instruction
stringclasses 4
values | input
stringlengths 70
400
| output
stringclasses 7
values |
|---|---|---|
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTTAGGTCTCAGGGCCAGGTGCATTGGCTTATGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACCTGAGGTCAGGAGTTCGAGACCAGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCGGACGCTGCTGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGGTGCGGACTCGGGGTTGGATGCCAGGGTGCGGGGTCCGCCTTG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGTTCCAGGGCGAAACCGCGGTCTCTCCCTCTCCACGGGAGCCAGGAGCCCGCCCGGTGTTCCCCACCTCGCAGCGGGGAGGGAGGGTGGCCTCCCAAGTC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCGCAGAAGGGGTTCCCCGCTTGAGCTAACGTAGTGGTGGCATCCAGAGGTGAACGCGGGAGCGGCCGCCTGCGGAGGGCACCCGGCTGCGTGGCGTCCGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCGCCCCGTCTGAGAAGTGAGGAGCCCCTCCGCCCGGCAGCCGCCCCGTCTGAGAAGTGAGGAGCCTCTCCGCCCGGCAGCCACCCCGTCCGGGAGGGAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCCGCCCTCCCTTCAGGCGCCCGGCCGCGCCCGGCCGCACTCAACCGCGGCTCCGCTCGTGCCTCGCCTTTCCTCCGCAAGTCCCTGTGAGCCGCCTACA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTTCATGCCAGTGGCCCTGACTTCTCAGGAGAAGGGCACTTGGCTGGCCTGGTAGGAAGGGCTTCCTGGAGGCTGCATTCCTGGTTGCTGTCTTGGAGGCA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGTCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCCCCAGCTCTCGGATACAGCCGACACCATGGGTTTCGGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCGGAACCAAGGCACTGGGCGCGGTGAGGCCGTGGGCGCAGAGTCCGAGAATCAACAGCTGTGGCTGGCCTCCCCGCGCCCAGAGCGAAATTAAGGGCATG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGGGGTGCCAAGGAGGAAAGAAGGAGATGGCAGTGCGGGGACAGGGCAGAGCCTGGGCCAAAGGAAGCCACACCCAGTTCTTGCCCTGCCCTGCCCGACAC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTGGGCAGAGCGGCTCCTCACTTCCCAGTAGGGGCGGCCAGGCAGAGGCGCCCCTCACCTCCTGGATGGGGCGGCTGGCGGGGCGGGGGGCTGACCCCCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGCTTTGTGTCCGCGCGGGGGGCGGGAAGGACGGCCGGGGTCCCCAGTGCGCGTCCCGCGGAGCGGCGCGCGGCGCCCGAACTGGAAAGTTGTCGCCGGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTGGCCGCCAGCCATCCCACCCCTCATGGCTACCCTCTGCCCACATCCCACACCCAACGGGGGCTGCCTCCCAAGGCCCCACAAGGCCGGACCCAGGAGAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGTCGTTTCCGTCTGCTGGCGATAGTCCCGGCCGGGTCGCTGGTGTTGCCAGTTCCGCCCAAAGCAGCTTCTAATAGCATCAACTGAAAGAGACCTCCTAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGGCGCAAACTTACCGCGAGCGCCCGCAAAGCCACCCGCGCAGGCGCCCCGGGATCGGCGCTCGCCGCGCGCAACCGCAGTGACAGCCGGCGGCCTGGCTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTCGGAGGGACCTACGCCCACAGAGTCTCGCTGATTGCTAGCACAGCAGTCTGAGATCAAACTGCAAGGTGGCAGCGAGGCTGGGGGAGGGGCGCCCACC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTCCGGACGGCAGCCGCGCCCCCTCGATGCCTGCTGGCTAGCTCGCTCGCTCAGGCCTGGCCGGCACCCCTCGAGCACAGCGCACTTGGCCTGTGGAACGC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGGAAGGAGGGGGCCGGGGCGAGGGGGGCGCCTACCACCACCGCCAGCCCCACCACCATTTCCACCATGGCGGCCACCGCGGGGGCTCCCTGCTGCAGCAC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AATGCTGCTGTCTGATCGTTCCTCTGGAAGTTTTGTCTCAGAAGAGTACCCGTCTGTGTGAGGTGTCAGTCTGCCCCTACTGGAGGGTGCCTCCCAGTTAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AAAATAGCATCATAATTCATCATAATTTGTAGGCTCGCAAACATTTTCTTGGAATCCACTGGACTCCCCCATGCTTTTTAATTCCGTACTTTCTGTGCAAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTAGTGACCGCGCCGGGGTTTCGGGGTGGCCCGAGGCTGCGCGCGGGCGTGGCGGCCGGACGAGGAAAGCCCTGGTCTCGGGGGTGGCCGGGGTCGCCCCG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGTTCAGAGGGGGCTCCCTCCCCACCCCCGCCGGCGTCCTCCTCGCCCTGCCAGGCCAGGGCCAGCTGCAGGTCCAGCCCCTCCAAGTCCTCGCCGGTCA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGGTGACCCCCCCTGAGCTGCACATTCTCTGCCCCAAGGCTGCAGCCTCTAGCTGGTCTGGGTGGCTGGCTGGATCCCTGCCTCCTTCCTTCCTTTGGAC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCGAACCGCCAGCCTCGGCCCCCAGCTCCCACTCAGCGCCCATGCTTCAGGCTTCCGACGCCAACGGCCCAGGACCATGCGGCAGAGGAAAGCAGGGAGAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGACCCCGGGGACCCGGTGCGCACGCTGAGCAGCACCAAGGACGGGGCGCACGGCCGGGGCTACGGCTGCAGGAGCTGCCGGAAGGGCGCGGCAGGGGGTT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCGCGCCCAGGGCTGAGGAGGGGTCGCGGCGAGGACAGCCGGGACTGGGCGCAGGCCCGCACTGTCTGCAGCTCCAGGATACTCCGCGGCCGCCGCGGCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGAGCTGGGGCTGGGGCTGGGGCTGGGGCTGGAGCTGGCAGGCCGAGGTTCCCACCCCACAGGCACCGGAGATGAGTTGGTAAGAAAAGGGCACCCTCTGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTTCTCGCCGGCTGGTAATGGGGCCCCAGGGTGGGTGGGCGGTGGGGACAGGGCTCCCCAAGCTCTTTGCTGGCCTTCCTGGGGGTGTCCTCCGGGGACAT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGGGGTTCACTCACCTTTACAGGGGACTCAACGCTGGTAGCCAGCTCCCTATTTCACTTTCAGTTTCCGCTCAGAAGCAAGTCTGAGAGGAAAGGGGAGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCGCGGCGGGACCATGCTCCCCTCGGGGAACCTCCCTCCCCGTTTCTCAAGGACCGAGTCCTCCCCGCGGCCCTGCACAGCAGCCCAGCTGCGCCCCTGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGAAGGCCCGGGGCCGTAGGTTCGGGCAAGCATCGCGCGCCAGCGGCCCCAGCTCAGTGGCTGCCGCATCTCCACGCCGCTTAATTCGTCCGTTGCCCAAA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCGGTGATCTCACTTGCGGCGCCCCCTCCCACGCCGGCCCCCTCCTCCCCCACTAGAGCGGCCCGCGTCGACTCGATGGGCGGACTCGATCGCGCACGCG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGCCCAGACCACTAGCCTCCATGAGGTTCTGAAAGGGCAAGTAGGAGGTTCTAGCTTACTTGGAGACGCTAAAGAGAAGCATCGCAAATGCAGAAAACAGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GATGCGATGCGCCCAATGATGGTGCGGTCGCCCGTGTTCACCACCAGGCCCTGCACGGTGCCTGCAGGGGGGCCAAGGCGCGACTCAGGGATAGGGGGCGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAGTCCTGGCAGGGGGAATAACTTGGCAGGTGTGAAGAAGAGTAAGGAGGTGAGTGAGGCTGGGAATGAGCTGAGGCCAGACGACCAGACATGAGCTACAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCCACCGTGAAGCCATGACCTGGCGCCCGAAGCTGCCGGCCGGGGTGTACTCCGCGCGGGACCCTGGGCCTCCGCAGGCCCCGGCGGGGTCGCCCCGAGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGTGGTGAAACGGACGCAGATCAGTAAGCCAGGCTGACAGCAGCTCGGTCCCTTTATCTTTTCTATCAATTTCCAAACACGCGCCCCCTATTTCTCGGCGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCGGGGTCGGGGCCTGGGAAGGTTCCGCCATGGCCTCCCCCGCAGCGGAGAGCGGCGCCGCGCTCCCAGCCCTAGGGCCGCATGGGCAACCAGCGCTCAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCCGCACCCCTGCCCCCTCTCCGCCGGCCTCCCTTTCCTCTCCCAGGCACCCTAGCCGGGAATCTGGGGTCTGGGTCCACGCAGAATTAAGAGGAGAACC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTGGCGGAGGTAAGGTTCCCAGCTGAAGTTTGAACTGGGAGAAGCGCCGCCTTCTAGTCGCAGCTCCTGTGCTGTAAACAAAGAGTCCTTTCCGCAGTCTG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCTGCCCCGCCGCCCCGTCTGGGATGTGAGGAGCACCTCTGCCCGGCTGCAACCCCGTCTGGGAGGTGAGGAGGGTCTCTGCCCGGCTGCCCCATCTGAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCAGCAGAAACACACACAGGCTGGGTTTCCTGCCAGGCCCCAGAGACATGCTCAGCTCTCACAGGGAGGAAGAGGCCAATGGGCTCGTGGTCACTGCCAGA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCAAACACACACGCAGCGCCCGCCGGCTGCCTGCCTTTCTCCCTTTCTCTCCCTGCCTCCCTCCCTCCCCGCTCGCTCTCTCCGAGCCTCTCTCAGAATG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTTCTTCCTTTACTAGCCTCCACATGAAAGAGTTACCTATGTCTCAGAGGCAGGAAGAGCCAAGGGCCAGATGGCACCCTAACCCCATCATTCCTGTCCCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCACTCCTAGCCTCAGTCTCCCCCGTGCAAAATGCGCAAGGGGCCCGGGGCGCAGGCTCCGGGGGCGCCGAGAGCGCGCAGCTCCGCTGGGTACCCCCGT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCAAGATGGCGGGCCCTGACGGGGCCGCCCCCCTTGAGCCTGGCGCAGTGGCTGCGCCCATGGGCCCGAAAAGCAGCCGCGGGAGCCCAGGCCGCGCGGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGGTCAGAGGCTGCCAGCCACAGAGGAGGGCCTTTTTTGAGGATCTCCAGAGTGGGCGCCCTGCTGCCACTACCCTTTCACCCTGCCCCAAGACAGCATGA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACGGGAATGGGGAGGGAAGTGGGGGAGCGGGAGAGGAGGGGTCAGGGGACTGCTGAGGACCAGAAGTGGGCGGCTGCTGGGTGCGGGAGTAAGCGGCACGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGGCAAAAAGAAACCGGAAATGCTGCTGCAAGAGGCAGAAATGTAAATGTGGAGCCAAACAATAACAGGGCTGCCGGGCCTCTCAGATTGCGACGGTCCTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTGGCGGTGGCTGCGGCGACGGCGGTCGCGTCGGCGTCAGGGTCGGGGTCGGTAAGGGGTGCGGCAATGCTGCAACTGCGGGACTCGGTGGACTCGGCCGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGCGCGCGGTCGGATCACAAGGCGGCGGCGGAGGAGGCCCAGAGACCGGAGCGCGGAGACCTCAGCCAGCGGCCTACGCCCAGGCCTTTCTCCACCGGAGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTGGACTGCGCACTTCCAGCTCCCGCCGAGACCTGCGAGGACTACGACTGACTTCCAAGGAGGCCATGGCGGAACTGAGCCAGATGCCGGAAGCGGAATTA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTTGCTTCCATCAGATGGATTCTGCCGATGCTTCAGGTTCCCTGGTTCACCCGCTTCTCTGAGCATCAGTCTCCGTTGTTTTGTTGTGAGACAGAAGAAGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGGCGGCGCCGCTGCCGGCTAACGCGGAGGGGCGCCTGGAGGCGGCGTGGCGTCCGCTCTGGCTCCGACTCCGGCTCTCGCTCTCGCTTCTAGCCCGCGTG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTGAGACTTGGGGCTGAACGCGCGAGCACGGAAAGAAATCCCACCGTAGGACGGAACCCAGTCTCTTCAGCTCCATCCTAAACTTCGCAAGTTTTCTCTGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGGCTCCCGGCCGGGCCGCGGCCGCCGACCGTTGAGCCGCCGGCTGAGCCGCCTGCTGAAGTCCCTCCCTCAGGAACCCCTCCGCCACCCTCCACCTCCGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCTCCGCCCGCTGCACGGAGAGCCCCCCAGAGGCAGCGACACGGCGCTTGGGGTCCGCGGGGCTCCTCCTCCAACTCCGCAGACCTCCGGGGAGGCCTCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGGGCAAGTTTGTTCCCCGAGTTCGGAGCCTAGGAGCCCCCCGCGGCTGCGGCGCAGGTGCCCTCGGCCTGAGTCGGGATGGAGCTGCCTGCTGTGAACCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CACGGAGCAAAGAGCAGGAGGACAGGGGATTGATCTCCCAAGGAAGGTCCCCCAATCCGAGTCATGGCACCAAATTTCATGCGCGTCCGTGTGAAGAGACC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TATCTGCCACTCTCAGAACTTCCTCTCTCTCCTCGCTCCTCTCTGCTGAGCCAGGTCTCCGCATATCCTCCTTTCCTTCCCAGATACCTCCCTCGGACCTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCGGGCGGGCCGGGTCAATGAGGAGCGGCCGGCGGAGTGCTGGGAACGGGAGGCTTGGACTGGGGGCCCGGGCGAGGCGCGGCCCGCGGCGGGTGGAACT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGTCCTCCGGGGCTCCGCCCCCACATGATGAGTGCCTCCTGCAGCCCTCAGCCGTCCCTGTGACTCCTGGGGCTTGCCATTGTGCAGATCGGGGTGCACAT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGGAAAGGGCGCCCGCCGCCTGCAGCCCCGCGGGGAGGGGACGAGGTGCGCCGGGCCCAGCTCTCCCGGGGGCCCGCCGGCCCTCCCGGCACAGGCCTCGC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCTGGCCGCGGGACCCCGGGCCTTCCTGCACTCCTCGGAGGAGGCCGGGGCGGCGGGCGGGCGGCGGGCGTCCGCGGGAAGGGGGCGCGCGTGGGCCGGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCAGACCTGGCCGCGGCCTTCAGCTCTCTCTGCCTCTGTGAGCCGAGGGCTGAAGGAAGCCGGAGCCCTGGGCCCTGACACGTACTCACTTTCTGGCCCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TCGAGTCGAGAGCCCGGCCGACCGACGCGCGACCCGCGCGCGTGCCACTGCAAGCTCTGCCTGCCGGCCGGGAGTCTCCAAGGCAAGGGACGCACTCGGCG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTTAAGCAGATACAAAGGCTCGGCTTGTTTTGTTACAGTTCATTCTATTCCGCGCCGCGGAGCGCAGCGGCCGGCGACAGGAGACGCGCGCGCATGCGCCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ATCTGGCGCATGCGCATCTTTTGTGGTGCCGCAAGATGGCTGCCAGCCATTTTGTCGCGCGTTGCTCCTCCGAGGAGTTGGGGGCGATGGCTGCAGCCCCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCGCCCCGCCCCGCCCCGGCTCCTCCCTCCGGCTCCGCCCTCGTCCCGCCCCGGCTCCTCCCTCCGGCTCCGCCCTCGTCCCGCCCCGGCTCCTCCCTCCG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTGGGGTCTCCGCCCGGGTGGACAGTGGCTGGGAGGTTCTGAACACGCTGCGGCTGCTCCTGGCCAGTCAGGTGGGGAGGGCGGCAGGGGTGGGAGGGAC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTGCCCTAGGCGGGAGGGAGGGTCGGAGGAGCCCTATCCTGCTGCGCGATGGAGGCGGTGGAGGCGGCGGCTCCGGCTGGAGGCTGGGACGGCCTCGCGCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TAAGGAGCCGGACCCGTGGGAGGGGCGGGGGCCCGCACGCCCGAGCTCTGGCCCTGTGCCGAGCGGACACTAGGACATCGCCCAGGCCGGAAAGCACAGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGAGGTCGCTCGGCCCCGCCCCCTCGCACTTCCGTGTGCCGCGGCGCCGGAGCCCGAGGCGGCTGTAGCCCACATCTCCCGAGCGACCCCCGGCGCCCGCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAGTCAGCACCACGGGGCATCTTCACCAGCTCATCCCCAGCCTCTCCATGTATGGCCCAAAGCTGGCATTTCTGATTTCCAGACTCTGCCTCCTGGCACCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AAACCACTCTGCCTAACAGTCACCCCGACGGCCGACGGCGAGGAATTGTGGAGGGGGCGGGGGAGAATTGCTCAGAACTTGGAAAGCGACTGGTCTCTCAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTTCCGTATCGAGGACCCCAATCAACAACCCACCTGGTGAGCGCCATCTTCTTCCGCTTCTTCCAGCGCGAGCGACAGCACCGCTGGGCGGGTCTTTCCAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCTGTAGAGGTCCATGCATTGGTGTGGGGCCAGTGGCTAGACTTCTTTGGTCAGCTTGGTGAGTCAAGGGCTAAGAGATGCACTAGGCACCATGGTTATA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGCCCTCCTGCCCCCTGCCCCCCCGCCACTGCCCCGGGATTGCAGAAATGCTAGGAAGCTGCACTGAAGTCAAAGCAGCAACCCCGGCCAGCTGTCCCACC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CAAGGAGCCGGCTGCTGGAAGACTGCTCCGAACCTCATCCCCTTGGTGCTCCTGATGCGGGCGATCCTCCGACTGCTCGGCGCCAACCACAACATGCTACC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAGGGGGCAGATTCAAGCGGGGCCTGAGCCCATCCCTGACCTACCACCTGCTCAGCTGCTGCAGGGAGACTTGGCTCCTGCACCCACCTCGTACTGCAGGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AACAGGCCAAGGAAACCCAGTACAGGGGGCTGCAGGGCCCAGGGAGTGGGTCCCTCATCTCTCCTCCCCACGCTTGGCCAGGTCCCCACCTCCCGGGAGTG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AACTTTAAGCAGTTGCTAACTTCAAACGTGGAACGCTTTGATGACTGCTGGCTCTCATGCTGTCTCACTGACATCCACGTACTATGCTTTAGTGGCCATCA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AAGTGAGGCGCCCCTCTGCCCGGCCAGCCGCTCCGTCCGGGAGGGAGGTGGGGGGGGTCAGCCCCCCGCCCGGCCAGCCGCCCCGTCCGGGAGGTGAGGGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCAACCCTGAGGTCCCTGGGCCACGAGCAGTTTGCGGGCGGCCTGAGGAGGCAGGCAGAGCTTCCCCCAGGCTGGAGGGGCCGTCTGCGGGCACTGGGGCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCAGGAGGCGGTGTCCCGTGACGCCGCGCGGCCGCGCTGTAGTGGCCGTCGAGGCCGCCGTCTGTTCGAAGGCTGTCCGACTTCACGGTTCCCCGCGGCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAAGCACCTGCACCCGAATCTGGGGCCCAGGGCTGCCCGACCCCCACTCCCATGGATGATGAGGAGCCCCAGACACCAGCTCCTCTGGCCTGGACTCAACT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CACCCTCCGCTCTGGACGCACTGGGCCCCAGGCCTCGCCCAGCCCGGGGACCGCTCCTCCCTCCCGTGGCTCACTTTGCAAAGGCACTTCGAGTGCGCGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCGGCCGCCTTGCCCCCGCTTCCTTTCACGCTGTCGCTGCCCGTAGGTGGTTGTGGCCACTGTGCCCGGAGGGAGGCGGCGGTGGCCAGTAATGCCTGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGCGCGAGGGCGCAGCGCCCCCAGACCGTCGGAGAGCGCAGAGAGGCAGCGGCGTGCTGAGGTTTCGCTGCCGCCCGGTCTTCCGCTGAGGCCCACGGGC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTAGAAGCCCCGGGTGCCGCCGACTCCGGCCTCAGAGTCCACTGCCCTCGCCCGCACTTTCCCGCGGCGTTACGAGGGGCCAACTCCGGGTGCCCGAGCCC | Binding Sites |