instruction
stringclasses 4
values | input
stringlengths 70
400
| output
stringclasses 7
values |
|---|---|---|
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCACACCCAGACCCACGGCGCACCCATCGCGCCCCGCACCCCCGCCCCGGCCTCCCGCCCTGCCCTCCCCCCCGCAGCACCCAGGCCGAGTCCACCGTTG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTTCAGGAAACAGATCATAGAAGCCTGTGGTTTCATCCTGTGTTCTCAGAGAAGAGGCACCAGGCTGGAAAGACATTTCTTTGGGCAGACAGGCCCAGAG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCGGCTGGCCGGGCAGGGGGCTGACCCCCCTCCCCCCTCCCGGACGGGGCAGCTGGCCGGGCGGGGGGCTGACCCCCCCCACCTCCCTCCCGGACGGGGTG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCCAGCCTGGGGCGCGCCCGGCCGCCGCCGCCTTCGCTGCCGCCACGGGCCCGTCTTCTTCCTCCTTCGGCTCCCAGGGTAAGGCGCGGGGCGCGGGGTT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGCCTACGAAGCCACCGAAACTGGAAACTCTGGCCTGTCGGCTACTTTTGCTCGTACCAGCAGGTGTGCACTGCCGCGTCAATCTCCAACAAAGCCGGAAA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTTTCTCTGGCTTTGCCCGAGCGGCGGCTGCCGGAGACCGAGCGGCTGCCCTTCTCGCAGCCGCCGCTGGGGGACTGGCACCTCTGGGTCCTAAAGGGATC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCATAAACTACGCTCTAGCTCCTCCCACTGCCGTTGTGGGTAACGCGGACGTGGAAGAACCTCGTCTGCGGAGGAAAAGGTAGATGTTAAATGGTAACTAC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCACGATCTTGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCATGCGCCACCACGCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGAGGGCTGGGCCTGAGGGGCGGAGCCCCGGCCCGGAGGTCTGTCATGCTGTTCCCGCTCCAGGTGGCCGCTGTAACCTCTTCGGTCCGCGACGATCCTCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACACACACACACACACACGTCTCTTCACCGGGCTCCCCTGCTAAGCAAATATGTCTCCCATTCTCTAGGGAAGTGTGTGTGCACCACTTGAAAAACACTAT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTCCTTGGACAGGCGACTGCCCGAGCCCCCCATCGCCCCGCCGCGCGCACAGCTCCGCCAACTCGCCTCGAGACGCAGACAACTTTCTCACTTCCGCCCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CACCCTGTTGCCCAGACTGGAGTGCAGTGGCGCCATCTCGGCTCACCGCAACCTCCGCCTCCCAGGCTCAAGCGATTCTCCAGCTTCAGTCACCGGAGTAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAGCATGCGCAGTGGCCTCGCTGGGGGATCCCGTAGAGGTTTGGCGTGTGGCCTGCGGGTTCCCCGGGCGGGTCGACGTGCGCTCCTCTCTGGTCTCGAGT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGTAAAGCTCGCAATCCGGGTGGAGGCCTCCACGTCCTAGCGCAGTCCAGTCCCGGGCGCAGGGAGGAGAGCTGGTCAGCCAAGATTCCAAGACAGGTGTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCGTCTCCAGTCCCGGGCGCAGCCCAGGGTACGTTGTCAGCATCGCGGAGCGCGGCCCTGGGCCTCTGCAGCCATCTTCAGGGAGGGAGGCGCGGCCTCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTCCACCATCTGGCGCTCCTCTTCAGCTATGGACTCGCACATTCAGCCCCCATTCACTCGGCTTCATTGATCTCCAGCAGCAACATAGTTACTTTCTCTT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAGGGTGTTCCAGTCCCCGGACCCTGCTGTGGACATGAGGACACCCATCCCCCACCAGCCGAGCCAGCTGCAAAGGCCTCATAATCCAGCCCCGGCCACCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CAAGCGCTCCGGGCCCAACGCCAGCGCACCCCCGGCCCCCGACACCCCCAGTCCCAGCGCCACGCCGGCCACCACGGCCACCACTGTCAGCAGCACAAGCA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCATGCGCACTCGGGCAGCAGGAGCCGCGGCGGGGAGGGGCGTCTTGGGCCTGGAGGTCAGTGTGGCCTCGCGTTTGTCTTCGGTGACGGGAAGTGAGTTT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTGCCCAGACACCTCGGGATGAGCCCCTGGTGGGACTGCTCGGGTGCCGGCAGGGAGTTCCTGGACCCACCCAAAGCCAGCTCTGCTTCTCCCTTCTCTCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACAGCCGCGGCAGGAAGCAGGCGGGCGCTCCCCGGCCACAGGCCTGTTGTTCTCGGAAGGGAGAAAGCTGGACATTTCCCCACGTAACTCCCAGCTCTGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAAGAGAATCACTTGAACCTGGGAGGCGGAGGTTGCAGTGAACCGAGATTGCGCCACTGCACTCCAGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTGCTGATGCTGTGCCAGGCTCCGAGGCCCCAGGACCCCGACCCGAGGCTGACACAACCCGAGAAGAGTCTCCAGGAAGCCCCGGGGCAGACTGGGGCTTC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCGCGCAGGGACGGTCCGGGGAAGCACTGGAAACAGCAGGACCATCCCGAAACTGCTTCTGCAGTGGGAGGCGCCGGGCGCCCGGCTGGCCGGGTGGAAAC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTTCTTTTCTGTGTTCCGTCTCCTCCGGAGCGGAGTGAGAGGGAAGCCGAGCTCACCCGCCGCCTGGCAGTGAGCCGGGGTTGTAAACGGCGTTTGCGCTG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AAAGGGGAGCGCAGGGGTTGCGGCGGGACTAGGAGCGCGGCGGGGCCGGCGGCAGAGCTGTCCGGCTGCGCGGTGGCCCGGGGGGCCCGGGCGGCAGGGCA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACATCCCCCAAGGGCAACGCTATCTTGATTACTCACCATGACATGCGTTTTACATTTACACAAATAGCCTCCTGTTACAGAGTTCTTTGGTTTTTGTTTTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCTGCGCAGGCGCAGTCGGCGGTCGGCGTGGGGCGCTATGCCGGGGCGGCACGTTTCTCGAGTCCGGGCATTGTACAAGCGCGTCTTGCAGCTGCACCGT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGCGCCGCTCTTTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTGCACGGTGAGTGCGGCGCCGGGGCGGGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGTGAGTAGCCAGGCGGCGCCCCGGTACCCAGCGCGACCCGGGCTCCGGCCCCGCCACTGCCCCCTGGCGGCCCGGCGAGCGCTGACGCCCTCTTCGCCCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCAGATACACGCCTGGCTTTAGGGGAAGTCGCGGCACTGGGTCTGCAGAGTCCGCTGAGCACGCACCTTCGTTGTGAAACTAAGGAAACCCTGGAGTGTCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTCTGCCCTGCAAGTGACCGTTTTCCTCAGCTCCATGGCTGTGGCCCTGGGTAGCCACCTCCACGGCGAGCCTGGGCTCCCTGGAGCTTTCTGGACCTGGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCAAGTACTCTAGCTATGGGCACTGGCCAGCTGCTGGGAGCGGAAGCGGCCGCCGAGCCCTCCTGGGCGCTGCCCGCCGCCGCCGGCTCCGGAAACCGGGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TCCACCCGCCTCGGCCTCCCGAAGTGCTGGGATTACAAGTGTGAGCCACCGCGCCCAGCCTCATCTCAGCACTTTAGGAGGCTGAGGCGGGAGGACTGCTT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CACCGCCCTCCGAGTCAGAGTCCCGGTCCAGCTGCCCAGCGCTGCTCACGATGTTGGCCAAGTGCACGGCCGTCCAGGCGAAGGGCATGCGGTAGCGGCCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACGTGCCTGGCATCGAGAAGAACTGGAGCACCGACCTCAACATCCAGGAGATCATGACGTGAGTGCCCGCCCCTCCCTGCAAGCCCCACCCCACAAGCCCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTGGCTCCCCCAAGGACCCCTCCCAGACCCCACAGCTGGATGTGGCCTTTCCCTTCTTGAGACTCCTGGGGTACGTCACAGCTGTGTACCCATCTGGCCCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTGCCCGAGGCCGCTTTCCGTTGCAAAGGTTCCTGAATTTGGGGAGGAAGAGCAGCAAGACTGAAATATTGGGCATACGTTTGTTGCTTCATAAACGTTT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCCTGCTCGCTGGGACCCAGGTTGGAGCCGCCCCAGCGCCCGCAGCCCCCCTTCCCCGCCCCAGGGCTCCACTGGGTCTCTGCCTGGGGCTGCCTTAACG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCGATGGCACTTAAGAGAGACCGGGAGGGAGCCGGGGAGAGCGGGCGGAGGGCGGGCGGGCGGGCGGAGGAGGGGCGGCGGGAGCCGTGCGCGCCGGCGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CAGTGGCCCGCGGTGCGCATTCTAATCCGTTTCACACACGGTGCTGCTACCTCGTTTGCTTCGTGCGTGCGTGCGCGCGCAGATGTGGGCCCCGCGGGAGC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCCCGGGAGCCGGGGCCTGGGGGGCCGTAGACAGCGCCAGACCTTCACTGGCCGCCCGAGCGAAGGGGTGGAGGTTGTCTTCCTCCTCCTCCTCCTCCTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AAAGCAGAAGGAAGGCGGGAGTCCCGACTGCAAACATTGAGGAAAGCCAGGCAGTAGAGGCCGCTATGGCGAACGTTCCGTGGGCAGAGGTCTGCGAGAAA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACCCTCGCCCCCAGGCCTACACACAGCTGTAGAGGCAGCGCCCGGCGCCTGGGCTGCACAGTGGGTGAGGCTTCCCTTCGCCTCAGCCTATCCCAGGCCTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGTAAATGGACAGGGGCCCCTCAGGCTGCCTCAGGGTCCAGCAGCCTGACGGCTCTGGCCCTGCCCGAAGAAGTAAATGCCAAATATGGAGGTCATTATGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCAGTGGAGCCACATGGCCTTACGGATCCCTCCCAGCCGAAAGCAGGGTACCAAGCCGACCTAGCCATTAAAGCAGCTTCCTGTGGGCGCGGCGCAGGACT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTCTGCCAATGATCCAGGAGCCGCTCCTTTCCACTCGGGAAACCTTCAGAGGAGTCTCAGAAAGGACACGGCTGGCTGCTTTTCTCAGCGCCGAAGCCGCG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCGGCTCCCGGCGCCCTCGCTGCCCCGTCCCGTCCCGCGCCCGTCGGGCCGCCCTCGCCGCCTCACCCGGCCTCGCCTCTCAGAGCCTCTCCCCTCCCCG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTTGAGTCGGAGGACGTCCGGCTAGCTCTGTGAACGGTGTTACCGCACTCGTCTCTTCCGGAGGTAGAGGGGCTACTCGCAACAGGAAGTTCCGCCCTTA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCGCCCCGGCCGGCGAGCTGCCGGCTCCCGCGCGCGGGCCTCGTGGCCGGGCGGCGCTGGGGAGAGGGGCCAAGCGGGGCGCGGGGCGGCTTCAGAGGCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTACCTTCCCCCACCTTCCTCGACAGCAGCCTCAGCGGCTACCTTCCCTCACCTTCCTCGACAGCAGCCTCAGCGGCTGCCTCCCCGCCACCCCCCCACA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCCCCGGTCAGGCGCGCCTCAGGGCGGGCTCCCCTGGCGGAGGCCGCGGCCGCCTCGCAGGGGCCGAAAGCGGCTGGGCTCGGGGTTTTTTCTCTCCATT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTTCCCAGCCTCTCCGGCGCGCTCCAAGGGCTTCCCGTCGGGACCATGCGCGGCCGTGAGCTCCCGCTGGTCCTGCTGGCGCTGGTCCTCTGCCTGGCGCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGGGAGGGGGCCGAGGAGTGACTGAGCCCCGGGCTGTGCAGTCCGACGCCGACTGAGGCACGAGCGGGTGACGCTGGGCCTGCAGCGCGGAGCAGAAAGCA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TAGAGGTCAGGGGCGTTGAGGTCTTGCCGGGGGGGCAGAGGAGCATCACGACTGTACTGCACTTCCCAGTTCTGGCAGTGGCAGTGGCAGCAGCGGCCACA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTTCTCCCCCGCGCGAACCCCAATCTTTTACTAAAAGCGCACGGTTGTCCGGAACCGCCGCGCCGGAAGCCGCTGTCTTTCCCGTCCCTCGCCGGAAGTG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AACCAACCCAGGGGTCTAGTGAGGAGTGCATTTGCCAGAGCTGCAAGCAGGATTACTATGGTTTATACCAAAACCTCAAATACAGTACCTCCCTTCCTGGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCAGCATTGGCCCTCCCCAAGCAGCCATGCCAGTCCTGTTGCTCCAGCATCCAAAGCCGAGGAATTCCTATGAGACCCACCTGCCGCCGCTCAGCCGCGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCACCCCCCGGGATTTGCTGTCCGGGAGTGCCTGCGTCCCTCCTGTGCGCGGCTCTGGGAATGCCGGGCTGGGGCTGGTTGTCTCGTGCGGGCGTTCCTG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GACTGGACCGTGGGGAAGAGGAAAGAGTCGGCAACCACAGCCGCTCCACTCCACTCCCACTCGGTCGCAGGCTCCAGCAAAATGGCGCCGGCGCCGCCAGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCGCAGCCTGCCAGTCTCCAGACCGCTGTGGCATGGGGTAGCAGACACGCTCTCCAGGGGCAGATGGTGGTAATCGCAGAGATTCTGGATCCCCATGTGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CAATCTCCACCCCCCAGGTTAAAGTGATTCTCCTGCCTCAGCCTCCTGAGTATCTGGGATTACAGGTGCCTGCCATCCTGCCTGGCTTATTTTTATATTTT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACCTAGCAGGCTGTCCTGGGAGGTCCACTTCCCTGGGGGAGACGGCACTGAGCCCCTCACCGCCTGCCCTTCCCTCCCGAGGGGCTCCCAGGCAGGTCCTA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CAGCGGCGGGCGGGCGGGGCGTCTGCGAACCCTCGGGGTCGCGGGGGAGGTGGGGCCCCGCGCGGGGGCTGGGGTCGCCGCTCCTTACCTACATCTGCATT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGGCCAGGCTCTGGGGCGGGGGCCATCCCGCCCGGACGGGTTTGGGAGTTGGGCGGGGGGAAAGCGCCGCCTCCGGAGGGGAAGGGGCGGTCCCGAGGACT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCA | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GAGAAAGGGAACACGGAGACGCTTGCGCAGTAAACACCGCACGCTCTCTTGCCTCGCCCAACCCCTTCTCTGCAGCAGGGAATTGCAGGCGTCGCTCCACC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCGACCGCTTCCGGTGCGCCGCGAGGGCCGCCGGGACGGGTCTCCCTGGCGATCCGTGGTGTGCCGCTACTGCCGGTGCAGCCGCCAAACCGGTGCCTCG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TCCCGCCCCGCAACACAACCGCCTTTTGGGAAGTCTGTTTCCGACCAAGTGTCAGAGAAGAAGGGCCCCAGTGAGGTCACAAAGCCCGGCACCTACGAATC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCGGGGTGCGCTGCTACGTCGCCCGCACGCCTGCCTCGGGCGCGCGGGGCCCGGATCCCGCGGGTTGGGGTCTTCACCCTTCCTGTGGTCGGTGGGTGGGA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCAGGTTTCCGGCTCCGGGTCCCGGGAGGAGGATCGCGGGCCAGAGGCGGAGCCGCCGCCCTGCCGCGACTTTCAGACTCCGACCATGGCCTCGCGCTGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TGTCCCAGCCCCAGCCCCACTGGCCGGGCGGCCTGGCTGTGTTCTGTGCTGGCTCTCTGCACACACTCTGCTGCTGCTAGCAGTGGGGTCCCACAGACATG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TCTTCGCCTCTTCCCGTCGGATCCCATCCCGGGATGTCGGGGGCAGGCGAGGAAGAGGCGGGGTCCGCGGGCGGGTGGAGCTCACCCCTCGAGGCTGTCCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCCTGGAACTGGTGGTGACAGATGAGAGGACACTCAGGGATCCCAGCCCCAGGCACTGCATTCAGGAAGGGGTTCAGCTCTCAGGGGGTGTCTCCCTTCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TACAGAAATGCCAGGCACAGTGGCTCATGCCTATAATCACACATACTAGGTGGGAGATTCACTTGAACGCAGGAGTTTGAAGCTGCAGTGGGCTTTATGAT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ACAAGCCAGTTACTTTCATACTCAGGGACACCGTCCCCCCCTCCGCCCCCCGCCCTCCGTAAGTGCTATTTTTACATCGAATGCCCTAGTCTGGAAGTAGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTTGGGGGAGCTACTGCGCAGGTCTGCGTGGAACCTGGTGGGGTGCGCCTGCGTCTTGGAGAACTAGGGTTGTCGCTCGTGGAGACTTTTGAACAATTTTT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTTGCTGTTGCTTAAAGTTCATTTGAACAGACGGAGCTCAATGAATTCCATCTTCCGCAGCCAAATTAAATAGAAAACAGTGCATTCTTAAGCAGTTCAC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGTTCTCCCAGGAGGGGAGGGAGGGGAGGTCAGGCCAGGCTGGGGGTGGGGCTCAGAGGCCTGGCCCTGGCACCAGGCAGAGGAAATTCCAGGCTGTAAGT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCCTTCCACTTTTGGCGTCCCAACGTCTCTCCGCTCCCATCTTTCTACTAACGTCCGACGCACGCTCCGCCTCTTTCTCCCACATTCGTCGTGTAAATTCT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCGCCCGGCCCGTACACCCAGCGCTCCAGCTCTTCCACTCGGGCCTGTAGCCGCTGCAAGTCAGTCAGACCCGCCATCGCTACTACCGACCCACCTCGGCC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AGTCTCGCTCTGTTGCCCAGGCTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAAGCTCCGCCTCCCGGGTTCACGCCATTCTCCTGCCTCAGCCTCCTG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TCCTTTGCCCAACAGGTGGTGACTTTATTTCCATCCAACTCCATCCCTCAGCACCCCCAGCGCAATCCGGCCTCCCTGTACCCACGCAGGCCCGCTCCCCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTGCAGTGGTGCGATCTCGGCTCACTGCTAACTCCGTCTCCCAGGTTCATGCCATTCTCCTGCCTCAGCTTCCCGAGTAGCTGGGACTACAGGTGCCCACC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTGGGCGGCGGCGGCGTTAGTTCTCCGGGTACCTCAGGCGCCTCAGCCTCCTTAGTCTCCTCATCCTGCTTCACAGGCTCCGCGGCCTCCGGCCTCCTCG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCTCCCCGGGTCCTCAAGCCGCCGCTGCTCCTACAGACAAAGTCGTCCGCACCTGACTCTGCTGGGCGCCGCCATCTTAACCGGAAATACGCACGGTTTCA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CGCTGTCGCCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTCACCGCAGGCTCCGCCCCCGGGGTTCACACCATTCTCCTGCCTCAGCCTCCGGAATAGCT | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TCGCGGAACGATGACGTACAGGGCTCGGTCGCGCTTTGTGACGTTGGCGTTACTTGCAGATTTTGCAAAGGTCCGGGCTCCGCTGTCGAGGCCTTTGCTGT | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | AATCAGAGAATCCTTGCAGAACGTCGTGAGTGTGCTCTCAGCTGCAATCACCAGAAGGACTCTTCACACTCGGTGAGTCCTCCTCATTTTATAGAAGCCAA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | ATAAAAGCGGCGCCGACGCACGGCGCGGGGATTTTCTGCTCCGGTTGGTGAGCGCGCCTGCGCGTTGACGGCGATTTTGCGTTCTGAGGCTGCAGCGTCGG | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GTGCCTCGCGGCCCCGATAAACCTTGAGCTCCCAGCCTTTGCCCCACCCCTCGCTCCCGGAACTCCACCTCCCAGAAGGCAGCGAGAACCGCACATGTGGC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTGGTTTGGGGCAGGAGTGGGTGTGGAGGAGAGCAGCTCCTGCCCTTCACTGGAGCCAGGAGGACTCGGCTTTGGGGACTCTGCTGGTTCTGCTCCTCCC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CCAGCCTGCAACCATGTAGAGAAGGCCCAGCCTGACCCAGCTGTTTCCTCAGCGGCGACTCTGCCCCAGGCTGTGCCAGGTGCCCTTGTCCCATGTTCCTG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTGTGCTCAGCCCCGGCCTGCCGGCGCGGAGCACGGCGGCAGGAAACCATTCTCTTCTCCCATTGGGAGCGCGACCCGCCATTCACTAGCGGGCCTTCGGG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | CTAAGTCTTAGGAGGAGGCGGGATTAGCAAGAGAAAGGAGGAGGAGGAGGGGAAAAAACTACTTTTTGTCTCTTCCTTCCCAACCCCTTTGGCTTCGGCCA | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCTGAACCTGGGAGCCAGAGATCATGCAGGTTTGCAGACCAGGGCAAGACAAGAGCACGGATTGCCCACCCCAAGCAAAAGGCAGACCAGCCAGCAGGAAG | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GGCCTTGCCTCCGCGAGCTCCGCGGCCTCGGCCCCGGCCCCGTCCACGGCCGCGACCCCGGCCCCGGATGCCACTGCCGAAACCTCCGCGGAAGCCACCGC | Background Sequences |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | GCGTCACGGCGAACGGGCGGGCACCGGGATTCTAGAGGGCGCGGGGGGTTGAGTGGGGCGCGCCGGCTGCAGCTGCCGAGGCGGGGCTGGTTGGGGTCGTC | Binding Sites |
Determine the Transcription Factor Prediction of following dna sequence, The result will be one of the following: Background Sequences, Binding Sites. | TTCGGCCACCTAGCCGACTGCGACTTCCTGGCTGCGCTCTACGGCCCCGCCGAGCCCTACCGCTCCCACCTGCGCAGGATCTGCGAGGGCCTGGGCCGGAT | Background Sequences |