle of 5 , although their overjet was in the normal range . other patients had skeletal class i malocclusions and anb angles ranging from 1 to 4. in the obg , the mp angle ( sn - gogn ) was 35.56 1.69 , fma was 28.17 1.62 , and the palatal plane ( pp ) angle ( sn - pp ) was 5.72 1.28 , revealing posterior rotation of the mandible and anterior rotation of the pp . in the cg , these measurements were 32.61 1.33 , 23.83 1.29 , and 7.28 1.32 , respectively . none of the patients had complaints related to masticatory difficulty , dysphasia , or swallowing disorders . a detailed description of the dynamic images obtained by b - tfe cine mri ( new intera nova ; philips medical systems , best , the netherlands ) has been presented in our previous reports.18,19 figure 1 shows the anatomical structures visible on these images . for each patient , images of the following 4 stages of deglutition during water swallowing were determined by a consensus of 3 specialists and printed on radiographs . stage 1 ( oral preparatory stage ) : the tongue tip contacts the maxillary incisors and/or the palatal mucosa ( figure 2a ) . stage 2 ( oral stage ) : the dorsum of the tongue loses contact with the soft palate ( figure 2b ) . stage 3 ( pharyngeal stage ) : the bolus crosses the posterior or inferior margin of the mandibular ramus ( figure 2c ) . stage 4 ( esophageal stage ) : the bolus enters the esophageal opening ( figure 2d ) . to determine the position and movements of the hyoid bone during deglutition , linear measurements were obtained from the printed radiographs by the same investigator ( sg ) to avoid inter - examiner variability . the distance between the hyoid bone and point sella ( h - s ) , the vertical distance between the hyoid bone and pp ( h - pp ) , and the vertical distance between the hyoid bone and a line connecting the most anteroinferior point of the third cervical vertebra and retrognathion ( h - c3rgn ) were used to evaluate the vertical movement of the hyoid bone . the horizontal movement was evaluated by measuring the distances between the hyoid bone and the most anteroinferior point of the third cervical vertebra ( h - c3 ) as well as the distance between the hyoid bone and retrognathion ( h - rgn ) ( figure 3 ) . the measurements of 10 patients were repeated 1 month later , and reliability was evaluated by using intraclass correlation coefficients ( iccs ) and bland - altman plots . all statistical analyses were performed with spss for windows ( version 15 , ibm spss inc . , the shapiro - wilks and levene tests were applied to the data and mean ages , which were both found to be normally distributed and showed homogeneity of variance between groups . within - group differences in the stages of deglutition were analyzed with the paired - samples t - test . repeated - measures analysis of variance ( anova ) was used to evaluate the differences between groups and the significance of the interaction between stages and groups . the iccs for h - s , h - c3rgn , h - pp , h - c3 , and h - rgn measurements were 0.99 ( 95% confidence interval [ ci ] = 0.96 to 0.99 ) , 0.86 ( 95% ci = 0.40 to 0.96 ) , 0.98 ( 95% ci = 0.92 to 0.99 ) , 0.96 ( 95% ci = 0.83 to 0.99 ) , and 0.97 ( 95% ci = 0.90 to 0.99 ) , respectively . mean values and standard deviations of the measurements according to the stages are shown for both obg and cg . with regard to the vertical movement of the hyoid bone ( tables 2 and 3 ) , the obg and cg showed significant decreases in the h - s measurement ( p < 0.001 and p < 0.01 , respectively ) between stages 1 and 2 and between stages 1 and 3 . however , the groups showed significant increases ( p < 0.001 and p < 0.01 , respectively ) at stage 4 , as determined by the comparisons between stages 2 and 4 and stages 3 and 4 . however , only the obg showed a significant difference between stages 1 and 4 ( p < 0.05 ) . similarly , the h - c3rgn measurement significantly decreased between stages 1 and 2 and between stages 1 and 3 , but significantly increased between stages 2 and 4 and stages 3 and 4 in the obg ( p < 0.01 ) . on the other hand , in the cg , this measurement showed significant changes only between stages 1 and 2 ( p < 0.01 ) and stages 1 and 3 ( p < 0.05 ) . moreover , both groups showed significant decreases in the h - pp measurement at stages 2 and 3 when compared with stage 1 ( p < 0.001 for the obg ; p < 0.01 and p < 0.001 , respectively , for the cg ) . significant increases in this measurement were also found between stages 2 and 4 and between stages 3 and 4 in the obg ( p < 0.001 ) and cg ( p < 0.05 and p < 0.01 , respectively ) . figures 5a-5c show the displacement of the hyoid bone according to the h - s , h - c3rgn , and h - pp measurements in both groups . the hyoid bone was located more inferiorly at all stages in the obg than in the cg . in terms of the h - s and h - c3rgn measurements , however , in the case of h - pp , the hyoid bone reached its most superior position at stage 2 in the obg . in the evaluation of the horizontal movement ( tables 2 and 3 ) of the hyoid bone , a significant increase in the h - c3 measurement was observed in between stages 1 and 2 in the obg ( p < 0.001 ) and cg ( p < 0.01 ) . although the increases between stages 1 and 3 and stages 1 and 4 were not significant in the obg ( p > 0.05 ) , they were significant in the cg ( p < 0.05 ) . the h - c3 measurement decreased between stages 2 and 3 , stages 2 and 4 , and stages 3 and 4 in both groups , but a significant change was determined only between stages 2 and 4 in the obg ( p < 0.05 ) . when the h - rgn measurement was evaluated , a significant decrease between stages 1 and 2 was found in both the obg ( p < 0.05 ) and the cg ( p < 0.001 ) . a significant decrease was also found between stages 1 and 3 in the cg ( p < 0.05 ) . this measurement increased between stages 2 and 3 , stages 2 and 4 , and stages 3 and 4 in both groups , but significant changes were determined only between stages 2 and 3 and stages 2 and 4 in the obg ( p < 0.05 ) . the hyoid bone was closer to the third cervical vertebra and retrognathion at all stages in the obg when compared to the cg ( figure 5d and 5e ) . according to h - c3 and h - rgn measurements , the hyoid bone reached its most anterior position at stage 2 and returned to its normal position gradually during stages 3 and 4 in both groups . interactions between groups and stages had no significant effects on the measurements ( p > 0.05 ) . however , when these factors were analyzed individually , the effects of group on the measurements were found to be significant ( p < 0.001 for h - s , h - pp , and h - rgn ; p < 0.01 for h - c3rgn and h - c3 ) . similarly , stage also had significant effects ( p < 0.001 for h - s and h - pp ; p < 0.01 for h - rgn , h - c3rgn , and h - c3 ) ( table 4 ) . the hyoid bone moves upward and downward by the contraction of the suprahyoid musculature and relaxation of the cricopharyngeus.21 this synergistic contraction and relaxation also facilitates displacement of the tongue , pulls the larynx forward and upward , and opens the upper esophageal sphincter , permitting the bolus to enter the esophagus.21,22 these phenomena are accompanied by the sealing of the larynx , which is essential for safe swallowing . as the suprahyoid muscles are attached to several craniofacial landmarks , including the mandibular symphysis , inferior border of the mandible , base of the skull , and tongue , a relationship exists between the hyoid , tongue , and mandible during swallowing . previous studies using cine mri revealed that movements during deglutition are affected by the dentofacial morphology and adaptive changes at the tip , dorsum , and root of the tongue.18,23 - 25 fujiki et al.17 and akin et al.18 reported compensatory coordination of tongue movement , soft palate movement , and pharyngeal constrictor muscle activity during deglutition in patients with open bite , but the effects on hyoid bone movements during deglutition were not evaluated . therefore , we evaluated the effects of anterior open bite on hyoid bone movements during deglutition by cine mri , a noninvasive and reliable technique . to the best of our knowledge , no such study has ever been performed . the turbo - flash sequence was preferred because this sequence provides the best temporal resolution and sufficient spatial resolution during motion.26 water - swallowing sets are reportedly more reliable than dry - swallowing sets for distinguishing the stages of deglutition because the borders of soft tissues , especially the tongue , can be easily and correctly determined.23 in this study , we used 10 ml water as the bolus . standardization of the bolus volume is also important because it affects the movements of the hyoid bone.27 in the current study , the vertical measurements revealed that patients with open bite had an inferiorly positioned hyoid bone during all stages of deglutition . when the movement of the hyoid bone was evaluated according to sella and the plane connecting the third cervical vertebra and retrognathion , both groups showed superior displacement of the hyoid bone from stage 1 to stages 2 and 3 . the hyoid bone reached its most superior position at stage 3 and nearly returned to its initial position at stage 4 . however , evaluation according to the pp revealed that the hyoid bone reached its most superior position at stage 2 in patients with open bite . this difference is probably related to anterior rotation of the pp frequently encountered in patients with anterior open bite . andersen12 and subtelny and sakuda13 compared the vertical positions of the hyoid bone between patients with open bite and those with normal occlusion . however , supporting our results , haralabakis et al.9 found that the distance between the hyoid bone and pp is greater in patients with open bite , indicating an inferior position of the hyoid bone . with regard to the horizontal measurements , the hyoid bone was closer to both the third cervical vertebra and retrognathion in patients with open bite . however , posterior rotation of the mandible is common in patients with anterior open bite28 and may explain our findings . depending on posterior mandibular rotation , the symphysis the horizontal measurements revealed that , in both groups , the hyoid bone was displaced anteriorly from stage 1 to stage 2 , reached its most anterior position at stage 2 , and was gradually displaced in a posterior direction at stages 3 and 4 . the inferior and posterior positioning of the hyoid bone during all stages of deglutition in patients with open bite can be explained by the released tension of the suprahyoid muscles . similar to our findings , many previous studies have showed a close association between the inclination of the hyoid bone and mandibular inclination.7,9,29 tallgren and solow7 reported that the vertical positional changes in the hyoid bone follow the patterns of change in mandibular inclination , whereas the horizontal positional changes mainly follow the changes in cervical inclination and craniofacial angulation . in our opinion , the closer position of the hyoid bone to the third cervical vertebra in patients with open bite is related to hyperextension of the head in these patients , causing the cervical spine to be stretched and decreasing the distance between the third cervical vertebra and hyoid bone . in accordance with our view , opdebeeck et al.30 reported that the cross - section of the lower pharynx is reduced and that the hyoid bone is closer to the cervical spine in subjects with a high fma . encroachment of the vital pharyngeal space induces stretching of the cervical spine and hyperextension of the head . jena and duggal,29 who evaluated hyoid bone position in subjects with different vertical jaw dysplasias , also reported that subjects with short face and long face syndromes have anteriorly and posteriorly positioned hyoid bones , respectively . haralabakis et al.9 found that the horizontal distance between the hyoid bone and the perpendicular line from the fh plane at porion is greater in patients with open bite , indicating a more posterior position of the hyoid bone . however , subtelny and sakuda13 found no difference in the horizontal position of the hyoid bone in patients with open bite , contrary to our findings . real - time b - tfe cine mri is a valuable tool to evaluate the movements of the hyoid bone during deglutition.the hyoid bone reaches its most anterior and superior positions at the oral ( stage 2 ) and pharyngeal ( stage 3 ) stages of deglutition , respectively . open bite does not affect the displacement pattern of the hyoid bone during deglutition.the hyoid bone is positioned more inferiorly and posteriorly in patients with open bite because of released tension of the suprahyoid muscles . real - time b - tfe cine mri is a valuable tool to evaluate the movements of the hyoid bone during deglutition . the hyoid bone reaches its most anterior and superior positions at the oral ( stage 2 ) and pharyngeal ( stage 3 ) stages of deglutition , respectively . the hyoid bone is positioned more inferiorly and posteriorly in patients with open bite because of released tension of the suprahyoid muscles .

the sebaceous glands cover the whole body surface except the palms of hands and the soles of feet . they are believed to contribute to the antibacterial properties of the skin , the hydration of the skin surface and the cutaneous vitamin e and other antioxidant compound synthesis , and to produce part of the lipids of the stratum corneum . they do so by excreting to the skin surface an oily waxy substance called sebum , the end product of the holocrine secretion of sebocytes . mutations that abrogate the lipid synthesis have shown to induce serious disruption of the epidermal barrier function in mouse . in humans , defects of the sebaceous gland function malignant transformation of the sebaceous gland leads to sc , an aggressive tumor that is often diagnosed late and carries a high mortality rate . the sebaceous gland has only recently been recognized to be of crucial importance for the maintenance of healthy skin . that is why several recent studies focused on the understanding of the sebaceous gland homeostasis and its contribution to the whole epidermal homeostasis . different niches of stem cells , which individually contribute to the homeostasis of an epidermal compartment , have been described in mice . the interfollicular epidermis ( ife ) was shown to be regenerated according to an autocrine wnt/-catenin pathway , with each cell of the basal layer being able to divide according an asymmetric model of division . but lrig1 + keratinocytes from the isthmus , located in the hair follicle at the junctional zone between the sebaceous gland , hair follicle and ife , were shown to be able to renew the whole epidermis in case of injury . lrig1 + cells replenish the infundibulum , the isthmus and the sebaceous gland in steady - state conditions , and can upon injury replenish the whole epidermis including the ife . lgr6 + cells , which are located above the bulge of the hair follicle , are also able to renew all the compartments of the epidermis . in human epidermis , the lrig1 niche is composed of lrig1 + clusters of keratinocytes in the basal layer . these clusters were described to be on the top of the rete ridges of the ife . more recently , we have shown a second niche of lrig1 + keratinocytes , more similar to the mouse niche as located in the human isthmus connecting the hair follicle with the sebaceous gland . during the morphogenesis of the folliculosebaceous unit ( fsu ) , divided into 8 stages , the lrig1 + cells are considered to be sebocyte precursor cells . sox9 represents a well - known hair follicle stem cell marker , which is also indispensable for the morphogenesis of the fsu . at the beginning of the morphogenesis , the lrig1 + cells are superposed with the sox9 + cells , but at stage 5 of morphogenesis , the lrig1 + cells dissociate from the sox9 + cells . the sox9 + cells stay at the bulge , to form the hair follicle , whereas the lrig1 + cells migrate more distally to the isthmus . at the isthmus the first sebocytes , which contain an essential enzyme for the triglyceride synthesis called stearoyl - coa desaturase 1 ( scd1 ) , appear at stage 5 of morphogenesis . lrig1 is a transmembrane protein whose biological function is to repress the epidermal growth factor receptor ( egfr ) therefore , lrig1 is expected to act as an inhibitor of tissue growth that maintains the cells in a quiescent state . logically , downregulation of lrig1 has been associated with diseases showing epidermal hyperplasia like psoriasis . recent studies showed that epgn ( epithelial mitogen ) supply ( epgn is a specific ligand of egfr ) to an embryo before stage e11.5 , in other words well before the epidermal stratification or the pilosebaceous morphogenesis , leads , in an egfr dependent manner , to postnatal hypertrophy of the sebaceous glands . this hypertrophy is maintained as long as epgn supply is high and the glands diminish in size after withdrawal of epgn . it is interesting to mention that these hypertrophic sebaceous glands have a strong lrig1 staining in the sebocytes . in addition , these glands logically showed an increase in c - myc expression , as this one is a regulator of epidermal growth downstream of the egfr pathway . a murine model of sebaceous gland tumors has recently been described . there , a dominant negative form of lef1 has been expressed specifically in the epidermis of transgenic mice . upon treatment with a mutagenic agent , all mice developed tumors of the sebaceous glands , indicating that mutations in the wnt/-catenin pathway are crucial for the malignant transformation of keratinocytes in sebaceous carcinoma - like tumor ( sclt ) . k14nlef1 mice had a mutation of the nh2-terminus of lef1 expressed under the control of keratin 14 promoter which hinders -catenin from binding to lef1 . however , under constitutive activation of rac1 , these adenomas evolve to poorly differentiated sclt . lrig1 is highly expressed in these poorly differentiated sclts compared to sa . in this study sclts induced in a murine model expressing a dominant active form of lef1 specifically in the basal layer ( k14nlef1 ) were shown to be all positive for lrig1 . we then analyzed human sebaceous tumors for their lrig1-expressing status in order to confirm this murine model . since a variant of cd44 , cd44v3 , has recently been shown to be present in the human fsu together with lrig1 , we also explored its expression in sebaceous tumors . we searched the biopsy database of the dermatopathology unit of the department of dermatology / university hospital of geneva for sebaceous tumors from 2004 to 2015 ; 8 sc , 35 sa , 2 sebaceous epitheliomas , 13 sebaceomas ( se ) and 35 sebaceous hyperplasias ( sh ) were found . according to the new nomenclature , proposed by troy and ackerman in 1984 , we added sebaceous epithelioma into the se group . we visualized all the sebaceous tumors on bright field microscopy . for this study , we then selected the ones with the clearest or the least ambiguous diagnosis on he staining : 4 sc , 7 sa , 10 se and 7 sh . all selected biopsy samples were formalin fixed and paraffin embedded ; 5-m - thin slices were cut , fixed on superfrost ultraplus object slides and dried overnight at room temperature . after the deparaffinization by using a robot , the slides were put in a boiling citrate buffer ( 10 mm , ph 6 ) for 15 min and cooled down at room temperature for 1 h. three baths in pbs ( phosphate buffered saline ) + 0.3% tritonx-100-t , 5 min each , followed . the slides were then saturated with a 15-min bath in pbs + 0.3% tritonx-100 + 1% bsa ( bovine serum albumin ) + 1% milk powder for 15 min before incubation with the first antibody overnight at 4c , diluted in pbs + 0.3% tritonx-100 + 1% bsa + 2% milk powder . the following antibodies with the following dilutions were used : rabbit anti - human lrig1 antibody diluted 1/5,000 provided by satoshi itami , osaka university , mouse anti - human cd44v3 antibody diluted 1/100 ( bender medsystems , bms144 ) and monoclonal mouse anti - human ki67 antibody diluted 1/100 ( dako , m7240 ) . the next day , the slides were warmed up at room temperature and rinsed in tbs - t ( tris 0.1 m , nacl 0.9% , tween 0.3% , ph 7.6 ) 3 times for 5 min . the secondary antibody ( dilution 1/200 ) plus dapi ( dilution 1/200 ) for dna counterstaining were added , all diluted in tbs - t + 1% bsa + 2% milk powder . for the secondary antibody , either an anti - mouse or an anti - rabbit antibody , depending on the host in which the first antibody was produced , was used . after an incubation for 60 min , the slides were rinsed again in tbs - t 3 times for 5 min and 5 min in pbs before mounting the object with a fluorescence mounting medium ( dako , s3023 ) . the slides incubated with the ki67 antibody were analyzed on immunohistochemistry and revealed with dab . for this series , the vectastain elite abc kit ( vector laboratories , pk-6200 ) was used according to a standard protocol . the slides were counterstained with a solution made of 1 tablet dab ( sigma dab , d5905 ) dissolved in 15 ml tris - buffered saline , ph 7.6 , for 150 s before stopping the reaction in a distilled water bath . then , the object was mounted . to visualize the results and capture the pictures , a pannoramic digital slide scanner 250 ( 3dhistech ) and a microscope confocal system leica sp5 were used . we calculated the degree of over- or underexpression , by scoring the staining in sebaceous tumors from 0 to 4 . where 0 means absent staining , 1 means normal expression as expected in normal sebaceous glands , 2 indicates moderate and 3 strong staining respectively . it is worth mentioning that for the ki67 staining , absent staining ( as would be expected in normal sebaceous glands ) was scored 1 . thus , in every sebaceous tumor sample , a value above 1 signifies higher expression and a value below 1 lower expression of the respective marker compared to normal sebaceous glands . we then compared the marker expression between different sebaceous gland tumors by calculating the respective marker 's mean values . to judge statistical significance the secondary antibody ( dilution 1/200 ) plus dapi ( dilution 1/200 ) for dna counterstaining were added , all diluted in tbs - t + 1% bsa + 2% milk powder . for the secondary antibody , either an anti - mouse or an anti - rabbit antibody , depending on the host in which the first antibody was produced , was used . after an incubation for 60 min , the slides were rinsed again in tbs - t 3 times for 5 min and 5 min in pbs before mounting the object with a fluorescence mounting medium ( dako , s3023 ) . the slides incubated with the ki67 antibody were analyzed on immunohistochemistry and revealed with dab . for this series , the vectastain elite abc kit ( vector laboratories , pk-6200 ) was used according to a standard protocol . the slides were counterstained with a solution made of 1 tablet dab ( sigma dab , d5905 ) dissolved in 15 ml tris - buffered saline , ph 7.6 , for 150 s before stopping the reaction in a distilled water bath . then , the object was mounted . to visualize the results and capture the pictures , a pannoramic digital slide scanner 250 ( 3dhistech ) and a microscope confocal system leica sp5 were used . we calculated the degree of over- or underexpression , by scoring the staining in sebaceous tumors from 0 to 4 . where 0 means absent staining , 1 means normal expression as expected in normal sebaceous glands , 2 indicates moderate and 3 strong staining respectively . it is worth mentioning that for the ki67 staining , absent staining ( as would be expected in normal sebaceous glands ) was scored 1 . thus , in every sebaceous tumor sample , a value above 1 signifies higher expression and a value below 1 lower expression of the respective marker compared to normal sebaceous glands . we then compared the marker expression between different sebaceous gland tumors by calculating the respective marker 's mean values . to judge statistical significance we confirmed the already known lrig1 + niche in the basal cells of human ife and found a second lrig1 niche at the isthmus of human sebaceous glands . we then analyzed 28 samples of human sebaceous tumors for the expression of lrig1 , cd44v3 and ki67 . a comparison of the mean values in different sebaceous tumors is presented in table 2 . all sc showed lrig1 overexpression , compared to 43% of sa , 80% of se and 0% of sh . sc showed the highest mean lrig1 score ( 3.25 ) , followed by se ( 2.3 ) , sa ( 2.0 ) and sh ( 1.0 ) . the difference in the lrig1 score between sc and sh was statistically significant ( p = 0.0001 ; table 3 ) . sc also presented the highest ki67 score with 3 , compared to 2.143 for sa and 2 for se . the difference in ki67 score between sc and other sebaceous tumors was statistically significant ( table 3 ) . in sc , we observed a slight cd44v3 downregulation scored at 0.75 . none of the differences in the cd44v3 score between sc and other sebaceous tumors was statistically significant . the data of lrig1 expression in tumors tend to define it as a good prognostic factor , in agreement with its tumor suppressor function . lrig1 ablation in mice induced duodenal cancers , which enforces the hypothesis that lrig1 is a tumor suppressor gene . high lrig1 expression is an indicator of good prognosis in squamous cell carcinoma of the skin , in estrogen receptor- breast cancer and in non - small cell lung cancer . on the other hand , loss of lrig1 or low lrig1 expression is hypothesized to be a predictor of poor survival and a risk factor for metastasis in breast cancer patients . in contrast , cd44 would rather be a marker of sebocyte differentiation , while lrig1 is a marker of sebocyte stem cells in mice and in humans . additionally , high expression of cd44 has been associated with bad prognosis and high metastatic capacity in lung cancer . a meta - analysis showed that cd44 expression has possibly negative effects on survival in gastric cancer . cd44 overexpression was associated with a poor prognostic outcome in non - small cell lung cancer . at the same time , however , in the sc of the eyelid , cd44 expression offers no prognostic value . as described above , since lrig1 is considered to be a tumor suppressor gene , an increased lrig1 staining is usually an indicator of good prognosis . concerning sebaceous tumors , our results can not definitively state whether lrig1 expression is a marker of malignant sc because of a lack of statistical power . however , all of the 4 scs analyzed were positive for lrig1 , and sc had a higher lrig1 score than other sebaceous tumors . although , this higher lrig1 score of sc compared to other sebaceous tumors is statistically significant only if the lrig1 score is compared between sc and sh ( table 3 ) . this observation then tends to confirm the animal model reported by frances et al . . in this study , activation of rac1 was sufficient to transform sa into malignant sc in k14nlef1 mutant mice presenting spontaneous sa . the sc that developed in these mice were shown to lose the sebaceous differentiation and to express high levels of the lrig1 stem cell marker . that is actually a feature we have found in the 4 sc analyzed here , again confirming the data from the mouse model reported by frances et al . . additionally , ki67 ( marker of proliferation ) was also high in our 4 sc human samples , when compared with sa or se , confirming the higher aggressivity of the sc . among the 4 cases of sc , only one presented a poor signal for cd44v3 staining , while the other 3 were negative . if cd44v3 is then considered as a sebaceous differentiation marker , this result then confirms that scs are poorly differentiated tumors , as already indicated by their high expression level of lrig1 and in agreement with the murine model described by frances et al . [ 35 . ] regarding the 7 cases of sa , cases of less aggressive sebaceous tumors , 3 showed lrig1 overexpression , whereas 4 did not . then , globally , the lrig1 signal appeared to be less intense in sa ( mean lrig1 score of 2 compared to 3.25 in sc ) . the p value for this difference in lrig1 score was at 0.2 and thus not statistically significant , possibly due to the low number of sc . ] however , lrig1 overexpression may not be a marker to very strictly differentiate sc from sa from a histopathological point of view . indeed , some sa may show lrig1 overexpression and some may not , while all sc show lrig1 overexpression . however , the absence of lrig1 overexpression may help discriminate sa from sc . whether lrig1 overexpression is a good survival prognostic marker can not be answered by this study as the survival rates of the patients included in this study have not been analyzed . nevertheless , these are interesting data that can be used to evaluate lrig1 overexpression in sa and to make a potential correlation with higher chances of transformation into sc . similar comments can be made for the lrig1 staining performed on the 10 cases of se in this study . se showed a slightly higher mean lrig1 score than sa : 2.3 in se compared to 2.0 in sa . however , in se , 8 out of 10 ( 80% ) cases showed some degree of lrig1 overexpression . this higher rate of lrig1 overexpression in se , compared to only 43% ( 3 out of 7 cases ) in sa , may confirm that se is a type of lesion between sa and sc , and thus more likely to transform into sc than sa . concerning sh , which is a benign lesion , none of the 7 cases analyzed showed lrig1 overexpression . the higher lrig1 score in sc compared to sh was statistically significant ( table 3 ) . additionally , sh had a statistically significant lower lrig1 score than se ( data not shown ) . this finding could confirm that poor lrig1 expression is a sign of a benign lesion in sebaceous tumors . sc , sa and se can potentially be part of the muir - torre syndrome ( a rare genodermatosis that presents itself by sebaceous neoplasms associated with at least one visceral malignancy ) and can therefore all have aggressive behavior . all of these three sebaceous tumors had a mean lrig1 score of 2 , and the mean lrig1 score in sh was 1 . in our study , although limited by a small number of tumor samples , the most aggressive sebaceous tumor ( sc ) showed the strongest lrig1 staining , and the most benign pathology ( sh ) showed no increase in lrig1 staining compared to normal sebaceous glands . therefore , in sebaceous tumors , lrig1 overexpression might be the sign of an advanced stage of tumorigenesis . recently , a study showed a murine model where deletion of ptch1 leads to the development of basal cell carcinoma ( bcc)-like tumors . these tumors derive from stem cells situated at the upper / lower bulge and the isthmus . interestingly , all these bcc - like tumors are lrig1 + , similar to the sclt reported by frances et al . . peterson et al . reported that bcc preferentially originate from epidermal stem cells , among which they identified lrig1 + cells located in the murine isthmus as inducers of bcc - like tumors . since we have demonstrated earlier that cells located in the human isthmus also express lrig1 , the positivity of lrig1 in all human sc found in this study may suggest that human sc also derive from lrig1 + cells originally located in the isthmus at the junction between the sebaceous gland and hair follicle . as explained above considering the general pro - oncogenic behavior of cd44-positive cells , we would expect an overexpression of cd44 in the most aggressive sebaceous tumors . the most malignant sebaceous tumor ( sc ) was only seen in 1 out of 4 ( 25% ) cases ; cd44v3 overexpression was observed in 14.3% in sa and 30% in se . indeed , a downregulation of cd44v3 was found in the most aggressive tumor , as sc showed a cd44v3 score of 0.75 . this could confirm on one hand the poor grade of differentiation of sc , as described in murine sc by frances et al . , and on the other hand this might be explained by the strong lrig1 signal which dominates in sebaceous tumors , the biological activity of which was shown to repress differentiation . this is also in line with the exclusion of cd44v3 expression from the lrig1 + clusters identified in ife . this inverse relationship of lrig1 and cd44v3 can be observed as no cd44v3 overexpression is noticed in 67% of sebaceous tumor samples with some degree of lrig1 overexpression . of the sebaceous tumor samples with very strong lrig1 overexpression , therefore , cd44v3 expression does not seem to be an indicator of tumor aggressivity in sebaceous gland tumors . ki67 is a known marker of proliferation and is expected to be overexpressed in highly proliferative cells such as sebaceous tumor cells . as expected , the most aggressive tumor ( sc ) has the highest mean ki67 score . this higher ki67 score in sc compared to other sebaceous tumors is statistically significant ( table 3 ) . the higher the ki67 staining , the more poorly differentiated the sebaceous tumor samples . 100% of the samples with absent ki67 staining are well differentiated , compared to only 25% of samples with moderate ki67 and 0% of samples with frank ki67 staining . this confirms the findings in human sebaceous tumor samples of cottle et al . and the findings in the murine model of sebaceous tumors reported by frances et al . . as we go from sh to sa , se and finally sc , the degree of differentiation is expected to decline with the rise of uncontrolled proliferation of tumor cells in more aggressive tumors . our study confirms this , as 75% of sc was poorly differentiated , compared to 14.3% of sa , 10% of se and 0% of sh . on the other hand , 0% of sc and se are well differentiated , compared to 28.6% of sa and 100% of sh . interestingly , 70% of poorly or moderately to poorly differentiated sebaceous tumor samples had some degree of lrig1 overexpression . this might be an lrig1-independent observation . since in sebaceous tumors lrig1 expression rises proportionally to the increase in malignancy cd44v3 staining tends to be slightly lower in sc and shows an inverse relationship with lrig1 staining . further studies are needed to explain the relationship of lrig1 and cd44v3 in human sebaceous tumorigenesis and homeostasis . we therefore confirm the findings of the previously reported murine model of sebaceous tumors which are also applicable in human sebaceous tumors . we propose that lrig1 may be used as a possible new marker for poorly differentiated sc . skin samples , previously collected for medical diagnostic , were obtained from the histopathology collection of dermatopathology unit of the university hospital of geneva .

este nico caso informa de una mujer de 32 aos que presentaba unos antecedentes de migraa de 10 aos . trataron a la paciente con acupuntura , modicaciones dietticas y enemas de hierbas medicinales chinas durante el transcurso de dos meses . la paciente experiment un alivio del dolor que llev a varios meses sin ninguna migraa . este artculo puede ayudar a ampliar las opciones de tratamiento de un mdico para incluir un sistema ms diverso de modalidades como los enemas de hierbas chinas . es necesario realizar ms investigaciones para investigar el papel de la medicina oriental y de los enemas de hierbas chinas en el tratamiento de afecciones dolorosas . migraine peaks between 15 and 24 years of age with the greatest prevalence between 35 and 45 years . migraine that attacks with monocular visual disturbances is subtyped as retinal migraine . migraine sub - types are also classified according to associated complications : chronic migraine and status migrainosus , which is a debilitating migraine lasting more than 72 hours . other complications include migraine - triggered seizures or a migrainous infarction , which requires neuroimaging to verify the presence of an ischemic brain lesion . patients often experience migraine without aura , typical aura with migraine headache , and typical aura without headache . migraine risks increase when a patient presents with the following : asymmetry of pain ; throbbing pain ; pain that is moderate to severe in intensity ; pain accompanied by nausea and sensitivity to light , sound , and often smell ; the presence of typical migraine aura symptoms ; and a family history of migraine . a three - question screen can help with the diagnosis of migraine . the screen asks if the patient felt nauseated or sick to his or her stomach in the last 3 months . finally , it asks if headaches limited the patient s ability to work , study , or complete daily tasks for at least 1 day . a positive response to two of the three questions suggests a 93% chance that the headaches are migraine ; if all three responses are positive , there is a 98% chance of migraine . the pathophysiology of migraine is due in part to the sensory input from the trigeminal nerve and the ninth and tenth cranial nerves , humoral factors ( eg , blood glucose , ingested food , gonadotrophic hormones ) , environmental factors ( sleep , stress , smells , light , and changes in barometric pressure ) , and other factors . auras are caused by a localized decrease of blood flow immediately followed by an increase of blood flow . the biomedical treatment of migraine is a three - pronged approach : avoidance of recognized triggers , prompt treatment of acute attacks , and preventive antimigraine therapy . the diary lists possible triggers such as weather , stress , menstruation , and diet . the drugs of choice for the past 20 years have been triptans ( sumatriptan , naratriptan , zolmitriptan , eletriptan , almotriptan , frovatriptan , and avitriptan ) . all seven triptans are available in the form of pill , injection , nasal spray , and dissolving oral tablets . the side effects of triptans include tingling ; flushing ; and sensations of warmth , heaviness , pressure , or tightness in different parts of the body including the chest and neck . positron emission tomography ( pet ) and magnetic resonance imaging ( mri ) scans have demonstrated how acupuncture modulates brain structures . acupuncture affects the mechanisms of pain by its vasodilatory effect on the radial artery diameter . acupuncture also affects cell secretion and signaling and afferent sensory input and the activity of norepinephrine , angiotensin ii , serotonin , enkephalin , beta - endorphin , and glutamate . acupuncture has been found to be more effective than both control treatment and preventive migraine pharmaceuticals . the research demonstrated that after a 12-week treatment protocol , the acupuncture group experienced larger decreases in monthly moderate - to - severe headaches compared to the topiramate group . traditional chinese medicine ( tcm ) theory classifies migraine as an external invasion or an internal disruption . the qi and blood of the six bowels and five viscera all ascend to the head . the three hand yang channels , the three foot yang channels , and the liver channel all meet at the head . the excess type of migraine , typically short in duration , is from external forces such as wind , cold , dampness , or heat . persistent migraine is caused by internal disruption concerning the liver , spleen , and kidney . other factors include weather , emotions , sexual activity , diet , posture , menstruation , and hypertension . damp phlegm accumulation due to eating fatty , greasy , or sweet food or dairy products initiates migraine . drinking alcohol or eating pungent food in october 2011 , a 32-year - old ethiopian - american woman , height and weight proportionate , presented with a 10-year history of debilitating migraine headaches . she described them as the worst feeling of her life , with a pain scale rating of 10 out of 10 ( 10 being the highest level of pain ) . during the attacks , the patient experienced sharp pain ; photophobia ; distorted vision with visible auras ; a feeling of heaviness , dizziness , and irritability ; occasional nausea and vomiting ; hypersensitivity to sound ; and a desire to lie down in a dark , noise - free room . the pain was often on the right side of her head , occurring once every 7 to 10 days . mri and computed tomography ( ct ) scans were taken 2 years prior by a neurologist and showed no abnormalities . the patient reported no previous major illnesses or surgeries , no family history of illness , and no use of medications or nutritional supplements . the tcm intake revealed the patient had cold hands and feet with a warm midsection . she vomited and felt nauseated weekly . once to twice a week , she was constipated with occasional blood in the bowl due to excessive strain to clear bowels . the patient had an intrauterine device , and her last menstrual cycle was may 2010 . the patient had a slightly red , swollen , and scalloped tongue with a thin yellow coating . the left pulse quality was slippery with a wiry and stronger guan position than the right guan position . the flaring - up of liver fire presented as migraine with a sharp pain , irritability , irregular menstruation , constipation , and a red tongue . damp phlegm accumulation was evidenced by dizziness , a heavy feeling , nausea , vomiting , a slippery pulse quality , and a swollen / scalloped tongue . the differential diagnosis of hyperactivity of liver yang was ruled out as the patient did not experience signs of internal wind such as shaking of the head and hands or restlessness , nor was there hypochondriac pain . uprising of stomach fire was also ruled out as there were no signs of focal pain in the forehead , profuse sweating , feverish feeling , sore throat , or painful gums . the treatment principle was to reduce liver fire , eliminate damp , resolve phlegm , and stop pain . all acupuncture treatments were performed with 0.25 x 30 mm dbc spring singles acupuncture needles ( lhasa oms , weymouth , massachusetts ) . each needle was inserted and retained for 20 minutes at the standard angle and depth . each needle was inserted and manipulated until the patient felt a dull pulling sensation at the needle site . this traditional method of needling is called de qi and is considered to bring optimal treatment effect . acupuncture point selection and indication acupuncture point the patient reported a diet high in fried foods , fat , and sodium . high - sodium diets are the major risk factor of hypertension and are linked to cardiovascular and cerebrovascular mortality . the patient was instructed to reduce her sodium / salt intake to less than 3 g per day . the fatty fried foods were replaced with organic fruits and vegetables and fresh fish and chicken . the regimen consisted of one enema the first week , two enemas the second week , and enemas three times a week by week three . the patient was provided with an enema kit : an enema bucket with hose and clamp , a raw chinese herbal formula ( zeng ye tang or increase the fluid decoction tea ; table 2 ) , and an instruction sheet . zeng ye tang : increase the fluid decoction herbal ingredients with indications the zeng ye tang or increase the fluid decoction tea with the coffee enema counteracted the hot property of the coffee with its cool properties . the coffee and caffeine , the zeng ye tang tea moistens the intestines , generates fluids , and counteracts the drying effect of the coffee . the liquid ingredients of the enema solution consisted of 1 cup of brewed organic light roast coffee , 1 cup distilled water , and 1 cup of zeng ye tang . the enema has a dual purpose : it clears the colon of toxic feces and bacteria while the caffeine dilates the ducts of the gall bladder and liver , allowing for a free flow of bile . glutathione - s - tranferase is an enzyme capable of removing a vast variety of electrophiles from the bloodstream . the removal of the toxins allows the body s self - healing mechanisms to perform their tasks . the enema solution was heated to approximately 98.9 f to prevent the colon from contracting . the patient would then lubricate 2 to 3 inches of the end of the enema tube before inserting it into the rectum . the patient was in a right lateral recumbent position with the enema bucket placed 3 feet above her . the enema tube was inserted 3 to 5 inches and the liquid allowed to flow . the solution was retained 12 to 15 minutes as it takes the body s blood supply 4 to 6 minutes to travel through the hepatic portal system . after the first week of acupuncture , the first enema , and the diet modification , the patient reported no migraines . she did suffer from a headache that lasted 2 days , and she vomited twice throughout the week . the headache was a 5 on a patient self - report numeric pain scale from 1 to 10 ( 10 being the most severe pain ) . she continued her enema treatments and made further improvements in diet . at week 3 , the patient reported constipation for 2 days . after the third enema , she reported having a full bowel movement and feeling better . prior to that , she reported one right temple area headache . at week 4 she indulged in fatty fried foods that had been eliminated from her diet in the recent 3 weeks . she reported improvement in sinus congestion and only a mild headache , 3 out of 10 on a patient self - report numeric pain scale . after 6 weeks of weekly treatment , the patient returned for follow - up after 8 months . the patient kept a food and migraine journal and was able to track the foods that triggered migraine and avoid them . she reported that acupuncture helped her immediate needs and the diet modification and enemas have contributed to her relief from migraines . the patient responded well to acupuncture and made long - lasting changes to her diet and lifestyle . the prognosis is very good for her as long as she continues to monitor her diet , continue enema treatments , and seek acupuncture for any acute headaches . tcm practitioners should seek out and learn other holistic therapies such as the gerson therapy as they can be incorporated into a tcm practice . more research is needed to investigate the role of oriental medicine and chinese herbal enemas in treating pain conditions .

silicone elastomers are used in maxillofacial restorations due to their ease of fabrication and realistic appearance.we added the highlighted parts in the addresses . they have properties that are important for human maxillofacial prosthetics such as elasticity , esthetics , heat , and chemical stability [ 13 ] . when adequately cured , silicone elastomers resist absorbing organic materials that lead to bacterial growth and so with simple cleaning are relatively safe and sanitary compared to other materials . chemically , maxillofacial materials are formed from the catalyzed reaction between a silane ( sih ) rich polysiloxane component and vinyl ( ch = ch2 ) rich polysiloxane component . toxicological studies have shown silicone materials to have a very low order of toxicity . studies have shown that such materials are both nontoxic and nonallergenic making them suitable for facial prosthetics . unfortunately , silicone elastomers have certain deficiencies that reduce the clinical longevity of the prostheses . the main reasons for mechanical failure in maxillofacial prostheses include tensile and tearing loads , respectively . the focus of this work is to determine if the addition of nanoscale reinforcing agents will improve the mechanical properties of maxillofacial materials . studies have been done to address the mechanical deficiencies by adding reinforcing agents to the materials . however , reinforcing agents or fillers will increase the rigidity or young 's modulus of a maxillofacial material . young 's modulus is the slope of the elastic region in a stress - strain curve and is conventional referred to as the stiffness of a material . increasing young 's modulus will decrease the flexibility of the prosthesis and processability of the uncured resin . one such example is the addition of nylon material to the silicone material to make the prostheses more durable . other materials such as the durable silicone se-4524u ( general electric , waterford , ny ) have been evaluated and showed a high resistance to tearing . however , this formulation was excessively heavy material and does not readily accept extrinsic coloration . methacrylated silicones have demonstrated improved peel strength when bonded with a variety of bonding agents . a new approach that has the potential to improve polymeric materials is the use of polyhedralsilsesquioxanes ( posss ) as a reinforcing agent . posss are a nanoscale organic - inorganic hybrid ( figure 1 ) containing a 1.5 nm silica cage with eight pendant organic groups . recent methodologies have allowed for the large - scale production of poss materials with functional organic groups such as methacrylate , vinyl , epoxy , and silane [ 9 , 10 ] . the solubility of a poss molecule is determined by the organic groups attached to the silica cage . many poss molecules are capable of forming homogeneous mixtures with polymeric resins . for example , poss with mono- , di- , and tri - methacrylate functionalities are commercially available and are soluble in methacrylate - based resin systems such as methyl methacrylate or dental resins . conceptually , a poss molecule with polymerizable functionalities could be used to form nanocomposites with a high degree of adhesion between the organic and inorganic phases . soluble mixtures of poss and resins behave as if they were a single - phase material . recent work has shown that poss materials with pendant methacrylate groups can be used to improve the properties of dental polymer systems used in restorative materials . other research groups have shown that the addition of poss to elastomers improves mechanical properties [ 1214 ] . the purpose of this in vitro study is to compare the effect of various concentrations of poss on the tensile strength and tear resistance of a silicone elastomer used for maxillofacial materials . a tri - vinyl ( i ) and tri - silane ( ii ) poss were added to the vinyl rich and silane rich components , respectively , as shown in table 1 . the null hypothesis is that the addition of the poss will have no effect on the tensile or tear properties of a silicone maxillofacial material . briefly , trivinyl poss ( i ) was mixed with the vinyl rich factor ii , part a and trisilane poss ( ii ) was mixed with the silane rich factor ii , part b in the appropriate weight ratios . the trivinyl poss - modified part a , was mixed with the trisilane poss - modified part b along with thixo and cured in a dumbbell or trousers mold . the tear strength and tensile strength were then evaluated on a universal testing machine . the maxillofacial materials factor ii a-2000 part a , factor ii a-2000 part b , and factor ii thixo were purchased from factor ii ( lakeside , az ) . the tris(dimethylvinyl ) isobutyl - poss and tris(dimethylsilane ) isobutylposs were purchased from hybrid plastics ( hattiesburg , ms ) and used without further purification . the dumbbell and trouser molds were made from aluminum according to astm standards d412 and d624 [ 15 , 16 ] for the testing of maxillofacial materials ( figure 2 ) . table 1 shows the formulation of the poss modified maxillofacial materials used in the study . the procedure for formulation and mixing is as follows . in a 60 ml cup designed for the speed mixer , factor ii part a was mixed with the tris(dimethylvinyl ) isobutylposs ( i , figure 1 ) in the ratios described in table 1 to form modified part a. this mixture was heated at 55c for fifteen minutes to promote miscibility . the cup was closed and placed in a speedmixer ( hauschild 59075 , hamm , germany ) for 2 minutes at 3000 rpm . the mixture was then cooled in a refrigerator for one hour to prevent spontaneous curing . an identical procedure was used to formulate factor ii part b with the tris(dimethylsilane ) isobutylposs ( ii , figure 1 ) to form modified part b. the modified part a ( 15 g ) and the modified part b ( 15 g ) were placed in a mixer cartridge with six drops of factor ii thixo . the cartridge is designed to allow the extrusion of the materials after mixing . the components were then speed mixed for one minute at 1000 rpm and mixed material extruded . the appropriate ( dumbbell or trouser ) mold ( figure 2 ) was placed on a thick glass slab and the maxillofacial material was extruded into the mold . another thick glass slab was placed on top of the mold and was clamped into place . the mold was placed into a preheated oven set at 80c for 4 hours . after curing , when cool , the clamps were removed and the mold was separated . once the glass slabs were removed , the samples were carefully removed and labeled . each sample was checked for defects along the areas that would receive stress during the testing process . dumbbell - shaped pieces were attached to the universal testing machine using custom made clamps . the samples were tested until failure at an extension rate of 500 mm / min and the peak load , failure load , and extension were measured . the samples were tested until failure at an extension rate of 250 mm / min . the tear strength test measured two variables : load at failure , and extension . for the tensile strength test , three ( 3 ) one - way analysis of variance ( anova ) procedures were carried out to statistically compare the mean load scores , extensions , and peak loads of the fabricated silicone elastomers across five different concentrations of poss incorporated in the material ( 0% , 0.5% , 1% , 2% , and 5% ) . for the tear resistance test , two ( 2 ) one - way analysis of variance ( anova ) procedures were carried out to statistically compare the mean load scores and extensions of the fabricated silicone elastomers across the same five concentrations of poss incorporated in the material . in each case where an anova procedure found an overall significant difference in the means of a particular variable , a post hoc tukey 's multiple comparisons were carried out to identify and rank those particular concentrations of poss whose mean results were found to be different . all anova tests were conducted at significance level 0.05 ; tukey 's multiple comparisons were conducted at an overall level of 95% for simultaneous confidence intervals . the mean load at failure featured a marginally significant difference across the five levels of poss concentrations at the .05 significance level ( p = .050 ) . < p < .05 ) for the pairwise comparison of concentration levels 0% and 5% . the corresponding analysis for mean extension yielded an overall significant difference ( p = .039 ) and a specific significant difference ( .01 < p < .05 ) between concentration levels 0% and 5% . the data for mean peak load indicated an overall significant difference ( p = .033 ) but no significant differences for pairwise comparisons were detected . based on these results we reject the null hypothesis that the addition of poss does not affect mean extension and conclude that there is a difference between the 5% concentration level versus control . we also reject the null hypothesis that the addition of poss has no effect on the tensile strength properties ( although tests were unable to detect specific pairwise differences . ) the null hypothesis that poss has no effect on tear properties of a maxillofacial material was also rejected with differences found between concentration levels 1% and 5% . siloxane polymers are viscoelastic in nature exhibiting properties of both a rigid elastic material and a viscous solid . as shown in figure 3 , the stress - strain curve of viscoelastic materials contains elements of elastic and rubbery materials . viscoelastic materials have an elastic region characterized by mostly reversible deformation , a yield point , and a rubbery region characterized by mostly permanent deformation , followed by a break or failure point . the greater the yield point is , the more resistant a material is to permanent deformation , and a large rubbery region indicates high toughness or the ability to absorb mechanical energy before failure . as stated previously , maxillofacial materials need to able to withstand large instantaneous forces such as tearing and continuous low - level forces from daily use . clearly , improving the resistance to deformation and increasing toughness would increase clinic longevity . the addition of filler particles such as poss to a polymer matrix should result in a stronger , stiffer , less flexible material . this should be characterized by an increase in young 's modulus and yield point but a reduced rubbery plateau region . while maxillofacial materials are strengthened , as measured by mean peak load , by the addition of poss , there is no statistically significant decrease in the extension at failure . interestingly , the data suggest that the extension is increased with poss loading . this effect is not statistically significant in the tensile test though the 1% and 2% samples in the tear test have significantly increased extension compared to control . maintaining or increasing extension with increased filler loading seems to run contrary to the idea that the addition of fillers will result in a more rigid material . however , it does suggest that poss may have a plasticizing effect on polymer matrixes . the significant increase in extension prior to failure is also observed in the tear test . though the mechanism is not clear , poss monomers may provide the most significant reinforcement in elastomeric or viscoelastic materials . the work in this paper expands on work by others [ 1214 ] to determine if poss can be used to reinforce elastomeric maxillofacial materials . previous work has demonstrated relatively modest gains from poss reinforcement in stiff or elastic polymers and composites at low levels of loading . however , in the maxillofacial materials we tested that the reinforcing effect is seen in both the elastic and viscoelastic regions of the stress - strain curve and at relatively high levels of loading . the increase in yield strength should provide increased resistance to tearing forces and increase in strain until failure is an indication of toughness , which will increase resistance to forces due to everyday handling . we also note that while the sample means for the peak load in the tensile test were found to differ among various concentrations of poss , only one individual pair of means were detected to be different , and only at a very marginal level ( concentration level 0% being lower than concentration level 5% ) . while this result seems paradoxical , it is a well - known statistical result that such a conclusion can occur with small sample sizes and somewhat large variability in the response variable , such as we have here ( see columns 2 and 3 of table 2 ) . this causes a reduction in the power of the statistical test . further experiments with larger sample sizes would help to clarify the issue . color stability and long - term environmental stability are also areas that have received significant attention in the literature and will be considered in future work [ 6 , 1822 ] . poss monomers have the ability to provide reinforcement to maxillofacial materials and potentially to other elastomeric systems . the poss loading had a significant effect on the tear and tensile properties of the maxillofacial materials . however the relatively small sample sizes reduced the power of the experiment and the ability to detect differences between groups .

we conducted a retrospective , open - label , multicenter study that included 41 patients with aosd . all patients had previously received standard synthetic immunosuppressive drugs and in some case other biologic agents . aosd was diagnosed at the rheumatology units of 19 spanish referral centers according to yamaguchi 's criteria . before ank onset , infections including hepatitis b or hepatitis c infections were excluded . in all patients latent tuberculosis was also ruled out by a tuberculin skin testing ( ppd ) and/or quantiferon and chest radiograph . analysis of results was performed based on the information registered by each investigator following a protocol agreed beforehand that included the collection of the relevant clinical and laboratory data of the patients . this was an observational study of ank therapy in patients with refractory aosd . in studies such as this , ethics committee approval is not mandatory according to spanish national regulation . however , written informed consent is mandatory and was obtained from all patients . the medical records were reviewed according to a previously established protocol . according to that , fever was defined if the temperature was 38c in the week before the assessment period . cutaneous rash was considered to be present if patients had a salmon - pink , macular , or maculopapular rash predominantly on trunk and extremities . hepatomegaly and splenomegaly if enlargement of liver or spleen was confirmed by ultrasound or computed tomography . lymphadenopathy was defined as the enlargement of lymph nodes in at least 2 different sites . a diagnosis of pericarditis was made if the patient presented with chest pain and had pericardial rub or an effusion documented by echocardiogram . improvement of the clinical manifestations was considered to be present if resolution of the clinical manifestations occurred during the follow - up period . according to the study protocol , information on routine laboratory markers of disease activity , including full blood cell count , erythrocyte sedimentation rate ( esr ) , c - reactive protein ( crp ) , ferritin serum levels , liver enzymes , creatinine serum level , proteinuria , and hematuria was collected . the esr was considered to be increased when it was higher than 20 or 25 mm/1st hour for men or women , respectively . crp was defined as elevated when it was higher than 0.5 mg / dl . high ferritin serum level was defined as a serum ferritin 200 ng / ml . data were first reviewed and then analyzed in an attempt to assess the following information : clinical and laboratory data , therapies used in the management of aosd , including those given to the patients before the onset of ank , response to this biologic therapy and adverse events . this information was extracted from the patient clinical records , reviewed for confirmation of the diagnosis , and stored in a computerized file according to a protocol established beforehand and agreed upon by researchers . to minimize entry error results were expressed as mean sd for variables with a normal distribution or as median and [ 25th75th interquartile range ( iqr ) ] when they were not normally distributed . the effect of ank on clinical features and other variables such as leukocyte count and hemoglobin level , esr , crp , ferritin , and daily prednisone dose was reviewed . comparisons of these variables were made between baseline and 1st month , 3rd month , 6th month , and 1st year . we conducted a retrospective , open - label , multicenter study that included 41 patients with aosd . all patients had previously received standard synthetic immunosuppressive drugs and in some case other biologic agents . aosd was diagnosed at the rheumatology units of 19 spanish referral centers according to yamaguchi 's criteria . before ank onset , infections including hepatitis b or hepatitis c infections were excluded . in all patients latent tuberculosis was also ruled out by a tuberculin skin testing ( ppd ) and/or quantiferon and chest radiograph . analysis of results was performed based on the information registered by each investigator following a protocol agreed beforehand that included the collection of the relevant clinical and laboratory data of the patients . this was an observational study of ank therapy in patients with refractory aosd . in studies such as this , ethics committee approval is not mandatory according to spanish national regulation . , fever was defined if the temperature was 38c in the week before the assessment period . cutaneous rash was considered to be present if patients had a salmon - pink , macular , or maculopapular rash predominantly on trunk and extremities . hepatomegaly and splenomegaly if enlargement of liver or spleen was confirmed by ultrasound or computed tomography . lymphadenopathy was defined as the enlargement of lymph nodes in at least 2 different sites . a diagnosis of pericarditis was made if the patient presented with chest pain and had pericardial rub or an effusion documented by echocardiogram . improvement of the clinical manifestations was considered to be present if resolution of the clinical manifestations occurred during the follow - up period . according to the study protocol , information on routine laboratory markers of disease activity , including full blood cell count , erythrocyte sedimentation rate ( esr ) , c - reactive protein ( crp ) , ferritin serum levels , liver enzymes , creatinine serum level , proteinuria , and hematuria was collected . the esr was considered to be increased when it was higher than 20 or 25 mm/1st hour for men or women , respectively . crp was defined as elevated when it was higher than 0.5 mg / dl . high ferritin serum level was defined as a serum ferritin 200 ng / ml . data were first reviewed and then analyzed in an attempt to assess the following information : clinical and laboratory data , therapies used in the management of aosd , including those given to the patients before the onset of ank , response to this biologic therapy and adverse events . this information was extracted from the patient clinical records , reviewed for confirmation of the diagnosis , and stored in a computerized file according to a protocol established beforehand and agreed upon by researchers . to minimize entry error results were expressed as mean sd for variables with a normal distribution or as median and [ 25th75th interquartile range ( iqr ) ] when they were not normally distributed . the effect of ank on clinical features and other variables such as leukocyte count and hemoglobin level , esr , crp , ferritin , and daily prednisone dose was reviewed . comparisons of these variables were made between baseline and 1st month , 3rd month , 6th month , and 1st year . data from 41 patients ( 26 women/15 men ) with aosd that received ank therapy were assessed . the mean age of the patients at the onset of ank was 34.4 14 years and the median [ iqr ] ) duration of aosd before ank onset was 3.5 [ 26 ] years . besides corticosteroids and before the onset of ank all the patients had received traditional synthetic immunosuppressive drugs and 20 ( 48.8% ) of them other biologic therapies ( table 1 ) . main features of 41 patients with refractory adult - onset still 's disease treated with anakinra ( ank ) ank was prescribed as monotherapy ( n = 12 ) or combined with other traditional synthetic immunosuppressive drugs ( n = 29 ) , usually with methotrexate ( table 1 ) . the initial ank dose was 100 mg / sc . every day ( table 1 ) . at ank onset the most frequent clinical features were joint manifestations ( n = 36 ) , fever ( n = 32 ) , cutaneous rash ( n = 24 ) , lymphadenopathy ( n = 11 ) , hepatomegaly ( n = 11 ) , splenomegaly ( n = 11 ) , pericarditis ( n = 8) , and pleuritis ( n = 6 ) . most patients also had abnormality of laboratory parameters including increase of esr ( n = 32 ) or crp ( n = 37 ) , anemia ( n = 23 ) , and leukocytosis ( n = 27 ) ( table 2 ) . nevertheless , most of them experienced improvement of clinical manifestations and laboratory abnormalities following ank therapy . the good response to ank was maintained over time ( table 2 and figure 1 ) . improvement of clinical manifestations and laboratory parameters following anakinra therapy in 41 adult - onset still 's disease patients refractory to previous immunosuppressive drugs rapid and maintained improvement following anakinra therapy ( data expressed as mean and standard deviation [ leukocyte count and hemoglobin ] or median and interquartile range [ all other variables ] compared with basal results ) . a , leukocyte count ( black line ) and hemoglobin value ( grey line ) . b , c - reactive protein ( crp ) ( black line ) , and erythrocyte sedimentation rate ( esr ) ( grey line ) levels . after 1 year of ank therapy , the frequency of joint manifestations decreased from 87.8% at baseline to 41.5% of the patients , the cutaneous manifestations from 58.5% to 7.3% , fever from 78% to 14.6% , and lymphadenopathy from 26.8% to 4.9% . also , the frequency of abnormal elevation of crp and esr decreased from 90.2% at the onset of ank therapy to 46.3% and from 78% to 22% of the patients , respectively . it was also the case for the frequency of leukocytosis that decreased from 65.9% to 14.6% , anemia from 56.1% to 9.8% , and high ferritin serum levels from 63.4% to 36.6% of the patients ( table 2 ) . interestingly , after 1 year of ank therapy the median [ iqr ] dose of prednisone had been reduced from 20 [ 11.347.5 ] mg / day at the onset of ank to 5 [ 010 ] mg / day at 12 months . there was also a significant corticosteroid sparing effect when basal dose of prednisone was compared with those taken at 1 month ( p < 0.01 ) , at 3 months ( p < 0.01 ) , at 6 months ( p < 0.01 ) , and at 12 months ( p < 0.01 ) , respectively ( figure 1 ) . after 1 year from the onset of ank therapy , 14 patients ( 34% ) had discontinued this biologic agent because of remission ( n = 1 ) , side effects ( n = 5 ) , lack of efficacy ( n = 7 ) and desire to become pregnant ( n = 1 ) . after a median [ iqr ] follow - up of 16 [ 550 ] months , cutaneous reactions were the most common complications related to ank therapy ( n = 8 ; 19.5% ) . nevertheless , in only 2 of these 8 patients the therapy had to be permanently discontinued due to a severe cutaneous rash . the remaining 6 patients experienced mild local cutaneous reactions in the site of ank injection ( n = 6 ; 14.6% ) . in terms of infections , this therapy had to be permanently discontinued because of severe infections in only 2 patients . one of them had phalanx osteomyelitis and the other a respiratory tract infection by pseudomonas aeruginosa and an abscess in the gluteal muscle . other infections attributed to ank were urinary tract infection ( n = 2 ) and herpes zoster ( n = 1 ) . other side effects observed were mild leukopenia ( n = 3 ) and myopathy with elevation of muscle enzymes in 1 patient who had to discontinue ank therapy for this reason . finally , with regard to the combination of ank with conventional immunosuppressive drugs , we observed that improvement of systemic symptoms and joint manifestations was more commonly observed in those patients who received combined therapy with methotrexate when compared with those patients taking ank alone . in this multicenter observational study , we have observed that ank yielded a rapid and maintained clinical and laboratory improvement , even in patients with aosd refractory to other biologic agents . recently , the therapeutic paradigm of this disease has shifted to include more specific biologic response modifiers , especially in patients corticosteroid - dependent and/or refractory to traditional immunosuppressors . in this sense , our group has recently reported promising results by the use of the il-6 inhibitor - tocilizumab in patients with refractory aosd . the rationale for the use of the anti - il-1 receptor antagonist ank in aosd is based on our understanding of the pivotal role of il-1 in this disease . regarding the cytokine cascade in aosd , il-18 promotes tnf- , and il-1 production via the nuclear factor-b pathway and induces ifn- production by th1 lymphocytes . overproduction of il-1 can explain the main symptoms of aosd , inducing fever , leukocytosis , thrombocytosis , acute - phase reactant production , and bone resorption . anakinra , a recombinant form of human il-1 receptor that binds to the il-1 receptor , has demonstrated efficacy in patients with rheumatoid arthritis . additionally , randomized placebo - controlled trials disclosed efficacy of ank in systemic juvenile idiopathic arthritis , an entity that shows some similarities with aosd . ank has been used in isolated cases and small case series of refractory aosd with promising results ( table 3 ) . to the best of our knowledge , the largest series of patients treated with ank because of refractory aosd were reported by laskari et al ( n = 25 ) and giampietro et al ( n = 28 ) . in our study , we describe information on 41 aosd patients followed for a median of 16 months . in keeping with former reports , all the patients from our series had received synthetic immunosuppressive agents ( table 1 ) . moreover , many of them had also been refractory to biologic drugs , mainly anti - tnf- agents ( table 1 ) . efficacy of ank in aosd in published series efficacy of ank in aosd in published series improvement of laboratory parameters was found in most patients from our series at the time of the first available assessment of data ( at month 1 ) after the onset of ank therapy . of note , improvement compared with basal results was also observed at 3 , 6 , and 12 months . in this regard , the significant reduction of crp and esr was especially remarkable compared with basal data prior to ank onset . this finding was in agreement with former reports that also have described decrease of these acute phase reactants since the first month after the onset of ank treatment . rapid improvement of systemic symptoms , such fever and cutaneous manifestations , was also observed in our series . laskari et al also reported clinical and laboratory improvement in 18 of 25 patients ( 72% ) after 1 year of treatment with ank . similar results were shown by giampietro et al . however , it is well known that joint manifestations in patients with aosd may be more refractory than systemic manifestations . in this regard , cavalli et al found a complete response in 37% of patients with chronic articular disease treated with ank and partial response in 25% ( 18 ) . it was also the case in our series as 41.5% of patients had persistence of joint involvement after 1 year of ank therapy . similar results were described by giampietro et al . taken together , our data along with those from previous reports indicate that joint manifestations have less response to anti - il1 blockade when compared with other clinical manifestations of aosd . likewise , partial improvement of joint manifestations was observed in refractory aosd treated with anti - il-6 . nevertheless , laskari et al reported improvement of joint manifestations ( evaluated by acr50 and acr70 response ) in 93% and 87% of their patients respectively . taken together , the reasons why articular symptoms show less response to anti - il-1 therapy when compared with other organs are unknown . a plausible explanation is that proinflammatory cytokines may play a major role in the development of systemic manifestations of aosd . according to that , either anti - il-1 or anti - il6 blockade would be more effective to improve active forms of systemic manifestations of aosd . in contrast , joint involvement could be due to a different pathogenic mechanism , similar to that observed in chronic inflammatory arthritis , which would explain the partial response to the biologic agents targeting proinflammatory cytokines . first - line therapy in aosd is based on corticosteroids , often requiring high dose and for a long time with subsequent risk of side effects . in our series this is of particular relevance in patients with chronic course of aosd , and in those who are refractory to conventional drugs since these patients receive an inappropriately high cumulative dose of corticosteroids leading to a high risk of side effects . this steroid - sparing effect is also another argument in favor of recommending ank , given as a subcutaneous daily injection . only 5 patients had to discontinue the treatment due to severe cutaneous reactions , severe infections and myopathy as described above . as described in our study ( table 1 ) , reduction of ank dose because of clinical improvement was also performed in some patients reported by laskari et al and giampietro et al . however , a question still unanswered is the optimal duration of treatment with ank in aosd . in our series , two - thirds of the patients completed almost 1 year of ank therapy . twenty - two of 41 patients were still receiving a dose of 100 mg / day at 1 year . this biologic therapy had been discontinued in 1 patient because of clinical remission and a reduction in the number of doses was achieved in 5 patients in the first year from the onset of this drug ( table 1 ) . , dose reduction may be considered when remission is achieved , increasing compliance and drug adherence and highlighting the potential cost - effectiveness of ank . we previously reported good results following anti - il-6 tocilizumab therapy in aosd patients refractory to conventional immunosuppressive drugs . therefore , comparison between ank and tocilizumab should be conducted . in conclusion , in the present report , we describe the largest series of aosd ank - treated patients refractory to conventional immunosuppressive drugs and in some cases to other biologic therapies . although ank showed global efficacy , joint manifestations were found to be more refractory than systemic manifestations . however , the retrospective and open - label nature of the study constitutes a potential limitation . hence , these promising results support the need for randomized clinical trials on the effectiveness of il-1 receptor blockade in aosd .

mesenchymal stem cells ( mscs ) transplantation has been proven to be an efficient method to treat a large spectrum of diseases . it is noteworthy that both autologous and allogeneic mscs have not induced host immunoreactivity upon local transplantation or systemic administrations . therefore , mscs are an ideal carrier to deliver genes into the tissues of interest for gene therapy applications . genetically manipulated msc can be used in different therapeutic strategies , either as immunosuppressive agents or as engineered cells to secrete a variety of different proteins in vitro and in vivo that could potentially treat a variety of serum protein deficiencies and other genetic or acquired diseases , such as bone , cartilage , and bone marrow ( bm ) disorders . in addition , the ability to genetically modify these mscs would further contribute to tissue engineering settings enabling the selective enhancement of specific differentiation pathways . as mscs are not immunologically rejected and possibly home to damaged tissues , they represent an opportunity to deliver therapeutic proteins . the advantages of msc gene therapy over pharmaceutical agents are the potential of long - term effects after a single intervention and the local expression of the desired gene . gene therapy can increase survival of engrafted stem cells when transgenes are inserted into the cell to prevent or reduce apoptosis and inflammatory injury . despite the promise of stem cell - based gene therapy to have an impact on human health , technical challenges remain to be solved in order to harness the full potential of stem cells . presently , the widely used method to transfer genes to msc is performed through defective viruses , such as adenovirus , lentivirus , and retrovirus . when mscs are used to compensate or correct a genetic pathology and must express the therapeutic gene for the duration of a patient 's life ( permanent expression ) , integrating viruses , such as lentivirus or retrovirus , are preferred because of their well - known capacity for long - term expression . on the contrary , when mscs are used to treat noninherited diseases and are only required to express the therapeutic gene for a short period of time ( transient expression ) , nonintegrating vectors including adenoviruses and nonviral gene delivery systems are preferred . although these cells can be more efficiently modified using viral methods , safety issues including mutagenesis , toxicity , and the immunogenicity of the virus itself remain considerable concerns . alternatively , and despite its less efficiency compared to viral methods , the advantage of using nonviral methods resides on its safety , demonstrating no immunogenicity , negligible toxicity , and easier preparation , and having the ability to carry larger therapeutic genes . overall , by using plasmids it is possible to modify genes or introduce new ones to make the cell undergo apoptosis or survive longer , secrete proteins or switch off genes , differentiate or not differentiate , and even proliferate . for these reasons , there is an increased interest in the development of a safe and efficient nonviral gene delivery system that can overtake the limitations associated to the viral approach . importantly , for in vitro analysis and subsequent use for transplantation , the selected system should not affect msc proliferation and differentiation after transfection . among the current nonviral methods , liposome carriers and electroporation - based gene transfer techniques were determined most efficient for transfecting msc . electroporation , while effective in transfecting stem cells , is rather harsh and leads to excessive cell death [ 5 , 911 ] . in a few reports , some lipofection reagents were described to successfully introduce transgenes and small interfering rnas ( sirnas ) into msc , while these cells have maintained their proliferation capacity and ability to differentiate into different mesodermal lineages ( bone , cartilage and fat ) without loss of transgene expression . the main reason why cationic liposomes have demonstrated lower transfection efficiencies compared to viral vectors is that these nonviral vectors are not provided with specific devices for controlling intracellular gene trafficking , turning its optimization essential [ 13 , 14 ] . so far , the development of liposomal vectors has been an empirical process taking into account the measurement of liposomal transfection by the percentage of cells expressing a reporter protein encoded by a plasmid determined either by microscopy or flow cytometry . nevertheless , although gene expression is the main goal of transfection , it depends on several factors including plasmid uptake , intracellular plasmid stability , plasmid access to nucleus , and finally transcription and translation efficiency . in this context , more promising enhanced vectors might be developed considering that all barriers that delivered dna must traverse in its journey from the outside to the nucleus of target cells . furthermore , the mechanism of nuclear transport of the delivered gene , as well as the relationship between the amounts of gene delivered to the nucleus and gene expression , is unclear at the present . thus , a quantitative understanding of the intracellular trafficking of plasmids delivered by these vectors is required to understand the factors governing the efficiency of gene expression . to achieve this goal , the quantification of the number of plasmid molecules that enter the cells can not only contribute to understanding the underlying mechanisms of liposomal gene delivery but it can also be a helpful tool to optimize the liposomal vectors increasing their transfection efficiencies . herein , by using this approach we were able to determine the optimal amount of delivered dna required for the best transgene expression and compare delivery efficiency in different cell passages of human adult bm - derived msc . overall , we believe our findings are extremely useful towards the maximization of gene delivery to human msc , without compromising cell function and viability , when the final goal is ( i ) to express a therapeutic gene in vivo in a safe and transient way ( ii ) or to improve their in vitro expansion or controlled differentiation by overexpression of stemness- or specific lineage commitment - related genes / proteins , respectively . pvax - gfp ( 3697 bp ) plasmid was obtained by modification of the commercial plasmid pvax1lacz ( 6050 bp , invitrogen ) , by replacement of the -galactosidase reporter gene by the enhanced green fluorescent protein ( egfp , referred to as gfp thereafter ) gene . the plasmid contains the human cytomegalovirus ( cmv ) immediate - early promoter , a cole1 type origin of replication and the kanamycin resistance gene for bacterial selection . plasmid dna ( pdna ) was obtained by growing e.coli cultures ( harbouring pvax - gfp ) overnight , in 2 l shake - flasks containing 250 ml lb medium and antibiotics ( 30 g / ml of kanamycin ) . plasmid purification was performed according to the endotoxin - free plasmid dna purification kit protocol ( macherey - nager ) . the concentration of purified pdna solutions was assayed by spectrophotometry at 260 nm ( nanodrop , thermo scientific ) , and dna integrity was confirmed by dna agarose gels stained with ethidium bromide . quantitative real - time pcr was performed by amplification of a 108 bp sequence within the gfp gene ( forward primer : 5-tcg agc tgg acg gcg acg taa a-3 ; reverse primer : 5-tgc cgg tgg tgc aga tga ac-3 ) . pcr reactions were carried out in a roche lightcycler detection system using the faststart dna master sybr green i kit ( roche diagnostics ) as recommended by the manufacturer . each 20 l of final reaction volume contained 2.0 l of the 10x sybr green mixture , 0.4 l of each primer ( 0.4 m final concentration ) , 1.6 l of mgcl2 solution ( 3.0 mm final concentration ) , and 27 l of our sample ( corresponding volume to 10,000 msc ) and the remaining volume was fulfilled by pcr grade water . reactions were incubated at 95c for 10 minutes to activate faststart dna polymerase and lyse cells , followed by 40 cycles of 10 seconds at 95c , 5 seconds at 55c , and 7 seconds at 72c ( adapted from ) . calibration curves were constructed by adding serial dilutions of pdna standards ( pvax - gfp ) to a suspension of nontransfected msc cells ( 10,000 cells per reaction ) . two negative controls were always included ; one containing the same amount of nontransfected cells , exposed to the pdna , but not to lipofectamine , and in the other , pcr grade water was used instead of control cells to detect undesired contamination . bone marrow ( bm ) aspirates were obtained from adult volunteer donors , after informed consent at instituto portugus de oncologia de lisboa francisco gentil . low density bm mononuclear cells ( mncs ) were separated by a ficoll density gradient ( 1.077 g / ml ) ( ge healthcare ) and then washed twice in dulbecco 's modified essential medium ( dmem , gibco ) with 10% fetal bovine serum ( fbs ) msc qualified ( gibcobrl ) , 1% ( v / v ) penicillin ( 10,000 u / ml)/streptomycin ( 10,000 g / ml ) , and 0.1% ( v / v ) fungizone ( gibco ) . bm mncs were then plated at a density of 2 10 cells / cm on plastic culture flasks in dmem with 10% fbs at 37c and 5% co2 in a humidified atmosphere . bm mscs were isolated based on adherence to plastic , and near cell confluence ( 70%80% ) exhausted medium was removed from the flasks , cells were washed with phosphate buffered saline ( pbs ; gibco ) and detached from the flask by adding accutase solution ( sigma ) for 7 minutes at 37c . upon isolation , mscs were expanded for 24 passages and kept frozen in liquid nitrogen . isolated bm msc , expressed their characteristic immunophenotype being cd73 , cd90 , and cd105 positive and negative for cd31 , cd34 , cd45 , and cd80 . when necessary , cells were thawed in a 37c water bath during approximately 1 minute and resuspended in 5 ml of prewarmed iscove 's modified dulbecco 's medium ( imdm , gibco ) supplemented with 20% fbs . then the suspension was centrifuged at 1250 rpm for 7 minutes , and the pellet was resuspended in prewarmed ( 37c ) dmem-10% fbs . after determination of the cell number and cell viability using the trypan blue ( gibco ) dye exclusion test , the cells were plated on 75 cm t - flasks at a density of 30006000 cells / cm and kept at 37c in a humidified atmosphere containing 5% co2 . when cultures reached approximately 80%90% confluence , cells were washed with pbs and harvested by enzymatic treatment ( accutase ; sigma ) . after discarding the supernatant , finally , cells were counted and seeded on t - flasks or 24 well - plates for the transfection protocol . a total number of 50,000 cells were plated per well in a 24-well plate . after 24 hours , lipofectamine2000-mediated ( lf2000 ) ( 1 mg / ml ) ( invitrogen ) transient transfection was performed according to the protocol given by the supplier ( invitrogen ) , varying transfection reagent volumes and the amount of dna ( pvax - gfp ) in ratios lf2000/pdna from 1 to 2.5 . dilutions of pvax - gfp and lf2000 were carried out in optimem 1 ( gibco ) , without serum or antibiotics . before the transfection , mixture has been added to the adherent msc , and the culture medium was changed to serum- and antibiotics - free dmem . five hours after transfection the medium was replaced with fresh 500 l dmem supplemented with serum and antibiotics . cell viability was determined by trypan blue exclusion method . for each transfected sample ( t ) , cell recovery ( cr ) was determined using the equation ( 1)cr(%)t = catcac100 , where cat is the number of transfected cells alive , and cac is the number of non - transfected cells alive ( control ) . determination of transfection efficiency was performed 24 hours after transfection through fluorescence microscopy and flow cytometry analysis . culture medium was removed and 500 l of pbs were added to each well . cells were observed immediately under a fluorescence optical microscope leica dmi 3000b ( leica microsystems gmbh ) , and digital images were taken with a digital camera nikon dxm 1200 f. cells were then harvested by enzymatic treatment , and cells suspension was then collected into a conical tube and centrifuged at 1250 rpm for 7 minutes , and after discarding the supernatant , the cells were resuspended in 1 ml pbs . thereafter , 500 l of this cell resuspension were collected into facs tubes for gfp expression analysis using a facscalibur equipment and the cellquest software ( bd biosciences ) . the other 500 l were used to determine the cell number and cell viability as previously described . finally , cells were centrifuged again at 2500 rpm for 6 minutes , the supernatant solution was removed , and pellets were stored at 80c for subsequent real - time pcr analysis . approximately 50,000 transfected and non - transfected ( control ) mscs per facs tube were incubated in the dark , with phycoerythrin- ( pe- ) conjugated monoclonal antibodies anti - cd73pe ( bd biosciences ) , cd105pe ( invitrogen ) , and cd90pe ( rd systems ) , for 15 minutes at room temperature . then the cells were washed in pbs and fixed with 2% ( w / v ) paraformaldehyde ( pfa ; sigma ) . appropriate isotype controls igg 1 and igg 2 ( bd biosciences ) were also considered . when cultured msc reached total confluence , osteogenic and adipogenic differentiation was induced through replacement of expansion medium by stem pro(r ) osteogenesis differentiation kit and stem pro ( r ) adipogenesis differentiation kit ( gibco ) , respectively . the medium was changed every 4 days and after 14 days on culture the differentiative potential of msc was checked by observation of the standard staining tests . oil red - o staining ( adipogenesis)cells in culture were washed with pbs , fixed with 2% ( w / v ) pfa for 45 minutes , washed again with distilled water and incubated with 0.3% oil red - o solution ( sigma ) for 1 hour . after a second wash with distilled water , cells in culture were washed with pbs , fixed with 2% ( w / v ) pfa for 45 minutes , washed again with distilled water and incubated with 0.3% oil red - o solution ( sigma ) for 1 hour . after a second wash with distilled water , alkaline phosphatase and von kossa stainings ( osteogenesis)cells in culture were washed with pbs , fixed with 2% pfa for 45 minutes , and washed again with distilled water . then cells were incubated in a solution of 1 : 3 naphtol as - mx phosphate and fast violet ( sigma ) for 45 minutes , washed three times with distilled water , and observed under the microscope . cells were then stained for von kossa by incubation with 2.5% ( w / v ) silver nitrate solution ( fluka ) for 30 minutes and were finally observed . cells in culture were washed with pbs , fixed with 2% pfa for 45 minutes , and washed again with distilled water . then cells were incubated in a solution of 1 : 3 naphtol as - mx phosphate and fast violet ( sigma ) for 45 minutes , washed three times with distilled water , and observed under the microscope . cells were then stained for von kossa by incubation with 2.5% ( w / v ) silver nitrate solution ( fluka ) for 30 minutes and were finally observed . msc were plated on 25 cm t - flasks with 5 ml dmem containing 10% fbs ( msc qualified ) at a density of 10 cells / cm ( 250 cells per t - flask ) . after 14 days in culture , without medium replacement , the cells were washed with pbs , a solution of 0.5% ( w / v ) crystal violet ( sigma ) was added and the cells were kept at room temperature for 30 minutes . after crystal violet solution removal , the cells were washed 4 times with pbs and 1 time with distilled water . finally , all the freestanding water was pipetted off and when the t - flasks were dry , the number of colony - forming units ( cfus ) was counted . different strategies were tested to enhance and optimize the msc transfection protocol using lipofectamine2000 ( lf2000 ) . the evaluation of the transfection efficiency was based on the percentage of cells expressing gfp assessed by cytometry analysis and on the determination of plasmid copy number by quantitative real - time pcr . to obtain the highest transfection efficiency and low cytotoxicity , transfection conditions were optimized by varying pdna ( d ) and lf2000 ( l ) amount . lipoplexes were firstly prepared using three different l / d ratios using the same amount of pdna ( 2 g ) . although it could be observed nearly the same number of gfp positive ( gfp ) cells in all three l / d ratios ( approximately 10% ) , the average number of plasmids per cell for l / d = 2 is 2.5-fold higher when compared to the other studied l / d ratios ( figure 1 ) . by phase contrast microscopic images of transfected msc ( figure 2(a ) ) it was possible to verify that no relevant changes have occurred in msc morphology upon lipoplexes contact . moreover , cells expressing gfp ( figure 2(b ) ) also maintained the characteristic spindle - shaped morphology of msc . by flow cytometry we compared the number of gfp cells of transfected samples with a control ( cells previously in contact with the same amount of lipid ) . in figure 2(c ) an overlay of two histograms of transfected and non - transfected cells is shown . around 35% of the cells were gfp with mean fluorescence intensity ( mfi ) around 1000 a.u . ( % gated and mean of m2 , respectively , shown on the table ) . transgene expression on msc was evaluated up to 7 days after transfection ( figures 3(a ) and 3(c ) ) . this assay was performed using lipoplexes with l / d ratios 1.25 , 2 , and 2.5 . varying either lipid amount ( 2.5 l or 4 l ) or dna quantity ( 1 g or 2 g ) a 70% decrease of gfp cells was observed along 7 days ( figures 3(a ) and 3(c ) ) . cellular viabilities and cell recoveries of all studied conditions are shown in figures 3(b ) and 3(d ) . while higher lipid amounts decreased cell viability ( from 90% to 80% ) and cell recovery ( from 95% to 85% ) , apparently dna amount did not influence cell survival , when using 2.5 l of lf2000 . typically , as mscs are rare in their niches ( as the bm ) , they have to be cultivated for several passages in order to reach clinically relevant cell numbers . to this end , mscs from 2 different donors , from passage 1 to 4 , were used . the cells were analysed by evaluating the number of cells expressing gfp , the mfi value ( measure of gfp expression level ) , and the number of plasmids per cell ( figures 4(a ) , 4(b ) and 4(c ) , resp . ) . we have found that the percentage of gfp cells and the mfi decreased with the passage number for both donors . this decrease is more evident between passages 1 and 2 . at early passages , the number of gfp cells or the mfi was donor dependent since the percentage of gfp cells is 4-fold higher for one of the donors . interestingly , the average number of plasmids per cell appeared to be approximately constant ( ~20,000 plasmids / cell ) and independent of the donor and passage number ( figure 4(c ) ) . this seems to indicate that the decrease in the number of gfp cells observed at higher passages is not related to plasmid uptake by the cell but to the efficiency of gfp expression . this higher efficiency observed at lower passages may be the result of a higher nuclear uptake and/or a more efficient transcription / translation of the gfp gene . cell viability and cell recovery after transfection are critical parameters to consider when determining the efficacy of nonviral gene delivery methodology . by analysing table 1 , it is remarkable that , under optimal transfection conditions ( l / d = 1.25 and plating cell density of 25,000 cells / cm ) , lf2000 led to high cell viabilities at all cell passages ( 90%95% ) . moreover , cell recoveries from 50% to 98% were obtained , which is the real measure of the number of cells that remained adherent , and supposedly functional , after lipoplexes uptake . according to the high capacity of msc to proliferate and differentiate in vitro into different mesodermal lineages , both clonogenic and differentiative potential assays were performed to verify to what extent lipofection could affect msc characteristics . it was also analysed if msc maintained their characteristic immunophenotypic profile . in order to verify if msc maintained the capacity to proliferate and originate colonies , a cfu assay was carried out for transfected msc and two controls . one control included cells incubated with 2.5 l of lf2000 ( figure 5(a ) , white bar ) and the other cells that were neither in contact with lf2000 nor pdna ( figure 5(a ) , grey bar ) . the transfected cells ( black bar ) , which had a transfection efficiency of nearly 20% , have considerably lost their clonogenic potential when compared to the control of cells only ( an 85% decrease ) . nevertheless , independently of pdna transfection , lf2000 itself had a harmful effect on msc clonogenic potential , since a decrease of 43% in colonies was observed . considering the maintenance of msc multilineage differentiative potential , transfected cells ( with transfection efficiency near 20% ) were induced to differentiate into the adipogenic and osteogenic lineages ( figure 5 ) . controls with non - transfected cells and cells incubated with lf2000 were also performed . as can be seen in figures 5(b ) and 5(c ) transfected msc were showed to preserve the capacity to differentiate into adipocytes ( figure 5(b ) ) and osteocytes ( figure 5(c ) ) . after 15 days in culture , the adipogenic differentiation was confirmed through the oil red - o test , where stained red lipid droplets inside vacuoles of mature adipocytes were visualized . on the other hand , osteogenic differentiation was confirmed with the appearance of nodules that stained positive ( in brown ) for calcified matrix through the von kossa staining and an increasing alkaline phosphatase activity was also observed , which is a distinctive characteristic of osteogenic commitment ( in pink ) . through immunophenotype staining , it was verified whether transfected msc ( with a transfection efficiency of nearly 20% ) maintained its characteristic phenotypic profile , namely over 90% positive for cd73 , cd90 , and cd105 . as expected , more than 90% of the non - transfected cells ( control ) expressed the three markers . when analysing the cell population that underwent the transfection protocol , a slight decrease ( < 9% ) on the percentage of cells expressing these markers compared to controls was observed ( table 2 ) . however , when considering only gfp cells from the transfected population , a higher decrease was observed , namely , 83.0% , 74.2% , and 86.5% of cells expressed cd73 , cd105 , and cd90 , respectively . bm mscs have been widely investigated due to their regenerative potential ; however , in many cases it might be useful to enhance some of their features through gene delivery strategies to harness their full potential in cell / gene - based therapies . previously , a method for plasmid delivery quantification was successfully established by us , fulfilling a lack in the study of msc transfection , since an efficient quantification of the number of plasmids that enter into the cell was required . this new rt - pcr quantification method has been revealed to be an extremely useful tool for the optimization of msc transfection using cationic liposomes , particularly to understand the relationship between expression and the plasmid uptake within a population of transfected cells . recently , an rt - pcr methodology was established to quantify the number of plasmids inside cho cells and bacteria . taking advantage of the usefulness of this technique we have previously established a rapid quantitative rt - pcr assay to determine intracellular plasmid dna in msc ( submitted for publication ) . in this previous work , the rt - pcr method showed good reproducibility , high sensitivity , and a wide linear range of 75 to 2.5 10 plasmid dna copies per cell . the influence of cell number on the rt - pcr sensitivity was also evaluated . in the work described herein we have studied the effect of the initial plasmid amount , cationic lipid , and cells passage number on the plasmid uptake for bone marrow - derived msc . by varying cationic liposome amount , using the same quantity of pdna , we have verified that major amounts of lipids did not correlate with higher amounts of pdna inside the cells . in fact , it has been shown that for each cell type there is an optimal dose of plasmid , above which any additional plasmid will not contribute to transgene expression even though it may be delivered to the nucleus . moreover , higher amounts of transfection reagent were thought to increase pdna protection against intracellular degradation by endonucleases , therefore increasing pdna entrance into the nucleus . however , it was reported that the highest values of dna protection do not correlate with higher values of transfection activity , even when using dope . this neutral lipid at physiological ph is included in lf2000 formulation and reacts to the acidic ph of endosomes promoting pdna release before their maturation into lysosomes . it was verified by others that dna complexes giving rise to effective transfection are released from endocytic vesicles at an early stage of endocytosis , that is , mainly before 1.5 hour after uptake , when the dna is still mostly nondegraded [ 21 , 22 ] . moreover , recently , the existence of a nuclear clumping of extranuclear dna was observed 24 hours after transfection of b16f10 mouse melanoma cells and a549 human lung carcinoma , with lf2000 .contrarily , other authors did not detect extranuclear dna 24 hours after lipofection of nih3t3 cells . this is advantageous because it is less time consuming but does not allow a distinction between pdna inside the nucleus or in the perinuclear space . assuming that different cells may lead to different rates of dna nuclear uptake and knowing that nih3t3 cells ( mouse embryonic fibroblasts cell line ) may show more physiological similarities with bm msc , which are fibroblast precursors , we may suggest that plasmid copies detected by our method 24 hours after transfection were mainly from the nucleus . nevertheless , higher amount of pdna copies was obtained at higher charge ratios ( l / d = 2 ) although not correlating with higher transgene expression . this lower expression could be either related to a higher level of dna aggregation , within lipids or proteins , in the perinuclear space , or due to saturation of gfp expression [ 13 , 23 ] , or both . indeed , with the increase of cationic reagent , apart from the occurrence of aggregation , higher number of plasmids may also enter into the nucleus because , in this case , more pdna molecules may be complexed . however , as observed in our case , an increase in pdna inside the nucleus could not lead to any increase in protein expression . furthermore , we verified that this formulation , l / d = 2 , led to higher levels of cell death because a reduction of around 10% in cell viability and recovery was observed when the lipid amount was increased from 2.5 l to 4 l . more fundamental studies on pdna intracellular trafficking in bm msc after lipofection are required in order to validate its kinetics , especially using different amounts of dna and cationic liposomes . since the plasmid used in this study does not have the capability of replicating inside cell , it will be diluted after transfection and with consecutive cellular divisions . thus it would be expected to observe a decrease in the number of cells expressing gfp over time as a consequence of the decrease in plasmid copy numbers inside the cells . as previously shown by others using cho cells transfected with the same plasmid and using an rt - pcr quantification method , the plasmid copy number inside these cells decreases exponentially along seven days . in contrast to the viral delivery systems , which are frequently used to long - term expression of a gene of interest , in many cases of non - inherited diseases it may be desirable to express the therapeutic gene transiently . in fact , since the transfection method used was only expressed for a short period of time ( 7 days ) it is an ideal candidate for this kind of therapeutic approach , such as , msc transient expression of anti - inflammatory genes to suppress an acute inflammation or expression of homing chemokines to move msc towards the site of injury . in addition , the expression profiles reported can also be useful in other regenerative medicine applications , including tissue engineering , where proliferation and/or differentiation into a specific lineage can be favoured by transient expression of a target gene involved in self - renewal or cell commitment , respectively . regarding transfection efficiencies using cationic liposomes , although the values obtained are still considerably lower than those obtained with the viral vectors and some nonviral vectors , namely , electroporation and nucleofection [ 25 , 26 ] , the results presented herein are very encouraging since a maximum value of 35% was reached using l / d = 1.25 . in fact , from all the available commercial reagents lf2000 has been shown to be more efficient on msc transfection , and efficiencies of 5%20% have been reported when similar detection methods were used [ 24 , 27 ] . it is worth mentioning that for some applications lower transfection efficiencies may be required , because in most cases , high transfection efficiencies are directly associated to a higher cell death . in fact , it was recently shown that cationic liposomes overcome not only the known clinical safety problems related to viral vectors but also the toxicity problem , since lipofectamine toxicity is generally less than 20% , which is considered to be adequate for several applications [ 24 , 29 ] . in this work it was verified that human msc transgene expression is cell passage dependent , in accordance with the results reported by others using similar and different transfection systems and cells [ 28 , 29 ] . indeed , only one report was found in the literature focusing on the effect of the cell passage number of msc on the transfection efficiency . these authors , however , only studied two different passages ( 5 and 7 ) . herein , regardless the decrease in gfp cells along cell passages , the same amount of plasmid entered the cells along the passages . according to our results around 20,000 pdna copies the effects of msc consecutive cell doublings on their genotypic and phenotypic characteristics were previously reported [ 30 , 31 ] , but to our best knowledge no adverse effect has been detected at passages 2 , 3 , and 4 . we hypothesize that upon the first passages the transcriptional mechanism of msc is being delayed which may explain the decrease of gfp cells and mfi whereas cells enclose similar amounts of plasmid dna . indeed , expression of nonnative proteins requires extra energy from the cells , and probably at early passages mammalian cells have more energy available to use in transcriptional activities of foreign genes . it is important to notice that our results were obtained with cells from donors above 60 years old , and cells from younger donors may lead to different results , since in few studies it has been reported that donors ' age might influence for example the replicative lifespan of cells or their capability to differentiation which are directly related to endogenous protein expression along different cell passages . the variability observed for the different donors might be due to intrinsic donor - to - donor variability . to date , and to our best knowledge , there are no reports establishing any relationship between plasmid copy number inside cells after lipofection and passage number of human msc . in this work , cell viabilities above 85% surpass those recently reported by others using nucleofection method for gene delivery to human msc . using this nucleofection procedure , higher transfection efficiency was achieved ( ~50% ) but over 50% cell death postnucleofection was induced . similarly , other authors reported less than 50% cell viability after msc electroporation ; in this case , a 90% gene delivery efficiency to msc is reported using 60 g pdna to 1 10 cells , which in turn represents ~17,000 cells/g dna , a lower cell / dna ratio than the one used in this work ( 25,000 cells/g dna ) . the cell recovery results obtained by lipofection ( 53%100% ) were better than those obtained by nucleofection ( 40% ) or other electroporation methods ( 35%40% ) . interestingly , no other reports on cell recovery ( i.e. , the real measure of cells that survived after lipofection ) of msc lipofection were found in the literature . in what concerns the multipotency of msc , it was possible to conclude that transfection does not affect msc differentiative potential since transfected msc could differentiate into cells from two different mesodermal lineages : adipocytes and osteocytes . this is especially interesting when considering msc as one of the preferable starting cell source for tissue engineering applications . on the other hand , it is believed that the decrease observed in the expression of the characteristic markers cd73 , cd90 , and cd105 , as well as in the clonogenic potential , does not jeopardize msc therapeutic potential especially if one considers that most applications with msc in cellular therapy are based on their intrinsic trophic ( secretory ) activity which is believed to be immunomodulatory ( i.e. , treatment of graft - versus - host disease ) . other potential applications of msc would also take advantage from demonstrated features as being angiogenic , anti - inflammatory , antiapoptotic , and promitotic . in this context , it would be interesting to determine how transfection can affect msc secretory activity of different factors as for instance interleukin-10 ( il-10 ) or vascular endothelial factor ( vegf ) . although all transfection experiments performed herein were based on expressing a reporter protein encoded by a plasmid , our final goal is to develop efficient and safe methodologies to geneticallyengineer msc to enhance their therapeutic efficacy in different regenerative medicine applications , namely , for tissue regeneration and cancer treatment . indeed , genetic modification of msc with genes encoding for tissue - specific growth factors and cytokines ( e.g. , bone morphogenetic proteins ) can promote , both in vitro and in vivo , lineage - specific differentiation and improve tissue function . on the other hand , several studies have shown that mscs engineered to express antitumour factors ( e.g. , tumour necrosis factor apoptosis ligand ( trial ) , interferon ( ifn)- , - , and interleukin-2 ) ( reviewed in ) represent an attractive tool as a cell - mediated gene therapy to counteract tumour growth . in summary , this study showed that cationic liposomes are promising transfection agents to human msc , especially for applications only requiring low and transient expression of proteins . we were able to achieve up to 35% of cells expressing gfp using l / d = 1.25 at early passages . furthermore , we found that human msc lipofected at different passages , using the same amount of plasmid displayed , different levels of protein expression regardless similar amount of plasmids were detected inside the cells . these findings contributed to better understanding of msc lipofection and also underlined the need to focus on more fundamental studies to comprehend the pdna trafficking mechanism from the cytoplasm into the nucleus in these cells . accordingly , this concept will be undoubtedly extremely useful in future developments of novel vectors for nonviral gene delivery to human msc , contributing to an optimization of the gene delivery processes as well as to broadening the field of msc applications .

microencapsulation is one of the most important forms of controlled release of substances that is widely used in several fields of the industry , particularly the food industry ( 1 ) . the encapsulated microbial cells have been used in wide range of fields for optimum activity benefiting the suitable conditions for growth and metabolism and at the same time protection from harsh environmental conditions ( 2 , 3).over the years , there has grown a great interest in developing suitable eukaryotic probiotics in general and probiotic yeasts in particular for human and animal practice ( 4 ) . however , nowadays yeasts are part of nutritional supplements and healthy food realms due to their established beneficial probiotic effects ( 5 ) . yeasts especially the genus saccharomyces are widely used probiotics in human and animals throughout the world ( 6 , 7 ) . providing probiotic living cells with a physical barrier against adverse environmental conditions is therefore an approach currently receiving considerable interest ( 8 , 9 ) . in addition microencapsulation via calcium alginate has been used extensively for immobilization of probiotic because of its simplicity of handling , its non - toxic nature , and its low cost ( 911 ) . the aim of this study was to evaluate the survival rate of free and microencapsulated s. cerevisiae by calcium alginate in simulated gastrointestinal conditions . the yeast strain used in this study was s. cerevisiae ( atcc code 9763 ) . yeast cells were activated by transferring cells from refrigerated slant to 50 ml of liquid culture medium sabouraud dextrose ( sd ) broth ( merck co. , darmstadt , germany ) and incubated overnight at 28 c with orbital shaking of 180 rpm . 1 ml of the incubation was inoculated into another 50 ml of the same medium and incubated for 24 h under the same culture conditions . cells were harvested by centrifugation at 10,000 rpm for 10 min and washed five times with distilled water to remove the culture medium from the cells thoroughly . simulated gastric juices ( sgj ) were prepared by suspending pepsin ( p7000 , 1:10,000 ) in sterile sodium chloride solution ( 0.5% , w / v ) to a final concentration of 3 g / l ( 1038 u / ml ) and adjusting the ph to 2.0 with concentrated hcl or sterile 0.1 mol / l naoh . simulated intestinal juices ( sij ) were prepared by suspending pancreatin usp ( p-1500 ) in sterile sodium chloride solution ( 0.5% , w / v ) to a final concentration of 1 g / l , with 4.5% bile salts ( oxoid , basingstoke , uk ) and adjusting the ph to 8.0 with sterile 0.1 mol / l naoh . both solutions were filtered for sterilization through a 0.22 m membrane . in this study extrusion technique then , the mixture of cell suspension and na alginate were injected into a 0.1 m cacl2 solution through a sterile insulin syringe . the tolerance of free and immobilized cells of s. cerevisiae on simulated gastric and intestinal juices was determined using the adapted method described by charteris et al . the tests were performed using a series of 10ml sterile falcon tubes , one for each sampling point . two different conditions were tested : in the first and second tests , 0.4 ml of the suspension of either immobilized or free cells were mixed with 1.8 ml of sgj or sij , gently mixed and incubated for 120 min at 28 c . the control for these tests was done by incubating 0.4 ml of either free or immobilized cells in 1.8 ml sterile sodium chloride solution ( 0.5 % , w / v ) for 120 min at 28 c . after the addition of free cells or immobilized to sgj and sij , the ph of these were corrected to 2.0 and 8.0 , respectively , with sterile 0.1 mol / l naoh or concentrated hcl . aliquots of 1 ml were removed at 0 , 30 , 60 , and 120 min ( for all trials ) for the determination of total viable counts . total viable counts of s. cerevisiae were determined by a pour plate method using sc agar ( merck co. , darmstadt , germany ) after serial 10-fold dilutions in peptone water . plates were incubated at 28 c for 72 h. the chi - square ( ) test was used to assess statistical differences between the groups . the yeast strain used in this study was s. cerevisiae ( atcc code 9763 ) . yeast cells were activated by transferring cells from refrigerated slant to 50 ml of liquid culture medium sabouraud dextrose ( sd ) broth ( merck co. , darmstadt , germany ) and incubated overnight at 28 c with orbital shaking of 180 rpm . 1 ml of the incubation was inoculated into another 50 ml of the same medium and incubated for 24 h under the same culture conditions . cells were harvested by centrifugation at 10,000 rpm for 10 min and washed five times with distilled water to remove the culture medium from the cells thoroughly . simulated gastric juices ( sgj ) were prepared by suspending pepsin ( p7000 , 1:10,000 ) in sterile sodium chloride solution ( 0.5% , w / v ) to a final concentration of 3 g / l ( 1038 u / ml ) and adjusting the ph to 2.0 with concentrated hcl or sterile 0.1 mol / l naoh . simulated intestinal juices ( sij ) were prepared by suspending pancreatin usp ( p-1500 ) in sterile sodium chloride solution ( 0.5% , w / v ) to a final concentration of 1 g / l , with 4.5% bile salts ( oxoid , basingstoke , uk ) and adjusting the ph to 8.0 with sterile 0.1 mol / l naoh . in this study extrusion technique was performed for microencapsulation process described earlier ( 11 ) . a 2% na then , the mixture of cell suspension and na alginate were injected into a 0.1 m cacl2 solution through a sterile insulin syringe . the tolerance of free and immobilized cells of s. cerevisiae on simulated gastric and intestinal juices was determined using the adapted method described by charteris et al . the tests were performed using a series of 10ml sterile falcon tubes , one for each sampling point . two different conditions were tested : in the first and second tests , 0.4 ml of the suspension of either immobilized or free cells were mixed with 1.8 ml of sgj or sij , gently mixed and incubated for 120 min at 28 c . the control for these tests was done by incubating 0.4 ml of either free or immobilized cells in 1.8 ml sterile sodium chloride solution ( 0.5 % , w / v ) for 120 min at 28 c . after the addition of free cells or immobilized to sgj and sij , the ph of these were corrected to 2.0 and 8.0 , respectively , with sterile 0.1 mol / l naoh or concentrated hcl . aliquots of 1 ml were removed at 0 , 30 , 60 , and 120 min ( for all trials ) for the determination of total viable counts . total viable counts of s. cerevisiae were determined by a pour plate method using sc agar ( merck co. , darmstadt , germany ) after serial 10-fold dilutions in peptone water . the chi - square ( ) test was used to assess statistical differences between the groups . a p value less than 0.05 was statistically considered significant . in this study the size , surface morphology and shape of the 50 randomly selected calcium alginate beads were determined with light microscope at a magnification of 400 . the shape of the beads was generally spherical , sometimes elliptical with a mean diameter of about 5090 m . on the other hand internal , appearance of coated bead at 400 magnification showed that yeasts were distributed randomly in the alginate matrix ( figs . 1 and 2 ) . the results of survival rate of encapsulated cells in simulated gastric ph and intestinal bile salt solutions showed in table 1 . no significant reduction in viable count was observed in free as well encapsulated cells in distilled water ( ph 6.5 ) on incubation for up to 2 h ( control condition ) . but variations in counts of free and microencapsulated s. cerevisiae during incubation period at sgj and sij were significant ( table . 1 ) . however , results show there were significant reductions of free yeast in immediate exposure to ph 2 and 8 . after 120 min incubation in simulated gastric and intestinal condition there was a significant increase ( p < 0.05 ) in survival of yeast cells in the capsulated compared with free cells . survival of microencapsulated and free sacchromyces cerevisiae in simulated gastric conditions number of alive cells after expose to sgi and sij for different times ( mines ) mean sea over the years , probiotics have gained scientific and commercial interest and have now quite commonplace in our daily life starting from health promoting functional foods to therapeutic , prophylactic , and growth supplements ( 11 , 12 ) . on the contrary to prokaryotic cells , the use of eukaryotic as probiotics is limited and only a few probiotics of eukaryotic origin are commercially available for human and animal practices . survival of the s. cerevisiae was found to increase on alginate encapsulation . also there was no significant difference in the viability of free cells in distilled water , indicating that water had no effect on the survival ( 13 , 14 ) . among the eukaryotic probiotics , yeasts especially saccharomyces species are dominant and routinely used in a broad range of hosts that can tolerate a wide range of temperature , salt concentration , and ph depending upon the strain especially s. cerevisiae(15 ) . in addition , the count of viable probiotic cells obtained for all the microcapsules was above the recommended levels for a probiotic food , i.e. , equal to or greater than 7 log cfu / g of the product , which is in accordance with earlier reports ( 15 , 16 ) . on the other hand , the free strain showed a steady loss in viability when exposed to acid conditions . however , the microcapsules containing s.cerevisiae survived very well ( p < 0.05 ) after exposure to in vitro acid conditions when compared to free cells . also , a decrease of approximately 4 log was noted in the number of free cells after 2 h of incubation at ph 2 , when compared to decreases of about 2 log in the all microencapsulated s.cerevisiae under similar conditions ( 11 , 17 ) . however , the literature report mentioned the effect of ox gall bile on the viability of the probiotics , in this study the capsulated yeast had a significant survival rate in sij . more recently , saccharomyces probiotics have been found to aid in controlling the pathogenesis of diabetes and other metabolic diseases . it is necessary to mentioned that high tolerance of yeast in different conditions such as intestinal and functional food showed the good potential of this cell as probiotic . regarding the above mentioned points and agreement of this study results with many other reports about microencapsulation of bacteria , ca alginate could be good material for protection of probiotic cells ( 1820 ) . s. cerevisiae yeast cells , fundamental in the fermentation industry , comprise a natural , safe ( food grade ) , cheap and abundant food material . the present study has shown that ca alginate microencapsulation significantly improve the yeast survival in simulated gastric environment , and allow viable cells to reach a beneficial level as probiotic . in order to obtain the other aspect of yeast probiotics , this study should be continued by different material and in functional food condition with defined variable in to the future .

urothelial carcinoma of the bladder is the sixth most frequent malignant disease in industrial countries and the second common cancer of the urogenital system in korea . approximately 70% of all patients with newly diagnosed urothelial cancer have nonmuscle - invasive bladder cancer . initial treatment of such tumors consists of transurethral resection ( tur ) , but at the first follow - up , the recurrence rate is between 3.4% and 45.8% . the probabilities of recurrence and progression for ta and t1 bladder cancer at 1 year range from 15 to 61% and from < 1 to 17% , respectively . at 5 years , the probabilities of recurrence and progression range from 31 to 78% and from < 1 to 45% , respectively . although white light cystoscopy ( wlc ) is still regarded as the gold standard for the diagnosis of bladder cancer , its sensitivity and specificity are not entirely satisfactory . small bladder cancers or flat lesions such as carcinoma in situ ( cis ) can be easily overlooked . it has been estimated that approximately 10 to 20% of tumors are not discovered by conventional wlc . such remnant tumors could lead to a significant increase in incomplete resection of tumors , which in turn would lead to a high risk of recurrence of bladder cancer . resection or complete destruction of a bladder cancer is considered the main factor preventing the recurrence of bladder cancer . to resolve these problems , fluorescence cystoscopy has been studied and , more recently , photodynamic diagnosis ( pdd ) has been viewed as a valuable aid to tur of bladder cancer . to date , two pdd agents have been studied in larger trials : delta - aminolevulinic acid ( ala ) and its derivative , hexaminolevulinate ( hal ; hexvix , photocure , norway ) [ 10 - 12 ] . the basis of pdd is the preferential accumulation of the photoactive porphyrin in neoplastic tissue , resulting in red fluorescence - emitting tumors . hal and 5-ala have been studied in many large trials . compared with 5-ala , hal provides the benefits of increased selectivity , brighter fluorescence , and a shorter instillation time . hal generates up to four times the levels of the fluorescent molecule , protoporphyrin ix , in half the time . the european association of urology guidelines state that fluorescence cystoscopy , performed in blue light and using a porphyrin - based photosensitizer , may help in discovering suspicious areas not visible in white light . the aim of this study was therefore to evaluate the efficacy of hal fluorescence cystoscopy in the diagnosis and management of bladder cancer and to compare it with that of standard cystoscopy . our institutional review board approved this study , and written informed consent was obtained from all participants before enrollment . thirty patients were diagnosed as having bladder cancer by use of cystoscopy or urine cytology . cytology - positive results meant that malignancy or suspicious malignancy was observed on two consecutive urine cytology tests . patients were excluded if they had massive hematuria ( blue light is highly absorbed by blood and clots ) , moderate to severe leukocyturia , urethral foley catheter insertion , chronic retention state , urinary tract infection , history of bladder cancer , or imaging evidence of upper urinary tract disease , pregnancy , hypersensitivity to porphyrins , or renal or hepatic impairment . a solution of hal hydrochloride ( 50 ml , 1.7 mg / ml , 8 mm , hexvix , photocure , norway ) in buffered saline solution was instilled via a 14-fr foley catheter inserted into the bladder and retained for 60 minutes before cystoscopy . the storz d - light - c system with a xenon arc lamp as a source was used in all cases . one hour later , the bladder was first inspected under wlc , and the number and location of cancers were noted , followed by blue light cystoscopy ( blc ) with all suspected lesions documented before tur . after marking the lesions confirmed with wlc or blc , tur of the lesion and pathologic confirmation tur of the lesions that were negative under both white and blue light was also performed randomly to calculate sensitivity and specificity . the primary endpoint was the sensitivity and specificity of hal in the diagnosis and treatment of bladder cancer . in addition , we compared sensitivity and specificity between wlc and blc , positive and negative predictive values , and side effects of the drug . between april 2010 and september 2010 , 30 patients who had a bladder lesion suggestive of bladder cancer were enrolled . a total of 25 males and 5 females were included ; the mean age of the study sample was 60.49.22 years . of the patients , 53.4% ( 16 ) had recurrent disease and 46.6% of the patients ( 14 ) had newly diagnosed cancer . from the total of 30 patients , bladder cancer was diagnosed in 77 specimens , and nonbladder cancer was diagnosed in 57 specimens . in normal tissue , 25 were normal tissue , 2 were squamous metaplasia , and 30 were chronic inflammation . of the chronic inflammation specimens , 23 were positive in blc , compared with 19 positive in wlc . with blc , all cis lesions were detected , whereas only 10 lesions ( 83% ) were detected with wlc . 62 cases were confirmed bladder cancer , whereas 24 specimens showed negative findings with wlc . therefore , the positive and negative predictive value of wlc were 72.1% and 68.8% , respectively . the sensitivity and specificity of wlc were 80.5% ( 62/77 ) and 57.8% ( 33/57 ) , respectively . thus , the positive predictive value of blc in the diagnosis of bladder cancer was 71.2% . thus , the negative predictive value of blc in the diagnosis of bladder cancer was 81.8% . the sensitivity of blc in the diagnosis of bladder tumor was 92.3% ( 72/78 ) and the specificity was 49.1% ( 27/56 ) . with wlc , 48 specimens were negative , but 23 of them were positive with blc ( 47.91% ) . within this group , the sensitivity of blc was higher than that of wlc ( p=0.021 ) , whereas the specificity of wlc and blc showed no significant difference . we checked urinary retention , nausea , vomiting , constipation , pain , fever , skin lesions , elevated liver enzymes or bilirubin , and sepsis . however , the examination was well tolerated and there were no significant side effects in the 24 hours after the instillation of hal . 62 cases were confirmed bladder cancer , whereas 24 specimens showed negative findings with wlc . therefore , the positive and negative predictive value of wlc were 72.1% and 68.8% , respectively . the sensitivity and specificity of wlc were 80.5% ( 62/77 ) and 57.8% ( 33/57 ) , respectively . thus , the positive predictive value of blc in the diagnosis of bladder cancer was 71.2% . thus , the negative predictive value of blc in the diagnosis of bladder cancer was 81.8% . the sensitivity of blc in the diagnosis of bladder tumor was 92.3% ( 72/78 ) and the specificity was 49.1% ( 27/56 ) . with wlc , 48 specimens were negative , but 23 of them were positive with blc ( 47.91% ) . within this group , the sensitivity of blc was higher than that of wlc ( p=0.021 ) , whereas the specificity of wlc and blc showed no significant difference . we checked urinary retention , nausea , vomiting , constipation , pain , fever , skin lesions , elevated liver enzymes or bilirubin , and sepsis . however , the examination was well tolerated and there were no significant side effects in the 24 hours after the instillation of hal . pdd has recently been viewed as a valuable aid to tur of bladder cancer as reflected in current guidelines . improved tumor detection by ala - induced fluorescence endoscopy has been demonstrated by several investigators and averages 20% compared with conventional wlc . . showed that sensitivity of the pdd group was 97% and the specificity was 67% , with 73% and 69% in the wlc group . . showed similar results of 96% and 67% in the pdd group for sensitivity and specificity versus 68% and 66% in the wlc group . in addition , daniltchenko et al . studied the long - term benefits of 5-ala in tur of superficial bladder cancer in 102 patients with a median follow - up of 42 months for the pdd group and 39 months for the wlc group . the recurrence - free survival rate was higher in the pdd group ( 41% ) than in the wlc group ( 25% ) . by comparison with ala lange et al . showed a high level of demarcation between red fluorescence malignant cells and blue light normal tissues . studied 52 patients with bladder cancer and calculated that hal imaging has 96% sensitivity compared with 73% for wlc . after several studies indicated that hal cystoscopy has the potential for improved detection in superficial bladder cancer , open , large randomized studies comparing the effectiveness of pdd using hal with wlc showed similar results . reported that among 45 patients , a total of 43 were diagnosed by fluorescence cystoscopy compared with 33 diagnosed by white light for sensitivity of 96% and 73% . hal cystoscopy was found to be particularly useful for finding cis in 13 patients , because all except 1 were diagnosed or confirmed by hal cystoscopy . reported that 96% of all tumors were detected with hal imaging compared with 77% by use of standard cystoscopy . this difference was particularly noticeable for dysplasia ( 93% vs. 48% ) , cis ( 95% vs. 68% ) , and superficial papillary tumors ( 96% vs. 85% ) . the diagnostic accuracy in our series was significantly improved for blc ( 92.3% ) by comparison with wlc ( 80.5% ) . we demonstrated that 29.5% of our patients received a diagnosis of bladder cancer by blc , whereas they were diagnosed as having no cancer on wlc . cis is highly predictive of progression to invasive cancer and requires prompt treatment but is not easily detected under wlc . the results obtained by geavlete et al . described a cis detection rate of 95.7% for blc , superior to wlc , which diagnosed only 51% of the cis lesions . other studies showed similar results of a cis detection rate of 97% for blc and 58% for wlc . our study also showed that 100% ( 12/12 ) of cis lesions were detected by blc . no local or systemic adverse events were reported , including urinary retention , nausea , vomiting , constipation , pain , fever , skin lesion , elevated liver enzyme or bilirubin , or sepsis . in our study , a total of 30 patients were enrolled and our mean follow - up period was 21.1 months and the bladder cancer recurrence rate was 20% ( 6 patients ) . among those patients , 3 patients showed t1 stage bladder cancer and among them , 2 patients experienced recurrence with t2 stage bladder cancer and were treated by radical cystectomy . another 3 patients showed ta stage bladder cancer and recurrence of the same stage bladder cancer . this study had some limitations . whereas an increased bladder cancer detection rate has an impact on tumor detection and more precise treatment of bladder cancer , there are insufficient data about the relation between increased diagnostic accuracy and the bladder cancer recurrence rate or survival benefit . lately , some studies have shown that pdd leads to improved treatment in 1 of 5 patients and reduces residual cancer rates and increases cancer - free survival significantly . pdd with hal helps to detect cancer lesions that could be missed with wlc only , especially cis lesions . pdd might be valuable in complete resection as well as for more accurate diagnosis of bladder cancer .

deep brain stimulation ( dbs ) is commonly accepted as a safe and effective treatment for many neurological diseases including movement disorders , refractory epilepsies , psychiatric diseases and pain disorders.14 dbs of the anterior nucleus of thalamus ( ant ) was recently reported as beneficial for patients with intractable epilepsy in a randomized , controlled , double - blind study.5 many studies have discussed the complications of dbs on classical targets . however , because of limited experience with ant dbs for epilepsy , its technical problems are rarely reported and unclear . in this case report , we describe a patient with a unique complication after ant dbs , whose dbs lead had migrated into ventricle , detected 8 years after implantation . a 57-year - old male was admitted for progressive loss of anti - epileptic effect from bilateral ant dbs during the last 6 months prior to admission . his first seizure developed at the age of 10 . since then , he suffered from chronic epilepsy with generalized tonic - clonic seizures and had regularly taken antiepileptic medications . a huge left frontal lobe meningioma detected due to increasing seizure frequency was removed in 2001 , when he was 43 year of age . after about 6 years of multiple antiepileptic drug treatment by an experienced epileptologist in a tertiary hospital , he was diagnosed with intractable bilateral frontal lobe epilepsy . he was considered to have medically intractable epilepsy and was evaluated with presurgical studies , including video - electroencephalography ( eeg ) , ictal and interictal single - photon emission computed tomography , magnetic resonance imaging ( mri ) , and positron emission tomography . bilateral ant dbs was performed in one hospital in 2007 . according to the medical records and old brain images , minneapolis , mn , usa ) and soletra ( model 7426 ; medtronic inc . , he had undergone replacement of bilateral implantable pulse generators ( ipgs ) in 2011 due to ipg depletion . however , his seizure frequency had increased gradually to three or more times a month , since 6 months before admission . his left ipg battery was found to be depleted at the outpatient clinic 2 weeks before admission . admission was decided to evaluate shortened longevity of the ipg and poor antiepileptic effect of dbs . he had no major head trauma history that could have affected the function of the dbs system . plain x - rays were taken to determine the integrity of bilateral leads and extension lines . brain mri showed that the left dbs lead was not located in the left ant , but in the third ventricle ( fig . the third and lateral ventricles had enlarged significantly and bilateral sylvian fissures had widened without any evident obstructive lesion in the cerebrospinal fluid pathway , compared to the mri performed in 2007 ( fig . we estimated the degree of ventricular enlargement and created fusion images using framelink navigation software ( medtronic inc . , minneapolis , mn , usa ) to identify the direction and degree of lead migration . to make fusion images , postoperative computed tomography ( ct ) scan , taken after the first dbs in 2007 , was merged on the stereotactic mri taken for re - visionary ant dbs in 2015 . other areas in the ct scan , except the dbs lead , were made invisible by controlling the contrast and transparency of the image ( fig . the patient required re - implantation of a new dbs lead in the left ant and replacement of the ipg . we removed the dbs lead and performed a mri - guided , transventricular ant dbs on the left side . postoperative ct scan was taken for detecting any acute complication , and then it was fused with the preoperative stereotactic mri to confirm the location of the electrodes . after verification of the eeg driving response and conducting test stimulations for 2 days , the ipg was replaced . comparison of the brain mris taken in 2007 and 2015 revealed that the evans index , the cella media index and the maximal width of the third ventricle had increased from 0.254 to 0.267 , 0.142 to 0.204 , 7.7 to 14.5 mm , respectively . the ct scan taken after the first dbs in 2007 showed that only the most distal electrode had definite contact with the ant parenchyma ( fig . we fused the ct scan with the recent mri taken in 2015 using the navigation software . the fusion images showed that the left lead had migrated medially into the third ventricle and the right lead had migrated laterally during the intervening 8 years ( fig . rather , it was firmly attached to the burr hole with thick adhesions and new bone formation . after a simple adhesiolysis between the lead and surrounding tissue , the lead was easily removed without much risk of intracerebral hemorrhage as it was in the ventricle , rather than within the thalamic parenchyma . after removing the lead and the extension line , the scan was merged with the preoperative stereotactic mri to confirm the final electrode locations . the fusion image revealed that successful targeting was achieved with sufficient contact to the ant parenchyma ( fig . the patient showed a mechanical , antiepileptic effect after re - implantation of the left ant lead , and a prominent eeg driving response was verified . it receives the mammillothalamic tract and projects to the cingulate gyrus.6 electrical stimulation of the ant to treat epilepsy was introduced by sussman et al.7 and by cooper et al.8 recently , the sante multi - center , prospective , randomized , double - blind study ( electrical stimulation of the anterior nucleus of the thalamus for treatment of refractory epilepsy ) demonstrated the efficacy of ant dbs to reduce epileptic seizures.5 the authors reported paresthesia , implant site pain and infection as the most common device - related adverse effects . initially mislocated electrodes were 8.2% of their cases , but the details were not described.5 in the present case , it was obvious that the lead had spontaneously migrated due to the significant enlargement of the ventricle because the patient had no definite history of trauma and no securing failure was observed near the burr hole site intraoperatively . the ct scan taken immediately after the first dbs in 2007 showed that only the distal part of the left dbs lead had contact with the ant parenchyma ( fig . the targeting was correct , but the contact surface for the electrodes was insufficient . in fusion images the left lead was revealed to have migrated medially into the third ventricle and the right lead had migrated laterally ( fig . we speculate that the left lead probably moved laterally due to laterally acting pressure caused by enlargement of the ventricle . then , the lead pulled out of the thalamic parenchyma , which eventually caused its medially directed migration , while the right lead remained in the laterally moved location in the thalamus . we think that it was caused by a shallow and insufficient lead implantation . a transventricular trajectory is usually avoided in dbs for classical targets , such as the subthalamic nucleus , globus pallidus interna , and ventral nuclei of the thalamus.9 ventricular puncture during the surgery may induce a brain shift due to loss of cerebrospinal fluid , which is a common cause of mistargeting . in addition , a dbs lead is not rigid enough to pierce through the ventricle and may proceed in the wrong direction in a curvelinear shape along the ventricular wall during the implantation.9 moreover , many vascular structures in the ventricles can cause acute hemorrhage.10 therefore , neurosurgeons carefully perform dbs so as not to interrupt the ventricular wall . however , transventricular trajectory is frequently chosen for ant dbs because of its proximity to the ventricle.6 the medial dorsal nucleus of thalamus also has profound projections to the cerebral cortex , which can be affected by a more anteriorly located trajectory , and which may lead to a synergetic effect with ant stimulation.11 during the 8 years , the patient had undergone significant atrophic brain changes ( figs . 2a and 2b ) . because the human brain changes with time , it is important for physicians to understand and predict the absolute or relative changes in electrode locations , which may cause unexpected side effects or loss of benefits.12 according to a longitudinal cross - sectional study , the volume of the cerebral cortex and subcortical structures decrease , and the ventricular volume increases during healthy aging.13 in that study , the volumes of the inferior lateral ( 5.47% ) , lateral ( 4.40% ) , and third ( 3.07% ) ventricles increased significantly , but the size of the fourth ( 0.71% ) ventricle did not change.13 studies have evaluated the influence of aging on structures , such as the subventricular and basal ganglia , the thalamus , and the brain stem region , where most dbs targets are located.1315 the atrophic changes in the brain of a patient with epilepsy are more severe . in a volumetric mri study , both the gray and white matter had more atrophy beyond the known epileptogenic area in the temporal lobe epilepsy ( tle ) patient group , compared to that in a healthy group.16 atrophy progresses more significantly compared to that observed during normal aging in patients with pharmacoresistant tle.17 in the present case , in addition , surgery of the huge frontal meningioma in 2001 , may have contributed the acceleration of atrophic changes of the brain by inducing traumatic injury . therefore , regular brain imaging studies can be helpful to identify possible changes in electrode locations of ant dbs , because many causes , such as aging , epileptic seizure and brain injury , can provoke and accelerate progressive ventricular dilatation and cerebral atrophy . in conclusion , the progressive dilatation of the ventricles and shallow , insufficient implantation of the initial ant dbs may have caused migration of the dbs lead . we recommend regular follow - up imaging studies as well as measuring impedance and battery status of the implanted device , because ventricular dilatation and cerebral atrophy can progress years after ant dbs in an epilepsy patient with injured , atrophied brain .

the dna damage response network ensures the fidelity of dna replication and controls the repair of damage arising during cellular replication or from exogenous agents such as genotoxic drugs . checkpoint kinase 1 ( chk1 ) is a serine / threonine kinase occupying a central position in this complex network of cell regulatory and dna repair mechanisms . chk1 is predominantly activated through phosphorylation on amino acid residues ser317 and ser345 by the upstream kinase ataxia telangiectasia and rad3 related ( atr ) in response to single strand breaks in dna , and it undergoes autophosphorylation on ser296 . g1/s , s , or g2/m cell cycle checkpoints are activated in response to genotoxic antitumor drugs to provide an opportunity for repair of damaged dna or to activate apoptotic pathways.(8 ) chk1 is involved in the s - phase checkpoint and stabilizing replication forks , and in the g2/m checkpoint through regulating the stability of the cdc25 phosphatases which control cell cycle progression by regulation of cdk1 . human cancers frequently have functional defects in the tumor suppressor p53 , with consequent loss of g1/s checkpoint control and greater reliance on s and g2/m checkpoints . thus , s or g2/m checkpoint inhibitors will selectively sensitize p53 deficient cancer cells to dna damaging agents . chk1 inhibition by sirna and several small molecule inhibitors , including the lead compound resulting from the studies reported herein,(17 ) has confirmed this in preclinical studies . a range of adenosine 5-triphosphate ( atp ) competitive chk1 inhibitors have been reported , with varying selectivity for the target enzyme over other kinases . inhibitor development has been assisted by structural biology studies of the enzyme , in particular crystallographic analysis of inhibitor binding to the protein . as well as atp - competitive inhibitors , allosteric modulators of chk1 have been identified.(31 ) some atp - competitive chk1 inhibitors have reached early clinical trials in combination with dna - damaging agents , although the therapeutic outcomes remain to be determined . previously we have shown how a fragment - based screening strategy identified several low molecular weight , ligand efficient templates which were developed into early stage chk1 inhibitors . the purine template hit 1 was initially elaborated to the pyrazolopyridine lead 2.(33 ) here we describe how structure - based design led , through several scaffold morphing steps , to the evolution of 2 into a potent and selective chk1 inhibitor ( r)-3 ( sar-020106,(17 ) figure 1 ) . structures of the template hit 1 , early stage lead 2 , and ( r)-3 ( sar-020106 ) . features conserved in the elaboration of the template hit and early stage lead into a potent and selective chk1 inhibitor are highlighted in blue and red . the crystal structure of 2 bound to chk1 confirmed that the ligand occupied the atp pocket and interacted with the hinge region of the kinase . the predicted hydrogen bonds were observed between n1 and n7 of the pyrazolo[3,4-b]pyridine with the backbone amides of glu85 and cys87 , respectively ( figure 2a ) . the 2-(aminomethyl)morpholine group was located in the ribose pocket , though no specific polar interactions were observed , while the ethyl ester was directed out onto the solvent exposed surface . the area around the gatekeeper and interior pocket was unexplored , and our initial synthetic effort concentrated on probing this area . chk1 contains a polar amino acid ( asn59 ; see figure 2a ) in the interior pocket beyond the gatekeeper residue , which differentiates the enzyme from many other protein kinases where a hydrophobic amino acid is located at the equivalent position . as a result , the interior pocket of chk1 , defined by asn59 , glu55 , and the lys38-asp148 salt bridge , is often observed in crystal structures to contain between 1 and 3 protein bound water molecules ( see figure 2a e ) . ligand interactions with these protein bound water molecules have been shown to be important in conferring both chk1 potency and selectivity against other kinases . crystal structures of 2 ( panel a , pdb 2ym3 ) , 4 ( panel b , pdb 2ym4 ) , 6 ( panel c , pdb 2ym5 ) , 8 ( panel d , pdb 2ym6 ) , 20 ( panel e , pdb 2ym7 ) , and ( r)-3 ( panel f , pdb 2ym8 ) bound to the chk1 kinase domain . panel g : plan view of the overlay of chk1 inhibitors 2 ( cyan ) , 8 ( gray ) , 20 ( blue ) , and ( r)-3 ( gold ) relative to the hinge region of chk1 ( cartoon ) . examination of the crystal structure of 2 suggested that a pendant phenyl at the 3-position of the pyrazolo[3,4-b]pyridine could provide a suitable vector toward the interior pocket . alternatively , fusing a third ring to the core to form a tricycle could also provide a platform for substitution to contact the protein - bound water molecules . we focused on substitution with functional groups having the potential to form hydrogen bonding interactions with the bound water molecules or the polar residues comprising the asp148-lys38 salt bridge in chk1 . in addition , we investigated the ability of the compounds to inhibit the functionally distinct checkpoint kinase 2 ( chk2).(35 ) selectivity for inhibition of chk1 over chk2 is desirable , since simultaneous ablation of both chk1 and chk2 by rnai has been shown to be inferior to selective depletion of chk1 alone in overriding the s - phase checkpoint.(36 ) the interior pocket of chk2 contains a hydrophobic leucine residue at the equivalent site to asn59 in chk1 , providing a less favorable environment for the binding of water molecules or polar ligand functionality . thus , successful targeting of the interior pocket in chk1 with polar functionality is predicted to lead to selectivity against chk2 . ic50 determined in a dissociation - enhanced lanthanide fluorescent immunoassay ( delfia).(33 ) mean of two independent determinations ; individual values in parentheses . standard inhibitor staurosporine gave chk1 ic50 = 2.1 ( 1.8 ) nm and chk2 ic50 = 27 ( 8 ) nm . ratio of ic50 values ( chk2/chk1 ) . ligand efficiency ( le ) calculated using le = [ 1.4 log10(ic50 ( m))]/(number of heavy atoms).(37 ) mean ( sd ) of at least three independent determinations . among several analogues prepared,(38 ) the trisubstituted pyrazolopyridine analogue 4 retained the potency of 2 ( table 1 ) and was shown by x - ray crystallography to hydrogen bond to a water in the interior pocket through the nitrile group ( figure 2b ) . however , the crystal structure also indicated that the ligand was unable to simultaneously position all three substituents optimally in the atp - binding site due to steric congestion . the 2-(aminomethyl)morpholine and ethyl ester were both twisted into potentially undesirable conformations compared to 2 , with the ester oriented orthogonal to the bicycle . the ligand attained only equivalent potency to 2 despite the addition of extra interacting functionality , reflected in the reduced ligand efficiency . we attempted to resolve the overcrowding by reverting to a pyrrolo[2,3-d]pyrimidine core(33 ) and removing the pendant ethoxycarbonyl group . substitution with the 3-(3-cyanophenyl ) group resulted in compound 5 , having slightly reduced chk1 potency relative to 4 , while the 3-(3-(hydroxymethyl)phenyl ) analogue 6 gave a 3-fold increase in activity . however , the selectivities for chk1 against chk2 were reduced for both 5 and 6 compared to 2 . the crystal structure of 6 ( figure 2c ) showed that although steric crowding around the core was reduced , the 3-hydroxymethyl substituent had adopted an alternative orientation along a vector into the ribose pocket and away from the interior pocket . the selectivity of compound 2 for chk1 over chk2 indicates that , in common with many atp - competitive inhibitors binding to active kinase conformations,(39 ) some specificity for inhibition can be obtained through interactions with the selectivity ( or solvent - exposed ) surface at the entrance to the atp - binding cleft . the amino acid residues comprising this region vary between kinases and thus alter the properties of the surface . in chk1 the surface includes contributions from tyr86 , cys87 , and ser88 ( see figure 2f ) , while in chk2 the equivalent residues are leucine , methionine , and glutamate , respectively . in compound 6 the absence of the pendant ethoxycarbonyl group and the failure of the hydroxymethyl group to engage with the water - filled pocket removed the potential contributions to chk1 selectivity . one possible approach to restoring selectivity was to replace the morpholine substituent with a less bulky , unbranched alkylamine and reintroduce the 5-substituent to the pyrazolo[3,4-b]pyridine core . less bulky alkylamine 4-substituents would be anticipated to relieve the crowding seen in 4 and permit both the 3- and 5-substituents to be present in favorable conformations for binding to chk1 . however , the 2-(aminomethyl)morpholine or similar cyclic 4-substituents on the 3-aryl substituted bicyclic cores were important in establishing novelty to provide patentable compounds in an area which has been intensively exemplified as kinase inhibitor scaffolds . instead , we maintained the morpholine substituent but elaborated the bicyclic core by the addition of a fused ring . initial compounds prepared from a commercially available pyrimidoindole tricyclic core ( 7 ) gave compounds with similar chk1 potencies and ligand efficiencies to 2 . no preference was seen for the enantiomers of the 2-(aminomethyl)morpholine group , ( r)-7 and ( s)-7 . the requirement for the inclusion of a suitable h - bond donor or acceptor capable of interacting with the protein - bound water molecules led to a more involved synthetic effort , resulting in both the nitrile substituted analogue 9 and the introduction of a nitrogen into the fused ring to give the 9h - pyrimido[2,3-b]azaindole 8 . while addition of the nitrile group 9 led to a drop in le , the more compact 8 gave equivalent potency and le to 2 and restored some of the selectivity over chk2 . x - ray crystallography confirmed that the azaindole nitrogen effectively contacted the network of bound waters in the interior pocket of chk1 , providing a rationale for the recovery of the selectivity in the absence of a substituent directed toward ser88 and the selectivity surface ( figure 2d ) . importantly , the pyrimido[2,3-b]azaindole core of 8 provided the opportunity to introduce a more varied range of alkylamino substituents to replace the 2-(aminomethyl)morpholine while still generating novel inhibitors.(47 ) the influence of the alkylamino group was probed with an array of analogues , including 1013 , resulting in the identification of the 4-(aminomethyl)piperidine 13 as a more potent and selective alternative . however , the rigid planar nature of the tricyclic scaffold and synthetic challenges to further elaboration prompted us to consider another scaffold morphing step and to disconnect the middle ring of the tricycle . this was envisaged to introduce a degree of flexibility into the core hinge - binding pharmacophore , potentially allowing the ligand to adopt a better conformation for simultaneous interaction with the hinge region and the water - filled pocket . an efficient synthesis of a small array of compounds allowed this variation to be quickly assessed ( table 2 ) . ic50 determined in delfia.(33 ) mean of two independent determinations ; individual values in parentheses . standard inhibitor staurosporine gave chk1 ic50 = 2.1 ( 1.8 ) nm and chk2 ic50 = 27 ( 8 ) nm . ratio of ic50 values ( chk2/chk1 ) . le = [ 1.4 log10(ic50 ( m))]/(number of heavy atoms).(37 ) mean ( sd ) of at least three independent determinations . the potency of simple n-(pyridin-3-yl)pyrimidin-4-amines ( see representative example 14 ) suffered , presumably as the steric clash between the pyrimidine 5-h and pyridine 4-h would force the core to adopt too extreme a nonplanar conformation . by switching the pyridine to a pyrazine ring , this was overcome , and the first ring opened adaptation , n-(pyrazin-2-yl)pyrimidin-4-amine ( 15 ) , showed some activity , though disappointingly 75-fold less than that of the parent compound , 13 . the incorporation of pyrazine substitution into chk1 inhibitors has been reported previously for a series of pyrazin-2-yl ureas , where the additional nitrogen atom in the pyrazine ring was shown by crystallographic studies to be important in restraining the urea moiety in the bioactive conformation.(27 ) comparisons with these chk1 inhibitors suggested that appending a nitrile in the 2-position of the pyrazine could be beneficial through achieving additional interactions with the protein in the region of the water - filled pocket . comparing 15 with 16 , optimization of the diamine substituent proved fruitful , as 4-(aminomethyl)piperidine gave excellent chk1 potency while retaining selectivity over chk2 when incorporated into the n-(pyrazin-2-yl)pyrimidin-4-amine 20 . crystallographic data explained the increased activity and selectivity of the 2-cyanopyrazines , as there was a clear interaction of the nitrile with the conserved lys38 and the water network filling the interior pocket ( see figure 2e ) . interestingly , a sharp loss of activity was seen when the terminal amine ( 1920 ) was replaced with structurally similar but nonbasic polar groups ( 2122 ) . activity relationship is in contrast with that demonstrated for ( 6-cyanopyrazin-2-yl)urea chk1 inhibitors , where replacement of a pendant amine with nonbasic polar groups was tolerated . thus , although occupying similar space within the atp - binding site , as shown by the crystallographic data , and interacting with some similar points on the chk1 protein , the two series did not have identical structure activity relationships . with limited points of substitution that would enable us to probe the solvent - exposed selectivity surface , we sought to exchange the pyrimidine for a pyridine . activity relationships discussed above , the reintroduction of the ester 5-substituent in 23 increased chk1 affinity by 4-fold ( 23 vs 20 ) and chk1 vs chk2 selectivity to approximately 300-fold . the 4,5-disubstituted pyridine scaffold presented one opportunity for optimization of the inhibitors , which will be reported separately . we also pursued a further scaffold morphing step , seeking to combine the 4- and 5-substituents into a fused ring to give imidazo[4,5-c]pyridines and isoquinolines . this gave the micromolar inhibitors 24 and 27 ( table 3 ) , with encouraging ligand efficiencies ( > 0.3 kcal mol heavy atom ) for the unsubstituted scaffolds . ic50 determined in delfia.(33 ) mean of two independent determinations ; individual values in parentheses . standard inhibitor staurosporine gave chk1 ic50 = 2.1 ( 1.8 ) nm and chk2 ic50 = 27 ( 8 ) nm . le = [ 1.4 log10(ic50 ( m))]/(number of heavy atoms).(34 ) mean ( sd ) of at least three independent determinations . we explored the reintroduction of basic amine substituents to mimic the substitution of 20 and 23 , originating either from the imidazole nitrogen of the imidazo[4,5-c]pyridines or through tethering via an ether linkage to the pyrazine portion of the scaffolds.(27 ) as shown by the representative example 25 , the analogues with the side chain originating from the imidazo[4,5-c]pyridines had substantially decreased affinity ( table 3 ) . moving the basic amine substituent to the pyrazine in 26 and 28 gave much improved activity against chk1 with good selectivity over chk2 . while both imidazo[4,5-c]pyridines ( e.g. , 26 ) and isoquinolines ( e.g. , 28 ) were potent and selective chk1 inhibitors , the cellular activities of the imidazo[4,5-c]pyridines were substantially lower than those of the corresponding isoquinolines ( see table 4 and discussion below ) , and thus , further optimization concentrated on the latter heterocycle . g2 checkpoint abrogation assay.(17 ) pi ; ratio of srb gi50 for chk1 inhibitor alone to gi50 for the combination of chk1 inhibitor and sn38 ( see ref ( 17 ) ) . alogp(53 ) and tpsa(54 ) calculated with pipeline pilot ( v7).(55 ) single determination . several published urea - based chk1 inhibitors(49 ) direct a chlorine substituent toward the selectivity surface . overlays of our isoquinoline scaffold with these ureas showed that a chlorine in the 8-position could be similarly positioned and have the potential to make a short oxygen halogen interaction with the carbonyl oxygen of ser88.(50 ) to explore this , reoptimization of the basic amine substituent was conducted on isoquinolines with and without 8-chloro substitution ( table 3 ) . in the main , the chlorinated analogues retained chk1 activity , and this set of compounds led us to the potent and selective compound ( rac)-3 . the chk1 enzyme inhibitory activity of ( rac)-3 could be attributed , on testing of the enantiomeric pair , to the r - enantiomer , ( r)-3 . x - ray crystallography of ( r)-3 in the chk1 enzyme ( figure 2f ) showed binding through hydrogen - bonding to glu85 and cys87 in the hinge region , the hydrogen - bonding of the nitrile to lys38 , and the dimethylamine nestled in the ribose pocket . the branched methyl on the side chain fitted closely to val23 while the isoquinoline chloro substituent was close to the specificity surface without projecting too far toward solvent . the distance from the chlorine to the carbonyl oxygen of ser88 measured in the 2.1 resolution crystal structure was 3.44 , greater than the sum of the cl and o van der waals radii . the potency of ( rac)-3 was only approximately twice that of the des - chloro analogue 34 , suggesting that an oxygen however , comparison of 34 and ( rac)-3 showed that selectivity against chk2 was improved from 120-fold to greater than 3000-fold by the addition of the 8-chloro substituent . selected compounds were investigated for activity in cellular assays during optimization of chk1 potency . cytotoxicity was measured with a sulforhodamine b ( srb ) assay(51 ) using the human colon carcinoma cell line ht29 . a cell based enzyme - linked immunosorbent assay ( elisa ) was developed to measure g2 checkpoint abrogation by quantifying the level of m - phase phosphoprotein 2 ( mpm2 ) expression ( a measure of mitosis ) in ht29 cells that passed through an etoposide - induced g2 arrest into mitosis , where they were trapped using nocodazole.(17 ) the ratio of srb cytoxicity to cellular elisa activity gave an activity index ( ai ) , which we found to be a useful indicator of selective inhibition of chk1 in cells . as shown in table 4 with selected examples of the scaffolds described above , the cytotoxity was generally weak , with only 30 and ( r)-3 giving gi50 values in the nanomolar range . the potency in the g2 checkpoint abrogation assay in general tracked the chk1 activity . isoquinolines 28 , 30 , and ( r)-3 , three compounds with chk1 ic50 < 100 nm , abrogated the etoposide - induced g2 checkpoint with ic50 < 200 nm . conversely , the imidazo[4,5-c]pyridines , e.g. 26 , demonstrated good potency in the enzyme assay but showed minimal activity in both the g2 checkpoint abrogation and srb assays . we attributed this to poor permeability of the imidazo[4,5-c]pyridine core scaffold when paired with the piperidine , consistent with the high polar surface area calculated for 26 . compounds abrogating the g2 checkpoint at nanomolar concentrations while remaining relatively noncytotoxic ( ai > 4 ) were assessed further to gauge the enhanced efficacy when used in combination with a cytotoxic drug . ht29 colon cancer cells were exposed to a fixed concentration of sn38 ( the active metabolite of the dna topoisomerase i inhibitor irinotecan(52 ) ) that inhibited growth by 50% relative to untreated controls , and they were additionally exposed to increasing concentrations of the chk1 inhibitor in a 96 h srb assay . the ability of the chk1 inhibitor to enhance the cytotoxicity of sn38 was expressed as a potentiation index ( pi ) , which was the ratio of gi50 for the chk1 inhibitor alone and the gi50 for the chk1 inhibitor in combination with sn38.(17 ) potentiation was observed for 27 , 28 , 29 , and ( r)-3 , with all except 27 giving a greater than 2-fold potentiation . the two analogues having the most favorable properties overall were 28 and ( r)-3 , which had gi50 values of 345 nm and 190 nm , respectively , in the presence of sn38 . the inhibitory activity of ( r)-3 was assessed at 1 m concentration against a representative sample of 124 kinases from across the human kinome , using radiometric assay format(56 ) at [ atp ] km , atp for all the enzymes ( figure 3 ) . only chk1 and 6 other kinases out of 124 showed > 80% inhibition at 1 m . a further 8 kinases showed some inhibition ( 4080% ) at 1 m , but the majority of kinases tested ( 109/124 ) showed less than 40% inhibition at 1 m concentration of ( r)-3 , indicative of > 100-fold selectivity . the kinase inhibitory activities of ( r)-3 were also determined in a smaller panel at the higher concentration of 10 m ( see supporting information ) . the compound also displayed good selectivity at this higher concentration , where only chk1 and 8 other kinases out of 50 tested showed > 80% inhibition . selectivity profile of ( r)-3 against a panel of 124 kinases measured at 1 m concentration of the test compound with [ atp ] km , atp for each kinase . metabolic turnover of ( r)-3 in mouse and rat liver microsomes was high ( 80% and 92% metabolized at 30 min , respectively ) , but the compound was appreciably more stable in human liver microsomes ( 35% metabolized at 30 min ) . good permeability was seen for a monolayer of human intestinal epithelial cells ( caco-2 ; a to b pe 1.43 10 cm s ) with no active efflux observed ( ratio a b / b a 0.25 ) . ( r)-3 was studied in vivo as previously described,(17 ) including pharmacodynamic and efficacy determinations in sw620 human colon carcinoma xenografts in nude mice.(59 ) although having minimal oral bioavailability in mice ( f = 5% ) , distribution of ( r)-3 following i.p . dosing ( 40 mg / kg ) was sufficient to inhibit chk1 in the tumors , as shown by inhibition of the irinotecan - induced chk1 ps296 autophosphorylation ( figure 4a).(17 ) at doses giving inhibition of chk1 activity in vivo , the selective chk1 inhibitor ( r)-3 showed no single agent activity in the sw620 xenograft model , and tumors grew at similar rates to the vehicle - treated controls . when dosed ( i.p . ) in combination with irinotecan , ( r)-3 was observed to potentiate the antitumor activity of the genotoxic drug in the sw620 xenograft model . tumor growth was delayed when compared to the vehicle - treated control , chk1 inhibitor alone , or cytotoxic drug alone . similar data were obtained for the combination of ( r)-3 with gemcitabine(57 ) ( figure 4b and see ref ( 17 ) ) . these experiments demonstrated that the in vitro cellular potency and potentiation of genotoxic cytotoxicity by ( r)-3 translated into in vivo biomarker modulation and potentiation of genotoxic drug efficacy expected for a selective chk1 inhibitor . ( a ) status of ps296 chk1 autophosphorylation in sw620 tumor xenografts following treatment with either irinotecan alone or in combination with ( r)-(3).(17 ) tumor bearing animals were administered either vehicle alone , irinotecan alone ( 25 or 50 mg / kg ip ) , or irinotecan combined with a fixed dose of ( r)-(3 ) ( 40 mg kg ip ) 1 h prior to irinotecan administration . tumors were collected 6 or 24 h following treatment ( 6 or 24 after administration of the first agent for combinations ) and snap frozen . tumor protein expression was characterized by western blotting using 50 g of sample per lane . ( b ) antitumor effects of combining ( r)-3 with irinotecan in nude mice bearing sw620 xenograft tumors.(17 ) symbols : ( ) dose administered ; ( ) vehicle alone ; ( shaded up triangles ) irinotecan alone ( 12.5 mg / kg ip ) ; ( shaded down triangles ) ( r)-3 alone ( 40 mg / kg ip ) ; ( ) irinotecan and ( r)-3 combined ( ( r)-3 dosed 1 h prior to and 24 h after irinotecan ) . the evolution of pyrazolopyridine 2 , a micromolar inhibitor of chk1 , to the potent and selective isoquinoline inhibitor ( r)-3 demonstrates how fragment - growing and scaffold morphing strategies can be combined to successfully progress fragment - derived hit matter to compounds with appropriate activity in vivo . by incorporating inhibitor selectivity against chk2 as a goal from the start of the medicinal chemistry , and guided by determinants of chk1 selectivity apparent from the structural biology of the enzyme , the promising selectivity for chk1 in the early fragment - derived leads was maintained and improved . fragment - growing identified two productive vectors for enhancing the potency and selectivity of the initial bicyclic inhibitors : an extension to contact the water - filled pocket of chk1 , best achieved with a tricyclic heteroaromatic framework , and substitution to bind at the specificity surface of the atp site . the determination of multiple protein ligand structures during the optimization confirmed the introduction of productive new binding interactions and allowed a rationalization of the poor affinity of sterically crowded bicycles which adopted energetically unfavorable conformations on binding . scaffold modification , or morphing , is a common strategy for improvement and diversification of lead molecules derived from screening approaches . in this case , breaking up the tricyclic scaffold to a series of n-(pyrazin-2-yl)pyrimidin-4-amines , followed by optimization of a basic amino - substituted side - chain , maintained the hinge - binding hydrogen bonds and other key interactions for chk1 potency and selectivity , while addressing challenges of synthetic tractability and crowded intellectual property space encountered with the tricyclic and bicyclic inhibitors , respectively . a further scaffold morphing step was achieved through translocation of the basic amine side - chain , allowing diversification of the hinge - binding group to include a series of 2-amino - isoquinolines . this approach led to the isoquinoline ( r)-3 ( sar-020106 ) , a potent inhibitor of chk1 with excellent selectivity with respect to chk2 and a broader sample of the kinome , representing one of the most selective chk1 inhibitors reported to date . despite the extensive scaffold modification , the isoquinoline ( r)-3 ( mw = 382 ) retained the good ligand efficiency of the original template hit , 6-(morpholin-4-yl)purine 1 . cell - based assays for selective chk1 inhibition , through measuring the abrogation of an etoposide - induced g2 checkpoint , and for nonselective cytotoxicity were used to confirm that the observed kinase selectivity translated into the expected chk1-selective pharmacology in cells . the pharmacokinetic properties of the optimized isoquinoline ( r)-3 were sufficient to demonstrate inhibition of chk1 in vivo on i.p . dosing . pharmacodynamic biomarkers showing the activation of chk1 by genotoxic drugs were inhibited in human tumor xenografts . at a pharmacodynamically active dose , the inhibitor potentiated the antiproliferative efficacy of the genotoxic agents irinotecan and gemcitabine toward human sw620 colon cancer xenografts in nude mice , and minimal effects of the selective chk1 inhibitor alone were shown . while optimization of pharmacokinetic properties is desirable to generate compounds suitable for development , the isoquinoline ( r)-3 is a useful in vitro and in vivo chemical tool to investigate the effects of selective chk1 inhibition . the synthetic procedures for the four scaffolds and the analogues discussed in this paper ( 334 ) are outlined in schemes 14 . the previously described pyrazolopyridine 35(33 ) was brominated at the 3-position using nbs ( scheme 1 ) . a suzuki miyaura coupling and deprotection of the amine gave the pyrazolopyridine 4 . for the pyrrolopyrimidine analogues commercially available 4-chloro-7h - pyrrolo[2,3-d]pyrimidine 37 was first brominated followed by sem protection of the pyrazole nitrogen to give 38 . displacement of the chlorine substituent with boc - protected 2-(aminomethyl)morpholine at 100 c in n - butanol gave an advanced intermediate 39 , which was elaborated using suzuki dual deprotection using tbaf and ethylenediamine in dmf followed by hcl in dioxane / meoh gave 5 and 6 . reagents and conditions : ( i ) nbs , dmf , rt , 77% ; ( ii ) pdcl2(dppf)ch2cl2 , 3-cyanophenylboronic acid , na2co3 , dme / h2o , 140 c , 2 h , microwave , 48% ; ( iii ) tfa , meoh , 80 c , 62% ; ( iv ) nbs , ch2cl2 , rt , 83% ; ( v ) nah , sem - cl , dmf , 0 c to rt , 93% ; ( vi ) boc - amine , tea , n - buoh , 100 c , 68% ; ( vii ) pd(pph3)4 , phenylboronic acid , na2co3 , dme / h2o , 120 c , 30 min , microwave , 4959% ; ( viii ) tbaf , ethane-1,2-diamine , dmf , 60 c , 7 h and then tfa , meoh , 80 c , 21% ; ( ix ) tbaf , ethane-1,2-diamine , dmf , 60 c , 7 h and then 4 m hcl dioxane , meoh , 24 h , rt , 17% . ( 4-(9h - pyrimido[4,5-b]indol-4-yl)-morpholin-2-yl)methanamines 7 were synthesized by reacting the racemic or single enantiomer(33 ) cbz - protected 2-(aminomethyl)morpholine with commercially available 4-chloro-9h - pyrimido[4,5-b]indole ( 48 ) and subsequent acid - mediated removal of the cbz protecting group ( scheme 2 ) . the pyrido[4,3:4,5]pyrrolo[2,3-d]pyrimidine and pyrimido[4,5-b]indole-7-carbonitrile tricyclic cores 49 and 50 were constructed from 4-chloro-5-nitropyridine ( 40 ) and 4-chloro-3-nitrobenzonitrile ( 41 ) , respectively ( scheme 2 ) . nucleophilic aromatic subsitution of the starting material with the anion of ethylcyanoacetate and reduction of the nitro group with zinc in acetic acid allowed an intramolecular cyclization which provided the ethyl 2-amino-1h - indole-3-carboxylate 45 or its 6-aza analogue 44 . condensation with formamide completed the tricyclic cores ( 46 , 47 ) , and chlorination with phosphorus oxychloride installed the reactive chloride functionality of 49 and 50 . the diamines were introduced as described for the previous examples to provide 713 . reagents and conditions : ( i ) nah , ncch2co2et , dmf , 0 c to rt and then 40 or 41 , 2 h , rt , 48% ; ( ii ) zn / acoh , 95 c , 1 h 15 min , 88% ; ( iii ) formamide , ammonium formate , 170 c , 18 h , 45% ; ( iv ) pocl3 , 75 c , 18 h , 100% ; ( v ) amine , tea , dmf , 120 c , 1 h , microwave and then 4 m hcl , dioxane / meoh , 2.5 h , 346% ; ( vi ) amine , tea , nmp , 140 c , microwave and then mp - tsoh column , 29% . the n-(pyridin-2-yl)pyrimidine-4,6-diamines and n-(pyrazin-2-yl)pyrimidine-4,6-diamines were assembled via a palladium - mediated amination of 4,6-dichloropyrimidine ( 51 ) with 3-aminopyridine ( 52 ) , 2-aminopyrazine ( 53 ) , or 2-amino-5-cyanopyrazine ( 54 ) ( scheme 3 ) . the resulting intermediates 5557 were derivatized by snar reactions with amines followed by a deprotection step , where required , to yield 1422 . reagents and conditions : ( i ) pdcl2(pph3)2 , lihmds , thf , 135 c , 20 min , 19%22% ; or when x = ch(bu3p)2pd(0 ) , naobu , toluene , 80 c , 2 h , 45% ; ( ii ) amine , nmp , 145 c , 20 min , ( 2641% ) ; ( iii ) amine , nmp , 145 c , 20 min , followed by tfa , ch2cl2 , 1 h , rt , or hcl , dioxane , mp - tsoh column ( 363% ) . the azabenzimidazoles 60 and 62 were prepared by first stirring 2-bromo-4-chloro-5-nitropyridine ( 58 ) at rt with tert - butyl 4-(aminomethyl)piperidine-1-carboxylate or 4-methoxybenzylamine followed by a reduction of the nitro group with tin(ii ) chloride dihydrate to give the diamine 59 or 61 ( scheme 4 ) . reagents and conditions : ( i ) 4-(aminomethyl)piperidine-1-carboxylate , tea , mecn , 1.5 h , rt , 93% ; ( ii ) sncl22h2o , etoh , 70 c , 2 h , 88% ; ( iii ) ( eto)3ch , ac2o , 100 c , 18 h , 40%100% ; ( iv ) 4-methoxybenzylamine , tea , mecn , 1.5 h , rt , 77% ; ( v ) aryl halide ( arcl for 24 , 25 , 29 ; ari for 27 ) , pd(oac)2 , ( )-binap , naobu , dmf / tol , 150 c , 30 min , microwave and then mp - tsoh column , 341% ( 11% for 25 including boc deprotection ) ; ( vi ) nhme2 ( 40% in h2o ) , 020 c , 2 h 40% ; ( vii ) aq nh3 ( 28% ) , 100 c , o / n , 91% ; ( viii ) nbs , ch2cl2 , 0 c , 1 h , 42% ; ( ix ) cui , 18-crown-6 , pd(pph3)4 , kcn , dmf , reflux , 3 h , 82% ; ( x ) nah ( 60% in oil ) , dioxane , aminoalcohol , 100 c , o / n , 1432% ; ( xi ) pd(oac)2 , ( )-binap , nabu , dmf / toluene , microwave , 140150 c , 30 min , or pd2(dba)3 , xantphos , cs2co3 , toluene , microwave , 140 c , 45 min ( 245% ) ; ( xii ) pd(oac)2 , ( )-binap , nabu , dmf / tol , microwave , 140150 c , 30 min , or pd2(dba)3 , xantphos , cs2co3 , toluene , microwave , 140 c , 45 min followed by tfa , 80 c , 30 min or tfa , ch2cl2 , rt , 1 h mp - tsoh column ( 226% ) . in the course of our investigations into the isoquinoline analogues , several different isoquinoline reagents were coupled using a variety of buchwald the lengthy synthesis of 64 has been previously described,(60 ) while 3-chloroisoquinoline 63 is commercially available and 8-chloroisoquinolin-3-yl trifluoromethanesulfonate 65 was synthesized in large quantities using the method reported by ventura et al.(61 ) buchwald hartwig palladium mediated aminations of 60 and 62 with commercially available 2-amino-5-cyanopyrazine 66 followed by deprotection of boc or pmb protecting groups using tfa in ch2cl2 at ambient temperature , or with neat tfa at 80 c , respectively , gave analogues 24 and 25 . similarly , palladium mediated aminations of 63 and 64 with 66 afforded analogues 27 and 29 directly . hartwig coupling partners for the other isoquinolines and azabenzimidazoles were constructed from 2,6-dichloropyrazine.(60 ) substitution of one chlorine using nh3 followed by bromination ortho to the remaining chlorine gave the precursor to the desired 5-amino-3-chloropyrazine-2-carbonitrile 70 . cyanation was achieved by heating with potassium cyanide in dmf with a crown ether and pd(pph3)4 to complete the synthesis of 70 . snar with protected or tertiary aminoalkoxides gave a range of substituted pyrazines 7176 for buchwald the single enantiomers of 1-(dimethylamino)propan-2-ol , e.g. 68 , required for the synthesis of ( r)-3 and ( s)-3 were prepared by the careful addition of an aqueous solution of dimethylamine to the appropriate , neat , enantiomerically pure propylene oxide , e.g. 67 ( scheme 4 ) . palladium mediated couplings between isoquinolines 63 or 65 with the relevant substituted pyrazines 73 , 74 , 75 , or 76 afforded products 33 , 34 , 3 , ( r)-3 , or ( s)-3 directly . the optical purities of ( r)-3 and ( s)-3 were determined to be > 95% ee by chiral hplc analysis ( see supporting information ) . where required , boc or pmb protecting groups were removed following coupling reactions using tfa in dichloromethane at ambient temperature , or with neat tfa at 80 c , respectively , to give compounds 26 , 28 , and 3032 . starting materials and solvents were purchased from commercial suppliers and were used without further purification . flash silica chromatography was performed using merck silica gel 60 ( 0.0250.04 mm ) . ion exchange chromatography was performed using isolute flash scx - ii ( acidic ) or flash nh2 ( basic ) resin cartridges . h nmr spectra were recorded on a bruker amx500 instrument at 500 mhz or bruker avance instrument at 400 mhz using internal deuterium locks . chemical shifts ( ) are reported relative to tms ( = 0 ) and/or referenced to the solvent in which they were measured . combined hplc - ms analyses were recorded using either ( 1 ) ( lct ) a waters alliance 2795 separations module and waters / micromass lct mass detector with electrospray ionization ( + ve or ve ion mode as indicated ) with hplc performed using supelco discovery c18 , 50 mm 4.6 mm or 30 mm 4.6 mm i.d . columns or an agilent 6210 tof hplc - ms with a phenomenex gemini 3 m c18 ( 3 cm 4.6 mm i.d . ) column [ both were run at a temperature of 22 c with gradient elution of 1090% meoh/0.1% aqueous formic acid at a flow rate of 1 ml / min and a run time of 3.5 or 6 min as indicated . uv detection was at 254 nm , and ionization was by positive or negative ion electrospray . the molecular weight scan range was 501000 amu . ] ( 2 ) ( zq ) a micromass zq mass spectrometer / waters alliance 2795 ht hplc with a phenomenex gemini 5 m , c18 , 30 mm 4.6 mm i.d . column or a waters x - bridge c18 , 2.5 m , 3.0 30 mm column . [ both were run at a temperature of 35 c with a gradient elution of 595% [ ( 0.1% ammonia in acetonitrile)/(0.1% ammonia , 5% acetonitrile , and 0.063% ammonium formate in water ) ] at a flow rate of 2 ml / min and a run time of 4 or 7 min as indicated . uv detection was at 220400 nm using a waters 996 photodiode array uv detector , and ionization was by positive or negative ion electrospray . all purified synthetic intermediates gave > 95% purity as determined by these methods except where indicated in the text . high - resolution mass spectra were measured using the agilent tof system described above . n - bromosuccinimide ( 0.044 g , 0.25 mmol ) was added in portions at rt to a solution of ethyl 4-(2-((tert - butoxycarbonylamino)methyl)morpholino)-1h - pyrazolo[3,4-b]pyridine-5-carboxylate(33 ) ( 35 ; 0.083 g , 0.20 mmol ) in dmf ( 2 ml ) . after stirring for 2 h , saturated brine was added and the precipitate was collected by filtration , washed with water , and dried , to yield 36 as a pale yellow powder ( 0.076 g , 77% ) . h nmr ( 500 mhz , d4-meod ) 1.401.46 ( 9h + 3h , m ) , 3.053.13 ( 1h , m ) , 3.133.29 ( 3h , m ) , 3.393.48 ( 1h , m ) , 3.553.62 ( 1h , m ) , 3.954.00 ( 2h , m ) , 4.024.07 ( 1h , m ) , 4.44 ( 2h , q , j = 7.5 hz ) , 8.53 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 4.83 min ; m / z ( esi ) 484 , 486 [ mh ] . a mixture of 36 ( 14 mg , 0.029 mmol ) , pdcl2(dppf)ch2cl2 ( 18 mg , 10 mol % ) , 3-cyanophenylboronic acid ( 9 mg , 0.06 mmol ) , and na2co3 ( 8 mg , 0.075 mmol ) in dme ( 2 ml ) and water ( 0.5 ml ) was heated to 140 c in a microwave reactor for 2 h. the mixture was partitioned between brine ( 10 ml ) and etoac ( 2 8 ml ) . the combined organic layers were washed with brine ( 10 ml ) and water ( 10 ml ) , dried , filtered , and concentrated . preparative tlc , eluting with 1:2 hexane / etoac , gave ethyl 4-(2-((tert - butoxycarbonylamino)methyl)morpholino)-3-(3-cyanophenyl)-1h - pyrazolo[3,4-b]pyridine-5-carboxylate as a light yellow oil ( 7 mg , 48% ) . h nmr ( 500 mhz , d4-meod ) 1.44 ( 3h , t , j = 7.5 hz ) , 1.46 ( 9h , s ) , 2.863.05 ( 4h , m ) , 3.063.26 ( 4h , m ) , 3.573.65 ( 1h , m ) , 4.45 ( 2h , q , j = 7.5 hz ) , 7.75 ( 1h , dd , j = 7.5 , 7.5 hz ) , 7.87 ( 1h , d , j = 7.5 hz ) , 8.01 ( 1h , d , j = 7.5 hz ) , 8.08 ( 1h , s ) , 8.55 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 4.74 min ; m / z ( esi ) 507 [ mh ] . ethyl 4-(2-((tert - butoxycarbonylamino)methyl)morpholino)-3-(3-cyanophenyl)-1h - pyrazolo[3,4-b]pyridine-5-carboxylate ( 2 mg , 0.004 mmol ) was dissolved in meoh ( 2 ml ) , and tfa ( 1 ml ) was added . after being refluxed at 80 c for 16 h , the solvents were evaporated and the residue was purified on scx - ii acidic resin ( 2 g ) , eluting with meoh and then 2 m nh3/meoh . the crude oil was purified by preparative tlc , eluting with etoac , to give 4 as a yellow oil ( 1 mg , 62% ) . h nmr ( 500 mhz , d4-meod ) 1.43 ( 3h , t , j = 7.5 hz ) , 2.462.51 ( 2h , m ) , 2.852.91 ( 1h , m ) , 2.973.05 ( 2h , m ) , 3.083.25 ( 3h , m ) , 3.623.67 ( 1h , m ) , 4.44 ( 2h , q , j = 7.5 hz ) , 7.75 ( 1h , dd , j = 7.5 , 7.5 hz ) , 7.90 ( 1h , d , j = 7.5 hz ) , 8.00 ( 1h , d , j = 7.5 hz ) , 8.08 ( 1h , s ) , 8.56 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 2.56 min ; m / z ( esi ) 407 [ mh ] . hrms ( esi ) m / z calcd for c21h23n6o3 ( m + h ) 407.1826 , found 407.1831 . a suspension of 4-chloro-7h - pyrrolo[2,3-d]pyrimidine ( 37 ; 0.49 g , 3.2 mmol ) and n - bromosuccinimide ( 0.68 g , 3.8 mmol ) in dry ch2cl2 ( 20 ml ) was stirred at rt for 2.5 h. the suspension was diluted with meoh and evaporated onto silica . the crude product was purified using flash column chromatography , eluting with 2:1 hexanes / etoac , to yield 5-bromo-4-chloro-7h - pyrrolo[2,3-d]pyrimidine as an off - white solid ( 0.613 g , 2.64 mmol , 83% ) . h nmr ( 500 mhz , d4-meod ) 7.64 ( 1h , s ) , 8.56 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 3.34 min ; m / z ( esi ) 236 , 234 , 232 [ mh ] . to a solution of 5-bromo-4-chloro-7h - pyrrolo[2,3-d]pyrimidine ( 1.03 g , 4.43 mmol ) in dmf ( 12 ml ) at 0 c was added nah ( 0.21 g , 60% suspension in oil , 5.05 mmol ) . after the suspension was stirred at this temperature for 15 min , sem - cl ( 0.89 g , 5.34 mmol ) in dmf ( 2 ml ) was added . the resulting suspension was then stirred at 0 c for 20 min and at rt for 1 h. water ( 30 ml ) was added ; the precipitate was collected by filtration , washed with water ( 2 30 ml ) , and dried in vacuo . compound 38 was obtained as light pink crystals ( 1.5 g , 93% ) . h nmr ( 500 mhz , d6-dmso ) 0.00 ( 9h , s ) , 0.90 ( 2h , t , j = 7.5 hz ) , 3.60 ( 2h , t , j = 7.5 hz ) , 5.70 ( 2h , s ) , 7.25 ( 1h , s ) , 8.70 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 4.34 min ; m / z ( esi ) 366 , 364 , 362 [ mh ] . a solution of tert - butyl morpholin-2-ylmethylcarbamate ( 0.075 g , 0.35 mmol ) , 38 ( 0.12 g , 0.33 mmol ) , and et3n ( 0.13 ml , 0.75 mmol ) in n - buoh ( 1.5 ml ) was heated at 100 c in a microwave reactor for 1 h. the solution was concentrated onto silica gel . the crude product was purified using flash column chromatography , eluting with 2:1 hexanes / etoac , to yield 39 as a viscous oil ( 0.122 g , 0.225 mmol , 68% ) . h nmr ( 500 mhz , cdcl3 ) 0.03 ( 9h , s ) , 0.93 ( 2h , t , j = 7 hz ) , 1.27 ( 9h , s ) , 2.95 ( 1h , dd , j = 7 , 7 hz ) , 3.213.23 ( 2h , m ) , 3.403.45 ( 1h , m ) , 3.56 ( 2h , t , j = 7 hz ) , 3.853.90 ( 2h , m ) , 4.024.16 ( 2h , m ) , 4.904.95 ( 1h , m ) , 5.58 ( 2h , s ) , 7.28 ( 1h , s ) , 8.43 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 4.30 min ; m / z ( esi ) 544 , 542 [ mh ] . a mixture of 39 ( 44 mg , 0.08 mmol ) , pd(pph3)4 ( 5 mg , 4 mol % ) , 3-cyanophenylboronic acid ( 24.5 mg , 0.22 mmol ) , and sodium carbonate ( 30 mg , 0.17 mmol ) in dme ( 1.5 ml ) and water ( 0.5 ml ) was heated to 120 c in a microwave reactor for 30 min . the mixture was partitioned between brine ( 10 ml ) and etoac ( 2 8 ml ) . the combined organic layers were washed with brine ( 10 ml ) and water ( 10 ml ) , dried ( na2so4 ) , filtered , and concentrated . preparative tlc , eluting with etoac / n - hexane/1:1 ( rf = 0.27 ) , gave tert - butyl ( 4-(5-bromo-7-((2-(trimethylsilyl)ethoxy)methyl)-7h - pyrrolo[2,3-d]pyrimidin-4-yl)morpholin-2-yl)methylcarbamate as a yellow oil ( 27 mg , 59% ) . h nmr ( 500 mhz , cdcl3 ) 0.00 to 0.04 ( 9h , s ) , 0.95 ( 2h , t , j = 8.0 hz ) , 1.45 ( 9h , s ) , 2.652.72 ( 1h , m ) , 2.822.98 ( 2h , m ) , 3.093.19 ( 1h , m ) , 3.353.50 ( 2h , m ) , 3.61 ( 2h , t , j = 8.0 hz ) , 3.623.78 ( 2h , m ) , 4.58 ( 1h , m ) , 4.78 ( 1h , broad s ) , 5.67 ( 2h , s ) , 7.30 ( 1h , s ) , 7.517.53 ( 2h , m ) , 7.78 ( 1h , d , j = 7.5 hz ) , 7.84 ( 1h , s ) , 8.55 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 5.57 min ; m / z ( esi ) 565 [ mh ] . a mixture of tert - butyl ( 4-((5-(3-cyanophenyl)-7-((2-(trimethylsilyl)ethoxy)methyl)-7h - pyrrolo[2,3-d]pyrimidin-4-yl)morpholin-2-yl)methylcarbamate ( 37 mg , 0.066 mmol ) , 1.0 m tbaf / thf ( 0.55 ml , 0.55 mmol ) , and ethane-1,2-diamine ( 20 l ) in dmf ( 1.5 ml ) was stirred at 60 c under n2 for 16 h. it was diluted with brine ( 8 ml ) and extracted with etoac ( 2 10 ml ) . the combined organic layers were washed with brine ( 10 ml ) and water ( 10 ml ) , dried ( na2so4 ) , filtered , and concentrated . the crude oil ( 12 mg ) was purified by preparative tlc , yielding 8 mg ( lc - ms rt 4.51 min ; m / z ( esi ) 435 [ mh ] ) . it was then dissolved in a mixture of meoh ( 3 ml ) and tfa ( 2 ml ) . the solution was stirred at 80 c for 12 h. the solvents were evaporated , and the residue was purified on scx - ii acidic resin ( 1 g ) eluting with meoh and then 2 m nh3meoh . the basic fractions were combined and evaporated to give 5 as a yellow oil ( 4.5 mg , 21% ) . h nmr ( 500 mhz , d4-meod ) 2.522.60 ( 1h , m ) , 2.632.70 ( 1h , m ) , 2.852.95 ( 2h , m ) , 3.413.51 ( 2h , m ) , 3.553.60 ( 1h , m ) , 3.74 ( 2h , d , j = 12 hz ) , 7.48 ( 1h , s ) , 7.797.55 ( 2h , m ) , 7.88 ( j = 7.7 hz , 1h , d ) , 7.93 ( 1h , s ) , 8.39 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 2.12 min ; m / z ( esi ) 335 [ mh ] . hrms ( esi ) m / z calcd for c18h19n6o ( m + h ) 335.1620 , found 335.1618 . a mixture of 4-chloro-9h - pyrimido[4,5-b]indole ( 47 ; 0.045 g , 0.221 mmol ) , morpholin-2-ylmethylcarbamic acid tert - butyl ester ( 0.055 g , 0.25 mmol ) , and et3n ( 0.10 ml , 0.75 mmol ) in dmf ( 0.70 ml ) was heated to 120 c in a microwave reactor for 1 h. the cooled solution was partitioned between water ( 20 ml ) and etoac ( 20 ml ) . flash column chromatography , eluting with etoac , gave [ 4-(9h - pyrimido[4,5-b]indol-4-yl)morpholin-2-ylmethyl]carbamic acid tert - butyl ester as a yellow solid ( 0.021 g , 0.0548 mmol , 25% ) . lc - ms ( lct , 6 min ) rt 5.57 min ; m / z ( esi ) 384 [ mh ] . a solution of [ 4-(9h - pyrimido[4,5-b]indol-4-yl)morpholin-2-ylmethyl]carbamic acid tert - butyl ester ( 0.021 g , 0.548 mmol ) and 4 m hcl dioxane ( 1 ml ) in meoh ( 5 ml ) was stirred at rt for 2.5 h. the solution was evaporated to dryness and purified by ion exchange on scx - ii acidic resin ( 2 g ) , eluting with meoh and then 2 m nh3meoh . preparative silica tlc , eluting with 1% nh39% meoh90% ch2cl2 , gave rac-7 ( 0.007 g , 0.025 mmol , 46% ) as a beige powder . h nmr ( 500 mhz , d4-meod ) 2.752.80 ( 2h , m ) , 3.003.06 ( 1h , m ) , 3.353.40 ( 1h , m ) , 3.753.85 ( 1h , m ) , 3.90 ( 1h , dd , j = 10 , 10 hz ) , 4.104.13 ( 1h , m ) , 4.19 ( 1h , d , j = 13 hz ) , 4.25 ( 1h , d , j = 13 hz ) , 7.35 ( 1h , dd , j = 8.8 hz ) , 7.47 ( 1h , dd , j = 8.8 hz ) , 7.57 ( 1h , d , j = 8 hz ) , 7.79 ( 1h , d , j = 8 hz ) , 8.46 ( 1h , s ) ; lc - ms ( lct , 6 min ) rt 1.98 min ; m / z ( esi ) 284 [ mh ] . ethylcyanoacetate ( 3.75 g , 38 mmol ) in dmf ( 3 ml ) was added dropwise at 0 c to a suspension of nah ( 1.5 g , 60% in mineral oil , 38 mmol ) in dmf ( 9 ml ) . the reaction mixture was stirred at rt for 30 min and then cooled to 0 c , and 3-nitro-4-chloropyridine ( 41 ; 2.63 g , 19 mmol , 1 equiv ) in dmf ( 3 ml ) was added slowly . two molar hcl ( 20 ml ) and etoac ( 20 ml ) were added after 2 h stirring at rt , and the organic layer was washed with water and brine , dried , and concentrated to give a red - orange oil . the crude oil was triturated with etoac , and the resultant solid was collected by filtration to give 42 ( 2.88 g , 48% ) . h nmr ( d6-dmso ) 1.18 ( 3h , t , j = 7.0 hz ) , 4.06 ( 2h , q , j = 7.0 hz ) , 7.58 ( 1h , br s ) , 7.88 ( 1h , dd , j = 1.0 , 7.0 hz ) , 8.70 ( 1h , s ) , 13.2 ( 1h , br s ) ; lc - ms ( zq , 4 min ) rt 1.13 min ; m / z ( es ) 190 [ m eto ] , 234 [ m h ] . a solution of 42 ( 2.20 g , 9.35 mmol ) in acoh ( 20 ml ) zinc dust ( 6.12 g , 94 mmol ) in 500 mg portions was added , and then the reaction mixture was heated at 95 c for 1 h 15 min . upon cooling , the filtrate was concentrated , and the residue was treated with saturated nahco3 to give a light brown solid . this was filtered , washed with water , and dried to give 44 as a light brown solid ( 1.69 g , 8.24 mmol , 88% yield ) . h nmr ( d6-dmso ) 1.32 ( 3h , t , j = 7.0 hz ) , 4.23 ( 2h , q , j = 7.0 hz ) , 7.0 ( 2h , br s ) , 7.41 ( 1h , d , j = 4.5 hz ) , 8.0 ( 1h , br ) , 8.31 ( 1h , br ) , 11.0 ( 1h , s , br ) . lc - ms ( tof , 4 min ) , rt = 1.70 min ; m / z ( es ) 206 . a mixture of 44 ( 1.80 g , 8.8 mmol ) and ammonium formate ( 0.62 g , 9.8 mmol ) in formamide ( 10 ml ) was heated at 170 c for 18 h. one molar hcl was added to the cooled reaction mixture , and the resulting suspension was filtered to remove insolubles . the resulting precipitate was collected by filtration and dried to a constant weight in a vacuum oven to give 46 ( 0.74 g , 45% ) . h nmr ( d6-dmso ) 7.89 ( 1h , d , j = 4.0 ) , 8.26 ( 1h , s ) , 8.37 ( 1h , d , j = 4.0 ) , 8.83 ( 1h , s ) , 12.5 ( s , br ) ; lc - ms ( zq , 4 min ) rt = 0.75 min ; m / z ( es ) 185 [ m h ] . a mixture of 46 ( 264 mg , 1.4 mmol ) and et3n ( 750 l ) in pocl3 ( 5 ml ) was heated at 75 c for 18 h. toluene was added to the cooled reaction mixture , and the solvents were then removed in vacuo to give 49 as a brown oil ( 290 mg , 100% ) used directly in the subsequent reaction . lc - ms ( zq , 4 min ) rt 1.25 min ; m / z ( es ) 205/207 . a mixture of 49 ( 20 mg , 0.098 mmol ) , morpholin-2-ylmethylcarbamic acid tert - butyl ester ( 32 mg , 0.147 mmol ) , and et3n ( 68 ml , 0.489 mmol ) in nmp ( 1 ml ) was heated in a microwave reactor at 140 c for 15 min . the reaction mixture was diluted with meoh and applied to a mp - tsoh cartridge which had been preconditioned with meoh . the product was eluted using 2 m nh3 in meoh , affording a brown oil , which was purified using preparative hplc to give 4-(2-(aminomethyl)morpholino)-9h - pyrido[4,3:4,5]pyrrolo[2,3-d]pyrimidine ( 11 mg , 40% ) . h nmr ( d4-meod ) 3.103.04 ( 1h , m ) , 3.253.19 ( 2h , m ) , 3.583.51 ( 1h , m ) , 3.83 ( 1 h , td , j = 11.6 , 2.5 ) , 4.003.94 ( 1h , m ) , 4.14 ( 1h , dd , j = 11.6 , 2.0 ) , 4.32 ( 1h , d , j = 13.4 ) , 4.46 ( 1h , d , j = 12.9 ) , 7.78 ( 1h , d , j = 5.6 ) , 8.43 ( 1h , d , j = 5.6 ) , 8.46 ( 2h , br s ) , 8.54 ( 1h , s ) , 8.84 ( 1h , s ) ; lc - ms ( zq , 7 min ) rt 1.78 min ; m / z ( es)285 [ m + h ] . hrms ( esi ) m / z calcd for c14h17n6o ( m + h ) 285.1458 , found 285.1457 . a mixture of 4,6-dichloropyrimidine ( 51 ; 1.0 g , 6.7 mmol ) , 2-amino-5-cyanopyrazine ( 54 ; 806 mg , 6.7 mmol ) , and bis(triphenylphosphine)palladium(ii ) chloride ( 94 mg , 0.134 mmol ) in dry thf ( 24 ml ) was degassed under a stream of nitrogen gas over 10 min with stirring . 1 m lihmds in thf ( 7.38 ml , 7.4 mmol ) was added , and the mixture was heated at 135 c for 20 min in a microwave reactor . the reaction mixture was adsorbed onto silica and purified by flash chromatography , eluting with 30% etoac in hexane , to give 57 ( 300 mg , 19% ) . lc - ms ( zq , 4 min ) rt = 1.64 ; min m / z ( es ) 231 [ m h ] . a mixture of 57 ( 124 mg , 0.533 mmol ) , 4-(aminomethyl)-1-n - boc - piperidine ( 228 mg , 1.066 mmol ) , and et3n ( 150 l , 1.07 mmol ) in 1-methyl-2-pyrrolidinone ( 1 ml ) was heated at 145 c for 15 min in a microwave reactor . the mixture was concentrated in vacuo , and the residue was purified by preparative hplc . the purified solid was dissolved in ch2cl2 ( 2 ml ) and trifluoroacetic acid ( 3 ml ) and was stirred for 1 h at rt before being applied to a mp - tsoh cartridge . after washing with meoh , the pure product was eluted using 7 m nh3 to give 20 ( 10 mg , 6.2% ) . h nmr ( d6-dmso , 400 mhz ) : 1.30 ( 3h , m ) , 1.85 ( 4h , m ) , 2.71 ( 2h , m ) , 3.18 ( 2h , m ) , 3.26 ( 1h , br s ) , 7.14 ( 1h , br s ) , 8.21 ( 1h , s ) , 8.62 ( s , 1h ) , 8.79 ( 1h , br s ) ; lcms ( lct , 4 min ) rt = 0.78 min m / z ( es ) 311 . hrms ( esi ) m / z calcd for c15h19n8 ( m + h ) 311.1742 , found 311.1727 . a solution of 4-methoxybenzylamine ( 0.756 g , 5.51 mmol ) in acetonitrile ( 2 ml ) was added to a mixture of 2-bromo-4-chloro-5-nitropyridine ( 53 ) ( 1.19 g , 5.01 mmol ) and et3n ( 0.768 ml , 5.51 mmol ) in acetonitrile ( 8 ml ) . after stirring for 1.5 h , the solution was diluted with etoac ( 100 ml ) , and the resulting solution was then washed successively with water and brine before being concentrated in vacuo to a light brown oil which solidified on standing to give n-(4-methoxybenzyl)-2-bromo-5-nitropyridin-4-amine ( 1.31 g , 3.87 mmol , 77% ) . h nmr ( d6-dmso , 400 mhz ) 3.70 ( 3h , s ) , 4.60 ( 2h , d , j = 6 hz ) , 6.95 ( 2h , d , j = 9 hz ) , 7.10 ( 1h , s ) , 7.35 ( 2h , d , j = 9 hz ) , 8.80 ( s , 1h ) , 9.00 ( br t , 1h , j = 6 hz ) . lc - ms ( zq , 4 min ) rt = 2.13 min ; m / z ( esi ) 336 , 338 [ m h ] . tin(ii ) chloride dihydrate ( 4.37 g , 19.4 mmol ) was added portionwise to n-(4-methoxybenzyl)-2-bromo-5-nitropyridin-4-amine ( 1.31 g , 3.87 mmol ) in absolute etoh ( 10 ml ) at rt . the mixture was heated at 70 c for 2 h before being concentrated in vacuo . the residue was suspended in a mixture of etoac and saturated sodium bicarbonate solution and filtered . the aqueous phase was re - extracted with etoac , and the combined organic layers were washed with brine , dried ( na2so4 ) , and concentrated to give 61 as a brown solid ( 1.05 g , 3.41 mmol , 88% ) . h nmr ( d6-dmso , 400 mhz ) 3.75 ( 3h , s ) , 4.30 ( 2h , d , j = 5.5 hz ) , 4.85 ( 2h , br s ) , 6.35 ( 1h , br t , 5.5 hz ) , 6.45 ( 1h , s ) , 6.90 ( 2h , d , j = 8.5 hz ) , 7.30 ( 2h , d , j = 8.5 hz ) , 7.40 ( 1h , s ) ; lc - ms ( zq , 4 min ) rt = 1.77 min ; m / z ( esi ) 306 , 308 ; ( esi ) 308 , 310 [ mh ] . acetic anhydride ( 1.28 ml , 13.6 mmol ) was added to a solution of 61 ( 1.05 g , 3.41 mmol ) in triethylorthoformate ( 13 ml ) . the mixture was heated at 100 c for 18 h and then concentrated to give 62 as a brown oil ( 1.18 g , quantitative ) . h nmr ( d6-dmso , 400 mhz ) 3.70 ( 3h , s ) , 5.45 ( 2h , s ) , 6.90 ( 2h , d , j = 9.0 hz ) , 7.35 ( 2h , d , j = 9 hz ) , 8.00 ( 1h , s ) , 8.60 ( 1h , s ) , 8.75 ( 1h , s ) . lc - ms ( zq , 7 min ) rt = 2.27 min ; m / z ( esi ) 318 , 320 ( mh ) . palladium(ii ) acetate ( 3.5 mg , 16 mol ) was added to ( )-2,2-bis(diphenylphosphino)-1,1-binaphthalene ( 59 mg , 94 mol ) in dmf / toluene ( 1:2 ) , and the resulting mixture was degassed under a stream of nitrogen gas for 10 min . 2-amino-5-cyanopyrazine ( 66 ; 19 mg , 0.16 mmol ) , sodium tert - butoxide ( 45 mg , 0.47 mmol ) , and 62 ( 50 mg , 0.16 mmol ) were added , and the mixture was degassed for a further 5 min before heating at 150 c for 30 min in a microwave reactor . the residue was dissolved in meoh , passed through a ps - thiol column , and concentrated . the product was purified using preparative hplc to give 5-(1-(4-methoxybenzyl)-1h - imidazo[4,5-c]pyridin-6-ylamino)pyrazine-2-carbonitrile ( 22.4 mg , 40% ) . h nmr ( d6-dmso , 400 mhz ) 3.72 ( 3h , s ) , 5.41 ( 2h , s ) , 6.96 ( 2h , d , j = 8.8 hz ) , 7.34 ( 2h , d , j = 8.8 hz ) , 8.17 ( 1h , s ) , 8.49 ( 1h , s ) , 8.738.76 ( 2h , m ) , 8.77 ( 1h , d , j = 1.3 hz ) , 10.84 ( 1h , br s ) . lc - ms ( zq , 7 min ) rt = 2.32 min ; m / z ( esi ) 358 ( mh ) , ( esi ) 356 ( m h ) . 5-(1-(4-methoxybenzyl)-1h - imidazo[4,5-c]pyridin-6-ylamino)pyrazine-2-carbonitrile ( 10.6 mg , 30 mol ) was treated with tfa at 80 c over 30 min . isolation by spe on a mp - tsoh cartridge , eluting with 2 m nh3 in meoh , followed by concentration , gave 24 as a white solid ( 7.02 mg , 100% ) . h nmr ( d6-dmso , 400 mhz ) 8.26 ( 1h , s ) , 8.35 ( 1h , s ) , 8.758.77 ( 3h , m ) , 10.85 ( 1h , br s ) , 12.79 ( 1h , br s ) ; lc - ms ( zq , 7 min ) rt = 1.36 min ; m / z ( esi ) 238 ( mh ) , ( esi ) 236 ( m h ) . hrms ( esi ) m / z calcd for c11h8n7 ( m + h ) 238.0836 , found 238.0845 . dimethylamine 40% in water ( 11.39 ml , 90 mmol ) was slowly added to ( r)-propylene oxide ( 5.25 ml , 74.9 mmol ) which had been cooled in an ice bath . this solution was stirred at rt for 2 h before being extracted with ch2cl2 ( 4 5 ml ) . the combined organic layers were dried over na2so4 , and the pure ( r)-1-(dimethylamino)propan-2-ol ( 5.12 g , 49.6 mmol , 40.0% yield ) was isolated as a clear oil using distillation under reduced pressure ( 50 mbar ) . h nmr ( cdcl3 , 500 mhz ) 1.12 ( 3h , d , j = 6.0 hz ) , 2.162.12 ( 1h , m ) , 2.252.21 ( 1h , m ) , 2.27 ( 6h , s ) , 3.40 ( 1h , br s ) , 3.823.76 ( 1h , m ) . 2,6-dichloropyrazine ( 69 ; 2.89 g , 19.4 mmol ) was stirred in aqueous nh3 ( 28% , 10 ml ) and heated to 100 c overnight in a sealed tube . trituration with water and then ether gave 6-chloropyrazin-2-amine as a white solid ( 2.28 g , 17.6 mmol , 91% ) . h nmr ( d6-dmso , 400 mhz ) 6.9 ( 2h , br s ) , 7.70 ( 1h , d , j = 0.4 hz ) , 7.80 ( 1h , d , j = 0.4 hz ) ; lc - ms ( zq , 7 min ) rt = 1.05 min ; m / z ( esi ) 130 , 132 ( mh ) . 6-chloropyrazin-2-amine ( 2.50 g , 19.3 mmol ) was stirred in ch2cl2 ( 60 ml ) and cooled to 0 c . n - bromosuccinimide ( 2.92 g , 16.4 mmol ) was added slowly , and the reaction mixture was stirred at 0 c for 60 min . the reaction mixture was filtered through celite and concentrated to give a brown oil . purification by flash chromatography , eluting with 025% etoac hexanes , gave 5-bromo-6-chloropyrazin-2-amine as a yellow solid ( 1.69 g , 8.16 mmol , 42% ) . h nmr ( d6-dmso , 400 mhz ) 7.1 ( 2h , br s ) , 7.65 ( 1h , s ) ; lc - ms ( zq , 4 min ) rt = 1.46 min ; m / z ( esi ) 205 ( m h ) . a mixture of 5-bromo-6-chloropyrazin-2-amine ( 1.00 g , 4.8 mmol ) , copper(i ) iodide ( 914 mg , 4.8 mmol ) , 18-crown-6 ( 95 mg , 0.36 mmol ) , and tetrakis(triphenylphosphine)palladium ( 0 ) ( 83 mg , 0.072 mmol ) was suspended in dry dmf ( 20 ml ) , and a stream of nitrogen was passed through it for 5 min . potassium cyanide ( 312 mg , 4.8 mmol ) was added , and the mixture was stirred at rt for 30 min and then refluxed at 200 c for 3 h. the mixture was cooled and diluted with etoac and absorbed onto silica gel ( 10 g ) . the product was purified by flash chromatography , eluting with 1:1 etoac hexanes , to yield 70 as a yellow solid ( 607 mg , 3.93 mmol , 82% ) . h nmr ( d6-dmso , 400 mhz ) 7.87 ( 1h , s ) , 8.1 ( 2h , br s ) ; lc - ms ( zq , 4 min ) rt = 1.20 min ; m / z ( esi ) 153 ( m h ) . ( r)-1-(dimethylamino)propan-2-ol ( 68 ; 0.667 g , 6.47 mmol ) was added dropwise to a suspension of nah 60% ( 0.388 g , 9.71 mmol ) in dioxane ( 16.18 ml ) and stirred for 30 min . 5-amino-3-chloropyrazine-2-carbonitrile ( 70 ; 1.000 g , 6.47 mmol ) was added in one portion and heated at 90 c for 14 h. after cooling water ( 200 ml ) was added and the solution was extracted with diethyl ether ( 4 100 ml ) and dried over mgso4 , the volatiles were removed under vacuum . column chromatography using a gradient of meoh in ch2cl2 ( + 1% nh3 ) gave 74 ( 0.558 g , 2.52 mmol , 39.0% yield ) as a yellow solid . h nmr ( 500 mhz , cdcl3 ) 1.35 ( 3h , d , j = 6.5 hz ) , 2.37 ( 6h , s ) , 2.52 ( 1h , dd , j = 4.0 , 13.5 hz ) , 2.76 ( 1h , dd , j = 7.5 , 13.5 hz ) , 5.31 ( 2h , br s ) , 5.425.35 ( 1h , m ) , 7.54 ( 1h , s ) . lc - ms ( tof , 3.5 min ) rt = 0.80 min ; m / z ( esi ) 222 ( m + h ) . to four microwave vials was added xantphos ( 66.8 mg , 0.116 mmol ) , pd2(dba)3 ( 52.9 mg , 0.058 mmol ) , 8-chloroisoquinolin-3-yl trifluoromethanesulfonate ( 180 mg , 0.578 mmol ) , 74 ( 128 mg , 0.578 mmol ) , and cs2co3 ( 376 mg , 1.155 mmol ) followed by dry toluene ( 4 ml ) . the vials were sealed , and dry nitrogen was bubbled through the stirred solution for 8 min . the reactions were irradiated at 130 c for 45 min in a biotage microwave . upon cooling , the mixtures were combined , diluted with meoh , and purified using an acidic ion exchange column which was washed with meoh before the basic components eluted with 2 m nh3 in meoh followed by ch2cl2/2 m nh3 in meoh . the residue was purified by column chromatography eluting with a gradient of meoh in ch2cl2 ( + 1% nh3 ) to give ( r)-3 ( 301 mg , 0.786 mmol , 45% yield ) as a light yellow powder . h nmr ( 500 mhz , d6-dmso ) 1.46 ( 3h , d , j = 6.5 hz ) , 2.21 ( 6h , s ) , 2.54 ( 2h , dd , j = 5 , 13 hz ) , 2.66 ( 1h , dd , j = 7 , 13 hz ) , 5.545.46 ( 1h , m ) , 7.66 ( 1h , d , j = 7.5 hz ) , 7.72 ( 1h , dd , j = 7.5 , 8.0 hz ) , 7.84 ( 1h , d , j = 8.0 hz ) , 8.26 ( 1h , s ) , 8.48 ( 1h , s ) , 9.40 ( 1h , s ) , 11.16 ( 1h , s ) . lc - ms ( tof , 3.5 min ) rt = 2.58 min ; m / z ( esi ) 383 ( m + h ) . hrms ( esi ) m / z calcd for c19h20cln6o ( m + h ) 383.1382 , found 383.1366 .

all mice were handled in accordance with nih guidelines and protocols approved by harvard medical school . syt7 ko mice ( jackson laboratory ) and wt littermates of either sex were used . aav2/9-hsyn - hchr2(h134r)-eyfp and its paav backbone ( addgene 26973 ) were obtained from the university of pennsylvania vector core . cdna encoding the rat syt7 wt isoform and c2a * mutant ( d225a , d227a , d233a ) were generously provided by taulant bacaj and thomas sudhof . for rescue experiments involving syt7 with mutated ca binding domains , we used the mutated c2a * version instead of the c2a*c2b * double mutant , as mutation of both c2 domains leads to lower levels of expression . the porcine teschovirus-1 2a ( p2a ) cleavage sequence and syt7 were inserted after the chr2 c - terminus in the paav backbone ( genscript ) . plasmid - driven expression of chr2-yfp and syt7 was confirmed in hek cells by syt7 immunostaining and patch - clamp recording of chr2 photocurrents . p18-p30 mice were anesthetized with ketamine / xylazine / acepromazine ( 100/10/3 mg / kg ) supplemented with 14% isoflurane . viruses were injected through glass capillary needles using a syringe ( hamilton ) mounted on a stereotaxic instrument ( kopf ) . injection coordinates from lambda were 2.69 mm ( rostral ) , 3 mm ( lateral ) , and 2.8 mm ( ventral ) . 1 l of virus suspension was delivered at a rate of 0.1 l / min using a a microsyringe pump ( wpi ; ump3 ) and microsyringe pump controller ( wpi ; micro4 ) . the needle was slowly retracted 510 minutes after injection , and the scalp incision was closed with gluture . post - injection analgesic ( buprenophrine , 0.05 mg / kg ) was administered subcutaneously for 48 hrs . brains were removed and placed in ice - cold solution containing ( in mm ) : 234 sucrose , 25 nahco3 , 11 glucose , 7 mgcl2 , 2.5 kcl , 1.25 nah2po4 , and 0.5 cacl2 . 270 m - thick transverse slices ( hippocampal recordings ) or 250 m - thick sagittal slices ( thalamic recordings ) were prepared on a vibrotome ( leica , vt1000s ) , and a cut was made between ca3 and ca1 to prevent recurrent excitation . slices were transferred for 30 min to 32c artificial cerebrospinal solution ( acsf ) containing ( in mm ) : 125 nacl , 26 nahco3 , 25 glucose , 2.5 kcl , 2 cacl2 , 1.25 nah2po4 , and 1 mgcl2 , adjusted to 315 mosm , and allowed to equilibrate to room temperature for > 30 min . experiments were performed at 33 1c with flow rates of 2 ml / min . for chr2 stimulation , 160 mw / mm laser pulses ( 0.20.5 ms ) from a 100 mw 473 nm laser ( optoengine , mbl - iii ) were focused through the 60x objective of the microscope ( olympus , bx51wi ) to produce a 80 m diameter spot over the stratum radiatum , > 500 m from the recorded cell to avoid activating chr2 in presynaptic boutons , which can artificially raise the probability of release and obscure facilitation . extracellular stimulation was performed with a stimulus isolation unit ( wpi , a360 ) using glass monopolar electrodes ( 0.51 m ) filled with acsf . stimulus electrodes were positioned ~500 m from the recording electrode in the stratum radiatum ( schaffer collaterals ) , the internal capsule ( corticothalamic ) , the hillus adjacent to the dentate granule cell layer ( mossy fibers ) , and the outer molecular layer ( lateral performant path ) . to ensure that mossy fiber responses were not contaminated by associational / commissural inputs the metabotropic glutamate receptor agonist dcg - iv ( 1 m ) was applied at the end of experiments to selectively block mossy fiber responses . data were included only if responses were reduced by more than 80% ( average reduction was 88 1 % in wt and 90 2% in syt7 ko mice ) , and the amplitude of mossy fiber responses was measured after subtracting the response remaining in the presence of dcg - vi . stimulus trials were repeated at 0.1 hz ( 0.033 hz at mossy fibers to avoid potentiation ) , and artifacts were deleted for display . recordings were acquired using an amplifier ( axon instruments , multiclamp 700b ) controlled by custom software written in igorpro ( provided by matthew xu - friedman , suny buffalo ) , and low - pass filtered at 2 khz . whole - cell recordings were obtained using borosilicate patch pipettes ( 25 m ) pulled with a horizontal puller ( sutter p-97 ) . the internal recording solution contained ( in mm ) : 150 cs - gluconate , 3 kcl , 10 hepes , 0.5 egta , 3 mgatp , 0.5 nagtp , 5 phosphocreatine - tris , and 5 phosphocreatine - na . fepsps were recorded in current - clamp mode with acsf - filled patch pipettes ( 0.51 m ) . inhibition was blocked with picrotoxin ( 50 m ) , and during fepsp recordings , cpp ( 2 m ) and cgp ( 3 m ) was added to the bath . 410 trials were conducted for each stimulus frequency , and recordings were averaged over trials . average responses are displayed with double exponential or polynomial curves fit in igorpro . unless stated otherwise , statistical significance was assessed by unpaired two - tailed student s t - test , or one - way anova followed by tukey s post hoc test . to record nmda - epscs cells were voltage clamped at + 40 mv , and the internal solution contained ( in mm ) : 85 cs - methanesulfonate , 4 nacl , 10 hepes , 0.2 egta , 30 bapta , 2 mgatp , 0.4 nagtp , 10 phosphocreatine - na , 25 tea , 5 qx-314 , ph = 7.3 . for recording nmda - fepsps , mg was excluded from acsf to relieve mg block of nmda receptors . picrotoxin ( 100 m ) and nbqx ( 5 m ) were added to the bath , and stimulation was conducted at 0.1 hz ( unless otherwise indicated ) for 5 minutes to obtain a baseline response . stimulation was halted for 10 minutes while ( + ) -mk801 ( 40 m ) was added and allowed to equilibrate . for experiments involving fepsps vs. presynaptic volley , the postsynaptic response was measured by the slope of the fepsp , while the amplitude of the presynaptic volley was used to determine the number of activated fibers . if p increases , the same number of activated presynaptic fibers will produce a larger fepsp . the ratio between fepsp and volley was determined by line fits to the linear regime of the input - output curve of individual experiments ( 2080 a stimuli ) . the study of probability of release is complicated because many people use p to refer to the probability of release of a vesicle ( pv ) and others refer to probability of release from an active zone ( psynapse ) that contains n vesicles in its readily releasable pool ( rrp ) . thus , an increase in the size of the rrp for an active zone can increase psynapse even if pv is unaltered . although mk801 blockade and fepsps vs. presynaptic volley are both widely - used methods to detect changes in the probability of release , for both approaches it is conceivable ( though unlikely ) that increases in pv could be obscured by a perfectly balanced decrease in the rrp size . however , the relationship between epsc amplitude and extracellular ca is similar in wt and syt7 ko animals . this suggests there is no increase in pv , which would cause this curve to saturate at lower values of cae for syt7 ko animals . moreover , the large differences in facilitation in wt and syt7 ko animals were even more pronounced when the probability of release was reduced 10-fold by lowering cae from 2 mm to 0.5 mm , which is incompatible with an increase in pv obscuring facilitation by depleting vesicles . briefly , ca3 fibers were labelled for three minutes using an acsf - filled pipette containing either magnesium green am or fura-2 am ( 240 m ) and 1% fast green , placed into the border of the ca3-ca1 field . slices were incubated for at least 1 hour and imaging was performed in stratum radiatum of ca1 at least 500 m from the injection site using a 60x objective and custom - built photodiode . excitation was achieved using a tungsten ( magnesium green ) or xenon lamp ( fura-2 ) . schaffer collaterals were stimulated using a glass electrode placed at least 300 m from the imaging site . to prevent recurrent excitation , experiments were performed in the presence of nbqx ( 10 m ) , cpp ( 2 m ) and picrotoxin ( 50 m ) . magnesium green is a low - affinity calcium indicator ( kd=7 m ) that provides an approximately linear measure of cares . as such it is well suited to measuring the time course of presynaptic cares ( fig . however , with the bulk loading approach the size of the fluorescence change is proportional to the number of stimulated fibers , so the absolute cares signal is not readily quantified with magnesium green . in contrast , fura-2 has a high affinity for calcium ( kd = 131 nm ) so it provides a saturating sublinear response to increases in cares . this can be used to test for changes in the absolute size of cainflux because a change in the cainflux per stimulus would change the ratio between the fluorescence change produced by the first and second stimuli . two to four weeks after aav injection , mice were anesthetized with ketamine and transcardially perfused with 4% pfa in pbs . slices ( 50 m thick ) were permeabilized ( pbs + 0.4% triton x-100 ) for 30 minutes and then prepared in blocking solution ( pbs + 0.2% triton x-100 + 2% normal goat serum [ pbst ] ) for 30 min at room temperature . slices were incubated overnight at 4c in pbst with primary antibodies ( anti - syt7 [ synaptic systems , 105173 ] , 1 g / ml ; 1:200 , targeting aa 46133 of syt7 , anti - vglut1 [ synaptic systems , 135304 ] , 1 g / ml ; 1:500 , and anti - calbindin - d28k [ sigma aldrich , c9848 ] , 1 g / ml ; 1:500 ) , followed by incubation with secondary antibodies in pbst for 2 hr at room temperature . for both wt and syt7 ko mice , images from each brain region were acquired on a laser scanning confocal ( olympus , fluoview1200 ) using the same laser / microscope settings and processed in imagej identically . all mice were handled in accordance with nih guidelines and protocols approved by harvard medical school . syt7 ko mice ( jackson laboratory ) and wt littermates of either sex were used . aav2/9-hsyn - hchr2(h134r)-eyfp and its paav backbone ( addgene 26973 ) were obtained from the university of pennsylvania vector core . cdna encoding the rat syt7 wt isoform and c2a * mutant ( d225a , d227a , d233a ) were generously provided by taulant bacaj and thomas sudhof . for rescue experiments involving syt7 with mutated ca binding domains , we used the mutated c2a * version instead of the c2a*c2b * double mutant , as mutation of both c2 domains leads to lower levels of expression . the porcine teschovirus-1 2a ( p2a ) cleavage sequence and syt7 were inserted after the chr2 c - terminus in the paav backbone ( genscript ) . plasmid - driven expression of chr2-yfp and syt7 was confirmed in hek cells by syt7 immunostaining and patch - clamp recording of chr2 photocurrents . p18-p30 mice were anesthetized with ketamine / xylazine / acepromazine ( 100/10/3 mg / kg ) supplemented with 14% isoflurane . viruses were injected through glass capillary needles using a syringe ( hamilton ) mounted on a stereotaxic instrument ( kopf ) . injection coordinates from lambda were 2.69 mm ( rostral ) , 3 mm ( lateral ) , and 2.8 mm ( ventral ) . 1 l of virus suspension was delivered at a rate of 0.1 l / min using a a microsyringe pump ( wpi ; ump3 ) and microsyringe pump controller ( wpi ; micro4 ) . the needle was slowly retracted 510 minutes after injection , and the scalp incision was closed with gluture . post - injection analgesic ( buprenophrine , 0.05 mg / kg ) was administered subcutaneously for 48 hrs . brains were removed and placed in ice - cold solution containing ( in mm ) : 234 sucrose , 25 nahco3 , 11 glucose , 7 mgcl2 , 2.5 kcl , 1.25 nah2po4 , and 0.5 cacl2 . 270 m - thick transverse slices ( hippocampal recordings ) or 250 m - thick sagittal slices ( thalamic recordings ) were prepared on a vibrotome ( leica , vt1000s ) , and a cut was made between ca3 and ca1 to prevent recurrent excitation . slices were transferred for 30 min to 32c artificial cerebrospinal solution ( acsf ) containing ( in mm ) : 125 nacl , 26 nahco3 , 25 glucose , 2.5 kcl , 2 cacl2 , 1.25 nah2po4 , and 1 mgcl2 , adjusted to 315 mosm , and allowed to equilibrate to room temperature for > 30 min . experiments were performed at 33 1c with flow rates of 2 ml / min . for chr2 stimulation , 160 mw / mm laser pulses ( 0.20.5 ms ) from a 100 mw 473 nm laser ( optoengine , mbl - iii ) were focused through the 60x objective of the microscope ( olympus , bx51wi ) to produce a 80 m diameter spot over the stratum radiatum , > 500 m from the recorded cell to avoid activating chr2 in presynaptic boutons , which can artificially raise the probability of release and obscure facilitation . extracellular stimulation was performed with a stimulus isolation unit ( wpi , a360 ) using glass monopolar electrodes ( 0.51 m ) filled with acsf . stimulus electrodes were positioned ~500 m from the recording electrode in the stratum radiatum ( schaffer collaterals ) , the internal capsule ( corticothalamic ) , the hillus adjacent to the dentate granule cell layer ( mossy fibers ) , and the outer molecular layer ( lateral performant path ) . to ensure that mossy fiber responses were not contaminated by associational / commissural inputs the metabotropic glutamate receptor agonist dcg - iv ( 1 m ) was applied at the end of experiments to selectively block mossy fiber responses . data were included only if responses were reduced by more than 80% ( average reduction was 88 1 % in wt and 90 2% in syt7 ko mice ) , and the amplitude of mossy fiber responses was measured after subtracting the response remaining in the presence of dcg - vi . stimulus trials were repeated at 0.1 hz ( 0.033 hz at mossy fibers to avoid potentiation ) , and artifacts were deleted for display . recordings were acquired using an amplifier ( axon instruments , multiclamp 700b ) controlled by custom software written in igorpro ( provided by matthew xu - friedman , suny buffalo ) , and low - pass filtered at 2 khz . whole - cell recordings were obtained using borosilicate patch pipettes ( 25 m ) pulled with a horizontal puller ( sutter p-97 ) . the internal recording solution contained ( in mm ) : 150 cs - gluconate , 3 kcl , 10 hepes , 0.5 egta , 3 mgatp , 0.5 nagtp , 5 phosphocreatine - tris , and 5 phosphocreatine - na . fepsps were recorded in current - clamp mode with acsf - filled patch pipettes ( 0.51 m ) . inhibition was blocked with picrotoxin ( 50 m ) , and during fepsp recordings , cpp ( 2 m ) and cgp ( 3 m ) was added to the bath . 410 trials were conducted for each stimulus frequency , and recordings were averaged over trials . average responses are displayed with double exponential or polynomial curves fit in igorpro . unless stated otherwise , statistical significance was assessed by unpaired two - tailed student s t - test , or one - way anova followed by tukey s post hoc test . to record nmda - epscs cells were voltage clamped at + 40 mv , and the internal solution contained ( in mm ) : 85 cs - methanesulfonate , 4 nacl , 10 hepes , 0.2 egta , 30 bapta , 2 mgatp , 0.4 nagtp , 10 phosphocreatine - na , 25 tea , 5 qx-314 , ph = 7.3 . for recording nmda - fepsps , mg was excluded from acsf to relieve mg block of nmda receptors . picrotoxin ( 100 m ) and nbqx ( 5 m ) were added to the bath , and stimulation was conducted at 0.1 hz ( unless otherwise indicated ) for 5 minutes to obtain a baseline response . stimulation was halted for 10 minutes while ( + ) -mk801 ( 40 m ) was added and allowed to equilibrate . for experiments involving fepsps vs. presynaptic volley , the postsynaptic response was measured by the slope of the fepsp , while the amplitude of the presynaptic volley was used to determine the number of activated fibers . if p increases , the same number of activated presynaptic fibers will produce a larger fepsp . the ratio between fepsp and volley was determined by line fits to the linear regime of the input - output curve of individual experiments ( 2080 a stimuli ) . the study of probability of release is complicated because many people use p to refer to the probability of release of a vesicle ( pv ) and others refer to probability of release from an active zone ( psynapse ) that contains n vesicles in its readily releasable pool ( rrp ) . thus , an increase in the size of the rrp for an active zone can increase psynapse even if pv is unaltered . although mk801 blockade and fepsps vs. presynaptic volley are both widely - used methods to detect changes in the probability of release , for both approaches it is conceivable ( though unlikely ) that increases in pv could be obscured by a perfectly balanced decrease in the rrp size . however , the relationship between epsc amplitude and extracellular ca is similar in wt and syt7 ko animals . this suggests there is no increase in pv , which would cause this curve to saturate at lower values of cae for syt7 ko animals . moreover , the large differences in facilitation in wt and syt7 ko animals were even more pronounced when the probability of release was reduced 10-fold by lowering cae from 2 mm to 0.5 mm , which is incompatible with an increase in pv obscuring facilitation by depleting vesicles . briefly , ca3 fibers were labelled for three minutes using an acsf - filled pipette containing either magnesium green am or fura-2 am ( 240 m ) and 1% fast green , placed into the border of the ca3-ca1 field . slices were incubated for at least 1 hour and imaging was performed in stratum radiatum of ca1 at least 500 m from the injection site using a 60x objective and custom - built photodiode . excitation was achieved using a tungsten ( magnesium green ) or xenon lamp ( fura-2 ) . schaffer collaterals were stimulated using a glass electrode placed at least 300 m from the imaging site . to prevent recurrent excitation , experiments were performed in the presence of nbqx ( 10 m ) , cpp ( 2 m ) and picrotoxin ( 50 m ) . magnesium green is a low - affinity calcium indicator ( kd=7 m ) that provides an approximately linear measure of cares . as such it is well suited to measuring the time course of presynaptic cares ( fig . however , with the bulk loading approach the size of the fluorescence change is proportional to the number of stimulated fibers , so the absolute cares signal is not readily quantified with magnesium green . in contrast , fura-2 has a high affinity for calcium ( kd = 131 nm ) so it provides a saturating sublinear response to increases in cares . this can be used to test for changes in the absolute size of cainflux because a change in the cainflux per stimulus would change the ratio between the fluorescence change produced by the first and second stimuli . two to four weeks after aav injection , mice were anesthetized with ketamine and transcardially perfused with 4% pfa in pbs . slices ( 50 m thick ) were permeabilized ( pbs + 0.4% triton x-100 ) for 30 minutes and then prepared in blocking solution ( pbs + 0.2% triton x-100 + 2% normal goat serum [ pbst ] ) for 30 min at room temperature . slices were incubated overnight at 4c in pbst with primary antibodies ( anti - syt7 [ synaptic systems , 105173 ] , 1 g / ml ; 1:200 , targeting aa 46133 of syt7 , anti - vglut1 [ synaptic systems , 135304 ] , 1 g / ml ; 1:500 , and anti - calbindin - d28k [ sigma aldrich , c9848 ] , 1 g / ml ; 1:500 ) , followed by incubation with secondary antibodies in pbst for 2 hr at room temperature . for both wt and syt7 ko mice , images from each brain region were acquired on a laser scanning confocal ( olympus , fluoview1200 ) using the same laser / microscope settings and processed in imagej identically . it is established that calcium plays an important role in synaptic facilitation , and a number of mechanisms have been proposed that involve different aspects of calcium signaling . here we discuss the calcium signals that evoke rapid vesicle fusion , and also those thought to be involved in facilitation ( a ) , and 3 mechanisms of facilitation are presented schematically ( b d ) . a , to understand the mechanisms that have been proposed to account for facilitation , it is important to appreciate different aspects of presynaptic calcium signaling . . an action potential opens calcium channels for less than a millisecond , and near open channels the calcium levels reach tens of micromolar . release sites near calcium channels experience high local calcium levels ( calocal ) that are highly dependent on the distance from open calcium channels . calocal can be reduced by high concentrations of fast calcium buffers that rapidly bind calcium . in addition there is a residual calcium signal ( cares ) that results from calcium equilibrating within presynaptic terminals , before calcium is gradually removed over tens to hundreds of milliseconds . the amplitude of cares ( and also total influx of ca , cainflux ) is determined by all of the calcium channels that open , not only those that produce calocal that drives release , and after initial equilibration cares is roughly uniform throughout the presynaptic bouton . it is generally accepted that fast synaptic transmission is produced by calcium binding to syt1 , syt2 or syt9 which have low - affinity binding sites , fast kinetics , and require the binding of multiple calcium ions . the time course of release follows the time course of calcium channel opening , but with a brief delay ( < 1 ms ) . cares after a single stimulus is much smaller than calocal . typical fluorescence - based approaches to measure calcium readily detect cares , but are insensitive to calocal which is too localized and short - lived to measure . note the y - axis is logarithmic to show both calocal and cares in ( a ) , but not in ( b d ) . b , for one mechanism of facilitation a fast calcium buffer is present in presynaptic terminals that binds calcium and reduces calocal . stimulating twice in rapid succession results in the same calcium influx for both stimuli . if there is no fast presynaptic buffer , the amplitudes of calocal and the epscs are the same for both stimuli ( red traces ) . if a fast high - affinity buffer is present ( black traces ) , it reduces the initial calocal and reduces the amplitude of the initial epsc , but if enough calcium enters and binds to the buffer , it reduces its ability to buffer calcium . as a result the second stimulus produces larger calocal than the first , and c , a second possible mechanism is that more calcium enters for the second stimulus , and as a result there is more neurotransmitter release . this could arise from a spike broadening , or from the modulation of calcium channels . it is possible that influx through all calcium channels in the presynaptic terminal would be increased , in which case both cares and calocal would be increased . it is also possible that the only calcium channels that are modulated are the subset that produce calocal that triggers release , in which case cares would not be significantly increased . d , finally , it is possible that there is a specialized calcium sensor that produces facilitation that is distinct from syt1 . previous studies have shown that such a sensor would need to be sensitive to cares based on the observation that facilitation is altered at some synapses by manipulations that affect cares without affecting calocal . according to this scheme , release is mediated by syt1 but calcium binding to a second sensor would increase p. the sensor is sufficiently slow that it does not influence release evoked by the first stimulus , but it able to influence release evoked by a second stimulus . fluorescent images of immunostaining for vglut1 ( top ) and syt7 ( bottom ) in slices from wt and syt7 ko animals , showing ( a ) the stratum radiatum ( sr ) of hippocampal ca1 region , ( b ) the ventral thalamus , ( c ) mossy fibers ( mf ) in hippocampal ca3 , and ( d ) the lateral and medial performant paths ( lpp and mpp ) in the outer molecular layer of the dentate gyrus . notably , syt7 expression in wt animals was higher in the lpp , where synapses exhibit facilitation , compared to the mpp , where synapses exhibit depression . the presence of syt7 labeling in regions containing ca3ca1 synapses , layer 6 to thalamus synapses , mf synapses and lppgranule cell synapses that are also colabeled with antibodies to the presynaptic marker for glutamatergic synapses vglut1 , suggests that syt7 is located presynaptically at these synapses . it is , however , difficult to obtain sufficient resolution with confocal microscopy in brain slices to unambiguously establish that syt7 is located presynaptically at these synapses . importantly , the allen brain atlas suggests that the presynaptic cells for these synapses contain mrna for syt7 . lastly , immunoelectron microscopy revealed selective staining of presynaptic boutons in the ca1 region of the hippocampus . fluorescent images of immunostaining for calbindin - d28k , which predominantly labels mossy fibers in the ca3 region of the hippocampus ( top ) and syt7 ( bottom ) in slices from wt and syt7 ko animals . colocalization of syt7 and calbindin staining in wt animals provides further support for the expression of syt7 in mossy fiber terminals . average normalized synaptic responses evoked by extracellular stimulation with trains at frequencies from 550 hz at four synapses in slices from wt and syt7 ko animals . enhancement during trains was eliminated for all synapses other than mossy fiber synapses , where significant enhancement was present by the 5th stimulus for 5 hz and 10 hz , the 3rd stimulus for 20 hz and the 6th stimulus for 50 hz ( compared to 1 by a wilcoxon signed rank test , p < 0.05 ) . this indicates that another form of synaptic enhancement gradually builds during repetitive activation and is consistent with a specialized form of synaptic enhancement that has been described at mossy fiber synapses in which spike broadening gradually builds during repetitive activation and leads to increased calcium influx . a , representative sepscs recorded from voltage - clamped hippocampal ca1 cells in wt ( black ) and ko ( red ) animals . b , representative sepscs , averaged from > 50 events recorded in wt and ko animals . d , average sepsc ( c ) amplitude and ( d ) frequency in wt ( n = 16 ) and syt7 ko animals ( n = 18 ) . a , representative nmda - epscs recorded in wt and ko animals before the application of mk801 ( average of 10 traces ) and after stimulation in the presence of mk801 ( average response of 1520 stimuli ) . b , average nmda - epscs recorded in the presence of mk801 , normalized to the first stimulus . * p < 0.05 , one - way anova with tukey s post hoc test . n.s . , not significant . b , ( top ) aav was injected into the hippocampal ca3 region in wt animals to express chr2 and ( a ) syt7 wt or ( b ) syt7 c2a*. ( bottom ) representative epscs and average paired - pulse ratios for responses evoked electrically and optically in wt slices with aav - driven expression of ( a ) syt7 wt ( electrical , n = 12 ; optical , n = 13 ) and ( b ) syt7 c2a * ( electrical , n = 5 ; optical , n = 13 ) . vertical scale bars , 100 pa . this graph illustrates the general relationship between ppr and external calcium for synapses in which buffer saturation produces facilitation ( green ) and for facilitation observed at the ca3ca1 synapse and many other synapses ( black ) . it has been shown previously that the for buffer saturation mechanism ( extended data fig . 1b ) the amplitude of facilitation is reduced when cainflux is reduced by lowering external calcium . this can be understood by considering that this form of facilitation is thought to require sufficient cainflux to saturate the endogenous buffer , and thereby reduce its ability to buffer calcium for subsequent stimuli . if cainflux is low then there is insufficient calcium entry to bind very much of the endogenous buffer , and little facilitation would result . in addition , as shown in extended data figure 1 for a calcium buffer to produce facilitation it would need to buffer calcium sufficiently that it would reduce initial p. we have shown , however , that p is unaltered in syt7 knockouts . this is perhaps not surprising in light of the fact that syt7 is thought to be located on the plasma membrane , and in cases where this type of facilitation has been observed it is associated with high concentrations of a fast cytosolic buffer . number of experiments related to the ca - dependence of probability of release . to normalize responses in different ca concentrations , all ca - dependence experiments included recordings in 2 mm ca followed by wash in of different ca concentrations .

up to 8% of children and adolescents have experienced fatigue for a duration of more than 1 month , and nearly 2% have experienced chronic fatigue lasting more than 6 months ( miike and bell , 2008 ) . because fatigue in students corresponds to a decrease in academic performance ( garralda and rangel , 2002 ) , clarification of the precise mechanisms of fatigue and identification of ways to overcome fatigue are very important . fatigue induces difficulty in initiating or sustaining voluntary activities ( chaudhuri and behan , 2004 ) . in fact , fatigued children and adolescents and patients with childhood chronic fatigue syndrome ( ccfs ) , which is characterized by profound and disabling fatigue for 6 months ( fukuda et al . , 1994 ) , show poor performance on cognitive tasks related to memory and attention ( haig - ferguson et al . , 2009 ; kawatani et al . , 2011 ; mizuno et al . along with structural changes in the brain from childhood to adolescence , executive function , defined as the set of mental cognitive control processes that permit goal - directed behavior , develops dramatically between childhood and adolescence ( travis , 1998 ) . recently , we reported that task performance on a divided attention task using the kana pick - out test ( kpt ) , which assesses participants ' allocation of attentional resources to two simultaneous activities [ picking out vowels ( pv ) and reading for story comprehension ( sc ) ] improved as children progressed from elementary to junior high school ( mizuno et al . , 2011a ) , and decreased with fatigue ( mizuno et al . , 2011b ) and lower academic motivation ( mizuno et al . , 2011c ) . poor performance of the kpt also relates to poor lifestyle choices ( skipping breakfast , too much time watching television ) and family conditions ( little time spent with family and little praise from family members ) in junior high school students ( mizuno et al . ccfs patients also have lower performance on the kpt ( tomoda et al . , 2007 ) . these findings suggest that although development of the ability to divide attention is crucial for good academic performance in adolescence , it is inhibited by fatigue , not only in healthy children and adolescents ( hca ) , but also in ccfs patients . therefore , clarifying the neural relationship between fatigue and divided attention is critical for the evaluation of cognitive development and interventional efforts in both fatigued children and adolescents and ccfs patients . however , there are currently no studies designed to investigate the neural substrates of the relationship between fatigue and divided attention in any age group . recently , we demonstrated the neural substrates associated with the kpt in healthy young adults using functional magnetic resonance imaging ( fmri ) ( mizuno et al . , 2012 ) . we compared patterns of activation in the brain obtained during performance of the individual tasks of pv and sc to levels of activation when participants performed the two tasks simultaneously during the kpt ( fig . activations of the left dorsal inferior frontal gyrus ( ldifg ) and left superior parietal lobule ( lspl ) in the dual task ( pv + sc ) condition were greater than in the two single task ( pv and sc ) conditions alone , suggesting that these increased activations during the kpt reflect the extent of utilization of attentional resources ( mizuno et al . , 2012 ) . in contrast , decreased activations of the left fusiform gyrus ( lffg ) and the left middle temporal gyrus ( lmtg ) , which are domain regions for processing of the pv ( murray and he , 2006 ) and sc ( grossman et al . , 2002 ) , respectively , were observed during the dual task conditions in comparison with the two single task conditions , suggesting that the reduced activations during the kpt reflect the difficulty of concurrent processing of the two tasks ( mizuno et al . , 2012 ) . based on these findings in the adult study , we tried to identify the neural relationship between fatigue and divided attention in hca and ccfs patients . we performed the fmri experiment in the hca group , which had an age range of 1114 years . a follow - up study was conducted in the hca group for a period of 2 years to identify fatigue - related neural processing during the kpt . we chose this age range because the number of fatigued students increases from elementary to junior high school in japan ( mizuno et al . the increase in the number of fatigued students from elementary to junior high school indicates that the variance in fatigue severity in hca increases ; thus , correlation analysis between fatigue and brain activation proves useful for identifying features of the neural basis of divided attention in fatigued children and adolescents . in addition , to specify the neural substrates of divided attention in ccfs patients , we compared the blood oxygenation level dependent signal during the kpt between hca and ccfs patients . they had normal or corrected - to - normal visual acuity , no history of medical illness , and were right - handed according to the edinburgh handedness inventory ( oldfield , 1971 ) . ten out of 23 hca could not completely perform the experiments three times due to a lack of understanding of the task and motion artifacts during fmri scans . a total of 13 hca ( 9 females and 4 males ) completely performed the experiments , and we analyzed the data . regarding ccfs patients recruited for the study , patients who had undergone treatment with antidepressants or hypotension drugs or who had diagnoses of neurological illness , migraine , obstructive sleep apnea , below average intelligence , or severe psychopathology were excluded from the study . serious psychopathology was evaluated as referral to at least one pediatric psychiatrist if the patient presented with indicative symptoms . no patients or healthy participants had any history of diagnostic and statistical manual of mental disorders fourth edition , text revision ( dsm - ivtr ) axis i disorder ( based on structured clinical interview for dsm - iv axis i disorders ) , drug abuse , head injury , or fetal drug exposure that may have influenced brain development . seventeen patients with ccfs participated in the fmri experiments , were right - handed , and scored more than 80 on the full scale intelligence quotient derived from the wechsler intelligence scale for children ( wechsler , 1991 ) . therefore , we analyzed the data obtained from 15 patients ( 6 females and 9 males ) , all of whom fulfilled the diagnostic criteria for ccfs ( fukuda et al . , 1994 ) . although two patients had been administered antidepressants , the drugs were discontinued 2 weeks before the fmri experiments . the protocol was approved by the ethics committee of the national institute for physiological sciences ( nips ) , and all participants and their parents gave written informed consent for participation in the study . the experiments were undertaken in compliance with national legislation and the code of ethical principles for medical research involving human subjects of the world medical association ( declaration of helsinki ) . the severity of fatigue was measured using the chalder fatigue scale ( chalder et al . , the reliability and validity of the japanese version of the chalder fatigue scale for evaluation of the severity of fatigue in students have been previously confirmed ( tanaka et al . , 2008 ) . the fatigue scale consists of 11 questions using a 4-level ( 03 ) scale that allows the following responses : 0 = less than usual ; 1 = no more than usual ; 2 = more than usual ; and 3 = much more than usual during the past several weeks . the total score for the 11-item fatigue scale ranges from 0 to 33 , with higher scores indicating a greater degree of fatigue . to identify the mental effort level of participants for the dual and single tasks , a visual analogue scale ( vas ) for the subjective experience of motivation to each task condition was measured after the fmri experiments ( mizuno et al . , 2008 ) . the vas scores ranged from 0 ( compete lack of motivation ) to 100 ( maximum motivation ) . the fmri experimental design was identical with that of the previous study ( mizuno et al . , 2012 ) , and is shown in fig . 1 . the participants performed the modified version of the kpt , which included single and dual task conditions presented on a computer screen for use with fmri . the single task conditions were pv and sc , and the dual task required participants to perform pv and sc tasks concurrently ( pv + sc ) . in addition , to control for the normal activation of brain areas due to visual and motor processing , the participants performed a test under control ( cl ) conditions . although we used the japanese version of the modified kpt in the present study , an english version has also been developed . hereafter , this part of the kpt is referred to as the pv and/or sc session . in the pv condition , participants judged whether vowels included in the words were presented in the center of the screen . if the target letters were presented in the center of the screen , participants were instructed to press the right button . if the target letters did not appear in the center of the screen , participants were instructed to press the left button . in the sc condition , participants read silently each presented word as it appeared in sequence on the screen . an example sentence was mariko gazed at the blue sea and watched the white bird , and takashi gazed at the blue mountain and watched the red bird . the participants pressed the right and left buttons alternately for each word presented . in the pv + sc condition , thus , when the target letters ( vowels ) were presented in the center of the screen , the participants pressed the right button . if target letters did not appear in the center of the screen , the participants were instructed to press the left button . these judgments about the individual vowels and the direction of the button press were performed while reading the story for comprehension . in the cl condition , the participants were not required to perform either task and were instructed to simply press the right and left buttons alternately when presented with the word each condition consisted of 20 trials during which 20 word stimuli were displayed for 1 s each , followed by a blank screen displayed for 1 s , for a total of 40 s per condition for the pv and/or sc session . before the first word stimulus was presented , the name of the stimulus condition appeared on the screen for 5 s ( pv , sc , pv + sc or the probability of a target letter appearing in the pv and pv + sc conditions was 50% . the sequence of presented words was pseudorandom in the pv condition , and the presented words were chosen from those used in the sc and pv + sc conditions . in order to control the difficulty of comprehension of the story between the sc and pv + sc conditions , sentences from the sc condition were alternately replaced with sentences from the pv + sc condition for each participant . after all conditions , the participants completed an answer session . in the sc and pv + sc conditions , this comprised a series of four yes or no questions to assess story comprehension . example questions were did mariko gaze at the sea ? , did takashi gaze at the sea ? , did mariko watch the red bird ? , and did takashi watch the red bird ? . participants were instructed to press the right button if the answer was yes and the left button if the answer was no . in the pv and cl conditions , participants were not required to answer questions and were simply directed to press the right or left button ( e.g. , press the left button . ) . the questions for each condition consisted of four trials , each of which lasted 4 s followed by a blank screen that lasted 1 s , for a total of 20 s in the answer session . the total time for each condition , including the answer session , was 60 s. each condition was repeated twice per run , in counter - balanced order , and the time interval between conditions was 20 s. the participants were instructed to perform each task as quickly and accurately as possible . the direction of the button press was inverted for half of the participants . before scanning , participants practiced a series of cl , pv , sc , and pv + sc conditions for approximately 15 min , to ensure that all participants understood the task . the visual stimuli and the duration of each stimulus presentation were developed and presented using presentation software ( neurobehavioral systems , albany , ca , usa ) . all images were obtained using a 3-tesla mr scanner ( allegra ; siemens , erlangen , germany ) located at the national institute for physiological sciences ( okazaki , aichi , japan ) . for functional imaging , a series of 272 volumes ( 136 volumes per run ) were acquired using t2-weighted , gradient echo , echo planar imaging ( epi ) sequences . each volume consisted of 34 transaxial slices , each having a thickness of 3.0 mm with a 0.5-mm gap between slices to include the entire cerebrum and cerebellum [ repetition time ( tr ) , 2500 ms ; echo time , 30 ms ; flip angle ( fa ) , 75 ; field of view ( fov ) , 19.2 cm ; in - plane matrix size , 64 64 pixels ; voxel dimensions , 3.0 3.0 3.0 mm ] . tight but comfortable foam padding was placed around the participant 's head to minimize head movement . to acquire a fine structural whole - brain image , magnetization - prepared rapid - acquisition gradient - echo ( mp - rage ) images were obtained [ repetition time ( tr ) , 2500 ms ; echo time ( te ) , 4.38 ms ; flip angle = 8 ; fov , 230 mm ; one slab ; number of slices per slab = 192 ; voxel dimensions = 0.9 0.9 1.0 mm ] . the first two volumes acquired in each mri run were discarded due to unsteady magnetization , and the remaining 134 volumes per run were used for analysis . data were analyzed using statistical parametric mapping 5 ( the wellcome trust centre for neuroimaging , london , uk ; http://www.fil.ion.ucl.ac.uk/spm ) implemented in matlab 7.7.0 ( mathworks , natick , ma , usa ) . following realignment for motion correction of all epi images , a high - resolution whole - brain t1-weighted image was co - registered with the first volume of epi images . the whole - head mp - rage images were then normalized to the montral neurological institute ( mni ) t1 image template . the epi images were spatially smoothed in three dimensions using an 8-mm full - width half - maximum gaussian kernel . we used the modified version of the kpt , which was a block - design version of the task used in a previous study ( mizuno et al . , 2012 ) . in each task condition ( i.e. , cl , pv , sc , and pv + sc ) , the event onset was designated as the presentation of the first stimulus of the first trial in a block in the pv and/or sc session or answer session . we modeled each of the four regressors ( cl , pv , sc , and pv + sc ) , which were convolved with a canonical hemodynamic response function to obtain the expected signal changes caused by the tasks . the data were high - pass filtered with a cut - off period of 160 s to remove low - frequency signal drifts . an autoregressive model was used for whitening the residuals to meet the assumptions for application of a general linear model ( glm ) . the weighted sum of the parameters estimated in the individual analyses consisted of contrast images . specifically , for each participant , the following first - level contrast images were generated : ( pv , sc , or pv + sc minus cl ) , ( pv minus sc ) , ( sc minus pv ) , and [ 2 ( pv + sc ) minus ( sc plus pv ) ] in the pv and/or sc session and answer session ( mizuno et al . , 2012 ) . second , the contrast images corresponding to each condition in each participant were used for group analyses with a random - effects model to obtain population inferences ( friston et al . , 1999 ) . we used a flexible factorial design that can compare the activities of task level contrasts within all the above contrast images , and among the 1st , 2nd , and 3rd trials of hca trial groups by repeated measures , as well as compare those between the hca and ccfs groups by non - repeated measures . the resulting set of voxel values for each comparison constituted a statistical parametric map of t statistics [ spm(t ) ] . significant signal changes for each contrast were assessed by means of t statistics on a voxel - by - voxel basis . the threshold for the spm(t ) of group analyses was set at p < 0.005 at the voxel level and p < 0.05 with a correction for multiple comparisons at the cluster level for the entire brain ( mizuno et al . , 2012 ) . comparisons of pv , sc , and pv + sc conditions with the cl condition ( pv , sc , or pv + sc minus cl ) were performed in order to obtain the activation pattern of the two types of single task processing and dual task processing . to specify the brain areas involved in the processing of pv , we used the contrast of ( pv minus sc ) . likewise , to identify the brain areas involved in the processing of sc , we used the contrast of ( sc minus pv ) . in addition , to specify the brain areas involved in the processing of pv + sc , we used the contrast of [ 2 ( pv + sc ) minus ( sc plus pv ) ] . anatomic localization of significant voxels within clusters was done using the wake forest university pick - atlas ( maldjian et al . , 2003 ) and a probabilistic cytoarchitectonic map ( eickhoff et al . , 2005 ) . the effects of task condition or group ( hca and ccfs ) on activation of brain region and task performance ( reaction time and accuracy ) in single and dual trials were analyzed using one - way repeated - measures analysis of variance ( anova ) or two - way anova . when statistically significant effects were found , intergroup differences were evaluated using a paired t - test with the bonferroni correction or student 's t - test . all p values were two - tailed , and p values less than 0.05 were considered significant . these analyses were performed with the spss 17.0 software package ( ibm spss inc . , table 1 summarizes the results for the fatigue score of the chalder fatigue scale and the vas scores for motivation to single or dual tasks . the fatigue scores of hca gradually increased at each measurement point [ f(2 , 24 ) = 3.47 , p = 0.048 ] . fatigue scores of ccfs patients were higher than those of hca . the vas scores for the motivation of each condition in hca among all the measurement points were not significantly different , and those of all the conditions between hca and ccfs were nearly equal . the reaction times and accuracies of each condition in both sessions among all the measurement points were not significantly different . the reaction times and accuracies of each condition in the pv and/or sc session between ccfs patients and hca were similar . the reaction times of each condition in the answer session ( questions to assess story comprehension ) between ccfs patients and hca were also nearly equal . in the answer session , although accuracies of the cl , pv , and sc conditions between ccfs patients and hca were not different , accuracy of the pv + sc condition in ccfs patients was lower than that in hca . the imaging results for each condition in the pv and/or sc sessions are shown in fig . 2 and table 3 . in hca , the lifg , bilateral spl , lffg , left inferior occipital gyrus ( liog ) , left middle occipital gyrus , and cerebellum were significantly activated in the pv condition . the left middle frontal gyrus ( lmfg ) , lifg , lmtg , left superior temporal gyrus , bilateral spl , bilateral inferior parietal lobules ( ipl ) , and bilateral precuneus were activated in the sc condition . the activated brain regions in the pv + sc condition almost overlapped with those in the pv or sc conditions . however , additional activated regions were not observed . in comparison with activation levels of the activated regions among all the measurement points in hca ( table 4 ) , likewise , we found similar results obtained by each comparison among them , discussed in the following paragraphs , indicating that activation levels and patterns in each condition were not changed by development in hca . in ccfs patients , these activated regions however , in addition to these brain regions , the right mfg ( rmfg ) was specifically activated in all conditions in ccfs patients . in the pv + sc condition , specific activation of the anterior cingulate cortex ( acc ) the activations of the lffg and liog of the pv condition were higher than those of the sc condition in hca ( fig . 3a ) . in the sc condition , unique activation of the lmtg was observed in comparison with the pv condition in hca and ccfs patients ( fig . , we found that activation of the liog of the pv condition was greater than that of the pv + sc condition in hca ( fig . 3a ) , and the activation of the lmtg of the sc condition was higher than that of the pv + sc condition in hca and ccfs patients ( fig . the activation levels of these regions between hca and ccfs patients were not significantly different ( fig . 3c , d ) . in both hca and ccfs patients , although the ldifg and lspl were commonly activated in the pv , sc , and pv + sc conditions ( fig . 2 ) , activations of these regions in the pv + sc condition were higher than those in the pv or sc conditions ( fig . activation levels of the ldifg [ brodmann area ( ba ) 9 : x = 46 , y = 12 , z = 26 ( common activated coordinates between hca and ccfs patients ) ] and lspl ( ba 7 : x = 28 , y = 66 , z = 38 ) between hca and ccfs patients were not significantly different . consistent with our results from hca and ccfs patients , the ldifg and lspl were strongly activated , whereas the lffg , liog , and lmtg were deactivated during the divided attention task relative to the two single tasks using the kpt in our previous study of healthy adults ( mizuno et al . , 2012 ) . to clarify fatigue - related neural processing during divided attention in hca and ccfs patients , we performed correlation analyses between the fatigue scores and activation levels in these brain regions . although activation of the lspl was not correlated with the fatigue score in hca ( fig . 4c ) , activation of the ldifg was positively correlated with the fatigue score in hca ( fig . the activation of the ldifg was negatively correlated with the accuracy of outcomes in the pv + sc condition in the answer session in hca ( fig . although there was a negative correlation between activation of the ldifg and accuracy of the pv + sc condition in the answer session in hca ( fig . 4h ) , a positive correlation between them was observed in ccfs patients ( fig . we also performed correlation analyses between vas scores for motivation and activation levels in these brain regions . only in ccfs patients , the vas score tended to be positively correlated with activation of the ldifg ( table 5 ) . a comparison of the results between hca and ccfs patients for each condition in the pv and/or sc session is shown in fig . , activations of the rmfg , which is included in the dorsolateral prefrontal cortex ( dlpfc ) [ ba 9 : x = 38 , y = 16 , z = 36 ( commonly activated coordinates among pv , sc , and pv + sc conditions ) ] , in ccfs patients were higher than those in hca ( fig . furthermore , only in the pv + sc condition , activations of the dorsal acc ( dacc , ba 32 , fig . 6 ) and lmfg ( ba 6 ) in ccfs patients were higher than those in hca . correlation analyses revealed that although activation levels of the rmfg of all conditions were not correlated with fatigue scores in ccfs patients ( fig . 5b ) , those of all conditions were positively correlated with vas scores for motivation ( fig . 5c ) . in addition , although correlation between the activation levels for the rmfg in the pv and pv + sc conditions and accuracies of these conditions in the pv and/or sc session was not observed ( fig . 5d ) , a positive correlation between activation levels for the rmfg in the sc and pv + sc conditions and accuracies of these conditions in the answer session was observed ( fig . + sc condition , activations of the dacc and lmfg were positively correlated with vas scores for motivation and fatigue , respectively ( table 6 ) . the lmfg , bilateral ifg , bilateral medial frontal gyri , bilateral ipl , bilateral spl , and cerebellum were activated in hca and ccfs patients . these brain regions were also activated in the pv + sc condition in hca and ccfs patients . unique or more strongly activated regions in the pv + sc condition in comparison with the sc condition were not observed in either hca or ccfs patients . our principal findings were that : 1 ) activation in the ldifg was greater in the dual task condition than in the two single task conditions in hca and ccfs patients ; 2 ) in hca , this activation level was positively and negatively correlated with the fatigue score and the accuracy for story comprehension , respectively ; 3 ) in ccfs patients , this activation level was positively and negatively correlated with accuracy for story comprehension and motivation score for the tasks , respectively ; 4 ) the rdlpfc of ccfs patients was specifically activated in both the single and dual task conditions , and these activation levels were positively correlated with motivation scores for the tasks and accuracy for story comprehension ; and 5 ) in ccfs patients , the dacc and lmfg were activated only in the dual task condition , and activation levels of the dacc and lmfg were positively associated with motivation and fatigue scores , respectively . the fronto - parietal areas , including the ldifg and lspl , are engaged by visual attentional processes ( kanwisher and wojciulik , 2000 ) . bookheimer noted that increased activation of the ldifg may reflect an increased need for attention to verbal memory processing ( bookheimer , 2002 ) . in addition , greater activation in the left parietal lobule during tasks with a higher short - term memory load is associated with allocation of attentional resources ( magen et al . , 2009 ) . when two arithmetic tasks are performed concurrently , the tasks compete for limited resources ( wickens et al . , 1983 ) , especially when these tasks entail activation in the same parts of the cortex ( klingberg and roland , 1997 ) , such as the ldifg and lspl in the present study . therefore , enhanced activations of the ldifg and lspl in the dual task condition engage more attentional processing than the single task conditions , due to greater and more complex demands on voluntary attentional resources . consistent with the present findings , we previously found that in young adults , activations of the ldifg and lspl in the dual task condition were higher than in the two single task conditions of the kpt . in contrast , activations of the lffg and lmtg , which are primary regions for processing of the pv and sc tasks , respectively , were lower in the dual task condition than in the two single task conditions ( mizuno et al . , 2012 ) . these cognitive compensation and decompensation patterns in the young adults were similar to those in children and adolescents in the present study , suggesting that the neural substrates of the kpt do not change dramatically from childhood to adulthood . however , in healthy children and adolescents , although the ldifg was not strongly activated , the participants demonstrated greater dual task performance . this suggests differences in activity levels in the ldifg in the kpt between children and adults , i.e. , adults may perform the kpt through more energy - efficient neural processing in comparison with children and adolescents . in hca , activations of the ldifg , which was more strongly activated in the dual task condition compared with the two single task conditions , were positively correlated with fatigue scores and negatively correlated with accurate comprehension . higher performance of a high - effort dual task is associated with a decrease in activation of the prefrontal cortex related to attentional resources , including the ifg ( jaeggi et al . , 2007 ) , suggesting that minimal utilization of attentional resources results in better performance of the dual task . because fatigue is related to an increase in brain activity during a high - effort cognitive task ( cook et al . , 2007 ; lange et al . , 2005 ) , fatigue may require utilization of more attentional resources during divided attention , which is reflected as greater activation of the ldifg , resulting in lower performance . in contrast , there were positive correlations between activation of the ldifg and accurate comprehension or mental effort level in the dual task condition in ccfs patients . this suggests that although severe fatigue consumes a considerable amount of attentional resources , severe fatigue forcibly recruits additional activation ( cognitive compensation ) and attentional resources , depending on the extent of mental effort , for better performance of the dual task . namely , ccfs patients have an impetus to recruit additional attentional , working memory , and salience regions ( mfg , dacc ) ( menon and uddin , 2010 ) in an attempt to complete the task despite their cfs disabilities . in addition , a greater level of fatigue in ccfs patients induced additional activation of the rmfg ( rdlpfc ) in both single and dual task conditions . our recent study revealed that increased activity of the right rmfg , which is included in the dlpfc , is involved in a facilitation system to increase the motor output caused by motivational input during physical fatigue conditions in healthy young adults ( tanaka et al . , 2013 ) . moreover , consistent with the present findings , a previous study by lange et al . showed that more extensive acc and bilateral prefrontal regions of patients with adult cfs were activated during a verbal working memory task in comparison with healthy adults ( lange et al . , it has been unclear whether these activations are caused by positive or negative emotion or whether they lead to better or poorer task performance . in the present study , we demonstrated that rdlpfc activation was associated with greater motivation and more accurate comprehension in ccfs patients , suggesting that the severely fatigued brain needs to recruit right frontal activation to perform the single and dual tasks appropriately , depending on the greater mental effort . only in the dual task condition because activation of the dacc was positively correlated with motivation level , to which we also referred previously ( holroyd and yeung , 2012 ) , activation may play a crucial role in motivation processing during the dual task trials in ccfs patients . in addition to the ldifg , greater activation of the lmfg was observed , indicating that severe fatigue recruits activation of not only the primary brain region involved in the attentional resource , but also the adjacent region . in fact , a positive association between activation of the lmfg and the severity of fatigue was observed . vasic et al . ( 2008 ) reported that decreased activity of the lmfg ( ba 6 ) in adolescents and young adults with dyslexia was observed during a verbal working memory task . ( 2005 ) found that during a verbal working memory task , a wider area of the lmfg ( ba 6/8 ) of cfs adults ( 270 voxels ) was activated in comparison with healthy adults ( 7 voxels ) . these results suggest that this cognitive compensative activity , i.e. , an increase in activity of the lmfg ( ba 6 ) , may be a common pathophysiological feature during an effortful executive verbal task in children and adults with cfs and may be a specific feature in cfs because this excessive activity of the lmfg ( ba 6 ) has not been observed in other developmental disorders . hence , patients with ccfs exhibit a wider area of activated frontal cortex during divided attention processing , and these excessive neural activations may contribute to a vicious cycle of further increases in fatigue . although previous imaging studies have reported that regional cerebral blood flow in the frontal regions of the brain is low during the resting state in both adult cfs patients ( kuratsune et al . , 2002 ) and ccfs patients ( miike et al . , 2004 ) , more extensive frontal regions were activated in the present study , including bilateral mfg and dacc , particularly during the dual task condition . therefore , ccfs may be characterized by overactivity of widespread frontal regions during divided attention processing . other studies have demonstrated reduction of gray - matter volumes of the rdlpfc ( ba 9/46 ) in adult cfs patients ( de lange et al . , 2008 ; okada et al . , 2004 ) and an association between the severity of fatigue and volume reduction of the rdlpfc . in addition , in adult cfs patients , reductions in the biosynthesis of the neurotransmitters glutamate , aspartate , and gamma - aminobutyric acid through acetyl - carnitine in the bilateral mfg and acc ( kuratsune et al . , 2002 ) and reductions in serotonin transporters in the acc ( yamamoto et al . in addition , our previous study using positron emission tomography revealed that although the regional cerebral flow and uptake of acetyl - carnitine in the lffgs of adults with cfs were not changed , those in the lmtg were reduced compared with healthy adults ( kuratsune et al . , 2002 ) . this indicates that not only the cognitive compensation regions but also the cognitive decompensation regions such as the lmtg are related to the pathophysiology of cfs . in addition to cognitive compensation and cognitive decompensation during the verbal divided attention task , short bursts of activity may occur in a large number of brain regions in a state of illness that allow accurate task completion compared to hca and changes in the default mode network in ccfs patients ( menon , 2011 ) . a recent study reported the existence of cerebral oxidative stress and mitochondrial dysfunction in adult cfs patients ( shungu et al . , 2012 ) , suggesting that accumulation of free radicals by excessive neural activities in chronic fatigue may induce cerebral oxidative stress . although further prospective study in fatigued children and adolescents and ccfs patients is necessary , it is possible that hyperactivity of the frontal regions in the brain during high - effort tasks is associated with pathophysiological alterations in the structures , neurotransmitter dynamics , and mitochondrial function in the frontal cortex from childhood to adulthood . ross et al . ( 2001 ) reported a decrease in performance of a dual task in adults with cfs . unfortunately , no reports have been published about the neural substrates of reduced dual task processing in adults with cfs . further study is necessary to identify the association between neural substrates of the kpt in adults with cfs and children and adolescents with cfs . our previous studies demonstrated that performance in attention control tasks ( divided attention and switching attention tasks ) in patients with ccfs is reduced compared with that in healthy children and adolescents ( tomoda et al . in this study , we investigated the effects of combination therapy with cognitive behavioral therapy and antidepressant medication for 6 months on the severity of mental fatigue and switching attention performance in ccfs patients ( kawatani et al . , 2011 ) . this combination therapy decreased the severity of mental fatigue and improved the performance in the switching attention task . correlations between these changes in fatigue severity and task performance by treatment were also observed . these results suggest that combined treatment with cognitive behavioral therapy and antidepressant medication is effective for improving poor attention characteristics associated with ccfs and may improve the cognitive compensation activity of the frontal cortex during the divided attention task . a review paper mentioned that the features of japanese ccfs are a lower motivation to learn , lifestyle and social factors such as chronic shortage of sleep , highly competitive scholastic environment , hard training at sports clubs , serious trouble with human relations ( e.g. , bullying ) , changing living environments ( e.g. , moving to a new house ) , and exhaustion after viral infection ( miike et al . , 2004 ) . this suggests that further studies are necessary to evaluate the intervention effects of lifestyle choices and social factors in ccfs patients . fig . 8 provides a conceptual diagram of the conclusions from the findings of the present study . better performance by hca on the dual task was associated with activation of a limited area of the frontal cortex . fatigue in hca induces greater activation of the frontal cortex and lower performance , indicating an inefficient process . with the same task , ccfs patients exhibited a wider area of activated frontal regions related to attentional resources in order to obtain an increase in their poorer task performance by forcibly driving motivation . this excessive frontal neural activation during a divided attention task is a characteristic feature of fatigued children and adolescents and ccfs patients . it seems to be related to the pathophysiology of ccfs patients and causes a vicious cycle of a further increase in fatigue . previous studies have suggested that recovery or compensation in language function following development of a lesion in the left hemisphere may depend on mechanisms in the right hemisphere ( blasi et al . , 2002 ; de guibert et al . , 2011 ) . specifically , greater activations of the right frontal regions during language and verbal working memory tasks are observed in patients with aphasia and dyslexia . in addition to recovery and compensation , we advocate a new concept of excessive brain activity caused by chronic fatigue .

in addition to being a well - documented dyslipidemic factor by itself , abdominal obesity is known to influence the effect of lipid - related gene variants . apolipoprotein ( apo ) e is one of the most widely studied genes in relation to the lipid - lipoprotein metabolism . apoe is a protein known for its key roles in the transport of cholesterol and other lipids in plasma and the central nervous system . the apoe genetic polymorphism contributes to variations in plasma lipid - lipoprotein concentrations in normal and dyslipidemic populations . apoe includes three main alleles ( 2 , 3 , and 4 ) that give rise to three common isoforms ( e2 , e3 , and e4 ) and six possible genotypes of which three are homozygous ( apoe2/2 , apoe3/3 , and apoe4/4 ) and three heterozygous ( apoe2/3 , apoe2/4 , and apoe3/4 ) . with a frequency of around 80% , apoe3 is the most common isoform , followed by apoe4 ( 12% ) and apoe2 ( 8% ) [ 24 ] . accordingly , apoe2/2 and apoe2/4 carriers are less frequent and represent less than 3% of the population . considerable advances have therefore been made in understanding the structure of apoe and the impact of the three common isoforms on the lipid / lipoprotein metabolism , health status , and risk of disease . apoe3 contains cysteine at position 112 and arginine at position 158 , while apoe2 shows cysteine at both sites and apoe4 contains arginine at both sites [ 1 , 5 ] . however , their disparities are not limited to this molecular difference ( table 1 ) . apoe4 forms a unique salt bridge between arg-61 in the n terminal and glu-255 in the carboxy - terminal domain and a molten globule state that could reduce its stability , whereas in apoe2 , cys-158 disrupts the salt bridge . the protein structure and lipid receptor binding of apoe2 and apoe4 are therefore differentially affected . while apoe3 and apoe4 have a normal low - density lipoprotein ( ldl ) receptor binding affinity , the binding of apoe2 is defective . furthermore , apoe3 and apoe2 display a preference for high - density lipoproteins ( hdl ) , whereas apoe4 prefers ldl and very - low - density lipoproteins ( vldl ) [ 79 ] . accordingly , apoe4 is frequently associated with increased plasma total and ldl - cholesterol levels in the homozygous and heterozygous ( e3/e4 ) states . in contrast , apoe2 is usually associated with normal or low lipid values in both homozygous and heterozygous ( e2/e3 ) subjects . finally , the apoe2 isoform has been associated with higher triglyceride ( tg ) levels and lower apob levels than the apoe4 isoform . together , these data indicate that apoe influences the lipid / lipoprotein metabolism levels with apoe2 and apoe4 isoforms having opposite effects . therefore , one could expect that on average apoe2/4 carriers would present a phenotype similar to that of apoe3/3 , just as the mix of an acid and a base results in a neutral solution . the answer to this question is uncertain , considering that the apoe2/4 genotype has almost never been studied . indeed , most of the previous studies of lipid metabolism have excluded apoe2/4 carriers . in other studies , the strategy was to group them with apoe2 carriers ( homozygous and/or heterozygous ) or apoe4 carriers ( homozygous and/or heterozygous ) . these strategies may have been justified and/or required by the small number of apoe2/4 carriers . moreover , considering that the modulator effect of adiposity would be stronger in apoe2 carriers , could abdominal obesity significantly influence the apoe2/4 carriers ' lipid profile ? due to a founder effect , the frequency of the apoe2 isoform in the saguenay - lac - saint - jean ( slsj ) region ( qubec , canada ) is among the highest ever reported . consequently , the apoe2/4 genotype is not rare in this population , offering the appealing opportunity to answer these questions . this paper therefore aims to compare the lipid - lipoprotein profile between apoe2/4 carriers and other apoe genotypes , in relation to waist circumference . the present study included 2,680 subjects ( 1,356 men and 1,324 women ) from the slsj region of quebec , canada . all subjects were screened at the chicoutimi hospital lipid clinic or ecogene-21 clinical research center and agreed to participate in studies on genetic determinants of type 2 diabetes ( t2d ) or coronary artery disease ( cad ) combining genome wide scans and candidate gene strategies . they were selected on the basis of having a positive family or personal history of dyslipidemia , cad , or t2d . subjects with or suspected to have familial hypercholesterolemia ( omim : 143890 ) , those homozygous for a null lpl gene mutation or with plasma tg levels superior to 20 mmol / l ( omim : 238600 and 144650 ) , and those with a body mass index ( bmi ) greater than 40 , taking drugs known to affect blood lipid levels , or with chronic alcohol consumption were excluded . the project was approved by the chicoutimi hospital ethics committee and written informed consent was obtained from each patient , in accordance with the declaration of helsinki . subjects with an elevated waist circumference ( > 90 cm in men or 85 cm in women ) were considered obese . t2d was defined according to the world health organization criteria as a 2-hour glucose concentration > 11.1 mmol / l following a 75 g oral glucose load . cad was defined by evidence of clinically documented myocardial infarction or angiographic analyses of coronary lesions [ 18 , 19 ] . blood samples were obtained in the morning after a 12-hour overnight fast from the antecubital vein into vacutainer tubes containing edta . cholesterol , tg , and glucose plasma levels were enzymatically measured on a cx7 analyser ( beckman ) . total cholesterol was determined in plasma and hdl after precipitation of vldl and ldl ( d > 1.006 g / ml ) in the infranatant with dextran sulphate and magnesium chloride ( mgcl2 ) . in this case , plasma ldl - cholesterol levels were estimated using the friedewald formula . when tg levels were higher than 4.5 mmol / l , plasma ldl - cholesterol levels were calculated using a validated method . cholesterol and tg contents of vldl , ldl , and hdl particles were also measured in a subsample of 1,531 subjects ( 742 men and 789 women , mean age = 49.2 11.9 ) after ultracentrifugation of plasma . this subsample was comparable to the main sample in regard to age , gender , and apoe distribution ( all p > 0.05 ) . non - hdl - cholesterol concentrations were calculated by subtracting the hdl - cholesterol level from that of total plasma cholesterol . clinical cutoff points used for plasma lipid - lipoprotein levels were established based on the primary prevention therapeutic target values of the national cholesterol education program - adult treatment panel ( ncep - atp ) iii and the canadian consensus for dyslipidemias [ 22 , 23 ] . apoe genotyping was performed using a restriction fragment length polymorphism ( rflp ) analysis , with the hha i restriction enzyme , as previously described . briefly , after cleavage of amplified sequences in specific regions , the dna fragments were separated by electrophoresis on a polyacrylamide gel . categorical variables were compared using the pearson statistic , which was also used to assess the hardy - weinberg equilibrium for the apoe genotype distribution . group differences for continuous variables were examined with a univariate analysis of variance ( anova ) followed by the bonferroni post hoc test or nonparametric kruskal - wallis tests followed by mann - whitney u tests when the homogeneity of the variance was not respected . data that were not normally distributed were transformed using a log10 transformation and geometric means are shown in tables . the independent sample student 's two - tailed t - test was performed to assess differences among obese and nonobese subjects within the same genotype . binary logistic regression models were built in order to estimate the relative odds of dyslipidemias associated with the various apoe genotypes including age , sex , waist circumference , and diabetes as covariates . all statistical analyses were performed using the spss package ( version 17.0 , spps , chicago , il , usa ) . the observed frequencies of the apoe genotypes did not differ from the expected frequencies according to the hardy - weinberg equilibrium ( p > 0.05 ) . as seen in table 2 , groups were comparable for age , sex , waist circumference , bmi , t2d , cad , and hypertension expression as well as hdl - cholesterol levels . though not significant , waist circumference and bmi tended to differ among groups . heterozygous apoe2/4 subjects had a lower level of tg than apoe2/2 carriers but higher than apoe3/3 carriers . figure 1 presents the lipid - lipoprotein profile following ultracentrifugation among a subsample of 1,531 subjects according to the apoe genotype . looking at significant group differences concerning the apoe2/4 genotype , the latter had higher ldl - cholesterol but lower vldl - cholesterol and vldl - tg concentrations than apoe2/2 carriers . figure 2 shows the risk ( odds ratio ) of exhibiting hyperlipidemia when compared to apoe2/4 carriers . results showed that apoe2/4 carriers were less likely than apoe2/2 carriers , but more likely than apoe3/3 carriers , to suffer from hypertg . they were at a lower risk of having high ldl - cholesterol levels or high non - hdl - cholesterol levels than apoe4/4 subjects . they showed an increased risk of having a high total cholesterol / hdl - cholesterol ratio when compared to apoe2/3 and apoe3/3 carriers . finally , they had a lower risk of having an abnormally high vldl - cholesterol / tg ratio than apoe2/2 carriers but a higher risk than apoe3/3 and apoe3/4 . table 3 displays the lipid - lipoprotein profile according to the apoe genotype and abdominal obesity . in all genotypes , the level of hdl - cholesterol was lower and the levels of tg and vldl - cholesterol were higher in individuals with abdominal obesity when compared to those without abdominal obesity . in apoe2/4 carriers , the total cholesterol / hdl - cholesterol ratio and vldl - tg were also higher in individuals with abdominal obesity when compared to those without abdominal obesity . furthermore , our results showed that nonobese apoe2/4 carriers had higher tg and vldl - cholesterol levels than nonobese apoe3/3 carriers , a higher ldl - cholesterol level than nonobese apoe2/2 and apoe2/3 carriers , and a higher non - hdl - cholesterol level than nonobese apoe2/3 , but a lower vldl - cholesterol level than apoe3/3 and a lower vldl - cholesterol / tg ratio than nonobese apoe2/2 carriers . apoe2/4 carriers with abdominal obesity had a lower level of tg than obese apoe2/2 carriers , a lower level of non - hdl - cholesterol than obese apoe2/2 and obese apoe4/4 carriers , a lower total cholesterol / hdl - cholesterol ratio than apoe4/4 carriers , and finally a lower vldl - cholesterol / tg ratio than apoe2/2 carriers . the apoe polymorphism is a key modulator of the lipid / lipoprotein metabolism , with apoe2 and apoe4 having mainly opposite effects . our results suggest that although both isoforms play a role in the lipid / lipoprotein metabolism in apoe2/4 subjects , the influence of the apoe2 allele is less pronounced than that of apoe4 , particularly in presence of abdominal obesity . this influence varies according to the lipid / lipoprotein subtype and presence of a secondary dyslipidemic factor . in nonobese subjects , the apoe2/4 carriers have higher ldl- and non - hdl - cholesterol concentrations than apoe2/3 carriers , closer to those of apoe3/4 and apoe4/4 carriers . in presence of abdominal obesity , the lipid - lipoprotein profile is as deteriorated in apoe2/4 carriers as in carriers of other apoe genotypes , with the exception of the tg - rich lipoprotein fractions that are higher in apoe2/2 carriers . this is a feature of type iii dysbetalipoproteinemia , a rare disorder mainly associated with the apoe2 isoform . the other exception is that non - hdl - cholesterol and total cholesterol / hdl - cholesterol ratio are higher in obese apoe4/4 [ 25 , 26 ] . this result is characteristic of the apoe2 isoform , which clears tg - rich particles from the plasma more slowly than apoe3 and apoe4 . importantly , the tg levels found in apoe2/4 carriers were not as high as those found in apoe2/2 carriers , suggesting that the apoe4 isoform also , to a lesser amplitude , influences the tg metabolism in apoe2/4 carriers . the present study also showed a trend for an increasing gradient of total apob concentrations ranging from apoe2/2 carriers to apoe4/4 carriers ; this result replicates previous work . results obtained after the ultracentrifugation showed the same trend for ldl - cholesterol , placing apoe2/4 closer to apoe3/4 than apoe2/3 . in this last finding , apoe2/2 carriers presented the lowest ldl - cholesterol concentration , which is in accordance with the 2 allele binding deficiency to ldl receptors [ 1 , 29 ] . those findings are consistent with previous work reporting lower ldl - cholesterol levels in apoe2 carriers than apoe4 carriers [ 11 , 29 , 30 ] . results obtained after the ultracentrifugation also showed that apoe2/4 carriers have lower vldl - cholesterol and vldl - tg concentrations than apoe2/2 carriers , suggesting that the apoe4 isoform influences the clearance of vldl particles in apoe2/4 carriers . altogether , these results imply that apoe2 and apoe4 isoforms both influence the apoe2/4 lipid / lipoprotein metabolism . supporting this idea , the findings of ikewaki and collaborators suggest that apoe2 and apoe4 have distinct metabolic pathways in heterozygous apoe2/4 individuals . as mentioned previously , apoe2/4 carriers had higher tg levels than apoe3/3 carriers . bringing this observation further , we found that apoe2/4 subjects had a higher risk of hypertriglyceridemia than apoe3/3 carriers , but less risk than apoe2/2 carriers . furthermore , apoe2/4 subjects were at decreased risk of ldl hypercholesterolemia and high non - hdl - cholesterol when compared to apoe4/4 carriers . compared to apoe2/3 and apoe3/3 , they showed an increased risk of having a total cholesterol / hdl - cholesterol ratio above 5 , a ratio often used as a marker of cad risk . finally , apoe2/4 carriers were at a lower risk of exhibiting a vldl - cholesterol / tg ratio greater than 0.5 when compared to apoe2/2 but at higher risk than apoe3/3 and apoe3/4 carriers . this last ratio is used for estimating the proatherogenic idl subfraction levels and as a marker of type iii dysbetalipoproteinemia risk . moreover , not surprisingly , most non - apoe2/2 type iii subjects were apoe2 heterozygous carriers , around 15% of apoe2/3 and apoe2/4 subjects having a type iii phenotype , whereas the prevalence of type iii among apoe3/3 and apoe3/4 carriers was below 5% . altogether , those results suggest that apoe2/4 is protective against hyperlipidemia when compared to apoe2/2 and apoe4/4 . however , when compared to apoe3/3 , the latter have a small increased risk for hypertg and hyperidl . they are also at increased odds of having a cholesterol / hdl - cholesterol ratio above 5 . additional primary or secondary factors , some very common such as obesity , could influence those risks . our results suggest that abdominal obesity , defined by an elevated waist circumference ( > 90 cm in men or 85 cm in women ) , affects hdl and tg concentrations as well as the cholesterol / hdl - cholesterol ratio in apoe2/4 carriers similar to what is observed for other apoe genotypes . more specifically , we found that obese subjects were characterized by lower concentrations of hdl - cholesterol than nonobese subjects . supporting our results , srinivasan and collaborators ( 2001 ) found that both obese apoe2 ( e2/2 and e2/3 ) and apoe4 ( e3/4 and e4/4 ) carriers showed reduced hdl - cholesterol when compared to their respective nonobese groups . obese apoe2/4 subjects also had increased tg concentrations , which is consistent with previous studies showing elevated tg levels and an increased hypertriglyceridemia risk in obese apoe4 carriers [ 34 , 35 ] . the cholesterol / hdl - cholesterol ratio showed the same pattern , with obese individuals having a higher ratio than nonobese individuals . potential limitations of our study include selection bias , considering that subjects were selected on the basis of having a positive family or personal history of dyslipidemia , cad , or t2d . it could therefore be more difficult to observe significant differences for the expression of cardiometabolic risk covariates . moreover , screening of subjects from a founder population has provided a certain ethnic homogeneity to our sample , which could also be considered as a bias . however , it is precisely these recruitment strategies that provided enough apoe2/4 subjects to allow such a study . until now now that these preliminary results have been obtained , they will need to be validated in larger samples and diversified populations to ensure their external validity . considering the small prevalence of this genotype , meta - analyses would be an appealing strategy to determine if the current results are representative of the general population . results of our study were also in line with the literature as regards the impact of the different genotypes on the lipid / lipoprotein metabolism . since other factors such as high - carbohydrate diets or certain chronic diseases have been reported to influence the lipid / lipoprotein metabolism , it would have been interesting to include them in this study . finally , it would also be interesting to perform such analyses after a standardized meal . we believe that the addition of postprandial and dynamic analyses could provide a more comprehensive understanding of the apoe metabolism and maybe the key unlocking some mechanisms . in summary , results of this study suggest that both apoe2 and apoe4 isoforms play a role in the lipid / lipoprotein metabolism of apoe2/4 subjects and that the magnitude of their respective importance depends on the lipid / lipoprotein subtype . furthermore , obesity is associated with an increased risk of dyslipidemia in apoe2/4 carriers similar to what can be observed for other apoe genotypes ( table 4 ) . however , in presence of abdominal obesity , the influence of the apoe2 allele appears less pronounced than that of apoe4 . these data have provided new insight on the lipid / lipoprotein profile of apoe2/4 carriers and their hyperlipidemia risk . given the influence of lipid concentrations on the risk of cad , studies that would directly examine the cad risk of apoe2/4 would give novel insights on the role of apoe in human health . increasing our knowledge on the duality of apoe4 and apoe2 isoforms may also help create new treatments for a variety of diseases . indeed , even if this paper focused on the impact of apoe on lipid concentrations , apoe is a well - known risk factor for many diseases including alzheimer 's disease . finally , because the current study was performed in a founder population ,

fentanyl is a strong opioid agent , which is ~100 times more potent than morphine.1 it is commercially available as a patch or transdermal therapeutic system ( tts ) that delivers drug to the skin surface and provides constant drug delivery to the general circulation for several days . fentanyl tts represents a cornerstone in the treatment of patients with severe pain and is convenient for patients with continuous severe pain in need of a drug with stable pharmacokinetic profiles . the renewal of the patch should occur every 3 days ( 72 hours ) according to manufacturer s guidelines . a retrospective chart review in a us pain center revealed that nearly every patient reported perceived end - of - dosage failure as the reason for taking the medication more frequently.2 consequently , some researchers recommend early replacement of the patches every 48 hours , predominantly if pain increases at the end of the 3-day period and if a higher dosage produces adverse effects without improving pain relief.3 more frequent dosing is not recommended by national guidelines or consensus statements,4 and no published reference recommends dosing intervals < 48 hours . the aims of this study were to assess the prevalence of early replacement of fentanyl tts in a cancer center in basel , switzerland , and to assess the reasons for early replacement in stationary patients . the st clara hospital is the largest private acute care hospital in basel , switzerland , with 229 beds . it gives emphasis on oncology and holds a palliative care unit of six single bedrooms within the cancer center . the electronic medical database was reviewed for administration of durogesic matrix ( fentanyl tts , all strengths ) between november 1 , 2011 , and january 31 , 2015 . the extracted data concerned patient ( year of birth , gender , ward , main diagnosis , body mass index [ bmi ] ) , fentanyl tts ( strength , dosage , application day , and hour according to the confirmation stamp of the dispensing nurse ) , co - medication ( name , strength , and dosage ) , co - analgesic treatment ( name , strength , and dosage , excluding local application forms ) , laboratory values ( aspartate transaminase [ ast ] and alanine aminotransferase [ alt ] ) , and psychological state ( inconspicuous , depressive , agitated , or others ) . the secondary measures were the daily use of breakthrough pain medication and of co - medications . the total quantity of dispensed breakthrough pain medication over periods of 24 hours was converted into an equivalent dosage of oral morphine ( in milligrams ) according to conversion tables retrieved from the literature ( supplementary materials ) . because patch renewal after 3 days was the topic of interest , patients with a short hospitalization stay , ie , < 10 days , were excluded . a written survey was developed assessing nurses , physicians , and pharmacists personal experiences with fentanyl tts and reasons for early replacement . it combined four open - ended questions , 23 closed - ended questions ( ten 10 cm visual analog scale [ vas ] , two yes / no answers , one multiple choice answer ) and took 10 minutes to complete . the study was approved by the ethics committee ethikkommission nordwest- und zentralschweiz ( eknz 2015 - 037 ) . the ethics committee deemed patient consent data depository and statistical analysis were performed with the statistical package for the social sciences software , version 22 for windows ( ibm corporation , armonk , ny , usa ) . the wilcoxon signed - rank test was used since the data were not normally distributed ( kolmogorov smirnov test ) . the st clara hospital is the largest private acute care hospital in basel , switzerland , with 229 beds . it gives emphasis on oncology and holds a palliative care unit of six single bedrooms within the cancer center . the electronic medical database was reviewed for administration of durogesic matrix ( fentanyl tts , all strengths ) between november 1 , 2011 , and january 31 , 2015 . the extracted data concerned patient ( year of birth , gender , ward , main diagnosis , body mass index [ bmi ] ) , fentanyl tts ( strength , dosage , application day , and hour according to the confirmation stamp of the dispensing nurse ) , co - medication ( name , strength , and dosage ) , co - analgesic treatment ( name , strength , and dosage , excluding local application forms ) , laboratory values ( aspartate transaminase [ ast ] and alanine aminotransferase [ alt ] ) , and psychological state ( inconspicuous , depressive , agitated , or others ) . the secondary measures were the daily use of breakthrough pain medication and of co - medications . the total quantity of dispensed breakthrough pain medication over periods of 24 hours was converted into an equivalent dosage of oral morphine ( in milligrams ) according to conversion tables retrieved from the literature ( supplementary materials ) . because patch renewal after 3 days was the topic of interest , patients with a short hospitalization stay , ie , < 10 days , were excluded . a written survey was developed assessing nurses , physicians , and pharmacists personal experiences with fentanyl tts and reasons for early replacement . it combined four open - ended questions , 23 closed - ended questions ( ten 10 cm visual analog scale [ vas ] , two yes / no answers , one multiple choice answer ) and took 10 minutes to complete . the study was approved by the ethics committee ethikkommission nordwest- und zentralschweiz ( eknz 2015 - 037 ) . the ethics committee deemed patient consent not necessary . data depository and statistical analysis were performed with the statistical package for the social sciences software , version 22 for windows ( ibm corporation , armonk , ny , usa ) . the wilcoxon signed - rank test was used since the data were not normally distributed ( kolmogorov smirnov test ) . of 3,514 patients who were prescribed fentanyl tts , 1,196 were excluded because of duplicate entry in the database , 1,557 because of hospitalization stay < 10 days , 11 because of no discharge date , and 11 were ambulatory patients . the median hospital stay was 17 days and mean was 14 days ( 10.7 days ) with a maximal length of 110 days ( one patient ) . the patients mean age was 71.411.5 years and bmi was 23.84.9 kg / m ( values < 25 kg / m were considered normal ) , and 55% were women ( table 1 ) . cancer was the most frequent diagnosis ( 79.4% ) , all in advanced or terminal stages . patients psychological states were mostly not specified ( 54.8% ) or inconspicuous ( 38.4% ) , and depression was recorded for 2.6% of the patients . liver enzymes were normal for 54.5% of the patients , increased for 37.8% of them , and not specified for the remaining 7.7% . oral co - medication was administered to 86.3% of the patients , mostly in the form of 5 to 10 medications ( 50.9% ) or > 10 medications ( 21.2% ) . from the 3,122 fentanyl tts that were administered , 872 ( 27.9% ) were excluded because of missing information . of the remaining 2,250 fentanyl tts with complete data sets , main times of administration were 2 pm ( 41.0% ) , 8 am ( 28.3% ) , 6 pm ( 7.1% ) and 12 am ( 6.7% ) . fentanyl tts dosages ranged from 6 g / hour to 500 g / hour with the most often used dosages being 25 g / hour ( 26.2% ) and 12 g / hour ( 25.4% ) . replacement intervals ranged from 2 hours to 120 hours , and 61.6% of the replacements occurred after 72 hours . patients with early replacement after 48 hours were significantly younger ( 63.8 years versus 71.5 years ; p<0.001 ) , obtained twofold higher mean dosages of fentanyl tts ( 89.0 g / hour versus 44.1 g / hour ; p<0.001 ) , and had more often cancer ( table 2 ) . range and significance of the values were maintained after exclusion of the three patients with the highest dosages of fentanyl tts ( > 300 g / hour ) . metamizole was the most often used non - opioid co - analgesic , either alone ( 19.9% ) or in combination with paracetamol ( 3.8% ) or nonsteroidal anti - inflammatory drugs ( 2% ) . the use of co - analgesic did not differ if the replacement interval for fentanyl tts was 48 hours or other ( data not shown ) . the cyp 3a4 inducers st john s wort , carbamazepine , and rifampicin were administered to seven patients ( 0.9% ) whose fentanyl ttss were not replaced after 48 hours . morphine was the most often used rescue medication and was administered as oral drops ( 44.2% ) , parenteral formulation ( 16.9% ) , or a combination of both ( 22.3% ) . for the fentanyl ttss that were replaced after 48 hours , the mean dosages of breakthrough pain medication ( calculated as oral morphine equivalent in milligram ) were similarly high during the first day/024 hours and the next day/2448 hours ( first day : 185.1 mg versus second day : 157.0 mg ; wilcoxon p=0.57 ) , but 4.5-fold and 5.5-fold higher than the fentanyl tts with other replacement time ( first day : 185.1 mg versus 39.6 mg ; chi2=238.3 , p<0.001 ; second day : 157.0 mg versus 28.8 mg ; chi2=227.2 , p<0.001 ; table 2 ) . for the fentanyl tts with other replacement time , the mean dosages of breakthrough pain medication did not change over the three consecutive days ( 39.6 mg [ first day ] and 30.2 mg [ third day ] ; wilcoxon p=0.83 ; table 2 ) . range and significance of the values remained after exclusion of the three patients with highest dosages of fentanyl tts , ie , > 300 g / hour . we wanted to investigate if the dosages changed from one application to the next , ie , according to the consecutive sequence of the administration of the fentanyl tts . we hypothesized that dosage between two consecutive administrations of fentanyl tts would increase for the tts replaced after 72 hours , as a mirror of the method of choice to obtain pain control . we hypothesized that dosage between two consecutive administrations of fentanyl tts would remain constant for the tts replaced earlier after 48 hours , with the rationale that if shortening the application time is the method of choice to obtain pain control , it should not be accompanied by dose increase . after exclusion of the three patients with the highest dosages of fentanyl tts ( > 300 g / hour ) , we sorted the fentanyl tts into the first four sequences of administration ( first to fourth ; n=1,668 ) . the total number of fentanyl tts per sequence neither correlated with age ( pearson r=0.07 ) nor with fentanyl dosage ( pearson r=0.12 ) . from one application to the next , the mean dosages of the fentanyl tts increased steadily from the first to the fourth application and according to replacement time , and statistical significance was reached between each sequence ( wilcoxon p<0.001 ; figure 1 ) . for each sequence , the mean dosages of the fentanyl tts with replacement after 48 hours were significantly higher than the fentanyl tts with other replacement time ( wilcoxon p<0.001 ; figure 1 ) . a total of 98 questionnaires were distributed on april 14 and 15 , 2015 , at the palliative unit , oncology wards , and during physician reports . the respondents were in average 37.29.3 years old , mainly women ( 76.8% ) , swiss ( 66.1% ) or german ( 32.1% ) , and nurses ( 58.9% ) or physicians ( 33.9% ) . half of the respondents were slightly not convinced that the administration of fentanyl tts every 72 hours would lead to pain relief ( a mean value of 7.2 on a vas from 0= not convinced to 10= absolutely convinced ) . in daily practice , the most frequent replacement interval was 72 hours ( 96% ) or 48 hours ( 4% ) . for 36 respondents ( 63.2% ) , early replacement of fentanyl tts a total of 27% of the respondents indicated that 16.7% of their patients obtained early replacement of fentanyl tts during the last 30 days . the most frequent reasons evoked were end - of - dosage pain ( 41.4% ) and inadequate adhesion owing to inappropriate skin property ( 31.4% ) . when asked to rate how often the participants encountered different reasons for an early replacement of fentanyl tts in practice ( from 0%= never to 100%= always ) from a list of eight reasons retrieved from literature , the most frequent reasons were an insufficient dosage of fentanyl ( 47% ) ; a dry , sweating , or cachexic skin ( 36% ) ; end - of - dosage pain ( 30% ) ; and poor adhesion of the tts ( 30% ) . a total of 98 questionnaires were distributed on april 14 and 15 , 2015 , at the palliative unit , oncology wards , and during physician reports . after 10 days , the respondents were in average 37.29.3 years old , mainly women ( 76.8% ) , swiss ( 66.1% ) or german ( 32.1% ) , and nurses ( 58.9% ) or physicians ( 33.9% ) . half of the respondents were slightly not convinced that the administration of fentanyl tts every 72 hours would lead to pain relief ( a mean value of 7.2 on a vas from 0= not convinced to 10= absolutely convinced ) . in daily practice , the most frequent replacement interval was 72 hours ( 96% ) or 48 hours ( 4% ) . for 36 respondents ( 63.2% ) , early replacement of fentanyl tts a total of 27% of the respondents indicated that 16.7% of their patients obtained early replacement of fentanyl tts during the last 30 days . the most frequent reasons evoked were end - of - dosage pain ( 41.4% ) and inadequate adhesion owing to inappropriate skin property ( 31.4% ) . when asked to rate how often the participants encountered different reasons for an early replacement of fentanyl tts in practice ( from 0%= never to 100%= always ) from a list of eight reasons retrieved from literature , the most frequent reasons were an insufficient dosage of fentanyl ( 47% ) ; a dry , sweating , or cachexic skin ( 36% ) ; end - of - dosage pain ( 30% ) ; and poor adhesion of the tts ( 30% ) . in this cohort of mainly cancer patients , replacement of fentanyl tts earlier than the prescribed 72 hours was observed in a higher than expected proportion ( 31% ) . they were related to dosage - finding strategies or inadequate skin adhesion or were the results of a time correction after an erroneous application such as in evening instead of morning . an application period of 60 hours was not used , probably because it would result in an inconvenient change every 2.5 days , such as one change in the morning and the next in the evening . this might also lead to more confusions than every third day . in our study , the frequency of an application period of 2 days ( 48 hours ) was 7.4% , which was in the range of other studies.5,6 higher opioid dosage and younger age of our patients were associated with early fentanyl tts replacement . to our knowledge , a similar relationship is mentioned in a korean study performed in cancer patients taking sustained - release opioids oral morphine , oxycodone and transdermal fentanyl patch.5 patients aged < 40 years and taking daily dosages > 120 mg oral morphine equivalent ( corresponding to fentanyl tts 50 g / hour ) showed more often breakthrough pain.5 the authors calculated that pain control with fentanyl tts lasted for 62.9 hours on average.5 however , the authors performed a self - reported survey over the last week , and thus , the results might simply mirror that younger patients who need high opioid dosages might feel breakthrough pain more easily than older patients . furthermore , extrapolation to tts is questionable because oral and transdermal application forms were aggregated . finally , stoicism is more pronounced in elderly patients whose beliefs may influence their pain experience.7 thus , we conclude that younger patients may complain more and thus obtain higher opioid dosages . in our study , early fentanyl tts replacement was also associated with higher rescue dosages . however , over the 2 days of tts application , the mean dosages of rescue medication were similar between the first 024 hours and the next 2448 hours , indicating that breakthrough pain was overcome with the appropriate method and according to the best practice . the analysis of consecutive applications from the first to the fourth tts showed that mean dosages of the fentanyl tts increased from one application to the next , independently of the replacement time ( after 48 hours or other time ) and refuted our hypothesis . increasing the dosage of the fentanyl tts at the end of the application interval ( 72 hours or 48 hours ) seemed to be the method of choice to obtain pain control and fits to best practice . several studies mentioned a substantial number of cancer patients who replaced fentanyl tts every second day because of pain aggravation before the next application.5,6 one reason for a reduction in the dosing interval is rooted in theory , ie , it is one option for obtaining higher plasma concentrations with the same drug and the same route of administration ; the second option is increasing the dosage.8 however , if this practice is valid for oral modified - release opioid formulations , it might be questionable for transdermal systems that were developed to deliver a constant amount of drug over several days . moreover , transdermal systems contain substantial amounts of residual fentanyl after the usual 3 days of dosing interval . nevertheless , it appears that some patients might not have adequate serum concentration of fentanyl over the 3 days of application , and thus , they manifest an increase in pain episodes at the second day after application of a tts , equivalent to an end - of - dosage failure.9 we identified in the literature potential factors responsible for transient flares of severe pain,10 ie , end - of - dose failure , liver function , and the use of cytochrome p450 - 3a4 inducers , as the most significant factors influencing serum fentanyl concentration.11 gene polymorphisms and demographic and disease pathology factors explain only a very small portion of variation in fentanyl concentrations.12 in our study , rationale reasons for an early replacement of fentanyl tts could not be deduced from the patients clinical data ( no impaired liver function , no interaction with cyp inducers ) . in this context , some authors conclude that additional variables may explain the large interpatient variability in serum fentanyl concentrations.12,13 hepatic clearance ( ie , liver blood flow ) and transdermal absorption ( ie , skin temperature , attachment , sweat , loss of subcutaneous fat ) are likely factors to explain the variability in serum fentanyl up to 200-fold , even for the same dosage.12 in our survey , poor adhesion to the skin and end - of - dosage pain were the two most often answers given by professionals involved in the care of cancer patients when asked about the reasons for early replacement of fentanyl tts . good adhesion of a transdermal patch to the skin is essential for maximum efficacy , and adhesion failure hampers proper dosing.14 consequently , and in the absence of any other rationale reason , skin adhesion problems may point practical reasons to explain an early replacement of fentanyl tts and mimic end - of - dosage failure . first , patients received a wide range of transdermal fentanyl dosages , reflecting real - world practice in pain cancer treatment . second , quantitative data were backed up with qualitative data obtained from the health care professionals currently caring for cancer patients . thus , this mixed method approach was able to add further facets in exploring the reasons for early transdermal patch replacement . finally , our findings represent a real - life context and add to the current knowledge base on the very real perception for need to change dose in patients . first , the conversion of the rescue medication into oral morphine equivalent was calculated with the equipotency references available from swiss hospitals . however , the most often used rescue medication in this study was morphine whose factor 100 is universal . thus , the potential variations in the calculated rescue medications can be considered as marginal . second , the rescue medication was extracted from the records and summed over 24 hours from 12 am to 11:59 pm . because most of the fentanyl tts were administered at 2 pm , a shift is thinkable within the amount of rescue medication calculated over each 24 hours . however , this difference concerns only the first 14 hours and merges into the next interval . as a consequence , small typing errors were corrected when the identification of the product was unequivocal ( eg , one fentanyl tts 50 g / hour was recorded as 50 fentanyl ttss ) or when the intention was unequivocal ( eg , the stop time was entered as an administration time ) . from the total 3,122 fentanyl tts administered to 739 patients , 27.9% were excluded because of missing data from a major field , mostly the strength . this might be due to time constraint on the wards or different interpretation of the entry fields in the database . thorough pain assessment and reassessment guide the monitoring and the dosing of the administered pain medication and are performed routinely at st clara hospital . however , our aims were not to correlate the administered pain medication according to patients pain scores , and thus , we focused more on data sets related to our question of interest . finally , we did not scientifically determine the reasons for early change , such as comparison of residual content of patches or sequential blood levels . first , patients received a wide range of transdermal fentanyl dosages , reflecting real - world practice in pain cancer treatment . second , quantitative data were backed up with qualitative data obtained from the health care professionals currently caring for cancer patients . thus , this mixed method approach was able to add further facets in exploring the reasons for early transdermal patch replacement . finally , our findings represent a real - life context and add to the current knowledge base on the very real perception for need to change dose in patients . first , the conversion of the rescue medication into oral morphine equivalent was calculated with the equipotency references available from swiss hospitals . however , the most often used rescue medication in this study was morphine whose factor 100 is universal . thus , the potential variations in the calculated rescue medications can be considered as marginal . second , the rescue medication was extracted from the records and summed over 24 hours from 12 am to 11:59 pm . because most of the fentanyl tts were administered at 2 pm , a shift is thinkable within the amount of rescue medication calculated over each 24 hours . however , this difference concerns only the first 14 hours and merges into the next interval . as a consequence small typing errors were corrected when the identification of the product was unequivocal ( eg , one fentanyl tts 50 g / hour was recorded as 50 fentanyl ttss ) or when the intention was unequivocal ( eg , the stop time was entered as an administration time ) . from the total 3,122 fentanyl tts administered to 739 patients , 27.9% were excluded because of missing data from a major field , mostly the strength . this might be due to time constraint on the wards or different interpretation of the entry fields in the database . guide the monitoring and the dosing of the administered pain medication and are performed routinely at st clara hospital . however , our aims were not to correlate the administered pain medication according to patients pain scores , and thus , we focused more on data sets related to our question of interest . finally , we did not scientifically determine the reasons for early change , such as comparison of residual content of patches or sequential blood levels . in summary in our study , control of severe cancer - induced pain was obtained by increasing dosages of fentanyl tts over consecutive applications and was accompanied by administration of constant doses of breakthrough medication , irrespective of replacement time according to best practice . thus , flares of pain after 48 hours seem to be the reason for early replacements of fentanyl tts . however , in the absence of any rationale reason ( physiological , pharmacological , or environmental ) , skin adhesion problems after 2 days may hamper delivery of the substance into the skin and thus induce subtherapeutic levels and breakthrough pain . this practical hypothesis for an early replacement of fentanyl tts needs to be confirmed in further studies .

vestibular evoked myogenic potentials ( vemps ) are mediated by the sacculocolic reflex arc , which initiates from the saccular macula and furthermore includes the inferior vestibular nerve , the lateral vestibular nucleus ( deiter 's nucleus ) , the vestibulospinal tract and the motor neurons of the contracted ipsilateral scm ( 1 , 2 ) . vemps , measured from the contracted sternocleidomastoid muscle ( scm ) , are inhibitory myogenic potentials that result from ipsilateral saccular stimulation by means of loud clicks or tone bursts . for determining right / left differences in the vemp results , there are several methods or parameters , such as comparisons of latency in early positive - negative p13-n23 component , peak - to - peak amplitude of the p13-n23 waveform complex , its interaural amplitude difference ratio ( iadr ) and threshold for the appearance of vemp waves according to sound intensity ( 1 , 3 ) . so far , many authors have reported some pathognomonic findings or results for the specific vestibular disorders . however , much more research remains to be done on the comparison of amplitude - related parameter . among aforementioned parameters , amplitude - related parameters change according to the degree of tonic contraction of ipsilateral scm . there is a direct correlation - the more tonic muscle tension , the larger the vemp amplitude response ( 1 , 3 , 4 ) . therefore , even normal subjects , whose saccular functions would be equal between right and left side , reveal right / left amplitude difference as well as wide ipsilateral test - retest variations . in order to quantify the right / left amplitude difference and normalize person - to - person variations , iadr can be presented as the degree of asymmetry in amplitude . however , there is a limitation to apply the value directly on clinical decisions because iadr shows a great deal of variations among even normal subjects . therefore , when collecting a vemp , we must have some way of controlling the amount of muscle tension between the right and left muscle . if not , the difference in the vemp amplitudes between both sides could simply be because one muscle is more tense or contracted than the other during the test . accordingly , it is difficult to interpret the vemp results and make normal range because the difference may come from lack of tonic muscle activity , not from real vestibular abnormality . ( 5 , 6 ) proposed a feedback method making use of a readily available blood pressure manometer with inflatable cuff to control scm contraction . when analyzing the relationship between the applied cuff pressures and vemp amplitude , they showed a linear relationship between them . they also used mean rectified voltage ( mrv ) which directly reflects the scm electromyograph ( emg ) , suggesting that the blood pressure manometer allow for a control of the scm contraction by means of the mrv measures and will result in a much better determination of left / right vemp amplitude asymmetries . since the degree of muscle contraction effects on the vemp result and its interpretation , the tonic emg activity that occurs immediately before each sound stimulation can be used for normalization for vemp results . this method , or with the combination of conventional feedback method , could make the result more reliable and objective . in this study emg rectification available bio - logic navigation pro was utilized for the vemp wave , amplitude and iadr . two different methods were employed for scm contraction in a normal subject -1 ) ' supine method ' , 2 ) ' blood pressure cuff method ' . the aim of this study is to evaluate and compare the effect of rectification in two conventional ways of scm contraction . twenty - two healthy subjects were included ( 11 men , 11 women ) ranging in age 24 to 36 ( average 27 yr ) . all subjects had normal hearing sensitivity ( pure tone air conduction hearing level measured at 0.5 , 1 , 2 , and 4 khz was < 20 db ) and no history of vestibular , neurologic disorders . the experiments were performed with an auditory evoked potential system , navigation pro , version 6.1.0 ( bio - logic system corp , mundelein , il , usa ) . the active electrodes were placed on the skin overlying the medial portion of the contracted scm muscle belly , the reference electrode on the upper part of the sternum and the ground electrode on the forehead . the responses were obtained from each side separately using tone bursts of 500 hz ( 95 db nhl , rise / fall time=1 msec , plateau time=2 msec , stimulation rate=5.1 hz ) , which were delivered unilaterally with insert earphones . the acoustically evoked vemp responses were amplified ( 1,000 ) , band - pass filtered ( 10 hz-1.5 khz ) , and averaged . the results of both runs were averaged , providing the final response from which the peak - to - peak amplitude ( p13-n23 ) was calculated . the vemp response was only considered as being reliable if the p13 and n23 peaks are reproducible in both runs . system obtained averaged waveform and user marks points ( p1 and n1 ) on it . for rectification , user chose prestimulus rectifcation ( psr ) function on selected waveform and averaged the absolute value of the prestimulus data during 20 msec . that value is divided into each of the 256 points along the collected vemp waveform . / left peak - to - peak amplitudes ( amp ) , iadr was calculated in both unrectified and rectified vemp waves . two different methods were applied : 1 ) the subjects lie flat on their back , lifting the head off the table and turning to the opposite side ( ' supine method ' ) . 2 ) the subjects have to flex the head approximately 30 degrees forward and rotate it approximately 30 degrees to the opposite side . while holding the cuff between right hand and jaw , the subject push with his or her head against the hand - held cuff to generate a cuff pressure of 40 mmhg ( ' bp cuff method ' ) ( 6 ) . statistical analysis was performed using spss 12.0 ( spss software , spss , chicago , il , usa ) . wicoxon signed ranks test was used for mean analysis and a significant level of 5% was adopted . twenty - two healthy subjects were included ( 11 men , 11 women ) ranging in age 24 to 36 ( average 27 yr ) . all subjects had normal hearing sensitivity ( pure tone air conduction hearing level measured at 0.5 , 1 , 2 , and 4 khz was < 20 db ) and no history of vestibular , neurologic disorders . the experiments were performed with an auditory evoked potential system , navigation pro , version 6.1.0 ( bio - logic system corp , mundelein , il , usa ) . the active electrodes were placed on the skin overlying the medial portion of the contracted scm muscle belly , the reference electrode on the upper part of the sternum and the ground electrode on the forehead . the responses were obtained from each side separately using tone bursts of 500 hz ( 95 db nhl , rise / fall time=1 msec , plateau time=2 msec , stimulation rate=5.1 hz ) , which were delivered unilaterally with insert earphones . the acoustically evoked vemp responses were amplified ( 1,000 ) , band - pass filtered ( 10 hz-1.5 khz ) , and averaged . the results of both runs were averaged , providing the final response from which the peak - to - peak amplitude ( p13-n23 ) was calculated . the vemp response was only considered as being reliable if the p13 and n23 peaks are reproducible in both runs . system obtained averaged waveform and user marks points ( p1 and n1 ) on it . for rectification , user chose prestimulus rectifcation ( psr ) function on selected waveform and averaged the absolute value of the prestimulus data during 20 msec . that value is divided into each of the 256 points along the collected vemp waveform . / left peak - to - peak amplitudes ( amp ) , iadr was calculated in both unrectified and rectified vemp waves . to contract the scm during the vemp test , two different methods were applied : 1 ) the subjects lie flat on their back , lifting the head off the table and turning to the opposite side ( ' supine method ' ) . 2 ) the subjects have to flex the head approximately 30 degrees forward and rotate it approximately 30 degrees to the opposite side . while holding the cuff between right hand and jaw , the subject push with his or her head against the hand - held cuff to generate a cuff pressure of 40 mmhg ( ' bp cuff method ' ) ( 6 ) . statistical analysis was performed using spss 12.0 ( spss software , spss , chicago , il , usa ) . wicoxon signed ranks test was used for mean analysis and a significant level of 5% was adopted . normal vemp responses with p13 and n23 waves were obtained in each healthy subject bilaterally in both ' supine method ' and ' bp cuff method ' . the collected vemp waves were also rectified and new corrected waves were obatained ( fig . 2 ) . the mean iadrs of unrectified and rectified vemp in ' supine method ' were 19.6 12.5 and 7.2 5.6 respectively , showing that the iadr of rectified vemp was significantly reduced ( p<0.001 ) . the mean iadrs of ' bp cuff method ' were 20.814.7 and 12.5 9.8 respectively and the iadr of rectified vemp was also significantly reduced ( p=0.013 ) . there was no statistical difference in unrectified iadr in both ' supine method ' and ' bp cuff method ' ( 19.6 vs. 20.8 , p=0.935 ) . the coincidence of amplitude - dominant side happened in 17 subjects ( 77% , right 9 , left 8) out of 22 between two different scm contraction methods . however , only five subjects ( 23% ) had the same direction after the rectification ( p=0.031 , fisher exact test ) ( fig . the rectified mean iadr of ' supine method ' ( 7.25.6 ) was less than the one of ' bp cuff method ' ( 12.59.8 ) , which , however , was not statistically significant ( p=0.053 ) ( fig . since the vemp amplitude is positively proportional to ipsilateral scm tonic contraction , it is important to make the contraction of the both sides equal and uniform . on this assumption , we can ensure that a difference in amplitude between the right and left vemps on a patient is because of vestibular abnormality , not because of the difference of tonic muscle activity due to patient fatigue or improper patient position . there are several methods to make the contraction equal , of which supine method and feedback method with bp cuff are conventionally used in many clinical setting . however , there still remains some asymmetry in both muscle activities because these methods are designed to make equal contractions only in a indirect way . this study showed significant decrease in asymmetry in normal subject with the direct use of pre - stimulus emg . the decrease of iadr was observed in both ' supine method ' and ' bp cuff method ' . the right / left difference in rectified vemp reflects a more amount of vestibular function difference than muscle contraction difference which usually originate from individual variation of muscle , patient fatigue or improper position . especially , individual variation of scm can not be ignored because the coincidence of dominant side in amplitude ( right vs. left ) happened in 17 subjects out of 22 ( 77% ) between two totally different scm contraction methods . this high coincidence rate indicates that people tend to have unilateral dominancy in scm contraction , which can be normalized by rectification . this explains that the result is not simply accidental , suggesting usefulness of rectification . in rectified vemp , asymmetry ratio obtained in supine method is lower than one in bp cuff method , even though it is not statistically significant ( 7.2 vs. 12.5 , p=0.053 ) . while the vemp without rectification , in other words , vemp not considering psr as a denominator , showed little difference in amplitude , however , vemp with rectification made the difference big . in addition to technical error in performing vemp test , following explanations can be suggested with care . this difference may result from right / left asymmetry of psr , which is used as a denominator in rectification function , meaning that asymmetry of psr is larger in ' bp cuff method ' than in ' supine method ' . the asymmetry of psr may be emphasized in ' bp cuff method ' because inadequate or uneven muscle recruitment due to low - power contraction can induce difference in pre - stimulus emg baselines . in addition , because the ' bp cuff method ' is carried out in sitting position and there is less compensatory surrounding muscle contraction , it enables only the scm to contract specifically . the vemp results from only the scm , which has more individual variation than any other muscles , might induce big right / left difference in psr . however , despite of the usefulness , rectification can only reduce the bias from the degree of muscle contraction . theoretically , in all kinds of scm contraction methods , iadr should be nearly zero in normal subject after rectification but it was not . it means that rectification can not eliminate muscle contraction bias and it also account for the inadequateness or limitation of rectification . more technical researches and development of standardized methods remain to be performed in the future . so far , there have been many studies dealing with otologic diseases in terms of latency of p13 , n23 or wave threshold . however , there have been few studies referring to amplitude difference or iadr for some specific otologic diseases . because those amplitude - related data have much variation according to individual , laboratory and scm contraction method , it is difficult to directly apply those amplitude - related values on clinical decisions . we compared the iadr using two conventional scm contraction methods , which are commonly used in many audiologic clinics . because the mean iadrs are not statistically different between two scm contraction methods , clinicians can choose a preferable method according to their clinics ' condition . in addition , if the rectification is employed on the top of those methods , further reduction of iadr would be observed . the lowest mean iadr could be obtained with the combination of both the supine method and rectification , which accounts for the clinical usefulness . of course , the ideal situation would be to actually measure the emg in real time and ask the patient to control the tonic muscle tension using bio - feedback . unfortunately , the tools to do this are not readily available in most audiology clinics . rectification is not real - time procedure since only the emg activity during each pre - stimulus time is averaged and divided into the collected vemp waveform . however , rectification method may be a good substitute for the real - time emg monitoring with ease on the following assumption - 1 ) the pre - stimulus baseline emg activity would not change after the sound stimulation and 2 ) the vemp amplitude has linear correlation with the baseline emg activity . even though it is difficult to decide whether this rectification is valid enough to determine vestibular disorders in terms of amplitude difference , this study would help clinicians make the normal range of iadr in each condition and decide some disease - specific findings using the rectification . in the study of normal subjects , rectified data showed more reduced and reliable iadr . it may help clinicians find some vestibular disorders according to amplitude - associated parameters without complicated diagnostic methods . in addition , the usage of rectification can be maximized with the proper scm contraction method .

in 36 bc marcus terentius varro , roman scholar , solider and prolific writer published his work entitled on agriculture wherein he counselled against locating homesteads next to swap land because ( in stagnant water ) there are bred certain minute creatures that can not be seen by the eyes , which float in the air and enter the body through the mouth and nose and there cause serious diseases . in the west , this idea fell out of favour with the decline of the roman empire and it was not until the 1673 that varro 's prediction of minute creatures was proven by the dutchman antonie van leeuwenhoek , whose pioneering work in microscopy made direct observation possible . leeuwenhoek 's letters were later published by the royal society in the journal philosophical transactions and are available as a web resource . the link between microscopic organisms and disease was later to be made by several authors . the hungarian obstetrician ignaz semmelweis noted the link between doctors who came into contact with puerperal fever and the deaths of subsequent patients from the same disease and advocated a hand washing regimen before and after patient contact . john snow traced the 1854 outbreak of cholera to contaminated water by analysing the outbreak geographically . french chemist louis pasteur provided evidence for the refutation of the miasma theory of disease by demonstrating decomposition in the absence of air . thus when , in 1867 , the 40-year - old joseph lister , professor of surgery at the university of glasgow published on the antiseptic principle in the practice of surgery in the british medical journal , the merits of the germ theory of disease were still being debated by the medical establishment . on his death some 45 years later , lister 's enduring legacy was to be known as the father of antisepsis , having translated the germ theory of disease into a near universally adopted system of preventative surgery ; an achievement for which he was awarded a barony , fellowship of the royal society and membership of the privy council . while it is for this reason that he is best remembered , lister 's researches focused on the interface between the experimental and the clinical and while his writings provide an illuminating insight into his many interests , the common thread running through his work ( and the remarkable clarity of vision behind it ) was the translational interface through which laboratory observation became meaningful clinical application . moreover , lister , like a number of his contemporaries , trialled a number of operations that are most certainly the domain of the plastic surgeon , including eyebrow reconstruction , cleft lip repair and skin grafting . as intimated in the 3 huxley lecture , delivered before the medical school of charing cross hospital on october 2nd , 1900 , lister 's interest in the germ theory of disease as it related to surgery probably stemmed from his investigation into the death of a little boy on whom he had operated for a suppurating infection of the elbow while a resident house surgeon . lister later summarised his theory in the opening passage of on the antiseptic principle thus : in the course of an extended investigation into the nature of inflammation and the healthy and morbid conditions of the blood in relation to it , i arrived at the conclusion that the cause of suppuration in wounds is decomposition brought about by the influence of the atmosphere upon blood or serum retained within them and in the case of contused wounds , upon portions of tissue destroyed by the violence of the injury . to prevent the occurrence of suppuration was an object manifestly desirable ; but till late apparently unobtainable , since it seemed hopeless to exclude the oxygen , which was universally regarded as the agent by which putrefaction was effected . pasteur that the septic property of the atmosphere depended on minute organisms suspended within it it occurred to me that decomposition of the injured part might be avoided without excluding the air , by applying as a dressing some material capable of destroying the life of the floating particles . lister advocated using carbolic or phenic acid ( a potent antibacterial and antifungal agent ) to kill contaminant flora and prevent further colonisation . in the paper entitled illustrations of the antiseptic system of treatment in surgery ( lancet 1867 ) lister advocated carbolic acid dressings for incised wounds , open or lacerated wounds left to heal by secondary intention and drained abscesses . he advocated either regular dressing changes or the addition of fresh carbolic acid to the dressings to ensure persistence of antisepsis . lister modified his approach for cavitating wounds by advocating the use of a space - occupying paste of carbolic acid , carbonate of lime and linseed oil . insightfully , he cautioned that the reparative powers of the tissues must be undisturbed . writing in the lancet 1875 lister abandoned the idea when he observed a rise in his infection rate . in an address to the glasgow medico - chirurgical society ( later published in the bmj 1868 ) lister suggested changing only the top layers of a dressing and leaving the bottom layer intact . in another example of lister 's perspicacity , he experimented with rudimentary nonadherent dressings to make dressing changes more comfortable . these concerns strike a chord with contemporary surgeons who manage complex wounds as the importance of wound dressings , and the interface between dressing material and wound bed is still an area of intense investigation and speculation . lister 's interest in preventing nosocomial infections led him to conclude that his antiseptic principles applied not only to theatre but to the wards as well . he highlighted the unhealthy atmosphere on hospital wards , suggesting that rather than a daily regimen of open windows ( practiced in order to release miasma ) , judicious hand washing and instrumental sterilisation should be enforced . recognising the role of haematoma in both infection and inflammation , lister advocated the use of a rudimentary drainage system to avoid collections of blood , pus or serous fluid . in reconstructive surgery , drains remain a ubiquitous means of preventing haematoma and serous fluid accumulation . it could be argued , from lister 's prodigious output on the subject , that inflammation remained lister 's primary scientific interest and that his interest in aseptic techniques stemmed for his pursuit of a means of moderating inflammation with the ensuing consequences of tissue necrosis and suppuration . in an address to the international medical congress of 1881 , lister cautioned that not all inflammation was due to the presence of bacteria and cautioned against the popular view that surgical debridement of all inflamed tissue was necessary or advantageous . he observed and documented changes in local capillary blood flow and permeability by the action of localised tissue insults such as mustard powder . writing in philosophical transactions lister presented the croonian lecture to the royal society on the coagulation of blood . if some of these inquiries appear curiously misguided , it is only because our current understanding of vascular physiology supports such authority in retrospect . that said , lister had observed that exposure of blood to foreign material resulted in clotting ( preceding formal description of the intrinsic cascade ) and consequently cultivated the idea that inflammation of the lining of a vessel resulted in coagulation of the blood within it . he reasoned that the vascular occlusion increased pressure through a capillary bed leading to the formation of liquor sanguinis that further compromised localised tissue perfusion . thus , lister linked inflammation with tissue perfusion . in an address to the harveian society of london in 1878 lister asserted that changes in blood vessel diameter as a result of position were not simply the result of hydrostatic principles but due to changes in the tension within the muscular vessel wall . he explained his theory thus . when a part has been deprived for a while of circulation , the want of the vital fluid creates in the tissues a demand for a supply of it , and that this demand operates on the vasomotor nervous apparatus of the limb as a stimulus inducing arterial relaxation . many years before a formal description of the regulatory systems on the coagulation cascade , lister , before an audience of the medical society of london , described his observations of the capillary bed , suggesting that a regulatory anti - coagulatory system existed . a meticulous observer , lister also advocated using a microscope , ( such as a compound microscope pioneered by his father , joseph jackson lister ) to examine pathological specimens . listers own scaled illustrations , published in the two - volume collected papers ( clarendon press ) in 1909 , reveal his exactitude . lister was to stress the need for accurate , scaled microscopic observations in his huxley lecture of 1900 . in the field of experimental surgery , lister was clearly interested in the reconstruction of form and function , leading him to design procedures for eyebrow reconstruction , cleft lip repair and skin grafting ( both split and full - thickness ) that he took from the inner arm . notably , he may also have performed the first radical mastectomy ( on his sister ) . he also described a method of closure of large open wounds by exploiting mechanical tissue creep . in the chapter entitled on amputation for holmes system of surgery , lister advised that all amputations should be covered with a muscle flap , thus cushioning the stump and preventing skin breakdown . in another chapter , lister recommended pulling the tongue forward to maintain the airway when using chloroform general anaesthesia . he also proposed that the last meal should be excluded to prevent troublesome vomiting during the inhalation . thus , lister published in the fields of physiology , pathology and clinical surgery and advanced the theory and practice of surgery in four key areas . these include the principle of antiseptic presurgical and surgical care , postsurgical wound management and ward practice ; recognition of the roles of inflammation and tissue perfusion on wound healing and surgical wound management ; microscopic analyses of specimens for pathological and microbiological diagnoses ; and elegant reconstructive stratagems to meet the expectation of survival following major surgery . lister refused to accept that suppuration , sepsis and death were the anticipated sequelae of invasive surgery . his approach improved patient safety and focussed on outcomes , with infection - free survival being lister 's surgical goal . these attitudes , controversial at the time , are nothing less than the founding principles on which modern surgery is based . thus , lister 's legacy is , in essence , a philosophical , as much as a practical one . by making surgical outcomes more predictable importantly , the advances in surgical standards attributable to antiseptic regimens such as those of lister and von bergmann not only include contemporary aseptic protocols but rather , as a consequence of these principles , diseases and injuries that were considered inoperable on account of certainty of suppuration have become survivable . lister was one such surgical pioneer , and the process gathered pace in the decades following acceptance of his antiseptic principles . for example , high energy lower limb trauma was ( until lister ) usually fatal . lister 's own experience highlighted an example of one such injury , and the patient survived because infection was prevented . today , complex reconstructive options , including three - dimensional external fixation , vascularised tissue reconstruction of the soft tissue envelope and bone transport techniques have been developed and are widely practiced in order to meet the expected goal of infection - free fracture union . contemporary surgical antisepsis includes a presurgical washing regimen , formal antiseptic surgical preparation , surgery using sterilised instruments , postoperative dressings and wound management systems ( including antibacterial dressings , drains and negative pressure wound therapy ) designed to modulate the postoperative inflammatory response , prevent haematoma collection and promote infection - free wound healing . the growth of the dressings industry , with dressings tailored to facilitate healing of wounds of different sizes , depths and aetiologies , resonates with lister 's attempts to develop antibacterial and nonadherent dressings . laminar flow theatre units have been developed to remove particulate debris from the atmosphere around the surgical site . given his writings on the subject , one feels that lister would have been amused by the politicisation of hand washing protocols and the observance of hygiene protocols . lister recognised that haematoma resulted in localised tissue inflammation and served as a nidus for infection . the only means that lister had at his disposal to prevent intra - operative bleeding and haematoma formation was drainage and surgical sutures , and indeed , lister experimented with catgut and silver thread in an attempt to find alternatives to the braided silk that he recognized to be associated with infective complications . while the development of contemporary suture materials can be traced , in part , to lister 's quest for a safe and biologically inert suture , so too can the development of techniques designed to minimise intra - operative bleeding , including electrocautery , liga - clips , and alginate packs . to minimise intra - operative blood loss and improve postoperative healing lister advocated techniques that are still in use today . in his address to the harveian society lister proposed exanguination by elevation , followed by the application of a tourniquet , to achieve a bloodless field in hand and wrist surgery ( a tourniquet had previously been used only for amputation ) . lister 's design for a hand and wrist splint achieves rest in the position of function , favoured today . lister 's reliance on microscopy has served as a template for contemporary surgical diagnostic practice . indeed , the integration of histology and microbiology as part of a multidisciplinary approach to surgical decision making is now considered an essential model for patient care . while lister did not have antibiotics at his disposal he nevertheless aimed to identify the micro - organisms responsible for infections on the basis of their microscopic appearance . the principle of empirical antibiotic use , which would not be introduced until the 1960 's , owes much to this approach . , when one reads lister 's papers , it is striking that of the many disparate topics that held his interest , antisepsis , inflammation and tissue perfusion , microbiology and reconstruction of form and function are threads that we , as plastic surgeons , may relate to . while most surgeons are likely to be aware of lister 's contribution to antisepsis , many may not be familiar with these additional interests . nonetheless , we must not forget that , by striving for infection - free survival as a surgical imperative , lister helped redefine surgical success and laid the foundations for the technical refinements and innovations to follow , including the evolution of new disciplines such as reconstructive and plastic surgery . with the advent of multi - drug resistance , the antiseptic principle in the practice of surgery promises to remain conceptually relevant today as it was in lister 's time . arguably , the most important lesson that a surgeon - scientist can learn by examining lister 's work is to challenge surgical dogma , resist skepticism and hostility to change , reflect on the translational implications of one 's research output and , ultimately , to enhance patient experience .

trwa poszukiwanie materiau , ktry bdzie cechowa si optymalnymi waciwociami chirurgicznymi , ograniczy krwawienia rdoperacyjne oraz powstawanie ponownych zwe , zwapnie i pseudottniakw w okresie odlegym . wstpna ocena wykorzystania aty osierdziowej cardiocel u pacjentw pediatrycznych poddanych korekcji wrodzonej wady serca wymagajcej zastosowania implantu do poszerzenia operowanych struktur . badaniem objto 8 pacjentw , ktrzy zostali poddani korekcji wrodzonej wady serca od stycznia 2015 do lutego 2016 r. at wykorzystano do plastyki zwenia nadzastawkowego aorty , plastyki uku aorty oraz ttnic pucnych . . rdoperacyjnie stwierdzono zadowalajc wytrzymao oraz elastyczno nowego materiau , co umoliwiao jego optymalne dopasowanie do tkanek natywnych . podczas wstpnych obserwacji nie stwierdzono ttniakw , pogrubienia aty oraz procesu kalcyfikacji w miejscach wszycia implantu u wszystkich pacjentw . pericardial patches made from animal tissue have a wide range of applications in various fields of surgery including vascular and general surgery , urology , and cardiac surgery . some noteworthy applications of pericardial patches in cardiac surgery include the reconstruction of the aorta and pulmonary vessels , closure of interatrial defects , closure of interventricular defects , and reconstruction of atrioventricular valves [ 13 ] . their advantages include the ease with which they can be obtained and used as well as the fact that they are associated with less intraoperative bleeding from the suture line in comparison with artificial materials [ 1 , 4 , 5 ] . the disadvantages include the development of secondary stenosis at the suture site ( resulting from fibrosis and calcification ) , the possibility of aneurysm development , and , often , high prices of the products . many implants are available on the market : biointegral pericardial patches , the bovine collagen membrane tutopatch , and the equine pericardial patch from edwards lifesciences . one of the newest products on the market is the bovine pericardial patch cardiocel , distinguished from the other available products by the fact that glutaraldehyde is not used during its processing . the aim of this report is to provide preliminary analysis of the effects of the cardiocel pericardial patch in pediatric patients undergoing congenital heart defect correction requiring the use of the implant . the study included 8 patients who underwent repair of congenital heart defects under extracorporeal circulation and were implanted with cardiocel pericardial patches during the period between january 2015 and february 2016 . the patients underwent three types of procedures : aortic arch reconstruction , repair of supravalvular aortic stenosis , and pulmonary artery reconstruction . the demographic details of the patients and the types of procedures are presented in table i. characteristics of patients , types of procedures , and application of pericardial patches haa hypoplastic aortic arch , vsd ventricular septal defect , pab pulmonary artery banding , lpa left pulmonary artery , rpa right pulmonary artery , tv tricuspid valve , as aortic stenosis , tof tetralogy of fallot , avsd atrioventricular septal defect , ps pulmonary stenosis , lsca left subclavian artery the study employed data originating from the patients medical records , operative protocols , and the local hospital database , as well as results of echocardiography , angiography , and computed tomography ( angio - ct ) . intraoperatively , the patch required no further preparation . after being taken out of the container , it was ready to be used . its mechanical endurance was found to be satisfactory : the sutures held without rupturing the graft , and the implant 's elasticity facilitated optimal adaptation of the patch to the native tissue . perioperatively , there were no clinical or laboratory signs of infection that could be associated with the patch implantation . intraoperatively , the patch required no further preparation . after being taken out of the container , it was ready to be used . its mechanical endurance was found to be satisfactory : the sutures held without rupturing the graft , and the implant 's elasticity facilitated optimal adaptation of the patch to the native tissue . perioperatively , there were no clinical or laboratory signs of infection that could be associated with the patch implantation . there was no in - hospital mortality ; all the patients included in the study were alive at the conclusion of the follow - up . the length of hospital stay ranged from 8 to 58 days ( median : 15 days ) . the observed complications included : pneumonia in 2 patients , vocal cord paralysis in 2 patients , and paralysis of the left diaphragmatic dome in 1 patient ( which necessitated a plication procedure during the same hospitalization ) . the postoperative follow - up lasted from 14 to 219 days ( median : 58 days ) . during this time , no aneurysms , patch thickening , or calcification at the suture site occurred in any of the patients . there were no clinical or laboratory signs of infection that could be associated with the patch implantation . in 2 patients , stenosis was observed at the suture site . in the patient with aortic arch hypoplasia , atrioventricular septal defect , and down 's syndrome , the stenosis at the suture site was observed from the first days after the procedure performed to widen the aortic arch . follow - up transthoracic echocardiography revealed no signs of coarctation at the suture site ; the mean flow velocity in the aortic arch was 3.0 m / s , and the flow in the abdominal aorta corresponded with the arterial flow . in the patient who underwent repair of supravalvular stenosis of the ascending aorta and reconstruction of the pulmonary trunk and right pulmonary artery , increasing stenosis is observed at both suture sites ( mvf 4.5 m / s in the ascending aorta and mvf 3.3 m / s in the pulmonary vessels ) . no significant clinical consequences of the stenosis were observed in either of the patients ; both remain under out - patient observation . the use of bovine pericardium has many applications in both adult and pediatric cardiac surgery [ 14 ] . many cardiac surgeons use it , appreciating the wide selection of implants and their potential advantages . currently , a search is ongoing for a material that will have optimal surgical properties and will limit the occurrence of complications such as secondary stenosis , intraoperative bleeding , infections at the suture site , and aneurysm development [ 57 ] . this report presents preliminary experiences with the use of a next - generation acellular bovine pericardial patch , the patch can be used for intracardiac defect corrections , atrioventricular valve reconstruction , or vascular repair . . demonstrated satisfactory results of using the patch for correcting intracardiac defects and performing vascular reconstruction in a group of 30 children . favorable properties of the patch as a potential material for valve reconstructions have been demonstrated in an animal model . were the first to report the use of cardiocel for reconstructing the aortic valve in 3 pediatric patients , with good results . the abovementioned reports present successful preliminary results , but are limited by small sample sizes and short follow - up periods . in our material , the patch was employed to reconstruct the aorta and pulmonary arteries . the use of the patch was associated with positive results according to the preliminary observations made at our center ; however , precise analysis requires studies on larger patient samples and with longer periods of follow - up .

due to both scientific and technological interest , the metal / semiconductor ( m / s ) interfaces have attracted much attention in order to further advance semiconductor devices and technologies . the current success of the micro- and nano - electronics is made possible by the improvements in the controlled growth of thin layers of semiconductors , metals and dielectrics . the further development of micro- and nano - electronic device technology requires detailed knowledge of the m / s contact formation and thus places new demands on the m / s interfaces . the development of smaller and more complex devices is based on the ability to control these structures down to the atomic level . in this sense , the understanding of the dynamical processes and the local stability of atomic structures on semiconductor surfaces have a significant importance . among these m / s interfaces , ag / si interface has been extensively investigated due to the important applications of si in the field of semiconductor technology . moreover , ( 1 ) thin ag film can be used as a model system in the study of two - dimensional ( 2d ) electrical transport phenomena ; ( 2 ) the ag / si system is an example of an abrupt interface with very limited interdiffusion of the two elements and is thus a prototypical nonreactive system ; and ( 3 ) the ag / si interface is widely used for contacts and metallization of electronic devices [ 1 - 3 ] . there is a wide range of si(111 ) reconstruction surfaces , such as 1 1 , 2 2 , 5 5 and 7 7 as well . because of the high stability and large unit cell , the adsorption of various metal atoms on si(111)-7 7 surfaces has been extensively studied , for example au , ge , pd , cu , co , in , and zn . diverse surface science techniques have been applied to study these interfaces , e.g. , scanning tunnelling microscopy [ 12 - 15 ] , electron energy loss spectroscopy , infrared reflecting adsorption spectroscopy , photoelectron emission spectroscopy and temperature - programmed desorption . in order to better understand the physical properties of the ag / si interfaces , first - principles calculations have also been employed to study these systems . the changes in the atomic and electronic structures of the si(111)-3 3-ag surface , ag nanocluster formation on the h - terminated si(111)-1 1 surfaces and diffusion of ag on the h - terminated si(111)-1 1 and clear si(111)-1 1 surfaces have been studied experimentally and theoretically [ 20 - 25 ] . in present work , we take ag as an example to investigate the influences of h on the adsorption of metal on the si(111)-7 7 surface using first - principles calculations . when h interacts with si surface - dangling bonds , this will cause the relaxation of the surface bond strain and reduce the surface free energy . the pre - adsorption of h on si(111)- 7 7 will alter the growth mode and morphology of the metal overlayers on the surface [ 28 - 30 ] . it is expected that ideal h - terminated si single crystal surfaces are generally considered rather unreactive , which will lead to the different surface kinetics and energetics between clean and h - terminated si(111)-7 7 surface . first - principles calculations within the framework of density functional theory ( dft ) were applied to study the influences of h on the adsorption of ag on the si(111)-7 7 surface using the vienna ab initio simulation package ( vasp ) . ab initio density functional calculations of surfaces and interfaces play a critical role in providing a nanoscopic understanding of the chemical bonding in these systems in the determination of the atomic geometry and electronic structure . a plane - wave method with the vanderbilt ultrasoft pseudopotentials was used within the spin - independent generalized gradient approximation ( gga ) for the exchange - correlation energy . the plane - wave cutoff energy was 200 ev , and the surface brillouin zone was sampled at the point for the total energy calculations and geometry optimizations . the si(111)-7 7 and 19h - si(111)-7 7 substrate structures were built based on the dimer - adatom - stacking fault ( das ) model . on the 19h - si surface , the 19 si surface dangling bonds ( dbs ) per unit cell are saturated by h atoms , corresponding to 12 adatoms , six rest atoms and a corner hole of the das . 1 . the unit cell contains a slab of five si layers ( 200 si atoms ) and a ~12 vacuum layer . the bottom of the slab has a bulk - like structure with each si atom saturated by an h atom . all atoms except for the h and si atoms at the bottom were fully relaxed to optimize the surface total energy . in this work , the faulted half unit cell ( fhuc ) was deliberately selected for study because there is little difference in electronic properties between fhuc and unfaulted half unit cell ( uhuc ) on the si(111)-7 7 surface . a the top and side views of dimmer - adatom - stacking ( das ) fault si(111)-7 7 structure . the blue balls are the si adatoms , and the pink balls are the si rest atoms . the positions of h3 , b2 and s sites are indicated in the top view within a basin , b the top view of 19h - si(111)-7 7 model surface . to understand the influences of h on the ag adsorption at a si(111)-7 7 surface , we first calculate the adsorption energies of ag atom at the high coordination sites on the clear and 19h - si(111)-7 7 surfaces , because all the previous data have confirmed that the high coordination sites on the si surface are the most favorable adsorption sites for different metal atoms ( including ag ) . on account of the symmetry of the three equivalent basins in a fhuc , only the adsorption energies at three different high coordination si surface sites ( h3 , b2 and s ) on a basin were considered . we derived the adsorption energies from calculating the total energy of the system including full relaxation of all si atoms and h atoms ( except for the bottom hydrogenated si atoms ) and the ag adatom . the adsorption energies ( ead ) are defined as , where esys is the system energy combining the bonding energy of the ag adatom on the surface and the surface relaxation energy ; esur is the energy of either si(111)-7 7 or 19h - si(111)-7 7 surfaces , which is 1,197.073 or 1,278.822 ev , respectively ; eatom is the binding energy of one bulk ag atom , i.e the calculation results show that the most stable site for a single ag atom adsorption is the s site for clear si surface , and h3 site for the 19h - si(111)-7 7 surface . the adsorption energies for ag atom at the h3 , b2 and s places on different surfaces are listed in table 1 . 1 , the s site is almost at the middle between the h3 and b2 sites . the system energy ( esys ) and adsorption energy ( ead ) of a single ag atom adsorption on different high coordination sites ( h3 , b2 and s ) at si(111)-7 7 and 19h - si(111)-7 7 surfaces the h3 , b2 and s sites are indicated in fig . 1 the change of the adsorption site of ag atom because of the pre - adsorption of h on si(111)-7 7 may be due to the reconstruction of si surface electronic structures induced by h. to depict the charge redistribution associated with the h adsorption on si(111)-7 7 surface in real space , we first calculate the difference charge density after h saturating the 19 surface dbs on the si(111)-7 7 substrate by subtracting the charge densities of the separate si substrate and h atoms from that of 19h - si(111)-7 7 . to verify the differences , the charge densities of the clean si substrate , 19h - si(111)- 7 7 and isolated h atoms are calculated with the same lattice parameters and atomic positions as the relaxed ag adsorbed 19h - si(111)-7 7 surface . this allows the charge densities to be easily subtracted point by point in the real space , even for ag adsorbed surfaces . figure 2 presents the calculated total valence charge density plots of ( a ) clean si substrate , ( b ) isolated h atoms , ( c ) h - terminated si surface in fhuc , and ( d ) the difference charge density plot . 2a , 2b from 2c in the plan determined by h atoms , si adatom and the rest atom in fhuc along the solid line shown in fig . 1b . in fig . 2d , the positive contours ( solid lines ) represent the charge accumulation , whereas the negative contours ( dashed lines ) represent the charge depletion . the charge density depletes around the h atom and transfer toward the si adatom when the h sits on the si adatom . there is a strong covalent bond between the h and the si rest atom when the h locates on the si rest atom . these results indicate that due to the strong charge transfer from adsorbed h to the si adatom , a local positive surface dipole will then form at the si adatom ( h - si ) . this means that h adsorbed on si adatom has different electronic properties from one adsorbed on the si rest atom . the calculations also show that the surface atomic charge distribution is much more uniform once all 19 surface dbs have been saturated by h , which is consistent with the previous results reported by stauffer and minot . the more uniformity of the surface charge distribution may decrease the ag diffusion barrier on h - terminated si(111 ) surface . calculated total valence charge density plots of a clean si substrate , b isolated h atoms , c9h - si(111)-7 7 and d the difference charge density plot by subtracting fig . the area is 11.5 8 ; the contours interval is 0.1e for fig . positive contours are shown as solid lines , negative contours as dashed lines and zero contours have been omitted . a is for si adatom and r for si rest atom , respectively by using the same calculation methods , we also obtain the charge distribution associated with the most stable adsorption of ag at h3 sites on 19h - si(111)-7 7 surface ( in fig . 3 ) and the h3 and s sites on si(111)-7 7 surface ( in fig . 4 ) . figure 3 shows the total valence charge density plots of ( a ) the ag reacted 19h - si(111)-7 7 surface with ag at the h3 site in fhuc , ( b ) isolated ag atom , and ( c ) the difference charge density plot . the plot in fig . 3a in the plan determined by h atoms , absorbed ag atom , si corner adatom and the rest atom . figure 3c reveals that the charge depletion and accumulation mainly occur between the ag atom and near h atoms , but no obvious charge difference happens around the close si atoms . this suggests that after the h passivation , the direct interaction between ag and si atoms becomes weak . however , it is interesting to note that the obvious charge accumulation takes place around the third si atom bonding with ag at the second layer ( not in the plane of fig . 3c ) , which has not been adsorbed by h. the charge around the h atom at the si adatom removes toward the adsorbed ag atom and forms a covalent - like ag - h bond . due to the charge transfer from the h to the si adatom on the 19h - si(111)-7 7 surface , the h atom is expected to be positively charged . when ag adsorbs on the surface , charges are much easier to transfer from ag to this h and form strong covalent bonds . no strong bonding was found between ag and the h at the si rest atom . calculated total valence charge density plots of : a ag reacted 19h - si(111)-7 7 surface with ag at the h3 site , the area is 11.5 8 , the contours interval is 0.1e for fig . 3c the calculated total valence charge density plots of a ag reacted si(111)-7 7 surface with ag at the h3 site , b isolated ag atom , c the difference charge density plot by subtracting figs . 2a and 4b from fig . 4a , and 4d the difference charge density plot with ag at the s site on si(111)-7 7 . the area is 11.5 8 , and the contours interval is 0.1e for fig . 4a and 4b , and 0.02e for fig . 4c and 4d figure 4 shows the calculated total valence charge density plots of ( a ) ag reacted si(111)-7 7 surface with ag at the h3 site in fhuc , ( b ) isolated ag atom , ( c ) the difference charge density plot which is obtained by subtracting figs . 2a and 4b from fig . 4a and 4(d ) the difference charge density plot with ag adsorption at s sites . without the h atoms on the si surface , we observe that the charge accumulates around the ag atom , and strongly depletes around the si adatom , rest atom and the third adjacent si atom at the second layer ( not in the plane ) when ag adsorbs at h3 sites on si(111)-7 7 ( see in fig . si bonds caused by nearly absolute charge diversion are considered as an electrovalent - like bond . however , when ag adsorbs on the most stable site ( s ) , the charge depletes around ag atom and transfer toward the si rest atom and the si atom at the second layer . it is surprising to find that there is no influence on the charge density around the si adatom ( see in fig . predicted from their principles calculations of a clean si(111)-7 7 surface that nucleophilic species ( e.g. , ag ) , relative to a si atom , should react with si - dangling bonds in the order of adatoms , corner holes , and rest atoms . , one can see that the adsorption behaviors of ag atom on the si(111)-7 7 and 19h - si(111)-7 7 surfaces are quite different . after passivating the si surface by h atoms , the adsorbed ag will form covalent bonds with h atoms at the si adatom , and consequently , the interaction between the ag and the si atoms become much weaker . jeong et al . have calculated the diffusion barriers for ag atom inside the hucs on the si(111 ) and h - terminated si(111 ) surfaces , which are 0.14 and 0.27 ev , respectively . the smaller diffusion barrier for ag atom on the h - terminated si surface is probably due to the uniformity of the surface atomic charge distribution because of the saturation of the surface si dbs by h atoms . they further concluded that due to the lower diffusion barrier , three dimension ag islands would be easily grown on the h - terminated si(111 ) surface because all the si dangling bonds are saturated by h atoms . the adsorption of a single ag atom on clear si(111)-7 7 and 19h - si(111)-7 7 surfaces was investigated using first - principles calculations . the results indicated that the adsorption of h atoms at dbs on si(111)-7 7 surface will uniform the surface charge distribution and consequently alter the surface electronic structures . a local surface positive dipole ( h - si ) may form due to the strong charge transfer from h to the si adatom . when ag adsorbs at h3 site on the 19h - si(111)-7 7 surface , a strong covalent bond with the h at the si adatom was found . the present results provide a theoretic framework for the understanding of the ag bonding properties on si(111 ) and h - terminated si(111 ) surfaces . this work was financially supported by national natural science foundation of china ( 20603028 ) .

onchocerciasis , or river blindness , has plagued over 37 million people worldwide , occurring mostly in the sub - saharan africa , yemen , and isolated areas of central and south america . the culprit for the infection is the filarial nematode onchocerca volvulus , which is transmitted to humans through bites of infected blackflies of the genus simulium . initial pathological manifestations of the disease include inflammation of the skin and eyes caused by dead or dying microfilariae that eventually results to skin lesions and blindness . currently , the antiparasitic agent ivermectin is the only drug available for mass treatment . while the drug has proven to be effective in reducing morbidity by killing the microfilariae , it does not target the adult worms and thus does not completely eliminate parasite transmission and infection . additionally , the emergence of ivermectin - resistant o. volvulus(5,6 ) further necessitates the need to develop therapeutic strategies for the treatment of onchocerchiasis . the shedding of the l3 cuticle during ecdysis and the proteolytic remodeling of the new l4 cuticle is particularly important for the transition between hosts and infection process of the parasitic nematode . chitinases act in concert with chitin synthases to facilitate chitin metabolism , a significant process for nematode development . chitinases have been implicated in remodeling processes during filarial molting and egg hatching . in the rodent filarial nematode acanthocheilonema viteae , rna interference studies targeting the chitinase gene significantly inhibited the molting of l3 worms . a chitinase from o. volvulus , ovcht1 , was recently identified and found to be solely expressed within the glandular esophagus of the infective l3 larvae and is secreted during postinfective development . ovcht1 was hypothesized to play roles in molting and parasite transmission and , as such , presents a potential target for pharmacological intervention . from our previous screening efforts , we had disclosed a known veterinary anthelmintic drug , closantel ( 1 ) , which exhibits potent and selective inhibition toward ovcht1 ( ic50 = 1.60 0.08 m , ki = 0.47 0.08 m ) . as closantel is a known uncoupler of oxidative phosphorylation , our recent findings implicated a potential bimodal action of the drug . furthermore , closantel was shown to inhibit the molting of o. volvulus l3 to l4 larvae at 100 m ; however , this profound effect on filarial molting was unclear as to whether it was due to inhibition of ovcht1 or uncoupling of mitochondrial activity . retro - fragment-based approach was conducted to unravel the molecular frameworks that are required for closantel s chitinase inhibitory activity , in which compound 2 was identified as the relevant structural fragment with a comparable potency as that of closantel ( ic50 = 5.8 0.3 m ) . in this study , we constructed a series of closantel analogues to deduce the molecular features that are critical for chitinase inhibition and mitochondrial - uncoupling activity . because the 3,5-diiodosalicylate moiety is key to closantel s binding specificity by anchoring it within the ovcht1 active site , we retained this fragment and focused on scaffold expansion of 2 to generate analogues 3 , 4 , and 5 ( which were easily accessed through amide coupling of carboxylic acids 6 and amine reactants , figure 1 ) . simple structural modifications led to the identification of more potent compounds with dual modes of action ( as an ovcht1 inhibitor and a protonophore ) as well as analogues acting as chitinase inhibitors only . we also demonstrate that while either ovcht1 inhibition or mitochondrial uncoupling was effective in abrogating the l3-to - l4 molt , synergistic activities incorporated into a single molecule afforded a more profound impact on molting . the presence of additional ( phenolic and amide ) protons in closantel may be key for its dual mode of action . for instance , the hydrogen - bonding moieties may be important to affect the required acidic residues of the chitinase catalytic site . to elucidate the relevance of these protons , we initially prepared a simplified version of closantel using a phenoxyphenyl scaffold ( compound 3a ) and its analogues containing methyl substituents in place of the key hydrogens ( compounds 3b d ) . as shown in table 1 , compounds 3a , 3b , and 3c have comparable chitinase inhibitory profile as closantel , indicating that the phenolic or amide proton is not necessary for chitinase inhibition . however , simultaneous substitution of both hydrogens with methyl groups ( as in the case of compound 3d ) resulted to a 2-fold decrease in potency . exclusion of the hydroxyl moiety ( compound 3e ) led to a slight increase in inhibitory activity with an ic50 value of 1.06 0.08 m . in an effort to increase the potency against ovcht1 , we constructed a series of derivatives based on compound 3a . from table 1 , it is evident that introduction of the chloro substituent at the para - position of the terminal phenyl ring ( compound 3h ) enhanced the potency almost 3-fold relative to 3a . the similar ic50 values of compounds 3i , 3j , and 3h further confirmed that neither the phenolic proton nor the hydroxyl functionality is important for chitinase inhibition . inclusion of a chloro - substituent in the middle phenyl ring ( compound 3 m , also known as rafoxanide and a known veterinary anthelmintic drug ) further improved the potency with an ic50 value of 0.34 0.03 m and a competitive inhibitory constant ( ki ) of 0.13 0.01 m . we then prepared naphthyl analogues 4a c and biphenyl compounds 5a c in an attempt to establish favorable -stacking and van der waals interaction with the hydrophobic residues within the chitinase active site to optimize ovcht1 inhibition . biphenyl scaffolds have been previously considered as privileged substructures that preferentially interact with diverse proteins . interestingly , we did observe enhanced potency with the biaryl compounds 4 and 5 , with ic50 values for ovcht1 inhibition as low as 0.37 0.03 m ( for compound 5c ) . select compounds that exhibited good potency against ovcht1 were also evaluated for inhibition of chitinases from other species . compounds 3h , 3i , 3j , 3 m , 5a , and 5c ( each at a final concentration of 10 m ) showed complete inhibition of ovcht1 ( see figure s1 in the supporting information ) while sparing other chitinases including those from another filarial nematode brugia malayi ( bmcht1 ) and protozoans entamoeba histolytica ( ehcht1 ) and plasmodium falciparum ( pfcht1 ) . these results indicate that the analogues are highly ovcht1-specific and thus are amenable for evaluation in chitinase - specific diseases such as onchocerciasis . to examine mitochondrial - uncoupling activity , compounds 15 were tested using tetramethylrhodamine ethyl ester ( tmre ) , a positively charged , mitochondrion - selective dye that serves as a membrane potential sensor . in the presence of a protonophore ( e.g. , carbonyl cyanide m - chlorophenyl hydrazone or cccp ) , the mitochondrion gets depolarized and thus fails to sequester tmre , resulting in decreased fluorescence intensity . a microplate fluorescence assay was developed to monitor mitochondrial uncoupling of hek-293t/17 cells in the presence of the inhibitors . following incubation with the inhibitors at 37 c , the cells were stained with tmre and subsequently analyzed by fluorescence spectrometry . as depicted in figure 2 , a dissociable proton ( i.e. , phenolic hydrogen as in 1 , 3a , 3h , and 4a ) for the salicylanilide class of compounds is critical for mitochondrial - uncoupling activity . as expected , removal of the hydroxyl moiety ( as in compounds 3e , 3j , and 4c ) or masking it with a methyl group ( compounds 3b , 3i , 3d , and 4b ) resulted to a loss of uncoupling activity . we note , however , that the amide proton is equally significant , as substituting it with a methyl group while retaining the hydroxyl moiety ( like in the case of compound 3c ) eradicated protonophoric activity . results of mitochondrial - uncoupling activity for the other compounds listed in table 1 are given in supporting information figure s2 . separate experiments using flow cytometry to analyze membrane polarization were also conducted and the results ( see figure s3 in the supporting information ) were in agreement to those obtained from the microplate fluorescence assay . hek 293t/17 cells were incubated with compound ( 50 m ) and subsequently stained with tmre . unstained cells ( no tmre ) and dmso were used as negative ( ) and positive ( + ) controls , respectively . rfu = relative fluorescence units ( ex = 488 nm , em = 575 nm ) . from the series of derivatives listed in table 1 , we have identified more potent analogues with dual biochemical roles ( both as a chitinase inhibitor and a proton ionophore ) as well as compounds with chitinase inhibitory activity only . compounds 3 m proved to be the most potent ovcht1 inhibitor with good mitochondrial - uncoupling activity , while compounds 3i , 3j , and 4b displayed similar chitinase inhibition profile but devoid of protonophoric activity . in general , nematodes are resistant to perturbation of small molecules due to the thick cuticles that line their exteriors and oral and rectal cavities . the highly insoluble cuticle of o. volvulus is a collagenous framework of proteins that are cross - linked by disulfide bridges . as the bioaccumulation of a drug is correlated to its bioactivity , we deemed it important to investigate the penetrability of the compounds in the nematode . the limited availability of o. volvulus , however , prompted us to consider an alternative model organism , the soil nematode caenorhabditis elegans . the cuticle of adult c. elegans is composed of multiple layers of collagenous extracellular structures and thus resemble the physical barriers of other nematodes . in fact , due to its easy culturability and rapid life cycle , it was previously used as a model system of bioaccumulation to identify small bioactive molecules . using a similar approach to address nematode permeability , we initially incubated late - stage l4 worms with compounds 1 , 3h , 3i , 3j , 3 m , 4a , 4b , 5a , 5c , and cccp ( each at 10 m final concentration , and equivalent to 2 nmol / mg worm ) for 6 h. by lc - ms analysis of worm homogenates , we determined that all the aforementioned compounds accumulated in c. elegans . c. elegans is also equipped with enzymatic xenobiotic defenses that add to its resistance to exogenous pharmacologicals . similar to what was observed in cattle and sheep , the primary , albeit minor , metabolic pathway of closantel in c. elegans is reductive deiodination , resulting in the formation of two monoiodoclosantel isomers ( see figure s4 in the supporting information ) . sulfation , glycosylation , and glucuronidation of the salicylate moiety of closantel were not observed in c. elegans homogenates . we add that no effect on the viability of the l4 worms was observed upon incubation with the compounds . we then set out to quantify the concentration of representative compounds in the nematode after 6 and 12 h of incubation . as indicated in figure 3 , compound 3 m displayed excellent bioaccumulation in c. elegans , with worm levels of 1.55 0.37 and 1.73 0.11 nmol / mg at 6 and 12 h , respectively , which were > 75% of the initial dose of the compound to worms . the concentrations of the naphthyl analogues 4a and 4b were a little less than 50% of the dose at 6 h , and increased to 1.13 0.14 and 1.28 0.08 nmol / mg , respectively , after 12 h. the inability to accumulate at adequate concentrations within the worm can render the compound ineffective no matter how potent it is against the target in vitro . in a survey of over 1000 drug - like small molecules , only less than 10% were shown to penetrate c. elegans at concentrations > 50% of the initial doses . thus , the findings that we observed for the closantel analogues are encouraging because they readily accumulate within the nematode at high levels . we surmise that these compounds also accumulate in the filarial nematode o. volvulus and thus increase the likelihood of interaction with the target protein ovcht1 . late - stage l4 worms were incubated with 10 m inhibitor ( equivalent to 2 nmol / mg worm ) for 6 and 12 h. data shown as mean concentration sd ( n = 3 ) , expressed in nmol / mg worm . the target protein ovcht1 is expressed predominantly in the infective l3 larvae and may be critical in the molting and development of the nematode . filarial molting of o. volvulus l3 larvae is typically assayed by incubation of the larvae in complete growth medium in the presence of peripheral blood mononuclear cells ( pbmcs ) . to evaluate the efficacy of the inhibitors based solely on their inhibitory properties , the l3 larvae were initially incubated with select compounds ( 10 m ) for 24 h ( to allow sufficient time for accumulation ) prior to addition of the growth medium and pbmcs and monitored until day 6 when molting was assessed . under this assay condition , compounds 3h , 3 m , and 4a ( all have dual protonophoric and chitinase inhibitory activities ) completely abolished molting at 10 m , as indicated in figure 4a . significant effects on molting ( up to 84% inhibition ) were also observed at a lower concentration of 1 m for compounds 3h , 3 m , and 4a ( figure 4b ) . of note , no considerable effect on cell viability was observed when hek 293t/17 cells were treated with 1 and 10 m of 3h , 3 m , or 4a , for 24 h ( see figure s5 in the supporting information ) . treatment of l3 larvae with compound 6b ( neither an ovcht1 inhibitor nor a protonophore ) , showed no inhibition on molting ( figure 4a ) . to ascertain which activity is relevant for inhibition , we also evaluated compounds 3i and 4b ( chitinase inhibitors only ) and cccp ( a protonophore only ) for their impact on l3 molting . compounds 3i and 4b have differing effects ; while 4b inhibited molting at 10 m , only marginal inhibition was observed with 3i at the same inhibitor concentration ( figure 4a ) . the difference in efficacy between the two compounds at 10 m could not be readily explained as both display similar ic50 values against ovcht1 ; however , compound 4b could be accumulating within o. volvulus at higher levels , as was observed in the c. elegans model ( vide supra ) , which might account for its better activity . at a higher concentration of 100 m , compound 3i cccp also fully inhibited the molting of l3 larvae at 10 m , suggesting that mitochondrial - uncoupling , by itself , affects this developmental process . many of the proteins that are necessary for o. volvulus l3 molting are stored within the granules of the esophageal glands . mitochondrial - uncoupling in the glandular esophagus may , therefore , affect the synthesis of key proteins ( including ovcht1 ) that are essential for larval development . at a final concentration of 1 m , both 4b and cccp did not show any impact on molting ( figure 4b ) . as both chitinase inhibitory and protonophoric activities are likely required for more potent inhibition , we investigated the effect of incubating l3 larvae with a 1:1 mixture of 4b and cccp . whereas 3h , 3 m , and 4a were effective at 1 m , no effect on molting was observed using a combination of 4b + cccp at 0.5 or 1 m of each compound ( figure 4c ) . treatment with 2.5 m each of 4b and cccp was sufficient to completely suppress the l3-to - l4 molt . molting of o. volvulus l3 larvae in the presence of inhibitors . percent molting at ( a ) 10 m and ( b ) 1 m inhibitor concentration , and ( c ) in the presence of 1:1 combination of 4b and cccp each at concentrations shown . data presented as percent molting in a total of 10 wells containing on average 510 larvae per well . combination therapy , the simultaneous use of two or more drugs with distinct modes of action and biological targets , has been exploited as a treatment modality in several diseases including hiv , metastatic melanoma , second - stage trypanosoma brucie gambiense sleeping sickness , and malaria . despite its efficacy in improving response to medication and minimizing drug resistance , combination therapy is resource - intensive , complicated to administer , and prone to drug the utility of combi - molecules or single agents with polypharmacological targets has emerged as an alternative strategy , displaying the same advantages while bypassing the drawbacks of drug combinations . the combi - targeting concept is a growing field of interest in the search for therapies against cancer and infectious diseases . this dual inhibition approach is well exemplified by compounds 3h , 3 m , and 4a , which , through concomitant uncoupling of oxidative phosphorylation and inhibition of ovcht1 , resulted in a more robust inhibition of o. volvulus molting . moreover , our results demonstrate the superior activity of the dual - targeted single molecules over monotherapy or a dual drug combination ( 4b + cccp ) . the implications of ovcht1 in filarial molting has opened an avenue to develop strategies toward the elimination of onchocerciasis . earlier , dna immunization with ovcht1 was shown to provide significant protection against the developing l3 larvae in mice ; however , large and frequent doses of dna were needed to attain the result . the efficacy of the dual mechanistic drug , closantel , has steered us to prepare analogues to further probe the individual effects of ovcht1 inhibition and protonophoric activity on o. volvulus l3 molting . by subtle structural modifications , we have identified potent bifunctional analogues ( 3h , 3 m , and 4a ) as well as ovcht1 inhibitors only ( 3i and 4b ) . these compounds were also found to readily bioaccumulate in the model nematode c. elegans at concentrations up to > 75% of the initial dose to worms . moreover , our results have clearly established the significance of each biochemical role in modulating the o. volvulus l3-to - l4 molt and that synergistic activities ( as displayed by 3h , 3 m , and 4a ) provided a formidable impact on molting . although these strategies will still need to be validated as potential antifilarial therapies , what we have presented thus far is a notch closer toward the search for effective treatments to combat onchocerciasis . h and c nmr spectra were recorded on a bruker drx-500 or bruker drx-600 equipped with a 5 mm dch cryoprobe . all carboxylic acid and amine starting reactants were obtained from commercial sources except for compounds 6b ( used for the syntheses of compounds 3b , 3d , 3i , and 4b ) , 6c ( prepared as described previously and used for syntheses of compounds 3e , 3j , and 4c ) and n - methyl-4-phenoxyaniline 7 ( used for the syntheses of compounds 3c and 3d ) . compounds 35 were prepared according to general procedure a or b. a mixture of 3,5-diiodosalicylic acid ( 1.0 equiv ) and thionyl chloride ( 5 equiv ) was heated under reflux for 7 h. after concentration under reduced pressure , cold hexanes were added to precipitate the acid chloride product . the residue was filtered , washed several times with cold hexanes , and air - dried . a solution of the amine reactant ( 1.0 equiv ) and dipea ( 3 equiv ) in dmf was added to the acid chloride , and the resulting mixture was stirred at rt for 1 h. the product was subsequently subjected to preparative hplc purification . a solution of 6b or 6c ( 1.0 equiv ) , dipea ( 2.0 equiv ) and hbtu ( 1.1 equiv ) in dmf was stirred for 15 min at rt . the amine reactant ( 1.0 equiv ) was added , and the resulting mixture was stirred overnight at rt . purity of the final products are generally > 95% as assessed by hplc . procedure a , 53% yield . h nmr ( 500 mhz , dmso - d6 ) 6.997.10 ( m , 4h ) , 7.14 ( t , j = 7.39 hz , 1h ) , 7.367.44 ( m , 2h ) , 7.647.71 ( m , 2h ) , 8.23 ( d , j = 1.90 hz , 1h ) , 8.40 ( d , j = 1.86 hz , 1h ) , 10.66 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 81.7 , 89.1 , 117.3 , 118.4 , 119.0 , 123.4 , 123.8 , 130.1 , 132.8 , 135.8 , 149.7 , 153.5 , 156.9 , 159.5 , 166.7 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h14i2no3 , 557.9058 ; found , 557.9058 . h nmr ( 600 mhz , cdcl3 ) 3.91 ( s , 3h ) , 6.957.05 ( m , 4h ) , 7.10 ( t , j = 7.38 hz , 1h ) , 7.33 ( t , j = 7.94 hz , 2h ) , 7.61 ( d , j = 8.84 hz , 2h ) , 8.24 ( d , j = 2.12 hz , 1h ) , 8.38 ( d , j = 2.13 hz , 1h ) , 9.38 ( s , 1h ) . c nmr ( 151 mhz , cdcl3 ) 62.7 , 90.1 , 93.8 , 118.7 , 119.8 , 121.9 , 123.4 , 129.4 , 129.9 , 133.2 , 141.3 , 150.5 , 154.2 , 157.1 , 157.5 , 160.9 . hrms - esi ( m / z ) : [ m + h ] calcd for c20h16i2no3 , 571.9214 ; found , 571.9213 . h nmr ( 600 mhz , cdcl3 ) 3.47 ( s , 3h ) , 6.927.02 ( m , 3h ) , 7.027.09 ( m , 4h ) , 7.13 ( t , j = 7.38 hz , 1h ) , 7.35 ( t , j = 7.91 hz , 2h ) , 7.92 ( d , j = 1.63 hz , 1h ) , 11.89 ( s , 1h ) . c nmr ( 151 mhz , cdcl3 ) 39.7 , 79.2 , 87.6 , 117.7 , 119.3 , 120.3 , 124.0 , 128.1 , 130.1 , 139.2 , 139.4 , 149.2 , 156.8 , 157.1 , 159.5 , 169.2 . hrms - esi ( m / z ) : [ m + h ] calcd for c20h16i2no3 , 571.9214 ; found , 571.9205 . h nmr ( 600 mhz , cdcl3 ) 3.46 ( s , 3h ) , 3.88 ( s , 3h ) , 6.82 ( d , j = 8.78 hz , 2h ) , 6.90 ( d , j = 7.85 hz , 2h ) , 7.01 ( d , j = 8.78 hz , 2h ) , 7.10 ( t , j = 7.40 hz , 1h ) , 7.297.40 ( m , 4h ) , 7.93 ( d , j = 1.98 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 37.5 , 62.7 , 87.6 , 93.3 , 118.9 , 119.5 , 123.7 , 128.3 , 130.0 , 133.9 , 137.4 , 138.1 , 147.6 , 155.9 , 156.3 , 157.0 , 166.7 . hrms - esi ( m / z ) : [ m + h ] calcd for c21h18i2no3 , 585.9376 ; found , 585.9366 . h nmr ( 600 mhz , cdcl3 ) 6.987.05 ( m , 4h ) , 7.11 ( t , j = 7.40 hz , 1h ) , 7.317.37 ( m , 2h ) , 7.56 ( d , j = 8.73 hz , 2h ) , 7.71 ( s , 1h ) , 8.12 ( s , 2h ) , 8.22 ( t , j = 1.39 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 95.2 , 118.9 , 119.7 , 122.3 , 123.5 , 129.9 , 132.7 , 135.4 , 138.3 , 148.4 , 154.5 , 157.4 , 162.7 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h14i2no2 , 541.9109 ; found , 541.9106 . h nmr ( 600 mhz , cdcl3 ) 2.34 ( s , 3h ) , 6.916.95 ( m , 2h ) , 6.987.04 ( m , 2h ) , 7.15 ( d , j = 8.25 hz , 2h ) , 7.447.50 ( m , 2h ) , 7.78 ( d , j = 1.89 hz , 1h ) , 7.87 ( s , 1h ) , 8.18 ( d , j = 1.89 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 20.9 , 77.2 , 80.3 , 89.0 , 116.7 , 118.9 , 119.3 , 123.5 , 130.5 , 130.7 , 133.5 , 134.3 , 151.1 , 154.5 , 156.0 , 160.4 , 166.4 . hrms - esi ( m / z ) : [ m + h ] calcd for c20h16i2no3 , 571.9220 ; found , 571.9215 . h nmr ( 600 mhz , cdcl3 ) 6.967.08 ( m , 6h ) , 7.49 ( d , j = 8.84 hz , 2h ) , 7.79 ( d , j = 1.44 hz , 1h ) , 7.92 ( s , 1h ) , 8.19 ( d , j = 1.72 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 80.3 , 89.0 , 116.6 ( d , j = 23.3 hz ) , 116.7 , 118.9 , 120.8 ( d , j = 8.26 hz ) , 123.6 , 131.1 , 134.3 , 151.1 , 152.7 ( d , j = 2.49 hz ) , 155.7 , 159.1 ( d , j = 242.8 hz ) , 160.4 , 166.5 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h13fi2no3 , 575.8963 ; found , 575.8957 . procedure a , 46% yield . h nmr ( 600 mhz , dmso - d6 ) 7.017.08 ( m , 2h ) , 7.077.14 ( m , 2h ) , 7.417.50 ( m , 2h ) , 7.657.74 ( m , 2h ) , 8.23 ( d , j = 1.80 hz , 1h ) , 8.40 ( d , j = 1.80 hz , 1h ) , 10.69 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 81.8 , 89.1 , 117.4 , 119.3 , 120.0 , 123.8 , 127.1 , 129.9 , 133.2 , 135.8 , 149.7 , 153.0 , 155.9 , 159.5 , 166.7 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h13cli2no3 , 591.8668 ; found , 591.8660 . h nmr ( 600 mhz , cdcl3 ) 3.91 ( s , 3h ) , 6.926.96 ( m , 2h ) , 7.017.05 ( m , 2h ) , 7.277.31 ( m , 2h ) , 7.607.66 ( m , 2h ) , 8.26 ( d , j = 2.20 hz , 1h ) , 8.39 ( d , j = 2.20 hz , 1h ) , 9.40 ( s , 1h ) . c nmr ( 151 mhz , cdcl3 ) 62.7 , 90.1 , 93.8 , 119.9 , 119.9 , 122.0 , 128.4 , 129.3 , 129.9 , 133.6 , 141.3 , 150.6 , 153.7 , 156.2 , 157.1 , 160.9 . hrms - esi ( m / z ) : [ m + h ] calcd for c20h15cli2no3 , 605.8824 ; found , 605.8817 . h nmr ( 600 mhz , cdcl3 ) 6.926.97 ( m , 2h ) , 6.997.04 ( m , 2h ) , 7.287.32 ( m , 2h ) , 7.57 ( d , j = 8.78 hz , 2h ) , 7.71 ( s , 1h ) , 8.108.15 ( m , 2h ) , 8.22 ( t , j = 1.35 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 95.2 , 119.8 , 120.0 , 122.4 , 128.5 , 129.9 , 133.1 , 135.4 , 138.3 , 148.4 , 154.0 , 156.1 , 162.7 . hrms - esi ( m / z ) : [ m h ] calcd for c17h10i2no2 , 573.8568 ; found , 573.8556 . h nmr ( 600 mhz , cdcl3 ) 6.886.93 ( m , 1h ) , 7.00 ( t , j = 2.12 hz , 1h ) , 7.047.08 ( m , 2h ) , 7.087.12 ( m , 1h ) , 7.237.29 ( m , 1h ) , 7.527.58 ( m , 2h ) , 7.80 ( d , j = 1.83 hz , 1h ) , 7.92 ( s , 1h ) , 8.20 ( d , j = 1.85 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 80.4 , 89.1 , 116.7 , 116.9 , 119.1 , 120.1 , 123.5 , 123.7 , 130.8 , 131.9 , 134.3 , 135.3 , 151.2 , 154.3 , 158.1 , 160.4 , 166.5 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h13cli2no3 , 591.8668 ; found , 591.8663 . h nmr ( 600 mhz , cdcl3 ) 6.987.02 ( m , 2h ) , 7.03 ( dd , j = 1.40 , 8.13 hz , 1h ) , 7.12 ( td , j = 1.44 , 7.80 hz , 1h ) , 7.237.25 ( m , 1h ) , 7.48 ( dd , j = 1.54 , 8.00 hz , 1h ) , 7.497.53 ( m , 2h ) , 7.78 ( d , j = 1.88 hz , 1h ) , 7.87 ( s , 1h ) , 8.19 ( d , j = 1.87 hz , 1h ) . c nmr ( 151 mhz , cdcl3 ) 80.3 , 89.0 , 116.7 , 118.5 , 121.2 , 123.5 , 125.3 , 126.2 , 128.2 , 131.1 , 131.3 , 134.3 , 151.2 , 152.3 , 155.0 , 160.4 , 166.4 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h13cli2no3 , 591.8668 ; found , 591.8662 . 7.467.51 ( m , 1h ) , 7.517.55 ( m , 1h ) , 7.78 ( dd , j = 2.08 , 8.86 hz , 1h ) , 7.91 ( d , j = 8.58 hz , 2h ) , 7.95 ( d , j = 8.90 hz , 1h ) , 8.25 ( d , j = 1.81 hz , 1h ) , 8.30 ( d , j = 1.61 hz , 1h ) , 8.48 ( d , j = 1.80 hz , 1h ) , 10.84 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 81.9 , 89.2 , 117.6 , 118.8 , 121.7 , 125.5 , 126.6 , 127.5 , 127.6 , 128.3 , 130.6 , 133.1 , 134.9 , 136.0 , 149.7 , 159.5 , 167.0 . hrms - esi ( m / z ) : [ m h ] calcd for c17h10i2no2 , 513.8807 ; found , 513.8800 . h nmr ( 600 mhz , cdcl3 ) 3.95 ( s , 3h ) , 7.427.46 ( m , 1h ) , 7.487.52 ( m , 1h ) , 7.57 ( dd , j = 2.12 , 8.75 hz , 1h ) , 7.81 ( d , j = 8.11 hz , 1h ) , 7.837.87 ( m , 2h ) , 8.27 ( d , j = 2.19 hz , 1h ) , 8.38 ( d , j = 1.70 hz , 1h ) , 8.44 ( d , j = 2.19 hz , 1h ) , 9.60 ( s , 1h ) . c nmr ( 151 mhz , cdcl3 ) 62.8 , 90.1 , 93.9 , 117.3 , 120.0 , 125.5 , 126.9 , 127.8 , 127.9 , 129.2 , 129.4 , 131.1 , 134.0 , 135.2 , 141.4 , 150.6 , 157.2 , 161.1 . hrms - esi ( m / z ) : [ m + h ] calcd for c18h14i2no2 , 529.9109 ; found , 529.9114 . h nmr ( 600 mhz , cdcl3 ) 7.44 ( ddd , j = 1.09 , 6.91 , 8.05 hz , 1h ) , 7.477.51 ( m , 1h ) , 7.57 ( dd , j = 2.07 , 8.74 hz , 1h ) , 7.787.86 ( m , 3h ) , 7.89 ( s , 1h ) , 8.17 ( d , j = 1.37 hz , 2h ) , 8.22 ( t , j = 1.46 hz , 1h ) , 8.27 ( s , 1h ) . c nmr ( 151 mhz , cdcl3 ) 95.2 , 117.6 , 120.1 , 125.6 , 126.9 , 127.8 , 127.9 , 129.2 , 131.1 , 133.9 , 134.8 , 135.5 , 138.4 , 148.4 , 162.9 . hrms - esi ( m / z ) : [ m h ] calcd for c17h10i2no , 497.8852 ; found , 497.8847 . h nmr ( 600 mhz , dmso - d6 ) 7.36 ( t , j = 7.35 hz , 1h ) , 7.47 ( t , j = 7.72 hz , 2h ) , 7.69 ( d , j = 7.31 hz , 2h ) , 7.72 ( d , j = 8.62 hz , 2h ) , 7.78 ( d , j = 8.64 hz , 2h ) , 8.24 ( d , j = 1.75 hz , 1h ) , 8.43 ( d , j = 1.79 hz , 1h ) , 10.73 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 81.8 , 89.2 , 117.5 , 122.2 , 126.4 , 126.9 , 127.4 , 129.0 , 135.9 , 136.6 , 136.8 , 139.5 , 149.7 , 159.5 , 166.9 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h14i2no2 , 541.9114 ; found , 541.9116 . procedure a , 70% yield . h nmr ( 600 mhz , dmso - d6 ) 2.34 ( s , 3h ) , 7.27 ( d , j = 7.91 hz , 2h ) , 7.58 ( d , j = 8.03 hz , 2h ) , 7.69 ( d , j = 8.62 hz , 2h ) , 7.76 ( d , j = 8.62 hz , 2h ) , 8.24 ( d , j = 1.65 hz , 1h ) , 8.43 ( d , j = 1.55 hz , 1h ) , 10.70 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 20.7 , 81.8 , 89.2 , 117.5 , 122.2 , 126.3 , 126.6 , 129.6 , 135.9 , 136.5 , 136.6 , 136.6 , 136.6 , 149.7 , 159.5 , 166.8 . hrms - esi ( m / z ) : [ m + h ] calcd for c20h16i2no2 , 555.9270 ; found , 555.9275 . h nmr ( 600 mhz , dmso - d6 ) 7.52 ( d , j = 8.46 hz , 2h ) , 7.687.77 ( m , 4h ) , 7.79 ( d , j = 8.61 hz , 2h ) , 8.24 ( d , j = 1.53 hz , 1h ) , 8.42 ( d , j = 1.57 hz , 1h ) , 10.73 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 81.8 , 89.2 , 117.5 , 122.2 , 126.9 , 128.2 , 128.9 , 132.2 , 135.2 , 135.9 , 137.1 , 138.3 , 149.7 , 159.4 , 166.9 . hrms - esi ( m / z ) : [ m + h ] calcd for c19h13cli2no2 , 575.8719 ; found , 575.8735 . methyl iodide ( 0.80 g , 5.6 mmol ) was added dropwise to a mixture of 3,5-diiodosalicylic acid ( 1.0 g , 5.1 mmol ) and k2co3 ( 0.90 g , 6.5 mmol ) in acetone ( 10 ml ) . after stirring for 3 h at rt , the solvent was removed in vacuo , and the residue was partitioned between h2o and ch2cl2 . the organic layer was separated , and the aqueous phase was extracted with ch2cl2 . the organic extracts were concentrated under reduced pressure to give crude methyl 3,5-diiodo-2-methoxybenzoate . the crude product was dissolved in hot methanol ( 10 ml ) to which 1 m koh ( 10 ml , 10 mmol ) was added . the resulting mixture was heated under reflux for 2 h , diluted with water , and neutralized by addition of 1 m hcl . the product was collected by filtration and recrystallized with ethanol to give 6b in 61% yield ( 0.62 g ) over two steps . h nmr ( 600 mhz , dmso - d6 ) 3.76 ( s , 3h ) , 7.95 ( d , j = 2.09 hz , 1h ) , 8.30 ( d , j = 2.08 hz , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 61.9 , 89.2 , 96.6 , 128.7 , 139.2 , 149.2 , 158.1 , 165.1 . hrms - esi ( m / z ) : [ m h ] calcd for c8h5i2o3 , 402.8328 ; found , 402.8325 . compound 7 was synthesized according to the literature procedure . to a cooled solution of n-(4-phenoxyphenyl)acetamide ( 0.50 g , 2.2 mmol ) in anhydrous thf ( 5 ml ) was added nah ( 97 mg , 2.4 mmol , 60% dispersion in mineral oil ) . after stirring for 5 min , mei ( 0.20 ml , 3.2 mmol ) was added dropwise , and the resulting mixture was stirred for 1 h at rt and then partitioned between h2o and ch2cl2 . concentration of the combined organic extracts in vacuo gave the crude n - methyl - n-(4-phenoxyphenyl)acetamide , which was used in the next step without further purification . concentrated hcl ( 0.5 ml ) was added to a stirred solution of crude n - methyl - n-(4-phenoxyphenyl)acetamide in ethylene glycol ( 3 ml ) . the mixture was heated under reflux overnight , diluted with h2o , and extracted with etoac . the organic layers were combined , dried over anhydrous na2so4 , and concentrated under reduced pressure . purification of the crude product by silica chromatography gave compound 7 in 56% yield ( 0.25 g ) over two steps . h nmr ( 600 mhz , cdcl3 ) 2.85 ( s , 3h ) , 6.616.65 ( m , 2h ) , 6.946.98 ( m , 4h ) , 7.03 ( t , j = 7.35 hz , 1h ) , 7.30 ( t , j = 7.96 hz , 2h ) . c nmr ( 151 mhz , cdcl3 ) 31.4 , 113.5 , 117.1 , 121.4 , 122.0 , 129.6 , 146.1 , 147.6 , 159.3 . hrms - esi ( m / z ) : [ m + h ] calcd for c13h14no , 200.1075 ; found , 200.1069 . h nmr ( 500 mhz , dmso - d6 ) 2.97 ( t , j = 7.45 hz , 2h ) , 3.57 ( q , j = 7.04 hz , 2h ) , 6.947.02 ( m , 1h ) , 7.037.11 ( m , 1h ) , 7.18 ( d , j = 2.21 hz , 1h ) , 7.34 ( d , j = 8.09 hz , 1h ) , 7.55 ( d , j = 7.86 hz , 1h ) , 8.148.23 ( m , 2h ) , 9.28 ( t , j = 5.43 hz , 1h ) , 10.84 ( s , 1h ) . c nmr ( 151 mhz , dmso - d6 ) 24.6 , 40.3 , 81.4 , 88.8 , 111.4 , 111.5 , 116.3 , 118.2 , 118.3 , 121.0 , 122.8 , 127.1 , 135.2 , 136.2 , 149.3 , 159.9 , 168.0 . hrms - esi ( m / z ) : [ m + h ] calcd for c17h14i2n2o2 , 532.9218 ; found , 532.9208 . adherent human epithelial kidney cells [ hek 293t/17 ] ( atcc crl-11268 ) were trypsinized and resuspended in 10% fbs in dmem at a density of 12 10 cells / ml . cells were incubated with dmso ( blank control ) or 50 m compound for 30 min at 37 c . tetramethylrhodamine ethyl ester perchlorate ( tmre , 450 nm final concentration ) was added , followed by incubation in the dark for 30 min at 37 c . cells were washed twice with 0.2% bsa in pbs , centrifuged , and resuspended in 0.2% bsa in pbs . for the microplate assay , fluorescence signals were measured using a spectramaxm2e microplate reader ( molecular devices , sunnyvale , ca ) ( ex = 549 nm , em = 575 nm ) . for flow cytometry , 12 10 cells per sample were collected using diva 6.0 software on an lsrii flow cytometer ( bd biosciences , san jose , ca ) . facs data was further analyzed using flowjo software ( tree star , inc . , ashland , or ) . c. elegans growth and maintenance were performed using standard protocols . the procedure for the small molecule accumulation assay was adapted from burns et al . briefly , synchronized worms were grown to late - stage l4 worms at 25 c on escherichia coli op50 for 40 h. worms were harvested , washed three times with water , and resuspended in m9 buffer to a final concentration of 510 worms/l . to 200 l of the worm suspension was added 2 l of 1 mm compound in dmso ( equivalent to 2 nmol / mg worm ) . after incubation for 6 h ( or 12 h ) at rt , the worms were washed with 500 l of 0.1% sds , followed by three 500 l washes with water . after washing , the worms were flash frozen in liquid nitrogen , lyophilized , weighed , and stored at 80 c until analyses . worms were homogenized for 5 min in a 100-volume equivalent of cold methanol / acetonitrile mixture ( 1:1 ) containing 500 nm internal standard 8 , using a bullet blender ( next advance , inc . after centrifugation for 10 min at 4 c , the supernatants were collected and analyzed by reversed - phase lc with ms detection ( mass filter at m / z = 589.846589.856 for 3h , m / z = 605.878605.888 for 3i , m / z = 623.807623.817 for 3 m , m / z = 513.875513.885 for 4a , and m / z = 529.906529.916 for 4b ) . standard calibration curves were prepared by fortification of blank worms with compounds 3h , 3i , 3 m , 4a , and 4b at concentrations up to 2 nmol / mg worm . the concentrations in worms were quantified using peak area ratios relative to the internal standard and linear regression parameters were calculated from the calibration curve standards prepared in blank worms . the lc system consisted of agilent 1200 lc ( agilent technologies , santa clara , ca ) equipped with an autosampler and a column heater . mass spectrometric experiments were performed with agilent tof 6210 and monitored with mass hunter qualitative analysis software , version b.03.01 ( agilent technologies , santa clara , ca ) . mass spectrometry acquisition was performed using electrospray ionization with the following parameters : capillary voltage = 3.5 kv , nebulizer pressure = 20 psig , drying gas flow = 7 l / min , and gas temperature = 350 c . samples were analyzed on a poroshell 120 ec - c8 column ( 2.7 m , 2.1 mm i.d . the mobile phase consisted of elution at 0.20 ml / min starting with an 8 min linear gradient from 70% a/30% b to 100% b and then 100% b for 12 min ( positive - esi , a = 0.1% formic acid in water , b = 0.1% formic acid in acetonitrile ; negative - esi , a = water , b = acetonitrile ) . experiments using o. volvulus l3 larvae in molting assay were the same as described previously except that the larvae were incubated with the compounds for 24 h prior to addition of the complete medium ( containing 20% heat inactivated fcs ) and normal pbmcs . hek 293t/17 cells ( 2 10 cells ) were plated in 96-well plates and incubated at 37 c for 24 h. cells were then treated with compounds 3h , 3 m , and 4a ( at a final concentration of 1 and 10 m ) , and an mts assay was performed at 0.5 and 24 h postincubation using the celltiter 96 aqueous non - radioactive cell proliferation assay ( promega , madison , wi ) per manufacturer s instructions .

its effect on the global population carries important economic , healthcare system , and human suffering consequences . influenza virus type a is highly contagious and is the most pathogenic of all human influenza viruses . human antibodies recognize two antigens ( glycoprotein ) expressed on the viral surface called hemagglutinin ( ha ) and neuraminidase ( na ) . changes in these glycoprotein represent antigenic variation ( antigen drift ) that is responsible for the constant changes within the common strains of seasonal influenza . influenza is classified into 16 ha subtypes and 9 na subtypes , and as pointed out , influenza comprises the oldest emerging virus that is still emerging . influenza pandemics occur when an influenza virus , that presents an hemagglutinin ( ha ) molecule for which there is limited or no existing immunity , emerges and efficiently transmits from human to human . the emergence of a new virus subtype with a new ha is called antigen shift and will condition the lack of immune response to infection by the new virus . despite of pandemics during the last century , this disease generally does not represent an actual concern for the overall population . several publications [ 1 , 2 , 47 ] , as well as the world health organization ( who ) and the american center of disease control ( cdc ) , had repeatedly pointed out that in a manner of time , the world would face a new influenza pandemic that would cause significant figures of global morbidity and mortality . influenza has a fast person - to - person transmission and a high mortality risk when not treated . among all the major pandemics , influenza a is the only one that may potentially infect a considerable fraction of the world 's population in a few months . the genomes of the last three pandemic influenza viruses , 1918 ( h1n1 ) , 1957 ( h2n2 ) , and 1968 ( h3n2 ) , originated from nonhuman reservoirs and all ha genes originated from avian influenza viruses . there are two mechanisms intervening in the introduction of a virus with new hemagglutinin ( ha ) subtypes in the human population : recombination and interspecies transmission . the first mechanism of the current influenza a ( h1n1 ) pandemic comprises recombined viruses of two swine flu types : one of those has a triple recombination strain containing segments originated from the last human seasonal flu h3n2 and the other one originated by avian and swine flu . in early april 2009 , cases similar to pneumonia and influenza were notified and reported to the pan - american health organization ( paho ) . as research progressed , it was observed that reported mexican and californian cases were caused by a similar virus , which triggered the alert of the world health organization ( who ) on april 24 . on july 11 , 2009 , the who raised its pandemic alert level to 6 . at the beginning of the outbreak there were a significant number of cases reported as possible new h1n1 influenza that , after the pcr test became widely available in may 2009 , were labeled as seasonal influenza a ( non - h1n1 ) . the national commission for medical arbitration ( conamed ) , as the designated authority to monitor all mortality cases due to influenza , compiled a series of clinical files of all suspicious cases . since the clinical profile of the new h1n1 virus is not significantly different to that of seasonal influenza a ( non - h1n1)described clinical profiles include cough , rhinorrhea , headache , myalgia , arthralgia , fever , dyspnea , and diarrhea [ 813]many of the initial cases filed by conamed were later confirmed by rt - pcr testing as seasonal influenza a ( non - h1n1 ) . this study describes the main differences between the new influenza h1n1 and seasonal influenza a virus mortality cases in terms of clinical profile and sociodemographic characteristics which may orient clinicians and authorities in decision - making processes . this is a cross - sectional analysis of secondary data related to deaths due to influenza a infection during the period from april 10 to july 13 , 2009 . cases of h1n1 and seasonal influenza a ( non h1n1 ) were identified , as well as information on the clinical and socio - demographic characteristics of individuals . for this study , case was considered as any deaths due to influenza type a confirmed by the national institute of epidemiologic diagnosis and reference ( indre ) through the rt - pcr test for influenza a ( h1n1 ) or seasonal influenza a. the analysis was based on information collected from patients ' clinical records and reporting forms from health facilities in mexico . as a first step to analyze the deaths from influenza a h1n1 , the necessary coordination with health care institutions and states of mexico was established in order for them to send records of all patients who had died with clinical diagnosis of influenza across the country to conamed . the influenza working group decided to develop two methods of analysis for such records , a clinical and an epidemiological one . the first in order to identify the individual characteristics of the deceased as well as the process of medical care received , the second to know the general characteristics of the population affected by variables of time , place , and person , and to estimate the rate of mortality and early lethality . in both cases , the primary source document was the clinical file of deceased patients diagnosed with influenza a ( h1n1 and non - h1n1 ) during the period from april 10 to july 13 , 2009 . once a database including only information from influenza a deceased patients with confirmation of whether it was h1n1 or seasonal a was constructed , variables needed to describe socio - demographic and clinical characteristics were reviewed to check consistency . the differences in the socio - demographic profile of the population were analyzed , seeking to identify characteristics that might be associated with a greater likelihood of death from h1n1 compared to influenza type a , that is , trying to identify a profile for these patients . for this purpose , tests for differences of means or proportions were calculated between groups , and further multivariate logistic regression models were carried out . to identify possible clinical differences among reported deaths and in order to avoid bias due to differences in socio - demographic characteristics , cases of h1n1 were matched on these socio - demographic characteristics to cases of non - h1n1 using propensity score matching techniques . the propensity score was constructed using age , sex , economic activity , schooling , and marital status . estimations were implemented using kernel matching in order to utilize as much information as possible from the available observations . the kernel matching compared a case ( h1n1 ) to the average of the noncases ( non h1n1 ) that had a score in the proximity of the case ; in this way , for all cases a match was generated . the sample included 324 influenza a cases of which 239 had rt - pcr diagnosis of influenza a h1n1 and 85 of seasonal influenza a ( non h1n1 ) . of the total 53.1% were women and 46.9% men . within the influenza h1n1 group 50.6% were women and 49.4% men . within the seasonal influenza a group , 41% of deaths within the influenza a h1n1 group occurred in the 2039-years - old age group and the same age group represented also 41% of the seasonal influenza a group . in terms of the general characteristics of individuals within the entire sample , the analysis shows that there are differences by age , education , and type of occupation among those who presented ah1n1 influenza in relation to influenza a non h1n1 . comparing between the two types of influenza , h1n1 deaths would occur from an earlier age , in people with less education , and among those who engage in activities where there is increased contact with other unknown persons ( trade or other independent activities ) ( table 1 ) . clinical manifestations and outcomes were similar in both types of influenza in most of the indicators but dysnea , headache , and chest pain that were less frequently found among cases with h1n1 compared to non h1n1 ( table 2 ) . for the regression analysis , the differences in some socio - demographic indicators were maintained in the multi - variable models . as reported in table 3 , junior high school was associated with lower probability of h1n1 compared to primary school or less and also , having an economic activity related to increased contact with unknown individuals ( salespersons or independent professionals ) was associated with an increased probability of h1n1 ( or 4.52 95% ci 1.5613.14 ) ( table 3 ) . to analyze the occurrence of clinical features in deaths , controlling for socio - demographic characteristics of individuals , as described in the methods section , cough was more prevalent among those with h1n1 influenza , while dyspnea , headache , and chest pain were less prevalent among h1n1 compared wit non h1n1 . also , it was found that days from clinical care to death were in average more for those with h1n1 . in all other clinical features analyzed , including time elapsed between diagnosis and treatment , and between diagnosis and death , there were no significant differences ( table 4 ) . the results presented here describe some differences among deceased individuals with influenza h1n1 compared to those with seasonal influenza a ( non h1n1 ) . cases of h1n1 were younger and in average less educated , confirming observations made during the peak of the pandemic . a contextual factor that could be related to higher exposure is the primary economic activity : cases of h1n1 were individuals that reported in a larger proportion working as salespersons or activities with a higher interaction with unknown individuals , that could result in a larger variety of exposure . in a previous study that analyzed the first 120 mortality cases of the new h1n1 virus , it was found that a proportion of 51% were women and 49% were males . the mortality rate was 2.2% and ranged from 0.3% in the 10 to 19 years and the question of which were the main differences between the new influenza h1n1 virus infection and the infection by seasonal a virus was still unanswered . most published case series have shown similarities between infection by both h1n1 and seasonal influenza a , main symptoms being fever , cough , headache , myalgia , and rhinorrhea [ 810 , 1214 , 17 , 18 ] . in terms of clinical characteristics that differentiate between the two groups , it was found that cough was more prevalent among those with h1n1 influenza , while dyspnea , headache , and chest pain were less prevalent among h1n1 compared to seasonal a influenza virus . this particular finding is worth noting since these are symptoms which may encourage patients to seek medical care and help physicians diagnose and determine severity of the case as it has been described as signs of progression to more severe disease or complications . while coughing was more prevalent , which is unspecific for most uncomplicated upper airway infections , symptoms that would alert of a complicated case were not as prevalent , this could be the reason behind the perceived lack of opportune treatment reported by many during the start of the pandemic in june also , it was found that days from clinical care to death were in average more for those with infection by h1n1 virus , signaling a relative delay in the evolution of the clinical profile after receiving medical care , which may be related to the h1n1 susceptibility and therefore response to antiviral therapy , although in severe cases only a partial one . it also correlates to longer evolution times and presence of virus for longer periods reported by others . the present study shows the main differences in the mortality cases between the new influenza h1n1 and seasonal influenza a virus in terms of clinical profile and socio - demographic characteristics on mortality cases ; these differences may prove useful to orient clinicians and authorities in decision making processes . at the present time , morbidity and mortality rates from the h1n1 virus have dropped ; however , the need to investigate the characteristics of this novel influenza virus along with the epidemiological pattern of the pandemic is still patent . this will increase our understanding of its nature and may help determine future plans to be prepared in case of similar events . as pointed out by the who , most studies drawing comparisons between influenza a h1n1 and seasonal influenza a mortality are based on estimates and related to differences in mortality rates , comparisons that may prove to be inaccurate and sometimes misleading . the present study does not pretend to conclude on these , but to draw attention to the main sociodemographic and clinical differences of both influenza a infections .

it is caused by mutation in the cystic fibrosis transmembrane conductance regulator ( cftr ) gene , which encodes a transmembrane glycoprotein [ 2 , 3 ] . the cf transmembrane conductance regulator has been shown to function as a cyclic adenosine monophosphate- ( camp- ) regulated chloride channel at the apical membrane of epithelial cells . one of the main consequences of mutations in the cftr gene is a dysfunction of ion channels resulting in elevated sweat chloride concentrations , pancreatic insufficiency , and progressive lung disease . newly introduced therapies and aggressive management have led to a median expected survival age of 36 years . however , new clinical problems that need to be identified and therapeutically addressed may become evident as the population ages . a number of reports have documented cf - related low bmd in both adults and children with cf [ 79 ] . cf - related bone disease ( cfrbd ) is multifactorial in etiology , primarily related to imbalanced bone deposition and resorption . other factors influencing cfrbd include low body mass index , vitamins d and k insufficiency , poor ca absorption and excessive ca secretion in the gastrointestinal tract , low levels of insulin - like growth factor 1 , chronic bacterial infection with associated chronic inflammation and heightened cytokine activity , and treatment with antibiotics and glucocorticoids [ 7 , 11 ] . the prevention , early diagnosis , and treatment of cfrbd are critical because pain , deformity , immobility related to fragility fractures , and kyphosis may contribute to reduction in lung function and effectiveness of cough . bmd is commonly assessed using dexa and is reported as both a t score and a z score . low bmd is defined using who criteria which state that a t score between 1.0 and 2.5 is osteopenia and < 2.5 is considered osteoporosis . the t score refers to the individuals ' bmd compared to individuals of the same gender between the ages of 2040 years . the z scores refer to the number of standard deviations between a patient bmd value and the average value of an age and gender matched healthy control population . a patient with a bmd z score below 2 is considered to have cf - related low bmd ( cystic fibrosis trust , 2007 ) . the cftr i1234v mutation is one of the common cf mutations among arabs in the gulf region belonging to a large kindred arab tribe [ 14 , 15 ] . the aim of this study was to study the spectrum of bmd in a cohort of cf patients greater than 10 years of age . we evaluate the relationship between bmd lumbar spine , total hips , and whole - body mineral content and age , sex , bmi , serum 25[oh]d , and severity of illness by chronic pseudomonas aeruginosa ( p. aeruginosa ) colonization and lung function . this study recruited thirty - three cf patients having the cftr i1234v mutation that were more than 10 years old who attended the cf clinic at hamad medical corporation , doha , qatar , between november 2009 and april 2010 . seven patients did not show up in follow - up cf clinic and their bmd values could not be recorded and hence were excluded from the statistical analysis . this study was initiated as a pilot study and therefore there was no formal sample size calculation done for this study . cf diagnosis was established by documentation of elevated sweat chloride levels and/or assessment of two cftr gene mutations . none had been acutely ill for at least four weeks and had taken oral , intravenous , or inhaled steroids . none had taken vitamin k or d supplements in three months prior to the study . this cross - sectional study was approved by the research ethics committee at hamad medical corporation . written informed consent was obtained from the parents or legal guardians of subjects less than 18 years old and from subjects aged 18 years or older . heights were measured using a harpenden stadiometer and height z score was calculated using standard formula for calculating z score . anthropometric measurements were performed using digital electronic platform scale and standing height measurement without shoes and with the patient being lightly dressed using a stadiometer . body mass index ( bmi ) was calculated by dividing weight in kg by height squared in meters { weight ( kg)/(height ( m))}. bmi z score was calculated and adjusted for age and gender . subjects performed spirometric tests in the respiratory laboratory unit in accordance with the standards of the american thoracic society using reference value for spirometry in children and adolescents given by knudson et al . . the best recorded forced expiratory volume in 1 second ( fev1 ) using a flow - sensing spirometer ( sensor medicus model v6200 , germany ) was recorded . a single venous blood sample was obtained from each patient for measurement of serum calcium , phosphorus , alkaline phosphatase , albumin , and liver enzymes using a roche modulator analyzer . circulating concentrations of 25[oh]d were measured using diasorin 25[oh]d radioimmunoassay kits double antibody assay ( diasorin , inc . , measurement of vitamin k levels was performed in france using high - performance liquid chromatography ( hplc ) . each measurement was categorized as normal or abnormal on the basis of standard age - appropriate limits as defined by hamad medical corporation laboratory . bone mineral density of the lumbar spine ( l1l4 ) , total hip , and the total body was determined by dexa by lunar prodigy system ( lunar corporation , minnesota , nj , usa ) . bone densities were expressed as bone mineral density ( bmd , g / cm ) . two sites were measured , namely , the lumbar spine ( l1l4 ) anteroposteriorly and the average of femur . all measurements were performed at the bmd unit at hmc by a single experienced technologist and reviewed by one of the authors ( m. h. ) . the normal bmd data base for children was used to derive the z score and the adult data base to derive the t score . the bmd machine in our institution is programmed to use the z score for those who are less than 21 years using lunar australian pediatric norms and t score is used for those who are 21 years or older using lunar middle east norms . the precision of the system was assessed by duplicate measurements of 15 individuals aged 1026 . categorical and continuous values were expressed as frequency ( percentage ) , mean sd , median , and range . quantitative variables means between the two independent groups were analyzed using unpaired t - test and mann - whitney u test . associations between two or more qualitative or categorical variables were assessed using chi - square test . chi - square test with continuity correction factor and fisher 's exact test were used in case of small cell frequencies . associations between specific variables including the age and bmd z and/or t scores were examined using pearson 's correlation coefficients . multiple linear regression analysis was applied to assess and examine the effect of different covariates such as age , gender , height z score , bmi z score , multivitamins , serum 25[oh]d , vitamin k , chronic p. aeruginosa colonization , and fev1 on outcome variable bmd z scores and/or t scores . a two - sided p value < 0.05 was considered to be statistically significant . all statistical analyses were done using the statistical package spss 19.0 ( spss inc . , chicago , il ) . thirty - three cf patients with i1234v cftr from a single large arab kindred tribe were approached to participate in this cross - sectional study . seven patients did not show up in follow - up cf clinic and their bmd values could not be recorded and hence were excluded from the statistical analysis . consequently twenty - six cf patients with cftr i1234v ( 16 males and 10 females ) from 14 families were enrolled in this study . there were three cf sibling pairs , three families with three cf siblings , and one family with four siblings . twenty - one cf patients were younger than 21 years and 5 cf patients were 21 years of age or older . the mean age ( standard deviation ) of the group was 17.29 4.95 years ranging from 10 to 33 years . seven patients ( 26.95% ) were exposed to sun for more than 30 minutes per day . serum calcium , phosphorus , alkaline phosphatase levels , vitamin k , albumin , and liver enzymes were all within the normal range . twenty cf subjects ( 76.9% ) had levels of 25[oh]d below the normal levels ( < 30 ng / ml ) and 6 cf patients had normal 25[oh]d levels . mean bmd z scores in the younger group were 0.69 0.96 ( l1l4 ) , 0.48 0.92 ( total hip ) , and 0.38 0.86 ( total body ) demonstrating more deficits at the lumbar spine . mean bmd t scores for patients 21 years or older were 0.14 1.13 ( l1l4 ) , 0.38 1 ( total hip ) , and 0.52 1.03 ( total body ) . six of the 7 cf patients with low bmd were younger than 21 years at one or more sites , the youngest being 14 years old . bmi was significantly lower among cf patients with low bmd ( 17.9 1.3 versus 23.7 6.5 ; p = 0.033 ) . vitamin d deficiency was found in 20 cf patients ( 76.9% ) with a mean of 25[oh]d tending to be lower in cf patients with low bmd . mean alp was found to be significantly higher in the vitamin d deficient group compared to normal vitamin d levels ( 122.9 53.2 versus 80.7 23.0 ; p = 0.011 ) . similarly , mean fev1 and bmi were observed to be higher in the vitamin d deficient group compared to normal vitamin d levels ; however , the difference did not achieve statistical significance ( p > 0.05 ) . among the patients younger than 21 years , fev1 was significantly and positively correlated with lumbar spine bmd z scores ( r = 0.755 ; p < 0.001 ) , total hip ( r = 0.672 ; p < 0.001 ) , and whole body ( r = 0.736 ; p < 0.001 ) . lumbar spine bmd z scores were positively correlated with bmi z scores , despite being not significant statistically ( r = 0.333 ; p > 0.05 ) ( figures 1 and 2 ) . among females mean lumbar spine bmd z scores were found to be higher compared to males ( 0.51 0.62 versus 0.86 1.19 ; p = 0.621 ) . there was no significant association observed between bmd z score and age , gender , height z scores , pseudomonas aeruginosa ( p. aeruginosa ) colonization , 25[oh]d levels , multivitamin , phosphorus , and alp ( p > 0.05 ) ( data not shown in the table ) . multiple linear regression analysis was used to assess the effect of age , gender , height z score , bmi z score , multivitamins , serum 25[oh]d , chronic p. aeruginosa colonization , and fev1 on outcome variable bmd z scores and showed that fev1 was significantly and positively associated with lumbar spine bmd z scores ( regression coefficient = 0.755 ; p < 0.001 ) , total hip z scores were significantly associated with fev1 ( regression coefficient = 0.522 ; p = 0.004 ) ( regression coefficient = 0.419 ; p = 0.017 ) , and whole - body z scores were significantly associated with fev1 ( regression coefficient = 0.514 ; p = 0.001 ) and bmi z scores ( regression coefficient = 0.382 ; p = 0.007 ) . in this study we observed low bmd during the first two decades of life in cf cohorts with cftr i1234v mutation associated with pancreatic sufficiency . bmd z score was significantly and positively associated with fev1 ; however , no significant association was observed with bmi in cf patients . in a study by gronowitz et al . reported bmd z scores were significantly lower in cf patients compared to normal population despite normal anthropometry and the strongest correlation was found with lung function . donadio et al . reported that most cf patients had bmd within normal limits and presented a positive correlation with pulmonary function and negatively correlated with chronological age and age at diagnosis . however , in our study there was no significant association observed between bmd and chronic p. aeruginosa colonization . data on association of cfrbd and nutritional status have been conflicting . a recent study suggested that the origin of cf bone disease in early childhood may be independent of nutritional status or disease severity . in contrast , another study suggested that bmd may be reduced and related to malnutrition and severity of disease , with males being more vulnerable . vitamin d plays a critical role in bone health by enhancing intestinal absorption of calcium and regulating bone turnover . the most striking finding in our study was that subjects with cf had significantly low serum 25[oh]d . about 76.9% of our patients with cf had 25[oh]d levels below 30 ng / ml , the suggested cutoff proposed by the consensus conference of the cystic fibrosis foundation . recently , we have reported a high prevalence of vitamin d deficiency despite normal pancreatic exocrine function , which might be related to the hot climate of the arabian gulf region and the usual traditional cloth that covers most of the body , and , in addition , they stay mainly indoors and may not have much adequate direct exposure to sun . in agreement with the recent study , it has been reported that inefficient levels of vitamin d are common and contribute significantly to impaired bone health and underline the need for higher supplementation doses in cf patients . in another study the result of an audit of dexa scan was reported for 108 adults with cf ; the most common risk factors for bone loss were vitamin d deficiency ( 89% ) , low body mass ( 39% ) , and post - lung transplantation ( 25% ) . however , there are conflicting reports regarding the correlation between 25[oh]d levels and decreased bmd [ 2022 ] . closer monitoring of vitamin d status in cf patients may be warranted because appropriate interventions at an early age may decrease the prevalence and severity of bone disease later in life . vitamin k deficiency is seen in 40% of patients with cf who are receiving fat - soluble vitamin supplementation . some limitation of the study must be stressed . the study was cross - sectional with a small cohort from whom we can not determine the mechanisms resulting in cfrbd . seven cf patients with cftr i1234v mutations did not show up in follow - up cf clinic and their bmd values could not be obtained and hence were excluded from the analysis . another limitation is that our bmd machine uses australian pediatrics norms as reference standard while for adults it uses lunar middle east norms which could have contributed to possible bias towards lower values in children younger than 21 years . however , we would like to stress the fact that the main objective of the study was not to compare the two groups together but to compare the bmd with lung function and the severity of illness by chronic p. aeruginosa colonization . bmd reduction does occur in cf patients with mild cftr mutation associated with pancreatic sufficiency . the results of our study suggest that pulmonary function ( fev1 ) and related factors might be the main determinants of bmd in cf . we recommend that all children and adults with cf undergo an assessment of bmd and body composition early in their life to make it possible to target those who need preventive treatment . follow - up data as a longitudinal study with the larger cohort of the mutation cftr i1234v in the gulf region is strongly recommended to develop effective preventive treatment and programs .

adolescence is a transitional period of life in which lifestyle including food habits are formed . adolescents tend to gain more money and to have more freedom to choose and buy their own foods and snacks . they also spend more time with their friends and imitate their behaviors , either healthy or unhealthy and newly formed ones establish gradually . recognizing food choices , behaviors and their related factors in adolescents are crucial as they affect adulthood health . as they make considerable portion of iranian population , investment on their health issues however , studies on dietary patterns of iranian adolescent indicated that they have inappropriate dietary patterns and food habits , include skipping meals , mainly breakfast , choosing unsuitable and non - nutritious snacks like sweet beverages , high fat and salty food item and low consumption of milk , fruits and vegetables that may cause growth retardation , metabolic changes resulting in reduced iq ( intelligence quotient ) , decreased concentration power , learning abilities and physical activities that totally affect reaching educational goals . adolescents spend lots of their day time at school and regarding their problem of skipping breakfast that effect their snack selection , school 's cafeteria are one of the major sources of providing their daily nutritional needs . many of these food centers supply unhealthy and low quality foods that can not meet nutritional needs of the students . so providing favorable , nutritious and healthy snacks , available via cafeterias , is an approach that may affect their food habits . further more , most of these food centers do not meet the minimum required standard of food services . in recent decade , there are trends toward qualitative methods in addition to quantitative researches . qualitative research is an easy , rapid and cost effective way of investigating ideas and understanding attitudes of studied population that in which , complexes statistical analysis is not used to state the results ; so it is an accepted technique for gathering information to plan appropriate intervention and policy making . so this qualitative study was done as a part of intervention program for training nutrition and health in order to improve schools cafeteria and food behavior of students to evaluate students snack habits regarding to their schools cafeteria status in tehran . this qualitative study was conducted on 240 students ( 12 - 15 years old ) using focus group discussion ( fgd ) technique . focus group discussion is the most important and efficient method of data collection in qualitative studies . subjects were selected randomly among the students , from 12 middle - schools in tehran ( n = 6 girls school and n = 6 boys schools ) . the students were informed about the importance of study and invited for participation as volunteers making them sure that all their opinions will be kept secret . field study consisted of 24 fgds was carried out . in each school , 2 fgds were holding separately , team including a moderator , a co - moderator , an observer and two note takers . focus group questions , including 10 questions , was designed according to two specific objects of the study ( breakfast and snacks consumption evaluation , cafeterias necessity and their evaluation ) by research team , then reviewed by an expert committee and modified based on their comments . after each session , records of two note takers were compared ; possible defects were completed and controlled by a recorder . before starting the field study , a pilot fgd was done with some students from a middle school which was not included into the main subjects of study , to match all team members performance and to check the questions intelligibility , study 's procedure and efficacy . finally , collected data were coded , categorized and analyzed using constant comparative method . data collection and analysis methods were performed and reviewed to make them valid . at the end of each meeting this study was approved by the research ethics committee ( no : 4230 ) of national nutrition and food technology research institute and all participants completed informed consent forms . why?what do you buy from school 's cafeterias?what is your opinion about school 's cafeteria ? based on the objectives , findings are presented in two parts : majority of students thought that eating breakfast is required and most of them consumed it . reason for skipping breakfast was mainly being late for school and poor appetite . in their opinion , honey , butter , jam , milk , bread and cheese , were nutritious for breakfast and about half of them , had bread with cheese , butter and walnut , as breakfast . their main reasons in this regard were : being energetic , useful to better understanding the lessons , prevent osteoporosis , increasing intelligence , having protein and vitamin contents , increasing height and making good mood . over half of their most important reasons were : preventing fatigue and hunger , providing energy , helping for better understanding the lessons , increasing intelligence , compensating for breakfast escape , having it as an entertainment and promoting health . the most consumed snacks among the students were cookies , fruits , bread and cheese , sandwiches , chocolate milk , fruit juices and potato chips . they thought that these snacks are nutritious ( having vitamins , protein , calcium and energy ) , useful for bone strength , prevent osteoporosis , and supply water for their body . majority of students stated that their schools cafeterias are not good . in their point of view , most of cafeteria are small , messy , and majority of the students mentioned about long queues for buying snacks and the cafeterias staff being unhygienic , with no uniforms and gloves . all of the students expect their schools cafeterias to be clean , larger and more organized , with suitable environment and equipments . majority of them believed that the staff must be hygienic , non smokers , wearing uniforms and gloves . majority of the students liked to have cafeterias as a necessary part of school , in the case of forgetting to bring snacks they can be beneficial to release their hunger . the most purchased items were : cookies , sandwiches with mayonnaise or ketchup , chocolate milks , soft drinks , potato chips , pop corn , chocolate , ice cream , puffed rice , fruit bars , nuts , dried fruits , jelly , cooked lentils and beans , roasted chickpeas , raisins , salted crackers , gum , tea , candy , fruits . their main reasons were making students satisfied by implementing their ideas and helping staffs for an efficient cafeteria . sources of nutritional knowledge for majority of the students were television , magazines , newspapers , parents , physicians , and teachers . their own experience , radio , media , relatives , classmates , friends , internet were other useful sources majority of students thought that eating breakfast is required and most of them consumed it . reason for skipping breakfast was mainly being late for school and poor appetite . in their opinion , honey , butter , jam , milk , bread and cheese , were nutritious for breakfast and about half of them , had bread with cheese , butter and walnut , as breakfast . their main reasons in this regard were : being energetic , useful to better understanding the lessons , prevent osteoporosis , increasing intelligence , having protein and vitamin contents , increasing height and making good mood . over half of their most important reasons were : preventing fatigue and hunger , providing energy , helping for better understanding the lessons , increasing intelligence , compensating for breakfast escape , having it as an entertainment and promoting health . the most consumed snacks among the students were cookies , fruits , bread and cheese , sandwiches , chocolate milk , fruit juices and potato chips . they thought that these snacks are nutritious ( having vitamins , protein , calcium and energy ) , useful for bone strength , prevent osteoporosis , and supply water for their body . majority of students thought that eating breakfast is required and most of them consumed it . reason for skipping breakfast was mainly being late for school and poor appetite . in their opinion , honey , butter , jam , milk , bread and cheese , were nutritious for breakfast and about half of them , had bread with cheese , butter and walnut , as breakfast . their main reasons in this regard were : being energetic , useful to better understanding the lessons , prevent osteoporosis , increasing intelligence , having protein and vitamin contents , increasing height and making good mood . their most important reasons were : preventing fatigue and hunger , providing energy , helping for better understanding the lessons , increasing intelligence , compensating for breakfast escape , having it as an entertainment and promoting health . the most consumed snacks among the students were cookies , fruits , bread and cheese , sandwiches , chocolate milk , fruit juices and potato chips . they thought that these snacks are nutritious ( having vitamins , protein , calcium and energy ) , useful for bone strength , prevent osteoporosis , and supply water for their body . majority of students stated that their schools cafeterias are not good . in their point of view , most of cafeteria are small , messy , and majority of the students mentioned about long queues for buying snacks and the cafeterias staff being unhygienic , with no uniforms and gloves . all of the students expect their schools cafeterias to be clean , larger and more organized , with suitable environment and equipments . majority of them believed that the staff must be hygienic , non smokers , wearing uniforms and gloves . majority of the students liked to have cafeterias as a necessary part of school , in the case of forgetting to bring snacks they can be beneficial to release their hunger . the most purchased items were : cookies , sandwiches with mayonnaise or ketchup , chocolate milks , soft drinks , potato chips , pop corn , chocolate , ice cream , puffed rice , fruit bars , nuts , dried fruits , jelly , cooked lentils and beans , roasted chickpeas , raisins , salted crackers , gum , tea , candy , fruits . their main reasons were making students satisfied by implementing their ideas and helping staffs for an efficient cafeteria . sources of nutritional knowledge for majority of the students were television , magazines , newspapers , parents , physicians , and teachers . their own experience , radio , media , relatives , classmates , friends , internet were other useful sources . majority of students stated that their schools cafeterias are not good . in their point of view , most of cafeteria are small , messy , and majority of the students mentioned about long queues for buying snacks and the cafeterias staff being unhygienic , with no uniforms and gloves . all of the students expect their schools cafeterias to be clean , larger and more organized , with suitable environment and equipments . majority of them believed that the staff must be hygienic , non smokers , wearing uniforms and gloves . majority of the students liked to have cafeterias as a necessary part of school , in the case of forgetting to bring snacks they can be beneficial to release their hunger . the most purchased items were : cookies , sandwiches with mayonnaise or ketchup , chocolate milks , soft drinks , potato chips , pop corn , chocolate , ice cream , puffed rice , fruit bars , nuts , dried fruits , jelly , cooked lentils and beans , roasted chickpeas , raisins , salted crackers , gum , tea , candy , fruits . their main reasons were making students satisfied by implementing their ideas and helping staffs for an efficient cafeteria . sources of nutritional knowledge for majority of the students were television , magazines , newspapers , parents , physicians , and teachers . their own experience , radio , media , relatives , classmates , friends , internet were other useful sources . in this study , fgd results showed that most of the students are aware of the necessity of breakfast and snack consumption and most of them eat breakfast which is consistent with other studies ; it seems that the students follow their own traditional patterns for their breakfast which is different from other countries patterns . reasons of skipping breakfast is nearly similar to findings of other studies in iran and other countries . morning snack consumption was a common fact among nearly all the students . despite their awareness of eating suitable snacks , consumption of non nutritious snacks was high at school . the most common consumed foods were biscuits , cookies , fruits and sandwiches which are consistent with other studies in iran . in italy , northern ireland and united state , variable cake , milk and soft drinks and sweet snacks were the most popular choices of students . it seems that being hungry is the most common reason of choosing cake and biscuits with milk or soft drinks as snacks by students . food availability , time , flavor and price could be also mentioned as determinant factors ; as it is shown that all these items are sweet and inexpensive to buy . croll and et al . , ( 2001 ) and sztainer and et al . , ( 1999 ) also mentioned hunger , food craving and cost in addition to parental influence on eating behaviors ( including the culture or religion of the family ) , benefits of foods ( including health ) , situation - specific factors , mood , body image , habit , media , time considerations of adolescents and parents and food availability were effective factors on food choices and eating behaviors . although , standardized cafeterias are important and necessary in schools , it seems that more than half of all cafeterias over the country are not acceptable neither environmental and equipments status nor food items . in study of cullen and et al . , ( 2007 ) , students declared that they prefer fresh and healthy foods , while they did nt have permanent access to these items . instead of plenty of unhealthy food , authors suggest that cafeterias in schools may cause eating less fruits , vegetables and milk and eating more soft drinks and chips . it seems that availability of healthy foods in cafeterias affect students snack habits . in conclusion , our findings showed that schools cafeterias are significant sources of supplying adolescents snacks which have undeniable impact on their snack habits . in the other words , although our students were enough aware of suitable foods to provide their nutritional needs , which resulted in their unsatisfaction with their cafeteria status , they continued to purchase their daily snacks , mainly because of hunger or peers impact and having no alternative option , which is consistent to other studies . schools cafeteria determine students food availability , as a result developing hygienic cafeterias containing healthy and nutritious food items is a key element to affect adolescents snack habits . reaching this goal requires administration of a multi disciplinary approach : it needs students cooperation in cafeterias , related activities as a part of nutrition education programs in which cafeterias would make informational and supportive environment , in addition to school principals and staff and parents help ; community and media support . these findings could be considered as an agenda for policy and decision makers of school nutrition programs , especially in respect of preventing non - communicable disease and promoting health of next generation .

bystanders often find it upsetting to witness an active person collapsing and becoming lifeless , especially young bystanders . cardiopulmonary resuscitation ( cpr ) can save lives , and has been practiced since about 200 b.c . current cpr techniques include mouth - to - mouth rescue breathing ( safar ) , chest compressions ( kouwenhoven ) , and defibrillation ( lown ) . the international liaison committee on resuscitation and american heart association ( aha ) published guidelines for cpr and emergency cardiovascular care in 2000 , 2005 , and 2010 . over the past 50 years , the rates of return of spontaneous circulation ( rosc ) and survival after cpr have been disappointing . in the united states , the rate of survival until hospital admission after ohca was 26.3% between 2005 and 2010 , and only 9.6% of patients are able to be discharged from hospital . in the 2010 aha guidelines , rapid initiation of effective chest compressions was upheld as the most important aspect of effective resuscitation in patients with cardiac arrest . although some studies found that rhythmic abdominal compression - cpr was superior to chest compression - cpr in terms of pressure and ventilation metrics , abdominal compression - cpr resulted in less carotid artery flow and longer delay until rosc rises . studies of alternative cpr techniques require evaluation of the resulting perfusion of vessels supplying the heart , brain , and other vital organs . hand - only cpr is recommended in ohca , especially in adults , because several important studies found that layperson hand - only cpr was associated with better survival after ohca compared to conventional cpr . performance of high - quality cpr is important , including achievement of effective chest compressions and minimization of the intervals between stopping chest compressions , opening the airway and performing defibrillation . real - time and other feedback systems can help to improve the quality of cpr . a randomized crossover trial included 24 health care professionals performing continuous chest compression cpr for 10 min with a cpro device and conventional manual cpr . studies found using cpr devices can reduce rescuer fatigue and pain during continuous chest compressions , resulting in a higher quality of cpr in simulated environments . however , a systematic review included 10 studies found insufficient evidence to support or refute the use of mechanical cpr devices in ohca settings or during ambulance transport . the linc randomized clinical trial which included 2589 patients with ohca conducted between 2008 and 2013 in 4 swedish , 1 british , and 1 dutch ambulance services and their referring hospitals found that mechanical cpr according to the present guidelines did not result in improved effectiveness compared with manual cpr . but cpr devices can provide a reliable alternative to manual cpr in a moving ambulance , reduce human resource requirements , and improve safety for emergency medical services ( ems ) personnel . use of alternative cpr techniques and devices may improve hemodynamic parameters and short - term survival when used by well - trained providers in selected patients . the 2010 aha guidelines recommend that trained rescuers should deliver rescue breathing using mouth - to - mouth or bag - mask techniques to provide oxygenation and ventilation . however , there is an ongoing debate regarding the optimal procedures for further ventilation , such as bag - mask ventilation and the use of endotracheal tubes , supraglottic airway devices , and the passive oxygenation . previously , all resuscitation protocols recommended early tracheal intubation as an important aspect of prehospital advanced life support . in the last decade , however , less invasive methods have been preferred for airway management in adult ohca patients . the 2010 european resuscitation council guidelines recommend prehospital tracheal intubation only if medical personnel with competent intubation skills are present , and only with minimal interruption of chest compressions . the 2010 aha guidelines recommend using the airway management device most familiar to the rescuer , and suggest that use of a supraglottic airway device may be as effective as bag - mask ventilation or tracheal intubation . a simple method of airway management like bag - mask ventilation is recommended for ohca . however , two recent studies found that the use of the laryngeal mask airway was probably associated with lower rates of neurologically intact survival than other methods of airway management . in the 2010 aha guidelines , rapid initiation of effective chest compressions was upheld as the most important aspect of effective resuscitation in patients with cardiac arrest . although some studies found that rhythmic abdominal compression - cpr was superior to chest compression - cpr in terms of pressure and ventilation metrics , abdominal compression - cpr resulted in less carotid artery flow and longer delay until rosc rises . studies of alternative cpr techniques require evaluation of the resulting perfusion of vessels supplying the heart , brain , and other vital organs . hand - only cpr is recommended in ohca , especially in adults , because several important studies found that layperson hand - only cpr was associated with better survival after ohca compared to conventional cpr . performance of high - quality cpr is important , including achievement of effective chest compressions and minimization of the intervals between stopping chest compressions , opening the airway and performing defibrillation . real - time and other feedback systems can help to improve the quality of cpr . a randomized crossover trial included 24 health care professionals performing continuous chest compression cpr for 10 min with a cpro device and conventional manual cpr . studies found using cpr devices can reduce rescuer fatigue and pain during continuous chest compressions , resulting in a higher quality of cpr in simulated environments . however , a systematic review included 10 studies found insufficient evidence to support or refute the use of mechanical cpr devices in ohca settings or during ambulance transport . the linc randomized clinical trial which included 2589 patients with ohca conducted between 2008 and 2013 in 4 swedish , 1 british , and 1 dutch ambulance services and their referring hospitals found that mechanical cpr according to the present guidelines did not result in improved effectiveness compared with manual cpr . but cpr devices can provide a reliable alternative to manual cpr in a moving ambulance , reduce human resource requirements , and improve safety for emergency medical services ( ems ) personnel . use of alternative cpr techniques and devices may improve hemodynamic parameters and short - term survival when used by well - trained providers in selected patients . the 2010 aha guidelines recommend that trained rescuers should deliver rescue breathing using mouth - to - mouth or bag - mask techniques to provide oxygenation and ventilation . however , there is an ongoing debate regarding the optimal procedures for further ventilation , such as bag - mask ventilation and the use of endotracheal tubes , supraglottic airway devices , and the passive oxygenation . previously , all resuscitation protocols recommended early tracheal intubation as an important aspect of prehospital advanced life support . in the last decade , however , less invasive methods have been preferred for airway management in adult ohca patients . the 2010 european resuscitation council guidelines recommend prehospital tracheal intubation only if medical personnel with competent intubation skills are present , and only with minimal interruption of chest compressions . the 2010 aha guidelines recommend using the airway management device most familiar to the rescuer , and suggest that use of a supraglottic airway device may be as effective as bag - mask ventilation or tracheal intubation . a simple method of airway management like bag - mask ventilation is recommended for ohca . however , two recent studies found that the use of the laryngeal mask airway was probably associated with lower rates of neurologically intact survival than other methods of airway management . early defibrillation is critical for survival after adult sudden cardiac arrest for several reasons : the most frequent initial rhythm is ventricular fibrillation ( vf ) , the most effective treatment for vf is defibrillation , the probability of successful defibrillation diminishes rapidly over time , and vf tends to deteriorate to asystole over time . the 2010 aha guidelines recommend integration of cpr and automated external defibrillator ( aed ) use , to give the patient the best chance of survival . when there are two or more rescuers present , one rescuer should immediately start cpr while the other activates the emergency response system and prepares the defibrillator . the cardiac arrest registry to enhance survival surveillance from 2005 to 2010 found that only 33.3% of ohca patients received bystander cpr , and an aed was only used in 3.7% of cases by bystanders before the arrival of ems providers . after a few minutes of vf , the oxygen supply and metabolic substrates of the myocardium are exhausted . a period of chest compressions before delivering a shock can deliver oxygen and metabolic substrates to the myocardium , thereby increasing the probability of a shock terminating vf and inducing rosc . the 2005 aha guidelines recommended that ems personnel should perform cpr for 2 min before the first analysis of cardiac rhythm . this recommendation was changed in the 2010 aha guidelines , which state that there is inconsistent evidence to support or refute such a delay in the analysis of cardiac rhythm . a recent study by stiell et al . found no difference in the outcome after ohca between a brief period ( 3060 s ) or a longer period ( 180 s ) of ems - administered cpr before the first analysis of cardiac rhythm . the resuscitation outcomes consortium primed trial found that shorter peri - shock pauses were significantly associated with a higher likelihood of survival in patients with cardiac arrest who presented with a shockable rhythm . future advances in cpr education and technology should focus on minimizing peri - shock pauses . longer peri - shock pauses were independently associated with a lower rate of survival to hospital discharge . two human studies ( conducted in 2006 and 2008 ) compared a one - shock protocol with a three - stacked - shock protocol for the treatment of vf cardiac arrest , and found that the one shock protocol was associated with a significant survival benefit compared with three - stacked - shock protocols . almost all studies found that lower - energy biphasic waveform shocks had a higher or equivalent success rate for termination of vf than monophasic waveform shocks . the 2010 aha guidelines suggest that it is reasonable to use a one - shock protocol for vf , preferably with a biphasic waveform shock , followed immediately by cpr . early defibrillation is critical for survival after adult sudden cardiac arrest for several reasons : the most frequent initial rhythm is ventricular fibrillation ( vf ) , the most effective treatment for vf is defibrillation , the probability of successful defibrillation diminishes rapidly over time , and vf tends to deteriorate to asystole over time . the 2010 aha guidelines recommend integration of cpr and automated external defibrillator ( aed ) use , to give the patient the best chance of survival . when there are two or more rescuers present , one rescuer should immediately start cpr while the other activates the emergency response system and prepares the defibrillator . the cardiac arrest registry to enhance survival surveillance from 2005 to 2010 found that only 33.3% of ohca patients received bystander cpr , and an aed was only used in 3.7% of cases by bystanders before the arrival of ems providers . after a few minutes of vf , the oxygen supply and metabolic substrates of the myocardium are exhausted . a period of chest compressions before delivering a shock can deliver oxygen and metabolic substrates to the myocardium , thereby increasing the probability of a shock terminating vf and inducing rosc . the 2005 aha guidelines recommended that ems personnel should perform cpr for 2 min before the first analysis of cardiac rhythm . this recommendation was changed in the 2010 aha guidelines , which state that there is inconsistent evidence to support or refute such a delay in the analysis of cardiac rhythm . a recent study by stiell et al . found no difference in the outcome after ohca between a brief period ( 3060 s ) or a longer period ( 180 s ) of ems - administered cpr before the first analysis of cardiac rhythm . the resuscitation outcomes consortium primed trial found that shorter peri - shock pauses were significantly associated with a higher likelihood of survival in patients with cardiac arrest who presented with a shockable rhythm . future advances in cpr education and technology should focus on minimizing peri - shock pauses . longer peri - shock pauses were independently associated with a lower rate of survival to hospital discharge . two human studies ( conducted in 2006 and 2008 ) compared a one - shock protocol with a three - stacked - shock protocol for the treatment of vf cardiac arrest , and found that the one shock protocol was associated with a significant survival benefit compared with three - stacked - shock protocols . almost all studies found that lower - energy biphasic waveform shocks had a higher or equivalent success rate for termination of vf than monophasic waveform shocks . the 2010 aha guidelines suggest that it is reasonable to use a one - shock protocol for vf , preferably with a biphasic waveform shock , followed immediately by cpr . adrenaline can increase cerebral perfusion pressure and coronary perfusion during cpr via alpha-1-adrenoceptor agonist effects . however , the dose , timing , and indications for adrenaline use are based on limited evidence . initial guidelines for the treatment of cardiac arrest recommended administration of intracardiac adrenaline ( 0.5 mg ) or high - dose intravenous adrenaline ( 10 mg ) , repeating with larger doses if required . the 2010 aha guidelines recommend administration of 1 mg of intravenous or intraosseous adrenaline every 35 min for adult cardiac arrest . if intravenous / intraosseous access is delayed or can not be established , adrenaline may be given endotracheally at a dose of 22.5 mg . however , recent research found that less frequent adrenaline use was associated with improved survival after ohca . the dose of adrenaline used during cpr has decreased over recent years . the first randomized controlled trial of adrenaline use compared high - dose adrenaline ( 10 mg ) with placebo after in - hospital cardiac arrest or ohca , and found no difference in short- or long - term survival between the two treatment groups . another randomized trial compared use of 1 mg doses of adrenaline with placebo , and found better short - term survival in the adrenaline group but no significant difference in long - term survival between the two groups , and could not exclude the possibility of harm from adrenaline use . experimental studies suggest that the adrenaline impairs cerebral macrovascular and microvascular blood flow , increases ventricular arrhythmias , and increases myocardial dysfunction after rosc . several animal experiments found that the use of vasopressin resulted in improved survival compared with the use of adrenaline in asphyxial cardiac arrest models . studies comparing the use of a combination of vasopressin , steroids , adrenaline compared with adrenaline alone , and of cytidine diphosphate choline compared with adrenaline , did not find better outcomes in the adrenaline groups . for in - hospital cardiac arrest , the rate of rosc is significantly higher when vasopressin is used compared with epinephrine . a subgroup meta - analysis found that the rates of rosc , survival to hospital admission , survival to hospital discharge , and favorable neurological outcome may increase with the use of four to five boluses of vasopressin titrated to the desired effect , but no beneficial effect of vasopressin use was observed in unselected cardiac arrest patients . a chinese study compared the use of adrenaline with shen - fu injection ( a chinese herbal medicine ) in a porcine model of prolonged cardiac arrest and found that shen - fu injection was associated with better oxygen metabolism and hemodynamic status . the available clinical data indicate that administration of adrenaline during cpr can increase short - term survival , but may have no benefit or even a harmful effect on long - term survival and neurological functional recovery . prospective trials are needed to determine the optimal dose , timing , and patient selection for use of adrenaline during the treatment of cardiac arrest . adrenaline can increase cerebral perfusion pressure and coronary perfusion during cpr via alpha-1-adrenoceptor agonist effects . however , the dose , timing , and indications for adrenaline use are based on limited evidence . initial guidelines for the treatment of cardiac arrest recommended administration of intracardiac adrenaline ( 0.5 mg ) or high - dose intravenous adrenaline ( 10 mg ) , repeating with larger doses if required . the 2010 aha guidelines recommend administration of 1 mg of intravenous or intraosseous adrenaline every 35 min for adult cardiac arrest . if intravenous / intraosseous access is delayed or can not be established , adrenaline may be given endotracheally at a dose of 22.5 mg . however , recent research found that less frequent adrenaline use was associated with improved survival after ohca . the dose of adrenaline used during cpr has decreased over recent years . the first randomized controlled trial of adrenaline use compared high - dose adrenaline ( 10 mg ) with placebo after in - hospital cardiac arrest or ohca , and found no difference in short- or long - term survival between the two treatment groups . another randomized trial compared use of 1 mg doses of adrenaline with placebo , and found better short - term survival in the adrenaline group but no significant difference in long - term survival between the two groups , and could not exclude the possibility of harm from adrenaline use . experimental studies suggest that the adrenaline impairs cerebral macrovascular and microvascular blood flow , increases ventricular arrhythmias , and increases myocardial dysfunction after rosc . several animal experiments found that the use of vasopressin resulted in improved survival compared with the use of adrenaline in asphyxial cardiac arrest models . studies comparing the use of a combination of vasopressin , steroids , adrenaline compared with adrenaline alone , and of cytidine diphosphate choline compared with adrenaline , did not find better outcomes in the adrenaline groups . for in - hospital cardiac arrest , the rate of rosc is significantly higher when vasopressin is used compared with epinephrine . a subgroup meta - analysis found that the rates of rosc , survival to hospital admission , survival to hospital discharge , and favorable neurological outcome may increase with the use of four to five boluses of vasopressin titrated to the desired effect , but no beneficial effect of vasopressin use was observed in unselected cardiac arrest patients . a chinese study compared the use of adrenaline with shen - fu injection ( a chinese herbal medicine ) in a porcine model of prolonged cardiac arrest and found that shen - fu injection was associated with better oxygen metabolism and hemodynamic status . the available clinical data indicate that administration of adrenaline during cpr can increase short - term survival , but may have no benefit or even a harmful effect on long - term survival and neurological functional recovery . prospective trials are needed to determine the optimal dose , timing , and patient selection for use of adrenaline during the treatment of cardiac arrest . for the protection of the brain and other organs , hypothermia is a helpful therapeutic approach in patients who remain comatose ( usually defined as a lack of meaningful response to verbal commands ) after rosc . targeted temperature management ( ttm ) has been investigated experimentally and used clinically for over 100 years . ttm is recommended in the 2010 aha guidelines , and its use has been extended to ohca with arrhythmia other than vf as well as to in - hospital cardiac arrest . although a cochrane review supports these guidelines , some researchers have suggested an urgent need for further trials to confirm or refute the current recommendations . in 2002 , two important clinical trials were published in the new england journal of medicine , which compared patients who remained unconscious after rosc and received ttm ( 3234c for 1224 h ) with those who remained unconscious after rosc and received standard treatment . one study included 77 subjects who were randomly assigned to treatment with hypothermia ( with temperature reduced to 33c within 2 h after the rosc and maintained for 12 h ) or normothermia . the other multicenter trial was prepared by hypothermia after cardiac arrest study group , 75 of the 136 patients in the hypothermia group had a favorable neurologic outcome , as compared with 54 of 137 in the normothermia group . these trials showed a significant improvement in neurological function and survival in patients treated with ttm . in 2011 , a research team from the american college of chest physicians reviewed studies of ttm , and strongly recommended use of ttm to a target of 3234c in ohca patients who first presented with vf or pulseless ventricular tachycardia and remained unconscious after rosc . however , nielsen et al . found that ttm to a target of 33c did not confer any benefit compared with a target of 36c in 939 ohca patients who remained unconscious after rosc . used a murine cardiac arrest model to compare cooling during cardiac arrest and before rosc ( intra - arrest hypothermia ) with post - rosc cooling , and found that intra - arrest cooling had a significant survival benefit compared with post - rosc cooling or normothermic resuscitation . a study from the weil institute of critical care medicine of america found that both intra - arrest head cooling and delayed surface cooling improved post - resuscitation myocardial function , with the most beneficial effect observed when head cooling was initiated during cpr . they also found that initiation of intranasal cooling at the start of cpr significantly improved the success of resuscitation in a porcine model of prolonged cardiac arrest . many studies over the past decade have evaluated various aspects of cpr in ohca . some of these studies were high - quality randomized controlled trials , which helped to improve the scientific understanding of resuscitation techniques and resulted in changes to cpr guidelines . for example , the previous airway - breathing - circulation basic life support algorithm for adults with cardiac arrest has changed to circulation - airway - breathing , and postcardiac arrest care has recently attracted more attention in accordance with the development of cardiocerebral resuscitation philosophies . the rates of rosc and survival after cpr are still disappointing . according to the 2012 national utstein report , the overall rate of rocs after ohca was 59% and the overall rate of survival after ohca was 10% . the survival rate was 3.75 times higher after witnessed ohca ( 15% ) than after unwitnessed ohca ( 4% ) . the survival rate after witnessed and shockable ohca with bystander cpr was 37% , but only 4% of bystanders used an aed . although technological advances like aed development have contributed to increased survival rates after cardiac arrest , no initial intervention will be performed unless bystanders are ready , willing , and able to act . it is , therefore , necessary to increase public education regarding cpr techniques in addition to studying the effectiveness of various interventions . education of public officials and community members regarding the importance of increasing the rate of bystander cpr and promotion of aed use by lay and professional rescuers , are important aspects of increasing survival rates . uninterrupted chest compressions , simple and effective airway management procedures during bystander cpr will continue to be highly recommended . although epinephrine is mostly used for successful rosc , the influence of this drug on recovery during the postcardiac arrest phase is debatable , and recently a few studies found that use of epinephrine was consistently associated with a lower chance of survival after return to rosc . future studies will focus on if and how epinephrine may provide long - term functional survival benefit . strongly recommendation of using ttm and

a total of 12 mouse lemurs of both sexes ( center for breeding and experimental conditioning of animal models , university montpellier 2 , montpellier , france ) were maintained in animal biosafety level 3 facilities , according to requirements of the french ethics committee ( authorization ce - lr-0810 ) . young and adult lemurs were fed ( 8 animals ) or ic inoculated ( 4 animals ) with 5 or 50 mg of l - bse infected brain tissue ( 10% homogenate in 5% glucose ) ( table ) . the isolate for the l - bse agent ( 022528 ) was derived from cattle in france ( 11 ) . when progression of prion disease was evident , the lemurs were euthanized and their brains were isolated . brains were processed for western blot analysis with sha31 monoclonal antibody against prp for prp detection , as described in mice ( 11 ) ; for histologic examination by using hematoxylin and eosin staining ; and for disease - associated prion protein ( prpd ) immunochemical detection by using the paraffin - embedded tissue blot method or immunohistochemical analysis with monoclonal antibody 3f4 against prp . * l - bse , l - type bovine spongiform encephalopathy source ; prpd , disease - associated prion protein . results obtained by western blot analysis and/or paraffin - embedded tissue - blot analysis and/or immunohistochemical analysis . beginning 3 months before the terminal stage of the disease ( 1922 months after inoculation ) , neurologic symptoms developed in the 4 mouse lemurs that received ic inoculations ( table ) . in all 4 animals , initial clinical signs and symptoms were blindness , thigmotaxic behavior , and poor appearance of the fur . next , locomotion became slower , followed by incoordination and loss of balance in the last month of life . one orally inoculated lemur , which was fed 5 mg of infected brain and euthanized 27 months later , had signs and symptoms of disease similar to those in ic - inoculated animals , except for the ipsilateral circling behavior . in 2 lemurs fed 50 mg and 2 others fed 5 mg of l - bse infected brain , clinical signs and symptoms of prion disease developed just a few weeks before the animals were euthanized ( 18 and 32 months and 33 and 34 months after inoculation , respectively ) . disease was characterized by progressive prostration , loss of appetite , and poor appearance of the fur , without incoordination or disequilibrium . the 3 remaining lemurs were orally inoculated at 2 years of age and were still alive and healthy 28 months after inoculation ( table ) . prp was readily detected by western blot analysis in brain extracts ( thalamus / hypothalamus region ) from 8 of the 9 animals examined ( table ) , although at lower levels in the lemur that was euthanized earlier ( i.e. , 18 months after inoculation ) . western blot analyses showed uniform prp molecular profiles , irrespective of the route or dose of inoculation , with a low apparent molecular mass ( 19 kda , similar to the prp in the original cattle brain ) ( figure 1 ) . however , the prp profile in mouse lemurs was characterized by a higher proportion of di- and monoglycosylated species ( > 95% of the total signal ) than in the inoculum of the agent of bovine l - bse ( 80% ) . in addition , prp was detected by western blot in the spleens of 3 ( 1 ic inoculated and 2 fed with 5 mg of cattle brain ) of the 9 animals examined ( figure 1 ) . western blot analysis of protease - resistant prion protein in the brain ( thalamus / hypothalamus ) and spleen of mouse lemurs inoculated with a cattle - derived l - type bovine spongiform encephalopathy ( bse ) isolate by oral and intracerebral routes by using sha31 monoclonal antibody against prion protein . lanes 1 , 7 : cattle l - type bse isolate ( 02 - 2528 ) ; lanes 2 , 3 : brain sample from intracerebral inoculation at 5 mg ; lane 4 : brain sample from oral inoculation at 50 mg ; lanes 5 , 6 : brain sample from oral inoculation at 5 mg ; lanes 8 , 9 : spleen samples from oral inoculation at 5 mg , positive and negative , respectively . histopathologic analysis showed severe spongiform changes in the brains of the 4 ic - inoculated mouse lemurs ( figure 2 , panel a ) . the brains displayed a pattern of vacuolation characterized by intense spongiosis with many confluent vacuoles in the basal telencephalon ( septum , striatum , caudate putamen nuclei ) , midbrain ( thalamus , hypothalamus ) , mesencephalon ( colliculi ) , and in some parts of the brainstem ( tegmental ventral area , raphe nuclei ) . cerebellum showed occasional small - size vacuoles . among the 5 orally inoculated animals , 2 ( 1 fed 5 mg , the other fed 50 mg ) showed histopathologic features similar to those observed in ic - inoculated animals . in the other 3 orally inoculated animals , spongiosis was characterized by fewer vacuoles and was restricted to the striatum ( figure 2 , panel b ) , thalamus , colliculi , and brainstem . histopathologic and disease - associated prion protein ( prpd ) immunodetection in the brain of 2 mouse lemurs after intracerebral ( 5 mg ) or oral ( 50 mg ) inoculation with a cattle - derived l - type bovine spongiform encephalopathy isolate . a , b ) spongiosis in the striatum ; scale bars = 30 m . c , d ) paraffin - embedded tissue blot analysis of sagittal brain section ; scale bars = 500 m . analyses in c f were performed by using the 3f4 monoclonal antibody against prp . distribution of prpd in the brain was assessed by paraffin - embedded tissue blot ( figure 2 , panels c and d ) or immunohistochemical analysis with 3f4 antibody ( figure 2 , panels e and f ) . results for ic - inoculated animals showed that prpd strongly accumulated in a dense synaptic pattern associated with nonamyloid plaques in the striatum , several thalamic nuclei ( figure 2 , panel e ) , the external cortex of the colliculi , and the tegmental area . other areas that were slightly less affected ( e.g. , neocortex and hippocampus ) showed few coarse granules and synaptic deposits . the cortical molecular layer and the corpus callosum were devoid of prpd ( figure 2 , panel c ) . in orally inoculated animals , prpd was strongly accumulated in the striatum and thalamus ( figure 2 , panel d ) but weakly accumulated in the cortex . immunohistochemical analysis showed synaptic deposits ( figure 2 , panel f ) , and some focal deposits were evident in animals that survived longer . we demonstrated that the agent of l - bse can be transmitted by the oral route from cattle to mouse lemurs . as expected , orally inoculated animals survived longer than ic - inoculated animals . orally inoculated lemurs had less severe clinical signs and symptoms , with no evidence of motor dysfunction . it was previously suggested that the agent of l - bse might be involved in the foodborne transmission of a prion disease in mink ( 11,12 ) , a species in which several outbreaks of transmissible mink encephalopathy had been identified , notably in the united states ( 13 ) . our study clearly confirms , experimentally , the potential risk for interspecies oral transmission of the agent of l - bse . in our model , this risk appears higher than that for the agent of classical bse , which could only be transmitted to mouse lemurs after a first passage in macaques ( 14 ) . we report oral transmission of the l - bse agent in young and adult primates . transmission by the ic route has also been reported in young macaques ( 6,7 ) . a previous study of l - bse in transgenic mice expressing human prp suggested an absence of any transmission barrier between cattle and humans for this particular strain of the agent of bse , in contrast to findings for the agent of classical bse ( 9 ) . thus , it is imperative to maintain measures that prevent the entry of tissues from cattle possibly infected with the agent of l - bse into the food chain .

the incidence of these disorders in pregnancy is likely to rise with the rising prevalence of obesity . hypertensive disorder is the leading cause of maternal mortality in india , accounting for more than 8% of maternal deaths . the identification and effective management of this entity play a significant role in both maternal and fetal outcome . it has been estimated that infants born to women with preexisting or gestational hypertension have a 16% risk of perinatal death or serious morbidity and with 36% of them needing high - level neonatal care . pharmacotherapy in pregnancy represents a special concern because of the potential risk of teratogenicity and the altered physiological state of the mother . up to 10% of congenital anomalies may be ascribed to exposure to medications , alcohol , or other exogenous factors that have adverse effects on the developing embryo or fetus . the rising use of drugs during pregnancy supports the importance of expanding the evidence about the risks and benefits of drug use during pregnancy and also suggests the need for systems to safeguard prescribing practices for women of reproductive age . despite the publication of a number of guidelines regarding proper drug use in hypertensive pregnancies , it is not possible to uniformly implement these because of patient specific disease states , the resident doctor 's learning curve , and the physician 's medication preferences . although the world health organization has developed the drug use indicators for evaluating drug use patterns in a region or facility , these are general indicators that do not refer to particular health problem and neither led directly to particular focused interventions required . a thorough literature search could not reveal any data on drug usage in complicated pregnancies and its outcome in the indian scenario . the primary objective of the present study was to assess the quality of health care in severe preeclampsia and eclampsia in context to the indian health care setting . the secondary objective of this study was to evaluate the dynamics of prescribing behavior in this health disorder . this prospective cohort study was conducted in the obstetrics and gynecological department of sir sundar lal ( ssl ) hospital of institute of medical sciences , banaras hindu university , varanasi , which is a large indian city having a population more than 4 millions . ssl hospital is a large tertiary care hospital funded by the government and most of the services here are provided free of cost . all gravid women with severe preeclampsia and eclampsia admitted to the obstetrics unit between november 2005 and february 2007 were included as the plan of the study was approved by the institute 's ethics committee and written informed consent was obtained from all women before participation in the study . detailed information regarding clinical features , antepartum and intrapartum care , eclamptic episode , and the maternal and perinatal outcome was sought by analysis of the inpatient case sheets , patient interviews , obstetrician , and the nursing staff . the gestational age at the time of the eclamptic fit was recorded . in postpartum eclampsia , this was taken to be the gestational age at delivery . maternal morbidity was defined as women having at least one complication of eclampsia or as a result of the management of eclampsia . severe preeclampsia was defined by blood pressure readings higher than 160/110 mm hg and > 5 g of proteinuria in a 24-h urine collection or > 3 + urine dipstick testing of two random urine samples . eclampsia was defined as presence of new onset seizures in a woman with preeclampsia [ american college of obstetrics and gynaecology ( acog ) ] . the treatment guidelines recommended by the national high blood pressure education program ( nhbpep ) working group report and the acog guideline are taken into consideration for the management of severe preeclampsia / eclampsia . the evidence gained by the magpie trial and the collaborative eclampsia trial drugs used by the women each day were entered into a predesigned case record form . numbers of drugs prescribed to each patient during the entire duration of hospital stay were calculated . values are expressed as mean with standard deviation , median with interquartile range , numbers , and as percentages . baseline parameters were compared by student 's paired or unpaired t - test for continuous variables and chi - square or fisher 's exact test was used for categorical variables . kaplan - meir survival curve was plotted to assess the gestational age at time of diagnosis . the treatment guidelines recommended by the national high blood pressure education program ( nhbpep ) working group report and the acog guideline are taken into consideration for the management of severe preeclampsia / eclampsia . the evidence gained by the magpie trial and the collaborative eclampsia trial was used as standards against which the drug use was measured . drugs used by the women each day were entered into a predesigned case record form . numbers of drugs prescribed to each patient during the entire duration of hospital stay were calculated . values are expressed as mean with standard deviation , median with interquartile range , numbers , and as percentages . baseline parameters were compared by student 's paired or unpaired t - test for continuous variables and chi - square or fisher 's exact test was used for categorical variables . kaplan - meir survival curve was plotted to assess the gestational age at time of diagnosis . the treatment guidelines recommended by the national high blood pressure education program ( nhbpep ) working group report and the acog guideline are taken into consideration for the management of severe preeclampsia / eclampsia . the evidence gained by the magpie trial and the collaborative eclampsia trial was used as standards against which the drug use was measured . drugs used by the women each day were entered into a predesigned case record form . numbers of drugs prescribed to each patient during the entire duration of hospital stay were calculated . values are expressed as mean with standard deviation , median with interquartile range , numbers , and as percentages . baseline parameters were compared by student 's paired or unpaired t - test for continuous variables and chi - square or fisher 's exact test was used for categorical variables . kaplan - meir survival curve was plotted to assess the gestational age at time of diagnosis . during the study period of 14 months , 198 admissions related to hypertensive disorders of pregnancy were recorded . patient disposition in the study is summarized following the strengthening and the reporting of observational studies in epidemiology ( strobe ) in figure 1 and their demographic and clinical characteristics in table 1 . the median age at delivery of the 164 women included in the study was 25 ( 22 - 28 ) . majority of the cases were antepartum eclampsia 86 ( 52.5% ) , followed by preeclampsia 51(31% ) and postpartum eclampsia 27(16.5% ) . nulliparous status ( 62% ) was significantly more common in eclampsia group ( < 0.001 ) , while multiparous women ( 59% ) were commoner in preeclamptic group [ table 1 ] . the gestational age at the time of diagnosis in three groups is presented in figure 2 . patient flow diagram ( strobe ) : assessment of clinical outcomes and prescribing behaviour in preeclampsia and eclampsia demographic , clinical features , and outcome of women with severe preeclampsia and eclampsia kaplan - meir curves to show probability of diagnosis of severe preeclampsia / eclamptic episode ( antepartum and intrapartum seizures ) or delivery ( postpartum seizures ) at different gestational ages the clinical features , maternal and perinatal outcome are summarized in table 1 . headache was most common symptom in both preeclampsia and eclampsia group ( 41.2% vs. 54.9% , p = 0.073 ) , while most common sign was oedema in preeclampsia ( 65% vs. 37% , p = 0.001 ) and hyperreflexia in eclampsia group ( 42% ) . proteinuria was found to be significantly more common in eclampsia group ( 88% ) as compared with preeclampsia ( 65% , p = 0.001 ) . regarding maternal outcome , mortality was observed in 6 ( 5 % ) women in eclampsia group , while none in preeclampsia group . the maternal morbidity due to infectious causes was also found to be high ( 34% ) in our study population . this morbidity has also led to prolonged hospital stay in these women ( 14.98 9.6 days ) as compared with the other women ( 9.97 4.58 days , p < 0.001 ) . a total of 27% of patient in eclampsia group required admission to intensive care in eclampsia group , while it was 10% in preeclampsia group ( p = 0.03 ) . the most common mode of the delivery in both groups was through lower segment cesarean section ( lscs ) . the fetal mortality was high ( 17% ) in eclampsia group as compared with 6% in preeclampsia group ( p = 0.09 ) . fetal distress and intrauterine growth retardation ( iugr ) were not significantly different in the two groups . a total of 50% of the newborn were having birth weight between 1.5 and 2.5 kg which was consequent with their premature birth . average number of drugs prescribed in women of preeclampsia , antepartum eclampsia , and postpartum eclampsia were 13.2 , 14.9 , and 14.2 , respectively . the percentage distribution of different classes of drugs in three groups is shown in figure 3 . antibiotics are the most common class of the drugs prescribed in all the groups , followed by vitamin and calcium supplements . anticonvulsants were the next most frequently prescribed drug in eclampsia women ( both ante and post partum ) , while antihypertensives were more common in cases of preeclampsia women and also represent the next most common class of drugs in case of eclampsia . antiemetic , gastroprotective , and analgesics constituted the other classes of drugs prescribed in these patient populations as shown in figure 3 . percentage use of drugs in patients of eclampsia ( n= 164 ) the prescription pattern of individual antihypertensive drugs is described in table 2 . the average number of antihypertensives prescribed was 1.8 drugs per patient ( 1.8 1.6 ) in preeclampsia . in antepartum eclampsia , an average of 1.7 ( 1.7 1.4 ) and in postpartum eclampsia an average of 1.6 drugs ( 1.6 1.3 ) were antihypertensives . calcium channel blockers ( ccbs ) were the most frequently prescribed antihypertensives ( 71% ) , followed by -blockers ( 21% ) . sympatholytics ( alpha methyldopa ) and diuretics ( furosemide ) were prescribed in 18% of women , while nitrates were given to 11 % of women population . nifedipine and amlodipine were the ccbs of choice prescribed , while atenolol was the preferred -blocker . prescription pattern of antihypertensive and anticonvulsant drugs the average number of anticonvulsant prescribed were 0.3 drugs per woman ( 0.3 0.7 ) in preeclampsia , 1.9 drugs per woman ( 1.9 1.0 ) in antepartum eclampsia and 1.8 drugs on an average ( 1.8 0.7 ) in case of postpartum eclampsia . magnesium sulphate ( mgso4 ) was clearly the anticonvulsant of choice , prescribed in 116 women . all ( 100% ) of the patients with eclampsia received mgso4 either alone or in combination , while only three ( 5.8% ) prescriptions in severe preeclampsia group received it [ table 2 ] . the cases showing disorientation , or diminished patellar reflex , decreased urine output , respiratory irregularity , or recurrence of seizures , while on mgso4 therapy were simultaneously put on intervenous phenytoin therapy . the choice of addition of third drug was to control seizure purely as trial and error in solitary atypical cases not controlled by standard approach . the reasons of discontinuation of mgso4 therapy were adequate seizure control or appearance of any of the above mentioned adverse effects . a combination of metronidazole , gentamicin , and cephalosporin ( mostly third generation ) was the most common antibiotic regimen prescribed , representing 63% of the antibiotic use . among these women , this was followed by the combination of metronidazole and third generation cephalosporins in 23% women in the study cohort . very few women received penicillin along with either metronidazole or gentamicin . a small percentage ( 6.6% ) of women during the study period of 14 months , 198 admissions related to hypertensive disorders of pregnancy were recorded . patient disposition in the study is summarized following the strengthening and the reporting of observational studies in epidemiology ( strobe ) in figure 1 and their demographic and clinical characteristics in table 1 . the median age at delivery of the 164 women included in the study was 25 ( 22 - 28 ) . majority of the cases were antepartum eclampsia 86 ( 52.5% ) , followed by preeclampsia 51(31% ) and postpartum eclampsia 27(16.5% ) . nulliparous status ( 62% ) was significantly more common in eclampsia group ( < 0.001 ) , while multiparous women ( 59% ) were commoner in preeclamptic group [ table 1 ] . the gestational age at the time of diagnosis in three groups is presented in figure 2 . patient flow diagram ( strobe ) : assessment of clinical outcomes and prescribing behaviour in preeclampsia and eclampsia demographic , clinical features , and outcome of women with severe preeclampsia and eclampsia kaplan - meir curves to show probability of diagnosis of severe preeclampsia / eclamptic episode ( antepartum and intrapartum seizures ) or delivery ( postpartum seizures ) at different gestational ages the clinical features , maternal and perinatal outcome are summarized in table 1 . headache was most common symptom in both preeclampsia and eclampsia group ( 41.2% vs. 54.9% , p = 0.073 ) , while most common sign was oedema in preeclampsia ( 65% vs. 37% , p = 0.001 ) and hyperreflexia in eclampsia group ( 42% ) . proteinuria was found to be significantly more common in eclampsia group ( 88% ) as compared with preeclampsia ( 65% , p = 0.001 ) . regarding maternal outcome , mortality was observed in 6 ( 5 % ) women in eclampsia group , while none in preeclampsia group . the maternal morbidity due to infectious causes was also found to be high ( 34% ) in our study population . this morbidity has also led to prolonged hospital stay in these women ( 14.98 9.6 days ) as compared with the other women ( 9.97 4.58 days , p < 0.001 ) . a total of 27% of patient in eclampsia group required admission to intensive care in eclampsia group , while it was 10% in preeclampsia group ( p = 0.03 ) . the most common mode of the delivery in both groups was through lower segment cesarean section ( lscs ) . the fetal mortality was high ( 17% ) in eclampsia group as compared with 6% in preeclampsia group ( p = 0.09 ) . fetal distress and intrauterine growth retardation ( iugr ) were not significantly different in the two groups . a total of 50% of the newborn were having birth weight between 1.5 and 2.5 kg which was consequent with their premature birth . average number of drugs prescribed in women of preeclampsia , antepartum eclampsia , and postpartum eclampsia were 13.2 , 14.9 , and 14.2 , respectively . the percentage distribution of different classes of drugs in three groups is shown in figure 3 . antibiotics are the most common class of the drugs prescribed in all the groups , followed by vitamin and calcium supplements . anticonvulsants were the next most frequently prescribed drug in eclampsia women ( both ante and post partum ) , while antihypertensives were more common in cases of preeclampsia women and also represent the next most common class of drugs in case of eclampsia . antiemetic , gastroprotective , and analgesics constituted the other classes of drugs prescribed in these patient populations as shown in figure 3 . percentage use of drugs in patients of eclampsia ( n= 164 ) the prescription pattern of individual antihypertensive drugs is described in table 2 . the average number of antihypertensives prescribed was 1.8 drugs per patient ( 1.8 1.6 ) in preeclampsia . in antepartum eclampsia , an average of 1.7 ( 1.7 1.4 ) and in postpartum eclampsia an average of 1.6 drugs ( 1.6 1.3 ) were antihypertensives . calcium channel blockers ( ccbs ) were the most frequently prescribed antihypertensives ( 71% ) , followed by -blockers ( 21% ) . sympatholytics ( alpha methyldopa ) and diuretics ( furosemide ) were prescribed in 18% of women , while nitrates were given to 11 % of women population . nifedipine and amlodipine were the ccbs of choice prescribed , while atenolol was the preferred -blocker . prescription pattern of antihypertensive and anticonvulsant drugs the average number of anticonvulsant prescribed were 0.3 drugs per woman ( 0.3 0.7 ) in preeclampsia , 1.9 drugs per woman ( 1.9 1.0 ) in antepartum eclampsia and 1.8 drugs on an average ( 1.8 0.7 ) in case of postpartum eclampsia . magnesium sulphate ( mgso4 ) was clearly the anticonvulsant of choice , prescribed in 116 women . all ( 100% ) of the patients with eclampsia received mgso4 either alone or in combination , while only three ( 5.8% ) prescriptions in severe preeclampsia group received it [ table 2 ] . the cases showing disorientation , or diminished patellar reflex , decreased urine output , respiratory irregularity , or recurrence of seizures , while on mgso4 therapy were simultaneously put on intervenous phenytoin therapy . the choice of addition of third drug was to control seizure purely as trial and error in solitary atypical cases not controlled by standard approach . the reasons of discontinuation of mgso4 therapy were adequate seizure control or appearance of any of the above mentioned adverse effects . a combination of metronidazole , gentamicin , and cephalosporin ( mostly third generation ) was the most common antibiotic regimen prescribed , representing 63% of the antibiotic use . among these women , this was followed by the combination of metronidazole and third generation cephalosporins in 23% women in the study cohort . very few women received penicillin along with either metronidazole or gentamicin . a small percentage ( 6.6% ) of women during the study period of 14 months , 198 admissions related to hypertensive disorders of pregnancy were recorded . patient disposition in the study is summarized following the strengthening and the reporting of observational studies in epidemiology ( strobe ) in figure 1 and their demographic and clinical characteristics in table 1 . the median age at delivery of the 164 women included in the study was 25 ( 22 - 28 ) . majority of the cases were antepartum eclampsia 86 ( 52.5% ) , followed by preeclampsia 51(31% ) and postpartum eclampsia 27(16.5% ) . nulliparous status ( 62% ) was significantly more common in eclampsia group ( < 0.001 ) , while multiparous women ( 59% ) were commoner in preeclamptic group [ table 1 ] . the gestational age at the time of diagnosis in three groups is presented in figure 2 . patient flow diagram ( strobe ) : assessment of clinical outcomes and prescribing behaviour in preeclampsia and eclampsia demographic , clinical features , and outcome of women with severe preeclampsia and eclampsia kaplan - meir curves to show probability of diagnosis of severe preeclampsia / eclamptic episode ( antepartum and intrapartum seizures ) or delivery ( postpartum seizures ) at different gestational ages headache was most common symptom in both preeclampsia and eclampsia group ( 41.2% vs. 54.9% , p = 0.073 ) , while most common sign was oedema in preeclampsia ( 65% vs. 37% , p = 0.001 ) and hyperreflexia in eclampsia group ( 42% ) . proteinuria was found to be significantly more common in eclampsia group ( 88% ) as compared with preeclampsia ( 65% , p = 0.001 ) . regarding maternal outcome , mortality was observed in 6 ( 5 % ) women in eclampsia group , while none in preeclampsia group . the maternal morbidity due to infectious causes was also found to be high ( 34% ) in our study population . this morbidity has also led to prolonged hospital stay in these women ( 14.98 9.6 days ) as compared with the other women ( 9.97 4.58 days , p < 0.001 ) . a total of 27% of patient in eclampsia group required admission to intensive care in eclampsia group , while it was 10% in preeclampsia group ( p = 0.03 ) . the most common mode of the delivery in both groups was through lower segment cesarean section ( lscs ) . the fetal mortality was high ( 17% ) in eclampsia group as compared with 6% in preeclampsia group ( p = 0.09 ) . fetal distress and intrauterine growth retardation ( iugr ) were not significantly different in the two groups . a total of 50% of the newborn were having birth weight between 1.5 and 2.5 kg which was consequent with their premature birth . average number of drugs prescribed in women of preeclampsia , antepartum eclampsia , and postpartum eclampsia were 13.2 , 14.9 , and 14.2 , respectively . the percentage distribution of different classes of drugs in three groups is shown in figure 3 . antibiotics are the most common class of the drugs prescribed in all the groups , followed by vitamin and calcium supplements . anticonvulsants were the next most frequently prescribed drug in eclampsia women ( both ante and post partum ) , while antihypertensives were more common in cases of preeclampsia women and also represent the next most common class of drugs in case of eclampsia . antiemetic , gastroprotective , and analgesics constituted the other classes of drugs prescribed in these patient populations as shown in figure 3 . the average number of antihypertensives prescribed was 1.8 drugs per patient ( 1.8 1.6 ) in preeclampsia . in antepartum eclampsia , an average of 1.7 ( 1.7 1.4 ) and in postpartum eclampsia an average of 1.6 drugs ( 1.6 1.3 ) were antihypertensives . calcium channel blockers ( ccbs ) were the most frequently prescribed antihypertensives ( 71% ) , followed by -blockers ( 21% ) . sympatholytics ( alpha methyldopa ) and diuretics ( furosemide ) were prescribed in 18% of women , while nitrates were given to 11 % of women population . nifedipine and amlodipine were the ccbs of choice prescribed , while atenolol was the preferred -blocker . the average number of anticonvulsant prescribed were 0.3 drugs per woman ( 0.3 0.7 ) in preeclampsia , 1.9 drugs per woman ( 1.9 1.0 ) in antepartum eclampsia and 1.8 drugs on an average ( 1.8 0.7 ) in case of postpartum eclampsia . magnesium sulphate ( mgso4 ) was clearly the anticonvulsant of choice , prescribed in 116 women . all ( 100% ) of the patients with eclampsia received mgso4 either alone or in combination , while only three ( 5.8% ) prescriptions in severe preeclampsia group received it [ table 2 ] . the cases showing disorientation , or diminished patellar reflex , decreased urine output , respiratory irregularity , or recurrence of seizures , while on mgso4 therapy were simultaneously put on intervenous phenytoin therapy . the choice of addition of third drug was to control seizure purely as trial and error in solitary atypical cases not controlled by standard approach . the reasons of discontinuation of mgso4 therapy were adequate seizure control or appearance of any of the above mentioned adverse effects . a combination of metronidazole , gentamicin , and cephalosporin ( mostly third generation ) was the most common antibiotic regimen prescribed , representing 63% of the antibiotic use . among these women , this was followed by the combination of metronidazole and third generation cephalosporins in 23% women in the study cohort . very few women received penicillin along with either metronidazole or gentamicin . a small percentage ( 6.6% ) of women the primary objective of management in women with pregnancy - induced hypertension is to protect the safety of the mother and the fetus and the subsequent delivery of a healthy baby . the reported outcomes of women with severe preeclampsia and eclampsia are limited . to add to this body of literature , we reviewed the obstetric outcome and medication utilization of 164 inpatiently pregnancies with superimposed preeclampsia / eclampsia at our institution . eclampsia has been found to be primarily a condition of young primigravid women , consistent with the current findings that 50% of patients were 25 years old and 62% were primigravidas [ table 1 ] . most studies found that eclampsia occurred in the extremes of ages . with the establishment of antenatal care and essential obstetrics services , . however , majority of the pregnant women presenting to our health facility are illiterate with only rudimentary medical knowledge of their own pregnancies . because of these reasons inpatient management if preferred in these cases for close monitoring and timely drug administration . the target population in this study were women with severe preeclampsia / eclampsia who remained inpatient during rest of their pregnancy . surprisingly , majority had no prior antenatal check - up and our study cohort women who presented for initial prenatal care with severely elevated blood pressure had a similar mean gestational age at diagnosis of superimposed preeclampsia , but a shorter latency period from diagnosis to delivery . in cases of preeclampsia , 64% were unbooked pregnancies with no prior health check - up during pregnancy and 77% of these cases underwent emergency caesarean section . however , this can be due to the fact that this number includes prescribed haematinics and calcium tablets , gastroprotectives ( including gelusil ) , antiemetics , antihypertensives , antibiotics as well as anticonvulsants . moreover , these represent the numbers of different drugs prescribed to each patient during the entire duration of the hospital stay . antihypertensive drug therapy is recommended only for those with systolic blood pressure > 160 mm hg and diastolic blood pressure > 105 mm hg . thus , an average prescription of 1.8 antihypertensive medications is justified in the study cohort of women with severe preeclampsia / eclampsia . however , 52 of the 74 women ( 70% ) received sublingual nifedipine which is against the recommendations for rational use of antihypertensive . rapid acting nifedipine should not be used for treating hypertension or hypertensive emergencies especially in pregnancy because it has been associated with fatal and nonfatal untoward cardiovascular events as well as compromised placental perfusion . amlodipine was also used to some extent both as single ingredient and as fixed dose combination ( fdc ) with atenolol in 13% of the women . most authorities recommend the total avoidance in early pregnancy and cautious use in late pregnancy . on analysis , it was found that in all 25 out of the 29 cases , it was prescribed post delivery . according to the recommendations women well - controlled on antihypertensive therapy before pregnancy may be kept on the same agents ( with the exception of angiotensin ( at)-converting enzyme inhibitors , at - ii receptor antagonists ) during pregnancy . in the present study , it was surprising to observe the low use of labetalol as antihypertensive for preeclampsia and eclampsia . with its efficacy , convenient routes of administration and better safety profile in pregnancy , labetalol has become the drug of choice for the acute control of blood pressure in cases of pregnancy - induced hypertension worldwide . according to the prescribers , the high cost of the drug does not allow prescribing it routinely . anticonvulsant therapy is indicated both to prevent the occurrence and control of convulsions in preeclampsia and eclampsia . magpie trial has shown that magnesium sulphate halves the risk of eclampsia in preeclamptic women . magnesium sulphate has now become the drug of choice for treating and preventing convulsions in women with preeclampsia / eclampsia . the collaborative eclampsia trial provides strong evidence for the routine use of magnesium sulphate rather than either diazepam or phenytoin for the management of eclampsia . magnesium sulphate was found to be the most common anticonvulsant being prescribed closely followed by phenytoin . the use of magnesium sulphate is expected and recommended for controlling convulsions in eclampsia , but such high use of phenytoin along with magnesium sulphate mandates further inquiry . about 60% of different drugs used in the obstetric practice were from the national essential drug list or complementary drug list . however , a relatively higher proportion of drugs ( 80%-90% ) were prescribed as trade names . cesarean delivery is an important factor for development of postpartum maternal infection and use of prophylactic antibiotics . our study revealed a relatively higher frequency of antibiotic usage in all the three subsets of women . evidence shows that antibiotic prophylaxis in cases of caesarean delivery reduces the incidence of maternal infectious morbidity . the trials evaluating the use of prophylactic antibiotics have also shown that a single preoperative dose of antibiotic is sufficient and multiple dose regimes do not offer any added benefit to reduce the infectious morbidity . the choice of antibiotics and duration of their use is based on the risk status of the patient . the patients are categorized as high risk if they were unbooked pregnancies , presenting to this particular health facility for the first time , usually of low socioeconomic status with no prior antenatal check - up which is usually the case in our study setting . further , the prescribers point to the fact that maximum number of women undergo emergency caesarean section and general standards of the antenatal and postnatal wards are such that development of infectious morbidity was more likely protocols for the management of eclampsia , including antihypertensive and anticonvulsant therapies , should be available and reviewed regularly to substantially improve the standard of care and reduce the prevalence of this complication of pregnancy .

the inter - lead variation of qt interval provides an index of the heterogeneity of ventricular refractoriness . the most commonly used index to calculate qt dispersion has been the difference between the longest and shortest qt intervals on the twelve - lead electrocardiography ( ecg ) , which is often adjusted for heart rate . abnormally prolonged qt dispersion has been correlated with the risk of arrhythmic death in some disorders , including coronary artery disease , although the results are not consistent.1 ischemia can increase qt dispersion.2 percutaneous coronary intervention ( pci ) is widely used to manage ischemia in patients with coronary artery disease . however , there is a dearth of information on the influence of elective pci on ecg parameters , especially qt parameters.3 the aim of the study was to evaluate the effect that percutaneous coronary intervention may have on such ecg parameters as qrs duration , qt interval , corrected qt interval , jt interval , corrected jt interval , qt dispersion , jt dispersion , corrected qt interval , and corrected jt interval . the patients included were selected from those admitted for elective pci on the basis of the following inclusion criteria : ( 1 ) angiographic evidence of significant stenosis ( 70% ) in only one main coronary artery , ( 2 ) chronic stable angina pectoris , and ( 3 ) successful angiographic pci . the exclusion criteria were : ( 1 ) acute coronary syndrome , ( 2 ) electrolyte disturbances , ( 3 ) ventricular pacing , ( 4 ) qrs duration > 0.12 seconds , ( 5 ) not being in sinus rhythm , ( 6 ) need for emergent coronary artery bypass grafting ( cabg ) or repeat pci during a 24-hour period after the procedure , ( 7 ) if qt interval could not be reliably measured in at least nine leads , ( 8) taking anti - arrhythmic , anti - psychotic , and anti - depressant drugs , which might affect qt interval and qt dispersion , and ( 9 ) twofold increase in cardiac enzymes or sustained monomorphic ventricular tachycardia or ventricular fibrillation during a 24-hour period after pci . atherosclerosis risk factors were defined as follows : hypertension was defined as taking antihypertensive drugs or baseline blood pressure 140/90 mmhg . diabetes mellitus was defined as taking hypoglycemic agents or a fasting plasma glucose level 126 mg / dl , a two - hour value in an oral glucose tolerance test 200 mg / dl , or a random plasma glucose concentration 200 mg / dl in the presence of symptoms . hyperlipidemia was defined as a total cholesterol level 220 mg / dl or a triglyceride level 150 mg / dl . the patients were imaged in the left lateral decubitus position in the parasternal and apical views using a commercially available system ( vingmed three , general electric - vingmed , milwaukee , wi , usa ) during the first day of admission . serum creatinine , sodium , potassium , calcium , and cardiac enzymes including troponin and ck concentrations were measured . standard twelve - lead ecgs were recorded before pci and 24 hours after that at 7:30 am with an electrocardiograph simultaneously acquiring six standard leads at a paper speed of 25 mm / s and a gain of 10 mm / mv . qt interval analysis was performed after magnification by two observers , who were not given the clinical data , and the mean of the two measurements was used . qt interval was measured from the beginning of qrs complex to the end of t wave using a ruler . the end of t wave was defined as the point of return to the isoelectric line . when a t wave was interrupted by a u wave , the end of the t wave was defined as the nadir between the t and the u waves . if the end of the t wave could not be reliably determined due to extremely low voltage ( < 0.1 mv ) , measurements of qt interval were not made and these leads were excluded from the analysis . in order to exclude the effect of heart rates on qt intervals , qt intervals were corrected according to the bazett formula : qtc = qt / square root of rr interval . jt interval was calculated in each lead as the difference between qt and qrs interval . corrected jt dispersion was defined as the difference between maximum and minimum jt intervals corrected according to the heart rate : jtc = jt/ square root of rr interval . each measurement was performed in three successive beats because averaging qt interval reduces the bias.4 the study protocol was approved by the ethics committee of jundishapur university of medical sciences . differences in the mean values before and after the procedure were compared using the paired t - test . the study population consisted of 96 patients : 67 ( 69.8% ) men and 29 ( 30.2% ) women . the patients were on aspirin ( n = 96 , 100% ) , beta blockers ( n = 51 , 73% ) , angiotensin - converting enzyme inhibitors ( n = 16 , 17% ) , and lipid - lowering medications ( n = 31 , 32% ) . the mean of the absolute difference between the first and second measurements of qt dispersion was 0.06 0.02 second ( range : 0.010.10 seconds ) with a correlation coefficient of 0.93 . there were significant differences between the mean qrs interval , mean qtc dispersion , and mean jtc dispersion before and after pci . there were significant differences between pre- and post - pci jtc dispersion ( 74.46 vs. 65.78 , p value = 0.001 ) and qtc dispersion ( 78.25 vs. 69.04 , p value = 0.001 ) . there were significant differences between pre- and post - pci jtc dispersion ( 73.85 vs. 59.78 , p value = 0.031 ) and qtc dispersion ( 83.98 vs. 66.32 , p value = 0.038 ) . the left anterior descending artery ( lad ) group comprised 62 patients ; there were significant differences between pre- and post - pci jtc dispersion ( 79.29 vs. 67.95 , p value = 0.001 ) and qtc dispersion ( 84.79 vs. 70.79 , p value = 0.001 ) . the left circumflex artery ( lcx ) group was comprised of 20 patients , and there were significant differences between pre- and post - pci jtc dispersion ( 74.93 vs. 67.04 , p value = 0.01 ) and qtc dispersion ( 76.94 vs. 74.16 , p value = 0.041 ) . the right coronary artery ( rca ) group consisted of 14 patients , there being significant differences between pre- and post - pci jtc dispersion ( 95.76 vs. 85.63 , p value = 0.001 ) and qtc dispersion ( 106.09 vs. 89.22 , p value = 0.001 ) . qt dispersion is an index of the heterogeneity of ventricular refractoriness and is sensitive to age , time of day , season of the year , and even body position.1 it has a highly specific upper normal limit of 50 ms and is longer in patients with a previous myocardial infarction than in normal subjects.5 although many qt experts recommend correcting qt and jt interval according to the heart rate , vassilikos et al . demonstrated that the heart rate did not influence qt dispersion and correction for rates faster than 100 beat / min could result in abnormally prolonged values.6 theoretically , an accurate measurement of qt and jt dispersion requires all the twelve leads of the ecg to be recorded simultaneously . therefore , simultaneous twelve - lead recordings have been proposed as a gold standard for a qt dispersion measurement , but simultaneous six - lead recordings can also be acceptable.7 the values of qt interval depend on the shape of the descending part of t wave . q wave dispersion can also influence qt dispersion , although its effect is significantly smaller than t wave offset . some experts believe that jt dispersion reflects better the dispersion of action potential duration and , consequently , suggest qt and jt dispersions be used as separate entities.7 increased qt dispersion reflects inhomogeneous ventricular repolarization , which may provide a background for significant ventricular arrhythmias.8 prolonged qt dispersion is associated with a higher risk of malignant ventricular arrhythmias in patients with the long qt syndrome , hypertrophic cardiomyopathy , and myocardial infarction.1 effective management of acute myocardial infarction or ventricular arrhythmias may reduce qt dispersion ; i.e. successful reperfusion after thrombolysis as well as revascularization with angioplasty and cabg grafting , especially concomitant with aneurysmectomy.810 the effect of myocardial ischemia on qt dispersion has been described in different clinical circumstances . a significant increase in qt dispersion during acute ischemia caused by balloon inflation has been demonstrated ; it is , however , reversible and decreases on reperfusion.1112 michelucci et al . showed that both ischemia and reperfusion could influence ventricular repolarization and thus lead to a less homogeneous ventricular recovery pattern.13 a significant decrease in qt dispersion may help us as an electrocardiographic index for successful reperfusion.14 in one study , a comparison of qt dispersion after primary pci with qt dispersion after thrombolysis showed a significant decrease in the first group;15 this difference may be related to more salvaged myocardium in the primary pci group because qt dispersion is mainly determined by the amount of viable myocardium in the infarct region . hence , qt dispersion may be utilized as a marker of viability in patients with chronic q - wave myocardial infarction.16 patients with chronic stable angina may have abnormal qt dispersion due to ongoing ischemia , previous myocardial damage , or both . there are some studies about the effects of revascularization on qt dispersion in patients with chronic ischemia , but the results are controversial . choi et al.17 demonstrated that qt dispersion decreased in coronary artery disease patients with no history of myocardial infarction at one month following a successful pci . another study performed by aydinlar et al.3 revealed a reduction in qt dispersion immediately after percutaneous transluminal coronary angioplasty . according to our data , a successful full revascularization of patients with chronic stable angina is associated with a significant reduction in qtc and jtc dispersion and even qrs duration ( not qt and jt dispersion ) 24 hours after the procedure . our data suggest that chronic ischemia alters ventricular repolarization in patients with chronic stable angina and prolongs qt and jt dispersion . these findings support the hypothesis that we can detect ischemia - induced inhomogeneity in ventricular refractoriness by a careful examination of qtc or jtc dispersion derived from the surface ecg . the high values of qt dispersion in our patients show that they were a high - risk group and almost all of them had considerable ischemia . hence , revascularization ameliorated this ischemia and led to a shortening of qtc and jtc dispersion . in our patients , there was no relationship between the ecg parameters and the involved vessel , which is in contrast with the results of a previous study performed by kilic et al.2 it may also be related to our high - risk patient selection and the presence of considerable ischemia in the involved vessel territory . the qtc and jtc dispersion values were higher in the rca group ( a small group with only 14 patients ) . furthermore , there was no significant difference between the baseline characteristics of these groups , and unfortunately we have no idea about the real reason therefore , we would recommend that future studies be designed with larger sample sizes in each group so as for this issue to be investigated more comprehensively . the major limitation of the present study may be represented by the small number of the patients . as a result , the other limitation is the relatively high interobserver differences in the measurement , which may have affected our results and reduced their reliability . another limitation is that patients with unsuccessful pci were not evaluated , which precluded an evaluation of the probable effects of the contrast media on the ecg parameters . in conclusion , our data indicate that the shortening of qtc dispersion and jtc dispersion in patients undergoing pci was prominent and coronary revascularization may prevent the frequency of repolarization abnormalities .

the proper physical therapy frequency is increasingly important in the determination of government financial and insurance benefits . the physical therapist is responsible for demonstrating the value and effect of services , and the therapy schedule should be planned carefully1 . although appropriate treatment frequency and duration are important in pediatric physical therapy , evidence for determining the optimal program is lacking2 , 3 . the frequency of physical therapy is a factor that should be considered with greater importance in children with cerebral palsy ( cp ) because children with chronic disabilities should receive therapy for as long as the family requests services4 . in practice , therapy is continued at various frequencies for which effectiveness has not been well documented4 . treatment frequency guidelines ( tfg)4 and treatment frequency and duration guidelines ( tfdg)1 have been developed and published . the tfg were developed for use by physical and occupational therapists through adaptations of the existing literature . the 4 developed modes included intensive therapy ( 3 to 11 times per week ) , weekly or bimonthly therapy ( 1 to 2 times a week to every other week ) , periodic therapy ( monthly or less often but at regularly scheduled intervals ) , and consultative therapy ( episodic or as needed ) . the tfdg modified the tfg , and consisted of 5 intensity levels : intensive , weekly , bimonthly , periodic , and consultative . the intensive mode was 3 to 5 times per week for a 26-week duration , while consultative mode provided therapy as needed when a patient was discharged from regularly scheduled therapy and consulted a therapist for only certain needs . changes in the gross motor function measure ( gmfm ) , which is used as a standard outcome measure in children with cp according to intensity dosage , have been variable5 . another drawback of previous studies on physical therapy frequency is that the research was performed over a short period of time . although physical therapy services are usually short - term during recovery from illness or surgery in the outpatient environment , there have been no reports on children with long - term needs6 . in addition , current cross - sectional data are limited for revealing the long - term impact of changes on outcomes in children with cp . because the effect of therapy for chronic disabilities such as cp is difficult to detect in a short period of time , a longitudinal follow - up study should be performed to investigate the proper therapy frequency . this study addressed the following two questions regarding the proper physical therapy frequency based on neurodevelopmental therapy ( ndt ) for gross motor function in children with cp . first , what is the correlation between physical therapy frequency and gross motor function outcome in children with cp ? second , do gross motor function outcomes differ among intensive ( 3 to 11 times a week ) , weekly , or bimonthly frequency modes of tfg ? the study sample comprised 161 children with cp ( mean age : 9 years , 1 month ; sd : 4 years , 6 months ) who attended a convalescent or rehabilitation center for disabled individuals or a special school for children with physical disabilities in south korea . this study was approved by the ethics committee of jeonju university ( jeonju university irb-1 ) . written informed consent to participate in the study was obtained from the parents of all the children . the types of cp in the children were spastic ( 85.1% ) , dyskinetic / athetotic ( 7.1% ) , and ataxic ( 7.8% ) . the participants were classified using the gross motor function classification system ( gmfcs ) : 26 ( 16.1% ) were classified into level i , 25 ( 14.9% ) into level ii , 19 ( 11.8% ) into level iii , 19 ( 11.8% ) into level iv , and 73 ( 44.8% ) into level v. the gmfm was used to assess gross motor function according to physical therapy frequency for 1 year . the gmfm is a standard criterion - referenced test that was designed to assess changes in gross motor function in children with cp . the 88-item test assesses activities in the 5 dimensions of lying and rolling , sitting , crawling and kneeling , standing , and walking , running , and jumping . the one - sample kolmogorov - smirnov ( k - s ) test was employed to determine the method of statistical analysis . because the results of the k - s test were statistically significant , a non - parametric test was performed to verify the physical therapy frequency . the correlation coefficients between physical therapy frequency and gross motor function are shown in table 1table 1.correlation between physical therapy frequency and gross motor function changeslying androllingsittingcrawling andkneelingstandingwalking , running , and jumpinggmfm totalphysical therapy frequencyall 0.0270.0000.1910.2400.1330.162gmfcs level v0.1520.0420.1760.2860.0930.058*p<0.05 , * * p<0.01 . the correlation between physical therapy frequency and gmfm scores , including crawling and kneeling , standing , walking , running and jumping , rolling , and the gmfm total score , was significant . in gmfcs level v , only standing score showed a significant correlation with physical therapy frequency . gmfm : gross motor function measure the results of the kruskal - wallis test are presented in tables 2table 2.differences in gross motor function changes by physical therapy frequencycategorymeansdgmfm domainpt frequencylying and rollingconsultative0.6914.23bimonthly2.0817.96intensive0.7413.47sittingconsultative4.5111.04bimonthly6.8614.79intensive3.5311.59crawling and kneelingconsultative 4.215.61bimonthly0.911.32intensive 1.5610.36standingconsultative 4.2214.35bimonthly 5.0517.78intensive 4.3312.41walking , running & jumpingconsultative15.9215.42bimonthly26.322.69intensive25.1820.31gmfm totalconsultative 2.268.73bimonthly 8.2411.48intensive 6.779.13gmfm : gross motor function measure . * the different superscript letter indicates a significant difference ( p<0.05 ) . and 3table 3.differences in gross motor function changes according to physical therapy frequency , gmfcs level vcategorymeansdgmfm domainpt frequencylying and rollingconsultative6.6416.14bimonthly0.8124.13intensive2.3621.94sittingconsultative3.4216.16bimonthly3.0319.04intensive5.9322.78crawling and kneelingconsultative 11.7721.29bimonthly2.3819.17intensive 4.1719.52standingconsultative2.435.23bimonthly 2.7722.45intensive5.3317.22walking , running , and jumpingconsultative20.8914.27bimonthly27.424.17intensive21.4523.25gmfm totalconsultative 1.576.89bimonthly 6.4511.04intensive 6.7418.47gmfm : gross motor function measure . the different superscript letters indicate significant differences ( p<0.05 ) .. the different superscript letters refer to significant differences ( p<0.05 ) . the differences in gross motor function according to frequency of physical therapy were significant for crawling and kneeling , standing , and gmfm total score . intensity mode showed a significant effect for improvement in crawling and kneeling , standing , and gmfm total score compared to the consultative mode . intensity mode showed a significant improvement effect for standing compared to the consultative mode in children with cp , which was classified into gmfcs level v. gmfm : gross motor function measure . gross motor function has been related to functional outcomes such as activities of daily living7 . activities and participation domains based on the international classification of functioning disability and health ( icf ) are considered major concepts in rehabilitation ; thus , improved gross motor function in mastering tasks and activities of daily living is a major goal of therapy for children with cp8 . the evidence of the correlation between physical therapy frequency and gross motor function should be clarified to determine the proper physical therapy frequency for improving gross motor function in children with cp . in this study , the correlation between physical therapy frequency and gmfm data was investigated during a 1 year follow - up period . the gmfm domains that showed significant correlations with physical therapy frequency were crawling and kneeling , standing , walking , running , and jumping , and gmfm total . in children with cp classified into gmfcs level there were significant differences in crawling and kneeling , standing , and gmfm total . the significant difference in standing was seen in children with gmfcs level v cp . these results indicate that intensive physical therapy might be effective for improving the gross motor function in children with cp . the cause of non - significant correlations for lying and rolling as well as the differences in lying and rolling and standing could be explained by the ceiling effect of the gmfm . vos - vromans et al.9 reported the ceiling effect of the gmfm in dimensions a , b , and c. they assessed gross motor function at baseline and at 3 follow - up assessments at 6-month intervals to describe the responsiveness of the measures used to evaluate the motor abilities of children with cp . dimensions a ( lying and rolling ) , b ( sitting ) , and c ( crawling and kneeling ) of the gmfm were not responsive in the children participating in this study . an explanation for this phenomenon is that dimensions a , b , and c of the gmfm are relatively easy for children with mild cp to achieve . the only significant difference of standing in gmfcs level v might be attributed to ceiling effect . the insignificant correlation between physical therapy frequency and walking , jumping , and running might be explained by the bottom effect . walking , jumping , and running labaf et al.10 reported that ndt improved gross motor function in children with cp in 4 dimensions ( lying and rolling , sitting , crawling and kneeling , and standing ) but that walking , running , and jumping did not improve significantly . although there was a significant effect between gross motor function and physical therapy frequency , the correlation coefficients were small . one reason for this result might be the content of the physical therapy provided for the children with cp . activity - based interventions should reduce activity limitations in children with cp8 . however , physical therapy based on ndt focused on reducing abnormal tone , reflexes , and posture , which comprised an impairment - based intervention . another cause of the small correlation coefficients might be due to the use of the gmfm for outcome measures in this study . the effect of physical therapy frequency was different at gmfcs level v. for that reason , the effect of physical therapy frequency should be examined according to gmfcs level to verify the specific effect of frequency . intensive physical therapy was more effective at improving gross motor function in children with cp . in particular , crawling and kneeling and standing ability were more increased in the intensive physical therapy mode . tsorlakis et al.12 compared the effect on gross motor function in group a with ndt twice a week and in group b with therapy 5 times a week for 16 weeks . the results showed that gross motor function in the children of both groups improved significantly after intervention and that the children in group b performed better and showed significantly greater improvement than those in group a. the results of this study support the effectiveness of ndt and emphasize the need for intensive treatment . although more intensive physical therapy is thought to be more effective , evidence of this assumption has been insufficient . this study provided evidence of the effects of intensive physical therapy in children with cp during a 1 year follow - up period . however , further studies should be performed to accumulate evidence of the various effects according to physical therapy frequency . first , the different effects according to physical therapy content should be investigated . because the effects of therapy on gross motor function might vary depending on whether therapy focused on gross motor function second , the different effects according to the ages of the children with cp should be examined . according to a previous meta - analysis10 , the effect of intensive treatment tended to be stronger for children 2 years of age . this study examined the effect of physical therapy based on ndt according to frequency during a 1 year follow - up of gross motor function in children with cp . intensive therapy significantly improved gross motor function for crawling and kneeling as well as standing .

ever since the first description of espinas on purkinje cells by cajal more than 100 years ago [ 1 , 2 ] , these tiny , femtolitre - sized , structures have been found on dendrites of a wide variety of neuronal cell types and the role of these minute structures in neuronal function has been the subject of considerable attention , speculation , and debate . these discrete dendritic protrusions form a rich structural scaffold for the majority of excitatory synapses in the brain , harbouring a complement of biochemical signalling machinery as well as a proteinaceous postsynaptic density ( psd ) containing , amongst others , ionotropic glutamate receptors of the ampa and nmda subtypes . these receptors mediate the bulk of fast excitatory neurotransmission in the brain . during postnatal development , dendritic spines acquire ampars and undergo structural enlargement , resulting in a positive correlation between spine size and ampar function . interestingly , the high degree of heterogeneity in dendritic spine structure and function at maturity suggests that spine growth is regulated in a synapse - specific manner and not simply a consequence of en masse spine development . in the past decade or so , a number of technological developments in fluorescence microscopy and molecular techniques have greatly accelerated our understanding of the relationship between structure and function at dendritic spines . for one , the induction of synaptic plasticity at single synapses was found to result in changes in spine structure , providing a plausible mechanism to explain the concurrent developmental changes in spine size and function . furthermore , recent studies have elaborated a mechanistic and molecular framework to suggest that spines function as discrete compartments , offering a basis for computationally relevant synaptic autonomy . based on the robust concordance between structural and functional plasticity , and on the similarities in the molecular underpinnings that drive these two processes , there is a growing trend in synaptic physiology to infer synaptic strength based on characteristics of spine morphology . however , the dissociation of spine structure and function under some experimental conditions suggests an important mechanistic divergence in the regulation of spine form and function . in this paper , we will provide an outline of the dendritic spine as a discrete functional compartment , discuss new developments in structural and functional plasticity at single spines and highlight key aspects of our understanding of the relationship between spine structure and function . despite unsheathing fundamental properties of various forms of synaptic plasticity , investigations based solely upon electrically evoked synaptic events left a number of open questions . although minimum stimulation methods allow the functional study of single synapses in isolation [ 69 ] , the inherent technical challenges of these experiments hinder the ability to efficiently amass data and resolve spatial parameters such as the morphology and location of the activated synapses ( relative to each other and to the soma ) . the advent of two - photon ( 2p ) laser scanning microscopy circumvented a number of these experimental limitations and has contributed considerable depth to our understanding of spine function and plasticity . the longer wavelengths and lower excitation energy used in 2p imaging increase imaging depth in scattering tissue ( such as brain ) while also reducing photodamage / toxicity compared to 1p imaging [ 1012 ] . furthermore , the 2p excitation event is highly restricted in physical space with an excitation volume that roughly approximates the diffraction limits of the optical system . this small excitation volume thus confers the ability to photoactivate molecules with high spatial precision , thereby providing novel opportunities for the study of synaptic physiology . for instance , 2p uncaging of caged forms of neurotransmitters ( for , e.g. , mni - glutamate ) provides the ability to selectively activate spatially discrete glutamate receptors in a number of experimental preparations in vitro [ 4 , 1324 ] and in vivo . pioneering work by matsuzaki and colleagues used 2p imaging and glutamate uncaging to probe ampar content and induce ltp at individual dendritic spines on hippocampal ca1 pyramidal neurons , generating key insight into single synapse plasticity [ 4 , 22 ] . for instance , the induction of ltp at single dendritic spines via 2p glutamate uncaging circumvented the presynaptic component of synaptic transmission and provided unequivocal support to the notion that , at least under certain conditions , synaptic plasticity can be mediated by solely postsynaptic mechanisms [ 4 , 26 ] . in addition to providing important information regarding plasticity at single synapses , advances in 2p imaging and related optical techniques have been instrumental in generating novel understanding of other neuronal mechanisms and properties such as the spatial distribution of synaptic weights , the autonomy of the spine as a functional compartment , the integrative behaviour of dendritic branches , and the recurrent connectivity of cortical circuits [ 14 , 16 , 21 , 27 ] . dendritic spines are specialized structures exhibiting a high degree of molecular organization and exist in a wide range of morphologies . although a number of nomenclatures have been proposed to describe the breadth of morphologies that individual spines can adopt , they can be broadly summarized as follows : mushroom - like , identified by a round dendritic spine head connected to the parent dendrite by a spine neck ; stubby spines , which are short , stout protrusions or bumps with no definitive spine neck ; filipodial / long spines , which appear as thin , finger - like protrusions [ 28 , 29 ] . there has been considerable speculation on the specific role imparted by these varying morphologies on aspects of spine function . for one , substantial attention has been given to the role of the spine neck and accumulating experimental evidence suggests that it serves to compartmentalize the dendritic spine head . this compartmental model is particularly attractive in light of the synapse specificity of the structural and functional changes that take place over development and during plasticity . the compartmentalization of dendritic spines can be broadly divided into two functional domains : ( i ) the biochemical compartment , which describes the spatial confinement of biochemical signalling due to diffusional restriction and physical segregation of proteins and signalling molecules ; ( ii ) the electrical compartment , where spine neck morphology can impact the kinetics and propagation of synaptic potentials in a spine - specific manner . here postsynaptic induction and expression of several forms of synaptic plasticity requires calcium influx through nmdars and the initiation of calcium - dependent biochemical signalling in the dendritic spine . the development of calcium - sensitive fluorescent indicators and imaging techniques has greatly facilitated the study of calcium dynamics during synaptic activity . specifically , calcium imaging experiments demonstrate that nmdar - mediated calcium influx elicited during synaptic transmission is tightly restricted to the spine head , with minimal calcium diffusion into the parent dendrite [ 18 , 3033 ] . given the key role of calcium as a second messenger in the regulation of synaptic plasticity , highly compartmentalized calcium signalling at dendritic spines is likely critical for providing the synapse specificity of synaptic plasticity . as a result , it has been proposed that the primary function of the dendritic spine structure is to compartmentalize signalling molecules such as calcium [ 31 , 34 ] . for instance , the presence of a spine neck has been suggested to restrict calcium diffusion and also appears to limit the diffusion of other molecules such as gfp and fluorescein dextran [ 31 , 33 , 3537 ] . in addition , calcium pumps such as pmcas and serca , calcium - binding molecules such as calmodulin ( cam ) or calbindin , and differential cytosolic viscocities at individual spines can all contribute to regulate free - calcium concentrations ( and its dynamics ) and influence intracellular diffusion [ 3840 ] . together , these diverse mechanisms indicate that dendritic spines utilize multiple strategies to compartmentalize biochemical signals and promote autonomous synaptic function ( see figure 1 ) . dendritic spines must also communicate with protein synthesis machinery located in the parent dendrite to sustain late phases of ltp [ 23 , 4143 ] . thus , the movement of signalling molecules to and from the dendritic spine must not be fully compartmentalized but conforms to some degree of regulation . an illustration of such regulation is provided by recent experiments showing that calcium / calmodulin - activated kinase ii ( camkii ) and ras , two important molecules for synaptic plasticity , exhibit differential displacements from activated spines into the parent dendrites during synaptic plasticity [ 19 , 44 ] . the authors assessed the spatial spread of two synaptically activated rho - gtpases , rhoa and cdc42 . whereas single - spine ltp induced by 2p glutamate uncaging leads to sustained activation ( up to 30 min ) of both rhoa and cdc42 , only activated rhoa readily traversed the spine neck into the parent dendrite , with activated cdc42 restricted to the stimulated spine . since the measured diffusional properties of these proteins were similar , it was proposed that mechanisms localized to the spine head were likely required to spatially restrict cdc42 activation , thereby enforcing the notion that spines are highly regulated biochemical compartments . taken together , the spatial compartmentalization of key regulatory molecules ( e.g. , protein kinases ) may also offer powerful constraints that impact the spread of intracellular signals from the spine to the parent dendrite . surface ( plasma membrane - bound ) ampars and nmdars exist at both synaptic and extrasynaptic locations . these surface receptor populations are not rigidly fixed , but in perpetual diffusional flux laterally through the membrane [ 4648 ] . similar to intracellular diffusion , the lateral mobility of proteins in the plasma membrane can also be influenced by morphological parameters of spines [ 4951 ] . for instance , frap analysis demonstrated that spine necks restrict the lateral diffusion of surface ampars . specifically , ampars at spines connected to the parent dendrite by a spine neck exhibit a twofold slower rate of lateral mobility compared to those at spines without a distinguishable spine neck ( figure 1 ) . similar results were obtained using membrane - bound gfp , indicating that the impedance of lateral mobility was dictated by morphological parameters of the spine , and not by intrinsic properties of ampar trafficking per se . evidence from both electron microscopy and fluorescence imaging indicates the presence of endocytic and exocytic zones within dendritic spines [ 5255 ] . interestingly , the dynamic balance of endo- and exocytosis modulates synaptic strength and underlie certain forms of plasticity . indeed , ltp induction results in an enhancement of ampar exocytosis [ 5660 ] . taken together , the strategic clustering of signalling proteins , the development of narrow spine necks , and the organization of vesicular cycling machinery can all contribute to biochemical compartmentalization of spines . this compartmentalization provides individual spines with the autonomous capacity to dynamically regulate the surface expression of distinct pools of ampars to promote the synapse specificity of synaptic plasticity . in addition to providing the morphological substrate for bestowing features of biochemical compartmentalization , spines may also function as electrical compartments capable of modulating the amplitude , kinetics , and integration of synaptic potentials . early estimations based on rallian cable theory and measurements of molecular diffusion indicated that only modest ohmic resistances would be provided by spine necks and therefore largely dismissed the notion that spines behave as electrical compartments [ 37 , 61 ] . however , recent experimental evidence suggests that electrical compartmentalization can take place in at least a subset of dendritic spines [ 13 , 17 , 62 ] . a combination of current - clamp recordings , 2p uncaging , and second harmonic membrane potential measurements provided evidence that long spine necks attenuate synaptic potentials between spine head and the parent dendrite . in this line , it is interesting to note that calcium transients induced by activation of nmdars can be readily detected by 2p calcium imaging in physiological extracellular magnesium concentrations ( ~1.0 mm ) in slices [ 6365 ] and in vivo [ 6668 ] , despite the presence of the voltage - dependent magnesium block of nmdars near resting membrane potentials . furthermore , calcium transients mediated by voltage - sensitive calcium channels ( vsccs ) can also be visualized upon synaptic activation , indicating unexpectedly large depolarizations at the spine head . together , these data suggest that spine necks may impart an appreciable degree of electrical resistance and charge accumulation in spine heads and thus electrically compartmentalize dendritic spines . an intriguing and functionally powerful idea is that the degree of both electrical and biochemical compartmentalization might be dictated by active modifications in spine morphology . this possibility is becoming increasingly prominent given the dynamic structural changes which accompany the expression of synaptic plasticity ( see below ) . the development of 2p glutamate uncaging to stimulate and induce ltp at single dendritic spines has been instrumental in providing key insights on the structural and functional changes that take place during plasticity . in 2004 , matsuzaki and colleagues induced ltp at individual dendritic spines by 2p glutamate uncaging and showed that the expression of ltp is associated with spine enlargement . furthermore , smaller spines carried an inherently higher propensity for ltp expression compared to larger spines , which were functionally and structurally more stable . interestingly , some of the molecular mechanisms underlying structural plasticity have been found to closely parallel those for synaptic plasticity . for instance , ltp induction stimuli involving strong synaptic input and large postsynaptic rises in calcium facilitate actin branching and polymerization , providing a protrusive force to mediate spine enlargement [ 4 , 6972 ] . conversely , ltd - inducing stimuli lead to actin depolymerization , spine shrinkage , and retraction . moreover , similar to the expression of long - lasting phases of ltp , the temporal stability of structural plasticity requires the synthesis of new proteins [ 23 , 42 ] . these fundamental similarities in the induction of both structural and functional plasticity indicate an intimate relationship between these two processes . one critical molecular link is camkii , a highly abundant protein in spines with an established role in synaptic plasticity [ 4 , 44 , 7375 ] . at rest , camkii directly bundles and stabilizes actin filaments and is involved in the structural stability of spines . camkii is activated by ltp - inducing stimuli , remaining persistently active and spatially compartmentalized to the stimulated spine properties that correlate well with the spatiotemporal characteristics of structural and functional plasticity . moreover , active camkii dissociates from the actin cytoskeleton causing structural destabilization , thus permitting structural modifications of the spine to take place . downstream , camkii activates a number of signalling molecules such as members of the rho - gtpase family ( rhoa , cdc42 , rac1 , and rnd1 ) to mediate changes in spine structure [ 45 , 72 , 77 ] . for instance , cdc42 becomes activated during ltp induction and interacts with p21-activated kinase ( pak ) proteins to stabilize structural modifications . mice expressing a dominant - negative pak ( dnpak ) transgene in the forebrain show abnormal dendritic spine morphology , defects in both ltp and ltd , and impairments in the consolidation of spatial and fear memory . whereas it is difficult to attribute the behavioural deficits exhibited by dnpak mice to synaptic impairments alone , these experimental strategies help to elucidate the interplay between structural and functional plasticity . although structural and functional changes rely on common signalling molecules , is it possible for these changes to occur independently of one another ? for instance , in ca1 pyramidal neurons , the temporal stability of ltp expression is dependent on actin polymerization . subsequent investigations have expanded on these findings , underscoring a critical role for cytoskeletal actin dynamics in the directed trafficking of ampars [ 69 , 70 , 78 , 80 , 81 ] . conversely , the insertion of ampars during ltp not only acts to increase synaptic strength , but has also been suggested to stabilize structural changes of the spine . these data suggest that the molecular components that drive structural changes in dendritic spines during plasticity also act to stabilize ampar insertion and vice versa . this dynamic interplay thus provides a basis for the tight association between changes in spine volume and ampar content during ltp . dendritic spines on pyramidal cell dendrites number in the thousands and exhibit a high degree of morphological heterogeneity . high - resolution electron microscopy studies provided the first indication that spine form and function were related by demonstrating that the size of the psd and number of ampars positively correlate with the size of spines [ 8386 ] . a number of recent studies provided functional support to these ultrastructural findings by showing a strong positive correlation between dendritic spine size and ampar function ( i.e. , size of ampar - mediated current ) , as determined by 2p glutamate uncaging [ 14 , 15 , 22 , 25 , 35 ] . considering the parallel changes observed in both structure ( i.e. , spine volume ) and function ( i.e. , ampar content ) during activity - dependent plasticity , it is perhaps not at all surprising that such a correlation exists . however , a more detailed and in - depth look at the literature , as outlined below , reveals that spines , at least in certain conditions , have the ability to significantly depart from such a tight structure / function coupling . one of the first indications pointing to a divergence of spine form and function was provided by smith et al . ( 2003 ) while describing the distance - dependent scaling of synaptic ampars in hippocampal ca1 pyramidal neurons . using a combination of whole - cell and dendritic recordings with 2p glutamate uncaging , they showed the synaptic weights of spines were progressively larger with increasing distances from the soma . however , this apparent increase in spine function was not accompanied with measurable changes in spine volume . nonstationary fluctuation analysis on 2p glutamate uncaging currents further revealed that this increase in function with dendritic distance reflected a higher density of spine ampars , and not an enhanced single - channel conductance . together , these data provide a convincing illustration that spines of similar size can express a strikingly wide range of ampar density . a disconnect between dendritic spine structure and function silent synapses contain detectable nmdars but are devoid of ampars and are therefore largely silent at rest ( ought to the magnesium - dependent blockade nmdars at resting membrane potential ) . they are thought to represent immature glutamateric synapses in part because their expression drastically diminishes during postnatal development [ 26 , 87 , 88 ] . not surprisingly , early 2p - glutamate uncaging investigations described the presence of silent synapses on thin , filipodial - like spines in developing ca1 pyramidal neurons . interestingly , however , subsequent investigations in the rodent somatosensory cortex reported that silent synapses can be detected at spines spanning a broad range of morphologies [ 14 , 18 ] . although providing indirect support to this notion , work in psd-95 ko mice also documented the presence of a structure / function uncoupling for spines . at an age where silent synapses were no longer detected in wt mice , psd-95 ko mice displayed a high proportion of silent synapses onto large spines that otherwise appeared mature . collectively , these data indicate that although there is a clear correlation between spine size and function , there is also room for a significant departure from this tight structure / function coupling . studies on the dynamical nature of spine structure during ltd also indicate a divergence in the signalling pathways that regulate spine size and function . 2004 ) reported that ltd and spine shrinkage at hippocampal synapses show differential requirements for protein phosphatase signalling via pp1 and calcineurin , despite sharing a similar requirement for nmdar activation . furthermore , while the actin - binding protein cofilin was involved in spine shrinkage , it seemed to play no role in the expression of ltd . more recent investigations have also indicated that clathrin - mediated endocytosis is not required for spine shrinkage , despite being essential for ltd expression . finally , ltd studies in cerebellar purkinje cells also reported dissociation between spine structure and function . indeed , sdrulla and linden reported that ltd at cerebellar parallel fiber - purkinje cell synapses was not associated with changes in either spine number or volume . in an interesting twist , the authors further identified a manipulation that led to a dramatic and global retraction of spines on purkinje neurons that , surprisingly , was not associated with significant changes in synaptic strength . thus , evidence obtained from ltd experiments in two distinct brain regions underscores a mechanistic divergence of spine structure and function . lastly , this divergence is further exemplified in a model of single - synapse homeostatic plasticity in dissociated cortical neuronal cultures . homeostatic plasticity refers to the ability of a neuron to bidirectionally tune synaptic ampar content in response to changes in overall network activity . recent experiments have expanded these findings by showing that homeostatic regulation of synaptic strength can be achieved at the level of individual dendritic spines [ 16 , 93 ] . in one experimental paradigm , chronic suppression of presynaptic glutamatergic input onto single spines leads to an enhancement of postsynaptic ampar function , as determined by 2p glutamate uncaging . interestingly , despite a marked increase in ampar currents , there were no discernable changes in spine volume ( see figure 2 ) . by comparing the current - voltage ( i - v ) relationship of ampars at these two populations of dendritic spines , activity - deprived synapses were found to express ampars with a distinct subunit composition ( ampars lacking the glua2 subunit ) . because this ampar subtype has an inherently higher conductance , this switch in subunit composition provides a mechanistically plausible model to account for the increased synaptic strength onto spines of similar volume . as a major component of excitatory synapses , spines are strategically poised to support important modulatory roles in synaptic transmission and neuronal function . although still subject to debate , an emerging notion posits that spines provide a structural scaffold to act as biochemical and electrical compartments . interestingly , discrete differences in dendritic spine morphology may directly influence the degree of functional compartmentalization ( figure 1 ) . in addition , the dynamic nature of spine structure [ 94 , 95 ] may generate parallel changes in the compartmentalization features of individual spines . one can speculate that these morphologically dependent degrees of compartmentalization lead to distinct states of metaplasticity at individual synapses . this notion aligns well with emerging theoretical models of synaptic learning that demonstrate that synapses exhibiting a gradation of states , each bridged by distinct metaplastic transitions , bestow neural networks with enhanced information storage capacity [ 96 , 97 ] . altogether , these considerations highlight the rich computational potential afforded by the yet to be completely understood relationship between form and function of dendritic spines .

advances in proteomic technology have allowed researchers to more deeply probe an organism s proteome resulting in a wealth of information . these methodologies have in part led to a shift from a global approach of assessing gene expression to one that is targeted and aims to identify and characterize proteins involved in a particular biological event ( kcher and superti - furga , 2007 ) . although most highly utilized for studies in yeast and animals , functional proteomic applications in photosynthetic organisms are on the rise , particularly in arabidopsis and rice , and have been employed to investigate such areas as development , stress response , and post - translational modification ( jorrn - novo et al . , 2009 ; wienkoop et al . , 2010 ; agrawal and rakwal , 2011 ) . they have also been used to explore protein interactions with other proteins , complexes and particular affinity matrices , which is ultimately important for understanding systems biology ( baginsky , 2009 ) . the use of affinity purification techniques has the added benefit of simplifying a complex mixture of proteins and enriching for those present in physiologically low amounts , facilitating detection . one area where affinity isolation approaches have had success is the study of rna binding proteins ( rbps ) . rbps are critical components of gene expression events in both the nucleus and cytoplasm and are involved in all facets of rna metabolism including transcription , pre - mrna processing , nuclear export , transport , localization , translation , and stability ( wilkinson and shyu , 2001 ; dreyfuss et al . , well - studied in yeast and metazoans , rbps are highly diverse and multifunctional ( wilkinson and shyu , 2001 ; dreyfuss et al . , 2002 ) with many characterized by the presence of one or more rna binding domains , such as the rna recognition motif ( rrm ) or k homology ( kh ) domain ( anantharaman et al . , 2002 ) . less is known about rbps in plants , however , and even though sequence analysis has predicted over 200 rrm- and kh domain - containing proteins within the arabidopsis genome alone , few are functionally characterized ( lorkovic and barta , 2002 ) . contributing to this lack of knowledge is that many rbps are plant - specific and lack homologs characterized in yeast and animal models ( lorkovic and barta , 2002 ; lorkovic , 2009 ) . as the importance of rbps in plant development and stress response becomes increasingly clear , it is imperative that more focus be directed at identifying and elucidating their activity ( fedoroff , 2002 ; bailey - serres et al . , 2009 ; lorkovic , 2009 ) . a few groups have attempted to do so by combining nucleic acid and ion exchange affinity chromatography with 2d gel electrophoresis ( 2de ) to enrich for low abundance rbps in arabidopsis , spinach , and rice ( baginsky et al . , 2007 ; xu et al . , 2007 ; masaki et al . , 2008 ; ni et al . , 2010 ) our laboratory has been particularly interested in identifying plant rbps involved in cytosolic rna localization , a process common to eukaryotes that spatially and temporally controls gene expression by targeting rnas to specific subcellular locations ( st . rna localization is dependent upon cis - localization , or zipcode , sequences within the rna which are recognized by one or more rbps ( singer , 1993 ) . along with other trans - factors , these rbps form a dynamic ribonucleoprotein complex that regulates nuclear processing and export , cytoskeleton - associated transport , localization , translation , and rna stability ( wilkinson and shyu , 2001 ; dreyfuss et al . rna localization has been well - characterized in yeast and metazoans , but relatively few studies have been reported in plants ( okita and choi , 2002 ; crofts et al . , 2004 ; bailey - serres et al . , one of the best models , however , is the localization of storage protein rnas in developing rice seed . for many years , our lab has been investigating the cytoskeleton - dependent , asymmetric localization of prolamine , and glutelin mrnas to distinct subdomains of the cortical endoplasmic reticulum ( er ) , the predominate site of protein synthesis in endosperm cells ( crofts et al . , 2004 , 2005 ; similar to other eukaryotes , this targeted transport requires cis - localization sequences likely recognized by rbps ( hamada et al . proper rna localization is critical to subsequent protein localization , as mis - targeting storage protein mrnas to the incorrect er domain results in improper protein deposition ( crofts et al . 2012 ) . in an attempt to elucidate the trans - acting rbps involved in rna transport , we previously identified ostudor - sn , a cytoskeleton - associated rbp that binds both prolamine and glutelin mrnas in rice endosperm cells and co - localizes with cytoplasmic prolamine mrna transport particles ( sami - subbu et al . , 2001 it is our goal , however , to identify the many other rbps that are likely involved in this process to better understand the mechanism of transport and ultimately , cytoplasmic plant gene expression . as previously mentioned , the increasing popularity of plant proteomics has led to a massive amount of information and efforts have been made to catalog these results ( jorrn - novo et al . , 2009 ) . here , we summarize our own efforts to provide such a resource for plant rbps identified by multiple affinity purification and proteomic experiments through the creation of the ricerbp database ( morris et al . , 2011 ; http://www.bioinformatics2.wsu.edu/ricerbp ) . to our knowledge , ricerbp is the first attempt to catalog experimentally identified rbps for use by the plant biology community . our interest in cytosolic gene expression in plants and the lack of available data in the literature led us to investigate what nucleic acid binding proteins , and in particular rbps , are found within the cytoplasm of developing rice endosperm cells . our ultimate goal was to deposit these findings into a publicly accessible database to share knowledge and resources with other plant scientists also interested in the field . we attempted to identify such proteins using a combination of affinity chromatography and proteomic techniques . as part of a more global approach , we enriched for nucleic acid binding proteins from a cytoskeleton - enriched developing rice seed extract using poly(u)-sepharose column chromatography , separated proteins in the bound fraction by 2de and identified reproducible protein spots by reverse phase liquid chromatography - tandem mass spectrometry ( lc - ms / ms ; doroshenk et al . , 2009 ) . from these experiments , over 150 distinct proteins were identified including putative rbps , translation factors , and metabolic enzymes . of the 20 proteins identified with suggested roles in rna metabolism , only four were previously characterized in the literature including ostudor - sn ( sami - subbu et al . , 2001 ; wang et al . , 2008 ) , confirming the successful application of such enrichment techniques . many of the uncharacterized rbps identified were predicted to be involved in rna processing based on the presence of rna binding domains such as the rrm and kh domain ( anantharaman et al . , 2002 ) . interestingly , review of the literature revealed that a number of proteins identified from this study categorized as having established roles in polypeptide biosynthesis or carbon metabolism were similar to proteins in other organisms that exhibited dual functionality and actually possessed rna binding activity ( doroshenk et al . this included protein chaperones and protein turnover enzymes involved in rna stability as well as membrane - associated transport proteins and carbohydrate metabolic enzymes with suggested roles in rna localization . the results of the poly(u)-sepharose experiments exposed the complexity of proteins that may be involved in cytosolic gene expression in plants . as our particular interest lies in the mechanism of rna localization using rice seed storage protein rna as a model , a more targeted approach was attempted to identify those proteins that interacted specifically with the prolamine rna cis - localization element , or zipcode . again taking an affinity chromatography / proteomics approach , the 36 nucleotide zipcode sequence from prolamine mrna was biotinylated and used as bait to isolate interacting proteins from a cytoskeleton - enriched developing rice seed extract ( crofts et al . , 2010 ) . the binding assay was performed in the presence of the competitive binding inhibitor heparin , a highly charged anionic molecule , to ensure specificity . bound proteins were separated by 1d sds - page and analyzed by lc - ms / ms . compared to a control capture experiment using non - zipcode rna as bait , 15 proteins were identified as having specificity for the prolamine zipcode ( crofts et al . , 2010 ) . ten of these proteins contained at least one predicted rna binding domain and of those , seven shared significant homology to heterogeneous nuclear ribonucleoproteins ( hnrnps ) , a class of proteins well - studied in metazoans and yeast with both nuclear and cytoplasmic roles in pre - rna processing , localization , and translation ( krecic and swanson , 1999 ; dreyfuss et al . , 2002 ) . interestingly , only one of the 15 proteins identified in the prolamine zipcode capture experiment was also identified in the poly(u)-sepharose binding fraction detailed above ( doroshenk et al . , 2009 ) , likely the result of the low abundance of these rbps in the cytosol and need for enhanced methods of enrichment . current efforts include further characterization of the identified prolamine rbps to establish their role in gene expression . because of the highly stringent nature of the prolamine zipcode capture experiment as a result of the addition of heparin in the binding buffer ( crofts et al . , 2010 ) , the experiment was repeated without the use of heparin to establish whether an even greater number of rbps could be identified . this was based partly on results from previous experiments demonstrating the known prolamine rbp ostudor - sn did not bind its target in the presence of heparin ( sami - subbu et al . , 2001 ; crofts et al . , 2010 ) . again using biotinylated prolamine zipcode rna as bait , bound proteins were analyzed by 1d sds - page and lc - ms / ms ( morris et al . , 132 putative rbps were identified including 12 proteins from the more stringent prolamine zipcode capture ( crofts et al . , 2010 ) . importantly , 77 proteins not found in either the poly(u)-sepharose affinity chromatography ( doroshenk et al . , 2009 ) or stringent prolamine zipcode capture experiments(crofts et al . , 2010 ) were identified and include a number of uncharacterized proteins with predicted rna binding domains ( morris et al . , 2011 ) . more study is necessary , though , to determine the nature of their role in plant rna metabolism . the three proteomic studies described above which sought to investigate rbps involved in plant cytosolic gene expression led to the combined identification of 257proteins derived from at least 221 distinct rice genes . these results have been compiled into ricerbp ( found at http://www.bioinformatics2.wsu.edu/ricerbp or bioinformatics1.smb.wsu.edu/ricerbp ) , a publicly accessible database for use by the scientific community ( morris et al . , 2011 ) . ricerbp is the only database to our knowledge containing data and analysis tools dedicated to the study of experimentally identified rbps . in fact , when compared to the pogs / plantrbp database ( walker et al . , 2007 ) which predicts plant rbps solely on sequence similarity , only 37% of the experimentally identified rice proteins had been previously annotated as rbps ( figure 1 ; morris et al . , functional annotations from the rice genome annotation project ( ouyang et al . , 2007 ) revealed a number of the experimentally identified rbps had putative roles in rna processing ( rna binding / translation ) as expected ( figure 1 ) . of interest , however , are the numerous proteins that had other unrelated predicted functions , particularly for the novel rbps not previously annotated as such by the pogs / plantrbp database ( walker et al . , 2007 ) , highlighting how little is known about this important class of plant proteins and the need for further study . functional annotations were obtained from the rice genome annotation project ( ouyang et al . , 2007 ) and proteins predicted to be rbps by the pogs / plantrbp database ( walker et al . , 2007 ) are represented in brown , while those newly identified as such are in green . reproduced with permission from morris et al . some of the features of ricerbp are demonstrated in figure 2 using rbp - p , a putative oligouridylate binding protein identified from the stringent prolamine zipcode capture experiment ( crofts et al . , 2010 ) , as an example . each unique , identified protein in ricerbp has been assigned a random identifier ( i.e. , rbp - a , -b or rbp-1 , -2 , etc . ) and cross - referenced to accession numbers representing gene , cdna and protein sequences from a variety of sources ( when available ) including ncbi , the rice genome annotation project , rice annotation project database and uniprot ( morris et al . , 2011 and references therein ) . information regarding predicted molecular weight , protein domains , subcellular localization , and functional annotation are given for each entry , as is whether the identification resulted from the poly(u)-sepharose ( polyu capture ; doroshenk et al . , 2009 ) , high stringency prolamine zipcode ( prolamine capture 1 ; crofts et al . , 2010 ) , and/or low stringency prolamine zipcode ( prolamine capture 2 ; morris et al . , 2011 ) detailed experimental methodologies for each of these experiments are provided in printable format as well . for each protein entry , the peptide sequences identified by mass spectrometry and position within the entire polypeptide sequence are highlighted ( a sub - set of mass spectrometry data is shown in figure 2 ) . separate links are also provided for each entry to view sequence alignments and phylogenetic tress highlighting paralogous family members within rice , as well as prokaryotic and eukaryotic orthologs , including important agricultural species such as barley ( hordeum vulgare ) , maize ( zea mays ) , sorghum ( sorghum bicolor ) , and wheat ( triticum aestivum ) . illustration of several features of ricerbp using rbp - p , a prolamine rna binding protein ( crofts et al . , 2010 ) , as an example . each protein entry contains information regarding accession identifiers , predicted function , antibody availability , and from which rbp capture experiment it was identified . links to web pages dedicated to each rbp provide additional information on predicted domains and subcellular localization as well as peptide data obtained from mass spectrometry analysis . a list of orthologous and paralogous family members for each entry , visualized by phylogenetic trees and sequence alignments , is also available . a variety of tools are offered for users of ricerbp including the ability to search the database for particular entries of interest using keywords or gene , transcript or protein accession identifiers . user supplied transcript or amino acid sequence can be entered to blast against rice proteins within the database as well . another resource includes visualization of transcript expression data from microarray experiments compiled from multiple public sources ( morris et al . , 2011 and references therein ) for a particular rbp entry if available . these datasets have been generated from a variety of rice tissue samples as well as developmental stages and experimental treatments . for those users interested in identifying proteins related to rice rbps in a specific species , an ortholog search tool is available with the option of selecting prokaryotic and/or eukaryotic queries and a downloadable results format . for details of the specific methodology for constructing ricerbp and available analysis tools , ricerbp continues to be a work in progress with the aim of providing a current and extensive plant rbp resource to the community . for instance , we hope to update the database with additional rbp orthologs as more plant genome sequences become available . we also plan to incorporate results from current efforts aimed at characterizing the functional roles of specific rice rbps in cytosolic gene expression , and particularly rna localization , as this data becomes available . antibodies have been generated to some of these proteins and their availability to the public has been noted within ricerbp . these antibodies are being used for rna binding and immunofluorescence localization studies , as illustrated by rbp - a and rbp - d , two putative hnrnps identified from the stringent prolamine zipcode rna capture experiment ( crofts et al . , 2010 ) . rna - immunoprecipitation ( rna - ip ) using rbp specific antibodies revealed both rbp - a and rbp - d interact with prolamine and glutelin rna in vivo ( crofts et al . , 2010 ; crofts et al . , unpublished results ) . furthermore , both proteins exist as multiple populations within rice endosperm cells , with rbp - a localized to the nucleus , microtubules , and cortical er ( crofts et al . , 2010 ) and rbp - d to the nucleus and particulate structures associated with actin filaments ( crofts et al . , unpublished results ) . dual localization of nuclear assembled ribonucleoprotein complex components has been demonstrated in other organisms as well ( giorgi and moore , 2007)and for rbp - a and -d may suggest multiple , diverse roles in pre - mrna processing , nuclear to cytoplasmic shuttling , cytoskeletal - associated rna transport , translational regulation or anchoring to the er . additional rice rbps will be subjected to similar studies . rna binding protein specific antibodies are also being used to identify both rna and protein targets which may offer further insight into functionality . rna - ip combined with microarray and next generation sequencing will identify rna targets specific to each rbp to better understand the global role of that particular rbp within the cell . based on the interacting rna sequences identified , prediction software is being utilized to determine whether particular rna sequence or structural motifs exist , which could be used to elucidate additional rna targets in rice . this information could also be used to identify targets of orthologous rbps in other plant species . rbp specific antibodies are also being used in traditional immunoprecipitation experiments to determine what other proteins may be associated . ribonucleoprotein complexes contain multiple proteins and rnas ( jansen , 2001 ; martin and ephrussi , 2009 ) and it would be of great interest to identify other protein components to understand the diverse mechanisms of rna transport , localization and stability within the cell . finally , mutant studies to further our knowledge of proteins involved in rna metabolism are underway . a number of rnai lines for particular rice rbps of interest have been generated while others are in construction . for example , characterization of rbp ostudor - sn rnai transgenic plants not only revealed a decrease in ostudor - sn transcript and protein levels , but also a decrease in prolamine transcript and protein levels , indicating a role in prolamine gene expression ( wang et al . , 2008).in addition , rice genetic mutants are being screened using the tilling method ( suzuki et al . , 2008 ) to identify those lines containing mutations within rbps of interest for further characterization . successful screens have identified candidate mutants for ostudor - sn and rbp - pand are currently being studied . specific to our interest in rna localization , genetic mutants impaired in storage protein synthesis , sorting or processing , which may be an indication of disrupted rna transport , have also been identified ( crofts et al . , 2004 , 2005 ) . one such mutant , glup4 , has been found to partially mislocalize both glutelin rna and protein and displays highly irregular membrane architecture within endosperm cells ( doroshenk et al . , 2010 ; fukuda et al . , 2011 ) . 2010 ) , a small gtpase with roles in early endosome formation and cytoskeleton - dependent transport , cargo recruitment , and er structuring ( zerial and mcbride , 2001 ; van der bliek , 2005 ; audhya et al . , 2007 ) . proteomic characterization of glup4 developing rice seed by two - dimensional difference in gel electrophoresis ( 2d - dige ) revealed a number of proteins that were differentially expressed in the mutant , including membrane - associated proteins and those involved in the biosynthesis of cell wall components and seed storage reserves ( doroshenk et al . the combined results of these studies suggest an interesting possibility that rna transport from the nucleus to the cortical er in rice endosperm is a membrane - associated process mediated by rab proteins(doroshenk et al . , 2010 , 2012 ) , an idea supported by work in drosophila oocytes ( ruden et al . , 2000 ; jankovics et al . , 2001 ; dollar et al . , as part of its role in membrane trafficking , the rice rab5 may bean important component of gene expression events within the cell . current studies include investigating whether rab5 plays an actual role in rna transport and if so , what other factors ( such as rbps ) may be involved . similar 2d - dige analysis of other genetic and transgenic mutants is also of interest . we anticipate that future versions of the ricerbp database will incorporate rna binding targets of selected rbps based on rna - ip microarray and sequencing data . additional functional and localization studies of rbps may also be included in the ricerbp database as such data becomes available . hence , we expect that the ricerbp database will continue to provide a centralized resource for biologists interested in this important , yet understudied , class of proteins and their role in plant gene expression . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

dowling - degos disease ( ddd ) was first described by dowling and freudenthal in 1938 , then by degos and ossipowski in 1954 . it is characterized by a reticulate pigmentation of the flexures with prominent comedone like lesions and pitted scars . the disease runs in families and has an autosomal - dominant mode of transmission with female preponderance . ddd , or dark dot disease , is a rare pigmentary genodermatosis that has been associated with hidradenitis suppurativa ( hs ) . hs is a chronically relapsing inflammatory disease that is characterized by recurrent draining sinuses and abscesses occurring predominantly in skin folds that carry terminal hairs and apocrine glands . hs is widely considered to occur more frequently in females than in males , with a ratio as high as 25:1 . the onset of hs peaks in individuals aged 1150 years , with an average patient age of 23 years . hs has a predilection for terminal hair follicles and apocrine sweat glands bearing region like axillary , inguinal and perineal regions . clinically , it is characterized by painful , tender erythematous papules and nodules , abscesses that burst open leading to sinus formation . we are reporting a rare interesting association of dowling - degos disease ( ddd ) and hs that is not reported in the indian literature till date . a 44-year - old female patient presented with multiple painful , tender nodular lesions and plaques with multiple sinuses discharging pus involving the buttocks , inner aspect of upper thigh , perianal region and both upper legs since the past 4 years but which aggravated since 1 month . two years back , she was diagnosed as a case of scrofuloderma and had received anti - tubercular treatment for 6 months . cutaneous examination revealed multiple tender nodules and plaques with multiple sinuses discharging pus involving the buttocks , inner aspect of upper thigh , anogenital region [ figures 1 and 2 ] and both upper legs . post inflammatory atrophic scarring was seen over the lower abdomen and inner aspect of the right thigh [ figure 2 ] . the patient also had asymptomatic , multiple , symmetrical , dark brown pigmented macules over the axillae [ figures 4 and 5 ] and groins . scattered comedo - like lesions ( dark dot follicles ) were seen over the abdomen , thighs [ figure 6 ] , back and upper extremity . the patient had multiple discrete pitted scars over the face [ figure 7 ] , back and axillae . multiple nodules and plaques with sinuses discharging pus involving the buttocks nodules , plaques and scars involving the inner aspect of the upper thigh and anogenital region crusted plaque over the right leg multiple dark brown pigmented macules and comedo like lesions ( dark dot follicle ) involving the right axilla multiple dark brown pigmented macules and comedo ( dark dot follicle ) involving the left axilla scattered comedo - like lesions ( dark dot follicles ) involving the right thigh multiple discrete pitted scars over the face investigations revealed normal blood counts , liver and renal function tests , but the erythrocyte sedimentation rate was raised . biopsy from the nodular lesion revealed neutrophilic and histiocytic infiltration around the pilosebaceous apocrine units [ figure 8 ] . histopathology from the pigmented lesion revealed irregular epidermis , acanthosis and elongation of rete ridges with increased basal melanin pigmentation [ figure 9 ] . neutrophilic and histiocytic infiltration around the pilosebaceous apocrine units ( h & e , 10x ) irregular epidermis , acanthosis and elongation of rete ridges with increased basal melanin pigmentation ( h & e , 10x ) our case was a female patient with onset of lesions at the age of 27 years . the patient had chronic relapsing multiple painful nodules , plaques with sinuses discharging pus and multiple scars in the aprocrine gland - bearing region . our patient was not aware of the flexural pigmentary lesions , comedones and pitted scars , which were also clinically and histopathologically suggestive of ddd . it has been associated with pigmentary disorders of skin folds ( dowling - degos and kitamura 's disease ) , rheumatologic diseases , neutrophilic diseases , cutaneous and other malignancies ( squamous cell carcinoma , epidermal cysts , keratoacanthoma ) . furthermore , the association of hs , ddd and multiple epidermal cysts has not been described before , but their co - existence in the same patient was likely to reflect the same follicular anomaly . it is possible that a single underlying defect of follicular proliferation may account for the co existence of these conditions . fenske et al , reported a case in which one patient had ddd , hs and multiple keratoacanthomas . abnormal epithelial proliferation involving mainly the pilosebaceous apparatus has been recognized in all three conditions . they speculated that a single underlying defect in follicular epithelial proliferation , characterized by variable expressivity , accounts for the co - existence of these clinically distinct disorders of follicular derivation . li et al , described a patient with hs in association with ddd and perianal squamous cell carcinomas . association may be due to co - occurrence rather than a truly common pathogenic mechanism or a gene linkage . there is paucity of reports in the literature regarding the association of hs and ddd . to the best of our knowledge

mantle cell lymphoma ( mcl ) is a rare subtype of non - hodgkin b - cell lymphoma . autoimmune haemolytic anaemia ( aiha ) is a relatively uncommon disorder with an estimated incidence in adults of 0.83 per 10/year , a prevalence of 17 : 100,000 and a mortality rate of 11% . recent reviews have focused on mcl treatment , without any data on haemolytic anaemia [ 1 , 3 ] . cases of mcl with aiha are usually excluded from clinical trials . in fact , this complication is rare in mcl in contrast with other lymphoproliferative disorders such as chronic lymphocytic leukemia . the treatment of aiha in mcl is not well defined , but immune chemotherapy is usually proposed to control the tumor and also hemolysis . ibrutinib , a bruton 's tyrosine kinase inhibitor , was recently approved for the therapy of relapse / refractory mcl . activation of the b - cell antigen receptor ( bcr ) signaling pathway contributes to the initiation and maintenance of b - cell malignancies and autoimmune diseases . ibrutinib is also an immunomodulatory drug , irreversibly binding to itk , thereby inhibiting th2 activation . this inhibition is specific to th2-polarized cd4 t cells , as resting lymphocyte kinase remains functional , thereby providing a compensatory platform for activation of th1 and cd8 t cells . recent data have demonstrated that cd4 t - cell populations isolated from chronic lymphocytic leukemia patients are skewed toward a th1 profile after exposure to ibrutinib . recent studies have suggested that ibrutinib is an effective treatment of ahai in chronic lymphocytic leukaemia [ 7 , 8 ] and could also be effective for ahai treatment related to mcl . a 75-year - old female was diagnosed with mcl with medullary involvement in august 2001 . given the evolution of her disease , she received 6 cycles of r - dhap ( rituximab , cisplatin , cytarabine , and dexamethasone ) followed by autologous stem - cell transplantation . complete remission was observed . in 2006 , however , she presented a lymph node relapse associated with an aiha . she received 6 cycles of r - had ( rituximab , bortezomib , aracytin , and dexamethasone ) , which allowed partial remission without aiha control . between february 2007 and february 2009 , she received maintenance treatment by bortezomib , rituximab , and cyclophosphamide and achieved complete remission of mcl and aiha . in july 2015 , a complete blood count showed a wbc of 4 10/l with 80% abnormal lymphocytes , haemoglobin 79 g / l , and a platelet count of 162 10/l . aiha was confirmed by an elevated lactate - dehydrogenase ( ldh ) level , reticulocyte count of 250 10/l , elevated total and direct bilirubin , low serum haptogloblin level , and a direct antiglobulin test was positive with 3 + reactivity with anti - igg . she was ecog 0 and showed no tumoral syndrome except for a 2-centimeter splenomegaly under the costal edge . the patient was diagnosed with aiha and relapse of mcl and received prednisone 1 mg / kg . one month later , a complete blood count demonstrated an improvement in anaemia ( haemoglobin 106 g / l ) and haemolysis ( normal ldh and bilirubin levels ) and disappearance of the splenomegaly . six months later , the patient had a normal level of haemoglobin at 120 g / l but without hemolysis stigmata . however , a direct antiglobulin test remained positive . aiha is a rare but life - threatening complication in mcl . in this report , ibrutinib allowed rapid aiha remission , whereas previous aiha had required several months of steroid therapy . in this situation , rapid discontinuation of steroid therapy may be a safer approach to aiha treatment of patients with mcl . to our knowledge , this is the first report of ibrutinib therapy aimed at controlling aiha in mcl .

cortical neurons receive thousands of excitatory and inhibitory synaptic inputs , both long - range and from local circuits . balancing between the resultant excitatory and inhibitory currents is therefore crucial to keep the neurons at a functional dynamic range , namely near their firing threshold , allowing them to rapidly elicit action potentials in response to changes in their inputs . substantial perturbation of this balance may lead to either a strongly inhibited circuit , where most of the neurons remain quiescent , or an epileptic state with runaway firing . indeed , excitation - inhibition imbalance has been implicated in several neurological and psychiatric diseases ( yizhar et al . , 2011 , dehghani et al . , 2016 ) . it has been shown that under conditions where recurrent neuronal circuits are connected via strong synapses , the firing rates of excitatory and inhibitory populations adjust dynamically , resulting in an asynchronous balanced state ( van vreeswijk and sompolinsky , 1996 ) . in this state , this fluctuation - dominated state has many spatial and temporal response properties that resemble those of cortical neurons ( brunel , 2000 , renart et al . , 2010 , hansel and van vreeswijk , 2012 , pehlevan and sompolinsky , 2014 , wimmer et al . , 2015 ) . however , the emergence of balanced states in excitation - inhibition networks is based on the common assumption of a uniform connection probability , namely that all neurons in a population have similar total number of connections . yet recent studies reported that cortical neurons exhibit significant heterogeneity in their input probability ( okun et al . , 2015 ) and in their total synaptic current ( xue et al . , 2014 ) . such heterogeneity is already apparent from anatomical studies of the first stage of input into the cortex : the innervation of layer 4 ( l4 ) neurons by thalamocortical axons ( da costa and martin , 2011 , furuta et al . , 2011 , schoonover et al . , 2014 ) . the assumption of uniform connectivity is hence questionable , and we therefore investigated how heterogeneity in input connectivity will impact the excitation - inhibition dynamics of cortical networks . we first study this issue in abstract network models in which the structural variability in the total synaptic input to postsynaptic cells across the population is much larger than expected from that of uniform connection probability . we show theoretically and by simulations that the dynamic cancelation between excitation and inhibition is undermined , and a majority of neurons are completely suppressed while a small number of neurons fire action potentials regularly at unrealistically high rates . we present a quantitative measure of the structural imbalance , accounting for both correlations and heterogeneity , which predicts whether excitation - inhibition balance can be achieved . the first is homeostatic synaptic plasticity , which adjusts the functional connectivity patterns in the network to compensate for the structural imbalance . we show that this adaptation current generates local negative feedback that cancels the excess synaptic input at the single - cell level . this leads to a novel adaptation - facilitated balance , in which the adaptation current enables neurons to remain near threshold and fluctuations drive irregular , asynchronous activity . we study the effect of heterogeneity on excitation - inhibition balance and the possible mechanisms to recover balance in a realistic network model of l4 of the d2 column of the vibrissal part of rat primary somatosensory cortex ( vs1 ; i.e. , barrel cortex ) . there is strong anatomical evidence that the l4 barrel comprises a relatively complete local network , with axons and dendrites of both excitatory and inhibitory neurons remaining largely restricted to the barrel , and thalamic ventral posteromedial nucleus ( vpm ) axons defining the barrel boundaries . using a statistical connectivity model based on reconstructions of the detailed 3d anatomy of the barrel cortex ( egger et al . , 2014 ) , we provide realistic estimates of the heterogeneity in input connectivity in the local l4 circuits ( i.e. , within the barrel ) and study the resulting dynamics in an anatomically constrained network of linear integrate - and - fire ( lif ) point neurons ( gerstner and kistler , 2002 ) . we find that non - uniformities in the distributions of excitatory and inhibitory somata ( meyer et al . , 2013 ) , and morphological diversity within and across l4 cell types ( koelbl et al . , 2015 , the estimated levels of correlations between excitatory and inhibitory input connectivity are significant but still yield substantial structural imbalance , and are therefore not sufficient to restore a balanced state . in numerical simulations , we find that structural heterogeneity has dramatic impact on the activity in the major thalamo - recipient layer , for example , allowing only a fraction of neurons to be responsive to sensory input . we test both homeostatic plasticity and the novel adaptation - facilitated balance on our anatomically constrained model of l4 in rat vs1 . we show that over the necessary long timescales of homeostatic plasticity , functional in - degrees can be adjusted to recover realistic firing . furthermore , we show that on more rapid timescales , adaptation currents with strengths and time courses comparable with those observed experimentally are sufficient to counteract the structural heterogeneity of the l4 network , thereby yielding an asynchronous balanced state with realistic firing rates during both periods of spontaneous and periods of stimulus - evoked activity . network models often assume a homogeneous probability of connection between pairs of neurons , given their cell types . in such networks , the in - degree , i.e. , the total number of inputs to individual neurons , is narrowly distributed around its mean , k. specifically , the sd k is proportional to the square root of the mean . in the cortex , typical in - degrees are on the order of thousands , so that in these homogeneous network models the sd of the in - degree is small relative to the mean ( figure 1a , left ) . to analytically study the effect of deviating from this homogeneity assumption , we consider networks with heterogeneous in - degrees and characterize their distribution by the coefficient of variation , cvk=k / k . in homogeneous networks , cvk is much smaller than 1 ; networks are said to be heterogeneous if they have cvk of order unity ( figure 1a , right ) . we study heterogeneous networks with three cell types : excitatory ( e ) and inhibitory ( i ) neurons as well as an excitatory external population denoted by o. we write the mean in - degree from type b onto type a as k. we also write k as the mean connectivity across the entire network . we focus here on the first- and second - order statistics of the connectivity structure , assuming negligible higher - order statistics such that the identities of a neuron s postsynaptic targets are independent of its own in - degree . furthermore , we assume the network is in an asynchronous state characterized by population rates : r , r , and r. we write the three in - degrees of the ith neuron of type a = e , i as { kiabkab } for b = e , i , o , where the relative in - degree , kiab , is neuron i s in - degree from cell - type b divided by the mean over all postsynaptic neurons of type a. then the total mean synaptic current to this neuron is(equation 1)iia = kiaejaere+kiaijairi+kiaojaoro , where j is the strength of synaptic connections from neurons of type b onto neurons of type a scaled by the mean number of connections k. as in the balanced network of van vreeswijk and sompolinsky ( 1998 ) we assume that the synapses are strong , such that action potentials in a small fraction of presynaptic neurons are sufficient to evoke an action potential in the postsynaptic neuron . therefore , the excitatory and inhibitory synaptic currents in equation 1 are each large relative to threshold , and for the net current to be within range of the threshold , the excitatory and inhibitory contributions need to approximately cancel each other , yielding a set of linear equations that we refer to as the balance conditions:(equation 2)kiaejaere+kiaijairi+kiaojaoro0.for a network with small cvk , all kiab are approximately 1 . thus , the near - threshold condition reduces to the two linear equations of the balanced state of homogeneous networks , two equations for the two unknowns r and r. in such a network it has been shown that the mean population rates will dynamically adjust their value and arrive rapidly at a steady state that satisfies these equations . this balancing of the net excitatory and inhibitory currents yields a state where most of the neurons are near threshold and driven by the fluctuations in synaptic current ( van vreeswijk and sompolinsky , 1998 ) . however , in the case where cvk is non - negligible , each relative in - degree kiab may be substantially different , and therefore there is no pair of excitatory and inhibitory population rates that can combine to satisfy equation 2 for more than a small fraction of the population . due to the substantial difference between in - degrees within the network , any given population rates will only balance synaptic current of a small fraction of neurons . the remaining neurons will either have a larger ratio of inhibitory to excitatory in - degrees , and therefore be completely suppressed by strong total inhibitory current , or they will have a smaller ratio , in which case they will be driven to high firing rates with regular inter - spike intervals ( isis ) . thus , we expect the dynamic balance between excitation and inhibition to fail in heterogeneous networks ( see experimental procedures ) . we have numerically confirmed these predictions by generating heterogeneous networks and simulating them with lif point neurons ( experimental procedures ) . even in a network with only moderate heterogeneity ( cvk = 0.2 ) , the lack of balance is immediately apparent in the dynamics of both the population firing ( figure 1b ) and the individual neuron subthreshold potentials ( figure 1c ) . the population rate distributions are highly skewed , with over 75% of neurons completely quiescent and an extremely long tail of neurons with very high firing rates and low average coefficient of variation of isi ( cvisi ) ( figures 1d1f ) . in such a state even the mean current over all postsynaptic neurons is not balanced , reflected in population firing rates versus input strength that deviate from the linear population balance predictions ( figure 1 g ) . evidently , substantial heterogeneity of input connectivity leads to a breakdown of the balanced state . the above analysis was based on the assumption that excitatory and inhibitory in - degrees are uncorrelated . if , however , they are correlated , this could potentially restore the excitation - inhibition balance . indeed , evidence of correlations between postsynaptic excitatory and inhibitory currents has been reported recently ( xue et al . , 2014 ) . in the extreme case where all three vectors of relative in - degrees are the same , kiab = kia , the set of balance equations ( equation 2 ) can be effectively reduced to the pair of population equations of the homogeneous case , and the dynamic balance of the population rates will guarantee that the net mean current on all postsynaptic neurons is canceled and balance is restored . writing kiab = kia+kiab , where kia is the mean of the three vectors kiab , we introduce a measure of structural imbalance:(equation 3)=(kiab)2,where the average is over neurons and type - to - type pathways . in the supplemental information , we show that to achieve excitation - inhibition balance note that can be small either if in - degrees are uncorrelated but narrowly distributed , such as in homogeneous networks , or if in - degrees are broadly distributed but highly correlated . this bound implies that the structural demands for maintaining balance in the face of heterogeneity are extremely stringent : in heterogeneous networks , the cell - to - cell variability of the input connectivity must be close to fully correlated across all presynaptic populations to enable the emergence of the balanced state . to check the above prediction , we generated heterogeneous networks scanning the two - dimensional parameter space consisting of cvk and the correlation coefficient c between in - degrees from each pair of presynaptic populations ( experimental procedures ) . in agreement with our theoretical bound , simulations reveal that only networks that are sufficiently homogeneous or have sufficiently correlated in - degrees exhibit the dynamics of excitation - inhibition balance ( figure 2 ) . for example , for networks with correlation coefficients as high as 0.7 , as cvk increases from 0 to 0.3 , we observe a crossover from a state in which all neurons are active with cvisi around 1 to a state in which more than 80% of neurons are quiescent throughout the trial ( figure 2a ) and those that fire have cvisi less than 0.5 ( figure 2b ) . furthermore , by plotting both cvisi and the fraction of quiescent neurons as a function of structural imbalance ( ) for networks with a range of structural parameters , we confirm that is an effective measure for predicting dynamical imbalance ( figure 2c ) . our simulations indicate that in - degree correlations mitigate the impact of structural heterogeneity , but balance is restored only for extremely high correlations . if the relative in - degree vectors are not highly correlated , excitation - inhibition balance can still be achieved if the synaptic weights are properly tuned . such a relation between synaptic efficacies and structural connectivity may emerge via homeostatic synaptic plasticity . a simple scenario is that the strength of each synapse is scaled by a factor proportional to the inverse of the in - degree of the postsynaptic neurons , jijab(jab / kiab ) , which will compensate for the structural heterogeneity . indeed , as we show in the supplemental information ( figure s1 ) , such a scaling of all synaptic strengths in the network yields balanced dynamics . however , such a scaling would require extensive plastic changes in the synaptic efficacies of all pathways , and the outcome will be a network with net synaptic currents that are homogeneous across each population . in fact , a recent study reported broadly distributed net synaptic currents across a cortical population , although with significant correlations between total excitatory and inhibitory synaptic currents . that study suggested that these correlations might be in part the consequence of plasticity of inhibitory synapses ( xue et al . in addition , two recent theoretical and numerical studies have proposed inhibitory plasticity as a mechanism for balancing excitatory and inhibitory inputs ( luz and shamir , 2012 , vogels et al . , 2011 ) . these results motivate the question : can plasticity in the inhibitory synaptic weights alone recover balance ? to explore this possibility , we assume a network with heterogeneous , uncorrelated in - degrees and initial homogeneous synaptic weights . we study plastic changes that depend only on postsynaptic activity and write the relative change in inhibitory synaptic strength onto the ith neuron of type a as jiai . this plasticity can be thought of as changing the functional in - degree of each neuron , kiai , so that the mean net synaptic input to neuron i is still given by equation 1 , but with kiai = kiai , struct(1+jiai ) , where kiai , struct is the structural in - degree . it is straightforward to see that plastic changes to the functional inhibitory in - degrees can be sufficient to bring the net current of each neuron near threshold , satisfying the balance conditions of equation 2 . in fact , the plastic changes that will satisfy those equations yield functional inhibitory in - degrees that are coplanar ( i.e. , lie in the plane spanned by the excitatory and external in - degrees ) , of the form(equation 4)kiai=ejaejaikiaeojaojaikiao , where the coefficients and must both be positive and they determine the firing rates ( relative to r ) that will dynamically balance the net synaptic currents ( see supplemental information for further details ) . to check whether a plausible homeostatic inhibitory plasticity can reach this solution , we simulated a homeostatic plasticity rule on inhibitory synapses , reminiscent of synaptic scaling ( turrigiano et al . , 1998 , rannals and kapur , 2011 , keck et al . , 2013 ) , in which changes in synaptic strength depend only on postsynaptic firing ( experimental procedures ) . this plasticity rule increases the strength of inhibition in proportion to the postsynaptic neuron s firing rate , thus preventing neurons from firing at extremely high rates . neurons firing at high rates due to structural imbalance will have their functional inhibition gradually increased , while quiescent neurons will have their functional inhibition reduced until equation 4 is satisfied self - consistently across the population ( see supplemental information ) . indeed , applying this plasticity rule on inhibitory synapses , we found that the network recovered excitation - inhibition balance by yielding coplanar functional in - degrees ( figure 3a ) , decreasing the functional imbalance throughout the time of plasticity ( figure 3b ) , and generating irregular firing dynamics with reasonable rate distributions ( figures 3c and 3d ) . as explained in the supplemental information , the solution of coplanar functional in - degrees achieved by homeostatic plasticity is qualitatively different from the situation of low structural imbalance presented earlier . with low structural imbalance , balance can be achieved for the same broad range of synaptic strength parameters , j , as for homogeneous networks . in contrast , after homeostatic plasticity , the functional in - degrees are aligned for the particular values of j , as reflected in equation 4 . homeostatic synaptic changes such as described earlier ( equation 4 ) depend on the structural in - degrees of the external drive . because homeostatic plasticity is relatively slow , of timescales of hours to days ( turrigiano et al . , 1998 , 2013 ) , this mechanism will be unable to react fast to changes in the identity of the external population that drives the circuit . it is thus important to explore faster mechanisms for restoring balance in structurally heterogeneous networks . adaptation currents have been widely reported in cortical neurons with decay times on the order of seconds , and may be generated by a number of possible cellular mechanisms including na- or ca - dependent k conductances ( sanchez - vives et al . , we show that spike - frequency adaptation currents can compensate for the imbalance due to heterogeneous connectivity . to explore this scenario analytically , we introduce a spike - frequency adaptation current such that after a neuron fires a spike it receives a negative current with amplitude jad that is on the order of magnitude of a single postsynaptic current and has a decay time , ad , of the order of a second . such current will add to the net current of ith neuron of type a ( equation 1 ) , a negative term , jadaadaria , where ria is the neuron s firing rate . because the decay time of adaptation is much larger than the membrane time constant , the adaptation current accumulated over time may be large ; we assume that it is of the same order of magnitude as the synaptic currents . therefore , adaptation can counter the local imbalance in the synaptic inputs and ensure that most neurons are in a near - threshold steady state . requiring that the net current on the active neurons is balanced yields an equation for the local firing rates(equation 5)ria=1jadaadakiaejaere+kiaijairi+kiaojaoro+,where x+ is x for x > 0 and zero otherwise . averaging these relations over all neurons in a population yields self - consistency equations for the population firing rates ( supplemental information ) . note that the neurons for which the net synaptic input is negative will be quiescent . the fraction of quiescent neurons is controlled by the strength of the adaptation or its time constant . for instance , for a fixed ad , as the adaptation current amplitude jad increases , the fraction of neurons that are quiescent decreases ; above some critical value all neurons are active ( supplemental information ) . in this parameter regime , the above equations for the local firing rates become linear and averaging them over the full population yields the following linear equations for the population rates , as a function of the external drive,(equation 6)(jeejadeade)re+jeiri+jeoro0jiere+(jiijadiadi)ri+jioro0.to test our theory , we simulated a network model with parameterized input heterogeneity and correlations ( figure 4 ) . we find that : ( 1 ) the above linear equations predict very well the mean network rates ( equation 6 ; figure 4a ) , ( 2 ) the fraction of quiescent neurons is near zero ( figure 4b ) , and ( 3 ) the cvisi is near 1 ( figure 4c ) . our theory yields a good prediction not only for the mean rates , but also for the individual neuron rates ( equation 5 ; figure 4d ) . the adaptation current facilitates the dynamic balancing of net current despite the heterogeneous in - degrees and enables the emergence of substantial membrane potential fluctuations ( figure 4e ) , which drive irregular firing ( figure 4f ) . furthermore , our theory predicts that the strength of the adaptation current necessary to recover balance depends on the extent of in - degree correlations . in fact , the measure of structural imbalance , as given by the deviation from full correlation , ( equation 3 ) , determines the strength of adaptation necessary to recover balance ( experimental procedures ) . for fixed cvk = 0.2 , we explored the impact of varying both correlations and adaptation strength on the dynamical state of the network ( figure 4 g ) . we observed that for a network with fully uncorrelated in - degrees to guarantee that only 5% of neurons were quiescent required that the post - spike amplitude of the adaptation current be about the same size as a single excitatory postsynaptic current ( epsc ) . however , in a network with in - degree correlations c 0.7 , for example , an adaptation current with one - third the amplitude was sufficient to achieve the same recovery of balance . we note that the adaptation - driven balanced state is qualitatively different from the balanced state of homogeneous networks in which the heterogeneity of firing rates emerges from the fluctuation - driven dynamical state even if all neurons have nearly the same number of inputs . here individual firing rates are determined by the individual input connectivity ( equation 5 ) , and in the parameter regime where all neurons are active these rates are a linear function of the in - degree ( supplemental information ) . finally , we observe that this solution to structural imbalance is robust . in contrast with the homeostatic plasticity solution , which achieves balance only for a particular pattern of activity of external populations and responds to changes only over long timescales , adaptation reacts rapidly to changes in the relative activity of external populations with independent connectivity statistics . to obtain realistic estimates of the extent of heterogeneity and correlations in the input connectivity within a cortical circuit , we use an anatomically well - constrained connectivity model of an l4 barrel in rat vs1 and its thalamic inputs ( figure 5 ) . as described previously ( egger et al . , 2014 ) and reviewed in the supplemental information , a full - scale matrix of the probability of connections between all neurons in vs1 ( dense statistical connectome ) was generated on the basis of precisely measured 3d distributions of excitatory and inhibitory somata , which are non - uniform and cell - type specific even within l4 ( figure 5b ) , and 3d reconstructions of in vivo- and in vitro - labeled dendrite and axon morphologies , which are highly variable even within cell types ( figure 5c ) . cell - type average connection probabilities have been validated ( egger et al . , 2014 ) by comparison with studies that used paired recordings ( feldmeyer et al . , 1999 , constantinople and bruno , 2013 ) or correlated light and electron microscopy ( schoonover et al . , 2014 ) . in the present study , we examine a network consisting of 3,283 excitatory neurons , comprising spiny stellate and star pyramidal cell types ( feldmeyer et al . , 1999 ) , and 680 inhibitory interneurons ( koelbl et al . , 2015 ) , representing the l4 barrel in the d2 column . in addition , all neurons in the network are innervated by 311 neurons located within the somatotopically aligned barreloid in the ventral posterior medial division of the thalamus ( vpm ) ( land et al . , 1995 ) . analysis of the resulting anatomically constrained connectivity reveals that the non - uniformities in the underlying anatomy give rise to substantial heterogeneity in the excitatory , inhibitory , and vpm input connectivities ( figure 5d ) . the resulting in - degree distributions are significantly broader than those of homogeneous networks ; in particular , we find values of cvk around 0.3 ( table 1 ) . our analysis also shows that the excitatory and inhibitory in - degrees are strongly correlated , with correlation coefficients ranging from 0.55 to 0.79 for input to excitatory cells and up to 0.91 for inhibitory cells ( table 1 ) . thus , an important question is whether these high correlations are sufficient to yield a balanced state . an initial answer is given by the network s structural imbalance ( equation 3 ) . we find for the anatomically constrained network k > 10 , which predicts a substantial imbalance of the dynamics . we test this answer by simulating the dynamics of a network of lif neurons with the anatomically constrained connectivity matrix . indeed , we find that the network deviates significantly from a balanced state ( figures 5e and 5f ) , despite the substantial in - degree correlations . the rate distributions are extremely skewed with a large fraction of neurons quiescent ( figures 5 g and 5h ) , individual neurons fire regularly especially at moderate rates ( figure 5i ) , and the mean population rates deviate from the linear balance equations ( figure 5j ) . nevertheless , the presence of correlations between the in - degrees does have a significant impact on the level of spike irregularity , reflected in a moderate cvisi , especially at low mean population rates . at low rates , the total excitatory and inhibitory currents are not substantially larger than threshold and therefore , in spite of the remaining imbalance , residual fluctuations continue to contribute significantly to the dynamics of active neurons , even as they account for less than one - third of the population . for higher mean firing rates ( 10 hz and above ) , however , the mean currents dominate and firing becomes regular ( figure 5 ) . our analysis shows that anatomical variability within the local recurrent network is expected to yield broken balance dynamics in the major thalamo - recipient layer . furthermore , we applied the anatomically constrained connectivity estimate to the excitatory circuit across the entire d2 column and we find that structural heterogeneity is substantial within and across all layers ( table s1 ) . as we show in the supplemental information , inhibitory homeostatic plasticity as described earlier on abstract network models succeeds similarly in the anatomically constrained network , aligning the functional in - degrees so that all neurons fluctuate near threshold and recover the realistic firing patterns generated by excitation - inhibition balance ( figure s2 ) . next we explore whether a biologically plausible spike - frequency adaptation can maintain balance on behaviorally relevant timescales . to test whether adaptation is a biologically plausible solution for the expected imbalance in local cortical networks due to structural heterogeneity , we introduced an adaptation current into our anatomically constrained network model and tested its effect in realistic spontaneous as well as stimulus - evoked states ( figure 6 ) . we simulated our network with external input from a population of vpm neurons with spontaneous firing rate set to drive the excitatory population at mean firing rate near 2.5 hz for 60 s. using an adaptation current comparable with that found empirically ( gupta et al . , 2003 , la camera et al . , 2006 ) , the network exhibited balanced dynamics : neurons fired irregularly and only 3% of neurons were quiescent , while the maximal firing rate was 15 hz . moreover , the shape of the rate distribution was roughly log - normal as observed empirically ( buzski and mizuseki , 2014 ) ( figure 6e , right ) . to gain insight into the respective role of adaptation and in - degree correlations , we compare our network to the same anatomically constrained network but without adaptation and also to a network without correlations but with the same marginal in - degree distributions ( experimental procedures ; figure 6e ) . the uncorrelated network has structural imbalance more than five times larger than the anatomically constrained network , yielding k 55 . as expected , all three networks fired irregularly at these low firing rates , but in the uncorrelated network without adaptation , 57% of excitatory neurons were quiescent throughout the entire 60 s simulation while active neurons reached rates greater than 90 hz . in the anatomically constrained network with correlations intact but without adaptation , the percentage of excitatory quiescent neurons was significantly lower , 37% , with maximum rates well more than 60 hz . as predicted by our theory , in - degree correlations due to the underlying anatomy moderately reduce the extent of imbalance , but nevertheless an adaptation current is necessary to bring the anatomically constrained network into a balanced steady state . furthermore , similar to the abstract network ( figure 4 g , top ) , in - degree correlations in the anatomically constrained network act in concert with the adaptation current to recover balance . the same strength adaptation current when applied to the uncorrelated network was only sufficient to reduce the fraction of quiescent neurons to 15% . an adaptation current four times larger was required to achieve a comparable level of 3% in the uncorrelated network . we now ask how our network model responds to realistic stimulus settings . to address this question , we simulated 100 trials of a well - studied stimulus protocol called the ramp - and - hold stimulus , in which the principal whisker ( pw ; i.e. , the one that corresponds to the somatotopic location of the barreloid - barrel ) is deflected for 200 ms and then released ( figure 6a ) ( simons and carvell , 1989 , brecht and sakmann , 2002 , minnery et al . , 2003 , de kock et al . , 2007 ) . we simulated the vpm neurons in our model so that at stimulus onset they fired at elevated rates for an initial 10 ms followed by moderate rates throughout the end of stimulus duration ( simons and carvell , 1989 ) ( figure 6b ) . in the uncorrelated network , on any given trial 88% of neurons were unresponsive to the stimulus and even more significantly , 73% of neurons were completely unresponsive to the stimulus throughout all 100 trials . the correlations present in the anatomically constrained network reduced the percentage of neurons unresponsive to the stimulus on any given trial to 78% , while 49% of the neurons never responded to the stimulus . finally , after introducing adaptation , the percentage of neurons unresponsive on a given trial declined to 55% and that of completely unresponsive declined to less than 10% ( figures 6c and 6d ) . our theoretical analysis above describes the steady - state balance generated by the adaptation current . it is therefore important to inquire how fast the balancing effect of adaptation sets in . our simulations of the transient response to a 200 ms stimulation show that the adaptation current in fact accumulates enough to recover balance at timescales that are a fraction of the adaptation time constants , which are in the range of 500 to 2,000 ms , and is sufficient to dramatically impact the transient network dynamics during stimulus response ( figure 6d , right ) . we conclude that a biologically plausible adaptation current together with high input connectivity correlations derived from the anatomical constraints are capable of recovering fluctuation - driven balance and realistic cortical firing in l4 during both spontaneous and stimulus - evoked states . studies in cat visual cortex ( da costa and martin , 2011 ) and rat barrel cortex ( furuta et al . , 2011 , schoonover et al . , 2014 ) have shown that the first stage of input into sensory cortex has remarkably heterogeneous connectivity : the total number of innervating thalamic synapses differs substantially from cell to cell in l4 . the anatomically constrained estimates of connectivity presented here support this conclusion and expand it to the recurrent connectivity as well . our theoretical and numerical results show that such input heterogeneity can have dramatic impact on the balance between excitation and inhibition in the l4 recurrent network . lacking a mechanism to recover balance , such networks will exhibit extreme population sparsity with a majority of neurons quiescent throughout both spontaneous and stimulus - evoked epochs and with active cells firing at high rates with temporal regularity . some research suggests that trial - to - trial variability in the l4 barrel cortex is externally generated , and thus excitation - inhibition balance may not be a feature of this network ( hires et al . , 2015 ) . others have found that cortical interactions even in l4 are in fact a rich source of variability ( cohen - kashi malina et al . , 2016 ) . in our simulations , individual neurons display variability that is due to vpm input and additional trial - to - trial variability due to cortical interactions ( figure 6f ) . regardless of how this open question is settled , however , the impact of heterogeneous connectivity on excitation - balance has far broader implications . our anatomy - based estimates of connectivity predict substantial heterogeneity in all cortical layers ( table s1 ) . thus , it is crucial to address how local networks maintain the dynamic balance of excitation and inhibition in spite of heterogeneous connectivity across cortical regions and layers . to assess the structural heterogeneity in cortical circuits and its impact on dynamics , it is necessary to quantify the extent of correlations in the net input from different presynaptic populations . correlations between total excitatory and inhibitory synaptic current onto cortical neurons were observed via in vivo intracellular recordings ( xue et al . , 2014 ) , and they are shown here to arise at least in part because of anatomical variability underlying local networks ( see anatomical sources of heterogeneity below ) . we show that these correlations ensure that a large component of heterogeneous synaptic inputs cancel out at the level of net current . we have presented a measure of the net structural imbalance that takes into account both the heterogeneity and the correlations in net inputs and predicts the extent of dynamic imbalance . we have proposed two cellular mechanisms capable of restoring excitation - inhibition balance in local networks despite substantial heterogeneity : homeostatic plasticity and adaptation . plasticity in parvalbumin - expressing inhibitory neurons was implicated for equalizing excitation - inhibition ratios in sensory cortex ( xue et al . , 2014 ) , and another study suggested that inhibitory neurons may contribute to homeostatic stabilization via synaptic scaling of postsynaptic gabaa receptor expression ( rannals and kapur , 2011 ) . we show that homeostatic plasticity of inhibitory synapses in heterogeneous networks can align functional in - degrees to precisely balance the combined excitatory input from recurrent and external sources . we use a simple plasticity rule , reminiscent of synaptic scaling ( turrigiano et al . , 1998 ) , in which changes in synaptic strength depend only on the activity of postsynaptic neurons . it is worth noting that this solution would require long timescales to align the in - degrees to a particular external population driving the network , and we therefore sought a solution that would be robust to more rapid changes to the identity of the primary external drive . spike - frequency adaptation has been widely studied for its coding properties ( wark et al . , 2007 ) . here we study the dynamical impact of adaptation on the emergent fluctuation - driven balanced state in heterogeneous networks . we show that the local negative feedback generated by spike - frequency adaptation balances out the excess synaptic current due to the structural heterogeneity , resulting in a new adaptation - facilitated balanced state . we note that while in other circuits adaptation generates synchronous oscillations ( van vreeswijk and hansel , 2001 , ladenbauer et al . , 2012 ) , in the present parameter regime it enables the emergence of a fluctuation - driven state , thereby yielding irregular firing . we found that the adaptation parameter regime necessary to recover balance is consistent with available estimates of the strength and time course of adaptation in cortical neurons . pyramidal neurons in the cortex have been widely reported to exhibit spike - frequency adaptation with timescales between 300 and 500 ms ( rauch et al . , 2003 ) . certain types of inhibitory neurons ( low - threshold spiking , for example ) exhibit substantial adaptation at timescales around 1 s ( gibson et al . , 1999 , gupta et al . , 2000 ) . furthermore , studies that have recorded from fast - spiking ( fs ) inhibitory neurons for long durations have found that they exhibit adaptation on even longer timescales ( descalzo et al . we have modeled inhibitory adaptation with the small relative strength of adaptation compared with excitatory neurons as reported by la camera et al . the overall amplitude of adaptation sufficient to restore the balanced state was of the same order of magnitude but somewhat larger than reported ( rauch et al . we have also studied a connectivity matrix based on slightly different assumptions regarding the relationship between morphology and connectivity , which yield somewhat higher correlations between excitatory and inhibitory input connectivity ( supplemental information ) . in this connectivity model , setting the adaptation strength to the value reported in the literature was sufficient to recover balance ( figure s3 ) . we also anticipate that the quantitative estimates of the required adaptation strength will vary if additional realistic features are added to our simple lif dynamics , for example , synaptic depression , which has been widely observed in the barrel cortex ( koelbl et al . , 2015 , beierlein et al . , 2003 , chung et al . , 2002 ) . both the large heterogeneity and the substantial correlations we observe in our anatomically constrained dense statistical connectome model of the l4 barrel result from a number of underlying anatomical sources of variability . as previously reported , the soma density distribution of l4 excitatory cells is non - uniform with respect to the horizontal barrel axes ( decreasing toward the septa between barrels ) , which is not the case for l4 inhibitory cells . on the other hand , the l4 inhibitory soma density is non - uniform with regard to the vertical cortex axis ( increasing toward the l4-l5 border ) ( figures 3a and 3b ) ( meyer et al . , 2013 ) . the innervating vpm axons also have non - uniform density within the l4 barrel ( oberlaender et al . , 2012 , furuta et al . , 2011 these underlying cell - type - specific spatial heterogeneities contribute significantly to the heterogeneity observed in our anatomically constrained network . another source of both variability and correlations in in - degrees is the large variability of dendrite and axon morphologies within and across excitatory cell types ( e.g. , dendritic length , layer - specific axon innervation ) as reported in narayanan et al . these combined sources of heterogeneity and correlation are not easily disentangled ; for example , comparing neurons with identical dendritic lengths , we find both heterogeneous in - degrees and correlations between in - degrees from different populations ( figure s4 ) . the same is also true for neurons located within the same sub - region of the barrel ( figure s4 ) . ( 2014 ) study suggested that inhibitory plasticity could be a source for correlations in total excitatory and inhibitory synaptic input . our dense statistical connectivity model assumes that for a given set of connection probabilities , individual contacts between a pair of neurons are drawn independently . past studies have reported a bimodal distribution in the number of contacts , suggesting statistical dependencies between multiple contacts between the same pair , and this has been supported by a recent electron microscopy ( em ) reconstruction study ( kasthuri et al . , 2015 ) . at present , it is unclear whether these features extend to connections between neurons throughout an entire layer and column . however , such dependencies are unlikely to have a major impact on the overall heterogeneity or correlations of input connectivity , because they are likely to increase cell - to - cell variability rather than decrease it . to avoid additional assumptions about either the distribution of the number of contacts or the relationship between synaptic strength and number of contacts , our study makes the simplifying assumption that ( in the absence of homeostatic plasticity ) the synaptic matrix is binary : neurons of a given cell - type pair are either unconnected or they are connected by a synapse of a fixed strength . in this framework the heterogeneity in total synaptic current arose from the probability of input connection , which was dependent on the identity of the postsynaptic neuron . equivalently , our theory applies also to networks where the main source of heterogeneity is not the number of input connections , but their strength . in the supplemental information we show the results of simulating an anatomically constrained l4 barrel network in which both the number and the strength of incoming connections exhibit large variance . here the distribution of synaptic strength shows long tails similar to experimental observations ( song et al . , 2005 , lefort et al . this network exhibits a loss of balance , as well as recovery of balance by correlations and adaptation , qualitatively similar to the network with fixed synaptic strength ( figure s5 ) . ( 2013 ) performed simulations of lif neuron networks in asynchronous irregular states with widely varying degree distributions . similar to our findings , they observed that larger sd of in - degree was correlated with lower cvisi . their study , however , did not offer a theoretical account of this finding , and they suggest that the lower cvisi may be primarily because of higher population firing rates . we make use of the balanced - state theoretical framework and show that independent of population firing rates , broader in - degree distributions push the network into a mean - driven regime where activity is inevitably more regular and the cvisi is lower . another recent study concurs with our observation that heterogeneous in - degrees threaten excitation - inhibition balance ( pyle and rosenbaum , 2016 ) . they study a simple model in which excitatory and inhibitory populations are each divided into two populations with distinct in - degrees . several studies have begun to develop theoretical frameworks relating structure to dynamics ( pernice et al . , 2011 , hu et al . , 2014 ) and , in particular ( shkarayev et al . , 2012 ) have studied mean - field theory of networks with heterogeneous in - degree , similar to our local balance equations ; however , they focus on mean - driven states , whereas we study fluctuation - driven balanced dynamics . our study compared heterogeneous networks with homogeneous networks in which all neurons from a given pair of types have the same probability of connection . it is worth noting that network models in which the probability of connection between a pair of neurons depends on factors such as the distance between them ( rosenbaum and doiron , 2014 ) often exhibit similarly narrow in - degree distributions . to capture the realistic variability of cortical circuits , such network models should incorporate heterogeneity in the total input connectivity as we have done here . the advent of connectomics has triggered great interest in the fine details of connectivity patterns of neuronal circuits . yet it remains unclear , in general , how and to what extent these details affect the dynamics and function of these circuits . here we have shown that a specific feature , heterogeneity in incoming connectivity , has a significant qualitative impact on local cortical dynamics , and that the circuits proper function depends on the interplay between connectivity structure and single neuron dynamical properties . we generate connectivity matrices for heterogeneous networks consisting of populations e and i , and external population o , where population sizes are n , n , and n , respectively . because the dynamics are directly influenced by the statistics of convergent input , we assume for simplicity that the input connectivity varies between postsynaptic neurons , but not between presynaptic neurons . this restriction can be relaxed without changing the qualitative results of this study . in our heterogeneous generative model , we draw each neuron s set of relative in - degrees ( kiae , kiai , kiao ) from a 3d truncated gaussian distribution with means 1 , sds cvk , and correlation coefficient c between each pair of presynaptic populations . given a neuron i s relative in - degree , we assign it kiabkab presynaptic partners at random from population b. for simplicity , we set kab / nb , the mean connection probability , to be uniform across pathways . we write cijab for the resulting binary , { 0,1 } , connectivity matrix from neuron j of type b onto neuron i of type a. in our anatomically constrained network , cijab is a bernoulli random variable with probability pijab generated from the anatomical data as described in the supplemental information . to construct a matrix with the same marginal input connectivity distributions as the anatomically constrained matrix , but without correlations ( figures 5c5e ) , we shuffle the rows of each pab matrix independently . we study lif point neurons whose dynamics are given by the equations : dviadt=1m(via(t)vl)+1cmbj=1nbwijabsjb(t)+iiao(t)via(t+)vr , whenvia(t)=vth , where via(t ) is the membrane potential of neuron i of type a{e , i } , sia(t ) is the neuron s normalized synaptic trace , a difference of exponentials with rise time sra and decay time sda . wijab = cijabwab , where wab is the strength of a single connected synapse from population b onto population a. iiao is cell - specific external current , vl is the equilibrium leak - potential , vr the reset potential , and vth the threshold potential ( table 2 ) . we write j = kw , the mean total strength of synapses from population b onto population a. for simulating the synthetic networks from our generative model , as well as for the initial analysis of the anatomically constrained network , we use time - independent external current iiao = kiaojaoro . for simulations of realistic spontaneous and whisker - stimulus conditions , the cell - specific external input is the synaptic current from the poisson - firing population , o , which is given byiiao(t)=jnocijaowaosjo(t ) . the anatomically constrained network parameters yield excitatory to excitatory postsynaptic potentials ( epsps ) equal 0.36 mv . simulations were conducted in matlab with a first - order euler method and step size of 0.05 ms . we consider the time - averaged synaptic current to a neuron i : iia=bj=1nbwijabsjb(t)+iiao(t). the temporal average of sjb(t ) is simply the average single - neuron rate rjb . because wijab is independent of rjb , we can write ( as in equation 1)iia=bkiabjabrb . following van vreeswijk and sompolinsky ( 1998 ) , we make synapses strong by scaling individual synapses by 1/k . for ease of notation , we define the strength of a synapse from connected neurons of type b onto type a as wab = k(jab / kab ) , where j have units of total charge and are of the same order of magnitude as the threshold current multiplied by membrane time constant , or equivalently , cmvth ( table 2 ) . then the net time - averaged synaptic current onto the ith neuron of type a isiia = k(bkiabjabrb ) . with this scaling , we can see that if the excitatory and inhibitory synaptic currents do not cancel the external current , then the net synaptic current will be large , o(k ) . the requirement that the synaptic currents be o(1 ) , i.e. , of the same order of magnitude as threshold - current yields balance equationsbkiabjabrb=0,which must be fulfilled up to order o(1/k ) . if cvk1 then kiab1 for most neurons , and these equations reduce to two equations with two unknowns , which are readily solved . if cvk is not small , however , then the balance equations can not be generically solved unless kiabkia . we treat this case in the supplemental information and derive the structural bounds on balance . we model a homeostatic plasticity rule on inhibitory synapses as an additive synaptic scaling in which individual synapse strength depends on postsynaptic firing : dwijaidt=1wwijai+azia(t),where zia is obtained by low - pass filtering neuron i s spike train : ddtzia=1lzia+k(tti , ka),where ti , ka is the time of the kth action potential of neuron i of type a. this plasticity rule applies only to connected neurons , i.e. , those with c = 1 . weight - decay component of the plasticity dynamics . to limit simulation duration , we use w = 40 s. l sets the timescale of the filtering of the neuron s activity . in our simulations we use l = 200 sets the timescale of the homeostatic component of the plasticity dynamics ; the relationship between and controls the relationship between mean population rates , r and r , at steady state . in our simulations we use e=(1/3)104ms1 and i=(1/12)104ms1 . we introduce to each neuron an additional current that has dynamics given bydiadadt=iadaada+jadak(ttk).where tk is the time of the k spike . we write jada = jada / k , where jada is of the order of magnitude of the threshold - current , and ada = kada , where ada is of the order of magnitude of the synaptic time constant . note that jada has units of current and that the area under the curve , i.e. , the total charge due to a single spike , depends on ada . the accumulated adaptation current for a neuron firing at rate ria is kjadaadaria , which is of the same order of magnitude as the total synaptic currents above . the net current onto neuron i is thereforeiia = k(bkiabjabrbjadaadaria),which yields local - balance equations ( equation 5)ria=1jadaadabkiabjabrb+,which must be solved self - consistently . we show the conditions under which all neurons will be active and solve the rate equations under these conditions in the supplemental information . note that if the firing is irregular , then the variance in the adaptation current will be ( 1/2)(jada)2ada , such that it contributes only after the dominant term in the net current is balanced . throughout our simulations , we fix adi=4ade and jadeade=10jadiadi , which are approximately the relations found empirically ( la camera et al . , 2006 ) . for realistic spontaneous and stimulus - evoked states , we use time constants of 2 and 0.5 s , for inhibitory and excitatory , respectively , and peak amplitudes of 2 and 75 pa , respectively , which is the same order of magnitude as found empirically . we claim that in order to facilitate balance it suffices for the accumulated adaptation current to be order k . suppose that ( 1/k)1 and scale the adaptation strength jada=(jada / k ) , theniia = k(kiabjabrb)+k(bkiabjabrbjadaadaria ) . this yields a self - consistent solution to the balance conditions in which the mean rates are given by ra = r0a+ra , where r0a are the homogeneous balance solutions ( bjabr0b=0 ) . with these mean rates , the individual firing rates are given byria=1jadaadabjab(kiarb+kiabr0b)+and the correction terms , r , are recovered self - consistently . in the case where all neurons are i.d.l . , r.e . , m.o . , and h.s . performed data analysis and wrote the manuscript .

stereotactic body radiation therapy ( sbrt ) uses highly conformal techniques to deliver ablative radiation doses in few fractions to the tumor while limiting the doses received by the surrounding organs at risk ( oars ) . the computed tomographic reconstruction correlated with respiratory motion ( 4d ct ) allows the creation of treatment plans with smaller safety margins for patients with thoracic tumors , since the volumetric range of the tumor movement due to breathing is encompassed in the internal target volume ( itv ) used for planning . when using a highly conformal radiation treatment for lung cancer , a therapeutic advantage may be achieved if the media heterogeneities in the path of the photon beam are incorporated when calculating an optimized treatment plan . calculation algorithms have been incorporated into the treatment planning software to account for contributions from tissues of different densities that are near , far , and enclosing the site of interest . the heterogeneity corrections in the pencil beam model are based on dose values calculated in a water equivalent material multiplied by a heterogeneity correction factor generated from an electron density matrix derived from a ct value matrix . the aapm task group 65 reported the observations by many investigators who demonstrated experimentally or by theoretical analysis that the pencil - beam convolution algorithm ( path length based ) does not work in regions of electron disequilibrium , and compute incorrect doses within or near to a low density medium , particularly when the field size is small . when creating sbrt treatment plans , the recently published , aapm task group 101 report recommends the utilization of algorithms that account for 3d scatter integration such as convolution / superposition , and algorithms that account for better photon and electron transport such as monte carlo . the anisotropic analytical algorithm ( aaa ) is a pencil beam superposition - convolution algorithm for dose calculations,[68 ] available in the eclipse treatment planning software from varian medical systems ( palo alto , ca ) , that has shown good accuracy overall and a great ability to handle small fields in inhomogeneous media . dose distributions calculated by the aaa algorithm have been studied by several investigators[1012 ] and in the heterogeneous media ; the aaa algorithm has been shown to be consistently more accurate than pencil beam convolution ( pbc ) . compared the collapsed cone convolution ( ccc ) algorithm ( oncentra masterplan ) , the aaa algorithm ( eclipse , varian ) , and xvmc monte carlo algorithm ( iplan and monaco ) , and showed that all these treatment planning systems performed accurate dose calculations in homogeneous and heterogeneous phantoms . recently , authors in a paper on the accuracy of dose calculations by the aaa algorithm for stereotactic radiotherapy in nasopharyngeal carcinoma concluded that the results from the aaa were much better than those calculated by the pbc algorithm . we performed this retrospective study looking at patients treated with pbc modified batho power law ( mbpl ) dose calculation algorithm in our institution . the purpose of this study has been to judge the effect the choice of calculation algorithm ( pbc or aaa ) has on dose distribution and how this choice might affect patient treatment planning in terms of prescribing equivalent doses . the subjects of this retrospective study were 20 patients with non - small cell lung cancer ( nsclc ) treated with sbrt in the department of radiation oncology at our institution . the average age of this group of patients was 71.5 years ( range , 58 - 85 years ) . all the patients were allowed to breathe freely , and the full breathing cycle was divided into ten phases . the real time position management ( rpm ) respiratory gating system version 1.6.5 ( varian medical systems , palo alto , ca ) was employed during the ct scanning ( ge lightspeed ct scanner ) to create the 4d ct images that were sorted and transferred to the planning software using the ge advantage workstation aw4.3_06 . the algorithms used for treatment planning were version 8.6.15 from eclipse external beam treatment planning ( varian medical systems , palo alto , ca ) . the plans used five to seven fields of non - opposing coplanar 6 mv beams . the itvs were delineated based on the average of all ten 4d ct images acquired during the full breathing cycle and given an extended margin of 0.7 cm to create the planning target volumes ( ptvs ) . the plans were first generated with pbc utilizing mbpl for tissue heterogeneity correction and optimized to deliver a prescribed dose of 60 gy in three fractions to at least 95% of the ptv , keeping the normal tissue doses for spinal cord , esophagus , heart , and ipsilateral bronchus limited to not more than 18 , 27 , 30 , and 30 gy , respectively , as recommended in rtog 0236 . for the normal lung , the percentage volume receiving 20 gy or more , v20gy , was restricted to 10% , unless this proved unworkable , in which case up to 15% was acceptable . because radiation pneumonitis is volume- and dose - dependent , dose volume parameters such as v10 gy ( v10 ) , v20 gy ( v20 ) , and v30 gy ( v30 ) representing the percent volumes of uninvolved lung tissue receiving doses above 10 , 20 and 30 gy , respectively , mean and maximum lung doses ( mld and maxld ) were calculated to better quantify this relationship . the previously optimized treatment plans were then re - calculated with aaa using identical beam arrangements , photon beam fluences , and monitor units . the plans calculated with pbc mbpl were used as the standard for the purpose of comparisons and the percent differences in values were calculated . the subjects of this retrospective study were 20 patients with non - small cell lung cancer ( nsclc ) treated with sbrt in the department of radiation oncology at our institution . the average age of this group of patients was 71.5 years ( range , 58 - 85 years ) . all the patients were allowed to breathe freely , and the full breathing cycle was divided into ten phases . the real time position management ( rpm ) respiratory gating system version 1.6.5 ( varian medical systems , palo alto , ca ) was employed during the ct scanning ( ge lightspeed ct scanner ) to create the 4d ct images that were sorted and transferred to the planning software using the ge advantage workstation aw4.3_06 . the algorithms used for treatment planning were version 8.6.15 from eclipse external beam treatment planning ( varian medical systems , palo alto , ca ) . the plans used five to seven fields of non - opposing coplanar 6 mv beams . the itvs were delineated based on the average of all ten 4d ct images acquired during the full breathing cycle and given an extended margin of 0.7 cm to create the planning target volumes ( ptvs ) . the plans were first generated with pbc utilizing mbpl for tissue heterogeneity correction and optimized to deliver a prescribed dose of 60 gy in three fractions to at least 95% of the ptv , keeping the normal tissue doses for spinal cord , esophagus , heart , and ipsilateral bronchus limited to not more than 18 , 27 , 30 , and 30 gy , respectively , as recommended in rtog 0236 . for the normal lung , the percentage volume receiving 20 gy or more , v20gy , was restricted to 10% , unless this proved unworkable , in which case up to 15% was acceptable . because radiation pneumonitis is volume- and dose - dependent , dose volume parameters such as v10 gy ( v10 ) , v20 gy ( v20 ) , and v30 gy ( v30 ) representing the percent volumes of uninvolved lung tissue receiving doses above 10 , 20 and 30 gy , respectively , mean and maximum lung doses ( mld and maxld ) were calculated to better quantify this relationship . the previously optimized treatment plans were then re - calculated with aaa using identical beam arrangements , photon beam fluences , and monitor units . the plans calculated with pbc mbpl were used as the standard for the purpose of comparisons and the percent differences in values were calculated . the minimum , maximum , and mean doses to the ptv calculated using pbc and aaa for all 20 patients are shown in table 1 . the aaa plans had significantly lower average minimum , mean , and maximum ptv doses by 16.6% , 8.2% and 2.1% , respectively , compared to those with pbc plans . figure 1(a ) shows the itv and ptv contours of a typical nsclc patient , figure 1(b ) shows isodose distributions ranging from 53 gy to 63 gy in increments of 2 gy calculated with pbc , and figure 1(c ) shows the same range of isodoses calculated with aaa . the dose volume histograms ( dvhs ) for pbc and aaa corresponding to this patient are shown in figure 2 . minimum , maximum , and mean doses ( in gy ) to ptv calculated with pbc and aaa for all 20 patients ( a ) itv and ptv contours of a typical nsclc patient planned with sbrt . the six isodoses represent 53 - 63 gy with increments of 2 gy , and both views ( b ) pbc and ( c ) aaa ( slightly magnified to display better the spread of isolines ) are shown at the treatment plan isocenter dose volume histograms ( dvhs ) of ptvs and uninvolved lung for both pbc and aaa treatment plans for the patient displayed in figure 1 . the minimum , mean , and maximum ptv doses are 43.21 , 53.25 , and 62.46 gy ( for aaa ) , and 56.27 , 63.48 , and 67.24 gy ( for pbc ) , respectively . the uninvolved lung volume doses were not significantly different for pbc and aaa plans doses to the 95% of ptv ( d95 ) calculated using pbc and aaa for all 20 patients are shown in table 2 . the average dose to d95 calculated for the entire patient group with aaa was significantly lower by about 14% compared to that with pbc . doses ( in gy ) to the 95% ptv ( d95 ) calculated with pbc and aaa for all 20 patients the average mld , average maxld , v10 gy , v20 gy , and v30 gy from all 20 patients are shown in table 3 . the aaa plans also had lower average mean and maximum doses to the uninvolved lung by 8.6% and 8.9% , respectively . also , the average v10 , v20 , and v30 were below 10.2% , 5.2% , and 3.0% for both pbc and aaa plans , with aaa resulting in less calculated dose to the uninvolved lung . average doses ( in gy ) of mld , maxld , and the average percent volumes of uninvolved lung tissues v10 , v20 , and v30 from all 20 patients since it is a relatively new technique , for which precision and conformality are essential , this study has been a part of an effort to improve this implementation , and therefore , maximize its therapeutic effect . recent studies have demonstrated that the most appropriate treatment planning calculation algorithm for small lesions in the lung is the superposition - convolution algorithm . the rtog 0236 protocol required that 95% of ptv be conformally covered by 60 gy delivered in three fractions with no heterogeneity corrections applied . xiao et al . , reported on the recalculation of a subset of 20 treatment plans from rtog 0236 with heterogeneity corrections using the superposition - convolution algorithm . they found that the average dose delivered to 95% of the ptv with no heterogeneity correction was 60.6 gy , whereas with heterogeneity correction the average value dropped to 55.9 gy . the authors advocated adjustment of the prescribed dose for future sbrt protocols that use accurate heterogeneity corrections . a prescribed dose of 18 - 19 gy per fraction for three fractions , instead of 20 gy per fraction for three fractions used in the rtog 0236 protocol was recommended . in our study , the average dose to 95% of the ptv recalculated with aaa was 51.6 gy for our group of 20 patients , whereas it was 60 gy calculated with pbc ( mbpl ) . our work clearly suggests a prescription dose reduction of at least 10% ( 54 gy instead of 60 gy in three fractions ) or even up to 14% ( 51.6 gy instead of 60 gy ) when calculating dose with aaa instead of pbc with mbpl heterogeneity corrections . fragoso et al . also observed a marked reduction in calculated dose to the ptv when pbc - based plans were recalculated with the monte carlo ( mc ) based algorithm . the minimum ptv doses shown with the pbc and mc were 97% and 58% , respectively . the 80% and 95% isodose lines covering the itv and ptv shown in a lung patient study , when calculated with pbc , did not encompass the ptv when recalculated with mc . a similar trend was also found in our study . in the dvhs shown in figure 2 , the minimum and mean doses to the ptv calculated with pbc ( mbpl ) were 56.3 gy and 63.5 gy , respectively , compared to 43.2 gy and 53.3 gy calculated with aaa ; for this patient , the minimum and mean doses were overestimated by 30% and 19% , respectively . also the isodoses from 53 to 63 gy did not cover the ptv in the aaa calculated plan as shown in figure 1c . schuring and hurkmans investigated the influence of inhomogeneity corrections on stereotactic treatment plans for nsclc . they made treatment plans to deliver 60 gy in three fractions using an equivalent path length ( epl ) algorithm ( like batho ) , and calculated plans with the ccc algorithm . their epl plans overestimated the dose to 95% of the ptv , and , in one case , this overestimation was as high as 43% . in addition , their calculated v10 , v20 , and mld using the ccc algorithm were significantly lower on average by 9.2% , 21.1% and 9.9% , respectively , compared to those using the epl . in comparison , our v10 , v20 , and mld were reduced by 5.8% , 10% , and 8.6% on average , respectively , when recalculated with aaa . the results from this study indicate that when creating sbrt treatment plans for lung lesions , the aaa algorithm , a scatter - based dose model with increased accuracy in scattered dose calculation , would be a more appropriate choice . if one decides to use the aaa dose calculation algorithm , the prescribed dose should be adjusted down by 10 - 14% in order to maintain equivalence to plans generated by the pbc algorithm with mbpl heterogeneity corrections . our results are in excellent agreement with the recent suggestion by the quality assurance working group of the phase iii rosel study to reduce prescription dose from 20 gy per fraction to 18 gy per fraction in three fractions when utilizing aaa or ccc dose calculation models instead of pbc / mbpl .

inflammatory bowel disease ( ibd ) is a multifactorial disorder for which a complete etiology is not yet known , but which occurs in response to the convergence of genetic predisposition towards disease development , intestinal microbiota , external environmental factors , and host immunobiological responses . human ibd is a naturally occurring polygenic disease expressed as abdominal pain , weight loss , diarrhea , vomiting , flatulus and ileus , ileitis , bloody stool , elevated mucous production and bowel and/or subcutaneous fistulation present in various proportions depending the area of the small and/or large bowel that is being affected . ibd predominantly occurs sporadically , with familial ibd occurring in only 5 - 14% of the affected population . clinical inflammatory bowel disease syndromes include ulcerative colitis ( uc ) in which limited mucosal and submucosal inflammatory processes predominantly affect the colon and adjacent areas of the rectum , and crohn 's disease ( cd ) characterized by chronic intermittent relapsing discontinuous transmural inflammation of the bowel with intestinal and perianal fistulation . canine phenotypic ibd disease classifications include lymphoplasmacytic enteritis , eosinophilic gastroenteritis , eosinophilic colitis , granulomatous colitis and histiocytic ulcerative colitis and neuronal hyperplasia . in horses , ibd is usually expressed as weight loss and clinical colitis which exhibit variable long - term responses to corticosteroid and anthelmintic treatment . nonhuman primates frequently exhibit diarrhea , and a subset of these animals appear to exhibit chronic diarrheal disease that can be categorized within familial aggregate groups . finally , cattle and other ruminants once infected with mycobacterium avium paratuberculosis will exhibit weight loss , chronic diarrhea , and other clinicopathological syndromes that are very similar to human inflammatory bowel disease , which is particularly significant because this organism is difficult to detect , can survive pasteurization and subsequently enter the human food chain . while many histological disease phenotypes and lesions expressed by human and animal patients are similar , some do differ , with the result that there is no one animal model that replicates every major expression of human or animal ibd among experimental animal models . additionally , in some instances functional phenotypes and histologic indications of inflammatory bowel disease can resemble other disease entities , which confound study and clinical diagnosis , and must be identified , treated and/or eliminated from consideration in determining disease etiology and pathogenesis . histological lesions in crohn 's disease feature noncaseating granulomatous inflammation while uc lesions typically exhibit ulceration , lamina propria inflammatory infiltrates and lack of granuloma development . patients have traditionally been diagnosed and categorized based on endoscopic histopathological lesion appearance and clinical responsiveness to medication . there are several different systems that have been used to characterize histological lesions observed in ibd , but classical histological interpretation of mixed inflammatory cellular infiltrates can be very subjective due to their occurrence in response to non - ibd related disease etiologies , and also because a uniform set of prognostic biomarkers has not yet been fully developed in human or veterinary medicine for cd or uc diagnosis . most small animal ibd patients are initially treated with diet restrictions , use of metronidazole to change the intestinal microbiota by eliminating anaerobic bacterial species ; increased fiber content and anti - inflammatory products . human uc and cd patients are treated using first line therapies , including oral mesalamine , sulfasalazine for colitis only , budesonide oral corticosteroid and oral proton pump inhibitors such as omeprazole . increasingly , newly introduced tumor necrosis factor antibody and other inhibitors are improving the success of human ibd therapy , and have been introduced in animal models to examine underlying pathogenic mechanisms . if initial treatment measures are not effective second line immunosuppressive therapy such as high dose prednisone , azathioprine , methotrexate and immunogold preparations ; and biological adjuvants such as the chimeric murine - human anti - tumor necrosis ( tnf ) antibodies infliximab , adalimumab and certolizumab ; and the integrin antibody natalizumab , will be added to the treatment protocol . however , many of these drug and biological adjuvant regiments do have significant side effects , and it would be advantageous to identify predictive biomarkers and new , effective therapeutic protocols to assist in managing these diseases . identifying biomarkers associated with different pathogenic and/or progressive stages in inflammatory bowel disease in humans has been difficult in part because of great variability in the contribution of underlying mechanisms to disease incidence , and in disease onset , progression , and remission over time . it is also not unusual for severely affected ibd patients to experience multiple abdominal surgeries to remove adhesions , obstructions , strictures and chronic inflammatory material debridement . experimental genetically modified transgenic animals are important model system applications in determining disease causation , identifying potential therapeutic targets , and piloting measures contributing to alleviation of pain and distress in model systems . this article will review the transgenic rodent models of ibd and shed light on their respective pathogenic mechanisms , contributions to knowledge about ibd etiological influences , and applicability for therapeutic drug intervention development and testing . animal studies reviewed in this report were presumed to have been conducted in accordance with humane regulatory standards by respective original authors in accordance with best animal welfare practices and international publication standards . ibd is thought to be a result of dysregulated cell signaling due to changes in bowel microbiota , diet as well as overstimulation and deficient regulation of innate and adaptive immune mechanisms within the bowel environment . the resultant spectrum of disease phenotypes have been termed " dysbiosis " , representing a loss of intestinal immune homeostasis , with particular emphasis on the th17 cell phenotypeassociated activities and dysregulation of treg cells in the intestinal mucosa , including il10 expression . some of the ibd animal models have relied heavily on adoptive transfer techniques to more clearly define disease activity spectra following reconstitution of selected , genetically manipulated cell populations in immunodeficient , genetically modified mouse models of inflammatory bowel disease . only 7 to 14 % of human spontaneous disease incidence has been attributed to genetic causes . recently , parlato and yeretssian noted that classified gene loci converge into common biological pathways essential for intestinal homeostasis- or inflammation - related processes , which included networks such as epithelial wound repair and barrier function , innate immune responses , autophagy , and t - cell differentiation among others . some environmental influences , in particular , commensal bacterial intestinal population characteristics , ibd is characterized by the presence of dysregulated immunoresponses governed by the activities of cd4 + th1 , th2 , th17 , and treg lymphocytes , resulting in sustained inflammation , mixed immune cell population recruitment , infiltration and functional activation , and marked shifts in enteric nervous system function . traditionally , t cells have been differentiated by their abilities to produce interferon gamma ( th1 ) and interleukins like il4 , il5 and il15 ( th2 ) . th1 cells are most effective in killing intracellular pathogens such as bacteria and viruses through monocytic pathways while th2 cells are especially effective in eliminating parasites resident in mucosal sites through activation of eosinophils , basophils and mast cells . several new t cell populations have also been identified and are thought to be important in driving disease development and progression in ibd . these include subtype th17 , which appears to fill a niche activating neutrophil populations by eliminating extracellular bacterial and fungal infections as well as inflammation characterized by neutrophil activation and opsonizing igg antibodies ; the cells produce il17 , il22 , a part of the il10 cytokine family , granulocyte colony stimulating factor ( g - csf ) and granulocyte macrophage colony - stimulating factor ( gm - csf ) . taken together these cells are especially important in supporting epithelial barrier integrity and microbial defense strategies . in addition , suppressor cd4+treg subsets are active in opposition to th17-induced inflammatory cell differentiation . when activated these cells are able to augment , coordinate and integrate adaptive immunity through their actions on diverse cell sets for pathogen eradication . it is through effector cells ( th1 : monocyte / macrophage lineages ; th2 : eosinophils , basophils and mast cells ; and th17 : neutrophils ) and elaborated soluble factors that are either pro - inflammatory or anti - inflammatory in character . additional polymorphic loci variants for genes that have been associated with elevated risk disease as well as other not yet identified candidate genes may also influence disease expression onset , development and progression . these unknown polymorphic variants may be modified through the accumulative effect of multigenerational single nucleotide polymorphisms , or , perhaps through modification of a significant as yet not described polymorphic gene variant by additional factors resulting in gradation of disease expression . recent genome wide association studies involving large case cohort human subjects trials have identified over 100 loci that are associated with enhanced risk of developing cd , uc , or both , including those governing innate genes ( definitive associations of nucleotide - binding oligomerization domain proteins ( nod proteins ) [ nod2 in the ibd1 16q12 linkage region for cd only ] ; modified immune function related to guanosine-5'-triphosphate hydrolyase ( gtpase ) m protein and autophagy - related protein 16-l1 ( atg16l1 ) autophagy gene expression , janus kinase 2 ( jak2 ) activation ; and il12b / p40 ) gene expression . the strongest cd gene associations are with il23r and nod2 , and an intact il23r is required in mouse ibd models for intestinal inflammation phenotypic expression . on the other hand , nod proteins are important cytosolic regulators of apoptopsis and pathogen response and resistance that contain leucine rich repeat segments . they express genetic polymorphisms in regions that have been associated with inflammatory disease or increased susceptibility to infection . the nod proteins nod 1 and nod 2 are important in sensing the presence of bacterial pathogens by identifying peptidoglycan wall peptide ligands gamma - d - glutamylmeso - diaminopimelic acid and muramyl dipeptide components that are associated with bacterial walls , and work with other proteins , specifically the toll - like receptors ( tlrs ) , in mediating responses to bacterial invasion . once nod proteins detect peptidoglycan group patterns in bacterial cells they are activated through the leucine rich repeat segment , recruit and bind receptor - interacting serine / threonine kinase ( rick ) through the caspase - recruitment domain interactions ( card ) . the resultant phosphorylation event activates nuclear factor kappa b ( nf-b ) , mitogen - activated protein kinases ( mapks ) such as jun - amino terminal kinase ( jnlk ) , jak , extracellular signal - regulated kinases ( erk ) and p38 mapk while also stimulates pro - inflammatory cytokine expression . all of the transcription factors and cytokines involved in this pathway are important mediators of inflammatory disease and immune pathogenesis , and through the card system , apoptosis and cysteine - dependent - aspartate directed protease ( caspase ) protein activation . nod1 is less active in this functional pathway , and has been primarily associated with demonstrating elevated levels in response to bacterial infection such as helicobacter pylori gastroenteritis . major nod 2 mutations r702w , g908r and l1007fsinsc are associated with impaired responses to the presence of bacterial pathogens ( and in some cases putative commensal bacteria ) that are persistently found in the lamina propria . the protein is expressed in lamina propria macrophages , monocytes and paneth cells of the mucosal epithelium , thus regulating production of antimicrobial alpha - defensins in the mucosa . the resultant overstimulatory reaction causes cd ; alternatively , some have suggested that nod deficiency / loss of function models are associated with t cell activation with subsequent cytokine and chemokine release . these reactions may also be associated with other immune - mediated or influenced diseases such as pediatric sepsis , allergy and atopy , psoriasis , sacroilitis , and graft vs host disease . in two syndromes , blau syndrome and early - onset sarcoidosis they are associated with granulomatous pathologic disease , and appear to operate through gain of function mutants , demonstrated through increased nf-b activation in the absence of muramyl dipeptide stimulation and in response to excessive nod signaling . once activated nod 2 interacts with card12 , which negatively regulates rick - mediated proteins and stimulating nf-b translocation into the nucleus , and release of proinflammatory cytokines . conversely , individuals with card15 mutations show very strong immune reactions to peptidoglycan peptides , elaborate high levels of il12 and il23 , and can easily support development of th1 mediated clinical colitis . interestingly , the card proteins are instrumental in activating caspase proteins that are important mediators of apoptosis , inflammation , necrosis and cell death , and can recognize intracellular double stranded rna which is commonly found in viral genomes ranging from the orthomyxoviridae viruses such as influenza virus , to rhabdoviridae family viruses such as rabies virus . both nod and caspase proteins are considered to be part of the inflammasome constituent of nucleotide - binding domain , leucine rich containing ( nlr ) family proteins . it is because of these complex innate immunological intersecting pathways that gene ablations and/or mutations induced in knockout and transgenic mouse models are so applicable to the study of disease syndromes . another important limb of the innate immune system are the pathogen associated molecular patterns ( pamp ) molecules , of which the tlr protein molecules are excellent examples of their activities . tlrs are transmembrane cell surface receptors that are associated with cell membranes and are important mechanisms by which pathogen - associated molecular patterns are recognized in the activation of innate immune responses , especially to bacteria , but also to viruses and fungi . they were initially recognized as genetic homologues to the drosophila toll gene family . in humans , there are ten different tlrs that have been characterized , all of which recognize different pathogen - associated molecular patterns . tlr9 recognizes unmethylated cpg dinucleotides in bacterial dna ; tlr2 recognizes diacyl lipopeptides present in gram negative cell walls ; and tlr4 binds to lipopolysaccharide extracellular cell domains and stimulates signaling cascades as demonstrated by recent crystal structures demonstrating the protein in complex with a functional antagonist . the tlr family functions appear to be conserved in vertebrates , and were most likely established as a part of the early innate immune defense system allowing detection of lipoprotein , peptidoglycan , lipopolysaccharides , flagellin , double or single strand rna and cytosine poly - guanine ( cpg ) dna as pathogen associated molecular patterns early in evolution . adaptive immune system functional associations for cd and uc appear to function through il23 receptor signaling and th17 cell subsets . substances involved in these phenomena include interleukin 12a ( il12a , p40 ) and signal transducer and activator of transcription 3 ( stat3 ) proteins among others . stat3 protein phosphorylation activation roles in ibd are likely to be both complex and confounding given that this protein family is downstream of pro- and anti - inflammatory cytokines and is activated directly by il23 signaling through the il23r complex . there is continuous cross talk and regulation between th1 , th2 , th17 and foxp3 + cd4 + t regulatory subset populations in association with changes in ibd disease phenotype expression . within the th17 functional pathway , th17 cells defend against gram positive and gram negative bacteria and upon activation secrete il17a , il17e , il17f , il21 , il22 , il26 , tnf alpha , interferon gamma , and various chemokines . il21 expressing effector cells in this pathway , typically mucosal epithelia and skin , function as a part of enhancing barrier immunity . other th17 associated genes expressed in cd phenotypes include c - c motive chemokine receptor 6 ( ccr6 ) in dendritic cells and memory t cells where they mediate b cell differentiation , dendritic and memory t cell migration ; and tumor necrosis factor ligand superfamily member 15 ( tnfsf15 ) , which facilitates th17 , th1 and th2 cell differentiation . similarly , the combined presence of il1 , il6 , il21 and tgf beta will induce il23r upregulation , resulting in th17 cell differentiation in some settings , and highlighting linkage between autoimmunity and ibd . tgf functions in this manner through reciprocal induction of forkhead box p3 ( foxp3 ) and retinoid - related orphan receptor gamma ( ror ) . foxp3 interactions with rort suppress il17 transcription , while the presence of il6 , il21 and il23 will decrease foxp3 inhibition by rort . through these mechanisms which are dysregulated by ibd , th17 and t regulatory cells are reciprocally regulated , and homeostatic expression levels determine self - tolerance and absence of bowel inflammation . it exerts considerable effect in inflammatory bowel disease as well as inflammatory diseases affecting the lung and skin . two cd associated genes , chemokine receptor 6 ( ccr6 ) and tumor necrosis factor ligand superfamily member 15 ( tnfsf15 ) ( http://www.ncbi.nlm.nih.gov/gene/9966 ) , enhance il17 expression in th17 , th1 and th2 cells . these variants appear to be important factors in cd development among people of european and asian ancestry . it is worth noting that there are differences in th17 cell development between mice and humans resulting in variable il1 and other pro - inflammatory cytokine spectra and expression levels between species . tgf and il1 appear to contribute to th17 cell development and differentiation at different levels between species . th17 cells can differentiate into interferon - gamma producing effector cell populations that resemble th1 cells under certain conditions , but their contribution to uc and cd has not been fully demonstrated . overall , however , cross regulations of th17 , th1 and treg cells are important modifiers of disease expression , with tgf causing activation of both t17 and treg cell subsets . tgf alone stimulates treg cell differentiation , while the presence of il1 , il6 and il21 causes induction of il23r expression , and differentiation of treg cell subsets . based on recent studies , it appears that there are gene perturbations , in common , between cd and uc , namely , those activated along the il23 pathway ( il23r , il12b , and stat3 ) . ongoing studies continue to define single nucleotide polymorphisms in these regions as well as elsewhere throughout the human genome and in animal models of this disease . uc syndromes are associated with il10 and actinrelated protein 2/3 complex subunit 2 ( arpc2 ) regulatory pathways , intestinal epithelial cell function extracellular matrix 1 ( ecm1 ) and activation of the e3 ubiquitin ligase containing hect domain and rld 2 ( herc2 ) . herc2 expression is important in dna repair function and share a common immune dysregulation genetic association with human leucocyte antigen regions of the major histo - compatibility complex . inflammatory bowel associated immune related genes have also been shown to be associated with other diseases in humans including diabetes mellitus types 1 and 2 , psoriasis , systemic lupus erythematosus , graves ' disease and rheumatoid arthritis among others . this association suggests that a more general tendency to develop immune related disease may exist in some individuals that when exacerbated by additional environmental or epigenetic factors activates a pathway resulting in an individual and specific disease syndrome(s ) among different human populations . because the clinical expression and therapeutic response characteristics of inflammatory bowel disease is similar across patient populations investigators have suggested that there is a limited disease phenotypic range for these diseases in humans . there is an increased risk for colonic adenocarcinoma in infectivity models such as helicobacter hepaticas , citrobacter rodentium , lawsonia intracellular , use of chemical mutagens , and the presence of predisposing genetic mutations including adenomatous polyposis coli - multiple intestinal neoplasia ( apc and cdx2 genes ) . equally important appears to be the developing interest in associating microbiota population characteristics with disease induction , expression and progression , as enterocolitis and colonic cancer expression can vary in rodent models in part in accordance with the presence or absence of defined bowel microbial species and load . however , the complex and sometimes confounding pathologic responses observed clinically in human patients and in relevant animals models reflect putative variation in pathogenic disease mechanisms , suggesting that these two disease phenotypes may represent a disease continuum , rather than distinct entities , and highlight our need for further delineation of cell reactivity lineages , functional pathways and resultant phenotype expression in these diseases . transgenic rodent models can serve as excellent model systems for mechanistic studies to further define underlying pathogenic disease factors , and in initial proof of concept studies to determine therapeutic approaches for future clinical efficacy . spontaneous inflammatory bowel disease has been noted in a number of rodent models which differ in genetic strain background , induced mutation , microbiota influences and immunopathogenic pathways . there are now many different inflammatory bowel disease animal models , with recent publications identifying in excess of 1800 recent individual publications in this area within the past three years . one comprehensive review by neurath in 2012 has identified over 69 spontaneous and induced rodent models in which clinicopathologic and therapeutic models of either cd or uc , or both , was invoked . animal models of inflammatory bowel disease continue to be very useful in examining basic pathogenic mechanisms of disease as well as in developing and evaluating new types of biological therapies such as anti - tumor necrosis factor , anti - integrin and anti - interleukin therapies . many ibd animal models exhibit th1 cell dominant immune reactivity ( mizoguchi a and mizoguchi e 2010 ) , with associated pro - inflammatory cytokine expression profiles , e.g. interferon , tumor necrosis factor- and il2 . non - t cellular monocytic cell populations are important regulators of bowel mucosal immunity so that when modified they can result in disease expression . antigen presenting cells seem to be important determinants of th2 cell immune response induction when challenged with infectious agents , thus providing a linkage between adaptive and innate immune responses in ibd disease onset . there are significant and complex interactions between adaptive immunity , innate immunity and intestinal microbiota ( including aspects of microbial species population as well as metabolic compound assessment ) and external environmental influences , suggesting that there are many opportunities for future basic and translational animal model development in this area . one of the earliest transgenic mouse models involved in driving control of tgf via use of a dominant negative mutant of the tgf type ii receptor , the itf - dnrii transgenic mouse ( table 1 ) , first described in 2001 to explore the effects of tgf1 on bowel immunity , extracellular matrix protein expression , and carcinogenesis . this model examined the hypothesis that modified tgf signaling was responsible for intestinal epithelial cell degradation and subsequent ibd disease development in mice similar to human inflammatory bowel disease expression . the role of the tgf signaling pathway was initially examined in itf - dnrii mice through overexpression of mutant dominant negative tgf- receptor ii , resulting in functional inactivation of tgfrii receptor proteins under the control of intestinal trefoil peptide promoter ( itf / tff3 ) in a tissue restricted fashion . resulting itf / dnrii transgenic mice exhibited clinical ibd disease when not maintained in specific pathogen free conditions , including weight loss , ruffled coat , diarrhea , hematochezia and anal / rectal prolapse . loss of tgfrii expression was noted throughout the epithelial and muscular layers in transgenic mice . when maintained in specific pathogen free conditions these mice exhibited similar signs only after treatment with dextran sodium sulfate in drinking water which has been shown previously to produce acute and chronic ulcerative colitis in mice . characteristic histopathogical changes were noted including severe , extensive mucosal ulceration , severe inflammatory cell infiltration and increased myeloperoxidase reactivity indicative of the presence of granulocytic cells . additional clinicopathologic characteristics included generation of major histocompatibility complex class ii antibodies in sera , increased matrix metalloproteinase activity within bower epithelium and autoantibody generated against intestinal goblet cells . in subsequent additional studies of dominant negative tgfii reception constructs expressing downregulation of tgfiir in the intestine , their absence was associated with higher cell nuclear antigen proliferation indexes following infection with helicobacter pylori . when treated with azoxymethane , a colon carcinogenic agent , these mice also exhibited increased numbers of aberrant crypt foci and higher incidences of dysplastic precancerous aberrant crypt foci and colonic cancer . loss of tgf intestinal signaling appears to increase organotypic susceptibility to uc , appears to influence level of tissue injury during inflammatory disease and may be associated with associated colonic neoplastic changes . later studies have examined inflammatory colitis induced through dextran sodium sulfate and azoxymethane treatment of smad3 mice , which are deficient in tgf signaling molecule smad3 . the outcome of these studies suggest that it most closely models cd and is significantly associated with subsequent carcinogenesis , including colonic epithelia crypt herniation , chronic - active repair characterized by epithelial hyperplasia , crypt herniation , squamous metaplasia , epithelial dysplasia , and subsequent tumor development . the double transgenic mouse dominant - negative knockout ( dnko ) construct develop fulminant uc that is sensitive to anti - cytokine treatment and broad spectrum antibiotics . dnko transgenic mice were constructed on c57b6 background with dominant negative tgfrii mice that were crossed with class ii cytokine receptor family member 2 [ crf2 - 4-deficient ( il10r2 ) ] mice that also resided on c57b6 background , resulting in mice that were null mutants for il-10r2 and expressed dominant negative phenotypic expression of tgfrii in the cd4 + and cd8 + compartments . further breeding of dntgfrii mice with il10r2 mice resulted in the development of the dnko transgenic mouse , with restricted lymphocytic phenotypic expression as a result , with three other control conditions generated similarly : il10r2 , dntgfrii and il10r2 . dnko mice exhibit failure to thrive at an early age with rapid weight loss and early mortality , a much earlier and more severe expression of disease than is commonly found in single transgenic mutants , and in parallel with human patient clinical presentation in a subgroup of ibd affected individuals . gross pathological changes included focal punctate ulceration , mucosal thickening in the cecum , descending colon and rectum , and milder changes in the ascending colon with minimal inflammatory change or damage noted in deeper intestinal layers and the absence of granulomata , colonic fistulas and strictures . severe inflammation was noted histologically and featured predominantly t cell infiltrates with additional immature myeloid / monocytic , neutrophilic , natural killer and b cell infiltrates as assessed using immunohistochemistry . histopathological changes were consistent with mucosal responses to inflammatory injury and included epithelial hyperplasia characterized by elevated crypt wall height and m - phase bodies per crypt ratios , statistically significant decreases in crypt numbers accompanied by increased crypt width and microabcessation , reduced numbers of goblet cells and eroded surface epithelium . cellular infiltrates consisted of mixed cell infiltrates into the mucosa and submucosa of the cecum , descending colon and rectum ; leukocytic infiltrates were also detected in the ascending colon but epithelial and goblet cells escaped severe injury . proinflammatory th1 cytokine expression ( interferon , tnf , and il6 ) was marked with elevated sera concentrations , and was consistent with the present of large numbers of expanded t cell populations among the inflammatory infiltrate . expression of colitis in these mice could be reversed through anti - cytokine ( interferon and tnf ) antibody treatment and inhibited following high dose ciprofloxacin and metronidazole antibiotic treatment . treated animals gained weight , did not exhibit any clinical or histological signs of inflammation and injury , and produced minimal proinflammatory cytokine levels , demonstrating the efficacy of these two therapeutic interventions and the important role the luminal bacterial exert in the pathogenesis of uc in this model . in their review devoss and diehl identify two transgenic mice that exhibit clinical signs of ileitis were identified as being commonly used ibd animal models . one of these is the tumor necrosis factor ( tnf ) deficient tnf transgenic mouse , which was generated from an original single tnf mutation on a c57/bl6 background as a model of rheumatoid arthritis and other inflammatory arthridities . the development of a double mutant mouse using cre - lox recombinant technology and carrying a deletion of the au - rich elements 3 ' untranslated region ( are 3'utr ) regulatory element for tumor necrosis factor resulted in an effective double disease model that can be used for investigative pathogenesis inquiry as well as for preclinical drug discovery . are consist of a class of regulatory sequence characterized by the presence of an auuua pentanucleotide that acts to regulate mrna stability and translation in tnf and other biologically active molecules . differential substitution of this mutant nucleotide into either a tnf type i or ii receptor mutant genetic background mouse resulted in loss of posttranscriptional regulation of this gene . while double homozygous mice developed in a completely normal fashion ( tnf / tnfri ) , tnf produced animals that exhibit inflammatory polyarthritis and bowel disease ( biomedcode www.biomedcode.com/gr/en/content/tnfdaredual-disease-model ) . heterozygous and homozygous tnf and tnf mice exhibit signs of arthritis ( joint swelling , paw distortion and severe movement abnormalities ) and inflammatory bowel disease consistent with chronic inflammation and cd . these include severe weight loss ( to 6 - 7 grams ) and early onset of disease by 12 days postnatally , and early mortality in homozygous mice by 5 - 12 weeks of age for tnf mice suggesting that they must be monitored closely to alleviate potential animal welfare and husbandry concerns . histopathologic intestinal lesions were first noted at 2 to 4 weeks of age in tnf and were localized to the distal ileum with occasional colonic involvement . lesions progressed from mucosal injury characterized by villus blunting and broadening and chronic - active mucosal and submucosal infiltrates composed of scattered neutrophils , mononuclear lymphocytes and plasma cells . severe intestinal inflammation was noted by 4 weeks of age in tnf and by 8 weeks of age for tnf , progressing by 4 - 7 months of age to severe transmural inflammation characterized by submucosal lymphoid aggregates and follicles , granulomata that resembled non - caseating granulomatous change in human ibd , and multinucleated giant cells , with superficial epithelial layers exhibiting loss of villus structures . . subsequent studies have found that this phenotype occurs secondary to expression of th-1 cytokine activation patterns including il-12 , interferon and requiring cd8 + t cell activation , with additional influences from redundant downstream cellular kinase activation pathways . mice deficient in both tnf and il-10 ( t / i mice ) that were developed from knockout il-10 on a c57b6 background ( b6.129p2-il10/j ) held under specific pathogen free conditions do not develop colitis . however , when this transgenic mouse is crossed with knockout tnf - deficient mice on a c57b6 background the result is a double knockout transgenic mouse ( b6.129s6-tnf / j ) ( tnf [ t - het / i ] and tnf il10/j ) ( http:/jaxmice.jax.org / strain/003008.html ) that exhibits a uc phenotype and develops spontaneous colonic tumors without any exogenous triggers shortly after weaning . this uc phenotype preferentially affected the terminal colon and rectum after 15 weeks of age with linear continuous inflammation involving the colon . histopathological lesions consisted of large numbers of neutrophils within the lamina propria , crypt abscesses and mucosal ulceration that generally did not affect tissue deeper than the muscularis mucosae and submucosa . inflammatory bowel disease in this model was completed prevented in t / i mice using a drug cocktail consisting of amoxicillin , clarithromycin , metronidazole antibiotics and omeprazole acid suppression agent to modify the luminal environment and suppress or eradicate colitogenic bacteria . colon cancer phenotypes generated in this model ranged from invasive mucinous adenocarcinoma to locally advanced transmural invasive tumor breeching the exterior colonic mesenteric serosal surface in mice older than 25 weeks of age , and without accompanying metastases . this model suggests that relative tnf insufficiency may result in mucosal compromise in a primary or secondary fashion resulting in expression of uc ibd , with concomitant elevated risk of colonic cancer development in the face of intestinal inflammation in this double knockout transgenic mouse strain . similarly , samp1/yit / fc transgenic mice were generated on an akr / j background and exhibit elevated numbers of macrophages , neutrophils and lymphocytes within the ileum indicative of immune activation in this site . samp1/yit / fc mice exhibit spontaneous small intestinal inflammation characterized by early secretary cell expansion , e.g. goblet , paneth and intermediate phenotype cells , within the epithelium of the ileum and discontinuous " skip " pattern of transmural and segmental chronic - active cellular infiltrates . inflammatory infiltrates target epithelial crypt epithelial locations and subsequently promote development of cryptitis , microabcessation , focal granulomatous inflammation and basal plasmacytosis with progressive disruption of the epithelium and tissue atrophy . this granulomatous inflammation is observed under specific pathogen free conditions , commencing at 10 weeks of age with 100 % penetrance by 30 weeks of age and severe bowel strictures noted in mice older than 40 weeks of age . this is an unusual aspect of this model as clinicopathologic signs rarely develop under specific pathogen free conditions in many ibd rodent models , and especially those that are dependent in part on chemical induction of intestinal inflammation . additional pathologies have been noted in samp1/tit / fc transgenic mice , including chronic helicobacter - negative crohn 's like gastritis and autoimmune hepatitis . the pathogenesis of this animal model is similar to that observed with human ibd disease in that early activation of th1 mediated pathways are associated with disease induction and intraluminal commensal bacteria act as antigenic stimulants that result in immunological dysregulation , or dysbiosis , of mucosal immunity in these mice . stat3 is activated over the course of disease progression in samp1/yit / fc mice ; accordingly , it is considered an important regulator of the inflammation in the samp1/yit / fc mouse as well as a potential therapeutic target . these include one of the only th2 cytokine predominant murine colitis ibd model described in the literature , wiskott - aldrich syndrome protein ( wasp ) deficient mice . the wasp molecule is primarily expressed in hematopoietic cells where it integrates surface receptor and actin cytoskeleton signaling networks , and is absent , changed or diminished in wasp human patients . an x - linked disease , human patients affected with this deletion exhibit eczema , thrombocytopenia , lymphoreticular cancers , recurrent infections and autoimmune diseases . affected mice exhibit weight loss , diarrhea , rectal prolapse and early mortality by 3 months , and all surviving mice tend to be affected by 6 months of age . clinicopathologic signs include lymphopenia , thrombocytopenia , cytoskeletal abnormalities characterized by cellular migration defects , t cell signaling defects and decreased regulator t cell quantity and diminished function . this model is histologically characterized by the presence of neutrophils ; cd8 + , cd4 + and treg cells ; increased macrophage and dendritic cell populations within the colonic lamina propria by 3 months ; crypt elongation followed by abcessation , goblet cell depletion , epithelial hyperplasia , and the absence of granulomata . in addition , a thickened bowel wall is noted accompanied by increased th2 cytokine expression and dysfunctional natural regulatory t cell function that closely mimics human disease in all aspects . interestingly , the wasp transgenic mice express normal tcr peripheral t cells , and elevated il13 expression thought to originate from natural killer t cells , which are also thought to be a colitogenic stimulus . it is not known if these cells are important actors in immune dysregulation associated with wasp deficiency in this model , however . wasp transgenic mice have been shown to also lack the ability to fully polymerize cellular actin and express colitis following helicobacter species infection . the presence of helicobacter appears to be necessary for subsequent development of colonic cancer in these mice . the transgenic rat model , the hla - b27 rat is the only transgenic rat model in this class . hla - b27 transgenic rats contain multiple inserted integrated copies of the hla - b27 gene on a lewis rat ( lew ) or fisher 344 ( f344 ) rat genome background . these animals exhibit a dose responsive significant association with several chronic inflammatory diseases categorized as spondyloarthropathies ( spa ) , a complex of diseases that affect the bowel ( ibd ) , joints and axial skeleton ( arthritis ) , and skin , and which involve the major histocompatibility complex class i gene for human leukocyte antigen ( hla ) . at least two different lines of hla - b27 rats have been developed , the 21 - 4h lines and the 33 - 3 lines hla - b27 . modulating diet to include increased levels of non - digestible carbohydrates have been shown moderate intestinal microbiome populations and decrease chronic intestinal inflammation in this model . recent evidence in experimental cell construct has demonstrated that human hla - b27 misfolds in hlab2 rat macrophages during these inflammatory episodes . it is noted that increased protein misfolding can act in a proinflammatory manner and that inappropriate unfolded protein responses to normal levels of misfolding can initiate inflammatory pathways . hla - b27 transgenic rats exhibit uc and cd phenotypes with intestinal inflammation noted within the epithelium of the stomach , large and small intestine , with histological ulceration typical of uc and expression of th1 cytokines usually associated with cd , including interferon , il2 , il1 , il1 , tnf and macrophage inflammatory protein 2 ( mip2 ) within the bowel mucosa and elevated levels of tnf- and il6 within affected rat sera . experimental rats also exhibit functionally defective dendritic cell populations that is hla - b27 dose dependent . clinical signs with associated evidence of histological inflammation include onset of diarrhea after 10 weeks of age , followed by peripheral arthritis . administration of fructo - oligosaccharides ( fos ) followed by examination of bacterial species using 16s rna prevalence demonstrated decreased the total overall number of bacteria noted in fecal samples . among the fecal microbiota examined were elevated amounts of bifidobacteria spp . all of these effects were less pronounced in cecal microbiota , but the cecal bifidobacterial , clostridial clusters i and iv i fos treated animals were quite different than those treated with inulin . bacteria can induce colitis in germ free rats but can act to protect against e.coli induced colitis under those conditions also . consequently , the role of this organism in ibd pathogenesis is not clear despite the observation that human ibd patients more frequently carry abundant amounts of bacterioides spp . the first human genetic risk factor associated with ibd syndromes was the nod2 gene ( nod2 ) , which encodes the intracellular receptor for bacterial wall component muramyl dipeptide , and three deficiency models generated by deletion of exons 1 , 3 , and a frameshift deletion , respectively , have been developed to model ibd . nod2-deficient mice are susceptible to intestinal inflammation following dextran sodium sulfate chemical injury and exhibit acute intestinal inflammation that is worsened in the absence of normal commensal bacteria , unlike most murine ibd models . nod2 deficient mice also exhibit altered tlr2 signaling , suggesting that this gene functions in part by inhibiting th1 cell mediated responses . tlrs are linked to myeloid differentiation factor 88 ( myd 88 ) , and together promote mucosal integrity , barrier function and tissue repair by recognizing and combating the effects of bacterial products prior to injury . tlr2 appears to regulate tight junction barriers found in intestinal stroma , and serve a more protective role while in a citrobacter rodentium infection - mediated ibd model in tlr chimeric mice , tlr4 was active in recruiting fibroblast like cells to colonic crypts , stimulating apoptosis in that location , stimulating hematopoietic cell populations , and activating stat3 transcription factors , thus promoting inflammatory changes . further study in this area is especially warranted , because investigators have suggested that this dual protective and injurious effect incurred by tlr signaling in the bowel may underlie the inability of tumor necrosis factor antibody therapy to effectively treat a substantial minority of ibd patients , and , subsequent induction of il11 cytokine and stat3 signaling . the x - linked gene encoding nf-b essential modulator ( nemo ) is an important regulator of intestinal homeostatic growth , inflammation and tight junctional permeability . it has been suggested that nf-b activation is a key mediator of mucosal homeostatic barrier function through stat5 mediated maintenance of zonula occulens protein : cytoskeletal junctional stability and resultant colonic barrier integrity . absence of stat5 in stat5 intestinal epithelial cell knockout deficient mice results in increased susceptibility to dextran sodium sulfateinduced chemical colitis and severe ileitis with associated severe inflammation and elevated numbers of cd4 + cd25 + foxp3 + regulatory t cells , cd4 + t cells , and macrophages accompanied by elevated proinflammatory cytokine expression . in addition , rectal bleeding , shortened colon , slow weight gain , stool quality that was soft to frank diarrhea , and inflamed intestinal epithelial cells were observed . these mice also exhibited increased nf-b activation in epithelial nuclei accompanied by decreased zonula occulens abundance , upregulation of myosin light chain kinase in epithelial cells , increased focal colonic apoptosis of epithelial cells , and increased epithelial proliferation . the result is a persistent mucosal barrier dysfunction and impairment of mucosal wound healing in this model . ikk-nemo / ikk deficient mice exhibit severe chronic pancolitis from neonatal life due to conditional targeting of the nrmo regulatory complex governing nf-b signaling . tlr mediated bacterial recognition is also thought to play a major role in crypt destruction exhibited by nemo knockout mice . similarly , nemo mice also express differences in expression of myosin light chain kinase , which modifies epithelial barrier function and promotes intestinal inflammation . dual knockout mice expressing defective tgfrii and il10rii exhibit severe , fulminant ulcerative colitis and crohn 's disease that is similar to that experienced by human patients , and which has been , despite the many types of genetically modified models now available , difficult to replicate in rodent models . it is thought that the cause of the severe colitis is overactive t cell populations ; unlike other models , this one can be completely reversed with broad spectrum antibiotics illustrating the importance of the intestinal microbiome in development , progression , severity and cessation of ibd symptomatology and pathogenic changes , as well as the efficacy of il10 and tgf pathway synergism in disease pathogenesis . another example of a dysfunctional mucosal permeability ibd model is the k8 keratin null transgenic mouse . human ibd has been associated with abnormalities in intestinal epithelial cell - specific intermediate filament class keratin 8 , 18 and 19 expression . intermediate filaments are one of three cellular cytoskeleton classes ( the other two being microfilaments and microtubules ) forming a type and cell - specific strong scaffold within animal cells . it is thought that keratins 8 and 18 colocalize in cells with the cytoplasmic domain of tnfrii where they function to moderate tnf - induced transcription factor signaling and activation . several different transgenic mice have been constructed that are keratin deficient ; one , the k8 null transgenic mouse , will develop colitis without additional stimulation and exhibits diarrhea with electrophysiological modifications such as reduced short circuit current production that is thought to be associated with reversed net cl intestinal secretion . in addition , altered epithelial marker expression from basal crypts to apical and lateral locations , and abnormal ion transporter distribution have been noted . some of these changes are thought to correspond to mistargeted protein translocation , which could promote imbalanced lumen microbiota growth rate and species distributions . both uc and cd human patients have documented keratin filament mutations , including k8 ( k464n ) , k8 ( i63v ) , k8 ( g62c ) . the endoplasmic reticulum is the cellular organelle responsible for polypeptide synthesis , posttranslational modification and peptide folding in the process of producing functional proteins . endoplasmic reticulum stress has been associated with excess levels of proteins with abnormal folding patterns ( " misfolded proteins " ) , a phenomena that is linked with a variety of different sporadic and inherited human diseases including neurodegenerative , developmental , metabolic , carcinogenic , infectious and inflammatory diseases . intestinal secretory epithelial cells are particularly important in these processes and as described in this article , are frequently deleteriously affected during waxing and waning ibd episodes . as discussed in an in - depth and excellent review , mcguckin and colleagues defined the complex cellular pathophysiologic pathways involving the unfolded protein response ( upr ) and endoplasmic reticulum associated protein degradation ( erad ) . these pathways are becoming increasingly important in defining underlying stressors in these types of diseases through induction of endoplasmic reticulum stress related proteins , chaperones , autophagy and protein degradation . x box - binding protein 1 ( xbp1 ) transcription factor mrna is the major substrate for inositol - requiring enzyme ( ire ) 1-/ , which is one of several initiating molecule for unfolded protein response pathways . under normal conditions , ire1 splices xbp1 mrna which results in coding for a transcription factor inducing upr target genes and erad molecules . unspliced xbp1 mrna codes for a transcription factor that suppresses upr target genes ; accordingly , one measure of upr activation is the ratio of spliced to unspliced xbp1 mrna . this is particularly important because the upr affects translation , protein folding and degradation of misfolded proteins , a complex process under normal conditions that is crucial in normal homeostasis for removal of abnormal proteins and polypeptides whose accumulation can be a significant cause of morbidity and mortality in a diverse array of inherited or spontaneous disease syndromes . intestinal secretory cells such as colonic goblet which produce mucin , and small intestinal crypt paneth cells , which produce defensins , lysozyme , antimicrobial lectins and collectins and so are extensively involved in protein manufacture , processing and granular storage of proteins that must maintain normal folding patterns for exit from the endoplasmic reticulum and targeting to appropriate cellular locations . paneth cell metaplasia has been noted with uc and cd , and inflammatory cytokines , pamp molecules , growth factors and nod proteins are all known to increase cellular transcription in intestinal secretory cells , thus placing increased stress on endoplasmic reticular systems . mcguckin ma and colleagues propose that er stress should be considered an emerging pathway in intestinal inflammation that influences disease development , progression , and response by decreasing mucosal barrier integrity and functional effectiveness , and through upr - initiated proinflammatory signals released by stressed secretory cells . x - box binding protein ( xbp1 ) deficient mice are inducible xbp1 upr transcription factor cre - recombinase knockout constructs using the villin promoter ( xbp1 ) that suppress colitis development and develop abnormal unfolded protein during expression of their intestinal inflammatory episodes . these mice express defective upr and partial xbp1 deficiency in the colon resulting in goblet cell loss , absence of spontaneous colitis but increased sensitivity to dextran sodium sulfate colitis induction . ire1 mice are knockout mice with loss of the ire1 upr endonuclease that cleaves xbpr mrna , and were the first transgenic mice to demonstrate linkage between inappropriate upr and intestinal inflammation . interestingly , ire1 knockout mice do not develop spontaneous intestinal inflammation but are more sensitive to dextran sodium sulfate induced colitis also . agr2 mice are germline ( agr2 ) conditional allele or inducible knockout mice that abolish muc2 biosynthesis , resulting in spontaneous intestinal inflammation , paneth and goblet cell apoptosis , and severe inflammation . protein folding is determined in part by primary sequence but also by the presence of intermolecular disulfide bond formation , and reduction of these bonds is necessary to correct misfolded proteins and to remove them from the endoplasmic reticulum . there is a family of isomerases that are important facilitators of this task , the protein disulfide isomerase ( pdi ) family , of which one member , the anterior gradient 2 ( agr2 ) isomerase appears to be highly upregulated during endoreticular stress in intestinal cells . agr2 also is important in stimulating cell proliferation , cell adhesion , motility ; and in inhibiting apoptosis . the presence of high levels of agr2 mrna and protein is associated with cell proliferation and inhibited apoptosis in gastrointestinal and mammary gland adenocarcinoma while decreased expression in humans is associated with increased risk of uc and cd . accordingly , agr2 germline knockout mice generated in fvb / ntgn(actb - cre)2mrt strain mice have abrogated anterior gradient 2 isomerase expression in muc2 produced in goblet cells , and do not produce mucus within the intestine . there is apparently mild endoplasmic reticulum stress in these mice , which suggests that upr - mediated mechanisms may cause differentiating goblet cells to cease their production of this mucin . these investigators first developed agr2 mice with deletions of agr 2 exons 2 , 3 and 4 derived from intestinal mrna by crossing protamine - cre transgenic mice with tg prm - cre mice that exhibited agr2 deletions in the male germline . inducible agr 2 mice were developed using a rosa26-creer strain with inducible systemic cre recombinase activation responsive to tamoxifen . these tg tam - cre transgenic mice crossed with agr2 generated agr2 and inducible agr2 mice . transgenic agr2flox / flox : tgtam - cre tamoxifen inducible cre loxp mice were combined , and then induced to stop expressing agr 2 following tamoxifen injection by stimulating the cre - loxp system that takes advantage of using nuclear hormonal receptor import mechanisms to import targeted cre - fusion proteins into the nucleus while avoiding lethality . in these experiments inducible strain agr 2 null allele mice exhibited expanded paneth cell populations and ectopic paneth cell locations within intestinal villi , with mature secretory cells that appear to experience severe endoplasmic reticulum stress , resulting in major epithelial damage . germline and inducible knockout mouse constructs develop severe terminal ileitis and colitis characterized by neutrophillic infiltrates surrounding crypt base and in submucosal perivascular spaces , peyers patch lymphoid follicular hyperplasia with granulomatous inflammation consisting of large numbers of multinucleated giant cells locater within interfollicular areas . colonic immunopathology was characterized by the presence of mixed inflammatory infiltrates with isolated lymphoid follicles distributed within the colonic lamina propria . paneth cells exhibited cell hypertrophy and expansion following induction of decreased agr2 expression in inducible transgenic mice within 24 hours of tamoxifen injection followed by goblet cell degeneration , acute neutrophillic inflammatory infiltrates into the lamina propria , further loss of paneth cells , villus enterocyte blunting . these histopathologic changes correlate with increasing apoptosis within all regions of the small intestine and colon . while there is limited biochemical evidence for er stress and upr initiation influences in uc and cd , it has been suggested through genome wide association studies that autophagy allele are directly linked with cd ( atg16l1 and irgm1 ) and uc ( atg16l1 ) , and that nod2 , which is strongly linked to ileal cd , activates autophagy processes . the presence of these factors could result in dysbiosis , or loss of intestinal homeostasis , and a tendency towards ongoing inflammatory reactivity result in uc and cd . because there are limited investigative efforts currently in this are exploration of the role of er stress could potentially be a fruitful area for future examination of mechanisms of disease and potential therapeutic targets within these cellular pathways . bridging integrator ( bini ) transgenic mice exhibit modified intestinal permeability through the action on intestinal tight junctional maintenance . interestingly , ablating bin1 does not appear to modify histological appearance of tissues alone , but does increase functional resistance of mice to action by dextran sodium sulfateinduced colitis : treated mice exhibited increased survival , and decreased clinical manifestations of ibd such as hematochezia , diarrhea , and weight loss that was specifically associated with immune dysfunction , and not with general disruption of tight junction permeability as documented by treatment of control mice with phorbol ester or sodium caprate . interleukin 23 ( il23 ) is an important factor in developing ibd in engineered rodent models but it is not yet fully understood how this signaling pathway affects ibd onset , progression , or cessation . an intact il23 signaling pathway is required for intestinal inflammation development in ibd mouse models and human . il23/th17 cell pathways have been implicated in ibd pathogenesis during human genetic investigations , suggesting that mucosal epithelial defense is a key component of disease protection . important functional partners in regulatory networks that govern mucosal immunity in response to commensal bacterial populations are th17 cell function and cd4 + t reg fox 3 cell function . in addition , il12b ( p40 ) forms a core basis of il12b and il23 ; jak 2 binds and causes phosphorylation of il23r , which then results in stat3 activation , phosphorylation and nuclear translocation . il12 was previously thought to be an essential component in ibd pathogenesis involving both adaptive and innate immunities but more recent studies have shown that it is il23 that is crucial . using il23p19 knockout mice and il12p35 knockout mice to assess the role of each of these cytokines in ibd models has demonstrated the il12 is an essential mediator of disease expression . spontaneous transmural enterocolitis and colonic adenocarcinoma are also observed in mice carrying specific disruption and concomitant deficiency of the signal transducer and activator of transcription 3 ( stat3 ) in stat3 deficiency transgenic mice . stat3 inducible deficient mice are generated using an intercross between the mx-1 cre transgenic mouse with cre recombinase controlled by the interferon - responsive mx1 promoter , and , stat2 " floxed " allele strain mice , with experimental adult m+/stat3 mice carrying the stat3 allele deletion , and mx-/stat3 mice serving as controls . following type 1 interferon stimulation by repeated intraperitoneal injections of synthetic double stranded rna immunostimulant preparation polyinosinic : polycytidylic acid ( pipc ) exhibit a clinical wasting syndrome that is associated with severe fatal enterocolitis within 2 to 3 weeks after treatment . experimental mice exhibited severe dehydration , lethargy , weight loss , diarrhea , anal bleeding and prolapse by day 11 and were typically sacrificed by day 17 due to significant morbidity . clinicopathological indices included elevated circulating monocytes and neutrophils ; multifocal macrophage and lymphocytic aggregates in peritoneal tissues ; and colon enlargement , hematochezia and diarrhea . histologic examination revealed the presence of mixed cell infiltrates consisting of lymphocytes and neutrophils that extended into the lamina propria and submucosa of the colon and were accompanied by ulceration , bleeding , lymphoid follicles , crypt abcesses with increased epithelial mitoses and ultimately destruction of intestinal glands and secretory cell populations . immunohistochemical evaluation identified predominantly cd4 + t lymphocytes among the lymphoid population , accompanied by proinflammatory cytokines and endothelial adhesion molecules in areas of reactive cell infiltration : il-1 , tnf , interferon , vascular cell adhesion molecule-1 ( vcam-1 ) and inflammatory cell adhesion molecule-1 ( icam-1 ) ; and , monocyte chemoattractant protein-1 and nitric oxide . stat3 expression was detected in inflammatory infiltrate and colonic epithelial cell nuclei where it is constitutively phosphorylated and was noted for a slightly extended period following the first pipc stimulant injection only . the disease course in this model could not be modified with antibiotic treatment , but was obliterated by neutralizing il12/il23 effects using anti - p40 antibodies , including the well documented role that this molecule plays in th1 responses as well as suggesting that il12 may stimulate natural killer effector cells and endothelial icam and vcam expression , contributing to the overall immune dysbiosis found in ibd disease and animal models . stat3 , while considered to be a nonspecific transcription factor , will bind downstream of many inflammatory cytokines that exhibit opposing actions , as well as inducing il23r expression and th17 differentiation . this complex combination of actions involving both pro- and anti - inflammatory mechanisms are undoubtedly activated in ibd , reflecting the presence of a broadly inflammatory environment as well as in stat3 deficiency mouse models , demonstrating the suppressive / regulatory effects of this transcription factor . similarly , stat4 is specifically associated with il12/il23 receptor signaling , and increased stat4 expression through construction of overexpression transgenic mice under the control of cytomegalovirus promotor systems targeting elevated stat4 levels to splenic and lamina propria cd4 + t cells when immunostimulated with hapten - linked antigens these mice exhibit severe transmural colitis that is thought to be in part due to abnormal activation of t helper 1 cell pathways . many of the transgenic strains were developed to assess mechanisms of inflammation , injury and repair . one example of this type of model is the il10 transgenic mice ; tcr transgenic mice . these mice develop severe mucosal inflammation at 12 - 16 weeks of age , possibly due to th2 cell dysregulation . recent studies have also identified familial early - onset crohn 's disease in some human populations that is associated with homozygous il-10 receptor mutations present in hematopoietic cells , based on disease rescue observed following allogeneic stem cell transplantation in human patients . in mice transgenic mice il10 , il10 and in those carrying a stat3 in circulating macrophages individuals develop spontaneous intestinal inflammation . il10 mice exhibit a significant increase in splenic macrophages when generated on non - obese diabetic ( nod ) strain backgrounds , but not on c57b6 genetic strain backgrounds . nod based il10 deficient mice housed under conventional husbandry conditions also exhibited high levels of rectal prolapse and histological evidence of colitis in comparison to control mice , along with abrogation of spontaneous diabetes and reduced sialoadenitis usually observed in a subset of nod mice housed in conventional facilities . using tlr cpg motif oligonucleotides as agonists in this il-10 deficient nod model resulted in elevated proinflammatory sera levels for tnf , interferon , and il7 while il12p70 was unaffected ( rajagopalan g et al 2006 ) . actually , mice that are il10 deficient as well as those that have been treated with anti - il10 antibody both develop significant chronic intestinal inflammation . similarly , il10 supplementation is protective against colitis disease development and appears to be associated with tgf1 potentiation of activated t cell effector and regulatory cd4 + t cell populations . also , in il10 double null mice , tumor necrosis factor inducible nitric oxide synthase ( inos ) appears to activate the intestinal epithelial cell apoptosis pathway normally responsible for crypt replenishment of epithelial bowel cells , contributing to increased epithelial degeneration and colitis in humans afflicted with ibd , and in these transgenic mice constructs . samp1/yit mice exhibit spontaneous colitis without genetic manipulation which is also thought to be mediated through stat3 activation pathways . stat3 expression is also important for epithelial restitution and enterocyte survival with induced somatic inactivation of this gene resulting in fulminant colitis . expression of epithelial e - cadherin ( cd324 , associated with uc gene cdh1 , and clinically , uc ) mediates adhesion between epithelial cells and formation of an effective barrier . an interruption of these fundamental homeostatic mechanisms can predispose towards developing ibd . e - cadherin is expressed in dendritic cells that are considered to be important in maintaining a balance between self - tolerance and expression of autoimmunity through intestinal portals . the il23 pathway appears to be responsible for the onset and progression of spontaneous colitis in il10 deficient mice . multiple murine colitis models have been identified with il23 pathway - mediated colitis due to expression blockade or deficiency . additionally , both il-10 deficient mice and gi2 mice , which are missing g protein subunit gi2 that normally regulates the inhibitory control of adenylyl cyclase , and negatively regulate tlr2 and tlr4-induced cytokine expression with subsequent decreased tnf and il6 expression , have been associated with colon cancer development . as a result of many recent large scale , individual and collaborative genome wide association scanning studies assessing ibd patients and experimental models for disease correlation with susceptibility loci , the number of known association loci has increased from 3 to 100 . now that genetic susceptibility data have been categorized and identified it is time to put this information into a clinical context through translational medicine , with a goal of finding appropriate cellular and molecular targets for therapeutic intervention , and , to better understand this complex disease pathogenesis at the level of the nucleic acid , protein assembly , microbiomic , metagenomic and ecological levels . the proliferation of different genetically engineered rodent ibd models which produce different aspects of this disease syndrome it would be prudent to consider areas in which less has yet been clearly described in the pathogenesis of the ibd syndromes , but which appear to greatly influence disease outcomes and patient therapeutic responses . one important aspect going forward in this line of research would be to ensure that rodent models under development and evaluation as putative ibd animal models exhibit well characterized intestinal microbiome prior to induction of this disease . infection , as this infection with this organism has been clearly associated with ibd disease expression in one transgenic rodent model . equally important is appropriate institutional animal care and use committee ( iacuc ) attention to investigator knowledge , experience and consideration of the medical implications involved in developing these types of animals ' models . it will be very important to make provision for adequate veterinary care and animal husbandry aspects involving accommodation of induced putative deficits in activities of daily living ( such as motor ability , food and water ingestion , and bodily functions ) ; and , assessment of discomfort and pain as several of the ibd transgenic murine models induce significant morbidity , and for some strains , mortality . these studies also suggest that it is important to further delineate gut microbiota as a way of characterizing conventional and specific pathogen free facilities , including those in which serological testing has suggested that common mouse and rat pathogens and commensal organisms are absent . epigenetic , environmental ( microbiome , metabolome ) and nutritional factors are important in ibd pathogenesis , and evaluating ways in which they influence disease expression represent potential investigative approaches with the greatest potential for new discoveries . these iterative approaches may produce new insights into underlying pathogenic mechanisms affecting ibd syndrome onset , progression , and cessation as observed in human and animal patients , and in animal disease models .

lysine acetylation has long been recognized as an important protein post - translation modification ( ptm ) that regulates a diverse array of cellular functions . acetylation of histone lysines , in particular , has been intensely investigated because of its key function regulating chromatin architecture and transcription . mounting evidence suggests that some histone ptms can be maintained through multiple cell cycles , giving rise to the proposal that the specific pattern of ptms found on histones represents a combinatorial code , regulating gene expression . the concept of a histone code has resulted in the idea that specific protein classes exist to add the ptm marks ( writer ) , recognize the marks ( readers ) , and remove the marks ( erasers ) . in the case of acetylated lysine ( kac ) these proteins are well characterized : histone acetyltransferases ( hats ) add the acetyl group , histone deacetylases ( hdacs ) remove the acetyl group , and bromodomains bind to and recognize kac , acting as readers of lysine acetylation state . there have been 61 bromodomains identified in the human proteome , which are found within 46 separate proteins , and that can be phylogenetically divided into eight distinct families . the precise cellular role of most bromodomain - containing proteins ( bcps ) is still unknown . however , those bcps that have been studied in detail have been linked to certain diseases , and this work has been extensively reviewed . as bromodomains are invariably components of large multidomain proteins , removal of the whole bcp does not provide information on the specific function of the bromodomain itself . consequently , an important strategy in the study of bromodomain function is the development of small molecule probes that selectively prevent the interaction of a given bromodomain with kac , without affecting other functions of the bcp . the most significant progress has been made in developing probes for the bromodomain and extra c - terminal domain ( bet ) family of bromodomains , which comprises bromodomain - containing proteins 24 ( brd24 ) and bromodomain testis - specific protein ( brdt ) . the compound reported by filippakopoulos ( 1 ) was based on structures disclosed in two mitsubishi pharmaceuticals patents , while the compound reported by nicodeme et al . ( 2 ) was identified based on a phenotypic screen monitoring apoa1 expression levels . further work on this chemotype has been reported by filippakopoulos et al . and zhou et al . structures of ( + ) -jq1 ( 1 ) , i - bet762 ( 2 ) , the 3,5-dimethylisoxazoles reported by hewings ( 3 , 4 ) , i - bet151 ( 5 ) , the 3,5-dimethylisoxazole ( 6 ) reported by hay et al . , pfi-1 ( 7 ) , and the optimized bet bromodomain ligands 8 and 9 . ic50 values for the compounds are shown with the method used to obtain values given in italics . we and others have reported the 3,5-dimethylisoxazole moiety as an effective kac mimic and employed it to develop a second , chemically distinct class of bromodomain ligands ( 36 ) . we showed that compound 3 ( figure 1 ) binds to the bet bromodomains , having ic50 = 4.8 m against brd4(1 ) . dawson et al . also employed the 3,5-dimethylisoxazole moiety in the development of compound 5 which showed low nanomolar potency in vitro and in cell based assays . very recently a third chemotype of bet bromodomain inhibitor has been reported by fish et al . herein , we detail the structure - based optimization of our previously reported lead compound ( 3 ) to furnish potent bet bromodomain inhibitors . the affinity of the optimum compounds ( 8 and 9 ) was rationalized by x - ray crystallography , yielding insights into the structural requirements for binding to bet bromodomains and the observed sar . in addition , compounds 8 and 9 were shown to have cellular activity consistent with a bet bromodomain inhibitor in an acute myeloid leukemia ( aml ) cell line . the x - ray crystal structure of our lead compound ( 3 ) bound to the first bromodomain of brd4(1 ) showed that the methyl group bound in a shallow hydrophobic groove frequently referred as the wpf shelf ( figure 2a ) . the ethoxy substituent was directed toward a channel formed by residues in the loop region between the z and a helices , termed the za channel . in order to develop a compound with improved affinity for brd4(1 ) , we have investigated enhancing the interactions of the compound in these two key regions . it was hypothesized that a substituent larger than the methyl group , such as those aromatic rings present in 1 , 2 , and 5 , would give an increase in brd4(1 ) affinity by occupying the wpf shelf more effectively ( figure 2a ) . in addition , it was noted that the 3,5-dimethylisoxazole moiety of 3 binds further out of the kac - binding pocket compared to , for example , 5 ( figure 2b ) . it seemed likely that the addition of a larger wpf shelf - binding substituent would push the 3,5-dimethylisoxazole further into the kac - binding pocket , increasing interactions in this part of the protein as well . therefore , a series of diarylmethanol derivatives ( 1216 , scheme 1 ) was designed including a simple phenyl derivative ( 12 ) and both meta- and para - substituted fluoro ( 13 and 14 ) and chloro analogues ( 15 and 16 ) . the aldehyde 10 was a common precursor for all compounds reported here , and synthesis details are provided in the supporting information . ( a ) overlaid x - ray crystal structures of compound 3 ( pdb code 3svg , carbon = yellow ) and compound 1 ( pdb code 3mxf , carbon = orange ) , both bound to human brd4(1 ) . the methyl group of 3 does not occupy the wfp shelf as effectively as the chlorophenyl moiety of 1 . ( b ) overlaid x - ray crystal structures of compound 3 ( pdb code 3svg , carbon = yellow ) and compound 5 ( pdb code 3zyu , carbon = orange ) , both bound to human brd4(1 ) . the 3,5-dimethylisoxazole moiety of 5 resides further into the kac - binding than that of compound 3 . conditions : ( a ) etbr , k2co3 , meoh , 120 c ( microwave ) , 30 min , 69% . ( b ) x = h : phmgbr , thf , rt , 17 h , 80% . x = m - f : 1-bromo-3-fluorobenzene , mg , et2o , reflux , 2 h and then 11 , et2o , rt , 2 h , 92% . x = p - f : 1-bromo-4-fluorobenzene , mg , thf , reflux , 3 h and then 11 , thf , rt , 61% . x = m - cl : 1-bromo-3-chlorobenzene , mg , thf , reflux , 1 h and then 11 , thf , rt , 2 h , 90% . x = p - cl : 1-bromo-4-chlorobenzene , mg , thf , reflux , 2.5 h and then 11 , thf , rt , 3 h , 67% . utilizing a peptide displacement - based amplified luminescent proximity homogeneous assay ( alpha ) , we evaluated the compounds for their ability to bind the bromodomains of brd4(1 ) and camp response element binding protein ( creb ) binding protein ( crebbp ) ( table 1 ) . a clear sar trend is evident for brd4(1 ) affinity , and the simple phenyl derivative 12 is the most potent compound with an ic50 of 640 nm . the fluorophenyl substituents ( 13 and 14 ) are better tolerated than the chlorophenyl substituents ( 15 and 16 ) , with para - substitution preferred to meta - substitution . these data suggest that increased affinity does result from a hydrophobic interaction with the wpf shelf , as has been observed with other bet bromodomain inhibitors . it initially appears surprising that the optimum substituent in the above series of compounds is the unsubstituted phenyl ring , given that both compounds 1 and 2 possess a chlorophenyl substituent that binds in the wpf shelf region . however , it is possible that the ethoxy group that resides in the za channel is not optimal , pushing the aryl ring further into the wpf shelf than is the case with 1 or 2 , meaning that there is less room available for the aryl substituent to bind ( figure 2a ) . our observations are consistent with the data of bamborough et al . who synthesized sulfonamide derivatives with a range of substituents occupying the wpf shelf . they noted that a lipophilic substituent of three to five heavy atoms was optimal for occupying the wpf shelf in their series of compounds . their series included a range of phenylsulfonamide derivatives , which would be expected to bind to the wpf shelf in a similar manner compared to compounds 1216 ; however , structural data are not available for these compounds . in their case , the o - chloro substituent was preferred over the m - chloro substituent , which was preferred over the p - chloro substituent . this disparity with our work might result from the phenyl rings in each series having different orientations in relation to the wpf shelf . however , the unsubstituted phenyl ring was optimal in both cases . an analogous series of methoxyphenyl - substituted sulfonamides compounds showed similar potency and trends compared to the chloro - substituted series , indicating that the electronic properties of the substituents did not affect the potency of the compound . in our case , we can not rule out the possibility that the electron - withdrawing nature of the halide substituents is affecting the affinity of the compounds for brd4(1 ) . : 200 nm . heat map shows relative ic50 values obtained in an alpha assay . ranges in parentheses represent 95% confidence intervals resulting from sigmoidal curve fitting to duplicate data . the affinity of all compounds for the crebbp bromodomain was also increased with compound 12 again the most potent . however , the selectivity for brd4(1 ) over crebbp was maintained , with compounds 3 and 12 both displaying approximately 6-fold selectivity for the bromodomain of brd4(1 ) . these data indicate that the phenyl group of 12 binds effectively to the wpf shelf region of brd4(1 ) , whereas interaction of this moiety with creebp , which does not possess this structural feature , is less favorable ( see supporting information figure s4 ) . one advantage of compound 3 was its leadlike ligand efficiency of 0.39 for brd4(1 ) , and despite an increase in molecular weight , compound 12 retains a respectable ligand efficiency of 0.36 for brd4(1 ) . the next area of sar we wished to explore was the substituent directed toward the za channel . as the number of ligand - bound structures of bet bromodomains solved has increased , it has become evident that there is always one , and usually two , water molecule present in the za channel . it was observed that in the x - ray crystal structure of compound 3 bound to brd4(1 ) , the oxygen atom of the ethoxy group was not hydrogen bonding to this water molecule ( figure 3a ) . conversely , an x - ray structure of a similar 3,5-dimethylisoxazole derivative ( 4 ) bound to the bromodomain of crebbp was forming a hydrogen bond with the corresponding za channel water molecule ( figure 3b ) . the loop region that binds the two za channel water molecules , which comprises p82 , q85 , p86 , v87 , and d88 in brd4(1 ) , is conserved in crebbp ( p1110 , q1113 , p1114 , v1115 , and d1116 ) ( see supporting information figure s5 ) . it should be noted that there are some differences between the brd4(1 ) and crebbp bromodomains . three key residues that differ are w81 , k91 and d145 in brd4(1 ) , which correspond to l1109 , l1119 and r1173 in crebbp , respectively ( see supporting figure s4 ) . however , the za channel water molecules are bound in a very similar manner by both bromodomains , and therefore , comparison between them is valid . it seemed possible that an increase in affinity would be achieved if the ligand was able to displace , or hydrogen - bond to , one of the za channel water molecules . ( a ) x - ray crystal structure of compound 3 ( pdb code 3svg , carbon = yellow ) bound to human brd4(1 ) . the oxygen atom of the ethoxy group does not hydrogen bond with the za channel water molecules . ( b ) x - ray crystal structure of compound 4 ( pdb code 3svh , carbon = yellow ) bound to human brd4(1 ) . the oxygen atom of the ethoxy group forms a hydrogen bond with one of the za channel water molecules . to test this hypothesis , compounds were designed to probe the interaction with the za channel water molecules . the smaller phenol ( 8) and acetate ( 9 ) derivatives ( scheme 2 ) were intended to form hydrogen bonds with these water molecules and hence would be expected to be the most potent if the water molecule remained in place . larger ethylene glycol and methoxy derivatives ( 2123 , scheme 3 ) were expected to be more potent if the water molecules were displaced . we also synthesized the ketone 17 to investigate the effect of an sp - hybridized carbon atom linking the two aryl rings ( scheme 2 ) . conditions : ( a ) phmgbr , thf , rt , 1 h , 91% ; ( b ) ac2o , naoh , h2o , proh , rt , 1 h , 90% ; ( c ) mno2 , 1,4-dioxane , 80 c , 53 h , 84% . r = me : ( a ) mei , cs2co3 , dmf , rt , 2.5 h , 92% ; ( b ) phmgbr , thf , 0 c , 1 h , 76% . r = ch2ch2ome : ( a ) 1-bromo-2-methoxyethane , k2co3 , meoh , 110 c ( microwave ) , 30 min , 70% ; ( b ) phmgbr , thf , rt , 1.5 h , 83% . r = ch2ch2oh : ( a ) 2-bromoethyl acetate , cs2co3 , dmf , 80 c , 16 h and then meoh , rt , 1.5 h , 41% ; ( b ) phmgbr , thf , rt , 3 h , 62% . compounds 8 , 9 , 17 , 2123 were evaluated for brd4(1 ) affinity in an alpha assay ( table 2 ) . the phenol ( 8) and acetate ( 9 ) showed ic50 values of 370390 nm against brd4(1 ) , which is a significant enhancement in brd4(1 ) affinity compared to the ethyl ether 12 . the ethylene glycol and methoxy derivatives ( 2123 ) had affinities greater than 1 m for brd4(1 ) . as only the ( r)-enantiomer of the lead compound 3 was observed in its x - ray crystal structure in complex with brd4(1 ) , the ( r)- and ( s)-enantiomers of phenol 8 were separated ( supporting information figure s1 ) and evaluated individually . kd values of 0.36 ( 0.300.41 ) m for the ( r)-enantiomer and of 0.39 ( 0.370.40 ) m for the ( s)-enantiomer were in good agreement with those determined in the alpha assay and demonstrated 1:1 binding stoichiometry with rapid on and off rates ( supporting information table s1 and figure s3 ) . compared to the lead compound ( 3 ) , 8 maintains the ligand efficiency and improves the lipophilic ligand efficiency ( table 3 ) . having confirmed that the enantiomers were stable in buffer and did not racemize ( supporting information figure s2 ) , we obtained x - ray crystal structures of both ( r)-( ) and ( s)-(+)-8 in complex with brd4(1 ) ( figure 4 ) in order to rationalize the observed affinities and to determine whether our sar predictions were correct . the absolute configurations were assigned after obtaining x - ray crystal structures of the ( )- and ( + ) -enantiomers of 8 in complex with brd4(1 ) . protein and peptide concentration : 50 nm . protein and peptide concentration : 50 nm . red indicates low ic50 values , and green / yellow indicates high ic50 values . ranges in parentheses represent 95% confidence intervals resulting from sigmoidal curve fitting to duplicate data . protein and peptide concentration : 50 nm . the x - ray crystal structures reveal that the ( r)- and ( s)-enantiomers have almost identical modes of binding to brd4(1 ) . overlaying the x - ray crystal structures of 8 [ ( s)-8 shown ] with that of 3 bound to brd4(1 ) shows that ( s)-8 resides deeper in the kac - binding pocket than 3 ( figure 4a ) . the phenyl ring of ( s)-8 occupies the wpf shelf and binds in a similar region as the chlorophenyl moiety of 1 ( figure 4b ) . it is possible that substituents on the phenyl ring will be better tolerated in a phenol - derived series than in the ethoxy series described above . we have not investigated this point , but this strategy might lead to compounds with further enhanced affinity for brd4(1 ) . overlaying the x - ray crystal structures of ( r)- and ( s)-8 explains the similar affinity of these two compounds for brd4(1 ) . as the phenyl group binds in the wpf shelf and the 3,5-dimethylisoxazole occupies the kac - binding pocket , the secondary hydroxyl group is solvent exposed ( figure 4c ) . consequently , the configuration at the stereogenic center does not impact the affinity of the compounds for brd4(1 ) . however , given the reduction in affinity of 17 , compared to 8 , it seems that a tetrahedral atom linking the two aryl rings is favored for brd4(1 ) binding . both enantiomers of compound 8 are observed to form a hydrogen bond between the phenol hydroxyl group and one of the conserved za - channel water molecules ( figure 4d ) ; a similar interaction is formed by the quinoline nitrogen atom of compound 5 . as we have discussed previously , it seems that this water molecule is tightly bound to brd4(1 ) and hence can not be displaced easily . it does seem , however , that forming a hydrogen bond with this water molecule might enhance the affinity of 8 for brd4(1 ) . a combination of this hydrogen bond and binding of the phenyl group in the wpf shelf likely pushes the 3,5-dimethylisoxazole group further into the kac - binding pocket . ( a ) x - ray crystal structures of compound 3 ( pdb code 3svg , carbon = orange ) and ( s)-8 ( pdb code 4j0s , carbon = yellow ) both bound to human brd4(1 ) . the 3,5-dimethylisoxazole moiety of ( s)-8 resides deeper in the kac - binding pocket than that of 3 . ( b ) overlaying the x - ray crystal structure of ( s)-8 ( pdb code 4j0s , carbon = yellow ) and 1 ( pdb code 3mxf , carbon = orange ) demonstrates that the phenyl group of ( s)-8 binds to the wpf shelf in a similar position as the chlorophenyl group of 1 . ( c ) overlaying the x - ray crystal structures of ( r)-8 ( pdb code 4j0r , carbon = orange ) and ( s)-8 ( pdb code 4j0s , carbon = yellow ) demonstrates that the hydroxyl group attached to the stereogenic center is solvent exposed . ( d ) the phenol hydroxyl group of 8 ( pdb code 4j0s , carbon = yellow ) forms a hydrogen bond with one of the conserved za channel water molecules . ( e ) docking studies indicate that a feasible binding mode for 9 ( docked , carbon = orange ) is in a similar orientation as ( s)-8 ( pdb code 4j0s , carbon = yellow ) , with the 3,5-dimethylisoxazole occupying the kac - binding pocket and the phenyl ring residing on the wpf shelf . ( f ) the phenolic oxygen atom of 9 is predicted to form a hydrogen bond with one of the conserved za channel water molecules . the acetate carbonyl group is predicted to form a hydrogen bond with a side chain of q85 . the methyl of the acetate group is predicted to be located in a hydrophobic region close to w81 . by use of the x - ray crystal structure of ( s)-8 bound to brd4(1 ) , docking studies ( autodock vina ) were performed to rationalize the high affinity of 9 for brd4(1 ) . these studies indicate that it is feasible for 9 to bind to brd4(1 ) in an orientation similar to that adopted by 8 ( figure 4e ) . the 3,5-dimethylisoxazole can occupy the kac - binding pocket , and the phenyl ring can reside on the wpf shelf . the phenolic oxygen atom of 9 is predicted to form a hydrogen bond with one of the conserved za channel water molecules ( figure 4f ) . the acetate carbonyl group is predicted to form a hydrogen bond with side chain of q85 and might also interact with the lower za channel water molecule . the methyl of the acetate group is predicted to be located in a hydrophobic region close to w81 , explaining how the extra steric bulk associated with the acetate moiety might be accommodated . consequently , the docking studies provide a possible model for the binding of 9 to brd4(1 ) . it is noted that compound 9 is both an active brd4(1 ) ligand and a possible precursor to compound 8 in a cellular setting . compound 8 showed 100% inhibition of the brd4(1 ) and crebbp bromodomains at 25 m . comparison of ic50 values from the alpha assays indicates that ( s)-8 is 3-fold selective for the bromodomain of brd4(1 ) over the bromodomain of crebbp . investigation of percentage inhibition of the bromodomains from atad2 , baz1a , baz2a , baz2b , brd9 , brpf3 , cecr2 , gcn5l2 , phip(1 ) , pb1(1 ) , and tif1 at 25 m indicated that compound 8 shows little affinity for these bromodomains . in addition , thermal shift analysis of 8 against the bromodomains from pcaf and taf(1 ) showed a tm of less than 0.5 c , which corresponds to very low affinity for these proteins . the alpha assay was also used to determine the selectivity of 8 , 9 , and 17 , 2123 for brd4(1 ) over the bromodomain of crebbp ( table 2 ) . comparison of ic50 values indicates that ( s)-8 is 2- to 3-fold selective while compound 9 shows 7-fold selectivity . the selectivity of 8 was further evaluated across a phylogenetically diverse range of bromodomains ( figure 5 ) . the alpha assay indicated that compound 8 displayed less than 25% inhibition of bromodomains contained in this panel at 25 m ( figure 5 ) , with the exception of brd4(1 ) and crebbp . for mv4;11 , a549 , and h1975 cells , viability was assessed after a 72 h incubation using mts . for u2os and hela cells , bet bromodomain inhibitors have previously shown antiproliterative effects in a variety of hematopoietic malignancies , including aml and multiple myeloma . consequently , we investigated the effects of compounds 8 , 9 , and 15 in the aml cell line mv4;11 , which harbors an mll af4 gene fusion ( table 4 ) . compounds 8 and 9 had ic50 values of 794 and 616 nm , respectively , in an mts cytotoxicity assay ( supporting information figure s4 ) . the weaker brd4 inhibitor 15 , which has an ic50 of approximately 7 times that of 8 and 9 in the brd4(1 ) alpha assay , was 5-fold less active than 9 in this cytotoxicity assay . gratifyingly , 8 and 9 showed no appreciable cytotoxicity ( > 100 m ) in hela or u2os cells over a period of 24 h suggesting that the effects seen in the mv4;11 cells result predominantly from inhibition of the bet bcps . over a period of 72 h , compounds 8 and 9 showed less toxicity than ( + ) -jq1 in the hela and u2os cells ( see supporting information table s2 ) . we also investigated the effects of 8 and 9 in two lung adenocarcinoma cell lines , a549 and h1975 . compounds 8 and 9 markedly reduced the viability of both cell lines at 100 m , as determined by an mts cytotoxicity assay ( supporting information figure s4 ) . h1975 appeared to be somewhat more sensitive to these compounds , a finding confirmed by a clonogenic survival assay ( supporting information figure s5 ) . the modest effect of 8 and 9 in these cell lines is consistent with the findings of mertz et al . , who observed only weak growth inhibition by bet inhibitor i - bet151 in several solid tumor lines . overall , these results suggest that compounds 8 and 9 are cell - permeable compounds without appreciable nonspecific cytotoxicity . these compounds show antiproliterative effects in a leukemic cell line with known sensitivity to bet inhibitors . we have described the structure - guided optimization of compound 3 to give potent inhibitors of the bet bromodomains ( 8 and 9 ) . the x - ray crystal structures obtained in this work help to demonstrate many of the structural characteristics required for a compound to show high affinity for the bet bromodomains . these compounds show some selectivity over the crebbp bromodomain and excellent selectivity over other phylogenetically diverse bromodomain classes . on the basis of our structural and docking studies , it seems that constraining the acetate substituent of compound 9 into a five- or six - membered ring might lead to a stronger hydrogen bond with q85 and provide entropic gains in binding affinity . a re - evaluation of the wpf - shelf - binding ring substituents might also lead to enhanced brd4(1 ) affinity and potentially improved selectivity for the bet bromodomains over the crebbp bromodomain . assessment of compounds 8 and 9 in a range of cells lines reveals that the compounds have submicromolar ic50 values in mv4;11 cells and that the effects are predominantly due to inhibition of the bet bcps . these compounds will likely prove to be useful tools in the study of the bet bromodomains and are highly ligand - efficient lead compounds for further development . h nmr spectra were recorded on bruker dpx400 ( 400 mhz ) or bruker avii 500 ( 500 mhz ) using deuterochloroform ( unless indicated otherwise ) as a reference for the internal deuterium lock . the chemical shift data for each signal are given as h in units of parts per million ( ppm ) relative to tetramethylsilane ( tms ) where h(tms ) = 0.00 ppm . the multiplicity of each signal is indicated by s ( singlet ) , br s ( broad singlet ) , d ( doublet ) , t ( triplet ) , q ( quartet ) , dd ( doublet of doublets ) , ddd ( doublet of doublet of doublets ) , or m ( multiplet ) . the number of protons ( n ) for a given resonance signal is indicated by nh . coupling constants ( j ) are quoted in hz and are recorded to the nearest 0.1 hz . identical proton coupling constants ( j ) are averaged in each spectrum and reported to the nearest 0.1 hz . the coupling constants are determined by analysis using bruker topspin software . c nmr spectra were recorded on a bruker avii 500 ( 126 mhz ) spectrometer with broadband proton decoupling and internal deuterium lock . the chemical shift data for each signal are given as c in units of parts per million ( ppm ) relative to tetramethylsilane ( tms ) where c(tms ) = 0.00 ppm . f nmr spectra were recorded on a bruker avii 500 ( 470 mhz ) using a broadband proton decoupling pulse sequence and deuterium internal lock . the chemical shift data for each signal are given as f in units of parts per million ( ppm ) . mass spectra were acquired on either a micromass lct premier spectrometer ( low resolution ) or a bruker microtof spectrometer ( high resolution ) , operating in positive or negative mode , from solutions of meoh . m / z values are reported in daltons and followed by their percentage abundance in parentheses . melting points were determined using a leica galen iii hot stage microscope and are uncorrected . compound purity for all tested compounds was determined by elemental analysis , obtained at the elemental analysis service , london metropolitan university , london . elemental analysis was carried out in duplicate ; average values are reported in supporting information . for all tested compounds , experimentally determined hydrogen , carbon , and nitrogen composition was within 0.4% of the expected value , implying a purity of > 95% . to a dry two - necked flask , equipped with a condenser , containing mg turnings ( 66 mg , 2.45 mmol , 3.0 equiv ) and a crystal of iodine was added dry et2o or dry thf ( 20 ml , as stated ) under a nitrogen atmosphere . aryl bromide ( 2.69 mmol , 3.3 equiv ) was then added either neat if a liquid or as a solution in thf ( 269 mm , 10 ml ) . the mixture was heated gently to initiate grignard reagent formation , then heated under reflux until all the mg had reacted . the mixture was then cooled to 0 c and added slowly to a solution of 11 ( 200 mg , 815 mol , 1.0 equiv ) in et2o or thf ( 81.5 mm , 10 ml , as stated ) at 0 c under a nitrogen atmosphere . the solution was warmed to room temperature . on consumption of aldehyde ( as indicated by tlc ) , the reaction was quenched with h2o and hcl ( 1 m aqueous ) . the combined organic layers were washed with h2o and brine , dried ( mgso4 ) , filtered , and concentrated in vacuo . the crude residues were purified by silica gel chromatography ( gradient elution , et2o / petroleum ether ) . to a solution of 11 ( 79 mg , 322 mol , 1.0 equiv ) in dry thf ( 5 ml ) under a nitrogen atmosphere was added phmgbr ( 0.9 m in thf , 716 l , 644 mol , 2.0 equiv ) dropwise at 0 c . the solution was warmed to room temperature over 17 h , then quenched with hcl ( 1 m aqueous , 10 ml ) and extracted with et2o ( 3 10 ml ) . the combined organic layers were washed with h2o ( 2 30 ml ) and brine ( 30 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 10% 60% et2o / petroleum ether ) gave 12 as a colorless oil ( 83 mg , 80% ) . h nmr ( 500 mhz , cdcl3 ) 1.42 ( 3h , t , j = 7.0 hz ) , 2.23 ( 3h , s ) , 2.29 ( 1h , d , j = 3.3 hz ) , 2.37 ( 3h , s ) , 4.04 ( 2h , q , j = 7.0 hz ) , 5.85 ( 1h , d , j = 3.3 hz ) , 6.67 ( 1h , dd , j = 2.2 , 1.6 hz ) , 6.82 ( 1h , s ) , 6.96 ( 1h , dd , j = 2.2 , 1.1 hz ) , 7.29 ( 1h , tt , j = 7.2 , 1.5 hz ) , 7.347.43 ( 4h , m ) ; hrms m / z ( es ) found [ m + na ] 346.1406 ; c20h21nnao3 requires m 346.1414 ; m / z ( es ) 324 ( [ m + h ] , 24 ) , 346 ( [ m + na ] , 33 ) , 669 ( [ 2 m + na ] , 100 ) . following the general procedure , 1-bromo-4-fluorobenzene ( 471 mg , 296 l ) and mg turnings in thf were heated under reflux for 3 h. following addition of the resultant cloudy yellow suspension to 11 in thf , the mixture was stirred for 4.5 h. then the reaction was quenched with h2o ( 15 ml ) and hcl ( 1 m aqueous , 15 ml ) . the phases were separated , and the aqueous layer was extracted with et2o ( 3 30 ml ) . the combined organic layers were washed with h2o ( 90 ml ) and brine ( 90 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 20% 80% et2o / petroleum ether ) gave 13 as a pale yellow viscous gum ( 170 mg , 61% ) . h nmr ( 500 mhz , cdcl3 ) 1.41 ( 3h , t , j = 7.0 hz ) , 2.19 ( 3h , s ) , 2.35 ( 3h , s ) , 2.98 ( 1h , br s ) , 4.03 ( 2h , q , j = 7.0 hz ) , 5.80 ( 1h , s ) , 6.66 ( 1h , dd , j = 2.3 , 1.5 hz ) , 6.79 ( 1h , s ) , 6.92 ( 1h , s ) , 6.987.05 ( 2h , m ) , 7.327.38 ( 2h , m ) ; hrms m / z ( es ) found 364.1318 ; c20h20fnnao3 requires m 364.1319 ; m / z ( es ) 342 ( [ m + h ] , 12 ) , 364 ( [ m + na ] , 19 ) , 396 ( [ m + na + meoh ] , 8) , 705 ( [ 2 m + na ] , 100 ) . following the general procedure , 1-bromo-3-fluorobenzene ( 471 mg , 300 l ) and mg turnings in et2o were heated under reflux for 2 h. following addition of the resultant cloudy yellow suspension to 11 in et2o , the mixture was stirred for 2 h. then the reaction was quenched with h2o ( 10 ml ) and hcl ( 1 m aqueous , 10 ml ) . the phases were separated , and the aqueous layer was extracted with et2o ( 2 20 ml ) . the combined organic layers were washed with h2o ( 60 ml ) and brine ( 60 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 20% 80% et2o / petroleum ether ) gave 14 as a pale yellow viscous gum ( 255 mg , 92% ) . h nmr ( 500 mhz , cdcl3 ) 1.42 ( 3h , t , j = 7.0 hz ) , 2.21 ( 3h , s ) , 2.36 ( 3h , s ) , 2.87 ( 1h , d , j = 3.4 hz ) , 4.03 ( 2h , q , j = 7.0 hz ) , 5.81 ( 1h , d , j = 3.4 hz ) , 6.68 ( 1h , dd , j = 2.1 , 1.3 hz ) , 6.80 ( 1h , dd , j = 1.4 , 1.3 hz ) , 6.92 ( 1h , dd , j = 2.1 , 1.4 hz ) , 6.936.99 ( 1h , m ) , 7.107.14 ( 1h , m ) , 7.147.19 ( 1h , m ) , 7.277.33 ( 1h , m ) ; hrms m / z ( es ) found 364.1312 ; c20h20fnnao3 requires m 364.1319 ; m / z ( es ) 342 ( [ m + h ] , 4 ) , 364 ( [ m + na ] , 14 ) , 396 ( [ m + na + meoh ] , 10 ) , 705 ( [ 2 m + na ] , 100 ) . following the general procedure , 1-bromo-4-chlorobenzene ( 515 mg ) and mg turnings in thf were heated under reflux for 2.5 h. following addition of the resultant cloudy yellow suspension to 11 in thf , the mixture was stirred for 3 h. then the reaction was quenched with h2o ( 10 ml ) and hcl ( 1 m aqueous , 20 ml ) . the phases were separated , and the aqueous layer was extracted with et2o ( 3 40 ml ) . the combined organic layers were washed with h2o ( 120 ml ) and brine ( 120 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 20% 80% et2o / petroleum ether ) gave 15 as a colorless viscous gum that slowly crystallized to a colorless solid under vacuum ( 195 mg , 67% ) . mp 103104 c ; h nmr ( 500 mhz , cdcl3 ) 1.42 ( 3h , t , j = 7.0 hz ) , 2.22 ( 3h , s ) , 2.37 ( 3h , s ) , 2.60 ( 1h , br s ) , 4.03 ( 2h , q , j = 7.0 hz ) , 5.81 ( 1h , s ) , 6.68 ( 1h , s ) , 6.80 ( 1h , s ) , 6.91 ( 1h , s ) , 7.297.37 ( 4h , m ) ; hrms m / z ( es ) found 380.1018 , c20h20clnnao3 requires m 380.1024 ; m / z ( es ) 358 ( [ m + h ] , 7 ) , 380 ( [ m + na ] , 7 ) , 412 ( [ m + na + meoh ] , 9 ) , 737 ( [ 2 m + na ] , 100 ) . following the general procedure , 1-bromo-3-chlorobenzene ( 515 mg , 316 l ) and mg turnings in thf were heated under reflux for 1 h. following addition of the resultant yellow solution to 11 in thf , the mixture was stirred for 2 h. then the reaction was quenched with h2o ( 10 ml ) and hcl ( 1 m aqueous , 10 ml ) . the phases were separated , and the aqueous layer was extracted with et2o ( 3 40 ml ) . the combined organic layers were washed with h2o ( 120 ml ) and brine ( 120 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 20% 80% et2o / petroleum ether ) gave 16 as a colorless viscous gum ( 262 mg , 90% ) . h ( 500 mhz , cdcl3 ) 1.42 ( 3h , t , j = 7.0 hz ) , 2.20 ( 3h , s ) , 2.36 ( 3h , s ) , 2.88 ( 1h , br s ) , 4.04 ( 2h , q , j = 7.0 hz ) , 5.78 ( 1h , s ) , 6.67 ( 1h , s ) , 6.79 ( 1h , s ) , 6.92 ( 1h , s ) , 7.217.29 ( 3h , m ) , 7.40 ( 1h , s ) ; hrms m / z ( es ) found 380.1018 , c20h20clnnao3 requires m 380.1024 ; m / z ( es ) 380 ( [ m + na ] , 4 ) , 737 ( [ 2 m + na ] , 100 ) . to a solution of 10 ( 250 mg , 1.02 mmol , 1.0 equiv ) in dry thf ( 20 ml ) under a nitrogen atmosphere was added phmgbr ( 0.9 m in thf , 3.4 ml , 3.06 mmol , 3.0 equiv ) dropwise at 0 c . the solution was warmed to room temperature over 1 h , then quenched with hcl ( 1 m aqueous , 10 ml ) and concentrated in vacuo to remove thf . the combined organic layers were washed with h2o ( 2 40 ml ) and brine ( 40 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 10% 50% etoac / petroleum ether ) gave 8 as a pale yellow solid ( 273 mg , 91% ) . mp 187188 c ( chcl3 ) ; h nmr ( 500 mhz , acetone - d6 ) 2.21 ( 3h , s ) , 2.38 ( 3h , s ) , 4.95 ( 1h , d , j = 3.1 hz ) , 5.84 ( 1h , d , j = 3.1 hz ) , 6.71 ( 1h , dd , j = 2.3 , 1.6 hz ) , 6.916.94 ( 1h , m ) , 6.96 ( 1h , dd , j = 2.3 , 1.4 hz ) , 7.24 ( 1h , tt , j = 7.3 , 1.3 hz ) , 7.317.36 ( 2h , m ) , 7.467.50 ( 2h , m ) , 8.50 ( 1h , s ) ; hrms m / z ( es ) found 318.1102 , c18h17nnao3 requires m 318.1101 ; m / z ( es ) 294 ( [ m h ] , 48 ) , 330 [ m + cl ] , 14 ) , 408 ( [ m + tfa , solid naoh dissolved in a minimum amount of h2o ( 37 mg , 915 mol , 2.7 equiv ) was added to a stirred suspension of 8 ( 100 mg , 339 mol , 1.0 equiv ) in proh ( 5 ml ) . ac2o ( 93 mg , 86 l , 915 mol , 2.7 equiv ) was added dropwise , and the solution was stirred at room temperature for 1 h. the solution was then concentrated in vacuo to remove proh and diluted with 10 ml of h2o , then extracted with etoac ( 3 10 ml ) . the combined organic layers were washed with h2o ( 30 ml ) and brine ( 30 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 10% 50% etoac / petroleum ether ) gave 9 as a colorless oil ( 104 mg , 90% ) . h nmr ( 500 mhz , cdcl3 ) 2.22 ( 3h , s ) , 2.30 ( 3h , s ) , 2.37 ( 3h , s ) , 2.63 ( 1h , d , j = 2.9 hz ) , 5.86 ( 1h , d , j = 2.9 hz , ) , 6.90 ( 1h , dd , j = 1.7 , 1.5 hz ) , 7.11 ( 1h , dd , j = 1.7 , 1.5 hz ) , 7.15 ( 1h , dd , j = 1.7 , 1.5 hz ) , 7.287.32 ( 1h , m ) , 7.337.42 ( 4h , m ) ; hrms m / z ( es ) found 360.1206 ; c20h19nnao4 requires m 360.1206 ; m / z ( es ) 338 ( [ m + h ] , 35 ) , 360 ( [ m + na ] , 100 ) , 697 ( [ 2 m + na ] , 95 ) . to a solution of alcohol 8 ( 207 mg , 701 mol ) in anhydrous 1,4-dioxane ( 10 ml ) was added activated mno2 ( 305 mg , 3.50 mmol , 5 equiv ) . the mixture was stirred under nitrogen at 80 c for 15 h , after which time further mno2 ( 152 mg , 1.75 mmol , 2.5 equiv ) was added , and stirring was continued at 80 c for 9 h. further mno2 ( 152 mg , 1.75 mmol , 2.5 equiv ) was then added , and stirring was continued at 80 c for 29 h. the mixture was cooled to room temperature and filtered through celite ( eluent ch2cl2 ) , then concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , gradient 20% 50% etoac/4060 c petroleum ether , then further purification of mixed fractions , 20% 35% etoac/4060 c petroleum ether ) gave 17 as a cream solid ( 172 mg , 84% ) . rf = 0.43 ( 50% etoac/4060 c petroleum ether ) ; mp 188190 c ( acetone ) ; h nmr ( 500 mhz , acetone - d6 ) 2.27 ( 3h , s ) , 2.45 ( 3h , s ) , 7.13 ( 1h , dd , j = 2.4 , 1.5 hz ) , 7.20 ( 1h , dd , j = 1.5 , 1.5 hz ) , 7.27 ( 1h , dd , j = 2.4 , 1.5 hz ) , 7.557.62 ( 2h , m ) , 7.667.71 ( 1h , m ) , 7.827.88 ( 2h , m ) ; hrms m / z ( es ) found 316.0938 ; c18h15nnao3 requires m 316.0944 ; m / z ( es ) 292 ( [ m h ] , 100 ) , 328 ( [ m + cl ] , 13 ) . to a solution of 18 ( 80 mg , 346 mol , 1.0 equiv ) in dry thf ( 5 ml ) under a nitrogen atmosphere was added phmgbr ( 0.9 m in thf , 769 l , 692 mol , 2.0 equiv ) dropwise at 0 c . the solution was stirred for 1 h , then quenched with hcl ( 1 m aqueous , 5 ml ) and concentrated in vacuo to remove thf . the combined organic layers were washed with h2o ( 20 ml ) and brine ( 20 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 30% 80% et2o petroleum ether ) gave 21 as a colorless oil ( 66 mg , 76% ) . h nmr ( 500 mhz , cdcl3 ) 2.21 ( 3h , s ) , 2.36 ( 3h , s ) , 2.68 ( 1h , s ) , 3.82 ( 3h , s ) , 5.84 ( 1h , s ) , 6.68 ( 1h , dd , j = 2.3 , 1.3 hz ) , 6.83 ( 1h , dd , j = 1.3 , 1.3 hz ) , 6.98 ( 1h , dd , j = 2.3 , 1.3 hz ) , 7.267.31 ( 1h , m ) , 7.337.38 ( 2h , m ) , 7.387.42 ( 2h , m ) ; hrms m / z ( es ) found [ m + na ] 332.1257 ; c19h19nnao3 requires m 332.1257 ; m / z ( es ) 332 ( [ m + na ] , 12 ) , 364 ( [ m + na + meoh ] , 6 ) , 641 ( [ 2 m + na ] , 100 ) . to a solution of 19 ( 150 mg , 545 mol , 1.0 equiv ) in anhydrous thf ( 10 ml ) under a nitrogen atmosphere was added phmgbr ( 0.9 m in thf , 1.2 ml , 1.08 mmol , 2.0 equiv ) dropwise at 0 c . the solution was warmed to room temperature and stirred for 90 min , then quenched with hcl ( 1 m aqueous , 5 ml ) and concentrated in vacuo to remove thf . the combined organic layers were washed with h2o ( 15 ml ) and brine ( 15 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . purification by silica gel column chromatography ( gradient elution , 6% 60% etoac / petroleum ether ) gave 22 as a colorless oil that crystallized slowly under vacuum to give a colorless solid ( 159 mg , 83% ) . mp 7073 c ; h nmr ( 500 mhz , cdcl3 ) 2.20 ( 3h , s ) , 2.35 ( 3h , s ) , 2.74 ( 1h , d , j = 3.2 hz ) , 3.44 ( 3h , s ) , 3.74 ( 2h , t , j = 4.6 hz ) , 4.11 ( 2h , t , j = 4.6 hz ) , 5.82 ( 1h , d , j = 3.2 hz ) , 6.71 ( 1h , dd , j = 1.9 , 1.5 hz ) , 6.83 ( 1h , dd , j = 1.6 , 1.5 hz ) , 6.98 ( 1h , dd , j = 1.9 , 1.6 hz ) , 7.257.30 ( 1h , m ) , 7.317.40 ( 4h , m ) ; hrms m / z ( es ) found [ m + na ] 376.1515 ; c21h23nnao4 requires m 376.1519 ; m / z ( es ) 376 ( [ m + na ] , 23 ) , 729 ( [ 2 m + na ] , 100 ) . to a solution of 20 ( 125 mg , 478 mol , 1.0 equiv ) in anhydrous thf ( 8 ml ) under a nitrogen atmosphere was added phmgbr ( 0.9 m in thf , 1.6 ml , 1.44 mmol , 3.0 equiv ) dropwise at 0 c . the solution was warmed to room temperature and stirred for 3 h , then quenched with aqueous hcl ( 1 m , 10 ml ) and concentrated in vacuo to remove thf . the combined organic layers were washed with h2o ( 20 ml ) and brine ( 20 ml ) , dried ( mgso4 ) , filtered , and concentrated in vacuo . the residues were purified by silica gel column chromatography ( gradient elution , 40% 80% etoac / petroleum ether ) to give a colorless gum that crystallized slowly under vacuum to give a colorless solid . repeated recrystallization from boiling chcl3/cyclohexane ( 1:1 ) gave 23 as a colorless solid ( 100 mg , 62% ) . mp 133134 c ( 1:1 chcl3/cyclohexane ) ; h nmr ( 500 mhz , dmso - d6 ) 2.20 ( 3h , s ) , 2.38 ( 3h , s ) , 3.71 ( 2h , dt , j = 5.5 , 5.0 hz ) , 4.00 ( 2h , t , j = 5.0 hz ) , 4.86 ( 1h , t , j = 5.5 hz ) , 5.73 ( 1h , d , j = 3.9 hz ) , 5.96 ( 1h , d , j = 3.9 hz ) , 6.76 ( 1h , dd , j = 2.2 , 1.4 hz ) , 6.936.96 ( 1h , m ) , 6.966.98 ( 1h , m ) , 7.21 ( 1h , t , j = 7.5 hz ) , 7.31 ( 2h , dd , j = 7.5 , 7.5 hz ) , 7.43 ( 2h , d , j = 7.5 , hz ) ; hrms m / z ( es ) found [ m + na ] 362.1353 ; c20h21nnao4 requires m 362.1363 ; m / z ( es ) 362 ( [ m + na ] , 7 ) , 701 ( [ 2 m + na ] , 100 ) the receptor was initially prepared by adding polar hydrogen atoms at ph 7.4 using protonate3d in moe . gasteiger charges were then assigned using autodock s graphical user interface autodocktools ( adt , version 1.5.4 ) . following the addition of gasteiger charges , adt was implemented to build a united atom model of the receptor by merging nonpolar hydrogen atoms and adding their partial charges to their parent carbon atoms . the ligands were prepared by adding polar hydrogens atoms at ph 7.4 using protonate3d in molecular operating environment ( moe ) , version 2011.10 . moe then assigned gasteiger charges before performing an energy minimization using an mmff94x force field with a 0.05 gradient . autodock s graphical user interface autodocktools ( adt , version 1.5.4 ) was subsequently used to build a united atom model of the ligands by merging nonpolar hydrogens and adding their partial charges to their parent carbon atoms . individual docking with autodock vina ( version 1.1.2 ) . the search space was defined as a cubic box with dimensions 18 18 18 and center x = 30.048 , y = 16.281 , z = 1.723 . the exhaustiveness and number of modes were both set to 20 , and all other parameters were kept at their default values . h4ac4 peptide ( brd4 assay , h2n - sgrgk(ac)ggk(ac)glgk(ac)ggak(ac)rhrk(biotin)-cooh ) and h3k56ac peptide ( crebbp assay , h2n - alreirryqk(ac)stellirklk(biotin)-cooh ) were synthesized by tufts university core facility . viability of mv4;11 , h549 , and h1975 cells was monitored by mts - based celltiter 96 aqueous nonradioactive cell proliferation assay ( promega , madison , wi ) . viability of u2os and hela cells was monitored by wst - based cell proliferation kit ( roche , mannheim , germany ) .

prostatic cancer ( pca ) is the most frequent neoplasia in men and second cause of cancer death in males . the incidence of prostatic cancer has increased over 50% and death from the disease by 40% . the trus- guided systematic prostate biopsy is the gold standard for diagnosis of prostate cancer . although , a trus - guided biopsy protocol regarding the number of biopsy cores as not yet been established . the number of biopsy cores taken per biopsy varies from 4 - 30 . the number of biopsies are been increasing , the exact value of these additional biopsies is still unknown . hyperechoic lesions are usually considered as benign like benign prostate hyperplasia , prostatitis or infarction . on trus , prostatic cancer is visualized as a hypoechoic lesion in 60% to 70% and as an isoechoic lesion in 30% to 40% of cases , hyperechoic lesion are rare with an incidence of 1.5% . the aim of this study was to estimate incidence of trus - hyperechoic , hypoechoic and isoechoic prostate cancer in trus guided specimens . this prospective study included a series of 493 patients having lower urinary tract symptoms ( luts ) with abnormal digital rectal examination and prostatic - specific antigen ( psa ) level less than 27 ng / ml with mean age ( 58.5 ) years . prior to ( transrectal ultrasound guided prostatic biopsy ) trus - guided biopsy , a 3 days course of an oral fluoroquinolone was given , patient was instructed to give self administered cleansing enema ( sodium - phosphate , dibasic sodium ) prior to biopsy . patients who where on aspirin or nasids were discontinued for 7 days and 3 days , respectively . each patient underwent trus ( transrectal ultrasonography ) and biopsy was taken from suspected lesions found on trus and were classified as hypo or hyperechoic , or isoechoic , and mix lesion considered as hypoechoic . we used a siemens si-400 ultrasound device with biplane transrectal probe , siemens 5.0/7.5 mhz type 5727 le . biopsy was performed by using a spring - loaded biopsy gun and an 18-g biopsy needle ( cr bard , covington , ga , usa ) the patients were positioned in either the right or left lateral decubitus position for procedure without anesthesia . trus was performed in a detailed , fasion biopsy cores were taken laterally from base , mid and apex of the prostate on the right side ( cores 1 to 3 ) respectively and then left side 4 to 6 , respectively . cores from these areas were inked on the distal margins and submitted to pathology , in accordingly marked separate containers providing correct correlation between trus and pathological findings . patients with positive cores obtained from hypo or hyperechoic trus lesions were included in the hypo or hyperechoic groups , the biopsy specimens were histopathologically analyzed and cancer graded according to the gleason score system . the results were analyzed statistically using chi - square test and student 's t - test with p < 0.05 level of significance . biopsy was performed by using a spring - loaded biopsy gun and an 18-g biopsy needle ( cr bard , covington , ga , usa ) the patients were positioned in either the right or left lateral decubitus position for procedure without anesthesia . a topical anesthetic ointment was applied to the anal canal . trus was performed in a detailed , fasion biopsy cores were taken laterally from base , mid and apex of the prostate on the right side ( cores 1 to 3 ) respectively and then left side 4 to 6 , respectively . cores from these areas were inked on the distal margins and submitted to pathology , in accordingly marked separate containers providing correct correlation between trus and pathological findings . patients with positive cores obtained from hypo or hyperechoic trus lesions were included in the hypo or hyperechoic groups , the biopsy specimens were histopathologically analyzed and cancer graded according to the gleason score system . the results were analyzed statistically using chi - square test and student 's t - test with p < 0.05 level of significance . in our study , patients who had serum psa < 4.0 three patients ( 0.6 ) had hyperechoic lesion and 20 ( 4.0 ) patients had hypoechoic lesions . the patients who had serum psa between 5 - 10 among them 15 ( 3.04 ) patients had hyperechoic and 44 ( 8.92 ) patients had hypoechoic lesions . the patients who had serum psa between 10 - 20 , 20 ( 4.05 ) patients had hyperechoic lesion and 63 ( 12.77 ) patients had hypoechoic lesion . the patients who had serum psa between 20 - 27 and more 27 ( 5.47 ) patients had hyperechoic and 84 ( 17.0 ) patients had hypoechoic lesions . out of 493 patients who were enrolled in the study , 65 ( 13.18 ) patients showed hyperechoic lesions on trus and 211 ( 42.79 ) patients had hypoechoic lesions on trus [ table 1 ] . results of prostatic specific antigen and transrectal ultrasonography findings in patients in our study , 70 ( 14.1 ) patients had isoechoic lesions on trus , which were positive on histopathology as prostatic carcinoma with gleason score of 4 - 9 . 25 ( 5.07 ) . sixty five ( 13.18 ) patients had hyperechoic lesions on trus among them 25 ( 5.07 ) patients were positive for prostatic carcinoma with gleason score of 6 - 9 , and 211 ( 42.79 ) patients had hypoechoic lesions on trus among them , 205 ( 41.5 ) patients had prostatic carcinoma on histopathology with gleason score of 5 - 9 [ table 2 ] . it is still believed that trus - guided biopsy is the only accurate pre - operative method for early diagnosis of prostatic carcinoma . the average number biopsies taken has been increasing but sextant biopsies are still used . in our study , hypoechoic lesions were found in 211 ( 42.79 ) patients among them 205 ( 41.5 ) patients had prostatic carcinoma and 65 ( 13.18 ) patients had hyperechoic lesions on trus among them , 25 ( 5.07 ) patients had prostatic carcinoma , 217 ( 44.0 ) patients had normal trus among them , 70 ( 40.1 ) patients proved to be positive on histopathology in our study , the number of prostatic carcinoma diagnosed were higher as compared with the study conducted by vo et al . a review of literature shows very rare findings of prostatic cancer originating in hyperechoic lesions the reported incidence is 1% to 5% . has done teus before radical prostatectomy in 157 patients with prostate cancer and hyperechoic cancers were present only in two patients ( 1.3% ) . malik , et al . had done biopsies in 100 patients suspected prostatic cancer and diagnosed 23 carcinomas none which was hyperechoic , our findings 65 ( 13.18 ) patients had hyperechoic lesions on trus and among them , 25 ( 5.07 ) indicated a higher rate of hyperechoic cancers then that reported in the literature . our study suggest that we should take additional biopsy of hyperechoic lesions and it should be part of the standard protocol in patients suspected cancer prostate .

there is a broad spectrum in the differential diagnosis of serous retinal detachment ( srd ) , particularly when it is bilateral and a history of ocular trauma is lacking . serous retinal detachment is common in chronic central serous chorioretinopathy ( cscr ) , posterior scleritis , rhegmatogenous retinal detachment with uveal detachment , multifocal choroiditis , uveal melanoma , metastatic tumor , severe hypertensive choroidopathy , vogt koyanagi behet disease is chronic - relapsing with multisystemic inflammatory disorders that are characterized by obliterative vasculitis.the major diagnostic criteria were the acute onset of diffuse uveitis in both eyes involving exudative retinal detachment , iridocyclitis , and/or papillary edema and the irritative signs of meningitis . the early ocular change of the disease was confirmed by fluoroscein angiography . anterior uveitis and occlusive retinal vasculitis with or without retinitis are characteristic of behet disease . very rare cases indicate signs of bilateral srd , such as anemic retinopathy secondary to gall bladder cancer , carotid cavernous fistulas , dilated cardiomyopathy , multiple sclerosis , and waldenstrm macroglobulinemia.[610 ] a healthy 27-year - old smoker man complaining about prodrome clinical findings , such as severe headache , tinnitus , nausea , and nuchal rigidity for the previous 1 month . he consulted a neurologist ; a diagnosis of migranious attack was made and medicine was prescribed accordingly without any relief . he subsequently developed ophthalmic symptom , including red eyes , photophobia , and visual blurring . he was not on any systemic medications and had no surgeries in the past . at presentation eyes were red , best corrected visual acuities were 20/100 and 20/200 od and os , respectively . there was nongranulomatous uveitis and anterior segment examination revealed 2 + of anterior chamber reaction without any other abnormal findings in anterior segmen . funduscopic examination showed bilateral 2 + vitritis accompanying with posterior pole and peripheral srds [ figure 1 ] . the fluorescein angiography showed leakage on papilla more prominent in the right eye and uniform hyperautofluorescence in the retina mixed with hypoautofluorescence in the areas of srd contributed to the diagnosis of vkh [ figures2 and 3].the patient had 3 weeks history of severe headache that did not improve in spite of prescription of propranolol , sumatriptin , valproat sodium , and dexamethason by neurologist . laboratory evaluations , including complit blood count , blood chemistries , syphilis serology , antinuclear antibody , angiotensin converting enzym , and purified protein drivative were negative . he was thought to have presumed vkh in the acute stage with classic intraocular findings thereafter . after ruling out infectious causes that could account for the clinical presentation , the patient was started on 60 mg of prednisone and topical prednisolone 4 times a day . the day after beginning the medicine , his headache was not relieved but his vision was improved ; 250 mg oral acetazolamide was also added to medicine once every 6 h. the day after taking acetazolamide the headache relieved and 2 weeks after medical treatment , visual acuities were 20/20 in the both eyes , anterior chamber was quiet and serous detachments were resolved.the steroid was slowly tapered after resolution of the ocular inflammation but 5 mg of prednisolon was continued for 16 months of follow - up without the appearance of any integumentary findings . serous retinal detachment right and left eye the 7th weeks of diseases , both eyes show reduced subretinal accumulation of fluorescein with certain multifocal hyperfluorescent dots ( white arrow ) . fluorescein angiogram on 7th week of diseases showing reduced of bilateral optic disc and retinal detachment and uniform hyperautofluorescence in the macula mixed with hypoautofluorescence in the areas of serous retinal detachment based on the ophthalmic and systemic manifestations , we present a case of bilateral srd as a presenting sign of vogt koyanagi harada 's disease in a hlab5-positive man . various investigators have used the criteria proposed by sugiura , the american uveitis society as well as the revised diagnostic criteria proposed by the first vkh international workshop group . these 3 sets of criteria share several clinical features that are considered to be essential for establishing the diagnosis of vkh . this disease can be associated with panuveitis as an ocular sign , and can be accompanied by meningismus , auditory findings without integumentary problems . there are genetic factors implicated as one of the pathogenetic signs of vkh and behet diseases . as described by horie et al , certain patients have risk alleles , such as human leukocyte antigen ( hla)-b51 and dr4 , but others do not . they report a sister case sharing the same hla haplotypes but , while the elder sister became ill with behet disease the younger was affected with vkh disease . the present case also showed the positive hlab5 in vkh disease supporting the risk alleles , such as human leukocyte antigen , in certain diseases . hashida et al reported a case of vkh subsequently to recurrent of malignant lymphoma , they suggested an association between soluble interleukin-2 receptor levels and disease activity in vkh and malignant lymphoma , which provides additional evidence providing that vkh can be induced by immune disorders caused by high sil-2r levels in ml . vrabechas reported the importance of differential diagnosis between behet exudative retinal detachment and other posterior uveitis . he has concluded to consider vkh diseases well , especially if it is recurrent or associated with hemorrhagic retinal vasculitis . he suggested that ocular inflammation often is not the presenting manifestation of behet disease and the human leukocyte antigen testing may support the diagnosis . this report provides some insight into the pathogenesis of vkh disease , however the lack of echography findings , optical coherent tomography , and cerebrospinal fluid evaluation are limitations of this report . a study about immunity by yah et al also explains the role of clinical course in the patient and fine balance between tumor - specific immunity and loss of self - tolerance . they define the ocular and systemic autoimmune sequels resembling vkh , which may develop after successful melanoma immunotherapy . this case had an interesting clinical presentation in a hlab5-positive patient without appearing any integumentary findings , but responded well to a combination of oral steroid and acetazolamide against intractable headache . during 16 months of follow - up

uterine lipoleiomyoma is a rare benign tumor with an estimated incidence of 0.03% to 0.2% . a 48 year - old , gravida 1 para 1 , had a slowly - growing cervical mass . on ultrasound , the mass was around 5 cm in diameter and had fibroid tissue consistency with components of fat consistency ( figure 1 ( fig . the tumor appeared encapsulated and measured 6.25.2 cm with some areas of what looked like necrosis suggestive of a degenerating fibroid . the uterus was hypertrophic , sounding to 10 cm , and curettage showed no malignancy . after consultation with the patient , we decided to proceed with total laparoscopic hysterectomy and bilateral salpingo - oophorectomy . operative findings included a large cervical fibroid that appeared somewhat fleshy and soft in texture ( figure 2 ( fig . , the adhesions of the sigmoid colon to the left pelvic sidewall were taken down . the infundibulopelvic ligaments , after visualizing the ureters to be separate from them , were bilaterally coagulated and transected . the broad ligament anterior peritoneum was undermined and transected from round ligament to round ligament . the broad ligament posterior peritoneum was undermined and transected to the level of the uterosacral ligament on each side allowing the ureters to retract laterally away from the uterus , increasing the safety of the procedure . with some trouble , the vessels on the left side were then coagulated with bipolar cautery and transected with harmonic scalpel . on the right side , again with difficulty the uterine vessels were skeletonized then coagulated and transected the same way as before . the cardinal ligament on this side was transected the same way . a sponge stick was placed in the anterior vagina and transverse incision was made over it and around the vagina separating it from the cervix . with the help of a tenaculum , the uterus with the cervical mass and adnexa were all removed and passed off . the operation was completed in 68 minutes and blood loss was approximately 150 cc . on opening of the resected tumor , no necrotic areas were noted . pathological report showed a 258 gram uterus with a lipoleiomyoma that originated in the parametrial soft tissue along the endocervical canal near the lower uterine segment . incidentally , a 2.1 cm adult granulosa cell tumor was found within the parenchyma of the right ovary . so , on ultrasound , a lipoleiomyoma can closely resemble a well - differentiated liposarcoma requiring more definitive imaging ( ct or mri ) , biopsy , or both to confirm its benign nature , , . 2001 who described a woman of the same age with a 5-cm well - circumscribed complex mass that arose from the lower uterine segment and was markedly echogenic on sonography . our case describes a combination of cervical lipomeiomyoma and ovarian adult granulosa cell tumor which has not been reported before . moreover , our case demonstrates the feasibility of total laparoscopic extirpation of a uterus with a large cervical lipomeiomyoma attached to it if the surgeon has the experience and the will to do it .

achalasia is a greek word that means does not relax and is the most recognized motor disorder of the esophagus . diagnosis of achalasia is made by clinical features plus radiographic , endoscopic and manometric findings . to date , several studies have reviewed demographic and clinical features of achalasia patients but none had large sample sizes . the etiologies of idiopathic achalasia are still unclear but measles , genetic influences , varicella zoster virus , disorders of the immune system and autoimmunity might be probable causes . achalasia may occur at any age but it mostly presents between third and sixth decades of life . it seems the most recognized pathologic feature of this disease is reduction of non - adrenergic , non - cholinergic inhibitory ganglion cells . as our center ( digestive disease research center , shariati hospital , tehran university of medical sciences ) is a referral center in iran , particularly for achalasia , we decided to gather and publish demographic , clinical features and treatment outcomes of our patients from 1994- 2009 . in this study , 700 patients with achalasia who were referred to our center between 1994 - 2009 were evaluated with regards to their demographic , clinical features and treatment outcomes . patients symptoms were scored according to iranian scoring for achalasia ( table 1 ) . a questionnaire was completed for each patient and included name , age , gender , phone , presenting symptoms , duration of symptoms , frequency of all symptoms , family history , medical history , symptoms scores , aggravating and alleviating factors , treatment obtained and follow up . patients were followed for a mean period of 23.3 months ( sd28.4 ) and responses to treatment were evaluated according to the vantrapen scoring system ( table 2 ) . * excellent and good were considered as responders to treatment . patients demographic , clinical features and response to treatment were analyzed by spss software ( version 16 , chicago , il , usa ) chi - square and independent t - test . in this study , men ( n=380 , 54.3% ) were affected more than women ( n=320 , 45.7% ) , respectively . the mean age of our patients was 38 years . initial symptoms in the patients were as follows : dysphagia to solids ( 79.7% ) , dysphagia to liquids ( 54.4% ) , active regurgitation ( 22.9% ) , passive regurgitation ( 20.9% ) and chest pain ( 11.9%)(figure 1 ) . initial achalasia symptoms the mean duration of symptoms before diagnosis was 4.9 years , with a range of 1- 15 years . the frequency of symptoms amongst patients was : dysphagia to solids ( 97.3% ) , dysphagia to liquids ( 87% ) , active regurgitation ( 68% ) , passive regurgitation ( 67.7% ) , weight loss ( 64.3% ) , chest pain ( 52.9% ) , nocturnal cough ( 44.4% ) and nocturnal dyspnea ( 18.3% ) ( figure 2 ) . frequency of achalasia symptoms aggravating and alleviating factors of dysphagia are listed tables 3 and 4 , respectively . other less frequent symptoms were globus sensation in ten patients ( 1.4% ) , hiccups ( two patients , 0.28% ) and heartburn ( two patients , 0.28% ) . mean weight loss was 3.9 kg ( range : 0 - 30 kg ; sd5.6 ) with a weight loss of 10 kg or more during six months seen in 52 patients ( 7.4% ) . in our study , chest pain was the only symptom significantly higher among women ( 59.7% vs. 47.1% , p=0.04 ) . also , patients older than 56 years complained of chest pain less often than those younger ( p=0.05 ) . in our study interestingly , there was one case ( female ) with achalasia in her mother and son , one case ( male ) with achalasia in all his siblings and one case ( male ) with achalasia in his mother and his brother . in our study there were six cases ( 0.85% ) of triple a syndrome ( achalasia , alacrimia and adrenal insufficiency ) , three of whom were males . additionally , there were three cases ( two females and one male , 0.42% ) of double a syndrome ( achalasia and alacrimia ) with mean age of 16 years . other accompanying diseases according to passive data collection and symptom - based evaluation include the following : hypothyroidism ( seven females and three males ) , hyperthyroidism ( one female ) , panhypopituitarism ( one male ) , intestinal pseudo - obstruction ( one male and one female ) , hodgkins lymphoma ( one male ) , down syndrome ( one male ) and sle ( one female ) ( table 5 ) . patients , scored according to table 1 , had a mean total symptom score prior to treatment of 8.8 ( sd3 ) . sle * = systemic lupus erythematosus of the 700 patients , 670 cases were treated by pneumatic dilation ( pd ) and the remaining 30 were treated with botulinum toxin ( bt ) according to the following criteria including : presence of sigmoid esophagus , presence of epiphrenic diverticula , patient s preference and older patients with cardiopulmonary disorders who were at high risk for emergency surgery in case of perforation . of 670 patients who were treated with pd , 188 ( 20.9% ) received pd twice , 34 ( 3.8% ) for three times , 8 ( 0.8% ) for four times and one patient received five treatments . a balloon size of 30 mm was used in 578 ( 71.6% ) patients , sizes 30 and 35 mm in 199 ( 24.7% ) and sizes 35 & 40 mm in 3.7% of patients . out of 670 patients treated with pd , a total of 258 patients were lost to follow up due to various reasons such as changes in address or phone numbers . the mean period of follow up was 23.3 months ( sd28.4 ) with a minimum of 6 months and a maximum of 156 months . two of these healed spontaneously , but one required surgery . after initiation of therapy with graded pd ( use of no . 3 balloons for all patients initially , and then gradually increasing the balloon size , if needed ) , no other cases of perforation were noted . according to the vantrapen scoring system , our patients were classified into four groups : excellent ( 32% ) , good ( 35% ) , moderate ( 24% ) and poor ( 9% ) . patients who were placed in the excellent and good groups were considered as responders to treatment ( 67% ) . the responders underwent pd once in 37% of patients , twice times in 56% and three times in 7% of the patients . according to the iranian scoring for achalasia , the mean total symptom scores before and after treatment were 8.8 ( sd3 ) and 5.1(sd3.8 ) , respectively . additionally , in our study , females responded better to pd than males ( 69% vs. 31% ) . using the chi - square test , there was a significant relation between gender and response to pd ( p<0.04 ) . although chest pain decreased significantly after treatment in both groups ( p<0.001 ) , it was still higher among women ( 34% vs. 21.9% , p=0.04 ) . the mean pretreatment total symptom score was 8.55 in responders and 9 in nonresponders . these familial cases exist among fathers , mothers , siblings , ancestors and even children . in our study there were six cases ( 0.85% ) of triple a syndrome ( achalasia , alacrimia and adrenal insufficiency ) , three of whom were males . the major clinical and demographic features of achalasia in iran are similar to reports from other parts of the world . in contrast to some reports , in our study achalasia was more common among men and chest pain was reported more frequently by women ( 59.7% vs. 47.1% , p=0.04 ) . in other studies , chest pain has been reported to be more common among younger patients . however , with advancing age the frequency of chest pain diminishes in most patients . additionally , the presence of familial cases and accompanying disorders are interesting and subject to additional investigation . in comparison to other articles , the numbers of studied cases in our center was significantly higher than previously reported , thus it would be valuable to compare our results with others . we have also reported on accompanying diseases such as thyroid dysfunction , downs syndrome , and triple a syndrome , to name a few . there have been some studies and case reports that have also reported on concomitant diseaseswhich is also a subject for additional investigation . dysphagia to solids and liquids were the most common symptoms in our patients ( 97.3% and 87% , respectively ) . dysphagia has been the most common complaint of patients in other studies worldwide , but the prevalence of chest pain in other studies was not the same . in contrast to our study and other reports , achalasia has been more common in females in a study by degli . as mentioned above , a large portion of our patients were treated by pd , and as measured by the vantrapen scoring system , nearly 67% of treated patients were excellent and good responders to pd ( 32% excellent , 35% good ) . in a similar study of 227 patients , 51.8 % and 21.6% of patients had excellent and good therapeutic outcomes after pd , respectively . another recent study reported excellent ( 19% ) , very good ( 26% ) and good ( 35% ) responses to pd in patients , respectively , for long term outcomes of pd in the treatment of achalasia . in a turkish study on 111 patients , therapeutic outcomes were excellent in 48% ( 54 patients ) , and good in 34% ( 38 patients ) . in all of the represented studies , excellent and good responses to pd it seems pd is a good treatment option , particularly in patients unwilling to undergo surgery . also , our group found that the injection of bt before pd did not significantly enhance the efficacy of pd . in a recently published report it has been stated that even though open myotomy and pd are both associated with symptom improvement , when considering other factors such as shorter hospitalization , time off from work , the risks of general anesthesia , probability of clinical relapse and cosmetic sequels into consideration , it seems that pd is preferable for the majority of patients . in this report it has been suggested that the choice between pd and myotomy as initial therapy for achalasia should be based on the patient s preferences and on the experience of the personnel available . in two other studies , it has been concluded that even though laparoscopic myotomy with fundoplication is the most effective treatment for achalasia , the initial cost of myotomy is usually higher and the recovery period , particularly following open myotomy , is generally longer . thus when myotomy is not possible for any reason , e.g. , medical contraindication , patient unwillingness , inability to afford surgery , or experienced centers for surgery or post - operative care are not easily accessible , therefore graded pd ( using 3.0 cm balloons initially ) with a slow rate of balloon inflation seems to be an effective and safe initial alternative . factors such as gender and pretreatment symptom score may also affect the response rate to pd . thus , according to this study , pd is an effective long - term therapy for achalasia .

vertical transmission of human immunodeficiency virus ( hiv ) is still a major challenge in the world , especially in the developing countries ( usaid ) . it is estimated that 90% of hiv infections in children result from mother - to - child - transmission ( who ( switzerland ) ) . in the absence of any intervention to prevent mtct ( pmtct ) , the mtct rate varies between 13% and 48% [ 3 , 4 ] . maternal combination antiretroviral therapy ( art ) together with postnatal interventions has demonstrated its efficacy in substantially reducing the risk of mtct in african breastfed children to less than 5% ( usaid 2013 ) [ 3 , 5 ] . however , access to art and the uptake of pmtct programs remain limited and children continue to be hiv infected ( abidjan , cote d'ivoire ) . the world health organisation ( who ) guidelines recommend that all pregnant women should be tested for hiv in the first trimester and that a second test be considered in the third trimester by 34 weeks of gestational age [ 1 , 68 ] . guidelines in resource - limited settings are increasingly recommending hiv testing as early as possible during pregnancy and repeat testing towards the end of pregnancy or during labour , a strategy that has proven to be cost effective . despite these recommendations , recent studies report hiv incidence rates of 10.8% in serodiscordant couples in kenya whenever a pregnancy occurred . more recently , a meta - analysis published in 2014 reports an aggregate seroconversion rate of 3.8 per 100 person - years in african countries by drake et al . in washington usa . hiv testing during labour has remained a challenge over the years in cameroon . in 2009 , of the 94,406 women with a previous negative result who presented in the labour rooms of the clinics carrying out pmtct activities , only 2,643 were retested , giving a proportion of 2.8% . in cameroon , the prevalence of hiv was estimated to be 4.3% in the general population ; a serosurveillance survey among pregnant women showed an hiv prevalence of 7.6% in 2010 . as a result , the number of new pediatric infections continues to grow in cameroon and there are still thousands of new infections each year . in 2011 , the unaids launched the global plan towards eliminating new hiv infections among children and keeping their mothers alive , making cameroon , where overall mtct risk was reported to be around 24% , one of the 21 priority countries . since 2011 , cameroon has tripled its coverage of pmtct prophylaxis , ranging from 6.9% to 36.5% in 2011 , leading to 30% fewer new hiv infections among children . in 2011 , continuing access of pregnant women living with hiv to prenatal hiv services and increasing access to hiv treatment for eligible children and pregnant women will reduce maternal and child mortality . cameroon has focused on strengthening pmtct services and caring of pediatric hiv cases for the 20112015 period ; 99.4% of health districts were equipped to provide hiv treatment services for pregnant women and children living with hiv in 2011 . however , even where the most effective pmtct interventions are available , many women and infants are lost at different steps of the pmtct cascade ; and the low cumulative uptake of pmtct services does not allow controlling the extent of mtct in cameroon . the hiv seroprevalence in the swr is 11.9% . this is one of the highest in cameroon , closely followed by the east region with 9.3% . there is a high rate of mtct of hiv with seroconversion in pregnancy [ 10 , 18 ] . in cameroon , particularly in the south west region , there are no reports regarding the incidence of hiv seroconversion during pregnancy . there is a probability that many cases that seroconvert in pregnancy go without appropriate management , resulting in high mtct as reported by muffih in 2011 . data on the seroconversion rate after initial negative hiv test result in pregnancy would be useful in improving the management of hiv in pregnancy in fako division , swr , cameroon . the aim of this study was to determine the incidence of hiv seroconversion during the second and third trimesters of pregnancy and ad hoc potential cofactors associated with hiv seroconversion after having an hiv - negative test result in the booking visit . we also studied knowledge of pmtct among pregnant women in seven health facilities in fako division , south west region ( swr ) , cameroon . this was a hospital based cohort study of women attending antenatal care ( anc ) clinics and labour rooms of the maternity units of seven healthcare facilities in the fako division , south west region , cameroon , during the period between september 12 and december 4 , 2011 . study participants were women who attended their booking or first antenatal care visit in any of the seven selected health facilities in the last six months and for whom an hiv test was done using the determine test strips on this booking ( first ) anc visit between 16 and 20 weeks of gestation . hiv seroconversion in pregnancy ( hsp ) was defined as maternal self - report of an hiv - negative test during the first antenatal care visit during this pregnancy , no documented use of antiretroviral drugs , and a positive hiv rapid test ( determine ) done 3 months after the first antenatal care ( booking ) test . the gestational age of the pregnancy was calculated from the last normal menstrual period ( lnmp ) . all the women who were found to be hiv - negative at this first visit consented ( written consent after study procedure and objectives had been explained to them ) to participate in the study ( table 1 ) . all study participants were counselled to repeat the hiv test within an interval of 3 to 6 months following the test of the booking anc visit . all participants were those residing within a 10 km radius from health facility for easy follow - up . the main outcome of interest was hiv seroconversion at second test during the ongoing pregnancy . sample size was calculated by using the who - steps approach with the assumptions of 95% confidence limits , 5% proportion of seroconverting women , and 2% margin of error . the minimum sample size was calculated to be 457 participants , but considering a nonresponse rate of 4% , we enrolled 477 participants for study . a total of seven health facilities were selected by simple random sampling ( balloting ) for study . participants who met the inclusion criteria were then selected by cluster sampling ; and in each cluster , participants were included individually and consecutively to maximize confidentiality . data collection was done during a period of 12 weeks , from september 12 to december 4 , 2011 . during this period , the study participants were met at their various antenatal clinic sites on specific days of the week when these activities were carried out . a total of 4 weeks were spent per health facility with at least two facilities targeted at once depending on their anc days ( table 2 ) . sociodemographic information ( maternal age , gravidity , marital status and marital type , employment status , level of education , and residence ) , knowledge of pmtct , and methods , if any , of hiv prevention were obtained from the study population . furthermore , voluntary counselling and testing ( vct ) for hiv was done on each study participant , whereby pretest counselling was done followed by the collections of 2 - 3 ml of venous blood by venipuncture into a dry vacutainer tube which was then allowed to settle for about 20 minutes to obtain serum from whole blood . the supernatant serum from the dry tube was then tested using determine hiv-1/2 rapid test ( abbott laboratories , abbott park , illinois , usa ) in the laboratory of the health facilities by trained laboratory personnel , experienced in hiv testing , according to manufacturer 's test procedure . the same brand of test kits was used across all the health facilities that participated in the study . following testing , a posttest counselling was done and results were delivered about one hour after testing . for participants who were positive for determine hiv 1/2 rapid test , a second - line test , sd bioline hiv 1/2 3.0 ( standard diagnostics , inc . ) , was done according to manufacturer 's instructions to differentiate between hiv-1 and hiv-2 . a participant was only considered positive if both tests were positive , negative if determine was negative , and indeterminate if determine was positive and then bioline test was negative [ 2022 ] . all the participants who were diagnosed hiv - positive were treated according to cameroon 's national guidelines for the pmtct , which at the time recommended option b involving either azt + 3tc + nvp or d4 t + 3tc + nvp . numerical variables like age , parity , and gestational age were classified into groups and their frequencies expressed in percentage were presented ; meanwhile , categorical variables like marital status , educational level , and occupation were expressed as frequencies . comparison of seroconversion incidence to other variables was done using fisher 's exact test reported with p values that were considered significant if p was less than 0.05 . univariable analysis was done using logistic regression to identify the potential factors associated with seroconversion in pregnancy , and then those with a p value less than 0.2 were included in the final model for multivariable logistic regression . results were reported as adjusted odds ratios ( or ) together with their 95% confidence intervals ( ci ) . ethical clearance was obtained firstly from the faculty of health sciences institutional review board ( fhs / irb ) as well as the cameroon baptist convention ( cbc ) institutional review board before patient enrolment . then , an authorisation was obtained from the regional delegation of public health for the south west region . permission was obtained from the health districts and the various health facilities for the study to be carried out in the desired health facilities . a total of 1954 antenatal women in seven healthcare facilities were tested for hiv to provide annual prevalence data in their first antenatal ( booking ) visit . among this sample , 201 ( 10.3% ) women were tested hiv - positive and were excluded from study . amongst the remaining 1753 hiv - seronegative pregnant women , 477 ( 27.2% ) were enrolled into the study in the second and third trimesters to study the incidence of seroconversion . the majority , 308 participants ( 64.65% ) , were in the age group 2130 and 364 ( 76.32% ) were married . about 350 ( 96.2% ) of those who were married were monogamously married . of the study population , 418 ( 87.6% ) were urban dwellers , 394 ( 83.12% ) had less than two children , three hundred and ninety ( 81.8% ) were in the third trimester of pregnancy , and 388 ( 81.3% ) had done secondary level of education and above . the incidence of participants who seroconverted was 2.1% ( 147.25 woman - years ) , giving an incidence rate of hiv seroconversion during pregnancy of 6.8 per 100 woman - years . the majority , 3% ( 8/262 ) , of the patients who seroconverted did the second test 3 months after the first test . a minority , 31.9% , of participants did not know their hiv status prior to the first antenatal care ( booking ) visit while 33.0% of participants did not also know the hiv status of their partners / husbands . it shows that no statistically significant relationship was found between sociodemographic factors and hiv seroconversion in pregnancy . had a repeat test 3 months after the first negative ( booking ) test result while 25.8% , 13.2% , and 6.1% had their repeat test done at 4 , 5 , and 6 months , respectively . eighty percent ( n = 8) of those who seroconverted did so by the fourth month after the booking or first antenatal care visit hiv testing ( figure 2 ) . six ( 60% ) of those who seroconverted were in a monogamous regime and 3 ( 30% ) were single , while 1 ( 10% ) was in a polygamous regime ( one husband and two wives ) . , 8 knew about mtct and pmtct of hiv including when transmission could occur ( either during pregnancy , labour / delivery , and breastfeeding or when the mother does not know she is hiv - positive ) . all the eight participants also knew it was possible to prevent mtct ( p = 0.07 ) and 7 out of 8 knew at least one correct method of pmtct ( avoiding breastfeeding , taking antiretroviral treatment , caesarean delivery , or mother being aware of her hiv serologic status before engaging in a pregnancy ) ( p = 0.78 ) . all the participants who seroconverted were having sexual intercourse during the current pregnancy ( p = 0.37 ) and 9 ( 90% ) were not users of the condom . all the participants who were hiv - positive had only one sexual partner throughout pregnancy ( p = 0.34 ) . the odds of hiv seroconversion during pregnancy were 5 times higher among pregnant women who did not know about pmtct ( aor 5.4 ; 95% ci 1.0627.56 ) . also , pregnant women who were employed were at a higher risk of seroconversion than those who were unemployed ( aor 3.2 ; 95% ci 0.6815.4 ) , though this was not statistically significant . the majority , 407 ( 85.3% ) , of the participants who knew about pmtct got the information from the hospital / health personnel mainly during antenatal consultations , while 36 ( 7.5% ) got informed through the media . hiv incidence during pregnancy and postpartum significantly increases risk of mtct and is an important public health problem in africa . understanding maternal hiv incidence during this time period can be helpful to guide prevention and repeat testing strategies and policies , and little data on hiv incidence in pregnancy from west africa exist . this study measures hiv incidence during pregnancy in seven healthcare facilities in fako division , south region of cameroon , by repeat testing later in pregnancy . women in the south west region , like those in most other low - income countries , come to health facilities for antenatal care very late in pregnancy , usually in the second trimester . at the same time , they prefer to give birth in a health facility because they perceive labour and delivery as a time of significant health risks that require biomedical attention . for this reason we sometimes find it difficult to have women tested for hiv in the first trimester of pregnancy , especially in the rural areas . the incidence of hiv seroconversion during pregnancy in this study was 2.1% ( 147.25 woman - years ) , yielding an incidence rate of 6.8/100 woman - years . these results are lower than that reported by moodley et al . in 2009 in uganda who showed that , among 2377 hiv - negative women retested , 1099 ( 46.2% ) and 1278 ( 53.4% ) were tested at urban and rural health facilities , respectively . seventy - two women ( 3% ) were hiv - positive ( 679 woman - years of exposure ) , yielding an hiv incidence rate of 10.7/100 woman - years ( 95% confidence interval ( ci ) 8.213.1 ) . hiv incidence in pregnancy was higher but not statistically significant at the urban facilities ( 12.4/100 woman - years versus 9.1/100 woman - years ) and at least two - fold higher among the 2529- and 3034-year age groups ( 3.8 and 4.5% , resp . ) as compared with the less than 20-year age group ( 1.9% ) . single women were at 2.5 times higher risk of seroconverting during pregnancy ( p = 0.017 ) . in another study , humphrey et al . reported that breastfeeding associated transmission for mothers who seroconverted postnatally ( n = 334 ) averaged 34.56 infant infections per 100 child - years ( 95% ci 26.60 to 44.91 ) during the first nine months after maternal infection , declined to 9.50 ( 95% ci 3.07 to 29.47 ) during the next three months , and was zero thereafter . among women who seroconverted postnatally and in whom the precise timing of infection was known ( 90 days between last negative and first positive test ) ( n = 51 ) , 62% ( 8/13 ) of transmissions occurred in the first three months after maternal infection and breastfeeding associated transmission was 4.6 times higher than in mothers who tested hiv - positive at baseline and whose infant tested hiv - negative with pcr at six weeks . our results conform with the 2.2% seroconversion rate reported by qolohle et al . in 1995 at the king edward viii hospital in durban , south africa ( 2.6% ) and the 2.9% reported by lockman and creek in francistown , botswana , at 62 weeks postpartum . with the 2.1% incidence of hiv or 6.8/100 woman - years incidence rate of hiv seroconversion during pregnancy in fako division , there would be a correspondingly increasing rate of mtct of hiv , thereby increasing the pediatric hiv burden . it has been estimated that 19% of infants born to hiv - positive mothers are hiv infected when tested at 19 months . this high rate of infant infection can be attributed to the fact that maternal hiv infection during pregnancy and breastfeeding occasion equally high rates of mtct of hiv-1 . all participants who seroconverted did so in the third trimester of pregnancy , when most of the study participants ( 81.8% ) were recruited . all the participants who seroconverted in our study had hiv-1 which is the type of hiv mainly responsible for mtct of the virus . therefore , all cases of hiv seroconversion during pregnancy should be considered as potential risks for more pediatric hiv . seventy percent of the participants who seroconverted were married ; therefore , marriage does not protect women from hiv infection in pregnancy . eighty percent of the participants who seroconverted had 3 - 4-month interval between the two tests , while there was no case of seroconversion among women who had 6-month interval . these results differ from those obtained in the tygerberg hospital of cape town where it was reported that women especially at risk of seroconversion are those who book much earlier , thereby increasing the interval between the initial test at first anc visit and the repeat test . to identify cases of seroconversion more early , it will be advisable for repeat hiv testing to be done to pregnant women every three months until delivery , no matter the time of first anc visit . the risk factors that were studied ( age , marital status , residence , parity and knowledge of mtct of hiv , hiv prevention , and hiv seroconversion in pregnancy ) did not show any significant statistical variations . these results are not in conformity with those reported in harare , zimbabwe , where women aged 17 and below were at higher risk of seroconverting than the general population of hiv - negative pregnant women studied . in this study , 442 ( 98.2% ) of participants who remained seronegative and 8 ( 1.8% ) of those who seroconverted had a good knowledge of pmtct techniques . this is probably because it has been a routine practice at all antenatal clinics to give the women talks on hiv and pmtct , especially during the first anc visit . familiarity level with pmtct practices in this study is similar to that obtained in yaounde , cameroon , in 2011 . the majority of study participants , though aware of mtct of hiv during pregnancy , did not take the necessary preventive measures . this was exemplified by the fact that some participants did not know their hiv status before the first antenatal care ( booking ) visit . this may be the result of inadequate sensitization of the population of the swr or negligence on the part of the participants . this fact alone could have a negative impact on the pmtct strategies put in place in fako division and based on recommendations of the who and the government of cameroon . the limitations to this study include the fact that we did not study the male partners ' or husbands ' risk factors and relied on results of hiv tests done at the booking or first antenatal care visit in the different health facilities . also , seroconversions were determined using rapid tests , not hiv rna tests , thus potentially underestimating incidence rates . furthermore , the study was underpowered to detect cofactors for risk and only measured cofactors based on demographics and pmtct knowledge . we did not assess many other potential cofactors for acquisition of hiv , such as stis . finally , the collection of data using an interviewer - administered questionnaire could have resulted in social desirability bias . the incidence of hiv seroconversion among pregnant women in the study is 2.1% , yielding an incidence rate of 6.8/100 woman - years in fako division . most of the participants seroconverted 3 months after the first test and therefore make up a potential risk for pediatric hiv . lastly , pregnancy did not stop the women from sexual activities and most of them had one sex partner .

today , success in the field of competitive swimming requires that swimmers and coaches have an understanding of fluid dynamics . this is highly challenging as the subject area is extremely complex , addressing multidisciplinary problems with a broad spectrum of research approaches ( wei , mark , & hutchison , 2014 ) . to enable a better understanding of the fluid dynamics of human swimming , wei et al . ( 2014 ) reviewed the existing research articles concerned with the fluid - dynamics - related aspects of swimming over the past five decades , and provided suggestions for improving performance ; however , their study did not address the most up - to - date research in this area . the field of computational fluid dynamics ( cfd ) is constantly advancing , and has been increasing our understanding of complicated hydrodynamic phenomena over several decades . in addition , particle image velocimetry ( piv ) has proven to be a powerful tool for measuring actual flow fields around swimmers . combining the results from cfd and piv should help us considerably in visualising and understanding complicated hydrodynamic mechanisms . moreover , actual experimental data , such as measurements of the relevant forces and pressures , are valuable to verifying cfd results , and as an aid to the interpretation of piv images . several experiments ( kudo , yanai , wilson , takagi , & vennell , 2008 ; nakashima & takahashi , 2007 ; takagi & wilson , 1999 ) have been performed to measure unsteady fluid forces or pressures on a mechanical arm , a swimming robot and human swimmers via the attachment of pressure sensors . nakashima ( 2006 ) has developed a simulation model that uses parameters derived from such experimental data , for example moving velocity and fluid forces ; the model is called the swimming human simulation model ( swum ) . if we can combine novel and sophisticated methodologies such as cfd , piv and swum , then we may be able to uncover the complex mechanisms that generate unsteady fluid forces while swimming . it has been only about 15 years since these methodologies have come into practical use in human swimming research ; notably , little information is available concerning the inherent limitations and potential of these methodologies . this paper reviews the numerical and experimental investigations of swimming from the start of these investigations to the present time , and discusses an appropriate methodology to resolve persistent problems still remaining in this area . the review was conducted in accordance with the ethics guidelines expressed in the declaration of helsinki . because the equations are non - linear , in both space and time , they are solved using numerical discretisation techniques . for the space discretisation , the computational domain is divided into a large number of individual cells or meshes , on which the velocities and pressures are defined . to resolve turbulent flow directly with such a mesh , the cell size must be smaller than the minimum vortex length , the so - called kolmogorov length scale , defined as : ( 1 ) where is the kinematic viscosity of water , l a reference length and u a typical forward speed ( rogallo & moin , 1984 ) . for the flow around a swimmer , is of the order of 2.0 m , assuming typical values = 10 m s , l = 2 m and u = 2 m s. here , is based on the order of the kinematic viscosity of water in a swimming pool , and the values l and u are the order of a typical world - class swimmer s height and advancing speed , respectively . if cubic - shaped cells are employed for the computational domain , this means that each side must be of length not exceeding 2.0 m , for a domain of relevance ; say 2 m 2 m 4 m , the total number of cells would be 2 10 ( i.e. 2000 trillion ) . even in an age of petaflop computer technology , a transient simulation featuring thus , to make progress , turbulence models need to be employed , in which turbulent phenomena are modelled , not calculated explicitly . unfortunately , there is no universal turbulence model known that can be applied to all types of flows , though reliable , approximate models do exist for specific cases ( kleinstreuer , 1997 ) . consequently , cfd simulations involving the use of turbulence models will incur errors . as well as the physical modelling errors , any cfd simulation will involve numerical errors resulting from the finite resolution , if sufficiently fine mesh is not possible to resolve all the macroscopic scales of relevance . thus , a grid - dependence study ( roach , 1998 ) is mandatory to achieve reliable quantitative numerical predictions . the first studies using cfd were undertaken at the los alamos national labs in the 1950s in the context of the development of airfoils ; these works have been reviewed by harlow ( 2004 ) . in accordance with the improvements in numerical algorithms and computer capabilities , two - dimensional ( 2d ) simulations were eventually extended to three dimensions , and today flows around complex geometries can include additional physical phenomena , such as two - phase or multi - phase flow conditions ( e.g. bubbly flow ) , phase change ( e.g. boiling flow ) , fluid structure interaction ( e.g. blood flow through flexible arteries ) . cfd simulations for swimmers resemble in many respects those for ships : a body advances close to , or just under , the water surface , subject to a balance of drag and thrust forces . nonetheless , compared with cfd simulations applied to ships ( stern , yang , wang , sadat - hosseini , & mousaviraad , 2013 ) , the difficulties of simulating a human swimming lie in the treatment of ( i ) the complicated and transient movements of a flexible body shape in the water ; ( ii ) the dynamically changing shape , with rotations of many body segments about multiple axes not aligned with the orthogonal external reference system or direction of travel ; and ( iii ) the large deformation of the water surface relative to the size of the swimmer ; such complications do not exist in the case of ships , and are challenging . besides the difficulties associated with the cfd methodology itself , as outlined in the previous paragraphs , the validation of cfd simulations for swimmers is in itself not at all straightforward , due to the limitations in accurately measuring the flow around the swimmer . cfd studies of human swimmers began with steady and accelerated flows around a 2d disc ( bixler & schloder , 1996 ) , the disc being a simplification of the swimmer s hand . the commercial cfd code fluent was used for these simulations , using three different turbulence models : the standard k model ( launder & spalding , 1972 ) ; the re - normalisation group k model ( orszag et al . , 1993 ) ; and the reynolds stress model ( gibson & launder , 1978 ) . these studies were undertaken in order to evaluate the influence of turbulence model on the hydrodynamic forces . the most accurate drag force was obtained by the reynolds stress model . from comparisons of the calculated drag forces for quasi - steady ( in order to simplify transient flows , the hydrodynamic forces exerted on a body moving unsteadily within a fluid are assumed to be determined at any instant only by the flow field at that instant ) and accelerated flow conditions , the authors were able to demonstrate that the drag under accelerated conditions is larger than that for quasi - steady conditions by almost 40% , clearly indicating the need for performing simulations under transient conditions ( i.e. in the accelerated flow condition ) instead of adopting the quasi - steady assumption . following this study , many cfd simulations ( alves , marinho , leal , rouboa , & silva , 2007 ; bilinauskaite , mantha , rouboa , ziliukas , & silva , 2013 ; bixler & riewald , 2002 ; gardano & dabnichki , 2006 ; marinho , barbosa , rouboa , & silva , 2011 ; marinho et al . , 2009b , 2010 ; minetti , machtsiras , & masters , 2009 ) were carried out for the flow around a hand and forearm under steady - state conditions ( an object or a body is statically placed in a uniform flow without any body motion ) ; these are listed in table 1 . although these steady - state simulations are , in principle , capable of estimating the thrust and lift forces , results are limited , as exemplified by bixler and schloder ( 1996 ) , because the swimmer s stroke path is usually curved , and the hand is accelerating.table 1 . summary of cfd simulation for hand and arm in steady state condition.authorsparticipantsobject2d/3dcfd codeturbulencemodel*bixler and schloder ( 1996)flow around flat plateflat plate2dfluentk , rng and rsmbixler and riewald ( 2002)flow around hand and forearmhand , forearm3dfluentkgardano and dabnichki ( 2006)flow around armarm3dfluentn / aalves et al . ( 2007)flow around hand and forearmhand , forearm3dfluentkmarinho et al . ( 2009b)flow around hand withdifferent thumb positionshand3dfluentkminetti et al . ( 2009)optimum finger spacinghand3dcfxk and kmarinho et al . ( 2010)flow around hand withsmall finger spreadhand3dfluentkmarinho et al . ( 2011)flow around hand and forearmhand , forearm3dfluentkbilinauskaite et al . ( 2013)quasi - steady approachfor fluid forces of handhand3dfluentk*turbulence model k , standard k ; k , standard k ; rng , re - normalisation group k ; rsm , reynolds stress model . a steady - state simulation of the flow around a swimmer s body in a prone , gliding position may be more appropriate than one of a hand only , because such a condition occurs in practice just after the start or the turn , in competitive swimming . three - dimensional ( 3d ) simulation of the flow around a gliding swimmer was first attempted by lyttle and keys ( 2004 ) using fluent. the body shape of an elite swimmer was scanned optically , and the surface of the swimmer represented by 60,000 triangular elements . bixler , pease , and fairhurst ( 2007 ) later also simulated the flow around a swimmer in a prone gliding position . an experiment using a mannequin , whose shape is identical to that adopted for the cfd simulation , was undertaken in a water flume for the purposes of validation . the drag forces predicted by cfd agreed with measured data within an error bound of 4% , and revealed that , in the range of 1.5 u 2.25 m s , approximately 75% of the drag is due to pressure forces ( i.e. form drag ) and 25% due to friction . the computed total drag coefficient ( c d = d/0.5 u a , where a is the frontal projected area ) was about 0.3 . following bixler s research , simulations of the flow around a gliding swimmer without body motion were performed by other groups ( machtsiras , 2012 ; marinho et al . et al . , 2011 ; sato & hino , 2010 ; silva et al . , 2008 ; zaidi , fohanno , taiar , & polidori , 2010 ; zaidi , taiar , fohanno , & polodori , 2008 ) ; summary of cfd simulation for full body in steady - state condition.authorsparticipantsobject2d/3dcfd codeturbulencemodel*lyttle and keys ( 2004)flow around gliding swimmerfull body3dfluentn / abixler et al . ( 2009a)flow around gliding swimmerfull body3dfluentksato and hino ( 2010)flow around gliding swimmernear free surfacefull body3dsurfsazadi et al . ( 2011)flow on gliding swimmer withdifferent head positionsfull body3dfluentkmachtsiras ( 2012)flow around gliding swimmerwith different head positions , gliding depths and swim suitsfull body3dstar - ccm+les*turbulence model k , standard k ; k , standard k ; les , large - eddy simulation . k , standard k ; k , standard k ; les , large - eddy simulation . sato and hino ( 2010 ) performed simulations of the flow around a swimmer gliding at different depths using the spalart allmaras turbulence model ( spalart & allmaras , 1994 ) as shown figure 1 . note that the spalartallmaras model was originally developed for aerospace applications , but has also been applied to ship hydrodynamics through validation exercises ( larsson , stern , & visonneau , 2014 ) . the wave - making resistance was predicted to contribute 20% to the total drag when the swimmer s body was slightly below the water surface ( figure 1(b and c ) ) . ( 2010 ) carried out cfd flow simulations around a swimmer using two turbulence models : the standard k model and the standard k model ( wilcox , 1988 ) . note that the standard k model is more accurate in near wall treatment than the standard k model , and is more suitable for separated flows . the total drag computed using the k model was approximately 40% lower than experimental measurement ( bixler et al . , 2007 ; vennell , pease , & wilson , 2006 ) , whereas the result of the k model was in agreement within an error of 3% for the case of an advancing speed of 2 m s. more recently , machtsiras ( 2012 ) has simulated the flow around a swimmer using the large - eddy simulation approach ( smagorinsky , 1963 ) . in large - eddy simulation , large scales of turbulence are directly resolved , and only the small scales of turbulent motions are modelled . compared with reynolds - averaged navier - stokes approach ( i.e. simulations employing turbulence models such as the spalart allmaras , k or k models , in which all the scale of turbulence is modelled ) , large - eddy simulation is expected to be more accurate , though its application does require a finer computational mesh than that for the reynolds - averaged navier - stokes approach , implying higher computational cost . results using large - eddy simulation were of higher accuracy than those obtained using the k model . in particular , the average drag obtained using large - eddy simulation was less than 3% in error of that measured by bixler et al . ( 2007 ) , but was around 18% in error when the k model was used . conditions of calculation and calculation results of a gliding swimmer for case f. three different gliding depths ; case d , 0.5 m ; case e , 0.3 m ; and case f , 0.1 m. as calculating conditions , reynolds number was 2.9 10 , froude number was 0.48 and advancing speed was 2.0 m s ( sato & hino , 2010 ) . ( a ) three different gliding depths ; ( b ) perspective view of the free - surface shape for case f ; ( c ) limiting streamlines , distribution of cp and stream lines for case f. conditions of calculation and calculation results of a gliding swimmer for case f. three different gliding depths ; case d , 0.5 m ; case e , 0.3 m ; and case f , 0.1 m. as calculating conditions , reynolds number was 2.9 10 , froude number was 0.48 and advancing speed was 2.0 m s ( sato & hino , 2010 ) . ( a ) three different gliding depths ; ( b ) perspective view of the free - surface shape for case f ; ( c ) limiting streamlines , distribution of cp and stream lines for case f. many cfd studies have been undertaken for flows around fixed bodies , since such simulations are relatively straightforward : that is , the treatment of the body motion is unnecessary , it representing just a fixed boundary to the flow . however , applied to a swimmer in motion , the continuous movement of the swimmer s body must be taken into account as this is essential for accurately predicting the overall thrust and drag forces , as well as other aspects of swimming , such as stroke and kick simulations . thus , the problem of analysing the flow of a swimmer with dynamically changing posture and limb orientations is an extremely complex and challenging one . in the cfd simulation method , there exist essentially three approaches for dealing with body motion : ( i ) a moving or dynamic grid approach including overset / overlapping grids ( hirt , amsden , & cook , 1974 ; noack , 2005 ; suhs , rogers , & dietz , 2002 ) ; ( ii ) a cut cell or immersed boundary approach ( mittal & iaccarino , 2005 ) ; and ( iii ) a meshless approach ( monaghan , 2012 ) . the first attempt to use cfd to simulate the moving body of a swimmer ( i.e. a swimmer with changing orientation and actively moving body segments ) was made by kawai ( 1997 ) . the 2d flow around the swimmer , performing a dolphin kick , was computed using the cut cell method , as implemented in the commercial cfd code , stream. following this initial study , a variety of cfd simulations incorporating the moving body of the swimmer were performed ( cohen , cleary , & mason , 2012 ; hochstein , pacholak , brcker , & blickhan , 2012 ; keys , 2010 ; lecrivain , slaouti , payton , & kennedy , 2008 ; pacholak , hochstein , rudert , & brcker , 2014 ; rouboa , silva , leal , rocha , & alves , 2006 ; sato & hino , 2003 , 2013 ; von loebbecke & mittal , 2012 ; von loebbecke , mittal , fish , & mark , 2009b ; von loebbecke , mittal , mark , & hahn , 2009c ) . summary of cfd simulation for moving body.authorsparticipantsobject2d/3dtreatment ofmotioncfd codeturbulencemodel*kawai ( 1997)dolphin kickleg and foot2dcut cellstream sato and hino ( 2003 , 2010)stroke of swimmerhand3dmoving gridsurfwithoutrouboa et al . ( 2009b , 2009c)dolphin kickfull body3dibvicar3dwithoutkeys ( 2010)dolphin , freestyle and breaststroke kickfreestyle swimming at water surfacefull body3d fluentrealisable kvon loebbecke and mittal ( 2012)stroke of swimmerhand and arm3dibvicar3dwithoutcohen et al . ( 2012)dolphin kickfull body3d openfoamn / asato and hino ( 2013)stroke of swimmerhand3dmoving gridsurfwithoutpacholak et al . ( 2014)dolphin kickfull body3d openfoamn / a*turbulence model k : standard k. summary of cfd simulation for moving body . in the von loebbecke et al . ( 2009a , 2009b , 2009c ) studies , the flow around a human body performing the dolphin kick motion was simulated . in these simulations , the swimmers were assumed to advance at a constant speed in water of infinite depth . the mean active drag for a female swimmer was estimated to be 135 n at a speed of 0.95 m s. the computed flow field for this female swimmer is shown in figure 2 , which clearly illustrates the vortices generated by the leg motion . from these studies , the authors concluded that most of the thrust was produced by the feet , the down kick producing a much larger thrust than the up kick . the propulsive efficiency of the dolphin kick was estimated to be within a relatively wide range : from 11% to 29% ( von loebbecke et al . , 2009b ) . ( 2014 ) also simulated the flow around an entire body performing the dolphin kick using the open source cfd code , openfoam. the formation and interaction of vortices near the swimmer s body , and in the swimmer s wake , were identified during successive dolphin kick cycles . these authors also demonstrated that maximum thrust was generated during the down kick , and that this was approximately twice that of the up kick . the predicted 3d vortex rings in the wake region are similar to those computed by von loebbecke et al . topology of vortex structures ( left ) , a slice containing flow vectors and flow speed contours ( middle ) and a slice containing vorticity contours ( right ) ( von loebbecke et al . , 2009c ) . topology of vortex structures ( left ) , a slice containing flow vectors and flow speed contours ( middle ) and a slice containing vorticity contours ( right ) ( von loebbecke et al . , 2009c ) . a common problem of cfd simulations of swimmers , as discussed earlier , is that a quantitative validation procedure has not been performed , except in some isolated cases ; for example , bixler et al . ( 2007 ) ; machtsiras ( 2012 ) ; and sato and hino ( 2013 ) . here , the quantitative validation procedure is ideally that : ( i ) an identical body shape is used in the experiment and the cfd simulation under the same boundary conditions ; ( ii ) a grid - dependence study ( roache , 1998 ) is performed ; ( iii ) the resolution of the flow - field measurement is high enough to evaluate the local velocity / pressure field , and thereby to validate the turbulence models ; and ( iv ) both global quantities ( e.g. the hydrodynamic forces acting on a body ) and local quantities ( e.g. velocity at a specific point ) are compared between measurement and simulation . in the case of transient simulations incorporating body motion , validation becomes difficult because local velocity estimations are prone to error . further , forces and moments acting on body segments can be measured accurately with robotic bodies . thus , the potential for improving the accuracy and effectiveness of the simulations by combining methods is apparent . piv is an optical method for flow visualisation that can be used to measure instantaneous velocities and related properties , such as normal and shear stress , in fluids . piv is the member of a broader class of measuring techniques to determine flow velocities in restricted regions of a fluid over time . such methods estimate the local velocity ( u ) using the discretised equation : ( 2 ) where x is the displacement of a marker originally located at position x at time t during a short time interval t . the most up - to - date piv setup consists of one or more high - speed ccd cameras ( sampling at frequency above 200 hz ) , a laser ( nd : yag lasers are commonly used ) controlled by an optical system , a synchronizer to act as an external trigger for the control of the ccd cameras and the laser , a marker or seed particle ( usually with a diameter of the order of 10100 m and ideally with the density similar to that of the fluid ) and the fluid under investigation . piv has been used successfully to study the locomotion of fish ( drucker & lauder , 1999 ; nagayama , tanaka , tanaka , hayami , & aramaki , 2008 ; sakakibara , nakagawa , & yoshida , 2004 ) , as well as insects ( dickinson , lehmann , & sane , 1999 ; fearing et al . , 2000 ) . 2004 ) were the first to apply piv to the research of swimming technique by measuring the flow field that develops around a moving hand while swimming , which may be the main source of propulsion for the crawl stroke . a remarkable amount of momentum generation was observed during the transition from insweep to upsweep motions during the latter part of the front crawl stroke ( figure 3(b ) ) because of the action of a pair of counter - rotating vortices . 2009 ) suggested that this increase in momentum directly leads to the unsteady fluid force generated according to newton s second law of motion . subsequently , matsuuchi and his group ( muramatsu , matsuuchi , nomura , sakakibara , & miwa , 2008 ; yamada et al . , 2006 ) developed a new piv system combined with motion analysis . this system synchronises piv images with 3d motion data by using two high - speed cameras to simultaneously capture the flow velocity fields for the geometrical configuration of the hand . the results obtained reveal that when the hand orientation was changed rapidly , vortex generation and shedding were observed , and thereby the momentum changes were detected in the flow field . such vortex behaviour might contribute to the generation of thrust ( matsuuchi & muramatsu , 2011 ) . in addition to the front crawl , kamata , miwa , matsuuchi , shintani , and nomura ( 2006 ) attempted to demonstrate the flow field during sculling movements and concluded that after the change in the direction of the hand motion , a pair of vortices formed with a jet flow induced between the vortices . this jet flow increased the momentum , and accordingly , a lift force exerted on the hand was believed to be generated . ( 2014 ) also performed a flow visualisation experiment during sculling using piv and the measurement of the pressure distribution around a hand . a series of piv images covering the period when the maximum resultant fluid force was produced is shown in figure 4 . ( 2014 ) concluded that a skilled swimmer produces large unsteady fluid forces during sculling when a leading - edge vortex occurs on the dorsal side of the hand and when wake capture occurs on the palm side ( see figure 4(ii - b ) ) . beside the sculling movement , the piv system has been extended to include the measurement of vortices during dolphin kicking ( hochstein & blickhan , 2011 ; miwa , matsuuchi , shintani , kamata , & nomura , 2006 ; miwa et al . , 2005 ) . hochstein and blickhan ( 2011 ) found that vortices generated in the region of strongly flexing joints acted as a form of pedalling and enhanced propulsion , the so - called vortex re - capturing ( figure 5).figure 3 . sequential variations of the velocity field at 70 ms intervals ( ( a ) ( b ) ( c ) ( d ) ) for a trained swimmer . the flume speed was set at 1.2 m s. the colour beside the velocity field represents the strength of the vorticity , measured in units of 1 s. the five filled circles in ( b ) correspond to the fingers . the maximum and minimum vortices are 135.3 s ( + ) and 108.1 s ( ) , respectively ( matsuuchi et al . , 2009 ) . still images of hand ( column a ) , computer - generated maps of vorticity and velocity ( column b ) and pressure distribution around the hand ( column c ) at each of the four critical phases ( rows i iv ) in sculling . the still images were recorded looking up from below the bottom of the controlled - flow water channel , and the hand is moving from a swimmer s side towards the centre line of body . in the maps of vorticity and velocity , the colour bars at the right indicate the direction and strength of the vortex : red and blue indicate counterclockwise and clockwise , respectively , and colour intensity relates to vorticity strength . the small arrows indicate the velocity of the flow field . for the graphs of pressure distribution ( column c ) , the horizontal axes indicate the sensor s position normalised to the width of the hand ( d ) . sensors p2 , p3 , p4 and p5 were attached to the palm side of the fifth , fourth , third and second fingers , respectively . sensors , p7 , p8 , p9 and p10 were attached to the dorsal side of the second , third , fourth and fifth fingers , respectively ( takagi et al . , flow velocities ( black arrows ) generated during the one kick cycle within a still water fixed window of 1 1 m. the time sequence shows the vortex above the shank from the creation to the destruction , the white open arrows at the legs show the motion of the appendage . because of the flexion of the knee ( a ) , a vortex is generated in the dorsal side of the knee region ( b ) and separated ( c ) . after the lower reversal point , the legs move upwards ( d ) and kick into the vortex ( e ) for propulsion ( vortex re - capturing ) ( hochstein & blickhan , 2011 ) . sequential variations of the velocity field at 70 ms intervals ( ( a ) ( b ) ( c ) ( d ) ) for a trained swimmer . the flume speed was set at 1.2 m s. the colour beside the velocity field represents the strength of the vorticity , measured in units of 1 s. the five filled circles in ( b ) correspond to the fingers . the maximum and minimum vortices are 135.3 s ( + ) and 108.1 s ( ) , respectively ( matsuuchi et al . , 2009 ) . still images of hand ( column a ) , computer - generated maps of vorticity and velocity ( column b ) and pressure distribution around the hand ( column c ) at each of the four critical phases ( rows i iv ) in sculling . the still images were recorded looking up from below the bottom of the controlled - flow water channel , and the hand is moving from a swimmer s side towards the centre line of body . in the maps of vorticity and velocity , the colour bars at the right indicate the direction and strength of the vortex : red and blue indicate counterclockwise and clockwise , respectively , and colour intensity relates to vorticity strength . the small arrows indicate the velocity of the flow field . for the graphs of pressure distribution ( column c ) , the horizontal axes indicate the sensor s position normalised to the width of the hand ( d ) . sensors p2 , p3 , p4 and p5 were attached to the palm side of the fifth , fourth , third and second fingers , respectively . sensors , p7 , p8 , p9 and p10 were attached to the dorsal side of the second , third , fourth and fifth fingers , respectively ( takagi et al . flow velocities ( black arrows ) generated during the one kick cycle within a still water fixed window of 1 1 m. the time sequence shows the vortex above the shank from the creation to the destruction , the white open arrows at the legs show the motion of the appendage . because of the flexion of the knee ( a ) , a vortex is generated in the dorsal side of the knee region ( b ) and separated ( c ) . after the lower reversal point , the legs move upwards ( d ) and kick into the vortex ( e ) for propulsion ( vortex re - capturing ) ( hochstein & blickhan , 2011 ) . the merits of piv are summarised as follows : ( i ) the method does not disturb the swimming motion owing to its contact - free setup ; ( ii ) instantaneous velocity , vorticity and heat - flux rates can be measured ; and ( iii ) multidimensional measurements are possible . the demerits are as follows : ( i ) it takes a long time to calibrate the flow field ; ( ii ) the time resolution is poor ( up to 15 hz ) ; and ( iii ) the dynamic range of the velocity is low . the most serious issue with piv appears to be the inherent limitations in the area of observation , and even in the latest studies , the observation area is limited to two dimensions and 1 m. the latter is clearly not sufficient to cover the entire swimming motion at once . to solve this problem , improvements in the output range of the laser sheet are essential . despite these issues , the momentum of flow can be calculated by piv and the data used to adjust the cfd models to so that the simulations match experimentally obtained fluid motion and momentum of vortices . although piv is a very powerful tool to understand the flow field around a swimmer in detail , it can be used only to analyse the actual ( happened ) phenomena . it can not be used to predict what will happen in unknown ( unmeasured ) situations , for example to predict how much the resultant swimming speed will change if a joint angle is changed by 5. for such predictions , computer simulations are very useful since it is possible to change only parameters of focus and to quantify the effect of those parameters . however , computer simulation based on cfd is not suitable for such prediction since the computation time becomes generally enormous . it takes too much computation time to conduct large - scale parameter study or parameter optimisation using cfd . therefore , an alternative computer simulation method that requires much less computation time than cfd has been developed by nakashima , satou , and miura ( 2007 ) . the model takes account of the added mass and unsteady fluid forces , including buoyancy and gravity . the equation of the motion of the human body for the translational direction in the absolute coordinate system ( o - xyz ) ( figure 6(a ) ) is given by ( 3 ) figure 6 . illustration of the principles of swum : ( a ) analytical model of swimming human ; ( b ) an example of body geometry ( male , 2029 years ) ; ( c ) fluid forces except buoyancy ; ( d ) buoyancy is calculated by integrating pressure force on divided quadrangles ; ( e ) divided elliptic plate ; and ( f ) judgement whether quadrangles submerge or not ( nakashima et al . , 2007 ) . illustration of the principles of swum : ( a ) analytical model of swimming human ; ( b ) an example of body geometry ( male , 2029 years ) ; ( c ) fluid forces except buoyancy ; ( d ) buoyancy is calculated by integrating pressure force on divided quadrangles ; ( e ) divided elliptic plate ; and ( f ) judgement whether quadrangles submerge or not ( nakashima et al . , 2007 ) . where mj is the mass of the jth truncated elliptic cone , xg is the displacement vector of the human s centre of mass g and fj is the external force vector acting on the jth cone . the human body is modelled as 21 segments representing the head , neck , shoulders , chest ( upper and lower ) , waist ( upper and lower ) , hips ( upper and lower ) , upper arms , forearms , hands , thighs , shank and feet ( figure 6(b ) ) . as the fluid force components act on each truncated elliptic cone , the inertial force due to added mass of fluid ( f a ) , drag forces normal ( f n ) and tangential ( f t ) to the longitudinal direction , and buoyancy are taken into account . each truncated elliptic cone is divided into thin elliptic plates along the longitudinal axis , as shown in figure 6(c ) , and all the fluid force components except buoyancy are assumed to act on each centre of the thin elliptic plates . buoyancy ( f b ) , on the other hand , is calculated by integrating the pressure force due to the gravitational force acting on the tiny quadrangle , into which the surface of the thin elliptic plate is again divided in the circumferential direction , as shown in figure 6(d ) . all the fluid forces except buoyancy are assumed to be computable from the local position , direction , velocity and acceleration of the centre of each divided thin elliptic plate . for example , the acceleration is used to calculate the inertial force due to added mass of fluid , while the velocity is used to calculate the normal and tangential drag forces . these fluid force coefficients can adjust the magnitudes of the estimated fluid forces , and have been determined from the experimental results . the fluid force model in swum has been found to be within 7.5% error against the experimental values ( nakashima , 2007 ; nakashima et al . , 2007 ) . the simulated fluid forces acting on the limbs sufficiently reproduced the experimental results for all the experimental conditions , although some discrepancies were observed for the motion close to the water surface or at the start or end of a cycle ( nakashima & takahashi , 2012a , 2012b ) . the overall performance of the simulation using the determined fluid force coefficients to predict the time variation of the fluid forces was satisfactory ( nakashima & ejiri , 2012 ) . the fluid forces acting on the swimmer can be calculated by swum without solving the flow field . therefore , the computation time generally becomes much smaller than cfd enabling large - scale parameter studies as well as the optimising calculations . however , swum is limited in that it considers neither the effects of the surrounding walls nor the mutual interaction of limbs ; thus , the computational results of swum might differ from those of cfd . nakashima and his group have performed simulations of various swimming motions using swum , including the front crawl ( nakashima & ono , 2014 ; nakashima , 2007 ; nakashima , maeda , miwa , & ichikawa , 2012 ) ; breaststroke ( nakashima , hasegawa , kamiya , & takagi , 2013 ) ; comparison of the four strokes ( nakashima , 2008 ) ; underwater undulation swimming ( nakashima , 2009 ) ; monofin swimming ( nakashima , suzuki , & nakajima , 2010 ) ; and dive starts ( kiuchi , nakashima , cheng , & hubbard , 2010 ) . these simulations have provided practical information for adjusting swimming movements to enable a human to swim faster . recently , swum was utilised not only for the objective of swimming faster but also for a transfemoral prosthesis for the swimming of persons with lower - limb amputations ( nakashima , suzuki , ono , & nakamura , 2013 ) . further applications , for example the product development of swimwear or tools which contribute to swimming easily , can be expected . although sophisticated methodologies such as cfd , piv and swum have come into practical use in swimming research , the direct measurement of forces and pressures is still important to verify the results by these methodologies . takagi and his colleagues ( takagi & sanders , 2002 ; takagi & wilson , 1999 ; tsunokawa , nakashima , sengoku , tsubakimoto , & takagi , 2014 ) have developed a methodology to estimate fluid dynamic forces acting on a hand or foot during swimming by pressure distribution measurement . the pressure measurements ( takagi & sanders , 2002 ) appear to have reliability higher than those from the conventional quasi - steady - state method ( berger , de - groot , & hollander , 1995 ; schleihauf , 1979 ) and are useful to validate the results computed using cfd . nakashima et al . ( nakashima & takahashi , 2012a , 2012b ) developed an underwater robotic arm that has five degrees of freedom to perform the various complicated limb motions that occur during swimming . using the robotic arm , unsteady fluid force actions on a hand or a foot were directly measured , and the resulting data were analysed with swum to improve the computational results . nakashima and his group also developed a humanoid robot ( chung & nakashima , 2013a , 2013b ) , which was designed to be able to perform the motion of the front crawl autonomously in a swimming pool . after various improvements , the humanoid robot could swim by itself at 0.20.24 m s ( figure 7 ) . using this approach , we may expect to understand the mechanisms by which unsteady fluid forces develop , and thereby make recommendations to increase speed . takagi collaborated with nakashima and matsuuchi to measure pressures using pressure sensors and flow field measurement by piv during a simple 2d motion of a robotic arm in water , to understand the interactions among pressures , forces and the flow field ( takagi , nakashima , ozaki , & matsuuchi , 2013 ) . they concluded that when the maximum resultant force acted on the hand , a pair of counter - rotating vortices appeared on the dorsal surface of the hand . the vortex attached to the hand increased the flow velocity , which led to a decrease in surface pressure and an increase in hydrodynamic force . takagi et al . ( 2013 ) determined that the drag and lift forces were 72% and 4.8 times greater than the values estimated under steady flow conditions , respectively.figure 7 . overview of swimming motion generation ( chung & nakashima , 2013a , 2013b ) . a frame format of interactions among vortices , induced flow and hydrodynamic forces when maximum resultant fluid forces occurred . v expresses the relative velocity vector towards a hand , and the angle of attack ( ) was equivalent to approximately 80. when the hand starts at such a high angle of attack , the rapidly increasing circulation does not remain bound to the hand but rather forms an attached vortex on the leading edge . as swimming proceeds , the leading - edge vortex is eventually shed from the hand . this shedding is known as von karman vortex shedding , and its magnitude of circulation is denoted by . the shedding vortex induces a jet flow between the dorsal side of the hand and the vortex , which further re - attaches to the thumb side vortex . by kelvin s circulation theorem , the magnitude of circulation about the attached vortex on the dorsal side increases with an increasing negative value of the shedding vortex ( ) . in consequence , the pressure in the dorsal side declines drastically ( takagi et al . , 2013 ) . a frame format of interactions among vortices , induced flow and hydrodynamic forces when maximum resultant fluid forces occurred . v expresses the relative velocity vector towards a hand , and the angle of attack ( ) was equivalent to approximately 80. when the hand starts at such a high angle of attack , the rapidly increasing circulation does not remain bound to the hand but rather forms an attached vortex on the leading edge . as swimming proceeds , this shedding is known as von karman vortex shedding , and its magnitude of circulation is denoted by . the shedding vortex induces a jet flow between the dorsal side of the hand and the vortex , which further re - attaches to the thumb side vortex . by kelvin s circulation theorem , the magnitude of circulation about the attached vortex on the dorsal side increases with an increasing negative value of the shedding vortex ( ) . in consequence , the pressure in the dorsal side declines drastically ( takagi et al . , 2013 ) . although each of the aforementioned methodologies has its own merits , integrating knowledge from each of the different methodologies is necessary , because the information provided by one method can fill the gaps in information provided by other methods or overcome the weaknesses of another method . therefore , we attempt to integrate the results obtained from front crawl analyses because this style of swimming is the most complex stroke and the one most commonly used , that is in training as well as in competition . the integrated approach could be applied to any swimming stroke . sato and hino ( 2003 , 2013 ) performed a 3d cfd simulation for the front crawl stroke of two competitive swimmers using the moving grid approach via the surf code . in their recent work ( sato & hino , 2013 ) , the stroke paths measured by stereo cameras were used for the simulation , and the transient forces acting on a hand were predicted ( figure 9 ) together with the thrust efficiency . in this simulation , all the transient effects ( i.e. acceleration , rotation and curved stroke path ) were taken into account . the code was validated by comparison with measurements for unsteady flow performed by kudo , vennell , wilson , waddell , and sato ( 2008 ) . according to the cfd result for ian thorpe ( figure 9(a ) ) , a successful competitive swimmer , when he was advancing at 1.84 m s , the mean resultant force , mean thrust force and thrust efficiency generated by his hand were 63.9 n , 32.4 n and 50.7% , respectively ( sato & hino , 2013 ) . of particular note was an upsweep phase in the latter part of the stroke so that the generated resultant force of his hand contributed to propulsion with zero waste , as shown in figure 9(a ) and , interestingly , links to the high elbow technique as contributing to his efficiency ( adams , 2000).figure 9 . . strokes of ian thorpe ( a ) and peter van den hoogenband ( b ) at 175 m in a race of 200 m ( sato & hino 2013 ) . strokes of ian thorpe ( a ) and peter van den hoogenband ( b ) at 175 m in a race of 200 m ( sato & hino 2013 ) . to assess the effectiveness of the high elbow technique , nakashima et al . ( 2012 ) studied computationally the optimal arm strokes during front crawl that maximise the propulsive efficiency and swimming speed . for this objective , an optimisation method that consisted of a random search and the particle swarm optimisation algorithm ( eberhart & kennedy , 1995 ) was constructed . to consider the muscle strength characteristics of the swimmer as the constraint condition of the optimisation , maximum joint torques obtained experimentally for various joint angles and angular speeds provided a database to perform the optimisation calculation . the results showed that optimal ( maximum ) propulsion efficiency occurred when the stroke cycle was 1.3 s. the efficiency reached about 29% as shown in figure 10(a ) . the locus of the hand tip drew the so - called s - shaped curve ( as viewed from above ) and the illustrations of whole body motion demonstrated high elbow technique as shown in figure 10(b ) . in this case , the swimming speed reached 1.71 m s. these results are in close agreement with finalists average values in the men s 200 m freestyle in the 10th fina world championships of 2013 in barcelona which were 1.37 s for the stroke cycle and 1.78 m s for the swimming speed . the optimal ( maximum ) swimming speed occurred when the stroke cycle was 0.9 s ( red line in figure 10(c ) ) . in this case , the locus of hand tip appeared i - shaped rather than the close match between simulation outcomes and swimmers actual techniques in practice is encouraging.figure 10 . ( a ) relationship between stroke cycle time ( t ) and propulsive efficiency ; ( b ) bottom view ( left ) and side view ( right ) of swimming motions at maximising propulsive efficiency ( t = 1.3 s ) ; and ( c ) loci of left hand tip for various stroke cycles at maximising swimming velocity while the stroke cycle time ( t ) varied from 0.8 to 1.3 s ( nakashima et al . , ( a ) relationship between stroke cycle time ( t ) and propulsive efficiency ; ( b ) bottom view ( left ) and side view ( right ) of swimming motions at maximising propulsive efficiency ( t = 1.3 s ) ; and ( c ) loci of left hand tip for various stroke cycles at maximising swimming velocity while the stroke cycle time ( t ) varied from 0.8 to 1.3 s ( nakashima et al . , 2012 ) . hand paths , takagi , nakashima , ozaki , and matsuuchi ( 2014 ) performed measurements for a hand attached to a robotic arm with five degrees of freedom , and the hand and arm were independently controlled by a computer . they directly measured forces on the hand , as well as pressure distributions ; underwater flow fields near the hand were obtained via 2d piv . the first is an unsteady lift force generated when the hand changed direction when scribing the s , leading to vortex shedding and the creation of a bound vortex around it . this bound vortex circulation results in a lift force that contributed to thrust in the swimming direction . the second is the generation of a krmn vortex street when the hand moved linearly with a large angle of attack when scribing the when the vortices in this street are shed , a drag force was produced that contributed to the thrust . thus , it may be concluded that professional swimmers can benefit from both an s-shaped hand path and an i-shaped hand path.figure 11 . s shaped ( upper panel ) and i shaped ( lower panel ) . by the end of insweep in s shaped , a clockwise vortex has formed near the thumb . as the hand changes from insweep to upsweep , this vortex sheds , forming a counterclockwise - bound vortex around the hand . this circulatory flow combines with the thrust , producing lift on the hand . in i shaped , near the middle of the motion at which the thrust is maximum , a krmn vortex street has formed from which clockwise and counterclockwise vortices are alternatively shed from the hand . at this point , the pressure difference between the dorsal and palm sides of the hand are large , producing drag that contributes to the thrust ( takagi et al . , 2014a ) s shaped ( upper panel ) and i shaped ( lower panel ) . by the end of insweep in as the hand changes from insweep to upsweep , this vortex sheds , forming a counterclockwise - bound vortex around the hand . this circulatory flow combines with the thrust , producing lift on the hand . in i shaped , near the middle of the motion at which the thrust is maximum , a krmn vortex street has formed from which clockwise and counterclockwise vortices are alternatively shed from the hand . at this point , the pressure difference between the dorsal and palm sides of the hand are large , producing drag that contributes to the thrust ( takagi et al . , 2014a ) . in the quasi - static approach to estimate forces produced by a hand ( berger et al . , 1995 ; schleihauf , 1979 ) , only hand speed and orientation to the flow were considered . however , by measuring forces acting on an accelerating hand sanders ( 1999 ) showed that accelerations have large effects on the total force and so must be considered in addition to the instantaneous speed when estimating forces from time records of hand motion . recently , this work has been extended by kudo , vennell , and wilson ( 2013 ) who investigated the effect of hand acceleration on force generation during the front crawl arm motion . using a hand forearm model attached to a triaxial load cell , they determined that the hydrodynamic forces acting on an accelerating hand varied between 1.7 and 25 times the forces on a non - accelerating hand calculated by the quasi - steady - state method ( figure 12 ) . they also found irregular oscillations in the forces produced by an accelerating hand and proposed that these were due to vortex shedding from the side of the little finger or the thumb . ( a ) drag force acting on the hand ( d ) ; ( b ) transverse lift force acting on the hand in the x direction ( lt ) ; and ( c ) lift force in the dorsal direction acting on the hand perpendicular to the drag and transverse lift forces ( ld ) in the flowing flume set at 1.5 m s. in ( a ) , ( b ) and ( c ) , the empty circles ( ) represent hydrodynamic forces on the hand measured during acceleration , and the filled circles ( ) represent hydrodynamic forces calculated for a non - accelerating hand . the hands in the figures show orientations , while the arrow with the hand represents the direction of the hydrodynamic force acting on the hand at the respective ( kudo et al . , 2013 ) . ( a ) drag force acting on the hand ( d ) ; ( b ) transverse lift force acting on the hand in the x direction ( lt ) ; and ( c ) lift force in the dorsal direction acting on the hand perpendicular to the drag and transverse lift forces ( ld ) in the flowing flume set at 1.5 m s. in ( a ) , ( b ) and ( c ) , the empty circles ( ) represent hydrodynamic forces on the hand measured during acceleration , and the filled circles ( ) represent hydrodynamic forces calculated for a non - accelerating hand . the hands in the figures show orientations , while the arrow with the hand represents the direction of the hydrodynamic force acting on the hand at the respective ( kudo et al . by reviewing these studies , we have found two important issues relating to swimming research : a mechanism of generating unsteady fluid forces and a theory to enable faster and more efficient swimming . for the generation of unsteady fluid forces , vortex generation plays an important role . according to the results of kudo et al . ( 2013 ) , irregular oscillations occur in the hydrodynamic forces while the hand is accelerating . ( 2014 ) suggested that these oscillations were caused by a krmn vortex street , that is a phenomenon when clockwise or counterclockwise vortices were alternately shed from the side of the little finger or the thumb . such krmn vortex street is known to be generated when the hand moves in a linear manner with a large angle of attack as in the i - shaped stroking pattern . at that time , the pressure on the palm side becomes positive , while that on the dorsal side becomes negative , and the pressure difference between the palm and dorsal sides increases , producing a drag force ( upper panel in figure 11 ) . another mechanism has been suggested to contribute to the generation of unsteady lift forces , for example by changing the leading edge of the hand ( takagi , nakashima et al . , 2014 ) . when the leading edge changes from the side of the thumb to the little finger , the direction of the bound vortex of the hand changes from clockwise to counterclockwise because of a shedding vortex from the side of the thumb . by adding this circulation to the moving velocity , the surface velocity increases , the surface pressure decreases and a lift force is produced ( lower panel in figure 11 ) . this phenomenon has been confirmed by experiments which measured the velocity field during front crawl with 3d motion analysis ( matsuuchi & muramatsu , 2011 ) ; thus , excellent swimmers also gain propulsion from this unsteady lift force . in terms of a theory for swimming faster or more efficiently , the results of nakashima et al . increasing stroke frequency ( f s ) is essential to increase swimming speed ( u s ) , which is consistent with the results of craig and pendergast ( 1979 ) who found that u s is proportional to f s. however , a swimmer can not , of course , increase f s limitlessly because of a limitation of muscle power or stroke coordination . ( 2012 ) also found that u s decreased conversely when f s exceeded the optimum frequency because of the muscle strength characteristics , that is the swimmer in the simulation could not produce a large joint torque during a motion that could exceed a certain threshold . for the fastest case , the stroke pattern appears to be the so - called i - shaped stroke . therefore , in the 50 m or 100 m freestyle event in which speed is more important than efficiency , it might be better for a swimmer to increase f s by using a alternatively , to improve propulsion efficiency , a swimmer should use a high elbow and scribe an by reviewing the available literature , both numerical and experimental , relating to swimming , we have seen that studies based on the cfd approach have the potential to provide new insights and to provide information that can not be obtained by testing and measurement . similarly , swum simulations offer practical benefits to coaches and swimmers by providing information regarding the optimal movements for improved training and performance . in addition , piv measurements play a vital role in verifying results from numerical simulations . furthermore , applying a combination of these methods will be a powerful tool to further advance research in swimming .

until 2012 , the morbidity of diabetes in the world had reached 6.4% , which seriously affected our normal life and 80%90% of the diabetes was type 2 diabetes mellitus ( t2 dm ) . furthermore , diabetes with sustained elevated blood glucose would destroy multiple organs ; it may cause diabetic foot , diabetic nephropathy , cerebrovascular disease , heart disease , skin disease , and so on . so it had no time to delay for us to overcome the diabetes , especially t2 dm . t2 dm was characterized by insulin resistance and regression of -cell . in recent years , glucagon - like peptide 1 ( glp-1 ) , which was secreted from intestinal l cells , had been reported to decrease blood glucose [ 4 , 5 ] , increase insulin secretion , and improve the damage of -cell . liraglutide as a kind of glp-1 analogue expressed 97% homoousia for amino acid sequences with glp-1 of human . and it had been reported that liraglutide could dose - independently enhance glucose - dependent insulin secretion without causing hypoglycemia , which indicated an insulin - like effect on t2 dm , decreased postprandial glucose levels , improved glycemic control , and lowered insulin dose in patients with t2 dm . protein tyrosine phosphatase 1b ( ptp1b ) was a novel target for t2 dm and had been proved to play a vital role in the negative regulation of insulin signal transduction . phosphatidylinositol 3-kinase ( pi3k ) , protein kinase b-2 ( akt2 ) , and glucose transporter type 4 ( glut4 ) played an important role in insulin transduction . the expression of glut4 and phosphorylation of akt2 were quite associated with t2 dm [ 11 , 12 ] . all of those signal molecules mentioned above were confirmed to be closely related to insulin transduction . however , whether liraglutide produces antidiabetic effects through these signal pathways remained unclear . we had ever reported the effect of liraglutide on blood glucose levels with oral glucose tolerance test ( ogtt ) and insulin tolerance test ( itt ) and glycogen , which showed that liraglutide could improve glucose metabolism and insulin resistance . more rapid increase and persistent decrease of blood glucose level in liraglutide and control groups were observed and the area under the curve ( auc ) of ogtt was significantly lower than kkay mice . in addition , fasting blood glucose ( fbg ) of itt in control and liraglutide groups was persistently decreased after 40 min since insulin injection , whereas glucose levels in kkay mice were elevated . meanwhile , the auc of itt in liraglutide and control groups had a significant decrease compared to kkay mice . the level of skeletal muscle glycogen was significantly lower in diabetic model mice , compared with normal mice ; however , liraglutide treated diabetic mice had greatly increased skeletal muscle glycogen levels , similar to the normal group . it was reported that diabetes would cause kidney , skeletal muscle , and liver damage , and mitochondria injury . therefore , we investigated whether liraglutide could improve tissue damage and mitochondria injury . in this study , we observed the ultrastructure and micrographs of mitochondria and myofibril and aimed to determine whether liraglutide could improve myofibril damage and mitochondria injury and the relationship with the pi3k / akt signaling pathway . the study protocols were approved by the ethics committee on the care and management of experimental animals in xi'an jiaotong university , xi'an , china . 1113-week - old male kkay mice ( n = 12 ) and the same age male c57bl/6j ( c57 ) mice ( n = 6 ) were purchased from the chinese academy of medical sciences ( beijing , china ) . all the mice were individually housed in cages at a temperature of 2022c , a humidity of 45%55% with specific pathogen - free ( spf ) environment , and a 12 h light and 12 h dark cycle . high - fat chow with 6% fat from beijing hfk bioscience company was supplied to kkay mice and the c57 mice were given ordinary rodent diet . the mice with fbg values > 16.7 mmol / l were randomly divided into liraglutide group ( n = 6 , treated with 250 g / kg / day liraglutide subcutaneous injection , provided by novo nordisk ) and model group ( n = 6 , treated with equivalent volume of normal saline ) . the male c57 mice ( n = 6 , treated with equivalent volume of normal saline ) were considered as the control group . all the mice were treated for 6 weeks between 16:00 and 16:30 pm each day . one was fixed in 10% formalin for hematoxylin - eosin ( he ) staining and one was immersed in stationary liquid for electron microscope assays . the third was immersed into tripure rna isolation reagent ( roche , basel , switzerland ) and reserved at 4c for real time - pcr examination . the fourth was frozen in liquid nitrogen for 1 minute and then stored at 80c for western blot analysis . for electron microscope , each muscle fraction of 1 mm 1 mm 1 mm was fixed in 2.5% glutaraldehyde in 0.1 mol / l cacodylate buffer and postfixed in 2% osmium tetroxide . after being dehydrated in grade ethanol , the ultrathin sections , placed on 200 mesh copper grids , were stained with uranyl acetate and lead citrate . individual mitochondrial area , mitochondrial area/100 m , and mitochondrial number/10 m were determined by analyzing ten images taken at 20000 magnification , similar to methodologies . total rna was isolated from mouse skeletal muscle using the tripure rna isolation reagent , and two micrograms of rna were reverse - transcribed using the prime script rt master mix ( perfect real time ) ( takara bio , inc . quantitative real - time pcr was performed using sybr premix ex taq ii ( perfect real time ) ( takara bio , inc . , pcr reactions were performed in 96-well plates in an iq5 real - time pcr detection system ( bio - rad laboratories , hercules , ca ) . all the primers and probes for real - time pcr were obtained from takara bio . the specific primers were as follows : ptp1b , 5-cac agt acg aca gtt gga gtt gga a-3 ( forward ) and 5-cag gcc atg tgg tgt agt gga-3 ( reverse ) ; pi3 k , 5-gct cct gga agc cat tga gaa-3 ( forward ) and 5-cgt cga tca tct cca agt cca c-3 ( reverse ) ; glut4 , 5-tct tat tgc agc gcc tga gtc-3 ( forward ) and 5-gcc aag cac agc tga gaa tac a-3 ( reverse ) ; gapdh , 5-tgt gtc cgt cgt gga tct ga-3 ( forward ) and 5-ttg ctg ttg aag tcg cag gag-3 ( reverse ) . efficiencies of real - time pcr for the target gene and the endogenous control were approximately equal . ct expresses the difference between number of cycles ( ct ) of the target genes and the endogenous control . results were expressed as 2 and express the x - fold increase of gene expression compared to control group . the standard curve and data analysis were produced using bio - rad iq5 software ( bio - rad laboratories , hercules , ca ) . 100 mg skeletal muscle tissue from mice was ground manually in 1 ml radio - immunoprecipitation assay ( ripa ) lysate . we got the supernatant by centrifuging the samples at 12000 g for 20 min at 4c and determined the protein concentration of the supernatant by bicinchoninic acid ( bca ) protein assay kit . proteins ( typically 50 g / lane ) were separated by 10% sds - page gel and transferred to pvdf membranes ( millipore , ma , usa ) . then we blocked the membranes with 5% nonfat milk , incubated them with primary antibodies and hrp conjugated secondary antibodies , and detected bands using chemiluminescence substrate reagents ( thermo , usa ) . primary antibodies for ptp1b , pi3k ( p85 ) , akt2 , and glut4 were all purchased from abcam ( abcam , cambridge , uk ) , phospho - akt2 ( p - akt2 , ser474 ) from cell signaling technology ( cst , bostin , usa ) , and -actin from santa cruz biotechnology ( santa cruz , ca , usa ) . -actin was used to normalize the result of each sample . significant differences between the two groups were evaluated by independent sample t - test and anova . analysis of he stained sections from skeletal muscle showed myofibril with clear cross striation and regular cross sections in normal c57 mice ( figure 1(a ) ) . in kkay mice , we observed atrophic and abnormal myofibril . furthermore , cross striation of diabetic muscle became fuzzy and some even disappeared ( figure 1(b ) ) . as shown in figure 1(b ) , a mass of vacuoles appeared in muscle and the nucleus increased . the image of liraglutide treated diabetic mice ( figure 1(c ) ) showed clearer cross striation and less atrophic myofibril , compared with the diabetic mice . from the micrograph ( figure 2(a ) ) , we observed no abnormal structural alteration in the skeletal muscle of the c57 mice . also , density and a large number of mitochondria with clear cristae were examined in figure 2(d ) . we could also see more lipid droplets in diabetic mice , compared with normal mice ( figure 2(b ) ) . as shown in figure 2(e ) , vacuolated , disarranged , and swollen mitochondria clusters were observed in skeletal muscle of diabetic mice . the abnormal arrangement of myofibril was improved after 6-week treatment with liraglutide in diabetic kkay mice ( figure 2(c ) ) . the increased number and regular arrangement of the mitochondria in liraglutide treated diabetic mice were the biggest change we observed ( figure 2(f ) ) . histologically , mitochondria abnormalities in liraglutide treated mice were improved largely , compared with those with diabetic mice . compared with diabetic kkay mice , individual skeletal muscle mitochondrion area in liraglutide treated mice was + 113% larger ( p < 0.01 ) ( figure 3(d ) ) , while mitochondrial area/100 m in liraglutide treated mice was + 396% larger ( p < 0.01 ) ( figure 3(e ) ) . the mitochondrial number/10 m in liraglutide treated mice was markedly increased ( + 441% ; p < 0.01 ) ( figure 3(f ) ) . the gene expression of ptp1b in skeletal muscle was shown in figure 4(a ) . compared with the model group , the control group had a significantly lower ptp1b gene expression level ( p < 0.05 ) . furthermore , we assessed the effects of liraglutide on pi3k and glut4 gene expression in model group . pi3k ( figure 5(a ) ) and glut4 ( figure 7(a ) ) gene expression was significantly increased in the control group compared with the diabetic model mice ( p < 0.05 ) . although the level of glut4 and pi3k in liraglutide group had no significant increase , the expression was higher than model group . to evaluate the mechanisms of liraglutide on antidiabetic effect , the major proteins in ptp1b and pi3k / akt signaling pathway were assessed using western blot after treatment with liraglutide for 6 weeks . ptp1b in the control and liraglutide groups was downregulated significantly when compared with the model group ( p < 0.01 ) ( figure 4(b ) ) . the level of pi3k had significant difference between liraglutide group and the model group ( p < 0.01 ) ( figure 5(b ) ) . in addition , p - akt2/akt2 in skeletal muscle was significantly increased in liraglutide group , compared with nontreated model group ( p < 0.01 ) ; however , akt2 protein expression did not change ( figure 6 ) . moreover , glut4 was significantly upregulated in the control and liraglutide groups compared with the model group ( p < 0.01 ) ( figure 7(b ) ) . as a novel glp-1 analogue , liraglutide had been used to treat diabetes since 2009 and was also reported to have the effect of improving glycemic control in diabetic mice , which decreased the occurrence of hyperglycemia . in our previous results , we had demonstrated that liraglutide could increase glycogen level and further improve glycometabolism . thus , to further assess these mechanisms of liraglutide in skeletal muscle , we examined pi3k / akt signaling pathway , a classic pathway which was vital for diabetes study , after he et al . studied diabetic cardiomyopathy , cao et al . studied glucose homeostasis , and zhang et al we examined the mrna expression of ptp1b , pi3k , and glut4 in skeletal muscle by real - time pcr to determine whether liraglutide produced antidiabetic effects through these signal molecules . protein expression of the above molecules and p - akt2/akt2 in skeletal muscle was also measured by western blot . ptp1b was a major molecule in insulin signal transduction [ 13 , 24 ] and was reported to negatively regulate insulin transduction by dephosphorylating ir and irs . several reports had demonstrated that pi3k was a member of insulin signaling system [ 26 , 27 ] , along with insulin receptors ( ir ) and insulin receptor substrates ( irs ) , and was modulated by them . therefore , the change of the level of ptp1b was associated with the expression of pi3k ; that is , ptp1b was able to indirectly regulate the expression of pi3k . this was the first time to assess whether liraglutide could modulate insulin signaling pathway through influencing ptp1b . in this study , administration of liraglutide in diabetic mice significantly decreased the ptp1b expression along with higher pi3k expression compared with the diabetic group treated with equivalent volume of normal saline . decreased level of ptp1b demonstrated that liraglutide exerted antidiabetic effect in skeletal muscle by reducing the expression of ptp1b . they discovered that ptp1b was significantly higher in diabetic subjects compared with the subjects without diabetes . in addition , another report with mice of knockoff of ptp1b found an effect of antidiabetes . previously , pi3k , as an important molecule in insulin signaling pathway , had been found to play a vital role in diabetes [ 30 , 31 ] . and so many people discovered it in their study , which was associated with diabetes . yang et al . examined the level of pi3k in db / db mice by western blot and elisa , showing that diabetes - induced suppression of pi3k may be related to oxidative stress . in addition , sato - miyata et al . determined the expression of pi3k to prove the damage of high level insulin in drosophila . in this study , we also investigated pi3k and found that liraglutide enhanced the expression of pi3k in skeletal muscle tissue significantly , suggesting that liraglutide may be able to improve insulin transduction through the pi3k / akt signaling pathway . these findings were in accordance with the study in liver tissue of diabetic mice , showing that pi3k was decreased in diabetic rats compared with normal rats . akt2 , as an isoform of akt , played a central role in insulin signaling and glucose metabolism . it was all known that akt2 was regulated by the activity of pi3k in skeletal muscle tissue . significant increase in p - akt2/akt2 ratio was observed in normal mice compared with diabetic mice , which proved that akt2 was a major modulator of diabetes . previous studies also studied the expression and the activity of akt2 in diabetic mice . to investigate the effect of garlic on cardiac complications in diabetic rats , padiya et al . examined the level of p - akt2/akt2 ratio by western blot . sajan and farese studied the protein level of akt2 in hepatocytes of type 2 diabetic humans to prove the importance of protein kinase c-1 in insulin signaling . as shown above , there had been several reports that argued the relationship between diabetes and akt2 . so , to determine the mechanisms of antidiabetic effect of liraglutide , we investigated the expression of akt2 in diabetes treated with liraglutide . we found that the p - akt2/akt2 ratio had a significant increase in liraglutide treated diabetic mice compared with diabetic mice . in addition , the increased p - akt2/akt2 ratio led to the enrichment of glut4 . investigation of the mechanisms of liraglutide to protect against t2 dm was examined by studying the levels of molecules in the pi3k / akt signaling pathway . the data from the real - time pcr and western blot indicated that glut4 was enhanced significantly with liraglutide treatments in comparison to diabetic mice . shih et al . discovered glut4 in skeletal muscle was greater in medicated groups than diabetic group . their results revealed the relationship between hypoglycemic effect of cne and glucose uptake in skeletal muscle . the action of glut4 in inflammation was destroyed in diabetes . as the insulin downstream effector , the deficiency of glut4 was considered closely related to the function of podocyte in diabetic nephropathy mice . their data indicated that glut4 deficiency could protect mice from diabetic nephropathy . in spite of the fact that the effect of liraglutide on the quality of mitochondrial ultrastructure had been studied by schwasinger - schmidt et al . , little had been done to discover the role of liraglutide on the other respect of mitochondria . in our study , we observed that all of the individual mitochondrial area , mitochondrial area/100 m , and mitochondrial number/10 m in skeletal muscle were significantly increased in mice treated with liraglutide when compared with the diabetic mice in a model group . our study showed that lipid droplets in skeletal muscle were decreased , similar to the conclusion above . in addition , liraglutide greatly ameliorated atrophy and derangement of myofibrils and sarcomere . from these results , we revealed that liraglutide , a protective drug for t2 dm , could improve the damage of mitochondria from the number and area and ameliorate myofibril damage and accordingly suppress oxidative stress . in conclusion , our data indicated a strong link between liraglutide and ptp1b as evidenced by its effect on diabetes . we found that liraglutide caused downregulation of ptp1b and upregulation of pi3k , p - akt2/akt2 , and glut4 and eventually led to the improvements of myofibrils and mitochondrion in skeletal muscle . furthermore , glut4 played a vital role in glucose uptake through the differential regulation of ptp1b , pi3k , and akt2 . it revealed that liraglutide could improve myofibril and mitochondria injury in skeletal muscle against t2 dm via ptp1b and pi3k / akt2 signaling pathway .

chronic suppurative otitis media ( csom ) is still the most common ear disease in developing countries . antibiotics in the treatment of otitis media have significantly decreased the incidence of complications ; however , the rate of complication of squamous - type csom is still significant in southeast asia.1 a common complication is acute mastoiditis,2 which may lead to further complication such as abscesses in the neck and brain . among them , bezold abscess comprises 1.3% of complications of csom.2 bezold abscess is defined as a complication of acute mastoiditis when the disease passes inferiorly through the medial aspect of the mastoid tip into the sheath of the sternomastoid muscle . few cases have been reported of further spread of bezold abscess into various other part of the body including intracranial spread . singh et al3 reported a case of anterior chest wall abscess secondary to bezold abscess . similarly , saha et al4 and dodonova and triantafilidi5 reported cases of spread of otogenic abscess to the lung ( lung abscess ) . development of lung abscess can be explained as the progression of later sinus thrombophlebitis and is a serious complication of csom . common signs and symptoms of bezold abscess are fever , otalgia , and swelling at the cervical region , otorrhea , restricted cervical mobility , and hypoacusis . computed tomography ( ct ) is a useful test in this disease , because it allows the identification of pus collections in the cervical region and mastoid involvement.6 this report describes a case of bezold abscess that further spread as scapular abscess and lumber cellulitis as a complication of csom . a 14-year - girl from rural area of nepal presented with foul - smelling purulent left ear discharge of 1-year duration and decreased hearing in same ear of 6-month duration . she developed painful swelling in left cervical area with restricted neck movement and high - grade fever of 3 days earlier . she also complained of swelling over the left scapular area of 1-day duration . on physical examination , the patient was febrile ( 102f ) and with single , diffuse , 8 6-cm swelling in left side of neck ( fig . 1 ) extending from the left mastoid tip to the lower attachment of the left sternomastoid muscle with erythematous overlying skin . otoscopy revealed outer attic wall destruction with cholesteatoma . digital radiography showed air shadow in subcutaneous planes in the left side of the chest . a ct scan revealed air fluid collection in the left mastoid and middle ear cavity ( fig . fluid collection with air foci within was also noted in soft tissue adjacent to left mastoid cavity and extending into neck , suggestive of abscess . ultrasonography ( usg ) of the neck showed multiple enlarged lymph nodes in the left side of neck in a posterior triangle , the submandibular area , along the jugular vein . adjacent soft tissues were edematous with increased vascularity . no definite pocket of collection was noted . left modified radical mastoidectomy with type iii tympanoplasty a small area of defective bone was found at the mastoid tip , through which there were communications between the mastoid cavity and the abscesses in the neck . thick , foul - smelling pus ( 20 ml ) was drained through tip cells and digastric ridge . the patient was kept under broad - spectrum intravenous antibiotics . despite antibiotic therapy , on the second postoperative day scapular swelling increased and the patient developed swelling at left lumber area . usg was repeated , focusing on the left scapular region , which showed a 34.7 8.7 35.3-mm collection in the left scapular region ( fig . then 300 ml of thick foul - smelling pus was drained from the scapular area ( fig . computed tomography scan of temporal bone axial cut showing normal right tympanomastoid area with destruction and clouding of left tympanomastoid area . incision and drainage ( i&d ) of scapular abscess . however , some patients with otitis media develop serious complications due to delay in diagnosis on the part of physicians , inadequate antibiotic therapy , increased bacterial resistance , negligence by the patients , and concomitant presence of cholesteatoma.7 although cholesteatoma is a benign disease histologically , its behavior may be aggressive locally , and its invasive properties are associated with significant bone destruction leading to other complications like mastoid abscess , meningitis , brain abscess , labyrinthitis , and facial nerve paralysis . inflammation and infection may result in necrosis of mastoid process through the digastrics groove . the pus is prevented from reaching the surface by neck musculature but can track along the fascial planes of digastrics or sternomastoid muscle leading to various abscesses like luc 's abscess , citelli 's abscess , and bezold abscess.8 further spread of bezold abscess is extremely rare . singh et al had reported a case of anterior chest wall abscess secondary to bezold abscess.3 the mechanism of spread of bezold abscess to scapular abscess and lumber cellulitis is not known . in case of abscess in any part of body with bezold abscess , csom has to be suspected as one of the primary source of infection .

a stroke is a neurological disease caused by a disturbance in blood supply to the brain1 . it has also been reported stroke patients exhibit a significant decrease in trunk performance as compared with matched healthy individuals4 . although trunk performance is considered to be less affected than those of the upper and lower extremities5 , poor recovery of trunk performance results in severe disability and reduces the activities of daily living2 . in the context of stroke rehabilitation , trunk control is an indispensable basic motor ability for the execution of many functional tasks6 , and convincing evidence indicates trunk performance is an important predictor of functional outcome after stroke7 . some authors have defined trunk performance as the ability to control trunk movement and balance while sitting and standing8,9,10,11 , and a recent study showed clear relations between trunk performance and measures of balance , gait , and functional ability in patients with stroke12 . despite evidence of the importance of trunk performance in stroke rehabilitation , therefore , this study was undertaken to investigate the effect of additional upper extremity exercises on trunk performance in patients with stroke . twenty in - patients at a hospital in the city of busan participated in the study . subjects with chronic stroke of at least 6 month s duration were included in the study if they met the following criteria : 1 ) had unilateral hemiparesis as a result of stroke , 2 ) had a k - mmse ( korean mini - mental state examination ) score exceeding 24 points , 3 ) were able to remain in a sitting position without support , and 4 ) reported no cardiac , respiratory , or neuromuscular condition that would interfere with performing the testing protocol . all participants meeting the inclusion criteria were given verbal and written information on the purpose of this study , and provided written informed consent . prior to initial evaluation , participants were equally allocated by simple randomization to an experimental or a control group . patients in the experimental and control groups received neurological rehabilitation treatment for stroke , which consisted mainly of physical therapy , by the rehabilitation center at our hospital . in addition to neurological rehabilitation treatment , patients in the experimental group received 30 minutes of extra training 3 times weekly for 4 weeks . the additional exercise consisted of movements of the upper extremities and trunk in a sitting position . the exercise was performed in a specific order13 and supervised by a therapist to prevent the patients from falling during all sessions . the tis contains 17 sub - items in three categories : static sitting balance , dynamic sitting balance , and coordination . this tool can be used to evaluate degree of trunk motor impairment after stroke . the highest possible tis score is 23 points , with 07 possible points for static sitting balance , 010 points for dynamic sitting balance , and 06 points for coordination , whereas a higher score indicates better trunk performance14 . the wilcoxon signed - rank test was used to determine whether tis scores changed within each group before and after intervention , and the mann - whitney test was used to determine the significances of intergroup differences . level of significance was set at 5% ( p<0.05 ) , and results are expressed as mean values standard deviations ( sds ) . baseline subject characteristics are summarized in table 1table 1.baseline characteristics of the subjectsexperimental group ( n=10)control group ( n=10)age ( years)56.0 7.259.0 8.4gender ( male / female)6/45/5paretic side ( left / right)3/76/4post - stroke duration ( months)11.6 3.415.0 4.7values are means standard deviation . measured characteristics were no different in the two groups . the results for all outcome measures are provided in table 2table 2.outcome measuresexperimental group ( n=10)control group ( n=10)pre - trainingpost - trainingpre - trainingpost - trainingtrunk impairment scale ( 023)11.3 3.415.9 3.312.4 3.914.8 3.7static sitting balance ( 07)4.9 1.06.5 0.35.9 0.66.4 0.7dynamic sitting balance ( 010)4.1 1.35.7 1.94.3 1.65.0 1.9trunk coordination ( 06)2.7 1.14.9 1.42.8 1.43.1 1.4values are means standard deviation.*p significant vs. post - training ( p<0.05 ) . significant intragroup differences in all items of the tis were observed in both groups after intervention ( p<0.05 ) , and significant intergroup differences were observed between dynamic sitting balance , and trunk coordination , and between total tis scores ( p<0.05 ) ( table 3table 3.between-group comparisonexperimental group ( n=10)control group ( n=10)trunk impairment scale ( 023)4.6 0.32.4 0.4*static sitting balance ( 07)1.6 0.10.5 0.1dynamic sitting balance ( 010)1.6 0.20.7 0.2*trunk coordination ( 06)2.2 0.10.3 0.1*values are mean standard deviation.*p significant between groups after training ( p<0.05 ) ) . values are means standard deviation values are means standard deviation . * p significant vs. post - training ( p<0.05 ) values are mean standard deviation . the purpose of this study was to determine the effect of additional exercises on trunk performance in patients with stroke . patients in both groups received neurological rehabilitation treatment for stroke , but patients in the experimental group also received 6 hours of bilateral upper extremity activities as additional exercise over a 4-week period . bilateral upper extremity activities require that unaffected upper extremities guide affected upper limbs in order to improve mobility and trunk control in affected sides15 . researchers have also reported that bilateral upper extremity activities reduced stiffening of damaged arms and associated reactions during passive movements , and induced symmetrical movements to activate trunk activity16 . hodges et al . observed that trunk muscles are activated before movement of upper extremities17 , and lehman et al . significant intragroup differences were found for total tis scores and all three tis subscales in the experimental and control groups after intervention , which indicates neurological rehabilitation treatment and bilateral upper extremity activities can effectively improve trunk performance in stroke patients . it was also found that bilateral upper extremity activities aimed at improving trunk performance resulted in short - term improvements above those achieved by neurological rehabilitation treatment alone , in dynamic sitting balance , trunk coordination , and total tis scores . these findings are consistent with previously published results that trunk control in stroke patients affects tis subscales associated with dynamic balance and coordination20 . indicated that limitation of compensatory trunk movement may be an essential element during task - related training of upper extremities particularly for chronic patients with hemiparesis21 , and bilateral upper extremity exercise was suggested to decrease the need of trunk involvement22 . it was also demonstrated that bilateral upper extremity training had beneficial effect on reducing trunk compensation23 . first , the small sample size prevents the generalization of results to all stroke patients , and thus , we suggest further larger scale studies be undertaken to confirm our results . second , neither the patients nor the physiotherapist that administered the interventions were blinded , which may have introduced bias . third , we only analyzed the data obtained at pre- and 4-week post - treatment assessments . future studies are required to evaluate the long - term effects of additional bilateral upper extremity activities . finally , our control group did not receive placebo therapy , and therefore , received less therapy than the experimental group . nonetheless , our findings suggest bilateral upper extremity activities , in addition to trunk exercises , have a significant beneficial effect on trunk performance in stroke patients .

to form a lbl in nanochannels of dimensions on the order of 100 nm , we first deposited lipid vesicles in the microchannels , allowed them to rupture , and then let the formed lbl spontaneously spread into the nanostructures ( figure 1a ) . we thus formed a uniform lbl in the nanochannels without introducing any vesicles into the channels . by imposing a counter flow of buffer ( 80 m / s ) opposite to the direction of the lbl spreading ( see supporting information ) , we ensured that no lipid vesicles or debris entered into the nanochannels during the formation of the lbl . this approach was used for all data presented in this work with the exception of that presented in figure 2a where the flow was in the direction of the lbl propagation in order to enable a partially lipid - covered surface . the spreading of the lbl front was characterized by fitting a power law to the progression of the lbl ( figure 1b ; see supporting information ) and was found to be consistent with surface - energy driven lipid spreading . to confirm the fluidity and continuity of the lbls that are formed , we characterized the lipid coating using fluorescence recovery after photobleaching ( frap ) ( see supporting information ) . after photobleaching , the fluoroescence in the bleached area recovers fully in approximately 1 h due to the replacement of the bleached molecules by an influx of molecules from areas that were not exposed to light ; figure 1c shows how the bilayer , as expected , recovers along the nanochannels only . a rough estimate of the lipid diffusion coefficient is d 1 m / s ( see supporting information ) , which is in good agreement with previously reported values ( 1.42 m / s ) for dhpe - rhodamine in popc bilayers . lipid passivation of micro- and nanochannels . ( a ) schematic overview of the device . four microchannels are used to bring in reagents to the nanofluidic structures in the center . in the illustrated scenario the right microchannel contains lipid vesicles and is coated with a lbl that spreads against a fluid flow into the nanochannels and the slit . solid line : averaged position of the progressing front of the lbls in 90 nanochannels ( 150 110 nm ) , as shown in the images . dashed line : power - law fit to the experimental data . the three images are recorded at times indicated by the arrows along the axis . solid line : time dependence of the fluorescence of the center of a photobleached spot ( 10 m radius ) in an array of 150 110 nm nanochannels , coated with a fluorescent lbl . the four images are recorded at times indicated by the arrows along the axis . to evaluate the usefulness of lbls as a passivation coating , we introduce three types of samples into our devices : streptavidin - coated quantum dots ( streptavidin - qds ) , fluorescently labeled reca proteins and reca dna complexes . bright streptavidin - qds allowed us to evaluate any deficiencies in the ability of lbls to prevent nonspecific protein binding , for example , due to small voids in the bilayer . streptavidin - qds were used because they provide a clear fluorescence signal for the presence of the streptavidin and because they are commonly used for labeling various types of biomolecules . the streptavidin molecules thus addressed the passivation capabilities of the lbl , while the bright fluorescence from the qds pinpointed where any defects were located . the streptavidin - qds were introduced into a nanofluidic chip consisting of a nanoslit ( horizontal ) and several nanochannels ( vertical ) , both partially coated with a lbl ( figure 2a ) . the channels were flushed with streptavidin - qds and subsequently with buffer . while the streptavidin - qds to a large extent stick to the noncoated part , there is almost no sticking to the lbl - coated part of the nanostructure . sporadic streptavidin - qd binding can be seen , but binding to the few available defect sites saturates quickly and at low concentrations , which indicates that the streptavidin - qds are bound to static defects in the lbl . freely diffusing streptavidin - qds were also observed in the lbl - coated structures in the absence of flow ( see supporting information ) , demonstrating the effectiveness of the lbl coating . to compare the performance of the lbl passivation to that of standard passivation schemes , we characterized the sticking properties of streptavidin - qds in nanochannels prepared according to standard protocols with bsa . bsa is a routine passivation agent in microfluidics and has been used in studies of dna protein interactions in nanochannels . in figure 2b , c the results of passivation of nanochannels with bsa and lbl , respectively , are compared . for the bsa - coated nanochannels ( for details on the coating see experimental section and supporting information ) streptavidin - qds can be readily flushed into the chip , but a significant number of them remain stuck to the channel walls ( more than 400 streptavidin - qd per 100 m , figure 2b ) even after thorough washing with buffer . in contrast , coating the nanochannels with a lbl leads to a significantly lower density of stuck streptavidin - qds ( less than 1 streptavidin - qd per 100 m , figure 2c ) after washing . the corresponding number for uncoated channels , determined from figure 2a , is on the order of 10 streptavidin - qds per 100 m , which completely blocks the nanochannels . we would like to emphasize that while the lbl spreads as a single entity and relies on the formation of a lbl in the microchannels , the bsa coating relies on single monomers entering the nanochannels and binding randomly to the surface , which in turn leads to a more uneven coating with more defects , as demonstrated by our streptavidin - qd experiments . in the experiments above , the relative performance of the lbl - coated nanostructures is underestimated since they allow a more concentrated flux of streptavidin - qds than both the bsa - coated channels and the noncoated channels . ( a ) fluorescence micrograph of a nanoslit in the center and arrays of nanochannels in the upper and lower right - hand side corners ( see the schematic in the inset ) partially coated with a lbl ( red ) . note that in this case , in order to enable the patterning of the lbl , the lbl was introduced with the flow of the vesicles . bright green spots , corresponding to bound streptavidin - qds , clearly indicate the propensity of nonspecific binding to the uncoated areas and , by contrast , show that the number of defects in the lbl is very low . ( b ) fluorescence micrograph of streptavidin - qds ( green ) in an array of bsa - coated nanochannels . ( c ) fluorescence micrograph of streptavidin - qds ( green ) in an array of lbl - coated nanochannels ( red ) . the cross - sectional dimensions of the nanochannels are ( a ) 150 120 nm and ( b ) and ( c ) 100 150 nm . the nanostructures have been flushed with a streptavidin - qd solution and subsequently thoroughly washed with buffer . lipid - coated nanochannels are potentially a powerful tool to directly visualize the organization and the dynamics of protein dna complexes . a key requirement for these types of experiments is that the dna can move freely in the channels . therefore , we first rule out any obstructions in the nanochannels or any nonspecific sticking of the dna to the lipids by introducing fluorescently stained -phage dna into the nanochannels ( see movie in supporting information ) . to demonstrate the antifouling properties of the lbl , we introduce a solution containing fluorescently labeled reca proteins and nonstained -phage dna into the chip ( figure 3 ) . reca is a prokaryotic enzyme that catalyzes dna strand - exchange reactions during homologous recombination and has a role in stimulating dna repair . reca proteins that are not dna bound are small , and diffuse fast in the microchannels , reaching the nanochannels first . flushing the proteins through the nanochannels , starting in the lbl - coated end , reveals that while the proteins do not stick to the lbl - coated part , the untreated nanochannels light up quickly due to adsorption of the fluorescently tagged protein ( figure 3b ) . dna complexes can be seen to readily move in the lipid - coated nanochannels while they stick immediately upon contact with the untreated nanochannel ( figure 3c ) . lipid bilayer prevents sticking of reca protein in nanochannel ( 400 150 nm ) arrays . ( a ) lbls , labeled with rhodamine - dhpe , coating the right - hand half of the channels , observed at 540 nm excitation wavelength . ( b ) reca proteins , observed at a 475 nm excitation wavelength , are flushed through the device and absorbed where there is no lbl . note that ( a ) and ( b ) are recorded at the exact same location on the chip . ( c ) reca bound to dna approaching from the right in lipid - bilayer treated channels toward the untreated channels . the untreated channels are clearly visible to the left with their nonspecifically bound fluorescently stained reca proteins . arrows indicate the direction of the fluid flow driving the motion of the dna . dna complex is immediately bound once it makes contact to the untreated channels . as an example of a dynamic process that we can observe in our devices , we demonstrate the activity of a working enzyme in the nanochannels by introducing -phage dna in lbl - passivated nanochannels together with dnase i , an enzyme that cuts dna at random locations . to be able to observe the actual cutting of the dna , we introduced the dna and the enzyme separately at different ends of the nanochannels . the dna encounters the enzyme within the nanochannel , and because of the low concentration of the enzyme , individual cutting events are observed ( figure 4a , b ) . the dna is typically entirely degraded within a time span of 10 s. this corresponds to the expected diffusion time of the enzyme along the length of the -phage dna in the channel , consistent with the known fast reaction kinetics of dnase i. as a negative control we rule out any significant contribution of photonicking to the degradation of the dna by a comparison with dna in nanochannels without enzyme ( figure 4c ) . ( a , b ) two examples of -phage dna in a nanochannel encountering dnase i enzymes . -phage dna in a lipid - coated nanochannel without dnase i. the process of forming the lbl and the lbl itself is very robust . the lbl can withstand shear rates that significantly exceed what is typically relevant for dna - related applications , as evidenced by the counter flow rates used during the lbl coating in our experiments ( with shear rates at the surface 6 10 s ) and as reported in the literature on the shear - induced motion of lbls ( with shear rates at the surface 3 10 s ) . the lbl - coated channels can be left in buffer for at least a week , without loosing the antifouling properties . furthermore , we performed at least five cycles of removal of the lbl using sds followed by formation of a lbl in the same chip without any detectable change in performance nor in frap behavior . another important feature of the lbl coated chip is that the lbl is compatible with a wide range of buffers necessary for a diverse set of experimental requirements . the three different applications demonstrated above were all done in different buffers , and none was performed in the buffer used for coating . we also note that the use of a lbl coating will allow us to insert specific groups with a variety of chemistries into the nanochannels or make it possible to tailor the surface charge of the channels by changing the composition of the lipid mixture . in conclusion , we have demonstrated the performance of a lbl coating as an excellent passivation approach for nanofluidics in a range of applications . we have demonstrated that a lbl prevents sticking of streptavidin - qds and reca proteins to the walls of a nanofluidic device . we have further shown that the lbl passivation allows us to visualize reca dna complexes as well as enzymatic digestion by dnase i along stretched dna molecules in the nanochannels . we envision that the lbl passivation approach will be useful for systematic elucidation of kinetics and site specificity of protein dna interactions as well as for implementing dna sequencing . the devices were made using standard micro and nanofabrication techniques as described in detail elsewhere . an overview of the device design is given in the supporting information ( figure s1 ) . the device fabrication comprises electron beam lithography for the definition of the nanochannels ( with periodicity of 1 m and channel widths ranging from 100 to 400 nm and depths 100 to 150 nm ) and nanoslits of 150 nm depth , uv lithography for the definition of the microchannels ( with typical widths of 50 m and depths of 1 m ) , and reactive - ion etching to make the channels in a fused - silica substrate . the dimensions of the channels were measured using electron microscopy and profilometry before sealing . after drilling holes in the substrates using sand blasting for sample access , the devices were sealed using thermal fusion bonding . for the creation of lbls we used zwitterionic 1-palmitoyl-2-oleoyl - sn - glycero-3-phosphocholine ( popc ) lipids with 1% lissamine rhodamine b 1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine , triethylammonium salt ( rhodamine - dhpe ) lipids added to enable observation of the lbl formation with fluorescence microscopy . prior to each coating procedure , lipid vesicles of approximately 70 nm diameter were created by extrusion ( see supporting information ) . the extruded vesicle solution was flushed through one of the microchannels of the fluidic system . subsequently , the lipid vesicles settle down on the surface , rupture , and form patches of lbl that connect within a few minutes to a continuous lbl , coating the entire microchannel . the lbl is subsequently allowed to spread spontaneously into the nanochannels , while the flow of lipid vesicles is sustained in the coated microchannel to ensure a steady supply of vesicles . during the coating process , a counter flow ( 80 m / s ) through the nanochannels is imposed into the coated microchannel to avoid any debris or vesicles in the nanochannels . this approach was used for all data described in the work except for that presented in figure 2a where an alternative , slightly quicker method was used . here we flush the lipid vesicles from the lbl - coated microchannels into the nanochannels where they are allowed to deposit and rupture . however , with this method vesicles and other residues may deposit , potentially blocking the nanochannels . for all the imaging presented here a nikon te-2000 inverted fluorescence microscope equipped with a 100w mercury lamp , a 60 na 1.00 water immersion objective ( nikon ) , and an andor ixon emccd camera ( dv-897 ) was used . streptavidin - qds ( qdot 585 ) , purchased from molecular probes ( life technologies ) , were introduced in the nanofluidic network at a concentration of 0.17 m . the buffer used was 100 mm nacl , 10 mm tris , 10 mm boric acid , and 0.225 mm edta ( ph 8.0 ) . bsa with a dye protein ratio of 5:1 ( alexa fluor 488 conjugate ) , purchased from molecular probes ( life technologies ) , was introduced in 100 150 nm nanochannels . to ensure saturation of the surfaces , the bsa concentration used was 800 g / ml buffer ( 100 mm nacl , 10 mm tris , 10 mm boric acid , and 0.225 mm edta , ph 8.0 ) . the protein solution remained inside the nanochannels for 12 h before the nanofluidic system was rinsed with buffer , and streptavidin - qds were introduced and subsequently washed out . -phage dna , purchased from new england bio laboratories ( neb ) , and fluorescently labeled reca were mixed in a test tube to concentrations of 0.8 m base pairs ( 0.5 g / ml ) and 1 m , respectively . the buffer used was 3.75 tbe with 50 m atp-s and 2 mm mg . recombinant reca was produced and labeled with atto 488-nhs ester at ph 6.2 , as described in ref ( 15 ) , and stored in 300 mm kcl , 20 mm tris - hcl ph 7.5 , 0.5 mm edta , 1 mm dtt , and 10% glycerol at 80 c . dnase i , purchased from sigma - aldrich , was introduced on one side of the nanochannels at a concentration of 0.12 units/l in 1.2 reaction buffer . -phage dna , purchased from new england biolabs ( neb ) , was introduced from the opposite end of the nanochannels . subsequently , the flow was stopped , and the dnase i was allowed to diffuse into the nanochannels and reach the confined dna molecules . we used a dna solution at 0.5 g / ml in 0.05 tbe buffer with 5 mm nacl , containing 3% 2-mercaptoethanol ( bme ) .

the world health organization in 2002 reported estimates that depression affects about 154 million people while schizophrenia affects about 25 million globally . mental disorder is sometimes believed to be incurable which can cause delay or prevention for help seeking and can be damaging . the prevalence of mental health conditions in india is at about 18 - 207/1000 population while about 2 - 3% are known to suffer from major mental illnesses . a review by bhola and kapur identified 23 school - based studies with morbidities related to mental health ranging from 3.23% to 36.50% . research on mental health literacy in various parts of the globe among adolescents and young adults showed that about half of them aged 12 - 25 years identified depression correctly and about a quarter identified psychosis . mental health literacy has related components including recognition and identification of mental health disorders and help seeking , knowledge on prevention of mental disorders , strategic knowledge about seeking self - help , knowledge regarding treatment and skills on how to provide support and first aid to others . in the context of adolescents , literacy related to mental health is vital as about half of those who will develop mental disorders have their first episodes before 18 years of age . people with limited health literacy do have a limited understanding of health problems , poor use of preventive measures and poor disease management skills . a lack in appropriate knowledge pertaining to mental disorders can pose as a bottleneck to early interventions . furthermore , poor and negative attitudes to people with mental illnesses may cause delays in help seeking for these conditions . evidence shows that limited mental health literacy impacts negatively not only on help seeking but also on decision - making on treatment and compliance . about 20% of the world 's population is made up of adolescents of whom about 85% reside in economically limited regions of the world . almost 243 million adolescents , i.e. , 21% of the nation 's population , call india home . adolescence is a vulnerable stage in life in which children are in transition from childhood to adulthood . mental health promotion among adolescents is appropriate as the first episodes of mental illnesses are known to emerge during adolescence and early adulthood with greater than half of all individuals having the first episode either in childhood or during adolescence . empowering the vulnerable young to identify and seek help early for this study attempted to assess mental health literacy and preferences regarding sources of help and general attitudes toward mental health conditions among late adolescents in udupi taluk , which is a highly literate region of karnataka in southern india . this cross - sectional study was conducted between january and july 2014 among preuniversity colleges of udupi taluk , which is one of three taluks in udupi district . the sample consisted of students within the 15 - 19 years age group in preuniversity colleges where they were studying in the 11 and 12 standard classes in either the science , commerce , or arts streams . the sample size was calculated at 872 with the estimation of proportion considered at 50% , relative precision of 10% , confidence interval at 95% , design effect of 2 , and a nonresponse rate of 10% . administrative approval for the study was obtained from the office of the deputy director of preuniversity colleges . the colleges were then stratified into three groups including government , private , and government aided colleges from which individual colleges were selected using the simple random method . a questionnaire was developed covering the following domains : sociodemographic profile , two case vignettes which described depression and schizophrenia and a questionnaire on help seeking as well as attitudes regarding mental health conditions . questions were designed based on the national survey of mental health literacy and stigma youth boost survey v5 with permission from reavley and jorm . in this study , the depression and schizophrenia vignettes [ table 1 ] were used with minimal modification from the original to fit the indian context and was validated by experts in the field of clinical psychology and public health . the description of symptoms in the vignettes met that of diagnostic and statistical manual of mental disorders , fourth edition and international classification of diseases , tenth edition diagnostic criteria for depression and schizophrenia . questions were included on whether they could identify the mental disorder in the vignette and their beliefs regarding the sources of help and prevention as well as their opinion on the interventions . the questionnaire was first developed in english following literature review and was then translated into the local language , i.e. , kannada . to check for consistency , back translation into english was done . tool validation was done by experts working in the field of public health , psychology , and psychiatric . a questionnaire was developed covering the following domains : sociodemographic profile , two case vignettes which described depression and schizophrenia and a questionnaire on help seeking as well as attitudes regarding mental health conditions . questions were designed based on the national survey of mental health literacy and stigma youth boost survey v5 with permission from reavley and jorm . in this study , the depression and schizophrenia vignettes [ table 1 ] were used with minimal modification from the original to fit the indian context and was validated by experts in the field of clinical psychology and public health . the description of symptoms in the vignettes met that of diagnostic and statistical manual of mental disorders , fourth edition and international classification of diseases , tenth edition diagnostic criteria for depression and schizophrenia . questions were included on whether they could identify the mental disorder in the vignette and their beliefs regarding the sources of help and prevention as well as their opinion on the interventions . the questionnaire was first developed in english following literature review and was then translated into the local language , i.e. , kannada . to check for consistency , back translation into english was done . tool validation was done by experts working in the field of public health , psychology , and psychiatric . the descriptive information on the sociodemographic distribution of the participants summarized in table 2 showed that of the 916 respondents , 54.15% were male while 45.85% were female . the majority ( 78.60% ) of the respondents ascribed to the hindu religion , hailed largely from rural areas ( 57.21% ) and were mostly studying in the 11 standard ( 72.49% ) . the distribution of the respondents in government , government - aided , and private schools was 30.79% , 36.14% , and 33.08% , respectively . distribution of respondents according to their sociodemographic characteristics there was wide variation observed regarding the parent 's educational levels among the respondents . around 8.41% of respondent 's father and 8.08% of respondent 's mother were illiterate . variation in family income was also observed with 36.14% having family income of less than rs . 10,000 ( $ 150 ) per month while 4.04% respondents refused to state their family income . most of the participant 's fathers ( 73.9% ) worked in the organized sector while most mothers were housewives ( 77% ) . mental health literacy assessed through the vignettes was very low with less than a third of the adolescents clearly identifying depression 29.04% and identification of schizophrenia was very low at 1.31% . taking into consideration the young age of the respondents with the possibility of limited exposure to mental health conditions during their lifetime , alternative labels such as mental illness or psychological / mental / emotional problems were considered as indicative of understanding depressive conditions which amounted to an additional 25.88% and for schizophrenia , labels including psychosis , psychological / mental / emotional problem or mental illness were included which accounted for an additional 23.47% [ table 3 ] . distribution of respondent 's ability to identify mental health conditions as observed from table 4 , the study findings on the preference of help seeking for depression indicates that adolescents preferred help both for self and others to a greater extent from family sources such as mothers ( 30.57% for self , 21.18% for others ) . for schizophrenia , similar findings included 20.74% for self and 16.8% for others ' help seeking from mothers . on assessing for more formal sources of help for depression , psychologists were rated higher for others to seek help ( 19.54% ) while it was comparatively lesser for self ( 7.10% ) . for schizophrenia , psychologists were thought to be good sources of help for others ( 31% ) than for self ( 12.15% ) [ table 5 ] . health seeking from doctors again reflected similar findings for depression ( 8.30% for self and 19.54% for others ) and for schizophrenia ( 8.52% for self and 12.23% for others ) [ table 4 ] . multiple choices were allowed for each respondent . however , ranking of the choices was not done . it was of concern that quite a large proportion felt that they would not need to seek help for either depression ( 30.68% ) or schizophrenia ( 33.62% ) [ table 5 ] if the situation arose . most adolescents felt it was easier to seek help for others as opposed to help seeking for self ( p = 0.037 ) . sources of help seeking to address depression sources of help seeking to address schizophrenia on assessing for attitudes toward strategies to prevent depression , becoming physically active ( p = 0.027 ) and listening to or understanding the problem ( p < ( p = 0.049 ) [ table 6 ] and listening to or understanding the problem getting admitted to the hospital for depression was not thought to be helpful but was instead considered harmful by male adolescents ( p < 0.001 ) and similar findings were obtained for both genders with regard to schizophrenia ( p = 0.049 ) which could reflect societal attitudes towards seeking professional help for mental illnesses . mental health conditions were not perceived as real medical illnesses by most of the male respondents ( p = 0.021 ) while the majority in both genders thought they should tell someone about their problem ( p = 0.004 ) . on questions alluding to sections of the population who might be affected with mental health conditions more often , the unemployed were thought to more likely suffer from mental health conditions ( p = 0.045 ) [ table 7 ] . this study aimed at assessing mental health literacy among adolescents and preferred help - seeking behaviors as well as attitudes towards mental health conditions in udupi taluk of southern india . less than a third of the adolescents could clearly identify depression ( 29.04% ) while identification of schizophrenia was even lower at 1.31% . in comparison , lauber et al . , in their study among swiss population sampled between ages of 16 and 76 showed that about 40% recognized depression and 75% identified schizophrenia appropriately . this could be related to the age of the sampled population which may reflect inadequate exposure and real - time experiences in relation to mental health conditions . although india has a national mental health program in place , school - based or targeted interventions related to mental health is largely lacking which could also indicate another important reason for low rates of identification of mental ill - health in this population . on adding alternate labels that were opted for depression , depression was identifiable by an additional 25.88% . similarly , schizophrenia was additionally recognizable by 23.47% of the participants . on assessing help seeking for mental health conditions , about 30.68% of the adolescents preferred not to seek help for possible mental health conditions with preferred sources of help being largely indicated as the mother . professional help was relegated more for others than for self . in this study , teachers were not indicated as an important source of help . the poor need for help seeking for mental health conditions that emerge from this study could be an important indicator of the stigma related to mental health conditions reflecting the deeply entrenched attitude toward mental illnesses in indian society . another interesting finding was that younger people and the unemployed were thought to more likely suffer from mental health conditions . although these were not significant findings , they do reflect a lack of awareness . the attitude that mental conditions should not be brought out into the open is reflected by the results reflecting the deeply pervasive perceived stigma against mental health conditions in society the results from this study reflect the urgent need to increase awareness on mental health conditions , thus increasing opportunities for early help seeking and , in turn , detection and initiation of interventions early on while also contributing to better long - term mental health outcomes . school - based health literacy programs have proven to have good outcomes in several settings . interventions targeting adolescents and stakeholders such as parents and teachers could prove to be the most effective form of intervention to reduce the burden of mental health conditions in the long - term . the pervasive stigma shrouding mental health conditions is an equally important fact that needs challenging and overcoming .

consecutive patients were recruited from the outpatient clinic of the department of ophthalmology of ludwig maximilian university . patients were included if they had diabetes ( based on world health organization criteria ) for at least 3 years . eyes were excluded if there were eye diseases involving the posterior pole other than dr , such as age - related macular degeneration . all patients underwent complete ophthalmological examination including a dilated ( 1% tropicamide ) stereoscopic fundus exam with slit - lamp biomicroscopy ( 78 d lens ) by a retina specialist . as part of the clinical examination , the degree of dr was assessed using the international clinical dr severity scale ( 16 ) . the presence of clinically significant macular edema ( csme ) was evaluated according to the edtrs scale . photographic graders were blinded for the clinical exam of the patients and had no access to clinical data . informed consent was obtained from all participants , and the study conformed to the principles expressed in the declaration of helsinki . optomap imaging was performed without pupil dilation before and independently of the clinical examination . it consisted of taking several images , and the best image per eye total scanning time is 35 min , including patient positioning , and was performed by one author ( i.h . ) . the optomap panoramic 200 device is a scanning laser ophthalmoscope , ( slo ) with two laser wavelengths scanning : a green ( 532 nm ) and a red ( 633 nm ) laser wavelength . the two images are then either viewed separately or superimposed by the software to yield semirealistic color imaging . this device requires a small optical path of only 2 mm , and by a special mirror design , it is able to obtain widefield images of 180200 through an undilated pupil . the optical resolution was 3,900 3,072 pixels , resulting in 1521 pixels per degree of arc . due to the slo principle , sharp images with high contrast were obtained ( 15 ) . prior to retinal photography , the patient s pupils were dilated using tropicamide 1% and additional epinephrine 10% drops if required . color retinal photographs , with a high - quality retinal digital camera ( zeiss ff450 ; carl zeiss meditec ag , jena , germany ) , were taken by an etdrs - certified photographer . a 5.0-megapixel , charge - coupled device ( ccd ) sensor ( sony 3ccd ; sony , focusing and alignment of the image were performed using the ocular tube of the camera in addition to a previewing camera . each study eye had 16 digital photographs taken according to the etdrs protocol : seven nonsimultaneous color stereo field pairs of the retina and one pair of the anterior segment . all images were taken by the same photographer , certified by the university of wisconsin fundus photograph reading centre for etdrs protocol photography , and for each patient , digital photographs were taken in the same format sequence . an example of an optomap widefield slo scan with an overlay of an etdrs - type 7-field composite fundus photograph is shown in fig . 1 . overlay montage of a representative optomap scan and etdrs 7-field ( mild npdr ) . ( a high - quality digital representation of this figure is available in the online issue . ) all retinal images were loaded from the server to a viewing station ( equipped with a conventional cathode ray 17 noncalibrated color monitor ) via network and assessed with the optomap viewing software ( optomap u - revu , version 1.0 ) . this software allows basic image manipulations such as changing contrast , brightness , and zooming . it also offers both viewing in the composite color image and the single color laser wavelengths . the images obtained by the different wavelengths were used to better identify and differentiate lesions ( especially red - free images ) ( 17 ) . grading of optomap images and etdrs 7-field stereo color photography was performed by two independent graders ( m.k . and f.p . ) who had not participated in examination of the patients and were masked to all additional information , such as visual acuity , duration of diabetes , or clinical symptoms . the graders , however , could decide not to grade due to poor image quality , which was defined as not covering at least the central 60 and both the macula and optic disc in adequate quality . nongradable images were reassessed by a third grader ( a.s.n . ) to reach consensus in gradability . in addition , the presence of csme was graded according to the etdrs classification ( 18 ) . all data were collected in a microsoft excel 2000 spreadsheet ( microsoft corporation , redmond , wa ) and analyzed using spss 19.0 for windows ( spss inc . , chicago , il ) . on all tests , statistics were calculated and assessed based on landis and koch ( 19 ) : < 0.20 , poor ; 0.210.40 , fair ; 0.410.60 , moderate ; 0.610.80 , substantial ; and 0.811.00 , almost perfect strength of agreement . unweighted was used to avoid potential bias by weighting . eyes with photographs classified as nongradable ( level 90 ) were excluded . for assessing agreement based on different thresholds , we used etdrs severity levels ranging from level 15/20 to high - risk proliferative dr ( pdr ) ( level 71/75 ) . consecutive patients were recruited from the outpatient clinic of the department of ophthalmology of ludwig maximilian university . patients were included if they had diabetes ( based on world health organization criteria ) for at least 3 years . eyes were excluded if there were eye diseases involving the posterior pole other than dr , such as age - related macular degeneration . all patients underwent complete ophthalmological examination including a dilated ( 1% tropicamide ) stereoscopic fundus exam with slit - lamp biomicroscopy ( 78 d lens ) by a retina specialist . as part of the clinical examination , the degree of dr was assessed using the international clinical dr severity scale ( 16 ) . the presence of clinically significant macular edema ( csme ) was evaluated according to the edtrs scale . photographic graders were blinded for the clinical exam of the patients and had no access to clinical data . informed consent was obtained from all participants , and the study conformed to the principles expressed in the declaration of helsinki . it consisted of taking several images , and the best image per eye was saved for grading . total scanning time is 35 min , including patient positioning , and was performed by one author ( i.h . ) . the optomap panoramic 200 device is a scanning laser ophthalmoscope , ( slo ) with two laser wavelengths scanning : a green ( 532 nm ) and a red ( 633 nm ) laser wavelength . the two images are then either viewed separately or superimposed by the software to yield semirealistic color imaging . this device requires a small optical path of only 2 mm , and by a special mirror design , it is able to obtain widefield images of 180200 through an undilated pupil . the optical resolution was 3,900 3,072 pixels , resulting in 1521 pixels per degree of arc . due to the slo principle , sharp images with high contrast were obtained ( 15 ) . prior to retinal photography , the patient s pupils were dilated using tropicamide 1% and additional epinephrine 10% drops if required . color retinal photographs , with a high - quality retinal digital camera ( zeiss ff450 ; carl zeiss meditec ag , jena , germany ) , were taken by an etdrs - certified photographer . a 5.0-megapixel , charge - coupled device ( ccd ) sensor ( sony 3ccd ; sony , tokyo , japan ) was used in this study . focusing and alignment of the image were performed using the ocular tube of the camera in addition to a previewing camera . each study eye had 16 digital photographs taken according to the etdrs protocol : seven nonsimultaneous color stereo field pairs of the retina and one pair of the anterior segment . all images were taken by the same photographer , certified by the university of wisconsin fundus photograph reading centre for etdrs protocol photography , and for each patient , digital photographs were taken in the same format sequence . an example of an optomap widefield slo scan with an overlay of an etdrs - type 7-field composite fundus photograph is shown in fig . 1 . overlay montage of a representative optomap scan and etdrs 7-field ( mild npdr ) . ( a high - quality digital representation of this figure is available in the online issue . ) all retinal images were loaded from the server to a viewing station ( equipped with a conventional cathode ray 17 noncalibrated color monitor ) via network and assessed with the optomap viewing software ( optomap u - revu , version 1.0 ) . this software allows basic image manipulations such as changing contrast , brightness , and zooming . it also offers both viewing in the composite color image and the single color laser wavelengths . the images obtained by the different wavelengths were used to better identify and differentiate lesions ( especially red - free images ) ( 17 ) . grading of optomap images and etdrs 7-field stereo color photography was performed by two independent graders ( m.k . and f.p . ) who had not participated in examination of the patients and were masked to all additional information , such as visual acuity , duration of diabetes , or clinical symptoms . the graders , however , could decide not to grade due to poor image quality , which was defined as not covering at least the central 60 and both the macula and optic disc in adequate quality . nongradable images were reassessed by a third grader ( a.s.n . ) to reach consensus in gradability . in addition , the presence of csme was graded according to the etdrs classification ( 18 ) . all data were collected in a microsoft excel 2000 spreadsheet ( microsoft corporation , redmond , wa ) and analyzed using spss 19.0 for windows ( spss inc . , statistics were calculated and assessed based on landis and koch ( 19 ) : < 0.20 , poor ; 0.210.40 , fair ; 0.410.60 , moderate ; 0.610.80 , substantial ; and 0.811.00 , almost perfect strength of agreement . eyes with photographs classified as nongradable ( level 90 ) were excluded . for assessing agreement based on different thresholds , we used etdrs severity levels ranging from level 15/20 to high - risk proliferative dr ( pdr ) ( level 71/75 ) . a total of 212 eyes , 100 right and 112 left , of 141 patients were included . mean patient age was 64 14.2 years ( sd ; range 2578 years ) . mean visual acuity was 0.56 0.42 log minimum angle of resolution , ranging from 0 to 1.40 . systemic blood pressure values were systolic 146 20 mmhg ( range 110185 mmhg ) and diastolic 81 9 mmhg ( range 6595 mmhg ) . in total , distribution of severity levels of dr as graded on a nine - step etdrs scale is given in table 1 for grader 1 . the table shows that , overall , a high agreement in grading results was obtained for both independent graders . for grader 1 was 0.792 ( se = 0.039 ) and 0.774 ( se = 0.039 ) for grader 2 , indicating a highly substantial agreement between the imaging methods . regarding csme , was 0.73 ( se = 0.061 ) for grader 1 and 0.77 ( se = 0.056 ) for grader 2 , which means a highly substantial agreement between the imaging methods . etdrs dr severity level from optomap vs. 7-field etdrs photographs for grading of dr level , similar levels of agreement were found for optomap and 7-field photography . agreement between readers was higher for optomap than for 7-field photography in assessing csme : exact agreement was 91 vs. 87.5% , and agreement one step was 100 vs. 98.6% . was 0.89 ( se = 0.03 ) for optomap and 0.84 ( se = 0.04 ) for 7-field photography . in fig . given the almost perfect agreement between graders for dr rating , only grader 1 results are shown . agreement decreases with higher dr levels , which appears to be caused by photographic readings assessing higher dr levels less severe than optomap readings . ( a high - quality color representation of this figure is available in the online issue . ) to assess agreement of imaging with clinical assessment , the etdrs scale was converted to the analogous five - part clinical scale : no dr ( level 1014 ) , mild non - pdr ( npdr ) ( level 1520 ) , moderate npdr ( level 3547 ) , severe npdr ( level 53 ) , and pdr ( level 61 ) . almost perfect agreement of optomap readings with clinical assessment was observed , well comparable with 7-field photographic imaging : exact agreement was 95.8 vs. 90.3% , and agreement one step was 100 vs. 96.5% . was 0.93 ( se = 0.03 ) for optomap and 0.83 ( se = 0.04 ) for 7-field photography . for csme , gradings from optomap scans showed substantial gradings from 7-field photography , moderate agreement to findings from slit - lamp bio : exact agreement was 87.7 vs. 83.2% , and was 0.72 ( se = 0.06 ) for optomap compared with 0.59 ( se = 0.07 ) for 7-field photography . a total of 212 eyes , 100 right and 112 left , of 141 patients were included . mean patient age was 64 14.2 years ( sd ; range 2578 years ) . mean visual acuity was 0.56 0.42 log minimum angle of resolution , ranging from 0 to 1.40 . systemic blood pressure values were systolic 146 20 mmhg ( range 110185 mmhg ) and diastolic 81 9 mmhg ( range 6595 mmhg ) . in total , distribution of severity levels of dr as graded on a nine - step etdrs scale is given in table 1 for grader 1 . the table shows that , overall , a high agreement in grading results was obtained for both independent graders . for grader 1 was 0.792 ( se = 0.039 ) and 0.774 ( se = 0.039 ) for grader 2 , indicating a highly substantial agreement between the imaging methods . regarding csme , was 0.73 ( se = 0.061 ) for grader 1 and 0.77 ( se = 0.056 ) for grader 2 , which means a highly substantial agreement between the imaging methods . for grading of dr level , similar levels of agreement were found for optomap and 7-field photography . agreement between readers was higher for optomap than for 7-field photography in assessing csme : exact agreement was 91 vs. 87.5% , and agreement one step was 100 vs. 98.6% . was 0.89 ( se = 0.03 ) for optomap and 0.84 ( se = 0.04 ) for 7-field photography . given the almost perfect agreement between graders for dr rating , only grader 1 results are shown . agreement decreases with higher dr levels , which appears to be caused by photographic readings assessing higher dr levels less severe than optomap readings . ( a high - quality color representation of this figure is available in the online issue . ) to assess agreement of imaging with clinical assessment , the etdrs scale was converted to the analogous five - part clinical scale : no dr ( level 1014 ) , mild non - pdr ( npdr ) ( level 1520 ) , moderate npdr ( level 3547 ) , severe npdr ( level 53 ) , and pdr ( level 61 ) . almost perfect agreement of optomap readings with clinical assessment was observed , well comparable with 7-field photographic imaging : exact agreement was 95.8 vs. 90.3% , and agreement one step was 100 vs. 96.5% . was 0.93 ( se = 0.03 ) for optomap and 0.83 ( se = 0.04 ) for 7-field photography . for csme , gradings from optomap scans showed substantial gradings from 7-field photography , moderate agreement to findings from slit - lamp bio : exact agreement was 87.7 vs. 83.2% , and was 0.72 ( se = 0.06 ) for optomap compared with 0.59 ( se = 0.07 ) for 7-field photography . in the u.s . , 16 million people suffer from diabetes , and 12,00024,000 new cases of blindness secondary to dr are reported each year . three million diabetes patients report visual impairment , and the number of individuals > 40 years of age with dr is expected to increase from 4.1 to 7.2 million in 2020 ( 3,20,21 ) . the projected increase in diabetes prevalence is likely to overwhelm current healthcare structures and capacities for currently recommended annual dilated retinal examinations as the standard of care . therefore , alternatives , such as telemedicine , should be harnessed as cost - effective strategies to improve early detection of dr as a means of reducing the risk of permanent visual impairment ( 5,6,12 ) . although developed almost 25 years ago , both edtrs imaging and grading protocols for standardized evaluation of dr and csme are still today s benchmark ( 7,8 ) . numerous clinical trials have validated the use of mydriatic etdrs 7-field stereo photography for dr screening . however , imaging techniques have evolved ; digital photography has outlived analog color slide film , as it becomes less and less available , in clinical practice . in addition , several limitations exist , as mydriatic etdrs 7-field stereo photography is time consuming and highly dependent on both the photographer s experience and the patient s compliance ( 6,22,23 ) . therefore , although remaining standard for clinical trials , it is not well suited for screening purposes . in an environment that demands cost reduction , efficiency , and effective disease screening , one important advantage inherent to nonmydriatic digital techniques is patient comfort ( no need for dilating pupils causing the inability to drive a car ) and facilitation of remote diagnostic image generation and interpretation . retinal imaging using the novel nonmydriatic optomap panoramic 200 slo allows nonmydriatic imaging not only of the posterior pole but even extending over the equator . it covers 180200 with no need for pupil dilation and far exceeds the area covered by the etdrs photographs ( 12,14 ) . on the other hand , this technique provides no real color images , only two monochromatic red and green slo scans that can be viewed separately or superimposed , resulting in a semirealistic bicolor optomap fundus image . the possibility to view the two simultaneously generated red and green slo scans separately potentially provides additional image information , as the green , red - free scan may inherit more selective information about the superficial layers of the neurosensory retina , and the red laser scan may better reflect the deeper retinal layers , including retinal pigment epithelium and choroid ( 12,14 ) . however , diagnostic image quality is an important concern for clinical research and telemedicine , and the lack of additional color information , compared with color fundus photography , may also provide a potential source for misinterpretation . in this study , values of 0.795 for grader 1 and 0.774 for grader 2 demonstrate a good correlation between nonmydriatic ultra - widefield slo ( optomap ) and etdrs - type , stereoscopic , mydriatic , 30 , 7-field , stereo color photography . in addition , a good intergrader reproducibility and a good correlation with clinical assessment of dr were shown for both imaging techniques . of note , optomap imaging had a lower rate of nongradable images , compared with 7-field etdrs . regarding the detection of csme , a moderate / substantial correlation of both imaging techniques with clinical assessment was detected . this is especially worth mentioning , as optomap is primarily a two - dimensional imaging technique and no stereoscopic information is obtained . however , this result regarding the detection of csme with optomap is in accordance with a previous investigation , where a comparable validity for both assessment of dr level and detection of csme with optomap in comparison with clinical stereoscopic slit - lamp fundus examination was found ( 14 ) . one reason may be that the lack of the stereoscopic aspect is at least partially compensated by the possibility to view both red and green laser scans with their different penetration and image information , which may give a certain impression of tissue swelling and edema that is helpful for detection of macular edema . regarding the grading of dr , there is evidence that color photography is superior to clinical fundoscopy alone ( 14,24,25 ) . however , the smaller area imaged , especially with nonmydriatic imaging techniques , may result in a decrease in sensitivity . aptel et al . ( 26 ) , for example , demonstrated that nonmydriatic 3 45 color fundus images still resulted in 92% sensitivity and 97% specificity . in contrast , dr grading by using a single 45 image of the central retina led to a significant reduction of sensitivity to 77% . this may be explained by the fact that particularly the nasal retina is of importance for a valid assessment of the dr level . however , large coverage of the retina allows the assessment of peripheral pathologies that would otherwise be overlooked in any case when only a smaller angle is imaged . this may also compensate , together with the possibility to easily zoom and view red and green channels separately , for the lack of full color information , as provided by color photography . one disadvantage of the technology is that compared with other approaches , such as simpler camera - based ones ( 911 ) , the widefield scanning laser technology is more costly . given the increasing availability of those machines , however , at least for several countries such infrastructure already exists . the american academy of ophthalmology has emphasized the importance of early screening and recommends annual dilated eye examinations in type 2 diabetic patients and retinal examinations 35 years after diagnosis of type 1 diabetes , followed by annual eye examinations ( 27 ) . however , annual dilated retinal examinations are most cost - effective for patients with advanced dr or elevated hba1c but may be less cost - effective in subjects with no , or mild , npdr ( 2830 ) . in addition , a number of barriers , including poor access to eye care and shortage of retinal specialists in rural areas , exist , leading to a high number of patients who are not screened for dr . the nonmydriatic ultra - widefield slo optomap allows imaging not only of the posterior pole of the retina but even beyond the equator . it covers up to 200 of the retina with no need for pupil dilation , which implicates theoretical advantages over 7-field etdrs photography ( fig . 1 ) . in addition , the results of this study clearly demonstrate that optomap imaging provides at least similar results for assessment of dr levels and presence of csme compared with etdrs 7-field stereo color photographs and correlates well with clinical assessment of dr . the optomap examination affords little experience by the photographer and has a fast learning curve ; it also can be performed easily by trained medical care personnel ( 12,14 ) . therefore , optomap provides promising properties for peripheral screening programs and telemedicare in diabetes patients .

a 53-yr old woman ( body weight : 63 kg , height : 162 cm ) was scheduled for living donor liver transplantation due to acuteon - chronic liver failure . two days ago , she was intubated due to rapidly developing grade 3 - 4 hepatic encephalopathy . in the preoperative evaluation , her laboratory examination showed hb 7.9 g / dl , platelet count 27 10/l , prothrombin time 3.5 international normalized ratio , fibrinogen 52 mg / dl , antithrombin iii 6% , sodium 136 mmol / l , potassium 3.9 mmol / l , creatinine 3.8 mg / dl , glucose 163 mg / dl , albumin 3.1 g / dl , total bilirubin 52.8 mg / dl , and ammonia 205 mol / l . her child - pugh and model for end - stage liver disease scores were 12 and 49 , respectively . however , brain computerized tomography and invasive icp monitoring could not be performed because the acute exacerbation of her clinical condition requires urgent liver transplantation . upon arrival at the operating room dopamine of 10 g / kg / min , dobutamine of 15 g / kg / min , and norepinephrine of 0.1 g / kg / min had been administered continuously . her systolic / diastolic / mean arterial blood pressure and heart rate were 100/50/67 mmhg and 80 beats / min , respectively . after establishing the standard monitoring used in our institute , ultrasound onsd measurements were done by a physician well - trained in ocular ultrasonography before anesthetic induction . based on the method described in a previous report , both eyes were scanned using a 7.5-mhz probe ( prosound ssd-4000 , aloka , tokyo , japan ) through closed eyelids with the patient in the supine position . right and left eyes were scanned in both sagittal and transverse planes , and the onsd value was calculated by estimating the average results of these measurements . transtemporal insonation of the left middle cerebral artery was done using a 2-mhz probe ( companion iii , viasys healthcare , warwick , uk ) . tcd measurements showed her systolic / diastolic / mean cerebral flow velocities were 100/7/37 cm / s ( normal reference values of systolic / diastolic / mean velocities [ mean sd ] : 77.1 12.23/37.4 7.13/50.6 8.42 cm / s ) . the resistance index was 0.93 ( normal reference value : 0.52 0.05 ) and the pulsatility index was 2.5 ( normal reference value : 0.80 0.13 ) , and the second systolic peak ( windkessel effect ) was lost , suggesting elevated icp ( fig . the bispectral index and suppression ratio were 30 and 20 , respectively , and right and left regional cerebral oxygen saturations were 15/15% . anesthesia was induced with thiopental and vecuronium , and was maintained using 0.5 - 1% isoflurane , a 50% o2/air mixture , and continuous infusion with fentanyl and vecuronium . the patient 's lungs were ventilated with a tidal volume of 10 - 12 ml / kg at a respiratory rate of 10 - 12 breaths / min to maintain hypocarbia ( paco2 : 28 - 32 mmhg ) throughout the procedure . also , mild hypothermia ( 34 - 35 ) was induced , and mannitol of 40 g was administered every six hours for the management of icp . after anesthesia induction , her arterial blood gas analysis showed a ph of 7.33 , a paco2 of 28 mmhg , a pao2 of 209 mmhg , bicarbonate of 14.8 meq / l , and base excess of -10.0 mmeq / l . she was transferred to the surgical intensive care unit . on the second postoperative day , right and left pupil size were 3/3 mm . according to glasgow coma scale evaluation , eye opening score was 4 , best motor response score was 4 , best verbal response score was not evaluated due to endotracheal intubation . however , on the third postoperative day , she was developed septic shock , and the patient died by septic shock on the fourth postoperative day . a 40-yr old man ( body weight : 73 kg , height : 172 cm ) was scheduled for living donor liver transplantation surgery due to acute liver failure . one week ago , he developed grade 1 hepatic encephalopathy . in the preoperative evaluation , electrocardiography and echocardiography were within normal range . his laboratory examination showed hb 9.9 g / dl , platelet count 107 10/l , prothrombin time 2.2 international normalized ratio , fibrinogen 82 mg / dl , antithrombin iii 12% , sodium 135 mmol / l , potassium 3.0 mmol / l , creatinine 1.1 mg / dl , glucose 144 mg / dl , albumin 3.0 g / dl , total bilirubin 23.1 mg / dl , and ammonia 82 mol / l . her child - pugh and model for end - stage liver disease scores were 12 and 28 , respectively . his systolic / diastolic arterial blood pressure and heart rate were 132/68 mmhg and 98 beats / min , respectively . after establishing institutional standard monitoring , an ultrasound onsd measurement was done by a physician well - trained in ocular ultrasonography . the bispectral index and suppression ratio were 98 and 0 , respectively , and right and left regional cerebral oxygen saturations were 43 and 44% , respectively . his lungs were ventilated with a tidal volume of 8 - 10 ml / kg at a respiratory rate of 10 breaths / min ( paco2 , 35 - 40 mmhg ) . he experienced severe hypotension ( systolic / diastolic arterial blood pressure : 62/48 mmhg ) and bradycardia ( 56 beats / min ) after graft reperfusion , and was treated with epinephrine ( 20 g ) , after which systolic / diastolic arterial blood pressure ( 122/72 mmhg ) and heart rate ( 92 beats / min ) rapidly recovered to within the normal limit . 2b ) , and hyperventilation was performed with a tidal volume of 12 ml / kg at a respiratory rate of 13 breaths / min ( paco2 , 28 mmhg ) . 2c ) , and ventilation was adjusted to maintain normocarbia until the end of surgery . he was moved to the surgical intensive care unit after surgery , and then transferred to a general ward without any complications on the seventh postoperative day . a 53-yr old woman ( body weight : 63 kg , height : 162 cm ) was scheduled for living donor liver transplantation due to acuteon - chronic liver failure . two days ago , she was intubated due to rapidly developing grade 3 - 4 hepatic encephalopathy . in the preoperative evaluation , her laboratory examination showed hb 7.9 g / dl , platelet count 27 10/l , prothrombin time 3.5 international normalized ratio , fibrinogen 52 mg / dl , antithrombin iii 6% , sodium 136 mmol / l , potassium 3.9 mmol / l , creatinine 3.8 mg / dl , glucose 163 mg / dl , albumin 3.1 g / dl , total bilirubin 52.8 mg / dl , and ammonia 205 mol / l . her child - pugh and model for end - stage liver disease scores were 12 and 49 , respectively . however , brain computerized tomography and invasive icp monitoring could not be performed because the acute exacerbation of her clinical condition requires urgent liver transplantation . upon arrival at the operating room dopamine of 10 g / kg / min , dobutamine of 15 g / kg / min , and norepinephrine of 0.1 g / kg / min had been administered continuously . her systolic / diastolic / mean arterial blood pressure and heart rate were 100/50/67 mmhg and 80 beats / min , respectively . after establishing the standard monitoring used in our institute , ultrasound onsd measurements were done by a physician well - trained in ocular ultrasonography before anesthetic induction . based on the method described in a previous report , both eyes were scanned using a 7.5-mhz probe ( prosound ssd-4000 , aloka , tokyo , japan ) through closed eyelids with the patient in the supine position . right and left eyes were scanned in both sagittal and transverse planes , and the onsd value was calculated by estimating the average results of these measurements . transtemporal insonation of the left middle cerebral artery was done using a 2-mhz probe ( companion iii , viasys healthcare , warwick , uk ) . tcd measurements showed her systolic / diastolic / mean cerebral flow velocities were 100/7/37 cm / s ( normal reference values of systolic / diastolic / mean velocities [ mean sd ] : 77.1 12.23/37.4 7.13/50.6 8.42 cm / s ) . the resistance index was 0.93 ( normal reference value : 0.52 0.05 ) and the pulsatility index was 2.5 ( normal reference value : 0.80 0.13 ) , and the second systolic peak ( windkessel effect ) was lost , suggesting elevated icp ( fig . the bispectral index and suppression ratio were 30 and 20 , respectively , and right and left regional cerebral oxygen saturations were 15/15% . anesthesia was induced with thiopental and vecuronium , and was maintained using 0.5 - 1% isoflurane , a 50% o2/air mixture , and continuous infusion with fentanyl and vecuronium . the patient 's lungs were ventilated with a tidal volume of 10 - 12 ml / kg at a respiratory rate of 10 - 12 breaths / min to maintain hypocarbia ( paco2 : 28 - 32 mmhg ) throughout the procedure . also , mild hypothermia ( 34 - 35 ) was induced , and mannitol of 40 g was administered every six hours for the management of icp . after anesthesia induction , her arterial blood gas analysis showed a ph of 7.33 , a paco2 of 28 mmhg , a pao2 of 209 mmhg , bicarbonate of 14.8 meq / l , and base excess of -10.0 mmeq / l . she was transferred to the surgical intensive care unit . on the second postoperative day , right and left pupil size were 3/3 mm . according to glasgow coma scale evaluation , eye opening score was 4 , best motor response score was 4 , best verbal response score was not evaluated due to endotracheal intubation . however , on the third postoperative day , she was developed septic shock , and the patient died by septic shock on the fourth postoperative day . a 40-yr old man ( body weight : 73 kg , height : 172 cm ) was scheduled for living donor liver transplantation surgery due to acute liver failure . one week ago , he developed grade 1 hepatic encephalopathy . in the preoperative evaluation , electrocardiography and echocardiography were within normal range . his laboratory examination showed hb 9.9 g / dl , platelet count 107 10/l , prothrombin time 2.2 international normalized ratio , fibrinogen 82 mg / dl , antithrombin iii 12% , sodium 135 mmol / l , potassium 3.0 mmol / l , creatinine 1.1 mg / dl , glucose 144 mg / dl , albumin 3.0 g / dl , total bilirubin 23.1 mg / dl , and ammonia 82 mol / l . her child - pugh and model for end - stage liver disease scores were 12 and 28 , respectively . his systolic / diastolic arterial blood pressure and heart rate were 132/68 mmhg and 98 beats / min , respectively . after establishing institutional standard monitoring , an ultrasound onsd measurement was done by a physician well - trained in ocular ultrasonography . the bispectral index and suppression ratio were 98 and 0 , respectively , and right and left regional cerebral oxygen saturations were 43 and 44% , respectively . his lungs were ventilated with a tidal volume of 8 - 10 ml / kg at a respiratory rate of 10 breaths / min ( paco2 , 35 - 40 mmhg ) . he experienced severe hypotension ( systolic / diastolic arterial blood pressure : 62/48 mmhg ) and bradycardia ( 56 beats / min ) after graft reperfusion , and was treated with epinephrine ( 20 g ) , after which systolic / diastolic arterial blood pressure ( 122/72 mmhg ) and heart rate ( 92 beats / min ) rapidly recovered to within the normal limit . 2b ) , and hyperventilation was performed with a tidal volume of 12 ml / kg at a respiratory rate of 13 breaths / min ( paco2 , 28 mmhg ) . his onsd decreased to 5.1 mm at 30 min after reperfusion ( fig . 2c ) , and ventilation was adjusted to maintain normocarbia until the end of surgery . he was moved to the surgical intensive care unit after surgery , and then transferred to a general ward without any complications on the seventh postoperative day . noninvasive estimation of ultrasonographic onsd has been reported to be a useful method for evaluating elevated icp ( defined as icp > 20 mmhg ) . in case 1 of a liver transplant recipient with grade 4 hepatic encephalopathy , we evaluated elevated icp using ultrasonographic onsd and tcd flow velocity before anesthesia induction . in case 2 , we evaluated onsd during the graft reperfusion period . this patient had grade 1 hepatic encephalopathy and showed a normal onsd before anesthesia induction and had a dilated onsd immediately after reperfusion . advanced hepatic encephalopathy ( grade 3 and 4 ) is associated with the development of cerebral edema , which is usually diagnosed by detecting an increased icp . indeed , cerebral edema and a high icp can decrease cerebral perfusion pressure , resulting in brain damage and mortality . during liver transplantation , the graft reperfusion period is critical due to the high risk of acute hemodynamic changes , which can range from a mild hypotensive episode to profound cardiovascular collapse , known as the postreperfusion syndrome . furthermore , the reperfusion of a new graft can induce an increase in icp , which is possibly related to cerebral vessel dilatation and vasoactive substances . thus , these observations suggest that liver transplant recipients are particularly exposed to high icp and decreased cerebral perfusion pressure during the perioperative period , and that intraoperative icp monitoring is important in patients with high icp - related neurologic abnormalities . invasive monitoring of icp is known to be a gold standard method ; however , it may not be feasible in recipients undergoing liver transplantation , since severe coagulopathy can develop as a result of preexisting coagulopathy , dilutional coagulopathy , fibrinolysis , hypocalcemia , hypothermia , intravascular coagulation , or the heparin effect during liver transplantation surgery , which exposes patients to a greater risk of hemorrhage . the optical nerve sheath is continuous with the dura mater of the brain , and has a subarachnoid space . the subarachnoid space in the optic nerve sheath communicates with the craniospinal subarachnoid space , and thus onsd can be influenced by changes in cerebrospinal fluid pressure in the cranial cavity . moreover , it is well known that onsd measured 3 mm behind the optic globe is increased by elevated icp . based on these considerations , noninvasive measurement of onsd has been increasingly attempted for monitoring icp in many clinical settings . especially , ultrasonographic onsd assessment has proven to be useful for monitoring high icp in patients with brain injury , idiopathic intracranial hypertension , and spontaneous intracranial hemorrhage . moretti et al . reported that there is a linear correlation between onsd and an invasive icp measurement , and that a significant reduction of the onsd occurs after cerebrospinal fluid drainage for the management of high icp ( onsd : from 5.89 to 5.0 mm ) . they also suggested that the optimal cut off value of onsd to predict icp > 20 mmhg is 5.2 mm . in another study , the best cut off value of onsd for predicting elevated icp was reported to be in the range of 5.0 - 5.9 mm in neurocritically ill adults . however , there is limited information available about the usefulness of ultrasonographic onsd assessment in liver transplant recipients , who may experience severe coagulopathy and high icp during liver transplantation . we found that ultrasonographic onsd was 6.4 mm before induction in one recipient ( case 1 ) with advanced hepatic encephalopathy and 5.7 mm after graft reperfusion in another recipient ( case 2 ) , indicating high icp . based on these findings , we believe that noninvasive estimation of ocular ultrasonography can provide important information about icp during liver transplantation . treatment strategies such as hyperventilation , hypothermia , and mannitol administration have been employed for the management of high icp . especially , mild hyperventilation prior to graft reperfusion was shown to prevent the increase in icp above the pre - reperfusion level in tcd flow velocity , suggesting that hyperventilation may be effective in reducing reperfusion - related high icp during liver transplantation . in case 2 , it is not clear whether short - term hyperventilation induces directly a reduction in onsd . however , we consider that it may , at least in part , influence the change in onsd . this finding suggests that ultrasonographic onsd measurement provides useful information about the effectiveness of treatments used to lower icp in liver transplant recipients with high icp . tcd can also be used to evaluate high icp noninvasively by measuring cerebral blood flow velocity . tcd findings in case 1 agree with those of a report by aggarwal et al . , in which high icp induced a loss of the second systolic peak ( windkessel effect ) and a sharpness of the systolic peak in the tcd waveform . also , tcd - derived indices such as diastolic and mean cerebral blood flow velocities have been used for the calculation of icp . based on the previous report , icp can be assessed noninvasively by tcd using the following formula : estimated icp = the mean arterial blood pressure ( 1 - diastolic flow velocity / mean flow velocity ) - 14 . the icp calculated by the formula was 40 mmhg in our liver transplant recipient ( case 1 ) , supporting that the dilated onsd is associated with icp > 20 mmhg . in this case report , we can not examine simultaneously onsd and tcd at several specific time points ( such as anhepatic phase , post - reperfusion phase , or neohepatic phase ) during liver transplantation . further studies will be required to evaluate the icp status by simultaneous examinations of onsd and tcd at specific time points . in addition , a possible limitation of ocular onsd measurement is intra - observer or inter - observer variability , which is dependent on clinical experience and skill of observers . however , we consider that onsd measurements are highly reliable because they were done by a physician well - trained in ocular ultrasonography . in summary , the cases described in this report suggest that ultrasound measurement of onsd may have clinical relevance as a feasible diagnostic tool for the noninvasive , rapid , and simple detection of increased icp in liver transplant recipients .

we are living within a cycling environment in which changes occur on a daily basis with a period length of 24 h and others that alternate with a periodicity ranging from several months ( seasonal ) , to annual cycles . importantly , not only are our surroundings rhythmic , but humans , as well as the simplest of organisms display endogenous rhythms . nevertheless , much of today 's identified rhythmic physiological processes are not coincidentally in or out of phase with exogenous rhythms but are in part driven and reset by cycling physical cues . the field of biological research that focuses on endogenous rhythms is known today as circadian biology . the term circadian was first coined by franz halberg in the late 1950s derived from latin circa meaning about and dies known as day , thus , referring to endogenous rhythms that cycle with a period length of about a day . rhythms with significantly shorter or longer periodicities than 24 h are known as ultradian and infradian rhythms , respectively . environmental rhythms as in the cycling of daylight , resulting from the earth 's rotation about its axis , and to which temperature rhythms are coupled to , have an impact on our endogenous clock . eyes for example , sense daily rhythms in light / dark cycles , thus , transmitting lighting information via the retinohypothalamic tract , in humans and other mammalian species , to a central circadian clock located in the suprachiasmatic nucleus ( scn ) . the scn in turn communicates information about time chemically , by regulating rhythmic melatonin synthesis for instance , to other downstream oscillators within the hierarchal structure of the circadian system . we , therefore , can say that daily exogenous rhythms function as zeitgebers ( german for time cues or time - givers ) for our internal circadian system . meaning , an overt rhythm , as in locomotor activity , maintains in synchrony ( of particular phase relationship ) with its environment . this is important because the periodicity of biological clocks generally deviate from cycling with a period of exactly 24 h. therefore , biological rhythms with periods > or < than 24 h , need to be reset backwards or forwards , respectively , on a daily basis . , 1998 ; hurd et al . , 1998 ) , feeding behavior ( stokkan et al . , 2001 ) , core body temperature ( castillo et al . , 2005 ) and memory processing ( chaudhury and colwell , 2002 ; fernandez et al . , 2003 ; lyons et al . , 2005 ) are just a few examples of either direct circadian outputs or indirectly modulated outputs of the circadian system . this review will focus on the role of the hormonal time cue , melatonin , on the circadian modulation of memory processing . melatonin ( n - acetyl-5-methoxytryptamine ) is a hormone first discovered in the late 1950s by aaron lerner ( lerner et al . , 1958 ) . melatonin in most vertebrates has been shown to be rhythmic with elevated levels restricted to nighttime ( cassone , 1990 ) irrespective to the organism 's activity profile , thus , the coined term the functional roles of melatonin , proposed in many studies , are widespread as shown next . the rhythmic melatonin profile is defined mostly by the temporal regulation of arylalkyamine - n - acetyltransferase - mrna at the transcriptional level ( klein et al . , 1997 ) and the product of post - translational regulation ( pozdeyev et al . , 2006 ) . the scn is coupled to the pineal gland , a photoneuroendocrine transducer , via interconnected anatomical neuronal substrates , collectively known as the photoneuroendocrine pathway ( korf et al . , 1998 ) . in contrast to scn driven pineal melatonin synthesis , local pineal oscillator - dependent rhythmic melatonin synthesis were identified in lower non - mammalian species such as birds ( zimmerman and menaker , 1975 ) , sauropsids ( bartell et al . , 2004 ) , and teleosts such as zebrafish ( cahill , 1996 ; kaneko et al . , 2006 ) . interestingly , the rainbow trout ( oncorhynchus mykiss ) among other salmonids , lacks a local pineal oscillator . consequently , the shape of its rhythmic melatonin synthesis profile is entirely dependent on the subjected light / dark cycle ( kroeber et al . , 2000 ) . in addition to a circadian regulation of melatonin synthesis , light itself impacts pineal melatonin synthesis on a post - translational level ( gastel et al . , 1998 ) . importantly , the inhibitory effect of light on melatonin synthesis seems to be preserved during evolution , irrespective of the presence of a local pineal oscillator ( gaston and menaker , 1968 ; zimmerman and menaker , 1975 ; turek et al . evolutionary differences in the regulation of melatonin synthesis may account for differences in the importance of pineal melatonin in circadian physiology across different animal models . for example , while in sparrows and lizards , melatonin has a profound role in the circadian organization , as the stability of the circadian system is sensitive to alterations in melatonin ( binkley et al . , 1971 ; underwood , 1983 ) , nocturnal rats show no measurable effect on rhythms of sleep - wake cycle and locomotor activity ( cheung and mccormack , 1982 ; fisher and sugden , 2010 ) . in humans , much of the focus on the role of melatonin and its therapeutic aspects is related to sleep , perhaps due to the coincidence of elevated nighttime melatonin levels , in phase with increased sleep drive and maintenance ( hughes et al . 2009 ) . the role of melatonin on sleep onset and/or sleep maintenance is in part through the direct action of melatonin on specific brain - areas involved in sleep regulation and via its role on the circadian system ( armstrong et al . , 1986 ; sack et al . , 1998 ) lavie argued that melatonin is involved in the regulation of sleep by inhibiting centers of the central nervous system ( cns ) involved in generating wakefulness ( lavie , 1997 ) . about the same time , sack , lewy , and hughes proposed an alternative hypothesis , stating that melatonin may act as a sleep promoting molecule by counteracting a signal believed to originate from the scn to promote daily awakening ( sack et al . , 1998 ) . nevertheless , apart from the role of melatonin on sleep , many studies propose broad applications for melatonin and its analogs on the circadian system , particularly in ameliorating the physiological and psychological effects of jet - lag ( arendt and broadway , 1987 ; petrie et al . , 1989 ) and as a therapeutic agent for disorders related to circadian rhythm disturbances . a role for melatonin in modulating complex processes such as learning and memory ( bob and fedor - freybergh , 2008 ) was first proposed when a functional impact for melatonin was discovered in brain structures such as the hippocampus known to play an important role in memory processing . at the society of neuroscience annual meeting ( 1995 ) gonzales and armstrong showed that melatonin interferes with neuronal transmission and long - term potentiation ( ltp ) in the dentate gyrus of the hippocampus . later , dawn collins and stephen davies proposed one mechanistic pathway for melatonin action on ltp and neuronal transmission by modulating nmda receptor functionality ( collins and davies , 1997 ) . the investigation by hogan , sherif , and wierasszko on the inhibitory action of melatonin on ltp , concluded the effect of melatonin on ltp to be mediated by modulating synaptic efficiency and/or excitability of hippocampal neurons ( hogan et al . , 2001 ) . rhythmicity in melatonin levels on a 24 h day / night cycle could thus , potentially alter hippocampal function and influence the physiology of memory processing . later it was demonstrated that inhibition of both melatonin receptors [ mt(1)/mt(2 ) ] using antagonists such as luzindole ( dubocovich , 1988 ) can attenuate the effect of melatonin on excitatory postsynaptic potentials ( wang et al . , 2005 ) . this was a big leap in the field , as the approach of using melatonin receptor deficient mice proved the specificity of melatonin action on hippocampal ltp , namely , to be melatonin receptor mediated . furthermore , by dissecting intracellular regulatory signaling pathways such as adenylyl cyclase ( also known as adenylate cyclase : ac ) -pka signaling known to be modulated by melatonin ( roberson and sweatt , 1996 ) , colwell 's group confirmed the inhibitory action of melatonin on ltp to be linked to the action of melatonin on ac - pka signaling in the hippocampus ( wang et al . , 2005 ) . furthermore , the inhibitory effect of melatonin on ac - pka pathway was shown to be mediated via the mt(2 ) melatonin receptor subtype , as the inhibitory effect on ltp was absent in both mt(2 ) and mt(1)/mt(2 ) deficient mice but not in mt(1 ) knockout animals . in addition , using a selective mt(2 ) receptor antagonist ( 4-pdot ) the inhibitory effect of melatonin on ltp could be blocked . ( 1995 ) in the scn , showing the activation of mt(2 ) receptors by melatonin to be negatively coupled to ac and pka activity ( reppert et al . , 1995 ) and positively coupled to the pkc cascade ( mcarthur et al . , 1997 ; larson and colleagues provided exciting results using both in vitro physiological and in vivo behavioral approaches to study the role of mt(2 ) receptors ( larson et al . , 2006 ) . here , mt(2 ) deficient [ mt(2 ) ] mice showed a significantly reduced ltp compared to wild type mice . furthermore , using an in vivo learning and memory task , to evaluate spatial long - term memory ( hippocampal dependent task ) , mt(2)-mice , demonstrated impaired memory performance . based on the here summarized data for the effect of melatonin on hippocampal neuronal electrophysiological properties , memory relevant signaling cascades and behavior ( table 1 ) , all of which are evidence for its influence on memory processing , depicts the hypothesis , that rhythmic endogenous melatonin functions as a cycling modulator for memory processing , almost as a given . mel , melatonin ; ko , knockout ; mt(2 ) , melatonin receptor 2 ; ltp , long - term potentiation . for references see : ( hogan et al . , 2001 ; wang et al . , 2005 ; larson et al evidence for a circadian influence on acquisition and memory processing ( gerstner et al . , 2009 ) was first demonstrated in systems where the circadian organization was disrupted ( tapp and holloway , 1981 ; fekete et al . , 1985 ; antoniadis et al . , 2000 ; devan et al . , 2001 ) . disturbing a system 's circadian organization in rats trained for either a passive or active - avoidance learning task influences the mnemonic performance of the animal by affecting memory retrieval ( fekete et al . , 1985 ) . however , in place navigation learning , disruption of the circadian organization results in impaired memory consolidation ( devan et al . , 2001 ) . this may indicate that memory processes such as acquisition , consolidation , and retrieval for various learning paradigms may be differentially affected by the animal 's circadian system . since learning associated with diverse tasks may involve different neuronal substrates for memory processing ( gerstner et al . , 2009 ) , distinct neuroanatomical structures can be differentially regulated by the circadian system , and , thus , may influence distinctive stages of memory processing . more recent studies , developed new methods that permit to conceive the circadian influence on memory processes while preserving the integrity of the circadian system ( chaudhury and colwell , 2002 ; fernandez et al . these studies not only confirmed the involvement of the circadian system in modulating memory processes , but could also for the first time visualize the effect and confirm which memory process ( acquisition , consolidation and/or retrieval ) is being modulated . for example , in aplysia californica , the formation of long - term memory ( consolidation process ) was shown to be most robust when animals were trained during the subjective day ( the active phase ) and suppressed during the subjective night ( the inactive phase ) ( lyons et al . , 2005 ) . in mice , two stages of memory processes ( acquisition and recall ) for a fear - conditioning paradigm was shown to be circadian modulated . mice recall the conditioned task better and show an increased learning rate during their inactive phase as opposed to their active phase ( chaudhury and colwell , 2002 ) . since these studies were performed under constant conditions , in the absence of external time cues , the rhythm in memory processing ( acquisition , consolidation and retrieval ) must be modulated by the organism 's circadian system . with the current knowledge , time is ripe to address the mechanism(s ) behind day / night difference in memory processing using innovative methodologies to gain new insights into how time is modulating memory . zebrafish ( danio rerio ) , a diurnal organism , was used as a model system to investigate the role of the circadian system in modulating learning and memory formation , using a modified active - avoidance conditioning ( aac ) paradigm ( rawashdeh et al . , 2007 ) . both compartments were separated by a semi - partition allowing the fish to swim freely between both compartments . in this task , animals had to learn to associate a compartment within the training tank having a light signal ( conditioned stimulus cs ) as the safe environment and/or the dark compartment associated with mild electric shocks ( unconditioned stimulus us ) as the unsafe environment . when fish were trained during their active phase ( daytime ) under a light / dark cycle , they demonstrated a shortening in the time required to meet the learning criteria as compared to training during the nighttime . furthermore , when retraining animals 24 h later , to measure for memory formation , only those animals trained during the light period showed improved performance when compared to the initial training session . this diurnal pattern in the rate of acquisition persisted also under constant conditions ( darkness ) , however , with a clear difference in the amplitude of the rhythm . more precisely , the performance in the rate of relearning when trained 24 h later during the subjective daytime was significantly reduced as compared to animals trained at the same phase but under light / dark conditions . it was hypothesized then , that in the presence of light the additional reduction of daytime melatonin levels in zebrafish , further decreases a melatonin mediated inhibition on memory consolidation . to test this hypothesis , the action of pharmacologically applied melatonin was tested on memory performance during the subjective daytime when memory formation for aac was enhanced . from the dose response curve for melatonin action on memory performance it was demonstrated that melatonin has indeed an inhibitory effect on memory consolidation . importantly , melatonin was found to be effective in interfering with long - term memory formation for aac , however , only when it was applied prior to training . furthermore , no effect of melatonin on memory retrieval was observed when animals were given melatonin prior to testing the animal 's performance after 24 h. the later suggests that melatonin does not obstruct the retrieval of the newly formed memory for aac . in conclusion , melatonin has a profound influence on an early yet necessary event required for memory consolidation in zebrafish . if endogenous nighttime melatonin had an effect on memory retrieval it would have become apparent when assaying aac performance for daytime trained animals during nighttime , 36 h instead of 24 h later . this , however , was not the case , since the time of training not the time of testing was the determining factor in the animal 's performance . the specificity of the effect of pharmacological melatonin treatment on memory consolidation to be mediated by its receptors was confirmed using mt(1)/mt(2 ) receptor antagonists prior to the melatonin treatment . it was next hypothesized that by blocking nighttime melatonin signaling using only melatonin receptor antagonists , that nighttime impairments in memory consolidation for aac could be lifted . indeed , training zebrafish during the nighttime , when memory consolidation following nighttime acquisition is weakest , mimicked daytime performance for aac . to confirm that endogenous melatonin plays a role in the circadian modulation of memory performance , demanded the removal of the main source of melatonin synthesis , namely the pineal gland ( figure 1 ) . the data show that pinealectomy per se has no effect on acquisition and on the improvement of daytime aac performance during testing as compared to sham operated animals . in contrast to daytime memory performance for aac , nighttime memory performance was different . during nighttime , when pinealectomized animals were trained for aac , zebrafish demonstrate memory performance for aac similar to their performances for normal daytime trained animals . therefore , it was concluded that endogenous nighttime melatonin has an inhibitory effect on zebrafish nighttime aac performance . whether this effect of melatonin is species specific and/or dependent on the activity profile of the animal model ( diurnal vs. nocturnal ) remains to be investigated . however , in the case of zebrafish , we conclude that cycling physiological melatonin is one mechanism by which the circadian system is rhythmically modulating memory processing for aac ( figure 2 ) . representative pictures of zebrafish brain . left : sham operated animal depicting an intact pineal gland ( see also inset ) . note the absence of a pineal gland between the telencephalon and the diencephalon in the photograph to the right as compared to the left . working model , illustrating the hypothesized rhythmic modulatory role of endogenous melatonin on memory processing . cycling endogenous melatonin levels regulated by the circadian clock and by light / dark cycles , modulate the processing of newly acquired information into long - term memory . inhibition ( ) of melatonin synthesis by the circadian clock or light directly , facilitates ( + ) long - term memory formation . alternatively , the nighttime peak in melatonin levels imposes an inhibitory effect ( ) on memory consolidation . the findings that nighttime melatonin may actively suppress memory consolidation following nighttime acquisition may implicate a similar endogenous role for melatonin in humans . note that under normal ( healthy ) physiological conditions the direct effect of melatonin on human cognition has not been investigated to the best of our knowledge . the only data available suggesting a link between endogenous melatonin rhythm and cognition in humans comes from studies in which the population sample chosen falls within a specific category of disease ( beversdorf et al . , 2000 ) or age ( touitou et al . , 1981 ; savaskan et al . , 2005 ; brunner et al . , although several studies included in their investigation , established questionnaires to evaluate the impact of melatonin on mental performance , this area of research remains at its infancy . while , we do not expect nighttime melatonin to be detrimental for proper memory consolidation for tasks acquired during daytime , we hypothesize that nighttime melatonin does have an effect on memories to be formed for tasks learned during nighttime . this , however , will be a very challenging task , as it calls to dissociate the impact of sleep - loss on the expense of nighttime learning from that of the hypothesized effect of melatonin on memory for newly nighttime acquired tasks . nevertheless , the improvement of memory by blocking nocturnal melatonin signaling in zebrafish , has some symptomatic resemblance to autism spectrum disorder individuals showing high memory capacities ( beversdorf et al . , 2000 ) associated with abnormally low and/or arrhythmic 24 h melatonin levels ( melke et al . , 2008 ) . in these individuals , applied melatonin treatments demonstrated to be beneficial in several of the symptoms associated with autism . however , since enhanced memory capacity in these individuals is secondary at least in the eyes of the parents as compared to severe social retrieval and sleep disturbances , the effect of such melatonin treatments on their mental performance has not yet been investigated . importantly , the finding that by blocking melatonin signaling , nighttime acquisition is translated into a long - term memory encourages further research as a possible therapeutic or perhaps as a short - term cognitive compensatory treatment for people subjected to abnormal sleep / wake cycles to improve temporary deficits in mental performance . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

malignancies of the clavicle are rare , making up just 0.451.01% of all bone tumours [ 1 , 2 ] . total claviculectomy is a rare , poorly described surgical technique , and to our knowledge there have been no large - scale trials on the outcome of those who have undergone this procedure . radical ablative surgery is avoided when possible , in favour of limb salvage procedures , which involve resection of the tumour and reconstruction using a prosthesis , an allograft , a bridging technique or a vascularized autograft . all of these techniques come with theoretical drawbacks , which can be overcome via en bloc resection of the tumour and extracorporeal irradiation , followed by reimplantation of the irradiated bone , providing a perfect fitting , non - allergenic structure devoid of tumour . this method means that the joint remains mobile , does not become loose or break like some massive prostheses , and the problems of bone banks and rejection of allografts can be avoided . in this report , we present a case where an extracorporeally irradiated clavicle was used as an autograft to treat a suspected clavicular malignancy . a 45-year - old woman presented with a 20-year history of a lump in the mid - third of the left clavicle , which had recently increased in size to 10 cm in diameter . plain x - ray , computed tomography ( ct ) chest and clavicle , and bone scans were used to image the lesion ( figs 13 ) . radiology reported the lesion as a parosteal osteosarcoma , based on the ct appearance of tumour growing into the medulla of the mid - third of the clavicle ; not usually a feature of an osteochondroma or an osteoma . biopsies showed dense sclerotic bone , with no obvious malignant features . to confirm diagnosis complete excision of the tumour was needed , with a partial excision and scraping the lump off the surface deemed unsafe . the patient was informed that , following a total claviculectomy , a 30% functional loss ( 29.5% ) in her left shoulder power would be expected . her active lifestyle meant this result was unacceptable , so she opted instead for excision of the tumour plus the adjacent clavicle , irradiation and reimplantation of the bone with internal fixation , despite this being relatively experimental . if successful , she would have virtually normal function . although possible risks included infection or development of non - union , which would require further surgery or possible complete claviculectomy , it was deemed oncologically safe with a low risk of complications . figure 2:preoperative ct scan , axial view showing the extent of the tumour . figure 3:preoperative bone scan . the surgery was carried out through an incision over the clavicle and the tumour was carefully dissected leaving a layer of normal tissue over the mass . the clavicle was then removed by resection through the sterno - clavicular and acromio - clavicular joints and careful division of the subclavius muscle , preserving the underlying neurovascular structures . the main mass of the tumour was then stripped from the clavicle , leaving the residual bone and the attached ligaments . the bone was then soaked in a solution of vancomycin 1 g dissolved in 200 ml of saline , wrapped in swabs and then two sterile bowel bags . irradiation of the bone with 90 gy was then carried out at the local radiotherapy unit . after 1.5 hours , the bone was removed from the sterile bowel bags and reimplanted . the conoid and trapezoid ligaments were repaired as were the ligaments and capsule at either end of the bone , with a plate applied to the bone to strengthen it . the wound was closed and the patient advised to use a sling for 6 weeks . the patient had 3 monthly follow - up and at 2 years , there was no evidence of local recurrence or complications . she had a full and pain - free range of motion of the shoulder and was completely asymptomatic ( fig . four years following the procedure , after discomfort in her shoulder , x - rays revealed that the plate had broken and there was a fracture of the clavicle . this plate was subsequently removed and an underlying non - union was found , but no evidence of recurrence of the tumour . she has been managed symptomatically since and has a full range of shoulder movements but some discomfort when doing heavy lifting , which she therefore avoids ( figs 5 and 6 ) . figure 5:follow - up radiograph at 76 months . surgical treatment of clavicular tumours can be extremely difficult without total resection of the clavicle . for our patient , the potential reduction in normal function that comes with total claviculectomy was unacceptable . reconstruction of the clavicle can be achieved using a variety of techniques , with resection of the tumour and extracorporeal irradiation followed by reimplantation of the irradiated bone , being chosen in this case . it is essential that the functional outcome of the method chosen at least equals that of the more radical procedure , total or partial claviculectomy . reconstructive surgery is useful cosmetically , as well as functionally , although there are case studies which argue the difference is minimal compared with claviculectomy [ 3 , 8 , 9 ] . extracorporeal irradiation and reimplantation of the patient 's own clavicle is a useful method of limb salvage . after irradiation , the clavicle is free of tumour , and can be used as a scaffold for reattachment of muscles and ligaments . there are inherent risks with this procedure , as it prolongs operative time , with a study in 20 patients showing a 15% risk of infection , a 25% risk of non - union and a 5% risk of fracture . previous studies on the functional outcome of patients who undergo total claviculectomy have been contrasting , with some finding the function to be 70.5% of normal . in our patient , she was completely asymptomatic at 2-year follow - up , with a full range of motion of the shoulder and no evidence of local recurrence or complications . however , she then developed a fracture 2 years following this , which meant the plate needed to be removed . despite this , the patient still has a good range of movement and any pain experienced has not been sufficient to warrant any further intervention . in summary , extracorporeal irradiation followed by reimplantation of the clavicle is a useful alternative to total claviculectomy for certain low grade tumours of the clavicle , as it provides functional , cosmetic and oncological outcomes that are equal to , if not superior those of total claviculectomy .

various studies have shown the risk factors for elbow and shoulder injuries among young baseball players1 , 2 . the incidence of elbow and shoulder pain increases with increasing age , increasing weight , decreasing height , weight lifting , pitching with arm fatigue , and increasing number of pitches thrown per season1 , 2 . in addition , the lower extremity motion of adolescent baseball players is important to understanding the pitching motion and the implications of the lower extremity technique in upper extremity loads , injury , and performance . the star excursion balance test ( sebt ) is a functional performance test of the lower extremity and is used to assess chronic ankle instability and anterior cruciate ligament injury3,4,5 . it has been proposed to challenge dynamic postural control because the subject must maintain balance on a single limb , whilst the other limb carries out a series of reaching tasks . moreover , the sebt reach distance is correlated with hip range of motion ( rom ) and strength6 , 7 . however , little is known about the relationship between lower extremity balance and tightness in young athletes . therefore , the purpose of this study was to examine the relationship between lower extremity tightness and lower extremity balance as measured by the sebt in junior high school baseball players . thirty - three male students belonging to baseball clubs in 2 junior high schools ( mean age , 13.4 0.5 years ; height , 158.9 5.9 cm ; weight , 49.8 5.5 kg ) participated in this study . none of the subjects had suffered an injury in the past 6 months or had a self - reported disability in a lower extremity . before enrollment in the study , the study conformed to the declaration of helsinki and was approved by the gunma university ethics committee . the sebt , a multidirectional test of dynamic postural control , involves balancing on 1 leg and using the other leg to reach the maximum distance in 8 different directions : 3 anterior , 2 lateral , and 3 posterior directions . for the sebt , we chose to examine the anterior ( ant ) , posterior ( pos ) , lateral ( lat ) , and medial ( med ) directions . participants underwent the testing barefoot , with the foot position controlled by aligning the heel with the center of the grid and the great toe with the anteriorly projected line . this position was marked with a piece of tape to ensure accurate repositioning between trials . subjects were instructed to perform maximal reach with the opposite lower extremity followed by a single , light toe touch on the tape ( fig . errors were recorded if the hands did not remain on the hips , the position of the stance foot was not maintained , the heel did not remain in contact with the floor , or the subject lost balance during the trial . leg length was used to normalize excursion distances by dividing the distance reached by leg length and then multiplying by 100 . leg length was measured from the anterior superior iliac spine to the distal tip of the medial malleolus using a standard tape measure while the participants lay in a supine position . in this study , we classified the leg on either side as the axis leg and step leg at the time of pitching . star excursion balance test ( sebt ) regarding muscle tightness measurement , the angle of each joint of the bilateral iliopsoas , quadriceps , hamstring , and gastrocnemius was measured , referring to the measurement method reported by tolii9 . additionally , bilateral hip external rotator and internal rotator tightness was measured in the supine position , with the hip flexed at 90 degrees . using spearman s rank correlation , we calculated bivariate correlations between the sebt score and the muscle tightness of the stance leg during the sebt . statistical analysis was performed using spss version 20 for windows , and a p < 0.05 was considered statistically significant in all analyses . all lower extremity tightness and sebt scores are presented in tables 1 and 2table 1 . star excursion balance test ( sebt ) resultsdirection of sebtstep - leg stanceaxis - leg stanceanterior ( % ) 91.9 6.991.1 5.9posterior ( % ) 88.8 6.887.1 6.6lateral ( % ) tightness test resultsmusclestep - leg tightness ( degrees)axis - leg tightness ( degrees)hip internal rotator41.4 9.638.9 7.9hip external rotator48.9 11.854.9 10.7quadriceps148.7 8.6147.0 8.3hamstring68.3 9.968.1 10.3iliopsoas8.5 2.18.5 2.7gastrocnemius51.9 6.250.8 6.3data are expressed as mean sd .. the ant direction of the step - leg stance was significantly negatively correlated with gastrocnemius tightness ( r = 0.470 , p = 0.006 ) . the med direction of the step - leg stance was significantly positively correlated with hip internal rotator tightness ( r = 0.572 , p = 0.001 ) and hamstring tightness ( r = 0.457 , p = 0.007 ) . the ant direction of the axis - leg stance was significantly negatively correlated with gastrocnemius tightness ( r = 0.420 , p = 0.015 ) . the lat direction of the axis - leg stance was significantly negatively correlated with iliopsoas tightness ( r = 0.394 , p = 0.023 ) and gastrocnemius tightness ( r = 0.416 , p = 0.016 ) . the med direction of the axis - leg stance was significantly negatively correlated with gastrocnemius tightness ( r = 0.371 , p = 0.033 ) . in this study , we observed a significant correlation between lower extremity tightness and reach direction in the sebt . a previous study reported that the ankle dorsiflexion rom was significantly correlated with the ant reach distance in the sebt10 . in addition , in the results of this study , it became clear that gastrocnemius tightness is also correlated with the med and lat reach distance . similarly , as gastrocnemius tightness increases , the med and lat reach distances also decreases . therefore , the role of ankle dorsiflexion movement is also important when reaching in the med and lat direction . the tightness of the hip internal rotator and hamstring is negatively correlated with med reach . as each muscle s tightness increases , med and lat reach decrease . a recent investigation exploring kinematic predictors of sebt performance reported that the sagittal plane motion of the knee and hip account for approximately 90% of the variance in med and lat reach6 . therefore , in med and lat reach , movement of the knee and hip joint is considered important , and the influences of iliopsoas tightness and hamstring tightness were significant . therefore , the ant reach direction in the sebt may be a useful clinical indicator of lower extremity function for individuals with gastrocnemius tightness , and the med and lat reach directions in the sebt may be useful for assessing individuals with tightness in the iliopsoas , quadriceps , and hamstring . the sebt is a functional performance test of the lower extremity and is used to assess chronic ankle instability and anterior cruciate ligament injury3,4,5 . in young baseball players , the rates of elbow and shoulder injuries are high . it is thought that the muscle tightness and instability due to muscle weakness of the lower extremity results in breakdown of the kinetic chain , causing early trunk rotation , an increase in elbow valgus , or shoulder rotation , and it is thought that the load of the upper extremity is increased . in other words , tightness and instability of the lower extremity may induce injury in the upper extremity . therefore , by including assessment of the tightness of the lower extremity , the sebt could be used as a standard evaluation test when examining upper extremity injuries in young baseball players . in the future , the relationship between throwing - related injuries and dynamic postural control measured by the sebt should be considered . from our results since the rate of upper extremity injury is high in these subjects and this could be due to tightness and instability of the lower extremity from a kinetic viewpoint , the sebt could be used as a standard evaluation test when examining upper extremity injuries in young baseball players .

a previous paper in this series summarised the steps that one is strongly encouraged to follow in order to ensure proper nomenclature of any gene . three examples were given to illustrate how and why one should strive for a standardised gene nomenclature system . in these examples , the focus of the paper was on using the gene names as search terms , rather than comparing a dna or protein sequence that has just been determined by searching via blast . the three examples included : ptgs1 and ptgs2 as the correct gene names for prostaglandin g / h synthase-1 and -2 , also known as cyclooxygenase-1 and -2 and commonly erroneously nicknamed ' cox-1 ' and ' cox-2 ' in many journals ; the short- and long - chain fatty acid synthase gene families , for which there is currently no official agreed - upon nomenclature ( although fasn on human chromosome 17q25 is the official symbol for the fatty acid synthase gene ) ; an por as the correct name for the nadph - p450 oxidoreductase gene . before deciding upon a new gene symbol , the reader is encouraged to visit the website describing this topic . this theme is extended in the current paper , which shows how two completely separate research communities adopted the same gene root name , while not realising that the other group had done the same thing . as head of the cytochrome p450 ( cyp ) superfamily gene nomenclature committee , david nelson maintains a website dedicated to cytochrome p450 gene nomenclature . the c. elegans genome has 76 full - length p450 genes and nine pseudogenes , which have been assembled by nelson during the past several years and were nearly completed after the genome sequence had been published . recently , dan lawson of wormpep asked nelson to review assemblies of these genes , following the recent revision of the worm 's genome . while carrying out this request , nelson discovered that dan lawson had referred to several p450 genes as ' ccp - xx ' . nelson then explored wormpep further and confirmed that ccp was being used as the root for cytochrome p450 genes . although the usual root for p450 gene names is cyp , this term ( cyp ) was being used in the c. elegans protein database for the cyclophilins ( table 1 ) can this be a problem -- i.e. the same gene root being used for different gene families by colleagues in two separate , very distant research fields ? data taken from jonathan hodgkin , cgc genetic map and nomenclature curator ( caenorhabditis genetics center ) , genetics unit , department of biochemistry , university of oxford , south parks road , oxford ox1 3qu , uk . the mammalian cytochrome p450 ( cyp ) superfamily encodes enzymes involved in : the metabolism of pharmaceuticals , foreign chemicals and pollutants ; arachidonic acid metabolism and eicosanoid biosynthesis ; cholesterol , sterol and bile acid biosynthesis ; steroid synthesis and catabolism ; vitamin d3 synthesis and catabolism ; retinoic acid hydroxylation ; biogenic amine and neuroamine metabolism ; and several orphan cyp genes still of unknown function . there are 102 and 57 putatively functiona cyp genes in the mouse and human , respectively . to date , more than 3,400 p450 sequences have been named with the three - letter root of cyp . this nomenclature has been in place since 1987 , and is growing every day . the official root names for mouse and human p450s are cyp and cyp , respectively . it is anticipated that the number of named p450 genes will exceed 4,000 by the end of 2004 . whereas continuing to use the cyp root for cyclophilin genes will be a nightmare for cyclophilin researchers , p450 researchers might find this an annoyance but not really much of a problem . to prevent conflicts over nomenclature , it becomes increasingly urgent to rename the cyclophilin genes . the three families of immunophilins , known as peptidylprolyl cis - trans isomerases ( ppiases ) , include the cyclophilins , the fk506-binding proteins ( fkbps ) and parvulin [ 11 - 13 ] . all three gene families are found in animals , plants and eubacteria . while two cyclophilins and two types of fkbps exist in archaebacteria , no parvulin homologue has been found . a search of the locuslink , hugo gene nomenclature committee , and the national center for biotechnology information ( ncbi ) unigene websites using ' parvulin ' , shows a single gene ; pin4 and pin4 are the approved mouse and human gene names , respectively . ' pin ' is an abbreviation for peptidylprolyl cis - trans isomerase nima - interacting-4 . ' nima ' stands for ' never - in - mitosis - gene - a ' , which was first isolated as a series of conditional cell cycle mutants that failed to enter mitosis in aspergillus nidulans . there are 11 genes ( nek1 , nek2 , ... nek11 ) in the human genome that encode nima - related mitotic kinases and are involved in dna replication and genotoxic stress responses . although parvulin has peptidylprolyl cis - trans isomerase activity , it shares no evolutionary homology with the fkbps or cyclophilins . immunophilins are defined as receptors for immuno - suppressive drugs including cyclosporin - a , fk506 and rapamycin . fk506 is also called tacrolimus , a macrolide of fungal origin ( produced by streptomyces tsukubaensis ) and having strong immunosuppressive actions . fk506- and rapamycin - binding proteins are abbreviated as fkbps and share no evolutionary homology with the cyclophilins or parvulin . a search of the locuslink , hugo gene nomenclature committee and the ncbi unigene websites using ' fkbp ' , shows more than 80 fkbp genes in the human and mouse ( fkbp1 , fkbp2 , ... fkbp82 ) . these gene products have many unique features , such as targeting bcl2 to the mitochondria and inhibiting apoptosis . cyclophilins , the third and last class of the ppiases , comprise cyclosporin - a - binding proteins ranging in size from 17 kda to 324 kda . this class of immunophilins carries out a wide range of functions -- including acting as a chaperone to facilitate the nuclear transport of the somatolactogenic hormones , facilitating the calcium - regulated mitochondrial permeability transition pore which precedes apoptosis and participating in the pre - mrna splicing machinery . cyclophilin - binding drugs are emerging as potential leads to novel targets for interference with interleukin-12 production and , therefore , to the possibility of treating conditions such as multiple sclerosis and rheumatoid arthritis . a search of the locuslink , hugo gene nomenclature committee and the ncbi unigene websites using ' cyclophilin ' , shows 15 putatively functional genes and 22 pseudogenes . the 15 putatively functional gene names ( table 2 ) include ppia through to ppih ( for peptidylprolyl isomerase - a , -b , ... -h ; cyclophilin a- , b- , ... h - related ) , one ppia - like ( ppial3 ) , and six cyclophilin - like ( ppil1 , ppil2 , ... ppil6 ) . list of putatively functional human cyclophilin genes . not included here are ppial , ppial2 , ppiap , ppi ap2 , ppiap3 , ppiap4 , ppiap5 , ppiap6 , ppihp1 , ppihp2 , ppil1p1 , ppip1 , ppip2 , ppip3 , ppip4 , ppip5 , ppip6 , ppip7 , ppip8 , ppip9 , ppip10 and ppip11 , which represent the 22 cyclophilin pseudogenes in the human genome project ( hgp ) database . ppid has the synonym ' cyp-40 ' , but this is no longer the official name . unfortunately , the mouse riken full - length cdnas that match this sequence are being called cyp40 , not ppid , so the name is propagating itself in the literature and into the databases in an uncontrollable way . the cloning and naming of 11 cyclophilin genes from c. elegans ( cyp-1 to cyp-11 ) a search of genbank for cyp20 finds ay568517 , a arabidopsis thylakoid lumen cyclophilin , named cyp20 - 2 . ( cyp20a1 is a chordate cytochrome p450 of unknown function , possibly involved in development . ) the date on this arabidopsis cyp20 genbank entry is 15th april , 2004 , showing that the problem is not going away . in fact , the pubmed link from the genbank entry leads to a publication in which a nomenclature system for the 29 cyclophilin genes in the arabidopsis thaliana genome is presented using cyp as the root . solutions -- like politics -- are local . we have contacted the c. elegans community and alerted them to this nomenclature conflict . they are responding and will select a new root for cyclophilins and change their p450 gene names to cyp- , from the current ccp- root . this will go into the official wormpep and wormbase nomenclature and will eventually prevent use of the cyp- root in c. elegans ( and , hopefully , c. briggsae ) for cyclophilins . additional effort will be needed for the arabidopsis community , as well as for the human and mouse gene databases . cyn has been used for cyclone , a mouse gene in locuslink ; cpn1 and cpn2 are being used for carboxypeptidase n-1 and -2 ; cph was considered , but cph1 has been used to refer to a cryptochrome or phytochrome ( light - sensing protein ) . because of the sharing of this paper ( while still being written ) with lois maltais of mouse genome informatics ( mgi ) , she consulted with the authors of the mouse cyclone gene paper and they have now agreed to use cycn , in order to free up cyn and cyn for the mouse and human cyclophilin , respectively . after searching databases and search engines for conflicts , the present authors suggest that cyn- might be the most suitable root for c. elegans cyclophilins , but this needs to be decided among members of the worm community . it is unfortunate that some databases ( eg worm , yeast and bacteria ) are mandating that gene names be limited to three letters . the authors suspect that three - letter root names for the ~19,000 c. elegans genes may not be enough . 26 cubed is only 17,576 ; this will require the use of odd letter combinations that have no symbolic meaning , such a xyz1 , cxq , rzx , etc . also , the nature of language is to use some letters more often than others , which will put great pressure on naming the genes that begin with the most often - used letters . using evolutionary trees to assign names to genes in the p450 superfamily , in the authors ' experiences , has been very positive . this can work in general for any other homologous group of genes and , in fact , has been used for at least 124 families and/or superfamilies to date . to illustrate this point , a simple sequence alignment ( figure 1 ) and tree ( figure 2 ) upgma tree and possible family and subfamily divisions of the caenorhabditis elegans cyclophilin gene family , based on evolutionary divergence . the root of cyn- , is acceptable because it has not yet been used by any other gene database , except ' cyclone ' in mouse . families are designated by arabic numerals and represent amino acid identity of 40 per cent or greater . subfamilies are designated by letters and represent amino acid identity of 54 per cent or greater . the vertical lines in figure 2 are suggested break - points for family and subfamily designations . branches on the tree intersected by the lines would define family and subfamily clusters . the lines could be moved to modify the number of families and subfamilies . as drawn , there are six subfamilies in family 1 , and one each in families 2 and 3 . moving the subfamily line to the left could reduce the number of subfamilies in family 1 from six to three . if cyn were used , ce28157 ( at the top of figure 2 ) would be named cyn3a1 and ce20374 ( at the bottom of figure 2 ) would be named cyn1a1 , and so on . a method for creating a network of ' gene co - occurrences ' from the literature , and portioning it into communities of related genes , a program is described ( but not named ) which searches all medline titles and abstracts and omim entries for occurrences and co - occurrences of gene symbols , gene names and diseases ; the databases contain more than 12 million abstracts . relationships are identified by automated bioinformatics methods between genes , and between genes and diseases , that might not be detected by less computationally intense methods . such methods must rely on consistent names , or they have to deal with a list of synonyms . first , many in the cyclophilin field continue to use cyp , which has been the gene root for the large cytochrome p450 gene superfamily since 1987 . secondly , the gene root chosen by the hugo human / mouse gene nomenclature committees had been ppi for peptidylprolyl cis - trans isomerase , although -- as detailed above -- the cyclophilins represent just one of three classes of the ppiases that are perhaps functionally related but evolutionarily unrelated . fourthly , eight of the 15 putatively functional human cyclophilin genes end in the letters ' a ' through to ' h ' , while the others end in two groups of numbers ( one ppia - like and six ppi - like ) . it is strongly recommended that these genes be named by families and subfamilies , according to evolutionary divergence , as shown in figure 3 . because of discussions related to the writing of this paper , the cyn root has now been officially approved for mammals . it would be desirable to incorporate as many species as possible into the naming scheme . one additional source of nomenclature friction is the strict use of three letter roots for gene names in c. elegans , yeast and bacteria ; this automatically creates conflicts when human and mouse root names can be much longer than three letters , as in ppial3 or nipsnap1 ; however , that is a battle for another day . if one were to drop vertical lines , as in figure 2 , one might name : ppil1 through to ppil6 as cynia1 through to cynia4 , and cynib1 and cynib2 , respectively ; ppib and ppic as cyn2a1 and cyn2a2 , respectively ; ppie , ppif , ppia and ppial3 as cyn2c1 , cyn2c2 , cyn2c3 and cyn2c4 , respectively ; ppig as cyn3 ; and so on . the writing of this article was funded , in part , by nih grant p30 es06096 ( d.w.n . ) .

the pathogenic mechanism of osteoarthritis ( oa ) is suggested as wearing and destruction of cartilage tissue due to ageing . however , it is described as an active and dynamic process with destruction and repair triggered by biochemical and mechanical factors , nowadays.1 the treatment of oa requires a combination of pharmacological and nonpharmacological therapy.2 the existing pharmacological methods are mostly acting as symptomatically but do not stop the progression of oa . surgical techniques , such as arthroplasty and osteotomy , provide encouraging results when appropriate patients are selected and good surgical techniques are applied . however , as there are controversies , there are lot of studies for developing cartilage protecting agents for slowing the progress of oa or even reverse it on the cases where there are no surgical indications or in early - mid - stage primary oa . these studies are directed toward providing the balance between the formation and destruction of the chondrocyte and extracellular matrix of cartilage.3 several epidemiological studies have shown that statins reduce cholesterol synthesis in hypercholesterolemia treatment by inhibiting the 3-hydroxy-3-methylglutaryl coenzyme - a enzyme in the liver and also reduce cardiovascular morbidity and mortality . besides these effects , independent of the reduction in cholesterol , there is also a positive effect on endothelial functions , thrombocyte functions , vascular inflammation , and the formation of atherosclerotic plaque . all these effects are said to be pleiotropic effects . in recent years , these effects of statins have been the subject of many clinical and preclinical research studies . we reviewed the literature and identified that the chondroprotective effects of statins using light microscopy.45 however , to the best of our knowledge , there are no studies examining cartilage protective effects using an electron microscopy . this study evaluates the cartilage protective effects of statins by examining intracellular and extracellular changes by light and electron microscope in a rabbit experimental knee oa model . the study was performed on 20 mature new zealand rabbits weighing between 2500 and 4000 grams obtained from the experimental animal breeding and research centre . the experimental knee oa model was created by cutting the anterior cruciate ligament ( acl ) of the rabbits as described by yoshioka et al.6 anesthesia was administered intramuscularly at dosages of 2% xylocaine hydrochloride 8 mg / kg and ketamine hydrochloride 100 mg / kg . after a longitudinal anterior midline skin incision over knee joint , an adequate opening was obtained by medial parapatellar arthrotomy with the patella dislocated laterally . the joint cavity was washed with saline and the joint capsule sutured with 3/0 absorbable sutures and the skin was closed with 3/0 nonabsorbable sutures . postoperative analgesia was administered as 12 mg / kg 100 ml paracetamol in the drinking water then the rabbits were left active in cages with standard feed . we added 40 mg atorvastatin into the 100 ml saline as we had 0.4 mg atorvastatin per 1 ml . the control group received an intraarticular administration of saline and the study group 0.4 mg / ml / kg saline atorvastatin concentration from the 1 week postoperatively , once a week for 3 weeks . the knee joints in which the acl was cut to develop the experimental oa model were removed including the femoral and tibial joint surfaces for light microscopy . the degenerative changes on the medial femoral condyle and medial tibia plateau were observed as macroscopically after arthrotomy . at the same time , a tissue sample for electron microscopy examination was taken from the degenerative area of the medial joint cartilage ( the cartilage in femur medial condyle and medial tibial plateau ) using a 16 gauge bone marrow biopsy needle . using the morphological stages classification described by pelletier et al.,7 cartilage tissues from the knee joint medial compartment ( medial femoral condyle and medial tibia plateau ) were evaluated for the extent of erosion and degenerative changes , according to the presence of minimal fibrillation , surface and mid - layer erosion , deep layer erosion and subchondral bone erosion . histological and histochemical changes in the cartilage tissue were evaluated according to mankin et al.,8 histological grading system , whereas structural , cellular changes and safranin - o involvement were evaluated according to the integrity of the tidemark structure . according to the mankin histopathological classification , the points expected for normal joint cartilage were accepted as 01 and mild , moderate , severe osteoarthritic changes as 25 , 69 , 1014 respectively.910 the obtained data were recorded on computer using statistical package for the social sciences ( spss inc . , chicago ) for windows 13.0 and the variables related to the macroscopic and microscopic evaluation were given as mean and standard error . the operated knee joints including the femoral and tibial joint surfaces were removed by cutting at a distance of 2 cm from the joint . after removal from the surrounding soft tissue , the knee joint medial compartments were kept in a 10% formaldehyde solution for 5 days to provide tissue fixation for histopathological examination . then the bone tissue was kept in a 10% formic acid solution until decalcification . sagittal slices of 5 micron thickness were taken after routine procedures and stained with hematoxylin - eosin and safranin - o for histopathological evaluation . at the same time , samples of joint cartilage were taken from the same area with a 16-gauge biopsy needle for electron microscopy . these samples were fixed for 4 h with 5% glutaraldehyde ( 0.13 m , ph : 7.2 phosphate pad ) . the tissues were washed in the pad solution twice for 1 h and decalcified with edta . complete decalcification was confirmed by the ammonium oxalate test , the tissues were washed again with the pad and second fixation was made with 1% osmium tetroxide ( 1 h at + 4c ) . the tissue samples were dehydrated by passing through alcohol of increasing strength from 70% , to 90% , 95% and 100% . after application of propylene oxide , they were embedded in epon and kept in an incubator for 48 h at 60c for polymerization . semi - fine sections ( 1 m ) taken from the obtained blocks with a reichert supernova ultramicrotome were stained with toluidine blue for joint cartilage to be examined by light microscope . after minimizing this area , the samples were examined by permeable jeol 100sx electron microscope ( jeol ltd . , tokyo , japan ) and photographed . the experimental knee oa model was created by cutting the anterior cruciate ligament ( acl ) of the rabbits as described by yoshioka et al.6 anesthesia was administered intramuscularly at dosages of 2% xylocaine hydrochloride 8 mg / kg and ketamine hydrochloride 100 mg / kg . after a longitudinal anterior midline skin incision over knee joint , the joint cavity was washed with saline and the joint capsule sutured with 3/0 absorbable sutures and the skin was closed with 3/0 nonabsorbable sutures . postoperative analgesia was administered as 12 mg / kg 100 ml paracetamol in the drinking water then the rabbits were left active in cages with standard feed . we added 40 mg atorvastatin into the 100 ml saline as we had 0.4 mg atorvastatin per 1 ml . the control group received an intraarticular administration of saline and the study group 0.4 mg / ml / kg saline atorvastatin concentration from the 1 week postoperatively , once a week for 3 weeks . the knee joints in which the acl was cut to develop the experimental oa model were removed including the femoral and tibial joint surfaces for light microscopy . the degenerative changes on the medial femoral condyle and medial tibia plateau were observed as macroscopically after arthrotomy . at the same time , a tissue sample for electron microscopy examination was taken from the degenerative area of the medial joint cartilage ( the cartilage in femur medial condyle and medial tibial plateau ) using a 16 gauge bone marrow biopsy needle . using the morphological stages classification described by pelletier et al.,7 cartilage tissues from the knee joint medial compartment ( medial femoral condyle and medial tibia plateau ) were evaluated for the extent of erosion and degenerative changes , according to the presence of minimal fibrillation , surface and mid - layer erosion , deep layer erosion and subchondral bone erosion . histological and histochemical changes in the cartilage tissue were evaluated according to mankin et al.,8 histological grading system , whereas structural , cellular changes and safranin - o involvement were evaluated according to the integrity of the tidemark structure . according to the mankin histopathological classification , the points expected for normal joint cartilage were accepted as 01 and mild , moderate , severe osteoarthritic changes as 25 , 69 , 1014 respectively.910 the obtained data were recorded on computer using statistical package for the social sciences ( spss inc . , chicago ) for windows 13.0 and the variables related to the macroscopic and microscopic evaluation were given as mean and standard error . the operated knee joints including the femoral and tibial joint surfaces were removed by cutting at a distance of 2 cm from the joint . after removal from the surrounding soft tissue , the knee joint medial compartments were kept in a 10% formaldehyde solution for 5 days to provide tissue fixation for histopathological examination . then the bone tissue was kept in a 10% formic acid solution until decalcification . sagittal slices of 5 micron thickness were taken after routine procedures and stained with hematoxylin - eosin and safranin - o for histopathological evaluation . at the same time , samples of joint cartilage were taken from the same area with a 16-gauge biopsy needle for electron microscopy . these samples were fixed for 4 h with 5% glutaraldehyde ( 0.13 m , ph : 7.2 phosphate pad ) . the tissues were washed in the pad solution twice for 1 h and decalcified with edta . complete decalcification was confirmed by the ammonium oxalate test , the tissues were washed again with the pad and second fixation was made with 1% osmium tetroxide ( 1 h at + 4c ) . the tissue samples were dehydrated by passing through alcohol of increasing strength from 70% , to 90% , 95% and 100% . after application of propylene oxide , they were embedded in epon and kept in an incubator for 48 h at 60c for polymerization . semi - fine sections ( 1 m ) taken from the obtained blocks with a reichert supernova ultramicrotome were stained with toluidine blue for joint cartilage to be examined by light microscope . after minimizing this area , the samples were examined by permeable jeol 100sx electron microscope ( jeol ltd . , tokyo , japan ) and photographed . in the control group , 1 rabbit died due to septic arthritis thus 9 rabbits in the control group and 10 rabbits in the study group were evaluated . the cartilage tissue of the medial compartment of the knee joint was macroscopically evaluated according to the pelletier classification system.7 the study group rabbits that had received statin were determined as 4 at stage 0 ( 40% ) , 4 at stage 1 ( 40% ) , and 2 at stage 2 ( 20% ) . the control group rabbits were determined as 2 at stage 3 ( 33% ) , and 7 at stage 4 ( 77% ) [ table 1 , figures 1 and 2 ] . when these results were evaluated statistically , the difference between the statin group and the control group was found to be statistically significant p < 0.001 ) . distribution of articular cartilage lesions to the groups according to pelletier classification system macroscopic view of a knee joint in study group ( stage 0 ) ( a and b ) macroscopic view of a knee joint in control group ( stage 4 ) according to the mankin histopathological classification , cartilage structure and cellular evaluation of the medial joint surfaces of the rabbit right knees were examined microscopically by considering the extent of safranin - o staining of the matrix and tidemark structure . in the evaluation of cartilage structure of the study group rabbits , 4 ( 40% ) were determined as normal [ figure 3 ] , 4 ( 40% ) showed surface irregularity and 2 ( 20% ) had cracks extending to the mid - layer . in the control group , total disorganization was observed in 3 ( 33% ) rabbits [ figure 4 ] , cracks extending to the calcified layer in 4 ( 44% ) and cracks in the deep layer in 2 ( 22% ) . ( a and b ) normal joint cartilage structure and intact tide - mark ( study group ) ( h and e , 100 ) histopathological picture showing . impaired joint cartilage structure ( control group ) ( safranin - o , 100 ) in the cellular evaluation of the study group rabbits , 8 ( 80% ) were determined as normal and 2 ( 20% ) had widespread hypercellularity . the control group were observed as 5 ( 60% ) with hypercellularity and 4 ( 40% ) with cloning . in the evaluation of safranin - o staining , 8 ( 80% ) of the study group rabbits were determined as normal and 2 ( 20% ) with a low level of staining . in the control group , no staining was seen in 3 ( 30% ) rabbits and a low level of staining in 6 ( 70% ) rabbits . tidemark integrity was determined as intact in 10 ( 100% ) rabbits in the study group . in the control group , there was transfer to the veins in 5 ( 60% ) rabbits and intact integrity in 4 ( 40% ) rabbits . in the evaluation of cartilage structure of the study group rabbits , 4 ( 40% ) were determined as normal , 4 ( 40% ) showed surface irregularity and 2 ( 20% ) had cracks extending to the mid - layer . in the control group , total disorganization was observed in 2 ( 22% ) rabbits , cracks extending to the calcified layer in 4 ( 44% ) and cracks in the deep layer in 3 ( 33% ) . in the cellular evaluation of the study group rabbits , 8 ( 80% ) the control group were observed as 4 ( 40% ) with hypercellualrity and 5 ( 60% ) with cloning . in the evaluation of safranin - o staining , 8 ( 80% ) of the study group rabbits were determined as normal , 1 ( 10% ) with a slightly low level of staining and 1 ( 10% ) with a moderately low level . in the control group , no staining was seen in 2 ( 22% ) rabbits and an extremely low level of staining in 7 ( 80% ) rabbits . tidemark integrity was determined as intact in 10 ( 100% ) rabbits in the study group . in the control group , there was transfer to the veins in 5 ( 60% ) rabbits and intact integrity in 4 ( 40% ) rabbits . according to the mankin classification system used in the histological and histochemical classification of the lesions of the knee joint medial compartment cartilage tissue , the results of examination of the cartilage structure , cellular changes , safranin - o involvement and impairment of the tidemark structure were determined as total points obtained from the evaluation of lesions which developed in the medial femoral condyle as mean 11.33 0.667 in the control group and mean 1.5 0.687 in the study group . the total points obtained from the evaluation of lesions that developed in the tibial medial condyle were determined as mean 11.56 0.709 in the control group and mean 1.40 0.618 in the study group . when the points obtained from the medial femoral condyle and medial tibial plateau cartilage tissue were statistically compared , a significant difference was determined between the control group and the study group p < 0.001 ) . the mid - layer of the cartilage tissue of the knee joint medial compartment of the study group was examined at the cellular level by electron microscope . typical round chondrocytes surrounded by territorial matrix formed from proteoglycan particles and fibrils were observed . study group chondrocyte ( blue star : fat granule ; yellow star : territorial matrix ; red star : interterritorial matrix ; blue arrow : chondrocyte membrane ; yellow arrow : granulated endoplasmic retinaculum ; red arrow : nuclear membrane ) , ( 5000 ) study group electron microscopic view ( yellow arrow : endoplasmic retinaculum ; red arrow : golgi complex ) , ( 20,000 ) in the examination of the mid - layer of the cartilage tissue of the knee joint medial compartment of the control group , irregular and fragmented collagen fibers were observed . there was a halo image in the pericellular area and pyknotic nuclei were observed [ figure 7 ] . saccular structures were seen in the granular endoplasmic reticulum of several chondrocytes [ figure 8 ] . control group electron microscopic view ( purple star : pericellular halo ; yellow star : pyknotic nucleus ; red star : territorial matrix ; red arrow : chondrocyte membrane ) , ( 5000 ) control group electron microscopic view ( saccular appearance of granulated endoplasmic retinaculum ) , ( 40,000 ) the cartilage tissue of the medial compartment of the knee joint was macroscopically evaluated according to the pelletier classification system.7 the study group rabbits that had received statin were determined as 4 at stage 0 ( 40% ) , 4 at stage 1 ( 40% ) , and 2 at stage 2 ( 20% ) . the control group rabbits were determined as 2 at stage 3 ( 33% ) , and 7 at stage 4 ( 77% ) [ table 1 , figures 1 and 2 ] . when these results were evaluated statistically , the difference between the statin group and the control group was found to be statistically significant p < 0.001 ) . distribution of articular cartilage lesions to the groups according to pelletier classification system macroscopic view of a knee joint in study group ( stage 0 ) ( a and b ) macroscopic view of a knee joint in control group ( stage 4 ) according to the mankin histopathological classification , cartilage structure and cellular evaluation of the medial joint surfaces of the rabbit right knees were examined microscopically by considering the extent of safranin - o staining of the matrix and tidemark structure . in the evaluation of cartilage structure of the study group rabbits , 4 ( 40% ) were determined as normal [ figure 3 ] , 4 ( 40% ) showed surface irregularity and 2 ( 20% ) had cracks extending to the mid - layer . in the control group , total disorganization was observed in 3 ( 33% ) rabbits [ figure 4 ] , cracks extending to the calcified layer in 4 ( 44% ) and cracks in the deep layer in 2 ( 22% ) . ( a and b ) normal joint cartilage structure and intact tide - mark ( study group ) ( h and e , 100 ) histopathological picture showing . impaired joint cartilage structure ( control group ) ( safranin - o , 100 ) in the cellular evaluation of the study group rabbits , 8 ( 80% ) were determined as normal and 2 ( 20% ) had widespread hypercellularity . the control group were observed as 5 ( 60% ) with hypercellularity and 4 ( 40% ) with cloning . in the evaluation of safranin - o staining , 8 ( 80% ) of the study group rabbits were determined as normal and 2 ( 20% ) with a low level of staining . in the control group , no staining was seen in 3 ( 30% ) rabbits and a low level of staining in 6 ( 70% ) rabbits . tidemark integrity was determined as intact in 10 ( 100% ) rabbits in the study group . in the control group , there was transfer to the veins in 5 ( 60% ) rabbits and intact integrity in 4 ( 40% ) rabbits . in the evaluation of cartilage structure of the study group rabbits , 4 ( 40% ) were determined as normal , 4 ( 40% ) showed surface irregularity and 2 ( 20% ) had cracks extending to the mid - layer . in the control group , total disorganization was observed in 2 ( 22% ) rabbits , cracks extending to the calcified layer in 4 ( 44% ) and cracks in the deep layer in 3 ( 33% ) . in the cellular evaluation of the study group rabbits , 8 ( 80% ) were determined as normal and 2 ( 20% ) had widespread hypercellularity . the control group were observed as 4 ( 40% ) with hypercellualrity and 5 ( 60% ) with cloning . in the evaluation of safranin - o staining , 8 ( 80% ) of the study group rabbits were determined as normal , 1 ( 10% ) with a slightly low level of staining and 1 ( 10% ) with a moderately low level . in the control group , no staining was seen in 2 ( 22% ) rabbits and an extremely low level of staining in 7 ( 80% ) rabbits . tidemark integrity was determined as intact in 10 ( 100% ) rabbits in the study group . in the control group , there was transfer to the veins in 5 ( 60% ) rabbits and intact integrity in 4 ( 40% ) rabbits . according to the mankin classification system used in the histological and histochemical classification of the lesions of the knee joint medial compartment cartilage tissue , the results of examination of the cartilage structure , cellular changes , safranin - o involvement and impairment of the tidemark structure were determined as total points obtained from the evaluation of lesions which developed in the medial femoral condyle as mean 11.33 0.667 in the control group and mean 1.5 0.687 in the study group . the total points obtained from the evaluation of lesions that developed in the tibial medial condyle were determined as mean 11.56 0.709 in the control group and mean 1.40 0.618 in the study group . when the points obtained from the medial femoral condyle and medial tibial plateau cartilage tissue were statistically compared , a significant difference was determined between the control group and the study group p < 0.001 ) . the mid - layer of the cartilage tissue of the knee joint medial compartment of the study group was examined at the cellular level by electron microscope . typical round chondrocytes surrounded by territorial matrix formed from proteoglycan particles and fibrils were observed . study group chondrocyte ( blue star : fat granule ; yellow star : territorial matrix ; red star : interterritorial matrix ; blue arrow : chondrocyte membrane ; yellow arrow : granulated endoplasmic retinaculum ; red arrow : nuclear membrane ) , ( 5000 ) study group electron microscopic view ( yellow arrow : endoplasmic retinaculum ; red arrow : golgi complex ) , ( 20,000 ) in the examination of the mid - layer of the cartilage tissue of the knee joint medial compartment of the control group , irregular and fragmented collagen fibers were observed . there was a halo image in the pericellular area and pyknotic nuclei were observed [ figure 7 ] . saccular structures were seen in the granular endoplasmic reticulum of several chondrocytes [ figure 8 ] . control group electron microscopic view ( purple star : pericellular halo ; yellow star : pyknotic nucleus ; red star : territorial matrix ; red arrow : chondrocyte membrane ) , ( 5000 ) control group electron microscopic view ( saccular appearance of granulated endoplasmic retinaculum ) , ( 40,000 ) an examination of the literature showed studies where light microscopy had been used to research the chondroprotective effects of statins , which are effective in the destruction of proteoglycans by inhibiting inflammatory mediators and matrix metalloproteinase ( mmps).245 however , no studies were found where cartilage protective effects had been examined by electron microscope . we searched the protective effect of statins on the golgi complex and endoplasmic reticulum level detailed on the cell level with the aid of electron microscopy and predicted that this study can direct the other future studies even though mmp and interleukin levels were not evaluated in the current study . the cartilage protective effects were evaluated in an experimental oa model , by examining intracellular and extracellular changes by light and electron microscopy . we predicted to decrease the side effects of oral statins by applying it locally ( intraarticularly ) as their bioavailability would be different and systemic side effects would be much more . we decided the minimum number of experimental animals to get the statistically significant result . the mann whitney u - test is the best test to be used instead of importance test of the difference between two averages if the data do not supply the parametric test hypothesis . whitney u - test in our study since parametric test hypothesis would be wrong due to < 10 number of samples . in the current study , in the macroscopic evaluation of cartilage tissue lesions from the knee joint medial compartment , no advanced stage oa was determined in the study group , whereas in the control group all the rabbits were determined as having advanced or moderate stage oa p < 0.001 ) . in the histological evaluation , when a comparison was made of the points obtained for the medial femoral condyle and medial tibial plateau cartilage tissue , a statistically significant difference was determined between the study and the control group p < 0.001 ) . according to the expected points ranges for the knee joint medial compartment cartilage tissue of the study group , 80% were found to be normal and a mild degree of osteoarthritic changes were observed in 20% . in the control group , osteoarthritic changes at a moderate level were observed in 28% and at an advanced level in 72% . these results determined that statins were effective to a significant degree in the histological and histochemical evaluation . the amount of proteoglycan in the intracellular matrix can be evaluated histologically by examining the prepared samples stained with safranin - o . lorenz et al.11 determined that oa was revealed by loss of metachromasia . in the current study , we determined a highly significant level of metachromasia loss in the control group using safranin - o staining p < 0.001 ) . in a study on black rats by yamamoto et al.,12 it was reported that the degeneration of cartilage tissue does not start in the surface layer , but that the first changes are seen in the mid - layer . therefore in the current study , the mid - layer of cartilage tissue was examined at the cellular level by electron microscopy . we identify healthy cartilage tissue with appropriate chondrocyte and matrix structures with electron microscopy in the study group whereas pyknotic nuclei and irregular collagen fibers were determined in the control group . shakibaei et al.13 examined the effects of fluoroquinolone group medications on cartilage tissue using electron microscope and reported that the pericellular halo image confirmed with cartilage matrix degeneration . in the current study , in the electron microscope evaluation , the pericellular images were examined in addition to the chondrocyte cell structure . while no pericellular halo image was determined on the sections examined from the study group , a halo image around chondrocytes was determined in the control group . kouri et al.,14 in a study using electron microscopy on an experimental oa rat model , identified reduction in the golgi complex intensity as an immune marker of the progression of oa . in the electron microscope evaluation of the current study , although immune staining was not used , the golgi complex was observed on the sections examined from the study group but not on those of the control group . in a study on c57 black rats , yamamoto et al.12 determined heterogenous regularity and reduced density of collagen fibers in cartilage tissue examined by electron microscope . they also observed saccular structures full of protein granules in the endoplasmic reticulum of the chondrocyte cytoplasm . although this situation shows active protein synthesis , it also shows impairment in the regular protein transport from the endoplasmic reticulum to the golgi complex . impairing formation and expression of glycosaminoglycans cause oa . in the current study , although saccular structures were seen in the granular endoplasmic reticulum in the control group sections examined in the electron microscope evaluation , no saccular structures were observed in the granular endoplasmic reticulum of the sections evaluated from the study group . it can be concluded that in the macroscopic , light and electron microscopy evaluation of cartilage tissue in an experimental oa model , it was determined that there was a chondroprotective effect of statin on the cartilage tissue . it would be much better if our study were supported with immunohistochemical stains . according to the findings obtained from electron microscope examination at the cellular level , the protective effect of statin is shown to be that by protecting the golgi complex structure and granular endoplasmic reticulum , thus it allows the continuity of the formation and expression of proteoglycans .

relativistic binaries containing white dwarfs ( wds ) , neutron stars ( nss ) , and black holes ( bhs ) in compact orbits are over - represented in globular clusters compared with their population in the galactic field . observations of this population reveal a host of exotic objects such as ultracompact cataclysmic variables , non - flickering x - ray and uv sources , low - mass x - ray binaries ( lmxbs ) , millisecond pulsars , and possible black holes . these objects and their dark counterparts in the population of relativistic binaries are also likely to be observable sources of gravitational radiation for low - frequency gravitational wave detectors such as the planned space - borne interferometer lisa . in the field , a relativistic binary is a product of the interplay between stellar evolution and the gravitational interaction of a tight binary . in globular clusters , the population of tight binaries is also a product of the dynamical evolution of an n - body gravitational system . thus , relativistic binaries result from a combination of several of the more interesting processes in astrophysics . in keeping with the focus of this review article , we shall only touch on the aspects of globular clusters , observations , binary evolution , and n - body dynamics as they relate to populations of this specific class of binaries in globular clusters . we begin in section 2 by looking at the physical structure and general history of the galactic globular cluster system that leads to the concentration of evolved stars , stellar remnants , and binary systems in the cores of these clusters . current observations of globular clusters that have revealed numerous populations of relativistic binaries and their tracers are presented in section 3 . many of these relativistic binaries are the product of stellar evolution in compact binaries . in section 4 , we will look at how mass transfer from one star in the presence of a nearby companion can dramatically alter the evolution of both stars in the process of binary evolution . the enhanced production of relativistic binaries in globular clusters results from dynamical processes that drive binaries toward tighter orbits and that preferentially exchange more massive and degenerate objects into binary systems . numerical simulations of globular cluster evolution , which can be used to predict the rate at which relativistic binaries are formed , are discussed in section 5 . finally , we conclude with a brief discussion of the prospects for observing these systems in gravitational radiation in section 6 . readers interested in further studies of the structure and evolution of globular clusters are invited to look at binney and tremaine , spitzer , and volumes i and ii of padmanabhan s theoretical astrophysics [ 171 , 172 ] for a good introduction to the physical processes involved . review articles of meylan and heggie and meylan also provide a comprehensive look at the internal dynamics of globular clusters . although our focus is solely on the galactic globular cluster system , the physics of globular cluster systems associated with other galaxies is well covered in the review article by harris as well as his lecture notes from the saas - fee course on star clusters . an observational perspective on the role of binaries in globular clusters is presented in an excellent review by bailyn , while a good introduction to the details of observing binary systems in general can be found in an introduction to close binary stars . although slightly out of date , the review of binaries in globular clusters by hut et al . is an excellent introduction to the interaction between globular cluster dynamics and binary evolution , as is a short article on globular cluster binaries by mcmillan , pryor , and phinney . an excellent introduction to the astrophysics and numerical techniques relevant to globular cluster dynamics can be found in the book by heggie and hut . globular clusters comprising 10 to 10 stars were formed early in the history of the milky way , and are scattered throughout the halo . the age of the clusters is about 13 gyr , with an age spread of less than 5 gyr . according to the frequently updated catalog of globular cluster properties maintained on the web by harris , the globular cluster system numbers roughly 150 clusters . although the list is fairly complete , new globular clusters have been recently discovered at very low galactic latitudes [ 114 , 135 ] , and there is the prospect for a few more clusters to be hidden behind the bulge or out in the far reaches of the galaxy . the distribution of globular clusters in galacto - centric coordinates is shown in figure 1 . figure 1globular cluster distribution about the galaxy . positions are from harris and are plotted as black circles on top of the cobe firas 2.2 micron map of the galaxy using a mollweide projection . positions are from harris and are plotted as black circles on top of the cobe firas 2.2 micron map of the galaxy using a mollweide projection . figure taken from brian chaboyer s website . because the clusters are of great age , most of the stars above about 0.8 m have already evolved off the main sequence . thus , a large number of red giants are readily visible in most pictures of globular clusters ( see figure 2 ) . when viewing the color - magnitude diagram ( cmd ) for a globular cluster , one can clearly see the red giant branch lifting up away from the main sequence . the horizontal branch of evolved stars is also seen in the cmd for m80 shown in figure 3 . figure 2hubble space telescope photograph of the dense globular cluster m80 ( ngc 6093 ) . figure 3color - magnitude diagram for m80 . the clearly visible turn - off point in the cmd for globular clusters is evidence for the roughly coeval nature of the stars in the cluster . during the early stages of the evolution of a globular cluster , subsequent replenishment of the intercluster gas by stellar winds from evolved stars is removed during periodic passages of the cluster through the plane of the galaxy . the overall structure of a globular cluster can be described in terms of a roughly spherical n - body system with central densities in the range 10 to 10 m/pc , and an average of 10 m/pc . the important characteristic radii of a globular cluster are the core radius rc , the half - light radius rh , and the tidal radius rt . the core radius is defined to be the radius at which the surface brightness has dropped to half the central value . the half - light radius is the radius that contains half of the light of the cluster and the tidal radius is defined as the radius beyond which the external gravitational field of the galaxy dominates the dynamics . the half - mass radius is a three - dimensional theoretical construct , while the half - light radius is a two - dimensional observational construct . typical values of these radii are 1.5 pc , 10 pc , and 50 pc , respectively [ 24 , 172 ] . these are the crossing time tcross , the relaxation time trelax , and the evaporation time tevap . the crossing time is the typical time required for a star in the cluster to travel the characteristic size r of the cluster ( typically taken to be the half - mass radius ) . thus , tcross r / v , where v is a typical velocity ( 10 km / s ) . the relaxation time is the typical time for gravitational interactions with other stars in the cluster to remove the history of a star s original velocity . this amounts to the time required for gravitational encounters to alter the star s velocity by an amount comparable to its original velocity . since the relaxation time is related to the number and strength of the gravitational encounters of a typical cluster star , it is related to the number of stars in the cluster and the average energy of the stars in the cluster . thus , it can be shown that the mean relaxation time for a cluster is [ 24 , 171 ] 1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{{\rm{relax } } } } \simeq { { 0.1n } \over { \ln n}}{t_{{\rm{cross}}}}.$$\end{document } for a globular cluster with n = 10 , a characteristic size of r rh 10 pc , and a typical velocity of v 10 km / s , the crossing time and relaxation time are tcross 10 yr and trelax 10 yr , although binney and tremaine use tcross 10 yr and consequently trelax 10 yr . in real globular clusters , the relaxation time varies throughout the cluster and the median value is closer to 10 yr as found in figure 1.3 of spitzer and in padmanabhan . the evaporation time for a cluster is the time required for the cluster to dissolve through the gradual loss of stars that gain sufficient velocity through encounters to escape its gravitational potential . in the absence of stellar evolution and tidal interactions with the galaxy , the evaporation time can be estimated by assuming that a fraction of the stars in the cluster are evaporated every relaxation time . thus , the rate of loss is dn / dt = n / trelax = n / tevap . the value of can be determined by noting that the escape speed ve at a point x is related to the gravitational potential (x ) at that point by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$\upsilon_{\rm{e}}^2 = - 2\phi ( x)$\end{document}. consequently , the mean - square escape speed in a cluster with density (x ) is 2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\langle \upsilon_{\rm{e}}^2\rangle = { { \int \rho ( x)\upsilon_{\rm{e}}^2{d^3}x } \over { \int \rho ( x){d^3}x } } = - 2{{\int \rho ( x)\phi ( x){d^3}x } \over m } = - { { 4w } \over m},$$\end{document } where w is the total potential energy of the cluster and m is its total mass . if the system is virialized ( as we would expect after a relaxation time ) , then w = 2k = m , where k is the total kinetic energy of the cluster , and 3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\langle \upsilon _ { \rm{e}}^2\rangle = 4\langle { \upsilon ^2}\rangle .$$\end{document } thus , stars with speeds above twice the rms speed will evaporate . assuming a maxwellian distribution of speeds , the fraction of stars with > 2vrms is = 7.38 10 . therefore , the evaporation time is 4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{{\rm{evap } } } } = { { { t_{{\rm{relax } } } } } \over \gamma } - 136{t_{{\rm{relax}}}}.$$\end{document } stellar evolution and tidal interactions tend to shorten the evaporation time ( see gnedin and ostriker and references therein for a thorough discussion of these effects ) . using a typical trelax for a globular cluster , we see that tevap 10 yr , which is comparable to the observed age of globular clusters . the characteristic time scales of globular clusters differ significantly from each other : tcross trelax tevap . when discussing stellar interactions during a given epoch of globular cluster evolution , it is possible to describe the background structure of the globular cluster in terms of a static model . these models describe the structure of the cluster in terms of a distribution function f that can be thought of as providing a probability of finding a star at a particular location in phase - space . the static models are valid over time scales which are shorter than the relaxation time so that gravitational interactions do not have time to significantly alter the distribution function . the structure of the globular cluster is then determined by the collisionless boltzmann equation , 5\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\upsilon \cdot \nabla f - \nabla \phi \cdot { { \partial f } \over { \partial \upsilon } } = 0,$$\end{document } where the gravitational potential is found from f with 6\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\nabla ^2}\phi = 4\pi \int { f(x,\upsilon , m){d^3}\upsilon \ , dm}.$$\end{document } the solutions to equation ( 5 ) are often described in terms of the relative energy per unit mass \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\mathcal e } \equiv \psi - { \upsilon ^2}/2$\end{document } with the relative potential defined as + 0 . the constant 0 is chosen so that there are no stars with relative energy less than 0 ( i.e. f > 0 for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\mathcal e } > 0$\end{document } and f = 0 for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\mathcal e } < 0$\end{document } ) . a simple class of solutions to equation ( 5 ) , 7\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f({\mathcal e } ) = f{{\mathcal e}^{7/2}},$$\end{document } generates what are known as plummer models . a convenient class of models which admits anisotropy and a distribution in angular momenta l is known as king - michie models . the king - michie distribution function is 8\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f({\mathcal e } , l ) = { \rho _ 1}{(2\pi { \sigma ^2})^{- 3/2}}\exp \left({{{- { l^2 } } \over { 2r_{\rm a}^2{\sigma ^2 } } } } \right)\left [ { { e^{{\mathcal e}/{\sigma ^2 } } } - 1 } \right],\quad { \mathcal e } > 0,$$\end{document } with f = 0 for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\mathcal e } \leq 0$\end{document } and 1 being a constant . the velocity dispersion is determined by and the anisotropy radius ra is defined so that the velocity distribution changes from nearly isotropic at the center to nearly radial at ra . the king - michie distribution can be generalized to multi - mass systems , and although not dynamically correct , they can be used for mass estimates . a good description of the construction of a multi - mass king - michie model can be found in the appendix of miocchi . an overview of the evolution of globular clusters can be found in hut et al . , we summarize here the aspects of globular cluster evolution that are relevant to the formation and concentration of relativistic binaries . the formation of globular clusters is not well understood and the details of the initial mass function ( imf ) are an ongoing field of star cluster studies . the kroupa mass function is the most common imf currently used ( see for a discussion of the local imf ) . it has the form 9\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$dn \propto { m^{- { \alpha _ i}}}dm,$$\end{document } where 10\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{array}{*{20}c}{{\alpha _ 0 } = + 0.3 \pm 0.7 , } & { 0.01 \leq m/{m _ \odot}\ ; < 0.08 , } \\ { { \alpha _ 1 } = + 1.3 \pm 0.5 , } & { 0.08 \leq m/{m _ \odot}\ ; < 0.50 , } \\ { { \alpha _ 2 } = + 2.3 \pm 0.3 , } & { 0.50 \leq m/{m _ \odot}\ ; < 1.00 , } \\ { { \alpha _ 3 } = + 2.3 \pm 0.7 , } & { 1.00 \leq m/{m _ \odot}. } \\ \end{array}$$\end{document } some older work uses the salpeter imf which assumes a single value of in equation ( 9 ) for all masses . once the stars form out of the initial molecular cloud the system is not virialized ( i.e. it does not satisfy equation ( 5 ) ) , and it will undergo what is known as violent relaxation as the protocluster first begins to collapse . during violent relaxation , the process of violent relaxation is a collisionless process and it occurs rapidly over a timescale given by a few crossing times . during violent relaxation , the energy per mass of a given star changes in a way that is independent of the mass of the star . these stars will then lose their kinetic energy to the less massive stars through stellar encounters which leads towards equipartition of energy . through virialization , this tends to concentrate the more massive stars in the center of the cluster a process known as mass segregation . the process of mass segregation for stars of mass mi occurs on a timescale given by ti trelaxm/mi . the higher concentration of stars in the center of the cluster increases the probability of an encounter , which , in turn , decreases the relaxation time . thus , the relaxation time given in equation ( 1 ) is an average over the whole cluster . the local relaxation time of the cluster is given in meylan and heggie and can be described by 11\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{\rm{r } } } = { { 0.065{{\langle { \upsilon^2}\rangle}^{3/2 } } } \over { \rho \langle m\rangle { g^2}\ln \lambda}},$$\end{document } where is the local mass density , v is the mass - weighted mean square velocity of the stars , and m is the mean stellar mass . the coulomb logarithm , ln , is the logarithm of the ratio of the maximum to minimum expected impact parameters in the cluster . binney and tremaine provide a range of values for ln from 10.1 in the center of the cluster to 12 at rh . note that in the central regions of the cluster , the value of tr is much lower than the average relaxation time . this means that in the core of the cluster , where the more massive stars have concentrated , there are more encounters between these stars . the concentration of massive stars in the core of the cluster will occur within a few relaxation times , t trelax 10 yr . this time is longer than the lifetime of low metallicity stars with m 2 m . consequently , these stars will have evolved into carbon - oxygen ( co ) and oxygenneon ( one ) white dwarfs , neutron stars , and black holes . after a few more relaxation times , the average mass of a star in the globular cluster will be around 0.5 m and these degenerate objects will once again be the more massive objects in the cluster , despite having lost most of their mass during their evolution . thus , the population in the core of the cluster will be enhanced in degenerate objects . any binaries in the cluster that have a gravitational binding energy significantly greater than the average kinetic energy of a cluster star will act effectively as single objects with masses equal to their total mass . these objects , too , will segregate to the central regions of the globular cluster . the core would undergo what is known as core collapse within a few tens of relaxation times unless these binaries release some of their binding energy to the cluster . in core collapse , the central density increases to infinity as the core radius shrinks to zero . an example of core collapse can be seen in the comparison of two cluster evolution simulations shown in figure 4 . note the core collapse when the inner radius containing 1% of the total mass dramatically shrinks after t 15 trelax . since these evolution syntheses are single - mass plummer models without binary interactions , the actual time of core collapse is not representative of a real globular cluster . figure 4lagrange radii indicating the evolution of a plummer model globular cluster for an n - body simulation and a monte carlo simulation . the radii correspond to radii containing 0.35 , 1 , 3.5 , 5 , 7 , 10 , 14 , 20 , 30 , 40 , 50 , 60 , 70 , and 80% of the total mass . lagrange radii indicating the evolution of a plummer model globular cluster for an n - body simulation and a monte carlo simulation . the radii correspond to radii containing 0.35 , 1 , 3.5 , 5 , 7 , 10 , 14 , 20 , 30 , 40 , 50 , 60 , 70 , and 80% of the total mass . the static description of the structure of globular clusters using king - michie or plummer models provides a framework for describing the environment of relativistic binaries and their progenitors in globular clusters . the short - term interactions between stars and degenerate objects can be analyzed in the presence of this background . over longer time scales ( comparable to trelax ) , the dynamical evolution of the distribution function as well as population changes due to stellar evolution can alter the overall structure of the globular cluster . we will discuss the dynamical evolution and its impact on relativistic binaries in section 5 . before moving on to the dynamical models and population syntheses of relativistic binaries , we will first look at the observational evidence for these objects in globular clusters . observational evidence for relativistic binaries in globular clusters has undergone an explosion in recent years , thanks to concentrated pulsar searches , improved x - ray source positions from chandra , and optical follow - ups with hst and ground - based telescopes . there are challenges to detecting most binaries since they have generally segregated to the cores of the clusters where crowding can be a problem . nonetheless , numerous observations of both binaries and their tracer populations have been made in several globular clusters . one tracer population of the dynamical processes that may lead to the formation of relativistic binaries is the population of blue stragglers . these are stars that appear on the main sequence above and to the left of the turn - off in the cmd of a globular cluster ( see figure 5 ) . these stars are hot and massive enough that they should have already evolved off the main sequence . consequently , these objects are thought to arise from stellar coalescences either through the gradual merger of the components of binaries or through direct collisions [ 62 , 180 ] . blue stragglers are some of the most visible and populous evidence of the dynamical interactions that can also give rise to relativistic binaries . for a good description of the use of far - ultraviolet surveys in detecting these objects , see knigge . for somewhat older but still valuable reviews on the implications of blue stragglers on the dynamics of globular clusters , recent observations of the blue straggler populations of 13 globular clusters indicates a correlation between the specific frequency of blue stragglers and the binary fraction in the globular cluster . this supports observations which also seem to suggest that binary coalescences are the dominant formation mechanism for blue stragglers in globular clusters . the globular cluster population of white dwarfs can be used to determine the ages of globular clusters , and so they have been the focus of targeted searches despite the fact that they are arguably the faintest objects in a globular cluster . for example , a recent search of centauri has revealed over 2000 white dwarfs , while hansen et al . deep acs observations of ngc 6397 have identified a substantial population of approximately 150 white dwarfs . in general , however , these searches uncover single white dwarfs . optical detection of white dwarfs in binary systems tends to rely on properties of the accretion process related to the binary type . therefore , searches for cataclysmic variables generally focus on low - luminosity x - ray sources [ 124 , 88 , 233 ] and on ultraviolet - excess stars [ 50 , 51 , 86 , 133 , 152 ] , but these systems are usually a white dwarf accreting from a low mass star . the class of non - flickerers which have been detected recently [ 36 , 228 ] have been explained as he white dwarfs in binaries containing dark co white dwarfs [ 56 , 89 , 92 ] . pulsars , although easily seen in radio , are difficult to detect when they occur in hard binaries , due to the doppler shift of the pulse intervals . thanks to an improved technique known as an acceleration search , which assumes a constant acceleration of the pulsar during the observation period , more short orbital period binary pulsars are being discovered [ 26 , 27 , 39 , 41 , 65 , 71 , 194 ] . for a good review and description of this technique , see lorimer . the progenitors of the ultracompact millisecond pulsars ( msps ) are thought to pass through a lmxb phase [ 48 , 88 , 121 , 195 , 198 ] . these systems are very bright and all of them in the globular cluster system are known . there are , however , several additional lmxbs that are currently quiescent [ 88 , 234 ] . additional evidence of a binary spin - up phase for msps comes from measurements of their masses , which indicate a substantial mass - transfer phase during the spin - up . several observed globular cluster msps in binary systems are seen to have masses above the canonical mass of 1.4 m . although there are many theoretical predictions of the existence of black holes in globular clusters ( see , e.g. , [ 160 , 189 , 159 , 42 ] ) , there are very few observational hints of them . measurements of the kinematics of the cores of m15 [ 74 , 90 ] , ngc 6752 , and centauri provide some suggestions of a large , compact mass . however , these observations can also be explained without requiring an intermediate mass black hole [ 148 , 175 ] . vla observations of m80 , m62 , and m15 do not indicate any significant evidence of radio emission , which can be used to place some limits on the likelihood of an accreting black hole in these clusters . however , uncertainties in the expected gas density makes it difficult to place any upper limits on a black hole mass . the unusual millisecond pulsar in the outskirts of ngc 6752 has also been argued to be the result of a dynamical interaction with a possible binary intermediate mass black hole in the core . if the velocity dispersion in globular clusters follows the same correlation to black hole mass as in galactic bulges , then there may be black holes with masses in the range 110 m in many globular clusters . recent hubble space telescope observations of the stellar dynamics in the core of 47 tuc have placed an upper bound of 1500 m for any intermediate mass black hole in this cluster . stellar mass black hole binaries may also be visible as low luminosity x - ray sources , but if they are formed in exchange interactions , they will have very low duty cycles and hence are unlikely to be seen . recent observations and catalogs of known binaries are presented in the following sections 3.1 , 3.2 , 3.3 , and 3.4 . cataclysmic variables ( cvs ) are white dwarfs accreting matter from a companion that is usually a dwarf star or another white dwarf . they have been detected in globular clusters through identification of the white dwarf itself or through evidence of the accretion process . white dwarfs managed to avoid detection until observations with the hubble space telescope revealed photometric sequences in several globular clusters [ 37 , 36 , 174 , 199 , 202 , 201 , 228 , 93 ] . spectral identification of white dwarfs in globular clusters has begun both from the ground with the vlt [ 162 , 163 ] and in space with the hubble space telescope [ 36 , 56 , 228 , 164 ] . with spectral identification , it will be possible to identify those white dwarfs in hard binaries through doppler shifts in the h line . this approach has promise for detecting a large number of the expected double white dwarf binaries in globular clusters . photometry has also begun to reveal orbital periods [ 166 , 55 , 128 ] of cvs in globular clusters . identifications of globular cluster cvs have been made through such outbursts in the cores of m5 , 47 tuc , ngc 6624 , m15 , and m22 [ 5 , 25 ] . with the exception of v101 in m5 , original searches for dwarf novae performed with ground this is primarily due to the fact that crowding obscured potential dwarf novae up to several core radii outside the center of the cluster [ 211 , 213 ] . since binaries tend to settle into the core , it is not surprising that none were found significantly outside of the core . subsequent searches using the improved resolution of the hubble space telescope eventually revealed a few dwarf novae close to the cores of selected globular clusters [ 210 , 212 , 216 , 214 , 5 ] . a more productive approach has been to look for direct evidence of the accretion around the white dwarf . this can be in the form of excess uv emission and strong h emission [ 59 , 87 , 133 , 134 , 50 ] from the accretion disk . this technique has resulted in the discovery of candidate cvs in 47 tuc [ 59 , 133 ] , m92 , ngc 2808 , ngc 6397 [ 36 , 56 , 228 ] , and ngc 6712 . these low luminosity x - ray binaries are characterized by a luminosity lx < 10 erg / s , which distinguishes them from the low - mass x - ray binaries with lx > 10 erg / s . initial explanations of these objects focused on accreting white dwarfs , and a significant fraction of them are probably cvs [ 234 , 237 ] . there have been 10 identified candidate cvs in 6752 , 19 in 6440 , 2 in cen , 5 in terzan 5 , 22 in 47 tuc , 5 in m80 , 7 in m54 , 25 in ngc 288 , 4 in m30 , 4 in ngc 2808 , and 1 in m4 . however , some of the more energetic sources may be lmxbs in quiescence , or even candidate qso sources . the state of the field at this time is one of rapid change as chandra results come in and optical counterparts are found for the new x - ray sources . a living catalog of cvs has been created by downes et al . and may be the best source for confirmed cvs in globular clusters . the x - ray luminosities of low - mass x - ray binaries are in the range lx 1010 erg / s . the upper limit is close to the eddington limit for accretion onto a neutron star , so these systems must contain an accreting neutron star or black hole . all of the lmxbs in globular clusters contain an accreting neutron star as they also exhibit x - ray bursts , indicating thermonuclear flashes on the surface of the neutron star . compared with 100 such systems in the galaxy , there are 13 lmxbs known in globular clusters . the globular cluster system contains roughly 0.1% of the mass of the galaxy and roughly 10% of the lmxbs . because these systems are so bright in x - rays , the globular cluster population is completely known we expect no new lmxbs to be discovered in the globular cluster system ( unless more multiple sources are resolved from these 13 sources ) . three have orbital periods greater than a few hours , four ultracompact systems have measured orbital periods less than 1 hour , and six have undetermined orbital periods . the period of x1746 - 370 in ngc 6441 has recently been measured at porb = 5.16 h using the rossi x - ray timing explorer ( rxte ) . a member of the ultracompact group , 4u 182030 ( x1820 - 303 ) in the globular cluster ngc 6624 , has an orbital period of 11 minutes . this is the shortest known orbital period of any binary and most certainly indicates a degenerate companion . the orbital period , x - ray luminosity , and host globular clusters for these systems are given in table 1 . table 1low - mass x - ray binaries in globular clusters : host clusters and lmxb properties.lmxb nameclusterlx ( 10 erg / s)porb ( hr)ref.x0512 - 401ngc 18511.9 < 0.85[48 , 217]x1724 - 307terzan 24.3[48 , 217]x1730 - 335liller 12.2[48 , 217]x1732 - 304terzan 10.5[48 , 217]x1745 - 203ngc 64400.9[48 , 217]x1745 - 248terzan 5x1746 - 370ngc 64417.65.70[48 , 181 , 217]x1747 - 313terzan 63.412.36[48 , 181 , 217]x1820 - 303ngc 662440.60.19[48 , 181 , 217]x1832 - 330ngc 66522.20.73[48 , 181]x1850 - 087ngc 67120.80.33[48 , 181 , 217]x2127 + 1191ngc 70783.517.10[48 , 181 , 217]x2127 + 1192ngc 7078[48 , 181 , low - mass x - ray binaries in globular clusters : host clusters and lmxb properties . the improved resolution of chandra allows for the possibility of identifying optical counterparts to lmxbs . if an optical counterpart can be found , a number of additional properties and constraints for these objects can be determined through observations in other wavelengths . in particular , the orbital parameters and the nature of the secondary can be determined . so far , optical counterparts have been found for x0512 - 401 in ngc 1851 , x1745 - 203 in ngc 6440 , x1746 - 370 in ngc 6441 , x1830 - 303 in ngc 6624 , x1832 - 330 in ngc 6652 [ 48 , 99 ] , x1850 - 087 in ngc 6712 [ 38 , 11 , 169 ] , x1745 - 248 in terzan 5 , and both lmxbs in ngc 7078 [ 8 , 239 ] . continued x - ray observations will also further elucidate the nature of these systems . the 13 bright lmxbs are thought to be active members of a larger population of lower luminosity quiescent low mass x - ray binaries ( qlmxbs ) . early searches performed with rosat data ( which had a detection limit of 10 erg / s ) revealed roughly 30 sources in 19 globular clusters . a more recent census of the rosat low luminosity x - ray sources , published by verbunt , lists 26 such sources that are probably related to globular clusters . recent observations with the improved angular resolution of chandra have begun to uncover numerous low luminosity x - ray candidates for cvs [ 88 , 89 , 99 , 110 , 100 , 101 , 54 , 55 , 75 , 182 , 183 ] . for a reasonably complete discussion of recent observations of qlmxbs in globular clusters , see verbunt and lewin or webb and barret and references therein . the population of known millisecond pulsars ( msps ) is one of the fastest growing populations of relativistic binaries in globular clusters . several ongoing searches are continuing to reveal millisecond pulsars in a number of globular clusters . previous searches have used deep multifrequency imaging to estimate the population of pulsars in globular clusters . in this approach , the expected number of pulsars beaming toward the earth , npuls , is determined by the total radio luminosity observed when the radio beam width is comparable in diameter to the core of the cluster . if the minimum pulsar luminosity is lmin and the total luminosity observed is ltot , then , with simple assumptions on the neutron star luminosity function , 12\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${n_{{\rm{puls } } } } = { { { l_{{\rm{tot } } } } } \over { { l_{\min}}\ln ( { l_{{\rm{tot}}}}/{l_{\min}})}}.$$\end{document } in their observations of 7 globular clusters , fruchter and goss have recovered previously known pulsars in ngc 6440 , ngc 6539 , ngc 6624 , and 47 tuc . their estimates based on equation ( 12 ) give evidence of a population of between 60 and 200 previously unknown pulsars in terzan 5 , and about 15 each in liller 1 and ngc 6544 . current searches include the following : arecibo , which is searching over 22 globular clusters ; green bank telescope ( gbt ) , which is working alone and in conjunction with arecibo [ 123 , 104 ] ; the giant metrewave radio telescope ( gmrt ) , which is searching over about 10 globular clusters ; and parkes , which is searching over 60 globular clusters . although these searches have been quite successful , they are still subject to certain selection effects such as distance , dispersion measure , and acceleration in compact binaries . for an excellent review of the properties of all pulsars in globular clusters , see the review by camilo and rasio and references therein . the properties of known pulsars in binary systems with orbital period less than one day are listed in table 2 , which has been extracted from the online catalog maintained by freire . see http://www.naic.edu/pfreire/gcpsr.html for references to each pulsar.pulsarpspin ( ms)clusterporb ( days ) e m2 ( m)j0024 - 7204i3.48547 tuc0.229 < 0.00040.015j0023 - 7203j2.10147 tuc0.121 < 0.000040.024j0024 - 7204o2.64347 tuc0.136 < 0.000160.025j0024 - 7204p3.64347 tuc0.1470.02j0024 - 7204r3.48047 tuc0.0660.030j0024 - 7203u4.34347 tuc0.4290.0000150.14j0024 - 7204v4.81047 tuc0.2270.34(?)j0024 - 7204w2.35247 tuc0.1330.14j0024 - 7204y2.19647 tuc0.5220.16j1518 + 0204c2.484m50.0870.038j1641 + 3627d3.118m130.5910.18j1641 + 3627e2.487m130.1180.02j1701 - 3006b3.594m620.145 < 0.000070.14j1701 - 3006c3.806m620.215 < 0.000060.08j1701 - 3006e3.234m620.160.035j1701 - 3006f2.295m620.200.02b1718 - 191004.03ngc 63420.258 < 0.0050.13j1748 - 2446a11.563terzan 50.0760.10j1748 - 2446m3.569terzan 50.4430.16j1748 - 2446n8.667terzan 50.3860.0000450.56j1748 - 2446o1.677terzan 50.2590.04j1748 - 2446p1.729terzan 50.3630.44j1748 - 2446v2.073terzan 50.5040.14j1748 - 2446ae3.659terzan 50.1710.019j1748 - 2021d13.496ngc64400.2860.14j1807 - 2459a3.059ngc 65440.0710.010j1824 - 2452g5.909m280.1050.011j1824 - 2452h4.629m280.4350.2j1824 - 2452j4.039m280.0970.015j1905 + 0154a3.193ngc67490.8130.09j1911 - 5958a3.266ngc 67520.837 < 0.000010.22j1911 + 0102a3.619ngc 67600.141 < 0.000130.02j1953 + 1846a4.888m710.1770.032b2127 + 11c30.529 m 150.3350.6811.13j2140 - 2310a11.019m300.174 it can be reasonably expected that the number of millisecond pulsars in binary systems in globular clusters will continue to grow in the coming years . although there have been hints of possible black hole binaries in extragalactic globular cluster systems [ 6 , 49 ] , there are no known black hole binaries in the galactic globular cluster system . all of the globular cluster high luminosity lmxbs exhibit the x - ray variability that is indicative of nuclear burning on the surface of a neutron star . it is possible that some of the recently discovered low luminosity lmxbs may house black holes instead of neutron stars , it is more likely that they are simply unusual neutron star lmxbs in quiesence . finally , there is very circumstantial evidence for the possible existence of an intermediate mass black hole ( imbh ) binary in ngc 6752 based upon an analysis of the msp binary psr a [ 34 , 35 ] . relativistic binaries are binary systems with at least one degenerate or collapsed object and an orbital period such that they will be brought into contact within a hubble time . ( note that this definition also includes binaries which are already in contact . ) outside of dense stellar clusters , most relativistic binary systems arise from primordial binary systems whose evolution drives them to tight , ultracompact orbits . the dynamical processes in globular clusters can drive wide binary systems toward short orbital periods and can also insert degenerate or collapsed stars into relativistic orbits with other stars . before addressing specific evolutionary scenarios , we will present the generic features of binary evolution that lead to the formation of relativistic binaries . the evolution of a binary system of two main - sequence ( ms ) stars can significantly affect the evolution of both component stars if the orbital separation is sufficiently small . if the orbital period is less than about 10 days , tidal interactions will have circularized the orbit during the pre- and early main - sequence phase [ 84 , 244 , 245 ] . both stars start in the main sequence with the mass of the primary mp and the mass of the secondary ms , defined such that mp ms . the binary system is described by the orbital separation a , and the mass ratio of the components q ms / mp . the gravitational potential of the binary system is described by the roche model where each star dominates the gravitational potential inside regions called roche lobes . the two roche lobes meet at the inner lagrange point along the line joining the two stars . figure 6 shows equipotential surfaces in the orbital plane for a binary with q = 0.4 . if either star fills its roche lobe , matter will stream from the roche lobe filling star through the inner lagrange point to the other star in a process known as roche lobe overflow ( rlof ) . this mass transfer affects both the evolution of the components of the binary as well as the binary properties such as orbital period and eccentricity . figure 6cross section of equipotential surfaces in the orbital plane of a binary with q = 0.4 . the values of the potential surfaces are 5.0 , 3.9075 , 3.8 , 3.559 , 3.2 , 3.0 , and 2.8 . cross section of equipotential surfaces in the orbital plane of a binary with q = 0.4 . the values of the potential surfaces are 5.0 , 3.9075 , 3.8 , 3.559 , 3.2 , 3.0 , and 2.8 . roche lobe overflow can be triggered by the evolution of the binary properties or by evolution of the component stars . on the one hand , the orbital separation of the binary can change so that the roche lobe can shrink to within the surface of one of the stars . on the other hand , stellar evolution may eventually cause one of the stars to expand to fill its roche lobe . when both stars in the binary are main - sequence stars , the latter process is more common . since the more massive star will evolve first , it will be the first to expand and fill its roche lobe . at this stage , the mass exchange can be conservative ( no mass is lost from the binary ) or non - conservative ( mass is lost ) . depending on the details of the mass exchange and the evolutionary stage of the mass - losing star there are several outcomes that will lead to the formation of a relativistic binary . the primary star can lose its envelope , revealing its degenerate core as either a helium , carbon - oxygen , or oxygen - neon white dwarf ; it can explode as a supernova , leaving behind a neutron star or a black hole ; or it can simply lose mass to the secondary so that they change roles . barring disruption of the binary , its evolution will then continue . in most outcomes , the secondary is now the more massive of the two stars and it may evolve off the main sequence to fill its roche lobe . the secondary can then initiate mass transfer or mass loss with the result that the secondary also can become a white dwarf , neutron star , or black hole . the relativistic binaries that result from this process fall into a number of observable categories . a wd - ms or wd - wd binary may eventually become a cataclysmic variable once the white dwarf begins to accrete material from its companion . if the companion is a main - sequence star , rlof can be triggered by the evolution of the companion . if the companion is another white dwarf , then rlof is triggered by the gradual shrinking of the orbit through the emission of gravitational radiation . if the total mass of the wd - wd binary is above the chandrasekhar mass , the system may be a progenitor to a type i supernova . the orbit of a ns - ms or ns - wd binary will shrink due to the emission of gravitational radiation . at the onset of rlof , the binary will become either a low - mass x - ray binary ( if the donor star is a white dwarf or main sequence star with m 2 m ) , or a high - mass x - ray binary ( if the donor is a more massive main - sequence star ) . these objects may further evolve to become millisecond pulsars if the neutron star is spun up during the x - ray binary phase [ 46 , 198 ] . a ns - ns binary will remain virtually invisible unless one of the neutron stars is observable as a pulsar . a bh - ms or bh - wd binary may also become a low- or high - mass x - ray binary . if the neutron star is observable as a pulsar , a bh - ns binary will appear as a binary pulsar . bh - bh binaries will be invisible unless they accrete matter from the interstellar medium . a comprehensive table of close binary types that can be observed in electromagnetic radiation can be found in hilditch . the type of binary that emerges depends upon the orbital separation and the masses of the component stars . during the evolution of a 10 m star , the radius will slowly increase by a factor of about two as the star progresses from zero age main sequence to terminal age main sequence . the radius will then increase by about another factor of 50 as the star transitions to the red giant phase , and an additional factor of 10 during the transition to the red supergiant phase . these last two increases in size occur very quickly compared with the slow increase during the main - sequence evolution . depending upon the orbital separation , the onset of rlof can occur any time during the evolution of the star . mass transfer can be divided into three cases related to the timing of the onset of rlof : case a : if the orbital separation is small enough ( usually a few days ) , the star can fill its roche lobe during its slow expansion through the main - sequence phase while still burning hydrogen in its core.case b : if the orbital period is less than about 100 days , but longer than a few days , the star will fill its roche lobe during the rapid expansion to a red giant with a helium core . if the helium core ignites during this phase and the transfer is interrupted , the mass transfer is case bb.case c : if the orbital period is above 100 days , the star can evolve to the red supergiant phase before it fills its roche lobe . in this case the typical evolution of the radius for a low metallicity star is shown in figure 7 . case a mass transfer occurs during the slow growth , case b during the first rapid expansion , and case c during the final expansion phase . the nature of the remnant depends upon the state of the primary during the onset of rlof and the orbital properties of the resultant binary depend upon the details of the mass transfer . case a : if the orbital separation is small enough ( usually a few days ) , the star can fill its roche lobe during its slow expansion through the main - sequence phase while still burning hydrogen in its core . case b : if the orbital period is less than about 100 days , but longer than a few days , the star will fill its roche lobe during the rapid expansion to a red giant with a helium core . if the helium core ignites during this phase and the transfer is interrupted , the mass transfer is case bb . case c : if the orbital period is above 100 days , the star can evolve to the red supergiant phase before it fills its roche lobe . in this case although there are still many unanswered theoretical questions about the nature of the mass transfer phase , the basic properties of the evolution of a binary due to mass transfer can easily be described . the rate at which a star can adjust to changes in its mass is governed by three time scales . the dynamical time scale results from the adiabatic response of the star to restore hydrostatic equilibrium , and can be approximated by the free fall time across the radius of the star , 13\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{{\rm{dyn } } } } \simeq { \left({{{2{r^3 } } \over { gm } } } \right)^{1/2 } } \sim 40{\left [ { { { \left({{r \over { { r _ \odot } } } } \right)}^3}{{{m _ \odot } } \over m } } \right]^{1/2}}\min,$$\end{document } where m and r are the mass and radius of the star . the thermal equilibrium of the star is restored over a longer period given by the thermal time scale 14\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{{\rm{th } } } } \simeq { { g{m^2 } } \over { rl } } \sim 3 \times { 10 ^ 7}{\left({{m \over { { m _ \odot } } } } \right)^2}{{{r _ \odot } } \over r}{{{l _ finally , the main - sequence lifetime of the star itself provides a third time scale , which is also known as the nuclear time scale : 15\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{{\rm{nuc } } } } \sim 7 \times { 10 ^ 9}{m \over { { m _ \odot}}}{{{l _ \odot } } \over l}{\rm{yr}}.$$\end{document } the rate of mass transfer / loss from the roche lobe filling star is governed by how the star s radius changes in response to changes in its mass . hjellming and webbink describe these changes and the response of the roche lobe to mass changes in the binary using the radius - mass exponents , d ln r / dln m , for each of the three processes described in equations ( 13 , 14 , 15 ) and defining 16\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\zeta _ { \rm{l } } } = ( 1 + q){{d\ln { r_{\rm{l } } } } \over { d\ln q}}$$\end{document } for the roche lobe radius - mass exponent . if l > dyn , the star can not adjust to the roche lobe , then the mass transfer takes place on a dynamical time scale and is limited only by the rate at which material can stream through the inner lagrange point . if dyn > l > th , then the mass transfer rate is governed by the slow expansion of the star as it relaxes toward thermal equilibrium , and it occurs on a thermal time scale . if both dyn and th are greater than l , then the mass loss is driven either by stellar evolution processes or by the gradual shrinkage of the orbit due to the emission of gravitational radiation . the time scale for both of these processes is comparable to the nuclear time scale . a good analysis of mass transfer in cataclysmic variables can be found in king et al . . consider a system with total mass m = m1 + m2 and semi - major axis a. the total orbital angular momentum 17\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$j = { \left [ { { { gm_1 ^ 2m_2 ^ 2a } \over m } } \right]^{1/2}}$$\end{document } is a constant , and we can write a ( m1m2 ) . using kepler s third law and denoting the initial values by a subscript i , we find : 18\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${p \over { { p_i } } } = { \left [ { { { { m_{1i}}{m_{2i } } } \over { { m_1}{m_2 } } } } \right]^3}.$$\end{document } differentiating equation ( 18 ) and noting that conservative mass transfer requires m1 = m2 gives : 19\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{\dot p } \over p } = { { 3{{\dot m}_1}({m_1 } - { m_2 } ) } \over { { m_1}{m_2}}}.$$\end{document } note that if the more massive star loses mass , then the orbital period decreases and the orbit shrinks usually , the initial phase of rlof takes place as the more massive star evolves . as a consequence , the orbit of the binary will shrink , driving the binary to a more compact orbit . in non - conservative mass transfer , both mass and angular momentum can be removed from the system . there are two basic non - conservative processes which are important to the formation of relativistic binaries the common - envelope process and the supernova explosion of one component of the binary . the result of the first process is often a short - period , circularized binary containing a white dwarf . although the most common outcome of the second process is the disruption of the binary , occasionally this process will result in an eccentric binary containing a neutron star . common envelope scenarios result when one component of the binary expands so rapidly that the mass transfer is unstable and the companion becomes engulfed by the donor star . the energy required to eject the envelope comes from the orbital energy of the binary and thus the orbit shrinks . the efficiency of this process determines the final orbital period after the common envelope phase . this is described by the efficiency parameter 20\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\alpha _ { { \rm{ce } } } } = { { \delta { e_{{\rm{bind } } } } } \over { \delta { e_{{\rm{orb}}}}}},$$\end{document } where ebind is the binding energy of the mass stripped from the envelope and eorb is the change in the orbital energy of the binary . the result of the process is the exposed degenerate core of the donor star in a tight , circular orbit with the companion . this process can result in a double degenerate binary if the process is repeated twice or if the companion has already evolved to a white dwarf through some other process . a brief description of the process is outlined by webbink , and a discussion of the factors involved in determining ce is presented in sandquist et al . . the effect on a binary of mass loss due to a supernova can be quite drastic . following padmanabhan , this process is outlined using the example of a binary in a circular orbit with radius a. let v be the velocity of one component of the binary relative to the other component . the initial energy of the binary is given by 21\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$e = { 1 \over 2}\left({{{{m_1}{m_2 } } \over { { m_1 } + { m_2 } } } } \right){\upsilon^2 } - { { g{m_1}{m_2 } } \over a } = - { { g{m_1}{m_2 } } \over { 2a}}.$$\end{document } following the supernova explosion of m1 , the expanding mass shell will quickly cross the orbit of m2 , decreasing the gravitational force acting on the secondary . the new energy of the binary is then 22\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$e^{\prime } = { 1 \over 2}{{{m_{{\rm{ns}}}}{m_2 } } \over { { m_{{\rm{ns } } } } + { m_2}}}{\upsilon^2 } - { { g{m_{{\rm{ns}}}}{m_2 } } \over a},$$\end{document } where mns is the mass of the remnant neutron star . we have assumed here that the passage of the mass shell by the secondary has negligible effect on its velocity ( a safe assumption , see pfahl et al . for a discussion ) , and that the primary has received no kick from the supernova ( not necessarily a safe assumption , but see davies and hansen or pfahl et al . for an application to globular cluster binaries ) . since we have assumed that the instantaneous velocities of both components have not been affected , we can replace them by v = g(m1 + m2)/a , and so 23\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$e^{\prime } = { { g{m_{{\rm{ns}}}}{m_2 } } \over { 2a}}\left({{{{m_1 } + { m_2 } } \over { { m_{{\rm{ns } } } } + { m_2 } } } - 2 } \right).$$\end{document } note that the final energy will be positive and the binary will be disrupted if mns < ( 1/2)(m1 + m2 ) . this condition occurs when the mass ejected from the system is greater than half of the initial total mass , 24\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\delta m > { 1 \over 2}({m_1 } + { m_2}),$$\end{document } where m = m1 mns . if the binary is not disrupted , the new orbit becomes eccentric and expands to a new semi - major axis given by 25\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a^{\prime } = a\left({{{{m_1 } + { m_2 } - \delta m } \over { { m_1 } + { m_2 } - 2\delta m } } } \right),$$\end{document } and orbital period 26\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p^{\prime } = p{\left({{{a^{\prime } } \over a } } \right)^{3/2}}{\left({{{2a^{\prime } - a } \over { a^{\prime } } } } \right)^{1/2}}.$$\end{document } we have seen that conservative mass transfer can result in a tighter binary if the more massive star is the donor . non - conservative mass transfer can also drive the components of a binary together during a common envelope phase when mass and angular momentum are lost from the system . direct mass loss through a supernova explosion can also alter the properties of a binary , but this process generally drives the system toward larger orbital separation and can disrupt the binary entirely . with this exception , the important result of all of these processes is the generation of tight binaries with at least one degenerate object . they occur whenever the orbital separation of a progenitor binary is sufficiently small to allow for mass transfer or common envelope evolution . population distributions for relativistic binaries are derived from an initial mass function , a distribution in mass ratios , and a distribution in binary separations . these initial distributions are then fed into models for binary evolution such as startrack or seba [ 191 , 168 ] in order to determine rates of production of relativistic binaries . the evolution of the binary is often determined by the application of some simple operational formulae such as those described by tout et al . or hurley et al . . for example , hils , bender , and webbink estimated a population of close white dwarf binaries in the disk of the galaxy using a salpeter mass function , a mass ratio distribution strongly peaked at 1 , and a separation distribution that was flat in ln(a ) . other estimates of relativistic binaries differ mostly by using different distributions [ 17 , 119 , 168 , 167 ] . when the above evolutionary scenarios are played out in the environment of a globular cluster , additional mechanisms arise that enhance the production of relativistic binaries . new binary systems can be formed by dynamical interaction among three or more single stars or through tidal capture , and the period distribution and binary components of existing binary systems can be altered by interactions with other stars in the cluster . we will discuss here the broad features of these interactions and how they affect the evolution of binary systems toward relativistic binaries . the formation of binaries during the dynamical evolution of globular clusters can occur either through tidal capture or through n - body interactions . tidal capture occurs when an encounter between two stars is close enough that significant tides are raised on each . if the energy absorbed in these oscillations is great enough to leave the two stars with negative total energy , then the system will form a binary . this process was originally thought to be the dominant channel through which binaries were formed in globular clusters [ 24 , 58 ] . it is now thought to be quite rare , as detailed calculations have shown that the final result is more likely to be coalescence of the two stars [ 10 , 116 , 198 ] . although n - body interactions are less likely to occur than tidally significant two - body interactions , they are now thought to be the dominant channel for the formation of binaries during the evolution of a globular cluster . this process , however , is not likely to produce more than a few binaries during the lifetime of a cluster [ 24 , 172 ] . observations of present binary fractions in globular clusters combined with evolutionary and dynamical simulations indicate initial binary fractions as large as 100% are not unreasonable . the existence of such a population of primordial binaries provides a much more efficient channel for the transformation of the initial distribution in component masses and orbital periods towards higher mass components and shorter orbital periods . this process follows from the interaction of primordial binaries with single stars and other binaries . three results of the interaction are possible : complete disruption of the binary , an exchange of energy between the binary and the field star , or a replacement of one of the binary components by the field star . when a binary interacts with either a field star or with another binary , the energy of the interaction is shared among all stars in the interaction . the result is that the lowest mass object in the interaction will receive the largest velocity and be more likely to escape the interaction . in general , these interactions are quite complex , and must be studied numerically . a typical exchange interaction between a binary and a field star is shown in figure 8 . the binary comes in from the right ( red - white ) , while the field star ( green ) enters from the left . after a complicated interaction , the white star is ejected and the newly formed red - green binary is in a more tightly bound orbit . figure taken from mcmillan . the binary comes in from the right ( red - white ) , while the field star ( green ) enters from the left . after a complicated interaction , the white star is ejected and the newly formed red - green binary is in a more tightly bound orbit . figure taken from mcmillan . if the initial binding energy of the binary is large , the result of these interactions is to shrink the orbit of the new binary as the gravitational energy of the binary is used to bring the field star up to the speeds of the binary components . however , if the binding energy is low , the field star contributes energy to the components of the binary , thereby widening the orbit . heggie s law , which can be summarized as hard binaries get harder and soft binaries get softer . for roughly equal mass stars , a binary is considered hard if its binding energy is greater than the average kinetic energy of a field star in the cluster and soft if its binding energy is less . for unequal mass encounters , hills has shown that the ratio of the orbital speeds of the binary components to the speed of the impactor is a better indicator of whether the binding energy will increase or decrease . the average kinetic energy of a field star in the cluster is sometimes related to an effective temperature of the cluster [ 96 , 155 , 189 ] so that mv = 3kt . numerical studies of the outcome of hard binary interactions indicate that the binding energy of the binary will increase by about 20% with each encounter [ 117 , 189 ] . since the encounter rate is proportional to the semi - major axis ( or 1/e ) and the energy increase per encounter is proportional to e , the rate of hardening per relaxation time is independent of the energy and is ebind 0.6 kt / trelax . a common feature of numerical studies of hard binary interactions is the preferential exchange of high - mass stars and stellar remnants with the least massive member of the binary . thus , the dynamical interactions in a globular cluster drive the initial orbital period distribution toward shorter periods by hardening the short period binaries while disrupting the softer binaries . through exchange interactions , the mass distribution of the binary components is also driven toward higher mass stars , which further enhances the number of mass - transferring systems that can evolve to become relativistic binaries . because stellar remnants can also be exchanged into hard binaries , globular cluster evolution opens up a new channel for the formation of relativistic binaries by introducing evolved components into binary systems that have not yet undergone a mass transfer phase . a particularly promising channel involves the exchange of a neutron star into a binary with a main - sequence star . the binary then undergoes case b or case c mass transfer with a common envelope phase , resulting in a ns - wd binary . similar interactions can occur to produce wd - wd binaries if a massive co or one white dwarf is exchanged into a hard binary . a collaboration of various groups working in stellar dynamics maintains a webpage that provides a number of useful computational tools for comparing how dynamical interactions can affect different binary evolution codes . black hole binaries can also form as a result of exchange interactions , but the process is different because black hole progenitors will evolve so quickly in relation to the relaxation time of most globular clusters [ 141 , 218 ] . one scenario that generates black hole binaries in globular clusters is described by portegies zwart and mcmillan . stellar mass black holes of mass m 10 m will be born early in the life of a globular cluster and , through mass segregation , they will quickly sink to the core . once in the core , these black holes will be so much more massive than the field stars that they will effectively form their own cluster and interact solely with themselves . single black holes will form binaries with other black holes through three - body encounters ; any black holes which are in binaries with other stars will team up with another black hole through exchange encounters . this population of black holes and black hole binaries will then evolve separately from the rest of the cluster as no other stars will be massive enough to affect its dynamics . current intermediate mass black hole ( imbh ) formation scenarios that involve globular clusters can also affect the dynamics of the globular cluster evolution , and therefore , can affect the evolution of binaries within the cluster . in the two most common scenarios , an imbh is either formed early in the life of the globular cluster through runaway mergers of massive stars [ 185 , 70 , 91 ] or it is formed through the gradual accumulation of black holes throughout the lifetime of the globular cluster . the existence of an imbh in a globular cluster can also alter its density profile , and this can have an affect on the rest of the dynamics of the cluster . we have seen how the dynamics of globular clusters can enhance the population of progenitors to relativistic binaries , making the standard channels of mass - transfer more likely to occur . in addition , globular cluster dynamics can open up new channels for the formation of relativistic binaries by inserting evolved , stellar remnants such as neutron stars or white dwarfs into binary systems and by shrinking the orbits of binary systems to enhance the likelihood of mass exchange . finally , binary - single star encounters can simply create relativistic binaries by inserting two evolved objects into a binary and then shrinking the orbit to ultracompact periods . we next discuss the probable rates for the formation of such systems and the dynamical simulations that are used to synthesize globular cluster populations of relativistic binaries . simulations of the populations of relativistic binaries in globular clusters rely on the interplay between the evolution of individual stars in the progenitor systems and the evolution of globular clusters . the evolution of stars in the progenitor systems has been discussed in the previous section 4 and we now turn to techniques for simulating the evolution of globular clusters . the evolution of a globular cluster is dominated by the gravitational interaction between the component stars in the cluster . the overall structure of the cluster as well as the dynamics of most of the stars in the cluster are determined by simple n - body gravitational dynamics . however , the evolutionary time scales of stellar evolution are comparable to the relaxation time and core collapse time of the cluster . consequently , stellar evolution affects the masses of the component stars of the cluster , which affects the dynamical state of the cluster . thus , the dynamical evolution of the cluster is coupled to the evolutionary state of the stars . also , as we have seen in the previous section , stellar evolution governs the state of the binary evolution and binaries may provide a means of support against core collapse . thus , the details of binary evolution as coupled with stellar evolution must also be incorporated into any realistic model of the dynamical evolution of globular clusters . to close the loop , the dynamical evolution of the globular cluster affects the distribution and population of the binary systems in the cluster . in our case , we are interested in the end products of binary evolution , which are tied both to stellar evolution and to the dynamical evolution of the globular cluster . to synthesize the population of relativistic binaries , we need to look at the dynamical evolution of the globular cluster as well as the evolution of the binaries in the cluster . modest ( modeling dense stellar systems ) , a collaboration of various groups working stellar dynamics , maintains a website that provides the latest information about efforts to combine simulations of both the dynamical evolution of n - body systems and stellar evolution . general approaches to this problem involve solving the n - body problem for the component stars in the cluster and introducing binary and stellar evolution when appropriate to modify the n - body evolution . there are two fundamental approaches to tackling this problem direct integration of the equations of motion for all n bodies in the system and large - n techniques , such as fokker - planck approximations coupled with monte carlo treatments of binaries ( see heggie et al . for a comparison of these techniques ) . for a recent review of progress in implementing these techniques , see the summary of the modest-2 meeting . in the next two sections 5.1 and 5.2 we conclude in section 5.3 with a discussion of the recent relativistic binary population syntheses generated by dynamical simulations . the n - body approach to modeling globular cluster dynamics involves direct calculations of the gravitational interactions between all n bodies in the simulation . in principle the positions of the n objects in the cluster are determined by direct integration of the 3n equations of motion : 27\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{\rm{\ddot r}}_i } = - \sum\limits_{j \ne i } { { { g{m_j}({{\rm{r}}_i } - { { \rm{r}}_j } ) } \over { |{{\rm{r}}_j } - { { \rm{r}}_i}{|^3}}}.}$$\end{document } when the positions indicate that objects are sufficiently close to each other , then the interaction is modeled to determine the outcome . in order to achieve realistic simulations with tidal interactions , possible mass transfer , and a mass spectrum of bodies , detailed stellar evolution and stellar collision models must be included and calculated . the kira integrator is part of the starlab environment which also includes stellar evolution codes and other modules for doing n - body simulations . the nbodyx codes have been developed and improved by aarseth since the early 1960 s . he has two excellent summaries of the general properties and development of the nbodyx codes [ 1 , 2 ] . for further details , a good summary of general n - body applications can also be found at the nemo website . nbody6++ is a parallelization of the nbody6 code for use on large computer clusters , and a parallel version of kira is under development . most large n - body calculations are done with a special purpose computer called the grape ( gravity pipe ) invented by makino . the most recent incarnation of the grape is the grape 6 , which has a theoretical peak speed of 100 tflops . there is also a pci card version ( grape-6a ) which is designed for use in pc clusters . the grape calculates the accelerations and jerks for the interaction between each star in the cluster . the next generation grape - dr , which could reach 1 pflops , should be operational in about three years . the main advantage of n - body simulations is the small number of simplifying assumptions which must be made concerning the dynamical interactions within the cluster . therefore , the details for those specific interactions can be calculated during the simulation . within the limits of the numerical errors that accumulate during the calculation obviously , one of the main computational difficulties is simply the cpu cost necessary to integrate the equations of motion for n bodies . the other computational difficulty of the direct n - body method is the wide range of precision required [ 115 , 98 ] . consider the range of distances , from the size of neutron stars ( 10 km ) to the size of the globular cluster ( 50 pc 10 km ) , spanning 14 orders of magnitude . if the intent of the calculations is to determine the frequency of interactions with neutron stars , we have to know the relative position of every star to within 1 part in 10 . the range of time scales is worse yet . considering that the time for a close passage of two neutron stars is on the order of milliseconds and that the age of a globular cluster is 10 yr 10 ms , we find that the time scales span 20 orders of magnitude . these computational requirements coupled with hardware limitations mean that the number of bodies which can be included in a reasonable simulation is no more than 10 . this is about an order of magnitude less than the number of stars in a typical globular cluster . although one has great confidence in the results of an n - body simulation , these simulations are generally for systems that are smaller than globular clusters . consequently , applications of n - body simulations to globular cluster dynamics involve scaling lower n simulations up to the globular cluster regime . thus , one scales the results of an n - body simulation based upon the assumption of a dominant process . however , one can never be certain that the extrapolation is smooth and that there are no critical points in the scaling with n. one can also scale other quantities in the model , so that the quantity of interest is correctly scaled . an understanding of the nature of the scaling is crucial to understanding the applicability of n - body simulations to globular cluster dynamics ( see baumgardt for an example ) . . the computational limitations of n - body simulations can be sidestepped by describing the system in terms of distribution functions fm(x , v , t ) with the number of stars of mass m at time t in the range ( x , x + dx ) and ( v , v + dv ) given by dn = fm dxdv . this description requires that either the phase - space element dx dv be small enough to be infinitesimal yet large enough to be statistically meaningful , or that fm be interpreted as the probability distribution for finding a star of mass m at a location in phase space . the gravitational interaction is provided by a smoothed gravitational potential , which is determined by 28\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\nabla ^2}\phi = 4\pi \sum\limits_i { \left [ { { m_i}\int { { f_{{m_i}}}({\bf{x}},{\bf{v}},t){d^3}{\bf{v } } } } \right].}$$\end{document } the effect of gravitational interactions is modeled by a collision term [ f ] ( see [ 24 , 172 ] for specific descriptions of ) . the dynamics of the globular cluster are then governed by the fokker - planck equation : 29\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{\partial f } \over { \partial t } } + { \bf{v } } \cdot \nabla f - \nabla \phi \cdot { { \partial f } \over { \partial { \bf{v } } } } = \gamma [ f].$$\end{document } in the fokker - planck approach , the mass spectrum of stars is binned , with a separate fm for each bin . increasing the resolution of the mass spectrum requires increasing the number of distribution functions and thus increasing the complexity of the problem . consequently , fokker - planck codes can handle at most a few dozen different fm . the inclusion of additional physical variables such as binaries adds sufficient further complexity that the codes are taxed beyond their capacity . methods for numerically solving the fokker - planck equation use either an orbit - averaged form of equation ( 29 ) , or a monte carlo approach [ 69 , 77 , 78 , 126 , 63 ] . the two time scales involved in the evolution of fm are tcross ( which governs changes in position ) and trelax ( which governs changes in energy ) . the orbit - averaged form of equation ( 29 ) derives from the realization that changes in position are essentially periodic with orbital period t tcross trelax . thus , one can average over the rapid changes in position and retain the slow changes in the phase space coordinates that occur over relaxation times . given suitable assumptions on the symmetry of the potential and the velocity distribution , when one does this , the fokker - planck equation is reduced to an equation involving the energy and the magnitude of the angular momentum . the orbit - averaged solutions of the fokker - planck equation can not easily handle the effect of binaries and the binary interactions that occur during the evolution of a globular cluster . the advantages of the orbit - averaged approach are that one can generalize it to handle anisotropy in velocity , thus allowing study of the effects of the galactic gravitational field and tidal stripping . the more recent monte carlo simulations [ 77 , 126 , 69 ] do not actually deal with the distribution functions , but rather treat the cluster as a collection of particles that represent a spherical shell of similar stars . based on the pioneering work of hnon [ 103 , 102 ] , they are able to represent an arbitrary number of species and can follow binary evolution and other effects . the underlying treatment of relaxation throughout the simulation is done in the fokker - planck approximation , but the interactions and evolution of the stars are handled on a particle by particle basis . consequently , these codes are significantly more robust in their ability to handle realistic populations of stars . a nearly continuous mass spectrum can be used , and stellar evolution and binarity can be included with relative ease . in addition , both stellar collisions and large - angle scatterings can also be tracked . the primary disadvantages of these monte carlo codes are that they require spherical symmetry and that they suffer from statistical noise despite the large number of particles being tracked . for an excellent overview of the implementations and history of the monte carlo methods based on hnon s work , see marc freitag s link on the working group 3 page at the modest website . another approach to solving the fokker - planck equation makes use of the analogy between a globular cluster and a self - gravitating gaseous sphere [ 145 , 80 ] . the most effective use of the gaseous models are in a hybrid code that treats the single stars in a gaseous model while treating the relaxation of binary , three- , and four - body interactions using a monte carlo code [ 81 , 82 ] . this approach shows promise for its flexibility in adding new physics . over the last ten years , there have been several works addressing binary populations in globular clusters [ 19 , 22 , 45 , 43 , 44 , 46 , 82 , 112 , 120 , 160 , 177 , 184 , 189 , 196 , 198 , 208 , 215 , 219 , 227 ] . although the motivations have been varied , it is often possible to extract information about the resulting populations of relativistic binaries . despite the differing models and population synthesis techniques , the predicted populations are in rough agreement . here , we summarize the different techniques and their predictions for relativistic binaries in globular clusters . although n - body simulations have the potential to provide the most detailed population syntheses of relativistic binaries in globular clusters , there are very few actual populations described in the literature . most of the current work that treats binaries in a consistent and detailed way is limited to open clusters [ 190 , 113 , 112 , 139 , 149 ] and is focused on a particular outcome of the binary population , such as blue stragglers , brown dwarfs , initial binary distributions , or white dwarf cmd sequences . focus on photometric observations of open clusters and on spectroscopy . in their comparison of n - body and fokker - planck simulations of the evolution of globular clusters , takahashi and portegies zwart followed the evolution of n = 1 k , 16 k , and 32 k systems with initial mass functions given by equation ( 9 ) and initial density profiles set up from king models . although they allowed for realistic stellar binary evolution in their comparisons , their focus was on the structural evolution of globular clusters . other n - body simulations suffer from this same problem . on the other hand , recent work by shara and hurley has focused specifically on white dwarf binary populations in globular clusters and has produced a detailed table of close white dwarf binaries that were generated in their simulation . it is possible to generate a population distribution for black hole binaries in globular clusters using the n - body simulations of portegies zwart and mcmillan that were intended to describe the population of black hole binaries that were ejected from globular clusters . their scenario for black hole binary ejection describes a population of massive stars that evolves into black holes . as the black holes are significantly more massive than the other stars , they effectively form a separate sub - system , which interacts solely with itself . the black holes form binaries and then harden through binary - single black hole interactions that occasionally eject either the binary , the single black hole , or both . they simulated this scenario using n = 2048 and n = 4096 systems with 1% massive stars . the results of their simulations roughly confirm a theoretical argument based on the recoil velocity that a binary receives during an interaction . noting that each encounter increases the binding energy by about 20% and that roughly 1/3 of this energy goes into binary recoil , the minimum binding energy eb min of an ejected black hole binary is 30\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${e_{{\rm{b}}\min } } \sim 36{w_0}{{{m_{{\rm{bh } } } } } \over { \langle m\rangle}}kt,$$\end{document } where m is the average mass of a globular cluster star and w0 = m 0/kt is the dimensionless central potential . after most binaries are ejected , m 0.4 m. after a few gigayears , nearly all of the black holes were ejected . at the end of this phase of black hole binary ejection , there is a 50% chance that a binary remains in the cluster with no other black hole to eject it . thus , there should be a stellar mass black hole binary remaining in about half of the galactic globular clusters . the maximum binding energy of the remaining black hole binary is eb min and is also given by equation ( 30 ) . we can then approximate the distribution in energies of the remaining black hole binaries as being flat in log(eb ) . the eccentricities of this population will follow a thermal distribution with p(e ) = 2e . dynamical monte carlo simulations can be used to study the evolution of binary populations within evolving globular cluster models . [ 125 , 126 ] ) to study the formation and evolution of ns - wd binaries , which may be progenitors of the large population of millisecond pulsars being discovered in globular clusters ( see section 3.3 ) . in addition to producing the appropriate population of binary millisecond pulsars to match observations , the simulations also indicate the existence of a population of ns - wd binaries ( see figure 9 ) . figure 9results of the monte carlo simulation of ns - wd binary generation and evolution in 47 tuc . the circles and error bars are the 10 binary pulsars in 47 tuc with well measured orbits . systems in a have evolved through mass transfer from the white dwarf to the neutron star . systems in b have not yet evolved through gravitational radiation to begin rlof from the white dwarf to the neutron star . results of the monte carlo simulation of ns - wd binary generation and evolution in 47 tuc . the circles and error bars are the 10 binary pulsars in 47 tuc with well measured orbits . systems in a have evolved through mass transfer from the white dwarf to the neutron star . systems in b have not yet evolved through gravitational radiation to begin rlof from the white dwarf to the neutron star . the tail end of the systems in group b of figure 9 represents the ns - wd binaries that are in very short period orbits and are undergoing a slow inspiral due to gravitational radiation . these few binaries can be used to infer an order of magnitude estimate on the population of such objects in the galactic globular cluster system . if we consider that there are two binaries with orbital period less than 2000 s out of 10 m in 47 tuc , and assume that this rate is consistent throughout the globular cluster system as a whole , we find a total of 60 such binaries . although this estimate is quite crude , it compares favorably with estimates arrived at through the encounter rate population syntheses , which are discussed in section 5.3.3 . more recent applications of the monte carlo simulations that have focused on the properties of binaries include fregeau et al . who look at the production of blue stragglers and other collision products as a result of binary interactions in globular clusters and ivanova et al . who have studied the evolution of binary fractions in globular clusters . the latter work demonstrates the gradual burning of binaries in the core that delays the collapse of the core . in addition , they have also shown the build - up of short period white dwarf binaries in the core through dynamical interactions ( see figure 10 ) . figure 10binary period distributions from the monte carlo simulation of binary fraction evolution in 47 tuc . the bottom panel indicates the period distribution for binaries containing at least one white dwarf . nb is the total number of binaries and nb , p is the number of binaries per bin . binary period distributions from the monte carlo simulation of binary fraction evolution in 47 tuc . the bottom panel indicates the period distribution for binaries containing at least one white dwarf . nb is the total number of binaries and nb , p is the number of binaries per bin . there is also great promise for the hybrid gas / monte carlo method being developed by spurzem and giersz . their recent simulation of the evolution of a cluster of 300,000 equal point - mass stars and 30,000 binaries yields a wealth of detail about the position and energy distribution of binaries in the cluster . further improvements on their code have resulted in direct integration of the binary - binary and binary - single interactions . as a result , they have been able to produce empirical cross - sections for eccentricity variations during interactions . one method for exploring the production of relativistic binary populations in globular clusters involves determining the encounter rate expected between different classes of objects in a globular cluster . sigurdsson and phinney use monte carlo simulations of binary encounters to infer populations using a static background cluster described by an isotropic king - michie model . their results are focused toward predicting the observable end products of binary evolution such as millisecond pulsars , cataclysmic variables , and blue stragglers . also uses this technique to determine the evolution of binary fractions , but they also do not provide sufficient detail of the population to distinguish the relativistic binaries from other binaries in the simulation . there is promise to produce a more detailed description of ultracompact x - ray binaries consisting of a white dwarf and a neutron star using encounter rates . davies and collaborators use the technique of calculating encounter rates ( based on calculations of cross - sections for various binary interactions and number densities of stars using king - michie static models ) to determine the production of end products of binary evolution [ 45 , 43 ] . although they also do not provide a clear description of a population of relativistic binaries , their results allow the estimation of such a population . using the encounter rates of davies and collaborators [ 45 , 43 ] , one can follow the evolution of binaries injected into the core of a cluster . a fraction of these binaries will evolve into compact binaries which will then be brought into contact through the emission of gravitational radiation . by following the evolution of these binaries from their emergence from common envelope to contact , for a globular cluster with dimensionless central potential w0 = 12 , davies followed the evolution of 1000 binaries over two runs . the binaries were chosen from a salpeter imf with exponent = 2.35 , and the common envelope evolution used an efficiency parameter ce = 0.4 . one run was terminated after 15 gyr and the population of relativistic binaries which had been brought into contact through gravitational radiation emission was noted . the second run was allowed to continue until all binaries were either in merged or contact systems . there are four classes of relativistic binaries that are brought into contact by gravitational radiation : low mass wd - wd binaries \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$({\rm{wd}}_a^2)$\end{document } with total mass below the chandrasekhar mass ; high mass wd - wd binaries \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\rm{(wd}}_b^2)$\end{document } with total mass above the chandrasekhar mass ; ns - wd binaries ( nw ) ; and ns - ns binaries ns . the number of systems brought into contact at the end of each run is given in table 3 . t evol \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\rm{wd}}_a^2$\end{document } \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\rm{wd}}_b^2$\end{document } nwns15 gyr1101015707418 number of relativistic binaries brought into contact through binary interactions . in the second run , the relativistic binaries had all been brought into contact . in similar runs , this occurs after another 15 gyr . an estimate of the present - day period distribution can be made by assuming a constant merger rate over the second 15 gyr . consider the total number of binaries that will merge to be described by n(t ) . thus , the merger rate is = dn / dt . assuming that the mergers are driven solely by gravitational radiation we define n(p ) to be the number of binaries with period less than p , and thus 31\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\eta = - { { dn } \over { dt } } = - { { dn } \over { dp}}{{dp } \over { dt}},$$\end{document } so 32\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{dn } \over { dp } } = { { - \eta } \over { dp / dt}}.$$\end{document } the merger rate is given by the number of mergers of each binary type per 1000 primordial binaries per 15 gyr . if the orbits have been circularized ( which is quite likely if the binaries have been formed through a common envelope ) , the evolution of the period due to gravitational radiation losses is given by 33\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{dp } \over { dt } } = - { k_0}{p^{- 5/3}},$$\end{document } where k0 is given by 34\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${k_0 } = { { 96 } \over 5}{(2\pi)^{8/3}}{{{g^{5/3 } } } \over { { c^5}}}{{\mathcal m}^{5/3}},$$\end{document } with the chirp mass \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\mathcal m^{5/3 } } \equiv { m_1}{m_2}{({m_1 } + { m_2})^{- 1/3}}$\end{document}. following this reasoning and using the numbers in table 3 , we can determine the present day population of relativistic binaries per 1000 primordial binaries . to find the population for a typical cluster , we need to determine the primordial binary fraction for globular clusters . estimates of the binary fraction in globular clusters range from 13% up to about 40% based on observations of either eclipsing binaries [ 4 , 242 , 243 ] or luminosity functions [ 204 , 205 ] . assuming a binary fraction of 30% , we can determine the number of relativistic binaries with short orbital period ( porb < pmax ) for a typical cluster with 10 m and the galactic globular cluster system with 10 m by simply integrating the period distribution from contact pc up to pmax , 35\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$n = \int\nolimits_{{p_{\rm{c}}}}^{{p_{\max } } } { { \eta \over { { k_0}}}{p^{5/3}}dp.}$$\end{document } the value of pc can be determined by using the roche lobe radius of eggleton , 36\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${r_{\rm{l } } } = { { 0.49{q^{2/3 } } } \over { 0.6{q^{2/3 } } + \ln { { ( 1 + { q^{1/3}})}^a}}},$$\end{document } and stellar radii as determined by lynden - bell and odwyer . the expected populations for an individual cluster and the galactic cluster system are shown in table 4 using neutron star masses of 1.4 m , white dwarf masses of 0.6 m and 0.3 m , and pmax = 2000 s. table 4encounter rate estimates of the population of relativistic binaries in a typical globular cluster and the galactic globular cluster system.object \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\rm{wd}}_a^2$\end{document } nwnscluster5.64.00.5system176.5125.216 encounter rate estimates of the population of relativistic binaries in a typical globular cluster and the galactic globular cluster system . although we have assumed the orbits of these binaries will be circularized , there is the possible exception of ns binaries , which may have a thermal distribution of eccentricities if they have been formed through exchange interactions rather than through a common envelope . in this case , an integration over both period and eccentricity , using the formulae of pierro and pinto , would be required . the small number of observed relativistic binaries can be used to infer the population of dark progenitor systems . for example , the low - mass x - ray binary systems are bright enough that we see essentially all of those that are in the galactic globular cluster system . if we assume that the ultracompact ones originate from detached wd - ns systems , then we can estimate the number of progenitor systems by looking at the time spent by the system in both phases . let nx be the number of ultracompact lmxbs and tx be their typical lifetime . also , let ndet be the number of detached wd - ns systems that will evolve to become lmxbs , and tdet be the time spent during the inspiral due to the emission of gravitational radiation until the companion white dwarf fills its roche lobe . if the process is stationary , we must have 37\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{{n_{\rm{x } } } } \over { { t_{\rm{x } } } } } = { { { n_{\det } } } \over { { t_{\det}}}}.$$\end{document } the time spent in the inspiral phase can be found from integrating equation ( 33 ) to get 38\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{\det } } = { 3 \over { 8{k_0}}}\left({p_0^{8/3 } - p_{\rm{c}}^{8/3 } } \right),$$\end{document } where p0 is the period at which the progenitor emerges from the common envelope and pc is the period at which rlof from the white dwarf to the neutron star begins . thus , the number of detached progenitors can be estimated from 39\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${n_{\det } } = { { { n_{\rm{x } } } } \over { { t_{\rm{x}}}}}{3 \over { 8{k_0}}}\left({p_0^{8/3 } - p_{\rm{c}}^{8/3 } } \right).$$\end{document } there are four known ultracompact lmxbs with orbital periods small enough to require a degenerate white dwarf companion to the neutron star . the lifetime tx is rather uncertain , depending upon the nature of the mass transfer and the timing when the mass transfer would cease . a standard treatment of mass transfer driven by gravitational radiation alone gives an upper bound of tx 10 yr , but other effects such as tidal heating or irradiation may shorten this to tx 10 yr [ 7 , 198 ] . the value of p0 depends critically upon the evolution of the neutron star - main - sequence binary , and is very uncertain . both k0 and pc depend upon the masses of the white dwarf secondary and the neutron star primary . for a rough estimate , we take the mass of the secondary to be a typical he white dwarf of mass 0.4 m and the mass of the primary to be 1.4 m. rather than estimate the typical period of emergence from the common envelope , we arbitrarily choose p0 = 2000 s. we can be certain that all progenitors have emerged from the common envelope by the time the orbital period is this low . the value of pc can be determined by using equation ( 36 ) and the radius of the white dwarf as determined by lynden - bell and odwyer . adopting the optimistic values of nx = 10 and tx = 10 yr , and evaluating equation ( 38 ) thus , we find ndet 110 , which is within an order of magnitude of the numbers found through dynamical simulations ( see section 5.3.2 ) and encounter rate estimations ( see section 5.3.3 ) . current production of ultracompact wd - ns binaries is more likely to arise through collisions of neutron stars with lower mass red giant stars near the current turn - off mass . the result of such a collision is a common envelope that will quickly eject the envelope of the red giant and leave behind the core in an eccentric orbit . the result of the eccentric orbit is to hasten the inspiral of the degenerate core into the neutron star due to gravitational radiation . continuing in the spirit of small number statistics , we note that there is one known radio pulsar in a globular cluster ns - ns binary ( b2127 + 11c ) and about 50 known radio pulsars in the globular cluster system as a whole ( although this number may continue to grow ) . we may estimate that ns - ns binaries make up roughly 1/50 of the total number of neutron stars in the globular cluster system . a lower limit on the number of neutron stars comes from estimates of the total number of active radio pulsars in clusters , giving \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${n_{{\rm{n}}{{\rm{s}}^2 } } } \sim { 10 ^ 5}$\end{document } . thus , we can estimate the total number of ns - ns binaries to be 2000 . not all of these will be in compact orbits , but we can again estimate the number of systems in compact orbits by assuming that the systems gradually decay through gravitational radiation and thus 40\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{{n_{{\rm{compact } } } } } \over { { n_{{\rm{n}}{{\rm{s}}^{\rm{2 } } } } } } } = { { { t_{{\rm{compact } } } } } \over { { t_{{\rm{coalesce}}}}}},$$\end{document } where ncompact is the number of systems in compact orbits ( porb < 2000 s ) , tcompact is the time spent as a compact system , and tcoalesce is the typical time for a globular cluster ns - ns binary to coalesce due to gravitational radiation inspiral . adopting the coalescence time of b2127 + 11c as typical , tcoalesce = 2 10 yr , and integrating equation ( 38 ) for two 1.4 m neutron stars , we find ncompact 25 . again a very exciting prospect for the observation of relativistic binaries in globular clusters lies in the fact that they will be sources of gravitational radiation . there is a phase in the evolution of most relativistic binaries during which the orbital period is slowly shrinking due to the emission of gravitational radiation . if the binary is in a circularized orbit , the gravitational radiation will be peaked strongly in the second harmonic of the orbital period , so fgw = 2forb . gravitational radiation can be described by the dimensionless strain amplitude ho . although the strength of the gravitational radiation varies with the orientation of the binary , an angle - averaged estimate of the signal strength is 41\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${h_0 } = 1.5 \times { 10^{- 21}}{\left({{{{f_{{\rm{gw } } } } } \over { { { 10}^{- 3}}{\rm{hz } } } } } \right)^{2/3}}\left({{{1\;{\rm{kpc } } } \over r } } \right){\left({{{\mathcal m } \over { { m _ \odot } } } } \right)^{5/3}}.$$\end{document } at a typical globular cluster distance of r 10 kpc and typical chirp mass of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\mathcal m } \sim 0.5{m _ \odot}$\end{document } , a relativistic wd - wd or wd - ns binary with porb = 400 s will have a gravitational wave amplitude of 10 . this value is within the range of the proposed space - based gravitational wave observatory lisa . many globular clusters lie off the plane of the galaxy and are relatively isolated systems with known positions . the angular resolution of lisa improves with signal strength . by focusing the search for gravitational radiation using known positions of suspected sources , it is possible to increase the signal - to - noise ratio for the detected signal . thus , the angular resolution of lisa for globular cluster sources can be on the order of the angular size of the globular cluster itself at fgw > 1 mhz . consequently , the orbital period distribution of a globular cluster s population of relativistic binaries can be determined through observations in gravitational radiation . we will discuss the prospects for observing each class of relativistic binaries covered in this review . wd - wd binaries that are formed from a common envelope phase will be briefly visible while the recently revealed hot core of the secondary cools . these objects are most likely the non - flickerers of cool et al . and edmonds et al . . wd - wd binaries formed through exchange interactions may very well harbor white dwarfs which are too cool to be observed . in either case , hardening through dynamical interactions will become less likely as the orbit shrinks and the effective cross section of the binary becomes too small . these objects will then be effectively invisible in electromagnetic radiation until they are brought into contact and rlof can begin . during this invisible phase , the orbital period is ground down through the emission of gravitational radiation until the orbital period is a few hundred seconds . with a frequency of 1 to 10 mhz , gravitational radiation from such there are 175 such systems predicted from encounter rates ( see table 4 ) . wd - ns binaries that are expected to be progenitors of the millisecond pulsars must pass through a phase of gravitational radiation after the degenerate core of the donor star emerges from the common envelope phase and before the spin - up phase begins with the onset of mass transfer from the white dwarf to the neutron star . the orbital period at the onset of rlof will be on the order of 1 to 2 minutes and the gravitational wave signal will be received at lisa with a signal - to - noise of 50100 at a frequency of around 20 mhz for a globular cluster binary . ( see section 5.3.4 ) to 125 from encounter rates ( see table 4 ) . binaries with significant eccentricity will have a spectrum of harmonics of the orbital frequency , with the relative strength of the nth harmonic for eccentricity e given by 42\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{array}{*{20}c}{g(n , e ) = { { { n^4 } } \over { 32}}\left\{{{{\left [ { { j_{n - 2}}(ne ) - { j_{n - 2}}(ne ) + { 2 \over n}{j_n}(ne ) + { j_{n + 1}}(ne ) - { j_{n + 2}}(ne ) } \right]}^2 } } \right.}\\ { \left . { \quad \quad \quad + ( 1 - { e^2}){{[{j_{n - 2}}(ne ) - 2{j_n}(ne ) + { j_{n + 2}}(ne)]}^2 } + { 4 \over { 3{n^2}}}{{[{j_n}(ne)]}^2 } } \right\},}\\ \end{array}$$\end{document } where jn is the bessel function . the higher harmonics of sufficiently eccentric binaries ( e > 0.7 ) can be detected by lisa even though the fundamental orbital frequency is well below its sensitivity band of 1100 mhz . dynamical interactions may produce an eccentric population of 30140 white dwarf binaries that would be present in the lisa data after a 5 year observation . although the globular cluster population of ns - ns binaries is expected to be quite small ( 10 ) , they may have high eccentricities . the binary pulsar b2127 + 11cis an example of a ns - ns binary in a globular cluster . in terms of the unknown angle of inclination i , the companion mass to the pulsar is m2 sin i 1 m and its eccentricity is e = 0.68 if the globular cluster systems of other galaxies follow similar evolution as the milky way population , these binaries may be potential sources for ligo as gravitational radiation grinds them down to coalescence . with their high eccentricities and large chirp mass , black hole binaries will also be good potential sources for gravitational radiation from the galactic globular cluster system [ 20 , 21 ] . the relatively close proximity of the galactic globular cluster system and the separations between individual globular clusters allows for the identification of gravitational radiation sources with their individual host clusters . although the expected angular resolution of lisa is not small enough to allow for the identification of individual sources , knowledge of the positions of the clusters will allow for focused searches of the relativistic binary populations of the majority of the galactic globular clusters . armed with a knowledge of the orbital periods of any detected binaries , concentrated searches in electromagnetic radiation can be successful in identifying relativistic binaries that may have otherwise been missed . the populations of these objects are the result of an interplay between the gravitational dynamics of large n - body systems , the dynamics of mass transfer , the details of stellar evolution , and the effect of the gravitational field of the galaxy . the gravitational dynamics of globular clusters can enhance the population of short period binaries of main - sequence stars as well as inject compact objects such as white dwarfs and neutron stars into stellar binary systems . once they are in such systems , the details of stellar evolution and mass transfer in close binary systems govern the likely end products of the dynamical interaction between the two stars . furthermore , most models of the evolution of the core of a globular cluster rely on the gradual hardening and ejection of binary systems to delay the onset of core collapse . the hardening of binaries in the core of globular clusters will produce relativistic binaries , but it will also eventually eject these systems as they gain larger and larger recoil velocities in each subsequent encounter . the threshold for ejection from a globular cluster depends both upon the gravitational potential of the cluster itself and the gravitational potential of its environment generated by the milky way . as the globular cluster orbits the milky way , its local environment changes . consequently , if other dynamical processes ( such as gravothermal oscillations ) do not dominate , the globular cluster s population of relativistic binaries may also reflect the past orbital history of the globular cluster . over the last decade , observational techniques and technology have improved to the extent that significant discoveries are being made regularly . at this point , the bottleneck in observations of binary millisecond pulsars , low - mass x - ray binaries , and cataclysmic variables is time , not technology . as these observational techniques are brought to bear on more clusters , more discoveries are bound to be made . in the next decade , the possibility of using gravitational wave astronomy to detect relativistic binaries brings the exciting possibility of identifying the populations of electromagnetically invisible objects such as detached white dwarf and neutron star binaries and black hole binaries in globular clusters . these observations can only help to improve the understanding of the complex and interesting evolution of these objects and their host globular clusters .

in the past 15 years , six new drugs have been approved by the us food and drug administration ( fda ) as disease - modifying therapies ( dmts ) for multiple sclerosis ( ms ) . all of these agents are either infusions or self - administered injections , and many patients report symptoms of pain , anxiety or injection - site reactions associated with these treatments . such side effects negatively impact some ms patients ' satisfaction and compliance with available dmts , and there are even ms patients who forgo dmts altogether because of difficulties associated with injections . currently , there are several promising oral dmts for ms in phase ii and iii clinical trials ( table 1 ) . the arrival of oral dmts for ms will represent a major advance in ms therapeutics . it is currently fda - approved in its injectible form for the treatment of hairy cell leukemia . cladribine has shown promise as a dmt for ms in its injectible form in several clinical trials , especially with regard to suppression of gadolinium - enhancing lesions [ 2 - 4 ] . in an 18-month trial of injectible cladribine in relapsing - remitting ms patients , treated patients had significant reductions in relapse rate and gadolinium - enhancing lesions on magnetic resonance imaging ( mri ) compared to placebo . an oral formulation of cladribine for ms is currently in phase ii and phase iii clinical trials , both as monotherapy and in combination with interferon beta-1a ( inf beta-1a ) , and has been designated by the fda as a fast - track product for expedited review . cladribine has shown to be generally well - tolerated in previous trials , but the risk of infection and bone marrow suppression associated with its long - term use is yet to be determined . laquinimod , a derivative of linomide , is thought to limit the infiltration of leukocytes into the central nervous system and to shift the lymphocyte populations towards th2/th3 cytokine expression . a phase ii trial of oral laquinimod showed that the drug was well - tolerated by ms patients , and that it significantly reduced gadolinium - enhancing lesions compared to placebo after 24 weeks . unlike linomide , which ultimately failed in clinical trials as an ms drug because of serious adverse cardiovascular events fingolimod ( fty-720 ) is a sphingosine-1-phosphate receptor modulator that prevents egress of lymphocytes outside of lymph nodes , the effect of which significantly reduces the number of circulating lymphocytes . specifically , it reduces the number of nave and memory t cells but not effector t cells , and it does not affect t - cell function . in a phase ii trial of 255 ms patients , oral fingolimod significantly reduced the number of gadolinium - enhancing lesions and the annualized relapse rate compared to placebo . the safety and tolerability of fingolimod remains questionable , as two serious adverse infections were reported in the extension phase of the phase ii study . teriflunomide is a metabolite of leflunomide , an fda - approved treatment for rheumatoid arthritis . a chemotherapeutic agent , oral teriflunomide blocks pyramidine synthesis by inhibition of dihydro - orotate dehydrogenase , and ultimately interferes with the interaction of t cells with antigen - presenting cells , thereby inhibiting t - cell activation [ 6,12 - 14 ] . teriflunomide has also been shown to suppress experimental allergic encephalomyelitis ( eae ) , a murine model of ms . in a 36-week , phase ii trial , oral teriflunomide significantly reduced the number of combined unique active lesions on mri in ms patients compared to placebo and was well - tolerated by patients . it is currently undergoing phase iii trials as monotherapy , and in combination therapy with both ifn beta-1a and glatiramer acetate . oral bg00012 has been shown to suppress the number of cd4 and cd8 lymphocytes in peripheral blood , and to cause a shift in t - cell cytokine production away from a th1 profile and towards a th2 profile . a phase ii , 24-week clinical trial of bg00012 showed a significant decrease in gadolinium - enhancing lesions , new t2 lesions , and hypointense t1 lesions on mri in ms patients compared to placebo , and was found to be generally well - tolerated . minocycline is an fda - approved oral antibiotic that is recognized to have both anti - inflammatory and neuroprotective properties , and is safe and well - tolerated . minocycline has been shown to inhibit matrix metalloproteinase-9 activity , which is important to lymphocyte migration into the central nervous system , and inhibits microglial activity and apoptosis in vitro . in a small , open - label trial of minocycline in ms , the proportion of active mri scans during the treatment was significantly lower than in the run - in phase . minocycline is currently in a phase iii trial as monotherapy for ms , and in phase ii trials as adjunctive therapy with glatiramer acetate and inf beta-1a . mycophenylate mofetil is an oral immunosuppressive agent that is fda - approved to prevent organ transplant rejection . it inhibits the synthesis of purines used in the proliferation of t and b lymphocytes . a phase ii trial in ms of mycophenylate mofetil as adjunctive therapy to inf beta-1a showed a significant reduction in relapse rate after 6 months on combination therapy compared to inf beta-1a monotherapy . oral mycophenylate mofetil is currently in phase iii trials as an adjunctive dmt with inf beta-1a . hmg - coa ( 3-hydroxy-3-methyl - glutaryl coenzyme a ) reductase inhibitors , the so - called statins , represent a group of oral medications that are approved to treat hyperlipidemia and that are generally well - tolerated . specifically , statins have been shown to suppress eae through a shift from th1 to th2 cytokine production and inhibition of lymphocyte migration across the blood brain barrier . a phase ii , open - label clinical trial of high - dose atorvastatin in ms showed a significant reduction in the number and volume of gadolinium - enhancing lesions after 9 months . however , one small study of high dose atorvastain versus placebo as adjunctive therapy with inf beta-1a showed that ms subjects in the atorvastatin group were significantly more likely to have clinical or mri disease activity after 6 months compared to those on placebo . pravastatin is currently in a phase iii trial as monotherapy for ms , and simvastatin is in a phase iii trial as adjunctive therapy with inf beta-1a . vitamin d deficiency has recently been associated with a higher risk of developing ms in a sero - epidemiological study , and vitamin d intake appears to be associated with a decreased risk of developing ms . vitamin d3 production is stimulated by sunlight exposure , and the recent vitamin d observations in ms may explain the long - observed phenomenon of higher ms prevalence in geographic areas where sunlight exposure is relatively low . vitamin d is also known to have immunomodulatory properties , especially with regard to t - cell regulation . a phase ii trial of high - dose , oral vitamin d3 therapy in ms as a dmt is currently ongoing . several promising oral agents are currently being evaluated in clinical trials as dmts for ms , and the likelihood is that at least some of them will gain fda approval . the arrival of these oral agents will give ms patients and ms physicians more therapeutic options , which will be especially beneficial for those ms patients who have difficulty with injections or who have experienced intolerable side effects from the currently available dmts . another important benefit of the emergence of oral dmts is that there is likely to be a reduction in the overall expense of ms therapeutic care . while some of these therapies are currently approved for other indications , we do not recommend off - label use of these oral drugs until results from phase iii trials are available . these agents may prove to be ineffective or even harmful and may encourage patients to avoid fda - approved therapies . the availability of oral dmts with proven efficacy will represent a significant advance in the ms physician 's ability to treat all ms patients . the advent of oral dmts will herald a new era of increased adherence to , and satisfaction with , therapy for ms patients . db has research grants from the national institutes of health , the department of veterans affairs , the national ms society , biogenidec and forest laboratories and he has received honoraria for speaking and unrestricted educational grants from teva neurosciences , emd serono , and biogenidec .

cardiovascular diseases ( cvd ) are the major cause of mortality in subjects with type 2 diabetes ( t2d ) . previous clinical studies have shown that impairment of lipid metabolism significantly increases the risk of cvd events . statins , 3-hydroxy-3-methylglutaryl - coenzyme a ( hmg - coa ) reductase inhibitor , can control both hypercholesterolemia and hypertriglyceridemia . the early statin trials were first reported in the 1990s , and several studies of the effects of statins showing the benefits on cvd have been published . more recent evidence has demonstrated that statins are beneficial in reducing the risk of cvd events in people without prior evidence of cvd . the effects of statins in primary and secondary prevention of cvd , especially in patients with t2d , is well established . previous studies have demonstrated that statins can reduce insulin - stimulated glucose uptake by inhibiting translocation of glucose transporter type 4 protein ( glut4 ) to the membrane . glut4 vesicles can translocate to the plasma membrane upon insulin stimulation via a multi - step process . in the normal status , glut4 is mainly located at intracellular vesicles , whereas relatively little glut4 resides at the plasma membrane . when stimulated by insulin , these vesicles can move to the plasma membrane , where they dock and fuse , thereby increasing the number of glut-4 molecules on the cell surface . insulin receptor substrate ( irs ) proteins play critical roles in regulation of the insulin signaling pathway . many studies have focussed on the effect of statins on glucose uptake in adipocytes rather than myocytes . however , evidence from a number of randomized clinical trials over the last 2 decades show a potential association between statin therapy and increased risk of development of diabetes , although this risk is low when compared with the benefits of reduction in coronary events . in this study , the glucose uptake of cardiomyocytes was determined after administration of atorvastatin , pravastatin , and rosuvastatin to investigate the effects of various statins on the insulin - induced glucose signaling pathway and to confirm its mechanism in cardiomyocytes . neonatal sprague - dawley ( sd ) rats ( age 24 h , male and female ) were provided by the experimental animal center of china medical university . atorvastatin , pravastatin , and rosuvastatin were purchased from santa cruz biotechnology ( santa cruz , ca , usa ) . the insulin purchased from the sigma - aldrich ( st louis , mo , usa ) . rabbit anti - glut4 , anti - pirs-1 , anti - rhoa , anti--actin , and goat anti - rabbit igg antibodies were purchased from sigma - aldrich . the heart was obtained from each neonatal sd rat with ophthalmic scissors under sterile conditions and cut into tissue blocks about l mm . after complete digestion , the mixture was centrifuged at 1000 rpm for 8 min and the supernatant was discarded . the deposit was suspended in dulbecco s modified eagle s medium ( dmem ) with 10% fetal calf serum and cultured in a co2 incubator for a differential plating period of 90 min to allow attachment of the non - myocardial cells . the cardiomyocytes were obtained from the deposit after centrifugation at 1000 rpm for 8 min and plated in 10-cm culture dishes ( falcon ) at a density of 110 cells / ml . following incubation for 24 h , the cultures were washed 2 times with phosphate- buffered saline ( pbs ) to remove the dead and non - adherent cells . the medium was changed every 3 days during incubation and the treatment factors were administrated on the fifth day . primary cultured cardiomyocytes were randomly divided into 5 groups : normal control group , insulin group , and statin 1-m , 5-m , and 10-m group , for each of the 3 different statins . the cardiomyocytes were pretreated with 0 , 1 , 5 , and 10-m of pravastatin , rosuvastatin , and atorvastatin for 72 h and then treated with 0.1-m insulin for 30 min . cells were washed twice with preheated pbs and the medium was then replaced by free - serum dmem medium containing 2-[h]-dg at a concentration of 1 ci / ml . [ u - c ] mannitol ( 0.1 ci / ml ) was also used as osmolality control . the uptake of 2-[h]-dg was determined after the cells were further incubated at 37c and 5% co2 in an incubator for 10 min . the medium was then replaced by pre - cooled pbs and the reaction was terminated by the addition of 10 mm phloretin . the cells were rapidly washed twice in pre - cooled pbs to remove phloretin and were dissolved in l% sds/0.l m naoh lysis buffer overnight at room temperature . the lysis solution ( 300 l ) was assayed for radioactivity by use of a liquid scintillation counter ( triathler 425 - 034 , hidex oy ) to determine the uptake of 2-[h]-dg in each group [ 11 , 17 ] . primary cultured cardiomyocytes were randomly divided into 5 groups : normal control group , insulin group , statin 1-m , 5-m , and 10-m group for each of the 3 different statins . the cardiomyocytes were pretreated with corresponding concentrations of statin for 72 h and then treated with 0.1-m insulin for 30 min . the membrane protein , cytoplasm protein , and total cell proteins were extracted using a cell fractionation kit ( biovision , california , usa ) according to the method of previous studies [ 11,1820 ] . the protein samples were then separated with 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) . the expression levels of glut4 , irs-1 , and rhoa were semi - quantified with western blotting . the gel was transferred to a polyvinylidene fluoride ( pvdf ) membrane ( solvay chemicals , belgium ) and blocked for 1 h. the rabbit anti - glut4 , anti - irs-1 , and anti - rhoa antibody were used as primary antibody at a dilution of 1:1000 . the secondary antibody was goat anti - rabbit igg antibody at a dilution of 1:10 000 . signals were visualized with the ecl kit ( amersham international , amersham , uk ) . image j software ( nih , bethesda , md , usa ) was used to compare the gray values between the proteins of interest and the internal control protein , as well as between the phosphorylated protein and the total protein . the expression levels of glut4 , irs-1 , and rhoa in each group were assessed by rt - pcr . total rna was extracted from cells using the trizol method , after which cdna was synthesized from the rna by reverse transcription . using specific primers , pcr amplification was performed to allow for fluorescence - based quantitation of the gene expression . pcr reaction volumes were 10 l and composed of cdna ( 1 l ) , primers ( 0.2 l each ) , 2 premix ex taq ( 5 l ) , and h2o ( 3.6 l ) . a variance analysis and an independent t test were performed for means and data are expressed as mean standard deviation ( s ) . neonatal sprague - dawley ( sd ) rats ( age 24 h , male and female ) were provided by the experimental animal center of china medical university . atorvastatin , pravastatin , and rosuvastatin were purchased from santa cruz biotechnology ( santa cruz , ca , usa ) . the insulin purchased from the sigma - aldrich ( st louis , mo , usa ) . rabbit anti - glut4 , anti - pirs-1 , anti - rhoa , anti--actin , and goat anti - rabbit igg antibodies were purchased from sigma - aldrich . the heart was obtained from each neonatal sd rat with ophthalmic scissors under sterile conditions and cut into tissue blocks about l mm . after complete digestion , the mixture was centrifuged at 1000 rpm for 8 min and the supernatant was discarded . the deposit was suspended in dulbecco s modified eagle s medium ( dmem ) with 10% fetal calf serum and cultured in a co2 incubator for a differential plating period of 90 min to allow attachment of the non - myocardial cells . the cardiomyocytes were obtained from the deposit after centrifugation at 1000 rpm for 8 min and plated in 10-cm culture dishes ( falcon ) at a density of 110 cells / ml . following incubation for 24 h , the cultures were washed 2 times with phosphate- buffered saline ( pbs ) to remove the dead and non - adherent cells . the medium was changed every 3 days during incubation and the treatment factors were administrated on the fifth day . primary cultured cardiomyocytes were randomly divided into 5 groups : normal control group , insulin group , and statin 1-m , 5-m , and 10-m group , for each of the 3 different statins . the cardiomyocytes were pretreated with 0 , 1 , 5 , and 10-m of pravastatin , rosuvastatin , and atorvastatin for 72 h and then treated with 0.1-m insulin for 30 min . cells were washed twice with preheated pbs and the medium was then replaced by free - serum dmem medium containing 2-[h]-dg at a concentration of 1 ci / ml . [ u - c ] mannitol ( 0.1 ci / ml ) was also used as osmolality control . the uptake of 2-[h]-dg was determined after the cells were further incubated at 37c and 5% co2 in an incubator for 10 min . the medium was then replaced by pre - cooled pbs and the reaction was terminated by the addition of 10 mm phloretin . the cells were rapidly washed twice in pre - cooled pbs to remove phloretin and were dissolved in l% sds/0.l m naoh lysis buffer overnight at room temperature . the lysis solution ( 300 l ) was assayed for radioactivity by use of a liquid scintillation counter ( triathler 425 - 034 , hidex oy ) to determine the uptake of 2-[h]-dg in each group [ 11 , 17 ] . primary cultured cardiomyocytes were randomly divided into 5 groups : normal control group , insulin group , statin 1-m , 5-m , and 10-m group for each of the 3 different statins . the cardiomyocytes were pretreated with corresponding concentrations of statin for 72 h and then treated with 0.1-m insulin for 30 min . the membrane protein , cytoplasm protein , and total cell proteins were extracted using a cell fractionation kit ( biovision , california , usa ) according to the method of previous studies [ 11,1820 ] . the protein samples were then separated with 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) . the expression levels of glut4 , irs-1 , and rhoa were semi - quantified with western blotting . the gel was transferred to a polyvinylidene fluoride ( pvdf ) membrane ( solvay chemicals , belgium ) and blocked for 1 h. the rabbit anti - glut4 , anti - irs-1 , and anti - rhoa antibody were used as primary antibody at a dilution of 1:1000 . the secondary antibody was goat anti - rabbit igg antibody at a dilution of 1:10 000 . signals were visualized with the ecl kit ( amersham international , amersham , uk ) . image j software ( nih , bethesda , md , usa ) was used to compare the gray values between the proteins of interest and the internal control protein , as well as between the phosphorylated protein and the total protein . the expression levels of glut4 , irs-1 , and rhoa in each group were assessed by rt - pcr . total rna was extracted from cells using the trizol method , after which cdna was synthesized from the rna by reverse transcription . using specific primers , pcr amplification was performed to allow for fluorescence - based quantitation of the gene expression . pcr reaction volumes were 10 l and composed of cdna ( 1 l ) , primers ( 0.2 l each ) , 2 premix ex taq ( 5 l ) , and h2o ( 3.6 l ) . all data were analyzed using spss 15.0 statistical software . a variance analysis and an independent t test were performed for means and data are expressed as mean standard deviation ( s ) . we detected the 2-[h]-dg uptake status in primary cultured cardiomyocytes after being treated by different concentrations of statins and insulin ( figure 1 ) . after being treated with insulin , the 2-[h]-dg uptake in cardiomyocytes was increased significantly compared with the control cardiomyocytes . when treated with the 3 statins in 1 , 5 , and 10-m , the 2-[h]-dg uptake decreased significantly with the increase in atorvastatin concentration , showing a significant negative correlation , and showing no significant correlation with pravastatin and rosuvastatin . in the 5- and 10-m groups , the 2-[h]-dg uptake in atorvastatin groups were significantly lower than that in pravastatin and rosuvastatin groups ( p<0.05 ) . the expression of glut4 protein on the membrane was determined by western blot and shown in figure 2a . the protein expression level of glut4 was increased when treated by insulin ( s1 group ) compared with the control group ( ob ) . the bands in western blotting showed that the protein expression of glut4 was significantly reduced by atorvastatin compared with the s1 group and decreased significantly with the increase of atorvastatin concentration , showing a significant negative correlation . in pravastatin and rosuvastatin 1- , 5- , and 10-m groups , no significant difference was observed between the groups compared with the insulin groups ( figure 2a ) . the mrna expression level of glut4 in primary cultured cardiomyocytes treated with insulin and atorvastatin was consistent with the expression of glut4 protein . the glut4 mrna expression in atorvastatin 1- , 5- , and 10-m groups was all significantly lower than in the insulin group ( p<0.05 ) , and the glut4 mrna expression in the atorvastatin 10-m group was significantly lower than in the 1-m group ( p<0.05 ) ( figure 2b ) . pravastatin and rosuvastatin showed no significant effects on the glut4 mrna expression ( data not shown ) . the mrna and protein expression levels of irs-1 in primary cultured cardiomyocytes were both significantly reduced by atorvastatin treatment , which was the same with the expression of glut4 . pravastatin and rosuvastatin showed no significant effects on the irs-1 expression ( figure 3 ) . the mrna and protein expression levels of rhoa both showed no significant difference when treated with the 3 different statins ( figure 4 ) . we detected the 2-[h]-dg uptake status in primary cultured cardiomyocytes after being treated by different concentrations of statins and insulin ( figure 1 ) . after being treated with insulin , the 2-[h]-dg uptake in cardiomyocytes was increased significantly compared with the control cardiomyocytes . when treated with the 3 statins in 1 , 5 , and 10-m , the 2-[h]-dg uptake decreased significantly with the increase in atorvastatin concentration , showing a significant negative correlation , and showing no significant correlation with pravastatin and rosuvastatin . in the 5- and 10-m groups , the 2-[h]-dg uptake in atorvastatin groups were significantly lower than that in pravastatin and rosuvastatin groups ( p<0.05 ) . the expression of glut4 protein on the membrane was determined by western blot and shown in figure 2a . the protein expression level of glut4 was increased when treated by insulin ( s1 group ) compared with the control group ( ob ) . the bands in western blotting showed that the protein expression of glut4 was significantly reduced by atorvastatin compared with the s1 group and decreased significantly with the increase of atorvastatin concentration , showing a significant negative correlation . in pravastatin and rosuvastatin 1- , 5- , and 10-m groups , no significant difference was observed between the groups compared with the insulin groups ( figure 2a ) . the mrna expression level of glut4 in primary cultured cardiomyocytes treated with insulin and atorvastatin was consistent with the expression of glut4 protein . the glut4 mrna expression in atorvastatin 1- , 5- , and 10-m groups was all significantly lower than in the insulin group ( p<0.05 ) , and the glut4 mrna expression in the atorvastatin 10-m group was significantly lower than in the 1-m group ( p<0.05 ) ( figure 2b ) . pravastatin and rosuvastatin showed no significant effects on the glut4 mrna expression ( data not shown ) . the mrna and protein expression levels of irs-1 in primary cultured cardiomyocytes were both significantly reduced by atorvastatin treatment , which was the same with the expression of glut4 . pravastatin and rosuvastatin showed no significant effects on the irs-1 expression ( figure 3 ) . the mrna and protein expression levels of rhoa both showed no significant difference when treated with the 3 different statins ( figure 4 ) . in our study , the 2-[h]-dg uptake in primary cultured cardiomyocytes was inhibited by atorvastatin and showed a significant negative correlation with the concentration of atorvastatin . statins , as the 3-hydroxy-3-methylglutaryl - coenzyme a ( hmg - coa ) reductase inhibitor in the cholesterol synthesis process of hepatic cells , show different permeability to cells depending on water solubility . it has been reported that lipophilic statins can more easily penetrate extrahepatic cell membranes , such as cells , adipocytes , and skeletal muscles , while hydrophilic statins are more hepatocyte - specific and are less likely to enter cells or adipocytes [ 2426 ] . because the membrane of extrahepatic cells consists of lipid bilayers , hydrophilic statins can not penetrate it , and thus can not reach the intracellular enzyme ; however , the hepatic cell membrane contains organic anion transporters , which take hydrophilic substances into the cell . therefore , lipophilic atorvastatin can enter the cardiomyocytes and inhibit the insulin - mediated glucose uptake more easily than hydrophilic pravastatin and rosuvastatin . to investigate the mechanism by which atorvastatin inhibits glucose uptake glucose mainly depends on the glucose transporters ( gluts ) to enter into cardiomyocytes . in cardiomyocytes , the 2 most highly expressed glucose transporters are glut1 and glut4 , and glut4 is the most abundant . glut1 mediates basal glucose transport , whereas glut4 is mainly responsible for insulin- or contraction - mediated glucose transport . in quiescent myocytes , the majority of glut4 protein resides in a specialized vesicle population in an intracellular compartment . upon insulin stimulation , glut4 vesicles are translocated to the pm via a multiple - step process by which glut4 storage vesicles ( gsvs ) move to the pm , tether , dock , and ultimately fuse with the pm to expose glut4 proteins on the cell surface . irs-1 is the insulin receptor substrate protein and mainly locates in the hepatic and adipose tissue , which is sensitive to insulin . irs-1 can associate with insulin receptor ( ir ) as the key intermediate in the insulin phosphatidylinositol 3-kinase/ protein kinase b ( pi3k / akt ) signaling pathway . the blocking of phosphorylation of irs-1 can reduce irs-1associated pi3k and akt activity and ultimately decrease insulin - stimulated glucose transport activity . in our study , the protein level of irs-1 on the pm and the translocation of glut4 to the membrane in cardiomyocytes was reduced by atorvastatin . it is confirmed that atorvastatin can inhibit the uptake of cardiomyocytes by blocking the pi3k / akt insulin signaling pathway . rhoa , a member of rho family of small gtpases , is a monomeric g protein that regulates a number of cell functions , including cytoskeletal reorganization , cell motility , and gene expression . there have been several reports of rhoa in the diabetic mesangial cells regulating glucose metabolism , but no effect was observed in cardiomyocytes after treatment with atorvastatin in our study . in primary cultured cardiomyocytes , lipophilic atorvastatin can inhibit insulin - mediated glucose uptake by blocking the pi3k / akt insulin signaling pathway , whereas hydrophilic pravastatin and rosuvastatin showed no effects on glucose uptake .

nod ( taconic farms , germantown , ny ) , balb / c , and akr mice ( the jackson laboratory , bar harbor , me ) were bred under specific pathogen - free conditions . newborn mice were treated intraperitoneally on days 1 and 3 with 200 g of the indicated antigen in 50% ifa ( gibco brl , gaithersburg , md ) . mouse gad ( gad65 ) , myelin basic protein ( mbp ) , and control escherichia coli -galactosidase ( -gal ) were purified as previously described ( 1 , 15 ) . the gad and heat shock protein peptide 277 ( hsp ) peptides have been reported elsewhere ( 1 , 16 , 17 ) . control hen egg white lysozyme ( hel ) peptide hel1125 , immunogenic in nod mice , was provided by eli sercarz ( la jolla institute for allergy and immunology , la jolla , ca ) . insulin b chain and hel were purchased from sigma chemical co. ( st . louis , mo ) . splenic t cells were isolated at 4 or 12 wk of age from individual antigen - treated mice as well as unmanipulated mice , and the frequency of antigen - specific t cells secreting ifn- , il-4 , and il-5 was determined using a modified elisa spot technique ( 15 , 18 ) . in brief , 10 splenic mononuclear cells were added per well ( in triplicate ) of an elispot plate ( athersys , cleveland , oh ) that had been coated with cytokine capture antibodies and incubated with peptide ( 20 m ) or whole protein ( 100 m ) for 24 h for ifn- , or for 40 h for il-4 and il-5 detection . after washing , biotinylated detection antibodies were added and the plates were incubated at 4c overnight . bound secondary antibodies were visualized using horseradish peroxidase ( hrp)streptavidin ( dako corp . , carpinteria , ca ) and 3-amino-9-ethylcarbazole . antibodies r4 - 6a2/xmg 1.2-biotin , 11b11/bvd6 - 24g2-biotin , and trfk5/trfk4-biotin ( all from pharmingen , san diego , ca ) were used for capture and detection of ifn- , il-4 , and il-5 , respectively . at the time of sacrifice , sera was collected and the isotype of gad and insulin autoantibodies were characterized using an elisa assay as described in the legend to fig . 1 and in reference 18 . in brief , gad ( synectics biomedical , stockholm ) or insulin b chain at 10 g / ml were bound to 96-well plates ( nunc ) , in 0.1 m nahco3 , ph 8.5 ( gad ) or ph 9.6 ( insulin b chain ) , at 4c overnight . the wells were rinsed with pbs and then blocked with 3% bsa in pbs for 1 h. mouse sera was added ( 0.1 ml of a 1:500 dilution ) and incubated for 1 h at 37c . after washing , bound ig was characterized using affinity purified hrp - coupled goat anti mouse igg+a+m ( h+l ) ( pierce chemical co. , rockford , il ) , or hrp - coupled goat anti mouse isotype - specific antibodies for igg1 and igg2a ( southern biotechnology associates , birmingham , al ) and abts . sera from untreated balb / c and akr mice were used as negative controls . nod ( taconic farms , germantown , ny ) , balb / c , and akr mice ( the jackson laboratory , bar harbor , me ) were bred under specific pathogen - free conditions . newborn mice were treated intraperitoneally on days 1 and 3 with 200 g of the indicated antigen in 50% ifa ( gibco brl , gaithersburg , md ) . mouse gad ( gad65 ) , myelin basic protein ( mbp ) , and control escherichia coli -galactosidase ( -gal ) were purified as previously described ( 1 , 15 ) . the gad and heat shock protein peptide 277 ( hsp ) peptides have been reported elsewhere ( 1 , 16 , 17 ) . control hen egg white lysozyme ( hel ) peptide hel1125 , immunogenic in nod mice , was provided by eli sercarz ( la jolla institute for allergy and immunology , la jolla , ca ) . insulin b chain and hel were purchased from sigma chemical co. ( st . louis , mo ) . splenic t cells were isolated at 4 or 12 wk of age from individual antigen - treated mice as well as unmanipulated mice , and the frequency of antigen - specific t cells secreting ifn- , il-4 , and il-5 was determined using a modified elisa spot technique ( 15 , 18 ) . in brief , 10 splenic mononuclear cells were added per well ( in triplicate ) of an elispot plate ( athersys , cleveland , oh ) that had been coated with cytokine capture antibodies and incubated with peptide ( 20 m ) or whole protein ( 100 m ) for 24 h for ifn- , or for 40 h for il-4 and il-5 detection . after washing , biotinylated detection antibodies were added and the plates were incubated at 4c overnight . bound secondary antibodies were visualized using horseradish peroxidase ( hrp)streptavidin ( dako corp . , carpinteria , ca ) and 3-amino-9-ethylcarbazole . antibodies r4 - 6a2/xmg 1.2-biotin , 11b11/bvd6 - 24g2-biotin , and trfk5/trfk4-biotin ( all from pharmingen , san diego , ca ) were used for capture and detection of ifn- , il-4 , and il-5 , respectively . at the time of sacrifice , sera was collected and the isotype of gad and insulin autoantibodies were characterized using an elisa assay as described in the legend to fig . 1 and in reference 18 . in brief , gad ( synectics biomedical , stockholm ) or insulin b chain at 10 g / ml were bound to 96-well plates ( nunc ) , in 0.1 m nahco3 , ph 8.5 ( gad ) or ph 9.6 ( insulin b chain ) , at 4c overnight . the wells were rinsed with pbs and then blocked with 3% bsa in pbs for 1 h. mouse sera was added ( 0.1 ml of a 1:500 dilution ) and incubated for 1 h at 37c . after washing , bound ig was characterized using affinity purified hrp - coupled goat anti mouse igg+a+m ( h+l ) ( pierce chemical co. , rockford , il ) , or hrp - coupled goat anti mouse isotype - specific antibodies for igg1 and igg2a ( southern biotechnology associates , birmingham , al ) and abts . sera from untreated balb / c and akr mice were used as negative controls . when unmanipulated nod mice were tested at the onset of insulitis ( 4 wk of age ) , we detected vigorous ifn- , but no il-4 or il-5 splenic t cell responses to a single determinant of gad , gad peptide 35 , ( hereafter called gadp35 ) consistent with a unipolar th1 response ( table 1a ) . by 12 wk of age , t cell autoimmunity had spread intramolecularly to additional gad determinants ( gadp6 and gadp15 ) and intermolecularly to other cas ( insulin b chain and heat shock protein , supporting earlier observations [ refs 1 , 2 ] ) : all of these second wave reactivities were also purely th1 in nature ( table 1 ) . thus , the spontaneously developing autoimmune process is characterized by the spreading of unipolar th1 type anti-ca reactivity . conceivably , the first wave of autoreactive th1 cells , via secretion of ifn- and induction of il-12 , creates an environment that favors th1 cell differentiation , generating a positive feedback loop of th1 reactivity and amplifying proinflammatory autoimmune responses to cas . we hypothesized that th2 autoimmunity , like th1 autoimmunity , might also spread , since the il-4 produced by th2 cells is itself a th2 differentiation factor ( 1922 ) . we tested this hypothesis by inducing th2 immunity to a single ca and characterizing the development of t and b cell responses to unrelated cas . nod mice were neonatally treated with control antigens or cas in ifa , a protocol which has recently been shown to induce vigorous th2 responses ( 15 ) . nod mice injected with the control antigens mouse mbp , hel , or -gal displayed vigorous il-4 and il-5 , but no ifn- responses to the injected antigen , indicating the induction of unipolar th2 responses ( table 1 ) . thus , nod mice are not generally th1 biased as has been thought , and can be manipulated to mount th2 responses . notably , induction of th2 immunity to these control antigens did not affect the spontaneous development of th1-biased anti-ca responses ( table 1b ) , nor disease incidence ( see below ) . neonatal injection of nod mice with a single ca peptide ( gadp35 , which contains the earliest known target determinant ; reference 1 ) , induced clear il-4 and il-5 responses not only to the injected peptide , but also to other gad peptides ( gadp6 and gadp15 , which contain later target determinants ) , indicating th2 type intramolecular spreading ( table 1a ) . similarly , neonatal treatment with gadp6 led to the spreading of th2 immunity to gadp35 and gadp15 , indicating that primed th2 responses can spread to other autoantigen determinants , independent of the order in which spontaneous autoimmune responses arise to these determinants ( see fig . 3 in reference 1 ) . indeed , after treatment with a gad peptide , th2 responses became predominant to the injected peptide , as well as to uninjected gad peptides through intramolecular spreading . furthermore , injection of cas individually ( gad , hspp277 , or insulin b chain ) , led to the development of th2 autoimmunity to noninjected cas ( intermolecular spreading , table 1b ) , creating an amplificatory cascade of this antiinflammatory limb . ca - treated nod mice failed to respond to nontarget tissue antigens ( mbp , hel or -gal ) , and in other strains of mice , primed th2 responses to cas were restricted to the injected antigen ( table 1 and data not shown ) . nod mouse immune responses to control nontarget tissue antigens ( mbp , hel and -gal ) were similar in magnitude to those induced by these antigens in other strains of mice ( data not shown ) but failed to spread to cas ( table 1 ) . thus , the spreading of th2 responses was limited to target tissue antigens and was dependent upon a local inflammatory process . analysis of humoral responses showed that while unmanipulated and control antigen treated nod mice had low levels of autoantibodies , gad - treated animals had elevated autoantibodies to both gad and insulin ( fig . neonatal treatment with insulin b chain raised the titer of gad - specific antibodies in addition to the insulin - specific ones . the induced antibodies were of the igg1 subclass , characteristic of th2 responses ( 19 ) . thus , the spreading of th2 immunity can lead to the diversification of humoral responses . furthermore , the gad peptide treated nod mice had significantly reduced long - term disease incidence ( 30% of gad peptide - treated mice versus 96% of controls developed diabetes over 1 yr ( p 0.02 ) ; fig . 2 ) . the lack of complete protection by gad treatment may be due to the diminution of th2 responses later in life ( 11 , 18 ) . while the induction of th2 responses to some nontarget tissue antigens has been associated with protection from autoimmune disease ( 23 , 24 ) , the control nontarget tissue antigens used in this study did not induce th2 spreading or protection from disease . although we induced th2 immunity before the onset of insulitis , ca - treated nod mice still developed ca - reactive th1 cells , suggesting that there is an inherent islet perturbation which promotes th1 autoimmunity to cas . however , the th1 responses to cas were markedly reduced in ca - treated animals relative to control groups ( table 1 ) . despite the presence of significant th1 responses , ca ( but not control ) -treated mice displayed almost no splenic t cell proliferative responses to the injected antigen and had greatly reduced proliferative responses to other cas ( data not shown ) . as the autoantibody responses in ca - treated mice were predominantly of the th2 type and the mice were protected from disease , it appears that th2 immunity can be functionally dominant and a potent regulator of pathogenic th1 activity . in summary , we have shown in unmanipulated nod mice that the anti- cell response starts and spreads as a pure th1 type autoimmunity , suggesting that a th1 cascade underlies disease progression . induction of th2 autoimmunity to a single ca resulted in the spreading of th2 type t cell and antibody responses to other cas in an infectious manner . these data suggest that both th1 and th2 autoimmunity evolve in amplificatory cascades defined by site - specific , but not antigen - specific , positive feedback circuits , which may be generated by the cytokine milieu ( 24 ) or induced changes in accessory molecule expression ( 2527 ) . th2 type determinant spreading introduces a novel mechanism for th2-mediated protection , providing an explanation for the infectious nature of tolerance and why different autoantigens can be successfully used for immune therapy . conversely , in th2-mediated diseases , th2 determinant spreading may contribute to the disease process , perhaps accounting for observations that in allergic conditions , individuals gradually become sensitized to an increasing number of antigens . thus , these findings may provide a new theoretical framework for understanding disease progression in autoimmune and allergic conditions , as well as for therapeutic intervention . nod mice were treated with hel , gad , or insulin b chain , as described in materials and methods . gad ( a ) and insulin ( b ) antibodies were characterized at 12 wk of age using antigen - specific elisa assays ( 18 ) . the data are represented as the mean absorbance values over background of triplicate samples from individual mice . experimental and control sera were tested simultaneously in two separate assays ( n = 5 for each group ) . the variance in absorbance values between triplicate samples from the two sets of experiments was < 8% . humoral responses to gad and insulin in control nod mice treated with hel were similar to those of unmanipulated nod mice . balb / c mice treated with cas developed antibodies only against the injected antigen ( data not shown ) , consistent with the observed lack of th2 spreading in these mice ( table 1b ) . antibodies to gad and insulin in sera from untreated balb / c and akr mice were at background levels ( data not shown ) . mice were intraperitoneally injected neonatally with control hel1125 peptide , gadp35 , and gadp6 , which constitute determinants ( 1 ) ; gadp11 , which does not constitute a determinant ; hspp277 ; insulin b chain ; or whole proteins gad , mbp , hel , or -gal in ifa . t cells from individual spleens were isolated at 12 wk of age ( except where indicated ) and the frequency of antigen - specific t cells secreting ifn- , il-4 , and il-5 was determined by elisa spot . the data are represented as the mean number of spot - forming colonies 10 splenic t cells above background . most wells without antigen showed no responses , but a background of up to five spots was observed in a few wells . experimental and control mice were tested simultaneously ( in triplicate ) in two separate experiments . intramolecular spreading of th2 responses to gad determinants ca treatment inhibits insulin - dependent diabetes . neonatal female nod mice were treated at days 1 and 3 with 200 g hel1125 , gadp11 , gadp35 , or gadp6 in ifa and were followed up until they reached 1 y of age in order to determine the effect of treatment on long - term disease incidence . two consecutive blood glucose levels of > 300 mg / dl was considered disease onset .

spinal cord stimulation ( scs ) provides significant relief for lumbosacral radiculopathy refractory to both medical and surgical treatment . clinical series report between 50% to 70% successful pain relief in patients treated with scs based on reduction in pain severity scores , improvement in function , and decreased pain medication dependence.17 until recently , scs has been considered relatively ineffective for treatment of chronic axial low back pain ( lbp).1,2,4,812 most clinical series report better pain control with scs in patients with lower extremity ( le ) radicular pain than in patients with isolated , axial lbp,1,13 an expected finding based on functional neuroanatomy . the representation of the low back within the sensory homunculus of the cerebral cortex and the dorsal columns of the spinal cord is relatively small compared to the representation of the legs.2 from dorsal to ventral , the representation of the low back within the dorsal columns is evenly distributed , and thus low back fibers may not be available to predominantly superficial stimulation of the dorsal columns.2 improvements in scs technology including programmable and percutaneously rechargeable implantable generators , increasing capabilities of implantable programmable generators , and paddle design enhancements reducing device migration14 have resulted in increasingly effective lbp control . accordingly , some combined low back and le pain studies have reported satisfactory pain relief with scs for the chronic lbp component.9 failed back surgery syndrome ( fbss ) is the most common indication for scs in the united states.15 scs in non - operated patients ( ie , without fbss ) with axial lbp has not been systematically studied . the current study retrospectively analyzes a patient population whose clinical characteristics have generally been considered a poor prognostic indication for scs . patients with either exclusive or predominant chronic axial lbp , regardless of previous spinal surgical intervention , are generally expected to respond less favorably to scs than those patients with predominantly le radicular pain.1,13 this current study evaluates the direct response of either exclusive or predominant chronic axial lbp to scs provided with the surgical implantation of paddle leads within the thoracic epidural space . this is a retrospective review of a consecutive series of patients with either exclusive or predominant chronic axial lbp evaluated and treated at a university health care setting from 2006 to 2011 with surgical implantation of a spinal cord stimulator . a small portion of the patients were also treated for le radiculopathy that was less severe than the axial lbp , as assessed by a preoperative visual analogue scale ( vas ) score for both the axial lbp and le pain . all patients underwent at least 6 weeks of treatment with physical therapy including heat , ultrasound , and exercises , followed by treatment with lumbar epidural or facet steroid injections as indicated prior to surgical intervention . all patients were found not to be optimal candidates for neural decompressive or fusion procedures after evaluation of their presentation and review of their neuroimaging by a spine surgeon at our institution . the study was approved by the university institutional review board . under intravenous sedation and local anesthesia , scs paddles were implanted in the dorsal thoracic epidural space at an average t9 level through a laminotomy . the patients were positioned prone over chest rolls on the operating table and were fully conscious after the paddle implantation for an intraoperative epidural scs trial of approximately 15 minutes , performed as previously described.16 after repositioning adjustments of the paddle as needed , the acute intraoperative scs screening trials ultimately successfully provided at least 50% pain relief in the habitual axial lbp distribution for all patients . among the two patients with le radiculopathy , acute intraoperative scs screening also provided at least 50% pain relief along the le pain distribution . the epidural scs paddles used were a three - column tripole lead ( st jude medical , inc . , saint paul , mn , usa ) or a five - column penta lead ( st jude medical ) . the paddle leads were anchored into position after the intraoperative screening trials and the connecting cables were subcutaneously tunneled to a buttock area . the cables were then attached to an implanted programmable generator within a pocket created in the subcutaneous tissue ( figure 1 ) . implanted programmable generators used were the eon rechargeable generator ( st jude medical ) . preoperative pain severity of axial lbp and le pain were recorded during an initial evaluation using the vas scale . following the placement of an implanted spinal cord stimulator , patients were followed for a minimum of 12 months , at which time the vas scores for axial lbp and le pain were again recorded . in addition , each patient at their follow - up visit was asked to rate the estimated decrease in axial lbp as a subjective measure of pain relief . all statistical analyses were conducted using stata 11 statistical software package ( statacorp , college station , tx , usa ) . the wilcoxon rank - sum test was used to test for statistically significant differences of the nonparametric means . p values were calculated as two - tailed , and p<0.05 was considered statistically significant . this is a retrospective review of a consecutive series of patients with either exclusive or predominant chronic axial lbp evaluated and treated at a university health care setting from 2006 to 2011 with surgical implantation of a spinal cord stimulator . a small portion of the patients were also treated for le radiculopathy that was less severe than the axial lbp , as assessed by a preoperative visual analogue scale ( vas ) score for both the axial lbp and le pain . all patients underwent at least 6 weeks of treatment with physical therapy including heat , ultrasound , and exercises , followed by treatment with lumbar epidural or facet steroid injections as indicated prior to surgical intervention . all patients were found not to be optimal candidates for neural decompressive or fusion procedures after evaluation of their presentation and review of their neuroimaging by a spine surgeon at our institution . under intravenous sedation and local anesthesia , scs paddles were implanted in the dorsal thoracic epidural space at an average t9 level through a laminotomy . the patients were positioned prone over chest rolls on the operating table and were fully conscious after the paddle implantation for an intraoperative epidural scs trial of approximately 15 minutes , performed as previously described.16 after repositioning adjustments of the paddle as needed , the acute intraoperative scs screening trials ultimately successfully provided at least 50% pain relief in the habitual axial lbp distribution for all patients . among the two patients with le radiculopathy , acute intraoperative scs screening also provided at least 50% pain relief along the le pain distribution . the epidural scs paddles used were a three - column tripole lead ( st jude medical , inc . , saint paul , mn , usa ) or a five - column penta lead ( st jude medical ) . the paddle leads were anchored into position after the intraoperative screening trials and the connecting cables were subcutaneously tunneled to a buttock area . the cables were then attached to an implanted programmable generator within a pocket created in the subcutaneous tissue ( figure 1 ) . implanted programmable generators used were the eon rechargeable generator ( st jude medical ) . preoperative pain severity of axial lbp and le pain were recorded during an initial evaluation using the vas scale . following the placement of an implanted spinal cord stimulator , patients were followed for a minimum of 12 months , at which time the vas scores for axial lbp and le pain were again recorded . in addition , each patient at their follow - up visit was asked to rate the estimated decrease in axial lbp as a subjective measure of pain relief . all statistical analyses were conducted using stata 11 statistical software package ( statacorp , college station , tx , usa ) . the wilcoxon rank - sum test was used to test for statistically significant differences of the nonparametric means . p values were calculated as two - tailed , and p<0.05 was considered statistically significant . a total of nine patients with either exclusive ( n=7 ) or predominant ( n=2 ) axial lbp were treated with spinal cord stimulation using a surgically implanted paddle lead within the thoracic epidural space ( table 1 ) . in this series , there were three males and six females with a mean age of 54.2 years ( range : 33 to 75 years ) . the etiology of the lbp was fbss ( n=4 ) , lumbar - sacral degenerative joint disease ( n=3 ) , lumbar - sacral degenerative disc disease ( n=4 ) , and lumbar spine fracture ( n=1 ) . degenerative joint disease was defined as facet arthropathy evident on a magnetic resonance imaging scan . the average thoracic spine level of the epidural spinal cord stimulator paddle lead implant was approximately the t9 level ( range , t6t12 ) . patients were followed for response to the scs treatment for a minimum duration of 12 months ( range , 1241 months ) . the distribution of lbp vas scores for the initial evaluation and the postspinal cord stimulator implantation is depicted in figure 2 . the mean vas score for axial lbp prior to implantation of a spinal cord stimulator was 7.20.8 and 2.30.9 after the spinal cord stimulator implant ( p=0.003 , figure 3 ) . of the two patients with concurrent le pain , the mean vas score for the le pain was 7.51.5 prior to scs and 0.00.0 after scs ( p=0.103 ) . the subjective estimated relief of lbp provided by the surgically implanted spinal cord stimulator was 66%9.3% . a total of nine patients with either exclusive ( n=7 ) or predominant ( n=2 ) axial lbp were treated with spinal cord stimulation using a surgically implanted paddle lead within the thoracic epidural space ( table 1 ) . in this series , there were three males and six females with a mean age of 54.2 years ( range : 33 to 75 years ) . the etiology of the lbp was fbss ( n=4 ) , lumbar - sacral degenerative joint disease ( n=3 ) , lumbar - sacral degenerative disc disease ( n=4 ) , and lumbar spine fracture ( n=1 ) . degenerative joint disease was defined as facet arthropathy evident on a magnetic resonance imaging scan . the average thoracic spine level of the epidural spinal cord stimulator paddle lead implant was approximately the t9 level ( range , t6t12 ) . patients were followed for response to the scs treatment for a minimum duration of 12 months ( range , 1241 months ) . the distribution of lbp vas scores for the initial evaluation and the postspinal cord stimulator implantation is depicted in figure 2 . the mean vas score for axial lbp prior to implantation of a spinal cord stimulator was 7.20.8 and 2.30.9 after the spinal cord stimulator implant ( p=0.003 , figure 3 ) . of the two patients with concurrent le pain , the mean vas score for the le pain was 7.51.5 prior to scs and 0.00.0 after scs ( p=0.103 ) . the subjective estimated relief of lbp provided by the surgically implanted spinal cord stimulator was 66%9.3% . scs has been traditionally recognized as an effective treatment for chronic pain of neuropathic origin , including le radiculopathy.17 axial lbp pain , on the other hand , has been difficult to treat with scs alone,1,2,4,812 possibly due to the nociceptive origin of the axial spine pain . vascularized granulation tissue , for example , has been found to be associated with chronic lumbar disc disease and histologically contains nociceptors that may be the cause of the nociceptive nature of isolated lbp in this population.17 fbss and chronic , unhealed fractures likely contain granulation tissue which may contribute to chronic lbp . this study demonstrates that scs with surgical implantation of an epidural paddle lead can provide effective long - term pain control in patients with exclusive or predominant axial lbp . the etiology of axial lbp in this series was diverse including fbss , degenerative joint the diverse utility of scs as a treatment of axial lbp . of the nine patients enrolled in this series , eight patients ( 89% ) reported 50% relief of chronic axial lbp at a mean follow - up evaluation at 19.9 months after a spinal cord stimulator implant . the 33-year - old patient that did not report benefit from the implanted spinal cord stimulator , case 5 , was the youngest patient of the series ( table 1 ) . she reported that her lbp increased from 8 to 9 at a 24-month follow - up visit . the paddle lead was initially inserted into the epidural space at approximately the t9 level through a laminotomy at t10 , but she did not receive pain relief in the distribution of her chronic lbp . ultimately , the paddle lead was passed inferiorly through the t10 laminotomy and provided at least 50% pain relief during the intraoperative scs trial ( figure 1 ) . the failure of the scs benefit at follow - up emphasizes the point that the t9 level may be the optimal level to place scs leads for adequate coverage of the low back.2 scs epidural leads can be generally classified into percutaneously placed linear leads or paddle leads surgically implanted through a laminotomy . scs for relief of axial lbp has been demonstrated to be superior to conservative medical management alone in a recent multicenter , randomized trial,18 but scs for axial lbp had been primarily evaluated with percutaneously placed epidural electrodes . placement of three individual percutaneously placed linear leads creating a tripolar configuration , for instance , was shown to benefit a single case of fbss utilizing a guarded cathode arrangement.19 several larger case series studies demonstrate improved axial lbp with scs using various configurations of percutaneously placed leads.12,2022 laminotomy for paddle lead placement is a more invasive procedure relative to placement of percutaneous leads , but laminotomy placed paddle leads have been shown to provide more durable pain coverage with less tendency to migrate.2325 newer hybrid lead designs that mimic the benefits of paddle leads can be placed percutaneously into the epidural space . a few recent studies have reported encouraging results using hybrid leads for treatment of axial lbp.14,26,27 another study showed that scs using a paddle lead with external radio - frequency stimulation benefited patients with predominantly axial lbp.28 our current study shows that scs with paddle leads connected to an implanted pulse generator provides sustained relief of axial lbp . this was a small case series at a single institution , limiting the generalization of the findings . as with other studies evaluating scs , this series was not blinded and did not include a control group to evaluate treatment relative to the natural progression of axial lbp , though in one study scs has been shown superior to medical treatment alone.18 this current study also does not include standardized functional outcome scores for the patients at follow - up . the study does , however , add to the growing amount of evidence found in the literature that axial lbp can be successfully treated by scs using paddle leads in a carefully selected population of patients . scs using a surgically implanted paddle electrode within the thoracic epidural space provides significant pain relief for chronic axial lbp and is a safe treatment modality . these findings support the development of a multicenter , prospective trial of scs for axial lbp .

the primary goal of this policy statement is to educate patients , physicians , medical providers , reviewers , adjustors , case managers , insurers , and all others involved or affected by insurance coverage decisions regarding lumbar disc replacement surgery . this policy statement was developed by a panel of physicians selected by the board of directors of isass for their expertise and experience with lumbar tdr . the panel 's recommendation was entirely based on the best evidence - based scientific research available regarding the safety and effectiveness of lumbar tdr . most of the major health insurance carriers in the us , including unitedhealth , aetna , humana , and most blue cross blue shield affiliates , do not provide coverage for single level lumbar tdr even in patients meeting strict selection criteria . as a result , millions of americans with chronic and debilitating lumbar degenerative disc disease who might reasonably benefit from a lumbar tdr are denied access to this technology based solely on their insurance carriers coverage policy . the most common explanation for denying coverage for lumbar tdr is that the technology is considered experimental and investigational . some carriers indicate that the long - term clinical outcome of lumbar disc replacement is unclear . the evidence from uncontrolled long - term studies suggests that potential degeneration of adjacent discs and facets and wear of the polyethylene part of the disc may occur and that , in some cases , revision surgery may be needed . statements like this are disingenuous , choosing to ignore the long - term outcomes from well - controlled level 1 studies demonstrating decreased adjacent segment degeneration , minimal component wear issues , and lower revision rates than fusion . a common definition of an investigational technique is one that is not approved and under investigation in clinical trials . evaluation of peer reviewed published literature and publicly - debated scientific presentations provides extensive evidence that lumbar disc replacement is neither experimental nor investigational . it has been extensively tested and has received fda approval after careful and lengthy evaluation of multicenter level 1 data . the idea of replacing damaged or degenerated lumbar discs started in the 1950 's . over the last several decades , multiple attempts have been made to replace painful lumbar disc with implants that maintain motion at the operative level . karin buttner - janz and kurt schellnack was first implanted in the us in 2000 to start a multicenter prospective randomized ide study . since 2000 , tens of thousands of patients have been treated in the us and worldwide with an increasing inventory of lumbar disc implants . although some critics speculated that the widespread availability of lumbar tdr would lead to large failure rates and high levels of revision , a detailed and unbiased review of the published literature demonstrates otherwise . most clinicians and scientists agree that the majority of complications associated with lumbar tdr implantation are related to errors in patient selection , deviating from well established inclusion and exclusion criteria ( table 1 , table 2 ) . inclusion and exclusion criteria for prodisc - l ( from the fda ss&e labelling document ) . diagnosis of ddd requires back and/or leg ( radicular pain ) ; and radiographic confirmation of any 1 of the following by ct , mri , discography , plain film , myelography and/or flexion / extension films : instability ( 3 mm translation or 5 angulation;decreased disc height > 2mm;scarring / thickening of annulus fibrosis;herniated nucleus pulposus ; orvacuum phenomenon instability ( 3 mm translation or 5 angulation ; decreased disc height > 2 mm ; scarring / thickening of annulus fibrosis ; herniated nucleus pulposus ; or age between 18 and 60 years failed at least 6 months of conservative treatment oswestry low back pain disability questionnaire score of at least 20/50 ( 40% ) ( interpreted as moderate / severe disability ) psychosocially , mentally and physically able to fully comply with this protocol including adhering to follow - up schedule and signed inform consent no more than 1 vertebral level may have ddd , and all diseased levels must be treated patients with involved vertebral endplates dimensionally smaller than 34.5 mm in the medial - lateral and/or 27 mm in the anterior - posterior directions known allergy to titanium , polyethylene , cobalt , chromium or molybdenum prior fusion surgery at any vertebral level clinically compromised vertebral bodies at the affected level due to current or past trauma radiographic confirmation of facet joint disease or degeneration lytic spondylolisthesis or spinal stenosis degenerative spondylolisthesis of grade > 1 back or leg pain of unknown etiology osteopenia or osteoporosis : a screening questionnaire for osteoporosis , score ( simple calculated osteoporosis risk estimation ) , will be used to screen patients to determine if a dexa scan is required . if dexa is required , exclusion will be defined as a dexa bone density measured t score < -2.5 . paget 's disease , osteomalacia or anything other metabolic bone disease ( excluding osteoporosis which is addressed above ) morbid obesity defined as a body mass index > 40 or a weight more than 100 lbs . over ideal body weight pregnant or interested in becoming pregnant in the next 3 years active infection systemic or local taking medication or any drug known to potentially interfere with bone / soft tissue healing ( e.g. , steroids ) rheumatoid arthritis or other autoimmune disease systemic disease including aids , hiv , hepatitis active malignancy : a patient with a history of any invasive malignancy ( except non - melanoma skin cancer ) unless he / she has been treated with curative intent and there has been no clinical signs or symptoms of the malignancy for at least 5 years indications and contraindications for prodisc - l . active systemic infection or infection localized to the site of implantation osteopenia or osteoporosis defined as dexa bone density measured t - score < -1.0 bony lumbar spinal stenosis allergy or sensitivity to implant materials ( cobalt , chromium , molybdenum , polyethylene , titanium ) isolated radicular compression syndromes , especially due to disc herniation involved vertebral endplate that is dimensionally smaller than 34.5 mm in the medial - lateral and/or 27 mm in the anterior - posterior directions clinically compromised vertebral bodies at the affected level due to current or past trauma lytic spondylolisthesis or degenerative spondylolisthesis of grade > 1 in 2005 blumenthal et al published the result of the first prospective , randomized trial comparing lumbar disc replacement with the charite to alif . the authors reported lower levels of pain and disability at all follow up intervals between 6 weeks to 24 months . in addition , the disc replacement group reported higher patient satisfaction , and shorter hospital stay compared to the fusion group . the complication rates in both groups were similar for both groups , but the re - operation rate was significantly lower in the lumbar tdr group compared to the fusion group ( 5.4% vs. 9.1% ) . in 2009 , guyer et al , published the 5 year follow up results of the charite ide trial . one hundred and thirty - three randomized patients were evaluated at a minimum of 5 years post index operation . the authors reported that the charite group had a statistically higher success rate than the alif group ( 58% vs 51% ; p=0.0359 ) . although there were no significant differences between the 2 groups in terms of odi , vas , or sf-36 , patient satisfaction and employment status were higher in the charite group . the re - operation rate at the index level was 8% for the charite group and 16% for the fusion group . the authors concluded that although there were no statistically significant differences between the 2 groups in clinical outcomes , the charite group demonstrated higher patient satisfaction , higher employment status , and lower re - operation rates , while maintaining motion at the operative level . longer term follow - ups at 10 years have been reported in europe , demonstrating durability of lumbar arthroplasty . lemaire et al reported on 100 charite patients with minimum 10 year follow - up . clinically , 62% had an excellent outcome , 28% had a good outcome , and only 10% had a poor outcome . these outcomes compare favorably with results described in the literature for fusion for lumbar ddd . david et al reported on 106 charite patients with mean follow - up of 13.2 years . clinical outcomes and the rate of return to work were excellent overall . the rate of adjacent level disease requiring operation ( 2.8% ) compared very favorably with rates of up to 30% in patients treated with fusion . in a more recent publication , zigler et al reported the results of the 5 year follow up of the prodisc - l study . of the 236 original cohort of patients , 82% were available for follow up at a minimum of 5 years post - op . although both groups demonstrated significant improvements in odi compared to pre op values , the percentage of patients indicating they would have the surgery again was higher in the prodisc - l group compared to the fusion group ( 82% vs. 68% ) . in addition , the re - operation at the index level was lower for the prodisc group versus the fusion group ( 8% vs. 12% ) . the authors concluded that although fusion and disc replacement are reasonable alternatives for well selected patients , patients undergoing lumbar disc replacement have higher patient satisfaction and avoid the segmental stiffness associated with fusion . as a companion article zigler et al also reported on radiographic adjacent level degeneration as measured by independent radiologic analysis . comparison of adjacent levels preoperatively and 5 years after surgery demonstrated a threefold increase in adjacent level degeneration in patients who randomized to single level 360 fusion over those who randomized to a prodisc - l implant . reoperation rates at the adjacent level were twice as high in the post - fusion patients at 5 years . although only prodisc - l is currently fda approved in the us for commercial use in the lumbar spine , there are several prospective studies published on the clinical and radiographic outcomes of other lumbar arthroplasty implants in the fda pipeline . several lumbar implants are used outside the us ( ous ) with thousands of patients implanted , but have not yet gone through an ide approval for sale in the us . gornet et al published results of the ide trial using the maverick metal on metal implant . the study was the largest prospective , randomized trial comparing lumbar tdr to alif with a metal cage and bmp . 577 patients were included in this study , including 405 in the tdr group and 172 in the alif group . the disc replacement group reported statistically superior outcomes ( p<0.05 ) at all post - operative evaluations in odi , back pain , and sf-36 . operative times and blood loss were higher in the maverick group , whereas device related adverse events were lower in the maverick group . the authors concluded that they had demonstrated statistical superiority of the maverick arthroplasty versus fusion on key clinical outcomes including improved physical function , reduced pain , and earlier return to work . metal on metal arthroplasty devices are under intense scrutiny by the fda as well as by the surgeon community . new mom designs are likely to face an even more strenuous regulatory path in the future . the study included prospective data from 2 sites in a multicenter trial comparing lumbar tdr with the flexicore implant versus circumferential fusion . operative time , blood loss , and hospital stay were statistically significantly lower in the flexicore group . the authors concluded that the flexicore compared very favorably to circumferential fusion for the treatment of lumbar ddd unresponsive to conservative treatment . in addition to us studies regarding patients enrolled in ide trials , there are several published european studies comparing lumbar tdr to fusion . skold et al reported results of a prospective randomized studies comparing lumbar tdr to fusion . of the 152 patients included in this study , 80 were randomized to tdr while 72 were assigned to the fusion group . 99% of the patients were available for follow up at 5 years post - op . at follow up the percentage of patients who were totally pain - free was significantly higher in the tdr group versus the fusion group ( 38% vs 15% ; p<0.003 ) . the authors also reported better improvement in vas and odi in the lumbar tdr group , with no difference in complications or reoperations . although not a randomized study , siepe et al reported their prospective outcomes 5 to 10 years after lumbar tdr with the prodisc - l implant . the authors reported significant improvements in vas and odi at all postoperative follow up stages ( p<0.0001 ) , and concluded that their results demonstrated satisfactory and maintained mid- to long - term clinical results after a mean follow - up of 7.4 years . the authors stated that the fears of excessive late complications or reoperations following tdr procedures can not be substantiated with the present data . science in general , and particularly clinical medicine , has evolved from anecdotal and retrospective investigations to more objective , rigorous , and prospective scientific investigation . in the face of strong level i prospective randomized multicenter studies with long - term follow - up , it is inexcusable that treatment guidelines be directed by personal opinions and business - based decisions . treatment guidelines should be based on these tested and proven therapeutic algorithms . our interpretation and understanding of the efficacy and safety of clinical interventions can only be dictated by well - established evidenced based guidelines . one of the best values of these multiple ide studies has been to identify the patients who would predictably benefit from lumbar arthroplasty . ide study inclusion and exclusion criteria should provide an easy avenue for insurance payors to define the patients they can approve for lumbar disc replacement , since the outcomes for these patients should be predictable . based on a thorough review of the best available evidence - based scientific literature the international society for the advancement of spine surgery concludes that lumbar tdr is not new , experimental , or investigational . it is a well - tested technology which should predictably lead to better outcomes and less complications than fusion surgery , as well as a protective effect on adjacent levels . there is sufficient evidence - based scientific evidence to support the safety and efficacy of single level lumbar tdr for patients meeting well established selection criteria . isass would support patient authorization guidelines that mirror the selection criteria from the ide studies , as long as the device is implanted by a trained experienced spine surgeon . there are now several long - term prospective and retrospective studies available on lumbar tdr which provide objective evidence regarding their safety and effectiveness . data from prospective randomized clinical trials have reported consistently low rates of re - operations , and extremely low levels of particulate wear debris complications . based on sound analysis of the scientific literature , the international society for the advancement of spine surgery recommends universal coverage for single level lumbar tdr in patients meeting the established selection criteria . rolando garcia receives royalties and consulting fees from aesculap . additional literature on lumbar total disc replacement

tea is the second most popular beverage after water which represents a major source of dietary polyphenols . thus the scientific community is interested in exploring the health - promoting constituents present in tea , namely , flavan-3-ols , flavonols , and their derivatives . recent epidemiological studies have demonstrated a protective effect of fruits and vegetables against the incidence of degenerative diseases . several classes of compounds have been assumed as potential protective factors , one of which is the flavonoids , generally considered as nonnutritive agents . flavonoids are known as secondary metabolites which are the largest class of polyphenols widely distributed in the plant kingdom . it can be subdivided into six major subclasses based on the structural variations : flavones , flavanones , isoflavones , flavonols , flavanols , and anthocyanidins . according to the study conducted by hollman et al . flavonols have recently received much attention due to their antioxidant , antimicrobial , anticancer , antiatherosclerotic , and antiproliferative properties [ 68 ] . the flavonols exist in tea plant ( camellia sinensis l. ) as flavonol glycosides with a sugar residue and the most common flavonol aglycones in tea are quercetin , kaempferol , and myricetin . ceylon tea from sri lanka , acclaimed as the best tea in the world , has its inherent unique characteristics and reputation running over more than a century . the objectives of this study were to investigate the variation in flavonol aglycones , namely , quercetin , kaempferol , and myricetin in tea ( camellia sinensis l. ) accessions including beverage and nonbeverage types . therefore , we report here the first systematic study on the flavonol content in representative accessions of the sri lankan tea germplasm . 50 g of tender tea shoots ( two apical leaves and the bud ) of 87 beverage type and 6 nonbeverage type germplasm accessions was collected in triplicate from the ex situ field gene bank of tea research institute of sri lanka ( tri ) , talawakelle ( latitude 654n , longitude 8042e ) , and brought to the laboratory at 4c . selection criteria for germplasm accessions in this study included the attributes such as morphological variations , origins , made tea quality , and sensitivity to biotic stresses [ 1113 ] . the tea samples were immediately stored in a 80c freezer for 6 h to two weeks and freeze - dried for 24 h ( labconco corporation , ms , usa ) . the freeze - dried leaves were ground to a fine powder ( passed through 500 m mesh ) , sealed in triple laminated aluminium foil packages , and stored at 20c until biochemical analysis . 100 mg of freeze - dried tea sample was hydrolysed in duplicate with 0.5 ml of 6 m hcl and 4.5 ml of 60% methanol for 2 h in a water bath preheated to 95c . hydrolysed sample extracts were topped up to 5 ml with 60% methanol and filtered through 0.45 m nylon filters into hplc vials . analysis of individual flavonols was carried out in the agilent 1260 infinity hplc system comprising of solvent delivery system , quaternary pump , temperature - controlled column oven , autosampler , degasser unit and a photodiode array detector with uv detection at 370 nm , and open lab / chemstation software system . the compounds were separated on a 4.6 250 mm , 5 m particle , and reversed phase zorbax eclipse plus c 18 column ( agilent , usa ) ( phenomenex inc . , usa ) with a guard column made of the same material ( security - guard , phenomenex inc . , usa ) at 30c . 30% hplc grade acetonitrile in 0.025 m potassium dihydrogen orthophosphate buffer solution adjusted to a ph of 2.5 with 6 m hcl was used as mobile phase at a flow rate of 1.0 ml / min . quantification was carried out from the integrated peak areas of the sample against the corresponding standard graph and results were expressed on dry matter basis ( figures 1(a ) and 1(b ) ) . the dry matter contents of the freeze - dried leaves were determined in accordance with iso1573:1980 . experimental data were analysed using sas system for windows v 9.1 ( sas institute inc . absolute methanol ( analytical reagent grade ) , anhydrous sodium carbonate , and acetonitrile ( hplc gradient grade ) were supplied by fisher scientific uk ; quercetin , kaempferol , and myricetin were purchased from sigma chemicals ; and potassium dihydrogen orthophosphate and hydrochloric acid ( analytical grade ) were purchased from british drug house ltd . , england . the major flavonols present in tea leaves make up 2 - 3% of the water - soluble solids in tea [ 15 , 16 ] . table 1 shows the amounts of myricetin , quercetin , and kaempferol quantified in the beverage and nonbeverage type accessions of the sri lankan tea germplasm . these results are agreeable to a greater extend with the results reported for 3 commercial samples of green tea and 30 commercial samples of black tea and those reported for 4 commercial samples of green tea and 2 commercial samples of black tea . according to the mean values of flavonols , quercetin ( 1.50 mg g ) is abundantly present in the beverage type accessions of the sri lankan tea germplasm followed by kaempferol ( 1.31 mg g ) and myricetin ( 0.94 mg g ) . the mean value of total flavonols in 89 beverage type c. sinensis was 3.75 mg g. among beverage type accessions , the highest quercetin contents were reported in the exotic accessions : pbgt41 ( 3.23 mg g ) , followed by pbgt73 , china , pbgt70 , and pbgt12 whereas tri1114 showed the lowest content ( 0.36 mg g ) . the highest kaempferol contents were observed in the exotic accessions pbgt61 ( 2.21 mg g ) followed by pbgt68 , pbgt48 , pbgt49 , and pbgt70 . among the 9 exotic accessions examined , pbgt41 reported the highest myricetin content ( 1.63 mg g ) followed by pbgt49 , pbgt68 , pbgt70 , and pbgt61 and intri6 recorded the lowest content ( 0.33 mg g ) . conversely , myricetin was available in trace amounts recorded in the nonbeverage type accessions except camellia sasanqua ( 0.37 mg g ) and camellia rosaflora ( 0.20 mg g ) . camellia rosaflora has reported the highest quercetin content ( 3.44 mg g ) when considering the entire germplasm , which is higher than that of the beverage type exotic cultivar pbgt41 . the specific patterns of flavonol occurrence in plant species vary based on their synthesis and distribution in the plant organism . in addition to intrinsic factors , flavonol content is strongly influenced by extrinsic factors such as variations in plant type and growth , season , climate , degree of maturity , preparation , and processing [ 2024 ] . several studies report varying content of flavonol in teas [ 1 , 25 , 26 ] . this is possibly due to the difference in tea samples used ( fresh tea leaves or processed tea ) and analytical methods utilized , resulting in different extraction efficiencies . according to finger et al . , flavonol glycosides are not affected by polyphenol oxidase and varying content in different tea types can be due to difference in tea varieties , geographic location , or agricultural conditions . the increasing knowledge on functional ingredients in food provides new opportunities for plant sciences to produce crops with higher amounts of selected health - promoting phytochemicals using crop husbandry techniques , plant breeding techniques , and genetic engineering . recent studies suggest that higher intakes of flavonoids from food are associated with reduced risk of degenerative diseases including cancer and heart disease [ 29 , 30 ] . the three flavonols , that is , myricetin , quercetin , and kaempferol , quantified in this study have also been extensively investigated for their health benefits . flavonols naturally occur as either glycosides ( with attached glycosyl groups ) or aglycones . however , dietary intake of the above flavonols is mainly in the glycoside form . during digestion and absorption sugar moieties digestive tract microbiota could also assist in the digestion and the absorption process of the flavonols . following absorption several organs contribute to flavonol metabolism including the liver , giving rise to glucuronidated , methylated , and sulfated forms of flavonols which are found in the plasma . . several mechanisms of actions such as antioxidant activity , anti - inflammatory activity , and modulation of signaling pathways are responsible for the beneficial effects of flavonols . ability of hydrogen radical donation from the phenolic group and the presence of an unpaired electron in the aromatic ring make the flavonols strong antioxidants in vivo , thus scavenging the reactive oxygen species and other free radicals . ability to chelate metal ions also reduces the production of harmful oxidant species in vivo . flavonols could contribute to the antioxidant properties through the protection or improvement of endogenous antioxidants especially by stimulating glutathione - s - transferase ( gst ) , an enzyme that protects cells from the damage caused by free radicals . the inflammatory response is part of the innate immune response which triggers the inflammatory cascade forming inflammatory mediators such as prostaglandin and thromboxane . although acute inflammation is essential in dealing with invading pathogens and injury , chronic inflammation can cause tissue destruction and is involved in the pathogenesis of degenerative diseases . commercially available anti - inflammatory drugs are used to prevent the formation of prostaglandins and thromboxanes by inhibiting the cyclooxygenase ( cox ) enzymes involved in the production of the above during inflammation . flavonoids can suppress the expression of the cox gene through interactions with cell signaling pathways , such as the protein kinase c , nf-b , and tyrosine kinase pathways . it has been reported that flavonols including myricetin , quercetin , and kaempferol could play an important role in reducing the risk of cardiovascular disease , cancer , and neurodegradative and other degenerative diseases through the above - mentioned mechanisms and several other mechanisms . several epidemiological studies also have found the beneficial effects of flavonols [ 36 , 37 ] . therefore , it could be argued that dietary items high in flavonols could be beneficial to human health . although flavonol glycosides can be important contributors to black tea flavour , these were hydrolysed by acid treatment to afford myricetin , quercetin , and kaempferol for hplc analysis due to the fact that the dietary forms of flavonol glycosides are initially hydrolysed to aglycones at the oral cavity [ 3942 ] and continued in the digestive tract [ 5 , 43 ] . even during the fermentation processes however the chemical form of flavonol prior to and after digestion is of great importance in determining the bioavailability and bioactivity . in a single plant very large number of individual glycosides may result based on the type and number of sugar residues , together with chain branching . this means that both the biosynthesis of the different aglycones and their conjugation with different sugars are controlled by the genotype . another comprehensive survey of flavonol content in 100 vegetables and fruits grown in china reported that quercetin was widely distributed in edible plants species . explored the bioavailability of quercetin from red wine , yellow onions , and black tea and came to the conclusion that tea is a rich source of flavonols . quercetin and kaempferol rhamnodiglucosides are characteristic compounds of camellia sinensis . according to finger et al . , black tea contains 00.95 mg g quercetin rhamnodiglucoside and 0.051.25 mg g kaempferol rhamnodiglucoside . however myricetin and kaempferol were also detected in many foods including tea [ 1 , 46 , 48 , 49 ] . based on the records available , less than 6% of the total accessions preserved in sri lankan tea germplasm have been utilized in the tea breeding programmes till 1998 , and utilization of tea accessions has increased up to 13.6% by the end of 2009 . the lack of information regarding the genetic variation , mainly biochemical and molecular diversity of the existing population , could be one reason for underutilization of the germplasm . according to present study , the lowest mean value of kaempferol content is observed for assam introductions ( figures 2(a)2(d ) ) . the ranges and mean values of quercetin and myricetin for full - sib and half - sib families are much similar to the assam introductions . therefore , it is indicated that the tri developed accessions have direct or indirect relationship with assam introductions . among the selected accessions , all exotic accessions recorded higher contents of quercetin than rest . besides , the highest mean values of total flavonol contents were reported for exotic accessions . these results revealed that those exotic accessions are having different geographic origin than other accessions present in germplasm in sri lanka . lasiocalyx followed by assamica and sinensis varieties . around 83% of the introductions acquired prior to the 1960s , mainly from india and indo - china , exhibit predominant cambod type ( ssp . lasiocalyx ) characters and introductions made in 21st century from korea reminiscent of more affinity to china type ( var . therefore , flavonols and their glycosides can be useful to chemotaxonomic studies of tea germplasm . as evident from the present work , the 9 exotic accessions with different geographic origin selected for this study along with the nonbeverage type accessions , especially camellia rosaflora and camellia japonica red , are worthwhile and thus merit focus in future germplasm studies . the contents of myricetin and myricetin glycosides are less in black tea ; unlikely , in fresh tea , they flush since they can still be affected by tea processing . myricetin and myricetin glycosides are the most likely of the three flavonols to be oxidised . however therefore it is crucial to focus on myricetin while discussing the flavonol content of tea . significant amounts of myricetin , quercetin , and kaempferol have been quantified in the beverage type tea accessions of the sri lankan tea germplasm . the var . lasiocalyx ; therefore flavonols and their glycosides can be useful to chemotaxonomic studies of tea germplasm . the nonbeverage type cultivars , especially camellia rosaflora and camellia japonica red along with the exotic accessions resembling china type , are worthwhile in future germplasm studies because they are rich sources of flavonols , namely , quercetin and kaempferol , which are potent antioxidants and health - promoting aspects . additionally , the flavonol profiles can be effectively used in choosing accessions in tea breeding programmes to generate progenies with wide variations .

secundum atrial septal defect ( asd ) is one of the most common forms of congenital heart disease ( chd ) in adults . with advancing years , patients become symptomatic and may develop pulmonary arterial hypertension ( pah ) . surgical and transcatheter closures of asd are widely accepted treatments . in patients with severe pah , however , closure presents the risk of provoking right ventricular failure and pulmonary hypertensive crisis . targeted medical therapies have been established for the treatment of pah associated with chd , and they can potentially modify the indication of asd closure in patients with severe pah . we report two cases of patients with secundum asd and severe pah successfully treated with surgical and transcatheter closures subsequent to effective combination medical therapy . a 31-year - old woman was referred to our hospital because of exertional dyspnea and syncope . she had felt exertional dyspnea about 2 years ago . the world health organization ( who ) functional class was iii on admission . echocardiography revealed right ventricular dilatation and hypertrophy with secundum asd ( 15 mm in diameter ) with left - to - right shunt . right heart catheterization ( rhc ) showed elevated pulmonary artery pressure ( pap ) and pulmonary vascular resistance ( pvr ) of 87/30 mmhg ( mean 57 mmhg ) and 697 dyn s / cm , respectively . we started supplemental oxygen therapy and medical therapy with bosentan ( 250 mg / day ) and sildenafil ( 60 mg / day ) . two months later , rhc revealed the improvement of pap and pvr , 60/21 mmhg ( mean 35 mmhg ) and 291 dyn s / cm . although medical therapy was effective , the qp / qs ratio increased to 2.19 and moderate dyspnea remained . we thought that continuation of medical therapy might further reduce pap and pvr , but subsequently increase shunt flow , which would insult the pulmonary circulation . therefore , we performed transcatheter closure 5 months after the initiation of medical therapy . after repair , symptoms had improved to who functional class i without oxygen administration , and the chest x - ray and echocardiography demonstrated the improvement of right ventricular overload ( fig . 1 ) . rhc performed 6 months after closure revealed that pap was 29/15 mmhg ( mean 22 mmhg ) and pvr 197 dyn s / cm.fig . case 1 ( a d ) and case 2 ( e h ) . cardiomegaly and ventricular overload were dramatically improved after closure ( b , d , f , h ) compared with those on admission ( a , c , e , g ) chest x - ray and trans - thoracic echocardiogram . case 1 ( a d ) and case 2 ( e h ) . cardiomegaly and ventricular overload were dramatically improved after closure ( b , d , f , h ) compared with those on admission ( a , c , e , g ) a 47-year - old man was admitted to our hospital because of leg edema and exertional dyspnea . he was diagnosed with asd in childhood , but felt no symptom until 3 years ago . who functional class was iii on admission . echocardiography revealed right ventricular dilatation , hypertrophy and pericardial effusion with large secundum asd ( 36 mm in diameter ) with left - to - right shunt . rhc showed pap of 93/29 mmhg ( mean 60 mmhg ) , pvr of 539 dyn s / cm and qp / qs ratio of 1.51 . we started supplemental oxygen therapy and medical therapy with bosentan ( 250 mg / day ) , tadarafil ( 40 mg / day ) and beraprost ( 60 g / day ) . pap and pvr decreased to 58/28 mmhg ( mean 39 mmhg ) and 109 dyn s / cm , respectively , while the qp / qs ratio consequently increased to 3.55 . we continued medical therapy with bosentan ( 250 mg / day ) , tadarafil ( 40 mg / day ) and beraprost ( 60 g / day ) after closure . the symptoms had improved to who functional class i without oxygen administration . the chest x - ray and echocardiography showed the improvement of the right ventricular overload ( fig . 1 ) . rhc revealed a pap of 29/21 mmhg ( mean 24 mmhg ) , pvr of 190 dyn s / cm and qp / qs ratio of 1.07 . . there are few studies reporting the efficacy and safety of the closure in patients with severe pah , and the benefit of closure remains controversial . steele et al . have shown that high pvr is associated with poor prognosis in surgically treated patients . hindi et al . have suggested that severe pah manifested as qp / qs < 0.7 and pvr > 7 woods units are contraindications for transcatheter closure . in these situations , pulmonary vascular disease is thought to be irreversible , and closure of the defect might induce right ventricular failure and pulmonary hypertensive crisis . in pah associated with chd , targeted medical therapy has been standardized and may induce reverse remodeling of pulmonary arteriopathy . based on these characteristics , medical therapy may have the potential to modify the operability of asd . the so - called treat - and - repair approach , which implements medical therapy ahead of surgical repair , has been discussed . because of the severity of symptoms , particularly the high pap and pvr , we first considered our patients inoperable and gave priority to medical therapy . with initial combination therapy given the increased qp / qs ratio , additional vasodilators could have induced a further increase in left - to - right shunt and pap , which would have led to progression of pulmonary arteriopathy . since the reduction of pvr was rapid , we assumed a strong vasoreactivity of pulmonary arteries . we thus considered the patients operable and decided to close the defects to further reduce pap . several case reports also mentioned the efficacy of treat - and - repair approaches [ 6 , 7 ] . in contrast to these previous studies , we undertook repair after a short - term effective combination medical therapy ( 25 months ) . if pulmonary vascular reactivity is preserved , medical therapy will decrease pvr , which may increase pulmonary flow through the defect and insult the pulmonary vasculature . therefore , in case of preserved pulmonary vasoreactivity , early closure of the defect may be safe and prevent further pulmonary vascular remodeling . although eisenmenger syndrome shares pathological manifestations with idiopathic pah ( ipah ) , the prognosis is known to be better than that of ipah . as a reason for this , a right - to - left shunt might act as a relief valve for the right ventricle . these observations argue against the operability of asd patients with severe pah because the closure may worsen the prognosis . in case 1 , the small size of the defect may indicate that the patient suffered from ipah with an incidental asd . nevertheless , the asd could be closed successfully , and normal pap levels were achieved , which may have hindered the progression of pulmonary vascular disease . based on our cases and previous reports [ 6 , 7 , 9 ] , consistent left - to - right shunt and preserved vasoreactivity should be considered prerequisites for safe and effective repair of asd in pah patients . we presented two cases of successful treatment for asd and severe pah with short - term powerful combination medical therapy ahead of the closure . even though this approach can not be generalized , subsequent shunt closure after medical therapy should be considered effective in selected patients with asd and severe pah .

written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

according to world health organization ( who ) data , there were 9 million new cases of tuberculosis ( tb ) globally in 2007 , and china had the world s second - largest tuberculosis epidemic , with 1.3 million new cases in the same year , accounting for 14% of the overall global incidence . central nervous system ( cns ) disease , which accounts for approximately 1% of all active tuberculosis ( tb ) cases , is one of the most devastating clinical manifestations of tuberculosis ( tb ) . according to british infection society guidelines , the brain of every patient with tb should be imaged with contrast - enhanced ct . early brain ct can help diagnose tb and provides important baseline information , particularly when considering surgical interventions for hydrocephalus . currently , much faster scanning speed is an advantage of multi - slice spiral computed tomography ( msct ) . however , for intracranial lesions , especially the relatively small blood supply granulation tissues within tb lesions , it has been unclear which scan timing window is optimal for intracranial tb lesions immediate scan or delayed scan . to solve this problem , dual - phase msct scanning was done in a group of patients with intracranial tb to discover the optimal scan timing window for displaying intracranial tb . we also hoped this finding could be used as supportive evidence for standardized procedures of intracranial tb ct scanning . this study was approved by the ethics committee of shandong chest hospital , and written informed consent was obtained from each patient before ct scanning . we enrolled 30 patients , including 19 males and 11 females , ages 1058 years ( mean age=29.3 years ) who were clinically diagnosed with intracranial tb between january 2008 and november 2011 . all patients had the most common clinical manifestations such as headache , fever , vomiting , and nausea and all met the clinical diagnosis criteria for intracranial tb : i ) clinical manifestations of fever and headache ( more than 14 days ) , vomiting , perceptual transformation , and dissociated sensory loss ; ii ) , cerebrospinal fluid ( csf ) examination showing increased csf lymphocytes ( higher than 2010/l , lymphocytes > 60% ) , elevated protein level ( higher than 100 mg / dl ) , and lowered glucose ( csf glucose < 60% of blood glucose level ) , negative results for both india ink stain test and microscopic test on cancerous cells ; iii ) , x - ray computed tomography findings showing exudates in both brain basal cistern and cistern of lateral sulcus , infarcts in basal ganglia region , gyriform enhancement , and formation of tuberculoma ; and iv ) evidence of tuberculosis involvement of other organs , such as positive ppd test . cranial computerized tomography ( ct ) was performed in all 30 patients , including pre- and dual - phase post - contrast ct scans . according to the location and the morphologies , the intracranial lesions were divided into 3 groups : 1 ) the meningeal thickening group ( thickening involved in various meninges , such as basal cistern meninges , pia mater , and ependyma ) , 2 ) the meningeal tuberculoma group ( including meningeal tubercle ) , and 3 ) the parenchymal tuberculoma group ( including parenchymal tubercle ) . tuberculous encephalitis , tuberculous vasculitis , and tuberculous brain abscess were excluded from the present study . the inclusion criteria were : 1 ) the meningeal thickening type : cord - like or spindle - shaped abnormally enhanced lesions on basal cistern meninges , pia mater , and ependyma ; 2 ) the meningeal tuberculoma type ( including meningeal tubercle ) : oval or round enhanced nodular lesions on basal cistern meninges , pia mater , and ependyma , with unenhanced center / invisible enhanced center ; in case of clustered distribution , the countable number of nodules was taken ; and 3 ) the parenchymal tuberculoma type ( including parenchymal tubercle ) : oval or round nodular lesions in parenchyma , may have unenhanced center . msct of the head was performed using a ge lightspeed 16-slice ct scanner ( msf medical equipment & service ltd . scan range was from the om line to the parietal lobe of the brain , with a section thickness of 5 mm and a layer spacing of 5 mm . the contrast agent iohexol ( 350 mg / ml ) was injected intravenously with a dose of 1.2 ml / kg ( patient body weight ) and a speed of 2.5 ml / sec . dual - phase acquisition was performed immediately after and 5 min after contrast agent injection . the marks of contrast phases on all images obtained were erased , then images were analyzed by 2 professional radiologists according to the following scoring method : for the size of isolated lesion , larger at the delayed phase ( dp ) than the immediate phase ( ip ) : dp scored 2 , and ip scored 0 ; larger at ip than dp : dp scored 0 , and ip scored 2 , equal on the both phase images : both phases scored 1 ; for the marginal definitions , more clearly at dp than ip : the dp scored 2 , and ip scored 0 ; more clearly at ip than dp : the dp scored 0 , and the ip scored 2 ; same on the 2 phase images : both phases scored 1 ; and quantitative analysis of the ability to distinguish the isolated lesion from the vascular section : tightly associated or indistinguishable : scored 1 , otherwise ( easily distinguishable ) , scored 2 . the ability of the 2 enhanced phases in displaying the lesion were compared , including the size , the margins , ct value change of the substantial part , and ability to distinguish the lesion and peripheral vasculature . statistical analysis was performed using the spss 13.0 statistical package ( spss , chicago , il , usa ) . the quantitative data acquired was conducted by the normality test method , and was approximately normally distributed ( p>0.05 ) , thus the t - test was used . this study was approved by the ethics committee of shandong chest hospital , and written informed consent was obtained from each patient before ct scanning . we enrolled 30 patients , including 19 males and 11 females , ages 1058 years ( mean age=29.3 years ) who were clinically diagnosed with intracranial tb between january 2008 and november 2011 . all patients had the most common clinical manifestations such as headache , fever , vomiting , and nausea and all met the clinical diagnosis criteria for intracranial tb : i ) clinical manifestations of fever and headache ( more than 14 days ) , vomiting , perceptual transformation , and dissociated sensory loss ; ii ) , cerebrospinal fluid ( csf ) examination showing increased csf lymphocytes ( higher than 2010/l , lymphocytes > 60% ) , elevated protein level ( higher than 100 mg / dl ) , and lowered glucose ( csf glucose < 60% of blood glucose level ) , negative results for both india ink stain test and microscopic test on cancerous cells ; iii ) , x - ray computed tomography findings showing exudates in both brain basal cistern and cistern of lateral sulcus , infarcts in basal ganglia region , gyriform enhancement , and formation of tuberculoma ; and iv ) evidence of tuberculosis involvement of other organs , such as positive ppd test . cranial computerized tomography ( ct ) was performed in all 30 patients , including pre- and dual - phase post - contrast ct scans . according to the location and the morphologies , the intracranial lesions were divided into 3 groups : 1 ) the meningeal thickening group ( thickening involved in various meninges , such as basal cistern meninges , pia mater , and ependyma ) , 2 ) the meningeal tuberculoma group ( including meningeal tubercle ) , and 3 ) the parenchymal tuberculoma group ( including parenchymal tubercle ) . tuberculous encephalitis , tuberculous vasculitis , and tuberculous brain abscess were excluded from the present study . the inclusion criteria were : 1 ) the meningeal thickening type : cord - like or spindle - shaped abnormally enhanced lesions on basal cistern meninges , pia mater , and ependyma ; 2 ) the meningeal tuberculoma type ( including meningeal tubercle ) : oval or round enhanced nodular lesions on basal cistern meninges , pia mater , and ependyma , with unenhanced center / invisible enhanced center ; in case of clustered distribution , the countable number of nodules was taken ; and 3 ) the parenchymal tuberculoma type ( including parenchymal tubercle ) : oval or round nodular lesions in parenchyma , may have unenhanced center . msct of the head was performed using a ge lightspeed 16-slice ct scanner ( msf medical equipment & service ltd . , scan range was from the om line to the parietal lobe of the brain , with a section thickness of 5 mm and a layer spacing of 5 mm . the contrast agent iohexol ( 350 mg / ml ) was injected intravenously with a dose of 1.2 ml / kg ( patient body weight ) and a speed of 2.5 ml / sec . dual - phase acquisition was performed immediately after and 5 min after contrast agent injection . the marks of contrast phases on all images obtained were erased , then images were analyzed by 2 professional radiologists according to the following scoring method : for the size of isolated lesion , larger at the delayed phase ( dp ) than the immediate phase ( ip ) : dp scored 2 , and ip scored 0 ; larger at ip than dp : dp scored 0 , and ip scored 2 , equal on the both phase images : both phases scored 1 ; for the marginal definitions , more clearly at dp than ip : the dp scored 2 , and ip scored 0 ; more clearly at ip than dp : the dp scored 0 , and the ip scored 2 ; same on the 2 phase images : both phases scored 1 ; and quantitative analysis of the ability to distinguish the isolated lesion from the vascular section : tightly associated or indistinguishable : scored 1 , otherwise ( easily distinguishable ) , scored 2 . the ability of the 2 enhanced phases in displaying the lesion were compared , including the size , the margins , ct value change of the substantial part , and ability to distinguish the lesion and peripheral vasculature . statistical analysis was performed using the spss 13.0 statistical package ( spss , chicago , il , usa ) . the quantitative data acquired was conducted by the normality test method , and was approximately normally distributed ( p>0.05 ) , thus the t - test was used . in 30 patients with intracranial tuberculosis , a total of 526 lesions were eligible to be included . of these lesions , 22 were meningeal thickening type , 235 were meningeal tuberculoma / tubercle type , and 269 were parenchymal tuberculoma / tubercle type . for tuberculous - meningitis - induced meningeal thickening , the images obtained from 5-min delayed scan were more superior to those obtained from the immediate phase in terms of both lesion size displaying and margin outlining , regardless of the location of involvement ( basal cistern meninges , pia mater , or ependyma ) ( p<0.01 ) . with respect to intracranial tuberculoma , regardless of location affected ( basal cistern meninges , pia mater , or ependymal ) , the images obtained from 5-min delayed scan were superior to those obtained from the first phase in terms of both lesion size and margin displaying ( p<0.01 ) ( table 1 ) . for distinguishing vascular sections from the cerebral sulcus and the tubercle , the images obtained from 5-min delayed scan had much better performance than these obtained from the immediate phase scan ( p<0.01 ) ( table 2 ) . in 30 patients with intracranial tuberculosis , a total of 526 lesions were eligible to be included . of these lesions , 22 were meningeal thickening type , 235 were meningeal tuberculoma / tubercle type , and 269 were parenchymal tuberculoma / tubercle type . for tuberculous - meningitis - induced meningeal thickening , the images obtained from 5-min delayed scan were more superior to those obtained from the immediate phase in terms of both lesion size displaying and margin outlining , regardless of the location of involvement ( basal cistern meninges , pia mater , or ependyma ) ( p<0.01 ) . with respect to intracranial tuberculoma , regardless of location affected ( basal cistern meninges , pia mater , or ependymal ) , the images obtained from 5-min delayed scan were superior to those obtained from the first phase in terms of both lesion size and margin displaying ( p<0.01 ) ( table 1 ) . for distinguishing vascular sections from the cerebral sulcus and the tubercle , the images obtained from 5-min delayed scan had much better performance than these obtained from the immediate phase scan ( p<0.01 ) ( table 2 ) . one of the biggest advantages of multi - slice ct was the high temporal resolution , which contributed to sub - millimeter thickness acquisitions over large longitudinal coverage in a very short time . the technique was considered as a revolutionary advance in medical imaging , especially in high quality ct angiography . however , regardless of whether the sequence or the spiral scanning technique was used , the cranial scan could be completed within 12 s , thus the high temporal resolution may be only useful in cerebral vascular imaging or some intracranial lesions with rapid arterial blood supply . in fact , not all intracranial lesions had rapid arterial blood supply ( e.g. , intracranial tuberculosis lesions ) . based on our clinical experience , immediate msct scanning after contrast agent injection was unable to demonstrate the changes of intracranial tb lesions in morphology and density . in most case , it was even weaker than the earlier non - spiral ct in the ability to show lesions . in the earlier non - spiral ct scan practice , contrast agent injection was performed in the therapy room before the patient was ushered to the scanner table , thus there was no significant difference in delayed or immediate scan , while currently , there was usually only 30 s to 1 min elapsed from the contrast injection to msct scanning . nonetheless , a study on the preference of delayed scan in msct scanning has never been reported . aiming to solve this problem , subsequently , the lesion - revealing performance of both scans on various types of tb lesions was compared . the key point was to find out whether the delayed scan was superior in displaying intracranial tb lesions . according to the generally - accepted classification criteria , intracranial tuberculosis is be classified into 5 types : tuberculous meningitis , tuberculous encephalitis , tuberculous vasculitis , intracranial tuberculomas , and tuberculous brain abscess . in our study , only tuberculous meningitis and intracranial tuberculomas were studied , because enhanced ct scan was inappropriate for tuberculous encephalitis imaging , and displaying tuberculous vasculitis needs proper arterial phase scanning , and cases of tuberculous brain abscess are rarely seen . the first group was the tuberculous meningitis type , which commonly presents with diffuse , thick meningeal enhancement , and mainly involves the basal cistern meninges , pia mater , and ependyma . intracranial tuberculoma and tubercle , which only differ in size , were the second group . the parenchymal tuberculoma was the third type of tb lesion . in the present study , all these were well displayed on the 5-min delayed scan images , and were superior to those obtained on the immediate phase . in our practice , we also found that it was difficult to distinguish the vascular sections in the cerebral sulcus from the small tubercles on the pia mater , especially on the immediate phase . thus , we also did a comparison between the immediate phase and the delayed phase scanning to find a better phase for displaying pia mater tubercles . granulation tissue was the pathological basis of the meningitis - related meningeal thickening , regardless of which portion of meninges ( basal cistern meninges , pia mater or ependymal ) was affected . it was also components of the wall of tuberculoma and tubercle , usually with insufficient blood supply and slow circulation speed , which both lead to reduced penetration of contrast agent , and thus result in deteriorated enhancement . also , due to the slow circulation , the injected contrast agent tended to be accumulated in the granulation tissues , subsequently resulting in better enhancement at delayed time . however , there has been no report published to date on the best contrast time for intracranial lesions . as a matter of experience thus , in the present study , a 5-min delay was selected to obtain sufficient enhancement , and thus achieving better display of the lesion size and margin outlines . of course , it was confirmed in the present study that the images obtained at delayed scanning phase were superior in terms of both displaying lesion size and outlining meningeal thickening for all types ( figures 13 ) . in a future study , an animal cerebral perfusion scan would be carried out , and the time to peak ( ttp ) of intracranial disease would be studied comprehensively and in detail . in terms of sulcus vascular section and tubercle identification , after contrast enhancement , the vascular sulcus sections were highly enhanced at the immediate phase and were difficult to differentiate from the tubercle due to its smaller diameter . moreover , it was unable to display the central caseous necrosis tubercle region by using current ct spatial resolution . thus , although the tubercle lesions were enhanced , they were still difficult to differentiate from the vascular sections with similar diameter . using 5-min delay after contrast ejection , density of the vascular sections was reduced and enhancement of the tubercle was further improved , resulting in significant differences in density , which makes the vascular sections and pia mater tubercle easily distinguishable . results of the present study show that the 5-min delayed scan has more advantages in obtaining better - quality images than the immediate phase scan , in terms of displaying meningeal thickening and intracranial tuberculoma , as well as distinguishing sulcus vascular section from tubercle . however , since blood vessels are another major tissue affected by intracranial tuberculosis , with presentation of wall thickening and luminal narrowing ( stenosis ) , proper arterial phase maybe useful and should studied in further investigations . radiation dose may be the main weakness of this study . because this was a prospective study , and our purpose was to determine the optimal scan timing window for displaying intracranial tb , 3 scans were applied , but the mean total radiation of our study did not exceed the prescribed radiation dose . of course , through our study , we found that image acquisition with 5-min delay after contrast agent injection was superior in displaying intracranial tuberculosis . if this scanning mode were used in our routine work , the radiation dose would be greatly reduced . generally , mr imaging appears to be superior to ct in the detection and assessment of cns tuberculosis , especially for bottom pool lesions , abnormal meningeal enhancing , and cerebral infarction display , but ct can detect abnormal intracranial calcification and there is no statistically significant difference in intracranial lesion detection rate between the 2 methods . currently , not all specialized tb hospitals have mr , and some patients are not suitable for mr examination , thus ct examination is still indispensable . we therefore believe that research for the appropriate ct scanning mode is necessary and has great value in clinical applications . one of the biggest advantages of multi - slice ct was the high temporal resolution , which contributed to sub - millimeter thickness acquisitions over large longitudinal coverage in a very short time . the technique was considered as a revolutionary advance in medical imaging , especially in high quality ct angiography . however , regardless of whether the sequence or the spiral scanning technique was used , the cranial scan could be completed within 12 s , thus the high temporal resolution may be only useful in cerebral vascular imaging or some intracranial lesions with rapid arterial blood supply . in fact , not all intracranial lesions had rapid arterial blood supply ( e.g. , intracranial tuberculosis lesions ) . based on our clinical experience , immediate msct scanning after contrast agent injection was unable to demonstrate the changes of intracranial tb lesions in morphology and density . in most case , it was even weaker than the earlier non - spiral ct in the ability to show lesions . in the earlier non - spiral ct scan practice , contrast agent injection was performed in the therapy room before the patient was ushered to the scanner table , thus there was no significant difference in delayed or immediate scan , while currently , there was usually only 30 s to 1 min elapsed from the contrast injection to msct scanning . nonetheless , a study on the preference of delayed scan in msct scanning has never been reported . aiming to solve this problem , subsequently , the lesion - revealing performance of both scans on various types of tb lesions was compared . the key point was to find out whether the delayed scan was superior in displaying intracranial tb lesions . according to the generally - accepted classification criteria , intracranial tuberculosis is be classified into 5 types : tuberculous meningitis , tuberculous encephalitis , tuberculous vasculitis , intracranial tuberculomas , and tuberculous brain abscess . in our study , only tuberculous meningitis and intracranial tuberculomas were studied , because enhanced ct scan was inappropriate for tuberculous encephalitis imaging , and displaying tuberculous vasculitis needs proper arterial phase scanning , and cases of tuberculous brain abscess are rarely seen . the first group was the tuberculous meningitis type , which commonly presents with diffuse , thick meningeal enhancement , and mainly involves the basal cistern meninges , pia mater , and ependyma . intracranial tuberculoma and tubercle , which only differ in size , were the second group . the parenchymal tuberculoma was the third type of tb lesion . in the present study , all these were well displayed on the 5-min delayed scan images , and were superior to those obtained on the immediate phase . in our practice , we also found that it was difficult to distinguish the vascular sections in the cerebral sulcus from the small tubercles on the pia mater , especially on the immediate phase . thus , we also did a comparison between the immediate phase and the delayed phase scanning to find a better phase for displaying pia mater tubercles . granulation tissue was the pathological basis of the meningitis - related meningeal thickening , regardless of which portion of meninges ( basal cistern meninges , pia mater or ependymal ) was affected . it was also components of the wall of tuberculoma and tubercle , usually with insufficient blood supply and slow circulation speed , which both lead to reduced penetration of contrast agent , and thus result in deteriorated enhancement . also , due to the slow circulation , the injected contrast agent tended to be accumulated in the granulation tissues , subsequently resulting in better enhancement at delayed time . however , there has been no report published to date on the best contrast time for intracranial lesions . as a matter of experience , thus , in the present study , a 5-min delay was selected to obtain sufficient enhancement , and thus achieving better display of the lesion size and margin outlines . of course , it was confirmed in the present study that the images obtained at delayed scanning phase were superior in terms of both displaying lesion size and outlining meningeal thickening for all types ( figures 13 ) . in a future study , an animal cerebral perfusion scan would be carried out , and the time to peak ( ttp ) of intracranial disease would be studied comprehensively and in detail . in terms of sulcus vascular section and tubercle identification , the delayed scan has been shown to have prominent advantages ( figure 4 ) . after contrast enhancement , the vascular sulcus sections were highly enhanced at the immediate phase and were difficult to differentiate from the tubercle due to its smaller diameter . moreover , it was unable to display the central caseous necrosis tubercle region by using current ct spatial resolution . thus , although the tubercle lesions were enhanced , they were still difficult to differentiate from the vascular sections with similar diameter . using 5-min delay after contrast ejection , density of the vascular sections was reduced and enhancement of the tubercle was further improved , resulting in significant differences in density , which makes the vascular sections and pia mater tubercle easily distinguishable . results of the present study show that the 5-min delayed scan has more advantages in obtaining better - quality images than the immediate phase scan , in terms of displaying meningeal thickening and intracranial tuberculoma , as well as distinguishing sulcus vascular section from tubercle . however , since blood vessels are another major tissue affected by intracranial tuberculosis , with presentation of wall thickening and luminal narrowing ( stenosis ) , proper arterial phase maybe useful and should studied in further investigations . radiation dose may be the main weakness of this study . because this was a prospective study , and our purpose was to determine the optimal scan timing window for displaying intracranial tb , 3 scans were applied , but the mean total radiation of our study did not exceed the prescribed radiation dose . of course , through our study , we found that image acquisition with 5-min delay after contrast agent injection was superior in displaying intracranial tuberculosis . if this scanning mode were used in our routine work , the radiation dose would be greatly reduced . generally , mr imaging appears to be superior to ct in the detection and assessment of cns tuberculosis , especially for bottom pool lesions , abnormal meningeal enhancing , and cerebral infarction display , but ct can detect abnormal intracranial calcification and there is no statistically significant difference in intracranial lesion detection rate between the 2 methods . currently , not all specialized tb hospitals have mr , and some patients are not suitable for mr examination , thus ct examination is still indispensable . we therefore believe that research for the appropriate ct scanning mode is necessary and has great value in clinical applications . because intracranial tuberculosis remains a condition with high mortality and morbidity , timely and proper imaging is still essential for diagnosis . our study shows that delayed acquisition at 5-min after contrast agent injection can improve precision and accuracy for imaging evaluation and clinical diagnosis , and be the preferred scanning type .

sequencing ) , release and marketing of clinical sequencing tests , and development of tools to facilitate the interpretation of genetic results , signal the emergence of sequencing as a clinical tool . with the shift from bench to bedside underway , the necessity of developing an approach for the return of clinical genomic results has gained urgency . in their scope , scale , and uncertainty , the potential sets of results generated by sequencing represent a radical departure from the results patients expect to learn in clinical care . the clinical testing with which patients are familiar typically yields a single result or limited set of results , aimed at uncovering the etiology of an existing medical complaint . those undergoing sequencing generally lack clinical experiences that prepare them for the psychological impact of receiving unexpected results of varying medical significance and relating to one or more among a vast array of conditions . both genetic research participants and laypersons are eager to learn about sequencing results , especially those with potential clinical utility , suggesting a high response efficacy about plans for acting on those results . with the advent of clinical sequencing , healthcare providers will be increasingly responsible for consenting individuals to genomic sequencing aimed at uncovering disease - associated variant(s ) and revealing additional information . conveying unexpected , uncertain and abstruse results sufficiently that one can make an informed choice about learning results is challenging . to effectively meet this challenge , it will be important to understand the expected benefits and value . a focus group study of 89 individuals from the general public explored the issue of return of individual results from genetic research . participants strongly supported the return of results , citing among their chief reasons the potential clinical utility of results , a sense of ownership of their genetic information , and personal empowerment . it is important to extend this hypothetical investigation to actual research participants facing these choices . in a survey of research participants , we previously identified enthusiasm for learning all types of results ; however , this conveyed limited understanding of the underlying perceived value of the information . we have advanced this agenda by conducting a series of focus groups with clinseq participants to explore in - depth expectations of findings , positive and negative , and preferences for how results are returned . participants were recruited from the clinseq cohort for participation in focus groups conducted in bethesda , md . clinseq is a longitudinal study of individuals with a spectrum of atherosclerosis from unaffected to severe , most of whom have been evaluated by exome or genome sequencing . the bins were defined according to a 10-year risk of developing coronary artery disease ( cad ) : bin 1 , < 5% ; bin 2 , 510% ; bin 3 , > 10% ; bin 4 , known cad . to elicit an array of responses , focus group participants were selected for characteristics that may affect their responses or the group s responses : sex , health status , and prior receipt of a result . those who participated in a prior quantitative study were not eligible . participants for two groups ( 4 & 5 ) were selected randomly from a subset of the cohort who had not yet received genetic results and were in bin 1 . participants for three groups ( 1 , 3 , 6 ) were selected randomly from the subset who had not yet received genetic results and were in bin 4 . participants for one group ( 2 ) were selected randomly from participants who had received at least one genetic result from the study ( table 1 ) . we recruited focus group participants by applying eligibility filters to the cohort database , calling the participants according to the system , and enrolling them in order of response . a number of people were not reached by telephone and six declined participation citing scheduling conflicts or ill health . groups were held locally on and off the nih campus in conference rooms and each lasted about 90 minutes . responses on benefits and value noted by the moderator on an easel pad were also coded . a professional moderator , aided by one of the investigators , conducted a discussion about the benefits and value of sequencing in accordance with a discussion guide . the discussion guide was developed based on quantitative data from a sample of clinseq participants that informed the content we aimed to explore further . participants were asked about the types of information they expected to receive from sequencing , the ways in which this information might be valuable to them or their families , their preferences regarding the logistics of receiving genetic results , and how they intended to use their genetic information . perceptions of uncertainty were also assessed for a larger purpose , which will be reported separately . the discussion guide for group 2 was altered such that participants reflected the experiences of receiving results . the discussion guide for group 1 was revised and shortened for groups 36 reverting to broader questions on the same topics . focus group transcripts were generated from recordings and notes and coded in nvivo qsr 9.0 . focus groups 1 and 2 were coded and preliminary secondary and tertiary codes created independently . a total of 39 clinseq patients participated in six focus groups between march and may 2012 . participants ranged in age from 4769 and were largely white , college - educated , and had household incomes of > $ 100,000/yr ( see table 2 ) . focus group participants demographically represented the overall clinseq cohort except that there were more males ( 59% ) than in the cohort ( 49% ) . the responses by focus group participants comprised of individuals who had received a sequencing result did not differ from other focus groups . chief among their reasons was the belief that results will confer specific benefits to the participant , the participant s family , and society or the scientific enterprise at large . yet participants also expressed concerns about learning certain information and discriminated circumstances where they would not want to learn results . these findings suggest that attitudes toward sequencing results are not uniformly positive , nor were they necessarily fully considered as concerns evolved during the focus group discussions . our results offer new insights into the complexities of the variation in the type of health information that may be revealed by sequencing . on a personal level , participants expected that they would gain insights about their current or future health , and that they could use sequencing results to make lifestyle changes or institute preventive measures to extend life length or quality . group 4 participant : if you make those changes , i mean , depending on the information that comes from the study and what that is to the individual , you might live longer group 4 participant : planning . with your family or future . with your financial papers . making sure everything is up to date , so [ your family does nt ] get hit with a ton of things ; they have no idea what s out there . the more information i have , the better . group 4 participant : if you make those changes , i mean , depending on the information that comes from the study and what that is to the individual , you might live longer group 4 participant : planning . with your family or future . with your financial papers . making sure everything is up to date , so [ your family does nt ] get hit with a ton of things ; they have no idea what s out there . participants expected that their own results , if they chose to share them , could potentially benefit family members by alerting them to health risks . some participants also conveyed altruistic reasons for enrolling ; they believed that , independent of any personal benefit , their data would contribute to scientific progress and benefit others . group 5 participant : you learn what we possibly have and what we possibly would be passing on to our children and future generations . to make them aware of the fact that , i have this , you may have it , your children , so that somebody is aware of it . group 6 participant : population health : if they found a relationship between genes and a disease it could influence large - scale decision making . group 5 participant : you learn what we possibly have and what we possibly would be passing on to our children and future generations . to make them aware of the fact that , i have this , you may have it , your children , so that somebody is aware of it . , back then grandma had it. group 6 participant : population health : if they found a relationship between genes and a disease it could influence large - scale decision making . when asked to describe the value of receiving genetic sequencing results , as distinct from the benefits , participants frequently mentioned attaining an increased feeling of personal control , peace of mind , and the alleviation of fear . moderator recorded responses : minimize stress ; peace of mind ; more control , fewer surprises . i think that s a great value about what [ other group member ] has mentioned about how his daughter was reacting . group 6 participant : alleviate personal fears of going to the doctor . moderator recorded responses : minimize stress ; peace of mind ; more control , fewer surprises . i think that s a great value about what [ other group member ] has mentioned about how his daughter was reacting . they know what they have to do to prevent certain diseases in the future . the majority of participants anticipated choosing to learn genetic sequencing results that were described to them as clinically non - actionable , perceiving them to have value and potential benefits . they expressed intentions to use non - actionable results to make more informed future planning decisions . they suggested that the understanding of un - interpretable variants may evolve and eventually have more utility for themselves or their relatives . group 2 participant : all knowledge is beneficial , i think , and you never know what might come out of it something later in life . maybe it could be caused from that and something might have developed three years from now that says , yeah , that is the cause of , you know the doctor might say , oh yeah , i did read a report that that could be the cause of that . group 4 participant : [ a non - actionable result ] is something i really want to know about because that s a different life expectancy and a different plan for your life , very much . group 2 participant : all knowledge is beneficial , i think , and you never know what might come out of it something later in life . maybe it could be caused from that and something might have developed three years from now that says , yeah , that is the cause of , you know the doctor might say , oh yeah , i did read a report that that could be the cause of that . group 4 participant : [ a non - actionable result ] is something i really want to know about because that s a different life expectancy and a different plan for your life , very much . some participants acknowledged that while genetic information might be reassuring and empowering , it could also be a source of distress and/or fear . a few mentioned others who they thought would not want to learn genetic results ; some wondered about the moral implications of learning their own genetic results as it concerned an obligation to inform relatives . group 1 participant : now , you have a bias in the [ study ] population because all of these people want to know more . that s a , a kind of bias not the whole population wants to do that . group 5 participant : if my tests come out that i have a predisposition for huntington s , does my brother want to know ? i do have a half sister who, the team suggested that i contact her and let her know [ actionable test results ] . and it s just a little awkward because we are not , um , the only time i ve met her was at my father s funeral , so it s a little awkward and i havent figured out how to do it . group 1 participant : now , you have a bias in the [ study ] population because all of these people want to know more . that s a , a kind of bias not the whole population wants to do that . group 5 participant : if my tests come out that i have a predisposition for huntington s , does my brother want to know ? i do have a half sister who, the team suggested that i contact her and let her know [ actionable test results ] . and it s just a little awkward because we are not , um , the only time i ve met her was at my father s funeral , so it s a little awkward and i havent figured out how to do it . in contrast to the majority of participants who expressed a strong desire to know all available results , some individuals were opposed to or ambivalent about certain types of results , especially those having to do with diseases that were untreatable or that might have implications for their children s health . group 3 participant : if it had to do with the mortalities of my children and was absolutely not actionable , i would not want to know if there s nothing i can do about it , i would nt want to know . and we were saying that we were really a little on the fence about whether we would want to know something like that we wondered if knowing something that awful , because it was really awful for our dads and our families , we wondered if that would be a place where it would be harder to know than not to know . i m still not really sure if i want to know all that s out there . group 5 participant : i do nt want to know anything about anything that your information shows for conditions that i may have which are either incurable or untreatable . group 3 participant : if it had to do with the mortalities of my children and was absolutely not actionable , i would not want to know if there s nothing i can do about it , i would nt want to know . and we were saying that we were really a little on the fence about whether we would want to know something like that we wondered if knowing something that awful , because it was really awful for our dads and our families , we wondered if that would be a place where it would be harder to know than not to know . i m still not really sure if i want to know all that s out there . group 5 participant : i do nt want to know anything about anything that your information shows for conditions that i may have which are either incurable or untreatable . participants were asked how they intended to use or had used their results . many indicated that their results might motivate them to make lifestyle changes , especially diet - related , or to engage in planning activities , such as financial planning or changing life priorities . group 3 participant : if there was something i could do right now to live a healthier , better life , i would want to know . especially if it was something easy . group 6 participant : it might be an inspiration to do things you wished to do and put off doing , depending on what you find out travel or changing jobs perhaps , or pursuing some interest . group 2 participant : makes me feel guiltier if i do nt get to the gym [ laugh] maybe i should put it more positively . that it reinforces the need to do what i ve been trying to do . group 3 participant : if there was something i could do right now to live a healthier , better life , i would want to know . especially if it was something easy . group 6 participant : it might be an inspiration to do things you wished to do and put off doing , depending on what you find out travel or changing jobs perhaps , or pursuing some interest . group 2 participant : makes me feel guiltier if i do nt get to the gym [ laugh] maybe i should put it more positively . that it reinforces the need to do what i ve been trying to do . the intention to share genetic results with others , especially siblings , spouse , children , and physicians , was prevalent . sharing genetic information with family members was often viewed as part of future planning ; in addition to alerting a family member to their potential health risks , it could help the family to prepare , pragmatically and emotionally , for a potential health event . group 3 participant : one thing i thought about is if we have children that we would be able to let them know , if there s something they should be aware of before they might have children . especially if it s something that their spouse might also carry , so the risk to their grandchildren in this case would be i understood why people in my family have had this cholesterol issue it s actually useful group 3 participant : one thing i thought about is if we have children that we would be able to let them know , if there s something they should be aware of before they might have children . especially if it s something that their spouse might also carry , so the risk to their grandchildren in this case would be group 2 participant : i understood why people in my family have had this cholesterol issue it s actually useful many participants expressed an intention to integrate their genetic sequencing results with other health information resources , such as advice from their physicians or the internet , to help them understand the information , allay fears , and inform their healthcare management . moderator recorded response : alert one s doctor about things not known . i would probably go to doctors who could give me support in whatever way , or confirmation of the information . moderator recorded response : alert one s doctor about things not known . i would probably go to doctors who could give me support in whatever way , or confirmation of the information . the moderator posited that a participant might be invited to the nih for each result , necessitating multiple trips over several years . in contrast , participants were told , the release of results to participants could be delayed until all their results had been generated , necessitating only one trip to the nih . participants stressed that actionability might be time - sensitive , and that getting results piecemeal would make comprehension easier . they were generally amenable to making multiple trips to nih to receive results , within limits . group 2 participant : moderator : but [ name ] , it sounds like , to you , is there a frequency with which that would be considered too much ? participant : just because of the distance , yeah . moderator : so what would be is there a point that would be too much as opposed to , you know , being more acceptable ? i think if they have the information that they do , it s better to give it to me at the same time , so i know what i m going to do with it . if i have to plan for something , to go to the doctor and do more testing or something , the sooner the better . group 5 participant : i would rather have [ the results ] at different stages as it comes out . because my mind is prepared for it now ; i do nt know what it s going to be like in four years . group 2 participant : moderator : but [ name ] , it sounds like , to you , is there a frequency with which that would be considered too much ? participant : just because of the distance , yeah . moderator : so what would be is there a point that would be too much as opposed to , you know , being more acceptable ? participant : i think if they have the information that they do , it s better to give it to me at the same time , so i know what i m going to do with it . if i have to plan for something , to go to the doctor and do more testing or something , the sooner the better . group 5 participant : i would rather have [ the results ] at different stages as it comes out . because my mind is prepared for it now ; i do nt know what it s going to be like in four years . participants were introduced to the concept of bundled results that is , results grouped according to categories ( i.e. , carrier testing results ) and returned in batches . while some responded positively , it was not well understood . they were asked follow - up questions about their tolerance for receiving up to twenty results at once or results with distinct health implications simultaneously . some participants were wary of the implications such streamlining had for personal choice about what types of results to learn . groups were ambivalent about their capacity to process large numbers of results simultaneously ; a few said they could handle twenty or more results only if they received a written report or detailed explanation . group 5 participant : i would like to have more specific information so that i can have a choice about what type of information i want . that s kind of like what you re suggesting is you go into a restaurant for a set dinner . someone mentioned laymen s terms; if it is in laymen s terms , then 20 may be easy to digest . but if it s complex stuff that nobody but a scientist would understand , then i think 20 would be a bit much . group 5 participant : i would like to have more specific information so that i can have a choice about what type of information i want . that s kind of like what you re suggesting is you go into a restaurant for a set dinner . someone mentioned laymen s terms; if it is in laymen s terms , then 20 may be easy to digest . but if it s complex stuff that nobody but a scientist would understand , then i think 20 would be a bit much . participants had varying preferences for how they wanted results , or invitations to receive results , communicated to them . many endorsed the approach intended for the clinseq study : an invitation to receive results , communicated by phone , followed by an in - person meeting and a written report . however , they stressed that the lag time from the phone call to the meeting should be as short as possible , to minimize anxiety . participants favored methods that allowed for mental preparation for receiving results and stressed the importance of providing resources ( i.e. , the phone number for a genetic counselor , web - based information ) for more information . i d like to have the time between the phone call and when i come in to be very short . i get very anxious and i start imagining all kinds of things , so i would love it if they did nt say , you can come in next month. i d rather it be in a couple of days or something . group 4 participant : i do nt want somebody calling me at 3:30 in the afternoon and say , hey , got a little information for you. i need something to come to me and say , we have some findings , we need to meet with you to discuss them. it s too quick ; it s too fast . group 5 participant : i would want that in writing so i could go back and digest it . i d like to have the time between the phone call and when i come in to be very short . i get very anxious and i start imagining all kinds of things , so i would love it if they did nt say , you can come in next month. i d rather it be in a couple of days or something . group 4 participant : i do nt want somebody calling me at 3:30 in the afternoon and say , hey , got a little information for you. i need something to come to me and say , we have some findings , we need to meet with you to discuss them. it s too quick ; it s too fast . group 5 participant : i would want that in writing so i could go back and digest it . a total of 39 clinseq patients participated in six focus groups between march and may 2012 . participants ranged in age from 4769 and were largely white , college - educated , and had household incomes of > $ 100,000/yr ( see table 2 ) . focus group participants demographically represented the overall clinseq cohort except that there were more males ( 59% ) than in the cohort ( 49% ) . the responses by focus group participants comprised of individuals who had received a sequencing result did not differ from other focus groups . chief among their reasons was the belief that results will confer specific benefits to the participant , the participant s family , and society or the scientific enterprise at large . yet participants also expressed concerns about learning certain information and discriminated circumstances where they would not want to learn results . these findings suggest that attitudes toward sequencing results are not uniformly positive , nor were they necessarily fully considered as concerns evolved during the focus group discussions . our results offer new insights into the complexities of the variation in the type of health information that may be revealed by sequencing . on a personal level , participants expected that they would gain insights about their current or future health , and that they could use sequencing results to make lifestyle changes or institute preventive measures to extend life length or quality . group 4 participant : if you make those changes , i mean , depending on the information that comes from the study and what that is to the individual , you might live longer group 4 participant : planning . with your family or future . with your financial papers . making sure everything is up to date , so [ your family does nt ] get hit with a ton of things ; they have no idea what s out there . group 4 participant : if you make those changes , i mean , depending on the information that comes from the study and what that is to the individual , you might live longer group 4 participant : planning . with your family or future . with your financial papers . making sure everything is up to date , so [ your family does nt ] get hit with a ton of things ; they have no idea what s out there . participants expected that their own results , if they chose to share them , could potentially benefit family members by alerting them to health risks . some participants also conveyed altruistic reasons for enrolling ; they believed that , independent of any personal benefit , their data would contribute to scientific progress and benefit others . group 5 participant : you learn what we possibly have and what we possibly would be passing on to our children and future generations . to make them aware of the fact that , i have this , you may have it , your children , so that somebody is aware of it . group 6 participant : population health : if they found a relationship between genes and a disease it could influence large - scale decision making . group 5 participant : you learn what we possibly have and what we possibly would be passing on to our children and future generations . to make them aware of the fact that , i have this , you may have it , your children , so that somebody is aware of it . , back then grandma had it. group 6 participant : population health : if they found a relationship between genes and a disease it could influence large - scale decision making . when asked to describe the value of receiving genetic sequencing results , as distinct from the benefits , participants frequently mentioned attaining an increased feeling of personal control , peace of mind , and the alleviation of fear . moderator recorded responses : minimize stress ; peace of mind ; more control , fewer surprises . i think that s a great value about what [ other group member ] has mentioned about how his daughter was reacting . group 6 participant : alleviate personal fears of going to the doctor . moderator recorded responses : minimize stress ; peace of mind ; more control , fewer surprises . i think that s a great value about what [ other group member ] has mentioned about how his daughter was reacting . they know what they have to do to prevent certain diseases in the future . the majority of participants anticipated choosing to learn genetic sequencing results that were described to them as clinically non - actionable , perceiving them to have value and potential benefits . they expressed intentions to use non - actionable results to make more informed future planning decisions . they suggested that the understanding of un - interpretable variants may evolve and eventually have more utility for themselves or their relatives . group 2 participant : all knowledge is beneficial , i think , and you never know what might come out of it something later in life . maybe it could be caused from that and something might have developed three years from now that says , yeah , that is the cause of , you know the doctor might say , oh yeah , i did read a report that that could be the cause of that . group 4 participant : [ a non - actionable result ] is something i really want to know about because that s a different life expectancy and a different plan for your life , very much . group 2 participant : all knowledge is beneficial , i think , and you never know what might come out of it something later in life . maybe it could be caused from that and something might have developed three years from now that says , yeah , that is the cause of , you know the doctor might say , oh yeah , i did read a report that that could be the cause of that . group 4 participant : [ a non - actionable result ] is something i really want to know about because that s a different life expectancy and a different plan for your life , very much . some participants acknowledged that while genetic information might be reassuring and empowering , it could also be a source of distress and/or fear . a few mentioned others who they thought would not want to learn genetic results ; some wondered about the moral implications of learning their own genetic results as it concerned an obligation to inform relatives . group 1 participant : now , you have a bias in the [ study ] population because all of these people want to know more . that s a , a kind of bias not the whole population wants to do that . group 5 participant : if my tests come out that i have a predisposition for huntington s , does my brother want to know ? i do have a half sister who, the team suggested that i contact her and let her know [ actionable test results ] . and it s just a little awkward because we are not , um , the only time i ve met her was at my father s funeral , so it s a little awkward and i havent figured out how to do it . group 1 participant : now , you have a bias in the [ study ] population because all of these people want to know more . that s a , a kind of bias not the whole population wants to do that . group 5 participant : if my tests come out that i have a predisposition for huntington s , does my brother want to know ? i do have a half sister who, the team suggested that i contact her and let her know [ actionable test results ] . and it s just a little awkward because we are not , um , the only time i ve met her was at my father s funeral , so it s a little awkward and i havent figured out how to do it . in contrast to the majority of participants who expressed a strong desire to know all available results , some individuals were opposed to or ambivalent about certain types of results , especially those having to do with diseases that were untreatable or that might have implications for their children s health . group 3 participant : if it had to do with the mortalities of my children and was absolutely not actionable , i would not want to know if there s nothing i can do about it , i would nt want to know . and we were saying that we were really a little on the fence about whether we would want to know something like that we wondered if knowing something that awful , because it was really awful for our dads and our families , we wondered if that would be a place where it would be harder to know than not to know . i m still not really sure if i want to know all that s out there . group 5 participant : i do nt want to know anything about anything that your information shows for conditions that i may have which are either incurable or untreatable . group 3 participant : if it had to do with the mortalities of my children and was absolutely not actionable , i would not want to know if there s nothing i can do about it , i would nt want to know . and we were saying that we were really a little on the fence about whether we would want to know something like that we wondered if knowing something that awful , because it was really awful for our dads and our families , we wondered if that would be a place where it would be harder to know than not to know . i m still not really sure if i want to know all that s out there . group 5 participant : i do nt want to know anything about anything that your information shows for conditions that i may have which are either incurable or untreatable . participants were asked how they intended to use or had used their results . many indicated that their results might motivate them to make lifestyle changes , especially diet - related , or to engage in planning activities , such as financial planning or changing life priorities . group 3 participant : if there was something i could do right now to live a healthier , better life , i would want to know . especially if it was something easy . group 6 participant : it might be an inspiration to do things you wished to do and put off doing , depending on what you find out travel or changing jobs perhaps , or pursuing some interest . group 2 participant : makes me feel guiltier if i do nt get to the gym [ laugh] maybe i should put it more positively . that it reinforces the need to do what i ve been trying to do . group 3 participant : if there was something i could do right now to live a healthier , better life , i would want to know . especially if it was something easy . group 6 participant : it might be an inspiration to do things you wished to do and put off doing , depending on what you find out travel or changing jobs perhaps , or pursuing some interest . group 2 participant : makes me feel guiltier if i do nt get to the gym [ laugh] maybe i should put it more positively . that it reinforces the need to do what i ve been trying to do . the intention to share genetic results with others , especially siblings , spouse , children , and physicians , was prevalent . sharing genetic information with family members was often viewed as part of future planning ; in addition to alerting a family member to their potential health risks , it could help the family to prepare , pragmatically and emotionally , for a potential health event . group 3 participant : one thing i thought about is if we have children that we would be able to let them know , if there s something they should be aware of before they might have children . especially if it s something that their spouse might also carry , so the risk to their grandchildren in this case would be i understood why people in my family have had this cholesterol issue it s actually useful group 3 participant : one thing i thought about is if we have children that we would be able to let them know , if there s something they should be aware of before they might have children . especially if it s something that their spouse might also carry , so the risk to their grandchildren in this case would be group 2 participant : i understood why people in my family have had this cholesterol issue it s actually useful many participants expressed an intention to integrate their genetic sequencing results with other health information resources , such as advice from their physicians or the internet , to help them understand the information , allay fears , and inform their healthcare management . moderator recorded response : alert one s doctor about things not known . i would probably go to doctors who could give me support in whatever way , or confirmation of the information . i would probably go to doctors who could give me support in whatever way , or confirmation of the information . the moderator posited that a participant might be invited to the nih for each result , necessitating multiple trips over several years . in contrast , participants were told , the release of results to participants could be delayed until all their results had been generated , necessitating only one trip to the nih . participants stressed that actionability might be time - sensitive , and that getting results piecemeal would make comprehension easier . they were generally amenable to making multiple trips to nih to receive results , within limits . group 2 participant : moderator : but [ name ] , it sounds like , to you , is there a frequency with which that would be considered too much ? participant : just because of the distance , yeah . moderator : so what would be is there a point that would be too much as opposed to , you know , being more acceptable ? i think if they have the information that they do , it s better to give it to me at the same time , so i know what i m going to do with it . if i have to plan for something , to go to the doctor and do more testing or something , the sooner the better . group 5 participant : i would rather have [ the results ] at different stages as it comes out . because my mind is prepared for it now ; i do nt know what it s going to be like in four years . group 2 participant : moderator : but [ name ] , it sounds like , to you , is there a frequency with which that would be considered too much ? so what would be is there a point that would be too much as opposed to , you know , being more acceptable ? participant : i think if they have the information that they do , it s better to give it to me at the same time , so i know what i m going to do with it . if i have to plan for something , to go to the doctor and do more testing or something , the sooner the better . group 5 participant : i would rather have [ the results ] at different stages as it comes out . because my mind is prepared for it now ; i do nt know what it s going to be like in four years . participants were introduced to the concept of bundled results that is , results grouped according to categories ( i.e. , carrier testing results ) and returned in batches . while some responded positively , it was not well understood . they were asked follow - up questions about their tolerance for receiving up to twenty results at once or results with distinct health implications simultaneously . some participants were wary of the implications such streamlining had for personal choice about what types of results to learn . groups were ambivalent about their capacity to process large numbers of results simultaneously ; a few said they could handle twenty or more results only if they received a written report or detailed explanation . group 5 participant : i would like to have more specific information so that i can have a choice about what type of information i want . that s kind of like what you re suggesting is you go into a restaurant for a set dinner . someone mentioned laymen s terms; if it is in laymen s terms , then 20 may be easy to digest . but if it s complex stuff that nobody but a scientist would understand , then i think 20 would be a bit much . group 5 participant : i would like to have more specific information so that i can have a choice about what type of information i want . that s kind of like what you re suggesting is you go into a restaurant for a set dinner . someone mentioned laymen s terms; if it is in laymen s terms , then 20 may be easy to digest . but if it s complex stuff that nobody but a scientist would understand , then i think 20 would be a bit much . participants had varying preferences for how they wanted results , or invitations to receive results , communicated to them . many endorsed the approach intended for the clinseq study : an invitation to receive results , communicated by phone , followed by an in - person meeting and a written report . however , they stressed that the lag time from the phone call to the meeting should be as short as possible , to minimize anxiety . participants favored methods that allowed for mental preparation for receiving results and stressed the importance of providing resources ( i.e. , the phone number for a genetic counselor , web - based information ) for more information . i d like to have the time between the phone call and when i come in to be very short . i get very anxious and i start imagining all kinds of things , so i would love it if they did nt say , you can come in next month. i d rather it be in a couple of days or something . group 4 participant : i do nt want somebody calling me at 3:30 in the afternoon and say , hey , got a little information for you. i need something to come to me and say , we have some findings , we need to meet with you to discuss them. it s too quick ; it s too fast . group 5 participant : i would want that in writing so i could go back and digest it . i d like to have the time between the phone call and when i come in to be very short . i get very anxious and i start imagining all kinds of things , so i would love it if they did nt say , you can come in next month. i d rather it be in a couple of days or something . i do nt want somebody calling me at 3:30 in the afternoon and say , hey , got a little information for you. i need something to come to me and say , we have some findings , we need to meet with you to discuss them. it s too quick ; it s too fast . group 5 participant : i would want that in writing so i could go back and digest it . more than a decade after the completion of the human genome project , myriad qualitative studies show that positive attitudes about , and optimistic expectations of , sequencing persist . both research participants and the public anticipate that sequencing could provide them with actionable information about individual disease risk . the majority of our focus group participants were eager to learn about genetic results of all types , including those of uncertain significance . this is consistent with results from our prior study of intentions to learn results among a large sample , though it was critical to understand why . the focus group discussion concurred not only with our published quantitative results from a distinct clinseq sample but importantly , also with those reported by others that indicate genetic research and bio - repository participants similarly express a strong desire to learn sequencing results . many of our participants reasons for wanting these results are consistent with those described in hypothetical studies . their reasons included the perceived benefits of acting on the information to extend length or quality of life and making informed decisions about financial planning and future care . however , participants also expressed a desire to learn medically non - actionable or uncertain results ; they regarded the knowledge itself as valuable . peace of mind about what to expect in the future and more control were cited in discussions of the value of sequencing results . as members imagined various types of results , they began to distinguish what they wanted to learn and what they did not . when hearing of the example of an incurable disease risk for one s child , some did not want to know and others felt strongly that they would . untreatable progressive disease risk was also subject to concern with many participants drawing a line at this information . concerns were raised about the emotional impact of such findings and the potential obligations to at risk relatives . so while benefits to relatives were uniformly endorsed , the downsides of communicating genetic information within families arose upon further consideration . overall , these findings suggest that attitudes toward receiving sequencing results are not fully formed and that education and counseling will be essential to help patients make informed choices . while the profile of , and public attitudes about , genome sequencing resemble those of other biotechnologies , the nature of sequencing and its implications for patient experience are new . there is no model for giving or receiving multiple results , relating to different medical conditions of varying significance . unprecedented , too , is the amount of time it would take medical providers to educate their patients about the results of sequencing . the expectation already exists : in a study about public attitudes toward direct - to - consumer personal genome testing , a majority of participants indicated they would want their physicians to help them interpret the results . the practical preferences expressed by clinseq participants have important implications for healthcare providers offering such sequencing . healthcare providers must be mindful that participants perceive results as time - sensitive , necessitating fast turn - around times and efficient scheduling of result return visits . the iterative nature of results return was popular both because it minimized the delay from generating information to sharing it , and because it limited the amount of information returned in one sitting . in a clinical setting , it is likely that many genetic results will be generated for an individual patient at one time , rather than piecemeal . this will pose another challenge : how to deliver many results at once , to avoid withholding information , in a way that is manageable for the patient . our participants also provide some evidence that these results are potentially anxiety - provoking , particularly those that are of unclear significance or not medically actionable . some participants may require psychosocial support in coping with not just receiving results , but anticipating them . this method is used to explore the scope of responses to new information and here to understand the basis of participants preferences and the value they conferred . the majority of participants had not yet received genomic sequence results and so their preferences were hypothetical . further research into actual choices to learn information will reveal how accurately participants predict their behavior . while the participants were representative of clinseq , they are highly educated and value science . although they do not represent the general public , our findings are similar to those of the public as sampled by bollinger and colleagues . there remains work to do with regard to clarifying how many and what types of results individuals want returned . upon further exploration of the generally strong desire to receive results , some of the focus group participants admitted that there were limits to what they wanted to learn . this suggests that individuals attitudes toward sequencing may be newly formed and that counseling to address these preferences will be essential . as translational efforts continue , researchers and healthcare providers should intensify efforts to educate patients about sequencing and prepare them for its scope and uncertainties . this will necessitate a multi - faceted approach ; it should include guidelines for healthcare providers , policy recommendations , and public internet resources . this method is used to explore the scope of responses to new information and here to understand the basis of participants preferences and the value they conferred . the majority of participants had not yet received genomic sequence results and so their preferences were hypothetical . further research into actual choices to learn information will reveal how accurately participants predict their behavior . while the participants were representative of clinseq , they are highly educated and value science . although they do not represent the general public , our findings are similar to those of the public as sampled by bollinger and colleagues . there remains work to do with regard to clarifying how many and what types of results individuals want returned . upon further exploration of the generally strong desire to receive results , some of the focus group participants admitted that there were limits to what they wanted to learn . this suggests that individuals attitudes toward sequencing may be newly formed and that counseling to address these preferences will be essential . as translational efforts continue , researchers and healthcare providers should intensify efforts to educate patients about sequencing and prepare them for its scope and uncertainties . this will necessitate a multi - faceted approach ; it should include guidelines for healthcare providers , policy recommendations , and public internet resources .

nicotinamide adenine dinucleotide ( nad ) is critical for energy homeostasis and mediates a variety of biological activities including inflammation , circadian rhythm , extension lifespan , and cancer [ 15 ] . depletion of nad in myeloma cancer cells increased cell death via autophagy [ 6 , 7 ] . the salvage pathway for nad synthesis is regarded as a major way to avoid the depletion of physiological nad level in mammals . one mammalian enzyme , nicotinamide phosphoribosyltransferase ( nampt ) , is a rate - limiting enzyme for nad biosynthesis . it has been demonstrated that nampt activity is mainly present in adipose tissue , macrophage , hepatocytes , and cancer cells . it is noteworthy that nampt gene expression appears to be associated with carcinogenic and inflammatory diseases [ 10 , 11 ] . thus , understanding the linkage between nad biosynthesis and inflammatory stress may resolve the problems associated with the chronic inflammation induced cancer formation . besides acting as one nad synthetic enzyme , nampt a variety of clinical evidence indicates nampt / visfatin is an important adipokine involved in metabolic disorders [ 4 , 5 ] . several lines of evidence provided the connection between inampt and nad - dependent deacetylase / adp - ribosylase ( sirt1 ) . reduction of inampt expression in smooth muscle cells ( smcs ) impairs cell survival , whereas overexpression of inampt upregulates cellular nad level , induces sirt1 activity , and then promotes cell maturation . inampt also protects cardiac myocyte cells from death induced by parp through nad dependent activation of sirt1 . inampt level can be augmented by genotoxic stress to prevent the depletion of mitochondrial nad level and then assisted cell survival via sirt3/4 dependent activation [ 16 , 17 ] . despite inampt being confirmed as one enzyme of nad salvage pathway to protect cells from apoptosis , the role of enampt remains controversial . several studies indicate that enampt is released from differentiated adipocytes as well as hepatocytes through a non - classical secretory pathway [ 1820 ] and nampt can exert insulin - mimetic effects in vitro or in vivo . however , some studies proposed that enampt - mediated robust nad biosynthesis might be critical for pancreatic cell in glucose homeostasis rather than the direct insulin - like action . in macrophages , enampt promotes cell survival to er stress induced by obesity associated disorders through the activation of il-6/stat3 autocrine pathway . nampt has such a variety of biological roles and much attention appears to focus on the effect that how nampt prevent an organism from damage of different stress generated via metabolic disorders , aging , and stress from genotoxic drugs for inflammation and cancer therapy . thus , reports have indicated several anti - nampt activity compounds and they can act as anti - cancer drugs . for example , apo866 ( fk866 ) as well as chs-828 has potent antitumor effect against hematologic malignancies [ 24 , 25 ] . two other potent nampt inhibitors , gmx1778 and cb-30865 , may have potential for therapeutic candidates to treat certain cancers [ 26 , 27 ] . the relation of nampt and cancer has also been mentioned that prostate cancer has higher level of nampt expression and may enhance cell survival and stress response . however , less study has investigated the role of nampt in hcc ( hepatocellular carcinoma ) . thus , we tried to understand the response of cellular nampt under oxidative stress and the possible role of nampt in the inflammation state of liver cancer cells . human kidney 293 t and hepatoma huh-7 cell lines were grown in dmem medium with 10% fetal bovine serum at 37c , 5% co2 incubation . 293 t cells were transiently transfected with flag - tag nampt / pcmv2b ( a gift from the laboratory of dr . sc lee , ntu , taipei ) or pegfp - n1 ( clontech laboratories , takara bio , inc . , huh-7 cells were transiently transfected with the same plasmids using polyjet in vitro dna transfection reagent ( signagen , md , usa ) . the sirnas for nampt were purchased from santa cruz biotech and then transfected into huh-7 cells via genmute sirna transfection reagent ( signagen , md , usa ) . 293 t cells were treated with h2o2 at different dosages while huh-7 cells were treated with 200 m h2o2 for 6 hours . in reporter assay experiment , huh-7 cells were treated with 10 nm fk866 ( sigma - aldrich , mo , usa ) 2 hours before the oxidative treatment . cells were lysed in a buffer containing 10 mm tris ph 8.0 , 20 mm kcl , 0.5 mm edta , 200 mm nacl , 0.1% triton 100 . identical amount of cell lysates proceeded sds - page and then immunoblot analysis by anti - nampt / pbef antibody ( c20 ) , anti - gadph ( 1d4 ) , anti--actin ( c4 ) ( santa cruz biotech , ca , usa ) , and anti - caspase 9 ( n2c3 ) ( genetex , ca , usa ) antibodies . the antibody for caspase 9 only detects the intact ( inactive ) form of enzyme . the cell culture medium from two 10 cm cell culture dishes was used for immunoprecipitation by anti - flag ( m2 ) agarose resin ( sigma - aldrich , mo , usa ) and then conducted immunoblot analysis . transfected cells were treated with h2o2 for 6 hours and then replaced with normal culture medium for the following incubation . after 1 , 2 , 4 , and 5 days of culture , cell proliferation activity was determined by a tetrazolium compound mts purchased from promega ( celltiter 96 aqueous one solution reagent ) following the procedures described in technical bulletin . proteins from anti - flag antibody immunoprecipitates of 293 t transfected lysates were resolved in sds - page . the gel slices were destained in a solution of 25 mm nh4hco3 and 50% ( v / v ) acetonitrile ( 1 : 1 ) . the dried slices were reduced by 2% -mercaptoethanol and then alkylated with 10% ( v / v ) vinylpyridine in 25 mm ammonium bicarbonate/50% acetonitrile for 20 min at room temperature . the slices were digested by 100 ng of modified trypsin ( promega , mannheim , germany ) in 25 mm nh4hco3 at 37c overnight . the tryptic peptides were solubilized in 0.1% formic acid and then injected into a nanoflow hplc system ( agilent technologies 1200 series , waldbronn , germany ) coupled to an ltq - orbitrap discovery hybrid mass spectrometer ( thermo electron , waltham , massachusetts , usa ) . the raw data were converted by the xcalibur 2.0.7 sr1 package and an in - house program into dta files . all dta files were analyzed by turbosequest software to match the peptides from human protein sequence database . the protein was identified at least two peptides matched and then the peptide ' xcorr scores was higher than 2.5 . mass spectral counts were normalized using the sum of the spectral counts from each biological sample for quantitative analyses . the relative protein amount is quantified by normalized spectral counts . huh-7 cells were cotransfected with nf-b derived luciferase ( pgl4.32[luc2p / nf-b - re / hygro ] ) and cmv - renilla ( pgl4.75[hrluc / cmv ] ) vectors ( promega , mannheim , germany ) . after oxidative treatment , the cells were incubated about 16 hours for reporter gene expression . the cells were lysed by dual - luciferase reporter assay kit ( promega , mannheim , germany ) . the relative luciferase activity of 10 g lysate was detected by fb12-single tube luminometer ( berthold detection system , pforzheim , germany ) . data are presented as the mean standard error of the mean ( sem ) . indicates p < 0.1 ; indicates p < 0.05 ; or # # # indicates p < 0.01 compared to the respective control as indicated in legend . liver has been demonstrated as major source of highly expressed nampt and the role of nampt / visfatin in hepatoma cells is less characterized , we try to determine whether the cellular level of nampt is affected by oxidative stress . our observation indicated that the cellular nampt ( inampt ) level was decreased following the treatment of low concentration of h2o2 in huh-7 hepatoma cells for 48 hours ( figure 1(a ) ) . to verify the specificity of nampt secretion , we examined the cell viability using mts assay under different dosages of h2o2 treatment to determine the cell damage state . we observed after 24-hour treatment the cell viability at low dosage of h2o2 ( 200 m ) in huh-7 cells has been less affected compared with higher dosage of h2o2 treatment ( 400 m ) ( figure 1(b ) ) . the result suggested that the 200 m of h2o2 will not damage the intact cell state probably on their membrane structure leading to the leakage of cellular proteins . propidium iodide ( pi ) staining of nonfixed huh-7 cells provided additional evidence that lose dosage of h2o2 treatment can prevent pi nuclear staining dye from penetrating into nonfixed cells after additional 24-hour culture ( see figure s1 in the supplementary material available online at http://dx.doi.org/10.1155/2015/392471 ) . thus , we proposed that the reduction of inampt is due to the secretion of nampt . however , the amount of nampt was not sufficient to be detectable in culture medium of huh-7 cells ; thus we conducted the exogenously expression of flag - tag nampt in 293 t cells and then examined the flag - inampt and flag extracellular form of nampt ( enampt ) protein using western blot and immunoprecipitation - immunoblot analysis , respectively . we also found that the level of flag - inampt was reduced under the treatment of h2o2 in 293 t cells . as we expected , the loss of flag - inampt was detected in the culture medium of h2o2-treated cells ( figure 1(c ) ) . to determine the distribution of nampt between intracellular and extracellular compartment , we increase the concentration of h2o2 to verify the level of flag - enampt released in culture medium . it appeared that inampt prominently decreased upon the treatment of h2o2 at the concentration of 400 m . in contrast , enampt level was increased under the oxidative stress of 200 m h2o2 incubation ( figure 2 ) . notably , the loss of intact form of caspase 9 in cell lysate of treated cells was observed after we increased the concentration of h2o2 to 600 m . it indicated that the concentration of h2o2 led to the fact that cell death was at least above 600 m . thus , the presence of enampt under the h2o2 treatment at 200 m was caused by the secretion of inampt but not cell death . similar redistribution of nampt was also observed in 293 t cells treated with etoposide ( vp16 ) ( data not shown ) . since nampt secretion resulted from oxidative stress , we would like to understand the biological effects of nampt under oxidative treatment in hepatoma cells . as we transiently transfected with flag - nampt in huh-7 cells , less effect has been found in cell viability detected by mts assay without h2o2 treatment . even though the relative activity was somewhat decreased in nampt transfected cells , the relative curve remained slightly increased after 5-day culture . however , relative cell viability was significantly decreased after 4 days via h2o2 treatment ( figure 3 , triangle ) . it appeared that the normal cell propagation was lost in nampt - expressed cells under oxidative stress . conversely , sirna for nampt reversed the suppression of cell normal propagation after h2o2 treatment ( figure 3 , circle ) . we also determined whether enampt released from 293 t cells after oxidative stress affected the cell viability of huh-7 cells without oxidative treatment . no prominent cell proliferation activity changed under the conditional medium incubation ( data not shown ) . it suggests that nampt is required for the inhibition of hepatoma cell growth under oxidative stress . to investigate the potential candidates affecting cellular nampt function under oxidative stress , we utilized biochemical approach on the protein complex associated with nampt / visfatin in 293 t cells . several proteins identified by orbitrap mass spectrometric analysis present in the immunoprecipitated with flag - nampt . the dna repair proteins such as dna - dependent protein kinase catalytic subunit and poly(adp - ribose ) polymerase 1 were decreased in the association with flag - nampt protein complex under genotoxic stress treatment while nf-b associated proteins p105 and peroxiredoxin-4 enhanced its interaction with nampt protein complex ( figure 4(c ) ) . notably , one inflammatory responsive protein nf-b p105 prominently increased its association with nampt compared with one in no - etoposide - treated 293 t cells . to confirm the above observation , we performed immunoprecipitation of flag - nampt transfected 293 t cells . as we immunoprecipitated flag - nampt from 293 t cell lysates , p105 protein could be specifically coimmunoprecipitated with nampt complex . the binding affinity appeared to be slightly enhanced after etoposide treatment ( figure 4(d ) ) . the result was consistent with the mass spectrometric analysis of flag - nampt immunocomplex that p105 of nf-b protein favored to associate with nampt complex under oxidative stress . next , we conducted nf-b - drive luciferase reporter assay to examine whether nampt affected its gene expression . however , nf-b activity was induced in the presence of nampt overexpression . as the cells treated with 200 m of h2o2 , the increase of nf-b gene expression will be suppressed . inhibition of nampt activity by one specific inhibitor fk866 also reversed the induction effect ( figure 5 ) . as we determined the nf-b reporter activity using higher dosage of h2o2 ( 500 m ) , low reporter activity is detectable in huh-7 cells . however , if we examined nampt - mediated nf-b gene expression under genotoxic stress using etoposide treatment , we would find that nf-b gene expression was induced by genotoxic stress ( supplementary material figure s2 ) . the upregulation is also observed in the presence of nampt overexpression , but the induction can not be further enhanced after genotoxic stress . the decrease extent of nf-b activation by fk866 was only affected on the level of nampt - mediated activation . the effect will be downregulated upon oxidative / genotoxic stress consistent with the loss of inampt under the same treatment . it suggests that nampt is participated in nf-b gene expression and affected under oxidative treatment . adipokines such as adiponectin as well as leptin have been demonstrated in the obesity - associated disorders , nonalcohol fatty liver disease ( nafld ) and hepatocellular carcinoma ( hcc ) . recent study has demonstrated that adiponectin rather than leptin or visfatin ( enampt ) is associated with hbv or metabolic induced hcc . however , the biological role of cellular nampt / visfatin ( inampt ) on hepatoma cells has remained to be determined . here , we explored the biological role of nampt / visfatin in hepatoma cells and examine the effect under oxidative stress similar to the condition of chronic low - level inflammation . we found that the release of nampt into medium in the flag - tag nampt overexpressed cell system can be stimulated under h2o2 treatment . in addition , nampt is required for nampt - mediated inhibition of cell growth under oxidative condition . although nampt expression activated nf-b gene expression , inactivation of nampt by fk866 reduced the effect . therefore , low level of inampt caused by oxidative condition may serve as one mechanism in the regulation of inflammatory state and cell viability in hepatoma cells . nampt / visfatin has been regarded as one adipokine in the verification of metabolic disease , cancer progression , and chronic inflammation . the role of nampt / visfatin in hepatocytes has been less addressed and remains to be further determined . nampt / visfatin secretion has been identified as one nonclassical pathway in adipocytes and hepatocytes [ 18 , 20 ] whereas no stress response was identified to be involved in the regulation of secretion . our finding about the release of exogenous expressed nampt was one unique effect and could be suitable for the detection of stress state in vivo . in addition , there is not only oxidative stress but also genotoxic stress that identified the effect . it suggests that the oxidative response seems to be general for any ros - related stress in the determination of the free radical extent in vivo . although the level of circulated nampt ( enampt ) under chronic inflammation could be monitored in obesity , diabetes , even metabolic disorders [ 32 , 33 ] , less characterization in biological effect of nampt / visfatin has reported after the reduction of intracellular nampt ( inampt ) level under stress condition . we identified the decrease of cell viability or cell growth arrest in nampt expressed cells under oxidative stress . it may imply that either increase of enampt or decrease of inampt triggers certain factors in the regulation of cell cycle or mitochondrial enzymes determined by mts assay . according to the study of visfatin in cell cycle regulation , branched chain amino acids induced p21-mediated cell cycle arrest and then visfatin caused apoptosis in hcc . nevertheless , further studies are required for the understanding how cellular activities are affected by the nampt - dependent cell viability in hepatoma cells . the biochemical interaction of nampt has been known to form homodimer and no prominent studies have shown its associated proteins . in this study , nf-b p105 was identified from tag - bait immunoprecipitation of nampt in 293 t cells . previous research has demonstrated that visfatin induced - ros generation led to the phosphorylation and activation of nf-b in c2c12 cells . our results are consistent with the effect that nampt can positively affect nf-b derived reporter whereas oxidative treatment causes the opposite effect . reasonable possibility is that depletion of inampt may diminish the positive effect of nf-b activation . the investigation of cytoplasmic and nuclear distribution of nf-b regulated by nampt remained to be elucidated . nampt inhibitors such as fk866/apo866 and chs828 are applied in chemotherapeutic clinical trial in cancer therapy [ 24 , 25 ] . other genotoxic drugs that often induce oxidative stress in vivo have generally served as chemotherapeutic weapon in clinical therapy . here we initially observed the effect of cellular response by these two types of drugs applied in the same time . nampt / visfatin involved in the chronic inflammatory effect may provide us to evaluate the dosage of drugs in the therapeutic procedure . it also gives an example of how an adipokine participates in the chemotherapy to regulate hepatoma cell viability . taken together , we utilized an exogenously overexpressed nampt to examine the release effect of nampt / visfatin mediated by oxidative stress . the response is different from the protective role of nampt to promote the cancer cell proliferation . this could explain that the induction of nampt gene expression is usually observed in oxidative / genotoxic stress in proliferative cancer cells . it could make tumor cells sensitive to the stress microenvironment in the decision of cell arrest or death . increase of the enampt / visfatin level might serve as one mechanism to maintain the proliferation of cells under chronic stress condition . regulation of oxidative nf-b gene expression might be regarded as the feedback control of oxidative stress . however , the mechanism of how nf-b is involved in the switch of inampt / enampt needs to be determined . we also found that nampt activated nf-b gene expression but the activity was suppressed after oxidative treatment . these results suggest that nampt might contribute a positive role in cellular inflammation response but the loss of inampt or the presence of enampt / visfatin suppresses the cell viability . the possible mechanism may be through the regulation of nf-b activity to mediate cell death . the study provides a novel role of nampt / visfatin in the regulation of cell survival under oxidative stress and gives one diagnostic strategy to determine cell viability via nad relative regulatory mode in vivo .

chronic subdural hematoma ( csdh ) is defined as a condition consisting of a slowly progressive accumulation of liquefied blood within the subdural space9 ) . this accumulation of blood in the subdural space may produce brain parenchymal compression , and at that time , patients have neurological symptoms such as headache , hypesthesia and hemiparesis . the other risk factors of this disease have been established in many studies like taking blood thinners , long - term alcohol abuse , and history of head trauma23 ) . surgical treatment might generally be indicated in conditions of large hematoma width ( > 10 mm ) or shift of the midline ( > 5 mm ) on brain computed tomography ( ct ) scan and surgical intervention has been accepted as the treatment of choice8 ) . however , its outcomes may not be satisfactory because of recurrence and physical infirmity associated with aging26 ) . when brain ct scan reveals slight compression of the brain parenchyma caused by hematoma and patients have no neurological symptoms or have mild symptoms , it is occasionally difficult to select the treatment strategy between surgical and conservative treatments and we can not be sure about the surgical decision . although many neurosurgeons are aware of spontaneously resolving subdural hematoma ( sdh ) , the clinical and radiological characteristics have not yet been adequately described in the literature9 ) . we compared and evaluated the clinical and radiological characteristics between the spontaneously cured cases and the cases requiring operation . clinical and radiological records of 241 patients who had presented with a low density to iso - dense sdh with parenchymal compression on brain ct scan between july 2005 and december 2014 were retrospectively reviewed . patients were excluded if they had initially received surgery for csdh or if they had presented with a low glasgow coma scale ( gcs ) score below 8 due to difficulty in assessing the neurological status . from among these patients , we enrolled 16 patients who had received conservative treatment for csdh without special medications which could affect hematoma resolution such as mannitol , steroids , tranexamic acid and angiotensin converting enzyme ( ace ) inhibitors . their brain ct scans showed the hematoma exerted a mass effect on the brain which may require surgical treatment such as burr - hole trephination with or without drainage . they were treated conservatively due to mild symptoms , their medical comorbidities , or their denial for operation . all patients had csdh which was identified on the initial brain ct or some patients had a chronic stage of traumatic sdh which had progressed from the initially identified acute sdh . we decided the treatment strategy for csdh such as surgery or observation according to the clinical and radiological findings . if patients had neurological symptoms such as decreased mentality , motor weakness , sensory change or progressive severe headache , we preferred to perform surgical treatment . depending on the patient 's condition , we closely observed the patients and assessed the neurological status daily in case of admitted patients or performed the follow - up assessment once a week in outpatients . we preferred close observation in cases with high possibility of recurrence after the initial operation such as those with antiplatelet use and hematological disorder and in cases belonging to the high risk group of general anesthesia . we wanted to reduce the number of unnecessary operations due to operative or anesthetic complications . we routinely performed follow - up brain ct once a week for 3 weeks and then once or twice a month until detection of nearly total resolution . within the follow - up period , if neurologic symptoms had newly developed or progressed , brain ct was performed to consider surgery as soon as possible . surgical methods were burr - hole trephination with drainage and saline irrigation . generally , when it is decided to treat patients with csdh surgically , the operation is carried out under local anesthesia . however , at our institution , considering the safety of patients and the possibility of lack of patients ' cooperation during the operation , all surgeries were carried out under general anesthesia . thus , prior to the treatment , it was inevitable to collect data regarding patient 's comorbidities . during the observation period , we considered continuation of observation at every follow - up visit by comparing the change in hematoma amount and symptoms . complete cure was defined when the sdh had nearly disappeared on follow - up brain ct . the demographic data were collected after obtaining information on clinical factors ; age , sex , history of trauma , past medical history such as diabetic mellitus , hypertension and medication especially antithrombotic agents , gcs , clinical symptoms and symptom duration , hematoma thickness and volume , degree of midline shift , accompanying intracranial lesion , glasgow outcome scale ( gos ) score . we measured the volume of hematoma from the ct scans ; all of these measurements were performed using the pacs imaging display software ( viewrex , techheim , seoul , korea ) . yoo ) on each axial image , and then these areas were added together and multiplied by the slice thickness . the midline shift was identified as deviation of the septum pellucidum from the central position . the grading score was used for patient classification and it ranged from 0 to iv . grade ii indicates drowsy or disoriented patients . sometimes , the patients who are classified as having grade ii have hemiparesis . grade iii indicates patients who are stuporous but respond appropriately to noxious stimuli and have hemiplegic symptom . the last grade , grade iv indicates patients who are comatose with absent motor responses to painful stimuli . we compared data such as the measured hematoma volume and the degree of midline shift . among these 16 patients , 13 ( 81.3% ) patients showed spontaneously resolved csdh and 3 ( 18.7% ) patients received surgery due to symptom aggravation and growing hematoma . they were categorized into two groups based on whether they were cured with conservative treatment or not . there were 9 men and 4 women with a mean age of 62 years ( range , 25 to 81 years ) . there were 8 patients over 65 years of age ( 61.5% ) and there were 5 below 65 years of age ( 38.5% ) . eight patients ( 61.5% ) had a medical history of hypertension , diabetes mellitus , hematologic disorder due to anaplastic anemia and alcohol abuse , anticoagulant use because of previous cerebral infarction or mitral valve replacement surgery and hemodialysis due to end - stage renal disease . the number of mgs grade i patients was 10 ( 76.9% ) and the number of mgs grade ii patients was 3 ( 23.1% ) . the mean hematoma volume was 43.1 ml ( range , 11.9 to 68.3 ml ) . the mean hematoma thickness on brain ct was 13.3 mm ( range , 9.3 to 17.3 mm ) . the mean degree of midline shift was 5.3 mm ( range , 0 to 10.4 mm ) . mean duration from identification to complete resolution of csdh was 17 weeks ( range , 4 to 96 weeks ) . there were 2 men and 1 woman with a mean age of 72 years ( range , 67 to 81 years ) . the mean hematoma volume was 62.0 ml ( range , 41.0 to 75.0 ml ) . the mean hematoma thickness was 17.5 mm ( range , 14.3 to 21.5 mm ) . the mean degree of midline shift was 6.0 mm ( range , 0 to 15.0 mm ) . mean duration from the decision of surgery for hematoma was 5.5 weeks ( range , 2 to 8 weeks ) . the results of univariate analysis with the wilcoxon rank sum test are described in table 3 . however , the point estimates of the median in the spontaneous resolution group and the progression - surgery group were 44.6 and 70 , respectively . therefore , further analysis with a larger sample size for strengthening statistical power is needed to strengthen our results15 ) . the initial brain ct revealed a scanty acute sdh in the right hemisphere ( fig . 1a ) . follow - up brain ct performed on the 20th hospital day ( hd ) showed a liquefied sdh that compressed the brain parenchyma with a mild midline shift ( fig the measured volume of the hematoma was 51.5 ml and the length of midline shift was 4.4 mm . because his symptom had been improving slowly and he did not have any other neurological signs , we made a decision of performing close observation . follow - up brain ct scan performed on the 46th hd showed an improved mass effect and a remarkably decreased amount of hematoma ( fig . he was discharged at that time and brain ct scan was acquired in the outpatient department 2 weeks later . the patient had aplastic anemia which was diagnosed 10 years ago and he was frequently treated by blood transfusion due to a hematological disorder . the initial brain ct scan showed a mixed subacute and csdh that compressed the brain parenchyma and caused a midline shift ( fig . . the measured volume of the hematoma was 62.0 ml and the length of midline shift was 10.4 mm . he had severe thrombocytopenia ( measured platelet count was 31000/ul ) which might have led to spontaneous bleeding and his medical condition was very poor . because we were concerned about hemostasis and poor general condition , we recommended conservative treatment and informed consent was obtained from the patient and his relatives . his neurological status was not aggravated and the clinical course was uneventful for 2 weeks . follow - up brain ct performed on the 14th hd revealed decreased amount of hematoma and mass effect ( fig . his neurologic symptom disappeared on the 30th hd , and brain ct scan revealed a remarkable reduction in hematoma volume ( fig . 2c ) . after discharge , brain ct scan was acquired in the outpatient department 1 month later . the brain ct scan revealed an iso - dense lesion in the subdural space in the bilateral convexity ( fig . we explained to his relative that this lesion had a chance of growing into a hematoma . close observation was performed . during the admission period , he did not have aggravation of symptoms . after 2 weeks , follow - up ct scan showed no change compared with the previous ct scan . we decided to discharge him and perform outpatient follow - up . at the first follow - up after discharge , his relative informed that the patient did not prefer to talk with other people as found in people with mutistic nature . the initial brain ct revealed a scanty acute sdh in the right hemisphere ( fig . follow - up brain ct performed on the 20th hospital day ( hd ) showed a liquefied sdh that compressed the brain parenchyma with a mild midline shift ( fig the measured volume of the hematoma was 51.5 ml and the length of midline shift was 4.4 mm . because his symptom had been improving slowly and he did not have any other neurological signs , we made a decision of performing close observation . follow - up brain ct scan performed on the 46th hd showed an improved mass effect and a remarkably decreased amount of hematoma ( fig . he was discharged at that time and brain ct scan was acquired in the outpatient department 2 weeks later . the patient had aplastic anemia which was diagnosed 10 years ago and he was frequently treated by blood transfusion due to a hematological disorder . the initial brain ct scan showed a mixed subacute and csdh that compressed the brain parenchyma and caused a midline shift ( fig . the measured volume of the hematoma was 62.0 ml and the length of midline shift was 10.4 mm . he had severe thrombocytopenia ( measured platelet count was 31000/ul ) which might have led to spontaneous bleeding and his medical condition was very poor . because we were concerned about hemostasis and poor general condition , we recommended conservative treatment and informed consent was obtained from the patient and his relatives . his neurological status was not aggravated and the clinical course was uneventful for 2 weeks . follow - up brain ct performed on the 14th hd revealed decreased amount of hematoma and mass effect ( fig . his neurologic symptom disappeared on the 30th hd , and brain ct scan revealed a remarkable reduction in hematoma volume ( fig . 2c ) . after discharge , brain ct scan was acquired in the outpatient department 1 month later . the brain ct scan revealed an iso - dense lesion in the subdural space in the bilateral convexity ( fig . we explained to his relative that this lesion had a chance of growing into a hematoma . close observation was performed . during the admission period , he did not have aggravation of symptoms . after 2 weeks , follow - up ct scan showed no change compared with the previous ct scan . we decided to discharge him and perform outpatient follow - up . at the first follow - up after discharge , his relative informed that the patient did not prefer to talk with other people as found in people with mutistic nature . 3b ) . surgical evacuation of the hematoma was performed and the patient fully recovered ( fig . the initial brain ct revealed a scanty acute sdh in the right hemisphere ( fig . follow - up brain ct performed on the 20th hospital day ( hd ) showed a liquefied sdh that compressed the brain parenchyma with a mild midline shift ( fig the measured volume of the hematoma was 51.5 ml and the length of midline shift was 4.4 mm . because his symptom had been improving slowly and he did not have any other neurological signs , we made a decision of performing close observation . follow - up brain ct scan performed on the 46th hd showed an improved mass effect and a remarkably decreased amount of hematoma ( fig . he was discharged at that time and brain ct scan was acquired in the outpatient department 2 weeks later . the patient had aplastic anemia which was diagnosed 10 years ago and he was frequently treated by blood transfusion due to a hematological disorder . the initial brain ct scan showed a mixed subacute and csdh that compressed the brain parenchyma and caused a midline shift ( fig . the measured volume of the hematoma was 62.0 ml and the length of midline shift was 10.4 mm . he had severe thrombocytopenia ( measured platelet count was 31000/ul ) which might have led to spontaneous bleeding and his medical condition was very poor . because we were concerned about hemostasis and poor general condition , we recommended conservative treatment and informed consent was obtained from the patient and his relatives . his neurological status was not aggravated and the clinical course was uneventful for 2 weeks . follow - up brain ct performed on the 14th hd revealed decreased amount of hematoma and mass effect ( fig . his neurologic symptom disappeared on the 30th hd , and brain ct scan revealed a remarkable reduction in hematoma volume ( fig . 2c ) . after discharge , brain ct scan was acquired in the outpatient department 1 month later . the brain ct scan revealed an iso - dense lesion in the subdural space in the bilateral convexity ( fig . we explained to his relative that this lesion had a chance of growing into a hematoma . close observation was performed . during the admission period , he did not have aggravation of symptoms . after 2 weeks , follow - up ct scan showed no change compared with the previous ct scan . we decided to discharge him and perform outpatient follow - up . at the first follow - up after discharge , his relative informed that the patient did not prefer to talk with other people as found in people with mutistic nature . 3b ) . surgical evacuation of the hematoma was performed and the patient fully recovered ( fig . several hypotheses about the mechanism of increase in the hematoma volume have been proposed since a long time . one hypothesis is the osmotic pressure theory after formation of internal and external capsules . as the hematoma volume increases , tension in the hematoma capsule is increased followed by micro - tear of its capillary vessels . then hemorrhage occurs and it becomes a factor involved in increasing the osmotic pressure in the hematoma25 ) . this osmotic theory recently been doubted due to the following factors : 1 ) there was no significant increase in the volume in this theory when hematoma membranes were used ; 2 ) fresh erythrocytes were always introduced in the hematoma fluid on repeated tapping ; 3 ) it was not possible to prove that the arachnoid acts as a membrane permeable to cerebrospinal fluid ; and 4 ) it has been shown that albumin , the most osmotically active protein , can not be found in destroyed red blood cells but is derived from the plasma17 ) . rather , hematoma expansion is thought to result from repeated micro - hemorrhage from the fragile neo - membranes413 ) . the phenomenon of recurrent bleeding from the hematoma capsule as an etiological factor for the development of chronic sdh was assumed by putnam and cushing in 1932 , and later by dandy . currently , various clinical and experimental studies indicate that fibrinolysis and liquefaction of the initial clot occur rapidly and subsequently inhibit the blood coagulation system in the hematoma . additionally , the byproducts of blood breakdown and the fibrinolytic process also cause thickening of the inner dural layer with ingrowing neocapillaries which play an important role in the leakage of blood , causing enlargement of the subdural collection due to microhemorrhage and further increase in the fibrinolytic activity . the correlation between this cycle of re - bleeding and fibrinolysis , and reabsorption of the subdural collection will determine whether the csdh will resolve , persist or enlarge24 ) . some authors stated that the hyperfibrinolytic activity has been proved to be critical for liquefaction of the hematoma and progression of csdh . several studies have indicated the hyperfibrinolytic and coagulative activity in csdh and some studies have shown that increased permeability of the capillaries in the hematoma outer membrane can influence the enlargement of a csdh5 ) . based on this rationale , they applied an antifibrinolytic agent for prevention of enlargment and recurrence of csdh11 ) . previous reports on spontaneous resolution of csdh without special medication and surgery have been published 1791012162022 ) . most of them were case studies which were composed of small cases series with 4 or 5 cases in one report . to the best of our knowledge , our study has the highest number of enrolled cases compared to the studies reported so far , and unlike other investigations , this study has a unique aspect as it considered the rate of spontaneous resolution of csdh . the mean age of this group was 66.5 years ( range , 21 to 87 years ) . most of them , except for 3 patients had a trauma history such as traffic accident , fall , and blunt trauma . mean hematoma thickness was 16.7 mm ( range , 9 to 34 mm ) and there was no data for thickness in 7 cases . the average degree of midline shift was 2.8 mm ( range , 5 to 12 mm ) . naganuma et al.20 ) reported 4 cases of spontaneous resolution of csdhs and suggested the three following characteristic ct findings associated with spontaneous resolution of chronic sdh : low density hematoma or iso - dense hematoma , small size , and ventricular dilatation . except for one case , there were no other cases of ventricular dilatation in this group and the mean evan 's ratio ranged from 0.19 to 0.32 . horikoshi et al.9 ) reported that the clinical and radiological findings of four cases ( five hematomas ) were compared to those of 19 surgical cases . they considered that spontaneously resolving csdh were asymptomatic or only caused mild transient headache , and disappeared within 4 to 9 months after head injury . all spontaneously resolving sdhs were located in the frontal region , and maximum thickness and midline displacement were less 5 mm . the mean value of midline displacement in our study was 5.2 mm and thickness was 13.3 mm . we suggest that close observation could be chosen when hematoma volume or thickness is below 43 ml and 13 mm , respectively , and midline shift is below 5 mm on brain ct scans . according to our results , there were no statistically significant differences between the two groups . this shows that the patients who have a definite large amount of csdh ( > 43 ml ) should be informed about the possibility of surgery during the close observation period . especially , horikoshi et al.11 ) suggested that brain ct scan demonstrated a low density line between the hematoma and the cerebral cortex , indicative of remaining cerebrospinal fluid space in four of five hematomas9 ) . in our study , in 7 patients ( 53.8% ) of the spontaneously resolution group , the low density line on the initial brain ct scans was visible . while in only one patient ( 33.3% ) of the progression - surgery group , the low density line was visible . some authors suggested that age over 70 years , worsening mental function , the presence of brain atrophy , and absence of clinical and radiological symptoms due to increased intracranial pressure are clinical and radiological findings that allow one to choose conservative therapy . in our study , the number of patients who were aged over 70 years was 5 ( 38.5% ) in the spontaneously resolution group . however , in this aging society , age can not be an independent factor that affects the decision making process . if the symptoms have not begun to resolve after 7 or 10 days of clinical observation , surgery should be performed immediately in patients with progressive neurological deficits and increase in size of the sdh regardless of the age22 ) . we suggest that the treatment modality could be determined according to the patient 's symptoms , and the clinical indication for close observation is patients who do not have any symptoms or patients who have moderate headache without neurological deterioration ( mgs 0 or i ) . nakamura et al.21 ) stated that the decreased fibrinolytic activity of the hematoma capsule and the fluid might have caused a spontaneous resolution . they also noted that the resolving hematoma appeared as a low density area or an area of decreasing density , from mixed to low , in successive ct scans . of the 209 cases , primary surgical intervention was performed in 137 ( 65.5% ) patients . the remaining 72 ( 34.5% ) patients were simply observed . in this report , the natural course or results obtained in the simply observed patients were not described in detail . lee et al.14 ) reported about the forty patients who were admitted to their institution due to csdh and finally only two ( 5% ) patients had a spontaneously absorbed csdh . some authors believed that only reduction in the internal pressure of a hematoma will cure csdh , and therefore , the problem may be solved nonsurgically if the internal pressure within a sdh can be reduced by any method , not necessarily craniotomy . hence , nonsurgical treatment consisting of osmotherapy with 20% mannitol was performed in a consecutive series . disappearance or marked reduction of the hematoma content and complete clinical recovery were obtained in 22 out of 23 patients25 ) . sun et al.24 ) reported regarding corticosteroid treatment for 26 csdh patients who had gcs score of 15 with no neurological deficits , but they had symptoms such as headache or unsteady gait ( mgs i ) . among them , only one case ( 4% ) required surgical drainage . they supported the rationale for dexamethasone treatment suggested by experimental studies that the development of csdh is due to an inflammatory process induced by the presence of erythrocyte breakdown products in the subdural space24 ) , and they showed that corticosteroids inhibited the formation of protein permeable membranes and decreased the size of chronic hematomas in rats6 ) . also , delagado - lpez et al.3 ) reported that although 21.8% of the patients on dexamethasone ultimately required surgical drain , a favorable outcome was obtained in 96% of the patients who had mgs i and ii . the rationale for the use of dexamethasone in csdh lies in its anti - angiogenic properties over the subdural clot membrane , as it is derived from experimental studies and very few clinical observations have been published . surgical evacuation of csdh is known to achieve excellent results , but there are no well - designed trials comparing medical versus surgical therapies3 ) . in the study by delgado - lpez et al.3 ) , they suggested that the only indication for surgery as an initial emergency treatment may be the case of a patient with depressed level of consciousness and severe neurological deterioration occurring acutely and it seems reasonable to propose the steroid trial as the first therapeutic choice . even though they conservatively treated mgs ii patients using corticosteroids , their outcome was almost favorable . we think it may be a noteworthy result , and when patient has a moderate neurologic deficit or decreased mentality and if the patient 's condition is very poor to undergo surgery , corticosteroid treatment could be chosen . in a recent report , tranexamic acid has been shown to prevent the early stages of csdh that can occur after head trauma and the recurrence of csdh after surgery . tranexamic acid is an antifibrinolytic agent that has fewer side effects than other agents and is widely used for hemostasis . in several studies assessing the role of hyperfibrinolytic activities in the liquefaction and enlargement of csdh5 ) , they hypothesized that tranexamic acid would inhibit the hyperfibrinolytic activity within the csdh11 ) . there is increasing evidence that impaired angiogenesis in the neomembrane and localized inflammation play a key role in the formation of a csdh . impaired angiogenesis results in blood leakage from immature vessels of the neomembrane and localized inflammation hampers angiogenesis and prevents leaked blood from being absorbed . 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitors , which are the first - line treatment in patients with high cholesterol and coronary heart disease , have been demonstrated to improve angiogenesis and reduce inflammation26 ) . the researchers reported that 22 of the 23 patients experienced improvements in symptoms , and reduction in hematoma volume within the first month of the treatment . hematoma was completely resolved in 17 patients ( 77.3% ) and shrank in 5 patients ( 22.7% ) within 3 months after the treatment was initiated26 ) . because the csdh is characterized by pathological vascularization of the parietal membrane , plasma leakage from immature vessels the researchers tested the hypothesis that the antiangiogenic mechanism of ace - inhibitor treatment for the control of arterial hypertension reduces the risk of recurrence of csdh . their data suggest that ace - inhibitor treatment for the control of arterial hypertension lowers the risk of recurrence in patients undergoing operation for csdh and possibly even the development of csdh . this effect might be the result of an antiangiogenic mechanism of ace - inhibitors27 ) . in comparison with surgical treatment , first , the prolonged presence of a hematoma on the cerebral surface even with low pressure may raise fears of an ill effect on cerebral function . the usual surgical treatment eliminates the hematoma as soon as it is discovered , while nonsurgical treatment can not eliminate a mass lesion by one effort25 ) . the third drawback is that longer follow - up periods may be required . because csdh frequently occurs in the elderly group , special attention should be paid to this side effect . it should be performed with combined sufficient hydration and with careful attention being paid to the electrolyte balance . gastric mucosal hemorrhage , edema , and increased risk of infection are associated with use of steroids2 ) . also , tranexamic acid had several side effects including gastrointestinal symptoms and ischemic events . ace inhibitors , which comprise a class of anti - hypertensive medications , may have unsolicited influence on blood pressure , and their effect on csdh is yet to be proven27 ) . second , the number of patients enrolled in this study is too small to reach a statistical significance . further study with a large number of patients is needed to establish the criteria for conservative management . despite these limitations , when physicians encounter a similar situation , our study might provide guidance in selecting the treatment modality . several hypotheses about the mechanism of increase in the hematoma volume have been proposed since a long time . one hypothesis is the osmotic pressure theory after formation of internal and external capsules . as the hematoma volume increases , tension in the hematoma capsule is increased followed by micro - tear of its capillary vessels . then hemorrhage occurs and it becomes a factor involved in increasing the osmotic pressure in the hematoma25 ) . this osmotic theory recently been doubted due to the following factors : 1 ) there was no significant increase in the volume in this theory when hematoma membranes were used ; 2 ) fresh erythrocytes were always introduced in the hematoma fluid on repeated tapping ; 3 ) it was not possible to prove that the arachnoid acts as a membrane permeable to cerebrospinal fluid ; and 4 ) it has been shown that albumin , the most osmotically active protein , can not be found in destroyed red blood cells but is derived from the plasma17 ) . rather , hematoma expansion is thought to result from repeated micro - hemorrhage from the fragile neo - membranes413 ) . the phenomenon of recurrent bleeding from the hematoma capsule as an etiological factor for the development of chronic sdh was assumed by putnam and cushing in 1932 , and later by dandy . currently , various clinical and experimental studies indicate that fibrinolysis and liquefaction of the initial clot occur rapidly and subsequently inhibit the blood coagulation system in the hematoma . additionally , the byproducts of blood breakdown and the fibrinolytic process also cause thickening of the inner dural layer with ingrowing neocapillaries which play an important role in the leakage of blood , causing enlargement of the subdural collection due to microhemorrhage and further increase in the fibrinolytic activity . the correlation between this cycle of re - bleeding and fibrinolysis , and reabsorption of the subdural collection will determine whether the csdh will resolve , persist or enlarge24 ) . some authors stated that the hyperfibrinolytic activity has been proved to be critical for liquefaction of the hematoma and progression of csdh . several studies have indicated the hyperfibrinolytic and coagulative activity in csdh and some studies have shown that increased permeability of the capillaries in the hematoma outer membrane can influence the enlargement of a csdh5 ) . based on this rationale , they applied an antifibrinolytic agent for prevention of enlargment and recurrence of csdh11 ) . previous reports on spontaneous resolution of csdh without special medication and surgery have been published 1791012162022 ) . most of them were case studies which were composed of small cases series with 4 or 5 cases in one report . to the best of our knowledge , our study has the highest number of enrolled cases compared to the studies reported so far , and unlike other investigations , this study has a unique aspect as it considered the rate of spontaneous resolution of csdh . the mean age of this group was 66.5 years ( range , 21 to 87 years ) . most of them , except for 3 patients had a trauma history such as traffic accident , fall , and blunt trauma . mean hematoma thickness was 16.7 mm ( range , 9 to 34 mm ) and there was no data for thickness in 7 cases . the average degree of midline shift was 2.8 mm ( range , 5 to 12 mm ) . naganuma et al.20 ) reported 4 cases of spontaneous resolution of csdhs and suggested the three following characteristic ct findings associated with spontaneous resolution of chronic sdh : low density hematoma or iso - dense hematoma , small size , and ventricular dilatation . except for one case , there were no other cases of ventricular dilatation in this group and the mean evan 's ratio ranged from 0.19 to 0.32 . horikoshi et al.9 ) reported that the clinical and radiological findings of four cases ( five hematomas ) were compared to those of 19 surgical cases . they considered that spontaneously resolving csdh were asymptomatic or only caused mild transient headache , and disappeared within 4 to 9 months after head injury . all spontaneously resolving sdhs were located in the frontal region , and maximum thickness and midline displacement were less 5 mm . the mean value of midline displacement in our study was 5.2 mm and thickness was 13.3 mm . we suggest that close observation could be chosen when hematoma volume or thickness is below 43 ml and 13 mm , respectively , and midline shift is below 5 mm on brain ct scans . according to our results this shows that the patients who have a definite large amount of csdh ( > 43 ml ) should be informed about the possibility of surgery during the close observation period . especially , horikoshi et al.11 ) suggested that brain ct scan demonstrated a low density line between the hematoma and the cerebral cortex , indicative of remaining cerebrospinal fluid space in four of five hematomas9 ) . in our study , in 7 patients ( 53.8% ) of the spontaneously resolution group , the low density line on the initial brain ct scans was visible . while in only one patient ( 33.3% ) of the progression - surgery group , the low density line was visible . some authors suggested that age over 70 years , worsening mental function , the presence of brain atrophy , and absence of clinical and radiological symptoms due to increased intracranial pressure are clinical and radiological findings that allow one to choose conservative therapy . in our study , the number of patients who were aged over 70 years was 5 ( 38.5% ) in the spontaneously resolution group . however , in this aging society , age can not be an independent factor that affects the decision making process . if the symptoms have not begun to resolve after 7 or 10 days of clinical observation , surgery should be performed immediately in patients with progressive neurological deficits and increase in size of the sdh regardless of the age22 ) . we suggest that the treatment modality could be determined according to the patient 's symptoms , and the clinical indication for close observation is patients who do not have any symptoms or patients who have moderate headache without neurological deterioration ( mgs 0 or i ) . nakamura et al.21 ) stated that the decreased fibrinolytic activity of the hematoma capsule and the fluid might have caused a spontaneous resolution . they also noted that the resolving hematoma appeared as a low density area or an area of decreasing density , from mixed to low , in successive ct scans . of the 209 cases , primary surgical intervention was performed in 137 ( 65.5% ) patients . the remaining 72 ( 34.5% ) patients were simply observed . in this report , the natural course or results obtained in the simply observed patients were not described in detail . lee et al.14 ) reported about the forty patients who were admitted to their institution due to csdh and finally only two ( 5% ) patients had a spontaneously absorbed csdh . some authors believed that only reduction in the internal pressure of a hematoma will cure csdh , and therefore , the problem may be solved nonsurgically if the internal pressure within a sdh can be reduced by any method , not necessarily craniotomy . hence , nonsurgical treatment consisting of osmotherapy with 20% mannitol was performed in a consecutive series . disappearance or marked reduction of the hematoma content and complete clinical recovery were obtained in 22 out of 23 patients25 ) . sun et al.24 ) reported regarding corticosteroid treatment for 26 csdh patients who had gcs score of 15 with no neurological deficits , but they had symptoms such as headache or unsteady gait ( mgs i ) . among them , only one case ( 4% ) required surgical drainage . they supported the rationale for dexamethasone treatment suggested by experimental studies that the development of csdh is due to an inflammatory process induced by the presence of erythrocyte breakdown products in the subdural space24 ) , and they showed that corticosteroids inhibited the formation of protein permeable membranes and decreased the size of chronic hematomas in rats6 ) . also , delagado - lpez et al.3 ) reported that although 21.8% of the patients on dexamethasone ultimately required surgical drain , a favorable outcome was obtained in 96% of the patients who had mgs i and ii . the rationale for the use of dexamethasone in csdh lies in its anti - angiogenic properties over the subdural clot membrane , as it is derived from experimental studies and very few clinical observations have been published . surgical evacuation of csdh is known to achieve excellent results , but there are no well - designed trials comparing medical versus surgical therapies3 ) . in the study by delgado - lpez et al.3 ) , they suggested that the only indication for surgery as an initial emergency treatment may be the case of a patient with depressed level of consciousness and severe neurological deterioration occurring acutely and it seems reasonable to propose the steroid trial as the first therapeutic choice . even though they conservatively treated mgs ii patients using corticosteroids , their outcome was almost favorable . we think it may be a noteworthy result , and when patient has a moderate neurologic deficit or decreased mentality and if the patient 's condition is very poor to undergo surgery , corticosteroid treatment could be chosen . in a recent report , tranexamic acid has been shown to prevent the early stages of csdh that can occur after head trauma and the recurrence of csdh after surgery . tranexamic acid is an antifibrinolytic agent that has fewer side effects than other agents and is widely used for hemostasis . in several studies assessing the role of hyperfibrinolytic activities in the liquefaction and enlargement of csdh5 ) , they hypothesized that tranexamic acid would inhibit the hyperfibrinolytic activity within the csdh11 ) . there is increasing evidence that impaired angiogenesis in the neomembrane and localized inflammation play a key role in the formation of a csdh . impaired angiogenesis results in blood leakage from immature vessels of the neomembrane and localized inflammation hampers angiogenesis and prevents leaked blood from being absorbed . 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitors , which are the first - line treatment in patients with high cholesterol and coronary heart disease , have been demonstrated to improve angiogenesis and reduce inflammation26 ) . the researchers reported that 22 of the 23 patients experienced improvements in symptoms , and reduction in hematoma volume within the first month of the treatment . hematoma was completely resolved in 17 patients ( 77.3% ) and shrank in 5 patients ( 22.7% ) within 3 months after the treatment was initiated26 ) . because the csdh is characterized by pathological vascularization of the parietal membrane , plasma leakage from immature vessels the researchers tested the hypothesis that the antiangiogenic mechanism of ace - inhibitor treatment for the control of arterial hypertension reduces the risk of recurrence of csdh . their data suggest that ace - inhibitor treatment for the control of arterial hypertension lowers the risk of recurrence in patients undergoing operation for csdh and possibly even the development of csdh . this effect might be the result of an antiangiogenic mechanism of ace - inhibitors27 ) . first , the prolonged presence of a hematoma on the cerebral surface even with low pressure may raise fears of an ill effect on cerebral function . the usual surgical treatment eliminates the hematoma as soon as it is discovered , while nonsurgical treatment can not eliminate a mass lesion by one effort25 ) . the third drawback is that longer follow - up periods may be required . because csdh frequently occurs in the elderly group , special attention it should be performed with combined sufficient hydration and with careful attention being paid to the electrolyte balance . gastric mucosal hemorrhage , edema , and increased risk of infection are associated with use of steroids2 ) . also , tranexamic acid had several side effects including gastrointestinal symptoms and ischemic events . ace inhibitors , which comprise a class of anti - hypertensive medications , may have unsolicited influence on blood pressure , and their effect on csdh is yet to be proven27 ) . second , the number of patients enrolled in this study is too small to reach a statistical significance . further study with a large number of patients is needed to establish the criteria for conservative management . despite these limitations , when physicians encounter a similar situation , our study might provide guidance in selecting the treatment modality . we suggest that the treatment modality should be determined according to the patient 's symptoms and clinical condition and close observation could be performed in patients who do not have any symptoms or in patients who have mild to moderate headache without neurological deterioration ( mgs grade 0 or i ) . when a patient has a moderate neurologic deficit or decreased mentality and if the patient 's condition is too poor to undergo surgery , corticosteroid treatment could be chosen . also , we suggest that close observation could be chosen when hematoma volume or thickness is below 43 ml or 13 mm , respectively , and midline shift is below 5 mm on brain ct scan .

endocrine disrupting chemicals ( edcs ) are a structurally diverse group of compounds that may adversely affect the health of humans , wildlife and fisheries , or their progenies , by interaction with the endocrine system . it has been suggested that edcs pose a potential risk and can alter the hormone balance in humans and wildlife . these environmental xenobiotics may impair the normal embryonic development and disrupt normal reproductive functions in adulthood [ 3 , 4 ] . organochlorine pesticide , such as 2,2-bis(4-chlorophenyl)-1,1,1-trichloroethane ( ddt ) , is a widespread environmental xenobiotics . ddt is a persistent organic pollutant with the features of wide pollution , huge harm , and longtime persistence in environment , and entering the living system via biomagnification of food chain . it may persist mainly by the forms of metabolite 1,1-dichloro-2,2 bis(p - chlorophenyl ) ethylene ( p , p-dde ) in the blood lipid and adipose tissue for several decades [ 3 , 57 ] . though having being banned or restricted for three decades , ddt is still being used for control of vectors in public health in some developing countries [ 810 ] . it has been reported that some abnormalities in sexual development in rats and wildlife might be associated with exposure to p , p-dde [ 11 , 12 ] . p , p-dde is antiandrogenic and can inhibit androgen binding to the androgen receptor . cell death by apoptosis is a part of normal development and maintenance of homeostasis , but it is also involved in pathological situation associated with sterility . in the testis , apoptosis is such a common programmed event that 75% of germ cells are reduced by spontaneous apoptosis . however , excessive or inadequate apoptosis of testicular cells will result in abnormal spermatogenesis or testicular tumors . the sertoli cell is the only somatic cell found in the testicular seminiferous tubule of mammalian . it plays major roles in the maintenance and control of spermatogenesis , such as structural support , participation in germ cell 's movement and spermiation , nourishing germ cells by secreting the tubular fluid and numerous factors [ 16 , 17 ] . therefore , the supporting capacity of sertoli cells in toto is a limiting factor controlling germ cell 's proliferation and output . since the number of sertoli cells can only determine a finite number of spermatozoa in the seminiferous tubules , any agent that impairs the viability of sertoli cells may cause serious effect on spermatogenesis . though there have been some reports concerning p , p-dde - induced toxicity in male reproductive system [ 20 , 21 ] , few studies investigated sertoli cells . we have previously examined the effects of p , p-dde on sertoli cells . that study demonstrated that p , p-dde could affect the expression of several functional marker genes including transferrin ( tf ) and androgen - binding protein ( abp ) . besides , ros generation might play a critical role in the initiation of p , p-dde - induced apoptosis in rat sertoli cells through mitochondria - mediated pathway . the aim of the present study was to determine the effects of different concentrations of p , p-dde on apoptosis of sertoli cells and to investigate fasl - dependent apoptotic pathway . we investigated the expressions of fasl and activation of nf-b in p , p-dde - induced apoptosis . as caspase family members play an important role in spermatogenesis and apoptosis , it is also of interest to determine the regulation of caspase-3 and -8 in p , p-dde induced apoptosis . 18- to 20-day - old male sprague - dawley ( sd ) rats were purchased from tongji medical college animal laboratory ( wuhan , china ) and acclimatized in accordance with the guide for the care and use of laboratory animals published by the ministry of health of china . primary culture of sertoli cells was prepared using sequential enzymatic procedures that had been previously described with modifications . briefly , testes from 18- to 20-day - old sprague - dawley rats ( day of birth = day 0 ) were collected , excised rapidly , decapsulated , cut into small fragments , and washed twice in hanks ' balanced salt solution ( hbss ) . the fragments were then digested sequentially in 10 ml of hbss containing 0.25% trypsin ( amresco , solon , oh , usa ) and 0.1% collagenase ( type i , invitrogen , grand island , ny , usa ) in a shaking water bath ( 35c , 120 cycles / min ) for 30 minutes . digested cells suspension was washed extensively with no - phenol red - dulbecco 's modified eagle 's medium ( dmem , invitrogen , grand island , ny , usa ) to remove peritubular cells , followed by filtration through b - d falcon cell strainers ( nylon mesh size , 70 m ) . the final sertoli cells suspension was supplemented with 5% fetal bovine serum ( invitrogen , grand island , ny , usa ) and seeded in cultured bottle in a humidified atmosphere of 95% air5%co2 at 35c . after 24 hours , these cells were extensively washed twice with hbss solution to remove unattached cells , then treated with 20 mm ph 7.4 tris - hcl for 5 minutes and with serum starvation for 24 hours . p , p-dde ( dr co. , augsburg , germany ) was dissolved in dimethylsulfoxide ( dmso , sigma - aldrich , st . louis , mo , usa ) as stock solution and diluted with culture medium to different concentrations before being added to the cells in culture . the final dmso concentration in the medium was not more than 0.3% ( v / v ) , which did not affect the viability of sertoli cells . this assay is dependent on the cellular reduction of mtt ( 3-(4 , 5-dimethylthiazol-2-yl)-2 , 5-diphenyltetrazolium bromide ) by the mitochondrial dehydrogenase of viable cells to a blue formazan product which can be measured spectrophotometrically . louis , mo , usa ) was added into each well with the final concentration of 5 mg / ml for 4 hours . then the culture plate was shaken for 10 minutes . the optical density ( od ) of each well was measured at 490 nm with an elisa reader ( bio - rad instrument group , hercules , ca , usa ) . cellular viability ( % ) was calculated using the following equation : cellular viability ( % ) = ( odtreatment / odcontrol)100 . ao / eb double staining : four l of ao / eb ( ao : 0.5 mg / ml , amresco , usa ; eb : 0.5 mg / ml in pbs , sigma , usa ) dye mixture was mixed with 100 l treated and untreated cells of 1 10 cells / ml , and then 10 l of cells were added onto the glass slides to test by fluorescence microscopy ( olympus , japan ) using epi - illumination and a filter combination suitable for observing fluorescein immediately with a magnification of 40 . flow cytometric analysis : sertoli cells were seeded in a 6-well plate , and apoptosis was tested by apoptosis detection kit ( molecular probes , eugene , or ) according to the instruction . in brief , the single sertoli cell was collected and incubated in the buffer containing 1 g / ml pi and 5 l annexin v in the dark at room temperature for 15 minutes . then the stained cells were analyzed by an facs calibur flow cytometer ( becton dickinson , san jose , ca , usa ) . the data were analyzed with cellquest software ( becton dickinson , san jose , ca , usa ) . the total rna was extracted with trizol reagent ( life technologies gmbh , karlsruhe , germany ) according to manufacturer 's instructions . the medium of 100 ml culture bottle was discarded , 1.0 ml trizol was added , and the contents were then placed in 1.5-ml ep tube without rnase . to isolate the samples , , 0.2 ml chloroform was added , and the tubes were shaken for 15 seconds and put on ice for 2 - 3 minutes , then they were centrifuged at 12000 rpm for 15 minutes at 4c . the colorless upper aqueous phase containing the rna was transferred to a new ep tube without rnase . an equal volume of isopropanol was added , and the rna was precipitated by centrifugation . the rna pellet was washed with 75% ethanol and dissolved in water treated with diethylene pyrocarbonate ( 1020 l ) . rna purity was tested by eppendorf biophotometer ( eppendorf , germany ) , showing an optical density ratio ( od260/od280 ) between 1.8 and 2.0 . titanium one - step rt - pcr kit ( bdbiosciences co. , beijing , china ) was employed to amplify the fasl , caspase-3 and -8 , and -actin sequences . the master mixture included 5 l 10 one - step buffer , 1 l 50 dntp mix , 0.5 l recombinant rnase inhibitor ( 40 units/l ) , 25 l thermostabilizing reagent , 10 l gc - melt , 1 l oligo(dt ) primer , and 1 l 50 rt - titanium taq enzyme mix . following the addition of 1 l rna sample , 2 l pcr primer mix , and 3.5 l rnase - free water into the reaction system , the final volume was 50 l . ( reverse transcription ) , 95c for 15 minutes ( to active taq enzyme ) , 94c for 30 seconds ( denaturation ) , 53c for 30 seconds ( primer annealing ) , and 72c for 1 minute ( primer extension ) , and final extension for 10 minutes at 72c , with 4c pause . after pcr , 2.5 l reaction mix was analyzed on 2% agarose gel with ethidium bromide ( 0.5 mg / ml ) . the levels of fasl and caspase-3 and -8 expression were measured by densitometric analysis and standardized by comparison to the -actin control using a digital imaging and analysis system ( biocapt mv software ) . the primer sequences were designed according to the related references and cdna sequence from genbank ( table 1 ) . sertoli cells ( 5 10 cells ) were lysed in 100 l lysis buffer ( 10 mm edta , 2 mm egta , 20 mm tris - hcl ( ph 7.4 ) , 250 mm sucrose , 0.1% triton x-100 , 1 mm phenylmethylsulfonyl chloride , and 100 mm pmsf ) and scraped from the culture plate to detect fasl and caspase proteins . each protein sample was measured by a bio - rad dc kit ( bio - rad , hercules , ca ) . cells extracts were separated in sds - polyacrylamide gel and transferred electrophoretically onto a pvdf membrane . the membranes were blocked in pbs containing 5% ( w / v ) nonfat dry milk and then incubated at 4c overnight with anti - fasl ( bs-0216r , beijing biosynthesis biotechnology co. , ltd . , beijing , china ) at a 1:100 dilution , antiprocaspase-3 ( santa cruz biotechnology , inc . , santa cruz , ca ) at a 1:200 dilution , anti - procaspase-8 ( wako , saitama , japan ) at a 1:200 dilution or anti--actin ( santa cruz biotechnology , inc . , santa cruz , ca ) at 1:200 dilution . then the membranes were incubated at 37c for 2 hours with the secondary antibody conjugated with horseradish peroxidase ( amersham pharmacia , buckinghamshire , uk ) diluted at 1:5000 . and immune - reactive proteins were detected using ecl western blotting detection system ( pierce biotechnology inc . , sertoli cells were immunofluorescence - labeled according to the manufacturer 's instruction using a cellular nf-b translocation kit ( beyotime biotech inc . , briefly , after washed and fixed , cells were incubated with a blocking buffer for 1 hour to suppress nonspecific binding . next , cells were incubated with the primary nfb p65 antibody for 1 hour , followed by incubation with a cy3-conjugated secondary antibody for 1 hour , then with dapi for 5 minutes before observation . p65 protein and nuclei exhibited red and blue fluorescence , respectively , and could be simultaneously viewed by laser scanning confocal microscope at an excitation wavelength of 350 nm for dapi and 540 nm for cy3 . significance was assessed by anova following appropriate transformation to normalized data and equalized variance where necessary . mean values were compared by subsequent student - newman - keuls ( snks ) using the spss statistical package 12.0 ( spss inc . , sertoli cells were treated with 10 , 30 , 50 , or 70 m p , p-dde for 24 hours and analyzed with mtt assay . as shown in figure 1 , the viability of sertoli cells was reduced after treatment with 50 or 70 m p , p-dde ( p < .05 ) . in 70 m p , p-dde - treated group , the cellular viability was about 53.54% of that in control group . based on this result , p , p-dde at concentration of 10 , 30 , or 50 m was used in subsequent experiments . sertoli cells were incubated in various concentrations of p , p-dde ( 10 , 30 , 50 m ) for 24 hours . in other experiments , cells were preincubated with 300 m nac for 1 hour followed by incubation with 50 m p , p-dde for 24 hours . then apoptosis was examined by ao / eb double staining and flow cytometric analysis . ao / eb double staining : morphologically , the early apoptotic cells , because of membrane integrity , exhibited stained green with ao , some nuclei exhibited bright condensed or fragmented chromatin , and the late apoptotic cells , because of the lost membrane integrity , were stained red with eb . sertoli cells with 30 or 50 m p , p-dde treatment , due to the increase in cell membrane permeability , showed green and red fluorescence and exhibited nucleus fragment , which could be blocked by preincubation with nac ( figure 2 ) . flow cytometric analysis : in our previous study , flow cytometric analysis showed that p , p-dde caused apoptotic cell death in a dose - dependent manner . after treatment of 50 m p , p-dde , apoptosis of rat sertoli cells reached a peak value of 30% , which could be attenuated by nac preincubation ( figure 3 ) . the mrna levels of fasl and caspase-3 and -8 were determined by rt - pcr in sertoli cells exposed to different doses of p , p-dde ( i.e. , 10 , 30 , and 50 m ; see figures 4(a)4(c ) ) . results from denistometric analyses of the intensity of various bands are illustrated in figure 4(d ) . fasl mrna level in 50 m dose group was significantly higher than that of the control group ( p < .05 ) . caspase-3 mrna levels of sertoli cells in 30 and 50 m p , p-dde - treated groups were markedly higher than that of the control group ( p < .05 ) . moreover , compared with the control group , caspase-8 mrna levels in different doses of p , p-dde were increased , and the differences were statistically significant ( p < .05 ) . as seen in figure 5(d ) , p , p-dde treatment induced an increase of fasl in 50 m dose group . a significant reduction was observed in procaspase-3 over 30 m p , p-dde and procaspase-8 over 10 m p , p-dde ( figure 5(e ) ) , suggesting the caspase activation , respectively . nuclear translocation of nf-b in rat sertoli cells was observed by laser scanning confocal microscopy . as seen in figure 6 , morphologically , p65 protein and nuclei exhibited red and blue fluorescence , respectively , and could be simultaneously viewed under laser scanning confocal microscope . in the present study , p , p-dde could induce apoptosis of sertoli cells through a fasl - dependent pathway including nuclear translocation of nf-b , increase of the fasl expression , and activation of the caspase-8 and -3 . recent discoveries have significantly advanced the understanding of biochemical and genetic requirements of distinct apoptosis pathways ( i.e. , mitochondria , death - receptor , and endoplasmic reticulum - mediated apoptosis ) and their dysregulation in disease . in the case of death - receptor , there are several members that belong to tumor necrosis factor ( tnf ) receptor superfamily , including fas ( cd95 , apol ) , tnfr1 ( p55 , cd120a ) , and death receptors 3 , 4 , and 5 ( dr3 , 4 , and 5 ) . the fas system is a widely recognized apoptosis signal transduction pathway in which a ligand - receptor interaction triggers the cell death pathway . fas is a surface receptor that triggers apoptotic cell death when cross - linked by fasl [ 27 , 28 ] . once activated , caspase-8 transduces a signal to effector caspases , including caspases-3 , -6 , and -7 , and eventually leads to the hydrolysis of cytosolic and nuclear substrates . the impact of organochlorine pesticides ( ocps ) on the reproductive function was put forward in 1967 by ratcliffe , who is the first to report eggshell thinning in some raptorial species . animal experiment demonstrated that exposure of rats to 50 and 100 mg ddt / kg b.wt during 10 consecutive days induced reproductive toxicology . the relative weight of testes and the number as well as the motility of epididymal spermatozoa were reduced . meanwhile , fsh and lh of serum were increased . the present study demonstrated that p , p-dde could induce a concentration - dependent increase in apoptosis of rat sertoli cells . in the normal state , sertoli cells express a basal level of fasl , which triggers apoptosis of a few fas - positive germ cells . some literatures point out that sertoli cells also express fas , and germ cells express fasl [ 32 , 33 ] . sertoli cells have such multiple functions as providing the cytoarchitectural support and microenvironment for developing germ cells . if sertoli cells are injured and the supporting capacity of sertoli cells is reduced , germ cells can not be supported adequately . our results demonstrated that fasl mrna level for 50 m dose group was significantly higher than that of the control group , and fasl protein levels increased with the increase of dose of toxicant after the cells were incubated by various concentrations of p , p-dde for 24 hours . this result indicated that fasl mrna levels increased and could lead to the enhancement of fasl protein expression , then activate the fas system , and eventually lead to the apoptosis of sertoli cells and abnormality of spermatogenesis , which might be a possible mechanism elucidating male reproductive abnormality caused by p , p-dde . similar studies were reported by previous findings for other categories of toxicants such as mono-(2-ethylhexyl ) phthalate , 2 , 5-hexanedione , diethylstilbestrol , and carbon disulfide . nf-b is present as a dimer of protein components ( p65/p50 ) in a latent / inactive form , bound to inhibitory protein ib in the cytoplasm . the liberated nf-b then rapidly translocates to the nucleus , where it regulates transcription by binding to consensus b sites in the promoters of the target genes . in the rat testis , the nf-b complex of p65 and p50 proteins is found to be constitutively expressed in the nuclei of sertoli cells at all stages of spermatogenesis . interestingly , nf-b can exert both pro- and antiapoptotic effects in different cells types . whether nf-b promotes or inhibits apoptosis seems to depend on the specific cell type and the type of the inducer . nf-b p65 complex can directly stimulate the expression of apoptosis - inducible genes such as fas , fasl , and death receptors 4 and 5 . for example , the promoters of the mouse fasl have b sites and can be upregulated by activation - induced cell death in t cells . kasibhatla demonstrated in jurkat t cells that activation of nf-b and ap-1 and their transactivation of fasl regulated vp-16- and vm-26-induced apoptosis via the expression of fasl . our study demonstrated that in vitro exposure to p , p-dde could induce an increase in nf-b activation and the expression of fasl in rat sertoli cells . the results suggested that nf-b could promote cell apoptosis through the fasl - dependent pathway in vitro exposure to p , p-dde in rat sertoli cells . there is a general agreement that male reproductive organs are particularly susceptible to the deleterious effects of reactive oxygen species ( ros ) and lipid peroxidation , which ultimately lead to impaired fertility . nf-b is a redox - regulated transcription factor , and nf-b heterodimer activation requires ib cleavage , which needs an oxidizing milieu . conversely , various antioxidants potently inhibit the fasl expression . in our previous studies , p , p-dde could induce apoptosis of sertoli cells via activation of mitochondria - mediated pathway including elevation of ros , decrease in m and sod activity , and increase in the leakage rate of ldh and mda level . our present study demonstrated that in vitro exposure to p , p-dde could induce increase of fasl in rat sertoli cells , and preincubation with nac could attenuate this effect successfully . all of our studies suggested that ros generation might play a critical role in the initiation of p , p-dde - induced apoptosis of sertoli cells through mitochondria - mediated and fasl - dependent pathway ( figure 7 ) . caspases are a family of cysteine proteases that are a central component of the apoptotic machinery . caspases are synthesized as inactive precursors ( procaspases ) that are cleaved at specific aspartate residues to generate the active subunits . among fasl - dependent apoptosis , caspase-8 plays the most important role in transduction of death signals . giammona et al . have indicated that mono-(2-ethylhexyl ) phthalate ( mehp ) , a well - characterized sertoli cell toxicant , can decrease levels of procaspase-8 and increase levels of procaspase-8 cleavage products in mice testis . this result is consistent with our study in which in vitro exposure to p , p-dde induces in rat sertoli cells an increase in caspase-8 mrna levels and a reduction in procaspase-8 protein levels . in addition activated caspase-3 can interact with a large number of targets within an affected cell to bring about its destruction by apoptosis . observed an increased activity of caspase-3 in the rat testis , 3 hours and 12 hours after 0.4 mg / g of mehp - exposure . our result demonstrated that in vitro exposure to p , p-dde could induce an increase in caspase-3 mrna levels and a reduction in procaspase-3 protein levels in rat sertoli cells . these results indicated that caspases were activated in p , p-dde - induced apoptosis of sertoli cells . the present data indicated that p , p-dde could induce apoptosis of rat sertoli cells through a fasl - dependent pathway . there are three major apoptosis pathways in the mammalian cells : mitochondria , death - receptor , and endoplasmic reticulum - mediated apoptosis . it is unlikely that a single mechanism regulates apoptosis in the testis , but rather that multiple apoptotic pathways are involved in the complex process of apoptosis . our previous study also demonstrated that p , p-dde could induce mitochondria - mediated apoptosis in sertoli cells . some studies showed the cell apoptosis through endoplasmic reticulum - mediated pathway in the rat testis [ 5557 ] . hence it is noted that endoplasmic reticulum - mediated apoptosis pathway and relationship among three apoptosis pathways in rat sertoli cells exposure to p , p-dde should be regarded as priority in the next studies . in conclusion , p , p-dde induces increases in apoptotic rate of sertoli cells by a mechanism possibly involving fasl - dependent pathway . in vitro exposure to p , p-dde can enhance ros and oxidative stress , then induce an increase in nf-b activation , fasl mrna , and protein levels in rat sertoli cells . upon engagement of fasl to fas , an intrinsic program of apoptotic death finally , apoptosis of sertoli cells is mediated by a terminal executioner , caspase-3 , thereby disturbing the spermatogenic process . the present study has provided preliminary but important data for further study of reproductive endocrine disorder resulting from environmental edcs .

mice were housed in facilities approved by the association for assessment and accreditation of laboratory animal care at the university of north carolina ( unc ) animal facility and handled according to the unc office of animal care and use . the original breeding pairs of nod.cg-prkdc il2rg tg(hla - a2.1)enge / sz and nod.cg-prkdcemv30-tg(hla-a/h2d/b2m)1dvs/dvsj mice were previously described ( 23,24 ) . mice were used at 814 weeks old and defined as diabetic if two consecutive weekly blood glucose measurements were 250 mg / dl . all protocols involving the collection and use of pbmcs were approved by the unc office of human research ethics and conducted according to institutional review board approval of human subjects research . peripheral blood from patients diagnosed with type 1 diabetes or nondiabetic donors ( ndd ) after isolation and purification , cells were tested for expression of hla - a2 by flow cytometry using fluorescein isothiocyanate labeled bb7.2 monoclonal antibody ( abcam , cambridge , ma ) . hla - a2 pbmcs from type 1 diabetic patients or ndds were adoptively transferred into mice . nod - scid/c / a2 mice were intraperitoneally injected with 1752 10 hla - a2 pbmcs in 400 l of pbs from type 1 diabetic patients or ndd . spleen , pln , blood , and islets were removed from recipient mice 2 to 6 weeks after transfer . briefly , pancreata were perfused with a 2 mg / ml solution of collagenase p ( sigma - aldrich , st . islets were purified using a ficoll pm 400 ( sigma - aldrich ) gradient , handpicked , counted , and then cultured overnight in rpmi-1640 containing 10% fbs and 4 ng / ml recombinant human interleukin ( il)-2 ( peprotech , rocky hill , nj ) . cell suspensions were stained using fluorescently - labeled mouse antibodies to human surface markers : cd45 ( percp ) , cd19 ( pecy7 ) , cd8 ( pb ) , cd3 ( antigen - presenting cell [ apc ] ) , and cd4 ( apc - cy7 ) ( ebioscience , san diego , ca ) , or cd3 ( po ) , cd3 ( ptr ) , and cd4 ( po ) ( invitrogen , carlsbad , ca ) . samples were analyzed on a beckman - coulter ( dako , glostrup , denmark ) cyan adp using summit v4.3.01 software . mice that had > 2 10 human cd45 cells in their spleen were included in our analysis . peptides igrp265273 ( vlfglgfai ) , ia-2797805 ( mvwesgctv ) , iapp513 ( klqvflivl ) , and insulinb1018 ( hlvealylv ) were purchased from genscript ( piscataway , nj ) at > 90% purity , dissolved in dmso , and stored at 20c . a2/igrp , a2/ia-2 , a2/iapp , and a2/insulin tetramers were assembled with these peptides as described ( 26 ) . briefly , hla - a2 and human 2-microglobulin were produced in escherichia coli and refolded with peptide in vitro . refolded peptide major histocompatibility complex ( mhc ) monomer was purified by high - performance liquid chromatography , biotinylated using biotin protein ligase , and assembled into tetramers by conjugation with ultraavidin - pe ( leinco , st . cells ( 23 10 ) were incubated overnight in complete rpmi-1640 containing 10% fbs and 4 ng / ml recombinant human il-2 ( peprotech ) . after 24 h , the cells were incubated with igrp , ia-2 , iapp , and insulin peptide pool or individually at 40 g / ml of each peptide . a2/igrp , a2/ia-2 , a2/iapp , and a2/insulin pe - conjugated tetramers ( 2.5 l each ) along with anti - cd28 ( 1 g / ml ) was added . cells were incubated at 37c , 5% co2 for 2 h. brefeldin a was added to inhibit protein secretion , followed by an additional 4-h incubation , placed on ice , stained with fluorescently labeled surface antibodies , fixed , permeabilized , and stained with human anti - interferon ( ifn)- monoclonal antibody ( ebioscience ) . mice were housed in facilities approved by the association for assessment and accreditation of laboratory animal care at the university of north carolina ( unc ) animal facility and handled according to the unc office of animal care and use . the original breeding pairs of nod.cg-prkdc il2rg tg(hla - a2.1)enge / sz and nod.cg-prkdcemv30-tg(hla-a/h2d/b2m)1dvs/dvsj mice were previously described ( 23,24 ) . mice were used at 814 weeks old and defined as diabetic if two consecutive weekly blood glucose measurements were 250 mg / dl . all protocols involving the collection and use of pbmcs were approved by the unc office of human research ethics and conducted according to institutional review board approval of human subjects research . peripheral blood from patients diagnosed with type 1 diabetes or nondiabetic donors ( ndd ) after isolation and purification , cells were tested for expression of hla - a2 by flow cytometry using fluorescein isothiocyanate labeled bb7.2 monoclonal antibody ( abcam , cambridge , ma ) . hla - a2 pbmcs from type 1 diabetic patients or ndds were adoptively transferred into mice . nod - scid/c / a2 mice were intraperitoneally injected with 1752 10 hla - a2 pbmcs in 400 l of pbs from type 1 diabetic patients or ndd . spleen , pln , blood , and islets were removed from recipient mice 2 to 6 weeks after transfer . briefly , pancreata were perfused with a 2 mg / ml solution of collagenase p ( sigma - aldrich , st . islets were purified using a ficoll pm 400 ( sigma - aldrich ) gradient , handpicked , counted , and then cultured overnight in rpmi-1640 containing 10% fbs and 4 ng / ml recombinant human interleukin ( il)-2 ( peprotech , rocky hill , nj ) . cell suspensions were stained using fluorescently - labeled mouse antibodies to human surface markers : cd45 ( percp ) , cd19 ( pecy7 ) , cd8 ( pb ) , cd3 ( antigen - presenting cell [ apc ] ) , and cd4 ( apc - cy7 ) ( ebioscience , san diego , ca ) , or cd3 ( po ) , cd3 ( ptr ) , and cd4 ( po ) ( invitrogen , carlsbad , ca ) . samples were analyzed on a beckman - coulter ( dako , glostrup , denmark ) cyan adp using summit v4.3.01 software . mice that had > 2 10 human cd45 cells in their spleen were included in our analysis . peptides igrp265273 ( vlfglgfai ) , ia-2797805 ( mvwesgctv ) , iapp513 ( klqvflivl ) , and insulinb1018 ( hlvealylv ) were purchased from genscript ( piscataway , nj ) at > 90% purity , dissolved in dmso , and stored at 20c . a2/igrp , a2/ia-2 , a2/iapp , and a2/insulin tetramers were assembled with these peptides as described ( 26 ) . briefly , hla - a2 and human 2-microglobulin were produced in escherichia coli and refolded with peptide in vitro . refolded peptide major histocompatibility complex ( mhc ) monomer was purified by high - performance liquid chromatography , biotinylated using biotin protein ligase , and assembled into tetramers by conjugation with ultraavidin - pe ( leinco , st . cells ( 23 10 ) were incubated overnight in complete rpmi-1640 containing 10% fbs and 4 ng / ml recombinant human il-2 ( peprotech ) . after 24 h , the cells were incubated with igrp , ia-2 , iapp , and insulin peptide pool or individually at 40 g / ml of each peptide . a2/igrp , a2/ia-2 , a2/iapp , and a2/insulin pe - conjugated tetramers ( 2.5 l each ) along with anti - cd28 ( 1 g / ml ) was added . cells were incubated at 37c , 5% co2 for 2 h. brefeldin a was added to inhibit protein secretion , followed by an additional 4-h incubation , placed on ice , stained with fluorescently labeled surface antibodies , fixed , permeabilized , and stained with human anti - interferon ( ifn)- monoclonal antibody ( ebioscience ) . previous studies using human hscs have shown nod - scid/c mice support growth , survival , and differentiation of cd34 hsc ( 17 ) . hla - a2 * 0201 is the most commonly expressed hla class i allele in europeans ( 45% ) and is permissive for the development of type 1 diabetes in humans and transgenic mice . therefore , we evaluated the ability of hla - a2matched pbmcs from ndd and type 1 diabetic patients to successfully engraft in nod - scid/c / a2 mice . flow cytometry analyses confirmed the presence of human cd45 cells in the spleen of mice receiving pbmcs from ndd or type 1 diabetic patients ( fig . human cd45 cells were also found in the blood and pln of nod - scid/c / a2 mice ( fig . the number of human cd45 cells in both groups of mice that received ndd or type 1 diabetic pbmcs appear to be similar in the spleen ( p = 0.206 , fig . therefore , we determined that both ndd and type 1 diabetic patient pbmcs survive and home to the spleen ( primary site of engraftment ) and pln of nod - scid/c / a2 mice after transfer . our data are consistent with previously reported findings that the primary site of engraftment by human cells in nod - scid/c mice is the spleen ( 27 ) . interestingly , the level of engraftment appears to increase markedly in mice receiving > 20 10 pbmcs from patients with type 1 diabetes . successful engraftment was defined as recovering 2 10 human cd45 cells from the spleen of mice that received pbmcs . in our studies , this demonstrates the ability of nod - scid / a2/c mice to support survival of pbmcs from patients with type 1 diabetes after transfer . human cells from type 1 diabetic ( t1d ) patients and ndds engraft in nod - scid/c / a2 mice . representative histograms of nod - scid/c / a2 splenocytes after intraperitoneal injection of pbmcs from type 1 diabetic patients ( a ) , ndds ( b ) , or scid ( c ) . cells were gated on human cd45 . at 2 to 6 weeks after transfer , summary of the percentages of human cd45 cells in the blood ( ndds , n = 9 ; type 1 diabetes , n = 10 ) ( d ) , spleen ( ndd , n = 9 ; type 1 diabetes , n = 10 ) ( e ) , and draining pln ( ndd , n = 8 ; type 1 diabetes , n = 10 ) ( f ) were determined by flow cytometry . the number of human cd45 cells in the spleen ( ndd , n = 9 ; type 1 diabetes , n = 10 ) ( g ) and draining pln ( ndd , n = 8 ; type 1 diabetes , n = 10 ) ( h ) was also evaluated . ( a high - quality color representation of this figure is available in the online issue . ) to evaluate proliferation potential of type 1 diabetic pbmcs in nod - scid//a2 mice , we labeled pbmcs with carboxyfluorescein succinimidyl ester ( cfse ) and confirmed the presence of human cd45 cells in the peripheral blood , spleen , pln , and islets of mice after transfer . most of the human cd45 cells in the peripheral blood , spleen , pln , and islets of nod - scid/c / a2 mice were cfse low , implying that many of cells underwent at least five rounds of cell division ( fig . l ) . proliferation of human lymphocytes from type 1 diabetic patients in nod - scid/c / a2 mice is shown 2 weeks after transfer . pbmcs from patients with type 1 diabetes were labeled with cfse and transferred intraperitoneally into 8- to 14-week - old nod - scid//a2 mice . at 2 , 3 , and 6 weeks after transfer of pbmcs , the proliferation of cd4 ( top row ) , cd8 ( middle row ) , and cd19 ( bottom row ) cells was determined by cfse dye dilution in cells from the blood ( a , e , and i ) , spleen ( b , f , and j ) , draining pln ( c , g , and j ) , and islets ( d , h , and l ) using flow cytometry . ( a high - quality color representation of this figure is available in the online issue . ) human cells were observed in the spleen and pln after adoptive transfer in nod - scid/c / a2 mice . cd3 t cells and cd19 b cells were observed in the spleen and pln ( fig . , the predominant human lymphocyte subset in the spleen and pln of mice was cd3 t cells . cd3 t cells in the spleen of mice receiving ndd or type 1 diabetic pbmcs were 97 1.8% and 82 17.4% , respectively , of the human cd45 cell population ( supplementary fig . the level of cd3 t cells in the spleen and pln was similar in mice receiving cells from ndds or type 1 diabetic patients ( fig . the number of cd19 b cells in the spleen and pln was also similar in both groups of mice . human t and b cells were recovered from the spleen and draining pln of nod - scid/c / a2 mice after transfer . beginning at 2 weeks after transfer , flow cytometry was used to determine the number of human cd3 t cells and cd19 b cells in the spleen ( a ) and pln ( b ) of mice that received pbmcs from type 1 diabetic ( t1d ) patients or ndds . the number of cd3cd4 t cells and cd3cd8 t cells were calculated in the spleen ( c ) and draining pln ( d ) . we compared the level of cd4 and cd8 t cells in the spleen and pln after transfer . 1c and d ) of cd4 and cd8 t cells in the spleen and pln was similar between both groups . in addition , both groups of mice had similar cd4/cd8 ratios in the spleen ( supplementary fig . we determined the level of islet infiltration in nod - scid/c / a2 mice receiving pbmcs from ndd or type 1 diabetic patients . we isolated islets from individual mice after engraftment and determined the presence of cellular infiltrates . the total number of human cd45 cells was significantly higher in mice that received type 1 diabetic pbmcs ( p = 0.0006 , fig . although not widely appreciated , b cells are found in the islets of both diabetic mice ( 25 ) and humans ( 28 ) . the level of cd3 t cells was significantly higher in mice that received type 1 diabetic pbmcs ( p = 0.0238 , fig . 4b ) , whereas the level of cd19 b cells was similar ( p = 0.1310 , fig . the percentage of cd3 t cells and cd19 b cells was similar between the two groups ( supplementary fig . human t and b cells from patients with type 1 diabetes ( t1d ) infiltrate the islets of nod - scid/c / a2 mice after transfer . the total number ( top ) of cd45 ( a ) and cd3 ( b ) t and cd19 b cells as well as the number of cd45 ( c ) , cd3 ( d ) , cd19 ( e ) , cd4 ( f ) , and cd8 ( g ) cells per islet ( bottom ) was determined from the islets of individual mice at 2 to 6 weeks after transfer . islets from individual mice were isolated as described in the research design and methods ( ndds , n = 7 ; type 1 diabetes , n = 6 ) . * p < 0.05 and * * p < 0.001 , one - tailed nonparametric mann - whitney test . on a per - islet basis , the number of human cd45 cells ( p = 0.0006 , fig . this suggests that although the percentages of infiltrating lymphocytes are similar , the actual numbers of t and b cells are increased in mice that received pbmcs from type 1 diabetic patients . we determined whether cd4 and cd8 t cells were present in the islets of mice after transfer because both are required for the development of type 1 diabetes in mice and the issue can not be tested in humans . the number of cd4 t cells per islet was significantly higher in mice that received type 1 diabetic pbmcs compared with ndd pbmcs ( p = 0.0175 , fig . although the level was not statistically significant , cd8 t cells were also increased in mice that received type 1 diabetic pbmcs ( p = 0.1820 , fig . this shows that a higher number of cd4 and cd8 t cells from the pbmcs of type 1 diabetic patients infiltrate the islets of nod - scid/c / a2 mice compared with ndds . interestingly , the cd4/cd8 ratio was higher in mice that received pbmcs from type 1 diabetic patients ( supplementary fig . the significant advantage of this transfer model is the potential to identify antigen - specific cd8 t cells , which are important for the development of diabetes in patients with type 1 diabetes . to understand the specificity of t cells in the islets of nod - scid/c / a2 mice transferred with pbmcs from type 1 diabetic patients , we used igrp , iapp , insulin , and ia-2/a2 tetramers to identify epitope - specific t cells . lymphocytes from the spleen and islets of nod - scid/c / a2 mice were incubated with pooled hla - a2 tetramers individually loaded with igrp , iapp , insulin , and ia-2 peptides after transfer to maximize our sensitivity of detection . figure 5a shows the number of tetramer cd8 t cells in the islets and spleen . in fact , the level of cd8/tetramer t cells was significantly higher in the islets ( 1780% ) compared with the spleen ( 524% ) of mice engrafted with type 1 diabetic pbmcs . specific cd8 t cells primarily infiltrate the islets of mice that received type 1 diabetic pbmcs . unfortunately , the sample size was not sufficient to examine the cells recovered from the islets for individual a2-tetramer specificity . specific cd8 t cells from type 1 diabetic patients in nod - scid/c / a2 mice . a : percentages of cd8/tetramer t cells in the spleen and islets of nod - scid//a2 mice engrafted with pbmcs from type 1 diabetic patients ( n = 6 ) . b : in vitro stimulation with a2 tetramers and peptides induced the production of ifn- from epitope - specific cd8 t cells from the spleens and islets of nod - scid/c / a2 mice that received type 1 diabetic patient pbmcs ( n = 5 ) . percentages ( c ) and numbers ( d ) of cd8/tetramer t cells in the spleen of mouse 1 and mouse 2 compared with the amount in the peripheral blood of a type 1 diabetic patient . d : the percentages are shown of cd8/tetramer t cells in the islets of mouse 2 . to determine if epitope - specific human cd8 t cells from the spleen and islets of mice after transfer are functionally active , cells were incubated with pooled a2 tetramers and their respective peptides and assessed for ifn- production after short - term stimulation . figure 5a shows that cd8/tetramer t cells are present in the spleen ( 12% ) and islets ( 15% ) . in addition , these epitope - specific cells from the spleen and islets produce ifn- after peptide stimulation ( fig . these results demonstrate that the islets of nod - scid/c / a2 mice contained functional , human , epitope - specific cd8 t cells that are capable of producing ifn- after restimulation . although overt diabetes did not develop in any the mice transferred with pbmcs from patients with type 1 diabetes , we did observe by histology islet infiltration ( supplementary fig . 2a ) and elevated blood glucose levels up to 235 mg / dl ( supplementary fig . mice that received ndd or type 1 diabetic pbmcs displayed no clinical signs of graft - versus - host disease , as determined by histologic analysis of the liver and kidney ( data not shown ) . to determine whether epitope - specific t cells can continue to expand from one mouse to the next , we isolated splenocytes from a nod - scid//a2 mouse that received 20 10 type 1 diabetic pbmcs ( mouse 1 ) and transferred 18 10 splenocytes intraperitoneally into a second nod - scid//a2 mouse ( mouse 2 ) . we compared the level of cd8/tetramer t cells isolated from a patient with type 1 diabetes ( a21 ) to 1 ) observe the level of epitope - specific cd8 t cells after each transfer and 2 ) determine if they expanded . the number and percentage of cd8/tetramer t cells increased from 3 10 to 7 10 cells and in percentage from 0.06 to 6.85% ( fig . 5c and d ) , in the spleen of the mouse transferred with type 1 diabetic pbmcs . in fact , these antigen - specific cd8 t cells were not only in the spleen but also in the islets of mouse 2 ( fig . previous studies using human hscs have shown nod - scid/c mice support growth , survival , and differentiation of cd34 hsc ( 17 ) . hla - a2 * 0201 is the most commonly expressed hla class i allele in europeans ( 45% ) and is permissive for the development of type 1 diabetes in humans and transgenic mice . therefore , we evaluated the ability of hla - a2matched pbmcs from ndd and type 1 diabetic patients to successfully engraft in nod - scid/c / a2 mice . flow cytometry analyses confirmed the presence of human cd45 cells in the spleen of mice receiving pbmcs from ndd or type 1 diabetic patients ( fig . human cd45 cells were also found in the blood and pln of nod - scid/c / a2 mice ( fig . the number of human cd45 cells in both groups of mice that received ndd or type 1 diabetic pbmcs appear to be similar in the spleen ( p = 0.206 , fig . therefore , we determined that both ndd and type 1 diabetic patient pbmcs survive and home to the spleen ( primary site of engraftment ) and pln of nod - scid/c / a2 mice after transfer . our data are consistent with previously reported findings that the primary site of engraftment by human cells in nod - scid/c mice is the spleen ( 27 ) . interestingly , the level of engraftment appears to increase markedly in mice receiving > 20 10 pbmcs from patients with type 1 diabetes . successful engraftment was defined as recovering 2 10 human cd45 cells from the spleen of mice that received pbmcs . in our studies , this demonstrates the ability of nod - scid / a2/c mice to support survival of pbmcs from patients with type 1 diabetes after transfer . human cells from type 1 diabetic ( t1d ) patients and ndds engraft in nod - scid/c / a2 mice . representative histograms of nod - scid/c / a2 splenocytes after intraperitoneal injection of pbmcs from type 1 diabetic patients ( a ) , ndds ( b ) , or scid ( c ) . cells were gated on human cd45 . at 2 to 6 weeks after transfer , summary of the percentages of human cd45 cells in the blood ( ndds , n = 9 ; type 1 diabetes , n = 10 ) ( d ) , spleen ( ndd , n = 9 ; type 1 diabetes , n = 10 ) ( e ) , and draining pln ( ndd , n = 8 ; type 1 diabetes , n = 10 ) ( f ) were determined by flow cytometry . the number of human cd45 cells in the spleen ( ndd , n = 9 ; type 1 diabetes , n = 10 ) ( g ) and draining pln ( ndd , n = 8 ; type 1 diabetes , n = 10 ) ( h ) was also evaluated . ( a high - quality color representation of this figure is available in the online issue . ) to evaluate proliferation potential of type 1 diabetic pbmcs in nod - scid//a2 mice , we labeled pbmcs with carboxyfluorescein succinimidyl ester ( cfse ) and confirmed the presence of human cd45 cells in the peripheral blood , spleen , pln , and islets of mice after transfer . most of the human cd45 cells in the peripheral blood , spleen , pln , and islets of nod - scid/c / a2 mice were cfse low , implying that many of cells underwent at least five rounds of cell division ( fig . l ) . proliferation of human lymphocytes from type 1 diabetic patients in nod - scid/c / a2 mice is shown 2 weeks after transfer . pbmcs from patients with type 1 diabetes were labeled with cfse and transferred intraperitoneally into 8- to 14-week - old nod - scid//a2 mice . at 2 , 3 , and 6 weeks after transfer of pbmcs , the proliferation of cd4 ( top row ) , cd8 ( middle row ) , and cd19 ( bottom row ) cells was determined by cfse dye dilution in cells from the blood ( a , e , and i ) , spleen ( b , f , and j ) , draining pln ( c , g , and j ) , and islets ( d , h , and l ) using flow cytometry . ( a high - quality color representation of this figure is available in the online issue . ) human cells were observed in the spleen and pln after adoptive transfer in nod - scid/c / a2 mice . cd3 t cells and cd19 b cells were observed in the spleen and pln ( fig . 3 ) . in fact , the predominant human lymphocyte subset in the spleen and pln of mice was cd3 t cells . cd3 t cells in the spleen of mice receiving ndd or type 1 diabetic pbmcs were 97 1.8% and 82 17.4% , respectively , of the human cd45 cell population ( supplementary fig . the level of cd3 t cells in the spleen and pln was similar in mice receiving cells from ndds or type 1 diabetic patients ( fig . the number of cd19 b cells in the spleen and pln was also similar in both groups of mice . human t and b cells were recovered from the spleen and draining pln of nod - scid/c / a2 mice after transfer . beginning at 2 weeks after transfer , flow cytometry was used to determine the number of human cd3 t cells and cd19 b cells in the spleen ( a ) and pln ( b ) of mice that received pbmcs from type 1 diabetic ( t1d ) patients or ndds . the number of cd3cd4 t cells and cd3cd8 t cells were calculated in the spleen ( c ) and draining pln ( d ) . we compared the level of cd4 and cd8 t cells in the spleen and pln after transfer . 3c and d ) and percentage ( supplementary fig . 1c and d ) of cd4 and cd8 t cells in the spleen and pln was similar between both groups . in addition , both groups of mice had similar cd4/cd8 ratios in the spleen ( supplementary fig . we determined the level of islet infiltration in nod - scid/c / a2 mice receiving pbmcs from ndd or type 1 diabetic patients . we isolated islets from individual mice after engraftment and determined the presence of cellular infiltrates . the total number of human cd45 cells was significantly higher in mice that received type 1 diabetic pbmcs ( p = 0.0006 , fig . although not widely appreciated , b cells are found in the islets of both diabetic mice ( 25 ) and humans ( 28 ) . the level of cd3 t cells was significantly higher in mice that received type 1 diabetic pbmcs ( p = 0.0238 , fig . 4b ) , whereas the level of cd19 b cells was similar ( p = 0.1310 , fig . the percentage of cd3 t cells and cd19 b cells was similar between the two groups ( supplementary fig . human t and b cells from patients with type 1 diabetes ( t1d ) infiltrate the islets of nod - scid/c / a2 mice after transfer . the total number ( top ) of cd45 ( a ) and cd3 ( b ) t and cd19 b cells as well as the number of cd45 ( c ) , cd3 ( d ) , cd19 ( e ) , cd4 ( f ) , and cd8 ( g ) cells per islet ( bottom ) was determined from the islets of individual mice at 2 to 6 weeks after transfer . islets from individual mice were isolated as described in the research design and methods ( ndds , n = 7 ; type 1 diabetes , n = 6 ) . * p < 0.05 and * * p < 0.001 , one - tailed nonparametric mann - whitney test . on a per - islet basis , the number of human cd45 cells ( p = 0.0006 , fig . 4d ) was also increased . the level of cd19 b cells ( p = 0.0256 , fig . this suggests that although the percentages of infiltrating lymphocytes are similar , the actual numbers of t and b cells are increased in mice that received pbmcs from type 1 diabetic patients . we determined whether cd4 and cd8 t cells were present in the islets of mice after transfer because both are required for the development of type 1 diabetes in mice and the issue can not be tested in humans . the number of cd4 t cells per islet was significantly higher in mice that received type 1 diabetic pbmcs compared with ndd pbmcs ( p = 0.0175 , fig . although the level was not statistically significant , cd8 t cells were also increased in mice that received type 1 diabetic pbmcs ( p = 0.1820 , fig . this shows that a higher number of cd4 and cd8 t cells from the pbmcs of type 1 diabetic patients infiltrate the islets of nod - scid/c / a2 mice compared with ndds . interestingly , the cd4/cd8 ratio was higher in mice that received pbmcs from type 1 diabetic patients ( supplementary fig . the significant advantage of this transfer model is the potential to identify antigen - specific cd8 t cells , which are important for the development of diabetes in patients with type 1 diabetes . to understand the specificity of t cells in the islets of nod - scid/c / a2 mice transferred with pbmcs from type 1 diabetic patients , we used igrp , iapp , insulin , and ia-2/a2 tetramers to identify epitope - specific t cells . lymphocytes from the spleen and islets of nod - scid/c / a2 mice were incubated with pooled hla - a2 tetramers individually loaded with igrp , iapp , insulin , and ia-2 peptides after transfer to maximize our sensitivity of detection . figure 5a shows the number of tetramer cd8 t cells in the islets and spleen . in fact , the level of cd8/tetramer t cells was significantly higher in the islets ( 1780% ) compared with the spleen ( 524% ) of mice engrafted with type 1 diabetic pbmcs . specific cd8 t cells primarily infiltrate the islets of mice that received type 1 diabetic pbmcs . unfortunately , the sample size was not sufficient to examine the cells recovered from the islets for individual a2-tetramer specificity . specific cd8 t cells from type 1 diabetic patients in nod - scid/c / a2 mice . a : percentages of cd8/tetramer t cells in the spleen and islets of nod - scid//a2 mice engrafted with pbmcs from type 1 diabetic patients ( n = 6 ) . b : in vitro stimulation with a2 tetramers and peptides induced the production of ifn- from epitope - specific cd8 t cells from the spleens and islets of nod - scid/c / a2 mice that received type 1 diabetic patient pbmcs ( n = 5 ) . percentages ( c ) and numbers ( d ) of cd8/tetramer t cells in the spleen of mouse 1 and mouse 2 compared with the amount in the peripheral blood of a type 1 diabetic patient . d : the percentages are shown of cd8/tetramer t cells in the islets of mouse 2 . to determine if epitope - specific human cd8 t cells from the spleen and islets of mice after transfer are functionally active , cells were incubated with pooled a2 tetramers and their respective peptides and assessed for ifn- production after short - term stimulation . figure 5a shows that cd8/tetramer t cells are present in the spleen ( 12% ) and islets ( 15% ) . in addition , these epitope - specific cells from the spleen and islets produce ifn- after peptide stimulation ( fig . these results demonstrate that the islets of nod - scid/c / a2 mice contained functional , human , epitope - specific cd8 t cells that are capable of producing ifn- after restimulation . although overt diabetes did not develop in any the mice transferred with pbmcs from patients with type 1 diabetes , we did observe by histology islet infiltration ( supplementary fig . 2a ) and elevated blood glucose levels up to 235 mg / dl ( supplementary fig . mice that received ndd or type 1 diabetic pbmcs displayed no clinical signs of graft - versus - host disease , as determined by histologic analysis of the liver and kidney ( data not shown ) . to determine whether epitope - specific t cells can continue to expand from one mouse to the next , we isolated splenocytes from a nod - scid//a2 mouse that received 20 10 type 1 diabetic pbmcs ( mouse 1 ) and transferred 18 10 splenocytes intraperitoneally into a second nod - scid//a2 mouse ( mouse 2 ) . we compared the level of cd8/tetramer t cells isolated from a patient with type 1 diabetes ( a21 ) to 1 ) observe the level of epitope - specific cd8 t cells after each transfer and 2 ) determine if they expanded . the number and percentage of cd8/tetramer t cells increased from 3 10 to 7 10 cells and in percentage from 0.06 to 6.85% ( fig . 5c and d ) , in the spleen of the mouse transferred with type 1 diabetic pbmcs . in fact , these antigen - specific cd8 t cells were not only in the spleen but also in the islets of mouse 2 ( fig . nod - scid/c / a2 mice have been widely used to study human immunology because these mice serve as a host for human immune cells ( 13 ) . in addition , immune - deficient mice are being used to study various human diseases , including graft - versus - host disease after the injection of mhc - mismatched human pbmcs ( 29 ) and also islet transplantation rejection by mismatching mhc class i molecules of donor pbmcs to recipient islet mhc class i molecules ( 12,30 ) . our goal is to study human autoimmunity , specifically type 1 diabetes , using a humanized mouse model by transferring hla - a2 matched pbmcs from type 1 diabetic patients and ndds into nod - scid/c / a2 mice . we observed proliferation and survival of t cells ( cd3 , cd4 , and cd8 ) and b cells for at least 6 weeks in these mice . similar levels of t cells in the spleen and pln were found in mice engrafted with pbmcs from type 1 diabetic patients and ndds ; however , more b cells were found in the spleen and pln in mice that received pbmcs from type 1 diabetic patients . this demonstrates the ability of human immune cell subsets to engraft secondary lymphoid organs after transfer . moreover , the higher levels of b cells in the pln and spleen may reflect what occurs in the pln and spleen of type 1 diabetic patients . nod - scid mice that express a chimeric a2/k gene and were wild - type at the il2r- chain locus were poorly engrafted ( data not shown ) . through this model we have revealed an increased level of islet infiltration in mice that received type 1 diabetic pbmcs compared with ndd pbmcs . previous studies using nod - scid mice and hla - a1 pbmcs from type 1 diabetic patients have demonstrated the presence of islet - reactive t cells in pancreatic tissue ( 31 ) , but these t - cell clones were not capable of intraislet infiltration . we have shown here that t and b cells preferentially infiltrate the islets of nod - scid/c / a2 mice that received type 1 diabetic pbmcs and that a significant number of cd8 t cells from the islets and spleen are specific for igrp , ia-2 , iap , and insulin ( known diabetogenic epitopes ) . these cells were found at a higher frequency in the islets compared with the spleen , indicating the islets are a preferred site of autoreactive t - cell expansion and accumulation . therefore , the extravasation and accumulation of human autoreactive islet - specific t cells from circulation into the islets suggest that pbmcs from type 1 diabetic patients are capable of infiltrating the target organs necessary for the induction of diabetes . circulating cytotoxic t lymphocytes isolated from hla - a2 type 1 diabetic patients have been shown to kill -cells through recognition of a glucose - regulated preproinsulin epitope ( 18 ) . in our model , higher frequencies of diabetogenic epitope - specific cd8 t cells from type 1 diabetic patients infiltrate the islets of nod - scid/c / a2 mice . furthermore , these antigen specific cells are capable of producing ifn- after peptide stimulation . until now , no reported studies have demonstrated islet infiltration of nod - scid/c / a2 mice by antigen - specific t cells using hla - a2matched pbmcs from type 1 diabetic patients . this may be the result of poor engraftment in previous models that is often associated with natural killer cell activity or the lack of human costimulatory molecules such as human mhc molecules ( 32,33 ) . we identified an engraftment threshold and determined that 2030 10 pbmcs is ideal for maximum engraftment in nod - scid/c / a2 mice . this signifies a size limitation for transferring human cells into mice , which is similar to previous findings using nod - scid/c mice ( 34 ) . although many genetic loci contribute to the development of diabetes , initial genome scans attribute particular mhc class i and ii alleles as major contributors to the development of autoreactive t - cell responses in both humans and nod mice ( 35,36 ) . the process of developing diabetes is accelerated in nod hla - a2.1 mhc class i transgenic mice and is mediated by pathogenic a2-restricted t - cell responses ( 37 ) . in humans , two islet - associated epitopes , ia-2 and gad65 , have been identified as being recognized by hla - a2restricted cd8 t cells , thus indicating that cd8 t cells that are hla - a2 restricted may contribute to -cell death . although it is not clear whether cd8 t cells are involved during the early phases of type 1 diabetes , we do know that they are involved in the development of diabetes because diabetes does not develop in nod mice lacking mhc class i. the importance of igrp , iapp , ia-2 , and insulin - specific cd8 t cells is still unknown in humans . however , gad65 and ia-2 are major islet antigens targeted in human type 1 diabetes . the presence of an enriched population of epitope - specific cd8 t cells in the islets after transfer may indicate the expansion of epitope - specific immunodominant t cells from patients with type 1 diabetes in these humanized mice . overt diabetes has not yet developed in any of the nod - scid/c / a2 mice that received pbmcs from hla - a2 type 1 diabetic patients , although one of the nine recipients of type 1 diabetes hla - a2 pbmcs did show elevated blood glucose levels up to 235 mg / dl . it is likely that in addition to the hla - a2 molecule , this mouse model may be improved by the addition of human mhc class ii molecules or other costimulatory molecules that would allow interaction of the donor cells with mouse cells in the spleen and lymph node and perhaps provide a better environment for engraftment in these tissues . in the current model , cd4 t cells can interact with engrafted donor apcs via human class ii only , whereas the cd8 t cells can receive stimulation from both donor and recipient ( nod - scid/c / a2 mouse ) cells . it is difficult to isolate large numbers of diabetogenic cd8 t cells directly from the peripheral blood of patients with type 1 diabetes . therefore , one of the advantages of this model is the 1,000-fold increase in epitope - specific cd8 t cells observed in mice engrafted with type 1 diabetic pbmcs . presumably , this will allow more studies of human diabetogenic t cells ; for example , we can test the cross - reactivity of diabetogenic t cells to common pathogens . this model also allows us to identify , directly from type 1 diabetic patients , islet epitope - specific cd8 t cells . the four epitopes tested here comprised 6388% of the islet - infiltrating cd8 t cells in three of six mice that received type 1 diabetic pbmcs . in the islets of the remaining mice engrafted with type 1 diabetic pbmcs , these epitopes were recognized by 1927% of cd8 t cell infiltrates . in the future , we plan to use larger pools of peptides derived from islet antigens , and this may lead to the identification of other islet - infiltrating t cells . this model of autoimmunity may also be useful in predicting islet cell transplantation by analyzing the level of pre - existing diabetogenic t cells in candidate patients with type 1 diabetes . therefore , with future developments of this model , researchers may investigate more directly the mechanisms underlying t cell responses . we can gain valuable insight into the pathogenesis of various autoimmune diseases and predict immunotherapeutic responses .

osteoporosis remains underrecognized and undertreated , more so in men than in women , adding considerably to fracture burden and costs . though men suffer fewer fractures than women , fracture - related morbidity and mortality are higher in men than in women , partly due to greater frailty . age - related changes in blood androgens and estrogens may contribute to the development or progression of frailty in men . men usually have higher bone mineral density which contributes to lower fracture incidence in men . numerous studies point to the significance of normal serum testosterone to maintain bone mineral density ( bmd ) at various stages of life . this study investigated the effects of normalizing serum testosterone on bmd in 45 men with osteoporosis who had consulted an orthopedic surgeon and who were diagnosed as testosterone deficient . testosterone deficiency may not be an entity in itself but it may be part of another condition and other constituents of the disease might contribute to bone loss as well . our patients were suffering from a number of diseases , which , apart from the associated testosterone deficiency , could account for the loss of bone mineral density as well . these conditions included klinefelter 's syndrome , crohn 's disease , alcohol abuse , hodgkin 's lymphoma , kidney transplant , and undescended testis . the study was carried out in a private urology practice , bremerhaven , germany , between the years 2004 and 2012 . this clinic routinely measures serum testosterone levels in patients with osteoporosis ( defined by a t - score more than 2.5 standard deviations below the mean value for young adult reference data ) , especially when patients are young . if , indeed , subnormal serum testosterone levels are encountered , the patient is referred to the urology practice for assessment of the etiology of subnormal testosterone levels and possible administration of testosterone , provided there are no contraindications . the cut - off level for below - normal serum testosterone was determined on the basis of the following considerations : although there is no international consensus as to the normal range of testosterone , clinical data suggest that the normal range of testosterone in adult men is between 12 and 40 nmol / l . a threshold of 12.1 nmol / l was confirmed by an international group of authors based on analyses of several well - known studies in which liquid chromatography tandem mass spectrometry had been used . men with klinefelter 's syndrome often have reduced bone mass [ 8 , 9 ] . remarkably , in one study the loss of bone mineral density in this group did not correlate with serum testosterone or with cag repeats of the androgen receptor . muscle strength , previous history of testosterone treatment , age at diagnosis and bone markers were predictors of bmd , but testosterone was not . so , positive effects of testosterone on bmd may be indirect by its well - known effects on muscle . bone cells from patients with quiescent crohn 's disease show a reduced growth potential and an impeded maturation . in a pilot study we have found a beneficial effect of testosterone on the clinical course of crohn 's disease . the mechanism of this improvement may be immunosuppressive effects of testosterone , reducing chronic inflammation of the intestinal wall in men with crohn 's disease . men with alcohol abuse may have a bone remodeling imbalance , with a predominant decrease in bone formation . in addition , recent studies have reported new mechanisms by which alcohol may act on bone remodeling , including osteocyte apoptosis , oxidative stress , and wnt signaling pathway modulation . men who have been successfully treated for malignancies earlier in life may develop hypogonadism when they age ( > 50 year ) . seven patients had a history of undescended testis , most of them bilateral and some with unilateral orchiectomy or testicular atrophy . if not appropriately treated , this often leads to a loss of exocrine and endocrine testicular function . the study was a cumulative , prospective , registry study of men ( mean age : 53.07 6.89 years ; minimum : 40 ; maximum : 68 years ) with testosterone levels below 12.1 their t - scores were ( mean sd ) 3.12 0.45 ( minimum 4.10 and maximum 2.60 ) . they received parenteral testosterone undecanoate of 1000 mg/12 weeks following an initial 6-week interval for up to six years . after six years , 44 men were included in the registry , after five years 36 men , after four years 32 men , after three years 25 men , after two years 10 men , and after one year 4 men . the declining numbers do not reflect drop - out rates but are a result of the registry design . exclusion criteria for testosterone administration included a previous diagnosis of primary or secondary hypogonadism , previous treatment with androgens , bone metastases , prostate cancer , prostate specific antigen ( psa ) levels > 4 ng / ml , international prostate symptom score ( ipss ) > 19 points , a history of congestive heart failure or recent angina , history of cerebral vascular accident or untreated sleep apnoea . all initial serum testosterone samples had been obtained between 7.00 and 11.00 h a.m. serum testosterone levels were measured before testosterone administration , and then before the second injection at 6 weeks , subsequently before the next injection of testosterone undecanoate was due , as a rule ; 12 weeks later . bmd was measured by using a whole body dual - energy x - ray densitometer ( norland xr-800 ) . the daily system quality assurance calibration procedures were strictly performed according to the instructions of the manufacturer using a qa calibration standard and a qc spine phantom . the accuracy of ap spine scans and hip scans was within 1.0% of industry standard . the in vivo precision of ap spine scan is 0.84% ( bmd l 24 cv ) . the in vivo precision of hip scan is 1.4% ( bmd femoral neck cv ) . bone mineral density is expressed in g / cm . the individual bone mineral density ( bmd ) variation was expressed as a t - score of measurements of the spine ( l24 ) and femoral neck . not only was bmd assessed in this study but also the metabolic conditions were followed up . at each visit , body weight , waist circumference , body mass index , serum levels of total cholesterol , hdl , ldl , triglycerides , glucose , and hemoglobin a1c were measured after an overnight fast . the aging male symptoms scale was measured and also the international index of erectile function ( erectile function domain ) was assessed . a number of safety parameters in relation to testosterone treatment were assessed : prostate volume , serum prostate specific antigen ( psa ) , residual bladder volume after voiding , the international prostate symptoms score ( ipss ) , hemoglobin and hematocrit values , and serum alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) . ethical guidelines as formulated by the german rztekammer ( the german medical association ) for observational studies in patients receiving standard treatment were followed . all subjects consented to be included in the research of their treatment protocol which is in accordance with the declaration of helsinki http://www.wma.net . all procedures were carried out with the adequate understanding and written consent of the subjects . for continuous variables , the mean , median , standard deviation , range , minimum , maximum , and sample size for the overall sample and various groups were reported at each time point . for categorical variables the frequency distribution was reported . we tested the hypotheses regarding change in outcome scores across the study period by fitting a linear mixed effects model to the data . time ( to indicate follow - up interviews ) was included as fixed effect in the model . estimation and test of change in scores were determined by computing the differences in least square means at baseline versus the score at each follow - up interview . trough levels after 1 to 6 years were well above the cutoff for hypogonadal values ( 12.1 nmol / l ) , so the values were steady in a eugonadal range ( table 2 ) . over the 6-year period there was a significant improvement of the t - score in these men ( table 3 ) . the improvement was progressive : each year of testosterone treatment led to a significant further improvement of the t - scores ( table 4 ) to a state defined as osteopenia ( 1 to 2.49 below the mean value for young adult reference data ) . figure 1 shows that over the 6 year period the t - scores of men improved and were no longer classified as osteoporosis but as osteopenia . table 4 compares t - scores over periods of testosterone treatment from 12 months to 72 months . metabolic parameters , blood pressure , and serum crp showed an improvement over the study period , so did the ams and iief - ef ( table 5 ) . in this study men with osteoporosis and lower - than - normal serum testosterone were treated with testosterone undecanoate whereupon serum testosterone levels normalized . but in all men , an improvement of t - scores was found upon testosterone treatment with a significant progression over duration of the testosterone treatment . in fact , while all men had been in the category of osteoporosis at baseline , the mean t - scores improved to a level which is classified as osteopenia . part of the positive effects may have been due to the positive effects of testosterone on muscle [ 2224 ] . several studies have documented the beneficial effects of testosterone administration on bmd in hypogonadal men [ 9 , 2531 ] . one study demonstrated that adequacy of testosterone is pivotal for the restoration of bmd in men . it is now well documented in the literature that a chronic state of testosterone deficiency leads to a host of pathologies in ( aging ) men [ 33 , 34 ] . these pathologies ( metabolic syndrome , inflammatory factors , lower urinary tract symptoms , erectile dysfunction , and psychological functions were also assessed in this study and showed improvements over the duration of the study ( table 5 ) . a significant part of the group studied were relatively young men , particularly the men with klinefelter 's syndrome . in a recent study it was reported that over one - third of men less than 50 years with testosterone deficiency and infertility or sexual dysfunction were found to have reduced bmd . these were no men with a classical condition of testosterone deficiency ( klinefelter 's or kallmanns syndrome etcs ) . over a mean follow - up of 2.5 years testosterone therapy in this population we noted not only an improvement of t - scores in the men studied but also a progressive improvement of the metabolic status of the study subjects : body weight , bmi and waist circumference improved progressively which was also the case for lipids , blood pressure , hemoglobin a1c , and a parameter of inflammation . there was a progressive improvement of serum alt and ast probably indicating improvement of liver steatosis , as we have reported earlier . sexual function , as measured by international index of erectile function , improved significantly over time as reported earlier [ 40 , 41 ] . we noted also an improvement of the aging male symptoms scale , also reported in other studies . earlier we have reported that there is a relation with parameters of inflammation such c - reactive protein . serious attention was paid to safety aspects of testosterone administration to men , for a part elderly , in this study . we noted a slight increase in prostate volume over the study period , which also occurs in men not treated with testosterone , simply because they age [ 42 , 43 ] . remarkably , residual volume in the bladder and scores of international prostate symptom score improved considerably upon testosterone treatment , a positive effect earlier reported from this clinic . as expected , hemoglobin levels and the hematocrit rose upon testosterone treatment but remained within safe limits as reported earlier . there was no indication of a disturbance of liver function . the safety of testosterone administration to elderly men is now well documented in the literature . this single - center , open - label study is not a randomized controlled study and therefore limits the scope of interpretation of the presented findings . the study was not primarily designed to monitor the effects of normalizing serum testosterone in hypogonadal men on bone mineral density and was performed in a urology setting . we never expected to have such a large number of patients with osteoporosis , and , therefore , biomarkers of bone remodeling were not measured . this study analyzed testosterone deficiency in a population of middle - aged to elderly men who were referred to an orthopedic clinic with complaints of the locomotor system and were diagnosed with osteoporosis . their copathologies varied widely but a state of testosterone deficiency was a common denominator . in spite of the varieties of etiologies of their testosterone deficiency , they all benefited from testosterone treatment restoring their serum testosterone to the mid normal range of reference values . it would appear from our study that men attending an orthopedic clinic should be assessed for testosterone deficiency , first on clinical grounds whether they have copathology associated with testosterone deficiency , and second by confirmation of measurement of testosterone . in case of lower - than - normal serum testosterone , treatment with testosterone not only improved their bone mineral density but benefited also their metabolic state , mood and sexual functioning .

vitamin d status , measured by 25-hydroxyvitamin d ( 25(oh)d ) , was long been viewed as a hormone acting chiefly to regulate calcium - phosphate metabolism and bone mineralization . over the last decade , however , basic science and clinical researchers have produced a bewildering amount of information on the extra - skeletal effects of vitamin d. consequently , vitamin d insufficiency is considered as a risk factor for a number of common chronic diseases , such as cancer , cardiovascular disease , metabolic syndrome , and type 2 diabetes . recently , attention has turned to gene - environment interactions that could influence various vitamin d - related disorders [ 46 ] . twin- and family - based studies have confirmed that heritable factors have an appreciable influence on 25ohd concentrations . genetic association studies , including genome - wide association studies ( gwas ) , have identified that a majority of snps are associated with circulating levels of 25ohd and vitamin d deficiency . various studies have demonstrated that race / ethnicity is an important predictor of serum circulating 25ohd levels . however , these genetic association studies were mainly conducted in western populations and in han chinese , and it remains unclear whether these genetic variants have similar effects in different ethnic groups . xinjiang province , locating in northwestern china , is located at latitude n34 to 48 and has a long winter . although these 2 ethnic populations live in the same environment and both have low vitamin d levels , they have different genetic backgrounds ; therefore , they present an interesting sample in which to investigate the relationship between vitamin d status and genetic variants . in this cross - sectional study , we aimed to clarify vitamin d status in these 2 ethnic populations , and to assess the association between 14 snps genetic variants and vitamin d status in uygur and kazak ethnic populations . our data originated from a cross - sectional comprehensive health examination for uygur and kazak ethnic populations living in xinjiang , china . , a multistage - cluster sampling survey was conducted between october 2013 and december 2013 . kashgar ( n39.2 , n=633 ) , tacheng ( n43.2 , n=232 ) , and urumqi ( n42.5 , n=135 ) and kazaks were recruited from 3 cities altay ( n47.5 , n=486 ) , fukang ( n43.9 , n=368 ) , and urumqi ( n42.5 , n=146 ) according to the regional distribution of these 2 ethnic populations . of the 2000 participants , 127 were excluded because of inadequate blood sampling to test 25ohd ( n=54 ) , or lack of demographic data ( n=73 ) . thus , a total of 1873 participants were included in the vitamin d status analysis . the study was conducted in agreement with the 1990 declaration of helsinki and subsequent amendments . the study protocol was approved by the ethics committee board in the first affiliated hospital of xinjiang medical university . written informed consent was obtained from all participants . in each ethnic population , 14 snps were determined in 300 participants . for 300 uygur ethnic participants , 217 persons were randomly selected from 862 participants with vitamin d deficiency and 83 participants were without vitamin d deficiency and 300 kazak ethnic participants , including 150 persons with vitamin d deficiency and 150 without vitamin d deficiency , were randomly selected from 672 vitamin d deficiency participants and 256 without vitamin d deficiency participants . blood samples were obtained after an overnight fasting and serum was stored in aliquots at 80c until analysis . total serum 25ohd , including d2 and d3 , was measured by roche modular analytics e170 with commercially available kits . the measurable range was 3.070.0 ng / ml , with an inter- and intra - assay variable coefficients were 915% and < 10% , respectively . biochemical parameters fasting blood glucose , calcium , phosphate , alkaline phosphatase , kidney function , and lipid profiles ( including triglycerides , total cholesterol , hdl cholesterol , and ldl cholesterol ) were measured by an auto - analyzer ( advia1650 ; siemens , ny , usa ) with commercially available kits . other measurements age , sex , weight , height , and ethnicity were also obtained . body mass index ( bmi ) was calculated using the standard bmi formula as body weight ( in kilograms ) divided by height ( in meters ) squared . vdr , maps on the chromosome 12q12-q14 , is a candidate gene of vitamin d deficiency . previous studies have related genetic variants of vdr with circulating vitamin d levels [ 1315 ] . we selected 14 snps in 5 candidate genes known to have a biological impact on vitamin d metabolism . these genes and snps were vdr ( vitamin d receptor ; rs7975232 , rs731236 , rs2239179 , rs1544410 , rs2228570 , rs12717991 , rs11168275 ) , gc ( group - specific components ; rs4588 , rs7041 , rs2282679 ) , dhcr7/nadsyn1 ( 7-dehydrocholesterol reductase / nad synthetase ; rs12785878 ) , cyp27b1 ( 1--hydroxylase gene ; rs10877012 ) , and cyp2r1 ( cytochrome , p450 , family 2 , subfamily r , polypeptide 1 ; rs10741657 , rs10766197 ) . genomic dna was isolated from peripheral blood leukocytes using the conventional phenol - chloroform extraction method . genotyping was performed using the multiplex snapshot assay with the abi 3130xl genetic analyzer ( applied biosystem , ca , u.s.a ) . the genotyping success rates for the 14 snps were all > 99% and the concordance rates were > 99% based on 10% duplicate samples . according to the recommendation of the institute of medicine , vitamin d deficiency was defined as serum 25ohd < 20 ng / ml , vitamin d insufficiency as serum 25ohd level 2030 ng / ml , and vitamin d sufficiency as serum 25ohd 30 ng / ml . obesity was defined by the world health organization as normal : 18.5 bmi < 25 kg / m ; overweight : 25 bmi < 30 kg / m ; and obesity : bmi 30 kg / m . hypertension was identified from a self - reported questionnaire and the clinical data measured by the investigators . the diagnosis meets at least 1 of 3 criteria : systolic bp ( sbp ) 140 mmhg ; diastolic bp ( dbp ) 90vmmhg , or using anti - hypertension medications . for database management and statistical analyses , we used the ibm spss statistics , version 21.0 ( ibm corp . , armonk , ny ) . data are given as median ( interquartile range ) for continuous variables or percentages ( % ) for categorical variables . logistic regression models were used to investigate the risk factors associated with vitamin d deficiency ( < 20 ng / ml ) . we performed separate analyses for uygurs and kazaks because of differences in linkage disequilibrium ( ld ) , allele frequencies , and biological and environmental factors contributing to serum 25ohd levels . for logistic regression models , we adjusted for age , sex , bmi , and study site . our data originated from a cross - sectional comprehensive health examination for uygur and kazak ethnic populations living in xinjiang , china . , a multistage - cluster sampling survey was conducted between october 2013 and december 2013 . kashgar ( n39.2 , n=633 ) , tacheng ( n43.2 , n=232 ) , and urumqi ( n42.5 , n=135 ) and kazaks were recruited from 3 cities altay ( n47.5 , n=486 ) , fukang ( n43.9 , n=368 ) , and urumqi ( n42.5 , n=146 ) according to the regional distribution of these 2 ethnic populations . of the 2000 participants , 127 were excluded because of inadequate blood sampling to test 25ohd ( n=54 ) , or lack of demographic data ( n=73 ) . thus , a total of 1873 participants were included in the vitamin d status analysis . the study was conducted in agreement with the 1990 declaration of helsinki and subsequent amendments . the study protocol was approved by the ethics committee board in the first affiliated hospital of xinjiang medical university . written informed consent was obtained from all participants . in each ethnic population , 14 snps were determined in 300 participants . for 300 uygur ethnic participants , 217 persons were randomly selected from 862 participants with vitamin d deficiency and 83 participants were without vitamin d deficiency and 300 kazak ethnic participants , including 150 persons with vitamin d deficiency and 150 without vitamin d deficiency , were randomly selected from 672 vitamin d deficiency participants and 256 without vitamin d deficiency participants . blood samples were obtained after an overnight fasting and serum was stored in aliquots at 80c until analysis . total serum 25ohd , including d2 and d3 , was measured by roche modular analytics e170 with commercially available kits . the measurable range was 3.070.0 ng / ml , with an inter- and intra - assay variable coefficients were 915% and < 10% , respectively . biochemical parameters fasting blood glucose , calcium , phosphate , alkaline phosphatase , kidney function , and lipid profiles ( including triglycerides , total cholesterol , hdl cholesterol , and ldl cholesterol ) were measured by an auto - analyzer ( advia1650 ; siemens , ny , usa ) with commercially available kits . other measurements age , sex , weight , height , and ethnicity were also obtained . body mass index ( bmi ) was calculated using the standard bmi formula as body weight ( in kilograms ) divided by height ( in meters ) squared . vdr , maps on the chromosome 12q12-q14 , is a candidate gene of vitamin d deficiency . previous studies have related genetic variants of vdr with circulating vitamin d levels [ 1315 ] . we selected 14 snps in 5 candidate genes known to have a biological impact on vitamin d metabolism . these genes and snps were vdr ( vitamin d receptor ; rs7975232 , rs731236 , rs2239179 , rs1544410 , rs2228570 , rs12717991 , rs11168275 ) , gc ( group - specific components ; rs4588 , rs7041 , rs2282679 ) , dhcr7/nadsyn1 ( 7-dehydrocholesterol reductase / nad synthetase ; rs12785878 ) , cyp27b1 ( 1--hydroxylase gene ; rs10877012 ) , and cyp2r1 ( cytochrome , p450 , family 2 , subfamily r , polypeptide 1 ; rs10741657 , rs10766197 ) . genomic dna was isolated from peripheral blood leukocytes using the conventional phenol - chloroform extraction method . genotyping was performed using the multiplex snapshot assay with the abi 3130xl genetic analyzer ( applied biosystem , ca , u.s.a ) . the genotyping success rates for the 14 snps were all > 99% and the concordance rates were > 99% based on 10% duplicate samples . according to the recommendation of the institute of medicine , vitamin d deficiency was defined as serum 25ohd < 20 ng / ml , vitamin d insufficiency as serum 25ohd level 2030 ng / ml , and vitamin d sufficiency as serum 25ohd 30 ng / ml . obesity was defined by the world health organization as normal : 18.5 bmi < 25 kg / m ; overweight : 25 bmi < 30 kg / m ; and obesity : bmi 30 kg / m . hypertension was identified from a self - reported questionnaire and the clinical data measured by the investigators . the diagnosis meets at least 1 of 3 criteria : systolic bp ( sbp ) 140 mmhg ; diastolic bp ( dbp ) 90vmmhg , or using anti - hypertension medications . for database management and statistical analyses , we used the ibm spss statistics , version 21.0 ( ibm corp . , armonk , ny ) . data are given as median ( interquartile range ) for continuous variables or percentages ( % ) for categorical variables . logistic regression models were used to investigate the risk factors associated with vitamin d deficiency ( < 20 ng / ml ) . we performed separate analyses for uygurs and kazaks because of differences in linkage disequilibrium ( ld ) , allele frequencies , and biological and environmental factors contributing to serum 25ohd levels . for logistic regression models , we adjusted for age , sex , bmi , and study site . there were substantial differences in bmi , systolic bp , diastolic bp , hypertension , obesity , fasting glucose , and lipid profiles ( all p<0.05 ) between these 2 ethnic groups ; kazaks had higher bmi and hypertension prevalence than uygurs . median serum 25ohd levels was significantly higher in kazaks than in uygurs ( 16.2 ng / ml vs. 10.4 ng / ml , p<0.001 ) . vitamin d deficiency were more common in uygurs than in kazaks ( 91.2% vs. 72.4% , p=0.001 ) . the majority ( 97.0% ) of uygur participants were vitamin d insufficient or deficient , with 25ohd levels < 20 ng / ml . the distribution of minor alleles frequencies of each snp in uygurs and kazaks are shown in table 2 . the minor allele frequencies in gc - rs7041 and cyp27b1-rs10877012 were significantly different between these 2 ethnic populations ( p<0.05 ) . hardy - weinberg equilibrium ( hwe ) was not met for some snps across the uygur ethnic population ( p<0.05 ) . the allele distributions in 14 snps were similar according to the presence ( n=217 ) and absence of vitamin d deficiency ( n=83 ) in uygurs ( p>0.05 , table 3 ) . the allele distribution in 14 snps were also similar in kazaks with different vitamin d status . association between genotypes and 25ohd deficiency are presented in table 4 . in each ethnic population , the genotype frequencies of 7 snps in vdr and 3 snps in gc were similar in the presence and absence of vitamin d deficiency ( p0.05 , table 4 ) . multivariable adjusted logistic regression analysis showed that cyp2r1-rs10766197 ( a / g ) was a significant risk factor for the presence of vitamin d deficiency in uygurs ( p=0.019 , or=6.533 , 95%c.i . : 1.36131.357 ) and dhcr7/nadsyn1-rs12785878 ( t / g ) was a significant risk factor for the presence of vitamin d deficiency in kazaks ( p=0.011 , or=2.442 , 95%c.i . : 1.2244.873 ) . some recent studies have shown that vitamin d status has ethnic specificity , and the allele frequency in vitamin d - associated snps may influence the circulating 25ohd levels [ 911,20,21 ] . however , little information is available about the vitamin d status and the impact of these snps frequency on 25ohd levels in uygur and kazak ethnic populations . our study found that the incidence of vitamin d insufficiency is astonishingly high in uygur and kazak adults residing in xinjiang , china . the median 25ohd concentration is as low as 10.4 ng / ml in uygurs and 16.2 ng / ml in kazaks . in uygurs , the prevalence of vitamin d deficiency , in - sufficiency , and sufficiency is 91.2% , 5.8% , and 3.0% , respectively . furthermore , it showed that mafs in gc - rs7041 and cyp27b1-rs10877012 is significantly different between uygurs and kazaks . cyp2r1-rs10766197(a / g ) , dhcr7/nadsyn1-rs12785878(t / g ) is significantly associated with 25ohd deficiency in uygur and kazak ethnic populations . xinjiang province in north - western china is located at 34 to 48 n latitude and has a long winter . although uygur and kazak ethnic populations have much lower vitamin d levels than other ethnic populations [ 2225 ] , vitamin d levels in uygurs are even lower than in kazaks . in ethnic chinese han , the average concentration of 25ohd is 26.9 ng / ml , much higher than that in uygurs and kazaks . kashgar , where most uygurs reside , is at near 39 n latitude and has approximately 73 sunny days per year . second , the uygur people prefer to wear long trousers and long sleeves , as required by their culture . third , low vitamin d content in food and little vitamin d medical supplementation might exacerbate the situation . vdr directly mediates the hormonal effects of 1 , 25(oh)2d3 and there is some evidence showing that vdr - rs2228570 is associated with higher risk of multiple sclerosis and female breast and reproductive system cancer [ 2729 ] . the association between vdr and plasma vitamin d levels has not been investigated in uygur and kazak ethnic populations . our study showed that there is no significant association between common genetic variants ( rs7975232 , rs731236 , rs2239179 , rs1544410 , rs2228570 , rs12717991 , rs11168275 ) and vitamin d deficiency , which is consistent with other previous studies . gc , encoding vitamin d - binding protein ( dbp ) , is a key transporter for vitamin d and its metabolites ( including 25ohd and 1,25(oh)2d3 ) in circulation . gc - rs7041 and rs4588 variants ( in exon 11 ) leads to a glu / asp amino acid change at codon 416 and a thy / lys amino acid change at codon 420 . however , we did not find any significant association between gc - rs2282679 , rs4588 and rs7041 with vitamin d deficiency . the possible explanations for these discrepancies include : ( 1 ) the significant association between vitamin d levels and the allele frequency of gc snps may only exist in some specific ethnic population . for example , gc - rs7041 polymorphism was associated with 25ohd levels in arab and south asian populations , but not in south east asians . a recent study , including 506 northeastern han chinese children , did not find any significant association between gc - rs2282679 , rs4588 and rs7041 and 25ohd levels as well . ( 2 ) total 25ohd concentration , measured in our clinical assays is composed of gc - bound fraction and free fraction . it is possible that the snps in gc may influence gc - bound fraction , not total 25ohd levels . cyp2r1 is a microsomal vitamin d hydroxylase that hydroxylates vitamin d at the 25-c position for 25ohd synthesis ( calcidiol ) in the liver . we found that cyp2r1-rs10766197 is significantly associated with vitamin d deficiency in the uygur population , but not in the kazak population . cyp2r1-rs10741657 is not related with vitamin d deficiency in uygurs or kazaks . a genome - wide association study , including 30 000 individuals of european descent , found that cyp2r1-rs10741657 was significantly associated with 25ohd levels . this association was also confirmed by another study , which recruited 745 healthy white subjects . encodes 7-dehydrocholesterol ( 7dhc ) reductase , which catalyzes 7dhc into cholesterol , providing sufficient substrate for vitamin d synthesis . our study found that dhcr7/nadsyn1-rs12785878 was significantly associated with vitamin d deficiency in the kazak ethnic population . recently , zhang et al . linked dhcr7/nadsyn1 snps ( rs3829251 , rs12785878 ) to decreased serum 25ohd levels in han chinese children , and cooper et al . linked rs12785878 to vitamin d deficiency in whites . however , a study of 1549 individuals ( arabs , south asians , and southeast asians living in kuwait ) did not find any association between genotypes of dhcr7/dhcr7/nadsyn1 ( rs7944926 , rs12785878 , rs4944957 , rs12800438 , rs3794060 , and rs3829251 ) and serum 25oh d levels in any of the 3 population groups . first , we selected only 5 candidate genes containing 14 snps that have been shown in previous gwas reports to have an association with vitamin d level and are known to have a biological impact in vitamin d metabolism . second , our study had a smaller sample size compared to the other studies . despite of these limitations , our study has several advantages . the study uncovered a severe vitamin d deficiency in the uygur and kazak ethnic populations , who live in places without sufficient sunlight exposure . furthermore , we revealed , for the first time , that polymorphisms in cyp2r1-rs10766197 , dhcr7/nadsyn1-rs12785878 were significantly associated with vitamin d deficiency in uygurs and kazaks . vitamin d deficiency is highly prevalent in uygur and kazak ethnic populations living in xinjiang , china , indicating that , dietary or medically , vitamin d supplementation is necessary . furthermore , cyp2r1 -rs10766197 , dhcr7/nadsyn1 -rs12785878 snps is coupled with 25ohd deficiency in uygur and kazak populations , reflecting ethnic gene variation in vitamin d metabolism .

the silicon nanorod arrays were fabricated from a single crystalline si wafer by adapting a previously described dry etching method . the 380 m thick , 100 cut and p - doped wafers exhibit a resistivity of 110 cm . they were cleaned by sonication , first in acetone then in isopropyl alcohol ( ipa ) , each for 5 min . they were then thoroughly rinsed with deionized water and dried in a stream of n2 . the clean si wafers were spin coated with mma resist ( copolymer resist el9 , microchem ) at 4000 rpm for 60 s , followed by baking at 180 c on a hot plate for 2 min . pmma resist ( polymer resist a2 , microchem ) was deposited on the mma layer by spinning at 2000 rpm for 60 s , followed by baking at 180 c on a hot plate for 2 min . an array of 250 nm diameter circular dots with 1 m spacing was written using a raith 150 ultrahigh - resolution e - beam lithography system ( raith gmbh , dortmund , germany ) . the patterned wafer was developed in mibk / ipa 1:3 for 1 min , followed by rinsing with ipa for 20 s and drying in an n2 stream . a nickel dot array was prepared by e - beam evaporating a 100 nm thick nickel layer at a base pressure of 10 torr with a rate of 1 / s . finally , the remaining resist was lifted - off in an acetone / ipa 1:1 solution , washed with ipa , and dried . vertical silicon nanowire arrays were fabricated by applying time - multiplexed reactive ion etching in an inductively coupled plasma deep reactive ion etching machine ( icp - drie , plasmatherm slr 770 ) . in order to form nanopillars with a well - defined breaking point , we have implemented a bosch process , that is , passivation followed by anisotropic etching . a variation of the ratio between the etching and the passivation times varies the scalloping and leads to different rod diameters . on the basis of this , we set up a three - stage etching process : six passivation - etching sequences with a time ratio of 1:1 allowed us to form 700 nm long nanorod segments . in order to create the breaking points , the ratio of the time windows was logarithmically changed to 0.7:1 during four further steps . finally , a wider base was formed by changing the interval ratio linearly to 2:1 in six further steps . the silicon rods were cleaned by removing the nickel caps chemically . in order to compute the normalized scattered light intensity sn , the rods are modeled as thin , homogeneous , dielectric needles of length l , diameter d , and relative permittivity r . we adopt the scattering theory for dielectric needles , valid in the limit l d/2 and ( (r)kd)/2 1 , to a standing - wave situation . the light intensity in the direction perpendicular to both the cavity axis ez and the field polarization axis ex is then proportional towith k = 2/ the wavenumber , w0 the cavity waist , and s = sinc[n(ez ey)kl/2 ] . here , we denote the center - of - mass position of the rod by ( x , y , z ) , and the orientation of the rod is determined by the radial unit vector n. the internal field points in the direction uint = 2ex + ( r 1)(nex)n . for comparison with the experiment in figure 2c and in supporting information figure s1 , the scattering intensity is evaluated along the rotor trajectory and normalized with respect to its maximum . the simplified equations of motion ( given in the supporting information ) reproduce the experimental observation remarkably well , although we have ( (r)kd)/2 0.7 . a precise description of the optical forces and torques requires advanced ( numerical ) techniques .

the use of all - ceramic restorations has become more popular in clinical dentistry due to the universal necessity to use a biocompatible and high esthetic prosthetic material.[15 ] however , the most dental ceramics are brittle and susceptible to breakage . as an alternative for these restorations , the zirconia - based materials have been introduced as a strong core for esthetic fixed prostheses with good esthetics , excellent biocompatibility , and high mechanical properties.[810 ] fracture pattern of all - ceramic crowns and fixed partial dentures ( fpd ) are nearly different . crowns fail from the cementation surface that is opposed to the occlusal surface , whereas fracture of all - ceramic fpds has a relatively high incidence in the connector areas . this high incidence in the posterior region is due to lower inter - occlusal space and short clinical crowns of molar abutments . it has been said that with smaller cross - sectional area of connectors , the needed load for fracture of core will be decreased . another procedure to minimize the connector fracture in all - ceramic restoration is to make broadly curved connector that has been proved to be relatively safer than sharply curved connector . another justification for importance of the connector size in the zirconia fpds is this fact that the connectors of zirconia frameworks are usually bulkier than the veneering porcelain and may produce residual stresses due to differential heating and cooling rates . these stresses can explain the high level of porcelain veneering delamination from the zirconia sub - structures . many design modifications have been suggested previously for improving the strength of metal ceramic restorations to increase the support of veneering porcelain . in vitro studies have shown that the alterations in metal ceramic restoration design such as increasing the radius of curvature at the gingival embrasure of the connector or adding a high lingual shoulder connected to a proximal strut can affect their resistance to fracture . adding lingual shoulder and proximal strut was used for improving the mechanical properties of all - ceramic single crowns , although this design did not improve the mechanical properties of the all - ceramic systems used in the study by lorenzoni et al . however , the effect of using this design in all - ceramic fpds is not completely investigated . most of the available studies about the zirconia framework design are about its effects on the marginal adaptation.[2022 ] the aim of this investigation was to evaluate the effects of framework design on fracture resistance of zirconium oxide posterior fpds . the null hypothesis was that the framework design did not have any effect on the fracture resistance of zirconium oxide posterior fpds . in this experimental - laboratory study , a maxillary typodont model was used ( ag-3 ; frasaco franz sachs and co. , tettnang , germany ) for making a nickel chromium ( ni cr formula 45+ti , neodontics , usa ) master die . the right first premolar and first molar were prepared so that the finish line was a circular shoulder ( 1.2 mm depth ) with rounded internal axio - gingival line angles and comprised 2 mm of occlusal reduction . ct , usa ) to ensure a bucco - lingual and mesio - distal occlusal convergence angle of 8. the occluso - gingival preparation height was 5 mm . the residual ridge in the pontic area ( second premolar ) was reduced 2 mm in height to create adequate occluso - gingival clearance for next study steps . impression of this model was made using a polyvinyl siloxane impression material ( panasil , kettenbach , eschenburg , germany ) and was poured with a type iv dental stone ( gc fujirock ep , gc dental products co. , tokyo , japan ) to make a working cast . the dies were scanned ( cercon eye , degudent , hanau , germany ) and four different framework designs were prepared using computerized software ( cercon art 2.2 , degudent , germany ) as follows [ figure 1 ] : specimens with anatomical ( a ) and modified design ( b ) a.occlusal view , b.lingual schematic view group i : the copings with 3 3 connector dimension and standard design group ii : the copings with 3 3 connector dimension and modified design group iii : the copings with 4 4 connector dimension and standard design group iv : the copings with 4 4 connector dimension and modified design . standard design was an uniform core with an even thickness of 0.7 mm . modified design consisted of a standard 0.7 mm thickness core increased in thickness by adding a 1 mm thick lingual margin of 2.0 mm height , connecting to full contour proximal struts with 3.5 mm height . in all designs a depth and width of 0.2 mm 3 mm indentation was prepared in the center of pontic area to use it in force application step . ceramic blocks ( cercon base ceramic , degudent , germany ) were milled using a milling unit ( cercon brain unit , degudent , germany ) according to aforementioned designs . all the specimens were sintered to full density in the cercon heat furnace ( a 6-h sintering program with a maximum temperature of 1350c ) . at last , 32 zirconia fpd frameworks were prepared according to four different designs ( n = 8) . the fabricated frameworks were checked to see their fit at the margins using a silicone material ( fit checker , gc co , tokyo , japan ) . petersburg , russia ) . after storing for one week in artificial saliva at 37c , the specimens were subjected to thermocycling for 2000 cycles at temperatures alternating between 5 and 55c for 30 s each , with an intermediate pause of 15 s. before loading of specimens , a teflon cylinder ( 3 mm diameter and 3 mm height ) was placed in the center of each pontic by the means of cyanoacrylate adhesive . this cylinder was placed to prevent any contact damage during the loading and to provide homogeneous load distribution on the pontic unit . the specimens were loaded in an universal testing machine ( electromechanical low - capacity testing machines , walter + bai , ag , switzerland ) at a constant crosshead speed of 0.5 mm / min until failure occurred . the maximum force to fracture the collected data were analyzed ( spss / pc 13.0 ; spss inc , chicago , il , usa ) using weibull , kruskal the weibull parameters , characteristic force at failure ( f0 ) , and the weibull modulus ( m ) were determined for each test group by fitting a weibull distribution to each respective dataset . f0 is load bearing capacity for the specimens at 63.2% probability of failure , whereas the modulus m is an indication of the scattering in the force at failure and of the reliability of the material investigated . the mean and standard deviations of the load to fracture of the zirconium oxide posterior fpd specimens are shown in table 1 . because the groups did not meet the assumption of homogeneity of variances , the effect of framework design on fracture resistance of zirconium oxide posterior fpds was evaluated by kruskal this statistical test revealed that there was a significant difference among all experimental groups ( p < 0.001 ) [ table 1 ] . the mann whitney test showed that the mean fracture resistance of group iv was significantly higher than group i ( p < 0.001 ) and group ii ( p < 0.001 ) , but there was not any significant difference between group iv and group iii ( p = 0.156 ) . the mean value of the load to fracture of the zirconium oxide posterior fpd specimens was affected significantly by the connector size ( p < 0.001 ) , but it was not affected by the framework modification ( p = 0.327 ) . the mean values ( sd ) of the loads to fracture ( n ) the zirconia bridges , and the weibull parameters f0 ( characteristic force at failure ) and m ( the weibull modulus ) the average load bearing capacity f0 and the reliability m are listed in table 1 . the highest load bearing capacity was seen in the group iv frameworks and the lowest is seen in the group i frameworks . the group ii frameworks were the most reliable , showing the smallest scattering of the measured load - bearing capacities [ figure 2 ] other group frameworks suffered from a broader load - bearing scatter which was showed by the lower weibull moduli . in this in vitro study , the fracture resistance of three - unit zirconium oxide posterior fpd was investigated . there was a significant difference among all experimental groups ( p < 0.001 ) , so the null hypothesis that the framework design did not have any effect on the fracture resistance of zirconium oxide posterior fpds was rejected . the effect of framework design modifications in all - ceramic systems is not fully understood . many of the present data about the framework design is about metal ceramic frameworks wherein core fracture is not an important issue . using proposed core - design modifications in metal ceramic restorations may improve the framework strength in all - ceramic restorations . showed that extending the core 2 mm above crown margins can decrease the veneer failure rates in zirconia - supported crowns . but lorenzoni et al . stated that framework design modification did not improve the fatigue life of the veneered yttria - stabilized tetragonal zirconia polycrystals ( y - tzp ) crowns . in the present study , the mean value of the load to fracture of the specimens was affected significantly by the connector size ( p < 0.001 ) , but it was not affected by the framework modification ( p = 0.327 ) [ table 1 ] . however , the fracture resistance of the modified frameworks increased in the present study ( 1.1 times ) , but it was not significantly different from anatomic specimens the connector is the thinnest section of a framework and will bend more easily than the pontic and abutment areas . to ensure optimum strength , the connectors must be of adequate dimensions.[412132527 ] connector dimension was evaluated for each specific all - ceramic system . the 3 3 mm and 4 4 mm dimensions were proposed for the most all - ceramic systems . but augereau et al . stated that increasing the dimensions of the connector is not necessary to increase resistance to fracture . on the other hand , dental technicians tend to make connectors with sharp gingival embrasures to have more esthetic fpds . theses sharp line angles can increase the failure rate of all - ceramic restorations in the connector areas . some authors showed that increasing the radius of the gingival embrasures of the connectors increased the fracture strength of y - tzpfpd . it is believed that design modifications can be useful in such cases because having ideal connector dimension is impossible due to hygienic and periodontal conditions , high functional forces , long span fpds , deep over bite , and parafunctional habits . however , in the present study , the kruskal wallis test showed that there was not any statistical difference between the groups with same connector size but different core designs [ table 1 ] . it is said that in such cases , materials other than all - ceramics should be considered . comparing the load - bearing capacities f0 for four study groups [ table 1 ] , it becomes obvious that the groups with 4 4 mm connector possess an approximately 1.5 to 2 times higher load - bearing capacity than groups with 3 3 mm connector dimension . it is well known that the load - bearing capacity for fpds depends not only on the properties of the ceramic material , but also to a high extent on the size , shape and position of the connectors , as well as on the span of the pontics . the increased load - bearing capacity found in the groups iii and iv was due to the larger size of the connectors of the test specimens . the slightly higher f0 for group iv when compared with group iii can be considered negligible . by enlarging the cross - section at the point of failure ( at the connectors ) the maximum stress at the connector load - bearing capacities f0 for all groups in the present study was higher than some other studies . however , the values calculated in the study by kokubo et al . were higher than present study . it can be due to difference in connector size , length of span , periodontal ligaments ( pdl ) simulation around study abutments , and high elastic modulus of abutment teeth . weibull moduli ranges between 6.1 - 8 and 4.5 - 5.7 for zirconia - based fpds and about 7 for zirconia frameworks were reported earlier , whereas the present study exhibited weibull moduli of 4.06 , 12.04 for groups i and ii , and 3.99 , 4.90 for groups iii and iv respectively [ figure 1 ] . the results of this study do not concur with the literature , where an increase in the weibull modulus was reported by increasing connector dimension . the weibull modulus is related to the distribution of flaws in a brittle material and it is not related to the size of the flaws . if the flaws are evenly distributed throughout the specimen , the resulting data will show little statistical scatter and result in a high value of the weibull modulus . in this study , the highest modulus ( m ) hence , it can be concluded that the specimens in this group have more uniform flaw distribution than other groups . the abutment teeth were made of nickel chromium alloy which had an elastic modulus higher than dentin . using supporting material with high elastic modulus resulted in increasing fracture strength . therefore , fracture forces evaluated in the present study might have been higher than in clinical practice . however , studies using resin material for the abutment teeth reported similar fracture forces for zirconia - based fdp . on the other hand , it is said that analysis using immobile retainers produces a much higher failure load than found when testing with mobile posts . however , increasing the complexity of the model and simulating the periodontal membrane , did not increase the validity of the results . beside , physical properties of pdl substitute materials were approximate and were not considered as real values . ideally , the fpd should be anatomically shaped with dimensions similar to those of fpds in clinical use . in the present study the fracture strength of the zirconia specimens can be increased considerably after veneering . however , in some studies , the fracture resistance of zirconia - based fpds was decreased after veneering . however , the fracture resistance values of veneered specimens can be due to veneer material fracture instead of core fracture . so , in the present study unveneered cores were used . to simulate aging , three main factors have to be present which are as follows : presence of water which propagates crack growth in ceramics.repeated thermal stressing which leads to a decrease in the mechanical properties of prosthetic restorations.the repeated application of mechanical force for simulating the chewing strokes . presence of water which propagates crack growth in ceramics . repeated thermal stressing which leads to a decrease in the mechanical properties of prosthetic restorations . therefore the specimens were stored in artificial saliva for one week and then were subjected to thermocycling for 2000 cycles ( 5 - 55c ) according to iso tr no . within the limitations of this in vitro study , one can conclude that : the mean fracture resistance of groups with 4 4 mm connector was significantly higher than groups with 3 3 mm connector.although the fracture resistance of the modified frameworks increased in the present study ( 1.1 times ) it was not significantly different from anatomic specimens . the mean fracture resistance of groups with 4 4 mm connector was significantly higher than groups with 3 3 mm connector . although the fracture resistance of the modified frameworks increased in the present study ( 1.1 times ) it was not significantly different from anatomic specimens .

periodontal disease is accompanied by inflammation of the gingiva and destruction of periodontal tissues , leading to alveolar bone loss in severe clinical cases . prostaglandin e2 ( pge2 ) , interleukin-6 ( il-6 ) , and il-8 are known to play important roles in inflammatory responses and tissue degradation . pge2 has several functions in vasodilation , enhancement of vascular permeability and pain , and induction of osteoclastogenesis and is believed to play important roles in inflammatory responses and alveolar bone resorption in periodontal disease . a kampo medicine , kakkonto ( tj-1 ) , has been clinically used for various diseases such as common cold , coryza , initial stage of febrile diseases , and inflammatory diseases . there are several reports showing that kakkonto possesses antiallergic [ 2 , 3 ] and antiviral [ 47 ] effects in animal and in vitro experimental models . regarding anti - inflammatory effects , recently , we reported that kakkonto suppresses lipopolysaccharide- ( lps- ) induced pge2 production by human gingival fibroblasts ( hgfs ) , as well as shosaikoto , hangeshashinto , and orento . kakkonto is constituted with seven herbs ( kakkon , taiso , mao , kanzo , keihi , shakuyaku , and shokyo ) . some herbs such as keihi and shokyo are known to possess anti - inflammatory effects and are clinically used to treat inflammatory diseases [ 13 , 14 ] . however , which compositions in kakkonto primarily show this effect is unclear . in this study , to elucidate the effect of kakkonto on decreasing lps - induced pge2 production more precisely , we examined those herbs that constitute kakkonto and their mechanisms . kakkonto was purchased from tsumura & co. powders of six herbs ( taiso , mao , kanzo , keihi , shakuyaku , and shokyo ) were provided by tsumura & co. ( tokyo , japan ) . kakkon ( puerariae radix ) was purchased from tsumura & co. a hot water extract of kakkon was prepared as reported previously . in brief , 10 g of kakkon was decocted for 1 h with 100 ml of water . powders of herbs and kakkonto were suspended in dulbecco 's modified eagle 's medium ( d - mem , sigma , st . louis , mo ) containing 10% heat - inactivated fetal calf serum , 100 u / ml penicillin , and 100 mg / ml streptomycin ( culture medium ) and were stored at 4c overnight under shaking . then , the suspension was centrifuged and the supernatant was filtrated through a 0.45 m pore membrane . lipopolysaccharide ( lps ) from porphyromonas gingivalis 381 was provided by professor nobuhiro hanada ( school of dental medicine , tsurumi university , japan ) . arachidonic acid , prostaglandin h2 ( pgh2 ) , ns-398 ( cyclooxygenase-2 ( cox-2 ) inhibitor ) , cay10502 ( cytosolic phospholipase a2- ( cpla2- ) specific inhibitor ) , bromoenol lactone ( calcium - independent pla2- ( ipla2- ) specific inhibitor ) , and thioetheramide - pc ( secretory pla2- ( spla2- ) specific inhibitor ) were purchased from cayman chemical ( ann arbor , mi ) . hgfs were prepared as described previously . in brief , hgfs were prepared from free gingiva during the extraction of an impacted tooth , with the informed consent of the subjects who consulted matsumoto dental university hospital . the free gingival tissues were cut into pieces and seeded onto 24-well plates ( agc techno glass co. , chiba , japan ) . hgfs were maintained in the culture medium at 37c in a humidified atmosphere of 5% co2 . for passage , hgfs were trypsinized , suspended , and plated into new cultures in a 1 : 3 dilution ratio . this study was approved by the ethical committee of matsumoto dental university ( number 0063 ) . the numbers of cells were measured using wst-8 ( cell counting kit-8 ; dojindo , kumamoto , japan ) according to the manufacturer 's instructions . in brief , the media were removed by aspiration and the cells were treated with 100 l of mixture of wst-8 with culture medium for 2 h at 37c in co2 incubator . optical density was measured ( measured wavelength at 450 nm and reference wavelength at 655 nm ) using an imark microplate reader ( bio - rad , hercules , ca ) , and the mean background value was subtracted from each value . hgfs were seeded in 96-well plates ( 10,000 cells / well ) and incubated in serum - containing medium at 37c overnight . then , the cells were treated with various concentrations of each herb or kakkonto in the absence or presence of lps ( 10 ng / ml ) for 24 h ( 200 l each well ) in triplicate or quadruplicate for each sample . after collecting the culture supernatants , the concentrations of pge2 in the culture supernatants were measured by enzyme - linked immunosorbent assay ( elisa ) , according to the manufacturer 's instructions ( cayman chemical ) , and were adjusted by the number of viable cells . cox-2 and prostaglandin e ( pge ) synthase activities were evaluated as shown previously with slight modifications . in brief , to estimate cox-2 activity , hgfs were treated with lps and herb for 8 h , washed , and incubated in culture medium containing exogenous arachidonic acid ( 10 m ) . pge synthase activity was determined after a 15 min incubation with exogenous pgh2 ( 10 nm ) , and the concentrations of pge2 were measured . hgfs were cultured in 60 mm dishes and treated with combinations of lps and herb for the indicated times . then , cells were washed twice with tris - buffered saline , transferred into microcentrifuge tubes , and centrifuged at 6,000 g for 5 min at 4c . supernatants were aspirated and the cells were lysed on ice in lysis buffer ( 50 mm tris - hcl , ph 7.4 , 1% nonidet p-40 , 0.25% sodium deoxycholate , 150 mm nacl , 1 mm ethylene glycol bis(2-aminoethyl ether)tetraacetic acid ( egta ) , 1 mm sodium orthovanadate , 10 mm sodium fluoride , 1 mm phenylmethylsulfonyl fluoride , 10 g / ml aprotinin , 5 g / ml leupeptin , and 1 g / ml pepstatin ) for 30 min at 4c . then , the samples were centrifuged at 12,000 g for 15 min at 4c , and the supernatants were collected . the protein concentration was measured using a bca protein assay reagent kit ( pierce chemical co. , rockford , il ) . the samples ( 10 g of protein ) were fractionated in a polyacrylamide gel under reducing conditions and transferred onto a polyvinylidene difluoride ( pvdf ) membrane ( hybond - p ; ge healthcare , uppsala , sweden ) . the membranes were blocked with 5% ovalbumin for 1 h at room temperature and incubated with primary antibody for an additional 1 h. the membranes were further incubated with horseradish peroxidase - conjugated secondary antibodies for 1 h at room temperature . antibodies against cox-2 ( sc-1745 , 1 : 500 dilution ) , cpla2 ( sc-438 , 1 : 200 dilution ) , annexin 1 ( sc-11387 , 1 : 1,000 dilution ) , and actin ( sc-1616 , 1 : 1,000 dilution ) , which detects a broad range of actin isoforms , were purchased from santa cruz biotechnology ( santa cruz , ca ) . antibodies against extracellular signal - regulated kinase ( erk ; p44/42 map kinase antibody , 1 : 1,000 dilution ) and phosphorylated erk ( phospho - p44/42 mapk ( thr202/tyr204 ) ( e10 ) monoclonal antibody , 1 : 2,000 dilution ) were purchased from cell signaling technology ( danvers , ma ) . horseradish peroxidase - conjugated anti - goat igg ( sc-2020 , 1 : 20,000 dilution ) was procured from santa cruz , and anti - rabbit igg ( 1 : 20,000 dilution ) and anti - mouse igg ( 1 : 20,000 dilution ) were purchased from dakocytomation ( glostrup , denmark ) . differences between groups were evaluated using the two - tailed pairwise comparison test with a pooled variance , followed by correction with holm 's method ( total of 10 null hypotheses ; 3 null hypotheses without herb versus with herb in the absence of lps , 3 null hypotheses without herb versus with herb in the presence of lps , and 4 null hypotheses without lps versus with lps ) ( figure 1 ) . differences between the control group and experimental groups were evaluated using two - tailed dunnett 's test ( figures 3 and 4 ) . dunnett 's test was performed using the glht function in the multcomp package the concentrations of pge2 were adjusted according to viable cell number . when hgfs cells were treated with 10 ng / ml of lps shokyo strongly and significantly decreased lps - induced pge2 production in a concentration - dependent manner ( figure 1 ) . kakkon and shakuyaku increased lps - induced pge2 production ( figure 1 ) . in the absence of lps , kakkon increased pge2 production , but kanzo decreased pge2 production ( figure 1 ) . therefore , we used three herbs ( kanzo , keihi , and shokyo ) in the following experiments . next , we examined the synergistic effect of three herbs ( shokyo , kanzo , and keihi ) on pge2 production and compared it with that of kakkonto . the concentrations of each herb ( 56 g / ml ) were determined based on the ingredient of kakkonto formula ( table 1 ) . the combination of two herbs ( shokyo + keihi and shokyo + kanzo ) decreased pge2 production to a similar level with 1 mg / ml of kakkonto . moreover , the mixture of three herbs decreased pge2 production more than kakkonto ( figure 2 ) . pla2 is the most upstream enzyme in the arachidonic acid cascade and releases arachidonic acid from the plasma membrane . pla2s form a superfamily and are classified into cytosolic pla2 ( cpla2 ) , calcium - independent pla2 ( ipla2 ) , secretory pla2 ( spla2 ) , and others . to elucidate which type of pla2(s ) contribute to arachidonic acid production in hgfs , we used selective pla2 inhibitors . cpla2-specific inhibitor cay10502 significantly decreased lps - induced pge2 production by approximately half ( figure 3 ) . however , both ipla2-specific inhibitor bel and spla2-specific inhibitor thioetheramide - pc did not alter lps - induced pge2 production ( figure 3 ) . then , we examined the mechanism by which kanzo , keihi , and shokyo decreased lps - induced pge2 production more directly . in order to bypass pla2 kanzo and keihi significantly decreased lps - induced pge2 production to approximately half , while shokyo slightly but not significantly increased pge2 production ( figure 4(a ) ) . the formation of pge2 from arachidonic acid requires both cox and pge synthase . to examine the effect of herbs on pge synthase however , all herbs had no effect on pge2 formation from exogenous pgh2 ( figure 4(b ) ) . kanzo increased cpla2 expression , while keihi and shokyo showed no effect ( figure 6 ) . based on its molecular weight ( approximately 90 kda in human ) [ 17 , 18 ] , this cpla2 is believed to be cpla2 subtype . annexin 1 , also named as lipocortin , is an anti - inflammatory mediator produced by glucocorticoids and inhibits cpla2 activity [ 19 , 20 ] . kanzo increased annexin 1 expression , while keihi and shokyo showed no effect ( figure 6 ) . cox-2 was not detected in the absence of lps and lps - induced cox-2 expression in hgfs . however , shokyo did not alter lps - induced cox-2 expression ( figure 5 ) . cpla2 is reported to be directly phosphorylated at ser505 by phosphorylated erk , resulting in cpla2 activation [ 21 , 22 ] . keihi suppressed lps - induced erk phosphorylation at 30 min , while kanzo and shokyo did not ( figure 6 ) . in the present study , we examined the effect of herbs constituting kakkonto on lps - induced pge2 production by hgfs . shokyo , kanzo , and keihi decreased lps - induced pge2 production in a concentration - dependent manner . previously , we examined the mechanisms of kakkonto and shosaikoto that contain shokyo and demonstrated that shosaikoto inhibited cox-2 activity and lps - induced cox-2 expression and that kakkonto suppressed erk phosphorylation . based on our findings in the present study , shokyo is believed to play an important role in decreasing lps - induced pge2 production by hgfs in kakkonto and shosaikoto . in addition , the mixture of three herbs ( shokyo , kanzo , and keihi ) synergistically decreased pge2 production ( figure 2 ) . the effect of two herbs mixture including shokyo was comparable to that of kakkonto . moreover , the effect of the three herbs mixture was stronger than that of kakkonto because mao and shakuyaku , which increase lps - induced pge2 productions ( figure 1 ) , are not included . these results suggest that the combination of these herbs in kakkonto is sufficient to decrease pge2 production . shokyo ( zingiberis rhizoma ) is the powdered rhizome of ginger ( zingiber officinale roscoe ) . several reports have shown that ginger has anti - inflammatory effects in humans , animal models , and in vitro models . ginger has been widely used in diet and also as a treatment for rheumatoid arthritis , fever , emesis , nausea , and migraine headache . recently , a systematic review and meta - analysis reported that the extracts of zingiberaceae including turmeric , ginger , javanese ginger , and galangal are clinically effective as hypoanalgesic agents . in an animal model , the aqueous extract of ginger significantly decreased serum pge2 level by oral or intraperitoneal administration by the rat . moreover , crude hydroalcoholic extract of ginger reduced the serum level of pge2 and improved tracheal hyperreactivity and lung inflammation induced by lps in rat . ethanol extract of ginger reduced the tissue level of pge2 and improved acetic acid - induced ulcerative colitis in the rat . in in vitro model , gingerols and shogaols extracted from ginger are reported to decrease pge2 production by several mechanisms . moreover , gingerols , but not 6-shogaol , suppress cox-2 expression in lps - treated human leukemic monocyte lymphoma u937 cells . our data showed that shokyo did not suppress cox-2 expression and that shokyo did not alter pge2 production when arachidonic acid or pgh2 is added to bypass their upstream pathway . these data suggest that shokyo did not affect the downstream pathway of arachidonic acid , which includes cox-2 and pge synthase . therefore , shokyo is considered to inhibit pla2 , which is the upstream pathway of arachidonic acid . although pla2s are classified into cpla2 , ipla2 , and spla2 , shokyo is suggested to act on cpla2 because cpla2 is the primary isoform in hgfs ( figure 3 ) . our data showed that shokyo only slightly decreased cpla2 expression but did not alter annexin 1 expression , which suppresses pla2 activity . although we have no direct data to show that shokyo inhibits cpla2 activity , this assumption is consistent with the fact that gingerols in ginger inhibit i / cpla2 activities . there are six molecules in cpla2 : cpla2 , cpla2 , cpla2 , cpla2 , cpla2 , and cpla2 . cpla2 was first identified and characterized by ca - dependence and substrate preference for arachidonoyl phospholipids . we detected cpla2 at approximately 90 kda as well as in human platelets and erythrocytes [ 17 , 18 ] , although the molecular weight of cpla2 protein on the basis of amino acid sequence is 85 kda . therefore , cpla2 that we detected in hgfs is believed to be cpla2. in contrast , cpla2-specific inhibitor cay10502 decreased lps - induced pge2 production to approximately half ( figure 3 ) , suggesting that other cpla2s such as cpla2 and cpla2 may contribute to producing arachidonic acid , and shokyo may inhibit these cpla2s . however , we could not detect cpla2 ( 114 kda in humans ) , cpla2 ( 61 kda in humans ) , cpla2 ( 100 kda in murine ) , and cpla2 ( 96 kda in murine ) . although the molecular weight of cpla2 from human / murine is 92 - 93 kda , cpla2 is distributed in the placenta . these results suggest that there is no or very little contribution of cpla2s other than cpla2 in hgfs ; therefore , the remaining mechanisms remain to be elucidated . as described above , our data that shokyo did not alter cox-2 activity and cox-2 expression are different from those of gingerols and shogaols . although there is no obvious evidence , the reason may be the preparation method of shokyo . however , the powders of herbs used in this study are prepared by decoction ; therefore , hydrophilic compositions are likely to be extracted but hydrophobic compositions are unlikely to be extracted . kanzo ( glycyrrhizae radix ) is the powdered root or stolon of glycyrrhiza uralensis fischer . we demonstrated that kanzo decreased lps - induced pge2 production ( figure 1 ) and further demonstrated that kanzo increased annexin 1 expression ( figure 5 ) , regardless of the increase of cpla2 expression , suggesting that kanzo decreases lps - induced pge2 production by enhancement of annexin 1 expression and following inhibition of cpla2 activity . moreover , we demonstrated that kanzo increased lps - induced cox-2 expression ( figure 5 ) . these findings are similar to those obtained using kampo medicines orento and saireito , which contain kanzo . in contrast , kanzo decreased lps - induced pge2 production when arachidonic acid is added , while kanzo did not decrease when pgh2 was added ( figure 4 ) . therefore , kanzo inhibits arachidonic acid cascade in multiple points and cpla2 and cox-2 activities . however , because the contribution of kanzo in kakkonto may be little , the ability of kanzo to decrease lps - induced pge2 production is weak . kanzo contains the compositions such as glycyrrhizin , glycyrrhizic acid , liquiritin , and isoliquiritigenin . nonetheless , the contributions of these compositions are unlikely in this study because they suppressed lps - induced cox-2 expression [ 3639 ] . moreover , the compositions that inhibit cox-2 activity have not been reported . cinnamon extracts have been used for the improvement of or protection against common cold , diarrhea , and pain . in a previous study , we demonstrated that erk phosphorylation was suppressed by kakkonto and orento , which also contains keihi . in this study , we demonstrated that this effect is responsible for keihi ( figure 6 ) . moreover , we demonstrated that keihi increased lps - induced cox-2 expression ( figure 5 ) and that keihi decreased lps - induced pge2 production when arachidonic acid is added while keihi did not decrease when pgh2 was added . therefore , keihi inhibits arachidonic acid cascade in multiple points , cpla2 activation , and cox-2 activity . however , the contribution of keihi in kakkonto may be little because the ability of keihi to decrease lps - induced pge2 production is weak . keihi contains the compositions such as cinnamic aldehyde , cinnamic alcohol , cinnamic acid , and coumarin . cinnamic aldehyde , but not others , suppressed lps - induced cox-2 expression and decreased pge2 production by raw264.7 cells [ 40 , 41 ] . moreover , cinnamic aldehyde suppressed carrageenan - induced cox-2 expression and improved footpad edema in mouse . however , the contribution of cinnamic aldehyde is unlikely in this study . aspirin - induced asthma ( aia ) occurs after ingestion of acid nonsteroidal anti - inflammatory drugs ( nsaids ) such as aspirin and indomethacin [ 42 , 43 ] . it is believed that aia is caused by leukotorienes ( lts ) , in which contract bronchus are increased by acid nsaids [ 42 , 43 ] . the production of lts is believed to be decreased because shokyo blocks arachidonic acid cascade at cpla2 level . in this case , shokyo may be safely used for patients with asthma , including aia , instead of conventional anti - inflammatory drugs . moreover , oral administration of ginger protects against aspirin - induced gastric ulcers in rats . therefore , shokyo is possible to be available as an anti - inflammatory drug instead of nsaids . we demonstrated that shokyo strongly and kanzo and keihi moderately decreased lps - induced pge2 production . moreover , shokyo may inhibit cpla2 activity and kanzo and keihi inhibit cox-2 activity directly and cpla2 activity indirectly . these results suggest that shokyo , and kakkonto , is clinically useful for the improvement of inflammatory responses in periodontal disease and other diseases .

azathioprine is an immunosuppressive agent used in the treatment of a variety of conditions , including inflammatory bowel diseases , connective tissue diseases , pemphigus , atopic dermatitis and neurological diseases . azathioprine hypersensitivity syndrome is a rare adverse reaction occurring a few days to weeks after treatment introduction . a diagnosis of azathioprine hypersensitivity syndrome may be delayed as its findings can mimic systemic infection or neutrophilic dermatitis associated with an immunological condition , such as inflammatory bowel disease , for which azathioprine was initiated . the cessation of azathioprine and the treatment with oral steroids led to a complete remission in all cases reported [ 1 , 2 ] . a 36-year - old male known to have ulcerative colitis , diagnosed in 2007 and previously treated with azathioprine and mesalazine , was seen at the gastroenterology department for a moderate exacerbation of his condition . azathioprine 100 mg / day was initiated along with prednisone 40 mg / day . of note , the patient 's thiopurine methyltransferase ( tpmt ) activity was not measured . two weeks later , he presented with a painful skin eruption on the back , buttocks and thighs associated with high fever ( 39c ) . on examination , there were multiple tender erythematous plaques , pustules and erosions on the lower back , buttocks and thighs ( fig . g / l ) and elevated c - reactive protein ( 128 mg / l ) . the histopathology findings showed a dense infiltrate of neutrophils in the hair follicles ; no papillary dermal edema was found and no evidence of vasculitis ( fig . we increased the dose of prednisone to 1 mg / kg / day ( 60 mg daily ) and azathioprine was discontinued . the patient had marked improvement within 3 weeks with a complete regression of the lesions . a 57-year - old male , diagnosed with ulcerative colitis in 2015 , presented with a painful skin eruption associated with high fever ( 40c ) 1 week after the initiation of azathioprine 75 mg / day and prednisone 10 mg / day for a flare - up of his condition . clinically , there were tender erythematous plaques and pustules on the lower limbs ( fig . g / l ) and elevated c - reactive protein ( 344 mg / l ) were among the laboratory findings . the histopathology findings showed a dense infiltrate of neutrophils in the hair follicles with no papillary dermal edema and no evidence of vasculitis . the dose of prednisone was increased to 20 mg / day and azathioprine was discontinued . the association of neutrophilic dermatosis and inflammatory bowel diseases is well reported in the literature . however , in the 2 presented patients , the appearance of symptoms and signs within 2 weeks after the initiation of azathioprine and the complete resolution after its withdrawal were in favor of the diagnosis of azathioprine hypersensitivity syndrome . its initial metabolism results in 6-mercaptopurine ( 6-mp ) and the imidazole derivative ( methyl nitroimidazole moiety ) . the metabolism of 6-mp by hypoxanthine phosphoribosyl transferase results in 6-thioguanine nucleotides , which are the active metabolites that disrupt the function of endogenous purines . they are responsible for the drug action and induce the dose - dependent side effects , such as myelosuppression , infection , nausea , vomiting and hepatotoxicity [ 2 , 5 ] . further metabolism of 6-mp by tpmt and xanthine oxidase yields inactive metabolites . however , hypersensitivity reactions to azathioprine are dose independent , and they occur regardless of tpmt level [ 2 , 3 ] . while the 6-mp moiety of azathioprine and its metabolites is thought to be responsible for most side effects , the imidazole component could be responsible for hypersensitivity reactions [ 2 , 3 ] . the exact mechanism is still not clear . in a literature review of 67 cases of azathioprine hypersensitivity syndrome , other clinical patterns with cutaneous findings included erythema nodosum , small vessel vasculitis , acute generalized exanthematous pustulosis and nonspecific dermatosis . the majority of patients developed symptoms and signs 525 days after the initiation of azathioprine . inflammatory bowel disease and neurological disease ( multiple sclerosis ) were the most common underlying diseases , comprising almost half of the patients . all cases reviewed showed either a normal tpmt level or did not report it . in a recent article , fever , painful erythematous plaques , leukocytosis , neutrophilia , elevated c - reactive protein and a histopathology of a dermal neutrophilic infiltrate with no evidence of vasculitis were among the most common findings . of note , in 2 cases , neutrophilic infiltration into hair follicles , similar to the histopathology of our patients , was reported . unlike our cases , the most common locations of lesions were the face , trunk , and upper extremities . the sweet - like clinical pattern of azathioprine hypersensitivity syndrome and the classic sweet syndrome have a lot of similarities . however , in some cases , as in ours , the lack of the massive papillary dermal edema and the hallmark dense dermal neutrophilic infiltrate in histopathology , as well as the lack of the classical sites of lesions usually seen in sweet syndrome and the presence of polymorphic phenotypes of lesions , suggest that they should be regarded as 2 distinct entities . it is typically reversible on azathioprine cessation [ 1 , 4 ] , but subsequent avoidance is crucial as rechallenge can lead to a more severe adverse reaction and even death [ 1 , 6 ] . therefore , it requires prompt diagnosis and must be distinguished from neutrophilic dermatosis associated with inflammatory bowel disease .