Datasets:

clinicalnlplab

/

PubmedSumm_train

like 0

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: leprosy patients may face the effects of stigma and different forms of discrimination , such as rejection , abuse , divorce , or loss of employment , leading to reduced self - esteem and loss of respect from their communities . interpersonal relationships , social status , mobility , and dignity suffer and may cause anxiety , depression , emotional stress , isolation , and suicide or attempted suicide . multiple studies found women to be more affected by leprosy and its stigma than men . often , the social and psychological complications due to leprosy remain even after the medical treatment is finished . the psychosocial consequences a person has to bear after being diagnosed by leprosy are often heavier than the physical consequences that may occur . an important example of a social complication of leprosy is the effect of leprosy on marital relationships . a qualitative study on the psychological needs of men and women with leprosy in south africa found that one - third of leprosy patients had been abandoned by their spouses . she states that it is clear that in maithili and nepali culture , it is undesirable to marry someone who has been or is affected by leprosy and the prevalence of visual signs of leprosy is important [ this time in ] affecting the opinion of prospective partners in arranged marriages . adhikari and colleagues , who did a cross - sectional study in nepal among community members unaffected by leprosy , found that 48 % of the community members thought that people affected by leprosy would encounter marital problems . however , not much is known about the nature of the effects of leprosy on ongoing marriages and even less is known about the effects on sexual relationships and perceptions of sexuality and reproductive health . in nepal , as in most cultures in the global south , marriage is considered very important . definitions of marriage may vary among nepal 's 60 ethnic groups . according to lamichhane and colleagues , however , overallwomen are expected to play a subordinate , submissive , and more conservative gender role in marital relationships especially in rural areas . in particular in rural areas , early marriage is quite common . even though there is a slow shift from arranged marriages to love marriages , arranged marriages are still predominant in nepal and individual choices are subordinate to relationships and agreements between families . in case of arranged marriages , especially when they happen at a young age , premarital romantic relationships often do not happen . for the majority of nepali women , the onset of sexual activity occurs within marriage . closely linked to the common practice of arranged marriages , marriage in nepal occurs at a rather young age , with a median age at first marriage of 16.5 years for women born in the late 1970s . sexuality is closely linked to marriage and has long been avoided as a study topic because of the taboo associated with discussing sexuality . for this reason , , no research has been done on the effects of leprosy on sexual relationships and perceptions of sexual health . however , a number of studies have investigated the effects of disability on sexual relationships . for people with a disability , sexuality is often not recognized as a legitimate form of pleasure and an expression of love . mccabe and taleporos , who studied predominantly people with a spinal cord injury , cerebral palsy , and acquired brain injury , found that having a physical disability leads to increased negative feelings , including a belief of being less sexually attractive than people without a disability and the feeling that people with a disability are limited in expressing their sexuality . the latter are generally less satisfied with their romantic relationships than their able - bodied peers . people with a disability are sometimes viewed as asexual . it is often inaccurately thought that people with disabilities lack the desire , ability , and capacity to be sexually active . according to nosek and colleagues , having a mobility - related disability limits the opportunity for sexual activity . they state that women with disabilities reported significantly lower levels of sexual activity , sexual response , and satisfaction with their sex lives . a lack of privacy , dependence on others for care , and inaccessibility to homes and meeting places also make it more difficult for people with a disability to maintain sexual relationships . leprosy is one of the neglected tropical diseases endemic in the country . in 2014 , 3,046 new cases were registered . in addition to those currently on treatment , many thousands of people live with residual leprosy - related disabilities , many of which are aggravated by social stigma which is still very strong . the scanty evidence that is available indicates that leprosy may severely affect relationships , to the extent that even divorce is not uncommon in marriages in which one spouse develops leprosy . given the fear of contagion that surrounds leprosy , it is likely that divorce is only the tip of the iceberg and that many problems in marital and sexual relationships go unnoticed . this study aimed to investigate the experiences of women affected by leprosy regarding marital life and sexuality , comparing these to the experiences of women with other physical disabilities and to those of able - bodied women in south - east nepal . this study focused on women , because women are often more severely affected by leprosy and its stigma than men . this study used a cross - sectional , nonrandom survey design with a qualitative approach . three groups of people were included in the study : women affected by leprosy , with and without visible impairments.non - leprosy - affected women with visible impairments.able - bodied , healthy women.the first group consisted of women who had completed their leprosy treatment and women who still received treatment . of the women who had a disability resulting from leprosy , the disabilities were graded using the grading system of the who , which grades impairments in eyes , hands , and feet . each hand , foot , and eye ( left and right ) is assessed and graded on its own . either the maximum grade or the sum of the six grades is used as indicator of the severity of impairment . in this study , the women affected by leprosy had to have at least a grade 1 impairment . both women with grade 1 and women with grade 2 impairments were included , to explore both problems resulting from physical appearance and problems resulting from the diagnosis of leprosy itself . women affected by leprosy , with and without visible impairments . non - leprosy - affected women with visible impairments . included were women with an impairment obvious to the community based on appearance and / or those with limited functioning . examples of visible physical impairments include people with neurological impairments requiring mobility aids and people with severe burn scars . both women with congenital impairments and women who acquired an impairment later in lifeable - bodied , healthy women were interviewed , to try and distinguish issues resulting from cultural practices , and lack of knowledge or awareness , from those caused by disability or leprosy . in total , 10 women affected by leprosy , 10 women with a visible physical impairment , and 10 able - bodied women were included . of the women affected by leprosy , 6 had a grade 1 impairment and 4 had a grade 2 impairment . all participants lived in the eastern terai region of nepal , in jhapa , morang , saptari , or sunsari districts . if women indicated a need for support or counselling , they were referred to the biratnagar leprosy referral centre . because we wanted to interview women with specific characteristics , participants were selected using purposive sampling . all women included in the study had to be married and had to be between the ages of 18 and 50 . excluded were women with a mental illness that interfered with their ability to undergo an in - depth interview , widowed women , and women whose husbands did not know they have or have had leprosy . the participants were contacted through the netherlands leprosy relief ( nlr ) network in the eastern development region of nepal and through local health posts . local health posts in the study area were visited to check whether there were leprosy - affected women that met the inclusion criteria . both the women with disabilities and the able - bodied women were selected based on their similarity to the leprosy - affected women , mainly in age and living area . participants underwent in - depth interviews about their marital and sexual relationship by means of semistructured interviews . the interview guide used consisted of four themes : sense of self , marital relationship , knowledge and awareness of sexual and reproductive health , and sexual relationship . the interview guide was developed based on a literature review and on discussions with leprosy specialists . some questions were translated multiple times using different interpreters , to ensure that the meaning of the original english version was retained . taking into account the sensitivity of the topic , participants were interviewed by a local , married female interpreter in their home , or at a private , safe space near their home . the interpreter had several years of experience working for nlr in the area of research . the interpreter had experience with and knowledge of working with people affected by leprosy and qualitative data collection . prior to the pilot interviews , the interpreter received an interview training of several days in which she did role plays and was provided with feedback by the researcher . the researcher herself was not present during the interviews to prevent discomfort on the side of the interviewee . the recordings were translated , transcribed , and analysed using open coding and content analysis . the interviews were transcribed in english by the interpreter and discussed with the researcher to help put issues in perspective and context . the software programmeopen , inductive coding was done in maxqda , where similar phrases with recurring themes were coded . all codes with supporting quotes were then clustered together in different tables , ordered by subquestion to get an overview of responses and to identify connection between codes and themes . prior to the in - depth interviews , participants were fully informed about the nature and objective of the study and of confidentiality of the data . written consent for participation in the studythe mean age was 35 years for the women affected by leprosy ( range : 2250 years ) , 36 for the women with physical impairments ( range : 2450 years ) , and 36 for the control group ( range : 2450 years ) . assessment of impairments using the who 's grading system for disabilities resulting from leprosy classified six women as grade 1 and four as grade 2 . three women still received treatment for leprosy , whereas seven women were released from treatment . all the women ( n = 30 ) who participated in this study were still with their husbands . ethnicity was categorized into four groups : ( i ) brahmin / chettri , ( ii ) dalit , ( iii ) tribal , and ( iv ) other . the majority of women were hindu ( n = 26 ) and lived in rural areas ( n = 21 ) . love marriages occurred mostly among the women with physical disabilities , with five women having a love marriage . except for one participant who had upper back problems , all participants with a visible physical disability had impairments related to their feet and legs , observable in walking . except for three women , three women , one in each group , were visibly pregnant at the time of the interviews . more than half of the women ( n = 17 ) indicated they did not work outside the home . no demographic data was collected about the husbands of the women included in the study . for five women affected by leprosy , all contacts , husband , neighbours , and relatives , knew they had leprosy , for two , only the husband knew , and for three , only a few people who were very close knew they were affected by leprosy . four out of ten women did not seem to know the real cause of their disease . one woman told us , before there were problems , i did not give them [ family ] food which i had taken . my husband is afraid that it transmits through respiration , so he does not want to tongue kiss for seven months . ( woman affected by leprosy , age 22 ) in the quotes presented , women mostly referred to their situation after contracting leprosy . before there were problems , i did not give them [ family ] food which i had taken . ( woman affected by leprosy , age 33 ) my husband is afraid that it transmits through respiration , so he does not want to tongue kiss for seven months . ( woman affected by leprosy , age 22 ) most of the thirty women who were interviewed ( n = 26/30 ) indicated that being married is important in their community and to themselves also . sexual relationship , an important part of marriage , seemed to be of mixed importance . six women from the control group indicated that sex is an important part of their relationship . for the women with a disability , five women considered it important , five did not . except for two women , all women indicated that sex is important to their husbands . some women ( n = 4/30 ) thought that their opinion on whether sex is important is not really of importance . according to them , what they think is important does not always matter . they are supposed to be ready whenever their husbands are ready , as the following quotes illustrate : yes , it is also important for me , but our importance has no value . ( woman affected by leprosy , age 26 ) it is not necessary how important it is for us because whenever our husband is ready we should be ready . ( woman affected by leprosy , age 50 ) it is not so important for me because of my condition , but i used to be ready for my husband and i do not mind , after all he is my husband . ( woman with physical disability , age 48 ) most women ( n = 24/30 ) did not receive sexual education in school or through a health post , or at least not before marriage . only six women said they received sexual education in school , mostly mentioning grade eight , nine , or ten . all of the women who mentioned they had had sexual education had received higher or secondary education . other women mentioned they received some form of sexual education through the health post or from a neighbour or relative . many women ( n = 15 ) mentioned receiving sexual education through tv or radio . yes , it is also important for me , but our importance has no value . ( woman affected by leprosy , age 26 ) it is not necessary how important it is for us because whenever our husband is ready we should be ready . ( woman affected by leprosy , age 50 ) it is not so important for me because of my condition , but i used to be ready for my husband and i do not mind , after all he is my husband . ( woman with physical disability , age 48 ) several factors may influence the marital relationship of the women interviewed . factors reported to have a positive effect on their marital relationship were love , harmony , and understanding each other , money or property , and sex . two women said : i think sex is the ultimate factor for a couple to stay happy . ( woman with physical disability , age 43 ) the most important is trust , love and understanding ( woman affected by leprosy , age 32 ) factors reported to have a negative influence on marriage are the ( alcohol ) drinking habit of the husband , a negative attitude of family members or others towards the woman , misunderstanding between husband and wife , and an unsupportive husband . furthermore , two women with leprosy indicated that they felt that people were more distant since they knew they are affected by leprosy . my sister in law was very rude , she used to come to the house as she was married and tell unnecessary things to my husband . ( woman from control group , age 32 ) when i was diagnosed with leprosy i felt that my husband 's behaviour had changed , he did not share anything with me and he pretended to be busy with work . ( woman affected by leprosy , age 33 ) before there were problems , when my father and mother - in - law knew about my disease , they hesitated to talk to me and come near me . ( woman affected by leprosy , age 33 ) however , the alcohol problem of the husband , if present , seemed to be the biggest problem . this was mentioned by all three groups , but was most frequently experienced by the women affected by leprosy . of these women , three women were in the control group , four women had a disability , and five women were affected by leprosy . i used to stay with my father and mother in law in their house . my sister in law was very rude , she used to come to the house as she was married and tell unnecessary things to my husband . ( woman from control group , age 32 ) when i was diagnosed with leprosy i felt that my husband 's behaviour had changed , he did not share anything with me and he pretended to be busy with work . ( woman affected by leprosy , age 33 ) before there were problems , when my father and mother - in - law knew about my disease , they hesitated to talk to me and come near me . ( woman affected by leprosy , age 33 ) when asked about the possibility of the husband of someone with either a disability or leprosy marrying and taking on a second wife , six women said they had never heard of this , 17 women said they had heard of this but had not experienced this themselves , four women indicated that only certain types of people do this , and two women affected by leprosy said they had experienced this themselves . the husband of one of these women had taken a second wife , because of her leprosy . another husband sent his wife away to her parents ' house and then had several affairs . some women with a disability pointed out the difference between men and women when it comes to remaining faithful to their marriage . one woman said , about taking on a second wife , if the husband has a disability then they marry a common woman or if he becomes disabled after marriage , then his wife stays with him , but if the woman is disabled then she can not marry a common man and if she becomes disabled then the husband brings another wife .... ( woman with physical disability , age 32 ) i feel that , if the problem that my husband has had had happened to me , my husband would have brought a second wife . but i am a woman so i can not do so and i love him . ( woman with physical disability , age 32 ) if the husband has a disability then they marry a common woman or if he becomes disabled after marriage , then his wife stays with him , but if the woman is disabled then she can not marry a common man and if she becomes disabled then the husband brings another wife .... ( woman with physical disability , age 32 ) i feel that , if the problem that my husband has had had happened to me , my husband would have brought a second wife . but i am a woman so i can not do so and i love him . ( woman with physical disability , age 32 ) there are positive and negative factors that influence the sexual relationship of women . factors that may have a positive influence include loving each other and being emotionally engaged , understanding each other , obeying the husband and / or giving priority to him , and the husband not drinking alcohol . two women said , if sexual intercourse is a mutual understanding then we can get pleasure . ( woman from control group , age 32 ) love helps for the good sexual relationship with my husband . ( woman affected by leprosy , age 35 ) if sexual intercourse is a mutual understanding then we can get pleasure . ( woman from control group , age 32 ) love helps for the good sexual relationship with my husband . ( woman affected by leprosy , age 35 ) factors that may have a negative influence on the sexual relationship of married women include the alcohol problem of the husband , being forced by the husband to have sex , disagreeing with the husband , and reduced interest in having sex on the side of the wife . only 11 women indicated not having any sexual problems . the husband drinking alcohol and , with thati feel so irritated but what can i do , we think of our husband as god and we should obey him . ( woman affected by leprosy , age 26 ) about being sexually abused , two women said , when i do not want to have sexual intercourse , my husband forces me . i used to earn money , bring food for you all but you do not want [ to have sex ] , then get out of the house ! ( woman affected by leprosy , age 32 ) he never asks about my health and forces me to have intercourse . ( woman with physical disability , age 33 ) of the women facing sexual abuse , three women were in the control group , three women had a disability , and five were affected by leprosy . furthermore , three of the four women who had a leprosy - related grade 2 impairment were being sexually abused by their husbands . in addition , of the women who had a husband with an alcohol problem ( n = 12 ) , all but one faced sexual abuse by their husbands , as illustrated below : there were problems , he used to drink alcohol and come near me and force me to have sexual intercourse . ( woman affected by leprosy , age 41 ) when he drinks alcohol and comes i feel irritated and he forces me to have sexual intercourse with him . ( woman from control group , age 32 ) sexual abuse and alcohol abuse seemed to go hand - in - hand with violence . many ( n = 7/10 ) women were either beaten or threatened to be beaten if they do not obey . this also became clear when talking about what happens if they do not agree with their husbands : if i refuse him he scolds me and raises a hand on me . ( woman with physical disability , age 33 ) if the husband likes to have sex , then we have to give , if not he certainly beats me . ( woman from control group , age 50 ) i have to give him everything he wants even when i am not feeling well , because he gets angry if i refuse to give . he warns me that he 'll have sexual pleasure with another girl if i can not give pleasure . ( woman from control group , age 28 ) five women affected by leprosy , of whom three also faced sexual abuse , faced additional problems while receiving treatment or when they were first diagnosed . these problems disappeared later on and were not experienced at the time of the interviews . they included having no intercourse at all due to fear of transmission of the disease , experiencing more distance and sometimes sleeping in separate beds while taking medicine : at first when he knew that i was affected by leprosy he did not sleep with me . once he came to the biratnagar clinic with me , he asked the doctor about the sexual relationship . he was told that it does not transfer to him so he started having sexual intercourse with me again . ( woman affected by leprosy , age 32 ) one woman did not want to talk about the problems she had before , before i had very bad problems , but now there is no effect , i do not want to remember the past and talk about that . ( woman affected by leprosy , age 35 ) he has the bad habit of drinking alcohol . i feel so irritated but what can i do , we think of our husband as god and we should obey him . ( woman affected by leprosy , age 26 ) when i do not want to have sexual intercourse , my husband forces me . i used to earn money , bring food for you all but you do not want [ to have sex ] , then get out of the house ! sometimes he raised a hand on me . ( woman affected by leprosy , age 32 ) he never asks about my health and forces me to have intercourse . ( woman with physical disability , age 33 ) there were problems , he used to drink alcohol and come near me and force me to have sexual intercourse . ( woman affected by leprosy , age 41 ) when he drinks alcohol and comes i feel irritated and he forces me to have sexual intercourse with him . ( woman from control group , age 32 ) if i refuse him he scolds me and raises a hand on me . ( woman with physical disability , age 33 ) if the husband likes to have sex , then we have to give , if not he certainly beats me . ( woman from control group , age 50 ) i have to give him everything he wants even when i am not feeling well , because he gets angry if i refuse to give . he warns me that he 'll have sexual pleasure with another girl if i can not give pleasure . ( woman from control group , age 28 ) at first when he knew that i was affected by leprosy he did not sleep with me . once he came to the biratnagar clinic with me , he asked the doctor about the sexual relationship . he was told that it does not transfer to him so he started having sexual intercourse with me again . ( woman affected by leprosy , age 32 ) before i had very bad problems , but now there is no effect , i do not want to remember the past and talk about that . we found that many women experience marital problems and / or sexual abuse , regardless of their leprosy or disability status . in addition , we found clear indications that leprosy may influence the marital and sexual relationship of married women in various ways . this included significant problems during treatment , which is often a full year , such as having no intercourse at all due to fear of contagion , experiencing more distance from close others , and husband and wife sleeping in separate beds . other studies found stigma to have negative consequences for persons affected by leprosy , leading to discrimination , problems in interpersonal relationships , and problems with social status . women affected by leprosy seem to face most problems when first diagnosed or while receiving treatment . the above problems may have been caused or aggravated by the fact that almost half of the women did not seem to know the cause of their disease and how leprosy is transmitted . thilakavathi and colleagues , who conducted in - depth interviews with 72 leprosy - affected men and women , of whom 48 were married , found that a few participants did not sleep in the same room as their spouses , but they did not elaborate on this . they also found that most of their interviewees lacked basic knowledge on the transmission and cause of leprosy . this happened to two women with grade 2 impairments due to leprosy in our study . qualitative evidence suggests that women are more likely to be deserted by their spouses than men , but conclusive evidence is not yet available . research in south - east nepal found that , of the nine men and ten women interviewed , three husbands had left their leprosy - affected wife and one wife had left her leprosy - affected husband . a study in south africa showed that of 23 married subjects , 9 men and 7 women had been deserted by their marriage partners because of leprosy . we can not tell whether the frequency of divorce found by scott , which is much higher than in our study , is due to sampling error , bias in the samples , or actual cultural differences , since the present study was only designed to explore the impact of leprosy , not to determine the prevalence of marital problems or divorce due to leprosy . our findings indicate that divorce is only the tip of the iceberg of marital problems that may be due to leprosy or other causes . an important finding is the high frequency of alcohol abuse among the husbands of the participants . this occurred in all three groups and therefore points to a more structural phenomenon in society . a larger survey using randomsampling will have to confirm whether the greater frequency of alcohol abuse among the husbands of leprosy - affected women compared to the other women included in this study is real , or a result of sampling error . jhingan and colleagues looked at alcohol dependence in dharan , in eastern nepal , and found the prevalence of alcohol dependence to be 25.8 % . they found dependence to increase with age , peaking with 41 % in the age group 4554 , compared to 10.7 % in the 1524 age group . several studies found the risk of sexual abuse and violence towards women to increase when husbands are drunk or are alcoholics . these studies were also conducted in developing countries and highlight the important role of alcohol use in sexual abuse . the present study seems to confirm the relationship between alcohol abuse and sexual abuse : most of the women who had a husband with an alcohol problem experienced sexual abuse and all husbands who sexually abused their wives reportedly had an alcohol problem . we did not find any literature on the relationship between alcohol abuse and sexual abuse when the spouse has an impairment . sexual abuse by the husband occurred in all groups , but the frequency was higher among women affected by leprosy . another study assessed the occurrence of violence against young married women aged 1524 years in rural nepal . as many as 53 % reported having experienced some form of violence in their lifetime and 46 % reported experiencing sexual violence . no or little interspousal communication and low autonomy of women were associated with violence against women . other studies that investigated sexual violence against young married women found a similar prevalence ( 49 % ) . lamichhane and colleagues associated women 's lower status in family and society with violence against women , particularly young women in rural nepal . also pradhananga and shrestha and puri and colleagues stress the low status of women in nepal . deepak and colleagues , who looked at violence and sexual violence against persons with disabilities in india , found that 14 % of their 146 participants reported experiences of sexual violence during the previous 12 months . the presence of visible impairments among leprosy patients and its influence on acceptance by others have been highlighted by other studies . kopparty , who looked at coping strategies of 500 families who had a leprosy - affected family member with and without disfigurement , found that the proportion of families having patients with deformities facing problems was ten times higher ( 57 % ) than those having patients with no deformities ( 5.7 % ) . it is therefore not unlikely that women with visible impairments would experience more discrimination and abuse than leprosy - affected women without visible impairments . their position in society may be low , possibly aggravated by alcohol abuse of the husband . furthermore , puri and colleagues found that 8 out of 15 women who refused to have intercourse with their husbands were beaten . being beaten or threatened with violence when not obeying their husbands was also reported by women in the present study . our study showed that a husband often has power over his wife and that wives are expected to obey their husband or otherwise may be expected to be punished . feelings were often not shared , because women felt their feelings and desires were not valued . these findings fit with the description of prevailing attitudes towards women described by regmi and colleagues . they stated that , in nepal , unequal power relations and lack of autonomy characterise the situation of married young women in many settings , the autonomy of married young women is particularly constrained and gender norms stress male entitlement to sex , even if forced within marriage . certain social roles are expected , and most of the women 's roles revolve around the household . an important finding was that most women had not received sexual education , or at least not before marriage . the few women who had sexual education before marriage received this sometime between grades 8 and 10 in school . there are major gaps in receiving information , services , and skills on sexual and reproductive health issues . the government of nepal has introduced sexual and reproductive health education in public schools for grades six to ten and in university curricula from 1998 onwards . regmi and colleagues assert that , in reality , young people do not have good access to appropriate information on sexual and reproductive health issues . this fits with our finding that several women who were in their twenties and who had secondary education or more indicated that they did not receive sexual education , despite the fact that a sexual and reproductive health education programme had already been introduced when they were in school . the current findings show that knowledge about leprosy and the relation between leprosy and marriage and sexual health should be addressed preventively whenever someone is diagnosed with leprosy . if at all possible , the spouse and possibly the in - laws of any newly diagnosed married patient should be included in such counselling efforts . materials addressing these issues should be developed and should be made available for distribution in primary health centres and other health facilities where persons affected by leprosy are diagnosed and treated . however , it was evident in our study that within - marriage violence and sexual abuse of women , aggravated by alcohol abuse of the husband , occurred in all groups regardless of health or disability status . sexual and reproductive health , freedom from violence , and freedom from discrimination are fundamental human rights that were systematically violated in the lives of many of the women interviewed . therefore , interventions to improve sexual health and safety of married women should be designed , tested , and implemented as a matter of urgency . the first limitation is the nonrandom sampling and small study size , as mentioned above . this , together with the specific geographic location of the present study , means that the results of the study can not be generalized to the whole study population or beyond . if men would have been included also , a more complete insight of the impact of leprosy on marital and sexual relationships could have been given . translating the interviews from nepali to english may have introduced some mistakes or misinterpretations , since not all words could be translated literally . the current study indicates that leprosy may influence the marital and sexual relationship of women in nepal in several ways . additional research is needed to gain more insight in the underlying reasons . knowing more about the factors that influence marital and sexual relationship may help patients as well as health workers deal with marital and sexual problems and may enhance their ability to anticipate and prevent problems . it will also inform policy and interventions to reduce within - marriage sexual abuse and violence . raising awareness of health workers concerning the risk of marital problems following a diagnosis of leprosy is essential . simple educational materials with facts about leprosy , explaining the absence of risk of transmission once someoneis being treated , would help health workers discuss these very important issues with their patients , preferably together with their spouses . on a wider scale , interventions to improve sexual health and safety of married women should be implemented as a matter of urgency . implementation research should investigate the appropriate format and manner in which this can be done . a larger study with a random sampleis needed to determine the extent of the problems identified and the added risk of being leprosy - affected or having a disability . many women in our study experienced marital problems and / or sexual abuse , regardless of their leprosy or disability status . fundamental human rights such as the rights to sexual and reproductive health , freedom from violence , and freedom from discrimination are systematically violated in the lives of many of the women interviewed.women affected by leprosy faced additional problems , related to fear of the disease , negative attitudes , and discrimination on account of leprosy.knowledge on the cause and transmission of leprosy was still lacking among leprosy - affected women and their community members . appropriate preventive and educational measures should be designed and tested to address these issues.lastly , women appear to have insufficient access to sexual education , despite programmes on sexual health education in schools and elsewhere . many women in our study experienced marital problems and / or sexual abuse , regardless of their leprosy or disability status . fundamental human rights such as the rights to sexual and reproductive health , freedom from violence , and freedom from discrimination are systematically violated in the lives of many of the women interviewed . women affected by leprosy faced additional problems , related to fear of the disease , negative attitudes , and discrimination on account of leprosy . knowledge on the cause and transmission of leprosy was still lacking among leprosy - affected women and their community members . lastly , women appear to have insufficient access to sexual education , despite programmes on sexual health education in schools and elsewhere . this should be addressed by the appropriate authorities .\noutput:\n" }, { "from": "agent", "value": "background . leprosy is one of the most stigmatized diseases known today . the stigma surrounding leprosy can be a major burden and affects many dimensions of a person 's life , including intimate relationships . we aimed to investigate the experiences of women affected by leprosy regarding marital life and sexuality , comparing these to the experiences of women with other physical disabilities and to those of able - bodied women in south - east nepal . methods . this study used a qualitative approach and a cross - sectional , nonrandom survey design . thirty women underwent in - depth interviews about their marital and sexual relationship by means of a semi - structured interview guide . these thirty women included ten women affected by leprosy , ten women with other physical disabilities , and ten able - bodied women living in south - east nepal . results . we found that many women faced violence and abuse in their marriages . however , women affected by leprosy appeared to face more problems with regard to their marital and sexual relationships than women with physical disabilities and able - bodied women . some of these related to the fear of leprosy . conclusions . further research is recommended to investigate the extent of this problem and ways to ameliorate the situation of the affected women . education and counselling at diagnosis may help prevent many of the problems reported ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: coronary heart disease ( chd ) accounts for the greatest number of deaths and disability worldwide , and burden of chds is on the rise in low - middle income countries ( lmics ) . the relationship between serum low - density lipoprotein cholesterol ( ldl - c ) , which correlates highly with total cholesterol ( tc ) , and chd risk has been observed throughout the world . it has been identified as a major risk factor for chd , and hence the primary target of cholesterol - lowering therapy as per reports of the adult treatment panel . it has been found that for every 1 % reduction in ldl - c , the relative risk for major chd events is reduced by nearly 1 % . hence , the accurate and standardize measurements of ldl - c are required for reliable classification of patients . recommendations for measurement of ldl - c were issued by a national cholesterol education program ( ncep ) expert laboratory panel in 1995 . the panel recommended standardization of the measurements , that is , achieving traceability of all results to accepted reference methods ( rms ) . the centre for disease control and prevention ( cdc ) uses - quantification as an rm , based on the lipid research clinics ( lrc ) . but the - quantification procedure is costly , labor intensive , time - consuming , not available everywhere and can be performed only on few samples a day . hence , its use is not feasible in routine laboratory especially in lmics . ncep and cholesterol reference method laboratory network of cdc certified commercially available direct ldl - c kits , and these have been available for use in routine clinical laboratories . but being costly , they are still not used in most of the indian laboratories . since ldl is important in chd risk assessment , the measurement of ldl should be accurate , and it should be cost - effective for the general population . most laboratories in lmics estimate ldl - c levels with the friedewald formula , based on the concentrations of tc , high - density lipoprotein cholesterol ( hdl - c ) , and triglycerides ( tgs ) . the calculation was actually proposed for use in epidemiologic studies but was later rapidly adopted and became the method of choice by routine clinical laboratories , in part for economic reasons . overestimation of very low - density lipoprotein cholesterol ( vldl - c ) and underestimation of ldl - c due to presence of chylomicrons , calculation requires a fasting specimen ( ideally 12 h fasting ) , calculation was recommended only for specimens with tgs up to 400 mg / dl , not useful in type iii hyperlipidemia or dysbetalipoproteinemia . a major disadvantage in calculating ldl by friedewald method is that the variability is a product of the combined variabilities in the three underlying measurements . in routine laboratories , variability appeared to be much higher ( 12 % ) as compared to variability in experienced and well - standardized lipid laboratories ( 4 % ) , as observed by the ncep expert panel . other limitations are underestimation of ldl - c in patients with diabetes mellitus , end - stage renal disease , hepatic failure and patients on hormone replacement therapy . moreover , ldl cholesterol includes intermediate density lipoprotein ( idl ) and lipoprotein ( a ) in it . increased concentration of idl and lp ( a ) are also associated with increased risk of chd . but because of their small concentration ( a few mg / dl ) , ncep working group on ldl cholesterol measurement suggested that ldl cholesterol value should not be corrected for the contribution of other atherogenic lipoproteins . it does not require hdl - c result for the calculation and hence can prove to be more cost - effective . since it uses only two analytes chances of analytical errorshowever , studies found that there was no advantage of anandaraja 's formula over friedewald formula for estimation of ldl - c by calculation . another modification in original friedewald 's formula for calculation of ldl was given by puavilai and laoragpongse which assumes that vldl constitutes one - sixth of total tgs and it is costly for serum ldl test from direct measurement , especially if it has to be tested several times in a year . the authors found modified formula to be more accurate than the original formula in estimation of ldl - c . it also partially overcame the problems of fasting , presence of diabetes , obesity and familial hypertriglyceridemia unlike seen with original friedewald formula . the literature on the use of this modified friedewald formula among indian population is not available . against this background , the present study was conducted ( i ) to determine that which of these calculated formulae ( original friedewald , anandaraja and modified friedewald ) show maximum correlation with direct low - density lipoprotein cholesterol method ( d - ldl - c ) estimation at different serum tg levels in indian population . we reviewed records of blood samples which were sent to our clinical biochemistry laboratory , department of biochemistry , lok nayak jai prakash hospital , new delhi for the estimation of fasting lipid profile . secondary data of 480 patients were collected after obtaining prior permission from the concerned authority . as a routine procedure , the samples were collected after 1012 h of overnight fast by withdrawing 3 ml of venous blood in plain vial . the samples were centrifuged at 3000 rpm for 15 min to obtain serum and were analyzed for lipid profile on the same day . serum cholesterol was estimated by cholesterol oxidase - peroxidase method using a commercial kit from beckman coulter on beckman coulter dxc ( beckman coulter ireland , inc .250 s. kraemer blvd . , brea , ca 92821 u.s.a . ) analyzer with a coefficient of variation ( cv ) of 3 % . serum tg was estimated by glycerol - 3 phosphate oxidase -3,5-dichloro-2-hydroxybenzenesulfonic acid method on the same analyzer using a commercial kit from beckman coulter with a cv of 3 % . hdl - c was estimated by a commercial kit from beckman coulter based on homogenous method ( with a cv of 3 % ) using a detergent which solubilizes only the hdl lipoprotein particles and releases hdl cholesterol to react with cholesterol esterase and cholesterol oxidase in the presence of chromogens to produce a color product . low - density lipoprotein cholesterol was estimated by direct homogenous method of daiichi pure chemicals , tokyo by using a commercial kit from beckman coulter on dxc analyzer with a cv of 2 % . homogenous method of ldl - c depends on unique detergent which solubilizes only the non - ldl lipoproteins and releases cholesterol to react with cholesterol esterases and oxidases to produce a noncolor forming reaction . a second detergent solubilizes the remaining ldl particles , and a chromogenic complex allows for color formation . low - density lipoprotein reagent is used to measure cholesterol concentration by a timed endpoint method . the change in absorbancethe change in absorbance is directly proportional to the concentration of cholesterol in the sample . apart from above method , ldl cholesterol was calculated by following formulae : friedewald : friedewald low - density lipoprotein cholesterol ( f - ldl - c ) = tc ( tg / 5 + hdl - c ) modified friedewald : modified friedewald low - density lipoprotein cholesterol ( mf - ldl - c ) = tc ( tg / 6 + hdl - c ) anandaraja : anandaraja low - density lipoprotein cholesterol ( a - ldl - c ) = ( 0.9 tc ) ( 0.9 tg / 5 ) 28 . friedewald : friedewald low - density lipoprotein cholesterol ( f - ldl - c ) = tc ( tg / 5 + hdl - c ) modified friedewald : modified friedewald low - density lipoprotein cholesterol ( mf - ldl - c ) = tc ( tg / 6 + hdl - c ) anandaraja : anandaraja low - density lipoprotein cholesterol ( a - ldl - c ) = ( 0.9 tc ) ( 0.9 tg / 5 ) 28 . discrete data were reported as mean and standard deviation . paired t - test and pearson correlation were performed to find the significant difference and correlation in ldl - c concentration obtained by a direct method and different calculations , respectively . the level of significance was taken as p 0.05 . to examine the degree of agreement between the values obtained by the two methods , blandwas calculated using the formula : pd calculated ldl - c = ( calculated ldl - c d - ldl - c ) / d - ldl - c 100 . data collected were classified into three groups according to the serum tg concentrations ( mg / dl ) as group a : tg - 200 mg / dl and below , group b : tg - 201400 mg / dl , and group c : tg - 400 mg / dl and above . we reviewed records of blood samples which were sent to our clinical biochemistry laboratory , department of biochemistry , lok nayak jai prakash hospital , new delhi for the estimation of fasting lipid profile . secondary data of 480 patients were collected after obtaining prior permission from the concerned authority . as a routine procedure , the samples were collected after 1012 h of overnight fast by withdrawing 3 ml of venous blood in plain vial . the samples were centrifuged at 3000 rpm for 15 min to obtain serum and were analyzed for lipid profile on the same day . serum cholesterol was estimated by cholesterol oxidase - peroxidase method using a commercial kit from beckman coulter on beckman coulter dxc ( beckman coulter ireland , inc .250 s. kraemer blvd . , brea , ca 92821 u.s.a . ) analyzer with a coefficient of variation ( cv ) of 3 % . serum tg was estimated by glycerol - 3 phosphate oxidase -3,5-dichloro-2-hydroxybenzenesulfonic acid method on the same analyzer using a commercial kit from beckman coulter with a cv of 3 % . hdl - c was estimated by a commercial kit from beckman coulter based on homogenous method ( with a cv of 3 % ) using a detergent which solubilizes only the hdl lipoprotein particles and releases hdl cholesterol to react with cholesterol esterase and cholesterol oxidase in the presence of chromogens to produce a color product . low - density lipoprotein cholesterol was estimated by direct homogenous method of daiichi pure chemicals , tokyo by using a commercial kit from beckman coulter on dxc analyzer with a cv of 2 % . homogenous method of ldl - c depends on unique detergent which solubilizes only the non - ldl lipoproteins and releases cholesterol to react with cholesterol esterases and oxidases to produce a noncolor forming reaction . a second detergent solubilizes the remaining ldl particles , and a chromogenic complex allows for color formation . low - density lipoprotein reagent is used to measure cholesterol concentration by a timed endpoint method . the change in absorbancethe change in absorbance is directly proportional to the concentration of cholesterol in the sample . apart from above method , ldl cholesterol was calculated by following formulae : friedewald : friedewald low - density lipoprotein cholesterol ( f - ldl - c ) = tc ( tg / 5 + hdl - c ) modified friedewald : modified friedewald low - density lipoprotein cholesterol ( mf - ldl - c ) = tc ( tg / 6 + hdl - c ) anandaraja : anandaraja low - density lipoprotein cholesterol ( a - ldl - c ) = ( 0.9 tc ) ( 0.9 tg / 5 ) 28 . friedewald : friedewald low - density lipoprotein cholesterol ( f - ldl - c ) = tc ( tg / 5 + hdl - c ) modified friedewald : modified friedewald low - density lipoprotein cholesterol ( mf - ldl - c ) = tc ( tg / 6 + hdl - c ) anandaraja : anandaraja low - density lipoprotein cholesterol ( a - ldl - c ) = ( 0.9 tc ) ( 0.9 tg / 5 ) 28 . discrete data were reported as mean and standard deviation . paired t - test and pearson correlation were performed to find the significant difference and correlation in ldl - c concentration obtained by a direct method and different calculations , respectively . the level of significance was taken as p 0.05 . to examine the degree of agreement between the values obtained by the two methods , blandwas calculated using the formula : pd calculated ldl - c = ( calculated ldl - c d - ldl - c ) / d - ldl - c 100 . data collected were classified into three groups according to the serum tg concentrations ( mg / dl ) as group a : tg - 200 mg / dl and below , group b : tg - 201400 mg / dl , and group c : tg - 400 mg / dl and above . there were 320 , 138 , and 22 patients in group a , b , and c , respectively . the mean ldl - c levels ( mg / dl ) were 117.02 , 106.63 , 102.25 , and 113.00 for d - ldl - c , f - ldl - c , a - ldl - c , and mf - ldl , respectively [ table 1 ] . no statistically significant difference was found in the mean of ldl - c calculated by modified friedewald method as compared to direct ldl - c . comparison between concentration of ldl - c measured by direct method and using different formulae ( n = 480 ) the calculated formulae underestimate ldl - c by 10.39 mg / dl , 14.77 mg / dl and 04.02 mg / dl by friedewald 's , anandaraja 's and modified friedewald 's method , respectively , in comparison to the direct method . on calculating the mean pd , it was found that mf - ldl - c differs by 3.44 % from the d - ldl - c which was much lower in comparison to the other two calculated formulae ( 8.88 % and 12.62 % by f - ldl - c and a - ldl - c , respectively ) [ table 1 ] . a strong correlation was found between all calculated ldl - c methods and d - ldl - c assay , that is , f - ldl - c versus d - ldl - c = 0.94 [ figure 1 ] ; a - ldl - c versus d - ldl - c = 0.93 [ figure 2 ] and mf - ldl - c versus d - ldl - c = 0.95 [ figure 3 ] . scatter plot of anandaraja low - density lipoprotein cholesterol against direct low - density lipoprotein cholesterol . there was a correlation of r = 0.93 scatter plot of anandaraja low - density lipoprotein cholesterol against direct low - density lipoprotein cholesterol . there was a correlation of r = 0.93 scatter plot of modified friedewald low - density lipoprotein cholesterol against direct low - density lipoprotein cholesterol . there was a correlation of r = 0.95 to find the agreement between the direct and calculated ldl methods , blandaltman plot was prepared [ figures 46 ] but the negative bias in them indicates that although they correlate to one another they can not be used in place of direct ldl except the modified friedewald method where the negative bias was minimum . altman plot for low - density lipoprotein cholesterol estimated directly and by friedewald 's calculation . mean : 10.39 ( negative bias ) , standard deviation ( sd ) : 22.18 ; mean + 2 sd : + 33.97 ; mean 2 sd : 54.75 blandaltman plot for low - density lipoprotein cholesterol estimated directly and by anandaraja 's calculation . mean : 14.77 ( negative bias ) , standard deviation ( sd ) : 24.82 ; mean + 2 sd : + 34.87 ; mean 2 sd : 64.41 blandaltman plot for low - density lipoprotein cholesterol estimated directly and by modified friedewald 's calculation . mean : 4.02 ( negative bias ) , standard deviation ( sd ) : 21.46 ; mean + 2 sd : + 38.90 ; mean 2 sd : 46.94 comparison of ldl - c at different levels of tgs did not show statistically significant difference between d - ldl - c and calculated ldl - c by friedewald and modified friedewald 's method ( f - ldl - c and mf - ldl - c ) [ table 2 ] . at tg 200 mg / dl and tg : 201 - 400 mg / dl , a significant difference was found between measured ldl - c and calculated ldl - c by anandaraja 's method ( a - ldl - c ) . ldl - c ( in mg / dl ) by different methods at different serum level of tg ( mg / dl ) coronary heart disease is one of the most prevailing causes of morbidity and mortality . in lmics , friedewald formula is commonly used to estimate ldl - c in routine laboratories , despite its several limitations . there were no limitations proposed with anandaraja 's formula but as said earlier , no advantage was found over friedewald 's formula by authors . to the best of author 's knowledge , this is the first study in which modified friedewald formula given by puavilai et al . was evaluated in india , and comparison was made with original friedewald formula and anandaraja 's formula . our study pointed that there was a good correlation between all calculated ldl methods and direct method . there was a correlation of 0.94 between d - ldl - c and friedewald ldl in our study which was in concordance of other studies which say it to be ranging from 0.78 to 0.93 . the correlation between d - ldl - c and a - ldl - c in our study was found to be 0.93 which was similar to other studies , that is , correlation of 0.93 , 0.89 , and 0.81 . our study found a correlation of 0.95 between mf - ldl - c and d - ldl - c , which was higher than the one found by kamal et al ( r = 0.81 ) . even if there was a positive correlation but to find the actual relation between these methods blandthis suggests that there is the difference in results obtained by calculated and direct method . the reason of negative bias was that there was underestimation of calculated ldl from direct ldl . this underestimation was 10.39 % , 14.77 % , and 04.02 % by friedewald , anandraja and modified friedewald respectively in our study . similar findings were reported by gupta et al . that there is underestimation of 10 % and 14 % with friedewald and anandaraja methods , respectively . however , kamal et al . found underestimation of 17 % and 22 % by friedewald and anandaraja methods , respectively . on the other hand , kamezaki et al . reported underestimation of only 5.9 % with friedewald formulathe calculation of mean pd of three calculated methods from the direct method suggested that the difference was least with the modified friedewald method as compared to others , that is , 08.88 % , 12.62 % , and 03.44 % for friedewald , anandaraja , and modified friedewald , respectively . similar differences were reported in the study by gupta et al . where it was 8.8 and 11.4 % for friedewald and anandaraja , respectively . however , in the study by vujovic et al . , these differences were found to be 6.9 and 3.9 % for friedewald and anandraja methods , respectively . kamal et al . also studied difference of modified friedewald method in addition , and reported differences were 16.7 % , 22.35 % , and 10.5 % for friedewald , anandaraja , and modified friedewald , respectively , that is , least with modified friedewald method . since the negative bias was maximum for anandaraja formula , so if this is used many cases of chd may be denied of early initiation of treatment . direct methods are accurate and precise for estimation of ldl but when ldl is to be frequently measured in monitoring of chd , it adds to the cost of treatment . keeping in mind that ldl calculated by modified friedewald formula correlates well with direct ldl so to monitor treatment of patients of chd ( i.e. decrease in ldl - c and tg and increase in hdl ) it should be used in place of friedewald formula in routine laboratories for calculation of ldl .\noutput:\n" }, { "from": "agent", "value": "purpose : the purpose was to compare the different calculated methods of low - density lipoprotein cholesterol ( ldl - c ) estimation and to determine which of them correlate best with the direct method.materials and methods : the records of 480 samples for lipid profile were analyzed . apart from the direct method , ldl - c was calculated by friedewald low - density lipoprotein cholesterol method ( f - ldl - c ) , modified friedewald low - density lipoprotein cholesterol method ( mf - ldl - c ) , and anandaraja low - density lipoprotein cholesterol method ( a - ldl - c ) . paired t - test and pearson correlation were evaluated between the different methods . degree of agreement between the calculated methods and direct method was detected by bland altman graphical plots.results : a strong correlation was found between all calculated ldl - c methods and direct low - density lipoprotein cholesterol method ( d - ldl - c ) assay , that is , f - ldl - c versus d - ldl - c = 0.94 ; a - ldl - c versus d - ldl - c = 0.93 and mf - ldl - c versus d - ldl - c = 0.95 . no statistically significant difference was found between d - ldl - c and mf - ldl - c . bland altman plot for mf - ldl - c showed minimal negative bias.conclusions : the study pointed out that mf - ldl - c correlated maximally with d - ldl - c estimation at all levels of triglycerides and mf - ldl - c can be used in place of d - ldl - c when the direct method can not be afforded ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in their seminal book the task of medicine , dialogue at wickenburg , kerr white et al1 discussed the importance of broadening both the information base for understanding our patients problems and the framework for interpreting what we learn . outcomes : pendleton2 states that they may he immediate , such as patient satisfaction ; intermediate , for instance patient compliance ; or long - term , such as any change in the patient 's health the health outcome . pendleton2 has also stated that patients come to a doctor with an understanding of their problems which may be incomplete , rudimentary , and inaccurate , or it may be elaborate and entirely in agreement with current medical opinion . this last sentence forms a theory which embodies the patient 's health understanding . in their article on the consultation and health outcome , horder and moore3 have stated that there is a growing body of investigations into the effectiveness of doctor - patient communication . these studies relate specific aspects of communi - cation between doctor and patient to evidence about their effectiveness in improving outcomes . in this article , our discussion focuses on the importance of addressing and developing the patient 's health understanding in order to enhance the effectiveness of the medical intervention and improve the long - term health outcome . what are the indicators of effective doctor -- patient communication ? in their studies , sherrie h. kaplan and collegues4 have shown that patient satisfaction and compliance are necessary but limited as indicators . they have shown that optimal health outcomes depend not only on patient compliance ( participation ) but upon the extent of behavioral change . by making patients more active in the consultation they succeeded in changing the behaviour of the doctor as well as that of the patient . furthermore , they assert that generic measures of patients health ( subjective health status ) , in addition to available physiological measurements ( objective health status ) are the logical outcomes against which to assess effective doctor - patient communication . the consultation 's processes are dependent upon the entire context of the doctor - patient relationship , including the cultural belief systems within which that encounter occurs , as well as the personal belief systems of the two individuals concerned . in their book on the experience of illness , fitzpatrick and his co - authors5 state that there is much evidence suggesting that patients interpretations of their symptoms are governed by concepts and ideas of considerable complexity and variety . in developed countries the contemporary high - tech medical practice has in recent years failed to meet lay expectations . illness is culturally shaped in the sense that how we perceive , experience and cope with it is based on our cultural belief system . kleinman et al6 have proposed the term : patient 's explanatory model , which entails beliefs not only in terms of the cause of the illness , but also regarding the social and personal meaning of it . lay concepts of illness may have powerful symbolic significance , which can not be conveniently expressed in so many words by the patient , but which form an essential element of the meaning of the illness experience5 doctors and other health workers may too narrowly limit the search for meaning if they only look for references to bodily symptoms or causes in the lay ideas of illness . as to pendleton 's concept of health understanding , it can be viewed as not only encompassing kleinman 's patient model ( causal explanations and meaning of illness ) but also the patient 's factual knowledge of the disease and its course . lefcourt ( 1976 ) quoted by lau ( 1988 ) 7 has written that it is determined by the degree to which individuals perceive events in their lives as being a consequence of their own actions and thereby controllable ( internal control ) or as being unrelated to their own behaviour , and therefore beyond personal control ( external control ) . several major reviews of the literature linking locus of control beliefs to health behaviours exist .8 , 9 richard r. lau7 has stated that this concept has been applied to the area of health for at least 25 years , and is regarded as a generalised , relatively stable aspect of personality . internal beliefs have been linked to health protective behaviour and to the desire for more information . though its predictive value must be interpreted in combination with a high value placed on health , the concept of locus of control has implications as to the design of treatment regimens to optimise patient participation . jaspars et al ( 1983 ) 10 point out that individuals are motivated by far more complex processes than simply their level of control over events . they state that one of the most fundamental drives in human behaviour is the need to make sense of the environment . this means finding some ways to explain events , and this is often achieved by searching for their causes . this leads us to the concept of causal explanations of illness see kleinman et al above .6 jaspars et al ( 1983 ) 10 also emphasise that one must distinguish between control and causality . an individual may believe that an illness is caused by something external such as a virus , but at the same time that the illness can be controlled by personal behaviour ( internal control ) . these lay beliefs and theories about illness can be made more explicit by considering the site of illness aetiology as helman ( 1984 ) 11 does in his book . he postulates that lay theories of illness place the aetiology of ill - health in one of the following sites : within the individual patient in the natural world in the social world in the supernatural world within the individual patient in the natural world in the supernatural world social and supernatural aetiologies tend to be a feature of some communities in the developing world , while natural or patient - centered explanations of illness are more common in the western developed world . fitzpatrick et al ( 1984 ) 5 claim that one of the most striking qualities of lay concepts of illness is their very complexity , and that the structure of lay beliefs is also more flexible than one might think . in the light of the foregoing , the major elements of health understanding are : the meaning of illnessthe patient 's explanations of the cause of illness factual knowledge of the disease and its course the concept of locus of control the meaning of illness the patient 's explanations of the cause of illness factual knowledge of the disease and its course the concept of locus of control as the patient 's health understanding can be seen to consist of these major elements , doctors clearly need some form of clinical strategy enabling them to quickly and effectively elicit these health beliefs . how do these aforementioned theoretical considerations of lay concepts actually relate to countries outside the developed western world , such as those of the middle east , where transcultural differences are greater ? anthropological and social studies justify the conceptual distance we make between disease and illness . where only disease is treated , care will be less satisfactory to the patient and less clinically effective than where both disease and illness are treated together . of paramount importance is the negotiation between the patient 's explanatory model and that of the doctor , leading to an agreement , especially as related to expectations and therapeutic goals . unfortunately , the traditional biomedical viewpoint of medicine has disregarded these lay concepts of illness . as mentioned above , optimal health outcomes depend on the extent of behavioural change achieved by the patient . kleinman et al6 outline a clinical strategy by putting forward a set of specific questions to that end . with regard to the applicability of such instruments of enquiry into these lay theories , however , despite these difficulties and the fact that the instruments are mostly adapted from the west , these instruments have to be re - evaluated in each cultural setting , as do other tools of measurement for the assessment of subjective health status . in oman , with its traditional arabic culture now being offered alien , 20th century health care , the dichotomy between the patients understanding and expectations and those of the physicians is broad indeed . given the continued prevalence of traditional medicine - wasm ( branding ) , shamanistic practices , and ayurvedic - like herbal and hot - vs - cold treatments - which are all much more readily acceptable , even to many urbanised omanis , there is obviously a great need for appropriately designed health education in its widest sense . that this situation applies similarly in other arab countriesis evident from a study reporting the health - beliefs and behaviours of saudi women , where it was shown that there was a lack of understanding of specific causes of various illnesses .12 to answer some of the questions posed in this article , the authors suggest appropriately designed research into these aspects of health beliefs and understanding , including an audit of the research 's effects regarding improved health outcomes . the open discussion of patient 's concerns and ideas is an essential first step to offering personally appropriate health information .5 however , the prerequisite for the patient 's health understanding is appropriate information , and if patients do not understand even the basic premises , they do nt ask questions .13 therefore , it is essential to offer an explanation of the diagnostic label as well as of any advice offered , and , furthermore , an explanation that makes sense in terms of the patient 's own world view . secondly , it is important to offer a treatment plan that matches the patient 's own concepts as well as the prevailing cultural belief system . studies have shown the difficulties attendant upon the utilisation of western models of health behaviour and beliefs in middle eastern countries14 , and it is to be expected that such cross - cultural diversities between medicine and society as exist elsewhere in the world would pose similar problems . in line with this , pendleton et al . ( 1984 ) write of patients beliefs , concerns and expectations as being major elements of health understanding and of the importance of achieving a shared understanding of the problem between the doctor and the patient . the challenge faced by health care providers is to properly identify the health beliefs and understanding of their patients , and then to offer an appropriately matched patient education and treatment regimen . on the basis of this , doctors and patients should be able to plan together the optimal management of health problems , more confident that patient acceptability will be achieved and that improved compliance , through greater understanding , will follow .\noutput:\n" }, { "from": "agent", "value": "literature regarding health belief models , health understanding and their effect on health outcome is reviewed . aspects of the major elements comprising health understanding including lay explanations of illness , locus of control and the affective meaning of symptoms are described . the particular problems posed by utilising these models in a developing middle eastern country are discussed , together with the importance of applied research to assess the feasibility of improving health outcome by enhanced health understanding ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it has been observed from several studies that intracanal instrumentation does not remove all the microorganisms , but use of intracanal medicament helps in removal of remaining bacteria after cleaning and shaping . enterococcus faecalis is the commonly found microorganism in failed / infected root canals of both primary and permanent teeth . this bacterium is most resistant and can survive even in 10010,000 folds in starvation stage . various medicaments / irrigants are advised for disinfecting the root canal as well as for removal of microorganisms from inaccessible sites . commonly used irrigants are chlorhexidine gluconate , ethylenediaminetetraacetic acid ( edta ) , and sodium hypochlorite . chlorhexidine is effective against both gram - positive and gram - negative microorganisms since it is a broad - spectrum antimicrobial agent . chlorhexidine gluconate is used as the gold standard antimicrobial agent with the most potent chemotherapeutic activity against many microbes . sodium hypochlorite has undesirable side effects such as tissue toxicity , allergy , and disagreeable smell and taste . because of the side effects of non - herbal medicines , herbal medicines are gaining importance . herbal medicines such as tulsi , garlic extract , triphala , curcuma longa , clove oil , neem ( azadirachta indica ) extract , aloe vera , terminalia chebula , propalis , salvia officinalis , were tried by many researchers with relative efficacy . it has antimicrobial properties and is most commonly used for treating variety of diseases such as arthritis , bronchitis , diabetes , and skin diseases . tulsi has been tested for its antimicrobial properties against escherichia coli , klebsiella , candida albicans , staphylococcus aureus , enterococcus faecalis , and proteus . it is well known that neem leaves ( a. indica or ai ) have antibacterial , antifungal , antiviral , antioxidant , anti - inflammatory , antipyretic , and analgesic effects without any side effect . ai has several active constituents like nimbidin , nimbin , nimbolide , gedunin , azadirachtin , mahmoodin , margolone , and cyclictrisulfide which are responsible for its antibacterial action . there are very few studies on the antibacterial efficacy of herbal medicines ( neem and tulsi extracts ) on e. faecalis in endodontics . hence , our study was undertaken to assess the antimicrobial efficacy of herbal medicines ( tulsi extract , neem extract ) and chlorhexidine against e. faecalis in endodontics . sixty samples were categorized into four groups with 15 samples in each : group i : chlorhexidine gluconate 2 % as positive control , group ii : neem extract , group iii : tulsi extract , and group iv : distilled water as negative control group . eighteen grams of tulsi extract ( residue 6 % w / w ) was obtained by dissolving 300 g of tulsi powder in 1 l of ethanol . neem extract ( a. indica ) was prepared by washing fresh mature neem leaves in sterilized water and adding them to 50 ml ethanol . the alcohol part of the extract was separated in a water bath to obtain 25 ml of extract . chlorhexidine gluconate 2 % solution was used as the positive control for the study and distilled water as the negative control . brain heart infusion ( bhi ) broth and agaragar diffusion method was performed to assess the antibacterial efficacy of medicaments / irrigants ( chlorhexidine , tulsi extract , neem extract , and distilled water ) . chlorhexidine gluconate , tulsi extract , neem extract , and distilled water were added to specific wells and the agar plates were incubated at 37c for 24 h. zones of inhibition were checked after incubation of each plate against e. faecalis . they were recorded and statistically assessed using one - way analysis of variance ( anova ) test and spss software version 20 ( ibm ) ( p 0.001 ) . eighteen grams of tulsi extract ( residue 6 % w / w ) was obtained by dissolving 300 g of tulsi powder in 1 l of ethanol . neem extract ( a. indica ) was prepared by washing fresh mature neem leaves in sterilized water and adding them to 50 ml ethanol . the alcohol part of the extract was separated in a water bath to obtain 25 ml of extract . chlorhexidine gluconate 2 % solution was used as the positive control for the study and distilled water as the negative control . brain heart infusion ( bhi ) broth and agar were used to maintain cultures of e. faecalis . agar diffusion method was performed to assess the antibacterial efficacy of medicaments / irrigants ( chlorhexidine , tulsi extract , neem extract , and distilled water ) . chlorhexidine gluconate , tulsi extract , neem extract , and distilled water were added to specific wells and the agar plates were incubated at 37c for 24 h. zones of inhibition were checked after incubation of each plate against e. faecalis . they were recorded and statistically assessed using one - way analysis of variance ( anova ) test and spss software version 20 ( ibm ) ( p 0.001 ) . table 1 and graph 1 show the mean values of antibacterial actions of chlorhexidine gluconate ( 2 % ) , tulsi ( 4 % ) , neem , and saline medicaments against e. faecalis in millimeters . graph 1 shows the mean inhibition zone against e. faecalis from highest to lowest : chlorhexidine ( 26.4 ) neem ( 20.5 ) tulsi ( 16.9 ) distilled water ( 0 ) . one - way a nova results indicate statistically significant mean zone of inhibition of the three groups from each other at f = 1438.276 , p 0.001 . inhibitory zone against e. faecalis by various medicaments inhibitory zone against e. faecalis by various medicamentsnowadays use of natural extracts in dentistry is gaining popularity because of their lesser side effects . e. faecalis was taken in the present study because it has been identified as the most common species in root canal diseases . the present study has shown maximum inhibitory effect against e. faecalis by chlorhexidine followed by neem extract and then tulsi extract and no effect with distilled water . found highest antimicrobial effect with 0.2 % chlorhexidine compared to herbal medicament ( morinda citrifolia , garlic and turmeric ) , whereas vinothkumar et al . found that neem extract is more effective than sodium hypochlorite 5.25 % against e. faecalis . observed in their study 100 % inhibition of bacterial growth ( e. faecalis ) with chlorhexidine followed by m. citrifolia gel , aloe vera , papin gel , and calcium hydroxide . found that neem was highly effective against e. faecalis compared to 5.25 % sodium hypochlorite and other extracts . bazvand et al . , observed that herbal medicines ( propalis , aloe vera ) were effective against e. faecalis compared to chlorhexidine . several studies showed that herbal extracts are relatively effective as irrigants and help in removal of smear layer , such as amla , neem , and triphala . zakarea et al . found that castor detergent 20 % and papain enzyme 4 % ( mcp ) has the ability to completely eradicate e. faecalis bacteria from the infected root canal in vitro in 5 min . herbal extracts ( neem , tulsi ) have shown significant inhibitory effects against e. faecalis compared to 2 % chlorhexidine gluconate . hence , these can be used alternatively as endodontic irrigants / medicaments .\noutput:\n" }, { "from": "agent", "value": "background : successful endodontic treatment depends on effective disinfection and complete sealing of root canal . various medicaments are advised for disinfecting root canal , such as herbal and non - herbal medicaments . this study was done to assess the antimicrobial activity of herbal medicines ( neem extract , tulsi extract ) and chlorhexidine against enterococcus faecalis in endodontics.materials and methods : agar diffusion method was used to evaluate the antimicrobial action of different medicines . sixty samples were segregated into four groups with 15 samples in each : group i : chlorhexidine 2 % , group ii : neem extract , group iii : tulsi extract , and group iv : distilled water . the inhibition zones against e. faecalis were recorded and statistically assessed using one - way analysis of variance ( anova ) test ( p < 0.05 ) . results : significant antibacterial effect against e. faecalis was observed with chlorhexidine followed by neem extract and tulsi extract.conclusion : herbal medicines seemed to be effective against e. faecalis compared to 2 % chlorhexidine gluconate ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: we administered questionnaires to gather information about standard knowledge , attitudes , and practices related to malaria and collected blood for testing with microscopy , rdt , and pcr ( technical appendix ) . specific , histidine - rich protein - 2 ( hrp - 2 ) / pan - plasmodium lactate dehydrogenase ( pldh ) rdt ( sd bioline malaria ag p.f / pan [ p. falciparum or other plasmodium species ] ; standard diagnostics , gyeonggi - do , south korea ) . we surveyed 631 children with a mean age of 2.4 years ( table 1 ) . bed net coverage was high ( 91.6 % ) and met targets for 2014 ( 5 ) . only 5 households ( 0.8 % of children surveyed ) reported use of indoor residual spraying . of the 3 districts , isingiro had the highest proportion of children living in the lowest wealth quartile ( 41.8 % ) and in households with thatched or leaf roofing ( 7.3 % ) ; this district also had the lowest consistent bed net use ( 85.7 % ) ( technical appendix table 1 ) . * falciparum infection only ; pf + , positive for p. falciparum monoinfection only ; pf / pan + , positive for p. falciparum monoinfection or p. falciparum mixed infection ; rdt , rapid diagnostic test ; mixed pf / pm , positive for p. falciparum monoinfection or p. malariae mixed infection . falciparum monoinfections , 7 ( 31.8 % ) were p. malariae monoinfections , 3 ( 13.6 % ) were p.sixteen ( 72.7 % ) of 22 blood - smear readings correlated directly with pcr results ( technical appendix table 2 ) . malaria parasite prevalence was 2-fold higher by rdt than by microscopy ( 6.7 % vs. 3.5 % ; table 1 ) . a comparison of the diagnostic performance of rdt and microscopy ( uncorrected by pcr ) indicates that agreement of results from these methods was high ( 94 % ) ; however , agreement was poor in detecting nonfalciparum infections ( = 0.15 ) compared with detecting overall infection ( = 0.41 ) and p. falciparum infection ( = 0.33 ) ( table 2 ) . pcr detected parasite dna in 53.7 % ( 22/41 ) of rdt - positive samples ; of these , 55 % ( 12/22 ) correlated with the correct rdt band pattern interpretation ( technical appendix table 2 ) . approximately one third ( 8/22 ) of children with microscopy - positive cultures had negative rdt results ( technical appendix table 3 ) . of these 8 discordant cases , 5 harbored pcr - confirmed p. malariae or p. ovale monoinfections ; all had parasite densities 1,060 / l ( technical appendix table 2 ) . conversely , two thirds ( 28/42 ) of rdt - positive samples were negative by microscopy . of the 28 children with rdt - positive and microscopy - negative samples , 8 ( 28.6 % ) had a malaria infection within the previous month ; 4 of those had detectable parasite dna . our findings indicate that strides in the control of p. falciparum malaria have continued in uganda . compared with data from 2010 , p. falciparum prevalence by microscopy had a 4 - and 5-fold decrease in urban and rural villages , respectively ( 3 ) . our estimates are consistent with prevalence estimates from 2009 ( 12 % ) and 20142015 ( 4 % ) ( 1,6 ) . in our study , falciparum species , particularly p. malariae , in contrast to the 1.2 % non p . in addition , 1 p. vivax monoinfection was detected by pcr in isingiro , confirming the continued presence of all 4 major species in uganda ( technical appendix table 2 ) ( 1 ) . furthermore , although most p. malariae cases were from isingiro , recent studies in other regions of uganda ( i.e. , northern and eastern ) have also reported a rise in nonone possible reason for the nearly equivalent prevalence of asymptomatic p. falciparum and non p . falciparum infections is the influence of seasonal fluctuations in species prevalence ; for example , p. malariae prevalence has been higher during the dry season in west africa ( 10 ) . another possibility is that the use of p. falciparum based rdts , which are advantageous because of low infrastructure costs and high prevalence of this species in uganda , has enabled nonwhat is apparent is that pldh / hrp - 2based rdts may not be the most sensitive diagnostic method to determine true prevalence in the future . in our study , rdt was negative in all 3 microscopy - identified p. ovale and in 3 of 7 p. malariae monoinfections , a finding that may be in part attributable to these species low parasite densities ( range 391,057 / l ) . identifying p. malariae and p. ovale infectionsis critical because p. malariae has been associated with chronic infections that can persist for years , including a chronic nephrotic syndrome that , once established , is unresponsive to treatment ( 10 ) . because these species have milder symptoms and lower parasite prevalence than p. falciparum , infections can remain undetected for extended periods , enabling persons to serve as reservoirs for ongoing transmission ( 2 ) . these species may transmit gametocytes more efficiently at low parasite densities ; a recent study found increased p. falciparum gametocyte production in the setting of mixed p. malariae infections ( 11 ) . in our study , 30 % of non p . finally , on the therapeutic side , studies have shown failure of parasite clearance after artemisinin - based combination therapy in nonp . ovale and p. vivax also form hypnozoites in the liver , and safe treatment with a 14 - day course of primaquine is necessary to clear parasitemia . six children in our study harbored p. ovale or p. vivax infections . from a malaria control perspective , the performance of the pldh / hrp - 2based rdt was suboptimal in our data , indicating a need for accurate diagnostic methods aimed at detecting plasmodium infections in this region . a diagnostic method that has been effective in resource - constrained settings is loop - mediated isothermal amplification ( lamp ) , which affords higher sensitivity in detecting low - level parasitemia , especially p. malariae infections that tend to exhibit lower parasite densities than p. falciparum and p. vivax ( 13 ) . in a 2013 rural uganda study , the sensitivity of lamp was 1.8-fold greater than microscopy , comparable to pcr ( 14 ) . wide - scale application of a field - friendly technique such as lamp might be possible in southwestern uganda , where asymptomatic persons might have low - density malaria infections that persist during the low malaria transmission season , enabling these persons to serve as reservoirs for ongoing transmission and disease ( 15 ) . effective methods for detecting and treating these infections are essential for controlling and eliminating malaria . detailed methods and tables describing risk factors for asymptomatic malaria infections and results of pcr - corrected samples found to be positive by microscopy and rapid diagnostic test .\noutput:\n" }, { "from": "agent", "value": "a survey of asymptomatic children in uganda showed plasmodium malariae and p. falciparum parasites in 45 % and 55 % of microscopy - positive samples , respectively . although 36 % of microscopy - positive samples were negative by rapid diagnostic test , 75 % showed p. malariae or p. ovale parasites by pcr , indicating that routine diagnostic testing misses many non p . falciparum malarial infections ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: subjective tinnitus is defined as a phantom perception of sound with the absence of external stimulation . regardless tinnitus pattern ( acute , chronic , constant , intermittent , pure tone vs noise - like ) advanced research conducted all over the world , the factor directly responsible for subjective tinnitus perception is still not clear . it is known that it is a result of a pathological activity in the nervous system , without corresponding mechanical activity in the cochlea . on the basis of functional mri we know that this perception is not only purely auditory phenomenon but also limbic - related central nervous system areas take part . according to some research , about 1020 % of the adult population suffers from tinnitus and it probably occurs with similar frequency among children . since its etiology is unclear and taking into account the heterogeneity of the tinnitus patients group , there is still no satisfactory method of treatment . the most accessible and used as a first - line treatment in outpatient clinics is pharmacotherapy , however , there is no european medicines agency ( ema ) - or food and drug administration ( fda ) - approved drug on the market . furthermore , cognitive - behavioral therapy or different forms of stimulations ( acoustic or electrical ) have most promising effects . numerous hypotheses on the etiology of tinnitus may suggest that there is no single mechanism of its onset . that is why , in patients with tinnitus and a cochlear hearing loss ( tinnitus spectrum often overlaps with the area of hearing loss ) electrical stimulation ( e.s . ) gives good effects in inflammation , pain or nervous system disorders treatment , improving the blood flow and tropism of tissues . nevertheless , with reference to the hearing organ , it is used in few clinical centers in the world . according to latkowski , e.s . increases transmission of neurotransmitters in the synapses , as well as it controls their secretion to the synaptic area . portman et al . state that it modifies the electrical potentials of the hearing organ . e.s . improves the blood flow in the inner ear and synchronizes spontaneous impulses in the auditory nerve fibers . , konopka et al . , morawiec - bajda et al . and mielczarek et al . using low frequency stimulation ( 501,600 hz ) via electrode dipped in saline solution in the external auditory meatus , with the other placed on the ipsilateral mastoid , observed improvement in 48 % of cases , which was comparable to morawiec - bajda et al. s results 46.6 % . attempted to reduce tinnitus , stimulating with a ball - electrode placed at the tympanic membrane . the authors , using different parameters of current ( square , sine , triangular current , within a range of frequencies 628,000 hz ) adapted individually according to patients response to stimulation , obtained improvement in tinnitus in 50 % of the cases . kozlowski et al . using similar method of e.s . , adapted parameters individually ( frequencies within 168,000 hz ) , reported improvement in tinnitus in 44 % of patients . of the hearing organ in tinnitus treatment adapting the frequency of current according to tinnitus frequency and to compare these effects with placebo group , as well as to evaluate hearing after e.s . in both groupsthe study comprised 120 patients suffering from tinnitus and sensorineural hearing loss ( n = 184 tinnitus ears ) divided into two groups . the patients from group one ( n = 119 tinnitus ears , 80 tinnitus patients , 38 females and 42 males ) , aged 2174 years ( average 53.59.31 ) , were treated with e.s . of the hearing organ . those from group two ( n = 65 tinnitus ears , 40 tinnitus patients , 24 females and 16 males ) , aged 2276 years ( average 56.511.2 ) , were subjected to placebo e.s . the allocation to the groups was randomized , done according to the order of admission to our department . the group one was created by first 80 patients admitted to our department to diagnose and treat tinnitus . group two was created by the following 40 patients . in order to decrease potential heterogeneity of the groups only the patients with tinnitus duration longer than 1 year , as well as with accompanying hearing loss , were qualified to present research . before the beginning of the therapy , we conducted the ent examination , hearing tests ( pure tone audiometry , speech audiometry , impedance audiometry , auditory brainstem responses , otoacoustic emissions ) and radiological diagnostics if necessary ( head and cervical spine computer tomography / nuclear magnetic resonance ) . patients who reported tinnitus in the head , not in ears , or their tinnitus lasted less than 1 year ( to minimize the potential rate of spontaneous disappearance ) , were also disqualified from the research . the patients completed questionnaires ( designed by the authors based on the tinnitus handicap inventory ) involving 20 questions concerning tinnitus . on the other hand , receiving 0 points meant that tinnitus is not a disturbing ailment . the person conducting hearing evaluation and administering the questionnaires was unaware of the fact that e.s . or placebo e.s . had been provided . e.s . was performed with the use of a custom - made apparatus supplied with four batteries of 1.5 v. the device has an on / off button , frequency and current intensity buttons . the active , silver probe was immersed inside external ear canal , avoiding contact with the skin of the canal . the passive electrode was placed on the forehead after skin abrasion with a suitable sterile abrasive electrode paste and clean gauze . the two electrodes were placed to obtain the transmission of the current throughout the hypothetical plane ( longitudinal axis ) of cochlea . the duration of the rectangular pulse ( the period ) depended on the frequency . for 250 hzthe voltage was constant and equals 3 v. the intensity ranged from 0.15 to 1.15 ma and was applied according to patient s sensation . the stimulation was started using the maximal intensity of current ( 1.15 ma ) ; if it was well tolerated , stimulation was continued . however , if the patient reported to feel the pain or other unpleasant sensation , the intensity of the current was decreased to the moment when this feeling stopped . the frequency of the current ranged from 250 to 8,000 hz and was adjusted according to the tinnitus frequency , so that the frequency of the current and the tinnitus frequency were similar ( 1,000 hz ) selective e.s . pitch - match frequency was performed for all patients before the beginning of the treatment . the treatment involved 15 applications of e.s . administered three or four times a week ( whole treatment lasted approximately 30 days ) . in group two , the patients were subjected to similar procedure of e.s . as patients from group one ; however , no current was delivered through the electrode , dipped in external acoustic canal . apart from that , evaluation of tinnitus and hearing ( in pure tone audiometry ) was conducted before , directly after , 30 and 90 days after 15 applications of e.s . in groups one and two . subjective assessment of the results considered a case history and the questionnaire . change from permanent tinnitus ( when patient reported to hear it every day , all the day ) to temporary tinnitus ( when appeared temporarily or the patient reported to have some periods without tinnitus ) was considered an improvement . regarding questionnaires , the increase in the total points ( by at least 20 % ) was considered deterioration , whereas their decrease an improvement . statistical testing for dependent ( correlated ) observations , we used the student s t test for correlated samples ( in case of both normal distribution samples ) or the wilcoxon test ( when at least one sample had non - normal distribution ) , for independent ( uncorrelated ) observations the mann whitney u test ( when at least one sample had non - normal distribution ) . in case of nominal features , we used the test ( for uncorrelated samples ) or the mcnemar s test ( for correlated samples ) . the results of the statistical testing were given as a p value ( p pmax , e.g. p 0.05 indicated the statistically significant relation on a given level ) . the research was approved by institutional review board of medical university of lodz ( rnn / 251 / 05 / kb ) . average duration of tinnitus was similar in both groups ( no statistically significant differences p 0.05 ) in group one 4.24 years 5.29 , in group two 3.98 years 4.17 . the minimal tinnitus duration in both groups was 1 year , the maximal in group one30 years , in group two27 years . before the treatment , group one ( n = 119 ears ) comprised 106 ears ( 89.1 % ) with permanent and 13 ears ( 10.9 % ) with temporary tinnitus ; group two ( n = 65 ears ) , 56 ears ( 86.1 % ) with permanent and 9 ears ( 13.9 % ) with temporary tinnitus . in groups one and two , directly after the treatment , the number of ears with permanent tinnitus decreased considerably ( p 0.05 ) , group one comprised 58 ears ( 48.8 % ) with permanent and 21 ears ( 17.6 % ) with temporary tinnitus , in 40 ears ( 33.6 % ) tinnitus disappeared ; group two 46 ears ( 70.8 % ) with permanent and 15 ears ( 23.1 % ) with temporary tinnitus , in four ears ( 6.1 % ) tinnitus disappeared . after 30 days , statistically significant changes were observed in group one ( p 0.05 ) , which were comparable with results returned 90 days later ( p 0.05 ) . changes in group two ( after 30 and 90 days ) were not significant ( p 0.05 ) . when compared , there were apparent differences between results of the groups ( p 0.05 ) ( table 1 ) . table 1 the evaluation of the treatment considering tinnitus charactergroup / n ( % ) earspermanenttemporarydisappearance p group one ( n = 119 ears ) before e.s. 106 ( 89.1 % ) 13 ( 10.9 % ) directly after e.s. 58 ( 48.8 % ) 21 ( 17.6 % ) 40 ( 33.6 % ) 0.0530 days after e.s. 58 ( 48.8 % ) 40 ( 33.6 % ) 21 ( 17.6 % ) 0.0590 days after e.s. 58 ( 48.8 % ) 47 ( 39.4 % ) 14 ( 11.8 % ) 0.05 group two ( n = 65 ears ) before placebo e.s. 56 ( 86.1 % ) 9 ( 13.9 % ) directly after placebo e.s. 46 ( 70.8 % ) 15 ( 23.1 % ) 4 ( 6.1 % ) 0.0530 days after placebo e.s. 50 ( 77 % ) 12 ( 18.4 % ) 3 ( 4.6 % ) 0.0590 days after placebo e.s. 48 ( 73.9 % ) 12 ( 18.4 % ) 5 ( 7.7 % ) 0.05 p 0.05 , change statistically significant p 0.05 , change statistically not significant e.s . electrical stimulation the evaluation of the treatment considering tinnitus character p 0.05 , change statistically significant p 0.05 , change statistically not significant e.s . electrical stimulation analysis of questionnaires , directly after the treatment , in group one showed improvement in 45 ears ( 37.8 % ) and in group two , in 20 ears ( 30.8 % ) . in group one , 30 days after the last e.s . , the statistical analysis showed subsequent improvement ( p 0.05 ) to 51.3 % . on comparing results to the analysis conducted 90 days after the treatment , there were statistically significant differences in groups one and two ( table 2 ) . table 2 the evaluation of tinnitus treatment based on the questionnairesgroup / n ( % ) earsimprovementno changesdeterioration p group one ( n = 119 ears ) directly after e.s. 45 ( 37.8 % ) 65 ( 54.6 % ) 9 ( 7.6 % ) 30 days after e.s. 61 ( 51.3 % ) 50 ( 42 % ) 8 ( 6.7 % ) 0.0590 days after e.s. 56 ( 47.1 % ) 49 ( 41.2 % ) 14 ( 11.7 % ) 0.05 group two ( n = 65 ears ) directly after placebo e.s. 20 ( 30.8 % ) 44 ( 67.7 % ) 1 ( 1.5 % ) 3,170 days after placebo e.s. 19 ( 29.2 % ) 43 ( 66.2 % ) 3 ( 4.6 % ) 0.0590 days after placebo e.s. 17 ( 26.1 % ) 44 ( 67.7 % ) 4 ( 6.2 % ) 0.05 p 0.05 , change statistically significant p 0.05 , change statistically not significant e.s . electrical stimulation the evaluation of tinnitus treatment based on the questionnaires p 0.05 , change statistically significant p 0.05 , change statistically not significant e.s . electrical stimulation we recognized subjective and audiometric improvements of hearing ( in pure tone audiometry ) in group one , at the end of the control period . after the treatment , patients reported subjectively improved hearing in group one in 36 ears ( 30.2 % ) , in group two in 14 ears ( 21.5 % ) . no deterioration of hearing was reported . in audiometric evaluation after the cycle of e.s . in group one , statistically significant improvement of hearing was registered : for frequencies between 1,000 and 4,000 hz ( by on average 4.35 db ) . there was no statistically significant deterioration of hearing in both groups . at the end of the control period , the improvement of hearing remained constant in group one ( table 3 ) . table 3the average hearing level ( dbhl ) in pure tone audiometryaverage hearing level ( dbhl ) frequency ( hz ) 1252505001,0002,0003,0004,0006,0008,000 group one ( n = 119 ears ) before e.s. 25.62726.431.435.241.147.656.451.6 directly after e.s. 29.428.527.527.230.136.542.053.449.690 days after e.s. 30.329.127.328.331.036.942.553.349.4 group two ( n = 65 ears ) before placebo e.s30 .931.431.733.23539.142.050.049.4 directly after placebo e.s. 27.929.131.131.533.235.341.547.045.390 days after placebo e.s. 25.625.627.833.336.135.039.547.847.8 e.s . electrical stimulation the average hearing level ( dbhl ) in pure tone audiometry e.s . the beginning of e.s . clinical application to the hearing organ appeared after observation of tinnitus disappearing after the implantation of a single - electrode cochlear implant . in 1973 , house ( the house ear institute ) reported total disappearing of tinnitus after the implantation of the single - electrode cochlear implant ( using electrical current to stimulate auditory nerve ) . this fact was a fundamental observation which resulted in the idea of suppressing tinnitus with electrical current . in this way the idea of the e.s . tinnitus suppression was obtained when cochlea , round window , promontorium , preauricular skin or mastoid was subjected to stimulation . in 1974 , house suggested a method of evaluation of the hypothetical benefit of the cochlear implantation based on the transtympanal e.s . of the promontory . in case of a sound sensation ( reported by a patient during the stimulation ) , peripheral impairment of the hearing organ ( outer , inner hair cells ) the authors suggested that in such cases , clinical diagnosis indicated central viii - th nerve dysfunction , rather than the peripheral one . they admitted , however , that some viii - th nerve s fibers , which were not impaired , could have been enough to evoke sound . the authors observed reception of the tones as well as speech signal , by some completely deaf patients in whom e. s. via external auditory canal ( with a ball - shaped electrode dipped in saline solution ) was conducted . in this way , they claim to stimulate the fibers of the auditory nerve , obtaining hearing sensation as an evidence . despite numerous researches on tinnitus disappearance after cochlear implantationas many patients benefit from hearing aid ( experiencing tinnitus suppression ) we may suspect that the enhancement of the signal in the auditory pathway is the factor responsible for this phenomenon . sensorineural hearing loss is one of the most apparent risk factor for tinnitus , probably resulting from maladaptive attempts at cortical reorganization due to peripheral deafferentation . as in patients with tinnitus and single - sided deafness ( ssd ) therapies based on acoustic input ( retraining , masking ) are impossible , the restoration of peripheral sensory input may be a method of masking / relieving tinnitus . there are some data showing good effects of binaural integration of acoustic ( unilateral normal hearing ) and electric stimulation ( via cochlear implant ) , which appeared to be superior to the alternative rehabilitation methods of ssd and tinnitus [ bone - anchored hearing aid ( baha ) , contralateral routing of signal ( cros ) ] . although groups of patients implanted with tinnitus and ssd were not numerous , there were studies demonstrating significant improvement reaching 100 % . in effect , ssd with severe tinnitus is considered a new indication for cochlear implantation ; however , appropriate patients selection is required . arts et al . state that cochlear implant should be considered as a treatment for tinnitus resulting from ssd ( from peripheral - cochlear deafferentation ) . furthermore , there may be some predictors of the degree of improvement after such procedure . collecting quantitative electroencephalography found positive correlation between increased activity of auditory posterior cingulate cortex and dorsolateral prefrontal cortex and slight tinnitus reduction after cochlear implantation . in the research , the intensity of current was applied according to patient s sensation and tolerance , whereas the frequency according to tinnitus pitch ( frequency ) selective e.s . as in the majority of cases , the cochlea may be a trigger or ignition site for subjective tinnitus , authors adopted the theory that the frequency of tinnitus might be consistent with the area of damaged outer hair cells in the basilar membrane . for that reason those parameters were similar as well as the tinnitus matching ( pitch ) method was used in the research . despite the fact that psychoacoustic measurements may not correspond to tinnitus severity , such quantification is needed in clinical trials for evaluation of treatment , but it requires standardization of techniques . summarize the state of the art knowledge of extra - and intracochlear e.s . in tinnitus . the authors state that the optimal parameters of stimulation are likely different for different subjects . offut claims that auditory stimulation with specific frequencies within the area of loss of hearing in pure tone audiometry can reduce tinnitus , by suppressing the inner hair cells . of hearing organ , observed that the effectiveness of the stimulation depended on the stimulating frequency and was optimal using 125 hz . morawiec - bajda et al . performed e.s . via external auditory meatus with the active electrode placed on tympanic membrane and the other on the forehead . furthermore , using for stimulation frequencies close to tinnitus frequencies , an increase in otoacoustic emission s amplitude ( more distinct in dpoae than teoae ) was obtained , as well as increase in amplitude and shortened latencies in auditory brainstem responses . the theories on the cochlea as an ignition site for tinnitus , together with hypothesized ways of influencing its structures by e.s . , may indicate the need for individually modified parameters of e.s . the promontory stimulations were conducted by aran and cazals who achieved satisfactory effects ( complete or partial improvement of tinnitus condition ) in 43 % of cases , compared with 60 % of improvement cases when oval window was stimulated . ito and sakakihara via stimulation of cochlea directly with cochlear implant received better outcomes ( 77 % ) than via stimulation of promontory ( 69 % ) . as far as an improvement is concerned , our outcomes are comparable to the results of non - invasive e.s . conducted by other authors . the total number of tinnitus disappearance is more apparent in presented research ; however , the tendency to decrease with time is observed . this non - invasive procedure allows the doctor to perform it in any outpatient clinics , and as a result , the patient does not have to stay under the medical observation directly after stimulation . furthermore , hydrotransmissive stimulation allows application of cycle of such stimulations , improving the chances of relieving tinnitus , as well as helping to boost and maintain the improvement of hearing . the idea was to stimulate in a simple , non - invasive way , giving the patient possibility to performthe number of stimulation applications ( 15 ) , performed regularly , might have had an influence on the subsequent improvement together with its stabilization . in our research , in both treated groups , we observed the change in the nature of tinnitus ( permanent to temporary ) . the change was most noticeable in group one ( treated with e.s. ) the number of cases with permanent tinnitus decreased by around 50 % , but in both stimulated groups ( groups one and two ) , the improvement was statistically significant ( p 0.05 ) . as patients referred , the change from permanent to temporary tinnitus was meaningful for them , and it allowed to experience some silent periods ( often after months or years of presence of continuous , chronic noise in the ear ) again . that is why most of the patients considered it an apparent improvement . in literature , such evaluation of the tinnitus treatment has not been found . in one of the earliest publications concerning e.s . in the tinnitus treatment , portman et al . described the dependence of the result of stimulation on the polarization of the current . using direct negative current , a sound sensation was evoked , proving that the viii - th nerve was stimulated . in case of positive polarization suppression of tinnitusafter the procedure was finished , tinnitus appeared again . in our research , in most cases a sound perception was observed during stimulation with positive current , so it may be possible that the factor responsible for such auditory reception is the condition of the hearing organ rather than current polarization . at early studies conducted by portmann , direct current appeared to be more harmful to the inner ear ( than alternating ) ; however , it was more efficient in suppressing tinnitus . konopka in his study on the influence of direct current on the hearing organ of guinea pigs demonstrated no pathologic effect on auditory pathway based on the evaluation of summation potentials , cochlear microphonics and auditory brainstem potentials . in present research , we did not notice any destructive influence of direct current based on the hearing evaluation , but in the literature there are some reports on damaging effect of direct current on the cochlea . furthermore , in our research , pure tone audiometry revealed statistically significant improvement in hearing threshold ( p 0.05 ) in group one , which can mean hypothetically that the function of outer hair cells improved ( but in present study , objective measurements such as otoacoustic emissions or auditory brainstem responses were not performed after the treatment ) . subjective evaluation of hearing in pure tone audiometry revealed the best effect in group one . although the degree of the hearing improvement seems not to be clinically meaningful , the hearing level reminded stable and this measurement was repeatable during control period . this might also be the result of disappearance or decreasing tinnitus severity , which could have had a masking effect . having in mind that sensorineural hearing loss is difficult to treat , especially in chronic course , this improvement appeared more significant , nevertheless it needs further confirmation in objective measurements . in group onewe observed a perception of sound in most ears while using direct positive current , with its frequency adopted according to the tinnitus frequency parameters ( selective e.s . ) . in the majority of cases those frequencies corresponded with impaired frequencies in pure tone audiometry peripheral cochlear impairment . this observation might be coherent with a hypothesis that the sound perception during e.s . many authors highlight the need for placebo - controlled studies to assess placebo effect in tinnitus treatment . the placebo effect is known to cause neurobiological changes comparable to those resulting from pharmacotherapies ; however , its mechanisms are not fully understood . placebo responses can be attributed to the two phenomena : conditioning and expectation of therapeutic benefit . [ positron emission tomography ( pet ) and functional magnetic resonance imaging ( fmri ) ] and neurotransmitter release measurement have contributed to explanation of some placebo underlying mechanisms . the differences of the placebo effect in patients may reflect variations in the activity in some neurotransmitter systems ( dopamine , serotonin , cholecystokinin , opioid ) . neuroimaging of placebo analgesia pointed to decreased activity in thalamus , insula and somatosensory cortex . with respect to tinnitus , the placebo effect was mainly assessed in pharmacotherapy ( dexamethasone , lidocaine , paroxetine , betahistine , vasodilators , diuretics ) and complementary medicine therapies ( ginko biloba , acupuncture , massage , meditation ) showing no advantage of therapy over placebo . the comparison of transcutaneous electrical stimulation and placebo stimulation resulted in similar outcomes . he obtained improvement in 40 % of tinnitus concluding that each uncontrolled clinical trial may by biased by placebo effect . mcferran and phillips point to difficulties in evaluating different tinnitus treatment methods as they lack blinding . they cite the duckert s experiment ( aforementioned ) stressing that placebo effect is often regarded pejoratively by practitioners of modern medicine , overlooking the fact that a placebo is not the same as no effect . the authors used lidocain to deliver local infiltration anesthesia to the stimulated region of the preaurical skin to create identical circumstances during e.s . and placebo e.s . substantial difficulty in placebo - controlled study is to establish comparable conditions for treated and placebo group . in case of e.s . the patient will feel the electric current . on the basis of our research and previous experiences only 26 % ( 31 ears ) felt electric current during e.s . in those cases patients reported sensation of pricking , tingling , warming and pain . they can experience some sensations like above , but not necessarily . according to hoare et al . most research on tinnitus lack blinding , thus those therapeutic methods remain to be demonstrated conclusively especially those most commonly used : hearing aids , maskers , tinnitus retraining therapy . on the other handmany patients with ear problems / diseases suffer from tinnitus as well , but only in few cases underlying etiology can by clarified . for that reason each therapy , also symptomatic , may be effective especially for those with constant , severe tinnitus . the application of direct current electrical stimulation of the hearing organ , with current frequencies similar to tinnitus frequencies ( selective electrical stimulation ) , was an efficient method in severe tinnitus treatment.we did not observed a harmful effect of direct current on hearing organ . the application of direct current electrical stimulation of the hearing organ , with current frequencies similar to tinnitus frequencies ( selective electrical stimulation ) , was an efficient method in severe tinnitus treatment .\noutput:\n" }, { "from": "agent", "value": "the objectives of the study are assessment of the influence of direct current electrical stimulations of the ear in tinnitus treatment , comparison of the results with placebo group and evaluation of hearing after electrical stimulations . the study comprised 120 tinnitus and sensorineural hearing loss patients ( n = 184 tinnitus ears ) . in group one ( n = 119 tinnitus ears ) the authors applied a non - invasive hydrotransmissive electrical stimulation ( 15 ) of the ear , in group two ( n = 65 tinnitus ears ) placebo electrical stimulation . direct rectangular , positive polarization current was used . the frequency of stimulation was adjusted according to tinnitus frequency . in group two , the authors used similar procedure , but no current was delivered through the active electrode . evaluation of tinnitus and hearing was conducted . in groups one and two , directly after the treatment , the number of ears with permanent tinnitus decreased considerably . in group one in 40 ears ( 33.6 % ) tinnitus disappeared ; in group two , tinnitus disappeared in four ears ( 6.1 % ) . after 30 days , statistically significant changes were observed in group one ( p < 0.05 ) , which were comparable with results returned 90 days later ( p > 0.05 ) . changes in group two ( after 30 and 90 days ) were not significant ( p > 0.05 ) . the authors recognized audiometric improvement of hearing ( in pure tone audiometry ) . the application of direct current electrical stimulation of the hearing organ , with current frequencies similar to tinnitus frequencies ( selective electrical stimulation ) , was an efficient method in severe tinnitus treatment . we did not observe a harmful effect of direct current on hearing organ ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: epiretinal membranes ( erms ) are characterized by wrinkling of the macular surface from cell proliferation . most commonly erms are noted in adults above the age of 50 years in association with posterior vitreous detachment ( pvd ) , laser photocoagulation , or after retinal detachment repair . a majority of erm in adults is of the cellophane macular reflex type referring to the thin transparent variety .1 erm in children and young adults is uncommon , because a pvd is uncommon in very young subjects . ocular trauma , pars planitis , ocular toxocariasis , ocular toxoplasmosis , combined hamartoma of the retina and retinal pigment epithelium , and coats disease are leading causes of secondary erm in children . the prevalence of erm in subjects less than 20 years of age is around 1 in 20,000.1 a majority of erm in young subjects is of the thick white contractile variety having strong adherence to retinal vessels .2,3 myofibroblasts , myoblastic differentiation of retinal pigment epithelial cells and fibrous astrocytes , as well as new collagen formation are more common in erm of young subjects than in erm in older subjects .4 we report a young adult with erm that underwent spontaneous release in a peculiar way ( erm tearing centrally ) apparently following valsalva maneuver . this 32 year - old healthy man complained of visual loss in the right eye 14 months prior to presentation and he was referred for surgical peeling of an erm ( figures 15 ) by two retina experts . two months before presentation , he indulged in heavy weight - lifting and noted repeatedly severe eye pressure during the exercise . two months later , ophthalmic exam revealed 6/6 uncorrected visual acuity with findings of a residual rolled - over erm supranasal to the fovea ( figure 6 ) . past fundus photograph 1.5 years ago revealed a dense macular gliosis with prominent radial stress line ( best seen on infrared photography ) throughout the posterior pole and centered around the thickest part of the membrane nasal to the disc ( as noted by red - free photograph [ figure 2 ] ) . intravenous fluorescein angiography done at the same time revealed obliteration of foveal avascular zone with tortuous macular capillaries and stretched out papillomacular vessels . optical coherence tomography ( oct ) done 1 year ago ( figure 5 ) revealed a diffuse erm thin temporal to the fovea and very thick nasal to the fovea with marked thickening of the central fovea . oct upon presentation demonstrated central peeling of erm ( figure 7 ) accompanied by normalization of central foveal thickness ( figure 8 ) . erm rupture could be noted with one edge ruptured temporally and the nasal edge rolling over ( figure 9 ) . there was no pvd identified by oct or by slit lamp fundus biomicroscopy with a 90 diopter lens . erm in young subjects commonly causes both metamorphopsia and reduced visual acuity from reduced axoplasmic flow , abnormal hemodynamic microcirculation , light - filtering effect of erm , and photoreceptor distortion by tangential traction .57 clinically , the superior and inferior vessels are narrowed while the perimacular vessels are pulled toward the epicenter with inner retinal striae . erm in young people and children is rare and may be caused by congenital defects resulting from persistent adhesions of primary vitreous to the retina .7 the clinical and ultrastructural features of juvenile macular pucker reflect a more rapidly changing , contractile tissue4 compared with the usually more quiescent features in most cases involving older patients . however in adults , pvd can damage the internal limiting membrane , thereby permitting the migration of glial cells to the retinal surface .6,8 alternate proposed hypothesis in adults is that an incomplete pvd provides the conditions suitable for membrane proliferation in the adhesion area between the vitreous and the retina . the cells involved in this process are retinal pigment epithelium metaplastic cells , glial cells ( muller cells and astrocytes ) , hyalocytes ,9 endothelial cells , fibroblasts , myofibroblasts , monocytes , and macrophages . it appears that several growth factors10 ( platelet - derived growth factor , tissue growth factor tgf beta1 and 2 , fibroblast growth factor , vascular endothelial growth factor , nerve growth factor ) could stimulate glial cells to transdifferentiate into myofibroblasts and stimulate myofibroblasts to turn on their contractile actions more so in young subjects .911 moreover the role of plasminogen and metalloproteinases in contraction of erm has been raised .12,13 spontaneous release of erm is a rare event but is known to occur in adults and is related to the occurrence of an acute pvd that simultaneously releases the attachment between the retina and erm ( figures 10 , 11 ) . separation or peeling of erm in young subjects is quite rare .1430 it may occur spontaneously by development of a pvd ,23 or shortly after panretinal photocoagulation or nd : yag ( neodymium - doped yttrium aluminum garnet ) posterior capsulotomy27 meyer et al15 presented six cases of spontaneous gradual remodeling with release of erm in young subjects . they hypothesized that when the contracting forces of the immature erm are stronger than its adhesions to the retina , the membrane may separate spontaneously . only one of six cases had pvd15 and one case with prior pvd also had release of erm .16 erm release was more common in eyes with pvd : 23 in a study of 1,248 consecutive eyes with idiopathic erm followed - up for around 3 years , erm self - separation occurred in 37 eyes ( 3.0 % ) , with 16 of 1,091 eyes with pre - existing pvd ( 1.5 % ) and 21 of 157 eyes without pre - existing pvd ( 13.4 % ) .23 a higher rate of spontaneous separation was reported in japan : nomoto et al24 detected five patients with spontaneous separation of erm among 92 patients with idiopathic erm . three mechanisms ( figures 1015 ) are proposed for spontaneous erm separation including the two previously described ones : pvd ( figure 11 ) , remodeling ( contraction of myofibroblast ) ( figures 12 , 13 ) , and rupture of weakest line by lifting heavy objects ( valsalva ) ( figures 14 , 15 ) . head - down position combined with weight - lifting ( table 1 ) and mouth closure lead to high intraocular pressure ( iop ) ( rise can reach up to 30 mmhg ) 31,32 and this places tension on tissues leading to compression of the vitreous against the retinal surface and hence retinal dehiscence in places of retinal lattice or in this case tearing off of the elastic fibrous tissue already under tangential traction at its weakest , thinnest point . valsalva maneuver comprises forcible exhalation against the closed glottis , thereby creating a sudden increase in the intrathoracic or intra - abdominal pressure . ocular and systemic changes are secondary to the extreme pressure elevations that occur in the intra - abdominal , intrathoracic , intracranial , intraocular , and vascular compartments . the enormous pressures generated lead to elevations in intracranial pressure obstructing venous outflow leading to hemorrhage and elevations in iop . in one study by dickerman et al32 iops were significantly elevated by weight - lifting by 15 mmhg from a mean of 13 to a mean of 28 with one subject s iop reaching 46 mmhg during maximal contraction . macdougall et al33 found severe elevations in blood pressure ( bp ) with mean value of 320/250 mmhg ( bp exceeding 480/350 mmhg in one subject ) and mouth pressures of 3050 torr during a single maximum lift ( normal mouth pressure being 15 torr ) . this combination of severe elevation in bp and intracranial pressure would have yielded a high incidence of ocular hemorrhage was it not for the dampening effect of high iop . erm rupture during weight - lifting was not previously reported in the literature ( table 1 ) .3242 the relation between weight - lifting and erm separation could be a coincidence with the natural history of erm taking its course . the current erm is thought to be primary and not secondary to trauma or inflammatory chorioretinal disorders . other factors may be involved in erm separation like rubbing of the eye or minor trauma to the eye , neither of which could be elicited in this case . a table of ocular findings in weight - lifters is enclosed ( table 1 ) . in conclusion , erms in young subjects seems strikingly different from that of those in older individuals ; they appear thicker , whiter with high prevalence of myofibroblast cells , hence the contracting forces that stretch the retina . potential maneuvers that can put stress on erm surface include severe acute oculopression or rubbing that can raise the iop acutely and valsalva maneuvers , hence triggering spontaneous resolution of erm via rupture in its thinnest meridian with subsequent contraction of the thicker side towards the epicenter .\noutput:\n" }, { "from": "agent", "value": "this patient presented for surgery at the age of 32 years , 14 months after his initial complaint of metamorphopsia and visual loss in the right eye . past tests demonstrated a whitish epiretinal membrane ( erm ) with translucent stress lines over a thickened macula . visual acuity was found on last presentation to be normal with minimal alteration on amsler grid testing . a torn erm was found in the center with left - over erm temporally and rolled - over erm nasally at the site of the epicenter with no posterior vitreous detachment . visual recovery occurred gradually over several days 2 months prior to presentation apparently following heavy weight - lifting with a sensation of severe eye pressure . sequential funduscopy and optical coherence tomography scans demonstrated the peeling of an erm accompanied by normalization of foveal thickness . valsalva maneuver had put excessive tension on erm which tore in its center at the weakest line with gradual contraction of the erm away from the fovea towards the peripapillary area . this is a new mechanism of self - separation of erm induced by valsalva . erm in young subjects is subject to rupture and subsequent separation by tangential traction . there are three mechanisms for spontaneous separation of erm : 1 ) posterior vitreous detachment with pulling of erm by detaching vitreous ( most common in adults ) ; 2 ) the contracting forces of the immature erm become stronger than its adhesions to the retina resulting in slow tangential traction on the edges of the erm and gradual separation from the edges towards the center ( remodeling common in youngsters ) ; and 3 ) acute tearing of erm at its weakest central point and retraction of part of the membrane towards the epicenter ( current case report ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a healthy 35 - year - old woman presented with a history of a painless , slow - growing nodule in the left eye caruncle over the previous 2 months ( fig . the lesion was not fixed to the underlying tissue , was freely mobile , and had a firm consistency . eversion of the upper and lower eyelids revealed that the lesion was confined to the caruncle without extension to the fornix or palpebral conjunctiva . the visual acuity was 20 / 20 and ocular movement was in the normal range . the ocular examination was otherwise unremarkable . on physical examination , there was no regional lymphadenopathy . the venereal disease research laboratory test , erythrocyte sedimentation rate , serum angiotensin converting enzyme level , and chest radiograph were all normal . the serum ige level was not elevated . she had no prior significant medical history ; however , she declined additional work - up . one week following presentation , the patient underwent an excisional biopsy of the left eye to confirm the diagnosis . a 1.30.50.3 cm sized nodule was removed and subsequently sent for histopathologic examination . gross examination of the mass revealed a smooth , firm nodule ; infiltration to the underlying tissues was not detected . microscopic examination with hematoxylin - eosin staining showed follicular lymphoid hyperplasia with germinal center and perifollicular fibrosis ( fig .2 ) . higher magnification revealed an eosinophil infiltrate with proliferation of vascular channels , especially the capillaries ( fig . vascular channels were lined by normal - appearing flat , spindle - shaped endothelial cells ( fig . immunohistochemical staining for cd20 and cd3 showed t - cells surrounding well - formed lymphoid follicles with germinal centers containing b - cells ( fig . 5a and 5b ) . on the basis of these histopathologic findings , we established a diagnosis of kimura disease . atthe last follow - up 6 months after surgery , the patient had no evidence of a recurrence . the caruncle is a modified cutaneous tissue containing fine hair , sebaceous glands , sweat glands , and goblet cells . although this large array of tissue elements can give rise to a wide variety of lesions , caruncular tumors are uncommon . kimura disease typically presents as firm , painless , pruritic , single - to - multiple subcutaneous nodules . kimura disease has a predilection for the skin of the pre - auricular , parotid , and submandibular regions . kimura disease of the orbit and ocular adnexa is uncommon , but well - documented by buggage et al . . the orbit , especially in the superior orbital space , may be a preferred site for kimura disease . the disease was first described in chinese literature as an eosinophilic hyperplastic lymphograuloma and was later characterized by kimura et al . in 1948 . hundreds of cases under a variety of names have been reported in asia , including china , japan , and indonesia . kimura disease occurs mainly in asian males , presenting as large ( 2 cm ) subcutaneous papules or nodules , elevated blood eosinophilia ( up to 54 % ) , hypergammaglobulinemia ( ige ) , regional lymphadenopathy , and salivary gland involvement . the patient described herein was female and had a normal peripheral blood eosinophil count and serum ige level . allergic reactions , infections , and autoimmune reactions with an aberrant immune response have been suggested . because of the non - specific presentation of kimura disease , strict histopathologic examination is crucial to confirming the diagnosis . histopathologically , kimura disease is characterized by an inflammatory infiltrate with prominent collections of eosinophils and scattered lymphoid follicles , increased fibrocollagenous tissue , and vascular proliferation , with vessels lined by normal endothelial cells . the differential diagnosis of kimura disease is broad and includes angiolymphoid hyperplasia with eosinophilia ( alhe ) , hodgkin lymphoma , langerhans cell histiocytosis , lymphadenopathy of a drug reaction , and parasitic lymphadenitis . however , distinguishing kimura disease from neoplasms is not difficult when reed - sternberg cells , atypical lymphocytes , and langerhans cells are identified . a positive history of drug use , and seropositivity for parasitic infections can be helpful for differentiating diagnoses . kimura disease and alhe were often confused in a number of early reports . over the years , the clinical features of kimura disease overlap significantly with those of alhe . clinically , both present as relatively asymptomatic soft tissue swellings in the head and neck . however , there are characteristic and distinctive clinicopathological features between the two diseases . in brief , the solitary lesions are usually in the deep subcutaneous tissues , and are frequently associated with regional lymphadenopathy and salivary gland involvement . by contrast , alhe occurs in all racial groups with a slight female predilection . patients present with small , superficial dermal papulonodules , which are frequently erythematous , accompanied by bleeding , pruritis , and tumor growth . regional lymphadenopathy , serum eosinophilia , and elevated ige levelskimura disease and alhe can be differentiated on a histopathological basis , especially with their vascular endothelial morphology . kimura disease is a chronic allergic or autoimmune inflammatory disorder , whereas alhe is a neoplasm of blood vessels . histopathologically , the most important diagnostic feature of alhe is the appearance of endothelial cells , which have a vesicular nucleus , abundant cytoplasm , and an oval - to - cuboidal shape . the histopathologic examination of the surgical specimen revealed flat , spindle - shaped endothelial cells which had normal - appearing nuclei and cytoplasm ; findings which are consistent with kimura disease . interestingly , kimura disease is associated with renal disease , which may develop before or concurrently with disease progression . . demonstrated ige in the renal glomeruli of a patient with kimura disease who manifested nephritic syndrome . excision is the most widely used therapy and oral or intralesional steroids , radiation , and chemotherapy can also be used . we treated the patient with complete excision and recurrence has not been detected through the 6 - month follow - up visit . there is a tendency for caruncular lesions to have inconsistencies between clinical and histopathologic diagnosis , which can be as high as 50 % . our patient is a further unusual example of the confounding nature of the caruncular lesions . despite its rarity , kimura diseasecaruncular lesions are rare and diverse , making clinical diagnosis difficult . with a strict histopathologic examination of excised tissue\noutput:\n" }, { "from": "agent", "value": "a 35 - year - old woman presented with history of a painless , slow - growing nodule in a left eye caruncle over the last 2 months . the visual acuity was 20 / 20 and the ocular movements were in the normal range . the venereal disease research laboratory test , erythrocyte sedimentation rate , serum angiotensin converting enzyme level , and chest radiograph were all normal . an excisional biopsy was done to confirm the diagnosis . a 1.3 0.5 0.3 cm sized nodule was extracted and sent for histopathologic examination . hematoxylin - eosin staining showed follicular hyperplasia with perifollicular fibrosis , an eosinophil infiltrate , and proliferation of capillary vessels . the capillaries were lined by normal - appearing , flat , spindle - shaped endothelial cells . on the basis of these histopathologic findings , the diagnosis of kimura disease in a caruncle was established . this is the first report describing kimura disease localized to a caruncle . kimura disease should be suspected and included in the differential diagnosis of a caruncular mass lesion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: schwannomas are rare peripheral nerve tumors arising from schwann cells of the nerve sheath , and they are usually located in the head and neck . computed tomography ( ct ) and other imaging modalities may help obtain information about tumor size , location and relationships with neighboring tissues , but they do not give a definitive diagnosis . a successful laparoscopic resection of a presacral schwannoma near the right internal iliac vessels and ureter is reported . a 54 - year - old woman was referred to our hospital with a mass in the pelvic cavity detected on chest - abdominal , ct done for investigation of breast cancer . she had no particular past and family history , and the physical examination was unremarkable . ultrasonography of the pelvis revealed a 54.3 cm , solid mass separated from her right adnexa ( fig . 1 ) . contrast enhanced - ct showed a 54 cm , solid , well - defined , heterogeneous mass in the right side of the pelvic cavity ( fig . 2 ) . mri showed that the tumor demonstrated homogeneous hypointensity on t1 - weighted images and heterogeneous slight hyperintensity on t2 - weighted images ( fig . sagittal sections of mri demonstrated that the mass was intricately related to the anterior presacral fascia ( fig . figure 1 : ultrasonography of the pelvis shows a 54.3 cm solid and an iso - echoic mass . figure 2 : contrast enhanced - ct shows a 54 cm solid , well - defined , heterogeneous mass in the right side of the pelvic cavity . figure 3 : mri shows that the tumor is a homogeneous hypointensity on t1 - weighted images ( a ) and a heterogeneous slight hyperintensity on t2 - weighted images ( b ) in a right side of the pelvic cavity . figure 4 : sagittal mri sections show the mass to be intricately related to the anterior presacral fascia . ultrasonography of the pelvis shows a 54.3 cm solid and an iso - echoic mass . contrast enhanced - ct shows a 54 cm solid , well - defined , heterogeneous mass in the right side of the pelvic cavity . mri shows that the tumor is a homogeneous hypointensity on t1 - weighted images ( a ) and a heterogeneous slight hyperintensity on t2 - weighted images ( b ) in a right side of the pelvic cavity . sagittal mri sections show the mass to be intricately related to the anterior presacral fascia . under general anesthesia , the patient was placed in the supine position , and a 4 - port technique was used . a 12 - mm port was inserted through an umbilical incision for the placement of a flexible laparoscope . three other ports ( one 12 - mm and two 5 - mm ports for retraction or the working port ) were placed . an initial incision was made in the retroperitoneum , and mainly sharp dissection by liga - sure was used to isolate the mass from the surrounding tissues . with careful dissection using sharp and blunt maneuvers , the mass was dissected from the neighboring vessels , such as the right internal iliac vessels and ureter ( fig . although the ureter was easily identified and dissected free , the mass strongly adhered to the right internal iliac vessels , making its dissection difficult . once free from the surrounding tissues , the mass was placed into a plastic bag to avoid spillage into the abdomen . a suction drainage tube was placed into the pouch of douglas through a 12 - mm port in the right side of the abdomen . figure 5 : laparoscopic findings of schwannoma in the pelvis . 1 , schwannoma 2 , right ureter 3 , rectum 4 , right iliac vessel . the intra - operative blood loss was minimal , and the operation time was 150 min . the specimen was an elastic hard , 54 cm mass with an integral envelope . on sectioning , it was yellow and white in color , predominantly solid with cystic change ( fig . 6 ) . pathologic examination showed whorls and interlacing fascicles of schwannoma spindle cells , along with alternating antoni - a and - b patterns with areas of hyalinization and fibrinoid degeneration ( fig . the cells stained positive for s - 100 protein and negative for desmin and muscle - specific actin , consistent with a benign schwannoma . the patient had an uneventful post - operative course and was discharged on the fourth post - operative day . the patient has had no evidence of recurrence so far , 20 months after surgery . figure 6 : the specimen is an elastic hard , 54 cm mass with an integral envelope . on sectioning , it is yellow and white in color , predominantly solid with cystic change . figure 7 : histologic findings of schwannoma in the pelvis ( hematoxylin and eosin , 200 ) . ( a ) the antoni a pattern is composed of spindle cells arranged in intersection fascicles . ( b ) the antoni b pattern is composed of loose hypocellular tissue . the specimen is an elastic hard , 54 cm mass with an integral envelope . on sectioning , it is yellow and white in color , predominantly solid with cystic change . ( a ) the antoni a pattern is composed of spindle cells arranged in intersection fascicles . pelvic schwannomas mostly arise from a sacral nerve or the hypogastric plexus . in the present casethe proportion of retroperitoneal schwannomas has been reported to be 0.72.6 % of all schwannomas . moreover , pelvic schwannnomas are very rare and account for 1 % of all benign schwannomas . in the literature , 60 cases of benign retroperitoneal schwannomas , of which 20 were located in the pelvis , have been reported . ultrasound ( us ) , ct and mri are non - specific in most cases . li et al . reported that only 15.9 % were identified preoperatively by these imaging modalities in a review of 82 retroperitoneal schwannomas . traditionally , pelvic tumors have been classified into congenital , inflammatory , neurogenic , osseous , specific soft - tissue masses and arteriovenous malformations . in the present case , ct - guided , fine needle aspiration ( fna ) or endoscopic ultrasound ( eus ) - fna is unreliable in large schwannomas due to cellular pleomorphism in areas of degeneration . since seeding of malignant cells and infection of cystic tumor are risks , complete operative removal remains the best biopsy . a few reports recently have described the usefulness of eus - fna for the diagnosis of small retroperitoneal schwannoma , especially for small tumors difficult to detect on ct or us . since most schwannomas are benign and seldom become malignant , patients with asymptomatic retroperitoneal schwannomas with no possibility of malignancy diagnosed by eus - fna may avoid unnecessary surgery . however , malignancy can not be excluded accurately preoperatively or even intra - operatively with frozen section analysis . at present , surgical resection is the only accurate approach for pathologic evaluation to enable diagnosis of a pelvic schwannoma . it has been argued that the local recurrence rate ranges from 16 to 54 % after conservative intralesional enucleation . on the other hand , because this is a benign mass , an enucleation or a partial resection of the mass is sufficient and have reported no increase in the size of the mass over a 6 - and 14 - year period . however , because the possibility of malignancy is not completely excluded with the exception of viewing enough tissue , the best treatment of schwannomas is complete surgical resection . during the present operation , the mass was easy to dissect off from adjacent organs such as the internal iliac vessels and ureter . a sponge dissection was useful for dividing the mass from the internal iliac vein or the anterior sacral fascia as in the present case . laparoscopy is a safe and efficient tool for approaching benign pelvic schwannomas and might offer the advantage of better visualization of structures with the magnification of the laparoscopic view , especially in narrow anatomic spaces .\noutput:\n" }, { "from": "agent", "value": "schwannomas are rarely located in the pelvis . a 54 - year - old woman was found incidentally to have a tumor in the abdomen . abdominal computed tomography and magnetic resonance imaging revealed a well - defined , heterogeneous tumor , 5 cm in diameter , in the pelvic cavity . with a diagnosis of a mesenteric tumor , a laparoscopic procedure was performed . intra - operatively , an elastic tumor was identified in the pelvis adjacent to the right internal iliac vein and ureter . the tumor was dissected free from adjacent structures using liga - sure and blunt maneuvers . a complete laparoscopic excision was performed . histopathological examination revealed a benign schwannoma . the patient had an uneventful post - operative course , and was discharged on the fourth post - operative day . laparoscopic treatment is useful and feasible for retroperitoneal pelvic schwannoma , with minimal invasiveness and an early post - operative recovery . thus , this procedure may be the first - choice surgical procedure for retroperitoneal pelvic schwannomas ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: an agilent 1200 series hplc system equipped with a diode array detector and a phenomenex c18 column ( 5 m , 25021.2 mm ) was used for preparative hplc . for hplc - ms analysis , an agilent hplc system equipped with a diode array detector and a 6130 series quadrupole mass spectrometer was used with a phenomenex c18 ( 5 m , 1004.6 mm ) column . the following gradient was used for hplc - ms analysis : 05 min , isocratic 10 % ch3cn + 0.1 % formic acid ; 525 min , linear gradient from 10 % ch3cn + 0.1 % formic acid to 100 % ch3cn + 0.1 % formic acid . nmr spectra were recorded in cd3od ( for compounds 14 ) or cd2cl2 ( for compound 5 ) at 600 mhz and referenced to the internal solvent peak at h 3.30 and c 49.0 or h 5.32 and c 53.8 , respectively . high - resolution mass spectrometry ( hr - ms ) was performed at the university of illinois urbanaan ant colony of a. dentigerum was collected from pipeline road , panama , on may 29 , 2008 , and placed in a sterile petri dish with moist cotton . after allowing the nest to stabilize for a few days , the pseudonocardia symbiont from this colony was isolated directly from the mesoternal lobe of a worker by scraping bacteria off the cuticle of the ant using a sterile scalpel and plating on chitin media following the methods of caldera and currie , and identified as pseudonocardia sp . ec080529 - 01 were grown on solid isp - 2 medium ( per liter : yeast extract , 4 g ; malt extract , 10 g ; glucose , 4 g ) in 12 petri plates ( 15020 mm , 1.2 l total ) for 7 d at 30 c . the solid agar was cut into small cubes and soaked in etoac ( 1.2 l ) overnight . the etoac was filtered and dried in vacuo to give the crude etoac extract . the solid agar was re - extracted overnight with meoh ( 1.2 l ) , and the meoh was filtered and dried in vacuo to give the crude meoh extract . the crude etoac extract was dissolved in 90 % meoh h2o ( 20 ml ) and passed through a c18 column , eluting with additional 90 % meohthe eluent from this column was diluted with h2o to give a final meoh concentration of 60 % . this solution was passed through another c18 column and washed with additional 60 % meohh2o fraction was purified by preparative hplc using the following gradient : 05 min , isocratic 20 % ch3cn h2o ; 560 min , linear gradient from 20 % ch3cnthe 100 % meoh fraction from this c18 column was purified by preparative hplc using the following gradient : 010 min , isocratic 50 % ch3cn h2o ; 1060 min , linear gradient from 50 % ch3cnthe crude meoh extract was dissolved in h2o and passed through an hp - 20 column . the hp - 20 column was washed with water to remove polar components , and the compounds of interest were then eluted with 100 % meoh . the eluent from this column was diluted with h2o to give a final meoh concentration of 30 % . this solution was passed through another c18 column and washed with additional 30 % meohthe 100 % meoh fraction from this c18 column was purified by reversed - phase hplc using the following gradient : 010 min , isocratic 10 % ch3cn h2o + 0.1 % formic acid ; 1060 min linear gradient from 10 % ch3cn h2o + 0.1 % formic acid to 100 % ch3cn + 0.1 % formic acid to give pure 1 ( 2.0 mg ) , 2 ( 0.9 mg ) , and 3 ( 1.8 mg ) . colorless solid ( 2.0 mg ) ; d 11 ( c 0.02 , meoh ) ; uv ( meoh ) max ( log ) 310 nm ( 3.11 ) , 279 ( sh ) , 271 nm ( 3.59 ) ; h nmr ( 600 mhz , cd3od ) and c nmr ( 150 mhz , cd3od ) , see table 1 ; ( + ) - hresi m / z 497.1438 [ m + h ] ( calcd for c26h25o10 , 497.1448 ) . yellow solid ( 0.9 mg ) ; d 2 ( c 0.02 , meoh ) ; uv ( meoh ) max ( log ) 377 nm ( 3.52 ) , 305 nm ( 3.87 ) ; h nmr ( 600 mhz , cd3od ) and c nmr ( 150 mhz , cd3od ) , see table 1 ; ( + ) - hresi m / z 495.1295 [ m + h ] ( calcd for c26h23o10 , 495.1291 ) . orange solid ( 1.8 mg ) ; d 3 ( c 0.09 , meoh ) ; uv ( meoh ) max ( log ) 403 nm ( 3.53 ) , 314 nm ( 3.96 ) ; h nmr ( 600 mhz , cd3od ) and c nmr ( 150 mhz , cd3od ) see table 1 ; ( + ) - hresi m / z 511.1229 ( calcd for c26h23o11 , 511.1240 ) . the appropriate test organism was grown in a 5 ml culture overnight in either lb medium ( for e. coli and b. subtilis ) or ypd medium ( for c. albicans and s. cerevisiae ) at 30 c . in each case , the overnight culture was diluted with additional sterile medium ( lb or ypd ) to an od600 of 0.01 . compounds 15 were dissolved in dmso to give a concentration of 5 mg / ml and 2-fold serially diluted . these solutions ( 1 l ) were added to the wells of a 96 - well plate , followed by the diluted culture of the test organism ( 99 l ) to give a final compound concentration ranging from 50 to 0.1 g / ml . the cultures were allowed to grow for 24 h at 30 c before the od600 was measured using a plate reader . the mic was defined as the lowest concentration that gave less than 5 % of the maximum od600 . dynemicin a was used as a positive control and gave mic values against e. coli , b. subtilis , c. albicans , and s. cerevisiae of 313 , 0.16 , 156 , and 156 ng / ml , respectively . compounds were tested for activity against hepg2 human hepatoma cells ( atcc ) that were maintained in dmem ( invitrogen ) , 10 % fbs ( sigma ) , and 1 % antibioticantimycotic ( invitrogen ) in a standard tissue culture incubator ( 37 c , 5 % co2 ) . for assays , compounds 15 ( in dmso ) the final concentration of dmso was 1 % , and compounds varied from 0 to 50 g / ml . cells were incubated with the compounds for 2 days at 37 c , and then liver cell viability was assessed with celltiter - glo ( promega ) . the relative signal intensity of each sample was evaluated with an envision ( perkinelmer ) system . liver - stage p. berghei assays were performed using a luciferase - expressing sporozoite strain of p. berghei anka . parasites were obtained from dissection of plasmodium - infected anopheles stephensi mosquitoes ( new york university langone medical center insectary ) . malaria parasites ( 4000 sporozoites ) were used to infect hepg2 cells ( 15000 cells ) in a 384 - well plate in the presence of compounds 15 in triplicate . the final concentration of dmso was 1 % , and compounds varied from 0 to 50 g / ml . cellswere incubated with the compounds for 2 days at 37 c , and then relative parasite load was determined after addition of bright - glo ( promega ) . data analysis for hepg2 toxicity and liver - stage malaria activity was carried out using graphpad prism , and curves were fit with a standard inhibition doseall statistical results are the mean ic50 value averaged from two independent experiments . atovaquone was used as a positive control and gave an ic50 in blood stage assays of 0.3 nm .\noutput:\n" }, { "from": "agent", "value": "three new members of the angucycline class of antibiotics , pseudonocardones a c ( 13 ) , along with the known antibiotics 6 - deoxy -8-o - methylrabelomycin ( 4 ) and x-14881 e ( 5 ) have been isolated from the culture of a pseudonocardia strain associated with the fungus - growing ant apterostigma dentigerum . compounds 4 and 5 showed antibiotic activity against bacillus subtilis 3610 and liver - stage plasmodium berghei , while 13 were inactive or only weakly active in a variety of biological assays . compound 5 also showed moderate cytotoxicity against hepg2 cells ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: wellens ' syndrome is an acute coronary syndrome that has a high risk for myocardial ischemic disease and threatens patients ' life . according to electrocardiogram ( ecg ) patterns , wellens ' syndrome can be divided into two types : changes of symmetric , deeply biphasic twaves classified as type 1 or inverted t waves classified as type 2 in precordial leads . these patterns are especially seen in v2v3 leads during painfree periods , and upright twaves with possible elevated or isoelectric st segments usually seen during pain episodes . we herein report a case of wellens ' syndrome with chest tightness and efficient pci should be considered of these patients . a 52yearold male smoker ( 20 cigarettes a day for 30 years ) with a history of diabetes mellitus , presented to an outlying hospital with acuteonset squeezing chest tightness in precordium at rest for 24 h. with ecg indicative myocardial infarction , he was treated with oral aspirin 300 mg and clopidogrel 300 mg before chest tightness remission . promptly hospitalized in the internal cardiology of our hospital , he had an initial diagnosis of acute st segment elevation myocardial infarction with st segment elevation and biphasic twaves in v1v4 by ecg ( fig .1 a ) . considering ckmb 49 u / l and ctni 2.09 ng / ml in laboratory studies , he was treated with oral aspirin 100 mg and clopidogrel 75 mg , subcutaneous low molecularweight heparin 0.4 ml , oral perindopril 2 mg , and oral lipitor 20 mg . urgent ecg revealed that twaves showed biphasic laterally in v1 and inversed in v2v4 ( fig . emergency coronary angiography showed severe stenosis ( 99 % ) in proximal lad at 10:25 ( fig .1 b ) , and immediately a stent helios 3.019 mm was successfully implanted ( fig . vectorcardiogram at discharge showed sinus rhythm which made high agreement in diagnosis recanalization with angiography ( fig 1e and f ) . he was stable for 2 months , and has been in constant followup and not experienced angina again . timi = 0 ~ 1 . c. ecg after the chest pain showed biphasic t waves in v1 , t waves inversed in v2v4 without st segment elevation . in 1982 , hj wellens and zwaan described a subtype of unstable angina , which is characterized by precordial lead twave dynamic evolution without st segment deviation and shown severe stenosis of left anterior descending in coronary angiography results . about mentioned clinical manifestations are also named anterior descending twave syndrome 2 . in clinic , these patients are diagnosed during unstable angina catabasis or the classic twave findings seen on an ecg taken when pain free , with normal or slightly increased myocardial enzymes , of which electrocardiogram characteristics : characteristic inversed or biphasic twave found in v2v3 , sometimes in v1 , v4 in the anterior leads with preserved rwave progression and without pathologic qwaves and stsegment elevation 3 , 4 . the complex and unanswered mechanisms of wellens ' syndrome confuse the doctors to diagnosis and treatment , although there are some theories of coronary artery spasm and stunned myocardium by twaves 5 . for this kind of patients , treatment with dual antiplatelet ( oral aspirin and clopidogrel ) , antithrombosis , blood pressure and blood sugar control , and oral statin therapy 1 did not achieve good control effect . for avoiding the condition of developing myocardial infarctionrapidly , we performed pci reconstruction of coronary blood supply when the patient had alleviated chest tightness with twaves changes and slightly ntni elevation at hospital admission , but the onset of angina within 24 h and twave dynamic evolution . early identification of characteristic ecg and clinical changes may provide critical clues for wellens ' syndrome . once wellens ' syndrome has been diagnosed , the patients should be ideally allowed to carry out an emergency coronary angiography and plan the revascularization via pci . urgent intervention treatment is important to avoid evolution to acute anterior myocardial infarction and possible sudden death .\noutput:\n" }, { "from": "agent", "value": "key clinical messagethe case is a 52yearold male admitted to cardiology department with chest tightness . admission ecg showed nontypical twave changes in v2v4 leads in pain peroids , and increasing severe narrowing of proximal lad . cardiac enzymes were abnormal . emergency coronary angiography showed severe stenosis ( 99 % ) in proximal lad ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the process of body odor formation in the axillae was found to depend on biotransformation of these odorless secretions into volatile odoriferous substances by commensal bacteria on the skin and hair surface .5 two distinct types of axillary microbiota dominated by either corynebacteria or staphylococci have been reported , the former being more prevalent in males and contributing to a more pronounced body odor .6 , 7 , 8 , 9 , 10 , 11 , 12 body odor , in particular axillary odor , is perceived as unpleasant by most cultures worldwide . moreover , excessive sweating and the resulting unpleasant odor are reported to adversely affect selfconfidence and selfesteem in both men and women .13 reducing or eliminating body odor is therefore an essential goal of many people 's daily personal care routine .14 typical hygiene practices include cleansing of the axillae and use of antiperspirants , both of which have been shown to alter odor production by changing the microbiota profile , its metabolic activity , and / or reducing the microbial biomass .12 , 15 , 16 over the last decade , removal of underarm hair has become more commonplace in men for hygiene as well as esthetic reasons .17 it was first demonstrated in the 1950s by shelley et al. 5 that removal of male axillary hair by shaving followed by soap washing resulted in a marked reduction or elimination of axillary odor compared with nonshaved axillae for at least 24 h. the authors concluded that the most effective means of reducing axillary odor included shaving of the axillary hair . the aim of the current study was to confirm these early findings in a clinical setting , to expand the original research by comparing different underarm hair removal procedures for their potential to improve the effectiveness of standard soap washing in reducing male axillary odor and to quantify any change in body odor development relative to baseline . eligible subjects were male , caucasian , aged 1848 years with an average malodor intensity score 4.0 and right left difference of 2.0 at baseline as determined by four trained assessors according to guidelines published by the american society for testing and material ( astm ) international .18 subjects were excluded if they had any active infection or irritation in the axillae area ; any allergies or intolerance to axillary antiperspirants , deodorants or soaps ; active eczema or psoriasis within the past 6 months ; a diagnosis of skin cancer within the past 12 months ; evidence or history of diabetes , any immunologic or infectious disease . no therapy with systemic or topical medications in the underarms within 2 weeks prior to the start of the study was permitted . subjects had to be willing to participate in a 14day preconditioning period and abstain from the use of all deodorants , antiperspirants , perfumed products , medicated products , and deodorant soaps on the axillary area for the entire conditioning and test period . the study lasted 19 days and the first 14 days were used as a pretreatment conditioning period . subjects were asked to abstain from the use of all deodorants , antiperspirants , perfumed products , medicated products , and deodorant soaps on the axillary area , otherwise they were free to perform their normal daily activities . on day 14 , subjects were screened for axillary irritation and only subjects free from irritation qualified for entry into the study . qualifying subjects had both axilla washed with a 2 % aqueous solution of unscented soap and were issued with a freshly laundered tshirt . after 24 h , baseline odor evaluations were carried out by all four trained assessors . subjects were eligible for participation in the study based on the inclusion criteria of a mean malodor intensity score 4.0 and right left difference of 2.0 at baseline . for the odor assessments , subjects removed their tshirt and elevated their arm to allow the odor assessor to place the wide end of a fresh , unused cone shaped cup , from which the narrow end was cut off , tightly against the axillary surface . the axillary region was assessed by placing the nose against the narrow end of the cup and sniffing . all four assessors evaluated first the right ; then , the left axillary area of every subject and the odor scores were averaged for the four assessors . the odor evaluations followed an elevenpoint scale ranging from no malodor ( score of 0 ) to extremely strong malodor ( score of 10 ) . for eligible subjects , the remaining 4 days constituted the evaluation period ( day 1 to day 4 ) . the axillae of healthy caucasian males were randomized to one of four hair removal treatments : clipped with scissors ; clipped with scissors followed by wet shaving with a razor ; waxed ; and untreated . a noncrossover , split body design was employed in which two of the four axillary treatments were evaluated per subject . the randomly assigned hair removal treatment was carried out by study site technicians on day 1 of the evaluation period : clipping with scissors axilla hair was clipped with clean sterile scissors as close to the skin as possible without touching the skin with the scissors.blade shavingaxilla hair was clipped as described above and a 10 % solution of unscented soap applied with a terry towel for 10 s to produce a lather . the area was shaved with a disposable single blade razor using downward strokes until all hair was removed.waxing a thin layer of heated wax ( 105f ) was applied to the axilla using a clean wooden tongue depressor followed by a wax remover cloth . the cloth was removed by pulling quickly in the opposite direction to the hair growth . a clean terry towel soaked in ice water was applied to the area after waxing and used to remove any remaining wax.no treatment clipping with scissors axilla hair was clipped with clean sterile scissors as close to the skin as possible without touching the skin with the scissors . axilla hair was clipped as described above and a 10 % solution of unscented soap applied with a terry towel for 10 s to produce a lather . the area was shaved with a disposable single blade razor using downward strokes until all hair was removed . waxing a thin layer of heated wax ( 105f ) was applied to the axilla using a clean wooden tongue depressor followed by a wax remover cloth . the cloth was removed by pulling quickly in the opposite direction to the hair growth . a clean terry towel soaked in ice water was applied to the area after waxing and used to remove any remaining wax . on day 1 , an odor evaluation was performed by the four trained assessors on the axillae of subjects assigned to the clipped and shaved treatment groups only , after the axilla hair was clipped and prior to shaving or soap washing . after treatment , all axillary sites were washed with a 10 % aqueous solution of unscented soap . the soap was applied with a cotton towel and the area washed for 10 s followed by thorough rinsing with warm water for 20 s to remove all visible signs of soap . the area was patted dry with a clean towel . odor evaluations for all subjects were carried out immediately , 12 and 24 h after controlled washing . after the 24h postwash odor evaluation ( day 2 ) , subjects had both axillae washed as described and odor evaluations were carried out immediately and after 24 h. on day 3 , subjects returned to the test facility for odor evaluations 24 h after controlled washing on day 2 and 48 h postaxillary treatment . after the 24 h postwash odor evaluation , subjects had both axillae washed as described and odor evaluations were carried out immediately and after 24 h ( day 4 , 72 h postaxillary treatments ) . the study schedule is shown in table 1 . postclipping and prior to shaving for clipped axillae sites only . immediately after 10 % soap wash . analyses were conducted on the full analysis set which is as close as possible to the itt ideal of including all randomized subjects .19 mean odor scores were calculated for each time point . an analysis of covariance was conducted using baseline data as covariate and the treatment , side ( left or right ) , and subject were included in the model . to more easily illustrate the degree of odor control , the percent reduction of body odor from baseline was calculated using the formula : odor reduction [ % ] = ( 1tx / t0 ) 100where t x = adjusted mean odor score at time t x ; t 0 = adjusted mean odor score at baseline . the study was approved by the institution 's review board or ethics committee and all subjects provided written , informed consent in accordance with title 21 of the code of federal regulations , part 50 . eligible subjects were male , caucasian , aged 1848 years with an average malodor intensity score 4.0 and right left difference of 2.0 at baseline as determined by four trained assessors according to guidelines published by the american society for testing and material ( astm ) international .18 subjects were excluded if they had any active infection or irritation in the axillae area ; any allergies or intolerance to axillary antiperspirants , deodorants or soaps ; active eczema or psoriasis within the past 6 months ; a diagnosis of skin cancer within the past 12 months ; evidence or history of diabetes , any immunologic or infectious disease . no therapy with systemic or topical medications in the underarms within 2 weeks prior to the start of the study was permitted . subjects had to be willing to participate in a 14day preconditioning period and abstain from the use of all deodorants , antiperspirants , perfumed products , medicated products , and deodorant soaps on the axillary area for the entire conditioning and test period . the study lasted 19 days and the first 14 days were used as a pretreatment conditioning period . subjects were asked to abstain from the use of all deodorants , antiperspirants , perfumed products , medicated products , and deodorant soaps on the axillary area , otherwise they were free to perform their normal daily activities . on day 14 , subjects were screened for axillary irritation and only subjects free from irritation qualified for entry into the study . qualifying subjects had both axilla washed with a 2 % aqueous solution of unscented soap and were issued with a freshly laundered tshirt . after 24 h , baseline odor evaluations were carried out by all four trained assessors . subjects were eligible for participation in the study based on the inclusion criteria of a mean malodor intensity score 4.0 and right left difference of 2.0 at baseline . for the odor assessments , subjects removed their tshirt and elevated their arm to allow the odor assessor to place the wide end of a fresh , unused cone shaped cup , from which the narrow end was cut off , tightly against the axillary surface . the axillary region was assessed by placing the nose against the narrow end of the cup and sniffing . all four assessors evaluated first the right ; then , the left axillary area of every subject and the odor scores were averaged for the four assessors . the odor evaluations followed an elevenpoint scale ranging from no malodor ( score of 0 ) to extremely strong malodor ( score of 10 ) . for eligible subjects , the remaining 4 days constituted the evaluation period ( day 1 to day 4 ) . the axillae of healthy caucasian males were randomized to one of four hair removal treatments : clipped with scissors ; clipped with scissors followed by wet shaving with a razor ; waxed ; and untreated . a noncrossover , split body design was employed in which two of the four axillary treatments were evaluated per subject . the randomly assigned hair removal treatment was carried out by study site technicians on day 1 of the evaluation period : clipping with scissors axilla hair was clipped with clean sterile scissors as close to the skin as possible without touching the skin with the scissors.blade shavingaxilla hair was clipped as described above and a 10 % solution of unscented soap applied with a terry towel for 10 s to produce a lather . the area was shaved with a disposable single blade razor using downward strokes until all hair was removed.waxing a thin layer of heated wax ( 105f ) was applied to the axilla using a clean wooden tongue depressor followed by a wax remover cloth . the cloth was removed by pulling quickly in the opposite direction to the hair growth . a clean terry towel soaked in ice water was applied to the area after waxing and used to remove any remaining wax.no treatment clipping with scissors axilla hair was clipped with clean sterile scissors as close to the skin as possible without touching the skin with the scissors . axilla hair was clipped as described above and a 10 % solution of unscented soap applied with a terry towel for 10 s to produce a lather . the area was shaved with a disposable single blade razor using downward strokes until all hair was removed . waxing a thin layer of heated wax ( 105f ) was applied to the axilla using a clean wooden tongue depressor followed by a wax remover cloth . the cloth was removed by pulling quickly in the opposite direction to the hair growth . a clean terry towel soaked in ice water was applied to the area after waxing and used to remove any remaining wax . on day 1 , an odor evaluation was performed by the four trained assessors on the axillae of subjects assigned to the clipped and shaved treatment groups only , after the axilla hair was clipped and prior to shaving or soap washing . after treatmentthe soap was applied with a cotton towel and the area washed for 10 s followed by thorough rinsing with warm water for 20 s to remove all visible signs of soap . odor evaluations for all subjects were carried out immediately , 12 and 24 h after controlled washing . after the 24h postwash odor evaluation ( day 2 ) , subjects had both axillae washed as described and odor evaluations were carried out immediately and after 24 h. on day 3 , subjects returned to the test facility for odor evaluations 24 h after controlled washing on day 2 and 48 h postaxillary treatment . after the 24 h postwash odor evaluation , subjects had both axillae washed as described and odor evaluations were carried out immediately and after 24 h ( day 4 , 72 h postaxillary treatments ) . postclipping and prior to shaving for clipped axillae sites only . immediately after 10 % soap wash . analyses were conducted on the full analysis set which is as close as possible to the itt ideal of including all randomized subjects .19 mean odor scores were calculated for each time point . an analysis of covariance was conducted using baseline data as covariate and the treatment , side ( left or right ) , and subject were included in the model . to more easily illustrate the degree of odor control , the percent reduction of body odor from baseline was calculated using the formula : odor reduction [ % ] = ( 1tx / t0 ) 100where t x = adjusted mean odor score at time t x ; t 0 = adjusted mean odor score at baseline . the study was approved by the institution 's review board or ethics committee and all subjects provided written , informed consent in accordance with title 21 of the code of federal regulations , part 50 . treatment assignments were randomized and balanced so that each treatment appeared on each axillary site an equal number of times ( n = 15 ) . there were no adverse events observed or reported during the course of the study ; however , subjects reported considerable discomfort during the waxing treatment . on day 1 , odor evaluations were carried out immediately after treatment plus controlled soap washing ( fig . 1 and table 2 ) . soap washing alone resulted in an immediate reduction of 23.5 % from baseline in axillary odor ( table 3 ) . hair removal by clipping with scissors followed by soap washing resulted in an immediate 27.2 % reduction from baseline , and this was not significantly different to soap washing alone . hair removal by shaving with a razor blade followed by soap washing resulted in an immediate reduction of 57.3 % from baseline in axillary odor and this reduction was significantly greater than soap washing alone ( p 0.0001 ) . waxingfollowed by soap washing resulted in an immediate reduction of 75.3 % from baseline in axillary odor , and this difference was significant compared with soap washing alone ( p 0.0001 ) . mean odor reduction from baseline at specified time points after treatment and controlled soap washing of the axillae . covariantadjusted mean odor score change from baseline by evaluation time sd , standard deviation ; se , standard error . covariantadjusted least squares mean and standard error were calculated for each time point . significant difference ( p 0.1 ) compared with soap washing only at each evaluation time . adjusted mean odor score percent change from baseline by evaluation time p 0.05 vs. soap wash only . p 0.10 vs. soap wash only . the significant improvement in odor control for a single soap washing after shaving with a razor blade compared with soap washing alone persisted for 24 h posttreatment ( p = 0.0682 ) ( table 3 ) . a single shaving treatment significantly improved the immediate effectiveness of soap washing on day 1 , day 2 , and day 3 compared with soap washing alone ( p 0.05 ) ( table 3 ) . similarly , a single waxing treatment significantly improved the immediate effectiveness of soap washing at all time points compared with soap washing alone ( p 0.001 ) ( table 3 ) . in contrast , clipping with scissors did not significantly improve the immediate effectiveness of soap washing compared with soap washing alone on day 1 or day 3 ( table 3 ) . on day 3 and day 4 , mean odor scores were similar to baseline for all treatments when assessed 24 h after controlled soap washing ( table 4 ) . adjusted mean odor scores were calculated for each time point using baseline data as covariate . significant difference ( p 0.10 ) compared with soap washing only at each evaluation time . odor assessments were also made on day 1 to determine whether hair removal by clipping with scissors without subsequent soap washing impacted axillary odor development . a reduction of 20 % from baseline in axillary odor was observed after clipping with scissors and before shaving or soap washing . the results presented here show that removal of male underarm hair by waxing or shaving significantly improved the immediate effectiveness of standard soap washing in reducing axillary odor compared with soap washing alone . although waxing was found to be more effective than blade shaving in reducing axillary odor after soap washing , it should be noted that the waxing procedure was associated with considerable discomfort which might outweigh the potential benefits of axillary hair removal by waxing . the reduction in axillary odor after hair removal by clipping with scissors followed by soap washing was not significantly different to soap washing alone suggesting that the method of hair removal was an important factor in axillary odor control . blade shaving followed by soap washing resulted in a marked reduction in axillary odor compared to nontreated axillae and importantly , this reduction remained significantly greater than control for at least 24 h , an effect not observed after axillary hair removal by waxing or clipping with scissors . our findings are consistent with the previous findings of shelley et al. 5 where removal of axillary hair in men by shaving resulted in a marked reduction or elimination of axillary odor for the next 24 h. however , the raters indicated only whether they were able to smell any odor ; their judgments on odor intensity and change from baseline were not recorded . in another study , the axillary odor of shaved armpits was rated as significantly less intense and more pleasant than the odor of unshaved armpits . it should be noted that nontrained assessors rated odor samples collected using cotton pads worn in the underarms for 24 h preassessment .20 . a single hair removal event by blade shaving or waxing but not hair clipping with scissors significantly improved the immediate effectiveness of soap washing in reducing axillary odor up to 3 days posttreatment when compared with untreated , washed axillae ( p 0.05 on day 1 , day 2 , and day 3 ) . it is postulated that removal of axillary hair by blade shaving or waxing provides soaps and cleansing products with better access to the skin and follicular openings for more effective odor reduction in the underarm than when hairs are present or clipped with scissors . the trained odor assessors were blinded to treatment assignments and previous odor score ; however , they were able to see the underarms of subjects when performing the odor evaluations . it could be argued that the results may be biased by assessors observing the presence or absence of underarm hair . while a potential limitation of the study , in general no significant difference was observed between odor intensities of clipped and untreated axillae suggesting that this was not the case . furthermore , no marked reduction from baseline in axillary odor was observed after clipping of hair with scissors ( before shaving or soap wash ) . this finding also challenges the hypothesis that axillary hair plays an important role in retaining chemical compounds active in communication processes21 , 22 and suggests that axillary hair plays a minor role , if any , in trapping odoriferous axillary chemicals . a mechanism for the reduced odor development following removal of axillary hair by shaving has been proposed . retained axillary secretions and debris on the hair shaft act as an excellent medium for the growth of microorganisms and subsequent axillary odor production . axillary secretions and bacteria have been reported to adhere firmly to the skin and hair , making them difficult to remove by soap washing alone .5 removal of axillary hair would therefore be expected to prompt a decrease in odor production compared with soap washing alone as observed in the present study following blade shaving or waxing . of interest , this effect was not observed after initial hair removal by clipping with scissors suggesting that the method of hair removal was an important factor in determining the extent of improvement in axillary odor reduction after standard soap washing . removal of dead skin and sebum by blade shaving or waxing , that otherwise trap odorants and dirt , might provide an additional odor reduction benefit over soap washing alone or hair removal by clipping with scissors followed by soap washing . thus , hair removal by blade shaving and waxing may allow a deeper cleansing of the axilla than clipping with scissors followed by soap washing or soap washing alone . given that the skin microbial community plays an important role in the formation of body odor in the axillae ,1 future studies should evaluate whether the different methods of hair removal followed by soap washing influence the bacterial population in the axillae in addition to the impact on axillary odor formation . the malodorous axillae have been reported to instigate a strong psychological impact on subjects resulting in social and functional impairment . future studies might also include subjects selfassessment of axillary odor , wetness perception , and impact on qualityoflife measures . the management of body odor by hygiene measures including underarm hair removal by waxing or blade shaving is important because axillary odor can be an unpleasant problem affecting a person 's confidence and selfesteem . practical recommendations regarding the most effective means of reducing axillary odor include shaving of underarm hair in men .5 , 13 our findings support these practical recommendations and may be of particular relevance in situations known to stimulate or exacerbate apocrine gland secretion and axillary odor development such as during periods of emotional stress , intense physical activity , or when in a hot or humid environment . management of body odor might explain , in part , why removal of axillary hair is becoming a more widespread crosscultural practice in men . research by retail analysts mintel23 revealed that 60 % of 16 to 24yearold british men now regularly remove their body hair . of those surveyed , 12 % had removed the hair from their underarms in the last 12 months .23 in a usbased study examining men 's motives for removing body hair , the main reason for doing so was for cleanliness ( 75 % ) with the majority of men removing hair by blade shaving .17 similarly , in europe , the preferred method of hair removal in the underarms by men is typically blade shaving ( procter & gamble , unpublished data ) . removal of male underarm hair by blade shaving and waxing significantly improved the immediate effectiveness of standard soap washing in reducing axillary odor compared with soap washing alone . this benefit was not seen when hairs were clipped to skin level with scissors . for blade shaving , this odor reduction benefit was observed up to 24 h after the soap wash . moreover , shaving with a razor blade was found to improve the immediate odor reducing effectiveness of soap washing for at least 48 h after hair removal when compared with soap washing alone . blade shaving of the axillae can optimize the cleansing and odor reducing effectiveness of daily hygiene measures for men without the discomfort associated with waxing . regular shaving with a razor should be considered as part of a grooming regimen that can be used to effectively manage body odors . editorial writing assistance , supported financially by the procter & gamble company , was provided by gill mcfeat of mcfeat science . the authors were fully responsible for all content , and editorial decisions were involved at all stages of manuscript development and have approved the final version .\noutput:\n" }, { "from": "agent", "value": "summarybackgroundaxillary hair can influence the development of underarm odor in men.objectiveto compare different hair removal procedures and their impact on the effectiveness of standard soap washing ( sw ) in reducing male axillary odor.methodsthe axillae of healthy caucasian males ( n = 30 ; 1848 years of age ) were randomized in a noncrossover , split body design . two of four axillary treatments were evaluated per subject : clipped with scissors ; wet shaved with a razor ; waxed ; and untreated . odor evaluations were performed by trained assessors according to the american society for testing and materials organization at baseline ( 24 h postcontrol sw ) , immediately , 12 and 24 h following treatment plus sw ( day 1 ) . further evaluations were conducted immediately and 24 h following sw on day 2 and day 3 . mean odor scores were calculated and an analysis of covariance conducted using baseline data as covariate.resultson day 1 , hair removal by clipping with scissors followed by sw offered no significant improvement in immediate odor control ( 27.2 % reduction from baseline ) when compared with sw alone . both shaving and waxing followed by sw resulted in an immediate , significant reduction in axillary odor compared with sw alone ( 57.3 % and 75.3 % reduction , respectively ; p < 0.0001 ) . this improvement persisted for 24 h after shaving ( p = 0.0682 ) . further , a single shaving treatment significantly improved the immediate effectiveness of sw on day 1 , day 2 , and day 3 compared with sw alone ( p < 0.05 ) . conclusionsblade shaving of the axillae can optimize the cleansing and odor reducing effectiveness of daily hygiene measures for men without the discomfort associated with waxing ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: transrectal ultrasound - guided prostate biopsy is routinely done to diagnose the absence or presence of malignancy . however , with 10 to 12 prostatic cores now being the standard , the procedure can be painful unless adequate analgesia is provided . although a wide variety of anesthetic techniques are available for transrectal ultrasound - guided prostate biopsy , including rectal administration of lidocaine gel , periprostatic nerve blocks , intravenous propofol , and narcotic intramuscular premedication , these methods may not optimally prevent or relieve pain . midazolam has been the most widely used sedative premedication because of its short half - life , faster onset of sedation , and excellent sedative hypnotic effect without any significant side - effects , such as vasculitis . midazolam is also associated with strong anterograde amnesia , and with usage of flumazenil as an antagonist , the side effects are easily treated [ 1 - 3 ] . this study was performed to evaluate the value and safety of midazolam anesthesia during transrectal ultrasound - guided prostate biopsy . from august 2008 to december 2009 , 104 patients underwent a 12 - core prostate biopsy . of the 104 patients ,51 patients ( group 1 ) were randomly assigned to prostate biopsy with 30 mg of i m ketorolac ( tarasyn ) and 53 patients ( group 2 ) were given 3 - 5 mg of midazolam iv ( dormicum ) . each subject provided informed consent and this study was approved by our medical center 's institutional review board . the indications for prostate biopsy were an abnormal prostate on digital rectal examination and / or elevated serum prostate - specific antigen ( psa ) 4 ng / ml . the patients ranged in age from 40 to 86 years ( mean , 66.99.3 years ) . subjects who had previous prostate biopsy , severe cardiovascular disease , pulmonary disease , bleeding hemorrhoids , acute anal fissure , or a history of chronic alcohol or drug abuse were not included in this study . we also excluded subjects taking medications such as erythromycin , verapamil , diltiazem , itraconazole , and ketoconazole , which can have drug interactions specifically with the benzodiazepine class . anticoagulation or aspirin therapy was stopped 1 week before the biopsy and the patients received a glycerin enema before the procedure . with the patients in the left lateral decubitus position , a digital rectal examination was performed and the rectum was cleaned with a betadine gauze pack . the urologist performed all prostate biopsies under ultrasound guidance by using a medison sa - 6000 machine with a 6.5 mhz biplane transrectal probe during longitudinal scanning by using an automated biopsy gun with a disposable 18 gauge biopsy needle . a betadine pack was kept for approximately 6 hours at the end of the procedure . the patients in group 2 were instructed to avoid consuming nicotine , alcohol , and caffeinated beverages for at least 12 hours before prostatic biopsy to maximize the likelihood that they would be able to fall asleep . a nurse intravenously administered midazolam to the subjects at doses of 3 to 5 mg . the initial intravenous dose was 3 mg ( no more than 0.05 mg / kg ) given slowly over at least 2 min , with titration to the desired level of sedation . an intravenous dose of 0.02 to 0.03 mg / kg was repeated at 2 - min intervals while the appropriate level of sedation was continually monitored . a total intravenous dose of more than 5 mg was not required for any examinations . at the end of the procedurethe sedation scale was measured after stimulating the patient ( i.e. , conversing with the patient or shaking the patient awake ) . after administration of midazolam , the presence of complications or side - effects to include apnea , oxygen desaturation , autonomic movement , chest pain , arrhythmia , injection in situ pain , and phlebitis were also assessed . the subjects were discharged once they fully recovered orientation of time and space in the setting of normal vital signs . immediately after the procedure , the patients were asked to rate their comfort level by using a 10 - point visual linear analog self - assessment pain scale ( fig . the degree of pain was interpreted as none ( 0 ) , mild ( 1 - 3 ) , moderate ( 4 - 6 ) , severe ( 7 - 9 ) , and intolerable ( 10 ) , accordingly . they were also asked whether their pain control method was satisfactory and whether they would be willing to undergo a repeat biopsy . recovery from sedation was assessed by using the mini - mental state examination ( mmse ) ( table 2 ) . the mmse was translated into and cross - culturally validated for the korean language ( k - mmse ) . the survey responses were coded and analyzed by using descriptive statistics , which are reported as medians with 5 - 95th percentiles . the statistical analysis was carried out by using the student 's t - test or the paired t - test . there were no significant differences in age , weight , body mass index , psa , or prostate volume among the groups ( table 3 ) . the differences in the pain scores were statistically significant ( p 0.05 ) . in group 1 , none or mild degrees of discomfort were expressed by 7 ( 13.7 % ) cases and severe or intolerable discomfort by 19 ( 37.2 % ) , respectively . in group 2 , none or mild degrees of discomfort were reported by 31 ( 58.5 % ) cases , whereas severe or intolerable discomfort occurred in only 1 ( 1.8 % ) patient ( fig . satisfaction with the pain control methods was noted in 11 ( 21.5 % ) cases and willingness to undergo a repeat biopsy by using the same pain control measures was noted in 10 ( 19.6 % ) cases . satisfaction and willingness were higher in group 2 than in group 1 ( 75.5 % and 60.3 % , respectively , p 0.05 ) ( fig .3 ) . the mean midazolam usage dose was 3.94 mg , and the mean time from injection to sedation was 5.1 minutes . we did not detect the aforementioned side - effects of midazolam in patients randomly assigned to the midazolam groups . mild headache ( 4 patients ) , nausea ( 3 ) , paradoxical rage ( 1 ) , and transient delirium ( 1 ) were noted but spontaneously disappeared without treatment . all changes in blood pressure and pulse rate were below 20 % of baseline values , and no patients were treated owing to changes in vital signs . the differences in the mmse score were not statistically significant ( p 0.05 ) ( table 4 ) . transrectal ultrasound - guided prostate biopsy is generally performed on an outpatient basis given its low complication rates and minimal to no need for anesthesia . however , a considerable degree of patient discomfort has been reported in the literature . pain during prostate biopsy and the anticipating anxiety regarding the procedure may cause unfavorable results or may influence a patient 's decision to undergo a repeat biopsy . although the application of local anesthesia is somewhat effective , pain may not be optimally relieved during prostate biopsy in some patients . given the general consensus regarding the need for some form of anesthesia , establishment of standard methods during transrectal ultrasound - guided prostate biopsy has been prompted . the major advantages of midazolam over diazepam include a shorter duration of action , profound anterograde amnesia , and better local tolerance , such as less burning on injection and lack of postoperative phlebitis . midazolam has a high affinity for the benzodiazepine receptor in the central nervous system , with in vitro data demonstrating that it has approximately twice the affinity of diazepam . the amino acid neurotransmitter gamma - aminobutyric acid ( gaba ) must be present for the benzodiazepine to elicit a response and for benzodiazepines enhance the inhibitory action of gaba . the actions of benzodiazepines do not involve the synthesis , release , or altered metabolism of gaba , but rather potentiate the inhibitory actions of gaba by augmenting the flow of chloride ions through ion channels . the increased flux of chloride ions into the cell decreases the ability of the cell to initiate an action potential . previous studies have found that anterograde , but not retrograde , amnesia can be demonstrated with midazolam [ 17 - 19 ] . this may be useful in preventing the explicit recall of perioperative events . because the onset of and the recovery from sedation is rapid and the risk of respiratory and cardiovascular depression is less for midazolam in comparison with the other agents used for sedation , it is the preferred agent for intervention procedures . in addition , it can safely be used in patients suffering from coronary artery disease or hypertension . in this study , the patients who received midazolam had both significantly less pain than did the ketorolac group and more satisfied pain control . also , 32 patients ( 60.3 % ) in the midazolam group were willing to undergo a future biopsy if required . the mean pain score in group 1 , which received ketorolac , was 6.7 , which is within the range of moderate to severe discomfort . the mean score of 2.7 calculated for group 2 was within the range of a mild degree of discomfort . prostate biopsy has now become common with the increased use of psa , and more biopsy cores are taken to increase the cancer detection rate . it has been reported that rectal administration of lidocaine has no impact on the tolerance of prostatic biopsy . although a periprostatic nerve block has been widely reported to be highly efficient , it is worthy to note that no significant difference or only borderline improvement in pain scores was detected in several recent studies , which suggests that pain relief with periprostatic nerve block is not as effective as previously suggested . irani and colleagues also reported that there was ineffective pain control , with 19 % not agreeing to undergo prostate re - biopsy without some form of anesthesia . there is no doubt that it is of great importance to establish a method of anesthesia that would improve patient tolerance to the procedure . in turn , improved pain control will likely increase patient agreement for re - biopsy when needed for cancer detection . the administration of midazolam and the routine non - invasive monitoring was performed by an anesthesiologist in several studies . in our study , blood pressure and pulse rate did not change significantly during the procedure and no patients had respiratory depression or hypotension . based on our experience , it is not necessary to have monitoring performed by an anesthesiologist . however , monitoring should be performed by an appropriately trained nurse or physician . the use of midazolam anesthesia may increase the procedure costs associated with a prostate biopsy . in the present study , the total cost per procedure was higher ( $ 5.14 ) for the midazolam anesthesia group , but the majority of the cost was covered by korean health insurance . the additional cost for midazolam - induced anesthesia under health insurance coverage is shown in table 5 . overall , 40 patients had a baseline mmse score of 25 ( normal ) , 13 had an mmse score of 21 - 24 ( mild ) , and no patients had an mmse score of 20 ( moderate to severe ) . after prostate biopsy , an mmse score of 25 was found in 39 patients , an mmse score of 21 - 24 was found in 14 patients , and an mmse score of 20 was not found ( fig . the difference in the mmse score was not significant after the midazolam anesthesia and there was no cognitive change to moderate or severe ( score below 20 ) . side effects of midazolam administration have been seen in some patients . however , no patients in this study had to be treated for side effects after midazolam anesthesia . our study indicates that midazolam anesthesia during prostate biopsy is well tolerated and is associated with no or minimal discomfort . the use of midazolam is a very simple technique that provides adequate analgesia during transrectal ultrasound - guided prostate biopsy . in addition , patient satisfaction is improved during conventional transrectal ultrasound - guided prostate biopsy . the use of midazolam is non - invasive and free of any local complications or systemic side effects . midazolam - induced anesthetic transrectal ultrasound - guided prostate biopsy is a safe and useful method .\noutput:\n" }, { "from": "agent", "value": "purposealthough transrectal ultrasound - guided prostate biopsy is useful for diagnosing prostate cancer , it is a painful procedure . there are many methods for providing pain relief and for treating discomfort during the procedure , but occasionally these are reported to be of limited use . we aimed to evaluate the value and safety of midazolam - induced anesthetic transrectal ultrasound - guided prostate biopsy.materials and methodsfrom august 2008 to december 2009 , 104 male patients , who were examined with transrectal ultrasound - guided prostate 12 - core biopsy , were randomly assigned to two groups . group 1 ( n = 51 ) received ketorolac ( tarasyn ) 30 mg . group 2 ( n = 53 ) was treated with midazolam ( dormicum ) 3 mg , which was increased to 5 mg if necessary . immediately after the procedure , the patients were asked to rate their comfort level by using a 10 - point visual analog self - assessment pain scale.resultsthe pain scale in group 2 was significantly lower than that in group 1 ( p < 0.05 ) . the patients assigned to group 2 experienced no side - effects from midazolam and were more satisfied than the patients in group 1 ( p < 0.05 ) . conclusionsmidazolam anesthesia relieves pain effectively , and the patient 's satisfaction is better than with conventional transrectal ultrasound - guided prostate biopsy . midazolam - induced anesthetic transrectal ultrasound - guided prostate biopsy is useful and safe ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: robot - assisted laparoscopic radical prostatectomy ( ralrp ) combines the advantages of minimal invasive surgery and quicker learning compared with conventional laparoscopic radical prostatectomy . as more patients seek ralrp , more anatomic variants will be encountered by surgeons performing this procedure . successful open radical retropubic prostatectomy has been described in patients with abnormalities of wolffian duct derivatives , including ectopic ureteral insertion into the seminal vesicle . we describe successful performance of ralrp on a patient with localized prostate cancer and complete left ureteral duplication with ectopic insertion into the prostatic urethra . a 52 - year - old man presented with psa of 5.1 ng ml and was found to have gleason 3 + 3 adenocarcinoma of the prostate with clinical stage t1c . his baseline creatinine was 0.9 mg dl ; no prior urological history or childhood illness existed . the right ureteral orifice was in the orthotopic position and the left ureteral orifice was not initially seen . closer inspection revealed a ureteral orifice on the left , draining into the prostatic urethra with urine effluxing from this position . a double pigtail ureteral stent was then placed with the flexible cystoscope . to completely excise the prostate , we proceeded with a transperitoneal approach to ralrp using the four - armed da vinci surgical system ( intuitive surgical , sunnyvale , ca , usa ) , with six trocars , as previously reported . before releasing the bladder from the anterior abdominal wall we elected to identify the left ureter by incising the peritoneum anterior to the common iliac artery . we localized the ureter with our stent seen within ; an additional second ureter running parallel was appreciated , thus confirming ureteral duplication . both ureters were traced down to the posterior detrusor using robotic instruments while leaving adequate surrounding adventitia . we proceeded with radical prostatectomy , including bladder mobilization from the abdominal wall , followed by incision of endopelvic fascia and ligation of the dorsal venous complex . the anterior portion of the prostatovesicular junction was incised , exposing the urothelial surface and trigone . the previously placed stent was emanating from the ectopic insertion in the prostatic urethra ( fig . 1 ) . given the finding of the second ureter , we closely observed for a second left ureteral orifice and this was appreciated very close to the bladder neck within the confines of the bladder . the patient therefore had complete left ureteral duplication with ectopic insertion of one ureter within the prostatic urethra .1 incision of posterior prostatovesicular junction ( single arrow - head ) with prostate above and bladder neck below . note the foley catheter ( double arrow - head ) providing upward traction and the ureteral stent ( arrow ) located in the ectopic ureter inserting into the prostatic urethra incision of posterior prostatovesicular junction ( single arrow - head ) with prostate above and bladder neck below . note the foley catheter ( double arrow - head ) providing upward traction and the ureteral stent ( arrow ) located in the ectopic ureter inserting into the prostatic urethra the posterior portion of the prostatovesicular junction was then incised . in performing this maneuver , we purposefully transected the left distal ectopic ureter as it entered the prostate . the dome of the bladder was lifted up with forceps using the fourth robotic arm . both left ureters were traced down along the posterior detrusor muscle to maximize ureteral length . the duplicated ureters were then transected by use of the robotic curved scissors at the level of the bladder hiatus where the lower pole moiety ureter entered the bladder . this defect in the posterior bladder was closed with running 2 - 0 vicryl in two layers . the remainder of the prostatectomy was completed including dissection of both vas deferens and seminal vesicles , incision of denonvilliers fascia , and control of the vascular pedicles with preservation of the bilateral neurovascular bundles . the urethrovesical anastomosis was completed using our modified running suture technique , which utilizes a single lapra - ty to secure approximation of the posterior plate . the ectopic ureter was previously stented and the second left ureter was cannulated with a 0.38 glidewire inserted through the assistant sa stay suture of 3 - 0 vicryl was placed in the lateral and medial adventitia surrounding the duplicated ureters . next , each ureter was spatulated by incising a short segment of their adjoining walls . a y - type conjoined ureteral anastomosis was then configured by bringing the respective posterior walls together using interrupted 5 - 0 pds followed by suturing the respective anterior walls together in the same fashion ( fig . a double pigtail ureteral stent was exchanged for the ureteral catheter leaving two stents emanating , one from each left ureter . after spatulation , an anterior and a posterior suture line provide for a common opening for both left ureters before ureteroneocystotomy y - type conjoined ureteral anastomosis for duplicated ureters . after spatulation , an anterior and a posterior suture line provide for a common opening for both left ureters before ureteroneocystotomy the bladder was filled with saline and a cystotomy was made in the left posterior bladder . this procedure was successfully completed in approximately 420 min without open conversion and the estimated blood loss was 200 ml . the patient had the pelvic drain removed on pod # 3 and was discharged on pod # 4 . a cystogram performed on pod # 14 revealed left - sided reflux to both moieties but no extravasation . final pathology demonstrated a 26 g gland with organ confined gleason 3 + 3 adenocarcinoma and negative surgical margins . the incidence of partial and complete ureteral duplication , on the basis of autopsy studies , is 1 in 125 or 0.8 % . although 80 % of ectopic ureters are associated with duplication , many ectopic ureters in males are associated with a single system . the most common sites of termination of ectopic ureters in males are the posterior urethra ( 47 % ) and the seminal vesicles ( 33 % ) . ideal cases for applying robotic assistance in laparoscopy involve a reconstructive component in a relatively confined working space . robot - assisted procedures are well described in the urological literature and include radical prostatectomy , radical cystoprostatectomy dismembered pyeloplasty , and vaso - vasostomy . the authors describe incidental right distal ureteral transection at the level of the seminal vesical , which was identified intraoperatively with indigo carmine . a stent was placed , the distal ureter was spatulated , and ureteroneocystotomy was performed . our case is similar but more complex , because of complete ureteral duplication and the elective nature of proceeding despite a potentially troublesome anatomic variant . we performed three reconstructive maneuvers during one case including vesicourethral anastomosis , a y - type conjoined ureteral anastomosis , and ureteroneocystotomy . although this complex procedure could have been performed with conventional laparoscopic techniques , we feel robotic assistance was extremely useful in saving time and minimizing operator fatigue . the reconstructive technique used for this duplicated system was a wallace anastomotic variant in which both ureters were brought together in a y - typed conjoined anastomosis before ureteroneocystotomy . this is a known refluxing type anastomosis classically described as a ureteral - intestinal anastomotic technique used during cystectomy and creation of urinary diversion . advantages of this technique include low occurrence of stricture and the ability to keep duplicated ureters together in a common sheath to be mobilized as a unit without risk of compromising a shared blood supply . the theoretical disadvantage is that obstruction of one ureter may lend to obstruction of the other , which is in immediately close proximity . accordingly , the wallace technique is not recommended during radical cystectomy when great concern for ureteral recurrence exists . other options for reconstruction were considered , for example ureteroureterostomy with the upper pole ureter joining the lower pole ureter proximal to the bladder hiatus . this course of action would have been difficult in this case given the extreme close proximity of the lower pole ureteral orifice to the bladder neck . consideration was also given to separately implanting each ureter into the bladder at separate locations . we felt this option was suboptimum because of theoretical concern for a shared blood supply between the duplicated ureters which if compromised could lead to stricture formation . this case demonstrates the possible utility of preoperative flexible cystoscopy in prostatectomy patients . at our institution flexible cystoscopy is routinely performed either in the office or in the operating room immediately before prostatectomy . this is not a practice uniformly accepted by all who perform radical prostatectomy but we agree with others who advocate performing flexible cystoscopy that it provides information about bladder pathology , preexisting urethral abnormalities , and the location and status of the ureteral orifices . in our teaching institution , we have also found that excision of the prostatovesicular junction is a relatively challenging step in teaching and learning this procedure and that immediate cystoscopy facilitates the learning process . in conclusion , ureteral anomalies , although uncommonly encountered , are detectable and do not preclude safe and effective performance of ralrp without the need for open conversion . in this case , robotic assistance enabled timely performance of three laparoscopic reconstructive maneuvers in one setting and improved surgeon ergonomics compared with conventional laparoscopic prostatectomy .\noutput:\n" }, { "from": "agent", "value": "robotically assisted laparoscopic radical prostatectomy ( ralrp ) has become an alternative surgical treatment option for patients with localized prostate cancer . rare anatomic variations result in modification of established techniques . we describe the first successful completion of ralrp for localized prostate cancer in a patient with coexisting complete left ureteral duplication and ectopic insertion of the upper pole moiety ureter into the prostatic urethra . after standard radical prostate excision and vesicourethral anastomosis , the unique anatomy in this case required additional reconstructive maneuvers including construction of a y - type conjoined ureteral anastomosis and ureteroneocystotomy . the procedure was safely completed without open conversion . operative time was 420 min and ebl was 200 ml . ureteral stents were removed in six weeks and ivp showed no evidence of obstruction . when faced with a ureteral anomaly , ralrp can be safely completed . robotic technology is helpful in performing additional delicate reconstructive maneuvers ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: hypoglycemia is the rate limiting complication in the achievement of strict glycemic control in diabetes management . significant episodes of hypoglycemia and its attendant counter - regulatory hormonal response lead to poor glycemic control . large trials ( action to control cardiovascular risk in diabetes , veterans affairs diabetes trial ) have shown that there were was a higher mortality in the group that had hypoglycemia ( intensively treated arm ) . hence , the american diabetes association ( ada ) guidelines emphasize on individualizing targets and reducing risk of hypoglycemia in patients with long duration of diabetes and comorbidities . thus , it is very important that the subjects are able to recognize and identify the symptom onset at an early stage in order to manage the episode effectively and take steps to prevent the recurrence . in a survey conducted by the american association of clinical endocrinology among 2530 type 2 diabetic patients in america , it was revealed that though more than half of the study population experienced hypoglycemic episodes in the past , many patients were unaware of the precipitating factors or causes of such episodes . there was definitely a knowledge gap which needed to be addressed . in a study done in erode district in the state of tamil nadu in india , that blood sugar levels can drop below normal while on drugsthe knowledge and awareness about the varied presentations of hypoglycemia and the possible preventive strategies for the same would go a long way in type 2 diabetes management . we proposed to study the knowledge about hypoglycemia among type 2 diabetes patients attending a large diabetes clinic in a teaching hospital from chennai . this study was done among type 2 diabetes mellitus patients attending the diabetes clinic of the endocrinology department in a medical college in south india . sample size calculation was done based on the study from erode wherein 40 % of the diabetic patients had knowledge about hypoglycemia . for 95 % confidence level and 5 % precision , the sample sizethe average outpatient ( op ) attendance of type 2 diabetic patients in the op department ( opd ) of endocrinology department is 6080 . patients were interviewed only once during the 4 months even if they came for follow - up visits regularly . patients with a diagnosis of type 2 diabetes mellitus who were on treatment with either oral hypoglycemic agents or insulin were included . patients with type 1 diabetes mellitus , pregnant women with gestational diabetes mellitus , diabetes secondary to other systemic diseases were excluded from the study . after obtaining informed consent , a questionnaire was administered to the subjects by the investigator . the classification of subjects into different socioeconomic groups was based on prasad 's criteria of per capita income ( 2013 updated version ) . all the patients attending the opd are given free oral medications fortnightly , and therefore , all included patients were on oral hypoglycemic agents ( ohas ) with or without insulin . therefore , the patients are classified as those who are taking only ohas ( mainly sulfonylureas [ glipizide ] and biguanides [ metformin ] ) and those taking insulin along with ohas . the target levels for fasting and postprandial blood glucose were asked in an open - ended question , and the correct response was adopted from ada guidelines 2014 . the knowledge of the diabetic patients on the symptoms of hypoglycemia ( both neurogenic and neuroglycopenic ) , the precipitating factors of such attacks , the immediate remedial measures which need to be adopted by them , the complications and how to prevent further episodes were asked to them . for each of the above question , multiple responses were given , and the patients were asked to give a yes or no response . finally , proportions were calculated for the right responses and are given under the results section . if the diabetic patients had the knowledge of at least three symptoms together with at least one precipitating factor and at least one remedial measure , they were considered as having good knowledge on hypoglycemia . patients with a diagnosis of type 2 diabetes mellitus who were on treatment with either oral hypoglycemic agents or insulin were included . patients with type 1 diabetes mellitus , pregnant women with gestational diabetes mellitus , diabetes secondary to other systemic diseases were excluded from the study . after obtaining informed consent , a questionnaire was administered to the subjects by the investigator . the classification of subjects into different socioeconomic groups was based on prasad 's criteria of per capita income ( 2013 updated version ) . all the patients attending the opd are given free oral medications fortnightly , and therefore , all included patients were on oral hypoglycemic agents ( ohas ) with or without insulin . therefore , the patients are classified as those who are taking only ohas ( mainly sulfonylureas [ glipizide ] and biguanides [ metformin ] ) and those taking insulin along with ohas . the target levels for fasting and postprandial blood glucose were asked in an open - ended question , and the correct response was adopted from ada guidelines 2014 . the knowledge of the diabetic patients on the symptoms of hypoglycemia ( both neurogenic and neuroglycopenic ) , the precipitating factors of such attacks , the immediate remedial measures which need to be adopted by them , the complications and how to prevent further episodes were asked to them . for each of the above question , multiple responses were given , and the patients were asked to give a yes or no response . finally , proportions were calculated for the right responses and are given under the results section . if the diabetic patients had the knowledge of at least three symptoms together with at least one precipitating factor and at least one remedial measure , they were considered as having good knowledge on hypoglycemia . the mean age ( standard deviation [ sd ] ) of the study participants was 59.6 ( 9.7 ) years and the age ranged from 29 to 85 years . majority of the patients ( 81 % ) were more than 50 years of age and were belonging to iii to v socioeconomic class ( 80 % ) . the mean ( sd ) duration of diabetes was 10.9 ( 5.9 ) years with a duration ranging from 6 months to 40 years [ table 1 ] . background characteristics of type 2 dm patients ( original ) the target fasting ( 70130 mg / dl ) and postprandial ( 100180 mg / dl ) blood glucose levels while on treatment was known to 135 ( 36.9 % ) and 126 ( 34.4 % ) patients , respectively . the knowledge of the blood glucose level at which one starts having symptoms of hypoglycemia ( 70 mg / dl ) was 11.2 % . the common symptoms of hypoglycemia known to the study subjects were dizziness ( feeling gare in local language ) ( 81.4 % ) , weakness ( 73.8 % ) , and drowsiness ( 72.1 % ) . it may be seen from table 2 that a lesser proportion of patients had knowledge on the neuroglycopenic symptoms of hypoglycemia . headache ( 19.7 % ) and seizures ( 2.7 % ) as symptoms were known to less number of patients only [ table 2 ] . three or more symptoms were known to 303 ( 82.8 % ) patients and 38 ( 10.4 % ) patients were not known even one symptom of hypoglycemia . knowledge of symptoms of hypoglycemia among type 2 dm patients ( original ) more than two - thirds ( 68.6 % ) of the patients knew that hypoglycemia may be precipitated by missing or delaying of meals . exertion as a precipitating factor was known to 35.2 % of patients [ table 3 ] . at least one precipitating factor was known to 285 ( 77.9 % ) patients and remedial measure , anyone , to be taken during an episode was known to 329 ( 89.9 % ) of patients . half of the patients ( 49.7 % ) did not know even one complication of hypoglycemia . knowledge of precipitating factors of hypoglycemia and its remedial and preventive measures among type 2 dm patients * ( original ) around 80 % of the patients knew that they must consume some sweets or chocolates or biscuits during an episode of hypoglycemia ( whenever they feel gare or drowsy ) . many of them ( 61.5 % ) answered that they must drink coffee or tea or some juice during an episode . eating foodwhich is either missed or delayed as a measure to be taken during an episode of hypoglycemia was known to 40 % of the study population . upon questioning their knowledge on prevention of further attacks , most of the patients ( 92 % ) mentioned taking timely meals as a measure and 87 % , to take medications as per prescriptions of the doctor . only a fifth of the patients were aware of self - monitoring of blood glucose ( smbg ) by glucometers as a means to prevent further attacks as this will help them to identify hypoglycemia at an early stage , correlate with symptoms and take preventive measures [ table 3 ] . thus , overall 242 ( 66.1 % ) diabetic patients had knowledge of at least three symptoms of hypoglycemia together with at least one precipitating factor and at least one remedial measure and therefore were considered to have good knowledge on hypoglycemia . the association of the knowledge of hypoglycemia with certain important background characteristics is shown in table 4 . as seen from the table , age is an important determinant of the knowledge and as age increases , the knowledge decreases ( p 0.05 ) , and this difference is statistically significant . literacy of a person has a statistically significant association with the knowledge of a patient on low blood sugars ( p 0.05 ) . a patient from class v socioeconomic status has a very low knowledge compared to those from class i to iv socioeconomic status and as socioeconomic status improves the knowledge on hypoglycemia also increases ( p 0.01 ) . association of good knowledge on hypoglycemia of type 2 dm patients with certain background variables ( original ) the duration of the disease ( diabetes mellitus ) had no association with the knowledge , but the type of treatment did have . those patients who took insulin along with ohaswere better informed about hypoglycemia , the cut - offs , the symptoms , measures to prevent , etc . more than 50 % of the patients attributed their knowledge of hypoglycemia to the doctor who treated them . a little lesser proportion ( 42.6 % ) attributed their knowledge to their friends and relatives . a quarter learnt about hypoglycemia from the fellow patients who get treatment from the op clinic [ figure 1 ] . this study done among 366 type 2 diabetic patients in the out - patient clinic of endocrinology department of a teaching hospital shows that two - thirds of the patients had good knowledge on hypoglycemia . higher age , illiteracy , and low socioeconomic status were associated with poor knowledge whereas treatment with insulin along with ohas was associated with good knowledge on hypoglycemia . the knowledge on the target fasting and postprandial blood glucose levels among the diabetic patients was low ( 39 % and 34 % , respectively ) . this was low compared to the study done in cmc , ludhiana ( 60 % ) . the knowledge on blood glucose level at which one starts having symptoms of hypoglycemia was very low ( 11.2 % ) . with respect to the knowledge on symptoms of hypoglycemia , dizziness , weakness , and drowsiness were the ones known to most patients and headache and seizures , the least . hypoglycemia may manifest with any symptom , and common symptoms may not always be the first to appear . therefore , the patients must be aware of every symptom in order to recognize early and take immediate corrective measures . missing meals as a precipitating factor was known to two - thirds of the patients and exertion to a third of the patients only . it is very important that the patients are well aware of the precipitating factors / causes so that they may take appropriate precautions such as taking toffees or packed food before planning to travel or exercise . only a third of the patients had knowledge on the complications , and knew that they have to report such episodes to the doctor . awareness about the complications would induce the patients to take this condition seriously and report any such episodes to the physician immediately . even though 85 % of the study population are diabetic for more than 5 years , smbg as a way to prevent future episodes was known to a fifth of the patients only . it is well - known that smbg aids in better glycemic control and prevention of hypoglycemia in type 2 diabetes patients by allowing for adjustments in diet , physical activity , and pharmacotherapy in response to test results . in this study , this might have been because of age - related cognitive decline insisting the importance of periodical educational programs to reinforce their knowledge . this study emphasizes the role of health care workers - doctors , nurses , diabetes educators , lab technicians in providing health education to the patients during every visit . they must educate on target levels , importance of smbg , symptoms of hypoglycemia , the ways of preventing it and immediate remedial measures to be adopted during every visit . furthermore , periodical educational reinforcement programs need to be conducted for all diabetic patients which must include topics on hypoglycemia . this is one of the few studies in india to study exclusively about the knowledge on hypoglycemia in detail among the type 2 diabetic patients . in india , which has the second largest number of diabetes patients , the limitation of the study is that the knowledge is assessed among patients attending a diabetes free clinic in a medical college hospital and may not be accurately representing that in a community comprising both affordable and poor patients . although the knowledge on the symptoms , remedial measures , and prevention of hypoglycemic episodes was good among the type 2 diabetic patients in the study , there were gap in knowledge on important aspects like precipitating factors , target levels etc . , which need to be addressed by health care workers through regular educational programs\noutput:\n" }, { "from": "agent", "value": "introduction : hypoglycemia being the rate limiting complication in the attainment of strict glycemic control in diabetes management , in this study , we intended to study the knowledge of its symptoms , target blood levels during treatment and ways of prevention among type 2 diabetes patients attending outpatient department ( opd ) of a medical college hospital.materials and methods : every fifth patient attending the opd during the 4 months between march and june 2013 was interviewed using a questionnaire.results : the study included 366 type 2 diabetic patients , of which 76.5 % were females . the target fasting and postprandial blood glucose levels while on treatment was known to 135 ( 36.9 % ) and 126 ( 34.4 % ) patients , respectively . the common symptoms of hypoglycemia known to the study subjects were dizziness ( 81.4 % ) , weakness ( 73.8 % ) , and drowsiness ( 72.1 % ) . overall , 242 ( 66.1 % ) diabetic patients had good knowledge on hypoglycemia ( knowledge of at least three symptoms of hypoglycemia together with at least one precipitating factor and at least one remedial measure ) . higher age , illiteracy , low socioeconomic status were associated with poor knowledge whereas treatment with insulin along with oral hypoglycemic agents was associated with good knowledge on hypoglycemia . sex and duration of disease were not associated with knowledge on hypoglycemia.conclusion : although the knowledge on symptoms of hypoglycemia , precipitating factors , remedial measures are high in this study , the target blood levels , complications were known to just a third of them . there is a knowledge gap on important aspects of hypoglycemia among type 2 diabetic patients ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: recognition of antigen as mhc peptide ( mhcp ) complexes by the t cell receptor ( tcr ) is the first stage of t cell activation , and therefore critical to all adaptive immune responses to pathogens and cancers , as well as to autoimmunity . the binding of tcr to mhcp initiates a protein kinase signaling cascade that branches out as it proceeds , to encompass various signaling pathways leading to changes in cell shape , adhesion , and motility , as well as to changes in gene transcription . there are several models for how tcr interaction with mhcp can lead to initial triggering of the signaling cascade . these have been comprehensively reviewed ( germain , 2001 ; krogsgaard and davis , 2005 ; van der merwe and dushek , 2011 ) , so will only be briefly mentioned here . they fall into several groups , aggregation , conformation / architectural changes , and separation models . evidence from studies of t cells activated by apc or by soluble mhcp indicate that some kind of crosslinking or aggregation of two or more tcrs is required ( boniface et al . , 1998 ; cochran et al . tcrs are grouped into microclusters during antigen recognition ( yokosuka et al . , 2005 ; varma et al . , 2006 ) , and there is also some evidence for pre - formed aggregations of tcrs existing on the cell surface ( schamel et al . clustering of the tcrs by antigen recognition aided by weak interactions with endogenous mhcp and the recruitment of co - receptor - bound lck to the site of recognition would then start the signaling cascade ( krogsgaard and davis , 2005 ; gascoigne , 2008 ) . conformational changes have been proposed as a mechanism for signal transduction , but apart from movement in the cdrs during binding to mhcp , conformation change upon antigen binding has only been found as a movement of part of the c domain , in a region predicted to interact with cd3 ( kjer - nielsen et al . , 2003 ; beddoe et al . , conformation changes in intracellular domains of cd3 seem to be involved in allowing signaling adaptor proteins to interact with cd3 ( gil et al . , 2002 ) or for accessibility for immunoreceptor tyrosine - based activation motif ( itam ) phosphorylation ( xu et al . , 2008 ) . a conformational / architectural model has received strong recent support whereby mechanical pulling by the tcrmhcp interaction puts torque on the cd3 subunits , leading to signal transduction ( kim et al . , 2009 ; , the interaction between short molecules like tcr and mhc at the immunological synapse requires that larger molecules such as cell adhesion molecules and the phosphatase cd45 are pushed out to the periphery . removal of negative regulators of signaling could thus aid phosphorylation steps at the center of the synapse ( davis and van der merwe , 2006 ) . these different classes of model are not necessarily mutually exclusive , and indeed elements of each class seem to operate in t cell activation ( van der merwe and dushek , 2011 ) . the very first stage of the tcr signaling cascade after tcr mhcp binding is the phosphorylation of the cd3 subunits of the tcr . complex consists of the tcr and chains that recognize mhcp , and the cd3 , , and dimers that form the signal transduction modules of the tcr . all of these subunits are cell surface transmembrane proteins and all have at least one itam in their cytoplasmic domain . cd3 , , and each have one itam , while cd3 has three . at the start of the signaling cascade , the cd3 itams are phosphorylated , and are then bound by another kinase called zap70 . each itam has dual tyrosines so that when they are both phosphorylated , they form a high affinity binding site for the dual sh2 domains of zap70 . after zap70 binds to cd3 , the co - receptors cd4 or cd8 , which are associated with the src - family kinase lck , become associated with the tcr cd3 complex and bind to mhc . mhcp interaction , and lck continues the phosphorylation of cd3 elements , zap70 and the many other downstream targets . a recent biophysical study on tcr and cd8 binding to mhcp demonstrated that the initial binding of tcr to mhcp induces , in a src - family kinase - dependent manner , the binding of cd8 to the mhcp ( jiang et al . , 2011 ) . this illustrates two related and important problems in understanding t cell activation that have never been fully resolved . firstly , how is the first cd3 phosphorylation step accomplished , and by which src - family kinase ( s ) ? secondly , if the co - receptor is brought to the activated tcr before the co - receptor binds to mhc , but after tcr signaling has started , how is this initial recruitment to the tcr accomplished ? rather little is known about these earliest steps in t cell activation . lck is a major target for drug discovery , as small molecule inhibitors could be used as immunosuppressives , for example in autoimmunity , rheumatoid arthritis , or asthma . current inhibitors are not very selective , also inhibiting other src - family kinases or other kinases ( martin and machacek , 2010 ) . it is therefore important to understand exactly how src - family kinases work in t cell activation . it was shown in the early 1990s that stimulation of the tcr enhances the binding of cd8 to mhc class i ( mhci ) , and that this increase in binding requires tyrosine kinase activity ( orourke et al . , 1990 ; orourke and mescher , 1992 ) . recently , a cell - based adhesion frequency assay was developed that enables investigation of molecular interactions at the cell surface with very fast time resolution ( huang et al . this method is based on touching a t cell to a red blood cell coated with appropriate mhcp ligands , then retracting it , and measuring whether or not the red blood cell membrane is distorted . this process is repeated multiple times with the interaction allowed to continue for certain fixed periods . for each of these interaction times , an adhesion frequency is calculated . this method showed clearly that tcr and cd8 interactions with mhcp are biphasic ( jiang et al . , 2011 ) . the first phase the initial tcr interaction with ligand starts within the first 0.25 s after the cell surfaces make contact ( figure 1 ) . after about 1 s of contact , a second , stronger , binding phase occurs . initiation of the second phase requires a src - family tyrosine kinase , as it does not occur when the inhibitor pp2 is present . the first phase is co - receptor - independent but the second phase is co - receptor dependent , as the second phase is blocked by anti - cd8 antibodies and does not occur when the cd8 binding site of mhci is non - functional . this is followed by a second phase of tcr - induced cd8 binding ( jiang et al . , 2011 ) . mhcp interaction , but like that , it has single - stage kinetics and reaches a plateau at about 1 s ( huang et al . , 2007 ) . this cd8mhci interaction is sufficient to concentrate cd8 at the interface between a t cell and an antigen - presenting cell ( yachi et al . , 2005 , 2006 ; gascoigne et al . , 2010 ) . a model for initiation of tcr cd3 phosphorylation , and the recruitment of the co - receptor . lck and / or fyn are associated with the plasma membrane , and lck also exists associated with cd8 . upon tcr binding to mhcp ( b ) the fyn and / or non - cd8cd3 complex , and phosphorylates cd3 itams and then zap70 which binds to the phosphorylated cd3 itams . ( c ) the sh2 domain of cd8 bound lck then interacts with the phospho - zap70 , pulling cd8 into proximity with the mhcp - interacting tcr . ( d ) the extracellular immunoglobulin domains then bind to the mhcp , stabilizing the tcrthis two - step activation ( jiang et al . , 2011 ) does not fit with the classical model of tcr triggering , where the co - receptor binding to mhcp is required for lck to phosphorylate cd3 itams . it is compatible with aggregation models such as the pseudodimer or co - receptor pre - concentration models , where the co - receptor s extracellular domains bind to non - cognate mhcp but the co - receptor - bound lck interacts with the antigen binding tcr / cd3 within the cell ( krogsgaard et al . it is also consistent with those models requiring a conformation / architectural change due to antigen binding , providing that the initial phosphorylation of cd3 recruits the co - receptor through the interaction of lck with phospho - itams . several lines of evidence indicate that the initial phosphorylation of cd3 itams and zap70 is caused by a src - family kinase ( lck and / or fyn ) that is not bound to cd4 or cd8 , yet the mechanism of this process that initiates the tcr signaling cascade is poorly defined ( acuto et al . , 2008 ) . it is clear that co - receptors are not absolutely required for tcr signaling as some t cells are independent of co - receptor , and the requirement for cd8 has been shown to be inversely related to the affinity of the tcr . tcrs with affinity above a certain threshold do not need co - receptor ( cho et al . another piece of evidence is that thymocyte development requires the presence of lck , but co - receptors are not absolutely required for thymocyte development ( schilham et al . , 1993 ; van laethem et al . , 2007in addition , the fact that cd8 does not bind mhc to stabilize tcr binding until after signaling has started argues this point strongly ( jiang et al . , 2011 ) . lck can be co - precipitated with tcr / cd3 in mild detergents ( schraven et al .2003 ) , but although lck can be co - capped with co - receptor ( after crosslinking by suitable antibody ) , it does not co - cap with tcr ( ehrlich et al . , 2002 ) . fyn can also be co - precipitated with the tcr in mild detergents ( samelson et al . thus there is evidence that both lck and fyn can associate in some way with tcr , but at very low stoichiometry . also , because these experiments used detergents that do not disrupt lipid rafts , it is possible that the interactions were artifacts due to the detergent lysis method causing interactions between normally separate lipid domains . fyn or lck individually can both perform the constitutive phosphorylation of tcr / cd3 required for maintenance of cell viability in vivo , but lck - deficient cells have stronger defects in most aspects of signaling than fyn - deficient cells . the signaling differences between t cells from fyn and lck knockout mice are summarized in table 1 . because of the block in positive selection in lckmice , data on lck - deficiency in mature t cells have come from a very elegant inducible transgenic system bred onto the lck ko background . this transgene is turned on to allow normal t cell development , then off so that lck expression is gradually lost . transgenic lck expression in mature t cells is , however , only about 1020 % of the normal amount ( seddon et al . , 2000 ; for the most part , the defects in fyn - deficient t cells were rather modest , but recent studies have shown that fyn may in fact be a negative regulator of tcr signaling . stimulation with antigen ( or with crosslinking anti - cd3 plus anti - cd8 ) gave stronger and faster responses in the absence of fyn ( filby et al . this is in contrast to earlier studies that showed that cells lacking fyn gave lower responses than normal to anti - cd3 stimulation ( as opposed to antigen or anti - tcr plus anti - co - receptor stimulation ; reviewed in palacios and weiss , 2004 ; salmond et al . data on mature t cells deficient in lck expression is from mouse with inducible lck expression , which can be turned off after development ( legname et al . most interestingly , in lck knockout mature t cells , fyn directs relatively strong erk activation , but reduced lat phosphorylation , while plc1 phosphorylation and ca signaling do not occur ( lovatt et al . , 2006 ; a direct interaction of grb2sos with cd3 has been suggested ( chau and madrenas , 1999 ; methi et al . , 2007 ) , which could perhaps provide such a pathway . however , t cell activation is very strongly dependent on the rasgrp pathway to activate ras and then erk , and it is unclear if sos has any crucial role ( dower et al . , 2000 ; priatel et al . , 2002 ) . it may also be important to consider that these studies in lck or fyn - deficient cell lines or knockout mice have not distinguished free lck from that bound to the co - receptor . resting t cells and thymocytes contain substantial quantities of both activated lck and fyn , and stimulation through tcr or co - receptor does not increase the proportion of the activated kinases ( nika et al . , 2010 ) . both lck and fynare targeted to the inner leaflet of the plasma membrane in lipid rafts through palmitoylation and myristoylation of their amino termini . this fatty acylation is required for fyn to interact with and phosphorylate cd3 itams ( vant hof and resh , 1999 ) . lipid - raft targeting by fatty acylation is also the case for lyn , a src - family kinase that is important in initiation of bcr signaling . a recent experiment showed that lyn interacts with the bcr after bcr crosslinking by binding to antigen , when ag - induced bcr microclusters interact with lipid rafts ( sohn et al . , 2008 ) . a similar mechanism is likely to apply for the initiation of tcr signaling by lck and / or fyn . yet another complexity comes from single - molecule studies of the movement of cell membrane - associated molecules . stimulation by very small clusters of anti - cd3 antibodies on a solid surface showed that a raft - targeted construct ( the amino terminal of lck with the fatty acylation sites ) or full - length lck both concentrated quickly at the stimulation site and were retained there ( ike et al . , 2003 ) . diffusion was slower closer to the site of stimulation , and faster away from these sites . directed movement of lck was not seen , indicating that lck was not brought to the signaling region by actin , but concentration at the stimulation site was blocked by drugs that either poisoned the cytoskeleton or dispersed lipid rafts . clustering of the actin filaments at the site of activation ( wulfing and davis , 1998 ) would slow diffusion away from the activation site , either because the actin mesh impedes free diffusion of the membrane - bound protein , or because of a picket fence of transmembrane proteins associated with the cytoskeleton . these phenomena would lead to corralling of lck ( and rafts ) at the activation site ( ike et al . , others have described a similar phenomenon of microdomains caused by proteins rather than lipids , where it was noted that cd45 was excluded from microdomains that contained lck ( douglass and vale , 2005 ) . this study also demonstrated that various t cell signaling proteins were able to move quickly from one microdomain to another . a protein such as annexin a6 , which binds negatively charged phospholipids , lipid rafts , and f - actin , could organize and bridge different kinds of microdomains and / or rafts around signaling receptors ( cornely et al . , 2011 ) . the data on biphasic tcr and cd8 interactions with mhcp show that in a very quick sequence , tcr binds mhcp , causing src - family kinase activity , then cd8 binds to the mhc and stabilizes the interaction between the three molecules ( jiang et al . , 2011 ) . if cd8 does not bind to mhcp until the second stage , then how is the co - receptor initially recruited to the tcr ? it has generally been assumed that this is accomplished by cd8 binding to mhc , but this does not fit with the new data . it has been suggested that cd8 is brought into the signaling complex passively , through an interaction of the lck molecule attached to cd8 with one of the phospho - tyrosines produced by the initial signal on cd3 , or to phospho - zap70 ( jiang et al . , 2011 ) . a study using a chimera between cd4 and lck demonstrated that the sh2 domain of lck was involved in cd4 co - receptor activity : a mutation stopping the lck sh2 from binding phosphotyrosine partially reduced co - receptor activity ( xu and littman , 1993 ) . this suggested that a protein protein interaction mediated by lck s sh2 domain is important for co - receptor function , and indeed it has since been shown that after tcr stimulation , the lck sh2 domain binds to phospho - zap70 bound to phospho - cd3 , and that this interaction causes the co - receptor to come into proximity with tcr ( thome et al . , 1995 , 1996 ) . as mentioned above , much of the lck in resting t cells is activated kinase , and this activity is not affected by tcr stimulation ( nika et al . , 2010 ) , but kinase activity is not required for the co - receptor function of cd4 ( collins and burakoff , 1993 ; xu and littman , 1993 ) . the cd4 co - receptor is bound to both active and inactive lck ( nika et al . , 2010 ) , indicating that there is no simple explanation . the proteincd8 exists as both an homodimer and as the heterodimer that is the main co - receptor for t cell activation . both forms are equivalent in their ability to bind to classical mhci , but cd8 binds much more strongly than cd8 to the non - classical mhci molecule h2 - tl ( cheroutre and lambolez , 2008 ) . cd8 is a much stronger co - receptor than cd8 , probably because of preferential localization of cd8 to lipid rafts where it is more likely to interact with lck . we tested the ability of the two forms expressed on the same cell to be recruited to the site of antigen recognition , and found that there was very little difference between them ( rybakin et al . , 2011 ) . if h2 - tl was present on the antigen - presenting cell , then the cd8 form was preferentially recruited , leading us to the conclusion that the ability of the cd8 isoforms to be recruited to the immunological synapse was not directly related to their co - receptor ability , but simply to the strength of their interaction with mhci . in previous studies from this lab , we used foerster resonance energy transfer ( fret ) microscopy in live cells to investigate the interaction of both cd4 and cd8 with tcr , using cd3cfp as fret donor and cd4yfp or cd8yfp as fret acceptors ( zal et al . , 2002 ; we showed that the co - receptors interact closely with the tcr only when tcr recognizes antigen , even though both cd4 and cd8 can be recruited to the immunological synapse without any requirement for antigen recognition . this was most striking for cd8 , which binds to non - antigenic mhci molecules and can be concentrated in the immunological synapse in proportion to the number of mhci proteins available ( yachi et al . , 2005 ; gascoigne et al . , 2010 ) . cd3 complex ( cd3cfp cd8yfp fret ) corresponded closely to strength of t cell activation by particular peptides , and that differences in fret kinetics during recognition of different mhcp ligands correlated closely to the ability of a particular ligand to induce positive or negative selection in thymocytes ( yachi et al . , 2006 ; mallaun et al . ,2008 ) . however , the kinetics of the close apposition of tcr and cd8 were slower than expected from other measures of t cell activation , as they developed over several minutes , peaking at about 10 min ( yachi et al . , 2005 , 2006 ) . early signaling events such as lat phosphorylation or calcium flux occur within a few seconds , although other events like cytoskeletal rearrangement for example , are on a longer timescale of a few minutes ( huse et al . , 2007 ) . in more recent higher - resolution experiments using a supported lipid bilayer system , we have been able to image tcrcd8 fret in small regions within the immunological synapse ( j. casas and nicholas r. j. gascoigne , unpublished ) . these were too localized to show a signal above the background when fret signals were averaged over the whole synapse , explaining why they were not noticed before . this leads us to believe that the strong fret signals measured previously in synapses with antigen - presenting cells that were on the timescale of minutes ( yachi et al . , 2005 , 2006 ) , represent the result of stabilization of tcr mhcp binding by the co - receptor the second phase of interaction identified in the cell cell adhesion experiments ( jiang et al . , 2011 ) , rather than the first . the tcr - chain connecting peptide motif ( - cpm ) is a highly conserved membrane - proximal extracellular sequence motif in the tcr - chain . it is important for the ability of cd8 to associate with tcr to enhance t cell responses ( naeher et al . , 2002 ; 2008 ) , and for t cell activation and positive selection ( werlen et al . , 2000 ) . mutation of the - cpm reduced the stable fret response between tcr and cd8 ( mallaun et al . the - cpm is believed to work by interacting with membrane - proximal regions of cd8 in aco - receptor zipper mechanism , enabling lck to completely phosphorylate the cd3 itams ( palmer and naeher , 2009 ) .2003 ) . the molecular basis of the interaction between the - cpm and cd8 is not clear , as it is unlikely that cd8 could approach closely enough to the - cpm to interact with it directly , due to the presence of the cd3 subunits . however , the transmembrane region of cd3 interacts with that of tcr ( call et al . , 2002 ) , and structural models place cd3 and tcr apposed to each other ( sun et al . , it has been suggested that movement within the tcr s - cpm could apply torque to cd3 in the architectural / conformational change model of tcr triggering described earlier ( kim et al . , 2010 ) . it will be interesting to find out how the - cpm mutation affects the two - stage tcr binding ( jiang et al . , 2011 ) . cd8 interaction after the initial tcr mhcp binding , so that mutation of the - cpm will inhibit the second phase of tcr mhcp binding without affecting the first phase . the molecular details of the apparent adaptor function of lck need to be more clearly worked out , and indeed , a similar function may exist in other src - family kinases . lck and fyn molecules have overlapping but distinct roles at the beginning of tcr signal transduction , but the mechanisms for their initial interaction with tcr to start the signaling cascade are still somewhat obscure . improvements in our ability to image tcr cd8 fret will allow us to investigate separately the early and later phases of the tcr cd8 interactions . the early phase likely corresponds to the passive recruitment of cd8 to tcr by the lck interacting with phospho - cd3 and / or phospho - zap70 , whereas the later and stronger phase of fret is likely the result of stabilization of tcr mhcp binding by the co - receptor . in this regard , it is worth noting that the two - stage binding model that shows co - receptor stabilization of the tcrindeed , modeling studies suggest that the major role of co - receptors , particularly cd4 , is simply to ferry lck toward the site of tcr activation ( artyomov et al . , 2010 ) . we are currently analyzing the different functions of cd8 and lck using mutational analyses and fret microscopy . the future application of super - resolution microscopy techniques such as palm and storm ( stochastic optical reconstruction microscopy ) will enable a nanometer - scale understanding of the molecular interactions in the early phases of t cell activation . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "recent data with cd8 + t cells show that the initial phase of t cell receptor ( tcr ) binding to mhc peptide ( mhcp ) is quickly followed by a second , stronger , binding phase representing the binding of cd8 to the mhcp . this second phase requires signaling by a src - family kinase such as lck . these data point out two aspects of the initial stage of tcr signaling that have not yet been clearly resolved . firstly , how and by which src - family kinase , is the initial phosphorylation of cd3 accomplished , given that the lck associated with the co - receptors ( cd4 or cd8 ) is not yet available . secondly , what is the mechanism by which the co - receptor is brought close to the bound tcr before the co - receptor binds to mhcp ?" } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: spinal fusion has evolved as a treatment modality for the management of spinal conditions that require stabilization , which include symptomatic degenerative disk disease , infection , scoliosis , traumatic injuries , and neoplasia .1 several techniques are available to achieve stabilization of the lumbar spine , which include the anterior lumbar interbody fusion ( alif ) , posterior lumbar interbody fusion ( plif ) , transforaminal lumbar interbody fusion ( tlif ) , direct lateral interbody fusion , posterolateral onlay ( intertransverse ) fusion , and facet screw or pedicle screw / rod placement .2 in addition , minimally invasive variations of these techniques have also been developed to minimize soft tissue dissection with the intention of minimizing intraoperative blood loss and complications as well as reducing postoperative pain and subsequent hospital stay .345678910 fusion of the affected segments is influenced by surgical technique including end plate preparation , by patient factors such as smoking and diabetes , and by the choice of bone graft , all of which are critical in influencing the degree and rate of fusion .11 if the fusion is incomplete , there is the risk of developing a painful pseudarthrosis of which there are four types : atrophic , transverse , shingle , and complex .12 the transverse type is the most common ,13 where there is a horizontal discontinuity despite remodeled bone . the source of pain is partly attributed to the sclerotic bone adjacent to fibrous soft tissue accompanied by microfractures of cancellous bone and motion of this segment .12 although difficult to diagnose , pseudarthrosis following lumbar fusion surgery is one of the most common complications ,14 and together with the chronic pain and disability that ensues ,131516 is a common indication for revision surgery .1718 despite its relatively high prevalence , there is a lack of robust clinical evidence on salvage options for lumbar pseudorthrosis .19 a prospective study was conducted to assess the radiographic and functional outcomes of alif as a salvage option for pseudarthrosis following posterior lumbar fusion surgery . institutional ethics board review approval was obtained from the south eastern sydney local health district , new south wales australia northern sector ( seslhd - ns ) ethics committee , ref : hrec 11/183 . from 2009 to 2013 , patient outcome data was collected prospectively over 5 years from 327 patients undergoing alif performed by a single surgeon ( r.j.m . ) with 478 levels performed . among these were 20 cases of failed prior posterior fusion that subsequently underwent alif and were retrospectively analyzed . inclusion criteria specified patients who were at least 9 months post posterior fusion with no evidence of infection or malignancy . symptomatic nonunion was diagnosed with a combination of the following : movement on flexion / extension x - rays at the previous operative level , halo around the pedicle screws on fine - cut computed tomography ( ct ) scan , no evidence of bone integration through or around the interbody implants , and uptake on bone scan consistent with nonunion . clinical parameters such as the visual analog score ( vas ) , oswestry disability index ( odi ) , and short form 12 - item health survey ( sf - 12 ) were measured pre - and postoperatively . the verification of fusion was determined by utilizing a fine - cut ct scan at 12 months postoperatively , performed and agreed on by an independent neuroradiologist and a senior spine surgeon ( r.j.m . ) . statistical analysis using student t test was used to analyze the clinical parameters from the outcome questionnaires . from the prospective database of alif procedures , 20 patients had previous failed posterior fusion ( either tlif or plif ) and thus met the inclusion criteria of the present study . the patient group had revision surgery on average 17.5 months ( range : 9 to 36 ) after the initial posterior fusion over a total of 27 lumbar spinal levels . there was an equal gender distribution with an average age of 56 years ( range : 32 to 81 ) with 5 ( 25 % ) smokers , 3 ( 15 % ) diabetics , and 4 ( 20 % ) patients receiving workers ' compensation ( table 1 ) . bone grafts included the following20 : 1 ( 5 % ) received autograft and 8 ( 40 % ) received ifactor ( cerapedics , inc . , denver , co , united states ) , 11 ( 55 % ) patients received allograft and infuse ( medtronic , memphis , tn , united states ) , and the remainder used allograft and recombinant human bone morphogenetic protein - 7 ( osteogenic protein 1 ; stryker , boston , ma , united states ; n = 2 , 10 % ) . abbreviations : alo , allograft ; aut , autograft ; dm , diabetes mellitus ; in , infuse ( medtronic , memphis , tn , united states ) ; n , no ; if , ifactor ( cerapedics , inc . , denver , co , united states ) , op1 , osteogenic protein 1 ( stryker , boston , ma , united states ) ; wc , worker 's compensation ; y , yes . there was a significant difference between the preoperative ( 7.250.8 ) and postoperative ( 3.12.1 ) vas scores ( p 0.0001 ) . the odi scale also demonstrated a statistically significant reduction from preoperative ( 56.316.5 ) and postoperative ( 30.419.3 ) scores ( p 0.0001 ) . likewise , the sf - 12 scores also demonstrated statistically significant improvement after alif surgery : physical health composite score ( 32.185.5 versus 41.079.67 , p = 0.0003 ) and mental health composite score ( 36.6212.25 versus 50.8910.86 , p = 0.0001 ) . the sf - 12 total score was significantly higher after alif fusion ( 68.7812.39 versus 93.2116.16 , p 0.0001 ) . preoperative versus postoperative visual analog score ( vas ) for back pain following anterior lumbar interbody fusion revision surgery . preoperative versus postoperative oswestry disability index ( odi ) scores following anterior lumbar interbody fusion revision surgery . preoperative versus postoperative short form 12 - item health survey ( sf - 12 ) scores following anterior lumbar interbody fusion revision surgery . significantly higher postoperative sf - 12 pcs scores and mcs scores were observed postoperatively compared to preoperative scores . overall , 19 patients ( 95 % ) achieved successful fusion , as verified by at least 12 - month follow - up with imaging . radiographic improvements in bony fusions were confirmed by x - ray and ct , as demonstrated in figs . sequence of events with nonunion . a 56 - year - old woman presented with nonunion following minimally invasive transforaminal lumbar interbody fusion ( tlif ) at l3l4 . intraoperative x - ray demonstrating removal of tlif cage and insertion of synfix ( synthes bettlach , bettlach , switzerland ) anterior lumbar interbody fusion ( alif ) . ( c ) solid union of the l3l4 motion segment can be seen at 12 months post - alif . ( c ) computed tomography scan 12 months postoperatively with solid union through all three levels . the aims of revision fusion surgery include correcting any technical errors , placement of superior graft material , maximizing end plate preparation , enhancing the biological environment for fusion , and improving biomechanical environment .151621 although the literature demonstrates that alif has been used to correct previously failed fusions , the overall number of cases for alif as an indication for pseudarthrosis is low . other approaches for revision surgery have been demonstrated to be costly and difficult to perform with varied and unpredictable outcomes .13 the indications for alif dictate its utility as a surgical option for the management of pseudarthrosis as the technique offers several advantages . first , the direct visualization and efficient access to the anterior column allows for an easier and complete diskectomy while offering better distraction to increase the neuroforaminal volume and to allow the placement of a large interbody fusion device .22232425262728293031 this technique achieves higher fusion rates ,262832 restores lumbar lordosis , and reduces anterior listhesis as well as coronal and sagittal balance ,222329 leading to reduced pain .2533 second , placement of the intervertebral fusion device and graft material in the anterior column redistributes the load anteriorly providing greater stability ,21 placing the graft in direct compression together with contact against a larger osseous end plate surface area with a larger vascular supply , thereby increasing the fusion potential .29 third , there is reduced intraoperative blood loss , reduced operating times ,222526 and reduced iatrogenic trauma to the paraspinal musculature , posterior spinal nerves , and posterior bony elements .262829 the authors therefore report on the utility of alif as a salvage procedure for painful established pseudarthrosis following posterior lumbar fusion . few studies have reported outcomes for revision or repair of the failed posterior lumbar fusion . in a study by wetzel and larocca ,349 of 12 patients developed pseudarthrosis from previous plif interventions . after additional procedures for repair of pseudarthrosis and repeat decompression , only 5 patients reported improved pain relief , and 7 patients were thought to have a solid fusion . no correlation was detected between solid fusion revision and relief of pain . in another study , highhouse et al retrospectively reviewed 6 patients with failed l4l5 plif interventions .35 after 38.5 months of follow - up after lateral intertransverse process fusions for salvage of the failed fusion , five of the six cases were still radiographically fused . another recent study suggested similar outcomes for anterior versus anteroposterior approaches for salvage of pseudarthrosis following tlif20 ; however , it is not clear whether these salvage procedures have directly improved radiographic and functional outcomes of these patients compared with presalvage . strengths of the present study include being one of the few studies investigating alif as a salvage option for pseudarthrosis . its sample size is relatively larger than prior case series , and its prospective design allows a better comparison between preoperative and postoperative vas back pain , odi , and sf - 12 scores . first , the small sample size may not provide adequate statistical power to detect complication rates . in this study , only 2 of 20 ( 10 % ) patients reported complications , which is considerably lower than the 40 % complication rate ( 12 of 30 patients ) in a previous study using posterolateral revision fusion with stand - alone metallic cages .36 future multicenter registry studies with large population samples will likely determine more accurately the true complication rate . second , the study population had confounders including smoking status , diabetes , and workers ' compensation . these factors are known to affect the outcomes of both primary and revision fusion surgery .3738 given the small cohort size of this study ,39 the effects of these confounders on the outcomes of revision alif surgery for nonunion could not be adequately assessed and should be further investigated in future studies . future studies should also prospectively compare alif versus tlif approaches for salvage of pseudarthrosis following posterior lumbar fusion surgery . increased follow - up would also allow assessment of long - term radiographic and functional outcomes of alif revision for pseudarthrosis . overall , our results suggest that the alif procedure results not only in radiographic improvements in bony fusion but also in significant improvements in the patient 's physical and mental experience of pain secondary to lumbar pseudarthrosis . the advantages offered by the alif technique are theoretically sound , and it appears to be a viable option for salvage operations and is safe in well - trained hands . our strong recommendation is that alif be considered as a salvage technique for patients who present with painful pseudarthrosis following posterior lumbar fusion .\noutput:\n" }, { "from": "agent", "value": "study design retrospective analysis of prospectively collected observational data . objective to assess the safety and efficacy of anterior lumbar interbody fusion ( alif ) as a salvage option for lumbar pseudarthrosis following failed posterior lumbar fusion surgery . methods from 2009 to 2013 , patient outcome data was collected prospectively over 5 years from 327 patients undergoing alif performed by a single surgeon ( r.j.m . ) with 478 levels performed . among these , there were 20 cases of failed prior posterior fusion that subsequently underwent alif . visual analog score ( vas ) , oswestry disability index ( odi ) , and short form 12 - item health survey ( sf - 12 ) were measured pre - and postoperatively . the verification of fusion was determined by utilizing a fine - cut computed tomography scan at 12 - month follow - up . results there was a significant difference between the preoperative ( 7.25 0.8 ) and postoperative ( 3.1 2.1 ) vas scores ( p < 0.0001 ) . the odi scale also demonstrated a statistically significant reduction from preoperative ( 56.3 16.5 ) and postoperative ( 30.4 19.3 ) scores ( p < 0.0001 ) . the sf - 12 scores were significantly improved after alif salvage surgery : physical health composite score ( 32.18 5.5 versus 41.07 9.67 , p = 0.0003 ) and mental health composite score ( 36.62 12.25 versus 50.89 10.86 , p = 0.0001 ) . overall , 19 patients ( 95 % ) achieved successful fusion . conclusions overall , our results suggest that the alif procedure results not only in radiographic improvements in bony fusion but in significant improvements in the patient 's physical and mental experience of pain secondary to lumbar pseudarthrosis . future multicenter registry studies and randomized controlled trials should be conducted to confirm the long - term benefit of alif as a salvage option for failed posterior lumbar fusion ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the quality of life is concerned with the degree to which a person enjoys the important possibilities of life . oral health has a major impact on the general quality of life . people 's oral health status can affect them physically and psychologically and influence how they enjoy life ; how they look , speak , chew , taste , enjoy food , and socialize . it also affects their self - esteem , self - image , and feelings of social well - being . successful aging is related to maintaining one 's quality of life , which in turn is dependent on how well individuals can fulfill these day to day activities . oral diseases seriously impair the quality of life in a large number of individuals and they may affect various aspects of their life , including function , appearance , interpersonal relationships , and career opportunities . poor oral health not only has an effect on the general health , but also might restrict various day - to - day activities leading to loss of working hours . oral health is an integral part of general health and health of the police personnel is of utmost importance , as they are personnel who work against crime and facilitate the people to live in peace and harmony with each other , and thus help the growth of the nation . the mission of the police of a state is to help the common man , to provide security , and to create a peaceful and law - abiding community with his cooperation . police personnel are a group of professionals , who have an altogether different working environment , with 24 hours duty , often being exposed to the highest form of physical strain and mental stress . on account of their odd working pattern , they often miss timely food , sleep , rest , recreation , and family contact . due to these factors , police personnelthis complicates their general as well as oral health , which in turn has an influence on their life and level of living . in india , few studies have been carried out to assess the oral health status of police personnel , but very scanty literature exists on the impact of oral health on the oral health - related quality of life in police personnel . the objective of the study was to assess the impact of caries prevalence on the oral health - related quality of life among police personnel in virajpet , south india . prior permission was taken from the deputy superintendent of police ( dysp ) , virajpet , and the police sub inspector ( psi ) of the respective police station to conduct the study . the virajpet taluk consists of six police stations , with a total of 296 police personnel . the sampling technique used was simple random sampling , without replacement , for a sample size n = 296 . a sample size of n = 172 was obtained by using the formula , where , e was the desired level of precision , which we had selected to be 5 % . the police personnel were explained about the study and informed consent was obtained from the study participants . the questionnaire was typed both in the local language ( kannada ) and english , to ensure comprehensibility by all police personnel . the internal reliability ( cronbach alpha ) of the questionnaire was tested in a pilot study done and was found to be acceptable ( 0.7 ) . the first part of the questionnaire consisted of questions on the sociodemographic factors , which recorded the sex and age of the police personnel . the second part of questionnaire was pertaining to the impact of oral health on the quality of life , which was measured by the oral health impact profile ( ohip - 14 ) questionnaire . each question in the ohip - 14 questionnaire was answered on a five - point likert scale , with answers ranging from very often to never , and the possible scores ranged from 14 to 70 . the questionnaires were distributed to the police personnel personally and they were given sufficient time to answer the questions , and the questionnaire was collected back on the same day . after receiving the filled questionnaires from the participants , a clinical examination was carried out by a trained , calibrated , single examiner and the caries experiences of the participants were recorded as per the who criteria ( 1997 ) . the ethical approval for the study was obtained from the institutional ethical committee of the coorg institute of dental sciences , virajpet , south india . the spss version 20.0 software for windows was employed for statistical analysis . the frequency distributions of the responses to the questions were produced . in addition to descriptive statistics , pearson 's correlation was used to assess the relationship between the variables . anova was used to compare the within - group differences of the selected sociodemographic factors in the study . most of them were male ( n = 154 , 89.5 % ) and only 18 participants ( 10.5 % ) were females . their mean age was 38.029.08 years and their age ranged from 20 to greater than 50 years . as shown in tables 1 and 2 there were no significant differences between the within - group comparison of age , gender or oral health - related quality of life . sixty - eight ( 39.5 % ) of the study participants were happy with their teeth and 66 ( 38.4 % ) participants were happy with the appearance of their teeth . ninety - eight ( 57 % ) of the study subjects responded that they never avoided smiling and laughing and 90 ( 52.3 % ) never felt embarrassed due to their oral health . between and within - group comparison of age and oral health - related quality of life between and within - group comparison of gender and oral health - related quality of life distribution of respondents by question and score other questions , such as , any difficulty in pronouncing words , avoiding certain types of food , headaches , problems in any other part of their body because of problems with their mouth or teeth were asked , to which 115 ( 66.9 % ) , 80 ( 46.5 % ) , 91 ( 52.9 % ) , and 109 ( 63.4 % ) of the participants replied negatively . fifty - five ( 32 % ) participants answered that they could have meals properly and 51 ( 29.7 % ) replied to being satisfied with their regular food habits . out of 172 police personnel 128 ( 74.4 % ) , 111 ( 64.5 % ) , 11768 % ) , and 118 ( 68.6 % ) acknowledged that they never avoided other people , oral health never affected their ability to work or their everyday activities , never felt that life has been less satisfactory , and they had never been totally incapable of functioning , respectively . it is evident from the table 4 that oral health - related quality of life scores were negatively correlated with the caries prevalence score ( r = -0.173 ) and it was statistically significant . correlation of total oral health - related quality of life scores of the subjects with caries prevalence ( dmft ) it can be observed from table 5 that there was no significant association between caries prevalence decayed , missing and filled teeth ( dmft ) and the oral health - related quality of life scores . association between caries prevalence ( dmft ) and oral health - related quality of life scoresthe fact that the police personnel are quite often engaged in 24 - hour duty , puts them under a lot of physical as well as mental strain . the present cross - sectional , self - administered questionnaire study was conducted in order to obtain data regarding the oral health of the police personnel of the virajpet taluk , as well as , the impact of this on their oral health - related quality of life . the reliability score of the questionnaire was assessed from a pilot study and was found to be 0.7 , which is considered good . the high prevalence of caries in the present study may be because police personnel stay for a long time in their working environment , thus giving less priority for oral health . not many studies have been published for comparison with this population group . however , a study done on police personnel in haryana showed a lower caries prevalence among the police personnel in that region . in the present study , between and within - group comparison of age and oral health - related quality of life was not statistically significant , which was similar to the other studies . moreover , the comparison of gender and oral health - related quality of life was not statistically significant . this result was similar to the other studies and was in contrast to the other studies . in the present studythe total women police personnel were less , and therefore , a difference may not have been found . women and younger age groups , in particular , perceived oral health as impacting more strongly on their life quality , as compared to men and older people . it is important to highlight the gender effect , as women have specific oral health needs and these must be addressed by the oral healthcare services . conflicting evidence on the influence of sex on the perceptions of how oral health impacts the quality of life has been reported . discerning sex differences in oral health is important and may facilitate understanding the differences in oral health practices , such as , service utilization , which requires further investigation . police personnel are exposed to many different types of stress that may affect the sleep quality and physical health , such as physical injury , injuring others in the line of duty , and witnessing death or injuries to other officers and civilians . the impact of this high rate of exposure on their emotional health has long been a significant public health concern . in addition , police officers are exposed to chronic non - traumatic stress arising from the demands of their work environment . therefore , it can be hypothesized that police officers engaged in operational activities , which include exposure to danger and risk of life , would be more stressed . police officers carrying out operational duties , being more exposed to confrontation , violence , and day - to - day involvement in a variety of traumatic incidents , would present a greater prevalence of emotional stress - and consequently bruxism - than those who do organizational work and are less subject to risks . it can be observed that oral health - related quality of life was negatively correlated with caries prevalence ( r = 0.173 ) . however , no significant association was observed between the prevalence of dental caries and quality of life scores among the police personnel . this is because , although they had high caries prevalence , probably the extent of the caries was less severe , so the impact was less on their oral health - related quality of life . therefore , further studies have to be carried out for a better understanding of the impact of dental caries on the quality of life . furthermore , the very cross - sectional design of the study limits the validity of the study . keeping this in view , further longitudinal studies have to designed and carried out for a better understanding of the impact of stress on dental caries in this population group . the present study showed that there was no association with oral health - related quality of life and caries prevalence among police personnel in virajpet . the sample of police personnel provided a unique opportunity to study a large population from diverse socioeconomic and geographical backgrounds . hence , their health was of utmost importance , not only for them and their families , but also for the entire nation . prevention oriented health education lectures should be delivered , and possibly , should also form part of police training curriculum . prevention oriented health education lectures should be delivered , and possibly , should also form part of police training curriculum .\noutput:\n" }, { "from": "agent", "value": "objective : the objective of this study is to assess the impact of caries prevalence on oral health - related quality of life among police personnel in virajpet , south india.materials and methods : police personnel were randomly selected from the 296 police staff working in virajpet , india . they were invited for a dental examination and a questionnaire survey . a self - administered questionnaire was used to collect their demographic information , and to determine the oral health - related quality of life ( ohrqol ) . caries experiences of the participants were recorded as per the world health organization ( who ) criteria ( 1997 ) . the analysis of variance ( anova ) was used to compare within - group differences of the selected sociodemographic factors and the chi - square analysis was used to explore the association between the variables.results : all the 172 invited participants joined this study . their mean age was 38.02 9.08 years . there was no significant difference in oral health - related quality of life scores according to gender and age . the prevalence of dental caries was found to be 78 % in the current study . data analysis showed that there was no statistically significant association between the oral health - related quality of life scores and caries prevalence.conclusion : the present study showed that there was no association between the oral health - related quality of life and caries prevalence among the police personnel in virajpet ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetes mellitus ( dm ) has emerged as one of the major global health problems and a heavy burden for all healthcare systems . current predictions estimate that by 2025 more than 480 million people globally will have an altered glucose tolerance and 380 million will have developed type 2 diabetes . among diabetic complicationsdiabetic nephropathy ( dn ) has already become the leading cause of end - stage kidney disease ( eskd ) worldwide . moreover , progressive decline of kidney function is associated with an increase in all - cause mortality and severe cardiovascular complications in patients with diabetes . despite important advances in understanding , for example , the molecular pathways associated with the pathogenesis of dn , the clinical management of patients , and pharmacological treatments to protect the kidney function are not completely satisfactory . the diagnosis of dn is based on clinical parameters including the measurement of urinary albumin excretion rate ( aer ) , assessment of glomerular filtration rate ( gfr ) , and registering end - organ complications ( retinopathy or neuropathy ) . leakage of albumin into urine ( albuminuria ) has been the golden marker to indirectly indicate the integrity of the glomerular filtration barrier and as an index of kidney functionality . depending on severity of damage , the level of albumin found in urine increases in a linear fashion . patients are commonly stratified as normoalbuminuric ( 20 g per minute or 30 mg / 24 hours ) , microalbuminuric ( 20200 g per minute or 30300 mg / 24 hours ) , or macroalbuminuric ( 200 g per minute or 300 mg / 24 hours ) . in the diabetic patient , the onset of microalbuminuria proceeding to macroalbuminuria typically appears between 5 to 15 years and 15 to 25 years from the onset of diabetes . however , in patients with type 1 diabetes the decline of gfr is not always in concordance with the level of albuminuria and gfr reduces without clear signs of albuminuria and conversely reversion from microalbuminuria to normoalbuminuria can happen . these evidences suggest that more than 1 pathway may well be involved in the development of dn and surrogate biomarkers in support of albuminuria are badly necessary to predict the progression of dn . in the last decadeurinary extracellular vesicles ( uevs ) have gained considerable research interest due to their content of potential key molecules for intercellular communication and the possible use as source of biomarkers . more in general cells secrete a surprising variety of vesicles such as exosomes , microvesicles , exosome - like vesicles , apoptotic blebs , and retrovirus - like particles ( rlps ) into the extracellular space apparently reflecting intracellular processes . thus , they provide a lucrative approach to better define the molecular events associated with metabolic disturbances as in diabetes . moreover , uevs have already shown to provide a promising source of biomarkers and their full potential has still to be utilised . in this study we reveal , for the first time , a comprehensive analysis of proteases and proteases inhibitors in uevs isolated from healthy subjects and dn in type 1 diabetes . control urine samples were collected from twelve healthy volunteers among the laboratory staff , aged 2040 , in accordance with ethical protocols of the dublin city university . first morning void urine was processed within 3 h without addition of protease inhibitors . urine was anonymously tested by combur 10 test d dipstick ( roche diagnostics , basel , switzerland ) for the following : specific gravity , leucocytes , nitrites , proteins , glucose , ketones , urobilinogen , bilirubin , blood , and haemoglobin . all patients participated in the finnish diabetic nephropathy ( finndiane ) study , a nationwide multicenter study with the aim of identifying genetic and clinical risk factors for diabetic nephropathy in type 1 diabetes . the study protocol is in accordance with the declaration of helsinki , and it has been approved by the local ethics committee in each participating study centre . urinary albumin excretion rate ( aer ) was determined in 24 h urine collections by immunoturbidimetry ( pharmacia , uppsala , sweden ) . the renal status was defined based on aer in at least two of three collections . uevs were purified by a hydrostatic filtration dialysis ( hfd ) system recently developed in our group . briefly , control and dn urine samples were centrifuged at a relative centrifugal force ( rcf ) of 2,000 g calculated at maximum radius of 160 mm in a swing bucket rotor benchtop universal 320 centrifuge ( hettich zentrifugen , tuttlingen , germany ) for 30 min at room temperature ( rt ) ( without using break ) . the supernatant ( sn ) was poured in a funnel connected to dialysis membrane with a molecular weight cutoff ( mwco ) of 1,000 kda as shown in supplemental figure 1 ( s ) ( see supplementary material available online at http://dx.doi.org/10.1155/2015/289734 ) . the hydrostatic pressure of the analyte solution is strong enough to push the solvent through the mesh of dialysis membrane carrying all the analytes below the mwco ( hfdb ) . thus , after the first step of concentration ( ~ 3 ml ) the funnel is refilled with 200 ml of deionised filtrate ( 0.22 m ) water to rinse what is left in the concentrated urine until the volume of ~ 5 ml was reached again . this concentration process is calledthe retained solution above the 1,000 kda cutoff ( hfda ) was used for all the following experiments . proteins were separated by sds - page employing freshly cast t 618 % , c 2.6 % gradient resolving gel ( 80 mm 50 mm 1.5 mm ) . protein amounts ( based on the bradford assay ) were first dried by vacuum concentration and then resuspended in a strong chaotropic solution made of the following : 7 m urea , 2 m thiourea , 5 % ( w / v ) sds , 40 mm tris - hcl , ph 6.8 , 0.5 mm ethylenediaminetetraacetic acid ( edta ) , 20 % ( v / v ) glycerol , and 50 mm dithiothreitol ( dtt ) in a ratio of 0.25 g of protein per l of solution . after electrophoresis the gels were either stained with colloidal coomassie or transferred to 0.45 m nitrocellulose membrane ( whatman , springfield , uk ) . for westernblotting , membranes were saturated with odyssey blocking buffer ( li - cor biosciences , lincoln , ma ) and incubated with specific antibody as follows : rabbit anti - tumour suppressor gene ( tsg101 ) ( sigma aldrich , dorset , uk ) , rabbit anti - ubiquitin ( dako , glostrup , denmark ) , and mouse anti - proteinase 3 ( r & d biosystem , minneapolis , mn ) . after 6 washes in pbs - tween ( 0.1 % , v / v ) membranes were incubated with infrared dye - coupled secondary antibody with a fluorescent tag ( an emission of either 680 nm or 700 nm ) ( li - cor biosciences ) dilution 1 : 50002 h incubation rt . determination of molecular weight of all bands of interest and quantification of the signal were performed by odyssey infrared laser scanner software ( li - cor biosciences ) . proteome profiler human protease array kit and proteome profiler human protease inhibitor array kit ( r & d systems ) were used to detect 34 proteases and 32 inhibitors , respectively . hfda pooled fractions were dried by vacuum concentration ( mivac speed trap , genevac ltd , ipswich , uk ) and resuspended in 50 l of 0.3 % ( w / v ) sodium dodecyl sulphate ( sds ) for 2 hours . samples were diluted to 1 ml with array buffer 6 plus 0.5 ml of array buffer 4 ( both buffers from r & d systems ) . fifteen microliters of reconstituted detection antibody cocktail was added to the sample solution and incubated for 1 hour at rt in end - over - end agitation . mix sample - antibody solutions were incubated overnight at 6c with the membrane on a rocking platform shaker . after three 10 - minute washes with 1x buffer , the membranes were incubated with infrared dye - coupled streptavidin with a fluorescent tag emitting at 800 nm ( li - cor biosciences ) , 1 : 2000 dilution for 1 h at room temperature on the rocking platform shaker . after three 10 min wash with 1x wash bufferthe membrane slides were acquired by odyssey infrared laser scanner ( li - cor biosciences ) and relative quantification analysis was performed by odyssey infrared laser scanner software ( li - cor biosciences ) . gelatin zymography was performed using gradient sodium dodecyl sulfate gel electrophoresis ( sds - page , t = 618 % c = 2.6 % ) copolymerized with 2 mg / ml pig skin gelatin type b ( sigma ) . uevs ( 5 g per group ) were incubated overnight in nonreducing laemmli buffer . ( v / v ) triton x-100 at 4c and were incubated overnight in collagenase buffer ( 50 mm trisgels were stained with coomassie bluer 250 ( bio - rad ) in 40 % ( v / v ) methanol and 10 % ( v / v ) acetic acid for 1 hour and were destained in the same solution without dye . the proteolytic activities of specific group of proteases in normo - , micro - and macroalbuminuric hfda fractions were assayed using 0.1 mm glycyl - prolyl - p - nitroanilide ( gp - pna ) and 0.25 mm n - benzoyl - proline - phenylalanine - arginine - p - nitroanilide ( be - pfr - pna ) , n - methoxysuccinyl - alanine - alanine - proline - valine - p - nitroanilide ( me - aapv - pna ) , and succinyl - alanine - alanine - proline - phenylalanine p - nitroanilide ( suc - aapfpna ) chromogenic substrate of chromogenic substrates to establish activity of dpp iv , kallikreins , proteinase 3 , and cathepsins , respectively . assays were performed for 20 min under same conditions of 100 mm tris - hcl buffer ph 7.8 with addition of 5 mm cacl2 except for gp - pna , for which 100 mm tris - hcl buffer ph 8.6 was used . incubations were performed at 37c for 20 min in 96 - well flat bottom microplates ( greiner bio one kremsmster , austria ) . reactions were stopped by 30 % ( v / v ) final concentration of acetic acid . results were read using 410 nm wavelength in biotek powerwave xs device ( biotek instruments inc . , the specific activity has been defined as mole of 4 - nitroaniline released per minute by one milligram of the protease under the assay conditions . briefly , an equivalent of 100 g of proteins from each sample was resuspended in milliq water in total volume of 375 l . next , 675 l of delipidation solution made of 60 % ( v / v ) diisopropyl ether ( dipe ) and 40 % ( v / v ) butanol were added . samples were vortexed and centrifuged for 10 min at 5000 rpm at rt . upper phase was removed ; 1125 l of dipe was added to aqueous phase and mixed end - over - end for 5 min at rt . samples were then centrifuged at 5000 rpm for 5 min in rt and the upper phase was discarded while tubes were placed under a fume hood to remove traces of an organic phase . bradford assay was performed to establish protein concentration and samples were diluted to obtain an optimal concentration for colorimetric assay . in the pilot study 12 ( 6 males and 6 females ) control volunteers provided 15 ml of midstream first morning urine . thirty seven urine samples from diabetes patients , with different levels of albumin - proteinuria were studied . after enriching uevs by hydrostatic filtration dialysis , samples were assayed in electrophoresis and western blots for general protein patterns and detection of the respective vesicle markers including tumor suppressor gene 101 ( tsg101 ) specific for exosome vesicles ( figure 1 ) . silver stained gels showed a good overlapping pattern with a moderate interindividual variability , most likely due to variable amounts of tamm - horsfall protein ( thp ) . interestingly , tsg101 assay also showed a progressive signal decrease in the micro - and macroalbuminuric groups , respectively . this trend was even more evident when urine pools were created for the protease and protease inhibitor arrays ( figure 2 ) . moreover , a detectable shift of the apparent tsg101 molecular weight ( mw ) was observed when pools were run in adjacent lanes in the same gel . these results were confirmed in two independent western blots , the second of which was carried out with an optimised gradient gel to have a better separation in the tsg101 molecular weight ( mw ) region . in order to investigate this alteration in detail we assayed the ubiquitination state of exosomes . although the precise molecular mechanism of the vesicle formation and protein recruitment needs to be fully elucidated , it seems apparent that this posttranslation modification ( ptm ) faithfully reflects the disease pathogenesis . interestingly , ubiquitination is involved in a variety of cellular processes , including protein sorting and translocation inside the vesicle lumen during vesicle biogenesis as well as in protein degradation . in support of this , western blotting revealed a specific ubiquitination pattern in the dn groups . in all the dn groups it is possible to observe a strong signal at 8.5 kda corresponding to the monomeric ubiquitin and 17 kda ( white rectangle ) which is absent in the healthy control . moreover a specific pattern in the normo - , micro - , and macroalbuminuric groups with an apparently relative changing for some bands ( asterisk ) is visible between 50 and 75 kda . despite the fact that the challenges of using sample pools have been thoroughly debated , pools for each study group were created to overcome substantial limitation such as a relative protein recovery from a limited volume of urine . moreover a superpool made of the same amount of protein for each hfda sample was created to normalise the relative quantitative changing of the proteases array ( figure 3 ( a ) ) and overcome the lack of a housekeeping protein . membrane slides were analyzed at the same time adjusting the intensity of the laser to reach the limit of saturation for the most abundant spot . the spots in positions a1 ,2 , a19 ,20 , and e1 ,2 represent the positive controls . the absence of spots in position e 7,8 ( white rectangular ) , which is the negative control , indicates the specificity of the antibody cocktail . table 1 reports changes of 1.5-fold of the proteases , with respect to the healthy control . a positive signal of 29 proteases was detected out of 34 , out of which 16 showed a significant change during progression of dn . figure 3 ( b ) shows the plots as bar chart of the fluorescent intensity ( f.i . ) for each protease normalised by the f.i . of the superpool . positive spots were considered as those with a detection limit ( signal - to - noise ratio ) 3 . a set of proteases appear to progressively increase in different groups of dn patients ( especially for the cathepsin family with a progressive increase of a , c , d , l , and z ) while only cathepsin e seems to decrease following a trend which becomes significant ( less than 1.5-fold ) in the macroalbuminuric group . in the family of kallikreins , kallikrein 3 / psa , kallikrein 10 , kallikrein 13 , and kallikrein 6 could be biased by the gender distribution of samples in the groups . metalloprotease mmp9 is abundantly present in the normoalbuminuric group while mmp2 showed a progressive decrease reaching the threshold of 1.5-fold in the micro - and macroalbuminuric groups . other proteases which showed an interesting trend are ddp iv targets of gliptins and proteinase 3 ( prtn3 ) or myeloblastin . ddp iv decreased in the normoalbuminic group and then increased during progression of dn while proteinase 3 ( prtn3 ) has an opposite trend with a marked increase in the normoalbuminuric and microalbuminuric group to reach a normal level in the macroalbuminuric group . beside the relative quantitative amount we checked the activity of some of these proteases by gelatine zymography for metalloproteases ( figure 4 ) which confirmed a clear increase of gelatinase activity in the normoalbuminuric group and by chromogenic substrates for dpp iv , kallikreins , cathepsins , and prtn3 ( figure 5 ) . spectrophotometric assays were performed in native condition and after organic delipidation to release proteases which can be localized in the vesicle lumen . after delipidation only the kallikrein family was significantly affected ( full loss of activity ) while all the other protease activities maintained the same profile . although there is a substantial increase of the cathepsin expression in the protease array , the colorimetric assay showed a decrease of the activity in the dn groups . moreover , it is interesting to notice that the activity of dpp iv was much lower in the dn groups independently of the levels detected in the array . proteinase 3 activity was high in the normoalbuminuric group but in the other groups it remained unchanged despite the higher levels especially in the microalbuminuric group . since proteomic profiling of uevs reported the presence of several protease inhibitors , such discrepancy between activity and expression levels could be caused by the presence of protease inhibitors . based on the same assay , a protease inhibitor array to screen the expression of protease inhibitors was performed . out of 32 inhibitors 19 were present in the same pool , and 15 showed more than 1.5-fold change ( table 2 and figure 6 ) . also in this array we can identify different trends . firstly , 6 inhibitors appeared to be more abundant ( cystatin b , fetuin b , angiotensinogen , serpin a8 , serpin f1 , and elafin ) progressively in the 3 diabetic groups . those with decreased amounts showed either a progressive decrease which becomes significant in the micro - and / or macroalbuminuric groups ( e.g. , serpin b5 and timp - 2 ) or very low amount in all the 3 dn groups ( cystatin c e / m , emmprin / cd147 , ha - 2 , and he4 / wfdc2 ) . finally , two protease inhibitors ( lipocalin - 2 / ngal and protease nexin ii ) showed a peculiar increase in the normoalbuminuric group and a sharp decrease in the macroalbuminuric cohort . in order to establish whether there is any functional interconnection between proteases and protease inhibitors we used the kidney & urinary pathway knowledge base ( kupkb ) designed to collect data set from scientific publications and other datasets related specifically to renal diseases . the query of the kupkb algorithm provided the protein network presented in figure 7 . out of 30 entries which are up - or downregulated by 1.5-fold in the protease and protease inhibitor arrays ,11 entities were found to be connected as a network together . within the network we have found that cathepsin l via cystatin a is connected to the metalloproteases 9 and 2thus , a further screening in western blot was carried out evaluating the full cohorts of samples as shown in figure 8 qualitatively confirming the array data . diabetic nephropathy ( dn ) is a major complication of diabetic patients , constituting the leading cause of eskd and considerably increasing cardiovascular risk and associated mortality . defining the pathophysiologic mechanisms in dn is necessary to better understand the disease and identify new targets for therapeutic intervention . kidney lesions can start to develop early during the quiescent period when the patient is still normoalbuminuric and with normal glomerular filtration rate ( gfr ) . microalbuminuria has a solid role in the clinical practice and management of diabetic kidney disease ( dkd ) . however , an increasing number of studies have shown that decrease of gfr can occur independently from the presence of albuminuria or progression to macroalbuminuria and therefore the utility of albuminuria itself has been questioned . thus , in addition to albumin excretion rate ( aer ) and gfr , selected biomarkers for the detection of early functional abnormalities have been proposed and recently reviewed by macisaac et al . . recently urinary exosomes or , more in general , urinary extracellular vesicles ( uevs ) have been actively studied for their biological role as a potentially new cell - to - cell communication system . despite the partly overlapping and confusing nomenclature , evs can be divided into various main categories with respect to their secretory pathway . thus , exosome vesicles are formed by inward invagination of the endosomal membrane in an ubiquitin - dependent mechanism which requires the endosomal sorting complex required for transport ( escrt ) machinery . exosomes are then released in the extracellular space when multivesicular bodies ( mvbs ) of late endosomes fuse with the plasma membrane and release their intraluminal vesicle cargo . microvesicles are shed vesicles or membrane particles which derive directly from the outward budding of plasma membrane in response to a variety of pathophysiological stimuli . furthermore , evs can mediate intercellular communication by delivering elements of genetic content from one cell to another in a paracellular fashion . thus , uevs faithfully reflect the antigenic characteristics of their parent cells thus making them excellent cell - type specific . this has led to an explosion of interest in evs as potential source of biomarkers as mirror of the pathophysiology of the cell of origin . thus , uevs can provide a good platform as a surrogate of a fluid biopsy to support the clinical management of , for example , diabetic patients , assuming the dn kidney damage is reflected in the repertoire of uevs with a specific fingerprint at each stage of disease progression . the first aim of this study was to isolate and characterize uevs from healthy donors and 3 cohorts of dn grouped according to the aer using a new isolation method developed in our group . this is based on a hybrid ultrafiltration - dialysis system which enriches vesicles without the interference of soluble protein like human serum albumin ( hsa ) . as shown in figure 1 for all the samples under investigation , the main protein present in the uevs is tamm - horsfall protein ( thp ) . thp is abundant in the healthy controls and it progressively decreases in the dn groups . no evidence of massive presence of human serum albumin ( hsa ) even in the macroalbuminuric group was seen . as expected , more prominent bands in the microalbuminuric and macroalbuminuric groups are visible at 62 , 52 , and 25 kda and these correspond to the heavy and light chains of immunoglobulin ( ig ) isotypes , , , and / or chains . immunoglobulins have been identified in the proteome profiling of uevs and elevated concentration of igg and iga in urine has been proposed as a novel mechanism of kidney damage independent from charge and size impairment in early dn . more dedicated studies are necessary to investigate the role of vesicles - ig interaction in dn for their role . detection of the exosomal marker tsg101 confirmed the abundance of uevs in the hfda fractions . additionally , a shift of the molecular weight of tsg101 was observed ( figure 2 ) . tsg101 can be acetylated and / or ubiquitylated and as component of the escrt - i machinery it binds ubiquitylated protein to sort it out into vesicles during its biogenesis to form the multivesicular body ( mvb ) which then either can release its vesicle cargo ( exosomes ) outside the cell and / or fuse with lysosome for degradation . thus , the ubiquitinated pattern of uevs in the healthy and dn groups was checked by western blot utilising a polyclonal antibody which recognised ubiquitin and monoubiquitinated proteins ( figure 3 ) . interestingly , the dn samples , at different stages of disease , provided a well defined and characteristic ubiquitome . this result along with decrease of tsg101 signal suggests that an impairment of the endosome / vesicle trafficking happens in the early stages of disease . ubiquitin , more in general the ubiquitin - proteasome , plays a pivotal role in the degradation of misfolded proteins , concentration , and turnover of cellular proteins . thus the ubiquitin - proteasome system works in synergy with lysosomal proteases , caspases , calpains , and separases to generate shorter polypeptides accessible to the proteasomes system for a full protein degradation . our results show convincingly that there are major intracellular changes reacting to altered microenvironment and this is reflected in the void uevs . proteases cover an important role not only in the pathogenesis of dn but more in general as the dynamic reaction obviously needed to keep the intracellular homeostasis , in our case to fight back the hyperglycaemia induced changes . in this study we wanted to focus our attention on proteases first andtheir well established inhibitors and how they are represented in the uevs as indicators of intracellular events . sixteen and nineteen proteases and inhibitors , respectively , changed by 1.5-fold with respect to the healthy group . cathepsins of the a , c , d , l , and xzp classes were found as markedly more abundant in the dn groups . the only one less represented is cathepsin e , while cathepsins b , s , and v did not show any change . cathepsins are lysosomal proteases , which can exert their proteolytic activity in the extracellular space in extracellular matrix ( ecm ) remodeling , and in synergy with mmp are implicated in the development of renal diseases ( crds ) . beside the increased level of cathepsinl the protease inhibitors array showed a concomitant increase of cystatin b a thiol proteinase inhibitor which , reversibly , binds cathepsin l . interestingly , neutrophil gelatinase - associated lipocalin ( ngal ) binds and preserves metalloproteinase 9 ( mmp - 9 ) from degradation thus supporting its gelatinase activity . increase of urinary excretion of ngal - mmp - 9 has been described in diabetic subjects in a gender - specific manner . in our study proteases , protease inhibitors arrays , and their functional verification withzymography showed that this association is also reflected inside the uev fraction . intriguingly , whether these findings show a spillover reflection of the cellular reaction to elevated glucose content or a mechanism to allow specific targeting to more downstream sites of protease needs should be studied in detail . increase of the urinary level of dpp iv associated with microvesicles is correlated with the worsening of dn . in our array , we found that the level of dpp iv decreases in the normoalbuminuric group and then starts to progressively increase in the samples from patients with micro - and macroalbuminuria . independently of the levels dpp iv , its functional activity is markedly lower in the 3 dn groups than in control . sun and colleagues reported an increased excretion of dpp iv associated with microvesicles in type 2 diabetic patients . their results are in contrast with the result of our screening but the methodological approach can explain such a difference . while in our study we collected the whole amount of uevs retained in the dialysis tube , they enriched dpp iv using a specific monoclonal antibody anti - ad - 1 ( leucine aminopeptidase ) . the authors reported it to be expressed on the brush border of the proximal tubular in the cortex ( s1 , s2 segments ) and in the outer medulla and in the medullary rays ( s3 segments ) . however , dpp iv is widely expressed also in the glomeruli and an increase of dpp iv activity in podocytes is correlated with kidney injury . of course additional studies are necessary to better evaluate changes in the dpp iv levels in microvesicles . in order to analyze the link between the proteases and their inhibitor we used the kidney & urinary pathway knowledge base ( kupkb ) to specifically focus on proteins / genes relative to pathways in the kidneys . in addition to the mmps and their relative inhibitors , two relatively new proteins emerged which are potentially involved in the complexity of dn pathogenesis : myeloblastin and its natural inhibitor trappin - 2 . myeloblastin or proteinase 3 ( prtn3 ) is a serine protease present in granules and the cell surface of neutrophils and monocytes . it has pleiotropic effects and multiple substrates including extracellular matrix and cytokines and it can be found in urine . recruitment of neutrophils in glomeruli and the release of prtn3 potentially lead to endothelial dysfunction . more recently podocytes have shown to actively regulate neutrophil recruitment through action of glomerular endothelial cells . prtn3 binds to the endothelial surface but it can be also internalised inducing apoptosis . moreover , prtn3 has been proposed as an inflammatory enzyme able to digest insulin - like growth factor 1 ( igf - 1 ) and the insulin - like growth factor - binding protein - 3 ( igfbp3 ) and promote glomerular inflammation in type 2 diabetes . interestingly , endothelial dysfunction and inflammation have been recently proposed as predictors of dn in type 1 and 2 diabetes . our results showed that also these mechanisms can be monitored by detecting a combination of selected proteases and their inhibitors . the protease array ( figure 3 ) , verified with the functional chromogenic activity ( figure 5 ) and screeningpatients ( figure 8 ) , confirmed an increase of the level and activity already in the normoalbuminuric group : in patients with changes induced by hyperglycemia but with no signs of permanent kidney damage yet . indirectly we can generalize that hyperglycemia leads also to inflammation , contributes to the complexity of changes , and can be the ultimate functional component for apoptosis and autophagy . this is supported by the dysregulated ubiquitination mirrored in the uevs ( figure 2 ) . this is interesting as very recently it has been reported that the ubiquitination - dependent of coactivator - associated arginine methyltransferase 1 ( carm1 ) can mediate podocyte apoptosis in dn . a more comprehensive analysis of the distinct proteases and their association to their preferential pathophysiological processesuevs have a strong potential as key elements for a fluid kidney biopsy by reflecting the respective pathophysiology , exact mechanisms involved , and often also information on the exact domain of the nephron affected . however , more detailed studies and , most preferably , correlating findings with those from tissue biopsies and clinical parameters are imperative . herewe show that the new hydrostatic filtration dialysis method offers an unbiased approach for vesicle enrichment from urine and their subsequent use for distinct purposes of protease inhibitor studies .\noutput:\n" }, { "from": "agent", "value": "diabetic nephropathy ( dn ) is one of the major complications of diabetes mellitus ( dm ) , leads to chronic kidney disease ( ckd ) , and , ultimately , is the main cause for end - stage kidney disease ( eskd ) . beyond urinary albumin , no reliable biomarkers are available for accurate early diagnostics . urinary extracellular vesicles ( uevs ) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers . here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement . urine samples were divided into groups based on the level of albuminuria and uevs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors , respectively . interestingly , myeloblastin and its natural inhibitor elafin showed an increase in the normo - and microalbuminuric groups . similarly , a characteristic pattern was observed in the array of protease inhibitors , with a marked increase of cystatin b , natural inhibitor of cathepsins l , h , and b as well as of neutrophil gelatinase - associated lipocalin ( ngal ) in the normoalbuminuric group . this study shows for the first time the distinctive alterations in comprehensive protease profiles of uevs in diabetic nephropathy and uncovers intriguing mechanistic , prognostic , and diagnostic features of kidney damage in diabetes ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: senescence , a natural , current and irreversible fact , is accompanied by the decline of many systems and functions that compromise human balance , which includes the vestibular system . vestibular disorders are frequent in the elderly people and causes dizziness and body imbalance , symptoms that may impair daily activities . there is a positive correlation between balance and functional ability in elderly patients with peripheral vestibular disorders . aging brings several changes in body systems , resulting in a higher frequency of falls and , therefore , a potentially negative impact on quality of life .1 there is a correlation between risk of falls and age . the annual incidence of falls in people over 65 is 25 % and 50 % in those over 80 years old . studies show that 30 % of people over 65 years of age fall at least once a year and that falls are responsible for 70 % of accidental deaths in people older than 75 years .2 falls commonly correlate with dizziness and may result in serious consequences and harm for elderly quality of life , increasing dependency . the functional limitations imposed by the symptom causes physical and psychological injuries and inability to perform daily and work activities .3 it is important for elderly people to be able to perform their daily activities , maintain functions , and retain their independence and autonomy . the association between falls and quality of life pointed to factors such as wellness , self - esteem , functionality , culture , ethics , religion , home environment , and health as key in determining quality of life .4 studies have shown that the elderly paradigm has been modified and that several factors contribute to healthy aging , including physical and mental health , family support , clinical monitoring , social integration , and financial and daily independence .5 falls may result in instability , postural imbalance , fear of falling , depression , isolation , and negative self - perception with respect to their independence .4 the risk of falling may induce fear of falls . many older adults experience fear of falling , which may reduce their participation in routine activities .6 such features should include intervention of all health professionals , considering that falls could be associated with several causes and implies a considerable amount of health care costs . these intervention programs are effective in reducing fear of falling among older adults .7 our research could not verify the correlation between the world health organization quality of life ( whoqol ) and the dynamic gait index ( dgi ) . the objective of this study was to evaluate the quality of life and gait in a healthy elderly group , as well as to assess quality of life and balance with respect to gender , age , and frequency of falls . this is a clinical , exploratory , descriptive , and qualitative study using the world health organization quality of life - brief ( whoqol - brief ) and the dynamic gait index ( dgi ) to study an elderly group from the northeast of brazil . this study was submitted to the ethics and research center of medicine of the institution , which approved and registered the projects with the following numbers : 0198.0.107.00009 and 6232.0.000.10710 . data collection and evaluations were performed in a private office in the city of aracaju and at a family health public center in itabaiana city . we started with a brief interview to collect preliminary data from the volunteers , listing inclusion and exclusion criteria , complaints of dizziness , and reported falling events . the final sample comprised 47 females and 9 males , retired , not institutionalized , and without regular practice of physical activities . volunteers were selected if they met the following two inclusion criteria : 1 ) they were over 60 years old ; 2 ) they presented no cutoff score less than 19 points on the mini - mental state examination .8 for data analysis , we used the proposition derived from the study of herrera jr . , caramelli , nitrini ,9 as shown in tables 1 and 3 . volunteers were excluded from the study if they were using medical drugs that could influence their level of awareness ; if they presented signs of dementia ; if they demonstrated hearing loss without a hearing aid ; if they had comprehension difficulties ; or if they had a limited or abnormal gait . to evaluate the quality of life , we used the brazilian version of the whoqol , validated by fleck et al10 , which is a self - assessment and self - explanatory inventory . there are 26 questions in the whoqol - brief : two address life quality issues and the other 24 represent the original instrument facets . it is important to observe that this inventory has no cutoff point because it considered a self - related perception , mainly in two questions : how would you rated your quality of life ? and how satisfied are you with your health ? . the whoqol - brief is divided in four domains : physical ( domain 1 ) , psychological ( domain 2 ) , social ( domain 3 ) , and environment ( domain 4 ) . physical domains include : daily activities ; dependence on medicinal substances and medical aids ; energy and fatigue ; mobility pain and discomfort ; sleep and rest ; work capacity . the psychological domain refers to : bodily image and appearance ; negative feelings ; positive feelings ; self - esteem spirituality / religion / personal beliefs ; thinking , learning , memory and concentration . the environment domain refers to : financial resources ; freedom , physical safety and security . health and social care include : accessibility and quality ; home environment ; opportunities for acquiring new information and skills ; participation in and opportunities for recreation / leisure activities ; physical environment ( pollution / noise / traffic / climate ) ; transport . to evaluate the gait , we used the dgi developed by shummway - cook et al11 , adapted to the brazilian language by castro et al. 12 in the dgi , there are eight tasks that evaluate and characterize balance during gait in different functional contexts . according to the standard reported by castro et al12 , the score 19 points indicates a gait disturbance and predicts falling risks . for statistical purposes , we used the summarized results ( mean , median , standard deviation , confidence interval above and below 95 % , absolute and relative frequency ) , and the alpha ( ) cronbach test , chi - square ( 2 ) , pearson 's test , and spearman 's test . we considered results lower than 0.05 % ( p 0.05 ) and lower than 0.01 % ( p 0.01 ) significant , which are indicated with one or two asterisks , respectively . their age ranged from 60 to 83 years and average age was 69.9 years . from the general sample , cronbachs test revealed an of 0.76 , being 0.75 for female and 0.83 for male . the value ranged from 98.2 % to 100 % for the correlations between the domains , dgi , and gender . table 2 shows the statistical results of the pearson correlation which analyzes the scores of dgi , domain 1 ( physical ) , domain 2 ( psychological ) , domain 3 ( social relationships ) , and domain 4 ( environment ) . the pearson correlation test detailed in table 2 reveals a positive correlation between domains 2 and 4 and the other domains . we used the pearson correlation to analyze the age and domain 1 , 2 , 3 , and 4 variables . the results , shown in table 3 , indicate a significant negative correlation between age and domain 2 . pearson correlation test . * p lower than 0.05 % ( p 0.05 ) , significant . * we used spearman 's test to analyze the responses to question 1 ( how would you rate your quality of life ? ) , question 2 ( how satisfied are you with your health ? ) , domain 1 , domain 2 , domain 3 , domain 4 . spearman 's test revealed a significant correlation between question 1 and domains 1 , 2 , and 4 and no correlation between questions 1 and 2 . we used spearman 's test to analyze the responses to questions 1 and 2 , dgi scores , and falls , as shown in table 5 . the results revealed a negative association between question 1 and falls , as well as a slight correlation between the dgi scores and question 1 . of the volunteers who reported falls , 72.7 % reported having a good quality of life and 54.5 % said that they were neither satisfied nor dissatisfied with their health . even though the pearson correlation test revealed no significant correlations between question 1 and 2 and gait complaints , a considerable portion ( 68.6 % ) of the volunteers reported a good quality of life , regardless of imbalance . in contrast to some studies , our statistical analysis indicates that gender does not affect the whoqol - brief results .1314 these studies have reported that the quality of life in elderly females is lower with respect to physical health , functional capacity and social and cognitive activities , in comparison to males of the same age who had a better perception of their quality of life . however , another study , which indicated that the presence or absence of satisfaction with quality of life was not associated with gender , concurs with our results .15 we showed that gender does not interfere with dgi tasks , as reported by a previous study .16 however , some studies have reported that female volunteers obtain better results than male volunteers , a conclusion that is not in accordance with our results .17 in our study , age did not correlate with the whoqol - brief . other research revealed similar results ,18 although these are in contrast to other studies which have reported that senescence induces health problems , financial weakness , depression , social and emotional isolation , and reduced autonomy and productivity . together , these factors contribute to a reduction in the quality of life .19 we found that age did not affect the dgi score , which concurs with a study by whitney .16 this is , however , in contrast to the results reported by another study that found that age influences both gait and balance in elderly people .20 out of the volunteers who reported falls , 36.3 % had low dgi scores , indicating that this is a useful measure for evaluating gait and predicting the risk of falling . other studies have also indicated that dgi is a good way to assess the ability to adapt to changes in gait during some tasks .1720 we did not find any correlation between fall frequency and age , though this relationship has been reported by other authors .21 previous studies have reported that females are prone to accidental falls at a younger age than males because women reach their peak muscular performance earlier in life . we did not find any evidence to support this theory in our study .13 as shown by table 1 , we found that domains 2 ( psychological ) and 4 ( environment ) were correlated with all domains , indicating that satisfaction with environment is associated with good mental health . financial proceeds decline is related to decrease in age , whereas satisfaction correlates with an individual 's personal life and stress status , estimated using in domains 2 and 4 . this causes a decrease in functional capacity and self - esteem , in addition to falls and fear of falling , resulting in social isolation and depression .2223 our study shows that psychological and environment domains are strongly connected , which concurs with previous research .24 in addition , the environment domain is considered to be a strong influence on the overall quality of life . we observed a negative correlation between age and domain 2 , in other words , the older the subject the lower their score in psychological domain . at present , there is no consensus regarding this relationship , as different studies have reported contrasting results . the presenting results are similar to that of other studies .2526 we found a correlation between question 2 ( how satisfied are you with your health ? ) and all of the domains from the whoqol - brief . this correlation has also been observed in other studies , which stated that general health includes physical , psychological , environmental , and social aspects , all of which are important for independence and autonomy in elderly groups .27 in elderly people , the physical , mental , and environmental aspects which determine a good quality of life were shown by the correlation between question 1 ( how would you rate your quality of life ? ) and domains 1 ( physical ) , 2 ( psychological ) , and 4 ( environment ) . this correlation has also been reported by other studies .2528 as well presented , the question 1 and 2 are correlated subjects , but not similar . our hypothesis is that this event could be explained by the link between quality of life and health , which often appear synonymous because these questions are assessed almost simultaneously . other studies have suggested this as well .29 such studies indicate that quality of life is connected to the individual 's perception of their health status and to general aspects of their life . our statistical analysis showed that volunteers perceived good health and quality of life to be similar . the volunteers who reported a good quality of life experienced fewer falls , a result which concurs with other studies .3031 we believe that fall frequency is an important factor to consider when assessing dependency and quality of life . there was a misperception of the volunteers about their welfare , since that which related to falls did not affect their judgment of their quality of life . previous research showed that falls affect quality of life of those prone to falls .17 the same pattern was observed for the second question ( 54.5 % ) , indicating that social , environmental , and psychological aspects may have influenced the perception of the subjects . we observed that high scores in other questions affected the importance of fall events , especially when they were sporadic . a considerable percentage of our sample reported good quality of life and satisfaction with their health , in addition to balance complaints . this led us to believe that positive responses did not follow the same pattern as other studies , some of which showing that complaints and gait disorders directly affect quality of life and health .32 the quality of life is determined by an individual 's self - perception , therefore , it is subjective . various factors are considered including lifestyle , expectations , motivations , and psychological state .25 this subjectivity and range of factors allow for mixed results , for example , two subjects with the same disease which respond differently to questions regarding their quality of life and health . therefore , we believe that dizzines complaints do not influence an individual 's self - perception of their quality of life and health . in this study , we found that the quality of life and health of elderly people was adequate in the presence of complaints and gait disorders , which was unexpected . according to the whoqol - brief , the quality of life of the subjects was either good or very good , even when a considerable percentage reported falls and gait disturbances . gender and age did not affect quality of life assessment or dgi , neither were these factors associated with falls .\noutput:\n" }, { "from": "agent", "value": "introduction the process of aging could lead to seniors being more prone to falls , which affects their quality of life.objective the objective of this study is to investigate the relationship between quality of life and gait in the elderly.methods we used world health organization quality of life - brief ( whoqol - brief ) brazilian version and the dynamic gait index to assess fifty - six volunteers from the northeast of brazil . ages ranged from 60 to 85 years.results the dynamic gait index , which indicates the probability of falls , resulted in 36.3 % of the sample presenting abnormal results . there was correlation between domain 2 ( psychological ) and domain 4 ( environment ) with domain 1 ( physical ) and domain 3 ( social ) ; a negative correlation between age and domain 2 ; correlation between question 1 ( how would you rate your quality of life ? ) and domains 1 , 2 , and 4 and no correlation between questions 1 and 2 ( how satisfied are you with your health ? ) . question 2 was correlated with all of the domains . there was negative association between question 1 and falls , and a slight correlation between the dynamic gait index scores and question 1 . conclusion the self - perception of the study group about their quality of life was either good or very good , even though a considerable percentage of individuals had suffered falls or reported gait disturbances ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: recist ( response evaluation criteria in solid tumors ) criteria have been widely used for response assessment both in general clinical practice and clinical trials . the criteria have been designed to be objective and reproducible . however , in recist , the focus is on unidimensional imaging and volumetric changes are not included . this lacuna was accepted in the 2009 update of recist ( version 1.1 ) ; however , unidimensional imaging remained the standard as volumetric assessment was not considered to be standardised appropriately , and the measurements were often time - consuming and required special techniques . furthermore , recist criteria are easier to apply in well - defined lesions , as in metastatic nodules . the application of these criteria in complex , irregularly shaped tumors like head and neck cancers might be more difficult . this assumes significance in situations where response to initial therapy would dictate the next treatment protocol , especially in patients being treated with curative intent . prasad et al . have shown that the treatment response was graded differently based on volumetric measurement as opposed to unidimensional imaging of tumor burden in head and neck cancers . thus , reliance on recist criteria alone for assessing response might have an implication on the treatment algorithm in head and neck cancers . induction chemotherapy is one of the treatment options in patients with head and neck cancers . the aim of induction chemotherapy is to decrease tumor load and to eradicate potential systemic micrometastases . the ideal response would be a pathological complete response ( pcr ) indicating chemosensitive disease . this was confirmed by licitra et al . ; those patients who achieved pcr post - induction therapy had a 5 - year survival of 78 % as opposed to 40 % in those who did not achieve pcr . at our centre , patients with borderline resectable tumors as determined by radiological imaging in a multidisciplinary clinic are treated with neoadjuvant chemotherapy ( nact ) . based on the radiological and clinical responses , further treatment could be definitive surgery or concurrent chemoradiotherapy . in our initial experience of oral cavity patients , there was a perceived discordance between response rates assessed by axial imaging and clinical resectability achieved at the end of induction .28.5 % of patients with radiological partial response ( pr ) were deemed clinically unresectable while , conversely , 35 % of patients with stable disease ( sd ) later underwent curative resection ( sent for publication ) . considering the discordance between the radiological response rates and surgical decisions and the proven significance of pathological response , we decided to analyse the correlation between radiological decrement in size of primary and pathological decrement in size of primary tumor . the aim was to study the positive predictive value ( ppv ) and negative predictive value ( npv ) of radiological response to induction chemotherapy ( complete response ( cr ) + partial response ( pr ) ) as a predictor for achievement of pcr . we gave importance to npv as if a patient would be denied a potentially curative treatment on the basis of its result ; then we feel that there should be a high npv of such a test . we performed a retrospective analysis of our neoadjuvant chemotherapy ( nact ) database which included all patients sequentially attending the head and neck services medical oncology outpatient department with the data being entered prospectively . all patients who received nact from august 2008 till april 2012 were screened . those patients who underwent axial imaging ( either computed tomography or magnetic resonance imaging ) not more than 1 month prior to starting nact and reassessment with the same imaging modality within 1 month of completion of nact were selected . among this cohort , the patients who underwent surgery within 6 weeks of last radiological assessment and had achieved either a pathological complete response or near pathological complete response at site of primary were selected for the present analysis . the pre - and post - nact axial images for all patients were reviewed by the radiologist , and the response was assessed according to recist criteria . the symptomatic response was documented in all cases and defined as a percentage reduction in size of the tumor as perceived by the patient at the end of nact . for the present analysis , analogous to the recist , a perceived decline of more than 30 % but less than 100 % was termed as prp , 100 % decline was termed as crp , a reduction not more than 30 % or a progression in size no more than 20 % was termed as sdp , and a progression in size of more than 20 % was termed as pdp . pathological complete response was defined as absence of foci of tumor cells at the local site ( pcr ) . near pathological complete ( pprl ) responsewas defined as either presence of scanty residual foci of cells or reduction of tumor size below 1 cm pathologically . a total of 1200 patients had received nact in head and neck cancers at our center within the last 4 years . unfortunately pathological cr rates are quite low in very locally advanced oral cancers ( which constituted 90 % of our whole population ) ; hence , only twenty - four patients were eligible for the present analysis . twenty - two patients ( 91.7 % ) had visible and palpable external swelling which was perceived by the patients . the primary site of tumor was oral cavity in 20 patients ( 83.4 % ) , maxilla in 2 patients ( 8.4 % ) , and laryngopharynx in 2 patients ( 8.4 % ) . in oral cavity , the most common primary was in the buccal mucosa in 16 patients ( 66.7 % ) . the t stage distribution was t1 in 1 patient ( 4.2 % ) , t3 in 5 patients ( 20.9 % ) , t4a in 14 patients ( 58.3 % ) , and t4b in 4 patients ( 16.7 % ) . the n stage distribution was n0 in 8 patients ( 33.3 % ) , n1 in 5 patients ( 20.9 % ) , n2 in 7 patients ( 29.2 % ) , and n3 in 4 patients ( 16.7 % ) . the clinical stage was stage iva in 16 patients ( 66.7 % ) and ivb in 8 patients ( 33.3 % ) . all of these patients were discussed in a multidisciplinary clinic , and a decision to administer nact in view of borderline resectability was made . due to poor performance of the traditional test of concordance we moved ahead to study whether there existed a relationship between decrement in size of the tumor radiologically and a decrement in size of the tumor pathologically . a scatter plot was plotted to study the relationship between percentage decrement in radiological size and percentage decrement in pathological size . since all body tissues are essentially three - dimensional , we tested whether reduction not only in single dimension ( linear fit ) but also in volume ( cubic fit ) or area ( quadratic fit ) of the tumor could correlate more consistently with the response . patients with pcr and those with scanty residual foci of cells were taken as having 100 % decrement . in those patients with decrement below 1 cm of tumor , the percentage of pathological decrement was calculated according to the formula given below.pathological decrement in size of tumor = maximum size in axial slice in axial imaging done prechemotherapy maximum size pathologically in post chemo resected specimen.proportional pathological decrement = pathological decrement in size of tumor / maximum size in axial slice in axial imaging done prechemotherapy.percentage pathological decrement = proportional pathological decrement 100 . pathological decrement in size of tumor = maximum size in axial slice in axial imaging done prechemotherapy maximum size pathologically in post chemo resected specimen . proportional pathological decrement = pathological decrement in size of tumor / maximum size in axial slice in axial imaging done prechemotherapy . scatter plot was plotted separately to study the relationship between percentage decrement in size reported by patient and percentage decrement in pathological size . then a correlation analysis was performed between the two parameters . the correlation coefficients are being reported with respect to the effect size as given by cohen . spearman correlation was done as the sample size was small and skewed so assumptions and conditions for use of pearson product moment correlation were violated . the chemotherapy schedule received was a 3 - drug combination of docetaxel , cisplatin , and 5 fu in 10 patients ( 41.7 % ) ; and 2 - drug combination of taxane and platinum in 14 patients ( 58.3 % ) . the waterfallplot of decrement in local tumor size according to radiological assessment and according to patient 's assessment of decrement in size of the swelling is shown in figures 1 and 2 , respectively . the overall response rate which included cr and pr was 45.8 % ( 11 patients ) . the patient 's perception of decline in swelling was documented in 22 patients , as only these patients had an externally visible and palpable swelling . crp was seen in 1 patient ( 4.5 % ) , prp was seen in 16 patients ( 72.7 % ) , and sdp was seen in 5 patients ( 22.8 % ) . the cross - tab between pcr and cr + pr combination has been shown in table 2 . it can be observed in the table that a significant percentage of patients ( 8/13 ) with radiological sd + pd eventually turned out to have pcr . the positive predictive value , negative predictive value , sensitivity , and specificity of radiological response ( combination of cr + pr ) to predict for pcr were 45 % , 38 % , 38 % , and 45 % , respectively . the scatter plot of the relation between percentage decrement in pathological specimen and percentage radiological decrement in size is shown in figure 3 . the scatter plot of the relation between percentage decrement in pathological specimen and percentage decrement in patient reported size is shown in figure 4 . on correlation analysis the spearman correlation coefficient was 0.174 ( p = 0.415 ) . though the correlation coefficient was numerically better and was unidirectional for patient reported decline in size , it was not statistically significant . the intent of recist is to provide objective , uniform , reproducible , and standard guidelines which could be applied in a uniform manner while reporting chemotherapy response rates . recist criteria are now more frequently used than who criteria as these are easier to apply ( single dimension measurement ) , lesions have been defined as measurable and nonmeasurable , the numbers of target lesions have been defined , the type of imaging has been defined , and a specific cut - off for progression has been defined . in recist the unidimensional measurement in the preintervention and postintervention scans is not necessarily the same . this implies that the longest dimension selected in the postintervention scan need not be the same as used in the preintervention scan . head and neck cancers arise in areas of complex anatomy with complex fascial planes , bones , and soft tissue . figures 5 ( a ) and 5 ( b ) depict one example of complex shapes often seen in head and neck cancers . in the present paper , we have shown that there is no correlation between the radiological response and the postoperative pathological response . furthermore , both the positive and negative predictive values of radiological response ( combination of cr + pr ) for prediction of pcr are below 50 % . this implies that radiological response alone can not accurately judge the actual pathological response within the tumor . consequently , relying on radiological criteria alone could conceivably limit the ability to distinguish responders from nonresponders . these results are in accordance with our previous experience where nearly one - third of patients with partial response did not undergo surgery while nearly one - third of patients with stable diseases according to radiological criteria underwent curative surgery . a hypothetical situation illustrates the limitations of recist in head and neck cancers . in scenario a , figure 6 , the target lesion is circular in axial image and shrinks centripetally following chemotherapy . thus , unidimensional measurement would proportionally predict for the change in volume . similarly in scenario b , a simple shaped tumor undergoes centrifugal shrinkage . the change in unidimensional measurement would predict for change in volume in this case too . posttherapy , there is an obvious reduction in the volume of the lesion appreciated visually . however , due to irregular shape , unidimensional measurement alone , in accordance with recist , will fail to show a satisfactory response . such scenarios are not uncommon in locally advanced head and neck cancers where nact has been used and could be the reason for discrepancy between radiological and pathological size decrement . discordance between pathological and morphological remissions has been seen in other solid malignancies , notably germ cell tumors . fibrous tissue , treatment - related necrosis , and nonviable tumors may not get resorbed completely . change of recist criteria to functional imaging based criteria like percist ( positron emission tomography response criteria in solid tumors ) might overcome this fallacy . targeted therapy represents another situation where lack of morpholic response does not imply lack of efficacy . in our analysis , we included patients with pcr as it appears to be a surrogate marker for improved survival . however , it was felt by the investigators that many patients would have nonmeasurable disease so we decided to include patients with disease on gross pathological examination below 1 cm . expanding the selection to include patients with residual disease on gross pathological examination below 1 cm enhanced our ability to see the correlation between decrement in size suggested by axial imaging versus decrement observed on pathology . all the scans of the patients included in this study were initially reported by dedicated oncoradiologists and reviewed by oncoradiologists of the head and neck multidisciplinary clinic . though majority of the scans ( 75 % ) were done in our institute , the remaining were done at other centres . sinceall the scans were later reviewed by our radiologists and found to be of adequate quality , we believe that this may not have significant effect on the results . at present , we do not have long - term follow - up data for these patients . in spite of these shortcomings , we believe our findings highlight the fallacies intrinsic to using recist criteria alone for the evaluation of response to chemotherapy in head and neck cancers . a combined assessment tool which includes physical examination , visual inspection ( with pre - and postphotographs ) , surgical opinion , patients ' perceived change in the tumor , and radiological responses is needed to accurately identify patients who derive with induction therapy and can have operable disease posttreatment . a comparable paradigm could be the use of separate criteria as have been developed for gastrointestinal stromal tumor ( gist ) and hepatocellular carcinoma . pcr is an important surrogate marker for long - term survival in patients with head and neck cancers . presently used radiological response criteria for response assessment appear to be inadequate in identifying true pathological response . this suggests an urgent need for developing new criteria for predicting response in head and neck cancer patients receiving neoadjuvant chemotherapy .\noutput:\n" }, { "from": "agent", "value": "this study studied the coorelation between radiological response to induction chemotherapy and acheivement of pcr or near pcr . it was a retrospective analysis in which all patients who received nact from 2008 till april 2012 were subjected to inclusion criteria . coorelation analysis was performed between cr + pr and acheivement of pcr or near pcr . twenty four patients were identified.the primary site of tumor was oral cavity in 19 patients ( 79.2 % ) , maxilla in 2 patients ( 4.2 % ) , laryngopharynx in 2 patients ( 4.2 % ) and oropharynx in 1 patient ( 4.2 % ) . the clinical stage was stage iva in 16 patients ( 66.7 % ) and ivb in 8 patients ( 33.3 % ) . the overall response rates ie a combination of cr and pr was seen in 11patients ( 45.8 % ) . the pcr was seen in 15 patients ( 62.5 % ) and rest had near pcr . there was no linear coorelation between radiological size decrement and tumor response . on coorelation analysis the spearman correlation coefficent was 0.039 ( p = 0.857 ) . this suggest that presently used radiological response criterias for response assesment in head and neck cancers severly limit our ability to identify patients who would have pcr or near pcr ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a physiologically based pharmacokinetic ( pbpk ) model would allow for simulating the dynamics of pesticide absorption , distribution , metabolism , and elimination ( adme ) from different routes of exposures and , in theory , could be used as a tool for evaluating biomarker measurements ( e.g. blood or urine levels ) associated with the exposures . the mechanistic representation of biological processes embedded in the pbpk model allows systematic route , dose , and species extrapolation , and for these reasons , pbpk models have been applied in pesticide risk assessments that are relevant for the interpretation of biomarker data . although the interpretation of pbpk model outputs could provide a link to the regulatory metrics in the form of reference dose , its application remains problematic due to the fundamental limitations resulting from the potential measurement errors associated with the aggregate exposure measurements . although those aggregate exposure data are needed in order to simulate the dynamics of adme for a specific pesticide , the uncertainties , mainly the temporal and spatial variations , associated with the measurements may inadvertently be carried over to the model outcomes . those uncertainties , however , are merely explicit statements of underlying assumption applied in the analysis of urinary biomarker data . a simple pharmacokinetic ( spk ) model incorporating reverse dosimetry and pbpk modeling approach , on the other hand , only requires urinary biomarker data as inputs and the a - priori knowledge of the exposure pathways for individuals . the use of urinary biomarker data in the spk simulation might be advantageous over the traditional pbpk model because urinary excretion is a primary route of elimination for many compounds , and urine samples are relatively easy to collect from individuals comparing to the aggregate environmental samples . the spk model allows for the estimation of absorbed dose from a dominated route of exposure while reducing the number of inputs into the model and could potentially minimize the uncertainties . therefore , the development of spk model may be important in the field of pbpk model by reducing the resources needed to model the dose metrics of certain chemicals . in this paper , we illustrated the development of an spk model adapted from a previously published pbpk model and the performance of the exploratory analysis using urinary biomarker data as inputs to the spk model . the effectiveness of the spk model in the pesticide risk assessment was evaluated by comparing the dose estimates among three different composites of biomarker data . the development of the spk model began with the pharmacokinetic equations that are used in previously developed pbpk models for animal and human data . while the solution of a conventional pbpk model results in a uniquely determined excretion profile of urinary biomarker , the reverse dosimetry analysis in this spk model development , which uses urinary biomarker concentrations as input , does not lead to a unique solution . it is , therefore , necessary to constrain the dose profile with additional information to reach an optimum dosing profile . we assumed that the predominant exposure pathway for organophosphorus ( op ) pesticides is via foods and , therefore , constructed the spk model focusing on oral ingestion . such assumption was based on the results of aggregate exposure assessment , and the previous pbpk model outputs which shows very little op residues in the environment and suggests dietary intakes of op pesticides constitute the majority of urinary metabolite concentrations , respectively . data employed in this spk model simulation were collected from a cross - sectional study with repeated biological and environmental sampling conducted in washington state in 1998 . results for the environmental measurements of several op pesticides and their respective urinary metabolites , as well as for absorbed dose reconstruction using a conventional pbpk model , were published previously . in brief , the study was conducted in the homes of 13 children ages 36 , who either lived in an urban / suburban ( nonagricultural ) area or in the agricultural region in which ops have been used in the nearby fruit tree orchards . each home was sampled for two 24 - hour periods ( over 3 days ) in summer and fall of 1998 . environmental and biological sample collections included 24 - hour indoor air , drinking water ; outdoors soil , house dust , toy wipes , 24 - hour duplicate diets , and 4 spot urine samples over a 24 - hour period ( figure 1 ) . the 1998 study was designed to capture the aggregate op exposures in the subsequent 4 spot urines over the course of a 24 - hour period . these were the before bedtime voids on the first day and the first morning lunch , and dinner voids on the second day . chlorpyrifos ( cpf ) was selected as the modeled pesticide in this study because it was commonly detected in the environmental matrices , and its specific metabolite , 3,5,6 - trichlorpyridinol ( tcpy ) , was frequently measured in the urine samples , as compared to other op pesticides . urinary data from the 1998 study , including tcpy concentrations , urine void volumes , and urine sample collection times , were used as inputs into the spk model to estimate the absorbed dose of cpf . the study protocol and procedures to obtain the assent of the children and informed consent of their parents or guardians were reviewed and approved by the university of washington institutional review board ( irb ) . the use of those data in the pbpk model analysis was reviewed and approved by emory university irb . tables in the database were structured in the same form as the raw study data to allow for easier manipulation of the data later in the analysis . there were missing values ( not collected ) , including the void and exposure times , values for void volumes , and values for the weight of the study subjects that were necessary to create the data file . values for the default void and exposure times were chosen based on a previous data file for the matlab pk model script . values for the default void volume were taken from a study by voorhess which examined urinary catecholamine excretion by healthy children . lastly , values for the default weights of children were taken from table 7 - 3 of the exposure factors handbook . tables were created to hold these values specific to sample , age , or sex depending on the measure . queries were written in sql to create the data files for input into the spk model . sql was used to join data from separate data tables into one query output , to make logic and arithmetic transformations to the data for input into the model , and to allow for dynamic creation of data files simplifying modification of data input file creation . since some of the data that are necessary to create the input file were missing , default values had to be calculated . this was done according to the type of data that was available and which data would provide values that would best represent the inputs . the script would first try to determine values based on data that would yield the most representative values . if this data was not available , then it would try other data that would yield less representative values successively based on availability of the relevant data until it reached the least representative values . the qry_calcttime query was used to calculate the previous and current void times using available data and default values depending on the data that was available . the qry_urinesampcalc query was used to calculate the urinary excretion rate from metabolite concentrations , sample void volumes , and times from qry_calcttime . once these queries produced the correct data for input into the model , the main query was used to export the data from access into excel 972002 format . once constructed , each of the input file for the matlab spk model script ( see supplementary material available online at doi : 10.1155 / 2012 / 131854 ) had nine variables . the subject i d was the part before the separator , and the study period was the part after the separator . for the study period , 1 signified the summer period , and 2 signified the fall period . for example , the identifier 114.1 denoted subject i d 114 in the summer study period . the third variable held the average metabolite urinary excretion rate that was calculated using the urinary metabolite concentration , the volume of the void , and the times for the previous and current void ( 1 ) ueravg ( mmol / hr ) = cuvu ( tc tp ) . in this formula , ueravg is the average urinary excretion rate between the current void and the previous void , cu is the measured metabolite concentration in the urine , vu is the volume of the void , tc is the time of the current void , and tp is the time of the previous void . the fifth variable denoted the route of the exposure and scenario , where 1 is an inhalation exposure , 2 is a dermal exposure , and 3 through 7 are bolus events . in this analysis ,3 was the first morning void on the second day , 4 was the lunchtime void , 5 was the before bedtime void on the first day , and 6 was the dinnertime void on the second day . the sixth variable held the start time of the exposure event on a 24 - hour clock with 0 at midnight before the exposure event . however , for the current analysis , this variable was not used since the exposures that were analyzed were bolus events . the eighth variable held the time of the previous urine void before the exposure event on a 24 - hour clock . the ninth variable held the time of the current urine void sample before the exposure event on a 24 - hour clock . once input files were created , the spk model was run using matlab version 7.0.1 . each input into the simple spk model was able to calculate an estimated absorbed dose for cpf by fitting the input variables to a generalized dose absorption curve . it then calculated the absorbed dose by finding the area under the curve over the course of a day . due to the construction of the script , the model was only able to compute one dose estimate from one exposure rather than from a collection of exposures . using the output from the spk model script , we composited four spot urine samples in three different ways in order to estimate the daily absorbed doses of cpf in three different scenarios . for the first composite ( spk i ) scenario , only tcpy concentrations from the first morning void were used to calculate the dose estimate . this void was suggested to be an accurate measure of tcpy metabolite because it was assumed that tcpy concentrations in the urine were 0 after the before bedtime void . urine would then be formed and held during the night and voided in the morning , which would give the sample greater accuracy in determining metabolite concentrations since a long period of time had elapsed before the void . for the second composite ( spk ii ) scenario , dose estimates from the before bedtime void and the first morning void were averaged normalized by the volume of each void . this was done because the spk model was only able to analyze one sample at a time rather than taking a collection of samples and computing a dose from them . in this calculation , it was assumed that metabolite concentrations from the before bedtime void and the first morning void were both due to exposure from dinner on the first day . since metabolite concentrations were assumed to be caused by the same exposure event ( dinner event ) , they should compute to the same absorbed dose . therefore , the two dose estimates were averaged to provide a fair measure based on both outputs . in order to determine the times used to calculate the urinary excretion rate for the before bedtime sample of spk ii , we used the volume of the void sample to estimate the time that the urine was allowed to collect in the bladder . this estimate was based on the average daily void volume of children of the same age and gender over a 24 - hour period . by dividing the sample void volume by the average daily void volume , the time that the urine was allowed to collect in the bladder was estimated using ( 2 ) , in which ( tc tp ) is the difference in hours from the time of the current void ( tc ) to the time of the previous void ( tp ) , vu is the volume of the urine sample , and vavg24 is the volume of the average daily void over the span of 24 hours : ( 2 ) ( tctp ) ( vuvavg24 ) 24 for the third composite ( spk iii ) scenario , dose estimates from the before bedtime void on the first day , and the first morning void , the lunchtime void , and the dinner void on the second day were averaged to reach a single absorbed dose estimate . for this calculation , the beginning exposure time for the lunch and dinner voids on the second day was set at dinner time on the first day . we assumed that part of the urinary metabolite measurements from the lunchtime and dinner voids on the second day may come from dinnertime exposure on the first day . since absorbed dose estimates could not be calculated using more than one exposure , a composite meal exposure was created using urinary metabolite measurements from the before bedtime void on the first day , the first morning void , the lunchtime void , and the dinnertime void on the second day . the time of the composite meal exposure was set at dinnertime on the first day . the results from the four estimates were then averaged to get an overall absorbed dose estimate . again , the times used to calculate the urinary excretion rate were estimated from dividing the sample void volume by the average daily void volume using ( 2 ) . the pbpk model was developed to quantitatively integrate the physiological , metabolic , and biochemical factors associated with adme . although the initial model validation has proven the accuracy of predicting cpf exposures , it was found later that the effectiveness of the pbpk model was highly dependent on the model parameters and the limitation of the input exposure data . this limitation has been highlighted in a recent study in which the pbpk model failed to predict tcpy excretion as compared to tcpy levels measured in urine collected from study subjects . such failure exposes the vulnerability of employing pbpk models in risk assessment without sufficient knowledge or assurance of the quality of exposure data that are used as pbpk model inputs . therefore , we were prompted to develop this simple pharmacokinetic model in order to improve the ability for estimating absorbed dose using urinary metabolite data as the model inputs . should tcpy levels measured in urine be considered the gold standard in reflecting the exposure to cpf ( by subtracting the preformed portion of tcpy ) , the use of urinary tcpy data in the pharmacokinetic analysis would provide more reliable dose estimates of cpf than using aggregate exposure data . the spk model simulation yielded to a total of 88 cpf dose estimates , separated by summer and fall seasons . the dose estimates resulted from the first morning void measurements appeared to be lower than but not significantly different to those using before bedtime , lunch , or dinner voids ( figure 2 ) . those estimates were modeled assuming that the exposure to cpf occurred during dinner meal ( at 7 pm ) on the first day . knowing that the biological half - life for orally ingested cpf is approximately 16 hours , the estimated absorption curve for the first morning void may mostly reflect the intake of cpf from dinner last night . dose estimates for spot urine samples collected later in the 2nd day were increasingly larger , suggesting additional cpf exposures from earlier in the day ( breakfast and lunch ) . dose estimates from before bedtime void samples were likely to be representative of cpf exposures that occurred throughout the first day rather than intakes from dinner , as was modeled . the disparity among the dose estimates using spot urinary tcpy measurements in different time points raises the concern of the validity of using single spot urinary measurement as the basis of dose estimation in risk assessment . the magnitude of such uncertainty would be considerably larger under the circumstance in which spot urine samples are collected at different time points within a predetermined time period ( e.g. , 24 hours ) from individuals . for instance , the national health and nutrition examination survey ( nhanes ) conducted by the center for disease control and prevention ( cdc ) collected single spot urine samples from subjects based on their appointments . if tcpy data from nhanes were used in the spk model simulation , the interpretation and the conclusions of the estimated doses for cpf in nhanes subjects should therefore be cautiously made . georgopoulos et al . also raised this issue in their case study involving the use of a physiologically based toxicokinetic modeling in conjunction with numerical inversiontechniques for reconstructing cpf exposure using tcpy data measured in the national human exposure assessment survey ( nhexas ) . as authors statedalthough the nhexas data set provides a significant amount of supporting exposure - related information , especially when compared to national studies such as the nhanes , this information is still not adequate for detailed reconstruction of exposures under several conditions , as demonstrated in the paper . we estimated the daily absorbed cpf doses for individual children using three different composites of the 4 spot urine biomarker measurements ( table 1 ) . dose estimates for spk i , ii and iii were not significantly different ( one - way anova ) ; however , the box plot in figure 3 showed that the median dose estimate from spk i model simulation are lower than those of spk ii and iii , consistent to the trend for the individual void simulations . while this may suggest that dose estimates between models reflect similar cpf exposure among subjects , it is also possible that the similarity among dose estimates is merely the result of the dose estimation being based on shared data . for instance , spk ii was based on the average between spk i and the dose estimates using the before bedtime voids , and spk iii was based on the estimates that comprised the spk ii estimate and estimates from the lunch and dinner samples . the spk ii dose estimates seemed to be more accurately representative of the daily exposure to cpf simply because it takes into account the excretion of tcpy in before bedtime voids in day 1 and the first morning voids in day 2 . the additional cpf exposure between lunch and dinner , if any , captured in the spk iii dose estimates did not significantly increase the overall daily dose estimates would support the validity of using spk ii as the benchmark for daily cpf absorbed dose . comparing the dose estimates by seasonality and the community where children lived in 1998 , we found that children living in urban / suburban have higher cpf exposure than those lived in agricultural community , and their cpf exposure was higher in fall than in summer season . the spk dose estimates for individual children participating in the 1998 study were significantly higher than those using the conventional pbpk model approaching , as published earlier . the highest pbpk predicted cpy dose of 2.3 g / kg / day resulted from the consumption of a food item containing 350 ng / g of cpf remained as the highest in the spk i , ii , and iii simulations with the estimated cpf doses of 9.1 , 5.5 , and 3.7 g / kg / day , respectively ( table 2 ) . the striking difference of dose estimates between these two pharmacokinetic models may be primarily due to the differences of input data . the use of aggregate exposure assessment as the input variables in the pbpk models targeted at chemicals with short biological half - lives , such as cpf , is prone to significant spatial and temporal variations associated with exposures that would lead to inaccurate outcome measurements . this is evident by the fact that the majority of the data collected from the environment ( figure 1 ) where the children lived were nondetectable for cpf residue , while spot urine samples collected from those same children frequently contained tcpy . by taking into account the degradation of cpf in the environment ( or in foods ) in the pbpk model simulation as described in previous studies , the pbpk model predicted that tcpy excretion was still not within a reasonable range of accuracy to the measured tcpy levels which are used in the spk model simulation . it is apparent that the 24 - hr aggregate exposure assessment is not capable of capturing cpf exposure in those children . this leads to the serious doubt of the validity of applying aggregate exposure measurements to the pbpk model simulation and subsequently in the risk assessment . the use of urinary tcpy data in the spk model simulation intuitively provided a plausible alternative to pbpk model in reconstructing the absorbed cpf dose . in theory , the dose estimates resulting from either pbpk or spk approach should yield to numerical values that are not significantly different to each other , particularly in this case in which both models were constructed using identical parameters , and the input data were collected from a study that is designed specifically for validating the pbpk model simulation . however , the problem of significant under estimation of cpy doses using the traditional pbpk , as identified in this paper , would be even more prevalent and dramatic under other circumstances in which less - structured environmental exposure data are collected and used as the pbpk model inputs . similar to other pbpk model applications , assumptions are needed in the spk models in order to facilitate the model simulation . the unique assumptions for spk model simulation include the prior knowledge of the predominant exposure pathway ( such as dietary intake in this project ) and the default time of exposure ( dinner in day 1 ) . without detail information of the exposure , those assumptions have to be made either arbitrarily ( time of exposure ) or by interpretation of study observations ( dietary ingestion ) . a mischaracterization of the predominant exposure pathway ( such as dietary intake versus inhalation ) will lead to completely different spk simulation and outcomes . due to the limitation in constructing the script files , the spk model is only able to compute one dose estimate from one urinary biomarker data input , instead of from a series of urinary biomarker data input within 24 hours . in order to overcome this limitation , we used the average dose estimates in spk ii and spk iii to incorporate more urinary biomarker data that is related to the interest of a specific exposure event in the simulation . it is likely that we would introduce unknown uncertainties to the overall simulation because urinary tcpy levels measured in the dinner time may include cpf exposure in day 2 which is not the interest of the analysis . although the magnitude of such uncertainty is relatively minimal in this study , by further examining the data for spk ii and spk iii , we acknowledge the existence of such uncertainty .\noutput:\n" }, { "from": "agent", "value": "we illustrated the development of a simple pharmacokinetic ( spk ) model aiming to estimate the absorbed chlorpyrifos doses using urinary biomarker data , 3,5,6 - trichlorpyridinol as the model input . the effectiveness of the spk model in the pesticide risk assessment was evaluated by comparing dose estimates using different urinary composite data . the dose estimates resulting from the first morning voids appeared to be lower than but not significantly different to those using before bedtime , lunch or dinner voids . we found similar trend for dose estimates using three different urinary composite data . however , the dose estimates using the spk model for individual children were significantly higher than those from the conventional physiologically based pharmacokinetic ( pbpk ) modeling using aggregate environmental measurements of chlorpyrifos as the model inputs . the use of urinary data in the spk model intuitively provided a plausible alternative to the conventional pbpk model in reconstructing the absorbed chlorpyrifos dose ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\noutput:\n" }, { "from": "agent", "value": "brain renin angiotensin system ( ras ) is significantly involved in the roles of the endocrine ras in cardiovascular regulation . our studies indicate that the brain ras participates in the development of cardiac hypertrophy and fibrosis through sympathetic activation . inhibition of sympathetic hyperactivity after myocardial infarction through suppression of the brain ras appears beneficial . furthermore , the brain ras modulates the cardiovascular and fluid electrolyte homeostasis not only by interacting with the autonomic nervous system but also by modulating hypothalamic pituitary axis and vasopressin release . the brain ras is also involved in the modulation of circadian rhythms of arterial pressure , contributing to non - dipping hypertension . we conclude that the brain ras in pathophysiological states interacts synergistically with the chronically overactive ras through a positive biofeedback in order to maintain a state of alert in diseased conditions , such as cardiac hypertrophy and failure . therefore , targeting brain ras with drugs such as renin or angiotensin converting enzyme inhibitors or receptor blockers having increased brain penetrability could be of advantage ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: metallic nanostructures composed of more than one component have attracted attention because of their vast potential for multifunctionality . in the best cases , such architectures provide function beyond the sum of their parts , enabling useful or unique combinations such as plasmon - enhanced catalysis , magnetically addressable drug delivery systems and catalysts , or combined contrast agents and hyperthermal cancer treatment . the combination of a plasmonic and a catalytic material is particularly interesting because plasmonic materials can interact with light in unique ways . an example is the emergence of localized surface plasmon resonances ( lsprs ) , which are light - driven , coherent oscillations of the conduction electrons in metallic particles smaller than the wavelength of light . lsprs create enhanced local electric fields that can increase signal intensity in optical spectroscopies , giving rise to techniques such as localized refractive index sensing and surface - enhanced raman , fluorescence , and infrared absorption spectroscopies . these approaches are exceptionally sensitive to subtle changes in surface chemistry , sometimes down to the single - particle level , and can provide feedback on chemical reactions as they occur . the decay of the lspr can also be useful and may lead to either localized heat or hot electrons that can speed up or enable new chemical reactions . combining materials in controllable waysis a prerequisite for the creation of multifunctional optical and catalytic nanostructures . these combinations are particularly interesting in cases where catalytic metals such as pt and pd do not sustain strong plasmon resonances ( due to significant losses in the visible range ) and where more traditional plasmonic metal nanoparticles such as au and ag may not be well - suited as catalysts for a target chemical reaction . several studies have now shown lspr activity both numerically and experimentally in core , the morphology and optical properties of triangular au nanoprisms decorated with pt nanoparticles ( nps ) of sizes relevant for catalysis ( 36 nm ) are reported . the alignment and structure of particles on both the side and large { 111 } au facets are disclosed , as are the different lsprs sustained by these bimetallic architectures . hexadecyltrimethylammonium bromide ( ctab , 99 % ) , chloroplatinic acid ( h2ptcl6 , 8 wt % in h2o ) hydrogen tetrachloroaurate trihydrate ( haucl43h2o , 99.999 % ) , l - ascorbic acid ( 99 % ) , sodium borohydride ( nabh4 , 99.99 % ) , sodium hydroxide ( 99.99 % ) , sodium iodide ( nai , 99.999 % ) , and trisodium citrate ( 99 % ) were obtained from sigma - aldrich and used as received . nanopure water ( thermo scientific , 18.2 mcm ) was used for all washing , synthesis , and purification protocols , as well as in the preparation of all solutions . all stock solutions were aqueous and prepared fresh before each reaction , unless otherwise noted . all glassware was washed with aqua regia ( 3:1 ratio of concentrated hcl and hno3 by volume ) and rinsed thoroughly with water . caution ! two hours after au nanoparticle seeds were added to the nanoprism growth solution , the reaction mixture was heated in a h2o bath to 37 c for 1 min to dissolve any ctab that may have recrystallized during the growth period ( this crystallized ctab can interfere with nanoprism purification by centrifugation ) . to separate the nanoprisms from pseudospherical nanoparticle reaction byproducts ,90 ml of the reaction mixture was divided into 15 ml conical tubes and centrifuged at 820 relative centrifugal force ( rcf ) for 15 min ( eppendorf centrifuge 5804 with swing bucket rotor a-4 - 44 ) . the supernatant and pellet were both extracted , and the nanoprism thin film was resuspended in 1.0 ml of h2o by vortexing for 5 s. to remove additional ctab and excess reagents , this mixture was transferred to 1.5 ml centrifuge tubes , and the prisms were then centrifuged using a spectrum mini - centrifuge ( sc1006 - r ) for approximately 5 min . after centrifugation , the supernatant was removed and the prisms were resuspended in 1.0 ml of h2o and subsequently combined in a 15 ml conical tube . the concentration of the purified nanoprisms in the nanoprism stock solution was then adjusted by diluting with h2o to an optical density ( o.d . ) of 1.0 at the maximum absorption wavelength ( max , approximately 1300 nm ) by ultravioletpt was deposited on the au nanoprisms using the purified au nanoprism product ( synthesis described above ) . briefly , 0.5 ml of the prism stock solution ( o.d . at max = 1.0 ) was added to a 1.5 ml centrifuge tube and diluted with 0.5 ml of water . to this mixturewas added 20 l of 20 mm ascorbic acid ( for a final h2ptcl6 : ascorbic acid molar ratio of 1:10 ) , and the solution was briefly mixed by vortexing . then , 4 l of 10 mm h2ptcl6 was added ( ph 1.8 ) , and the solution was mixed by vortexing again . after allowing 1 h for completion of nanoparticle growth , the reaction mixture was purified from excess reagents by centrifugation ( 5 min at 2200 rcf using a spectrum mini - centrifuge ( sc1006 - r ) ) . after removal of the supernatant , the particles were resuspended in 1.0 ml of h2o by brief sonication ( 10 s ) . the extinction spectra of the resulting colloid were measured by uv vis nir spectroscopy using a cary 5000 spectrophotometer ( agilent , inc . ) . spectra were baseline - corrected with respect to the spectrum of water for optical density measurements . particles were drop cast from solution onto si3n4 membrane windows for electron energy loss spectroscopy ( eels ) , ( temwindows inc . ) or thin carbon film supports for tomography and energy - dispersive x - ray spectroscopy ( eds ) , ( agar scientific ) immediately prior to analysis . electron energy - loss spectroscopy ( eels ) data of decorated au prisms were obtained on a monochromated , cs - and cc - corrected fei titan g4 pico ( forschungszentrum jlich ) equipped with a gatan quantum ers electron spectrometer . eels data from bare au nanoprisms , the precursor to the decorated nanoprisms , were obtained on a monochromated , cs - corrected fei titan themis ( rice university ) equipped with a gatan quantum ers electron spectrometer . the pixel dwell time was set to 4050 s and 0.02 s on the pico and themis , respectively . the beam energy was set to 80 kv in both instruments to optimize the width of the zero - loss peak ( zlp , 0.08 ev on the pico and 0.13 ev on the themis ) and to maximize the plasmon interaction cross section . eels spectrum images were obtained for six decorated au / pt nanoprisms and five undecorated au nanoprisms , from which three representative examples of each are shown in the paper and supporting information . high - angle annular dark - field scanning transmission electron microscopy ( haadf - stem ) tilt series images for tomography were acquired on a cs - corrected fei titan g2 chemistem equipped with a bruker super - x quad eds detector and operated at 80 kv . an eds spectrum image was acquired with 10241024 pixels and 4096 energy channels ( 0.01 kev dispersion ) on the same fei titan g2 chemistem instrument . eds data analysis was performed in hyperspy ( open source software , available at hyperspy.org ) on a 4 spatially binned spectrum image ( 256256 pixels and 4096 energy channels for improved intensity statistics ) . x - ray intensities reported are background - subtracted , integrated over an appropriate window centered around the pt and au l and l1 lines ; the m lines for these elements were not used because they present a high degree of overlap . haadf - stem tilt series images for electron tomography were acquired manually , with tilt increments of 2 or 5 and angular ranges of ca .65 , and were aligned using a combination of cross - correlation ( fei inspect3d ) and landmark - based alignment ( tomoj ) . the tilt series images were background - subtracted and normalized such that all images in each tilt series had the same integrated intensity ; these steps reduced the impact of carbonaceous contamination and diffraction contrast . tomographic reconstruction of the background - subtracted tilt series was carried out via a compressed sensing approach , using the astra toolbox ( available at https://sourceforge.net/projects/astra-toolbox/ ) in conjunction with a 3d implementation of tval3 ( ref ( 44 ) , available at http://www.caam.rice.edu/~optimization/l1/tval3/ ) for total variation minimization . a thorough description of total variation minimization and its implementation in electron tomographic reconstruction can be found in references ( 41 , 42 , 44 , and 45 ) . volume rendering and isosurface visualizations of the 3d reconstructions were generated using paraview ( available at http://www.paraview.org/ ) . the z - direction labeled on the reconstructions is parallel to the optic axis ( the missing wedge direction ; supporting information ) ; the y - direction is parallel to the tilt axis , and the x - direction is perpendicular to these . stem - eels data analysis was performed in hyperspy . a 200200 pixel 2048 energy channel ( 0.01 ev dispersion ) spectrum image was acquired for the particle shown in figures 6 and 7 ; a blind source separation approach based on non - negative matrix factorization ( as described previously ) was used to decompose the spectrum image into a set of n spectral components ( or factors ) , which were then used to reconstruct the eel spectra at each pixel . because the whole data set is fitted at once , information about both the spectral and spatial distribution of lsprs is obtained . the same n components are used to fit each spectrum ; their relative intensity is varied at each point . the amount by which each component is multiplied for each point is referred to as a loading ; mapping this loading provides information about the spatial distribution of the probability of exciting this particular component . note that components are not constrained to specific lineshapes . the reduction of h2ptcl6 on large ( 100300 nm edge length ) colloidal au nanoprisms yielded an array of small pt nps decorating the au { 111 } facets ( figure 1 ) . in addition to triangular structures , the reaction mixture contained a small number of various truncated nanoprisms , hexagonal plates , and some elongated , ribbon - like morphologies ( figure s1 ) . all particle shapes are thin plates ( typically ca . 7 nm thick ) , display broad { 111 } facets , and also support the deposition of pt nps . pt - decorated au nanoprisms : ( a , b ) haadf - stem images of au nanoprisms before and after pt decoration ; ( c ) haadf - stem image and ( d , e ) stem - eds maps of pt and au . the red and yellow ellipses highlight areas of high and low pt concentration , respectively . the composition of the decorated nanoprisms was confirmed to be au and pt by eds . figure 1d , e shows elemental maps for pt and au ( obtained from the background - subtracted integrated intensities for both l and l1 emission , located at 9.71 and 11.44 kev for au and 9.44 and 11.07 kev for pt ; a full spectrum and additional maps are available in figure s2 ) . the eds map for au is generally homogeneous , as expected for a prismatic nanoparticle . the regions of higher x - ray intensity correlate well with the regions of higher haadf - stem intensity , as shown by red ellipses in figure 1c , d . thicker regions of material or higher atomic number ( z ) material give rise to stronger scattering and thus higher haadf - stem intensity . in this case , the values of z for au and pt are nearly identical , and the haadf contrast is mainly due to thickness effects . the correlation between the pt eds map and the haadf - stem image indicates that the thicker regions are where pt nps have grown . analogously , the regions where fewer pt nps are present , contained in yellow ellipses in figure 1c , d , generate weaker x - ray emission in the pt map . finally , the eds signal from the nps located at the edges of the nanoprisms more clearly verifies their chemical identity , containing almost exclusively pt signals , as shown by the difference map in figure s2e . traditional ( electron or other ) transmission microscopy techniques provide an image that represents an integral projection through an object , meaning that information pertaining to three - dimensional ( 3d ) structure may be hidden . in the case of a very thin nanoprism decorated on both sides , this makes discerning the shape , size , and distribution of the pt nps on each respective side difficult , if not impossible . previous reports used scanning electron microscopy , an essentially surface - sensitive technique , to observe the alignment of the pt nps , bypassing the projection obstacle by observing strictly one side of the structure at a time . however , that approach does not readily allow analysis of both sides of a given nanoprism , nor of the full 3d structure . here , tilt series ( from large negative to large positive sample tilt angles ) of haadf - stem images were obtained and used to study the 3d structure of the pt - decorated au nanoprisms via tomographic reconstruction ( figure 2 and supporting information ) . this approach is successful because , as noted above , to a sufficient approximation ( supporting information ) the haadf - stem signal varies according to the thickness of the specimen ( i.e. , the thicker the region of the sample , the stronger the high - angle scattering and the higher the image intensity ) . this enables tomographic reconstruction of a 3d structure involving back - projection of the tilt series of images . volume rendering visualizations of the four pt - decorated au nanoprisms studied by electron tomography . ( a , b ) planar 7 nm thick au nanoprisms with lower and higher amounts of pt np growth , respectively ( total thickness 15 nm ) . ( c ) smaller ( edge length 110 nm ) but thicker ( 14 nm ) au nanoprism with extensive pt np growth ( combined thickness 25 nm ) . the inset orthoslice reveals well - defined convex { 111 } facets of the au nanoprism . further volume rending visualizations are available in figures s3s6 and movies 912 . from figure 2 , it can be seen that pt nps form in abundance over all of the faces of the nanoprisms ( further visualization is provided in the supporting information ) . in addition to enabling more clear analysis of the growth of pt nps on each of the large au { 111 } surfaces ( figure 2 and vide infra ) , the 3d reconstructions reveal information about the shape of the underlying au nanoprism . interestingly , in addition to the planar morphology expected ( figure 2a c ) , one of the nanoprisms is considerably bent ( figure 2d ) . this is consistent with the occasional observation of strong diffraction contrast in transmission electron microscopy ( tem ) and dark - field tem imaging , a consequence of local bending of the crystal structure . the bent morphology is fully revealed only by electron tomographic reconstruction . however , the vast majority of nanoprisms analyzed exhibit an overall planar morphology dictated by their face - centered cubic crystallography . figure 2c , for example , shows an orthoslice perpendicular to the large { 111 } facets , revealing a convex edge structure of the nanoprism , consistent with the presence of slow - growing { 111 } facets and predicted theoretically from modified wulff constructions . these nanoprisms are confirmed here for the first time to be very thin truncated bitetrahedra with eight { 111 } facets and , as previously known from electron diffraction , containing a central { 111 } twin plane . the electron tomography reconstructions also enable detailed analysis of the pt np morphologies , as shown in figures 3 and 4 ( further visualization is also provided in the supporting information ) . in figure 3 , orthoslices ( 2d slices through the 3d tomogram ) are shown at different heights , intersecting the nps on the extended faces of the au nanoprism at different vertical positions , as well as providing cross sections of the nps on the nanoprism side faces . projection images ( such as conventional 2d haadf - stem images ) mix the signal from nps on the top and bottom of the nanoprism , but the 3d tomogram and orthoslices enable separate analysis . sequential orthoslices ( a g ) through the electron tomographic reconstruction of a pt - decorated au nanoprism ( corresponding to that shown in figure 2a ) . orthoslices are labeled according to the regions of the pt nps on the extended faces of the au nanoprism that they dominantly intersect : roots , trunks , or caps , as labeled on the inset enlarged view of a side - face np in panel d. orthoslices for all nanoprisms studied by electron tomography are available in figures s3s6 and movies 58 . isosurface renderings of the electron tomographic reconstructions , showing the pt np morphologies . ( b , c ) specific morphologies : ( b ) distinctive root , trunk and mushroom - like caps ; ( c ) irregularly branched ( dendritic - type cap ) , and nps without caps and greater ( uncapped trunk ) and lesser ( stump ) height . the pendant pt nps grow epitaxially and exhibit a dendrite - like morphology , which is a growth mode observed in several systems involving pt overgrowth . however , the orthoslices ( figure 3 ) and 3d isosurface renderings ( figure 4 ) reveal several distinct motifs . morphology in which pt nps exhibit a narrow trunk region that is directly appended to the nanoprism surface and is capped by a more broad pt feature ; examples are highlighted in the enlarged region of figure 3d and in figure 4b . as highlighted in the enlarged region of figure 3 g and in figure 4c , there are also nps that develop an irregularly branched morphology ( dendritic - type ) , as well as particles that are not branched at all . in the case of extensive pt np growth ( figure 2c ; see also volume renderings and orthoslices in the supporting information ) , the nps form a dense array in which many of the particle branches are irregularly shaped and in which many pt nps are no longer discrete , as their branches are fused to those of neighboring nps . pt nps deposit on both the broad triangular facets and the side facets of the au nanoprisms and tend to align in parallel to one of the nanoprism edges . this alignment results in the formation of discrete lines of pt nps , although these may migrate and / or fuse over time ( figure 2c ) . the decorated triangular nanoprisms either exhibit pt np rows oriented to a single edge of the nanoprism , or there may be 2 or 3 different row directions , each of which is oriented parallel with respect to a different nanoprism edge . the separable analysis of top and bottom pt nps made possible by the 3d tomograms is useful to understand whether there is a relationship between the alignment of the pt nps on the top and bottom surfaces . registration could indicate cooperative alignment across the high curvature nanoprism side facets . to explore this possibility , the alignment of nps was analyzed using a series of orthoslices parallel to the main { 111 } facets ; each orthoslice enables analysis of the pt nps on either the top or the bottom , without any contribution from the other side . lines were drawn as shown in figure 5 , and the alignment was observed through a stack of orthoslices ranging from the np roots to their caps . although there is some similarity in line directions , this appears related more to growth mediated by the edges of the nanoprisms . the superposition of the top and bottom sets of lines ( figure 5d , h ) does not show explicitly consistent coupling of patterns for the top and bottom pt nps lines . this result indicates that there is no or minimal cooperative effects between growth on the top and bottom facets . alignment of the pt nps on au nanoprisms : ( a , e ) haadf - stem images , which comprise a projection through both top and bottom surfaces ; orthoslices of the tomographic reconstructions for the ( b , c ) top and ( f , g ) bottom surfaces , respectively , taken at heights corresponding approximately to the trunks of the pt nps ; and ( d , h ) schematic of top and bottom np growth lines . alignment is increased when the nanoprism symmetry is lowered to 2-fold , as seen in parallelograms ( supporting information ) , and when the size of the nanoprism is increased . conversely , nps tend to align less on small nanoprisms ; the particle shown in figure 2c , with less alignment of pt nps , is smaller than those in figure 2a , b . it is also worth making a brief remark that the pt np growth sometimes results in distinct circular patterns ( e.g. , figure s4c ) , as well as localized patches of lower np density or lower np growth , as revealed clearly by the orthoslices . note also that many of these regions of lesser np growth are not mirrored on the top and bottom surfaces , suggesting np growth ( and / or migration over time ) without top bottom coupling . the use of pt in the form of small , high surface area discrete nps on a plasmonic material such as au offers an opportunity for plasmon - driven catalysis and in situ monitoring of catalytic processes via surface - enhanced spectroscopies . using stem - eels performed in a monochromated fei titan , we confirmed that the presence of discrete pt nps did not prevent enhanced fields at the surfaces of the au nanoprisms . electrons passing near the surface of a plasmonic nanostructure can excite lsprs and lose the amount of energy associated with this resonance ; such electrons are dispersed by an electron spectrometer and imaged on a charge coupled device ( ccd ) camera , yielding information about the spatial distribution of lsprs . spectra at different positions of a 190 nm side length pt - decorated au nanoprism , binned from areas 5 pixels ( 9.3 nm ) wide , are shown in figure 6 . when the electron beam is near the nanoprism corners , a distinct peak is visible at 1 ev , indicating that many electrons lose 1 ev of energy . similarly , when the beam passes near the center of an edge , electrons are likely to lose 1.3 ev . these peaks suggest that the nanoprisms may sustain lsprs with different energy and spatial distribution . raw ( color - coded diamonds , binned 55 pixels equivalent to 9.39.3 nm ) and fitted ( linear combination of nmf - extracted components , black lines ) eels spectra obtained from a pt - decorated au nanoprism , at the positions indicated by color - coded squares in the haadf - stem image ( square sizes exaggerated by a factor of 3 for clarity ) . the solid and dotted black arrows show the approximate position of the corner and edge lsprs , respectively . scale bar , 50 nm . to unravel spatial and spectral information about lspr excitation on pt - decorated au nanoprisms , stem - eels spectrum images were analyzed using non - negative matrix factorization ( nmf ) ( see experimental details ) . this approach enables the extraction of both spectral component energy and spatial localization and has been applied to several systems , including bimetallics.figure 7 shows the results of this decomposition applied to the spectrum image of the nanoprism shown in figure 6 . four components were used because this number was found sufficient to explain the full spectrum image . systematic analysis ( ncomponents = 47 ) for the particle presented in figures 6 and 7 , and other particles , are reported in the supporting information . lsprs and other contributions to eels spectrum imaging of the pt - decorated au nanoprism shown in figure 6 . ( a ) nmf - extracted spectral components and fit of the raw data , for the eels response of a 55 pixel region ( 9.39.3 nm ) at the position in the inset ( purple square size exaggerated by a factor of 3 for clarity ) . ( b ) spatial loadings of each of the components across the full spectrum image ; zlp , ibts , edge lspr , and corner lspr . scale bars , 50 nm . the overall greatest contribution to the spectrum image of figure 7is the tail of the zlp , i.e. , the energy distribution of the incoming electrons . as a result of absorption and scattering , this spectral contribution is weakest inside the particle ; it is constant outside the particle because the underlying si3n4 film thickness is reasonably uniform . the second contribution to the spectrum image is a broad component with an onset at 1 ev ; this represents the interband transitions ( ibts ) in both au and pt . indeed , the fact that pt contributes to this energy loss can be seen by the considerable intensity of the component in regions exactly corresponding to nps , i.e. , at the edges of the nanoprism . the next component , represented by a blue line in figure 7a , is the edge lspr . its spectrum is centered at 1.25 ev , with a full - width half - maximum ( fwhm ) of 0.7 ev . the spatial distribution of the edge lspr is akin to that observed in undecorated au nanoprisms . the other component unraveled by nmf is the corner lspr , which localizes the electric field at the tips of the nanoprisms . this component is centered at 0.9 ev and is sharper , with a fwhm of 0.4 ev . both lsprs extend into the pt nps , which , combined with studies of far - field optical coupling , may open possibilities for multifunctional nanostructures . stem - eels experiments and nmf data analysis performed on undecorated au nanoprisms from the same synthesis batch used for producing the decorated nanoprisms ( supporting information ) , as well as previous studies on similar bare structures , reveal nearly identical corner and edge resonances . all undecorated and decorated nanoprisms studied here by stem - eels ( five and six of each , respectively ) showed similar behavior . however , a direct comparison of the plasmon energy before and after pt decoration is not feasible with stem - eels because of the impracticality of locating the same nanoprism ( s ) before and after decoration , as well as the potentially perturbing effects of a substrate on solution - phase growth . here , a bulk measurement , uv vis nir spectroscopy , provides additional information about the effects of pt on the lspr and complements stem - eels by providing statistical , ensemble - averaged behavior . nir spectra show a slight red - shift and dampening of the plasmon ( supporting information ) , consistent with previous studies on corethis spectral broadening effect is primarily due to the poor plasmonic activity of pt caused by interband transitions . when combined , these analyses strongly corroborate the notion that plasmonic activity is only minimally impacted by the presence of pt . the reduction of h2ptcl6 on large ( 100300 nm edge length ) colloidal au nanoprisms yielded an array of small pt nps decorating the au { 111 } facets ( figure 1 ) . in addition to triangular structures , the reaction mixture contained a small number of various truncated nanoprisms , hexagonal plates , and some elongated , ribbon - like morphologies ( figure s1 ) . all particle shapes are thin plates ( typically ca . 7 nm thick ) , display broad { 111 } facets , and also support the deposition of pt nps . pt - decorated au nanoprisms : ( a , b ) haadf - stem images of au nanoprisms before and after pt decoration ; ( c ) haadf - stem image and ( d , e ) stem - eds maps of pt and au . the red and yellow ellipses highlight areas of high and low pt concentration , respectively . the composition of the decorated nanoprisms was confirmed to be au and pt by eds . figure 1d , e shows elemental maps for pt and au ( obtained from the background - subtracted integrated intensities for both l and l1 emission , located at 9.71 and 11.44 kev for au and 9.44 and 11.07 kev for pt ; a full spectrum and additional maps are available in figure s2 ) . the eds map for au is generally homogeneous , as expected for a prismatic nanoparticle . the regions of higher x - ray intensity correlate well with the regions of higher haadf - stem intensity , as shown by red ellipses in figure 1c , d . thicker regions of material or higher atomic number ( z ) material give rise to stronger scattering and thus higher haadf - stem intensity . in this case , the values of z for au and pt are nearly identical , and the haadf contrast is mainly due to thickness effects . the correlation between the pt eds map and the haadf - stem image indicates that the thicker regions are where pt nps have grown . analogously , the regions where fewer pt nps are present , contained in yellow ellipses in figure 1c , d , generate weaker x - ray emission in the pt map . finally , the eds signal from the nps located at the edges of the nanoprisms more clearly verifies their chemical identity , containing almost exclusively pt signals , as shown by the difference map in figure s2e . the reduction of pt salts can be used to produce discrete dendritic pt nanoparticles at sizes relevant for catalysis across all surfaces of colloidal au nanoprisms , with distinct nanoparticle morphologies ranging from pseudospherical to dendritic and spatial distributions that appear to be strongly dictated by the nanoprism geometry . pt - decorated au nanoprisms can sustain localized surface plasmon resonances , which extend into the pt nps . given the well - known catalytic properties of pt and the burgeoning field of plasmon - enhanced catalysis , these insights provide a step toward , and motivation for , precise tailoring of bimetallic nanoparticles that couple catalytic and optical properties to provide versatile multifunctional systems .\noutput:\n" }, { "from": "agent", "value": "catalytic and optical properties can be coupled by combining different metals into nanoscale architectures in which both the shape and the composition provide fine - tuning of functionality . here , discrete , small pt nanoparticles ( diameter = 36 nm ) were grown in linear arrays on au nanoprisms , and the resulting structures are shown to retain strong localized surface plasmon resonances . multidimensional electron microscopy and spectroscopy techniques ( energy - dispersive x - ray spectroscopy , electron tomography , and electron energy - loss spectroscopy ) were used to unravel their local composition , three - dimensional morphology , growth patterns , and optical properties . the composition and tomographic analyses disclose otherwise ambiguous details of the pt - decorated au nanoprisms , revealing that both pseudospherical protrusions and dendritic pt nanoparticles grow on all faces of the nanoprisms ( the faceted or occasionally twisted morphologies of which are also revealed ) , and shed light on the alignment of the pt nanoparticles . the electron energy - loss spectroscopy investigations show that the au nanoprisms support multiple localized surface plasmon resonances despite the presence of pendant pt nanoparticles . the plasmonic fields at the surface of the nanoprisms indeed extend into the pt nanoparticles , opening possibilities for combined optical and catalytic applications . these insights pave the way toward comprehensive nanoengineering of multifunctional bimetallic nanostructures , with potential applications in plasmon - enhanced catalysis and in situ monitoring of chemical processes via surface - enhanced spectroscopy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: a 75 - year - old man was admitted for treatment of acute alcoholic hepatitis . with enhanced computed tomography ( ct ) , endoscopic ultrasound ( eus ) showed a multiple - cystic lesion with mural nodule in the tail of the pancreas and a diameter of 17 mm . to obtain pancreatic juice for cytopathologic examinationcannulation of the pancreatic duct was difficult and took more than 30 minutes ( no cannulation into the bile duct during the procedure ) . we did not perform intraductal ultrasound and brushing because the cystic lesion was located on the end of the pancreas close to the splenic hilum . subsequently , an indwelling 5 - fr enpd - tube was inserted in the pancreatic duct ( fig . 1 ) . the enpd tube had 4 side holes within 35 mm of its distal end . there was no obvious finding to suggest the presence of pancreaticobiliary maljunction based on magnetic resonance cholangiopancreatography ( mrcp ) prior to ercp ( fig . 2 ) . however , backflow of a small amount of contrast medium into the bile duct was present when a generous amount of contrast medium was injected into the pancreatic duct ( fig . 1 , no ae was noted during the procedure . a 5 - fr endoscopic nasopancreatic drainage tube indwelling in the pancreatic duct . there was no obvious finding suggestive of the presence of pancreaticobiliary maljunction , but a small amount of contrast medium flew back into the bile duct ( arrow ) . on magnetic resonance cholangiopancreatography , there were no obvious findings suggestive of the presence of pancreaticobiliary maljunction . although about 200 ml of pancreatic fluid had been drained and the enpd tube was removed 22 hours after the ercp , the level of pain kept increasing . contrast - enhanced ct showed a swollen gallbladder with an apparent thickening of the wall without evidence of biliary tract dilatation . in addition , massive ascites that had not been seen before ercp were identified ( fig . 3 ) . ascitic fluid was orange - colored and cloudy , and bilirubin and amylase concentrations ( 38.9 mg / dl and 4325iu / l , normal limit is 1.0 mg / dl and 125 iu / l ) far exceeded the corresponding values measured in the blood on the same day ( 0.6 mg / dl , 119perforation of the duodenum but not the biliary tree was initially suspected , as both amylase and bilirubin levels in the ascites were high . contrast - enhanced computed tomography ( ct ) at 30 hours post - endoscopic retrograde cholangiopancreatography . subsequently , exploratory laparotomy was performed . despite substantial bile in the peritoneal cavity , there was no evidence of duodenal perforation . the contents of the gallbladder were aspirated and its bilirubin and amylase levels were determined . therefore , acute cholecystitis with perforation due to acute pancreatobiliary reflux was diagnosed , and cholecystectomy was performed . pathologic examination revealed that inflammatory cells had infiltrated throughout all layers , and abscess formation and necrosis with perforation were found in the subserosal layer ( fig . no finding , such as hyperplastic change of gallbladder mucosa , was made that was suggestive of pancreaticobiliary maljunction and there were no gallbladder stones or tumor . the postoperative course was uneventful and the patient was discharged 9 days after surgery . the red arrow is the site of a puncture made by the surgeon to aspirate the contents of the gallbladder . b microscopic examination at the site of perforation showed invasion of inflammatory cells throughout all layers and abscess formation and necrosis in the subserosal layer .2 reported that thrombosis in the intramural vessels appeared to be related to the events leading to ipgb . in contrast , a few reports have suggested that pancreatobiliary maljunction may contribute to its etiology 13 . nevertheless , it has been thought that pancreatobiliary reflux could result in several of various pathologic conditions in the biliary system , including acute cholecystitis , and pancreaticobiliary maljunction was not a necessary prerequisite 4 . acute cholecystitis generally is well known as a cause of ipgb 5 . in our case , however , there was no stone or tumor that could cause the cholecystitis in the biliary tree . in this case , acute cholecystitis and perforation occurred after insertion of the indwelling enpd - tube , thus it is believed that this pathologic condition occurred as an ae related to the ercp and insertion of the indwelling enpd - tube . pancreatobiliary reflux was highly implicated in the ipgb based on the high amylase concentration in the gallbladder contents 3 . however , in our case , pancreatobiliary maljunction was not identified on mrcp or ercp . past literature suggests that pancreatobiliary reflux can occur in individuals without pancreaticobiliary maljunction 678 . in particular , pancreatobiliary reflux has been frequently observed in individuals with a relatively long common channel 9 , and in our case , it was observed on ercp images . in fact , a small amount of contrast medium injected into the pancreatic duct back flowed into the bile duct , although mrcp did not indicate any pancreatobiliary maljunction . thus , it was speculated that pancreatic fluid could easily flow into the bile duct due to the indwelling enpd tube , which would eliminate space between the tube and the common channel . consequently , the concentration of pancreatic enzymes in the biliary tree rapidly increased and pooled in the gallbladder after insertion of the indwelling enpd tube , potentially causing acute cholecystitis , and subsequently gallbladder perforation . although enpd insertion is common in japan , it is hard to explain why ipgb has not been observed in many other cases . our patient might have a tendency to easily develop pancreatobiliary reflux because of the anatomy of the long common channel . in conclusion , our case supports the suggestion that pancreatobiliary reflux is an important cause of ipgb . in addition , ipgb also should be recognized as a possible ae of pancreatic stent insertion , especially in patients who have a long common channel .\noutput:\n" }, { "from": "agent", "value": "background and study aims : endoscopic retrograde pancreatocholangiography ( ercp ) is associated with many types of adverse events ( aes ) but idiopathic perforation of the gallbladder ( ipgb ) is very rare . pancreatobiliary reflux is one of the factors involved with occurrence of ipgb 1 . here we present a case of acalculous gallbladder perforation as an ae following the insertion of an indwelling endoscopic nasal pancreatic drainage ( enpd ) tube ( a pancreatic stent ) to obtain pancreatic fluid . in this case , acute pancreatobiliary reflux might have been caused by the insertion of the enpd - tube ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the use of mobile phones has increased rapidly over the past decades . mobile phones are very popular communication devices for doctors and nurses who are continuously moving around in clinics and hospitals . health care providers also use mobile phones as an input / output tool for hospital information systems ( his ) . mobile phones enable healthcare professionals to possess a portable platform from which to provide many healthcare - related applications and are a popular means to directly communicate with colleagues and patients . however , the electromagnetic radiofrequency ( rf ) radiation in microwave ( mw ) range emitted from mobile phones may interfere with medical electronic equipments . therefore , requirement for shielding medical equipments have long been part of the us fda s requirement to market medical equipments . in contrast with the us fcc , which concentrates on the potential interference of rf emitting devices with medical equipments , the fda focuses on the issue of safety and efficiency of medical equipments for patient use . fda s range of the products which can be classified and regulated as medical devices is very broad and includes devices such as medical information networks , mobile phones programmed to remind patients to take prescribed medicines on time . home blood glucose monitors ( hbgms ) , measuring glucose levels by using a convenient glucose meter and test strips , efficiently help patients achieve optimal health through understanding the effects of medications , meal planning , and physical activity on their glucose levels . hbgms also help patients make decisions about treatment modalities and allow them to recognize possible emergency situations . over the past years , our laboratory has focused on studying the health effects of exposure of laboratory animals and humans to some common and / or occupational sources of electromagnetic fields such as mobile phones [ 5 - 12 ] and their base stations , mobile phone jammers , laptop computers , radars , dentistry cavitrons and mri . the purpose of this study was to determine if electromagnetic radiofrequency radiation emitted from gsm mobile phones decreases the accuracy of home blood glucose monitors . forty five female nondiabetic students ranged in age from 17 to 20 year participated in this study . blood samples were obtained from volunteer participants by venipuncture and analyzed for glucose level by using a new bionime ( gm110 , taiwan ) blood glucose monitoring system . for control - emf group , within ten minutes after venipuncture , blood glucose concentration for each individual was measured in presence and absence of electromagnetic fields caused by a common gsm mobile phone ( htc touch , diamond 2 ) during ringing . position of the mobile phone and the bionime home blood glucose monitor during measurement is shown in figure 1 . for control - repeat group , two repeated measurements in the same time interval were performed for eac participant in the absence of electromagnetic fields . position of the mobile phone and the bionime home blood glucose monitor during measurement . after performing both measurements in control - emf and control - repeat group , the magnitude of the changes between glucose levels in two repeated measurements or | c | was calculated as : | c | = glucose level in the 1st measurement - glucose level in the 2nd measurement ( eq .1 ) in this equation , glucose level in the 2nd measurement was either the measurement in the presence of emf ( in control - emf group ) or the repeated measurement in control - repeat group . blood glucose levels ( mg / dl ) in 30 participants of control - emf group are indicated in table 1 . the 45 participants in the study ranged in age from 17 to 20 year old with a mean of 18.700.84 y for control - emf group and 18.730.96 y for control - repeat group . blood glucose levels ( mg / dl ) in 15 participants of control - repeat group are indicated in table 2 . the range of blood glucose level for control - emf group was between 69 and 103 mg / dl while it was between 82 and 100 mg / dl for control - repeat group . the magnitude of the changes between glucose levels in two repeated measurements ( | c | ) in control - repeat group was 1.070.88 mg / dl while this magnitude for control - emf group was 7.534.76 mg / dl . after performing mann - whitney u - test , the difference between | c | of these two groups was statistically significant ( p 0.001 , two - tailed test ) . blood glucose level ( mg / dl ) in 30 participants of control - emf group . blood glucose concentration for each individual was measured in presence and absence of electromagnetic fields generated by a mobile phone during ringing . blood glucose level ( mg / dl ) in 15 participants of control - repeat group . blood glucose concentration for each individual was measured twice in absence of electromagnetic fields generated by a mobile phone during ringing . findings of this study showed that mobile phones can cause electromagnetic interference in home blood glucose monitors and stop these popular user - friendly devices from working properly . the magnitude of the changes between glucose levels in two repeated measurements ( | c | ) in control - repeat group was 1.070.88 mg / dl while this magnitude for control - emf group was 7.534.76 mg / dl ( p 0.001 , two - tailed test ) . to the best of our knowledge , this is the first study to assess the electromagnetic interference in home blood glucose monitors . electromagnetic interference of medical equipments has been known for some time in hospitals . in some countriesauthorities have published guidelines about interference from mobile phones in medical equipments . in january 2009 , the uk nhs announced that use of mobile phones in nhs hospitals is generally allowed , as long as their use does not affect the safety of patients or other people , patients privacy and dignity or the operation of medical equipment . in this reportuk nhs , confirmed that mobile phones generated electromagnetic interference of medical equipments can stop medical equipment such as dialysis machines , defibrillators , ventilators , monitors and pumps from working properly . based on the results obtained in this study , it can be concluded that electromagnetic interference from mobile phones has an adverse effect on the accuracy of home blood glucose monitors . we suggest that mobile phones should be used at least 50 cm away from home blood glucose monitors .\noutput:\n" }, { "from": "agent", "value": "mobile phones are two - way radios that emit electromagnetic radiation in microwave range . as the number of mobile phone users has reached 6 billion , the bioeffects of exposure to mobile phone radiation and mobile phone electromagnetic interference with electronic equipment have received more attention , globally . as self - monitoring of blood glucose can be a beneficial part of diabetes control , home blood glucose testing kits are very popular . the main goal of this study was to investigate if radiofrequency radiation emitted from a common gsm mobile phone can alter the accuracy of home blood glucose monitors . forty five female nondiabetic students aged 17 - 20 years old participated in this study . for control - emf group ( 30 students ) , blood glucose concentration for each individual was measured in presence and absence of radiofrequency radiation emitted by a common gsm mobile phone ( htc touch , diamond 2 ) while the phone was ringing . for control - repeat group ( 15 students ) , two repeated measurements were performed for each participant in the absence of electromagnetic fields . the magnitude of the changes between glucose levels in two repeated measurements ( | c | ) in control - repeat group was 1.07 0.88 mg / dl while this magnitude for control - emf group was 7.53 4.76 mg / dl ( p < 0.001 , two - tailed test ) . to the best of our knowledge , this is the first study to assess the electromagnetic interference in home blood glucose monitors . it can be concluded that electromagnetic interference from mobile phones has an adverse effect on the accuracy of home blood glucose monitors . we suggest that mobile phones should be used at least 50 cm away from home blood glucose monitors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the world health organization ( who ) estimated that globally in 20081.4 million women had syphilis in pregnancy , causing approximately 520,000 adverse pregnancy outcomes including 305,000 perinatal deaths . untreated maternal syphilis currently equals or exceeds hiv , neonatal tetanus , or malaria as a cause of perinatal mortality . caused by the bacterium treponema pallidum , syphilis is efficiently transmitted in utero to the fetus . when left untreated , adverse pregnancy outcomes can occur in up to 80 % of affected pregnancies , with the most severe outcomes occurring in women with early ( i.e. , primary , secondary , or early latent ) infections . a recent meta - analysis adjusting for other causes of mortalityestimated that , among asymptomatic women , untreated maternal syphilis caused stillbirth in 21 % and neonatal death in 9 % of affected pregnancies and led to low birth weight in 6 % and congenital infection in 15 % of surviving infants . early detection and adequate treatment ( i.e. , long - acting intramuscular penicillin ) prevent poor outcomes due to mother - to - child transmission ( mtct ) of syphilis . nyanza province , located in western kenya , has the second highest neonatal ( 39 per 1000 live births ) and fifth highest perinatal ( 37 per 1000 live births and stillbirths ) mortality rates among kenya 's eight administrative provinces . in comparison , western european nations have neonatal and perinatal mortality rates of less than 5 per 1000 live births and 10 per 1000 live births plus stillbirths , respectively . nyanza also has the nation 's highest prevalence of hiv ( 14 % ) and syphilis ( 2.3 % ) among reproductive - aged women . low maternal educational attainment , limited health care access , and poverty may adversely influence maternal and infant health outcomes . in 2008 - 2009 , only 17 % of women in nyanza province had completed primary school , 48 % of pregnant women received antenatal care ( anc ) at low - level facilities with minimal services , and 35 % delivered their infants with a skilled birth attendant . about 63 % of the population lives on the equivalent of less than $ 1 a day . although some anc services , such as hiv testing , are provided without cost , women must pay for most basic services and supplies such as syphilis testing , antibiotics , and exam gloves . antenatal syphilis testing and treatment are highly cost effective and are recommended by who in the basic anc package . until recently , diagnosis in asymptomatic populations ( the case for most pregnant women infected with syphilis ) has depended on serologic tests requiring basic laboratory capacity that is unavailable at most low - level facilities . newer , inexpensive , and rapid syphilis tests ( rsts ) have been developed that use finger - prick whole blood samples and can be done at low - level facilities , with results and treatment provided at the clinic visit . in this evaluation , we sought to identify the feasibility and challenges of integrating rsts into anc services in low - level health facilities in a remote , rural setting and to assess the impact of rsts on diagnosis and treatment of syphilis in pregnant women . because introduction of new services can affect existing services , we also sought to ascertain the impact of the introduction of rsts on uptake of rapid hiv testing . in 20112013 , a kenyan nongovernmental organization called the safe water and aids project ( swap ) , the kenya medical research institute ( kemri ) , the kenyan ministry of public health and sanitation ( moh ) , and the us centers for disease control and prevention ( cdc ) conducted an evaluation of a pilot rst program that was incorporated into a project that integrated nurse training ; health facility improvement ; and safe water , hygiene , and nutritional interventions into antenatal care in low - level facilities in two rural districts ( mbita and suba ) in nyanza province , kenya . this evaluation was a component of a larger project integrating improved anc services and safe water practices in low - level health facilities in mbita and suba districts . the large project involved an intervention with three components : ( 1 ) special training of nurses on emergency obstetrical care , neonatal resuscitation , safe water and hygiene practices , and improved anc services including congenital syphilis prevention ; ( 2 ) diagnosis and treatment supplies for clinics , including hand - washing and drinking water stations , infant resuscitation equipment , rst kits , and penicillin and injection equipment for women with reactive syphilis tests ; and ( 3 ) public health commodities ( safe water storage containers , water treatment products , soap , protein - fortified flour at anc visits , and clean delivery kits with exam gloves , sterile razor blades , and swaddling cloths ) provided to pregnant women as incentives to attend anc . this intervention was available at no cost to the estimated 8000 pregnant women receiving anc services during the intervention period ( from march 2011 to february 2012 ) . for this evaluation assessing the feasibility and challenges of rsts in low - level facilities , we used several methodologies : ( 1 ) a before - and - after assessment without concurrent controls using summary statistics of syphilis testing uptake and treatment among women receiving anc services in eight facilities ; ( 2 ) an assessment of diagnosis and treatment commodity stock outs ( i.e. , occasions when supplies of rsts and penicillin in the clinics had been consumed and not yet resupplied ) using stock books from the eight facilities ; ( 3 ) an assessment of syphilis and hiv testing uptake using individual , patient - level data from anc registries at three high - volume facilities ; and ( 4 ) an evaluation of intervention challenges from in - depth interviews of nurses and patients . we worked with all 25 rural health facilities to test the impact of various incentives on the use of antenatal and delivery services , including syphilis testing . because of time and resource constraints , we limited the rst evaluation to all eight clinics selected using the following criteria : ( 1 ) public ( moh ) clinics ; ( 2 ) feasible to reach within one day ; and ( 3 ) maintained antenatal registries from 2010 to 2012 . they included three dispensaries , four health centres , and a subdistrict hospital ( table 1 ) . dispensaries are the lowest - level facilities in the health care system , providing simple outpatient and preventive services with basic supplies and a nurse . managed by a clinical officer and staffed by two or more nurses and a pharmacist , health centres can provide simple ambulatory and preventive services ( e.g. , vaccines ) . the subdistrict hospital is similar to health centres but has a laboratory for simple tests ( e.g. , blood slides for malaria parasites and urine dip tests ) . in february 2011 , faculty from emory university , cdc , and swap provided a two - day , hands - on training for nurses and midwives that included modules on the public health importance , diagnosis , and treatment of congenital syphilis . nurses were instructed on integrating rsts with existing rapid hiv testing , counseling women about syphilis results , referring partners for treatment , and recording results of testing and treatment into anc registries . for the before - and - after assessment comparing syphilis testing uptake , seropositivity , and treatment rates , we abstracted data from the records of all anc attendees in the anc registries at the eight facilities during the preintervention period ( march 2010february 2011 ) and during the intervention period ( march 2011february 2012 ) . to further estimate syphilis treatment adherence , we reviewed anc registry and stock book data to determine the ratio of penicillin vials used overall to the number of women whose syphilis tests were seroreactive . to assess the impact of syphilis testing on hiv testing rates , we used individual - level program data on syphilis and hiv testing from 330 consecutive women attending anc at threehigh - volume clinics ( i.e. , served more than 400 women per year ) during a time without shortages ( stock - outs ) of hiv or syphilis test kits . we collected individual data on gestational age , syphilis testing , hiv testing , and test results and determined syphilis and hiv test uptake by month before and during the intervention . we believed these data were useful because they allowed a purer assessment of test uptake in a time without test - kit stock - outs , and the individual - level data allowed exclusion of women with previous positive hiv status ( i.e. , ineligible for another hiv test ) . finally , to assess the challenges of introducing rsts , we conducted a series of qualitative , semistructured interviews with a convenience sample of nurses and mothers from the priority clinics . interview guides were written in english and translated into the local language ( dholuo ) by two swap enumerators who conducted and recorded the interviews . quantitative data were entered into microsoft excel 6 databases and analyzed with sas 9.3 ( cary , n.c . ) and openepi version 2.3.1 ( atlanta , ga ) to calculate the proportion of women tested for syphilis and hiv at the first anc visit and compare the proportion testing positive in the 12 - month intervals before and during the intervention . qualitative data were analyzed using qsr international nvivo 8.0 ( melbourne , australia ) . in an iterative process , we read and reread the interview texts for emerging themes and attached codes to the text representing them until no new themes emerged . the cdc institutional review board approved the reliance on a non - cdc irb in accordance with 45 cfr 46.114 ( protocol 5996 ) . written informed consent was obtained from all participants , and personal identifiers were irretrievably removed from databases at the end of the study . of 1614 anc attendees recorded in the anc registries in the eight clinics during the one - year intervention period , 1123 ( 70 % ) were tested for syphilis compared with 279 ( 18 % ) of 1586 anc attendees recorded in anc registries during the prior year ( p 0.001 ) ( table 1 ) . notably , at the three dispensaries , 79 % of attendees were tested during the intervention period compared with none during the previous year . during the intervention period ,35 women ( 3 % ) tested positive for syphilis compared with one ( 1 % ) during the previous year . a total of 34 penicillin treatment kits were used at seven health facilities where 28 anc syphilis tests were positive for a ratio of 1.2 : 1 , suggesting that women testing positive received at least one penicillin injection ( stock book ( i.e. , treatment ) data in one facility were incomplete and thus were excluded ) . during the intervention periodhowever , we noted that one dispensary temporarily lacked saline to dissolve penicillin and referred two patients to other facilities for treatment . another facility experienced stock outs for one - two days during three separate months . during the 12 - monthsprior to the intervention , syphilis test kits and treatment were unavailable at most low - level facilities and inconsistently available in the district hospitals . in contrast , hiv test kits were more consistently available at anc facilities than syphilis tests during the 12 months prior to the intervention , although stock - outs in hiv test kits occurred for short periods during the intervention . anc registry data indicated that 1292 ( 72 % ) of 1614 anc attendees had hiv testing during the intervention period compared to 1386 ( 87 % ) of 1586 attendees during the prior year ( p 0.001 ) ( table 1 ) ; hiv testing frequency during the intervention period was significantly lower at two of three dispensaries , two of four health centres , and the subdistrict hospital . the summary anc registry data did not indicate results of previous hiv testing ( previously positive women would not have been offered another hiv test ) . of 330 women attending anc in three high - volume clinics during the intervention ( combined data from two health centres and one subdistrict hospital ) , more women were tested for hiv ( 87 % ) than syphilis ( 76 % ) ; 67 % received both tests and 4 % received neither ( table 2 ) . in the 12 months before intervention , hiv test uptake ( 6094 % per month , median 82 % ) exceeded syphilis test uptake ( 549 % per month , median 26 % ) . during the intervention , hiv uptake was similar ( 7095 % per month , median 82 % ) , and syphilis uptake increased greatly ( 4498 % per month , median 60 % ) . hiv testing exceeded syphilis testing during all months of the intervention period except for july - august 2012 ( figure 1 ) . from qualitative interviews , 10 nurses worked an average of 13 years ( range , 2 years to 27 years ) in a variety of facilities and four years at the current facility ( range , one month to 10 years ) . although syphilis treatment practices varied among the nurses , none of the nurses mentioned that patients are declining treatment because of partner violence . about half of the nurses ( 6 ) had attended the training on syphilis testing and treatment . although all knew that proper treatment included intramuscular penicillin injections , not all knew the correct number of injections . most nurses reported that the overall program had been successful but identified three main challenges . first , partner treatment was unaffordable for many ; nurses recommended providing free partner treatment . second , nurses were concerned about sustaining the program of free testing and treatment when the study ended . finally , some nurses did not receive the training because of staff shortages at their facilities and recommended making training available to all nurses . interviews with 21 mothers revealed that they were not always fully informed about the tests and did not feel they could ask nurses for more information . testing practices were inconsistent from one pregnancy to the next and some mothers had never been tested . findings from this evaluation suggest that rsts are feasible for use in anc services at low - level , rural facilities , resulted in an increased diagnosis and treatment of syphilis in pregnant women , and did not impact rapid hiv testing uptake . the percentage of pregnant women tested for syphilis at their first anc visit increased dramatically from 1 % to 70 % , resulting in the identification of 35 infections . although documentation of treatment was poor , the number of syphilis treatment kits used in the clinics roughly corresponded to the number of cases identified , suggesting that women testing positive were usually treated , likely averting cases of congenital syphilis . syphilis prevalence in this population ( 3.5 % ) exceeded the rate reported in national surveys ( 2.3 % ) , a finding that is consistent with studies elsewhere reporting higher syphilis prevalence among rural than urban women . syphilis testing is frequently unavailable in remote settings where syphilis infections may go undetected and consequently untreated . although anc registry data suggested that most women testing positive for syphilis received at least a single dose of 2.4 million units long acting penicillin intramuscularly ( i m ) ( sufficient to prevent mtct of syphilis ) , data recording was inconsistent and therefore difficult to interpret . additionally , although a single i m dose of penicillin can prevent congenital syphilis , kenya 's guidelines ( and global guidelines ) recommend three weekly doses of 2.4 million units ( 7.2 million units total ) to treat an asymptomatic , seroreactive mother with unknown duration of infection . prior to the intervention , high - level approvals were obtained to modify existing anc registries to include syphilis treatment ; and the nurses ' training involved intensive instruction on recommended treatment , the need to use i m penicillin during pregnancy , and practice on modifying the registry and documenting syphilis treatment . the failure of this aspect of the interventions suggests that to improve collection of syphilis treatment data , an important indicator of program effectiveness , moh officials will need to add a syphilis treatment field to existing anc registries and assure that providers are trained in both adequate treatment of syphilis in pregnancy and in entering treatment data properly . our data suggested that women were willing to be tested for both syphilis and hiv . although overall anc data suggested that a smaller percentage of women were tested for hiv during the intervention period than before , a more in - depth analysis of three high - volume clinics indicated the reverse : that , following the introduction of rsts , hiv testing did not change . the latter finding was consistent with other studies that found that the introduction of rsts did not adversely affect antenatal hiv test uptake . the discrepant findings in this study could be explained by a lack of data on previous hiv testing in anc registries . women who previously tested positive for hiv would not be retested at later pregnancies , and including them in the denominators would ( incorrectly ) suggest a decrease in hiv test uptake . furthermore , in november 2011 one of the tests used in kenya 's hiv testing algorithm was removed from stocks due to inadequate performance in some lots , leading to short - term but widespread shortages in hiv tests . this may explain the documentation of hiv test shortages in some clinics during the intervention period . some anc attendees in early 2012 may have been offered hiv testing at later anc visits or not at all . first , the nurses did not adequately communicate the importance of syphilis testing and treatment to anc attendees , and women did not feel comfortable asking nurses for information . this problem may have been exacerbated by the frequent transfer of nurses and other providers who may have taken their knowledge of performing rsts , maintaining rst stock , and recording results with them without transferring knowledge to new nurses . addressing these training problems , as well as possibly including community outreach regarding congenital syphilis prevention , could help improve program operation . their lack of participation in anc and inability to pay for treatment is a lost opportunity that also places treated women at risk of reinfection . the anc setting has been found to be an appropriate place to counsel and test male partners in other programs ( e.g. , hiv ) , and treatment of partners for syphilis would be a relatively simple and inexpensive addition , possibly serving as an incentive for men to accompany their partners to anc . finally , some nurses were concerned about the sustainability of the program when outside funding to purchase rsts is no longer available . health ministries will need to consider means of covering basic anc services in order to achieve global maternal and infant health goals . first , because the facilities we evaluated were in only two districts of nyanza province they may not have been representative of rural facilities elsewhere . second , most antenatal registries were incomplete , limiting our interpretation of the findings , particularly of treatment of women with positive rsts . despite this limitation , the very large increment in the percentage of women receiving rsts left little doubt about the program 's impact on syphilis detection . third , hiv test uptake in the 8 clinics was likely underestimated because antenatal registries did not allow identification of previously positive women . additionally , the removal of one of the hiv tests in kenya 's hiv testing algorithm during the intervention may have led to lower hiv testing rates in some clinics that were unrelated to introduction of rsts ( a problem inherent to before - and - after studies ) . finally , the perspectives from the key informants may not have represented the broader population of nurses and mothers . however , we believe the sample was of sufficient size to capture a comprehensive range of perspectives . in conclusion , our findings suggest that integrating rst into routine anc services in low - level facilities in remote , rural settings where many women in sub - saharan africa receive mch services was feasible , led to large increases in syphilis testing uptake , and uncovered higher syphilis prevalence than had been previously reported . these data are important for health ministries seeking practical and affordable methods for providing syphilis testing , a recommended component of basic anc services . the data also add support for projected benefits from modeling studies indicating that early syphilis detection and treatment in antenatal women are a cost - saving intervention in settings with moderate - to - high syphilis prevalence , even when laboratory capacity is limited . introducing rststhis study documented that reporting treatment data was not optimal but could be addressed by improving anc registries and training providers . additional training for nurses could help ensure that patients are fully counseled on the tests that are offered to them and on the meaning of the results . nurses could also receive additional training on partner notification to ensure that partners of patients diagnosed and treated are also tested and treated . community education programs would be another strategy to promote syphilis testing to mothers and their partners . taken together , these strategies could provide a meaningful contribution to global efforts to reduce mtct of syphilis .\noutput:\n" }, { "from": "agent", "value": "we evaluated the integration of rapid syphilis tests ( rsts ) and penicillin treatment kits into routine antenatal clinic ( anc ) services in two rural districts in nyanza province , kenya . in february 2011 , nurses from 25 clinics were trained in using rsts and documenting test results and treatment . during march 2011february 2012 , free rsts and treatment kits were provided to clinics for use during anc visits . we analyzed anc registry data from eight clinics during the 12 - month periods before and during rst program implementation and compared syphilis testing , diagnosis , and treatment during the two periods . syphilis testing at first anc visit increased from 18 % ( 279 of 1,586 attendees ) before the intervention to 70 % ( 1,123 of 1,614 attendees ) during the intervention ( p < 0.001 ) ; 35 women ( 3 % ) tested positive during the intervention period compared with 1 ( < 1 % ) before ( p < 0.001 ) . syphilis treatment was not recorded according to training recommendations ; seven clinics identified 28 rst - positive women and recorded 34 treatment kits as used . individual - level data from three high - volume clinics supported that the intervention did not negatively affect hiv test uptake . integrating rsts into rural anc services increased syphilis testing and detection . record keeping on treatment of syphilis in rst - positive women remains challenging ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the prognostic value of slow heart rate recovery ( hrr ) after exercise in predicting cardiovascular disease ( cvd ) events has been established . initial increases in heart rate with exercise are due to parasympathetic withdrawal while sympathetic activation is responsible for heart rates greater than a 100 beats / minute . in the first two minutes following cessation of exercise , the rapid decrease in heart ratealthough slow hrr is associated with less autonomic nervous system responsiveness , the underlying mechanisms linking slow hrr to increased cardiovascular morbidity are not well understood . prior studies of patients referred for cardiac angiography for suspected ischemic heart disease ( ihd ) suggest an association between slow hrr and higher atherosclerotic burden . further , slow hrr has been observed to be associated with several risk factors for atherosclerosis . however , the relationship between hrr and atherosclerosis in the general population has not been studied using a prospective study design . in a cohort of healthy young adults , we investigated whether slow hrr following a graded exercise treadmill test ( gxt ) was associated with the presence of coronary artery calcium ( cac ) , a marker of subclinical atherosclerosis , when assessed 15 years later . the coronary artery risk development in young adults study ( cardia ) is a longitudinal study designed to investigate the origins of cardiovascular disease in young adulthood . beginning in 1985 ,5,115 african - american and caucasian individuals [ ( african - american ( 52 % ) and women ( 54 % ) ] ages 1830 were recruited at sites in birmingham , alabama ; chicago , illinois ; minneapolis , minnesota ; and oakland , california . the test included nine 2 - minute stages of increasing difficulty with participants encouraged to exercise to exhaustion , followed by a recovery period at a speed of 3.2 km / hour at 0 % grade . hrr was defined as the difference between the maximum hr and hr at 2 - minutes into recovery . participants were ineligible for exercise testing if they were on cardioactive medications , had a resting systolic or diastolic pressure 160 or 100 mmhg , or were febrile at time of examination . the rate of energy expenditure for the completion gxt was estimated and reported in metabolic equivalents ( mets ) , as previously described . information on physical activity was collected by interview using a standardized questionnaire . at the year15 follow - up examination , returning participants ( n = 3,043 ) underwent coronary artery computed tomography ( ct ) scanning for the measurement of cac . mean hrr did not differ between those who did and did not return to the year 15 examination ( 42.8 versus 42.5 bpm , respectively ; p = 0.55 ) . details of the scanning procedures have been described elsewhere . briefly , using standardized protocols , two scans were obtained for each participant ( 12 minutes apart ) using electron beam ct scanners at the chicago and oakland sites and multidetector - row ct scanners at the birmingham and minneapolis sites . calcium scores were calculated across each coronary artery and then summed across all the arteries . the final cac score of positive scans was calculated as the mean of the two cac scores obtained from each of the scans . participants were sequentially excluded from this analysis for the following reasons : use of medications that affect heart rate ( hr ) ( n = 27 ) , unavailable gxt or cac data ( n = 661 ) , missing data on blood pressure , lipids , glucose , or smoking ( n = 353 ) , pregnancy ( n = 27 ) or those absent at the year 15 exam ( n = 1,399 ) . following exclusions , 2,648 participants remained . test for linear trend was performed with hrr as a continuous variable using linear regression models . the cochran - armitage test was used to check for linear trend in binomial proportions across the hrr categories . next , logistic regression was used to estimate the odds of the presence of cac ( defined as a cac score 0 ) in relation to year 0 hrr ( independent variable ) . hrr was modeled both as a continuous variable and in tertiles ( fastest hrr tertile as the reference ) . statistical significance was determined at p 0.05 . all analyses were conducted using sas version 9.1 ( sas institute inc , cary , nc ) . demographic characteristics of the study sample , by 2 - minute hrr tertiles , are presented in table 1 . mean 2 - minute hrr ( standard deviation ) for men and women were 44.3 ( 11.4 ) and 41.7 ( 11.5 ) bpm , respectively . participants with slower hrr had less favorable gxt performance characteristics , a higher resting heart rate ( both at year 0 and year 15 ) and reported less physically activity ( both at year 0 and year 15 ) . table 1baseline characteristics according to tertiles of 2 - minute heart rate recovery ( n = 2,648 ) abaselinebaseline sex - specific hrr tertiles1 ( slow ) 23 ( fast ) p trendnumber of women479463521nanumber of men392391402nahrr ( median [ min , max ] ) women31 .0 ( 1.0 , 36.0 ) 41.0 ( 37.0 , 45.0 ) 51.0 ( 46.0 , 116.0 ) namen34 .0 ( 6.0 , 39.0 ) 44.0 ( 40.0 , 48.0 ) 54.0 ( 49.0 , 97.0 ) naage ( years ) 25.4 ( 3.5 ) 25.1 ( 3.6 ) 25.0 ( 3.6 ) 0.003 african - american , n ( % ) 360 ( 41.3 ) 383 ( 44.9 ) 435 ( 47.1 ) 0.014 body mass index kg / m24 .9 ( 5.2 ) 24.1 ( 4.2 ) 23.8 ( 4.0 ) 0.001 resting heart rate ( bpm ) at year 071.5 ( 11.4 ) 69.3 ( 10.2 ) 66.1 ( 9.7 ) 0.001 resting heart rate ( bpm ) at year 1568.3 ( 10.8 ) 68.2 ( 12.1 ) 66.5 ( 11.3 ) 0.001 maximum heart rate ( bpm ) 180.1 ( 15.8 ) 180.0 ( 14.6 ) 181.0 ( 13.9 ) 0.001 estimated mets at peak exercise11 .8 ( 3.0 ) 12.1 ( 2.7 ) 12.5 ( 2.7 ) 0.001 total physical activity score ( exercise units ) at year 0375.8 ( 273.0 ) 428.6 ( 317.5 ) 459.7 ( 307.3 ) 0.001 total physical activity score ( exercise units ) at year 15325.4 ( 278.1 ) 346.9 ( 288.0 ) 382.4 ( 296.6 ) 0.001 values are expressed as mean ( standard deviation ) unless otherwise indicated . mets = metabolic equivalents baseline characteristics according to tertiles of 2 - minute heart rate recovery ( n = 2,648 ) a values are expressed as mean ( standard deviation ) unless otherwise indicated . mets = metabolic equivalents the prevalence of cac in the study sample was 9.0 % ( n = 239 ) . mean hrr at year 0 did not differ between those who had positive cac scores versus those who had a cac score of 0 at year 15 ( 42.8 bpm , for both ) . the unadjusted odds ratio ( or ) for having a cac score 0 for those in the slowest hrr tertile compared to those in the fastest hrr tertile was not significantly greater than 1.00 ( table 2 ) . table 2unadjusted odds ratio ( 95 % confidence interval ) for the presence of coronary artery calcium ( score 0 ) at year 15 by baseline 2 - minute heart rate recoverytotal samplecaucasian mencaucasian womenafrican - american menafrican - american womenodds ratio ( 95 % ci ) for threshold models based on hrr tertilestertile 1 ( slow ) 1.13 ( 0.811.57 ) 0.90 ( 0.541.50 ) 1.12 ( 0.532.33 ) 1.11 ( 0.522.36 ) 1.44 ( 0.603.49 ) tertile 21.20 ( 0.871.66 ) 0.90 ( 0.541.50 ) 0.90 ( 0.412.01 ) 1.55 ( 0.783.09 ) 1.37 ( 0.573.32 ) tertile 3 ( fast ) 1.00 ( ref ) 1.00 ( ref ) 1.00 ( ref ) 1.00 ( ref ) 1.00 ( ref ) odds ratio ( 95 % ci ) for hrr as continuous variableper sd change in hrr0 .99 ( 0.871.13 ) 1.04 ( 0.841.28 ) 0.86 ( 0.651.15 ) 0.95 ( 0.701.30 ) 0.88 ( 0.601.27 ) hrr = heart rate recovery . cac = coronary artery calcium . sd = standard deviation sd of hrr was 11.5 bpm unadjusted odds ratio ( 95 % confidence interval ) for the presence of coronary artery calcium ( score 0 ) at year 15 by baseline 2 - minute heart rate recovery hrr = heart rate recovery . sd = standard deviation sd of hrr was 11.5 bpm in secondary analysis , similar findings were observed when the presence of higher cac burden ( defined as a score 100 [ n = 34 ] ) was studied , as well as when quartiles or quintiles of 2 - minute hrr were analyzed . lastly defining hrr at 1 - minute into recovery also did not result in any association between hrr and cac . slower hrr in young adulthood is not associated with the presence of cac when assessed 15 years later in middle age ( average age 40 years ) . moreover , mean hrr at baseline did not differ between those with and without measurable cac at year 15 . while previous studies have examined the relationship of hrr with cad events this study is first to investigate the relationship of hrr with a measure of subclinical atherosclerosis . slow hrr has been associated with higher incident all - cause mortality , sudden cardiac death ( scd ) , and cvd events ; however , the underlying mechanisms that link these relationships together are not known . morshedi - meibodi et al . using data from the framingham heart study ( fhs ) observed slow hrr to be associated with coronary heart disease events ( defined as acute coronary syndromes or scd ) , suggesting a possible relationship between slow hrr and ischemic processes . similarly , slow hrr has been observed to be associated with several risk factors for atherosclerosis . in contrast to findings from the fhs , jouven et al . observed slow hrr to be related only to scd and not death from myocardial infarction . due to over lapping and discrepancy in clinical end points used in prior hrr studies , it can not be determined whether slow hrr is associated with atherosclerosis or an increased susceptibility to lethal cardiac arrhythmias . the ability of coronary ct to assess the global burden of atherosclerosis in young adults is uncertain , and cac is only a subset of atherosclerosis , representing calcified plaques which tend to be more stable than their lipid - rich counterparts . despite these limitations , our study suggests that slow hrr in young adulthood is not related to subclinical atherosclerosis at middle age , which supports the hypothesis that slow hrr is associated with mechanisms related to cardiac arrhythmia rather than atherosclerosis .\noutput:\n" }, { "from": "agent", "value": "we tested whether slower heart rate recovery ( hrr ) following graded exercise treadmill testing ( gxt ) was associated with the presence of coronary artery calcium ( cac ) . participants ( n = 2,648 ) ages 1830 years at baseline examination underwent gxt , followed by cac screening 15 years later . slow hrr was not associated with higher odds of testing positive ( yes / no ) for cac at year 15 ( or = 0.99 , p = 0.91 per standard deviation change in hrr ) . slow hrr in young adulthood is not associated with the presence of cac at middle age ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: vascular lesions of the small intestine are common causes of gastrointestinal hemorrhage . arteriovenous malformations ( avms ) are an important vascular cause of gastrointestinal bleeding . an avm is most often located in the cecum and right side of the colon ; however , avms of the small intestine are rare . it can be exceedingly difficult to localize and diagnose gastrointestinal tract bleeding , particularly in cases of occult small bowel avms . angiography and enhanced computed tomography ( ct ) are very useful and convenient for the detection of gastrointestinal avms . moreover , double - balloon endoscopy or capsule endoscopy would be also useful in the diagnosis of avms in the small bowel . we report the case of a 69 - year - old man who presented with intestinal bleeding with anemia resulting from a small bowel avm which was detected by double - balloon endoscopy . a 69 - year - old man presented with a 6 - month history of gastrointestinal bleeding and symptomatic transfusion - dependent anemia . thus , he was referred to our hospital for the purpose of intensive examination and treatment . he had renal dysfunction due to diabetes , but no prior history of tarry stool . capsule endoscopy examination revealed oozing of blood in the ileum , however a significant lesion was not detected . double - balloon endoscopy established the source of the bleeding as a 0.5 - cm polypoid mass appearing as a submucosal tumor with redness and pulsation in the lower ileum ( fig . the polypoid mass was detected about 10 cm orally from the ileocecal valve by contrast radiography ( fig . histological evaluation revealed the polypoid mass to be showing an intact mucosal cover and numerous abnormal vessels in the underlying submucosa . gastrointestinal bleeding that originates in the small intestine is often difficult to diagnose . when successful diagnosis reveals a lesion that can be localized preoperatively , the laparoscopic approach is an appropriate and beneficial treatment modality for small bowel resection . avm of the small bowel is rare , and whether endoscopic appearances are distinctive enough to raise the possibility of a polypoid avm remains unclear . in our case , the mass resembled a submucosal tumor and the tumor had redness and pulsation , suggesting a vascular lesion ( fig . preoperative small bowel endoscopy can be useful for diagnosing the cause and localization of avm in the small intestine .\noutput:\n" }, { "from": "agent", "value": "gastrointestinal bleeding that originates in the small intestine is often difficult to diagnose . when successful diagnosis reveals a lesion that can be localized preoperatively , the laparoscopic approach is an appropriate and beneficial treatment modality for small bowel resection . a 69 - year - old man presented with a 6 - month history of gastrointestinal bleeding and symptomatic transfusion - dependent anemia . upper and lower endoscopy were normal . double - balloon endoscopy established the source of the bleeding as a 0.5 - cm polypoid mass appearing as a submucosal tumor with redness and pulsation in the lower ileum , suggesting a vascular lesion . laparoscopic small bowel resection was successful in removing the mass in the ileum . histological evaluation of the mass revealed an arteriovenous malformation . preoperative small bowel endoscopy can be useful for diagnosing the cause and localization of arteriovenous malformation in the small intestine ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: most cases of hepatoblastoma are found under age two , and occurrence in adults is extremely rare .12 there are only 45 reported cases of adult hepatoblastoma globally ,345 and only 3 cases in korea .267 most of the cases are asymptomatic and might be diagnosed at late stages of the disease .28 complete surgical resection is essential in the treatment of hepatoblastoma and standardized chemotherapy which reduces tumor size increases resectabilities ,9 but not so many experiences in adult hepatoblastoma makes it difficult to occur complete remission . survival time varies from 2 week to 38 months , with a median of 6 months and is shorter in adults than childhood .10 we report a case of adult hepatoblastoma with chronic hepatitis b ( chb ) which was misdiagnosed as a combined hepatocellular carcinoma and cholangiocarcinoma ( chcc - cc ) . a 36 - year - old female presented at the emergency department with aggravating right upper abdominal pain for 2 hours . the patient was diagnosed hepatitis b virus ( hbv ) carrier for several years and non - alcoholics . initial blood pressure was 100/60 mmhg , pulse rate 70 / min , respiration rate 20 / min , body temperature 37.5 . the laboratory findings were white blood cell 12,000 / mm ( poly : 70 % ) , hemoglobin 12.8 g / dl , platelet 198,000 / mm , prothrombin time 14.3 seconds , international normalized ratio 1.11 , aspartate aminotransferase 22 iu / l , alanine aminotransferase 12iu / l , total bilirubin 0.5 mg / dl , alkaline phosphatase 134 iu / l , lactate dehydrogenase 295iu / l , gamma - glutamyl transpeptidase 26 iu / l , protein / albumin 6.4 / 4.0 g / dl , uric acid 5.0 mg / dl , blood urea nitrogen / creatinine 16.6 / 0.7 mg / dl . and serum viral markers were hbsag ( + ) , anti - hbs ( - ) , anti - hbc ( + ) , hbeag ( - ) , anti - hbe ( + ) , hbv - dna 20 iu / ml , anti - hcv ( - ) and anti - hiv ( - ) . the patient 's serum - fetoprotein ( afp ) was 676.5 ng / ml and carbohydrate antigen 19 - 9 ( ca19 - 9 ) 0.6 u / ml . she took an abdominal ct scan , which showed a 9 cm sized necrotic mass with internal hemorrhage at the right hepatic lobe and ruptured to peritoneum ( fig . the initial histological diagnosis was chcc - cc with spindle cell metaplasia of cholangiocarcinoma element ( fig . regarding as chcc - cc , postoperative adjuvant chemotherapy with tegafur / uracil ( uft ) was administrated for 3 months .3 months later , follow - up abdominal ct scanning showed previously unseen a 5.5 cm sized left subphrenic mass with mild enhancement in delayed image ( fig . on histologic examination , mesenchymal elements consisted of a proliferation of primitive - appearing mesenchymal spindle - shaped cells , intimately admixed with the epithelial elements in a highly cellular pattern . cytoplasm was more abundant than that of mature fibroblasts , and the nucleus was elongated and plump . these cells blended progressively with areas of less intense cellular mesenchymal proliferation , and with relatively acellular , fibrous septa . osteoid was present either within the primitive mesenchyme , near the fibrous septa or pseudocapsule , or admixed within the epithelial elements . the immunohistochemistry stains showed expression of hepatocyte , - hcg , afp , vimentin , ck7 , ck19 , cd56 and - catenin and negativity for cea . metastatic hepatoblastoma was confirmed by histologic examination with immunohistochemistry stains , so immunohistochemistrically re - examination of previous surgical specimens was also confirmed as hepatoblastoma . follow - up abdominal ct scan performed 1 month after reoperation showed a newly onset 1.7 cm sized subtle enhancing soft tissue mass in splenic bed , and positron emission tomography ( pet ) showed multiple fdg uptake ( max suv 3.80 ) in left upper and lower quadrant area of abdomen , paralumbar area including right subphrenic area ( fig .5 a , b , c ) . follow - up afp was 162.69 ng / ml . systemic chemotherapy started with cisplatin ( 60 mg / m ) , 5 - fluorourasil ( 5 - fu ) ( 600 mg / m ) , vincristine ( 1.5 mg / m ) and total 3 cycles of chemotherapy were done every 4 week . after the 3rd chemotherapy cycle , follow - up abdominal ct and pet scan showed progression of multiple intraperitoneal metastasis with large amount of intraperitoneal fluid ( fig .6 a , b ) and follow - up afp was further increased to 254 ng / ml . so chemotherapy regimen was changed to carboplatin ( 350 mg / m ) with doxorubicin ( 30 mg / m ) every 3 weeks . the patient experienced neutropenia after the new regimen , but recovered shortly after treatment with granulocyte colony - stimulating factor ( g - csf ) . after second carboplatin with doxorubicin chemotherapy , follow - up afp was increased 1510.19 ng / ml , but abdominal ct scan showed that amount of ascites was decreased ( fig . 7 ) . after 4th chemotherapy , follow - up abdominal ct revealed progression of multiple intraperitoneal metastatic masses , newly developed hepatic metastasis and large amount of intraperitoneal fluid ( fig . 8 ) . a diagnostic paracentesis was performed and showed white blood cell 310 / mm ( poly 20 % , lymph 80 % ) , protein 3.6 g / dl and albumin 2.3 g / dl on ascitic fluid analysis . the serum albumin was 3.1 g / dl and serum - ascites albumin gradient ( saag ) was 0.8 g / dl . regarded as peritoneal carcinomatosis , the patient underwent conservative treatments including the use of repeated therapeutic paracentesis for 1 month before death . hepatoblastoma is a highly malignant tumor occurring in infants , and reports of adult cases are extremely rare . initial symptoms are non - specific and the usual presentation is failure to thrive , loss of weight and a rapidly enlarging abdominal mass . it has been shown that chronic hepatitis or liver cirrhosis is often present in adult cases , whereas in children hepatoblastoma can occur in a normal liver .11 in our case , the patient was a hbv carrier . because of the rare incidence of hepatoblastoma in adult , the initial consideration was a primary chcc - cc rupture associated with chb . abdominal ct scan demonstrated a 10814 cm - sized huge low - density mass in the liver and selective celiac angiogram revealed faint tumor staining from hepatic artery and splenic artery . the mesenchymal cells were spindle in shape and proliferated over the whole tumor with focal osteosarcomatous differentiation . the epithelial components showed well - differentiated hepatocellular carcinoma - like areas , poorly differentiated acinar or tubular structures . the patient 's serum hbsag was positive and afp was 9,103 ng / ml . abdominal ct scan demonstrated a 67 cm - sized huge low - density mass with central necrosis in liver . after surgery , the mass was finally diagnosed as hepatoblastoma on h & e stain .6 lee et al . , also reported a case of hepatoblastoma diagnosed by h & e stain in a pregnant woman . the patient 's serum hbsag was negative and afp was 199 ng / ml . abdominal ct scan demonstrated a huge heterogeneous mass in the liver . after surgery , patient died in about 25 days .7 all of these cases were confirmed by h & e stain . but , the mass was confirmed as a hepatoblastoma by histologic re - examination with immunohistochemistry stain . according to the widely used classification of ishak and glunz ,12 hepatoblastoma can be divided into mixed epithelial and mesenchymal type and epithelial type , and the latter can be divided into fetal type and embryonal type ,13 but mixed type is more common .10 the pathogenesis of hepatoblastoma are not yet exactly discovered , but chromosome 1q , 2 ( or 2q ) , 4q , 8 ( or 8q ) and 20 are known cytogenetic and molecular genetic alteration .14 loss of heterozygosity imprinting at locus 11p 15.5 , nuclear p53 accumulation and p53 mutation are other suggested pathogenesis of the malignancy .15 high expression of polo - like kinase 1 may be related to poorer outcome , but need to get more research outcome .16 according to embryologic theory , hepatoblastoma is known to originate during intrauterine life , but this hypothesis seems difficult to apply in the adult . because several cases of hepatoblastoma were found in more than 70 years of age ,31117 and underlying liver cirrhosis was frequently found in adult ,34 but not in children . the mass size varies from 2.5 cm to 25 cm in diameter , more commonly presented as single mass in right lobe , so multifocal type was reported only 1 case .10 in this case , presented with single mass in right lobe , afp - producing mixed epithelial and mesenchymal type . an additional 5 patients had a history of viral hepatitis ( a , b or c ) , but no reported fibrosis . general presenting symptoms are body weight loss , fever , abdominal pain , abdominal lymphadenopathy and masses , but these are non - specific , so found in a more advanced state .11 imaging study plays an important role in the initial diagnosis . ultrasonography can be used for initial evaluation , and ct , magnetic resonance imaging and laboratory examination like serum afp , beta - human chorionic gonadotropin ( hcg ) , serum platelet count also can be helpful . afp is usually elevated ,11 beta - hcg is rarely elevated but can be the cause of pediatric isosexual precocity .18 in the final diagnosis , histologic confirmation is essential to differentiate from hepatic sarcoma , carcinosarcoma , malignant mesenchymal tumor , hcc with sarcomatous change .11 even if microscopic examination , differential diagnosis was difficult .111920 especially , chcc - cc which are intimately admixed hcc and cc was more difficult to distinguish from hepatoblastoma by histologic morphology .12 actually , gonzalez - crussi et al . , reported that pathologists were unfamiliar with various epithelial hepatoblastoma , so they mistook hepatoblastoma for hepatocellular carcinoma in adult .21 because the lack of experience of hepatoblastomas in adult patients with chb , we mistook it for chcc - cc initially . the reactivity has been found for keratin , ema , vimentin , polyclonal cea , heppar - 1 , afp , 1 - antitrypsin , cd99 , cd56 ( n - cam ) , human chorionic gonadotropin , transferrin receptor , and delta - like protein .2223 there was also showed that aberrant nuclear immunostaining for - catenin is a highly characteristic feature .24 our case showed that positive immunohistochemical stains of vimentin , - hcg , afp , ck7 , ck19 , cd56 and - catenin . survival improvement in last 30 years has been due to not only the surgery itself , but standardized chemotherapy which reduces tumor size and increases resectabilities .9 in 1990 ~ 1994 , siopel - 1 ( society of pediatric oncology liver tumor study group launched its first prospective trial ) revealed preoperative chemotherapy and delayed surgical resection increases tumor resectability .25 doxorubicin , cisplatin , vincristine , 5 - fu , cyclophosphamide are known relatively well responding chemotherapeutic agents .26 radical resection and chemotherapy are known most appropriate approach for hepatoblastoma , but not so many experiences in adult hepatoblastoma makes it more urgent to establish determinant of prognosis in hepatoblastoma .27 suggested poor prognostic factors were multiple lobes involvement , embryonic type , decreased p27 gene expression , multifocal dissemination , afp level lower than 100 or higher than 100,000 ng / ml .2829 survival time varies from 2 weeks to 38 months , 6 months in median , shorter in adult than childhood .10 the 3 reported cases in korea , survival time of 2 cases were about 25 days and 2 months after surgery .27 the one case could not be identified .6 but , our case showed that survival time was extended 12 months after the cisplatin , 5 - fu , vincristine of 3 cycles chemotherapy and carboplatin , doxofubicin of 4 cycles chemotherapy . in addition , our case was quite severe that the size of tumor was 9 cm and intraperitoneal metastasis from a ruptured hepatoblastoma compared to the previous three cases , however , aggressive chemotherapy improved survival time . in conclusion , hepatoblastoma in adults is rare , but must be a consideration . it shows no distinct histological findings , but the diagnosis requires a pathologic examination including immunohistochemical stain .\noutput:\n" }, { "from": "agent", "value": "hepatoblastoma usually occurs in children under the age of 2 years , with very few cases reported in adults . we experienced a case of adult hepatoblastoma in a 36 - year - old female with chronic hepatitis b. she had experienced sudden onset abdominal pain . her serum alpha - fetoprotein level was markedly elevated , and abdominal ct showed a 9 - cm mass with internal hemorrhage in the right hepatic lobe with hemoperitoneum , so an emergency hepatic central bisectionectomy was performed . the initial histologic examination revealed that the mass mimicked combined hepatocellular carcinoma and cholangiocarcinoma with spindle - cell metaplasia of the cholangiocarcinoma element . follow - up abdominal ct performed 3 months later showed a 5.5 - cm metastatic mass in the left subphrenic area . laparoscopic splenectomy with mass excision was performed , and hepatoblastoma was confirmed histologically . a histologic re - examination of previously obtained surgical specimens also confirmed the presence of hepatoblastoma . metastatic hepatoblastoma was found at multiple sites of the abdomen during follow - up , and so chemotherapy with cisplatin , 5 - fluorouracil ( 5 - fu ) , and vincristine was applied , followed by carboplatin and doxorubicin . despite surgery and postoperative chemotherapy , she died 12 months after symptom onset ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetic retinopathy ( dr ) is a well - recognized sight - threatening chronic microvascular complication of diabetes . despite decades of research and effective therapies , however , with appropriate medical and ophthalmologic care , it can be prevented in 90 % of cases . earlier lipid profile was believed to have a direct correlation with dr but in contrast to this widely accepted view , previous studies have not shown a consistent relationship between lipid profile and dr . recently , there has been an interest in the relationship of apolipoprotein a1 ( apo - a1 ) and apo - b with dr . apo - a1 is an high - density lipoprotein ( hdl ) constituent and apo - b is present in very low - density lipoprotein ( vldl ) , intermediate - density lipoprotein ( idl ) , ldl , and lipoprotein ( a ) . both apo are not affected by prandial status . because apo - a1 better reflects lipid accumulation in peripheral tissue and apo - b is present in the retina of human eyes with dr , they may be more directly relevant to the biophysiological changes associated with dr than the traditional lipids ( e.g. , hdl and ldl cholesterol and triglycerides ) . however , the extent to which apo measures are useful to identify individuals at risk of dr remains unknown . in this study , the associations of apo and traditional lipid parameters with dr were evaluated and compared in adults with diabetes . diabetes patients of age group 1675 years , who were suffering from dr , were selected on the basis of inclusion and exclusion criteria . history of glaucomahistory of epilepsyhad undergone vitreous surgerycataract on eye examinationany other preexisting retinal disease / retinopathy from any other causepatients on lipid profile modifying drugs . had undergone vitreous surgery cataract on eye examination any other preexisting retinal disease / retinopathy from any other cause patients on lipid profile modifying drugs . detailed history , clinical examination , anthropometric measurements , and biochemical indices were assessed for all the selected patients . serum lipid profile was obtained by autoanalyzer and included hdl , ldl , vldl , triglycerides , and total cholesterol level . serum apo - a1 and apo - b were measured using immunoturbidimetric kit , sgm italy , on a fully autoanalyzer machine . retinopathy was graded from the digital retinal photographs , taken with nonmydriatic auto fundus camera afc 230/210 ( for 7 visual fields ) and classified according to international clinical dr disease severity scale . the analysis was performed using spss ( version 10.1 for windows , ibm in 2009 ) . baseline characteristics of the participants with dr were compared using a chi - square test for proportions , t - test for means . correlation matrix of variables was used to assess the association between serum lipids and apo and dr . diabetes patients of age group 1675 years , who were suffering from dr , were selected on the basis of inclusion and exclusion criteria . history of glaucomahistory of epilepsyhad undergone vitreous surgerycataract on eye examinationany other preexisting retinal disease / retinopathy from any other causepatients on lipid profile modifying drugs . had undergone vitreous surgery cataract on eye examination any other preexisting retinal disease / retinopathy from any other cause patients on lipid profile modifying drugs . detailed history , clinical examination , anthropometric measurements , and biochemical indices were assessed for all the selected patients . serum lipid profile was obtained by autoanalyzer and included hdl , ldl , vldl , triglycerides , and total cholesterol level . serum apo - a1 and apo - b were measured using immunoturbidimetric kit , sgm italy , on a fully autoanalyzer machine . retinopathy was graded from the digital retinal photographs , taken with nonmydriatic auto fundus camera afc 230/210 ( for 7 visual fields ) and classified according to international clinical dr disease severity scale . the analysis was performed using spss ( version 10.1 for windows , ibm in 2009 ) . baseline characteristics of the participants with dr were compared using a chi - square test for proportions , t - test for means . correlation matrix of variables was used to assess the association between serum lipids and apo and dr . mean ldl values for mild npdr ( 119.74 mg / dl ) , moderate npdr ( 124.76 mg / dl ) , severe npdr ( 132.60 mg / dl ) , and pdr ( 128.11 mg / dl ) were observed . on statistical analysis , their correlation with severity of dr was found to be poor ( p = 0.081 ) . mean hdl values for mild npdr ( 39.96 mg / dl ) , moderate npdr ( 36.74 mg / dl ) , severe npdr ( 32.95 mg / dl ) , and pdr ( 29.33 mg / dl ) were observed . on statistical analysis , they were found to be significantly negatively correlated to the severity of dr ( p 0.001 ) . mean apo - b for mild npdr ( 74.98 mg / dl ) , moderate npdr ( 96.45 mg / dl ) , severe npdr ( 101.00 mg / dl ) , and pdr ( 108.11 mg / dl ) were observed . on statistical analysis , apo - b has significant positive correlation with severity of dr ( p 0.001 ) [ graph 1 ] . distribution of cases according to apolipoprotein - b in relation to severity of retinopathy mean apo - a1 for mild npdr ( 148.86 mg / dl ) , moderate npdr ( 124.39 mg / dl ) , severe npdr ( 110.30 mg / dl ) , and proliferative dr ( 103.22 mg / dl ) were observed . on statistical analysis , apo - a1 has significant negative correlation with severity of dr ( p 0.001 ) [ graph 2 ] . distribution of cases according to apolipoprotein - a1 in relation to severity of retinopathy graph 3 shows the distribution of cases according to apo - b / a1 in relation to severity of retinopathy . in apo - b / a10 .400.50 group , totally 19 patients were found , and they all belonged to mild npdr group . in 0.510.60 apo - b / a1 group , totally 29 patients were found , and they all also belonged to mild npdr group . in apo - b / a1 group 0.610.70 , totally 6 patients were found and out of them , 1 and 5 had mild and moderate npdr , respectively . in apo - b / a1 group 0.710.80 , total 22 patients were found and out of them 1 , 19 , and 2 had mild , moderate , and severe npdr , respectively . in apo - b / a1 group 0.810.90 totally 17 patients were found and out of them 14 , 3 had moderate and severe npdr , respectively . in apo - b / a1 group 0.911.00 , totally 17 patients were found and out of them , 14 and 3 had severe npdr and pdr retinopathy , respectively . while in apo - b / a1 group 1.00 , 7 patients were found and out of them , 1 and 6 had severe npdr and pdr retinopathy , respectively . distribution of cases according to apolipoprotein - b / a1 in relation to severity of retinopathy mean apo - b / a1 for mild npdr ( 0.51 ) , moderate npdr ( 0.78 ) , severe npdr ( 0.92 ) , and pdr ( 1.05 ) were observed . thus , the ratio of apo - b / apo - a1 is a better marker of dr with stronger correlation than each molecule alone ( p 0.001 ) . in our study , it was found that hdl correlated well with the severity of dr , bearing an inverse relationship with the same . apo - a1 and apo - b showed a consistent relationship with severity of dr . apo - a1 was inversely related to the severity of dr while apo - b was directly related to the severity of dr . the ratio apo - b / apo - a1 showed a direct relationship with severity of dr with severity increasing as the ratio increased . lyons et al . in their study , showed an inverse relationship of hdl with the severity of dr . zoppini et al . in their study , showed that tg / hdl - c ratio was positively associated with dr and other microvascular complications . hdl - c itself is a complex of several lipoproteins , cholesterol , and triglycerides and has several postulated mechanisms of vascular action , notably reverse cholesterol transport as well as anti - inflammatory and antioxidant properties . furthermore , there is emerging evidence that hdl - c improves glycemic control by modulating glucose uptake into skeletal muscle and protects against islet - cell dysfunction . although the exact putative mechanism for protection is unknown , it is known that hdl - c exerts beneficial effects on many of the pathways known to be detrimental to the vascular biology . wu et al . , in their research , showed that quantitative dyslipidemia is associated with the initiation and progression of dr . they hypothesized that in a manner analogs to atherogenesis , extravasation of ldl from retinal capillaries and its subsequent oxidation may be implicated in the progression of dr . however , lipid profile has shown an inconsistent relationship with dr in many of the other previous studies . similar to our findings , data from the dcct did not show an association with total cholesterol levels . the multi - ethnic study of atherosclerosis showed no associations of serum lipids with dr . apo - a1 is produced by the liver and intestine and is essential for the reverse transport of cholesterol from peripheral tissue to the liver . in addition to possessing an anti - inflammatory and anti - oxidant actions , apo - a1 is also involved in intraretinal lipid transport indicating its importance in preventing microvascular ocular complication of diabetes . higher apo - a1 levels in vitreous fluid and retinal pigment epithelium among individuals with diabetes than in those without diabetes suggest protective mechanisms within the retina through apo - a1 against lipid deposition and inflammation induced lipotoxicity that can otherwise lead to dr . on the contrary , apo - b is a major structural protein for vldl , idl , and ldl and is responsible for delivering lipids from the liver and intestine to peripheral tissue . simo et al . in their study , compared apo - a1 expression in retina of diabetic and nondiabetic donors . they found that apo - a1 overexpression is an early event in the retina of diabetic patients and can be involved in the pathophysiology of dr . , however , failed to document any association between apo - a1 and apo - b and severity of dr . the major limitation of their study , as stated by them , was the small size of the study groups . first , apo and components of conventional basic lipid profile ( including hdl and ldl ) are not one and the same . apo are protein moieties with structural , enzymatic , and receptor binding functions , and hdl cholesterol and ldl cholesterol refer to the cholesterol lipid content of hdl and ldl only . using only hdl and ldl ignores the contribution from other lipoproteins , resulting in the inconsistent association . the diabetic environment induces changes such as nonenzymatic glycation , oxidation , and advanced glycation end product modification of lipoproteins which may affect the assay results . similarly , there may be differences in the precision of measurement of lipoproteins and potential for differential effects of sample handling and nonenzymatic glycation and oxidation on the different assays . on the contrary , apo - a1 and apo - b levels are more stable than lipid levels , particularly in individuals with diabetes and are not affected significantly by prandial status . these reasons may have accounted for our findings showing highly significant association of apo - a1 and apo - b in comparison to lipid profile . strengths of this study include an appreciable sample size and study of both lipid profile as well as apo in our study . however , cross - sectional design accounts for our shortcomings as further prospective studies will be needed for better understanding of the association and risk factors . second , lack of control population is also one shortcoming of our study . finally , it was not possible to determine the strength of association of apo - b , apo - a1 , and apo - b / a1 ratio was independent of other factors such as duration of diabetes , the level of glycemic control , hypertension . therefore , although further studies are needed to establish the result , we propose these apo as the better and stronger biomarkers of dr as compared to hdl and ldl in relation with dr .\noutput:\n" }, { "from": "agent", "value": "aim : diabetic retinopathy ( dr ) is the most common preventable cause of blindness where early detection and treatment can be sight - saving . search for biomarkers of the disease has been relentless . we aimed to determine whether lipoproteins apolipoproteins a1 and b1 ( apo - a1 and apo - b1 ) have stronger associations with dr in contrast to conventionally measured low - density lipoprotein ( ldl ) and high - density lipoprotein cholesterol levels.materials and methods : we performed a cross - sectional study and studied 117 patients . serum lipid profile was assessed by autoanalyzer . serum apo - a1 and apo - b were measured using immunoturbidimetric kit on an autoanalyzer . apo - b / a1 ratio was calculated . retinopathy was graded from the digital retinal photographs , taken with nonmydriatic auto fundus camera and classified according to international clinical dr disease severity scale.results : mean apo - a1 for mild , moderate , severe retinopathy , and proliferative dr ( pdr ) shows a significant negative correlation ( p = 0.001 ) with severity of retinopathy . mean apo - b for mild , moderate , severe , pdr displayed a significant positive correlation with severity of retinopathy ( p = 0.001 ) . mean apo - b / a1 for mild , moderate , severe , pdr showed highly significant positive correlation with severity of retinopathy ( p < 0.001 ) . in contrast , mean ldl for mild , moderate , severe , pdr showed insignificant association with severity of dr ( p = 0.081 ) . conclusion : apo - a1 and apo - b have a stronger association with the development of dr than traditional lipids and can thus facilitate early detection and treatment of the disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: study area - central - west brazil covers an area of 1,606,371 km and consists of the following four federal units : mt , ms , go and df . the region is divided into 467 municipalities , most of which are in go [ brazilian institute of geography and statistics ( ibge.gov.br / cidades ) ] , which has a population of 14,993,194 , found predominantly in urban areas ( 89 % ) . geographically , central - west brazil is formed by a central and a southern plateau and the pantanal plain . the cerrado , the predominant biome , covers the greatest area ; however , the other biomes include the pantanal , atlantic forest and amazon forest ( fig . the climate is tropical with the following two well - defined seasons : a rainy summer between october - march and a dry winter between april - september .1 : study area showing the states in central - west brazil and the limits of the biomes in this region . df : federal district ; go : state of gois ; ms : state of mato grosso do sul ; mt : state of mato grosso . distribution data - the phlebotomine occurrence data were obtained from the entomology services in the state departments of health ( mt , ms , go and df ) and correspond to captures conducted between 1996 - 2014 . in addition , the literature data between 1962 - 2014 were reviewed ( martins et al .2006 , dorval et al . 2006 , 2009 , 2010 , andrade filho et al .2007 , missawa & dias 2007 , missawa & maciel 2007 , silva et al . 2007 , 2008 , 2008 , missawa et al . 2008 , andrade et al . 2009 , de almeida et al . 2010a , b , de 2013a , b , paiva et al . the records from scientific collections in specieslink ( splink.cria.org.br / ) , a distributed information system that combines primary data from scientific collections in real time and in the museum of zoology of the university of so paulo were analysed as well . the taxonomic classification used follows galati ( 2003 ) and the abbreviations of the sandfly genera are those proposed by marcondes ( 2007 ) . species occurrence in the biomes - to analyse the phlebotomine occurrence in the biomes in central - west brazil , the species distribution data and the limits of the biomes in the region were superimposed using qgis 2.6 . the relative occurrence ( the number of records in the biome / total number of records for the species in central - west brazil ) was then calculated and represented graphically using excel . enm - the phlebotomine species records were georeferenced with a confidence level of 5 km and an approximate accuracy of 0.01 . the geographic coordinates of named places were obtained from an online gazetteer ( fallingrain.com/world ) and the data were organised in spreadsheets . the species occurrence database was reviewed in arcgis to avoid duplicate records at the spatial resolution used and obvious errors of georeferencing ( e.g. , points in the ocean ) or identification ( out dated taxonomic arrangements ) . potential distribution models were produced for the phlebotomine species with more than 20 records to allow for more accurate modelling ( stockwell & peterson 2002 ) . the models were based on the following eight climatic variables : the mean annual temperature , mean diurnal temperature range , temperature seasonality , maximum temperature in the warmest months , minimum temperature in the coldest months , annual precipitation , precipitation in the wettest months and precipitation in the driest months . these data were obtained from the worldclim project ( worldclim.org ) and are the result of interpolation of the mean monthly climatic data from meteorological stations over 30 - 50 years ( 1950 - 2000 ) , depending on the data availability at the stations ( hijmans et al . the eight variables were selected to avoid confounding effects by producing models in an environmental space with an excess of dimensions ( peterson & nakazawa 2008 ) . the environmental data used in the analyses had a spatial resolution of 5 x 5 km per pixel . the potential distribution models were produced by the maximum entropy method using maxent , v. 3.2.1 . the basic parameters proposed by the program were used with 10 replications by bootstrap sub sampling . the occurrence data for the species were separated into two sets , as follows : one set for the model calibration ( 75 % of the points ) and the other set for the model evaluation ( 25 % of the points ) . the potential geographic distribution models ( the median output grids from maxent ) were imported and edited using the arcgis 9 program ( esri ) . the model accuracy was assessed by analysing the omission rates associated with the test points ( anderson et al . the jackknife test implemented in maxent was used to identify which variables had the greatest influence on the distribution of the recorded phlebotomine species ( phillips et al . this test measures the predictive effect of each variable in the model by determining the quality of the models produced with only the variable being tested and the quality of those produced with this variable being omitted . in all , 2,803 phlebotomine records for 17 genera and 127 species were analysed in central - west brazil , as follows : bichromomyia ( 2 spp ) , brumptomyia ( 7 spp ) , evandromyia ( 21 spp ) , expapillata ( 1 sp . ) , lutzomyia ( 12 spp ) , martinsmyia ( 2 spp ) , micropygomyia ( 11 spp ) , migonemyia ( 2 spp ) , nyssomyia ( 8 spp ) , pintomyia ( 11 spp ) , pressatia ( 3 spp ) , psathyromyia ( 19 spp ) , psychodopygus ( 13 spp ) , trychopygomyia ( 3 spp ) , trichophoromyia ( 6 spp ) , sciopemyia ( 3 spp ) and viannamyia ( 3 spp ) . these fauna correspond to approximately 50 % of all the known phlebotomine species in brazil . mt was the state with the greatest species richness ( n = 108 ; 85 % ) , followed by ms ( n = 61 ; 48 % ) , go ( n = 39 ; 31 % ) and df ( n = 29 ; 23 % ) . the evandromyia , lutzomyia , psathyromyia and psychodopygus genera had the greatest species richness . the brumptomyia , evandromyia , lutzomyia , nyssomyia , pintomyia , psathyromyia , micropygomyia and sciopemyia genera were distributed widely throughout central - west brazil . the geographical distributions of most of the phlebotomine species analysed in this study are shown in supplementary figure . all 34 species with more than 20 points have at least one record in the cerrado and 24 ( 70 % ) presented a relative occurrence 50 % in this biome ( fig . ten species were more common in the amazon , particularly evandromyia bacula , psychodopygus complexus and trychopygomyia dasypodogeton . cruzi were the species with the highest number of records in the atlantic forest and the pantanal , respectively ( fig .2 : relative occurrence of 34 phlebotomine species in biomes in central - west brazil based on the percentage of known occurrences in each area . the white line indicates a relative frequency of 50 % . to study the potential geographic distribution of the phlebotomine species in central - west brazil , 2,216 records were analysed , as follows : bi . flaviscutellata ( n = 62 ) , brumptomyia brumpti ( n = 55 ) , brumptomyia avellari ( n = 33 ) , ev . bacula ( n = 21 ) , evandromyia carmelinoi ( n = 76 ) , evandromyia evandroi ( n = 98 ) , evandromyia lenti ( n = 143 ) , evandromyia saulensis ( n = 62 ) , evandromyia termitophila ( n = 116 ) , evandromyia teratodes ( n = 38 ) , evandromyia walkeri ( n = 61 ) , evandromyia sallesi ( n = 105 ) , lu . longipalpis ( n = 129 ) , micropygomyia acanthopharynx ( n = 49 ) , micropygomyia villelai ( = micropygomyia goiana ) ( n = 25 ) , micropygomyia longipennis ( n = 62 ) , micropygomyia quinquefer ( n = 22 ) , mg . whitmani ( n = 178 ) , psathyromyia aragaoi ( n = 76 ) , psathyromyia hermanlenti ( n = 85 ) , psathyromyia lutziana ( n = 53 ) , psathyromyia aff . ( n = 73 ) , psathyromyia punctigeniculata ( n = 61 ) , pintomyia christenseni ( n = 29 ) , psychodopygus complexus ( n = 27 ) , psychodopygus davisi ( n = 68 ) , sciopemyia sordellii ( n = 123 ) and tythe ecological niche models of most of these species and their geographic coordinates are shown in the supplementary figure and table , respectively . whitmani was distributed widely in all the states and had the potential to occur throughout the entire territory of central - west brazil ( fig . bi . flaviscutellata and ny . antunesi were common in mt , where the climate was more suitable to these species . however , bi . flaviscutellata had high potential to occur in southern go as well . neivai and ny . intermedia were more restricted to ms and go , respectively ( fig . areas in northern go , north - western mt and southern ms were not highly suitable for lu .3 : potential geographic distribution of american tegumentary leishmaniases vectors in central - west brazil . the triangles represent the points used to produce the ecological niche model based on eight climate variables . the red scale shows climate suitability for the different species ( dark : high ; light : low ) . fig .4 : potential geographic distribution of visceral leishmaniases vectors in central - west brazil . the triangles represent the points used to produce the ecological niche model based on eight climate variables . the red scale shows climate suitability for the different species ( dark : high ; light : low ) . the temperatures in the coldest months and temperature seasonality were the variables with the greatest influence on the models , according to the jackknife tests . most of the test points for the species were included in the areas predicted by the enms . this study updated the geographic distributions of phlebotomine species in central - west brazil , which account for approximately one - half of all the known species recorded in brazil . the results show that phlebotomine species have different geographic distribution patterns in this region and that nearly all the areas of central - west brazil have climate conditions that favour the occurrence of at least one of these species . the distribution patterns show that sandflies are found more frequently in the cerrado areas and that temperature seasonality and temperature in the coldest months are the climate variables that have the greatest influence on the species distribution . missawa & maciel ( 2007 ) and ses / mt ( 2013 ) recorded 106 species in mt , which is fewer than the 108 species registered in this study . in ms , de oliveira et al . ( 2010b ) reported 57 species , which is fewer than the 61 species registered here . ( 2002 ) detected 41 species in go , whereas 47 were found in this study . this study did not find new records of sandfly species in central - west brazil . the differences between the numbers of species in the previous lists and in this study are in part because the records of the health departments of municipalities are generally unpublished . ( 1978 ) , which is sometimes overlooked in the literature and even the latest revision of galati ( 2014 ) , which updates the species records in the brazilian states . the higher species richness in mt is probably related to the size of this state and the variety of the biomes ( the cerrado , amazon forest and pantanal ) and transition zones , which could favour diversification of phlebotomine fauna , as observed for triatomine species ( pereira et al . shannoni do not occur in brazil and , based on this taxonomic review of the shannoni series , the specimens recorded in central - west brazil is psathyromyia bi - geniculata ( floch & abonnenc , 1941 ) . the records of lutzomyia cruciata , pintomyia andina , psathyromyia lanei , psathyromyia ruparupa , psychodopygus nigaraguensis and viannamyia caprina require confirmation . moreover , lutzomyia gomezi , micropygomyia vonatzingeni , evandromyia cortelezzii and pintomyia kuscheli could be incorrectly registered in the cwb because they are morphologically similar to lutzomyia sherlocki , micropygomyia oswaldoi , evandromyia corumbaensis and pintomyia fischeri or pintomyia pessoai , respectively ( eab galati , unpublished observations ) . specimens identified as sciopemyia microps and pa . runoides can be new species ; in the present study they are considered as sciopemyia aff . the occurrence records in the present study are according to identified species by health services and formally published . the revision of specimens deposited in scientific collections should elucidate these possible taxonomic problems . whitmani showed a widespread geographic distribution in central - west brazil , corroborating the findings of other studies ( young & duncan 1994 , galati 2003 , peterson & shaw 2003 ) . its presence in an area is positively correlated with deforestation and it occurs primarily in municipalities with lower economic development indexes ( galati et al . 2006 , da costa et al . intermedia occurs predominantly in go and df ; however , this study indicated that areas in western mt are climatically suitable and could therefore favour dispersal of this species within this state . this species has a widespread distribution in the southeast region of brazil ( peterson & shaw 2003 ) . the climatic conditions in southern central - west brazil ( particularly in ms ) were suitable for ny . neivai should be revised in future studies because they are similar species and identification errors could cause it to be difficult to map their geographic distributions correctly ( marcondes 1996 , andrade filho et al . 2003 , 2007 ) . flaviscutellata had great potential to occur in southern go within the cerrado biome , for which there are few records of this species . according to young and duncan ( 1994 ) our results show that it is frequently found in the cerrado as well and that it probably disperses along the gallery forests in this biome . complexus were found predominantly in northern mt and had a significant relative occurrence in the amazon biome , which is in agreement with young and duncan ( 1994 ) . longipalpis occurred in all the biomes in central - west brazil , confirming its great adaptability to different environments ( deane & deane 1962 , lanzaro et al .1993 , sherlock 1996 , aguiar & medeiros 2003 , galati 2003 , de almeida et al . cruzi occurred predominantly in mt and ms , confirming the findings of missawa and lima ( 2006 ) . lenti was widespread in central - west brazil , as previously reported by young and duncan ( 1994 ) and galati ( 2003 ) . the variables with the greatest influence on the models were the temperatures in the coldest months and temperature seasonality , as in the study of lu . these results are in agreement with those of guzmn and tesh ( 2000 ) and highlight the fundamental importance of temperature for the development and occurrence of phlebotomines . however , biotic and socioeconomic variables influence the occurrence of these insects as well ( zeilhofer et al . therefore , further studies analysing the geographic distribution of phlebotomines under environmental and climate - change scenarios are required ( moo - llanes et al . considerable efforts were made in this study to establish a comprehensive , representative , up - to - date database of phlebotomine species in central - west brazil . however , although the data were gathered from a variety of sources ( e.g. , scientific articles , museums and books ) , some records will inevitably have been overlooked , as an inherent limitation of geographic distribution studies . furthermore , taxonomic issues might have had an effect on the occurrence data , maps and models described here . the database spatial resolution in this study could limit the accuracy of the enms . models based on low - resolution data tend to overestimate the species distribution limits ( seo et al . the effects of these uncertainties related to low resolution tend to be smaller in studies on a continental or regional scale ( wiens et al . 2009 ) . finally , this study could facilitate the development of surveillance and control strategies for leishmaniases in central - west brazil . areas that are climatically suitable for the species discussed in this study and are without any confirmed occurrence should be investigated in future phlebotomine surveys . the maps produced here could serve as reference to future studies on sandflies and are the first step to developing an atlas of phlebotominae in brazil , with the geographical distribution of all the species , which could be useful in academic studies and health services .\noutput:\n" }, { "from": "agent", "value": "this study updates the geographic distributions of phlebotomine species in central - west brazil and analyses the climatic factors associated with their occurrence . the data were obtained from the entomology services of the state departments of health in central - west brazil , scientific collections and a literature review of articles from 1962 - 2014 . ecological niche models were produced for sandfly species with more than 20 occurrences using the maxent algorithm and eight climate variables . in all , 2,803 phlebotomine records for 127 species were analysed . nyssomyia whitmani , evandromyia lenti and lutzomyia longipalpis were the species with the greatest number of records and were present in all the biomes in central - west brazil . the models , which were produced for 34 species , indicated that the cerrado areas in the central and western regions of central - west brazil were climatically more suitable to sandflies . the variables with the greatest influence on the models were the temperature in the coldest months and the temperature seasonality . the results show that phlebotomine species in central - west brazil have different geographical distribution patterns and that climate conditions in essentially the entire region favour the occurrence of at least one leishmania vector species , highlighting the need to maintain or intensify vector control and surveillance strategies ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: recently , many efforts in solar cell development have employed nontraditional schemes that are different from the conventional planar semiconductor p - n junction design in order to focus on simplifying fabrication and decreasing cost while maintaining a competitive efficiency . of these solar cell designs , the most promising is the dye - sensitized solar cell ( dssc ) , first reported in 1991 to have an efficiency of 7.1 % . since then , the efficiency has been pushed to over 10 % , but the theoretical limit of 31 % for a single junction semiconductor photovoltaic device remains far from reach . many attempts have been made to improve the original dssc design and circumvent its inherent limitations , especially the low conductivity of the disordered tio2 nanoparticle film and potential charge recombination at the tio2 surface . one promising approach is to replace the nanoparticle network with a vertically aligned nanotube [ 7 - 10 ] or nanowire [ 11 - 17 ] array , which provides the electrons with a direct , uninterrupted route to the anode . even though this variation is expected to improve the performance , the efficiency of the modified dssc typically remains in the 15 % range . many explanations have been proposed for why the above modifications have failed to improve the performance , including an insufficiently large surface area for dye adsorption compared to the nanoparticle film , air trapped inside the nanotubes , and large series resistance between the nanostructure and the electrodes . a detailed analysis of the modified structures within the new designs is therefore desired and critical in order to elucidate the failure mechanisms and quantify their effects . in order to achieve this , we propose a sequential method , which disassembles the modified dssc in order to gather information that can not be obtained once a bulk device has been assembled . with this strategy , one can track the contribution of each component and identify which step or interface is most responsible for the poor performance . shell nanowires of carbon nanofiber coated with anatase tio2 ( cnf / tio2 ) will be the subject of this study . in a recent work , a vertically aligned cnf / tio2 nanowire array was employed to replace the sintered tio2 nanoparticle network . the observation of complete fluorescence quenching suggests that the cnf readily accepts photoexcited electrons from the tio2 . this allows the electrons to be transported through the higher - conductivity cnf core instead of the lower - conductivity tio2 shell , improving charge transport and decreasing recombination . additionally , this structure offers an enhanced surface area for dye adsorption compared to traditional nanowires ( nws ) due to the rough tio2 surface . despite these expected improvements , the efficiency of the cnf / tio2 modified dssc was much below that of the original dssc . to understand the underlying physics behind the low efficiency , we have investigated charge transport properties and photoconductivity of single cnf / tio2 - dye nw devices . the cnf / tio2 core shell nw samples were prepared by depositing a particulate anatase tio2 film for 30 min at 500 c onto a vertically aligned carbon nanofiber ( vacnf ) array by metal organic chemical vapor deposition ( mocvd ) . the vacnfs used are a subset of multi - walled cnts grown by plasma - enhanced chemical vapor deposition ( pecvd ) on silicon substrates [ 18 - 20 ] . the details of the growth have been described elsewhere . to fabricate individual cnf / tio2 core shell nw devices as schematically shown in fig .1 a , the as - grown nws were dispersed into ethanol and transferred onto a silicon substrate covered with 500 nm thermally grown silicon dioxide . bi - layer electron beam resist ( pmma / mma - maa ) was used in the electron beam lithography ( ebl ) process for the definition of two or four electrodes . before electrode deposition , a subset of the samples was treated with o2 plasma at 20 w for 30 s via reactive ion etching ( rie ) at a pressure of 7.1 mtorr in order to remove any possible residual electron beam resist and other surface contaminants that could prevent ohmic contact between the electrodes and tio2 shell . ti ( 15 nm ) / au ( 120 nm ) electrodes were deposited by using electron beam evaporation through the ebl - defined mask followed by liftoff with acetone . after fabrication , all samples were annealed at 400 c for 30 min with a temperature ramping rate of 15 c / min . the annealing was performed in vacuum at a pressure of ~ 10 torr or better , with the intention of avoiding oxidation of ti in the bottom layer of the electrode and desorbing any possible residual chemicals on the surface of the nanowire due to the above processes . to attach dye molecules onto the tio2 surface of the cnf / tio2 core shell nw device , the o2 plasma treated and untreated samples were soaked in 0.2 mm ethanol solution of cis - bis ( isothiocyanoto ) bis ( 2,2 - bipyridyl -4,4-dicarboxylato ) - ruthenium ( ii ) bis - tetrabutylammonium dye ( n719 , solaronix ) for 12 h and blown dry with pure n2 . the soaking and mounting of the samples were performed in dark in order to limit the premature exposure of the devices to light . the prepared samples were enclosed in an aluminum box in order to measure the dark i v characteristics before exposure to one sun illumination ( 100 mw / cm ) produced by a solar simulator outfitted with an am 1.5 g filter ( newport ) . a schematic diagram of a single cnf / tio2 core shell nw device . shell structure of the cnf / tio2 nw . the yellow dashed line shows the interface between the tio2 shell and cnf core . figure 1a schematically depicts the structure of the cnf / tio2 - dye core shell nw device . it consists of a cnf / tio2 core / shell nw with two metal electrodes on the surface of the tio2 sheath . a scanning electron microscopy ( sem ) image of a representative cnf / tio2 core / shell nw device is shown in fig . . 1b , which was fabricated to measure the contact resistance between the metal probes and the nw . the cnf core of the nw has an average diameter of ~ 100 nm , while the tio2 sheath of the samples used in this study is about 1015 nm thick . the microstructures and morphologies of the cnf / tio2 core shell nw were studied using high - resolution transmission electron microscopy ( hrtem ) . as shown in fig .1 c , tio2 forms a conformal particulate film surrounding the cnf core , covering the cnf core uniformly even at a kink of the cnf , which is shown by the dashed line at the interface of the core and shell . fast fourier transform ( fft ) was used to analyze the crystalline structure of cnf core and tio2 shell . distinct ordered planes as suggested by the discrete spots were observed on cnf ( right inset of fig .1 d ) , while a mixture of compact fine grains several nanometers in size embedded in an amorphous phase was suggested for the tio2 sheath ( left inset of fig . x - ray diffraction analysis on cnf / tio2 nw array indicates the fine grains are anatase tio2 . hrtem suggests the dimension of the grains is in the range of 3 - 5 nm . figure 2a shows the i v characteristics of sample d1 , which is a representative in a group of six samples not treated with o2 plasma , in dark and under illumination before and after dye attachment . although only the positive bias is shown , it should be noted that the curve is symmetric . contact resistance in the range of 38 m was typically observed for the untreated samples . as previously mentioned , this large contact resistance is likely due to a contaminated tio2 surface , which may prevent ohmic contact between ti and tio2 during metal evaporation and the diffusion of ti to tio2 during annealing . before dye attachment , this may be attributed to the large number of dangling bonds and the interfaces in the amorphous tio2 phase and between crystallites and amorphous tio2 phase in the tio2 sheath . the resulting high density of oxygen vacancies may act as electron donors and therefore cause substantial dark current . the illuminated current ( open red circles ) is only slightly higher than the dark current before dye attachment , which may contain direct band transition in the tio2 ( eg ~ 3.4 ev ) close to the uv end of the solar spectrum and sub - band transition of tio2 . the sub - band transition is commonly seen in nanostructured tio2 and is due to localized defect - induced band gap states . furthermore , the measurement on uncoated individual cnf samples ( not shown ) exhibits no photoresponse under the conditions presented in this paper , suggesting the observed photoresponse is due to the tio2 or dye only . v curves for sample d1 without and with dye and b the corresponding curves for sample d2 after attaching dye molecules , the dark ( solid black squares ) and illuminated ( solid red squares ) current of sample d1 decreased noticeably as shown in fig . 2a . we speculate that the decrease is due to the passivation of some hole traps during the dye attachment . it has been suggested that non - equilibrium holes rapidly become trapped in deep traps , which may be concentrated in particular regions due to inhomogeneity in the lattice such as grain boundaries . these traps produce a local potential barrier that prohibits electrons from readily recombining with the holes , thus separating charge carriers and improving conductivity . the n719 dye is expected to attach to the tio2 surface via its carboxyl group . while the sample is soaking in solution , the protons that previously resided on the now negatively charged carboxyl group may passivate some of the hole traps near the surface . these hole traps are commonly associated with oxygen vacancies , which can readily occur on the surface as well as at the grain boundaries within the nanocrystalline / amorphous tio2 . even though both the dark and illuminated currents decreased , the photo - induced current , defined as the difference between the illuminated and dark currents at a particular bias , increased after dye attachment . this suggests that the dye molecules do in fact contribute to the photo - induced current , or more specifically , the free electron density . first , the dye molecules may inject photo - excited electrons into the tio2 layer and increase the electron density . it should be recognized that dye regeneration may not occur effectively in this case due to absence of the electrolyte , so this mechanism is not expected to contribute to the measured current . second , the presence of the dye molecules may modify the number of the hole traps , as argued earlier . third , since the measurements occur in air , which contains molecular oxygen , a known electron scavenger , the presence of the dye molecules may block some of the molecular oxygen from removing conduction electrons and forming adsorbed o2 sites that decreases the free electron density in the tio2 . measurements of single cnf / tio2 nanowires in vacuum ( not shown ) exhibit a current that is 12 orders of magnitude higher than in air . this is in qualitative agreement with studies on thin films of nanocrystalline tio2 in which environments containing lower oxygen content resulted in higher current due to the decreased number of electron scavengers . this suggests that blocking access to the surface of the tio2 would have a similar effect and thus increase the electron concentration and hence current . the i v measurements were repeated on sample d2 , which is representative of the samples with electrode contact area treated with o2 plasma before electrode deposition . the o2 plasma treatment improved the electrical contact to the cnf / tio2 nw considerably as shown in fig . the contact resistance of the treated samples is several to several tens of k , which is two to three orders of magnitude smaller than that of the untreated samples . the resistivity of sample d2 is estimated to be ( 6.42.1 ) 10 cm . this value seems reasonable since it lies between the intrinsic resistivity of cnf ( 0.4710 cm [ 26 - 28 ] ) and that of tio2 thin films ( 2.61010 cm ) . shell nanowire compared to thin film tio2 suggests that the cnf does in fact contribute to the charge transport even when both electrical contacts are on the tio2 shell . this low - resistance interface may be understood from the growth chemistry of the tio2 shell on cnf . during pecvd , a mixture of c2h2 ( at 62 sccm ) and nh3 ( at 252 sccm ) this generates an important plasma etching effect to remove the amorphous carbon , which may be deposited at the cnf surface . for many carbon nanotube studies , the hydrogen atoms covalently bonded to the cnf surface at the graphitic edge do not seem to be a problem . four - probe electrical measurements with side contact by zhang et al . did not show any evidence of an interface problem . in addition , during mocvd of tio2 , the oxygen atoms involved in the reaction will likely react with hydrogen and form a c o bond before tio2 is deposited . the i v characteristics become more linear after o2 plasma treatment , which indicates an ohmic contact on the metalthe reduction of the contact resistance results in a significant current enhancement of almost two orders of magnitude both in dark and under illumination when compared to the untreated sample d1 . in addition , the photo - induced current in sample d2 is significantly higher than in d1 . at 100 mv bias , the photo - induced current in sample d2 is ~ 0.21 a after dye attachment , which is about two orders of magnitude higher than in the untreated samples . this result confirms that an ohmic contact to the nanostructured materials is essential to the charge transport in a nw device . the o2 plasma treatment was also applied to the tio2dye interface in order to examine if a similar residue or interface layer was present that could hinder dye adsorption . to make a direct comparison , the dye was removed from sample d2 before it was subjected to o2 plasma cleaning under the same processing conditions mentioned earlier except for a longer processing time of 1 min . immediately after the treatment , the sample showed an enhanced photo - induced current that decayed back after 12 h in the dark in air . dye was then attached using the previously described method , and the photo - induced current recovered more or less the original value shown in fig . this observation suggests that the surface of the tio2 was clean with respect to dye attachment . it remains a question whether such plasma cleaning benefits electron transfer from dye to tio2 in the presence of electrolyte . the spectral dependence of the photo - induced current ( sample d2 ) before dye attachment is illustrated in fig . the first is at wavelengths smaller than 375 nm , which corresponds to a bandgap of ~ 3.3 ev and is within the reported range for nanocrystalline tio2 . the second peak appears around 550 nm , which has been observed on tio2 nanoparticles and is attributed to the sub - band transitions . interestingly , no such peak was observed on the photoluminescence curve measured on tio2 / cnf array with 60 min of tio2 growth time , as opposed to 30 min for the samples used in this work . a plausible explanation is the much improved crystallinity in tio2 layer with longer growth time , which resulted in much reduced sub - band charge carriers . on the other hand , the direct transport measurement employed in this work may provide higher sensitivity than the optical one . as we mentioned earlier , the possible contribution of the cnf core to the spectral feature of the photo - induced current can be ruled out . in fact , the same spectral current measurement was repeated on individual cnf devices , and no photo - induced current was observed . photo - induced current at constant bias for a single cnf / tio2 nw device as a function of a incident light wavelength and b light intensity figure 3b shows the photo - induced current ( normalized to that at 1 sun ) for sample d2 with and without dye as a function of incident light intensity . before dye attachment , the current increases linearly with the light intensity , which indicates the carriers excited in tio2 is proportional to the number of incident photons . however , after dye molecules were attached to the nw , the photo - induced current versus light intensity curve experienced a dramatic drop at a light intensity of around 1.5 suns . after dye molecules were damaged above a certain light intensity , they may be detached from the tio2 surface . based on the above discussion , this would reintroduce many electron traps and open up the tio2 surface to electron scavenging by molecular oxygen leading to a decrease in the number of free electrons . while the previously mentioned i v measurements were made under steady state conditions , the samples in fact exhibit a transient response to either the introduction or removal of incident light . the presence of transient photoconductivity is well documented in nanocrystalline tio2 thin films , but is interesting to observe in a single nw . in this measurement , the samples were first exposed to one sun illumination at a constant bias of 100 mv . the high surface - to - volume ratio and thus high density of electron traps due to hydroxylated surface ti sites prevents achievement of steady state current until all traps are filled and equilibrium is reached between trapping and de - trapping events . it was observed ( not shown ) that after dye attachment , the time required to reach steady state current was reduced by approximately 75 % . this suggests that the dye molecules may passivate many of the hydroxylated surface ti sites and greatly reduce the number of electron traps . however , since nearly 1 min is still required to reach steady state current after dye molecules are attached , it is likely that many potential dye adsorption sites remain and the dye loading is not optimized . once a steady state current was achieved , the incident light was removed and the photo - induced current decay was recorded . figure 4 shows the normalized photo - induced current decay profile in log log and linear scale ( inset ) for samples without and with attached dye molecules . as previously mentioned , under illumination , nonequilibrium holes become trapped in deep traps due to oxygen vacancies leading to an excess electron density equal to the trapped hole density . these traps are assumed to be concentrated in certain regions due to inhomogeneities such as grain boundaries . this leads to local electric fields that spatially separate charge carriers and require electrons to overcome a potential barrier in order to recombine . as time goes on , the separation between the quasi fermi levels increases causing the recombination time to increase along with it . as can be seen in fig .4 , the decrease in current is immediate and initially very fast followed by a much slower leveling off as the probability for the electron capture by tunneling through surface and inter - grain potential barriers decreases , which is consistent with previous work done on nanocrystalline tio2 thin films . it can be clearly seen that the photoconductivity decay is more rapid when the dye is present . this is consistent with the above observations that the dye attachment passivates some hole traps on the surface . as the number of hole traps decreases , the recombination time also decreases . normalized photo - induced current decay of sample d2 a without dye and b with dye . in conclusion , electrical conductivity has been investigated on individual cnf / tio2 core shell nw attached with n719 dye molecules in dark and under illumination . it has been found that the contact resistance to the tio2 surface may sensitively affect the dark and photo - induced conductivity by nearly two orders of magnitude , suggesting that care must be taken to ensure ohmic contact between the tio2 structure and the anode in the dssc . the nanocrystalline state of the tio2 shell affects both spectral and dynamic behaviors of the conductivity due to the presence of the defect - induced bandgap states and hole traps such as oxygen vacancies . the dye attachment reduces such an effect by passivating some of the vacancies at low illumination intensity up to 1.5 suns , above which damage to and subsequent detachment of the dye molecule may occur . the single nanowire approach presented in this workmay be applied to many nanostructures involved in nanostructured dssc and other optoelectronic devices to achieve an understanding of the electrical transport at the nanoscale . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author ( s ) and source are credited . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author ( s ) and source are credited .\noutput:\n" }, { "from": "agent", "value": "a vertically aligned carbon nanofiber array coated with anatase tio2 ( cnf / tio2 ) is an attractive possible replacement for the sintered tio2 nanoparticle network in the original dye - sensitized solar cell ( dssc ) design due to the potential for improved charge transport and reduced charge recombination . although the reported efficiency of 1.1 % in these modified dssc s is encouraging , the limiting factors must be identified before a higher efficiency can be obtained . this work employs a single nanowire approach to investigate the charge transport in individual cnf / tio2 core shell nanowires with adsorbed n719 dye molecules in dark and under illumination . the results shed light on the role of charge traps and dye adsorption on the ( photo ) conductivity of nanocrystalline tio2 cnf s as related to dye - sensitized solar cell performance ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: intestinal transplantation ( itx ) has added a new dimension to the management of patients with irreversible intestinal and parenteral nutrition failure . a good measure of its success not only involves having a patient alive , well and off parenteral nutrition ( pn ) , but having a patient that is nutritionally replete . thus evaluating successful nutritional function after transplant needs objective measures to avoid delays in decision making that might compromise the graft . the aim of this study is to determine whether igf - 1 and calprotectin in combination can act as potential biomarkers , to stratify patients into distinct nutritional categories . the patients that have clinical signs of bowel dysfunction are easy to spot , however it is the ones that are clinically well that are the focus of this article . between october 2008 and january 2013 , our centre performed 18 cadaveric intestinal transplantations . there were 11 males and 7 females . the cause of intestinal insufficiency was crohn s disease in 4/18 ( 23 % ) , mesenteric infarction in 4/18 ( 23 % ) , visceral neuropathy in 3/18 ( 17 % ) , radiation enteritis in 2/18 ( 11 % ) , desmoid tumour in 2/18 ( 11 % ) , volvulus in 1/18 ( 5 % ) , necrotizing enterocolitis in 1/18 ( 5 % ) and ulcerative colitis in 1/18 ( 5 % ) . two patients underwent a modified multi - visceral itx , 10 isolated small bowel , 1 isolated small bowel and kidney and 5 isolated small bowel and abdominal wall transplant . we have been prospectively measuring igf - 1 levels in patients undergoing intestinal transplantation at the following time lines : pre - transplant , at 3 month intervals for a year and then annually . it plays an important role in childhood growth and continues to have anabolic effects in adults . measurement of igf - 1 with the available commercial kits is easy and inexpensive , and in clinical practice it may be useful both to provide better diagnostic information and to monitor nutritional changes during treatment . effluent calprotectin levels were measured at 3 month intervals for a year and then annually . calprotectin is a 36 kda calcium and zinc binding protein expressed by the gene s100 calcium - binding protein a8 , s100a8 . an increased calprotectin concentration in stool is the direct consequence of neutrophil degranulation due to mucosal damage . the main diseases that cause an increased excretion of faecal calprotectin are crohn s disease , ulcerative colitis and neoplasms ( cancer ) . levels of faecal calprotectin are normal in patients with irritable bowel syndrome ( ibs ) . optimal nutritional status ( ons ) was defined by using the malnutrition universal screening tool ( must ) ( accessed 21 jan 2014 , http://www.bapen.org.uk/screening-for-malnutrition/must/introducing-must ) . igf - 1 and calprotectin were correlated with ons by pearson correlation . a grading scheme reflecting optimal nutritional statusnormally distributed continuous variables were expressed as mean sd and compared with the t test ; otherwise they were expressed as median and interquartile range ( iqr ) and the mann - whitney test was used . allreported p values are two - sided and a p value of 0.05 was considered statistically significant . eighteen cadaveric intestinal transplants were performed over 1,650 days ( median follow up 425 days , range 291,650 days ) . mean igf - 1 and calprotectin were significantly associated with independent nutrition ( p = 0.039 and 0.008 respectively ) . igf - 1 increased two - fold ( mean 175 ng / ml before and 3616 ng / ml 1 year after transplant , p = 0.003 ) . effluent calprotectin was 5543 mcg / g at 1 year . must score was 2 for 2 patients and 1 for 5 , during episodes of malnutrition . during malnutrition ( n = 7/18 ) the mean igf - 1 was 2214 ng / ml and calprotectin 1,5971,055 mcg / g . mean weight during episodes of malnutrition decreased from 64.778.76 kg to 59.058.5 kg ( 8.91.25 % ) . igf - 1 and calprotectin levels show a strong negative correlation coefficient at 0.612 ( pearson s r , p = 0.144 ) . when compared to routine levels , mean igf - 1 and calprotectin levels during malnutrition episodes show statistical significance ( p = 0.039 and 0.008 respectively ) . as intestinal transplantation takes its place as a recognized option for patients with irreversible intestinal failure , objective measurement of functional outcomes has become an important factor in assessing its success . being nutritionally replete without the need for total parenteral nutrition ( tpn ) is a desired outcome after successful transplant . butfurthermore , is there more than one category of nutritionally replete patients after successful transplantation ? is it possible that even though patients are independent from tpn , they are still not nutritionally replete due to some underlying process that may come to light to cause bowel dysfunction ? and finally , more importantly , can we objectively identify these patients , long before there is irreversible damage to the bowel ? nutritional management is a key component of post - itx management , in the context of possible previous malnourishment and a newly created intestinal anatomy . however , the nutritional biomarkers that can guide us through appropriate decision making , i.e. , amending the nutritional regimen have yet to be determined . our results suggest that igf - 1 levels show statistically significant increase as early as 3 months post - itx . this is what we would expect from patients that have achieved full clinical nutritional autonomy . our results confirm a strong negative correlation coefficient that almost reaches statistical significance ( p = 0.144 ) . the number of patients included in our study is small and therefore significant conclusions can not be safely extracted . relatively short follow up is another limitation and therefore our results will have to be verified by longer studies . group 2 ( equivocal nutritional parameters ) : patients with normal or low normal igf - 1 and high calprotectin .1 depicts the mean igf - 1 and calprotectin levels for the 3 distinct groups . by stratifying itx patients into 3 groupsgroup 2 patient presents with equivocal findings and follow up / investigations may have to be tailored for the individual patient . these patients need to be further investigated as the biomarkers suggest malnutrition and bowel inflammation . furthermore , we propose that group 3 ( low igf - 1 levels and high calprotectin ) should have enteral feeding interrupted and be put back on tpn till cause of high calprotectin is determined .\noutput:\n" }, { "from": "agent", "value": "the objective of this study is to valuate two biomarkers that may guide nutritional assessment during follow up after intestinal transplantation . we performed a retrospective study on prospectively collected data of insulin - like growth factor - 1 ( igf - 1 ) and effluent calprotectin in patients undergoing intestinal transplantation . optimal nutritional status ( ons ) was defined by using the malnutrition universal screening tool ( must ) . igf - 1 and calprotectin were correlated with ons by pearson correlation . eighteen cadaveric intestinal transplants were performed over 1,650 days ( median follow up 425 days , range 291,650 days ) . mean igf - 1 and calprotectin were significantly associated with independent nutrition . seven patients became malnourished on one or more occasions . during malnutrition the mean igf - 1 was 22 14 ng / ml and calprotectin 1,597 1,055 mcg / g . mean weight during episodes of malnutrition changed from 64.77 8.76 kg to 59.05 8.5 kg ( 8.9 1.25 % ) . both igf - 1 and calprotectin negatively correlated with ons ( pearson s r , 0.612 , p = 0.014 ) . patients broadly aligned with three groups : nutritionally replete ( normal igf - 1 and normal calprotectin ) , nutritionally equivocal ( normal or low normal igf - 1 and high calprotectin ) , and malnourished ( low igf - 1 and high calprotectin ) . patients with low igf - 1 and high calprotectin may have a benign clinical presentation . however it is in their interests to have parenteral nutrition restarted pending further investigation ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: after identification of the melanoma antigen gene ( mage ) family as a tumor - associated antigen ( taa ) , a number of taas have been revealed by means of various approaches including serex and cdna library screening . some taas , such as mage , gp100 , and muc1 , have been applied to treat various cancers in clinical trials , and vaccine - based therapy is now considered as a promising approach to fight against various cancers . we have identified dozens of genes specifically expressed in cancer cells by genome - wide expression profile analysis for cdna microarray consisting of more than 30,000 cdnas and expressed sequence tags ( ests ) . among them , two genes , cadherin 3 , type 1 , p - cadherin ( cdh3 ) and kinesin family member 20a ( kif20a ) , were found to be upregulated in pancreatic cancers . cdh3 is one of the classic cadherin family that plays a critical role in cell - cell adhesion and epithelial morphogenesis . we reported that overexpression of cdh3 promoted the motility of cancer cells and blocking of cdh3 by anti - cdh3 antibody inhibited the migration of cdh3 - expressing cells . kif20a is a member of the kinesin family , which is characterized to be a motor protein in cancer cells , and northern analysis indicated no expression of kif20a among examined 23 normal tissues except testis . furthermore , knock down of kif20a expression with small interfering rna suppressed the proliferation of pancreatic ductal adenocarcinoma cells . thus , both cdh3 and kif20a would play oncogenic functions in pancreatic cancer cells and are attractive target molecules for cancer therapies including immunotherapy . we here identified cdh3 - and kif20a - derived novel hla - a * 2402 - restricted epitope peptides that can induce peptide - specific cytotoxic t lymphocyte ( ctl ) , suggesting that these epitope peptide would be applicable to peptide - based cancer vaccine therapies for hla - a * 2402 positive pancreatic cancer patients . cdh3 and kif20a - derived 9 - mer and 10 - mer peptides that have high binding affinity ( binding score 10 ) to hla - a * 2402 were predicted by the binding prediction software bimas ( http://www-bimas.cit.nih.gov/molbio/hla_bind/ ) and were synthesized by sigma - aldrich japan kk ( ishikari , japan ) according to a standard solid - phase synthesis method and purified by reversed - phase high - performance liquid chromatography ( hplc ) . hiv - a24 epitope peptide ( rylrdqqll ) was also synthesized as a negative control . the purity ( 90 % ) and the identity of the peptides were confirmed by analytical hplc and mass spectrometry analysis , respectively . peptides were dissolved in dimethylsulfoxide at 20 mg / ml and stored at 80c . cdh3 - and kif20a - negative human b - lymphoblastoid cell line tisi ( hla - a * 2402 ) was purchased from the ihwg cell and gene bank ( seattle , wa ) . monkey kidney cell line cos7 , human b - lymphoblastoid cell line jiyoye ( hla - a32 ) , human b - lymphoblastoid cell line eb - 3 ( hla - a3 / aw32 ) , and cdh3 - expressing human lung cancer cell line h358 ( hla - a3 ) were purchased from american type culture collection ( manassas , va ) . cdh3 - expressing human pancreatic cancer cell line pk - 45p ( hla - a24 / a33 ) and kif20a - expressing human pancreatic cancer cell line pk - 59 ( hla - a31 / a33 ) were provided by cell resource center for biomedical research , tohoku university ( sendai , japan ) . kif20a - expressing human stomach cancer cell line mkn - 45 ( hla - a24 ) and miapaca - 2 cells ( hla - a24 ) were purchased from health science research resources bank ( osaka , japan ) . tisi , jiyoye , eb - 3 , h358 , pk - 45p , pk - 59 , and mkn - 45 were maintained in rpmi1640 media ( invitrogen , carlsbad , ca ) , cos7 were maintained in dmem media ( invitrogen ) , and miapaca - 2 cells were maintained in emem media ( invitrogen ) . each medium was supplemented with 10 % fetal bovine serum ( gemini bio - products , west sacramento , ca ) and 1 % antibiotic solution ( sigma - aldrich , st . the expression of cdh3 and kif20a protein was confirmed by western blotting using anti - cdh3 antibody ( bd transduction labs . , bd biosciences , san jose , ca ) or anti - kif20a antibody ( bethyl laboratories , montgomery , tx ) . to examine the ability to induce peptide - specific ctl , purified cd8 t cells were cocultured with autologous monocyte - derived mature dendritic cells ( dcs ) pulsed with peptide . both cd8 t cells and dcs were prepared from peripheral blood mononuclear cells ( pbmcs ) of same hla - a * 2402 - positive healthy volunteers . briefly , pbmcs were isolated by ficoll - paque solution ( ge healthcare , uppsala , sweden ) , then cells were cultured in aim - v medium ( invitrogen ) containing 2 % heat - inactivated autologous serum ( as ) . after the over night incubation , nonadherent cells were washed out , then 1000 u / ml of granulocyte - macrophage colony - stimulating factor ( gm - csf ; r & d systems , minneapolis , mn ) and 1000 u / ml of interleukin ( il ) - 4 ( r & d systems ) were added in the culture to induce monocyte - derived dcs . to mature dcs , 0.1 ke / ml of ok - 432 ( chugai pharmaceutical co. , tokyo , japan ) was added in the culture on day 5 . g / ml of synthesized peptide in aim - v medium containing 3 g / ml of 2 - microglobulin ( sigma - aldrich ) at 37c for 3 h and incubated in the media containing 30 g / ml of mitomycin c ( mmc ) ( kyowa hakko kirin co. ltd . , following washing out residual peptide and mmc , cells were used as antigen - presenting cells to induce peptide - specific ctl . generated monocyte - derived mature dcs expressed cd80 , cd83 , cd86 , and hla class ii on their cell surface ( data not shown ) . autologous cd8 t cells were prepared from pbmcs derived from the same hla - a * 2402 - positive donor by positive selection with dynal cd8 positive isolation kit ( invitrogen ) according to the manufacturer 's instructions .1.510 of peptide - pulsed dcs and 310 of cd8 t cells were cocultured in 0.5 ml of aim - v medium supplemented with 10 ng / ml of il - 7 ( r & d systems ) and 2 % as on 48 - well plates ( corning inc . , il - 2 ( chiron , emeryville , ca ) was added to the culture at 20 iu / ml 3 days after coculture , and peptide - pulsed dcs were additionally supplied into the culture on days 7 and 14 . eight wells were prepared for ctl induction by every peptide in a single experiment . on day 21 , interferon - ( ifn - ) production was examined by ifn - enzyme - linked immunospot ( elispot ) assay under the stimulation with peptide - pulsed tisi cells . t cell response to epitope peptide was measured by elispot assay using ifn - elispot kit and aec substrate set ( bd pharmingen , san diego , ca ) according to the manufacturer 's instruction . briefly , tisi cells were pulsed with 20 g / ml of respective peptide at 37c for 20 h , and the residual peptide that did not bind to tisi cells was washed out to prepare peptide - pulsed tisi cells as the stimulator cells .200 l of cell culture suspension were distributed to two wells ( 100 l each ) on multiscreen - ip 96 - well plate ( millipore , bedford , ma ) following removing 500 l of supernatant from each well from culture of in vitro induction of peptide - specific ctl . cells were co - incubated with peptide - pulsed tisi cells ( 110 cells / well ) at 37c for 20 h. the plates were analyzed by the automated elispot reader , immunospot s4 ( cellular technology ltd , cleveland , oh ) and immunospot professional software version 5.0 ( cellular technology ltd ) . tisi cells pulsed with hiv - a24 epitope peptide ( rylrqqllgi ) were used as control . when the spot number in the peptide - stimulating well was more than 50 spots / well compared with that in the control well , we estimated that peptide - specific ctl were induced ( positive ) and subsequently expanded ctl from the positive well . sensitivity of our elispot assay was estimated as approximately average level by elispot panel of cancer immunotherapy consortium [ cic ( http://www.cancerresearch.org/consortium/assay-panels/ ) ] . peptide - specific ctl obtained from ctl positive well of in vitro induction of peptide - specific ctl were expanded by the modified protocol based on the previously described methods . briefly , 510 of ctls were cocultured with 510 of mmc - treated ( 30 g / ml at 37c for 30 min ) eb - 3 and jiyoye cells in 25 ml of aim - v containing 5 % as and 40 ng / ml of anti - cd3 mab . the cultures were supplemented with il - 2 ( final concentration : 120 iu / ml ) 24 h later and fed with aim - v medium containing 5 % as and il - 2 ( 30 iu / ml ) on day 5 , 8 , and 11 . on day 14 , expanded t cells were harvested to examine specific response to epitope peptide by ifn - enzyme - linked immunosorbent assay ( elisa ) . peptide - specific ctl clones were established by limiting dilution method from the expanded ctls specifically responding to epitope peptide . briefly , t cells were diluted to 0.3 , 1 , and 3 cells / well in 96 - well round - bottomed plates and cultured with 110 cells / well of mmc - treated eb - 3 and jiyoye cells in 150 l of aim - v containing 5 % as , 125 iu / ml of il - 2 , and 30 ng / ml of anti - cd3 mab . the culture was supplemented with il - 2 to the final concentration of 125 iu / ml on day 10 . on day 14 , some peptide - specific ctl clones were expanded as described above . in some experiments , established ctls were co - incubated with 110 cells of respective peptide - pulsed tisi cells or 510 cells of cos7 cells in 200 l of aim - v / 5 % as media on 96 - well round bottom plate ( corning inc . ) . after 24 h incubation , cell free supernatants were harvested and ifn - production was examined by human ifn -- specific elisa kit ( bd pharmingen ) according to the manufacturer 's instructions . specific cytotoxic activity of induced ctl clones was tested by a 4 h cr release assay as previously described . the cdna encoding an open reading frame of hla - a * 2402 gene with flag tag or oncogene ( cdh3 or kif20a ) coding region with the myc tag sequence was amplified with pcr and cloned into pcdna3 .1 vector ( invitrogen ) . cos7 cells transiently expressing hla - a * 2402 and / or oncogene were prepared by the transfection of the vectors encoding respective genes using lipofectamine 2000 ( invitrogen ) according to the manufacturer 's instruction . the expression of hla - a * 2402 and oncogene - derived protein was confirmed by western blotting using anti - myc ( upstate biotechnology , lake placid , ny ) or anti - flag antibody ( sigma - aldrich ) . two days after transfection , the transfected cells were harvested with versene ( invitrogen ) and used to stimulate peptide - specific ctl clones . expression of peptide - specific t cell receptor ( tcr ) was examined on facs - cantoii ( becton dickinson , san jose , ca ) using peptide - hla - a * 2402 dextramer - pe ( immudex , copenhagen , denmark ) ( cdh3 - 10 - 807 / mhc - dextramer - pe and kif20a - 10 - 66 / mhc - dextramer - pe ) according to the manufacturer 's instructions . briefly , expanded ctl lines were incubated with peptide - hla - a * 2402 dextramer - pe for 10 minutes at room temperature , then treated with fitc - conjugated anti - human cd8 mab , apc - conjugated anti - human cd3 mab , pe - cy7 - conjugated anti - human cd4 mab , and 7 - aad ( bd pharmingen ) at 4c for 20 minutes . bimas , we synthesized 21 cdh3 - derived epitope - peptides and 28 kif20a - derived epitope - peptides that were expected to have high affinity to hla - a * 2402 molecule and activate ctls ( table 1 ) . hla - a * 2402 - positive cd8 t cells were cocultured with autologous dcs pulsed with respective peptide , and then peptide - specific ifn - production was analyzed by elispot . fourteen peptides derived from cdh3 and 7 peptides derived from kif20a were able to induce peptide - specific ctls producing ifn - ( table 1 ) . amongst these peptides , we successfully obtained ctls that specifically produced significant amount of ifn - after ctl expansion when cdh3 - 9 - 406 , cdh3 - 10 - 807 , kif20a - 9 - 305 , kif20a - 9 - 383 , kif20a - 10 - 304 , and kif20a - 10 - 66 peptide were pulsed ( figures 1 ( a ) and 1 ( b ) ) . cdh3 - 10 - 807 - , kif20a - 9 - 305 - , kif20a - 10 - 304 - , or kif20a - 10 - 66 - specific ctl clones were established and produced a potent amount of ifn - specifically responding to the stimulator cells pulsed with the respective peptide , but not hiv - a24 peptide ( figures 2 ( a ) 2 ( d ) ) . we then examined that the established peptide - specific ctl clones can recognize cells that express hla - a * 2402 and the target proteins . cos7 cells were transfected with plasmid designed to express hla - a * 2402 molecule and / or that to express the full length protein of cdh3 or kif20a . cdh3 - 10 - 807 peptide responding ctl clone substantially produced ifn - when exposed to cos7 cells that expressing both hla - a * 2402 and cdh3 , but not cos7 cells that expressing either hla - a * 2402 or cdh3 ( figure 3 ( a ) ) . similarly , kif20a - 10 - 66 peptide responding ctl clone produced significant amount of ifn - when exposed to cos7 cells that expressing both hla - a * 2402 and kif20a , but not cos7 cells that expressing either hla - a * 2402 or kif20a ( figure 3 ( b ) ) . both ctl clones also produced ifn - responding to cos7 cells , which transfected with pires - vector containing both hla - a * 2402 and respective oncogene ( data not shown ) . on the other hand , ctl clones responding to kif20a - 9 - 305 peptide or kif20a - 10 - 304 peptide did not produce ifn - when exposed to cos7 cells expressing both hla - a * 2402 and kif20a ( data not shown ) . only cdh3 - 10 - 807 peptide and kif20a - 10 - 66 peptide , but not other candidate peptides , were able to induce ctl responding to cos7 cells expressing hla - a * 2402 and cdh3 or kif20a , albeit we have tried several times using pbmc derived from different healthy donors ( data not shown ) . expression of cdh3 - 10 - 807 / hla - a * 2402 - or kif20a - 10 - 66 / hla - a * 2402 - specific t cell receptor ( tcr ) was examined using cdh3 - 10 - 807 / mhc - dextramer - pe or kif20a - 10 - 66 / mhc - dextramer - pe . significant population of cd3 cd8 cells , but not cd3 cd8 cells , expressed cdh3 - 10 - 807 / hla - a * 2402 - or kif20a - 10 - 66 / hla - a * 2402 - specific tcr after expansion of cells obtained by in vitro induction of peptide - specific ctl ( figures 4 ( a ) and 4 ( b ) ) . as expected , ctl clones established by cdh3 - 10 - 807 peptide - or kif20a - 10 - 66 peptide - pulsed cells were cd8 positive and expressed respective peptide / hla - a * 2402 - specific tcr ( figures 4 ( c ) and 4 ( d ) ) . cdh3 - 10 - 807 or kif20a - 10 - 66 peptide - specific ctl clone demonstrated cytotoxic activity against hla - a * 2402 - positive tisi cells when respective peptide was pulsed , but not when hiv - a24 peptide was pulsed or peptide was not pulsed ( figures 5 ( a ) and 5 ( b ) ) . these results suggested that cdh3 - 10 - 807 or kif20a - 10 - 66 peptide - specific ctl clone specifically exerted cytotoxic activity responding to respective epitope peptide binding to hla - a * 2402 on cells . we , then , finally examined the cytotoxic activity against cancer cells , which endogenously expressed cdh3 or kif20a gene . expression of cdh3 protein was confirmed in hla - a * 2402 - positive pk - 45p cells and hla - a * 2402 - negative h358 cells , but hla - a * 2402 - positive miapaca - 2 cells did not express cdh3 ( figure 6 ( a ) ) . cdh3 - 10 - 807 peptide - specific ctl clone exerted significant cytotoxic activity against cdh3 - expressing hla - a * 2402 - positive pk - 45p cells , but not h358 or miapaca - 2 cells ( figure 6 ( b ) ) . expression of kif20a protein was confirmed in hla - a * 2402 - positive mkn - 45 cells and hla - a * 2402 - negative pk - 59 cells , but hla - a * 2402 - positive miapaca - 2 cells did not express kif20a ( figure 6 ( a ) ) . kif20a - 10 - 66 peptide - specific ctl clone exerted significant cytotoxic activity against kif20a - expressing hla - a * 2402 - positive mkn - 45 cells , but not miapaca - 2 cells ( figure 6 ( c ) ) . kif20a - 10 - 66 peptide - specific ctl clone demonstrated cytotoxic activity against kif20a - expressing hla - a * 2402 - negative pk - 59 cells ; however , this cytotoxicity was always less when compared with that against kif20a - expressing hla - a * 2402 - positive mkn - 45 cells ( figure 6 ( c ) and data not shown ) . no homologous sequence to cdh3 - 10 - 807 peptide or kif20a - 10 - 66 peptide was demonstrated by the homology research using the blast algorithm http://blast.ncbi.nlm.nih.gov/blast.cgi ( data not shown ) , suggesting that these peptide would be the unique epitope peptide presented on hla - a * 2402 of cdh3 or kif20a - expressing cells . taken together , presented results suggested that cdh3 - 10 - 807 peptide - specific or kif20a - 10 - 66 peptide - specific ctls exert potent ifn - production and cytotoxic activity specifically responding to hla - a * 2402 - positive cancer cells expressing cdh3 or kif20a , respectively . pancreatic cancer is one of the most malignant cancers , since 5 - year survival rate is only 5 % and the therapeutic modalities are very limited . both cdh3 and kif20a were upregulated in the majority of pancreatic cancers and have oncogenic functions . thus , cdh3 and kif20a would be promising target molecules to develop novel therapeutic strategies for pancreatic cancer . hence , we identified hla - a * 0201 - restricted peptides derived from cdh3 and kif20a . in present study , we successfully identified hla - a * 2402 - restricted novel epitope peptides derived from both cdh3 and kif20a and demonstrated that these peptides could induce specific ctls producing potent amount of ifn - and exert cytotoxic activity . established cdh3 - 10 - 807 - specific ctl clones or kif20a - 10 - 66 - specific ctl clones responded to cdh3 - or kif20a - introduced cos7 cells as well as cdh3 or kif20a endogenously expressing cancer cells ( pk - 45p or mkn - 45 ) in hla - a24 - restricted manner . these results indicated that induction of cdh3 - 10 - 807 - specific ctls or kif20a - 10 - 66 - specific ctls would exert antitumor effect against pancreatic cancers in hla - a24 - positive patients . predicted binding score of kif20a - 10 - 66 peptide to hla - a * 2402 was relatively low when compared with that of cdh3 - 10 - 807 peptide . we previously reported epitope peptides derived from rnf43 and imp - 3 , and those peptides also have low affinity to hla molecule . interestingly , both peptides have been already applied for clinical trials as peptide - based immunotherapy and ctl were obtained in many cancer patients . these results suggested that some peptides possibly induce ctls albeit binding score was low by bimas prediction and kif20a - 10 - 66 peptide , as well as cdh3 - 10 - 807 peptide , possibly induces ctl in cancer patients . recent improvement and development of cancer therapies , including combined treatments of standard therapies ( chemotherapy , radiotherapy , and surgical resection ) , substantially improved the survival of advanced cancer patients . however , unfavorable adverse events are still often observed . on the other hand , immune therapies inducing cancer - cell - specific ctls are now developed to improve the efficacy against cancers and the quality of life of patients . on - going several clinical trials using epitope peptides derived from taa have been proving the evidence that ctl - inducing therapies are much less harmful to the patients . however , efficacy of some vaccine therapy trials is still limited mainly due to the development of escaping variant cancer cells that lost targeted taa expression during the treatment . therefore , it is generally thought that the therapeutic efficacy would be improved when the origin of vaccinated peptide is functionary essential molecule for cancer cell survival , proliferation , and / or motility . we have been screening epitope peptides derived from cancer - specific genes and reported several epitope peptides , which can elicit specific ctl responses . some of these peptides have been already applied for translational researches of multipeptide vaccine to treat esophageal cancer and colorectal cancer . moreover , multiple - antigen vaccine therapy was suggested to more effectively hinder escape mechanisms in the guidance from food and drug administration ( guidance for industry : clinical considerations for therapeutic cancer vaccines ) . thus , we believe that identification of ctl - inducible epitope peptides derived from several molecules that play critical roles in various types of cancer is important to develop multipeptide cocktail , and that resulted in the improvement of efficacy of ctl - inducing cancer therapies . presented results demonstrated that cdh3 - 10 - 807 peptide and kif20a - 10 - 66 peptide pulsed dcs induced specific ctl to possibly exert antitumor effect . the immunogenicity of cdh3 - 10 - 807 peptide and kif20a - 10 - 66 peptide should be examined in patients bearing these genes - expressing cancers , and we are now going to conduct clinical trials .\noutput:\n" }, { "from": "agent", "value": "we here identified human leukocyte antigen - ( hla - ) a2402 - restricted epitope peptides from cadherin 3 , type 1 , p - cadherin ( cdh3 ) and kinesin family member 20a ( kif20a ) that were found to be specifically expressed in cancer cells through genome - wide expression profile analysis . cdh3 - 10 - 807 peptide and kif20a - 10 - 66 peptide successfully induced specific ctl clones , and these selectively responded to cos7 cells expressing both hla - a2402 and respective protein while did not respond to parental cells or cos7 cells expressing either hla - a2402 or respective protein . furthermore , ctl clones responded to cancer cells that endogenously express hla - a2402 and respective protein , suggesting that cdh3 - 10 - 807 peptide and kif20a - 10 - 66 peptide are naturally presented on hla - a2402 molecule of human cancer cells . our results demonstrated that cdh3 - 10 - 807 peptide and kif20a - 10 - 66 peptide are novel hla - a24 - restricted tumor - associated antigens and would be applicable for ctl - inducing cancer therapies ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: poly - n - isopropylacrylamide ( pnipaam ) and its copolymers , due to high - speed transition from liquid to solid phase and a critical dissolution temperature of 32c , can be used in the field of medical science , as well as in drug delivery systems and tissue engineering . at temperatures higher than 32c , the material exists in a solid and hydrophobic state , and at temperatures below 32c the polymer shows fully hydrated and hydrophilic properties . pnipaam was synthesized in 1957 by wooten .1 this smart polymer enables surface modification of materials for use in cell sheet engineering .2,5 different methods for surface modification of polymers , eg , polyethylene , polypropylene , polystyrene , and polyethylene terephthalate , with pnipaam grafting using chemical and physical methods , including gamma - ray exposure , plasma , ozone , and ultraviolet and electron beam can be used , each with advantages and disadvantages .6,9 in all such methods , a radical is created on the surface and , during collision with a monomer , the polymerization process occurs . the ultraviolet irradiation method , in terms of its simplicity and low cost , could potentially be a suitable method for biomaterial surface modification .10,11 factors such as radiation distance , absorption intensity , wavelength used appropriately to the initiator , thickness , and usual factors , including degassing , substrate , initiators , and sensitizers , contributed to the ultraviolet radiation delivery .12 of course , this method is required for optical sensitizers or initiators such as anthraquinone13 or benzophenone .14 selected solvents used in spectroscopy and polymerization with ultraviolet radiation are very important . among the solvents used , water and ethanol are the most common organic solvents used in polymer chemistry . the hydrogen atoms of alcohols are transferred to radical substrates , and this can lead to competition between the monomers and alcohols with polymer radicals . one of the properties of alcohol as a solvent is constant chain transfer that is considered a very effective feature .15 in one study , the effect of solvents such as methanol , acetone , and water on 2 - hydroxyethyl methacrylate polymerization under ultraviolet light on the nylon substrate was evaluated .15 the results showed that acetone , methanol , and water underwent the best grafting . acetone , due to a lack of hydrogen , can not donate a hydrogen atom to a substrate ; hence , surface radicals can easily react with the monomer . however , there are problems with acetone , in particular , sensitivity to ultraviolet radiation ( chromophore ) and rapid evaporation during the process ; thus , the amount of grafting is reduced .1517 the negative effects of methanol as a solvent on acrylamide grafting to a polyethylene substrate18 have been investigated . the constant chain transfer of water was zero , but the combination of water and methanol increased the grafting of acrylamide onto cellulose , and then decreased it .18 methanol , due to its small molecular size , high swelling properties , and relatively low chain transfer constant ( when its concentration in water was very low ) , showed more grafting than the heavier alcohols . when the concentration of methanol increased , the role of the chain transfer agent would be superior in the swelling process , and therefore grafting was reduced . ethanol and propanol showed relatively reduced surface grafting due to weak swelling properties and a larger molecular size . the superiority of the stronger chain transfer agent with regard to swelling caused a sharp decrease in grafting . alcohol solvents could cause solvent evaporation due to their better solubility in the monomer under radiation , and this is important with long - term radiation . on the other hand , the use of water as a solvent was problematic due to lower solubility of acrylamides in water than in alcohols . thus , a mixture of solvents could potentially solve these problems .1519 in this study , several important solvents , including water , ethanol , and dimethyl sulfoxide and their complexes were used for grafting pnipaam onto a polystyrene surface by ultraviolet radiation . also , the nanometric thickness of the grafting was shown to have an important effect in the process of adhesion and separation of cells and cell sheets . in thisresearch , technical knowledge was also used to achieve intelligent surfaces with nanometric thicknesses using this type of radiation and the best solvent type and ratio for the polymerization process . polystyrene dishes ( orange county industrial plastics , anaheim , ca ) with dimensions of 11 cm and 1 mm thickness , ethanol and methanol ( merck co , tehran , iran ) , nipaam ( sigma - aldrich , tehran , iran ) , n - hexane ( merck co ) , distilled water , polystyrene , and epithelial cells ( pastor institute , tehran , iran ) were used in this study . the polystyrene dishes were put in the solution of ethanol - methanol in a 50/50 ratio for 24 hours to dissolve impurities and oils existing on the surface of the dishes . for recrystallization of nipaam , 10.3 g of nipaam ( sigma - aldrich ) were dissolved in n - hexane 125 ml , and the solution was put in a refrigerator prior to grafting . the nonirradiated polystyrene samples were irradiated at a dose of 40 kgy ( co -- radiation source , supplied by karaj atomic research center , karaj , iran ) . monomers were dissolved in different percentages of solvents , including distilled water , ethanol , methanol , and acetone and their combinations , with a constant ratio of anthraquinone -2-sulfonic acid , and sodium salt monohydrate ( 3 % w / v ; fluka co , st . the samples were degassed by nitrogen ( 2 - bar mass flow rate ) for 30 minutes . the solutions were then poured in a plastic washer ( diameter 1 cm and height 3 mm ) attached to the polystyrene substrate . the samples in solution were exposed to an ultraviolet radiation source ( black light , 160 w , 365 nm ; philips , eindhoven , the netherlands ) for 30 minutes . the samples were then removed and washed in distilled water , subsequently put in distilled water for 72 hours along with soxhlet for removal of the ungrafted monomer , and then taken out for analysis . the effect of the solvents on the extent of grafting was measured using the following formula : grafting ( % ) = ( ww ) 100 / wwhere w and w indicate the grafted and ungrafted sample weight , respectively . the samples were examined by attenuated total reflection fourier transform infrared ( atr - ftir ; nexus ; thermo niocolet , waltham , ma ) before and after adjustment , and then were put under the instrument for investigation . the surface characteristics of various modified and unmodified films were studied by scanning electron microscopy ( cambridge stereoscan , model s - 360 ; cambridge scientific instruments , cambs , uk ) to measure changes in surface morphology . the films were first coated with a layer of gold ( joel fine coat , ion sputter for two hours ) to provide surface conduction before scanning . surface topology characteristics and the thickness of various modified and unmodified films were studied by atomic force microscopy ( tmx 2010 and the nanosurf easyscan 2 model ) to study changes in surface topology . the static contact angle of the sample surfaces was investigated using the contact angle measuring device ( g10 ; krss , hamburg , germany ) following the sessile drop method . the contact angle formed would be the angle between the solid / liquid and the liquid / steam joint surface . in order to review the sample surface s hydrophilic / hydrophobic behavior at high and low temperatures , a better sample was considered at two different temperatures of 4c and 37c , and the contact angles were measured at these temperatures . better samples were investigated by thermal analysis using a differential scanning calorimetry device ( dsc 200 f3 ; netzsch , selb , germany ) at a heating rate of 5c / min from 0c to 60c in a nitrogen gas atmosphere . aliquots of cell suspension in rpmi medium including 300,000 sw742 epithelial cells were seeded on a 6 - multiwell cell culture plate ( orange county industrial plastics ) which was precoated with samples . the plate was put in an incubator ( 3c , co2 ) over three hours for cell attachment , followed by rinsing of the loosely attached cells with phosphate buffer solution , and adding 2 ml of fresh medium to the cell culture in the incubator for seven days . the mtt tetrazolium compound was reduced by living cells into a colored formazan product that was soluble in tissue culture medium . the quantity of formazan product was directly proportional to the number of viable cells in the culture . the assays were performed by adding 1 ml of mtt solution ( sigma - aldrich ) and 9 ml of fresh medium to each well after aspirating the spent medium , and incubating at 37c for four hours with protection from light . the colorimetric measurement of formazan dyeing was performed at a wavelength of 570 nm using a microplate reader ( rayto , shenzhen , people s republic of china ) . for cell detachment , sw742 cells were seeded onto the samples at a density of 1,000,000 cells , and were cultured at 37c under a humidified atmosphere of 5 % co2 . cell detachment was evaluated by incubating the cultures at 4c for up to 60 minutes . the numbers of detached cells and cells attached to the original well were determined by mtt assay . the nonirradiated polystyrene samples were irradiated at a dose of 40 kgy ( co -- radiation source , supplied by karaj atomic research center , karaj , iran ) . monomers were dissolved in different percentages of solvents , including distilled water , ethanol , methanol , and acetone and their combinations , with a constant ratio of anthraquinone -2-sulfonic acid , and sodium salt monohydrate ( 3 % w / v ; fluka co , st . the samples were degassed by nitrogen ( 2 - bar mass flow rate ) for 30 minutes . the solutions were then poured in a plastic washer ( diameter 1 cm and height 3 mm ) attached to the polystyrene substrate . the samples in solution were exposed to an ultraviolet radiation source ( black light , 160 w , 365 nm ; philips , eindhoven , the netherlands ) for 30 minutes . the samples were then removed and washed in distilled water , subsequently put in distilled water for 72 hours along with soxhlet for removal of the ungrafted monomer , and then taken out for analysis . the effect of the solvents on the extent of grafting was measured using the following formula : grafting ( % ) = ( ww ) 100 / wwhere w and w indicate the grafted and ungrafted sample weight , respectively . the samples were examined by attenuated total reflection fourier transform infrared ( atr - ftir ; nexus ; thermo niocolet , waltham , ma ) before and after adjustment , and then were put under the instrument for investigation . the surface characteristics of various modified and unmodified films were studied by scanning electron microscopy ( cambridge stereoscan , model s - 360 ; cambridge scientific instruments , cambs , uk ) to measure changes in surface morphology . the films were first coated with a layer of gold ( joel fine coat , ion sputter for two hours ) to provide surface conduction before scanning . surface topology characteristics and the thickness of various modified and unmodified films were studied by atomic force microscopy ( tmx 2010 and the nanosurf easyscan 2 model ) to study changes in surface topology . the static contact angle of the sample surfaces was investigated using the contact angle measuring device ( g10 ; krss , hamburg , germany ) following the sessile drop method . the contact angle formed would be the angle between the solid / liquid and the liquid / steam joint surface . in order to review the sample surface s hydrophilic / hydrophobic behavior at high and low temperatures , a better sample was considered at two different temperatures of 4c and 37c , and the contact angles were measured at these temperatures . better samples were investigated by thermal analysis using a differential scanning calorimetry device ( dsc 200 f3 ; netzsch , selb , germany ) at a heating rate of 5c / min from 0c to 60c in a nitrogen gas atmosphere . aliquots of cell suspension in rpmi medium including 300,000 sw742 epithelial cells were seeded on a 6 - multiwell cell culture plate ( orange county industrial plastics ) which was precoated with samples . the plate was put in an incubator ( 3c , co2 ) over three hours for cell attachment , followed by rinsing of the loosely attached cells with phosphate buffer solution , and adding 2 ml of fresh medium to the cell culture in the incubator for seven days . the mtt tetrazolium compound was reduced by living cells into a colored formazan product that was soluble in tissue culture medium . the quantity of formazan product was directly proportional to the number of viable cells in the culture . the assays were performed by adding 1 ml of mtt solution ( sigma - aldrich ) and 9 ml of fresh medium to each well after aspirating the spent medium , and incubating at 37c for four hours with protection from light . the colorimetric measurement of formazan dyeing was performed at a wavelength of 570 nm using a microplate reader ( rayto , shenzhen , people s republic of china ) . for cell detachment , sw742 cells were seeded onto the samples at a density of 1,000,000 cells , and were cultured at 37c under a humidified atmosphere of 5 % co2 . cell detachment was evaluated by incubating the cultures at 4c for up to 60 minutes . the numbers of detached cells and cells attached to the original well were determined by mtt assay . the grafted polystyrene samples with the different solvents under ultraviolet radiation were weighed at a constant temperature . table 1 and figure 1a show that there was almost no grafting of samples using 100 % solvents without water . more grafting is obtained with a methanol / water solvent of 10 % ( v / v ) . table 2 and figure 1b show an increase in grafting with increased nipaam concentration in a methanol / water solvent of 10 % ( v / v ) . the peaks around 20 % ( g / v ) and 40 % ( g / v ) were probably due to the trommsdorff effect . the small peak around 20 % might be attributed to water , while the large one around 40 % would be attributable to methanol . atr - ftir spectra results of the regular unadjusted and the ultraviolet radiation - adjusted polystyrene samples are shown in figure 2 . the nipaam grafted by the ultraviolet - radiated polystyrene atr - ftir spectra are shown in figure 3 . the pnipaam peak characteristics include 1601 cm indicating nh groups , 17301830 cm indicating c = o groups , 3025 cm indicating ch3 groups , and 3443 cm indicating - nh groups in pnipaam . these observations show that grafting between the pnipaam and the polystyrene surface occurs by activation of ultraviolet radiation coating . the microscopic images for investigating the adjusted samples through ultraviolet radiation have been shown in figures 3 and 4 . the surface topography and the graft thickness created on the surfaces with different solvents are shown in the atomic force microscopic images . figure 3c shows the surface topography for the grafted sample in the solvent of 9:1 ( v / v ) water / methanol . figure 3d is the atomic force microscopic image obtained from the grafted polystyrene samples in pure methanol . the mean graft thickness for the better sample grafting in the solvent of 9:1 ( v / v ) water / methanol and the pure water was about 600 nm , and the white spots indicate roughness created during radiation . figure 4 shows the surface topography and thickness of the grafted sample , with better grafting ( 120 % ) using the 40 % nipaam concentration resolved in a solvent of 9:1 ( v / v ) water / methanol . the average graft thickness for this sample was about 2 m , and the white spots indicated roughness created during radiation . figures 5a d show the scanning electron microscopic images for the grafted polystyrene samples created using different solvents . figure 5a shows the surface morphology and thickness for the grafted sample in the water solvent . figure 5b shows the surface morphology and thickness for the grafted sample in the solvent of 9:1 ( v / v ) water / methanol . figure 5c shows the surface morphology and thickness for the grafted sample in the solvent of 9:1 ( v / v ) water / methanol with 40 % of nipaam . the mean graft thickness for the better sample grafted in the solvent of 9:1 ( v / v ) water / methanol and with 40 % of nipaam was about 600 nm and 2 m . figure 5d shows the surface morphology of the grafted sample in the solvent of 9:1 ( v / v ) water / methanol . for contact angle measurement , the measured angle of normal polystyrene adjusted by ultraviolet - radiated pnipaam surface samples at 4c and 37cthe tabulated data for the best grafted sample ( 40 % nipaam concentration resolved in the solvent of 9:1 ( v / v ) water / methanol ) indicate that the samples show different contact angles at 4c and 37c , which is another reason why pnipaam grafting onto a polystyrene surface occurs . the average contact angles of 43.3 and 60.4 have been calculated for 4c and 37c temperatures , respectively . the results indicate a contact angle decrease below the temperature of 32c ( 4c ) , as well as hydrophilic surface features . when the contact angle increased above 32c temperature ( 37c ) , the hydrophobic surface feature was also seen . the samples were investigated by the differential scanning calorimetry device ( netzsch dsc 200 f3 ) , with a heating rate of 5c per minute from 0c to 60c in a nitrogen gas atmosphere . review of the differential scanning calorimetry data for the grafted samples showed a critical temperature for the grafted pnipaam using a water / methanol ratio of 9/1 . figure 6 shows the differential scanning calorimetry thermogram in which a slope curve is obtained at 32c . this shows no significant change in smart polymer critical temperature during the radiation and grafting process . biocompatibility data demonstrated that the grafted samples with better grafting ( 120 % ) with 40 % of nipaam concentration resolved in the solvent of 9:1 ( v / v ) water / methanol under ultraviolet radiation supported epithelial cell adhesion and proliferation , and that the cells also maintained high viability ( figure 7 ) . after culture for seven days on grafted samples , almost all cells were alive , suggesting that the grafted samples were suitable for cell attachment and proliferation , and that the viability was about 75 % ( figure 7a ) . when the cells were placed outside the incubator and the mediumwas cooled from 37c to 4c , almost all of them were alive ( figure 7b ) and the viability was as high as 70 % . figure 8a shows good cell growth on the surface of grafted samples at the physiological temperature of 37c . figure 8b shows spontaneous cell growth detached from the grafted sample surface , in the absence of enzymes ( trypsin / ethylenediamine tetra - acetic acid ) . in contrast , cell growth on the tissue culture polystyrene dishes did not show any temperature - dependent cell sheet detachment . after a longer period of cell cultivation ( for seven days ) , confluent cells formed a continuous monolayer cell sheet on the surface of the grafted samples . the cell sheet was spontaneously detached from the surface of the thermoreversible grafted samples when cooled to 4c without treating by any enzymes . as shown in figure 8b , cell detachment started from the edge of the cell monolayer . after 60 minutes of incubation at 4c , a monolayer cell sheet could be lifted up from the edge upon mild perturbation of the medium . a living cell sheet , completely detached from the culture surface , such results demonstrated that cold treatment effectively released the cell sheet from the plate without damaging cell cell connections . the grafted polystyrene samples with the different solvents under ultraviolet radiation were weighed at a constant temperature . table 1 and figure 1a show that there was almost no grafting of samples using 100 % solvents without water . more grafting is obtained with a methanol / water solvent of 10 % ( v / v ) . table 2 and figure 1b show an increase in grafting with increased nipaam concentration in a methanol / water solvent of 10 % ( v / v ) . the peaks around 20 % ( g / v ) and 40 % ( g / v ) were probably due to the trommsdorff effect . the small peak around 20 % might be attributed to water , while the large one around 40 % would be attributable to methanol . atr - ftir spectra results of the regular unadjusted and the ultraviolet radiation - adjusted polystyrene samples are shown in figure 2 . the nipaam grafted by the ultraviolet - radiated polystyrene atr - ftir spectra are shown in figure 3 . the pnipaam peak characteristics include 1601 cm indicating nh groups , 17301830 cm indicating c = o groups , 3025 cm indicating ch3 groups , and 3443 cm indicating - nh groups in pnipaam . these observations show that grafting between the pnipaam and the polystyrene surface occurs by activation of ultraviolet radiation coating . the microscopic images for investigating the adjusted samples through ultraviolet radiation have been shown in figures 3 and 4 . the surface topography and the graft thickness created on the surfaces with different solvents are shown in the atomic force microscopic images . figure 3c shows the surface topography for the grafted sample in the solvent of 9:1 ( v / v ) water / methanol . figure 3d is the atomic force microscopic image obtained from the grafted polystyrene samples in pure methanol . the mean graft thickness for the better sample grafting in the solvent of 9:1 ( v / v ) water / methanol and the pure water was about 600 nm , and the white spots indicate roughness created during radiation . figure 4 shows the surface topography and thickness of the grafted sample , with better grafting ( 120 % ) using the 40 % nipaam concentration resolved in a solvent of 9:1 ( v / v ) water / methanol . the average graft thickness for this sample was about 2 m , and the white spots indicated roughness created during radiation . figures 5a d show the scanning electron microscopic images for the grafted polystyrene samples created using different solvents . figure 5a shows the surface morphology and thickness for the grafted sample in the water solvent . figure 5b shows the surface morphology and thickness for the grafted sample in the solvent of 9:1 ( v / v ) water / methanol . figure 5c shows the surface morphology and thickness for the grafted sample in the solvent of 9:1 ( v / v ) water / methanol with 40 % of nipaam . the mean graft thickness for the better sample grafted in the solvent of 9:1 ( v / v ) water / methanol and with 40 % of nipaam was about 600 nm and 2 m . figure 5d shows the surface morphology of the grafted sample in the solvent of 9:1 ( v / v ) water / methanol . for contact angle measurement , the measured angle of normal polystyrene adjusted by ultraviolet - radiated pnipaam surface samples at 4c and 37c is shown in table 3 . the tabulated data for the best grafted sample ( 40 % nipaam concentration resolved in the solvent of 9:1 ( v / v ) water / methanol ) indicate that the samples show different contact angles at 4c and 37c , which is another reason why pnipaam grafting onto a polystyrene surface occurs . the average contact angles of 43.3 and 60.4 have been calculated for 4c and 37c temperatures , respectively . the results indicate a contact angle decrease below the temperature of 32c ( 4c ) , as well as hydrophilic surface features . when the contact angle increased above 32c temperature ( 37c ) , the hydrophobic surface feature was also seen . the samples were investigated by the differential scanning calorimetry device ( netzsch dsc 200 f3 ) , with a heating rate of 5c per minute from 0c to 60c in a nitrogen gas atmosphere . review of the differential scanning calorimetry data for the grafted samples showed a critical temperature for the grafted pnipaam using a water / methanol ratio of 9/1 . figure 6 shows the differential scanning calorimetry thermogram in which a slope curve is obtained at 32c . this shows no significant change in smart polymer critical temperature during the radiation and grafting process . biocompatibility data demonstrated that the grafted samples with better grafting ( 120 % ) with 40 % of nipaam concentration resolved in the solvent of 9:1 ( v / v ) water / methanol under ultraviolet radiation supported epithelial cell adhesion and proliferation , and that the cells also maintained high viability ( figure 7 ) . after culture for seven days on grafted samples , almost all cells were alive , suggesting that the grafted samples were suitable for cell attachment and proliferation , and that the viability was about 75 % ( figure 7a ) . when the cells were placed outside the incubator and the mediumwas cooled from 37c to 4c , almost all of them were alive ( figure 7b ) and the viability was as high as 70 % . figure 8a shows good cell growth on the surface of grafted samples at the physiological temperature of 37c . figure 8b shows spontaneous cell growth detached from the grafted sample surface , in the absence of enzymes ( trypsin / ethylenediamine tetra - acetic acid ) . in contrast , cell growth on the tissue culture polystyrene dishes did not show any temperature - dependent cell sheet detachment . after a longer period of cell cultivation ( for seven days ) , confluent cells formed a continuous monolayer cell sheet on the surface of the grafted samples . the cell sheet was spontaneously detached from the surface of the thermoreversible grafted samples when cooled to 4c without treating by any enzymes . as shown in figure 8b , cell detachment started from the edge of the cell monolayer . after 60 minutes of incubation at 4c , a monolayer cell sheet could be lifted up from the edge upon mild perturbation of the medium . a living cell sheet , completely detached from the culture surface , such results demonstrated that cold treatment effectively released the cell sheet from the plate without damaging cell cell connections . the effect of solvents on polymer grafting in a polystyrene sample dish under ultraviolet radiation was studied . the chain transferring constant and molecular weight effect of solvents and their penetration into the materials led to competition between the solvents for grafting . the chain transfer constancy of water was nearly zero , but the monomer nipaam did not solve well . in contrast , the monomer was well solved in alcohol , but the chain transfer constancy increased with an increase in the molecular weight of the alcohol . water combined with a low chain transfer constant and an alcohol of low molecular weight could be a good solvent for grafting . imaging and gravimetric analysis of the grafting quantity with different solvents indicated an increase in the grafting quantity by adding 10 % methanol to water with 40 % of nipaam concentration . the scanning electron microscopic images showed the grafted surface morphology for different solvents , and we could clearly observe and compare our increases in graft increasing . the graft thickness of the best samples of solvent in this study was about 600 nm . the contact angles 43 and 60 obtained at temperatures of 4c and 37c , as well as polymer critical temperature constancy ( 32c ) measured by the differential scanning calorimetry method indicated that grafting caused no change in pnipaam operation and function . thermoresponsive polymers were grafted to the dishes covalently , which allowed epithelial cells to attach and proliferate at 37c . cells from the sheet also detached spontaneously when the temperature decreased below 32c , without using enzymes . these characteristics suggest that these types of grafted materials have potential as biomaterials for cell sheet engineering .\noutput:\n" }, { "from": "agent", "value": "background : the best solvent type and ratio for grafting of poly - n - isopropylacrylamide ( pnipaam ) on the surface of polystyrene is obtained under ultraviolet radiation . in this study , the effects of solvents , such as water , methanol , and their combinations , under ultraviolet radiation were investigated successfully.method and results : attenuated total reflection fourier transform infrared analysis showed the existence of the graft pnipaam on the substrate for all samples resolved in solvents . the best solvent ratio and nipaam concentration for grafting was obtained with 40 % nipaam concentrations resolved in a solvent of 9:1 ( v / v ) water / methanol ( 120 % ) . scanning electron microscopic and atomic force microscopic images clearly showed that a 10 % increase of methanol to water would increase the amount of grafting . surface topography and graft thickness in atomic force microscopic images of the grafted samples showed that the thickness of these grafts was about 600 nm . the drop water contact angles of the best grafted sample at 37c and 4c were 43.3 and 60.4 , respectively , which demonstrated the hydrophilicity and hydrophobicity of the grafted surfaces . differential scanning calorimetric analysis also revealed the low critical solution temperature of the grafted sample to be 32c . thermoresponsive polymers were grafted to dishes covalently , which allowed epithelial cells to attach and proliferate at 37c . the cells were also detached spontaneously without using enzymes when the temperature dropped below 4c . conclusion : mtt analysis also showed good viability of cells on the grafted samples , suggesting that this type of grafted material had potential as a biomaterial for cell sheet engineering ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: water scarcity is already a major global issue that carries heavy adverse health sequelae , and climate change will further destabilize access to fresh water . one : in the north china plain , where half of china s wheat is grown , the water table is falling by as much as 3 m per year . two : certain states in india are using half of their electricity budget to pump water from depths as deep as 1 km to irrigate crops . three : roughly 300 million chinese and indians are eating food grown on fossil water that is not replenished . four : in the middle east and north africa , current rates of freshwater use are equivalent to 115 % of total renewable runoff . given such unsustainable use around the world , the number of people living in water - scarce countries is expected to rise sixfold from 470 million to 3 billion between 1990 and 2025 . rapid human population growth combined with economic development begets increased water demand from homes , industry , and agriculture . in agriculture alone , the amount of water required to keep pace with global food demandthis is water that , in many parts of the world , simply is not available . the availability of adequate potable water is a pillar of public health without which human well - being falters . in addition to hindering food production , inadequate access to water and sanitation has direct effects on human health . today , half of the urban populations of africa , asia , latin america , and the caribbean suffer from diseases associated with inadequate access to water and sanitation , and roughly 1.7 million people die every year from these diseases . scientists predict that the hydrologic cycle will be altered with , generally speaking , wet areas becoming wetter while dry areas become dryer . heavy precipitation events and associated runoff may make water supplies less reliable and may also make conditions favorable to outbreaks of water - borne disease . in the united states , for example , over 50 % of water - borne disease outbreaks in the second half of the 20th century were preceded by precipitation events that were above the 90th percentile . warmer temperatures will also increase evapotranspiration , increasing water requirements for agriculture . at the same time , the availability of water during the height of the growing season may be less , owing to earlier melting of winter snowpack in the spring , leaving less water for summer irrigation . agricultural systems dependent on glacial melt , such as the andean nations of south america or much of asia that receives water from the tibetan plateau , may suffer such a fate as glaciers melt away . as these glaciers dwindle , they will provide ever less dry - season water flow into many of the world s great rivers . the indus river , for example , receives 4050 % of its dry - season flow from glaciers that are rapidly receding . finally , sea - level rise and more extreme storms will lead to coastal inundation and intrusion of salt water into freshwater aquifers , further reducing coastal freshwater supply . perhaps even more problematic to human welfare in the coming century than a further diminution in the availability of fresh water is the impact of climatic disruption on the supply of food . as with water , the number of people suffering from protein - calorie malnutrition exceeded 1 billion after reaching a low of around 830 million in the 1990s ( figure 1 ) . in poor countries around the world , malnutrition underlies roughly one - third of the entire burden of disease , and roughly 2 to 3 billion people almost half the human population already suffer from micronutrient deficiencies . looking forward , farmers around the world will need to double agricultural production by 2050 in order to keep up with demand from a growing and more affluent human population that aspires to a more meat - based diet . this doubling of output will need to occur despite headwinds that already strain agricultural productivity . water scarcity , as discussed above , is a major constraint to increasing agricultural production . in addition , roughly one - third of the earth s land surface suffers from land degradation from the combined effects of soil erosion , salinization , nutrient depletion , and desertification . finally , the rise of the biofuels industry evidenced in the diversion of one - quarter of the us grain harvest to biofuel production is generating enormous demand for grain . by increasing grain demand and , as a consequence , demand for arable land and irrigation , growing grains as biofuel feedstock pits human food needs against biofuel production . amid rapidly rising demand for food , increasing environmental pressures on food production , and growing human malnutrition , climate change additionally compromises both agricultural yields and the nutritional quality of the crops produced . observational , longitudinal , and modeling studies all confirm that a 1c rise in temperature corresponds to roughly a 10 % reduction in yield of the major grains [ 3 - 5 ] . as temperatures rise 26c over the next century , the reduction in agricultural yield will depend , in part , on our capacity to adapt and , in part , on how temperature variability changes ; but , in general , yields are expected to drop . as discussed above , climate change is expected to alter the timing and quantity of water available for agriculture while increasing the needs of plants as temperatures rise . increased production of ground - level ozonecurtails agricultural yields , as ozone is a potent plant toxin . when ozone concentrations reach 3045 ppb ( parts per billion ) , yield losses for the major grains approach 1040 % . by 2030 , mean annual ozone concentrations in south asia are expected to exceed 50 ppb . increasingly intense tropical cyclones , sea level rise , more frequent forest fires , droughts , and floods will also conspire to diminish local harvests . despite strong evidence that climate change will increase the risk of numerous challenges to agricultural production , the net effect of climate change on global food production is difficult to quantify . little is known , for example , about how climate change may alter the relationships between plants and their pests and pathogens , though several worrying examples indicate that climate change may promote infestations of plant pests , as higher winter minimum temperatures enable insects to overwinter more effectively . also poorly understood is how climate change will impact the extent and pattern of cloud cover which , to some degree , determines the solar radiation available to plants for photosynthesis . in addition to these impacts on the quantity of food produced , it appears that rising concentrations of atmospheric carbon dioxide also affect nutritional quality . grains grown at elevated concentrations of carbon dioxide appear to have reduced concentrations of protein , iron , zinc , and perhaps other nutrients . as with other examples already cited in this article , these potential decrements in plant nutritional content are of particular concern given the current state of affairs : iron and zinc deficiency account for roughly 63 million years of life lost annually , and the major grains are a critical source of these nutrients for many populations around the world . taken together , these additional threats to food production may very well have extensive impacts on human nutrition and global health . population displacement may be the final common pathway for many of the climate change impacts discussed above . regional changes in precipitation leading to increased droughts and flooding , increased incidence of natural disasters like tropical cyclones and forest fires , local crop failures , and severe water scarcity are all likely to force people around the world to abandon their homes ( figure 2 ) . in addition to these threats , coastal vulnerability puts many people at risk for displacement . more than one - third of the human population lives in coastal areas and on small islands that are within 100 km of the shore and less than 50 m above sea level . the combination of sea - level rise , increasingly intense storms , and destruction of coastal barriers ( mangroves , wetlands , vegetated dunes , and coral reefs ) leaves these populations extremely vulnerable . by 2050an estimated 200 million to 1 billion people may be displaced due to climate change . these estimates are highly uncertain in part because many of the biophysical changes that contribute to displacement remain hard to quantify . despite this uncertainty , a significant fraction of the human populationwill undoubtedly be displaced in this century , and displaced persons face stark health realities . nonimmune populations migrating into endemic areas are more susceptible to a variety of infectious diseases . poor housing , sanitation , and access to safe drinking water combined with poor nutrition lead to disease epidemics , particularly diarrheal disease , measles , and acute respiratory infections . malnutrition plagues displaced populations , with rates as high as 50 % seen in refugee populations in africa . in addition to infectious disease and malnutrition , displaced people suffer from high rates of violence , sexual abuse , and mental illness . post - traumatic stress disorder has been diagnosed in 3075 % of resettled refugee children and adolescents . finally , displacement may lead to civil strife and violent conflict as large numbers of people with few resources move into areas where they frequently are not welcome . there is no doubt that climate change will have important impacts on human health , but we are uncertain about what those impacts will be and where and when they will be most severe . the most consequential health effects of climate change will come about from interactions between biophysical changes to the natural environment , demographic trends , and human adaptations ( figure 3 ) . the biophysical changes such as temperature variability or sea level rise are difficult to predict with accuracy today , and the capacity for adapting to these changes is largely unknown . butuncertainty about the exact timing , location , or magnitude of climate change impacts is no excuse for complacency . with evidence that climate change is already imposing a hefty health burden , the future climate , particularly if greenhouse gas releases into the atmosphere go unabated , portends health crises for hundreds of millions of people . rather than be used as a rationale for inaction , the uncertainty inherent in climate science should serve as an organizing principle for adaptation to its ill effects . for example , uncertainty about future viable regions and conditions for agriculture requires a variety of new crop strains with traits such as heat and drought resistance . changes in the timing of seasonal flow from melting snowpack or glaciers call for a dramatic increase in water - storage capacity for people depending on these flows for household use or irrigation . insurance schemes allowing different countries or populations to pool their risk of crop failure and food insecurity might be enacted to blunt the toll of regional climatic disruption . surveillance efforts should be designed that allow us to better detect changing distributions of infectious disease , water scarcity , or food insecurity early on so that resources can be efficiently redirected . never beforehave the consumption patterns of those in the wealthy countries of the world played such an important role in putting the health of the poor at greater risk . how the wealthy world responds to the moral imperative to help the developing world adapt to climate - change vulnerability will be a defining characteristic of this century .\noutput:\n" }, { "from": "agent", "value": "global climate change threatens the health of hundreds of millions of people . while much has been written about the direct impacts of climate change on health as a result of more severe storms , more intense heat stress , changes in the distribution of infectious disease , and reduced air quality , we are concerned that the indirect impacts of a disrupted climate system may be orders of magnitude more important in terms of the human suffering they cause . because these indirect effects will result from changes in biophysical systems , which are inherently complex , there is significant uncertainty about their magnitude , timing , and location . however , the uncertainty that shrouds this issue should not be cause for complacency ; rather it should serve as an organizing principle for adaptation to its ill effects ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although ubiquitous , and one of the most studied substances on earth , water is still shrouded in mystery . supercooled water water that remains liquid below its freezing point exhibits pronounced anomalous properties , such as decreasing density , increasing isothermal compressibility , and isobaric heat capacity with decreasing temperature . also , structural dynamics are significantly slower in supercooled water than in normal water . recently , the rotational mobility of trehalose , a solute that strongly interacts with water through hydrogen bonding , has been studied by nuclear magnetic resonance ( nmr ) in aqueous solutions over a wide range of concentrations and over a temperature range encompassing the supercooled and normal regions . found that the trehalose tumbling rate is lower than the rate predicted by the stokesdebye ( sed ) equation due to a secondary dynamic solvent effect , where the trehalose molecule slows down the structural dynamics of water in the hydration layer , which in turn slows down its rotation . they also found that the ratio between measured and limiting sed tumbling times is a nonmonotonic function of temperature showing a maximum in the supercooled region , which was explained by the fact that the activation energy for structural water dynamics changes less in the hydration layer than it does in the bulk water . an interesting question arises : does the translational diffusion of a solute follow the stokes einstein relation in the supercooled region ? rotational diffusion of solute molecules has been studied extensively through the years using electron paramagnetic resonance spectroscopy ( epr ) , primarily with stable nitroxide spin probes ( nitroxides ) . in 1976 , the first epr article on supercooled water presented a study of the rotational correlation time , r , of the spin probe di - tert - butyl nitroxide ( dtbn ) in supercooled water in the temperature range 240288 k. the rapid increase of the esr line widths with decreasing temperature below 273 k was attributed to the rapid increase of the viscosity of supercooled water . another study of the rotation of dtbn in supercooled water reported an anomalous behavior of the hydrodynamic radius of the probe below 273 k that was connected to the dynamics of the clusters of water molecules with four h - bonds and to their growth , as well as to the effect of local viscosity . banerjee et al . have studied the rotation of the small polar spin probe 4 - hydroxy -2,2,6,6-tetramethylpiperidine-1-oxyl ( tempol ) in interstitial deeply supercooled water of polycrystalline ice , from 90 to 300 k. they observed two fractions of tempol with different mobility and fragility in interstitial supercooled water of polycrystalline ice . by varying the degree of confinement of the supercooled water fraction in ice / water mixtures , banerjee et al . have recently shown that the rotational mobility of probe molecules , surprisingly , increases in water with stronger confinement . they argued that ice - like regions are present in loose confinement , while these regions are suppressed in supercooled water with stronger confinement , which increases the fluidity of water molecules and thereby increases the rotation of the probe . have measured the epr spectra of tempol in rapid - quench - formed amorphous water in the temperature range 140210 k and have found evidence that in this region supercooled water coexists with crystalline ( cubic ) ice . in nature , droplets of highly supercooled water , at temperatures as low as 235.5 k , have been observed in deep convective clouds . supercooled water at this extremely low temperature was attributed to small droplet size and the absence of ice nuclei . for that reason , the spin probe epr method has been used to study small droplets of supercooled water confined in a polyuria microcapsule and a silica gel with a high hydration level . using a precise method of least - squares nonlinear epr spectral line fitting , our group has recently studied the rotation of four small nitroxide probes in supercooled bulk water , down to 251 k. although the rotation of the spin probes was about an order of magnitude slower than the rotation of water molecules , when the probes rotational correlation times were scaled to the rotational correlation time of water , their functional dependence appeared to be very similar . interestingly , the rotational correlation times of the probes can be fit well to a power law functionality with a singular temperature of 228 k , just like many other physical quantities . we also found that the activation energies of the rotation of the probes and water viscosity in ambient water are very close , while in the supercooled region the activation energies of the probes rotation are greater than that of the viscosity of water . the hydrodynamic radius calculated from the rotational correlation time of the probes clearly indicated two distinct dynamical regions crossing at 277 k. the change in hydrodynamic radius was correlated to the change in density fluctuations . epr has not been employed to study translational diffusion in supercooled water . in principle , heisenberg spin exchange ( hse ) studies of nitroxides provide an ideal method because of two facts : ( 1 ) spin exchange only occurs upon contact during the short period of time , c , during which the unpaired spin orbitals of the two nitroxides overlap , and ( 2 ) the mean time between successive spin exchanges within a cage , re , and the long - time - averaged spin exchange rate constants , kex , may be measured independently . the collision rate constant , kd , is related to kex as follows : 1where feff is an effective steric factor . therefore , a measurement of kex provides an estimate of the collision rate constant . furthermore , for nitroxides where significant spin density resides over the entire molecule , feff 1 . the factor 1/2 in eq 1 is due to the fact that only spin exchange between nitroxides with different electron spin quantum numbers affects the spectrum . for identical spheres of radius rex , the smoluchowski equation relates kd to the diffusion coefficient of one of the spheres , d , as follows : 2where 2rex is the distance at which spin exchange occurs . the translational diffusion coefficient is often approximated by the stokeseinstein equation3where rstokes is the radius of a sphere diffusing in an incompressible fluid of shear viscosity , kb is the boltzmann constant , and is a coefficient that embodies the boundary condition ( bc ) ; = 1 corresponds to stick and = 3/2 to slip bc . combining eqs 2 and 3 and changing concentration units to mol / l yield4 in units l / mol s , where r is the gas constant . setting rex = rstokes leads to the well - known stokessmoluchowski ( ses ) expression , independent of the size of the sphere . in practice , the hse method did not reach its full potential until recently because dipole dipole ( dd ) interactions introduce spectral changes that compete with those due to hse and a sound method to separate the two was not previously available . recently , we have been able to separate the two effects by extending the theoretical approach proposed by salikhov . we interpret the results of this study in terms of a simple model in which two molecules suffer a first - time collision ( an encounter ) with rate constant kd followed by a series of recollisions ( re - encounters ) within a cage with mean frequency 1 / re . we refer to the former as being due to macroscopic diffusion and the latter due to microscopic diffusion . the purpose of this work is to study microscopic and macroscopic diffusion of perdeuterated 2,2,6,6 - tetramethyl -4-oxopiperidine-1-oxyl ( pdto ) in normal and supercooled water and integrate these findings into those gleaned from studies of the rotational diffusion of the same molecule . both hse and dd broaden the lines , induce a dispersion component , and shift the lines . the fact that the induced dispersion and line shifts have opposite signs for dd and hse , while the line broadening has the same sign , enables one to successfully separate the two contributions . since the hse - dd separation method has been published in detail in ref ( 25 ) , we will present only a short overview of it here . the hse rate constant may be calculated from the concentration dependence of hse broadening , bex , as follows5where is the gyromagnetic ratio of the electron and c ( mol / l ) is the concentration . combining eqs 1 , 4 , and 5 yields a hydrodynamic estimate of the hse broadening constant from the ses equation6 using nonlinear least - squares epr spectral fitting , it is possible to extract from the epr spectrum the resonance fields of the lines , hmi , the peak - to - peak line widths hpp0 ( c ) mi , mixing parameters which are used to extract the separate lorentzian , hppl ( c ) mi , and gaussian , hppg , contributions to hpp0 ( c ) mi , the peak - to - peak amplitudes of the absorption components , ( vpp ) mi , and the extremum values of the dispersion components , ( vdisp ) mi , where mi = + 1 , 0 , and 1 represent the low - , middle - , and high - field lines , respectively . once the spectral parameters are extracted , the total broadening of the mi line may be calculated as follows : 7where bdip is the dd broadening . b is independent of mi for values of b / a01 where a0 is the hyperfine spacing at c = 0 ; however , because the outer lines broaden faster than the central line , it must be replaced by its average over three lines , b. see figure 7 of ref ( 30 ) . the ratio of the dispersion extremum values to the absorption heights ( vdisp ) mi / ( vpp ) mi corrected for instrumental dispersion and a small nonlinearity with b / a0 employing eqs 3 and 4 of ref ( 31 ) denoted by mi ( vdisp / vpp ) mi # is proportional to b / a0 as follows : 8 there are two independent values of the lhs of eq 8 which should satisfy + ( vdisp / vpp ) + # = ( vdisp / vpp ) # . we denote the average of the two values by ( vdisp / vpp ) and use one - half the difference as an estimate of the systematic fitting error . if the low - field extremum is positive and the high - field negative , hse dominates so k is positive . the ratio of the broadening by hse to the overall broadening , , is calculated from k9where b depends on the details of the molecular diffusion . using the permanent diffusion model , we have shown that b = 4/19 gives a negligible error in the separation of dd and hse . the values of bex are computed from eq 9 , and the values of bdip , from eq 7 . the resonance fields of the mi = 1 absorption lines are shifted by coherence transfer induced by both dd and hse . one - half the difference in these fields , aabs , varies quadratically with b / a0 . spin precession during c and during the mean time between re - encounters , re , shifts the mi = 1 lines linearly with bex / a0 = b / a0 . adding the two contributions , we get10where11equation 11 supposes that c re . the value of c is estimated to be approximately 10 s , while the value of re is about 10 s , figure s9 . perdeuterated - tempone ( pdto - cdn isotopes lot # p607p2 ) was used as received . three stock solutions of pdto at concentrations of 30.4 , 49.25 , and 70.39 mm were prepared by weight in water . these solutions were diluted to other intermediate concentrations of 0.095 , 0.2 , 0.496 , 0.985 , 2.47 , 7.56 , 10 , 12.6 , 15 , 17.6 , 20 , 25.3 , 34.42 , 39.4 , 44.34 , 55.71 , 60.58 , and 65.3 mm . the samples were drawn into 5 - l capillaries ( radius 150 m ) , which were then sealed at both ends by an open flame . epr spectra were taken with a bruker esr 300e spectrometer equipped with a bruker variable temperature unit . the sample temperature , which was held stable within 0.2 c , was measured with a thermocouple using an omega temperature indicator . the thermocouple tip was always positioned at the top of the active region of the epr cavity , to avoid reducing the cavity quality factor . samples were measured in steps of 2 k in a temperature range from 259 to 279 k and in steps of 5 k in a temperature range from 283 to 303 k. samples were equilibrated at each temperature for at least 5 min to ensure a uniform temperature throughout the sample . five first - harmonic epr spectra were acquired at each temperature employing a sweep time of 84 s , microwave power of 5 mw , time constant of 20.5 ms , sweep width of 50.2 g , and modulation amplitude of 0.2 g. the spectra were then transferred to a personal computer and were analyzed using the computer program lowfit as detailed previously . after preliminary runs , the final data set includes 1590 epr spectra which may appear to the reader as overkill ; however , our intention was to obtain very careful data with high statistics with which to test future software and theoretical ideas . figure 1 shows an experimental epr spectrum of 70 mm pdto in water at 264 k together with its fit . to illustrate the epr spectral fitting method , the residual , showing only minor contributions from c lines , indicates an excellent fit . the positive values of + ( vdisp / vpp ) + # and ( vdisp / vpp ) # indicate that hse dominates the dd interaction . experimental epr spectrum of 70 mm pdto in water at 264 k ( top trace ) . the second trace shows the three absorption lines , and the third , the three dispersion lines extracted from the fit of the experimental epr spectrum . the fourth trace is the residual , the difference between the experimental spectrum , and the sum of the absorption and dispersion lines , showing that the fit is excellent ; only the hyperfine lines due to c in natural abundance are evident . note that the positive dispersion for the low field line and negative dispersion for the high field line indicate that hse is dominant . the total broadening rate constant db / dc and that due to hse , dbex / dc as functions of t / for pdto in water are presented in figure 2 . the data analysis leading to the values of db / dc and dbex / dc has been published previously and is reported in detail in the supporting information . the solid line is the ses equation , eq 6 , assuming that rex = rstokes , setting feff = 1 , and assuming stick bc , = 1 . the right - hand ordinate , kex , is computed from eq 5 , and kd is twice that value assuming feff = 1 . total ( ) and hse ( ) broadening constants versus t / for pdto in water , left ordinate . the hse rate constant , the right ordinate , is computed with eq 5 . the solid lines through the data are linear least - squares fits to guide the eye . the error bars are standard deviations of five measurements and are less than the size of the symbols . the stokes einstein ( se ) expression describing the dd broadening rate constant , dbdip / dc , in the motional narrowing limit is as follows : 12where 2rc is the distance of closest approach between the two nitroxide dipoles and cdip = 763 ( kg ) / ( cpm ) . the dephasing rate constant due to dd can be found from dbdip / dc using wdd = ( 3/2 ) dbdip / dc . when the spin probe is immobilized , dbdip / dc approaches 49.03 g / m . the solid line is the se prediction , eq 12 , assuming rc = rstokes . as can be observed the data are described rather well by the simple hydrodynamic prediction in that dbdip / dc varies monotonically with / t . we note that although dbdip / dc is reasonably well described by the se in water , it is very poorly described in more viscous systems . the dephasing rate constant due to dd , wdd = ( 3/2 ) dbdip / dc , the right ordinate . . the values of er from the fits to eq 10 in figure s3 can be used in eq 11 to obtain the rate of re - encounters 1 / re . figure 4 shows 1 / re versus t / . the solid line in figure 4 is the reciprocal of the se prediction for the mean time between re - encounters given by13 re - encounter rate versus t / for pdto in water . the error bars are the standard deviations of five consecutive measurements . to draw the line in figure 4 , we have assumed that rstokes and rc are equal to the van der waals radius of pdto , rvdw = 3.5 . from figure 2 it can be seen that the hse rate constant dbex / dc of the probe behaves hydrodynamically ; that is to say , it varies monotonically with t / and even in remarkable agreement with the ses equation , eq 6 , in view of the assumptions inherent in the ses relation . these results might be expected since the rvdw = 3.5 is greater than that of the water molecule , 1.4 , the probe perceives the collective behavior of the surrounding water molecules as a continuum . also , dbex / dc and dbdip / dc do not show any noticeable difference between the supercooled and normal regions . from the point of view of macroscopic diffusion as reported by hse and dd , the water in the measured temperature interval can be viewed as one kind of liquid . figure 4 shows a peculiar upturn in the re - encounter frequency as the temperature is decreased below 2762 k. such an upturn can not be reconciled by a hydrodynamic theory . have found that the ratio of the measured tumbling time to the limiting tumbling time , calculated from the sed equation and assuming the bulk water viscosity and hydration volume equal to the apparent solute volume as a function of temperature , is nonmonotonic and reaches a maximum in the supercooled region , at 255 k , figure 9 in ref ( 9 ) . this maximum represents a maximal slowing of the solute due to the secondary dynamic effect of water molecules in the hydration layer . if re is plotted as a function of t , figure s9 in the supporting information , it has a maximum just like r / r0 in figure 9 in ref ( 9 ) . this similarity might indicate that the slowing down of re is caused by the similar interactions between pdto and its hydration layer . trehalose has eight hydroxyl groups which can form hydrogen bonds , while pdto is a nitroxide radical which can form two h - bonds due to the no moiety , while the rest of the molecule is hydrophobic . pdto is soluble in both water and alkanes , while trehalose is not soluble in alkanes . also , the rotation of trehalose at 293 k , r = 117 ps , is about 1 order of magnitude slower than the rotation of pdto at the same temperature r = 19 ps . therefore , it is very likely that trehalose and pdto interact with the hydration layer slightly differently . this can be seen by comparing the hydrodynamic radius of pdto calculated by the sed equation from the measured rotational correlation time , figure 4b in ref ( 18 ) , to r / r0 in figure 9 in ref ( 9 ) , which shows opposite behavior . also , the minimum in figure 4b in ref ( 18 ) is at about 2772 k , which is about 20 k higher than the maximum in figure 9 in ref ( 9 ) . can the upturn in the re - encounter frequency be reconciled by turning to a free volume view of diffusion ? in contrast with classical hydrodynamics , which assumes a continuous liquid , theories are based on intermolecular cavities dating from the early work of frenkel , who showed that , even under full compression , free volume exists . the viscosity and diffusion are related to the free volume , thus offering an alternative view of diffusion often accompanied by ideas of jumps . to put values of 1 / re into the context of free volume , we define a simplified geometrical fraction of free volume as follows : 14where v is the volume of the sample and vmolecule is the volume of molecules within the sample . taking the molecules as spheres of radius rvdw = 1.4 , we have15figure 5 shows the values of 1 / re as a function of the density ( bottom axis ) and simplified geometrical fraction of free volume ( top axis ) . the re - encounter rate appears to be a linear function of both density and free volume ; the minimum re - encounter rate occurs at = 1.0 g / cm and = 0.62 , or 277 k. this may mean that this short - time diffusion behavior is influenced by the availability of free space into which the probe might be trapped . as the equilibrium freezing point and the temperature of maximum density have no special significance for the dynamic behavior of supercooled water , it is puzzling that we observe the minimum re - encounter rate close to 277 k. at the moment , we do not know why that is so ; we hope that md simulations of pdto in water might give some answers . re - encounter rate versus the density ( bottom axis ) and simplified fraction of free volume ( top axis ) for pdto in water , eq 15 . although the fractional free volume in water is high , it has been discovered that the cavities in water are distributed in smaller packets due to the small size of water molecules . on the other side , due to the fact that the water molecules have the same number of donor and acceptor sites arranged tetrahedrally , water can form a cage around even nonpolar solutes without disrupting much of its hydrogen bonding . actually , the number of h - bonds might be slightly higher , so the hydration layer can be viewed as an elasticated net , or a dynamic cage . several extensive md studies have shown that both rotational and translational diffusion of water are affected by the presence of long - lived molecular cages . between steps of continuous diffusion water moleculessimilarly , we hypothesize that the nitroxide probes during an encounter might be trapped in a cage . figure 5 suggests , but does not prove , that part of the microscopic diffusion process as reflected by 1 / re depends on free volume , in other words , the availability of cages . note that the detailed relationship between free volume and the density depends on the system , but in any case they are very likely monotonic functions of one another . it is of interest to compare the diffusion coefficients for pdto derived from epr with those for water using other techniques . diffusion coefficients may be computed from the experimental quantities as follows : 161718 figure 6 compares the diffusion coefficients of pdto in water ( open symbols ) using epr , eqs 1618 , with those of water ( filled symbols ) using nmr , tracer experiments , and quasi - elastic neutron scattering , scaled by 1.4 / 3.5 to put them on the same scale of the ordinate as the diffusion coefficients of pdto , eq 3 . the two solid lines correspond to the ses estimates using stick bc ( = 1 , lower line ) or slip bc ( = 3/2 , upper line ) , respectively . figure 6 shows that not only pdto but also water molecules themselves behave hydrodynamically , with water fitting numerically within the stick and slip bc of the ses relation . the data for pdto are numerically below these limits ; however , small adjustments in either rex / rstokes ( see ref ( 32 ) ) or feff ( see ref ( 22 ) ) could even render these data numerically consistent with the ses equation . at any rate , even without adjustments in either rex / rstokes or feff , a hydrodynamic description is remarkably good . clearly , translational diffusion of both water and pdto vary smoothly through both 277 and 273 k. figure 6 also highlights the fact that the short - time , microscopic diffusion as reflected by dre , is poorly characterized by a hydrodynamic description . since two water molecules are hydrogen bonded to the n o moiety , when two pdto molecules encounter there could be additional hydrogen bonding between the hydrogen bonded waters of the pair . these solvent - mediated interactions might enhance the short time diffusion of pdto above what is expected from a force - free model . unfortunately , according to our knowledge there is no simple way to estimate the effect of these interactions . translational diffusion coefficients of pdto in water derived from epr using hse , open squares , using dd , open circles , and using re - encounter frequency , open diamonds . translational diffusion coefficients of water scaled by 1.4 / 3.5 from nmr , filled circles , from tracers , filled diamonds , and from quasi - elastic neutron scattering , filled squares . the upper , lower lines are the hydrodynamic predictions corresponding to slip or stick bc , respectively . these same lines correspond to the diffusion of pdto and to the scaled values of diffusion for water . by using time - resolved transient absorption spectroscopy , stickrath et al . measured the primary geminate recombination and cage escape times of alkyl radicals in water over a temperature range from 0 to 80 c . caged radical pairs are produced by photodissociation from their parent molecule in a cage . accounting for the differences between pdto and the alkyl radicals , the values of re measured in this work are several times smaller than the values of the cage escape time obtained in ref ( 46 ) . in the same way , we assume that the re - encounters and rotation of pdto very likely occur in molecular cages made of a dynamic network of tetrahedrally coordinated water molecules . therefore , it is anticipated that these two dynamic processes should be influenced by the microstructure and microdynamics of the surrounding water molecules . from figure 4 , one can see that ( i ) the re - encounter rate is faster than the hydrodynamic prediction , eq 13 , assuming the distance of closest approach is two times the van der waals radius , b = 7.0 , and ( ii ) the re - encounter rate increases as the temperature is decreased below 2762 c . the decrease with decreasing t / in the normal region is as expected for a normal liquid and is the same as observed in the case of pdto and the nitroxide spin probe 3 - doxyl -5-cholestane in a series of n - alkanes . recently , the rotational diffusion of pdto in water was investigated over the same temperature range . there , we introduced an effective hydrodynamic radius of the probe rr which could be found from rotational correlation time r using the stokes einsteindebye equation19 we found that rr varied with temperature which we attributed to the changing bc under rotation . the relationship between rr and rvdw depends on the bc as follows : rr = 0 slip and rr = rvdw for stick bc . the behavior of rr with temperature was very similar to that of the density fluctuations , and it is opposite to the normalized tumbling time r / r0 of trehalose and the time between re - encounters re of pdto . the similarity between figure 4 of ref ( 18 ) and figure 4 in this paper is that the temperature of change is the same within the experimental error , which might suggest that the bc under microscopic translation might be responsible for the dependence in figure 4 . nevertheless , we can not conclude on the basis of the present data that a varying bc is responsible because the density varies in this region and secondary order dynamic solvent effects might be partially responsible . perhaps experiments under pressure holding the density constant and md simulations could resolve this issue . the translational diffusion of pdto in water and supercooled water is obtained independently from hse and dd using our recently developed method for separating the effects of these interactions on epr spectra . the diffusion coefficients , measured either by hse or dd , are remarkably predicted by simple hydrodynamic considerations . the diffusion of the probe is similar to the diffusion of water when the diffusion coefficients of the two molecules are scaled according to their size . the frequency of re - encounters does not follow a hydrodynamic description , showing an upturn in frequency as the temperature is decreased below 2762 k. although the re - encounter time and the effective radius extracted from the rotational correlation time show opposite behavior with temperature , both of them show evident differences in normal and supercooled water . the precision of the present measurements does not permit a distinction between the melting point and the point of maximum density as the beginning of the upturn . therefore , whether the re - encounter rate depends on the properties of the first hydration layer or on the density , or a combination of the two , can not yet be distinguished .\noutput:\n" }, { "from": "agent", "value": "bimolecular collision rate constants of a model solute are measured in water at t = 259303 k , a range encompassing both normal and supercooled water . a stable , spherical nitroxide spin probe , perdeuterated 2,2,6,6 - tetramethyl -4-oxopiperidine-1-oxyl , is studied using electron paramagnetic resonance spectroscopy ( epr ) , taking advantage of the fact that the rotational correlation time , r , the mean time between successive spin exchanges within a cage , re , and the long - time - averaged spin exchange rate constants , kex , of the same solute molecule may be measured independently . thus , long - and short - time translational diffusion behavior may be inferred from kex and re , respectively . in order to measure kex , the effects of dipole dipole interactions ( dd ) on the epr spectra must be separated , yielding as a bonus the dd broadening rate constants that are related to the dephasing rate constant due to dd , wdd . we find that both kex and wdd behave hydrodynamically ; that is to say they vary monotonically with t / or / t , respectively , where is the shear viscosity , as predicted by the stokes einstein equation . the same is true of the self - diffusion of water . in contrast , re does not follow hydrodynamic behavior , varying rather as a linear function of the density reaching a maximum at 276 2 k near where water displays a maximum density ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the overexpression of epidermal growth factor receptors ( egfrs ) plays an important role in carcinogenic cellular processes in several tumor types . however , purpuric lesions are rarely seen as an adverse cutaneous reaction . in this report , we described a patient with purpuric papular eruption secondarily infected with staphylococcus aureus ( sa ) due to erlotinib therapy , who was successfully treated with pulsed azithromycin . a 73 - year - old female patient was referred to our outpatient clinic for evaluation and treatment of a widespread acneiform eruption . the patient has developed nonpruritic papules and pustules on her upper limbs , trunk , and then on lower limbs for the past 2 weeks . dermatological examination revealed multiple , purpuric erythematous papules , and papulopustules of 0.81 cm in diameter widespread over the body except the face [ figures 13 ] . laboratory tests including complete blood count with differential , erythrocyte sedimentation rate , prothrombin time , partial thromboplastin time , liver and kidney function tests were within normal limits . bacterial culture obtained from a pustule on the back grew methicillin sensitive sa . histopathological examination of a papule demonstrated a mixed infiltration of eosinophils and lymphocytes and erythrocyte extravasation [ figure 4 ] . papulopustular eruption on the trunk lesions more pronounced on the right lower back area closer view of the tiny pustules mixed infiltration of eosinophils and lymphocytes and erythrocyte extravasation seen in a purpuric papule ( h and e , 200 ) depending on clinical and histopathological findings , the patient was diagnosed as having a purpuric papulopustular eruption due to erlotinib treatment complicated with staphylococcal infection . the severity of adverse cutaneous reaction was grade 2 according to the national cancer institute common toxicity criteria , version 3 . the patient was started on pulse azithromycin therapy using a regimen of two weekly pulses of 500 mg for 3 consecutive days . the occurrence of cutaneous adverse events , experiencing multiple adverse events , and more severe cutaneous lesions were found to be closely related to a better tumor response and overall survival . the papulopustular reaction is the most common cutaneous adverse reaction of egfr inhibitors , and the rash is observed in 50100 % of patients , in a dose - dependent manner . the papulopustular eruptions due to egfr inhibitors were classified as early and late phase reactions concerning the time of onset of the rash . involving of trunk without face , presence of pruritus , sa isolation in culture , and the long interval from erlotinib initiation to emerging eruption of our patient suggested that the rash was a late phase reaction . a recent study described 7 patients with late phase rash secondarily infected by sa suggested that sa infection may be involved in the pathogenesis . the pustular component of rash seen in our patient may be a secondary infection on the purpuric inflammatory process triggered by erlotinib . we suggest that the immunocompromised state and cutaneous toxicity caused by erlotinib may lead to skin barrier impairment and overgrowth of sa in these cutaneous regions . prophylactic oral and topical treatments have been used to prevent acneiform eruptions due to egfr inhibitors . concurrent use of egfr inhibitors with oral tetracycline has provided decreased incidence of moderate to severe folliculitis , not mild form until tetracycle treatment was discontinued . there is no consensus on the treatment options of egfr inhibitor related acneiform eruptions . in a recent study ,11 of 20 patients with acneiform eruption due to egfr inhibitors who were resistant to previous tetracyclines , were treated with 500 mg azithromycin for 3 consecutive days per week for at least 2 weeks without performing bacterial cultures . this case was successfully treated with systemic azithromycin depending on the result of the bacterial culture of the pustule . we suggest that treatment depending on bacterial culture and antibiotic susceptibility tests will be a better approach to the treatment of papulopustular eruption due to egfr inhibitors . routine bacterial culture should be performed before any treatment since secondarily infection with sa may be associated .\noutput:\n" }, { "from": "agent", "value": "erlotinib belongs to the targeted cancer treatments acting through epidermal growth factor receptor inhibition . papulopustular eruption is the most common cutaneous toxicity . the pathogenesis of the rash is not clear . there is no consensus on treatment . in this report , we describe a 73 - year - old female patient who was referred to our outpatient clinic for evaluation and treatment of a widespread acneiform eruption . she was put on erlotinib therapy for 3 months for the treatment of lung adenocarcinoma . the patient has developed nonpruritic papules and pustules widespread over the body except the face for the past 2 weeks . bacterial culture obtained from a pustule on the back grew methicillin - sensitive staphylococcus aureus ( sa ) . histopathological examination of a papule demonstrated vacuolar degeneration of basal layer , prominent walls of vessels , a mixed infiltration of eosinophils , and lymphocytes and erythrocyte extravasation . the eruption was successfully treated with two weekly pulses of azithromycin 500 mg for 3 consecutive days . this case demonstrated that erlotinib may cause purpuric papular eruption secondarily infected with sa . routine bacterial culture should be performed from pustules before any treatment ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: open surgical repair remains a gold standard therapeutic option in the management of descending thoracic aorta ( dta ) aneurysm . because of the progress in cardiopulmonary bypass ( cpb ) strategies , spinal cord protective adjuncts , as well as improvements in postoperative care , outcomes of open repair of dta have improved . despite these improvements , morbidity and mortality rates in dta replacement still remain high , with the recent data showing operative mortality rate of 4.7 % , lower extremity paralysis rate of 3.4 % , and stroke rate of 2.7 % even in the high - volume aortic centers . , concerns regarding the challenging risks of open surgical repair of dta have led to the global atmosphere favoring thoracic endovascular aortic repair ( tevar ) more frequently even without hard evidence in support of the long - term benefits of tevar . reviewing the literature published in korea , only a few studies have analyzed clinical outcomes of open surgical repair of dta , of which the largest - scale study is one that evaluated 22 patients decades ago . we therefore sought to evaluate the outcomes following open surgical repair of dta in a reasonably sized cohort in the current era and to determine independent predictors of long - term outcomes . out of 212 patients who underwent dta repair between june 1999 and august 2011 at asan medical center , we identified 103 patients ( mean age , 53.813.1 years ; 23 women ) who underwent aortic surgery only for thoracic aortic segments . one hundred and nine patients who underwent aortic surgery combined with thoracoabdominal aorta repair and arch replacement were excluded in this study . the operative procedure was conducted as follows : patients were intubated with a double lumen endotracheal tube . cerebrospinal fluid ( csf ) drainage was in 56 patients ( 54 % ) who were supposed to receive lower thoracic aorta replacement . left posterolateral thoracotomy was performed for all patients , and the level of entrance ( 46th intercostal spaces ) was determined on the basis of the aortic segment replaced . the left femoral artery was the preferred site for arterial cannulation in the absence of atherosclerotic changes in the distal arteries . in general , arterial and venous cannulation was established with a wire - directed approach . deep hypothermic circulatory arrest ( dhca ) was used in 44 patients ( 42.7 % ) , and partial cbp was used in 58 patients ( 56.3 % ) . the decision between dhca versus partial cpb strategies depended on anatomic factors including involvement of the distal arch or feasibility of aortic cross - clamping , butthe patients who underwent dhca ( n = 44 , 45 % ) were cooled to the core body temperature of 18c , and when circulatory arrest was initiated , the aorta was opened . proximal aortic anastomosis was made with a branched vascular graft in an open fashion , and then , an additional arterial cannula was inserted through the side branch of the aortic graft so that both the upper and the lower body could be perfused . for partial cpb strategies , proximal dta clamping or distal arch clamping ( between left common carotid and left subcalvian artery [ lsca ] ) with separate lsca clamping was performed under mild hypothermia ( 30c ) . distal anastomosis was performed in an open fashion if distal clamping was not feasible in both dhca and partial cpb techniques . after cpb weaning , protamine was administered to return the activated clotting times to baseline . stroke was defined as any new clinically and radiographically evident brain injury including focal and global deficits . paraplegia was defined as a deficit of the lower extremities including weakness or complete loss of motor function . for study purposes , renal failure was defined as the new requirement for hemodialysis , and low cardiac output syndrome ( lcos ) was defined as heart failure requiring mechanical ventricular support such as intra - aortic balloon pulsation or veno - arterial extracorporeal membrane oxygenation . categorical variables were presented as frequencies and percentages , and continuous variables were expressed as meanstandard deviation or medians with inter - quartile ranges . for multivariable analyses , cox proportional hazards models were used to determine the risk factors of death . variables listed in table 1 were evaluated in the models , and those with a p - value of 0.20 or less in the univariable analyses were candidates for the multivariable cox models . multivariable analyses involved a backward elimination technique , and only variables with a p - value of less than 0.10 were used in the final model . all statistical analyses were performed with pasw spss ver . 18.0 ( spss inc . , chicago , il , usa ) . out of 212 patients who underwent dta repair between june 1999 and august 2011 at asan medical center , we identified 103 patients ( mean age , 53.813.1 years ; 23 women ) who underwent aortic surgery only for thoracic aortic segments . one hundred and nine patients who underwent aortic surgery combined with thoracoabdominal aorta repair and arch replacement were excluded in this study . the operative procedure was conducted as follows : patients were intubated with a double lumen endotracheal tube . cerebrospinal fluid ( csf ) drainage was in 56 patients ( 54 % ) who were supposed to receive lower thoracic aorta replacement . left posterolateral thoracotomy was performed for all patients , and the level of entrance ( 46th intercostal spaces ) was determined on the basis of the aortic segment replaced . the left femoral artery was the preferred site for arterial cannulation in the absence of atherosclerotic changes in the distal arteries . in general , arterial and venous cannulation was established with a wire - directed approach . deep hypothermic circulatory arrest ( dhca ) was used in 44 patients ( 42.7 % ) , and partial cbp was used in 58 patients ( 56.3 % ) . the decision between dhca versus partial cpb strategies depended on anatomic factors including involvement of the distal arch or feasibility of aortic cross - clamping , butthe patients who underwent dhca ( n = 44 , 45 % ) were cooled to the core body temperature of 18c , and when circulatory arrest was initiated , the aorta was opened . proximal aortic anastomosis was made with a branched vascular graft in an open fashion , and then , an additional arterial cannula was inserted through the side branch of the aortic graft so that both the upper and the lower body could be perfused . for partial cpb strategies , proximal dta clamping or distal arch clamping ( between left common carotid and left subcalvian artery [ lsca ] ) with separate lsca clamping was performed under mild hypothermia ( 30c ) . distal anastomosis was performed in an open fashion if distal clamping was not feasible in both dhca and partial cpb techniques . after cpb weaning , protamine was administered to return the activated clotting times to baseline . stroke was defined as any new clinically and radiographically evident brain injury including focal and global deficits . paraplegia was defined as a deficit of the lower extremities including weakness or complete loss of motor function . for study purposes , renal failure was defined as the new requirement for hemodialysis , and low cardiac output syndrome ( lcos ) was defined as heart failure requiring mechanical ventricular support such as intra - aortic balloon pulsation or veno - arterial extracorporeal membrane oxygenation . categorical variables were presented as frequencies and percentages , and continuous variables were expressed as meanstandard deviation or medians with inter - quartile ranges . for multivariable analyses , cox proportional hazards models were used to determine the risk factors of death . variables listed in table 1 were evaluated in the models , and those with a p - value of 0.20 or less in the univariable analyses were candidates for the multivariable cox models . multivariable analyses involved a backward elimination technique , and only variables with a p - value of less than 0.10 were used in the final model . all statistical analyses were performed with pasw spss ver . 18.0 ( spss inc . , chicago , il , usa ) . eleven patients ( 10.7 % ) underwent emergency or urgent surgeries as indicated in table 1 . cpb time was longer in the dhca group ( 196.459.7 minutes versus 116.984.0 minutes , p 0.001 ) , and mean circulatory arrest time was 23.313.5 minutes in the dhca group . the causes of early deaths were lcos in all patients , among which four patients showed multi - organ failure . regarding the early mortality cases , one patient had low left ventricle ( lv ) ejection fraction ( 35 % ) preoperatively , in whom partial cpb strategy was applied . early major complications occurred in 21 patients ( 20.3 % ) including 7 patients ( 6.8 % ) of re - exploration for postoperative bleeding . ten patients ( 9.7 % ) required new dialysis for acute renal failure and 7 patients ( 6.8 % ) developed stroke , but no cases of paraplegia were reported . between the dhca group and the partial cpb group , the dhca group had a higher rate of lcos ( 13.3 % versus 1.7 % , p = 0.041 ) andthe duration of mechanical ventilation was longer than in the partial cpb group . during the median follow - up duration of 56.3 months ( inter - quartile range , 23.1 to 85.1 months ) , there were 17 ( 16.5 % ) late mortalities including 11 cardiovascular - related deaths . non - cardiovascular causes of death were malignancy in one , respiratory failure in four , and alcoholic liver disease in one patient . the overall survival rates at 5 and 10 years were 80.9 % 4.3 % and 71.7 % 5.9 % , respectively ( fig .1 ) . the 5 - and 10 - year reoperation - free survival rates were 77.3 % 4.8 % and 70.2 % 5.8 % , respectively ( fig . there was one aortic reoperation case during follow - up , in whom asymptomatic pseudoaneurysm at the anastomoses site was seen at regular follow - up computed tomography performed 3 months after surgery . the patient variables associated with mortality in the univariate analysis were age ( p 0.001 ) , lv ejection fraction ( p = 0.001 ) , and glomerular filtration rate ( p = 0.002 ) . multivariable analyses revealed that age ( hazard ratio [ hr ] , 1.10 ; 95 % confidence interval [ ci ] , 1.05 to 1.15 ; p 0.001 ) and lv function ( hr , 0.88 ; 95 % ci , 0.82 to 0.96 ; p 0.003 ) were significantly associated with mortality ( table 3 ) . ruptured aorta and urgent / emergency cases , however , furthermore , different cpb strategies ( p = 0.49 ) and distal arch involvement ( p = 0.92 ) did not significantly affect mortality . open surgical repair remains a gold standard approach in the management of dta lesions requiring invasive intervention . progress in pre - operative management and cpb strategies as well as adjunctive maneuvers to protect the kidneys , visceral organs , and central nervous system has significantly improved surgical outcomes . however , open surgical repair of dta is still regarded as a surgical challenge having a reported early mortality rate of 4.8 % to 22.4 % . in addition , in the era of endovascular alternatives , patients who undergo open repair of dta generally have highly complex aortic pathology where tevar approaches are regarded inappropriate , and these circumstances make it more challenging for practicing surgeons to undertake open surgery for dta , particularly for surgeons in low - volume aortic centers . in the past decades , a number of researches have been conducted to improve the preservation of end - organ functions from ischemic damages . several perfusion techniques were developed such as dhca and partial cpb including femoral - femoral bypass and left heart bypass . adjunctive strategies such as intercostal reimplantation , csf drainage , motor / somatosensory - evoked potential monitoring , and rapid renal cooling have also been developed . despite these improvements in surgical techniques and adjuncts for end - organ protection , recent studies reviewed that dhca for open repair of dta has several advantages over non - dhca . first , a bloodless field without clamping the aorta can be obtained . in particular , since clamping of the aorta is not safe if the aortic disease involves the distal aortic arch , dhca may offer a safe environment for surgery in this situation . patel et al . demonstrated that half of the patients suffered from postoperative stroke when cross - clamping was conducted for the atheromatous aortic arch , but the stroke rate decreased to 11 % when dhca was used without aortic clamping . secondly , hypothermia has a protective effect on the spinal cord and visceral organs by decreasing the oxygen demand . in support of this hypothesis , rokkas et al . reported that the spinal cord is protected by dhca not only by decreased metabolism but also by the inhibition of the release of excitatory amino acids in the extracellular neuronal space . in dhca strategies , however , prolonged cpb time may require more transfusion , and hypothermia induces impairment of coagulation cascade . partial cpb strategies have certain advantages such as requirement for shorter cpb time than dhca , which consequently reduce the risks of coagulopathy and lethal intrapulmonary hemorrhage that may hamper postoperative recovery . moreover , several recent studies reported excellent spinal cord protection using a mild - hypothermic distal perfusion technique in combination with csf drainage . acher suggested that the quality of spinal cord protection relies mainly on perfusion , metabolism , and oxygen delivery to the spinal cord during mild hypothermia rather than the cpb strategies themselves . spinal cord perfusion can be further augmented by csf drainage and maintaining the mean arterial pressure above 80 mmhg . along with the optimization of the hemoglobin level , oxygen saturation and cardiac index are regarded important to prevent postoperative delayed paraplegia . in support of these previous reports , the present study also showed that the cpb strategy was not significantly related to early mortality , multi - organ failure , neurologic injury , and arf . although the rate of immediate postoperative lcos requiring mechanical support was higher in the dhca group ( table 2 ) , the cpb strategy did not affect long - term survival even in a univariate analysis ( table 3 ) . the independent predictors were age ( hr , 1.10 ; 95 % ci , 1.05 to 1.15 ; p 0.001 ) and lv ejection fraction ( hr , 0.88 ; 95 % ci , 0.82 to 0.96 ; p 0.003 ) , which are not factors adjustable by surgery . because of the retrospective nature of this studyhowever , considering the higher rates of lcos ( p = 0.041 ) in the dhca group , we recently changed our strategy to assertively insert an lv vent ( via lv apex ) when conducting dhca . despite the improvements in the operative outcomes of open surgical repair of dtaearly mortality rates following tevar are reported to be up to 7.4 % and 4 - year mortality after tevar for ruptured thoracic aneurysm has been estimated to be 25.4 % . for elective cases , tevar was associated with lower risks of early death and complications compared with open repair of dta . however , there are only a few studies that have compared long - term outcomes between tevar and open repair in dta . of note , makaroun et al . reported that tevar showed a comparable 5 - year survival rate ( 68 % versus 67 % , p - value = 0.433 ) with that of open surgery . nevertheless , the risk of vascular complications following tevar is reported to be substantial , and the 5 - year re - intervention rate was reported to be 3.6 % to 17 % . in this regard , overall clinical outcomes including intervention - related complications should be compared between tevar and open surgery in further large - scale studies in order to determine optimal candidates for each treatment option . this study is limited by a retrospective analysis that includes an inherent bias . non - randomized design may have affected the results because of unmeasured confounders , procedure bias , or detection bias , even with the use of rigorous statistical adjustment . further , this study represents the experience of a single large tertiary referral center and might not be generalized to other centers . the outcomes of open surgical repair of dta were feasible in terms of excellent perioperative mortality / morbidity as well as favorable long - term outcomes . age and lv function were independent predictors of long - term mortality , whereas the surgical strategies did not significantly affect the clinical outcomes . this study is limited by a retrospective analysis that includes an inherent bias . non - randomized design may have affected the results because of unmeasured confounders , procedure bias , or detection bias , even with the use of rigorous statistical adjustment . further , this study represents the experience of a single large tertiary referral center and might not be generalized to other centers . the outcomes of open surgical repair of dta were feasible in terms of excellent perioperative mortality / morbidity as well as favorable long - term outcomes . age and lv function were independent predictors of long - term mortality , whereas the surgical strategies did not significantly affect the clinical outcomes .\noutput:\n" }, { "from": "agent", "value": "backgroundto determine the predictors of clinical outcomes following surgical descending thoracic aortic ( dta ) repair.methodswe identified 103 patients ( 23 females ; mean age , 64.112.3 years ) who underwent dta replacement from 1999 to 2011 using either deep hypothermic circulatory arrest ( 44 % ) or partial cardiopulmonary bypass ( cpb , 56 % ) . resultsthe early mortality rate was 4.9 % ( n = 5 ) . early major complications occurred in 21 patients ( 20.3 % ) , which included newly required hemodialysis ( 9.7 % ) , low cardiac output syndrome ( 6.8 % ) , pneumonia ( 7.8 % ) , stroke ( 6.8 % ) , and multi - organ failure ( 3.9 % ) . none experienced paraplegia . during a median follow - up of 56.3 months ( inter - quartile range , 23.1 to 85.1 months ) , there were 17 late deaths and one aortic reoperation . overall survival at 5 and 10 years was 80.9 % 4.3 % and 71.7 % 5.9 % , respectively . reoperation - free survival at 5 and 10 years was 77.3 % 4.8 % and 70.2 % 5.8 % . multivariable analysis revealed that age ( hazard ratio [ hr ] , 1.10 ; 95 % confidence interval [ ci ] , 1.05 to 1.15 ; p < 0.001 ) and left ventricle ( lv ) function ( hr , 0.88 ; 95 % ci , 0.82 to 0.96 ; p < 0.003 ) were significant and independent predictors of long - term mortality . cpb strategy , however , was not significantly related to mortality ( p = 0.49 ) . conclusionsurgical dta repair was practicable in terms of acceptable perioperative mortality / morbidity as well as favorable long - term survival . age and lv function were risk factors for long - term mortality , irrespective of the cpb strategy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the world health organization ( who ) defined sexual health as the integration and coordination between mind , emotions , and body that drives the social and rational aspects of human toward personality development and leads to formation of communication and love . sexual issues are among the most important issues in martial life , and adaptation in sexual relationship is counted as the element that influences happiness . one of the current issues in the domain of sexual relationship is sexual self - esteem which is among the dimensions of general self - esteem . one of these factors is sexual self - esteem , which refers to individuals ' emotional reaction toward the evaluation of their own thoughts , emotions , and sexual behaviors . defined sexual self - esteem as the self - value that the individuals consider for themselves as a sexual person . sexual self - esteem plays a pivotal role in individuals ' ability to preserve close relationship with their spouses and enjoy having sex with them . oattes and offman concluded that general self - esteem and sexual self - esteem could predict more ability of making satisfactory sexual communication , and hierarchical regression showed that sexual self - esteem was a unique index for the quality of sexual relationship , and most of all , general self - esteem . zarbakhsh et al . also showed that sexual self - esteem and all its dimensions had a positive significant association with marital satisfaction among athletic women . zeanah and schwarz believed that individuals ' emotional reaction toward their mental evaluation forms the basis of sexual self - esteem and its five components . these components include skill and experience , the ability to enjoy with the sexual partner ; attractiveness , believing in self - beauty and attractiveness ; control , the ability to manage one 's thoughts , emotions , and sexual behavior ; ethical judgment , the ability to self - evaluate thoughts , emotions , and sexual behavior ; and finally , adaptability , the ability to adapt personal sexual behavior experiences with others ' personal goals . low sexual self - esteem leads to women 's concern about their sexual ability , underestimation of their personal rights in sexual relationship , and fighting against their sexual identity . shortage of research in this field is assumed to be associated with the new concept of sexual self - esteem and its exiting ambiguity . one of the effective factors in all fields of human life and social communications is individuals ' personality trait that directly influences partners ' communicational processes . personality is defined as the internal organization of affective , emotional , cognitive , and conceptual systems determining humans ' unique reactions toward the environment . this personality model categorizes the individuals ' traits into five categories of neuroticism , extroversion , openness , agreeableness , and conscientiousness . each individual can have specific attitude and desire toward different aspects of life based on their personality traits . neuroticism refers to the tendency to experience anxiety , tension , selfishness , hostility , impulsivity , shyness , irrational thinking , and depression . extroversion refers to the tendency to experience positive emotions , excitement seeking , kindness , and sociability . openness refers to the tendency to have curiosity , imagination , esthetics , wisdom , enlightenment , and innovation . agreeableness refers to the tendency to forgiveness , personality traits , and various dimensions of sexual and marital relationship . there are few studies on the association between personality dimensions and sexual self - esteem as an effective factor in sexual relationship . with regard to the role of sexual self - esteem in improvement of sexual relationship and more joyfulness , the importance of such an issuetherefore , the present study aimed to investigate the relationship between personality traits and sexual self - esteem in women referring to health care centers in mashhad . this is a correlation study that was conducted on 127 married women who referred to health care centers in mashhad in 2015 . the least sample size was calculated based on the sample selection formula of correlation studies and with respect to the findings of a primary pilot study conducted on 15 women . with consideration of confidence interval of 95 % and test power of 80 % , the highest sample size ( n = 120 ) was obtained as the final sample size . selection of the health care centers for sampling was done in sequential steps . in the first step , next , with regard to the number of urban health care centers covered by each mother health care center , 10 health care centers were selected through lotto draw and considered as a cluster . then , based on the number of clients referring to family planning unit , the related portion was determined . next , the researcher obtained the approval of ethics committee of mashhad university of medical sciences ( no : ir . rec .1392.801 ) and a written introduction letter from the nursing and midwifery school as well as the needed permissions from health care centers ' authorities . the researcher referred to these centers and selected the subjects from the women referring for flaming planning through convenient sampling . the goal of the study was explained to the subjects and written informed consents were obtained from them . inclusion criteria were having literacy of reading and writing , living at least 1 year with the spouse , and no polygamy . exclusion criteria were : subject or her spouse having sexual diseases , experiencing a mental crisis within 3 months prior to the study , history of mental disorders , and chronic diseases in the subject or her spouse . in the end , incompletely filled questionnaires were excluded . to collect data , a demographic characteristics questionnaire , neo personality questionnaire ( brief form ) , and zeanah and schwarz sexual self - esteem questionnaire were adopted . demographic characteristic form contained information of subjects , their spouses , and their family characteristics and marital life related information . neo personality questionnaire included 60 items ( 12 items for each personality major factor ) that measured extroversion , agreeableness , commitment , neuroticism , and openness . the items were scored by a five - point likert 's scale ( absolutely disagree = 0 , absolutely agree = 4 ) . this questionnaire has 81 items in a six - point likert 's scale ( absolutely agree = 6 , absolutely disagree = 1 ) . scores range between 81 and 481 and higher scores show higher sexual self - esteem . this questionnaire has five sub - scales of experience and skill ( 18 items ) , attractively ( 17 items ) , control ( 16 items ) , ethical judgment ( 15 items ) , and addictivenessconscientiousness was confirmed by rubinstein and strul by cronbach alphas of 0.88 , 0.85 , 0.70 , 0.84 , and 0.62 , respectively . in iran , its validity and reliability were confirmed by garousi et al . in the present study , reliability of its all sub - scales . reliability of sexual self - esteem questionnaire was confirmed by cronbach alpha over 0.85 by rubinstein and strul . in iran , its validity and reliability were confirmed by content validity and cronbach alpha over 0.70 . in the present study , description of subjects ' baseline characteristics was done by descriptive statistical tests . with regard to normal distribution of personality dimensions and sexual self - esteem variables , stepwise regression model was also adopted to investigate the role of each personality dimension in prediction of sexual self - esteem . this study was approved by the ethics committee of mashhad university of medical sciences and all ethical considerations including subjects ' volunteer participation and confidentiality of their data were respected . this study was approved by the ethics committee of mashhad university of medical sciences and all ethical considerations including subjects ' volunteer participation and confidentiality of their data were respected . subjects ' and their spouses ' mean ages were 27.44 ( 6.24 ) and 34.29 ( 28.54 ) years , respectively . subjects ' mean marriage length was 6.52 ( 5.31 ) years in the study group , and 40.9 % of the subjects had one child [ table 1 ] . mean scores of neuroticism , extroversion , openness , agreeableness , and conscientiousness of personality were 24.61 ( 6.52 ) , 29.44 ( 5.52 ) , 23.53 ( 4.66 ) , 28.67 ( 4.94 ) , and 32.39 ( 5.65 ) , respectively . mean score of women 's sexual self - esteem was 331.26 ( 49.25 ) out of its range ( 81481 ) . in addition , mean scores of skill and experience , attractiveness , control , ethical judgment , and addictiveness dimensions were 74.84 ( 10.41 ) , 66.05 ( 13.04 ) , 62.29 ( 12.25 ) , 65.34 ( 11.22 ) , and 62.72 ( 10.81 ) , respectively . pearson correlation coefficient used in investigation of the association between personality dimensions score and sexual self - esteem in all studied women showed an inverse significant association between neuroticism and sexual self - esteem and all its dimensions ( p 0.05 ) . there was a direct significant association between the dimensions of extroversion , agreeableness , and conscientiousness , and sexual self - esteem and its dimensions scores ( p 0.05 ) . there was no association between openness and sexual self - esteem ( p 0.05 ) . meanwhile , the association between this personality dimension , and the dimensions of attractiveness and sexual self - esteem control was significant ( p 0.05 ) [ table 2 ] . in order to predict the variance of women ' s sexual self - esteem based on personality dimensions , stepwise regression was adopted , which showed that agreeableness , neuroticism , and extroversion were capable of predicting 27 % of sexual self - esteem variance ( p = 0.001 ) [ table 3 ] . distribution of personal variables the correlation coefficients matrix for personality dimensions and sexual self - esteem and its components stepwise regression summary for prediction of sexual self - esteem according to personality dimensionsconcerning the dimensions of personality and sexual self - esteem , an inverse significant association was observed between scores of neuroticism , and women 's sexual self - esteem and all its dimensions . this personality trait includes sensitivity to having unreal beliefs , poor control of desires , and the tendency to experience psychological disorder in the form of anxiety , anger , depression , shyness , hatred , and a range of negative emotions . higher scores in neuroticism are accompanied by lack of emotional stability and negative emotions such as fear , sorrow , being at a loss , anger , feeling guilty , and hatred . such persons are more likely to have illogical beliefs and have less control on their desires and impulses . consequently , all these factors result in reduction of persons ' ability to enjoy having sex with their partners , inappropriate perception of their attractiveness , a reduction in management of sexual behaviors , incorrect evaluation of their thoughts and sexual behaviors , and consequently , a reduction in adaptability of their sexual experiences with others ' personal goal , which eventually lead to a reduction in sexual self - esteem . in this direction , costa et al . reported an inverse significant association between neuroticism dimension of personality , and women 's sexual knowledge level and body image . as body image is , in fact , the sub - scale of attractiveness in sexual self - esteem , costa 's results are consistent with the present study . in line with these findings , nouri et al . also reported an inverse significant association between the score of women 's neuroticism and their satisfaction with their body image . davis et al . also showed that the persons with higher scores of neuroticism are more concerned with their appearance . fisher and mcnulty , in a study on 72 newly married couples , concluded that neuroticism of the couple at the very beginning of marriage predicts less sexual and marital satisfaction in the coming year . reported an inverse significant association between personality dimension of neuroticism and marital satisfaction among male and female employees of governmental offices in ahwaz , iran . reported a significant association between sexual self - esteem and all its dimensions , and the score of marital satisfaction , which is in line with the present study . the association between extroversion , and sexual self - esteem and all its dimensions was positive and significant in the present study . john and srivastava explain that extroversion reflects the existence of an energetic approach toward monetary and social world in individuals that includes traits such as socialization , activeness , decisiveness , and dare . extroversion is associated with positive emotions such as good temper , optimism , love , and friendship . those who attain a high score in extroversion usually manifest their emotions and feelings conveniently and have less ability of avoidance . among those with lower extroversion , these persons have more tendency to keep away and be formal with others , even with their sexual partner . the significant association between extroversion dimension of personality and marital satisfaction was also reported in the study of attari et al . meanwhile , an insignificant association between this dimension of personality with two other dimensions of sexual relationship ( experience and sexual satisfaction ) was reported in the study of costa et al . menard and offman reported a significant association between sexual self - esteem and sexual satisfaction ; therefore , the results of costa are assumed to be inconsistent with the present study . nouri et al . also reported a significant association between extroversion and body satisfaction , which is in line with the results of the present study concerning the association between extroversion and attractiveness dimension of sexual self - esteem . previous studies show that women and men with high openness have more information about sexual relationships , have more sexual experiences , more sexual instinct , and a broader attitude toward sexual action and a wider sexual attitude , while openness was not significantly correlated with sexual self - esteem in the present study . consistent with the present study , the associations between openness and marital adaptation in the study of cook et al . and marital satisfaction in the study of ahadi et al . , mccrae reported a significant association between women 's high level of openness ( not men 's ) with their sexual satisfaction in married couples , possibly due to the fact that these women have a high tendency to discover new sexual experiences , which may lead to couple 's satisfaction . in addition , costa et al . reported that women with higher scores of openness have higher sexual knowledge and activity and a better body image . mccrae and costa believe that among the five basic factors of personality , openness is the most sophisticated one whose perception and detection are not easy . therefore , with regard to this sophistication , the existing ambiguity and controversy concerning the association between openness and sexual relationship dimension reveal the need for further studies to detect and perceive such associations . meanwhile , the association between openness and the dimensions of attractiveness and control of sexual self - esteem was significant , which is consistent with the significant association between openness and women 's body image , reported by nouri et al . the association between agreeableness and sexual self - esteem and its dimensions was significant in the present study . agreeableness reflects the appropriate and social approach versus hostility approach toward others that includes altruism , amiability , trust , and humility . persons with higher agreeableness can talk about their sexual needs and pleasures with each other . it results in a more positive mutual understanding between the couples , and consequently , a more sexual self - esteem to express sexual needs . nouri et al . also reported a significant association between agreeableness and satisfaction with body image , which is consistent with the present study . the association between conscientiousness and score of sexual self - esteem and its five dimensions was significant in the present study . nouri et al . also reported a significant association between conscientiousness and satisfaction with body that is in line with the present study . attari et al . also reported a positive and significant association between loyalty and marital satisfaction . reported no significant association between conscientiousness and sexual satisfaction , but between conscientiousness and body image in their study , possibly due to the fact that higher sexual self - esteem is more dependent on individuals ' personal and existence - related traits while sexual satisfaction is influenced by numerous factors . for instance , one of the effective factors is the partner 's sexual behavior and traits which reveals the fact that more important factors affect sexual satisfaction , compared to just personality traits . in addition to the observed associations between personality traits and sexual self - esteem , stepwise regression model showed that agreeableness , neuroticism , and extroversion were able to predict 27.3 % of sexual self - esteem variance . shakerian , in a study on prediction of marital adaptation based on personality dimensions , showed that neuroticism , openness , and conscientiousness were able to predict 26.7 % of marital adaptation score variance in the last step of stepwise regression . it shows that their ability in prediction of sexual self - esteem and marital adaptation is approximately similar . overall , the results showed an association between most of the personality traits and sexual self - esteem as well as the capability of these dimensions in prediction of women 's sexual self - esteem . as sexual self - esteem is one of the most important factors in couples ' sexual relationship and martial life satisfaction , adaptation of neo personality before marriage counseling for those who have no previous sexual problems can help the counselors to detect high - risk women or those with low sexual self - esteem and suggest them appropriate strategies . despite our obtained results , this study had limitations including the subjects ' reluctance to complete sexual self - esteem questionnaire with respect to iranian cultural background . among the strong points ofthe present study is high capability of generalization of the findings with regard to sampling from the general population of married women who can be proper representatives of the women at fertility age . as most of the studies have investigated a specific class of society , for instance , the students or employees of a specific organization , further studies on other races and in other provinces of iran with regard to their local culture are suggested .\noutput:\n" }, { "from": "agent", "value": "background : women 's sexual self - esteem is one of the most important factors that affect women 's sexual satisfaction and their sexual anxiety . various aspects of sexual life are blended with the entire personality . determining the relationship between personality traits and self - concept aspects such as sexual self - esteem leads to better understanding of sexual behavior in people with different personality traits and helps in identifying the psychological variables affecting their sexual performance . the aim this study was to determine the relationship between personality traits and sexual self - esteem.materials and methods : this correlation study was performed on 127 married women who referred to selected health care centers of mashhad in 20142015 . data collection tools included neo personality inventory dimensions and zeanah and schwarz sexual self - esteem questionnaire . data were analyzed through pearson correlation coefficient test and stepwise regression model.results : the results of pearson correlation test showed a significant relationship between neuroticism personality dimension ( r = 0.414 ) , extroversion ( r = 0.363 ) , agreeableness ( r = 0.420 ) , and conscientiousness ( r = 0.364 ) with sexual self - esteem ( p < 0.05 ) . the relationship between openness with sexual self - esteem was not significant ( p > 0.05 ) . in addition , based on the results of the stepwise regression model , three dimensions of agreeableness , neuroticism , and extraversion could predict 27 % of the women 's sexual self - esteem variance.conclusions : the results showed a correlation between women 's personality characteristics and their sexual self - esteem . paying attention to personality characteristics may be important to identify at - risk group or the women having low sexual self - esteem in premarital and family counseling ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: simple hepatic cysts is a frequent finding and occur in approximately 2.5 % of the population .1 they are usually benign , asymptomatic and require no treatment .2 although usually asymptomatic they may cause symptoms due to local compression , such as : abdominal discomfort or pain , dyspnoea , early satiety , swelling of the lower limbs due to caval compression , portal hypertension or jaundice .1 this report describes the occurrence of atrial arrhythmia due to right atrial compression by a simple hepatic cyst in a 71 - year old man . a case report is presented where it is postulated that a simple hepatic cyst , located just beneath the right atrium is responsible for symptomatic palpitations due to frequent atrial premature beats , induced by slight right atrial compression . a 71 - year old , caucasian male presented with the clinical problem of symptomatic palpitations for a period of two years . he was not using any medication , never smoked , and never had any previous surgery . the electrocardiogram was normal , however holter monitoring revealed frequent atrial premature beats ( see fig . 1 and 2 ) . the transthoracic echocardiogram did not reveal any pathological findings , however the subcostal view demonstrated a large , simple hepatic cyst , measuring 4.49 cm in diameter with occasional slight compression of the right atrium ( see fig . 3 , 4 and 5 ) . the patient did not have any obstructive respiratory disease , a common cause of atrial premature beats . true hepatic cysts can be classified as parasitic or non - parasitic .3 the former is almost exclusively the result of hydatidosis3 , caused by the cestode echinococcus4 . echinococcus is classified into two species : e. granulosis , the most common which causes chronic disease and e. multilocularis , which causes a more progressive and multifocal infection .4 the liver is the main site of infection with the right lobe most frequently affected .4 non - parasitic cysts are the result of congenital anomalies which affect the intra - and extrahepatic biliary ducts , leading to varying degrees of cystic dilatations .3 these may be solitary or polycystic . 1 according to henson et al1 non - parasitic and non - congenital cysts may be classified as neoplastic , inflammatory and traumatic cysts . although usually asymptomatic , hepatic cysts may cause clinical symptoms due to local compression , such as abdominal discomfort or pain , dyspnoea , early satiety , swelling of the lower limbs due to caval compression , portal hypertension or jaundice .1 liver function enzymes will only be abnormal if biliary compression is present3 and cyst infection may occur if a communication is present between the biliary tree and the cyst .3,5 these cysts may also cause extrinsic gastric compression and mimic the symptoms and endoscopic findings of gastric submucosal tumors .6,7 a case of extrinsic duodenal compression with obstruction due to a hepatic cyst have also been described .8 in this case report a subcapsular , simple hepatic cyst is shown in the left lobe of the liver . other case reports have shown cysts such as this to lead to gastric compression , mimicking the endoscopical appearance of submucosal tumors and duodenal compression , leading to intestinal obstruction . figures 3 , 4 and 5 clearly show that the cyst is causing slight right atrial compression . thus , a new complication of simple hepatic cysts is proposed atrial premature beats due to right atrial compression .\noutput:\n" }, { "from": "agent", "value": "simple hepatic cysts are a relatively common radiological finding . these cysts may be classified as parasitic and non - parasitic . they are usually asymptomatic , but may cause symptoms due to local compression . these compressive complications include : portal hypertension , edema due to caval compression , extrinsic gastric compression and duodenal compression with obstruction.however , no reports in the literature exist describing atrial compression by hepatic cysts.in this case report a simple hepatic cyst causing slight right atrial compression is described . this slight compression is the cause of atrial premature beats.it is proposed that simple hepatic cysts may be the cause of atrial premature beats ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: lipid rafts are specialized cholesterol and glycosphingolipid - rich membrane microdomains thought to be abundant on most eukaryotic cell surfaces . the concept came into light during the study of epithelial cell polarity , where the apical surface was found to be enriched with glycosphigolipids ( 1 ) . the physicochemical properties of lipid rafts resemble densely packed liquid order phase , which is distinct from the loosely packed liquid disorder phase exhibited by the rest of the plasma membrane ( 2 ) . morphologically , these microdomains can be classified as planar rafts or flask - shaped invaginations called caveolae . the results from in vivo studies on lipid rafts indicate the existence of lateral membrane heterogeneity which eventually led to a notion that these are fluctuating nanoscale assemblies . these structures can be stabilized to form specialized platforms that coordinate diverse biological processes ( 3 ) . many different roles for these membrane platforms have emerged over the years ( 3 ) . the most widely studied function of rafts is to provide a distinct environment for signalling molecules and receptors and therefore regulate downstream pathways ( 4 ) . one potential mechanism for such modulation is the coalescing of lipid raft microdomains , bringing into proximity a new repertoire of protein protein and protein lipid interactions ( 5 ) . moreover , small changes in protein composition of lipid raft could lead to initialization and / or amplification of signalling cascades . for example , observations from cell signalling studies suggested that raft association is critical for receptors and many signalling molecules to perform their function ( 6,7 ) . the presence of several protein transporters as well as drug efflux proteins in lipid raft highlighted roles for lipid rafts in the transport of substrates , and exogenous compounds both in and out of the cell ( 812 ) . likewise , different pathogens , including viruses and bacteria , use membrane lipid raft as a portal to enter the host cell ( 1315 ) . growing evidence indicates that lipid rafts can act as sorting platforms involved in targeted membrane trafficking of various proteins . the presence of raft - like membranes on secreted extracellular vesicles , such as exosomes , indicate the involvement of rafts in sorting and release of exosomes from cell surface ( 16 ) . moreover , clathrin - independent endocytic pathways are thought to be regulated by caveolae and non - caveolar lipid raft carriers ( 17 ) . alterations in lipid rafts have been reported in many disorders ( 18 ) . due to their apparent importance as a signalling and sorting platform , membrane lipid rafts have been studied in several tumours , including prostate ( 1921 ) , breast ( 22,23 ) , lung ( 24 ) and colon cancer ( 25,26 ) . likewise , these specialized membrane domains are also implicated in pathological conditions , such as alzheimer 's ( 27 ) , parkinson 's ( 28 ) , cardiovascular disorders ( 29 ) and hiv , etc . , rafts are proposed to be a therapeutic target to cure or prevent these disorders . lipid rafts are perhaps the best - studied and thus most well - understood membrane microdomains , although our understanding of them is still far from complete . protein components in those domains would have a marked impact on their structure , activities and interactions . identification , characterization and quantitation of all or most of the proteins would therefore be critical in understanding functional organization of this complex biological system . due to their biological importance , involvement in disease pathologies , and supposed ease of purification , lipid rafts have been a very popular target for proteomics studies ( 32 ) . numerous lipid raft proteomics studies have been published in the past decade with a continuing upwards trend as shown in figure 1 . these studies were performed on a variety of cell / tissue types , and utilized different biochemical extraction methods to enrich membrane raft fraction ( 33 ) . therefore , the new challenge is a bioinformatic tool to collate and integrate the wealth of published lipid raft proteomics data . here we present , for the first time , a dedicated online resource raftprot comprising of comprehensive collection of searchable lipid raft proteomics studies for researchers . the data set was obtained by searching the following terms in pubmed and google scholar : lipid raft , microdomains and detergent - resistant membrane . only studies focused on mammalian lipid raft proteomes were chosen for further analysis . the proteins were then mapped to standard uniprotkb accessions , using uniprot i d mapping tool and customized scripts . we also kept the original annotation intact , so that user can always trace back the protein annotation from original article . various quantitative experiments attempted to explore time - dependent and post - translational changes in lipid raft proteome . consequently , some studies explored dynamics compartmentalization of proteins into different subcellular organelles in response to external stimulus . from those studies only information about lipid raft fractionalthough we have performed an extensive search to extract as many lipid raft proteomic studies as possible , some relevant studies may still have been left out unintentionally . therefore , we encourage researchers to submit their lipid raft proteomics data along with all related information . the schematic representation of raftprot architectureall the data were stored in a relational database schema in mysql server 5.1.73 ( http://www.mysql.com ) . graphical output of summary statistics of the database was implicated with the help of google visualization api . but in addition , we also envisage raftprot to serve as a data source for other data analysis / mining systems . we have implemented restful like web - service approach for the transfer of data in javascript object notation format . this separation of data from presentation allows the potential for other data analysis / mining systems to pull data dynamically from raftprot . furthermore , this approach also allows raftprot to be easily extended with addition data post - processing functionalities . organization of data into different phenotypic categories , such as cell , tissue or organ , is one of the challenges for today 's databases . one way of tackling this problem is allowing computers to logically manage that information by integrating biological ontologies ( 34 ) . ontologies specify how data , terminology , concepts and ideas all relate to each other in the system of interest . as the lipid raft proteomics studies have little overlap in specific cell type used , we wish to enable search for all experiments that used related cell types in order to derive a , we developed a placental mammalian cell ontology ( pmclo ) which classifies cell lines from placental mammals based on cell - type , tissue and organs . this ontology is represented in standard open biological ontology ( obo ) format ( familiar to users of the gene ontology ) which was visualized and edited using obo - edit ( 35 ) . searching or browsing by several available parameters including organism , cell / tissue type , lipid raft preparation method and treatment conditions , such as cholesterol depletion . an advanced search function is offered to search multiple fields at the same time . outputs are visualized on the web interface , and can be downloaded in comma separated or pdf format . comparison across experiments is available for the list of proteins in result output by accessing thesearch . most of the databases offer searching against single cell line or experiments at a time . but with the integration of pmclo to raftprot , users can search for tissue - or organ - specific lipid raft proteome . the use of ontology permits the user to access all the cell lines associated with particular tissue or organ for which lipid raft proteomics data is available . furthermore , we provide an option of category search of proteins and experiments identified from primary cells , perpetual cell lines and cancer - associated cell lines . currently raftprot comprises 27773 entries from 117 proteomics experiments reported in 81 scientific publications . we are able to assign uniprot accession to 7959 proteins ( 75 % of total proteins ) . the data sets were generated from 69 different cell / tissue / organs belonging to six mammalian species . among themt - cells , melanoma cells , fibroblasts , macrophages and brain tissues are the most common . most of the studies were focused on human cell lines and / or tissues ( figure 3 ) . detergent - resistant membrane was the most popular method for lipid raft preparation , used in 80 % experiments . lipid raft isolation based on biochemical / biophysical properties may lead to co - isolation of contaminant , non - lipid raft proteins . test for lipid raft presence ( 32,33 ) , however , only five experiments used this treatment . therefore , we also consider that co - isolated contaminant proteins are likely to be specific to each biochemical isolation method , and used identification by more than one biochemical method as a second criteria for inclusion in the high confidence lipid raft protein list . proteins that fulfill either criteria were added to the high confidence list of 2185 proteins ( 27.5 % of total 7959 proteins of the database ) . the data set was obtained by searching the following terms in pubmed and google scholar : lipid raft , microdomains and detergent - resistant membrane . only studies focused on mammalian lipid raft proteomes were chosen for further analysis . the proteins were then mapped to standard uniprotkb accessions , using uniprot i d mapping tool and customized scripts . we also kept the original annotation intact , so that user can always trace back the protein annotation from original article . various quantitative experiments attempted to explore time - dependent and post - translational changes in lipid raft proteome . consequently , some studies explored dynamics compartmentalization of proteins into different subcellular organelles in response to external stimulus . from those studies only information about lipid raft fractionalthough we have performed an extensive search to extract as many lipid raft proteomic studies as possible , some relevant studies may still have been left out unintentionally . therefore , we encourage researchers to submit their lipid raft proteomics data along with all related information . all the data were stored in a relational database schema in mysql server 5.1.73 ( http://www.mysql.com ) . graphical output of summary statistics of the database was implicated with the help of google visualization api . but in addition , we also envisage raftprot to serve as a data source for other data analysis / mining systems . we have implemented restful like web - service approach for the transfer of data in javascript object notation format . this separation of data from presentation allows the potential for other data analysis / mining systems to pull data dynamically from raftprot . furthermore , this approach also allows raftprot to be easily extended with addition data post - processing functionalities . organization of data into different phenotypic categories , such as cell , tissue or organ , is one of the challenges for today 's databases . one way of tackling this problem is allowing computers to logically manage that information by integrating biological ontologies ( 34 ) . ontologies specify how data , terminology , concepts and ideas all relate to each other in the system of interest . as the lipid raft proteomics studies have little overlap in specific cell type used , we wish to enable search for all experiments that used related cell types in order to derive a , we developed a placental mammalian cell ontology ( pmclo ) which classifies cell lines from placental mammals based on cell - type , tissue and organs . this ontology is represented in standard open biological ontology ( obo ) format ( familiar to users of the gene ontology ) which was visualized and edited using obo - edit ( 35 ) . raftprot can be explored through the web interface using search or browse options . proteomics experiments , and their corresponding protein lists , can be retrieved by searching orbrowsing by several available parameters including organism , cell / tissue type , lipid raft preparation method and treatment conditions , such as cholesterol depletion . an advanced search function is offered to search multiple fields at the same time . outputs are visualized on the web interface , and can be downloaded in comma separated or pdf format . comparison across experiments is available for the list of proteins in result output by accessing the analyse option followingsearch . most of the databases offer searching against single cell line or experiments at a time . but with the integration of pmclo to raftprot , users can search for tissue - or organ - specific lipid raft proteome . the use of ontology permits the user to access all the cell lines associated with particular tissue or organ for which lipid raft proteomics data is available . furthermore , we provide an option of category search of proteins and experiments identified from primary cells , perpetual cell lines and cancer - associated cell lines . currently raftprot comprises 27773 entries from 117 proteomics experiments reported in 81 scientific publications . we are able to assign uniprot accession to 7959 proteins ( 75 % of total proteins ) . the data sets were generated from 69 different cell / tissue / organs belonging to six mammalian species . among themt - cells , melanoma cells , fibroblasts , macrophages and brain tissues are the most common . most of the studies were focused on human cell lines and / or tissues ( figure 3 ) . detergent - resistant membrane was the most popular method for lipid raft preparation , used in 80 % experiments . lipid raft isolation based on biochemical / biophysical properties may lead to co - isolation of contaminant , non - lipid raft proteins . test for lipid raft presence ( 32,33 ) , however , only five experiments used this treatment . therefore , we also consider that co - isolated contaminant proteins are likely to be specific to each biochemical isolation method , and used identification by more than one biochemical method as a second criteria for inclusion in the high confidence lipid raft protein list . proteins that fulfill either criteria were added to the high confidence list of 2185 proteins ( 27.5 % of total 7959 proteins of the database ) . cholesterol - rich membrane rafts regulate a myriad of cellular functions associated with health and disease . raftprot is a unique resource providing the means to systematically analyse existing lipid raft proteomics data sets in an informed manner . critical experimental information is captured in a searchable format . combined with the use of a novel cell ontology , this user - friendly portal will enable biologists to distil useful lipid raft proteomics data from the potentially bewildering public data sets . currently , there are limited number of studies for most cell types , specific treatments and preparation methods . with continued input from the research community to raftprot , we will be able to increase our knowledge of the proteomic constituents and dynamic re - arrangement of mammalian lipid rafts . australian research council [ ft120100251 to m.m.h . ] . international postgraduate research scholarship [ to a.s . ] . national breast cancer foundation [ ecf - 14 - 043 to m.j.d . ] .\noutput:\n" }, { "from": "agent", "value": "raftprot ( http://lipid-raft-database.di.uq.edu.au/ ) is a database of mammalian lipid raft - associated proteins as reported in high - throughput mass spectrometry studies . lipid rafts are specialized membrane microdomains enriched in cholesterol and sphingolipids thought to act as dynamic signalling and sorting platforms . given their fundamental roles in cellular regulation , there is a plethora of information on the size , composition and regulation of these membrane microdomains , including a large number of proteomics studies . to facilitate the mining and analysis of published lipid raft proteomics studies , we have developed a searchable database raftprot . in addition to browsing the studies , performing basic queries by protein and gene names , searching experiments by cell , tissue and organisms ; we have implemented several advanced features to facilitate data mining . to address the issue of potential bias due to biochemical preparation procedures used , we have captured the lipid raft preparation methods and implemented advanced search option for methodology and sample treatment conditions , such as cholesterol depletion . furthermore , we have identified a list of high confidence proteins , and enabled searching only from this list of likely bona fide lipid raft proteins . given the apparent biological importance of lipid raft and their associated proteins , this database would constitute a key resource for the scientific community ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: despite the importance of sexual expression to the vast majority of people , it has been reported that some women are not particularly bothered by even substantial physiological perturbations in their sexual function . this lack of bother may be secondary to : a lack of interest in sexuality ; adaptation in sexual practices / expectations to compensate for perceived or real sexual dysfunctions / limitations / preferences ; or other factors . distress is a key component in the diagnosis of clinically relevant sexual problems according to the american psychiatric association . a condition that influences sexual functionality can not be construed as a problem in need of clinical intervention if the individual is not experiencing emotional , mental , or relationship bother referable to the condition . hence , desire for change is an important factor in determining the scope of a sexual or other health problem . a number of validated scales have been developed to quantify and measure sexual function in women for research purposes . most widely utilized among these is the female sexual function index ( fsfi ) , a 19 item validated questionnaire for the assessment of six domains of female sexual function ( desire , arousal , lubrication , orgasm , satisfaction , and pain ) . the fsfi has been shown to help identify women at risk for sexual dysfunction ; however , it does not explicitly assess the more nebulous but clinically important concept of sexual distress / bother . complementary scales such as the female sexual distress scale ( fsds ) and the index of sexual life ( isl ) have been developed to directly assess subjective bother from sexual problems . there is evidence that the fsfi captures data that are distinct but related to findings from instruments such as the isl and fsds ; ergo , there is a rationale for multidimensional assessment of sexuality using a variety of instruments and measures . since the 1960s there has been little attention to sexual life satisfaction and sexual practices in this north american medical students . medical students are generally a young , highly educated , and healthy population of individuals ; as sexual problems are negatively associated with these demographic characteristics it might be assumed that the prevalence of physiological sexual problems in medical students would be low . however , recent publications on sexuality in north american medical students have suggested a high prevalence of sexual concerns in these individuals relative to normative population data . sexual problems in medical students are of interest as a quality of life measure for the individual student but may also have ramifications for how students address sexuality in the clinical context . furthermore , there is some evidence that female medical students may experience sexual problems more frequently than their male peers . our group recently completed an analysis of sexuality and sexual practice in north american medical students . in this sub - set analysis , we investigate subjective assessment of desire for change in sexual life ( henceforth referred to as sexual bother as shorthand ) and its relationship to ethnodemographic factors and scores on validated instruments for the assessment of sexual function . we hypothesized that personal and relationship variables , evidence of depression and / or anxiety on validated psychometric questionnaires , and lower scores on validated instruments for the assessment of human sexuality would predict sexual bother . however , we also hypothesized that some individuals with relatively poor scores on validated instruments would not endorse bother related to their sexual functionality and that other individuals with high functionality scores might still endorse sexual dissatisfaction . medical students in north america were invited to participate in an internet - based survey . invitations were extended via postings on the american medical student association ( amsa ) list - serves , the student - doctor network ( www.studentdoctor.net ) , and a news story posted at medscape ( www.medscape.com/viewarticle/574229 ) . the survey was posted at questionpro.com and was available from february 22 , 2008 until july 31 , 2008 . approval for this study was granted by the committee for human research ( chr ) at our institution . implied consent was assumed by subject participation in , and completion of , the survey instrument . our chr deemed this methodology for consent as adequate and compliant with relevant ethical and legal standards . only one response per ip address was permitted so as to limit the potential for repeated submissions by a single individual . the primary outcome measure was a single item question : which of the following statements best summarizes your feelings about your sexual function at this time ? i am satisfied with my sexual function and would not change anything , 2 ) i am mostly satisfied with my sexual function but there are things i would like to change ,3 ) i am dissatisfied with my sexual function but i do nt want to change anything at this time , 4 ) i am dissatisfied with my sexual function and there are things i would like to change , 5 ) i have a sexual problem or dysfunction and would like to do something about it , and 6 ) subjects who selected response 4 or 5 ( endorsing a problem and desire for change ) were considered to have sexual bother on subsequent analyses . subjects who had not engaged in partnered sexual activity were not included in subsequent analyses . the survey also consisted of a questionnaire that assessed age , ethnicity , relationship status , maternity , medical school location , year in medical school , and several other demographic characteristics . a sexuality survey was appended which assessed variables such as sexual orientation , age at first partnered sexual activity ( if any ) , number of lifetime sexual partners , recent ( past 6 months ) sexual partners and past participation ( yes / no ) in specific sexual activities ( masturbation , oral sex [ giving and receiving ] , vaginal sex , anal sex [ insertive and receptive ] , bondage / restraint [ giving and receiving ] , sexual sadism , and sexual masochism ) . to assess psychological morbidity in the study population , subjects completed the center for epidemiological studies depression scale ( ces - d ) , a 20 item instrument designed to assess presence and severity of depressive symptoms . a score of 16 or greater on the ces - d was taken as evidence of significant depressive symptoms . a total score of 26.55 or less on the fsfi ( score range 236 ) has been utilized as a cut - off value for high risk of female sexual dysfunction ( hrfsd ) . in this validation studythe cut - off of 26.55 correctly classified 88 % of the sexually functional women and 70 % of the sexually dysfunctional women and was the optimal cut - point per their analyses . subjects who were in relationships were asked to complete the index of sex life ( isl ) , an 11 item validated instrument for the assessment of three domains including sexual drive , sexual life satisfaction , and general life satisfaction in women . the isl also assesses disruption of sexual life from stress , tiredness , disease , and gynecological problems . the isl was initially developed to assess sexual life and response to treatment in women whose partners had ed ; however , the specific questions pertain to sexual and emotional variables relevant to her relationship with her partner and were therefore deemed of interest for this research . the sexuality specific instruments were developed and validated for use in subjects engaging in heterosexual coitus within the past 4 weeks . subtle modifications to instructions and wording were made so as to maximize their applicability to subjects whose primary means of sexual expression is not heterosexual coitus ( i.e. subjects in same sex relationships as well as heterosexual / bisexual subjects who engage in non - coital partnered sexual activity ) . these changes consisted primarily of 1 ) removing gender specific terms for the subject s partner and replacing them with gender neutral pronouns / nouns and 2 ) expanding the scope of what constitutes sexual intercourse as vaginal intercourse and / or stimulation of the genitalia with hands or mouth in the intent of producing orgasm ( not as part of foreplay ) for the fsfi . a version of the fsfi similar to ours has been previously validated for use in lesbian women ; we therefore deemed this instrument most appropriate for conducting a study in women of diverse sexual orientations . independent samples t - test and anova were used to assess differences for continuous variables , while chi squared tests were used for categorical variables . levene s test for unequal variance was used to ascertain differences in variance between comparison groups . the unequal variance t - test was used when variance was found to be unequal between groups . we report odds ratios ( ors ) and their 95 % confidence intervals to estimate the association between subject characteristics and sexual distress . multivariable logistic regression models for sexual bother were developed with a - priori selected predictor variables including gender , race , year in school , ethnicity , marital status , sexual orientation , sexual frequency , number of sexual partners in the last 6 months , and hrfsd . a second multivariable analysis was conducted examining individual domain scores for the fsfi and isl ; this was intended to ascertain which specifics aspects of sexual function were most clearly associated with odds of sexual bother in this population . for these domain specific analyses , we selected a change of of a standard deviation from the mean for each domain as a clinically significant unit of change for bivariable and multivariable analysis . subjects who had not ever had partnered sexual activity ( virgins ) , had not had sexual activity within the past 4 weeks , and / or those that did not have complete data for all of the above were excluded from all analyses . stata 10 ( statacorp , college station , tx , usa ) was used for all analysis . there were a total of 661 non - virgin female respondents who provided a valid response to the primary outcome measure question ; all of these had been with a sexual partner within the prior 6 months . response to the primary outcome variable is presented in table 1 ; 173 ( 26 % ) women reported sexual bother and 281 ( 43 % ) reported hrfsd per fsfi results . sexual bother was more prevalent in women with depressive symptoms , a single partner in the past 6 months , lower sexual frequency , hrfsd , and interference in sexual life from tiredness or stress ( p 0.001 for all ) . mean score for the individual domains of both the fsfi and isl , stratified by sexual bother , are presented in table 2 . all mean fsfi and isl domain scores were significantly lower in women who reported sexual bother ( p 0.001 ) . on bivariable analysis , depressive symptoms and interference in sexual life from tiredness and / or stress were associated with significantly increased odds of sexual bother . hrfsd was associated with markedly increased odds of sexual bother ( or 24.74 , 95 % ci 14.5841.97 , table 3 ) . there was a trend towards greater odds of sexual bother in third year students and bisexual women but these were not statistically significant . asian race , having 2 or more partners in the past 6 months , and sexual frequency 6 times per month were associated with decreased odds of sexual bother . higher scores for the fsfi desire , orgasm , and satisfaction domains were associated with lower odds of sexual bother ( p 0.001 , 0.01 , and 0.001 , respectively ) . none of the sexual practices surveyed were associated with significant differences in prevalence of sexual bother . after multivariable adjustment , hrfsd , bisexual orientation , and interference in sexual life from stress were significantly associated with greater odds of sexual bother ( table 4 ) . asian race and sexual frequency of 11 or more times per month were associated with lower odds of sexual bother in this analysis . our second multivariable analysis of the association between individual fsfi / isl domains and sexual bother is presented in table 5 . higher score on the desire , orgasm , and satisfaction domains remained associated with lower odds of sexual bother ( table 5a ) after adjustment . these relationships held after inclusion of the isl interference in sexual life questions ( table 5b ) . after inclusion of the isl sub - domains , only the fsfi desire and satisfaction domains remained significantly associated with odds of sexual bother ( table 5c ) . interestingly , higher ( i.e. better ) scores on the isl sexual life satisfaction domain were associated with lower odds of sexual bother but higher general life satisfaction scores were associated with greater odds of sexual bother . this was a reversal from the bivariable analysis , in which lower general life satisfaction was associated with greater odds of sexual bother . the sexual drive domain of the isl did not show a relationship with sexual bother , in distinction with what was observed with the fsfi - desire domain . in this study of female medical students , nearly a quarter reported a desire for change in their sexual lives . this one quarter figure is similar to what has been reported ( 2427 % ) in other series of women in the general population . the rate of women at risk for sexual dysfunction in our study ( 43 % ) is also similar to prior results . it is clear from these data and our own that there is an important distinction and difference in prevalence between sexual dysfunction ( perturbation in some aspect ( s ) of sexual response ) and sexual bother / desire for change . in the prevalence of female sexual problems associated with distress and determinants of treatment seeking ( preside ) study , women aged 2029 ( the cohort most similar to our own ) had an 8 % prevalence of sexual problems associated with distress ; problems of desire , arousal , and orgasmic function occurred in 6 % , 4 % , and 3 % of this population , respectively . in preside sexual problemswere diagnosed in women who answered rarely or never to questions pertaining to sexual desire , arousal , and orgasm that were derived from the changes in sexual function questionnaire ; sexually related distress was diagnosed based on a score of 15 or greater on the fsds . it is interesting that the prevalence of both sexual problems and sexual distress in our study of mostly young women was similar to what has been reported for women in general ( including much older women ) from the preside study and others . this suggests that the burden of sexual problems in young medical students is similar to what is observed in older women . however , a direct comparison between data from the current study and those from the preside study is not possible given the highly select sample studied here . bancroft et al . have previously reported that emotional well - being and relationship to the partner are stronger predictors of sexual distress in women than measures such as arousal , lubrication , and orgasmic function . in the youngest age cohort ( twenties from bancroft s study , impaired physical responsewas associated with relationship distress but not with the woman s sense of her own sexuality . one might speculate that it is problems in the relationship and / or poor communication about sexual desires that cause much sexual distress in this group . our data do not dispute this finding but it is clear that other factors ( desire and orgasmic function ) are also important determinants of sexual satisfaction for young women . perturbations of sexual desire have been reported as the most common sexual concern in women 1829 , the age group most similar to our population . it is clear from our data that there are important differences between the isl - sex drive ( derived from response to questions on frequency of wish for sex and attempts at sexual activity ) and the fsfi - desire ( derived from questions on how often desire was felt and self - rating of personal sexual desire ) domains . of greater interest , however , is the reversal of the negative association between sexual bother and isl general life satisfaction domain after multivariable adjustment . there is no easy explanation for this finding and the possibility of type 1 error exists . however , in the validation study of the isl it was found that the general life satisfaction domain did not correlate with the other two isl domains . furthermore , sexual problems / bother do not always associate with treatment seeking behavior nor with personal distress , particularly in women . it is obvious that the relationship between sexual satisfaction and general life satisfaction is not a simple direct association in women . it is intriguing that women with 2 or more partners in the preceding 6 months from our study had lower odds of sexual bother . we speculate that these women may have more sexually liberal beliefs and therefore may be less conflicted / distressed by sexuality . alternatively , some of these participants might be women who had recently started a new relationship or were not in a relationship ; either of these states might lead to lower odds of sexual bother related to ahoneymoon phase or a lack of stress related to maintaining a serious sexual relationship during medical training , respectively . our findings with respect to lower prevalence of sexual bother in asian subjects and higher prevalence in bisexual subjects are interesting . in a population of women seeking care at a military medical facility , nusbaum et al reported that women of asian descent were less likely than caucasian women to report sexual dissatisfaction on a broad number of sexuality issues or a high number of sexual concerns ; however , higher levels of education were associated with greater odds of sexual concern in asian women from this study . mental and physical problems are more frequently endorsed by bisexual women compared to their lesbian counterparts and our data suggest that this might well extend to sexual problems as well . limitations of this study include a lack of subject interview data ; in the absence of formalized evaluation and explanation of the survey instruments themselves it is difficult to be certain how subjects may have interpreted certain questions . our single item question to classify sexual bother status was not validated ; this may limit the conclusions that can be derived from our dataset . we chose to make a number of response options to the bother question available to our subjects but collapsed bother responses into two categories for analysis ; our intent was to simplify the analysis and reduce the likelihood of type i error from numerous comparisons . our version of the fsfi was subtly different from the previously validated versions of the fsfi used in heterosexual women and in lesbian women ; this was deemed necessary so as to capture uniform data from a diverse population but may compromise internal validity to some extent . . furthermore , medical students who participate in an uncompensated internet based sexuality survey may not be representative of the general population of medical students ; some may provide spurious and / or inaccurate data . despite these shortcomings , our data are of value in its broad quantitative and qualitative assessment of a variety of sexuality related issues in a population that has not been the focus of thorough investigation on sexual distress / bother . sexual function is obviously of importance to many of the subjects of this study . in a female medical student with sexual concerns , the nature of the sexual problem and the preferable means to remediate them ( education , facilitation of communication in intimate relationships , time management , medical assessment / treatment , etc . ) will be dependent on highly individual factors for each woman . the psychological and temporal rigors of medical school suggest that time and stress management are likely to be key factors in addressing sexual concerns for many women in this population . low score on the fsfi is fairly specific for the determination of sexual bother in this population . sexual bother in young female students may be related to sexual dysfunctions ( most likely issues of desires or orgasm ) or other issues . given the variety of factors associated with sexual bother in these women , a holistic approach to the assessment of sexual function is important to optimize outcomes .\noutput:\n" }, { "from": "agent", "value": "we analyzed associations of dissatisfaction with sexual life and desire for change in female medical students . students enrolled in medical schools in north america between february and july 2008 were invited to participate in an internet based survey of sexual function . the principle outcome measure was a single item question on sexual life satisfaction and desire for change . women who reported dissatisfaction and desire for change were classified as sexually bothered . the survey also assessed ethnodemographic factors , student status , sexual history , and depressive symptoms . respondents completed the female sexual function index ( fsfi ) and the index of sex life ( isl ) . descriptive statistics , anova , and multivariable logistic regression were utilized to analyze responses . there were 661 non - virgin female subjects with data adequate for analysis . whereas 281 ( 43 % ) of these met criteria for high risk of female sexual dysfunction ( hrfsd ) based on fsfi scoring , just 173 ( 26 % ) reported sexual bother . among women with hrfsd , 126 ( 45 % ) reported sexual bother ; in women without hrfsd , 362 ( 95 % ) were not sexually bothered . interference in sexual life from tiredness and stress were associated with sexual bother . progressively better scores on the fsfi - desire , orgasm , and satisfaction domains were significantly associated with lower odds of sexual bother . few women in this cohort with fsfi score > 26.55 reported sexual bother . women with fsfi less than 26.55 had greater odds of sexual bother but this criterion alone was not pathognomonic for sexual concerns . issues of sexual desire and orgasm appear to play a more important role than lubrication , arousal , and sexual pain issues in this population ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: campomelic dysplasia ( cd ; omim # 114290 ) is a sporadic autosomal dominant disorder that results in skeletal and developmental abnormalities ( 1 , 2 ) . its reported incidence is about 0.05 - 0.09 per 10,000 live births ( 3 ) . spranger and maroteaux et al . ( 4 ) first described it fully and originally in 1971 . cd is a frequently lethal skeletal dysplasia syndrome whose hallmark features include angular bowing and shortening of the long bones with pretibial skin dimpling , hypoplastic scapulae , missing pairs of ribs , a narrow thorax , and bilateral club feet . in addition , hydrocephalus , hydronephrosis , and congenital heart disease ( ventriculoseptal defect , atrioseptal defect , aortic stenosis , and / or tetralogy of fallot ) are also present . a secondary feature of cd is male - to - female sex reversal , which occurs in about two - thirds of patients with an xy karyotype . like the sex reversal and the various skeletal symptoms , the bending of the long bones is not an obligatory feature and is absent in about 10 % of cases , referred to as acampomelic cd ( 5 ) . to our knowledge , the present case is the first reported case in korea of a male with a novel sox9 frameshift mutation . a baby boy was born to a gravida 2 mother with a vertex presentation following a full - term pregnancy in asan medical center 's neonatal intensive care unit ( nicu ) on august 20 , 2008 . an ultrasound study at 36 weeks of gestation during this second pregnancy demonstrated shortened long bones , club feet , and a large head . at birth , the boy 's birth measurements were as follows : weight 3,272 g ( 25th percentile ) , length 46 cm ( 25th - 50th percentile ) , and head circumference 37 cm ( 75th - 90th percentile ) . his facial features included a flattened and prominent forehead , a flattened nasal bridge , and short palpebral fissures . micrognathia and retrognathia were also present , as was a cleft in the soft palate . skeletal deformities included a small thoracic cage , short limbs , pretibial skin dimples on the left thigh ( fig . a chest radiograph showed a small bell - shaped thoracic cage and 11 pairs of ribs with mild t - l scoliosis and hypoplastic scapulae ( fig . the pelvic and lower limbs ' radiography demonstrated a bowed femur , short fibulae , and no visible talus on either side ( fig . cerebral ultrasonography on the fifth day showed a small cystic change from both germinal matrix hemorrhages . the patient 's karyotype was 46xy with male external genitalia . to screen for a mutation , we isolated genomic dna from peripheral blood using a quickgene dna kit ( fujifilm life science , tokyo , japan ) . to analyze the sox9 gene 's mutation , we performed pcr using eight sets of primers designed in the intronic flanking region and containing three exons referred to by genbank accession number nt_010641.15 . we performed dna sequencing using the same primers used in pcr and a bigdye terminatore v3 .1 cycle sequencing kit ( applied biosystems , foster city , ca , usa ) . direct automated sequencing identified a novel frameshift mutation at nucleotide 1372 in exon 3 ( fig . the patient carried both mutant and normal alleles , indicating that the mutation was heterozygous . after his discharge from nicu , the patient was hospitalized four times for treatments of pneumonia . he underwent a tracheostomy at the age of three months for severe laryngomalacia and died at the age of four months from progressive respiratory failure . characteristic features of cd are skeletal hypoplasias and anomalies affecting the face , head , scapulae , spine , pelvis , and upper and lower limbs . the head is macrocephalic with flattened face and nasal bridge , high forehead , low - set ears often with associated deafness , hypertelorism , long philtrum , small mouth , and micrognathia ( 6 - 9 ) . the skeletal features are the most prominent characteristics of cd as presented in our case including anterior bowing of the tibia and characteristic pretibial skin dimples . the femurs are also mildly angulated , and talipes equinovarus and dislocation of the hips are usually present . usually present are flat vertebrae ( particularly at the cervical level ) , hypoplastic scapulae , and a small bell - shaped chest that 's often slender with 11 pairs of ribs and a poorly mineralized sternum ( 7 - 9 ) . after the critical first year , quality of life tends to improve , although most survived patients are known to be mentally retarded . the oldest reported survivor was a 17 - yr - old who had an iq of 45 ( 7 , 9 ) . most cases of cd are caused by heterozygous de novo mutations of the sox9 gene at chromosome 17q 24.3 - q25 .1 ( 5 , 10 ) . a growing number of reports describes cd with the chromosome 17 rearrangement breakpoint located some distance from sox9 ( 1 , 10 - 12 ) . sox9 contains a 79 - amino acid dna - binding motif known as the high - mobility - group ( hmg ) domain , which recognizes typical sox binding sequences and a second domain essential for its function , a proline / glutamine / serine - rich c - terminal transcription - activation domain ( 1 , 13 , 14 ) . sox9 is a transcription factor that plays a role in the expression of col2a1 , a major collagen gene , and anti - mllerian hormone , which is secreted from the sertoli cells for male sex differentiation ( 15 , 16 ) . cd is a good model to illustrate how a single transcription factor can control the development of several organs . both the skeletal dysplasia and the xy sex reversal in cd are caused by mutations in sox9 . all reported mutations in sox9 can cause cd , and approximately 75 % are associated with xy sex reversal ; whereas no mutation in sox9 has been associated with isolated sex reversal ( 17 ) . ( 18 ) demonstrated that cooperative dimerization of sox9 was essential for activation of key chondrogenesis genes , but not for male gonadal development , which might explain why cd is not necessarily associated with xy sex reversal as shown in our case . four major classes of heterozygous sox9 mutations cause cd : 1 ) amino acid substitutions in the hmg domain , 2 ) truncations or frameshifts that alter the c - terminus , 3 ) mutations at the splice junction , and 4 ) chromosomal translocations . all reported missense mutations lie in the hmg domain and affect dna binding , frameshifts , and splice mutations that truncate sox9 's c - terminus , resulting in the loss of transactivation domains ( 17 , 18 ) . in the present case we identified , a novel frameshift mutation in codon 458 at nucleotide 1372 . this mutation altered the transcription activation domain in the c - terminus , leading to a loss of sox9 's function . to date , two cases of cd have been reported in korea ( 19 , 20 ) . the first had multiple congenital anomalies ( polysplenia , complex heart disease , bilaterally trilobed lungs , and a brain anomaly ) and died immediately after delivery . the other was a case in which cd was identified in utero at 30 weeks of gestation whose pregnancy ended in abortion . herein we report a novel de novo frameshift mutation ( p.gln458argfsx12 ) in the sox9 gene of a korean male with cd .\noutput:\n" }, { "from": "agent", "value": "campomelic dysplasia ( cd ; omim # 114290 ) , a rare form of congenital short - limbed dwarfism , is due to mutations in sox9 , a member of the sox ( sry - related hmg box ) gene family . multiparous mother at 38 weeks ' gestation delivered a 3,272 g baby boy with characteristic phenotypes including bowing of the lower limbs , a narrow thoracic cage , 11 pairs of ribs , hypoplastic scapulae , macrocephaly , flattened supraorbital ridges and nasal bridge , cleft palate , and micrognathia . he underwent a tracheostomy at the age of three months for severe laryngomalacia after a number of repeated hospitalizations due to respiratory problems and died at the age of four months from progressive respiratory failure . he was diagnosed as having cd based on a novel frameshift mutation ( p.gln458argfsx12 ) in the sox9 gene , the mutation which has not yet been reported in korea ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: salivary gland tumours are rare and most cases are referred to the head and neck clinic . the annual incidence of salivary gland cancers ranges from 0.5 to 2 per 100,000 in different parts of the world , with the highest incidence occurring in croatia . in the united states , there is a rise in the incidence of salivary gland cancers ; this group accounted for 6.3 % of all head and neck cancers in 19741976 , as compared to 8.1 % in 1998 - 1999 . the sex distribution for salivary gland cancers is equal , and the majority of the cases arise in the sixth decade .80 % of major salivary gland tumours occur in the parotid glands , while most minor salivary tumours are located in the palate . as a general rule in clinical practice , the smaller the salivary gland is , the more likely the tumour is malignant . in the parotid glands , 2025 % of the tumours are malignant . this rises to 40 % for the submandibular glands , and more than 90 % of sublingual gland tumoursthe etiological agents of salivary gland cancers remain unclear . whilst most other head and neck cancers are strongly related to smoking and drinking , these do not play a role in the salivary glands . some studies have found that a diet rich in vitamin c and low in cholesterol may be effective in preventing salivary gland cancer . on the other hand , possible risk factors include therapeutic radiation for other head and neck cancers , occupational exposures in rubber manufacturing and woodworking , and also employment at hairdressers or beauty shops . history of previous cancers , related to epstein - barr virus , immunosuppression , and radiation were also associated with an increased risk of salivary gland cancer . in a swedish study , the risk of salivary gland cancer was increased 4 fold in hodgkin 's lymphoma patients . salivary gland tumours in the parotid or submandibular glands usually present as an enlarging mass . this may be associated with neurological symptoms such as facial nerve paralysis or pain if the tumour is malignant . clinical features suspicious for malignancy include ipsilateral facial nerve palsy , sudden tumour growth , pain , tumour fixation to the overlying skin or underlying muscle , and cervical lymphadenopathy . in both the major and minor salivary glands , the commonest type of benign tumour is pleomorphic adenoma . pleomorphic adenoma , also called benign mixed tumour , can occur in the deep lobe of the parotid gland with extension into the parapharyngeal space , which makes it the commonest type of parapharyngeal space tumour constituting 40 % of tumours there . pleomorphic adenomas need to be managed diligently for its capacity to recur and to undergo malignant transformation . capsular rupture and subsequent tumour spillage during excision is the most important risk factor for recurrence . features predictive of malignant change include age , tumour size , a long history of the mass , submandibular location , and the presence of hyalinized stroma . for malignant salivary tumour , however , if we look at each salivary gland in turn , several large series have shown that mucoepidermoid carcinoma is only the commonest cancer in the parotid glands , comprising around 33 % . adenoid cystic carcinoma is the commonest cancer in the submandibular and minor salivary glands , making up 4249 % . a review of 45 parotid cancer patients treated at the author 's institute from 2000 to 2010 also shows mucoepidermoid carcinoma to be the commonest type ( table 1 ) . mucoepidermoid carcinoma is a distinct histological type with a wide variation in clinical behavior . as such , histologicalthe tumour is classified as of low , intermediate , or high grade based on various histopathological criteria such as intracystic component , neural invasion , necrosis , mitosis , lymphovascular invasion , and bone invasion . the five - year disease - free survival for low - grade tumours is reported to be 8095 % , while that for high - grade tumours is 3050 % . these tumours metastasize quite early because of their propensity for perineural invasion and hematological spread , with the lungs being the most common site . even with distant metastases , however , patients can survive for 15 to 20 years . a review of 50 patients with adenoid cystic carcinoma actually showed that the location of salivary gland involved , tumour stage , node positivity , and perineural invasion did not affect overall survival or local control . acinic cell carcinoma is also considered to be a low - grade tumour which seldom invades the facial nerve . regional recurrences occur late in this tumour but 1620 % of patients eventually die of this cancer . it is used to delineate the tumour location such as intraglandular or extraglandular and whether it is in the superficial or deep lobe of the parotid gland , to detect malignant features , to define local extension and invasion of surrounding tissues , and to detect regional nodal and systemic metastases . ultrasound is the preferred tool for initial assessment of tumours in the superficial parotid and submandibular gland . ultrasound imaging resolution of these superficial structures is excellent and it does not carry any risk of radiation . it can also be employed to guide the needle when carrying out fine needle aspiration cytology ( fnac ) to reduce sampling error . for tumours located deep in the parotid gland or in the minor salivary glands , ct and mri are more useful . comparing the two modalities , mri has an edge over ct in predicting malignancy and is also more sensitive in picking up small tumours . benign tumours generally show high signal on t2 - weighted scans , while malignant lesions usually show intermediate to low signal . mri is more useful in detecting deep lobe extension ( figure 1 ) , marrow infiltration , and perineural spread and involvement of the facial nerve . mr spectroscopy is employed to differentiate malignant and benign salivary gland tumours and also to distinguish warthin 's tumour from pleomorphic adenoma . the role of ct is usually limited to evaluation of cortical bone involvement and the concurrent presence of calculus disease . the role of positron emission tomography ( pet ) in salivary gland disease is still being evaluated . the diagnostic yield of fnac can be quite good with large study series showing sensitivity up to 85 % and specificity up to 99 % . however , reports of other studies are far from ideal , and thus controversy as to the usefulness of fnac still persists . it is safe to say that the role of fnac mainly lies in preoperative patient counseling and surgical planning . in the case of a malignant fnac result , the patient can be better prepared in terms of the extent of surgery , higher potential complications , and need for neck dissection or postoperative radiotherapy . from 2010 onwards , salivary gland cancers are staged according to the seventh edition of the american joint committee on cancer ( ajcc ) cancer staging manual . the primary tumour ( t ) is staged according to size , extraparenchymal extension , and direct invasion . regional lymph node ( nsurgery is the mainstay of treatment for salivary gland tumours . in the case of parotid gland tumours , superficial parotidectomy with facial nerve dissection and preservation is the standard diagnostic procedure . this operation is also therapeutic in cases of benign or small malignant tumours limited to the superficial lobe of the gland . studies in the past have found enucleation of benign tumours to be associated with an unacceptably high chance of tumour recurrence especially for pleomorphic adenomas . however , several recent studies have suggested that a more limited resection in the form of extracapsular dissection where the pleomorphic adenoma is resected only with a cuff of normal glandular tissue offers better postoperative cosmetic result and lower incidence of frey 's syndrome without an increase in the incidence of tumour recurrence and facial nerve injury . recurrence rates with either approach are in the order of 13 % in the literature . whether a superficial or limited partial parotidectomy is carried out , the surgical approach is similar . a modified blair 's incision which begins just anterior to the tragus and then curves posteriorly towards the mastoid process and then gently turns anteriorly and inferiorly towards a neck skin crease is used ( figure 2 ) . a skin flap is then raised anteriorly in the relatively avascular plane of the superficial musculoaponeurotic system ( smas ) ( figure 3 ) . the parotid gland is dissected free from the tragus and sternocleidomastoid muscle in order to expose the main trunk of the facial nerve as it exits the stylomastoid foramen . the most consistent landmark used in its identification is the tympanomastoid suture which can be palpated easily . the rest of the operation involves dissection of individual branches of the facial nerve which will end up with removal of the superficial lobe of the parotid gland ( figure 4 ) . if the tumour involves the deep lobe of the parotid gland , a total parotidectomy is the procedure of choice to achieve adequate tumour clearance . this entails full dissection of all branches of the facial nerve from the superficial lobe , followed by delivery of the deep lobe from underneath the nerve . total parotidectomy with facial nerve preservation is also indicated for high - grade malignancies and t3 - 4 cancers . in these cases , preoperative mri is very important in order to delineate the proximity of the tumour to the internal carotid artery and skull base . radical parotidectomy , in which the facial nerve is sacrificed , is only necessary if the tumour is enveloping or infiltrating the facial nerve . in such cases , there is often a degree of facial nerve paralysis evident preoperatively . after facial nerve resection , the nerve is most often repaired with an interposition graft from another nerve . even in experienced hands , the facial nerve function rarely recovers fully and only house - brackmann grade iii can be achieved . when dealing with submandibular gland tumours , complete excision of the gland is adequate treatment if the lesion is small , limited to the gland parenchyma , and also of benign or low - grade malignant nature . more extensive tumours require excision of the gland bed and also adjacent soft tissues similar to a supraomohyoid neck dissection . the standard approach is via a transverse incision placed two finger - breadths below the mandible ( figure 5 ) and then elevation of a subplatysmal flap with careful identification and protection of the marginal mandibular branch of the facial nerve . the facial vessels are ligated and the gland is dissected free from the digastric and mylohyoid muscles while safeguarding the hypoglossal and lingual nerves . the gland is finally excised after ligation of the wharton 's duct ( figure 6 ) . studies on the long - term efficacy of various approaches in dealing with n0 neck are limited . some advocate neck dissection for every salivary gland cancer patient , while others choose selective neck dissection or irradiation of the neck for high - risk cancers only . because of the small size of these studies , no single approach has been shown to be superior . overall , the risk of regional lymph node metastasis in salivary gland cancer is low compared to other head and neck cancers and range from 1420 % . high - risk factors include high - grade and advanced t - stage tumours , tumours with extracapsular extension , and presence of preoperative facial paralysis . elective neck dissection should also be performed if resection of the primary tumour is aided by removal of the surrounding lymph nodes . an exception to this is in the case of adenoid cystic carcinoma in which the chance of occult lymph node metastasis is low and elective neck dissection is unlikely to offer any additional benefit . selective neck dissection for parotid gland cancer should include levels ib , ii , iii , iv , and va , while that for submandibular gland cancer should include levels i , ii , and iii . for patients with proven nodal metastasispostoperative radiotherapy has proven benefit in salivary gland cancer patients at high risk of locoregional recurrence . several studies have identified important prognostic factors ( table 2 ) and postoperative radiotherapy is recommended . the different types of radiotherapy for salivary gland cancer include electrons , electron / photon mix , protons , and neutrons . neutron beam radiation therapy has been shown to be more effective in certain tumour histology especially adenoid cystic carcinoma . intensity modulated radiation therapy is a popular technique since it offers conformal radiation producing steep dose gradient which allows for excellent tumour coverage while reducing dose to surrounding normal tissues . the usual postoperative radiotherapy dosage ranges from 60 to 70 gy in 2 gy daily fractions . the role of chemotherapy remains to be largely palliative in treating metastatic , recurrent , or unresectable salivary gland cancers . due tothe paucity of these patients , randomized phase iii studies on the use of chemotherapy are lacking . combination therapies with cisplatin , 5 - fluorouracil , cyclophosphamide , and doxorubicin have also been studied , but the response rates are quite variable due to the small number of patients enrolled . more recently , targeted therapies have also been studied , and the targets include epidermal growth factor receptor ( egfr ) , her2 protooncogene , c - kit protooncogene , and vascular endothelial growth factor ( vegf ) . salivary gland tumours are best managed in specialized head and neck clinics because of their rarity and need for thorough workup by a multidisciplinary team of specialists . surgery forms the keystone of their management since it serves both diagnostic and therapeutic purposes . the most important step is in the surgical planning and preoperative counseling . large or deep parotid lobe tumours , and those suspected to be malignant , should be imaged preferably with mri in order to decide on the expected extent of resection and to determine the potential risk to the facial nerve . the whole surgical exercise in removing a parotid tumour revolves around careful identification and preservation of the facial nerve . injury to the facial nerve causes significant morbidity to the quality of life of the patients . elective selective neck dissection in clinically n0 salivary gland cancer is recommended when the primary tumour exhibits high - risk features . on the same note , the role of chemotherapy is as yet not well established and investigations of targeted therapy are still at an early stage .\noutput:\n" }, { "from": "agent", "value": "salivary gland tumours most often present as painless enlarging masses . most are located in the parotid glands and most are benign . the principal hurdle in their management lies in the difficulty in distinguishing benign from malignant tumours . investigations such as fine needle aspiration cytology and mri scans provide some useful information , but most cases will require surgical excision as a means of coming to a definitive diagnosis . benign tumours and early low - grade malignancies can be adequately treated with surgery alone , while more advanced and high - grade tumours with regional lymph node metastasis will require postoperative radiotherapy . the role of chemotherapy remains largely palliative . this paper highlights some of the more important aspects in the management of salivary gland tumours ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: angiomyolipoma ( aml ) of the kidney is a clonal neoplasm , derived from perivascular epitheloid cells . the most common serious complication of renal aml is hemorrhage , especially aggravated by renal trauma . aml with renal calculus is a challenge for the treating physician because of aml 's vulnerability to bleed . the blood vessels in aml are thick - walled , tortuous and often have angiomatous arrangement . the vessels are devoid of all important elastic tissue and instead have a disorganized adventitial cuff of smooth muscle . anatomically they are devoid of capsule and may extend through the renal capsule into the perinephric space making free hemorrhage ( without temponade ) a serious possibility . this is the rare situation , where the presence of aml leads to challenging alteration in the standard therapy of the renal stone . the ultrasound - guided lithotripsy has real - time ability to prevent the shockwaves from traversing the aml at all times . a 54 year - old non - hypertensive and non - diabetic lady presented with flank pain and repeated symptomatic urinary tract infection like fever , dysuria and urgency of micturition . she was treated with culture - based antibiotic therapy for ten days and was advised swl after culture negativity . on sonography the patient was found to have a 15 - mm right renal pelvic stone with mild hydronephrosis . on contrast computed tomography ( ct ) urography the lesion was confirmed to be aml [ figure 1 ] . the hounsfield units ( hu ) of the stone were 900 hu . in view of past history of recurrent infection and relatively lower hounsfield units of the stonea three - dimensional ( 3d ) reconstruction was done to find out the anatomic co - relation of the aml and renal calculus . patient was subjected to swl on siemens modularis vario ( erlangen , germany ) having focal zone of 12.1 mm x 130.4 mm and depth of penetration 140 mm . the imaging modality used was siemens sonoline g20 , with transducer c5 - 2 , with footprint measuring 6.7 cm which enabled us to have a broader field of view . pre operative ct scan showing right renal calulus with aml lesion the therapy head of siemens modularis vario is angulated at 55 degrees hence the natural course of shockwave travel is demonstrated in figure 2a by yellow line ; the patient was given supine right lateral tilt of 15 degrees so that the aml lesion was away from the focal zone of the lithotripter . once the stone was localized behind the crosshair , the distance between the aml lesion and stone was always kept more than 6 mm from the edge of the stone considering the diameter of focal zone as 12.1 mm . the therapy head of siemens modularis vario is angulated at 55 degrees hence the natural course of shockwave travel is demonstrated in figure 2a by yellow line ; the patient was given supine right lateral tilt of 15 degrees so that the aml lesion was away from the focal zone of the lithotripter . once the stone was localized behind the crosshair , the distance between the aml lesion and stone was always kept more than 6 mm from the edge of the stone considering the diameter of focal zone as 12.1 mm . patient was well hydrated before the procedure so as to ensure good fragmentation of stone during swl . treatment was initiated with energy level of 0.1 for first 100 shockwaves so that vasoconstriction would lead to prevention of kidney tissue injury . gradually , energy was increased after initial 500 shockwaves and maximum of 3.0 energy was reached by the end of 1000 shockwaves . clouds of echogenicity were seen in the area of the stone . with every consecutive shockwave these clouds of echogenicity progressed through the collecting system indicating clouding effect which suggests adequate fragmentation at around 2900 shockwaves . as ultrasound machine can not directly observe cavitation elements , remnant gas bubbles appear as echogenic region . at the end of 3000 shockwavesthe treatment was terminated as we never wanted the adverse effects of the cavitation bubble . patient had indwelling foley 's catheter for 24 h post swl to monitor urine output and to watch for hematuria and was discharged one day later . a sonography scan was performed to check for hematoma at the time of discharge . after one week , the patient was screened by x - ray , which was suggestive of good fragmentation with few residual fragments in the upper ureter along the l3 - 4 vertebrae . complete stone clearance was confirmed by x - ray kidney ureter bladder ( kub ) at the end of the second week by observing these calculi . to conclusively diagnose aml , many authors have tried fine needle aspiration cytology ( fnac ) as well as fine needle aspiration biopsy ( fnab ) . fnab is more reliable , however , fraught with the unwanted and often serious complication of hemorrhage . thus most amls are diagnosed based on their ct features . extrapolating this data of fnab , we believe that chances of injury to the aml are high during the puncture . hence we did not consider doing pcnl ( per cutaneous nephrolithotomy ) in this patient . kropp had performed percutaneous nephrolithotomy directly through an aml eiley dm had performed percutaneous nephrolithotomy with renal aml with the help of 3d ct imaging to achieve accurate renal puncture and angle during percutaneous nephrolithotomy . however , a second tract was needed and this was done using standard biplanar fluoroscopic technique which traversed an aml . to avoid such a complicationhowever , it is done at very few centers therefore we believe that sonography - guided lithotripsy is very safe in the presence of aml . cavitation erosion is especially observed in the anterior and posterior side of the artificial stone in vitro . cavitaion plays important role in stone disinegration after the initial spalling effect have disintegrated the calculus . the collapse of the cavitational bubble is asymmetric , resulting in the emission of a liquid jet that may have significant destructive effects on tissue exposed to swl . since cavitation is an undisputed reason for renal tissue injury and cavitational bubble occurs at the entry site of the shockwave rather than exit site , our major concern was to place the aml lesion outside the focal zone of our machine . considering the fact that the diameter of the focal zone was 12.1 mm , the minimum distance required between the centre of the stone and the aml lesion had to be more than 6 mm at all times during swl . this can effectively be achieved only by real - time usage of sonography and not fluoroscopy . in such special cases of concurrent aml and renal stone we strongly suggest usg - guided lithotripsy for its real - time ability to avoid shockwaves traversing the aml . real - time sonography is able to detect any hemorrhage from aml during the procedure which enables us to stop swl on time .\noutput:\n" }, { "from": "agent", "value": "treatment of angiomyolipoma ( aml ) of kidney with stone has been challenging for urologists . we present our experience of treating the renal stone in the presence of aml with shockwave lithotripsy ( swl ) . position of the patient with respect to the direction of the shockwaves and accurate knowledge of the dimension of the focal zone are critical aspects of swl . keeping the aml safely away from the focal zone at all times during the procedure is only possible by usage of real - time ultrasonography in lieu of fluoroscopy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: many infectious diseases flourishes when the weather is cold and when the people living in closed houses and decrease in warmer weather and the people get out of doors and ventilate their homes . the identification of the reasons for seasonality of infectious diseases may offer the possibilities for preventive measures , and can even help in the development of effective policies and allowing for use resources more efficiently and effectively . in this short paperwill briefly discuss the most factors influencing the seasonal patterns of infectious diseases , providing an overview of seasonal infectious disease epidemiology . the first section outlines summary information on the seasonal changes in human physical activity and their association with different modes of human infectious disease transmission . the second section provides an overview of seasonal environmental changes and maintenance of pathogens infectivity . the third section deals with the seasonal variation of immune system function . in the four and five sections , discuss the possible links between seasonal variation of vitamin d levels and melatonin in the seasonal patterns of infectious diseases . inadequate and poorly designed ventilation in crowded public places and urban transit systems may boost exposure to air - borne pathogens . besides , higher relative humidity may also affect the stability of air - borne droplets in which pathogens transmitted from person to person . for example , the transmission of the influenza virus by droplets is enhanced in cooler , more humid seasons . in many countriesthe onset of cooler , more humid weather coincides with the increased aggregation of people and the seasonal effect can be exacerbated . cholera being more frequents in warm season , seems to be related to the ability of vibrios to grow rapidly in warm environmental temperatures etc . their incidence rises and declines because of changes in factors associated with the diseases . in all cultures , most of social proceedings are synchronized by calendars ; and usually all calendars reflect the cyclic rhythm of nature . social celebrations or gathering people observed by communities according to calendars , for example . increased contacts between children during schools time , or in summer camps , reflectingschools calendars , and also reflect the time of some infectious diseases associated with it . human physical activity is high in summer and spring compared to winter . in a study , it is observed that the majority of australians and germans have decreased the level of physical activity in winter , especially as it relates to outdoor activity or work activity . from thiswe can conclude that weather has a modest effect on the physical activity of population . one study conducted in japan , shows that the physical activity increased as temperature became warmer , up to 17c , and then declined as the temperature decreased . seasonal clothing styles due to weather conditions , is a step of adaptation with environment . wearing heavy clothing in winter and less clothing in summer and springseveral studies show that clothing styles that cover whole the body have adverse effects on vitamin d concentration and can lead to vitamin d deficiency due to limited exposure of skin surface to sunlight . in order to meet the requirement of converted vitamin d from sunlight , it is important that the most vulnerable region of the body like the arms , legs and face be exposed to the sunlight at least two or three times a week . the maintenance of infectivity by any pathogen outside the host is dependent on a number of factors including temperature , moisture , dehydration , and uv light . temperature has the greatest effect , since the rate of most chemical and physical processes are dependent upon it . it can be postulated that the occurrence of infectious diseases is driven by seasonal environmental changes directly on pathogen abundance , survival , or virulence , due to the annual changes in seasonal cycle are associated with changes in the physical environment like temperature , oxygen concentration and humidity . for example , some micro - organisms like e. coli strains were most stable at low - humidity conditions and markedly unstable at high - humidity conditions . viruses ( e.g. , polioviruses ) without structural lipids are more stable at high - humidity conditions , whereas viruses ( influenza and vaccinia ) with structural lipids are least stable . pox viruses have been shown to survive for several months under natural indoor conditions . in case of mycobacterium tuberculosisthe observational studies showed that they are inducing changes in the cell wall as a response to the temperature variation in the surrounding environment . the studies suggest that the complex composition of mycobacterium cell wall which contains waxes , glycoproteins and glycolipids are responsible for the virulence of the mycobacteria and gives it the ability to survive in hard environmental conditions such as dehydration or increase in the environment temperature . however , very little is known about the mechanisms by which mycobacteria modulate the expression of cell - wall components in response to changes in the environment , such as oxidative stress , growth , anaerobiosis , nutrient deprivation and temperature shifts . changing seasonal and environmental factors , such as temperature , sunlight , rain , wind and humidity has a direct link with the increasing number of infectious diseases . example can be seen in increase in meningococcal epidemic in sub - saharan africa during the season of dry winds and ending with the onset of the rains . correspondingly , respiratory syncytial virus epidemics occur in the colder months of winter and spring in the united states . while respiratory syncytial virus epidemicsit has been proposed that dryness of mucosal surfaces increases the probability of bacteremic spread . a recent explanation of seasonal variation in the incidence of respiratory infection suggests that this variation is due to the effects of atmospheric pollutants on host mucociliary action . nonetheless , the change of environmental factors influence the host susceptibility to infection , either as a result of seasonal changes on host immune function ( humoral and cellular immunity ) or as a result of direct environmental effects . the mechanisms of seasonal influence on the host immune system vary , evident from data of the experiments that have been performed on animals and human . recent experimental studies on rodents , birds and humans suggest that the immune system is weakened during the winter . a different study on siberian hamsters showed an increase in the natural killer - cell activity and lymphocyte blastogenesis but decrease of phagocytosis and oxidative burst activity by granulocytes in summer days . as observed in rodents , seasonal variations caused substantial variations in lymphocyte mitogenic responses and in the quantity of circulating lymphocytes , neutrophils , cd4 and cd8 cells and il - 6 . some values , such as for lymphocyte aryl hydrocarbon hydroxylase activity , peak in summer , while others , such as a number of circulating cd4 t , cd25 t , cd20b cells , and cd4 / cd8 ratio peaked in winter and lowest in summer . additionally , a down - regulation of tlr -4-mediated il - 1 , il - 6 , tnf - , interferon ( ifn ) - and il - 10 production in summer was observed compared to winter . furthermore , few studies observed seasonal variations in other immunological values during the annual seasons . for example , significant variation in total number of white blood cells , with peaks occurring in winter ( maximum around december - march ) and troughs in summer ( may - august ) and seasonal variation in number of circulating t and b lymphocytes were observed . such asnumber of t cells peaked in late fall , whereas b cells peaked in winter . in a study of healthy west african children , the lymphocyte percentage , the absolute lymphocyte count , the absolute cd4 t - lymphocyte count , andthe cd4 / cd8 ratio were significantly lower during the rainy season ( june - october ) compared with the dry season ( november - may ) , whereas the cd8 percentage was higher during the rainy season than the dry season . in another study , four healthy individuals were followed for 7 years , the absolute numbers of cd4 t lymphocyte were lowest in summer when the cd8 t - lymphocytes were highest . there were no significant seasonal changes in the total number of white cells or in total lymphocyte counts . similarly , the total leukocyte and lymphocyte counts in a different study of six healthy subjects did not show seasonal variation over the course of one year , whereas the percentage of b cells in the coldest month was at almost twice the level observed in summer . suggested by a more recent study , the lower level in the mean number of cd4 t cells and mean cd4 / cd8 ratio were found in hiv - infected men during summer and spring . the mechanism underlying the circannual change in immune function has been linked with adrenocortical hormones activity . adrenocortical hormones vary on a circannual basis with increased levels of secretion in winter and decrease in summer . adrenal corticosteroids , especially glucocorticoids , depress cellular immune function and show to be more effective against t - suppressor cells . thus , when adrenocortical activity is elevated , t - cell activity is depressed and b - cell activity is elevated . in contrast the circadian fluctuations in immune parameters appear to be independent of glucocorticoid secretion . to determine whether the seasonal variation in immune activity is temperature dependent or not , one study of eight healthy men shows elevation in nk cell activity after exposed to acute cold air . another study found a significant increase in the proportion of monocytes , lymphocytes and the percentage of cd14 and cd25 cells after acute cold - water ( 14c ) immersion , three time a week for a duration of 6 weeks . the link between vitamin d deficiency and susceptibility to infection has been suggested for longer than a century . more recently , epidemiologic studies have demonstrated strong associations between seasonal variations in vitamin d levels and the incidence of various infectious diseases . significant seasonal vitamin d level variations were observed in several communities , which reveal a variation of values for 25 - ( oh ) d , increased during summer and spring , while gradually decreasing in autumn and winter . one study conducted in boston ( 42n ) found the conversion rate of pro - vitamin d3 to pre - vitamin d3 in june and july at maximum , and then gradually decreasing in august and october . a similar study conducted in edmonton , canada ( 52n ) , the conversion of pre - vitamin d3 ceased after mid october and did not return until mid april . in a study of healthy subjects living in baltimore aged from 20 to 94 years , there was increase in the level of 25 - oh d from a nadir in april - may of 72.9 studies from many parts of the world have confirmed a significant seasonal variation in vitamin d. epidemiological evidence suggests that seasonal variability is due to the effect that mainly people in winter are more frequently indoors and wear more clothing , thereby expose less skin surface area to sunlight . furthermore , the amount of uv light that reaches to any subjects on the earth 's surface are varies with season and latitude , particularly in winter . melatonin is a powerful natural hormone that is well known for its association with circadian and seasonal rhythms , and its synthesis is regulated by the environmental light / dark cycle . melatonin participates in various functions of the body , among which its immunomodulatory role has assumed considerable significance in recent years . melatonin has been shown to be involved in the regulation of both cellular and humoral immunity . melatonin not only stimulates the production of natural killer cells , monocytes and leukocytes , but also alters the balance of t helper ( th ) - 1 and th - 2 cells mainly towards th - 1 responses and increases the production of relevant cytokines such as interleukin ( il ) - 2 , il - 6 , il - 12 and interferon - . the seasonal changes in immune function observed in animals and humans are likely to be mediated by the changes in the duration of melatonin secretion . this fact may in part account for the cyclic pattern of symptom expression shown by certain infectious diseases , which become more pronounced at particular times of the year . inadequate and poorly designed ventilation in crowded public places and urban transit systems may boost exposure to air - borne pathogens . besides , higher relative humidity may also affect the stability of air - borne droplets in which pathogens transmitted from person to person . for example , the transmission of the influenza virus by droplets is enhanced in cooler , more humid seasons . in many countries the onset of cooler , more humid weather coincides with the increased aggregation of people and the seasonal effect can be exacerbated . cholera being more frequents in warm season , seems to be related to the ability of vibrios to grow rapidly in warm environmental temperatures etc . their incidence rises and declines because of changes in factors associated with the diseases . in all cultures , most of social proceedings are synchronized by calendars ; and usually all calendars reflect the cyclic rhythm of nature . social celebrations or gathering people observed by communities according to calendars , for example . increased contacts between children during schools time , or in summer camps , reflectingschools calendars , and also reflect the time of some infectious diseases associated with it . human physical activity is high in summer and spring compared to winter . in a study , it is observed that the majority of australians and germans have decreased the level of physical activity in winter , especially as it relates to outdoor activity or work activity . from thiswe can conclude that weather has a modest effect on the physical activity of population . one study conducted in japan , shows that the physical activity increased as temperature became warmer , up to 17c , and then declined as the temperature decreased . seasonal clothing styles due to weather conditions , is a step of adaptation with environment . wearing heavy clothing in winter and less clothing in summer and spring also has a significant influence on seasonal variations in human behavior . several studies show that clothing styles that cover whole the body have adverse effects on vitamin d concentration and can lead to vitamin d deficiency due to limited exposure of skin surface to sunlight . in order to meet the requirement of converted vitamin d from sunlight , it is important that the most vulnerable region of the body like the arms , legs and face be exposed to the sunlight at least two or three times a week . the maintenance of infectivity by any pathogen outside the host is dependent on a number of factors including temperature , moisture , dehydration , and uv light . temperature has the greatest effect , since the rate of most chemical and physical processes are dependent upon it . it can be postulated that the occurrence of infectious diseases is driven by seasonal environmental changes directly on pathogen abundance , survival , or virulence , due to the annual changes in seasonal cycle are associated with changes in the physical environment like temperature , oxygen concentration and humidity . for example , some micro - organisms like e. coli strains were most stable at low - humidity conditions and markedly unstable at high - humidity conditions . viruses ( e.g. , polioviruses ) without structural lipids are more stable at high - humidity conditions , whereas viruses ( influenza and vaccinia ) with structural lipids are least stable . pox viruses have been shown to survive for several months under natural indoor conditions . in case of mycobacterium tuberculosisthe observational studies showed that they are inducing changes in the cell wall as a response to the temperature variation in the surrounding environment . the studies suggest that the complex composition of mycobacterium cell wall which contains waxes , glycoproteins and glycolipids are responsible for the virulence of the mycobacteria and gives it the ability to survive in hard environmental conditions such as dehydration or increase in the environment temperature . however , very little is known about the mechanisms by which mycobacteria modulate the expression of cell - wall components in response to changes in the environment , such as oxidative stress , growth , anaerobiosis , nutrient deprivation and temperature shifts . changing seasonal and environmental factors , such as temperature , sunlight , rain , wind and humidity has a direct link with the increasing number of infectious diseases . example can be seen in increase in meningococcal epidemic in sub - saharan africa during the season of dry winds and ending with the onset of the rains . correspondingly , respiratory syncytial virus epidemics occur in the colder months of winter and spring in the united states . while respiratory syncytial virus epidemicsit has been proposed that dryness of mucosal surfaces increases the probability of bacteremic spread . a recent explanation of seasonal variation in the incidence of respiratory infection suggests that this variation is due to the effects of atmospheric pollutants on host mucociliary action . nonetheless , the change of environmental factors influence the host susceptibility to infection , either as a result of seasonal changes on host immune function ( humoral and cellular immunity ) or as a result of direct environmental effects . the mechanisms of seasonal influence on the host immune system vary , evident from data of the experiments that have been performed on animals and human . recent experimental studies on rodents , birds and humans suggest that the immune system is weakened during the winter . a different study on siberian hamsters showed an increase in the natural killer - cell activity and lymphocyte blastogenesis but decrease of phagocytosis and oxidative burst activity by granulocytes in summer days . as observed in rodents , seasonal variations caused substantial variations in lymphocyte mitogenic responses and in the quantity of circulating lymphocytes , neutrophils , cd4 and cd8 cells and il - 6 . some values , such as for lymphocyte aryl hydrocarbon hydroxylase activity , peak in summer , while others , such as a number of circulating cd4 t , cd25 t , cd20b cells , and cd4 / cd8 ratio peaked in winter and lowest in summer . additionally , a down - regulation of tlr -4-mediated il - 1 , il - 6 , tnf - , interferon ( ifn ) - and il - 10 production in summer was observed compared to winter . furthermore , few studies observed seasonal variations in other immunological values during the annual seasons . for example , significant variation in total number of white blood cells , with peaks occurring in winter ( maximum around december - march ) and troughs in summer ( may - august ) and seasonal variation in number of circulating t and b lymphocytes were observed . such as number of t cells peaked in late fall , whereas b cells peaked in winter . in a study of healthy west african children , the lymphocyte percentage , the absolute lymphocyte count , the absolute cd4 t - lymphocyte count , and the cd4 / cd8 ratio were significantly lower during the rainy season ( june - october ) compared with the dry season ( november - may ) , whereas the cd8 percentage was higher during the rainy season than the dry season . in another study , four healthy individuals were followed for 7 years , the absolute numbers of cd4 t lymphocyte were lowest in summer when the cd8 t - lymphocytes were highest . there were no significant seasonal changes in the total number of white cells or in total lymphocyte counts . similarly , the total leukocyte and lymphocyte counts in a different study of six healthy subjects did not show seasonal variation over the course of one year , whereas the percentage of b cells in the coldest month was at almost twice the level observed in summer . suggested by a more recent study , the lower level in the mean number of cd4 t cells and mean cd4 / cd8 ratio were found in hiv - infected men during summer and spring . the mechanism underlying the circannual change in immune function has been linked with adrenocortical hormones activity . adrenocortical hormones vary on a circannual basis with increased levels of secretion in winter and decrease in summer . adrenal corticosteroids , especially glucocorticoids , depress cellular immune function and show to be more effective against t - suppressor cells . thus , when adrenocortical activity is elevated , t - cell activity is depressed and b - cell activity is elevated . in contrast the circadian fluctuations in immune parameters appear to be independent of glucocorticoid secretion . to determine whether the seasonal variation in immune activity is temperature dependent or not , one study of eight healthy men shows elevation in nk cell activity after exposed to acute cold air . another study found a significant increase in the proportion of monocytes , lymphocytes and the percentage of cd14 and cd25 cells after acute cold - water ( 14c ) immersion , three time a week for a duration of 6 weeks . the link between vitamin d deficiency and susceptibility to infection has been suggested for longer than a century . more recently , epidemiologic studies have demonstrated strong associations between seasonal variations in vitamin d levels and the incidence of various infectious diseases . significant seasonal vitamin d level variations were observed in several communities , which reveal a variation of values for 25 - ( oh ) d , increased during summer and spring , while gradually decreasing in autumn and winter . one study conducted in boston ( 42n ) found the conversion rate of pro - vitamin d3 to pre - vitamin d3 in june and july at maximum , and then gradually decreasing in august and october . a similar study conducted in edmonton , canada ( 52n ) , the conversion of pre - vitamin d3 ceased after mid october and did not return until mid april . in a study of healthy subjects living in baltimore aged from 20 to 94 years , there was increase in the level of 25 - oh d from a nadir in april - may of 72.9 studies from many parts of the world have confirmed a significant seasonal variation in vitamin d. epidemiological evidence suggests that seasonal variability is due to the effect that mainly people in winter are more frequently indoors and wear more clothing , thereby expose less skin surface area to sunlight . furthermore , the amount of uv light that reaches to any subjects on the earth 's surface are varies with season and latitude , particularly in winter . melatonin is a powerful natural hormone that is well known for its association with circadian and seasonal rhythms , and its synthesis is regulated by the environmental light / dark cycle . melatonin participates in various functions of the body , among which its immunomodulatory role has assumed considerable significance in recent years . melatonin has been shown to be involved in the regulation of both cellular and humoral immunity . melatonin not only stimulates the production of natural killer cells , monocytes and leukocytes , but also alters the balance of t helper ( th ) - 1 and th - 2 cells mainly towards th - 1 responses and increases the production of relevant cytokines such as interleukin ( il ) - 2 , il - 6 , il - 12 and interferon - . the seasonal changes in immune function observed in animals and humans are likely to be mediated by the changes in the duration of melatonin secretion . this fact may in part account for the cyclic pattern of symptom expression shown by certain infectious diseases , which become more pronounced at particular times of the year . seasonal variability in infectious disease incidence is likely to be influenced by population susceptibility and behaviours ; however , environmental influences are also important considerations . such environmental factors can impact the abundance of pathogens , the knowledge of the role of environmental factors ( infection , cold , etc . ) or other triggers ( indoor activity , vitamin d intake ) could be used to improve prevention measures and educational strategies , especially in people with a risk of infection . people should be informed about the importance of proper housing ventilation and the potential benefits of increased outdoor activity in natural uv light . furthermore , adequate vitamin d status may be required particularly in winter to decrease infection rates ; future population - based studies to evaluate broad effects of vitamin d supplementation on infection rates may be warranted .\noutput:\n" }, { "from": "agent", "value": "the recognition of seasonal patterns in infectious disease occurrence dates back at least as far as the hippocratic era , but the mechanisms underlying these fluctuations remain poorly understood . many classes of mechanistic hypotheses have been proposed to explain seasonality of various directly transmitted diseases , including at least the following ; human activity , seasonal variability in human immune system function , seasonal variations in vitamin d levels , seasonality of melatonin , and pathogen infectivity . in this short paper will briefly discuss the role of these factors in the seasonal patterns of infectious diseases ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: heartworm ( dirofilaria immitis ) is a roundworm parasite that is spread to dogs by mosquito bites , causing heart failure in the definitive host canine . the nematode is found throughout the world and in the united states is endemic to the east , southeastern seaboard , and the southern coast . in the event that a human is bitten by an infected mosquito , the nematode travels from the subcutaneous tissue into the vessels , and eventually enters the right ventricle . the majority of patients are asymptomatic , however non - specific signs and symptoms that have been reported include cough , hemoptysis , chest pain and wheezing . although dirofilaria is a parasite , peripheral eosinophilia is only found in about 6.515 % of the cases , . in the right clinical setting , these lesions are presumed to be neoplastic and require the appropriate workup . we describe a 48 - year - old gentleman with a 30 pack - year smoking history who was admitted for refractory hypoglycemia secondary to a suspected insulinoma . biochemical work up proved positive warranting imaging studies with computed tomography ( ct ) chest / abdomen / pelvis to look for an underlying insulin - secreting tumor . his complete blood count showed a white blood cell count of 9.910 / l , hemoglobin of 13.8 g / dl , platelet count of 442 k / l with an absolute eosinophil count of 0.1 k / l . complete metabolic panel revealed a mildly low sodium level and a glucose level of 34 mg / dl but was otherwise unremarkable . his insulin level was elevated at 133 miu / ml , as well as pro - insulin of 46.5 pmol / l , random cortisol of 129.1 mcg / dl , and c - peptide of 9.3 ng / ml . his vitals signs were normal and he was afebrile . imaging studies revealed multiple pulmonary nodules , the largest measuring 1.4 cm 1.2 cm in left lung ( fig . further serologic work up was negative for fungal and mycobacterial causes of pulmonary nodules as antibodies for histoplasma , aspergillus , coccidioides , and blastomyces were negative by immuno - diffusion and complement fixation . a ct guided core needle biopsy of the largest lung mass was done to rule out neoplasm and revealed a necrotic granuloma on microscopy ( fig . this is not pathognomonic for parasitic disease in this case so other infectious etiologies were considered . the specimen was sent for fungal and mycobacterium culture which were negative at 4 and 6 weeks respectively . no sputum cultures or smears were performed on this patient in the acute setting , this is one of the limitations of our workup . further inquiry of patient 's social history revealed that the patient has three dogs , one of which was ill with fatigue , weight loss , and hair loss . the patient denied any travel history to suggest tropical disease and granulomatous diseases such as granulomatosis with polyangiitis and sarcoidosis were ruled out based on the appearance of the biopsy and the absence of any systemic signs or symptoms consistent with inflammatory disease . there were no fevers throughout his hospitalization and lab testing for autoimmune disease was not performed during the workup . while there was not a confirmatory test or obvious parasite on biopsy , clinically the patient was diagnosed with an indolent infection secondary to d. immitis . the patient was still experiencing repetitive , symptomatic episodes of hypoglycemia while on maximum medical therapy and was transferred to a quaternary care center for management of his biochemical insulinoma . in the united states , heartworm infection in dogs and humans are endemic in the east and southeast regions . it is believed that the organism is inoculated into humans via a mosquito bite . from therethey then migrate into the heart via the capillary system in order to mature for another 6 months . the human body is an unsuitable environment for heartworm and as the nematode dies it embolizes the pulmonary vessels causing infarction and eventual nodule formation that can present as a solitary or multiple pulmonary nodules . the first case of human dirofilariasis was documented in a brazilian boy in 1887 by de magelhaes when he discovered a filarial worm in the left ventricle of the patient . the majority of patients infected with d. immitis are asymptomatic and most commonly present with a solitary pulmonary nodule incidentally found on chest radiography . occasionally there can be multiple pulmonary nodules mimicking metastatic disease or fungal or mycobacterial infection . regardless of the number of nodules , these asymptomatic nodules should be evaluated for possible underlying malignancy . in our patient , given his significant smoking history , invasive testing was necessary in order to prove his lesions were not neoplastic . diagnosis of dirofilariasis can be made by a dirofilaria - specific antibody , through enzyme - linked immunosorbent assay ( elisa ) . in addition , the elisa assays are not known to be particularly accurate with problems of cross - reactivity between d. immitis and other filariases . the majority of cases are diagnosed by microscopy which shows a central core of necrosis surrounded by a granulomatous zone of tissues . one feature we would typically expect to see in patients with invasive parasites is peripheral eosinophilia . however , as in our case , many other cases have not shown any eosinophilia . it is believed that the incidence of eosinophilia in infected patients is between 6.5 % and 15 % , . few of the case reports also document eosinophils on microscopy as part of the inflammatory process . it is not known if there is a trend in the eosinophil level throughout the infectious process or if it trends either way . based on previous case series , other risk factors include the size of the dog population in the area , the prevalence of d. immitis infection in those dogs , the density of the mosquito population and the degree of human exposure to bites by said mosquitoes . it is possible , though , that the patient 's dog was sick due to d. immitis infection without treatment . we hypothesize , therefore , that the patient was exposed to a mosquito that also bit this dog . one of the limitations of our study was the lack of elisa antibody testing to help establish a diagnosis . in addition , the fine needle aspiration ( fna ) that was performed showed only necrotizing granuloma consistent with a parasitic infection but did not show the actual parasite . however , we are confident in our diagnosis in that we have ruled out other granulomatous infections and conditions . in conclusion , human pulmonary dirofilariasis should be considered as a differential diagnosis in patients presenting with asymptomatic solitary or multiple pulmonary nodules in the appropriate epidemiologic and clinical setting . we determine the right clinical setting to be one that has a high rate of d. immitis infected dogs ( both stray and domesticated ) in addition to having a high mosquito population in order to be able to transfer the parasite from canines to humans .\noutput:\n" }, { "from": "agent", "value": "canine heartworm , dirofilaria immitis , is a nematode parasite that infects dogs by way of mosquito bite . rarely , humans play accidental hosts to this parasite and are not a suitable environment for the nematode to live . as the parasite dies in the pulmonary vessels it embolizes the vessels causing infarction and eventual nodule formation in the lungs . in the right clinical context , a nodule can be considered malignant prompting invasive tissue sampling . we describe a case of a 48 - year - old man who was found to have multiple asymptomatic scattered pulmonary nodules during imaging workup for an insulinoma . fine needle biopsy of the largest nodule revealed a necrotic granuloma , lab testing and culture ruled out fungal and bacterial causes . clinically , this picture was consistent with d. immitis infection ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: rituximab and etanercept are biopharmaceutical recombinant proteins used for the treatment of non - hodgkin lymphoma and rheumatoid arthritis ; and as a monoclonal antibody and a fusion protein they are composed of a pair of heavy and light chains and a homodimer with several cysteines , respectively . both proteins are assembled with inter - and intrachain disulfide bonds that are established during their biosynthesis in the endoplasmic reticulum of recombinant cho cells . once folded , glycosylated within the cell , and secreted into culture medium , recombinant proteins can be subjected to physicochemical stress , either during their residence in the cell culture media or during the steps of purification , formulation , filling , and storage , which stem mainly from changes in ph , temperature , and ionic strength . the degree of modification determines the stability of the protein , which may expose buried cysteine residues or broken disulfide bridges , allowing for the measurement of the free thiols as a quality attribute for ensuring the safety and efficacy of a biopharmaceutical product . during the last years spectroscopic techniques used for recombinant protein characterization are gaining interest in order to identify specific structural properties , folding phenomena , and stability based on the absorptivity response , fluorescence , and light dispersion effects . several protocols for quantifying free thiols have been described in the past to study protein structure and stability . however , to the best of our knowledge , there are no validation protocols and criteria for the measurement of free thiols in biopharmaceuticals , and there is no correlation between the structural conditions and biological activity of the biotherapeutic protein and their exposure of thiol groups . colorimetric methods , like 5,5 - dithionitrobenzoic acid ( dtnb ) , are useful to analyze free thiols above the nanomolar range but at the expense of large protein quantities . to overcome this , dylight maleimide ( dlm ) can be used for the nanomolar range , taking advantage of their fluorescence properties and selectivity against thiol groups , well known for maleimides . both orthogonal techniques can provide a wider concentration range for thiol analysis and a verification of the total content or trend observed for a protein , when analyzed under different conditions . native , denaturing , and denaturing - reducing conditions allow for the quantification of the free cysteine 's thiols coming from degradation , unfolding , or broken disulfide bridges buried in the protein and the total cysteines content within the protein , respectively . in every case , a correlation against the integrity of the protein structure can be done by the use of spectroscopic techniques such as circular dichroism ( cd ) and intrinsic fluorescence lifetime measured by time - correlated single photon counting method ( tcspc ) . protein identity and oxidationcan be tested from the comparison of the theoretical content of cysteines that comes from the amino acid sequence . this information together contributes to the physicochemical characterization and the establishment of quality attributes and comparability criteria among products . the use of suitable methodologies for intended purpose , mentioned before , plays an essential role in biopharmaceutical companies , as they are feasible tools for bioprocess development , formulations design , and stability studies in order to define product shelf life . here we present a physicochemical comparability study using two orthogonal thiol quantification methods , correlated with other spectroscopic and biological methods , and its validation . l - cysteine hcl , ellman 's reagent , dylight 488 maleimide , and slide - a dialysis cassettes were obtained from thermo scientific ( cincinnati , oh , usa ) . monobasic and dibasic sodium phosphate , sodium citrate , citric acid , mannitol , sucrose , and sodium azide were obtained from j. t. baker ( center valley , pa , usa ) . edta , dithiothreitol ( dtt ) , guanidine hydrochloride ( gdnhcl ) , tris - hcl , polysorbate 80 , crystal violet , dimethyl sulfoxide ( dmso ) , phenylisothiocyanate ( pit ) , and heat inactivated fetal calf serum were obtained from sigma - aldrich ( saint louis , mo , usa ) . human serum complement was obtained from quindel ( san diego , ca , usa ) ; somatropine crs ( batch 3 , code : 50947000 , i d : o12yrg ) was obtained from edqm ph . human serum albumin ( hsa ) batch 4330200029 was purchased from csl behring ag ( king of prussia , pa , usa ) . ( mexico city , mexico ) and 10 kd protein marker part number a26487 for cief batch m205297 was obtained from beckman coulter ( brea , ca , usa ) . dmem medium supplemented with glutamine 6 mm and pyruvate 1 mma375 human melanoma and wil2 - s lymphoma cell lines were purchased from atcc ( manassas , va , usa ) and maintained in a humidified chamber at 37c with 5 % co2 .30 kda centricons were obtained from emd millipore ( billerica , ma , usa ) . mabthera batches , b60360 , b60420 , b60480 , b60490 , b6074b04 , and b6083 , were obtained from f. hoffmann - la roche ltd . enbrel batches , 34359 , 1027881 , 1030760 , g18414 , f65452 , and f40596 , were obtained from amgen inc . kikuzubam batches , 5445110403 , 5433120509 , and 5445100901 , and infinitam ( drug substance ) batches , etpp12001 , etpp12002 , etpp12003 , and etpp12005 from probiomed s.a . de c.v . ( brea , ca ) and a nanodrop 2000 uv - vis spectrophotometer from thermo fisher scientific inc . ( waltham , ma ) were used for dtnb and protein concentration determinations . a fluorolog 3 spectrofluorometer from horiba jobin yvon ( kyoto , japan ) , equipped with a xenon arc lamp of 450 w , was used to obtain fluorescence data ( steady state ) . all sample incubation treatments were carried on a thermomixer comfort from eppendorf ag ( hamburg , germany ) . structural analyses were performed in a circular dichroism j - 815 spectrometer from jasco international co. ltd . intrinsic trp fluorescence lifetime measured by time - correlated single photon counting ( tcspc ) was performed using a 288 nm pulsed diode light source , with pulse duration 1.2 ns . right angle emission was detected at 333 nm with 1 mhz rate using a fluorolog 3 spectrofluorometer from horiba jobin yvon . bioassays absorbance was measured using spectramax plus384 microplate spectrophotometer from molecular devices ( sunnyvale , ca ) using soft max pro software . placebo used for rituximab included nacl 150 mm and 0.14 mm polysorbate 80 in citrate buffer 29 mm ph 6.5 , while placebo used for etanercept was manitol 22 mm and sucrose 3 mm in 10 mm tris buffer ph 7.4 . protein samples were concentrated up to 100 mgml and dialyzed against their corresponding placebos using 30 kda centricons spin columns at 14,000 g for 15 min . etanercept samples for the analysis under denaturing - reducing conditions were additionally digested with neuraminidase using 20 u per mg of protein . protein concentration was therefore adjusted to 20 , 7.5 and 1 mgml for native , denaturing , and denaturing - reducing conditions for dtnb method , respectively .100 mm sodium phosphate and 5 mm edta buffer solution at ph 8.0 were used for dtnb method and 100 mm sodium phosphate , 150 mm sodium chloride , and 5 mm edta buffer solution at ph 7.0 were used for dlm method . protein concentration for dlm methodwas adjusted to 1 mgml either under native or denaturing conditions . for denaturing conditions of both methodspbs with gdnhcl was added to samples to give a final concentration of 5 m , while for denaturing - reducing conditions gdnhcl was taken up to 7.2 m and 10 mm dtt , and samples were incubated for 30 min at 30c . once samples were reduced , dtt was eliminated by buffer exchange with 100 mm sodium phosphate , 5 mm edta buffer solution at ph 8.0 , passed over nap - 5 columns . protein concentration under denaturing - reducing conditions was estimated at this step , prior derivatization . all solutions including placebos were degassed by sonication for 30 min and bubbled with nitrogen during 5 min prior its use , following previous reports that used argon during 15 minutes . placebos were treated like samples for both methods , and absorbance and fluorescence were measured as described below . hsa was diafiltered against purified water , using 30 kda centricons , until triptofanate acetate was eliminated .1 mg of purified hsa was treated with 2.5 mm dtt on pbs at ph 7.0 for 30 min at 22c . dtt was eliminated by buffer exchange with pbs at ph 7.0 , in nap - 5 columns . dtt was added in order to reduce sulfenic acids from cys 34 to sulfhydryl groups . derivatization was carried at a final concentration of 500 m of dtnb and 1 h incubation at 30c . absorbance was measured at 412 nm and 280 nm in 1 cm qs quartz cuvettes . dlm derivatization was carried at a final concentration of 0.125 mm and 2 h incubation at 25c . extensive dialysis against 100 mm sodium phosphate , 150 mm sodium chloride , and 5 mm edta buffer solution at ph 7.0 , ( phosphate buffer solution ( pbs ) ) using 10 kda slide - a dialysis units , was performed after derivatization . protein concentration under native and denaturing conditions was adjusted to 1 mgml using 100 mm sodium phosphate , 150 mm sodium chloride , 5 mm edta buffer , and gdnhcl 5 m solution at ph 7.0 . dlm fluorescence emission was measured at 518 nm , exciting at 493 nm in 3 mm qs quartz cuvettes at 25c 1c as previous studies recommended . to neutralize amines under native conditions , 50 l of a mixture 50 : 50 ( v / v ) phenyl isothiocyanate , dmso , was added into 10 aliquots of 5 l with continuous stirring to 0.4 ml of a solution at 2.5 mg / ml of protein in carbonate buffer ( 0.1 m ph 9.0 ) . samples were incubated at 53c for 8 h , in the dark . afterwards , the buffer was exchanged with 15 mm sodium azide in pbs using nap - 5 columns recommended by . prior derivatization , dlm was taken from a stock solution at 12.5 mm and was allowed to react with 50 l of 50 mm cysteine in pbs for two hours at 25c , 600 rpm . sample preparation and derivatization were done as described using cysteine reacted with dlm instead of dlm ( sections 2.3.2 and 2.3.3 ) ; expecting not having covalent reactions against proteins , dlm - cysteine was left to form van der waals or hydrophobic interactions with proteins . circular dichroism studies were carried out in a jasco - 815 spectropolarimeter , using a modified method previously reported . etanercept and rituximab samples were diluted to 0.1 mgml for far - uv cd spectra ( 190300 nm ) in a 0.1 cm quartz cell and to 3.3 mgml for near - uv cd spectra ( 240350 nm ) either under native , denaturing , or denaturing - reducing conditions . samples were diluted with 10 mm phosphate ph 7.0 for native conditions and with 10 mm phosphate and 5 m gdnhcl buffer solution ph 7.0 for denaturing conditions , while for denaturing - reducing conditions samples were treated with 10 mm dtt for 30 min at 25c and buffer exchanged using nap - 5 columns against 10 mm phosphate buffer solution and gdnhcl 0.5 m ph 3.0 . samples were reconstituted to 10 mm phosphate buffer solution and gdnhcl 3 m ph 3.0 final concentration . spectrum was acquired as an average of 3 scans using 0.01 ( far - uv cd ) and 0.1 cm ( near - uv cd ) quartz cuvettes at 1 nm data pitch , 1 nm bandwidth , and 50 nmmin of scan speed . measurements were done in a fluorolog 3 spectrofluorometer from horiba jobin yvon ( kyoto , japan ) , equipped with a xenon arc lamp . etanercept samples were adjusted to 2 mgml with 10 mm phosphate buffer solution at ph 7.0 and measured . data analysis for tcspc was done using das6 software ; fitting results were adjusted using 2 exponential decays for least squares regression . briefly , cell antiproliferation was induced by rituximab through complement - dependent cytotoxicity ( cdc ) to cd20 expressing cells ( wil2 - s , atcc crl - 8885 ) in the presence of human serum complement ( quidel , ca , usa ) . cells viability , following cdc treatment with rituximab , was measured using alamar blue probe ( promega , wi , usa ) . rituximab potency was expressed against a reference standard of 100 % potency . neutralizing activity of etanercept over tnf - was measured as the viability of a375 cell line treated with actinomycin d . cells were seeded in triplicate at 510 / well into a 96 - well plate in dmem medium supplemented with 10 % ( v / v ) fbs and then were incubated for 24 h , 37c at 5 % co2 . medium containing tnf - at 21 ng / ml was added to the cell culture ( final concentration 7 ng / ml ) ; then , etanercept dilutions within the range of 5.2 to 60.0 ng / ml and actinomycin d at 390 ng / ml ( final concentration 130 ng / ml ) were added to the cell culture . cells were incubated for additional 18 h at 37c , 5.0 % co2 , and then fixed with formaldehyde 5 % adding 50 l to each well and dyed with 10 % violet crystal . the ed50 value was calculated by four - parameter logistic curve fit using soft - max pro software . ( 1 ) determination coefficient for l - cysteine hcl standard curve ( 5200 m ) must be 0.980 . ( 2 ) absorbance measurement at 412 nm from placebo ( blank ) , water , and a thiol - free protein must be 0.005 au . ( 3 ) cys / protein molar ratio under denaturing - reducing conditions of somatropine crs standard must be 4.00.5 . ( 1 ) determination coefficient for dlm standard curve ( 0.17.5 m ) must be 0.980 . ( 2 ) fluorescence measurement for placebo , water , and a thiol - free protein must be 20,000 cps . sextuplicate samples at 0.4 and 1.0 mgml for etanercept and rituximab , respectively , were analyzed with dtnb and dylight 488 maleimide methods . the intermediate precision aws that two different analysts measured etanercept and rituximab samples in two different days . ( etanercept for dtnb method and rituximab for dlm method ) relative standard deviation 10 % was expected . triplicates of somatropine crs and hsa at 1 mgml were prepared under denaturing - reducing and native conditions , respectively . hsa was treated with 2.5 mm dtt , 30 min , 22c prior analysis , in order to reduce oxidized cysteines . recovery percentages , expected from 90 to 110 % and 60 to 140 % , were calculated against theoretical cys / protein molar ratio of 4 and 1 , for somatropine and hsa , respectively . somatropine and hsa concentrations were determined from absorbance at 280 nm , using values of 0.82 glcm , 0.531 glcm and molecular masses of 22 , 124 gmol and 66 , 470 gmol , respectively . placebos , somatropine crs at 1 mgml , ga ( negative control , thiol - free peptide ) at 20 mgml , and 10 kd protein marker at 1 mgml were analyzed under denaturing - reducing and native conditions . absorbance and fluorescence measurements according to the system suitability were expected . the lowest concentration level for dtnb and dlm method curves with a rsd cysteine stock solutions ( 1.5 mm ) were done gravimetrically , diluted to 5 m , 10 m , 25 m , 50 m , 100 m , and 200 m , and analyzed in triplicates using dtnb method . dlm was incubated with pbs , 50 mm cysteine for 2 h at 25c . dilutions to 7.5 m , 5 m , 3.75 m 1.85 m , 1 m , 0.25 m , and 0.1 m were analyzed in triplicates using dlm method . dlm concentration was determined by absorbance at 493 nm using an extinction coefficient of 70,000 mcm . two group sample comparisons were done by unpaired and two - tailed student 's t - test . t - test comparison was calculated depending on f - max test , using microsoft excel software . error bars are depicted as standard error of mean ( se ) . for dtnb method , thiol concentration was calculated from cysteine standard curves depending on the specific condition related to the assay . absorbance at 412 nm was recorded and interpolated into curve made with phosphate buffer 0.1 m , ph 8.0 , for native and denaturing - reducing conditions , while curve made with phosphate buffer 0.1 m and 5 m gdnhcl , ph 8.0 , was used for denaturing conditions . for dlm method , this curve was made with phosphate buffer 0.1 m and 5 m gdnhcl , ph 7.0 , and was used either for native or denaturing conditions . cysteine nanomoles were divided by the protein nanomoles to obtain cys / prot molar ratio . dtnb method showed no difference between placebo ( blank ) and glatiramer acetate ( ga ) ( thiol free peptide ) at 20 mgml , with absorbance values of 0.0005 and 0.0014 au for placebos and ga , respectively . glatiramer acetate ( ga ) , a random copolymer of tyrosine , lysine , alanine , and glutamic acid , was used as negative control . fluorescence measurements about 1600 and 5000 cps were obtained for placebo and 10 kda protein marker , respectively . linear range using l - cysteine as standard was demonstrated from 5 m to 200 m derivatizing with dtnb , while for dlm method , using dylight 488 maleimide linked to l - cysteine as standard , it was demonstrated from 0.1 m to 7.5 m ( table 1 ) . analysis of three different batches of mabthera and kikuzubam shows no statistical differences for their cys / protein molar ratios , with p values of 0.6233 and 0.7499 for dtnb and dlm methods , respectively . cys / rituximab average molar ratios were 0.018 and 0.020 for mabthera and kikuzubam , respectively , using dtnb method with a confidence interval at 95 % from 0.0253 to 0.0096 for mabthera , while 0.064 and 0.068 average molar ratios were obtained for the products using dlm method with a confidence interval at 95 % from 0.0865 to 0.0408 for mabthera ( tables 2 and 3 ) . enbrel and infinitam showed no statistical difference with dtnb method ( p = 0.0758 ) , while dlm method reveals statistical differences among products ( p 0.001 ) . cys / etanercept average molar ratios were 0.024 and 0.014 for enbrel and infinitam , respectively , using dtnb method with a confidence interval at 95 % from 0.0361 to 0.0120 for enbrel , while 0.084 and 0.047 average molar ratios were obtained for the products using dlm method with a confidence interval at 95 % from 0.0978 to 0.0710 for enbrel ( tables 2 and 3 ) . like native conditions , ga was used as negative control , with its absorbance values lower than 0.002 au , for dtnb method , while fluorescence from 10 kda protein marker was below 5000 cps for dlm method ( table 4 ) . linear range , using l - cysteine as standard , was demonstrated from 5 m to 100 m for dtnb method and , using dlm linked to l - cysteine as standard , was from 0.1 m to 7.5 m for dlm method ( table 1 ) . statistical analysis shows equality between mabthera and kikuzubam with p values of 0.4022 and 0.8027 for dtnb and dlm methods , respectively . cys / rituximab average molar ratios of 0.602 and 0.558 with a confidence interval of 95 % from 0.6977 to 0.5068 for mabthera were obtained using dtnb method , while 1.149 and 1.076 average molar ratios were obtained for mabthera and kikuzubam , respectively , using dlm method with a confidence interval from 1.7010 to 0.5973 for mabthera ( tables 2 and 3 ) . statistical equality was obtained for enbrel and infinitam with p values of 0.2450 and 0.7983 using dtnb and dlm methods , respectively . cys / etanercept mean molar ratios of 0.447 and 0.498 for enbrel and infinitam , respectively , with a confidence interval at 95 % from 0.5388 to 0.3548 for enbrel , were obtained with dtnb method . mean molar ratios of 0.7787 and 0.7618 using dlm method were obtained for enbrel and infinitam , respectively , with a confidence interval at 95 % from 0.9488 to 0.6087 for enbrel ( tables 2 and 3 ) . unlike native or denaturing conditions , the analysis of free thiols under denaturing - reducing conditions is a direct measure of the total cysteines residues within the protein . somatropine crs was used as positive control to verify the measurement , with an expected cys / somatropine mean molar ratio of 4 ( table 4 ) . the expected number of cysteine residues in rituximab , as an igg isotype i , is 32 . dtnb method results for mabthera and kikuzubam were 31.60.8 and 30.81.5 , respectively . statistical analysis showed a p value of 0.1475 between products with a confidence interval at 95 % from 32.3 to 31.0 for mabthera ( table 2 ) . dtnb method results for enbrel and infinitam under denaturing - reducing conditions were 56.62.5 and 58.91.4 , respectively . statistical analysis reveals a p value of 0.0229 with a confidence interval at 95 % from 58.6 to 56.6 for enbrel ( table 2 ) . dtnb method , complied with all the previously designed acceptance criteria , was based on results obtained during analytical development . repeatability results show better performance for dlm method than for dtnb method under native conditions ; rsd was decreased from 17.3 % to 13.3 % . also 20 times less protein concentration was used ( 1 mgml instead of 20 mgml ) and a lower quantification limit ( 5 m to 0.1 m ) linearity was evaluated using the solution buffers according to the different conditions ( native and denaturing ; for denaturing - reducing conditions samples were previously buffer exchanged with native conditions ' buffer ) as components can affect standard curve slopes . calibration curve slopes for cysteine standard using dtnb method under denaturing conditions and native conditions showed a difference of 27.3 % ( table 1 ) . calculated recovery percentage under denaturing - reducing conditions , using somatropine crs , was 99.5 % for dtnb method . calculated recovery percentage under native conditions , using hsa , for dlm method was 101.0 % ( table 4 ) . analysis of free thiol groups under native conditions of the evaluated rituximab products ( kikuzubam and mabthera ) showed equivalent cys / protein molar ratios , for dlm ( p = 0.7499 ) and dtnb method ( p = 0.6233 ) , suggesting that both molecules have comparable structures and physicochemical integrity ( tables 2 and 3 ) . cys / protein molar ratios within the range of 0.010 to 0.020 have been reported for therapeutic mab 's under native conditions using dtnb as derivatizing agent . these values , derived from current commercial products , predicted to maintain biological , physicochemical , and structural integrity , can be used as a reference range , where the preservation of the folded structure inhibits the exposure of sulfhydryl groups and their oxidation to sulfenic , sulfinic , or sulfonic groups while restraining disulfide bridges cleavage . cys / protein molar ratios of rituximab products , using dtnb method , rely within the aforementioned range , with 0.020 and 0.018 for kikuzubam and mabthera , respectively ( table 2 ) . however , dlm method revealed higher cys / protein molar ratios , although comparability between products was confirmed , with 0.068 and 0.064 for kikuzubam and mabthera , respectively ( table 3 ) . the enhancement of fluorescence was expected from dlm noncovalent interactions towards hydrophobic patches within the protein or by the covalent reaction against amine substituents , although dlm reaction against primary amines was diminished using a low dlm concentration and a buffer at ph 7.5 . nevertheless , dlm method results for glatiramer acetate ( thiol - free peptide ) , used as a negative control , revealed that fluorescence response was only reduced at placebo - response levels after phenylisothiocyanate titration against its amine groups ( table 5 ) . it was possible to make this phenomenon evident because of the basic nature and high lysine concentration of glatiramer acetate ( pi around 10.5 ) , showing a cys / protein molar ratio of 0.045 under native conditions , far from the 0.003 ratio after amine neutralization , where dlm - amine interactions were avoided and expected null response was obtained ( table 5 ) . nonspecific interactions of dlm were tested using cysteine to neutralize dlm prior contact with protein , resulting in a cys / protein molar ratio 0.001 for glatiramer acetate , under native conditions , which is an indicative of absence of those interactions ( table 5 ) . instead , cys / protein molar ratios from rituximab and etanercept tested with cysteine neutralized dlm were 0.023 and 0.035 , respectively , enlightening a protein - specific dlm interaction , related to three - dimensional conformation , polarity , and electrical charge . overall , this explains the high cys / protein molar ratios observed for dlm method and the unsuitability of arithmetical corrections . it is worth to mention that maleimide artifacts are major drawbacks of dlm method , although the fundamental reasons need to be understood and overcome , which is out of the scope of this paper . under denaturing conditions , cys / protein molar ratios of both rituximab products show no statistical difference , using dlm ( p = 0.8027 ) and dtnb methods ( p = 0.4022 ) . this confirmed structural similarity among products because of the content of buried thiol substituents , coming from nonbonded or broken disulfide bridges , revealing the same susceptibility towards degradation ( tables 2 and 3 ) . although , under denaturing conditions , cys / protein molar ratios are 15 to 30 times higher than native conditions ( tables 2 and 3 ) , no impact in the biological activity of rituximab products was detected ( table 6 ) . this is in accordance with published data that shows no impact on the biological activity of a mab that binds cd20 containing unpaired cysteines . once fully denatured and reduced , 32 exposed cysteine residues are expected in rituximab according to its primary sequence . cys / protein molar ratio measurements , under denaturing - reducing conditions using dtnb method , showed that mabthera and kikuzubam are comparable ( p = 0.1475 ) and have a mean value of 31.6 and 30.8 cysteine residues , respectively ( table 2 ) . kikuzubam difference against the theoretical value ( 3.8 % ) relies within the rsd of the method ( table 1 ) . quantitation of buried thiol substituents that come from broken and unpaired disulfide bridges or the total cysteine content within denatured and denatured - reduced rituximab products , respectively , was suggested from structural analysis by cd spectra . as seen from figure 1 rituximab secondary structure ( far cd - uv spectra ) , that comprises mainly domains of two beta sheets linked by a disulfide bridge and compressed by - antiparallel barrel , this was also observed for tertiary structure response ( near cd - uv spectra ) , as signal from native condition was diminished under denaturing conditions and lost when rituximab was treated with a reducing agent , thus confirming structural similarity among rituximab products . cd analyses for etanercept also confirmed structural similarity among the evaluated products , infinitam and enbrel , revealing comparable loss of structure from native to denaturing - reducing conditions for near cd - uv and far cd - uv spectra ( figure 1 ) . thiol analysis under native conditions , using dlm method , showed a higher content of free and exposed thiols for enbrel than infinitam , while dtnb method showed no statistical difference between cys / protein molar ratios of etanercept products ( p = 0.0758 ) ( tables 2 and 3 ) . statistical analysis of cys / protein molar ratios for dlm method revealed a p value 0.001 , suggesting a higher amount of denatured molecules in enbrel batches or different glycosylation patterns that could affect thiol determination ( steric hindrance ) . however intrinsic trp fluorescence lifetime ( table 7 ) and biological activity through tnf - neutralization assays ( table 6 ) revealed no significant differences among products . these results make evident the same dlm artifacts seen for rituximab and glatiramer acetate , mostly relevant for the measure of cys / protein molar ratios 1.0 . actually , under denaturing conditions , statistical equality was observed using dlm ( p = 0.7984 ) and dtnb ( p = 0.2450 ) methods . for the analysis of etanercept products , under reducing conditions , samples were previously desialylated with neuraminidase in order to avoid the electrostatic repulsion of dtnb dye against sialic acids and to diminish steric hindrance effects that could came from the high glycan density of etanercept ( up to 30 % of the total molecular mass ) and its high negative charge density ( 0.1 to 0.2 nmoles of sialic acids per mole of etanercept ) . neuraminidase treatment improved the measurement from the initially obtained cys / protein mean molar ratio around 20 , far from the expected value of 58 , to mean molar ratios of 56.6 and 58.9 for enbrel and infinitam , respectively . enbrel difference against the expected value was 2.5 % ; thus it is meaningless to establish a difference among products , despite the fact that both groups are not statistically equal ( p = 0.0229 ) . thus differences against theoretical values of rituximab and etanercept products are due to sample properties , possibly due to their vulnerability to be oxidized , although degassing of dissolved oxygen for all buffers solutions was performed . however , the observed difference in both pharmaceutical ingredients is lower than the rsd of the method ( tables 2 and 3 ) . validation of dlm and dtnb methods complies with the specified acceptance criteria ( table 1 ) . specificity test for dtnb method using glatiramer acetate ( negative control ) showed a mean absorbance of 0.0014 , around 10 times below than etanercept under native conditions , thus being acceptable and confirmatory of all results ( table 4 ) . for dlm method the use of glatiramer acetate was not possible because of nonspecific reactions .10 kda protein marker was proved to be suitable as negative control , but absolute cys / protein mean molar ratios need to be taken carefully when being 1.0 ; although being repeatable ( rsd 17.3 % ) and consistent , still they are beneath the artifacts values . it is worth to mention that high rsd for dtnb and dlm , in tables 2 and 3 , comes mainly from batch to batch variability than method uncertainty ; therefore they can be useful for measured dispersion between batches and also in new molecules process development . accuracy for dtnb method under denaturing - reducing conditions was assured using somatropine crs as positive control ; results showed a cys / protein mean molar ratio of 3.98 , which corresponds to the theoretical value of 4 ( 99.5 % recovery ) ( table 4 ) . measurements with dlm method , using hsa as positive control , proved to be accurate around the theoretical value of 1 ( 101.0 % recovery ) , which is above nonspecific dlm - protein values ( tables 4 and 5 ) . therefore , orthogonal dlm and dtnb methodologies showed that structural integrity of biopharmaceuticals produced by different manufacturers is comparable , kikuzubam versus mabthera and infinitam versus enbrel , respectively . several drawbacks were identified and some overcame ; these arise mainly from the lack of detailed descriptions in the published procedures ; issues , causes , and solutions are listed in a troubleshooting guide ( table 8 ) that highlights aspects of the methodology here described . dtnb and dlm methods were proven to be suitable according to validation results for the characterization and comparability analyses of free thiol groups in biopharmaceuticals , whereas dlm method showed to be at least 50 times more sensitive than dtnb method ( demonstrated by comparison of curves , quantitation limit ) . however , it could not be used in the low range thiol quantification because several interactions of dlm towards protein amines and hydrophobic patches are present . using both techniques , comparability between rituximab and etanercept products coming from different manufacturerswas proved for thiol analysis under native , denaturing , and denaturing - reducing conditions and confirmed by cd , tcspc , and biological activity assays . each selected condition was chosen as a measure of the protein either : intact , denatured without disulfide bridges disruption , or denatured reduced with all its thiol substituents exposed . nowadays , to the best of our knowledge , several studies report the use of dtnb and dlm methods for different purposes ; however in this study we recommended some suggestions to reduce variability of measurements , high background , over thiol quantification and also increase the method sensitivity in order to have successful method performance . here we reported the capabilities of both colorimetric and fluorometric methods to determine free reactive thiols under different protein conditions , in order to demonstrate the protein structural correspondence between biosimilars and innovator drug products .\noutput:\n" }, { "from": "agent", "value": "protein structure depends on weak interactions and covalent bonds , like disulfide bridges , established according to the environmental conditions . here , we present the validation of two spectroscopic methodologies for the measurement of free and unoxidized thiols , as an attribute of structural integrity , using 5,5 - dithionitrobenzoic acid ( dtnb ) and dylight maleimide ( dlm ) as derivatizing agents . these methods were used to compare rituximab and etanercept products from different manufacturers . physicochemical comparability was demonstrated for rituximab products as dtnb showed no statistical differences under native , denaturing , and denaturing - reducing conditions , with student 's t - test p values of 0.6233 , 0.4022 , and 0.1475 , respectively . while for etanercept products no statistical differences were observed under native ( p = 0.0758 ) and denaturing conditions ( p = 0.2450 ) , denaturing - reducing conditions revealed cysteine contents of 98 % and 101 % , towards the theoretical value of 58 , for the evaluated products from different etanercept manufacturers . dlm supported equality between rituximab products under native ( p = 0.7499 ) and denaturing conditions ( p = 0.8027 ) , but showed statistical differences among etanercept products under native conditions ( p < 0.001 ) . dlm suggested that infinitam has fewer exposed thiols than enbrel , although dtnb method , circular dichroism ( cd ) , fluorescence ( tcspc ) , and activity ( tnf neutralization ) showed no differences . overall , this data revealed the capabilities and drawbacks of each thiol quantification technique and their correlation with protein structure ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: structural and functional disorders of the central nervous system may be influenced by genetic conditions . for instance , children with down syndrome ( ds ) who have an extra chromosome 21 present with many brain disorders that cause retarded psychomotor development and problems with learning . there are 3 groups of problems affecting the central nervous system that cause psychomotor dysfunctions in ds children : changes in the shape and number of neurons and changes in cerebrum size ; disorders of the central nervous system maturation ; pathophysiological processes : degenerative processes of the nervous system , disorders in neuronal apoptosis regulation , overexpression of genes that code beta amyloid precursor protein ( app ) processes leading to decreased release of neurotransmitters . significant changes in cerebrum size appear after the 6 month of life and deletions in motor development are also seen from the 6 month of life . volumetric neuroimaging studies have revealed smaller frontal , occipital , and temporal lobes with smaller hippocampal volume , reduced corpus callosum and cerebellum size , decreased superior temporal gyrus , and brainstem volume . for instance , smaller frontal lobe volumes cause problems with voluntary activities , cognitive deficits , and gait quality , especially in adult life . increasing ageis associated with grey matter reduction in the frontal , parietal , and temporal cortex , similar to alterations in mild alzheimer s disease . hypoplasia of the cerebellum in ds children is a symptom caused by overexpression of the gart gene . a study using mr reported that granule cell density is reduced in ds children to approximately 70 % of typically developing children . cerebellum hypoplasia is responsible for muscle hypotonia , problems with movement fluency and axial control ( axial truncal muscle ) , and body balance , coordination , and speech disorders . corpus callosum size is also reduced in children with ds and is associated with mental retardation , problems with coordination , and atypical laterality . differences are seen from the 22 week of gestation but there are strong manifestations from the 6 month of life . pathophysiologic processes caused by overexpression of genes located in chromosome 21 lead to : degenerative processes of the nervous system caused by overexpression of genes coding peroxidase enzymes : cu / zn superoxide dismutase ( cu zn - sod ; sod -1 ) , disorders in neuronal apoptosis regulation , overexpression of genes that code beta amyloid precursor protein ( app ) , processes leading to decreased ratio of neurotransmitters . increased sod - 1 activity in the mitochondrial intermembrane space is responsible for cognitive impairment and delays motor development by increased free radical generation and chronic oxidative stress . ds subjects , mostly those above 40 years of age , present with progressive cognitive impairment resembling the cognitive profile of alzheimer s disease . overexpression of beta amyloid precursor protein ( app ) initiates and stimulates neurodegenerative processes resulting in the occurrence of aggregated amyloid fibrils in the brain . it is believed that the overexpression of app located in chromosome 21 leads to earlier neuronal apoptosis , which is why the occurrence of dementia symptoms or even alzheimer s disease is frequent in patients with ds , mostly as they become older . other neuropathological alzheimer - type changes in ds patients are the reduced ratio of neurotransmitters such as n - acetylaspartate ( naa ) , choline ( cho ) , myoinositol ( mi ) , gamma - amino butyric acid ( gaba ) in temporal lobes and reduced ratio of naa , cho , mi , glutamate glutamine complex ( glx ) in frontal lobes . the reduced ratio of neurotransmitters such as glx and naa in frontal lobes and naa , cho , mi , gaba in temporal lobes and in the hippocampus in ds children may influence delay in developing motor abilities and may lead to problems associated with memorizing and learning . nowadays , the prognosis for children with ds is better than in previous years thanks to advanced medical treatment and educational opportunities . although congenital heart diseases ( in4050 % of children with ds ) are still the main cause of death , the survival rate in ds has improved and is reported to be up to 91 % at 1 year of age and 85 % at age 10 . similarly , despite increased leukemia susceptibility in children with ds , overall survival rates are approximately 80 % , which is why life expectancy has increased so much . all of the medical problems that may affect children with ds ( e.g. , thyroid problems , epilepsy , gastrointestinal defects , orthopedic problems such as atlantoaxial instability , and even leukemia ) can be treated by specialists . the purpose of therapy for children with ds is to help them stay healthy and increase their quality of life as early as possible , which is why there are diagnostic methods to determine as early as possible whether the child has ds . some of these methods are prenatal , for example amniocentesis , chorionic villus sampling , pregnancy ultrasound , or non - invasive prenatal testing ( nipt ) , which is a molecular approach for assessing fetal aneuploidy using cell - free fetal deoxyribonucleic acid ( cffdna ) from the plasma of pregnant women . others are performed after birth , such as fluorescent in situ hybridization followed by chromosomal karyotyping . knowing that the pathological changes in the number of neurons and changes in the cerebrum size , maturation disorders of the central nervous system , and pathophysiological processes lead to delays in motor development , especially from the 6 month of life , we speculated that motor abilities that children develop after the second half of infancy may develop later than other functions of motor development , in part because children with ds require more time and effort than typically developing children to acquire antigravitional skills , such as standing . the aim of this study was to examine motor abilities and determine which are significantly delayed in ds children , even if they receive physical therapy . another purpose of the study was to assess the functional balance as a feature of quality of movement . the aim of this study was to examine motor abilities and determine which are significantly delayed in ds children , even if they receive physical therapy . another purpose of the study was to assess the functional balance as a feature of quality of movement . the study was approved by the bioethics committee of the poznan university of medical sciences in 2009 ( consent ref . written consents were obtained from the parents of the children enrolled in the study and the consents were signed on behalf of the children enrolled . the study group consisted of 79 children with ds ( 42 boys , 37 girls ) , mean age : 6 years and 3 months 4 years and 6 months . participants were divided into 3 groups according to ( i ) age : 3 years old , 36 years old , 6 years old , and ( ii ) motor impairment rating scale : mild ( snr1 ) , moderate ( snr2 ) and severe ( snr3 ) . the therapy was individually tailored for each child because children with ds have a wide variety of symptoms , although that all of them had laxity , low muscle tone , and psychomotor development deficits . the therapy for each child included developing psychomotor abilities according to individual motor skills assessed in each child . therapy also focussed on developing good quality of motor function and normalization of muscle tone . training balance reaction and postural maintenance and change were also addressed in each child s therapy based on the knowledge of cerebellar hypoplasia , which presents in children with ds . even children who were younger than 12 months were trained by ndt bobath therapists , trying to normalize the muscle tone by influencing tone patterns , training protection reaction , and balance reaction appropriate to the age of the child and individual level of motor development . the aim of the therapy of the youngest research group was to facilitate standing position with good postural reactions . the study took place in the greater poland region , and involved patients with ds coming from towns and villages of the greater poland region . even if a child come from rural areas , she or he had the same therapists , and the same frequency of therapeutic meetings as a child who come from urban areas because each person in research group attended to poznan rehabilitation and orthopedic center , yesassociation or to leszno to polish association for persons with mental disability kolo . the economic status and education of parents and the influence of these factors on therapy were not considered . the study was approved by the bioethics committee of the poznan university of medical sciences . the scale was first validated for children with cerebral palsy and is now also validated for children with ds . there was no control group because the original validation sample of gmfm - 88 included children aged from 5 months to 16 years , so the score of gmfm - 88 is the percentage of the score of the original validation group . a 5 - year - old child without any motor disabilities should present all functions included on the gmfm - 88 scale . gmfm - 88 consists of motor functions grouped into 5 dimensions : 1 ) gmfm 88 a : lying and rolling ( 17 items ) , 2 ) gmfm 88 b : sitting ( 20 items ) , 3 ) gmfm 88 c : crawling and kneeling ( 14 items ) , 4 ) gmfm 88 d : standing ( 13 ) , 5 ) gmfm 88 e : walking , running , and jumping ( 24 items ) . according to the gmfm - 88 guidelines formulated for the assessment of ds children , the environment should be as familiar for the children as possible to encourage the performance of activities . sometimes , several meetings were needed to assess a child because of the tendency of ds children to get distracted . assessment of each child was completed within 1 week to avoid changes in motor functions which otherwise might have appeared due to child development . the 0 value indicated that a child did not initiate the task , 1 point the child performed less than 10 % of a task , 2 points the child partially completed an item ( 10 % to 100 % ) , 3 points the child completed an activity ( 100 % ) . body balance was estimated by pediatric balance scale ( pbs ) among children who were able to stand unsupported and who were older than 4 years old . we assessed all 14 items of pbs on the criterion , based on a 04 scale . for instance , retrieving an object from the floor or changing from a standing position to sitting with each test session lasting 1020 minutes . a child who successfully completed all the tasks could gain a maximum of 56 points . the nearer to maximum the sore is , the better the functional balance in the context of everyday life . a few unrelated samples were tested using kruskal - wallis test with dunn s multiple comparison post - test . the study was approved by the bioethics committee of the poznan university of medical sciences in 2009 ( consent ref . written consents were obtained from the parents of the children enrolled in the study and the consents were signed on behalf of the children enrolled . the study group consisted of 79 children with ds ( 42 boys , 37 girls ) , mean age : 6 years and 3 months 4 years and 6 months . participants were divided into 3 groups according to ( i ) age : 3 years old , 36 years old , 6 years old , and ( ii ) motor impairment rating scale : mild ( snr1 ) , moderate ( snr2 ) and severe ( snr3 ) . the therapy was individually tailored for each child because children with ds have a wide variety of symptoms , although that all of them had laxity , low muscle tone , and psychomotor development deficits . the therapy for each child included developing psychomotor abilities according to individual motor skills assessed in each child . therapy also focussed on developing good quality of motor function and normalization of muscle tone . training balance reaction and postural maintenance and change were also addressed in each child s therapy based on the knowledge of cerebellar hypoplasia , which presents in children with ds . even children who were younger than 12 months were trained by ndt bobath therapists , trying to normalize the muscle tone by influencing tone patterns , training protection reaction , and balance reaction appropriate to the age of the child and individual level of motor development . the aim of the therapy of the youngest research group was to facilitate standing position with good postural reactions . the study took place in the greater poland region , and involved patients with ds coming from towns and villages of the greater poland region . even if a child come from rural areas , she or he had the same therapists , and the same frequency of therapeutic meetings as a child who come from urban areas because each person in research group attended to poznan rehabilitation and orthopedic center , yesassociation or to leszno to polish association for persons with mental disability kolo . the economic status and education of parents and the influence of these factors on therapy were not considered . the study was approved by the bioethics committee of the poznan university of medical sciences . the scale was first validated for children with cerebral palsy and is now also validated for children with ds . there was no control group because the original validation sample of gmfm - 88 included children aged from 5 months to 16 years , so the score of gmfm - 88 is the percentage of the score of the original validation group . a 5 - year - old child without any motor disabilities should present all functions included on the gmfm - 88 scale . gmfm - 88 consists of motor functions grouped into 5 dimensions : 1 ) gmfm 88 a : lying and rolling ( 17 items ) , 2 ) gmfm 88 b : sitting ( 20 items ) , 3 ) gmfm 88 c : crawling and kneeling ( 14 items ) , 4 ) gmfm 88 d : standing ( 13 ) , 5 ) gmfm 88 e : walking , running , and jumping ( 24 items ) . according to the gmfm - 88 guidelines formulated for the assessment of ds children , the environment should be as familiar for the children as possible to encourage the performance of activities . sometimes , several meetings were needed to assess a child because of the tendency of ds children to get distracted . assessment of each child was completed within 1 week to avoid changes in motor functions which otherwise might have appeared due to child development . the 0 value indicated that a child did not initiate the task , 1 point the child performed less than 10 % of a task , 2 points the child partially completed an item ( 10 % to 100 % ) , 3 points the child completed an activity ( 100 % ) . body balance was estimated by pediatric balance scale ( pbs ) among children who were able to stand unsupported and who were older than 4 years old . we assessed all 14 items of pbs on the criterion , based on a 04 scale . for instance , retrieving an object from the floor or changing from a standing position to sitting with each test session lasting 1020 minutes . a child who successfully completed all the tasks could gain a maximum of 56 points . the nearer to maximum the sore is , the better the functional balance in the context of everyday life . a few unrelated samples were tested using kruskal - wallis test with dunn s multiple comparison post - test . the median gmfm - 88 score for girls was 89.66 % ( 5.1 % 100 % ) and for boys : 91.11 % ( 12.43 % 100 % ) . there was no significant difference between motor functions in ds children in different groups divided according to motor impairment rating scale , p = 0.56 ( table 1 ) . however , when both age and motor impairment scale were taken into account , a significant difference between groups was observed ( table 2 ) . two groups with moderate ( snr 2 ) and severe ( snr3 ) motor impairment were combined because of the small number of children with severe motor impairment . many functions included in gmfm - 88 were considered with respect to the typical age when they should be achieved . the standing position was achieved by 10 % of children in the first age group ( 3 years old ) and 95 % of children aged 3 to 6 years . similarly , the walking ability was performed by 10 % of children under 3 years old and by 95 % of children aged 3 to 6 years . functional balance was assessed in 44 children older than 4 years in the research group ( 26 girls and 18 boys ) by pediatric balance scale ( pbs ) . there was a statistically significant correlation between pbs scores and gmfm - 88 scores , r = 0.7 ; p 0.0001 , especially between balance scores and gmfm 88 e ( walking , running , jumping ) ( r = 0.64 ; p 0,0001 ( figure 1 ) . it is common knowledge that ds children develop slowly , but it may not be obvious how slowly their development progresses . none of the ds children in the age group 3 to 6 years old developed 100 % of the motor functions evaluated by gmfm - 88 . it is important to notice that all gmfm - 88 functions should be performed by typically developing children at age 5 . there are other studies showing that 6 - year - old children with ds do not develop functions typical for 5 - year - old children who develop normally . the difference in developing motor abilities increases with age and it is approximately 2 years in 5 - year old ds children retarded motor functions may cause delay in acquiring abilities in areas of development such as mental , emotional , and social . the ability to stand and walk makes their hands free , which enables them to hold an object . it also allows children to better see things because the head is higher than in the earlier stages of motor development . however , the pathophysiological processes in the brain , changes in the cerebrum size and maturation disorders of the central nervous system , observed in ds children especially from the 6 month of life , cause dysfunctions in motor development . for this reason , psychomotor development is thought to be delayed . when the development of the central nervous system is delayed and the musculoskeletal system is disordered because of low muscle tone , laxity of tendons , and instability of articulations , then the motor development may be delayed . the majority of ds children ( 95 % ) in the present study achieved the ability to stand upright at between 3 and 6 years of age . children without any disabilities acquire the ability to stand when they are 910 months old . the results of the present study that the standing position is the most difficult for infants with down syndrome to develop in the first year of life , corroborate those obtained by the aforementioned author as well as piper ( 2010 ) and pereira ( 2013 ) . the standing position is achieved after acquiring postural alignment between the head , torso , and hip . the ability to stand is difficult for children with an additional 21 chromosome because it engages both the flexor and extensor of the trunk . this is why children with ds should attend physiotherapy sessions to improve postural alignment , as well as proper distribution of muscle tone and symmetry , thus minimizing psychomotor development delay . in addition , to maintain the standing position children have to be able to keep their bodies balanced . because ds children have cerebellar hypoplasia , their balance reaction can be disordered . most ds children included in the study began walking when they were older than 3 years . the result is similar to the period of developing the walking ability shown by melyn and white . in his study , palisano described the 3 year of life as when children with ds develop the ability to walk . typically developing children learn to walk during their 1 year of life and sometimes during the 2 year of life . walking ability is an example of a motor function that gives children independence , and affects cognitive , social , and subsequent motor development . childcare starts to be easier when they begin to walk because there is no need to constantly lift and hold infants to change their position . another reason for delay in developing walking is inherent joint laxity and muscle hypotonia of individuals with ds . the low muscle tone and postural abnormalities seen in ds children delay the development of body balance and disorders the balance reactions in the upright position , which may delay walking ability . infants with ds begin to walk on average about 1 year later than normal infants ( nd ) . in addition , more individuals with ds appear to have greater instability during walking , particularly in the mediolateral direction and have increased energetic cost . delays in acquiring motor abilities such as independent standing and walking are also affected by pathophysiologic processes and the shape and volume of the brain , especially the cerebellum , caused by the additional chromosome 21 . at presentthere is no radiological examination we could have used in this study to measure the size of the brain , including the cerebellum . because there was no indication to perform an examination such as mr or ct , we did not perform any radiological measurement of the cerebellum in the present study . in addition , some children would have needed anesthesia during mr or ct , which may be problematic for them and their parents . knowing that the cerebellum is responsible for maintaining balance , pbs was performed to show cerebellar function . in the measurement of balance , various other methods may be used , including observation of oculovestibular reflexes , vestibulospinal reflexes , and tests using posturography . dysfunction in balance may lead to problems in psychomotor abilities , especially those that are more advanced in childhood motor development , classified as gmfmthe study showed that there is a correlation between psychomotor ability and gmfm 88 , especially gmfm - 88 e. balance functions play an important role in development of motor abilities . the cerebellum is important not only for balance but also limb coordination and locomotion , and it is well known that the cerebellum is involved in developing motor function at each level of learning motor abilities . this is why the therapy for children with ds should consider developing motor skills and improving balance . the limitations of the study are associated with the expensive mr examination , h - mrs ; therefore , information about brain disorders was derived from research literature available in pubmed . the limitations of the study are associated with the expensive mr examination , h - mrs ; therefore , information about brain disorders was derived from research literature available in pubmed . psychomotor development , especially standing and walking ability , is delayed in ds children even if they attend physical therapy sessions . functional balance should be considered in therapy of children with ds because balance may influence development of motor abilities , especially those that are developed in childhood .\noutput:\n" }, { "from": "agent", "value": "backgroundchildren with down syndrome ( ds ) present with delays in motor development . the reduced size of the cerebrum , brain maturation disorders , and pathophysiological processes lead to motor development delay . the aim of this study was to examine the gross motor function and estimate what motor abilities are significantly delayed in children with down syndrome even if they attend physical therapy sessions . another purpose of the study was to assess the functional balance.material / methodsthe study group consisted of 79 children with ds ( 42 boys , 37 girls ) , average age 6 years and 3 months 4 years and 6 months . participants were divided into 3 groups according to ( i ) age : < 3 years old , 36 years old , and > 6 years old ; and ( ii ) motor impairment scale : mild ( snr 1 ) , moderate ( snr 2 ) , and severe ( snr 3 ) . children were assessed using the gross motor function measure - 88 ( gmfm - 88 ) and pediatric balance scale ( pbs ) . resultsnone of the assessed children developed all the functions included in gmfm - 88 . the standing position was achieved at the specified age by 10 % of children in the first age group ( < 3 years old ) and 95 % of children aged 36 years . similarly , the walking ability was performed by 10 % of children under 3 years old and by 95 % of children aged 36 years . the median score of pbs was 50 points ( min . 34 p. max . 56 p. ) . there was a statistically significant correlation between pbs scores and gmfm - 88 scores , r = 0.7 ; p < 0.0001 , and between balance scores and gmfm 88 e ( walking , running , jumping ) ( r = 0.64 ; p < 0.0001 ) . conclusionsmotor development , especially standing position and walking ability , is delayed in children with down syndrome . balance and motor functions are correlated with each other , so both aspects of development should be consider together in physical therapy of children with down syndrome ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: avulsion of the aortic valve commissure as a cause of acute aortic valve regurgitation is mostly due to trauma , infective endocarditis , or ascending aortic dissection . an 80 - year - old male with hypertension was seen in the emergency department with acute onset dyspnea . echocardiogram revealed left ventricular hypertrophy with adequate systolic function , prolapse of the noncoronary cusp , and incomplete coaptation of the right coronary and noncoronary cusps with severe aortic valve regurgitation . aortic valve replacement was performed , and the patient was alive and well 4 years after surgery . a review of the literature showed that more than three - fourths of the similar cases occurred in males , and about half in patients with hypertension and those 60 years of age or older . in the case of acute aortic regurgitation without a history of trauma , infection , or valvotomy , when 2 prolapsed aortic cusps are observed by echocardiography in the absence of an intimal tear of the ascending aorta , an avulsion of the aortic commissure should be suspected , especially in males with hypertension who are 60 years of age or older . acute aortic valve regurgitation ( ar ) caused by detachment of the aortic valve commissure from the aortic wall , also known as avulsion of the aortic valve commissure , is usually related to blunt chest trauma , infective endocarditis , or ascending aortic dissection . it had not been mentioned in recent guidelines or in cardiology textbooks as a cause of acute ar . we present a case of acute ar resulting from nontraumatic avulsion of the aortic valve commissure , and review the relevant literature with a focus on potential risk factors and echocardiographic findings . an 80 - year - old male presented to the emergency department with dizziness and shortness of breath for 1 day . he had hypertension , but denied any history of dyspnea , fever , chills , or chest pain . physical examination revealed tachycardia , a systolic - diastolic murmur grade 2/6 over the aortic area / left lower sternal border , bilateral rales of lungs without lower legs pitting edema , and a distended urinary bladder . echocardiography revealed a hypertrophic interventricular septum , concentric left ventricular hypertrophy ( lvh ) , adequate left ventricular systolic function with an ejection fraction of 68 % , prolapse of the noncoronary cusp ( ncc ) ( fig .1 a ) , and incomplete coaptation of right coronary cusp ( rcc ) and ncc ( fig . 1b and c ) with severe ar ( fig . ( a ) echocardiography parasternal long - axis view showed prolapse of the noncoronary cusp in the diastolic phase . ( b ) m - mode at the level of the aortic valve showed incomplete coaptation of right and noncoronary cusps . ( c ) parasternal short - axis view showed incomplete coaptation of right , left , and noncoronary cusps . the patient underwent intubation for impending respiratory failure , and a cardiovascular surgeon was consulted . cardiac catheterization revealed a normal coronary angiogram and left ventricular systolic function , as well as severe ar without aortic dissection . chest computed tomography showed aneurysmal dilatation of the ascending aorta with aortic valve calcifications and moderate bilateral pleural effusions . mild atherosclerotic changes of the aortic cusps and prolapse of the left coronary cusp ( lcc ) and ncc ( fig .2 a ) , as well as a transverse crack measuring approximately 0.8 cm in length over the lccin addition , concentric lvh and a fusiform aneurysm of the ascending aorta ( with a maximal diameter of 4.8 cm ) were noted . aortic valve replacement was performed with a hancock - ii 25 mm porcine valve and longitudinal aortoplasty . ( a ) intraoperative photograph showing mild atherosclerotic changes of the aortic cusps , and prolapse of left and noncoronary cusps . ( b ) after removal of the aortic cusps , local avulsion of the aortic commissure between left and noncoronary cusps was observed ( arrow ) . histopathology examination of the aortic valve showed myxoid degeneration , fibrosis , and calcification ( fig . examination of the ascending aorta revealed myxoid degeneration and fragmentation of elastic fibers ( fig . postoperatively , the patient was transferred to the intensive care unit with ventilator and inotropic ( dobutamine ) support and continuous intravenous dormicum sedation . he was classified as new york heart association class i when last seen 4 years after the surgery . ( a ) the 3 aortic cusps that were surgically removed exhibited white and firm deformed valvular tissue . ( b ) histopathological examination of the aortic valve showed myxoid degeneration , fibrosis , and calcification ( 40 ) . ( c ) examination of the ascending aorta revealed myxoid degeneration and fragmentation of elastic fibers ( 40 ) . ( d ) examination of the ascending aorta revealed myxoid degeneration and fragmentation of elastic fibers ( 400 ) . acute ar can be secondary to trauma , infective endocarditis , type a aortic dissection , annuloaortic ectasia , rheumatic fever , syphilis , bicuspid aortic valve , iatrogenic secondary to a procedure ( such as aortic balloon valvotomy ) , or a failed surgical valve repair . nontraumatic aortic valve commissure avulsion is rare , but should be considered in a case of ar . the diagnosis of avulsion of the aortic commissure is difficult prior to surgery on the basis of imaging alone . transthoracic or transesophageal echocardiography may demonstrate aortic valve prolapse with severe ar , which is a nonspecific finding . a more specific finding is the presence of 2 prolapsed aortic cusps , and a limited intimal tear on the commissure may be observed just above the valves . in addition to avulsion of a commissure , the possible etiologies of aortic valve prolapse include floppy valve , fraying valve , excessive tissue within a congenital bicuspid valve , ruptured cusp , laceration of the aorta , and ventricular septal defect with displacement of the aortic root . as prolapse of the cusps may be observed on echocardiography , the commissural tear may mimic an intimal tear in a type a aortic dissection , or a mass - like lesion . in such a case , transesophageal echocardiography may demonstrate a normal aortic valve with a dissection flap in the proximal ascending aorta just above the aortic valve , but without the intimal tear extending to the aortic root . this is different from a type a aortic dissection , in which an intimal tear may be noted in the ascending aorta . in a case of ar without a history of trauma , infection , or valvotomy , when 2 prolapsed aortic cusps are observed in the absence of an intimal tear of the ascending aorta , an avulsion of the aortic commissure should be suspected . hypertension plays an important role in the formation of a nontraumatic aortic valve commissure avulsion . using avulsion and dehiscence combining with aortic valve commissure as key words to search literature indexed in pubmed , we found 5 and 10 cases of nontraumatic aortic valve commissure avulsion , respectively , and we identified 9 more cases from the references of the reports retrieved ( table 1 ) . including our case , of the 20 cases in which information regarding hypertension was available , 10 had hypertension . other potential risk factors included male sex ( 17/22 ) and older age ( 13/22 at 60 years or older ) . the possible pathogenesis of avulsion of the aortic commissure includes high blood pressure , especially high diastolic pressure which avulses a weakened commissure that may be normal or have underlying atherosclerosis , fibrosis , hyalinosis , cystic medial necrosis , pseudoxanthoma elasticum , annuloaortic ectasia , granulation , elastic fiber tear or myxomatous changes . the aortic valve cusps may be normal , or have mucoid degeneration , atherosclerosis , or myxomatous changes . medical therapy failed in 3 early cases of avulsion of the aortic commissure , and the patients died . surgery aimed at either repair or replacement of the aortic valve or aortic root is lifesaving , with only 1 death out of 22 cases . in the presence of aortic medial disease , connective tissue disease , atherosclerosis , or myxomatous degeneration of aortic valve , if avulsion of the commissure is accompanied by aortic root dilation or avulsion of the aortic cusp , aortic root replacement is indicated . aortic root replacement was performed in 1 case of 2 dehiscences of the aortic valve commissure and cusp in order to reinforce the aortic wall around the left coronary artery ostium . direct suturing of the degenerated and avulsed commissure to the diseased aortic root usually leads to a poor long - term prognosis . hirata et al sutured the detached commissure to the aortic wall in a patient with pseudoxanthoma elasticum , but the long - term results were unknown . newcomb et al initially used teflon pledgeted polypropylene sutures to suspend the commissure to its previous position in a case with a normal aortic valve , but changed to aortic valve replacement due to persistent mild to moderate aortic regurgitation . charokopos et al suspended the detached commissure to its proper position using 3 teflon pledgeted 20 sutures combined with bioglue to reinforce the site of repair which was sutured in 2 layers . shimamoto et al reported a novel method for repair of commissural detachment in 2 cases with annuloaortic ectasia and 1 case with a dilated sinotubular junction . he reimplanted the root in a valsalva graft , and used 20 polyester sutures for the first row and 40 polypropylene sutures for the second row . therefore , we chose aortic valve replacement using a porcine valve , which achieved a good outcome at 4 years after surgery . in conclusion , transthoracic and transesophageal echocardiography may demonstrate 2 prolapsed aortic cusps with or without a limited intimal tear on the commissure just above the valves . hypertension plays an important role in the formation of an avulsion in patients with atherosclerosis , medial necrosis , myxomatous changes , granulation , fibrosis , hyalinosis , or fibrosis . surgery is the only reliable method available to treat this condition , which includes aortic valve repair , replacement , and aortic root replacement .\noutput:\n" }, { "from": "agent", "value": "abstractbackground : avulsion of the aortic valve commissure as a cause of acute aortic valve regurgitation is mostly due to trauma , infective endocarditis , or ascending aortic dissection . nontraumatic avulsion of the aortic valve commissure is very rare . we reviewed the literature and analyzed potential risk factors of nontraumatic avulsion.case presentation : an 80 - year - old male with hypertension was seen in the emergency department with acute onset dyspnea . echocardiogram revealed left ventricular hypertrophy with adequate systolic function , prolapse of the noncoronary cusp , and incomplete coaptation of the right coronary and noncoronary cusps with severe aortic valve regurgitation . surgery revealed an avulsion between the left coronary and noncoronary cusps . histopathology examination of the aortic valve showed myxoid degeneration , fibrosis , and calcification . examination of the ascending aorta revealed myxoid degeneration and fragmentation of elastic fibers . aortic valve replacement was performed , and the patient was alive and well 4 years after surgery . a review of the literature showed that more than three - fourths of the similar cases occurred in males , and about half in patients with hypertension and those 60 years of age or older.conclusions : in the case of acute aortic regurgitation without a history of trauma , infection , or valvotomy , when 2 prolapsed aortic cusps are observed by echocardiography in the absence of an intimal tear of the ascending aorta , an avulsion of the aortic commissure should be suspected , especially in males with hypertension who are 60 years of age or older ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: due to the importance of electrostatic interactions in biomolecular systems , a variety of computational methods have been developed for evaluating electrostatic forces and energies [ see ( 16 ) and references therein ] . typical computational electrostatics methods for biomolecular systems can be loosely grouped into two categories : explicit solvent methods , which treat solvent molecules in full molecular detail , and implicit solvent methods , which include solvent solute interactions in averaged or continuum fashion . implicit solvent methods are , by definition , limited in detail and therefore lack the atomic - scale accuracy of their explicit solvent counterparts . however , implicit solvent methods have gained increasing popularity , in part due to their elimination of the extensive sampling of solvent configurations required with explicit models ( 1,37 ) . the basic ingredients of an implicit solvent electrostatics calculation are environmental parameters such as temperature , solvent dielectric and ionic strength ; biomolecular atomic coordinates ; and parameters for atomic charges and radii . while the environmental parameters are relatively straightforward to specify , the remaining two ingredients can often be difficult to supply . in particular , most biomolecular structures in the protein data bank ( pdb ) ( 8 ) do not contain hydrogen atoms , and many are also missing a fraction of the heavy atom coordinates . the addition of hydrogens and the reconstruction of these missing coordinates is not a trivial process ; electrostatic properties obtained from the repaired structures can often be very sensitive to the manner in which missing atoms are added and protonation states are assigned ( 9,10 ) . furthermore , inconsistent atomic nomenclature and other force field idiosyncrasies can often make the assignment of atomic charges and radii a cumbersome task . an additional obstacle to the use of pdb structures in electrostatics calculations and other biomolecular computational tasks is the accurate assignment of parameters to non - standard residues and ligands . previously ( 9 ) , we introduced the freely available pdb2pqr service ( http://pdb2pqr.sf.net/ ) , which was designed to facilitate the setup and execution of continuum electrostatics calculations from pdb data , particularly by non - experts . the original pdb2pqr server automated many of the common tasks of preparing structures for continuum electrostatics calculations , including adding a limited number of missing heavy atoms to biomolecular structures , estimating titration states and protonating biomolecules in a manner consistent with favorable hydrogen bonding , assigning charge and radius parameters from a variety of force fields , and finally generatingpqr output ( a pdb - like format with the occupancy and temperature factor columns replaced with charge q and radius r , respectively ) compatible with several popular computational biology electrostatics [ apbs ( 10 ) and mead ( 11 ) ] , docking [ autodock ( 12 ) ] , simulation [ amber ( 13 ) ] and visualization [ vmd ( 14 ) , pymol ( 15 ) and pmv ( 16 ) ] packages . since its inception , we have continued to expand the capabilities of the pdb2pqr server to address the challenges associated with ligand parameterization in pdb files and to include several new features . the pdb2pqr web service is driven by a modular , python - based collection of routines , which provides considerable flexibility to the software and permits non - interactive , high - throughput usage . the service is available via a number of web mirrors listed at http://pdb2pqr.sf.net/ . the source code is also available for download from this link , and due to the portability of python , pdb2pqr can be executed on a wide range of platforms . figure 1 outlines the typical workflow of a pdb2pqr job and summarizes the features described in more detail below . the procedures for reconstruction of missing atoms , hydrogen optimization and apbs input generation were described previously ( 9 ) and are essentially unchanged in the current version of the software . since their initial development , these atom reconstruction options have been greatly improved through a number of bug fixes and code optimization , robust support for separate biomolecular chains , and improved chain termini optimization . the process begins with an input pdb file and ends with a parameterized pqr file and , optionally , an apbs input file . the process begins with an input pdb file and ends with a parameterized pqr file and , optionally , an apbs input file . protonation states for titratable protein groups are assigned by propka 1.0 ( http://propka.ki.ku.dk ) ( 17 ) . propka utilizes a very fast empirical method to predict pka values and is successful at predicting unusual pka values . recently , a comparative study of several protein pka prediction methods showed that propka was the most accurate method overall ( 18 ) . propka uses a heuristic method to compute the pka perturbations due to desolvation , hydrogen bonding and charge charge interactions . in the current version of propka , contributions from nucleic acids as well as heteroatoms such as bound ions or ligands to the pka values are not included . note that , during the course of titration state assignment , propka generates statistics on residue hydrogen bonding , location and solvent accessibility and coulombic interactions . this information is available to users as a downloadable text file provided at the end of the pdb2pqr / propka calculation . pdb2pqr currently allows users to assign protein and ( where available ) nucleic acid parameters based on explicit solvent amber99 ( 19 ) and charmm27 ( 20 ) force fields , the parse continuum electrostatics force field ( 21 ) , a poisson boltzmann - optimized force field by tan et al . user - defined parameters can be uploaded to the pdb2pqr server in a simple flat - file format described in the pdb2pqr user guide . additionally , pdb2pqr output can be customized to include a variety of atom naming schemes , including amber99 ( 19 ) , charmm22 ( 20 ) , parse ( 21 ) and an internal naming scheme based on the iupac naming recommendations ( 23 ) . this flexibility in nomenclature was included to facilitate import of pdb2pqr output into other modeling packages . map which is output at the end of every pdb2pqr calculation and presents a table of atoms name / number , residue name , chain name , amber atom type and charmm atom type to aid in the interpretation of parameter assignment and the development of user - defined charges and radii . the calculation of ligand charges necessitates detailed information on molecular structure and protonation states due to the large variation in the covalent structures of small - molecule protein ligands . the current version of pdb2pqr therefore requires the ligand structure , protonation state and formal charge to be specified by the user in the popular mol2 ( 24 ) format . ligand structures in mol2 format are readily available from popular molecular modeling software and free web services such as prodrg ( 25 ) . future versions of pdb2pqr will include a pdb2mol2 parser and automatic assignment of default ligand protonation states from a small - molecule pka database . the calculation of ligand charges in pdb2pqr is based on the partial equalization of orbital electronegativities ( peoe ) procedure developed by gasteiger and marsili ( 26 ) . in the peoe procedure , orbital electronegativitiesare linked to partial atomic charges q by a polynomial expansion ( = a + bq + cq + dq ) . the coefficients a , b , c and d were optimized by gasteiger and marsili using gas phase data on ionization potentials and electron affinities . we utilize a peoe algorithm , which has been optimized by czodrowski et al . to obtain better agreement between theoretical and experimental solvation energies for a set of small molecules including the polar amino acids ( 27 ) . the resulting peoe_pb charges have been tested for small - molecule complexes with trypsin , thrombin ( 28 ) and hiv protease ( 29 ) , and have been found to give results that are in agreement with experimental values . the current version of pdb2pqr supports an extension directory for user - defined processing of pdb2pqr output . such extensions might include alternative naming schemes , identification and parameterization of other molecule types , additional hydrogen bond processing , etc . however , it is straightforward for users to download the pdb2pqr software and setup their own web servers with additional functionality based on custom extensions . protonation states for titratable protein groups are assigned by propka 1.0 ( http://propka.ki.ku.dk ) ( 17 ) . propka utilizes a very fast empirical method to predict pka values and is successful at predicting unusual pka values . recently , a comparative study of several protein pka prediction methods showed that propka was the most accurate method overall ( 18 ) . propka uses a heuristic method to compute the pka perturbations due to desolvation , hydrogen bonding and chargecontributions from nucleic acids as well as heteroatoms such as bound ions or ligands to the pka values are not included . note that , during the course of titration state assignment , propka generates statistics on residue hydrogen bonding , location and solvent accessibility and coulombic interactions . this information is available to users as a downloadable text file provided at the end of the pdb2pqr / propka calculation . pdb2pqr currently allows users to assign protein and ( where available ) nucleic acid parameters based on explicit solvent amber99 ( 19 ) and charmm27 ( 20 ) force fields , the parse continuum electrostatics force field ( 21 ) , a poisson boltzmann - optimized force field by tan et al . user - defined parameters can be uploaded to the pdb2pqr server in a simple flat - file format described in the pdb2pqr user guide . additionally , pdb2pqr output can be customized to include a variety of atom naming schemes , including amber99 ( 19 ) , charmm22 ( 20 ) , parse ( 21 ) and an internal naming scheme based on the iupac naming recommendations ( 23 ) . this flexibility in nomenclature was included to facilitate import of pdb2pqr output into other modeling packages . map which is output at the end of every pdb2pqr calculation and presents a table of atoms name / number , residue name , chain name , amber atom type and charmm atom type to aid in the interpretation of parameter assignment and the development of user - defined charges and radii . the calculation of ligand charges necessitates detailed information on molecular structure and protonation states due to the large variation in the covalent structures of small - molecule protein ligands . the current version of pdb2pqr therefore requires the ligand structure , protonation state and formal charge to be specified by the user in the popular mol2 ( 24 ) format . ligand structures in mol2 format are readily available from popular molecular modeling software and free web services such as prodrg ( 25 ) . future versions of pdb2pqr will include a pdb2mol2 parser and automatic assignment of default ligand protonation states from a small - molecule pka database . the calculation of ligand charges in pdb2pqr is based on the partial equalization of orbital electronegativities ( peoe ) procedure developed by gasteiger and marsili ( 26 ) . in the peoe procedure , orbital electronegativitiesare linked to partial atomic charges q by a polynomial expansion ( = a + bq + cq + dq ) . the coefficients a , b , c and d were optimized by gasteiger and marsili using gas phase data on ionization potentials and electron affinities . we utilize a peoe algorithm , which has been optimized by czodrowski et al . to obtain better agreement between theoretical and experimental solvation energies for a set of small molecules including the polar amino acids ( 27 ) . the resulting peoe_pb charges have been tested for small - molecule complexes with trypsin , thrombin ( 28 ) and hiv protease ( 29 ) , and have been found to give results that are in agreement with experimental values . such extensions might include alternative naming schemes , identification and parameterization of other molecule types , additional hydrogen bond processing , etc . however , it is straightforward for users to download the pdb2pqr software and setup their own web servers with additional functionality based on custom extensions . we have described a number of new features for the free pdb2pqr web server , a service which helps users prepare molecular structures for further computational work by modeling missing atoms , assigning charges and titration states , and providing a mechanism for assignment of ligand parameters . readers interested in these tasks might also be interested in other servers , which provide complementary services for biomolecular structure processing ( 3032 ) . planned future developments for pdb2pqr include the construction of a pdb2mol2 parser to allow for the automatic parameterization of non - protein atoms , the correct treatment of protein post - translational modification , and the integration of a poissonwe anticipate that the pdb2pqr service will continue to be a helpful addition to the portfolio of tools available to the structural and computational biology communities .\noutput:\n" }, { "from": "agent", "value": "real - world observable physical and chemical characteristics are increasingly being calculated from the 3d structures of biomolecules . methods for calculating pka values , binding constants of ligands , and changes in protein stability are readily available , but often the limiting step in computational biology is the conversion of pdb structures into formats ready for use with biomolecular simulation software . the continued sophistication and integration of biomolecular simulation methods for systems - and genome - wide studies requires a fast , robust , physically realistic and standardized protocol for preparing macromolecular structures for biophysical algorithms . as described previously , the pdb2pqr web server addresses this need for electrostatic field calculations ( dolinsky et al . , nucleic acids research , 32 , w665w667 , 2004 ) . here we report the significantly expanded pdb2pqr that includes the following features : robust standalone command line support , improved pka estimation via the propka framework , ligand parameterization via peoe_pb charge methodology , expanded set of force fields and easily incorporated user - defined parameters via xml input files , and improvement of atom addition and optimization code . these features are available through a new web interface ( http://pdb2pqr.sourceforge.net/ ) , which offers users a wide range of options for pdb file conversion , modification and parameterization ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: national cancer institute estimates that 192370 - female and 1910 - male new cases of breast cancer will appear in the united states in 2009 . also , it is estimated that 40170 females and 440 males will die of this cancer . also , mammography remains one of the best modalities used by radiologists for early detection of cancerous tumors before clinical symptoms appear . a cad system can be used to assist radiologists in differentiating between normal and suspicious regions , and thus reducing number of unnecessary biopsies and false - positive rates ( fp ) by the radiologist , fp is an erroneous positive diagnosis when the breast is normal . several rough set - based and fuzzy - based methods have been proposed in literature for breast cancer detection . hassanien and ali proposed a rough set technique for feature reduction and classification - rule generation from mammographic images . hu et al . proposed a rough set model ( rsm ) based on relational algebra that replaces the traditional rough set models . their proposed algorithm is very efficient in large data sets and may be adaptable for real - time applications . proposed a hybrid machine learning algorithm by hybridizing k - nearest neighbor algorithm with a fuzzy - artificial immune method where a 10-fold cross validation criterion was used to compute algorithm 's accuracy . hassanien proposed a hybrid method that first uses fuzzy logic to enhance image contrast , extracts region of interest , and enhances its edges . then , the gray - level cooccurrence matrix is used as a feature extraction method . rsm can also be used as a feature selection algorithm while fuzzy logic as a classifier . in , an algorithm was proposed that combined pca , ica , and fuzzy classifier for breast cancer detection . membership functions of fuzzy sets were generated from the product space of the selected features . also , the selected features from pca - ica phase suffered from data inconsistency which degraded the fuzzy classifier performance . in this work , an integration of pca , ica , rough set , and fuzzy classifier to identify and label suspicious regions from digitized mammograms is developed . results of this system showed a higher efficiency in detecting suspicious regions and reducing false - negative ( fn ) rates in comparison with the results of where fn is an erroneous negative diagnosis but the breast tissue has cancer . this work presents a new approach since the mapping range is integrated into the rough set model as opposed to being part of a fuzzy classifier as was the case with . the rsm is integrated into the proposed system as a feature subset selection method in order to reduce the impact of data inconsistency . finally , the membership functions of the fuzzy sets are based on the mean and standard deviation of the testing data . in an algorithmwas proposed that combined ica with rsm for breast cancer detection where ica was used for feature extraction and reduction while in this work pca is used for feature reduction since pca is superior to ica in dimensionality reduction which will enhance the ica performance , and since it is recommended to preprocess the data through whitening prior to ica as a tool to reduce the complexity of the problem , pca was a natural choice since whitening is an intrinsic step in pca . the novelty of this work is the integration of rsm for feature selection with a fuzzy classifier as well as generating the framework for the integration of the pca , ica , rsm , and fuzzy classifier for breast cancer detection . section 3 presents fuzzy logic adaptation while the proposed approach is presented in section 4 . this means that most of the information contained in the original vector can be represented by a much smaller vector after the pca stage . in this paper , pca is used as a dimensionality and noise reduction module . ica is a statistical technique that can be used to extract hidden features within a set of data . a mammographic image x can be expressed as a linear mixture of a set of features or basis functions ai as shown in ( 1 ) : ( 1 ) x = iaisi where si are stochastic coefficients that are data dependent . other transforms such as wavelets and gabor assume basis vectors that are independent from data while ica assumes basis vectors that costumed to the data under consideration . using matrix notations , ( 1 ) can be expressed as shown in ( 2 ) : ( 2 ) x = as where s is a matrix contains the source components and a is the mixing matrix . this means that a mammographic image consists of a mixture of source components s. their combination can be described using the coefficients of the mixing matrix a which can be used as extracted features that describe efficiently any normal and suspicious region . the ica algorithm estimates the separating matrix w ( inverse of a ) that makes the source components s as statistically independent as possible with non - gaussian ( super - or sub - gaussian ) distribution which results in obtaining independent components as shown in ( 3 ) . this means that a should be a square matrix which can be achieved by preprocessing of pca : ( 3 ) s = wx the ica algorithm can be presented as an optimization process of which an objective function is modeled to minimize statistical dependency between the source components . the statistical estimation of the w and s matrices is a result of this optimization process . the dependency between the source components can be minimized using several suggested methods such as minimizing the mutual information of the components representation , maximizing their likelihood , or maximizing their non - gaussianity . rsm determines and removes the dispensable attributes representing the redundant information within the data while it aims to keep the core attributes representing the minimum essential information . by relaxing the core algorithm , the selected reduct should have the same discernibility and representation power as the original data . the cardinality of a set is defined as the number of elements in the set . for example , table 1 shows three selected features for 8 images ( symbols are used instead of pixel values for simplicity ) . the cardinality of table 1 is ( 4 ) | i | = 6 objects , where i = { feature 1 , feature 2 , feature 3 , decision } . core attributes should be in every reduct to ensure correct classification . hu et al . defined the core attributes by ( 5 ) as ( 5 ) | icj | | icjd | 1 , where i is the decision matrix i = [ cd ] , c is the condition attributes ( selected features ) , d is the decision attribute ( normal or suspicious image ) , and cj is the current attribute to be classified as a core or not . the merit value of an attribute or the significance of the attribute is calculated using ( 6 ) which is a measure of the degree of dependency for an attribute on the condition and decision attributes : ( 6 ) s ( cj ) = | i | | icj | | i | = 1 | icj | | i | . for example , in table 1 , the 2nd and the 8th objects are said to be consistent . on the other hand , inconsistent objects are conflicting objects since they have same selected features but belong to different classes . rough set model is used in this work to reduce number of inconsistent objects . fuzzy logic is proved to be a powerful tool to handle and process noisy and vague data . they allow partial set membership and overlapping between fuzzy set definitions which should simplify the classification phase as opposed to crisp rules that are restricted to either a membership or nonmembership to the set . also , they can be expressed in terms of linguistic statements based on expert knowledge . finally , the interpretability of the results can be improved by fitting fuzzy rules to the labeled observed data . figure 1 shows , for example , that the object x has a membership degree of 0.7 to the fuzzy setseveral approaches have been developed for automatic derivation of fuzzy rules from the labeled observed data such as genetic algorithm , neuro - fuzzy , and fuzzy clustering . in all , the derived fuzzy rules should be accurate , compact , and linguistically interpretable . fuzzy if - then rules are used to implement membership function of fuzzy sets as shown in ( 7 ) : ( 7 ) if antecedent then consequent [ weight ] . the weight is a number in the interval [ 0.0 , 1.0 ] that can be evaluated based on the antecedent numbers . for example , a tested subimage has a membership degree of 0.7 to the fuzzy setin this case , a single fuzzy if - then rule can be used which produces a classifier output of normal for the tested subimage as shown by the following . ( 8 ) if x is normal [ 0.7 ] and x is suspicious [ 0.3 ] , theny = normalfor example , the union fuzzy operator can be applied using ( 9 ) : ( 9 ) u ( a , b ) = max ( a , b ) , where a and b are the membership degrees for the membership functions . applying ( 9 ) to the antecedent of ( 8 ) will result in selecting the normal fuzzy set from the antecedent with membership degree of 0.7 as follows : ( 10 ) u ( a , b ) = max ( 0.7,0.3 ) = 0.7 . the antecedent results are applied then to the consequent , which is known as the inference step . in this case , the classifier will label the tested subimage as normal . this paper integrates four techniques , namely , pca , ica , rough set , and fuzzy classifier to build a cad system . pca algorithm is used as a dimensionality and noise reduction tool ( prewhitening ) , and ica algorithm is used as a feature extraction module while rsm is used as a feature subset selection module followed by a fuzzy classifier .119 regions of suspicion ( ros ) are manually extracted from mias database based on center of each abnormality of which 51 are malignant and 68 are benign regions . two sets are formed where the first set is with subimages of size 4545 while the second set of size 3535 pixels . four other sets of normal subimages are randomly and automatically extracted such that the first set is of size 3535 and the other sets are of size 4545 pixels from the normal mias mammograms . each set of ros is mixed with one set of normal subimages and then divided into two groups : one for the training phase and the other is for the testing phase as shown in table 2 . a training matrix rtrainnm is constructed by placing training subimages as rows in the matrix where n represents number of training subimages ( 119 ) and m represents size of each square subimages . pca algorithm is used to reduce its dimensionality according to the following equation where v represents number of selected principal components and rmv represents a matrix with the principal components in its columns sorted by descending order according to their variances ( 11 ) rnvr = rtrainnmrmv . in this paper , ica scheme is based on minimizing the mutual information of the source components which can be achieved using cumulants . this is proposed ( a modified version of ) in order to estimate the separating matrix wand the independent source region matrix s in an unsupervised mode as follows . this means that ica is performed on a set of v linear combinations of the original subimages instead of performing it on all n subimages . this should reduce its computational complexity and hence increase its speed : ( 12 ) svm = wvv ( rmv ) t . ( ii ) the change in w is calculated using the natural gradient , that is , ( 13 ) w = [ ig ( s ) st ] w , where is the learning rate ( step size ) , i is the identity matrix , and g ( s ) must be a nonlinear and nonfast growing function . this function is used to measure the statistical dependence between the source components . in this paper , g ( s ) is used as follows : ( 14 ) g ( s ) = f1 ( k3 , k4 ) s2 + f2 ( k3 , k4 ) s3 , where k3 and k4 are the 3rd and 4th cumulants and ( ) indicates hadamard product of two matrices and ( 15 ) f1 ( k3 , k4 ) = 0.5 k3 ( 4.5 k41 ) , f2 ( k3 , k4 ) = 1.5 ( k3 ) 2 + 16k4 ( 4.5 k41 ) , as were defined in . ( iii ) the momentum method is used to boost the convergence speed of ( 13 ) using ( 16 ) w ( t +1 ) = w ( t ) + w ( t1 ) , where is in the range . in this paper , alpha is chosen to be 0.5 . ( iv ) the separating matrix is updated and then normalized : ( 17 ) w ( t +1 ) = w ( t ) + w ( t ) , w ( t +1 ) = w ( t ) w ( t ) . ( v ) stop the algorithm when w converges . a minimum square error approximation of the training matrix rtrainnm can be found using the following equation based on ( 11 ) : ( 18 ) xrec = rnvr rmvt = rtrainnmrmv rmvtrtrainnm . ( 19 ) ( rmv ) t = wvv1svm . and substitution of ( 19 ) into ( 18 ) yields ( 20 ) xrec = rnvrrmvt = rnvrwvv1svm . since xrec is an approximation of rtrain and by comparing ( 20 ) with ( 2 ) , the extracted features from the corresponding training set are estimated using ( 21 ) : ( 21 ) qtrainnv = rnvrwvv1 . first , a testing matrix rtestnm is constructed , where each testing subimage forms a row in the matrix . third , the regions in rtestnm are projected on the reduced data from the training procedure using ( 22 ) : ( 22 ) qtnv = rtestnm rmv . the reduced dimensionality extracted features from the corresponding testing set are estimated using ( 23 ) which is the same principal as ( 21 ) : ( 23 ) qtestnv = qtnvwvv1 . the estimated matrices qtrainnv and qtestnv contain n rows where each row contains v selected features from the corresponding subimage . a linear stretching method is used to map them into a limited range of [ 0 , r ] using ( 24 ) : ( 24 ) q ( x , y ) = ( q ( x , y ) min ( q ) ) ( r ) max ( q ) min ( q ) . there are some inconsistent elements ( subimages ) in the estimated matrices qtrainnv and qtestnv . rough set reduction is used as a subset selection in order to remove features that cause inconsistency and thus improve classification results . the resulting matrix is qtrainnnv , where nn n. construct the decision matrix , inn ( v +1 ) = [ qtrainnnvdnn1 ] , where q contains the condition attributes ( selected features from pca - ica phase ) and d is the decision attribute ( 1 : abnormal , 0 : normal ) . initialize core vector into . check the cardinality for each attribute cj c ; if it satisfies | i cj | / | i cjd | 1 , then update core vector as core = [ corecj ] . initialize core vector into . check the cardinality for each attribute cj c ; if it satisfies | i cj | / | i cjd | 1 , then update core vector as core = [ corecj ] . find reduct attributes using the following procedure which is a modified version of . initialize reduct vector : reduct = core.set rest = i reduct and compute the significance of its attributes using : ( 25 ) s ( cj ) = | i | | icj | | i | = 1 | icj | | i | . let cmax be the attribute with the largest significance value , update reduct as : reduct = [ reductcmax ] update rest = i reduct.if k t or the significance values of the remaining attributes are zeros , stop the procedure . equation ( 26 ) means that reduct has inconsistent elements ( with ratio of t ) greater than or equal to that of the decision matrix : ( 26 ) k = number of inconsistent rows for [ reductd ] number of inconsistent rows for i.else , go to step ( ii ) . initialize reduct vector : reduct = core . set rest = i reduct and compute the significance of its attributes using : ( 25 ) s ( cj ) = | i | | icj | | i | = 1 | icj | | i | . let cmax be the attribute with the largest significance value , update reduct as : reduct = [ reductcmax ] update rest = i reduct . if k t or the significance values of the remaining attributes are zeros , stop the procedure . equation ( 26 ) means that reduct has inconsistent elements ( with ratio of t ) greater than or equal to that of the decision matrix : ( 26 ) k = number of inconsistent rows for [ reductd ] number of inconsistent rows for i. else , go to step ( ii ) . in this step , features are selected from the matrix qtestnv in the same order they were selected from qtrainnv during the training phase . finally , qtrainnvv and qtestnvv are reconstructed with selected reduct features while dispensable features are thrown away . two single fuzzy if - then rules are used to represent the normal and abnormal fuzzy sets . the membership functions of each antecedent fuzzy set are aggregated using the information about the selected feature values of the training subimages . the proposed fuzzy - based classification algorithm can be summarized as follows : two activation functions asn1 and nsn1 are initialized to 0 where each element of them represents the aggregated membership functions of the selected feature values for the corresponding testing subimage . ask1 represents the membership degree of the kth testing subimage to the fuzzy set abnormal . nsk1 represents the membership degree of the kth testing subimage to the fuzzy set normal where 1 k n. ask1 represents the membership degree of the kth testing subimage to the fuzzy set abnormal . nsk1 represents the membership degree of the kth testing subimage to the fuzzy set normal where 1 k n. using ( 27 ) , membership functions of fuzzy sets of the testing subimages are obtained from the mean and standard deviation of their selected features based on the information from the selected feature values of the training subimages : ( 27 ) aij ( xj ) = exp ( ( xjj ) 22 ( j ) 2 ) , where j represents mean of all samples of the current selected feature xj , j represents their standard deviation , and i is an index for the selected features from the training phase . the membership functions are aggregated using ( 29 ) in order to find the degree of activation of each fuzzy set where i is an index for the selected features from the testing phase : ( 29 ) i ( x ) = j = 1naij ( xj ) . by assigning the corresponding testing subimage into the fuzzy set with the maximum degree of activation , a crisp decision is made , that is , normal or abnormal . equation ( 30 ) is used for this purpose where c is used as an index of a testing subimage being identified as normal or abnormal : ( 30 ) c = max ( as ( x ) , ns ( x ) ) . table 3 presents results of using pca - ica - rough - fuzzy ( pirf ) , pca - ica - fuzzy ( pif ) , pca - fuzzy ( pf ) , pca - rough - fuzzy ( prf ) , ica - fuzzy ( if ) , and ica - rough - fuzzy ( irf ) in terms of accuracy , recall , precision , fn rates , and fp rates as computer - aided detection systems . algorithm accuracy is defined as the ratio between the total number of correctly classified subimages to the total number of testing subimages . our proposed pirf cad system shows a robust performance in comparison with the other algorithms . for example , pirf achieved an average accuracy of 77.73 % , pif of 75.21 % , irf of 74.16 % , prf of 71.85 % , pf of 71.64 % , and if of 49.58 % . as table 3 shows , pirf has the highest recall percentage among all the other algorithms while it has an average precision of 73.33 % . as the results show , fuzzy classifier can not be implemented with ica model alone without a dimensionality reduction since , without it , a large number of membership functions will be generated . also , without a feature subset selection module , the classifier task complexity is increased and performance is degraded . furthermore , results indicate that integrating ica model with pf generated better results than integrating rsm with pf . the average accuracy was improved by 4.68 % and false negative rates were improved by 4.76 % if a pca model was used with the ica model while following it with rsm improved its average accuracy by 0.29 % and its fn rates by 6.33 % . integrating rsm improved total pf algorithm performance by 0.29 % but degraded its fn rates by 6.34 % . results also indicate that rsm and pif integration improves accuracy with an average of 3.35 % . comparing the results using fn rates , we find that pirf has an fn of 8.82 % , pif of 12.61 % , irf of 13.66 % , pf of 13.24 % , prf of 14.08 % , and if of 40.34 % . results indicate that using pca as a dimensionality reduction module reduces fn rates in pirf and pf at the expense of a little increase in the fp rates . also , average fn rates are very close to average fp rates in pif and prf algorithms . on the other hand , average fn rates are increased in irf and if algorithms when no dimensionality reduction was integrated . finally , integrating rsm into pif and pf algorithms reduces the number of principal components required to obtain reduct . the previous discussion shows that each one of the integrated techniques ( pca , ica , rsm , and fuzzy classifier ) is necessary and should be implemented in the proposed sequence in order to achieve the highest accuracy rates . an implementation of the pif proposed in reports , table 3 , a lower accuracy than our proposed pirf system in two testing sets while they had same accuracy in the other two testing sets . the average accuracy of the pif in all test sets is 75.21 % while 77.73 % for pirf . fn rates improved in three testing sets for the pirf in comparison with the pif . the average fp and fn rates of the pif are 12.19 % and 12.61 % , respectively , while 13.45 % and 8.82 % for pirf . the average accuracy for pif improved by 3.35 % with pirf system and its average fn rate improved 30.01 % . also , the average selected number of principal components in pirf algorithm which is 7.75 is less than that of pif algorithm which is 9.75 . in other classification methods such as in , three sets of sizes 2020 , 4040 , and 6060 pixels were extracted from mias mammographic images where each set consists of 330 subimages . their results were 65.71 % , 59.36 % , and 82.22 % for the three sets using ica - rough algorithm and 81.9 % , 88.57 % , and 69.27 % using pca - rough algorithm . the proposed cad system uses several parameters that impact performance accuracy such as number of the principal components in the pca algorithm , learning rate and alpha in the ica algorithm , threshold in the reduct process , and mapping range . number of pcs selectedreducing data dimensionality using pca module affects pirf algorithm accuracy . when large number of principal components is selectedhowever , if a small number is selected , extracted features can not be estimated precisely and the fuzzy classifier performance will also be degraded . when large number of principal components is selected , extracted features will have redundant information and therefore will degrade the performance accuracy . however , if a small number is selected , extracted features can not be estimated precisely and the fuzzy classifier performance will also be degraded . table 6 shows the highest accuracy for four testing sets using different numbers of the selected principal components while the other parameters are kept constant . results also show that selecting less than 9 principal components achieves best results in all cases which means that less than 0.65 % of the image features are selected for the 3535 subimages and less than 0.4 % of the image features are selected for the 4545 subimages . this is in agreement with all reported literature that used pca algorithm for dimensionality reduction . on the other hand , figure 3 shows the receiver operating characteristic ( roc ) plot for a different number of selected principal components for testing set number 4 . as the figure indicates , selecting five principal components produces the largest area under the curve which means that it produces the highest average accuracy . learning ratethe estimation of the matrices w and s is affected by the learning rate , which determines the speed and accuracy of convergence to the optimal value . since optimal values of w and s are unknown and they are data dependent , optimal value of can not be estimated adaptively . also , since represents the step size for w , choosing a small value of it ensures accuracy but reduces the speed of convergence . learning rate impact on four testing setsis shown in figures 4 , 5 , 6 , and 7 where all parameters were kept fixed except for the learning rate . figure 8 shows the roc plot for different values of the learning rate for testing set number 4 . as the figure indicates , the smallest value of ( 0.001 ) produces the largest area under the curve which means that it produces the highest average accuracy . the estimation of the matrices w and s is affected by the learning rate , which determines the speed and accuracy of convergence to the optimal value . since optimal values of w and s are unknown and they are data dependent , optimal value of can not be estimated adaptively . also , since represents the step size for w , choosing a small value of it ensures accuracy but reduces the speed of convergence . learning rate impact on four testing setsis shown in figures 4 , 5 , 6 , and 7 where all parameters were kept fixed except for the learning rate . figure 8 shows the roc plot for different values of the learning rate for testing set number 4 . as the figure indicates , the smallest value of ( 0.001 ) produces the largest area under the curve which means that it produces the highest average accuracy . momentum method constantthis constant determines the ratio of the previous w that should be added to the current w to increase the convergence speed of w. since w utilizes the natural gradient to find direction of w toward a minimum point , adding its previous value to its current value pushes it toward the minimum point faster but does not change its direction . this constant determines the ratio of the previous w that should be added to the current w to increase the convergence speed of w. since w utilizes the natural gradient to find direction of w toward a minimum point , adding its previous value to its current value pushes it toward the minimum point faster but does not change its direction . mapping rangein investigating the mapping range values ' effect on the accuracy of the results , we found that mapping the data into a limited range results in accuracy loss but simplifies computational complexity and processing time . figures 9 , 10 , 11 , and 12 show accuracy results versus mapping range for four testing sets while other parameters are kept constant . figure 13 shows the roc plot for different values of the mapping range for testing set number 4 . as the figure indicates , choosing a mapping range in the interval produces the largest area under the curve which correlates with the highest average accuracy . in investigating the mapping range values ' effect on the accuracy of the results , we found that mapping the data into a limited range results in accuracy loss but simplifies computational complexity and processing time . figures 9 , 10 , 11 , and 12 show accuracy results versus mapping range for four testing sets while other parameters are kept constant . figure 13 shows the roc plot for different values of the mapping range for testing set number 4 . as the figure indicates , choosing a mapping range in the interval produces the largest area under the curve which correlates with the highest average accuracy . threshold - ta threshold value t is necessary , ( 26 ) , as a criteria to stop the reduct procedure . the optimum t value is the value , at which the reduct attributes are complete , at which the number of inconsistent rows equals to that of the decision matrix . furthermore , the cropped size impacts the accuracy of the results as shown in table 3 . as the table shows , the larger subimages ( of size 4545 pixels ) resulted in the highest accuracy . a threshold value t is necessary , ( 26 ) , as a criteria to stop the reduct procedure . the optimum t value is the value , at which the reduct attributes are complete , at which the number of inconsistent rows equals to that of the decision matrix . furthermore , the cropped size impacts the accuracy of the results as shown in table 3 . as the table shows , the larger subimages ( of size 4545 pixels ) resulted in the highest accuracy . a computer - aided detection system has been developed and implemented by integrating pca , ica , rsm , and a fuzzy classifier . its performance is compared against the performance of pca - ica - fuzzy , pca - fuzzy , pca - rough - fuzzy , ica - fuzzy , and ica - rough - fuzzy algorithms . results from tables 3 and 4 indicate that pca algorithm should be used in order to reduce fn rates at the expense of fp rates . it is shown that integrating rsm and pca in one algorithm allows for a lower number of principal components to be selected while maintaining the performance accuracy as opposed to use pca without rsm . using ica model andfuzzy classifier produced a cad system with poor performance unless pca is used for dimensionality reduction . rsm is used for further features reduction in order to reduce data inconsistency and consequently improve classifier performance . results also indicate that pca algorithm should be followed be ica algorithm instead of rsm . results of table 3 indicate that the proposed pirf algorithm is robust in comparison with the other algorithms . finally , the proposed cad algorithm reduces the fn rates considerably which is the main concern of cad systems . parameter values as well as block size play a vital role in the system 's performance and an investigation of this relation and perhaps automation of their selection is needed to further improve system 's robustness . although cumulants offer simple computations , they are sensitive to outliers ( large values within the set ) . therefore , an alternative route that may be worthwhile to investigate is to use a learning rule of the ica algorithm that is based on negentropy instead of cumulants .\noutput:\n" }, { "from": "agent", "value": "we propose a computer aided detection ( cad ) system for the detection and classification of suspicious regions in mammographic images . this system combines a dimensionality reduction module ( using principal component analysis ) , a feature extraction module ( using independent component analysis ) , and a feature subset selection module ( using rough set model ) . rough set model is used to reduce the effect of data inconsistency while a fuzzy classifier is integrated into the system to label subimages into normal or abnormal regions . the experimental results show that this system has an accuracy of 84.03 % and a recall percentage of 87.28 % ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the unnecessary prescription of antibiotics to treat viral infections , incorrect prescriptions due to a lack of culturing to determine the exact cause of infection , patients not completing their antibiotic treatments , and the excessive use of antibiotics in stock feed are some of the causes of the increased selective pressures placed on bacteria by antibiotics , leading to resistance . there has been a decrease in the development of antimicrobial agents by pharmaceutical companies as their development is not as profitable as developing drugs that treat chronic and lifestyle diseases . in the last four decades , only three new classes of antibiotics have been discovered which are lipopeptides , oxazolidinones , and streptogramins . as most of the old and cheap antibiotics are no longer effective , the use of second or third line drugs has become necessary , and these may have side effects . when patients are infected with organisms resistant to all available antimicrobials , surgery is required to remove the nidus of infection , increasing the risk of death . infectious diseases account for half of all deaths in tropical countries and 90 % of infections are caused by bacteria . bacteria have the ability to acquire resistance mechanisms such as genes encoding enzymes such as - lactamases , genes that alter the bacterial cell wall resulting in no binding site for the antimicrobial agent and efflux pumps through conjugation , translation , and transduction . efflux pumps are transport proteins involved in the extrusion of toxic substrates ( including almost all classes of clinically relevant antibiotics ) . efflux pumps either can be selective or can be multidrug efflux pumps , and the extrusion of antimicrobial agents via these efflux pumps is a major component of resistance . cells can use proton driven antiporters and / or atp driven ( atp - binding cassette ) transporters to expel drugs . efflux pump inhibitors can be used to restrict the efflux of antibiotics from bacterial cells , meaning that resistance to antibiotics such as ciprofloxacin can be reversed and drug resistance can be inhibited . examples of commonly used efflux pump inhibitors are verapamil and mc - 207,110 . as a result of antibiotic resistance , new antimicrobials that will either replace or be used with antibioticstraditional medicines are used by approximately 80 % of the population , while usage of alternative medicines in developed countries is increasing . traditional medicines are extensively incorporated into the public health system of some countries . to date , studies have confirmed that some plant extracts can be used to treat infectious diseases caused by bacteria as they have antibacterial properties . studies have been conducted to determine the effects of plant extracts on the activity of antibiotics against resistant bacteria . interest in herbal medicines has increased in recent years due to the fact that they are cheap , readily available , and effective , as well as the high cost of industrialized medicines , lack of access to healthcare , and the side effects caused by taking synthetic medicines . natural products offer a large diversity of chemical structures which often serve as lead molecules whose activities can be enhanced by manipulation through combinations with chemicals and by synthetic chemistry . natural plant extracts have been found to be an important source of secondary metabolites such as tannins , terpenoids , alkaloids , and flavonoids , which have been found in vitro to have antimicrobial properties . some plant extracts have also been classified as resistance modifiers because they can enhance antibiotic activity or reverse antibiotic resistance . in zimbabwe , plants have been used for centuries to treat various ailments . examples are vernonia adoensis leaves for the treatment of tuberculosis and salons delagoense leaves and fruits for the treatment of scabies in children . aloe excelsa , cymbopogon nardus , pepper , coconut milk , and coconut oil are some plants used for the preparation of ointments , lotions , and creams . the aim of this study was to investigate the antibacterial properties of the aqueous and methanol extracts of cissus welwitschii and triumfetta welwitschii var . cissus is a member of the grape family vitaceae . c. welwitschii is found in tropical africa , often on granite outcrops and termite mounds and in forests , semievergreen bushland , and woodland . the plant is a vigorous grower , that is , 1.89 m long or shrubby , and has aerial roots . c. welwitschii has hairlessthe plant has simple leaves and tendril , and is closely related to c. fragilis . c. welwitschii is used traditionally in zimbabwe for the treatment of cancer . welwitschii is a perennial herb that grows annual stems from a woody rootstock and usually flowers before the leaves develop . three varieties of t. welwitschii exist , namely , welwitschii , descampsii , and hirsuta . in zimbabwe , t. welwitschii is used to treat diarrhoea , suggesting that it has antibacterial effects . microorganisms contribute to food spoilage and in turn diarrhoea , so treatment of diarrhoea using the t. welwitschii plant extract may indicate that the plant has antibacterial activity . in south africa , a decoction of the tuber is mixed with milk and drunk as a fever remedy suggesting that it has antipyretic effects . this strain is found in meat products , unpasteurised fruit juices , fruits , vegetables , and untreated water and is known to cause haemolytic uremic syndrome . e. coli o55 , o111 , and o127 have been associated with infant diarrhoea , while other strains have been associated with nosocomial infections in the skin , urinary tract , and surgical wounds . the emetic toxin produced by b. cereus has been associated with improperly stored boiled and fried rice ( causes nausea and vomiting ) while the diarrheal type is associated with a wider range of foods . as b. cereus and e. coli cause very serious illnesses , new drugs are needed that can adequately manage the infections that they cause . many plants used traditionally achieve good results , so studying these plants may give rise to new potent antimicrobials with different mechanisms of action . the results of this study can be used to either validate or invalidate the use of t. welwitschii and c. welwitschii in traditional medicine . all chemicals and antibiotics used were purchased from sigma - aldrich , steinheim , germany , and were of analytical grade . the major chemicals and antibiotics used were methanol , for extractions , reserpine , an efflux pump inhibitor , rhodamine 6 g , a probe compound for the drug efflux assay , propidium iodide dye , used to stain nucleic acids , bradford 's reagent for protein determination using the bradford 's assay , and the three antibiotics used in the study : ampicillin , kanamycin , and norfloxacin . cissus welwitschii and triumfetta welwitschii were collected from centenary ( 16.8 s , 31.1167 e , and 1156 m above sea level ) , mashonaland central province , zimbabwe . christopher chapano , a botanist with the national botanical and herbarium garden ( harare , zimbabwe ) . the dried leaves and roots of each plant were ground separately in a blender ( philips co. , shanghai , china ) . to 10g of plant material , either 100 ml of methanol or 200 ml of distilled water was added . two hundred millilitres of distilled water was used as the mixture became viscous during stirring . the methanol extracts were filtered using no . 1 whatman filter paper , while the water extracts were filtered using mutton cloth . the filtrate was evaporated to dryness , collected , and stored at room temperature . the bacteria were grown from glycerol stocks stored at 33c . on nutrient agar plates ,25 l of bacteria was plated and grown overnight at 37c in an incubator ( lab design engineering ( pty ) ltd . , maraisburg , south africa ) . from the plates ,1 colony was inoculated into nutrient broth and grown overnight at 37c with shaking at 160 revolutions per minutes ( rpm ) ( lab companion , jeio tech , south korea ) . molten nutrient agar was inoculated with bacteria to a final concentration of 110 cfu / ml . stock solutions of c. welwitschii , t. welwitschii , and the antibiotic ampicillin were prepared to a concentration of 25 mg / ml by dissolving the plant extracts in the extracting solvent and ampicillin in distilled water . filter paper disks measuring 6 mm in diameter were prepared . to each disk , 20 l of extract or antibiotic was added . the disks were allowed to dry before being placed onto the plates impregnated with bacteria . the plates were stored at 4c for two hours to allow the extracts and antibiotics to diffuse into the agar . the mics of the plant extracts and antibiotics against b. cereus and e. coli were determined using the broth dilution method . the plant extracts and ampicillin , the concentrations used ranged from 0.008 mg / ml to 4 mg / ml , while , for kanamycin and norfloxacin , the concentrations used ranged from 1 g / ml to 1 mg / ml . one hundred microliters of the extracts and antibiotics was added to wells in microwell plates . to each well , 100 l of bacteria was added to achieve a final concentration of 110 cfu / ml . wells containing 200 l of broth only , 100 l of the extracts or antibiotics and 100 l of broth , and 100 l of broth and 100 l of bacteria were used as the controls . after incubation , the absorbance of the wells was measured at 600 nm using a microplate spectrophotometer ( spectramaxplus , molecular devices , sunnyvale , usa ) . to each well , 25 l of 3 - ( 4,5 - dimethylthiazol -2-yl ) -2,5-diphenyltetrazolium bromide ( mtt ) was then added . the absorbance was measured at 570 nm . to determine the mbc , one loopful of the bacteria in the wells that contained the mic was streaked , in duplicate , onto nutrient agar plates without antibiotics . the wells that contained extracts at one and two concentrations higher and one concentration lower than the mic were also plated . the drug accumulation assay was used to determine the effects of the plant extracts on drug accumulation in e. coli and b. cereus . the method described by chitemerere and mukanganyamathe bacteria were grown overnight at 37c in two separate flasks containing 400 ml nutrient broth ( 120 rpm ) . the bacteria were centrifuged at 4000 rpm for 10 minutes ( mse minor 35 , england ) . the pellet was washed twice in phosphate buffered saline ( pbs ) ( ph 7.2 ) . the cells were centrifuged at 4000 rpm for 5 minutes in a preweighed tube . the supernatant was discarded and the pellet was weighed using a kern eg balance ( kern & sohn , germany ) . pbs containing 10 mm sodium azide ( nan3 ) was added to the tube to achieve a concentration of cells of 40 mg / ml . the tube was gently inverted to disperse the cells within the pbs . rhodamine 6 g ( r6 g ) to a final concentration of 10 m was immediately added and cells were incubated at 90 rpm for 1 hour . the cells were divided into two tubes , a and b , in the ratio of 1 : 2 but both with the same concentration of cells . a , the supernatant was discarded , and pbs alone was added to achieve a final concentration of cells of 40 mg / ml . for tubeb , the supernatant was discarded and the pellet was resuspended in pbs containing 1 m glucose . the contents of tube b were then divided into five tubes , b1 to b5 . reserpine was added to tube b1 to a final concentration of 60 ng / ml . tube b2 served as a control with glucose alone . plant extracts were added to tubes b3 to b5 to achieve final concentrations of 60 ng / ml of plant extract in each tube . equal concentrations of plant extracts and reserpine were used to allow comparisons to be conducted . all of the tubes were mixed on a vortex mixer ( barnstead / thermolyne , usa ) before being incubated for 30 minutes ( 90 rpm , 37c ) in a lab companion si - 300 incubator . after incubation , the tubes were centrifuged at 4000 rpm for 10 minutes and the supernatant was discarded . the cells were mixed on a vortex mixer before being incubated at 37c , 90 rpm overnight . the tubes were centrifuged at 4000 rpm for 10 minutes and the supernatant was collected . the standards were prepared by diluting r6 g in glycine hcl , and the concentrations used ranged from 0 m to 5 m . the dye is unable to enter viable cells , making it useful for determining the effects of plant extracts on bacterial membranes . b. cereus and e. coli cells were suspended in 0.9 % saline solution ( od600 = 1.5 ) . the cell suspensions were exposed to plant extracts at concentrations of the mic and double the mic in duplicate for 10 minutes . the bacteria ( 1 ml ) were centrifuged for 1 minute at 11000 g ( centrifuge 5415c , eppendorf , berlin , germany ) . three microliters of propidium iodide was added to each sample and the solution was mixed . fluorescence was measured at excitation and emission wavelengths of 544 nm and 612 nm , respectively , using an fmax microplate spectrofluorometer ( molecular devices , sunnyvale , usa ) . the controls used were nontreated cells , 3 % dmso , 0.1 % sds , and kanamycin . b. cereus and e. coli cells were suspended in 0.9 % saline solution ( od600 = 1.5 ) . the cell suspensions were exposed to plant extracts at concentrations of the mic and double the mic . the samples were incubated at 37c with shaking ( 120 rpm ) for 120 min . five hundred microlitres of cell suspension was centrifuged at 7000 rpm for 2 min . to 50 l of the supernatant , 950 l of coomassie brilliant blue g - 250 was added to measure the protein content by bradford 's method . the colour was allowed to develop for 10 min before the absorbance was measured at 595 nm using a spectrophotometer . the controls used were kanamycin , 3 % dmso , 0.1 % sds , and untreated cells . bovine serum albumin ( bsa ) was used as a standard to determine protein concentration . the one - way analysis of variance test ( anova ) with dunnett 's multiple comparison test was used to analyse the results . the zone of inhibition refers to the diameter of the zone in which no growth of bacteria was observed minus the diameter of the filter paper disk ( 6 mm ) . the root methanol extract from t. welwitschii had the largest zones of inhibition against both b. cereus and e. coli at 6 mm and 4.5 mm , respectively . t. welwitschii leaf and root methanol extracts produced larger zones of inhibition against the bacteria than c. welwitschii leaf and root methanol extracts . the leaf water extracts of both c. welwitschii and t. welwitschii produced no zones of inhibition , making them the least effective extracts . the ampicillin was more effective at inhibiting e. coli than b. cereus ( 12 mm and 9 mm , resp . ) . the results of the mic assay , shown in table 2 , show that c. welwitschii leaf and root methanol extracts were more effective against e. coli than b. cereus . the t. welwitschii root water and methanol extracts were more effective against b. cereus than e. coli . the t. welwitschii leaf methanol showed significant growth inhibitory effect against both e. coli and b. cereus with an mic of 0.125 mg / ml . all 3 antibiotics , particularly kanamycin and norfloxacin , inhibited b. cereus and e. coli at very low concentrations . b. cereus and e. coli were inhibited at 0.5 g / ml and 1 g / ml , respectively , by kanamycin and 0.25 g / ml by norfloxacin . of the plant extracts , t. welwitschiileaf methanol extract had the lowest mbc of 0.5 mg / ml against b. cereus and e. coli . c. welwitschii leaf and root methanol extracts and t. welwitschii root water extract were the highest at 4 mg / ml . the antibiotics had lower mics and mbcs against b. cereus than e. coli , except norfloxacin which had the same mic for both bacteria . of note was that at 4 mg / ml of c. welwitschii root methanol extract , e. coli grew fairly well , but at 2 mg / ml the extract killed the bacteria . the results of the r6 g accumulation assay using t. welwitschii extracts are shown in figure 1 ( a ) . generally more drug accumulation was observed in e. coli ( 4 m ) than in b. cereus ( 4 m ) . in the presence ofthe leaf methanol and root methanol extracts 5.10 m and 5.39 m r6 g , respectively , accumulated in e. coli , while in the presence of reserpine 4.89 m r6 g was accumulated . for e. coli none of these resultswere significantly higher than the control : cells exposed to glucose only ( 4.38 m ) . when the b. cereus cells were exposed to reserpine , 5.01 m r6 g was accumulated in the cells . there was a significant decrease in r6 g accumulation when b. cereus cells were exposed to the t. welwitschii root methanol extract . figure 1 ( b ) shows the accumulation in b. cereus and e. coli after exposure to c. welwitschii extracts . in e. coli , the leaf methanol extract caused the accumulation of large amounts of r6 g ( 9.25 m ) . the remaining c. welwitschii extracts , the root methanol and leaf water extracts , caused much less accumulation at 3.06 m and 2.93 m , respectively , than the control cells that were exposed to glucose . in e. coli , more r6 g accumulated inside the cells treated with glucose than in those treated without glucose ( 4.65 m and 1.98 m , resp . ) . in b. cereus , c. welwitschii extracts caused more drug accumulation than that observed in cells treated with reserpine , but the accumulation was not significantly different to cells exposed to glucose only . the root methanol , leaf methanol , and leaf water extracts caused the accumulation of 4.98 m , 4.95 m , and 4.92 m r6 g , while reserpine caused the accumulation of 4.03 m . the cells exposed to glucose had more accumulation of r6 g than those without glucose . the fluorescence of propidium iodide in b. cereus and e. coli cells after exposure to the t. welwitschii leaf methanol and root methanol extracts is shown in figure 2 . against b. cereus , the fluorescence of propidium iodide increased as the concentration of the root methanol extract increased . at the mic ( 0.25 mg / ml ) and double the mic ( 0.5 mg / ml ) , the fluorescence of propidium iodide was 1.94 fluorescence units ( f / units ) and 2.53 f / units , respectively . the fluorescence at 0.5 mg / ml was significantly higher than the fluorescence of propidium iodide in the untreated b. cereus cells , which was 1.72 f / units . in e. coli , following exposure to the leaf methanol extract , the fluorescence of propidium iodide was 1.741 f / units and 1.743 f / units after exposure to the mic ( 0.125 mg / ml ) and double the mic ( 0.25 mg / ml ) , respectively . the root methanol extract at 0.5 mg / ml and 1 mg / ml ( mic and double the mic , resp . ) caused nucleic acid leakage in e. coli cells . however , as the concentration of plant extracts increased , the fluorescence of propidium iodide decreased : 3.386 f / units at the mic and 2.871 f / units at 2-fold the mic . untreated e. coli cells had a propidium iodide fluorescence of 1.61 f / units . sds was able to cause nucleic acid leakage in b. cereus and e. coli . in b. cereusthe fluorescence of propidium iodide in cells exposed to dmso was 1.692 f / units which was similar to that in untreated cells . the same was true for e. coli cells , where the fluorescence of propidium iodide was 1.403 f / units for cells treated with dmso . in b. cereus cellsthe t. welwitschii extracts do not cause protein leakage ( figure 3 ) . in the presence of the plant extracts , the root methanol extract at 0.25 mg / ml and 0.5 mg / ml ( the mic and double the mic , resp . ) caused significantly less protein leakage than the untreated cells . ampicillin caused the leakage of large amounts of protein ( 0.073 mg / ml ) . in the cells treated with sds , 0.46 mg / ml of protein was leaked , while in those treated with dmso 0.057 mg / ml of protein was leaked out . these amounts were similar to the untreated cells : 0.052 mg / ml of protein was leaked from the cells . in e. coli ( figure 3 ) , the root methanol extract caused protein leakage at 1 mg / ml ( double the mic ) : 0.048 mg / ml . the protein leakage observed in the untreated cells was 0.0098 mg / ml . dmso did not change the amount of protein leakage in b. cereus cells . the search for new antimicrobial agents has been necessitated by the increase in antimicrobial resistance in recent years . natural plant products are a good source of new antimicrobials as they generally have low toxicity , cause minimal environmental pollution , have a low risk of development of resistance by pathogens , are cheap , and are generally safer than synthetic medicines . the use of known medicinal plants is advantageous as they have been prescreened over thousands of years , resulting in a higher probability of isolating useful and safe compounds from them than from plants not in use by humans already . plant materials are either present in or have provided models for approximately 50 % of drugs . screening t. welwitschii and c. welwitschii for antibacterial activity was more likely to be successful as these plants are already used for medicinal purposes . the extracts from the two plants were generally more effective against b. cereus than e. coli . b. cereus is a gram - positive bacterium while e. coli is gram - negative , suggesting that the plant extracts are more effective against gram - positive than gram - negative bacteria . according to the literature , plant extracts are generally more active against gram - positive than gram - negative bacteria . gram - negative bacteria are more resistant to antibacterial agents than gram - positive bacteria because of the presence of the outer membrane that acts as a permeability barrier . seasotiya and dalal and narayan found that gram - positive bacteria were more susceptible to the tested plant extracts than gram - negative bacteria . the mbc test results showed that when exposed to 4 mg / ml of c. welwitschii root methanol extract , e. coli grew fairly well , but at 2 mg / ml the extract killed the bacteria . the anomalous result observed may have been caused by high levels of nutrients present in the tuber that allowed the bacteria to overcome any bactericidal substances in the root extract . nutrients would be more concentrated at 4 mg / ml compared to lower concentrations . all of the plant extracts except the t. welwitschii root water extract against e. coli were able to inhibit the growth of the bacteria . plants found to have antibacterial activity include leonotis nepetifolia , melia azedarach , avicenna marina , l. erythrorhizon , adansonia digitata , tamarindus indica , aframomum alboviolaceum , and ocimum gratissimum . the plant extracts had much higher mics and mbcs than those produced by the antibiotics against the bacteria , showing that they are not as effective as the antibioticsthere may have been a lack of specificity as there were many compounds working together at reduced concentrations . studies have shown that plant extracts , though effective against bacteria , are in most cases not as effective as antibiotics . bacteria use these efflux pumps to expel antibiotics from the cell until their concentration is too low to be effective against the bacteria . the extracts from t. welwitschii caused accumulation of more r6 g in e. coli cells than in b. cereus cells . t. welwitschii was more capable of binding to the efflux pumps on e. coli than those on b. cereus . however , t. welwitschii failed to cause significant drug accumulation in both bacteria . c. welwitschii in b. cereus was ineffective as an efflux pump inhibitor . the c. welwitschii leaf methanol extract was a more effective efflux pump inhibitor in e. coli than reserpine . the c. welwitschii leaf methanol extract has potential for use as an efflux pump inhibitor . r6 g was expected to accumulate in the bacterial cells in the absence of glucose while efflux of r6 g would occur in the cells exposed to glucose . r6 g may not have accumulated without glucose as cells may use proton driven antiporters and / or atp driven ( atp - binding cassette ( abc ) ) transporters to expel drugs . the r6 g may have been expelled from the cells through the proton driven antiporters as opposed to the abc transporters . e. coli has 19 antiporters belonging to the major facilitator superfamily , small multidrug resistance family and the resistance / nodulation / cell division family , and 80 abc transporter proteins . proton driven antiporters expel drugs by coupling drug efflux to the influx of a proton , h , while abc transporters couple drug efflux to the hydrolysis of atp . the acrab - tolc pump is a member of the resistance - nodulation - cell division ( rnd ) family of tripartite multidrug efflux pumps ubiquitous throughout gram - negative bacteria . in e. coli , the multidrug efflux pump has been shown to expel a wide range of antibacterial agents . many plant extracts with the ability to promote drug accumulation in bacterial cells have been studied . hydrastis canadensis , curcuma longa , capsicum annum , and elettaria cardamomum have been found to inhibit efflux pump activity . some compounds are capable of disrupting the integrity of the bacterial cell wall / membrane ; for example , polymyxins increase bacterial membrane permeability and lipopeptides like daptomycin and crystallomycin bind to bacteria and cause rapid depolarisation of the bacterial membrane and eventual cell death . the t. welwitschii root methanol extract was capable of causing damage to the b. cereus and e. coli membranes resulting in nucleic acid leakage ( figure 2 ) . dmso did not cause damage to the bacterial membranes as the protein and nucleic acid leakage from the bacterial cells did not change significantly when the cells were exposed to dmso . although the root methanol extract caused leakage of nucleic acids in e. coli , the leakage decreased with increasing concentration of plant extracts . plumbago zeylonica , leucas aspera , and hemidesmus indicus were all found to be capable of causing nucleic acid leakage in bacteria . the plant extracts from these plants were found to contain phenols and flavonoids , resulting in the authors concluding that the membrane disrupting activities of the extracts may be due to the activities of these phytochemicals . ampicillin was able to cause significant protein leakage in b. cereus but not in e. coli . ampicillin is thus expected to be more effective against gram - positive bacteria than gram - negative bacteria due to the differences in their structures . gram - positive bacteria have thick cell walls ( 2080 nm ) composed mainly of peptidoglycan while gram - negative bacteria have thin , inner peptidoglycan layers ( 27 nm ) and an outer membrane ( 7 - 8 nm ) of lipid , protein , and lipopolysaccharide . protein leakage was only observed in e. coli after treatment with 1 mg / ml t. welwitschii root methanol extract . the root methanol extract was able to bind to and disrupt the e. coli membrane and not the b. cereus cell wall . some authors have found that plant extracts are capable of causing membrane disruption . henie et al . found that psidium guajava was capable of causing protein leakage in various bacteria , while akinpelu et al. found that extracts from garcinia kola caused protein leakage in bacteria , including e. coli . in conclusion , the leaf and root extracts of c. welwitschii and t. welwitschii were shown to have antibacterial activity against b. cereus and e. coli . t. welwitschii extracts were more potent growth inhibitory activity against the bacteria than the c. welwitschii extracts . further analysis is needed to investigate the exact mode of activity of the plant extracts and the in vivo toxicity of the plant extracts and to determine the phytoconstituents present in the plant extracts .\noutput:\n" }, { "from": "agent", "value": "antibiotic resistance has increased sharply , while the pace for the development of new antimicrobials has slowed down . plants provide an alternative source for new drugs . this study aimed to screen extracts from cissus welwitschii and triumfetta welwitschii for antibacterial activity against escherichia coli and bacillus cereus . the tests conducted included a susceptibility determination test , analysis of the effect of t. welwitschii on cell wall integrity , and transport across the membrane . it was found that the t. welwitschii methanol extracts were more effective than the water extracts and had the lowest minimum inhibitory concentration and minimum bactericidal concentration at 0.125 mg / ml and 0.5 mg / ml , respectively , against e. coli and b. cereus . the c. welwitschii extract caused the most drug accumulation in e. coli . in b. cereus , no significant drug accumulation was observed . nucleic acid leakage in b. cereus and e. coli and protein leakage in e. coli were observed after exposure to the t. welwitschii extract . the extracts from t. welwitschii had greater antibacterial activity than the extracts from c. welwitschii . t. welwitschii may be a potential source of lead compounds for that could be developed into antibacterial agents ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the hormone betatrophin , primarily produced in the liver , was recently described as a key stimulator of beta - cell mass expansion in response to obesity and insulin - resistant states in mice . in fact , a 17-fold increase in beta - cell proliferation was observed when the hormone was overexpressed . presently , the development of drugs with betatrophin as the active component is considered for the treatment of both type 1 and type 2 diabetes . in humans , an increased beta - cell mass by approximately 50 % although minimal human beta - cell replication has been observed in such autopsy studies and in a mouse model of induced insulin resistance , human beta cells may proliferate in response to an obesogenic environment in mice . in contrast , in obese humans with type 2 diabetes a 4060 % deficit in beta - cell mass when compared to bmi - matched healthy controls has been reported . this may merely reflect beta - cell loss by apoptosis in manifest diabetes and could also mirror a primary defect in the beta cells to adapt and expand in response to obesity and insulin resistance . the present study aimed to investigate circulating betatrophin concentrations in type 2 diabetes patients and in bmi - matched controls without diagnosed diabetes , testing the hypothesis of a betatrophin deficiency in individuals with diabetes . the study was approved by the regional ethical board of uppsala county and conducted in accordance with the declaration of helsinki as revised in 2000 . all study participants were given oral and written information and signed a consent form prior to inclusion in the study . patients with type 2 diabetes ( n = 27 ) were identified from the uppsala - based diabetes registry andiu ( http://www.andiu.se ) or the swedish national diabetes registry ( http://www.ndr.nu ) . the inclusion criteria were based on who diagnosis criteria . only patients with glucose - lowering treatment were included . most of the patients had metformin as monotherapy ( n = 19 ) or in combination with another oral antidiabetic drug ( oad ) ( n = 3 ) , and one patient ( n = 1 ) was treated with metformin in combination with exogenous insulin . two patients ( n = 2 ) had another oad as monotherapy and two patients ( n = 2 ) exogenous insulin . age - , gender - , and bmi - matched nondiabetic controls ( n = 18 ) were recruited through advertising at a local health care center . inclusion criteria for controls were apart from described parameters ; no history of diabetes , and no first - degree relative with diabetes . all study participants were characterized with regard to regarding weight , height , waist - and hip circumference , blood pressure and family history of diabetes , for descriptive data see table 1 . betatrophin levels were analysed with an elisa ( wuhan eiaab science , wuhan , china ; catalogue number . all samples were analysed as duplicates and samples with coefficient of variation ( cv ) values 15 % were excluded . we have in a previous publication confirmed the reliability of obtained elisa values with western immunoblotting with a primary antibody ( phoenix pharmaceuticals , phoenix , usa ; wbk - 051 - 55 ) . beta - cell function at steady state ( % b ) , insulin sensitivity ( % s ) , and insulin resistance ( ir ) was estimated with the updated homeostasis model assessment ( homa2 ) , and calculated based on fasting plasma glucose and fasting plasma c - peptide with the homa2 calculator v2 .2 diabetes trials unit , university of oxford . an unpaired two - tailed t test was used to compare differences between the groups . circulating levels of betatrophin were approximately 40 % higher in the type 2 diabetes patients when compared to their controls ( 89380 versus 63966 pg / ml ; p = 0.03 ) , whereas there was no difference in gender distribution , age , bmi , waist - hip circumference , or waist - to - hip ratio between the two groups ( table 1 ) . as expected , fasting plasma glucose and hba1c were higher in the type 2 diabetes patients ( glucose 8.50.4 versus 6.20.2 mmol / l for controls , p 0.0001 ; hba1c 6.80.1 % ( 50.61.6 mmol / mol ) versus 5.80.1 % ( 40.10.8 mmol / mol ) for controls , p 0.0001 ) , but control individuals fulfilled the ada criteria for impaired fasting plasma glucose . the patients with type 2 diabetes had a lower homa2 % b ( reflecting beta - cell function at steady state ) index when compared to controls ( 77.98.3 versus 108.86.0 , p = 0.008 ) , whereas there was no difference in homa2 % s ( reflecting insulin sensitivity ) or homa2 ir ( reflecting insulin resistance ) . the plasma levels of cholesterol , hdl cholesterol , and ldl cholesterol were higher in the control group . however , the number of study participants using lipid - lowering drugs ( statins ) was lower in the control group ( 22 % versus 48 % ) , although the difference was not statistically significant . for plasma triacylglycerol levelsthere was no difference between the two groups . in controls , we observed a positive correlation between betatrophin concentrations and age ( cc = 0.572 , p = 0.01 ) ( figure 1 ( a ) ) , whereas in the type 2 diabetes group there was no such correlation ( table 2 ) . however , in the type 2 diabetes patients we instead observed a positive correlation between plasma betatrophin levels and hba1c ( cc 0.482 , p = 0.01 ) ( figure 1 ( b ) ) . there were no correlations between plasma betatrophin and other markers of metabolic control , for example , fasting plasma glucose concentrations , c - peptide concentrations , or any homa index , in either the controls or type 2 diabetes patients . similarly , there were no correlations between plasma betatrophin levels and blood lipid levels in either the controls or type 2 diabetes patients . when computing correlations for all study participants , regardless of whether they were controls or patients with type 2 diabetes , we observed a positive correlation between plasma betatrophin concentrations and hba1c ( figure 1 ( c ) ) , similarly as in the type 2 diabetes group , but not with age as was observed in the control group . there was a tendency towards a positive correlation with plasma creatinine ( cc = 0.267 , p = 0.06 ) but not with the glomerular filtration rate ( gfr ) calculated with mdrd based on creatinine levels ( cc = 0.208 , p = 0.170 ) . there was also a tendency towards a negative correlation between plasma betatrophin and plasma cholesterol ( cc = 0.286 , p = 0.06 ) , when computing correlations for all study participants . we therefore subanalysed the study participants with regard to whether they were treated with lipid - lowering drugs ( table 3 ) . among the controls , only four individuals were treated with lipid - lowering drugs , and when comparing them to controls without treatment ( n = 14 ) , we observed no statistical difference with regard to plasma betatrophin , cholesterol , hdl cholesterol , ldl cholesterol , triacylglycerols , or bmi . among the patients with type 2 diabetes , there were 14 patients that were treated with lipid - lowering drugs and 13 that were not . plasma ldl cholesterol was lower in the subjects treated with lipid - lowering drugs , whereas there was no difference for plasma betatrophin , cholesterol , hdl cholesterol , triacylglycerols , hba1c , fasting plasma glucose , or bmi . the present work shows that plasma betatrophin concentrations in patients with type 2 diabetes are not subnormal , instead higher concentrations than in nondiabetic individuals were recorded . therefore , although resistance to betatrophin effects in type 2 diabetes patients can not be excluded , there is at least no obvious betatrophin deficiency to substitute in these individuals . we have previously reported on betatrophin concentrations in young adult healthy controls and patients with type 1 diabetes . the presently recorded betatrophin concentrations in controls were approximately doubled when compared to those in the previous study . however , at least in mice , betatrophin expression has been shown to be primarily regulated by insulin resistance in liver . the controls in the previous study had a mean bmi of 23 , whereas it was 29 kg / m in the present study . moreover , the present controls had a mean waist circumference exceeding 100 cm and mean homa2 ir values well exceeding the 75 percentile ( homa2 ir 1.133 ) of a normal scandinavian population . also when insulin sensitivity was calculated as homa2 % s values , these values were in the present controls only half of those in a normal caucasian population . thus , the assigned control group in the present study was clearly insulin resistant similar to the patients with type 2 diabetes but had not developed similar decrease in beta - cell function ( as assessed by homa2 % b ) , despite fulfilling the ada criteria for impaired fasting glucose . although no strict correlations were observed between homa2 indices and plasma betatrophin levels , the higher betatrophin concentrations observed in the present study suggest that betatrophin expression also in humans may be induced by insulin resistance . a limitation with the present study was that insulin resistance was not measured by a glucose - clamp technique but instead estimated by homa2 ir indices . nevertheless , such indices are generally considered to preferentially reflect insulin resistance in liver rather than overall insulin resistance . in this study , most of the patients were treated with metformin , which is considered as first line of treatment according to ada and easd position statement . therefore , very few patients with diagnosed type 2 diabetes were identified , who were treated with other antidiabetic drugs or only had diet and exercise as treatment . theoretically , treatment with metformincould decrease plasma betatrophin levels , since it reduces insulin resistance which is described as the main stimulus for betatrophin secretion . in four identified patients without metforminthere was in fact a tendency towards increased betatrophin levels when compared to those treated with metformin ( 1241167 ( n = 4 ) versus 83285 ( n = 23 ) pg / ml , p = 0.0694 ) . however , since the number of patients without metformin treatment is limited this would have to be further investigated . our correlation analysis also identified that the plasma betatrophin concentrations in nondiabetic humans increase with age . moreover , when including the type 2 diabetes patients with variable metabolic control , plasma betatrophin concentrations were observed to increase with hba1c . noteworthy , there also tended to be a positive correlation between plasma betatrophin concentrations and plasma creatinine , which would suggest that betatrophin normally is excreted in the urine , although there was no correlation between calculated gfr and betatrophin . increased circulating concentrations of betatrophinmay both reflect increased secretion and reduced clearance of the hormone , but there were no differences in plasma creatinine or calculated gfr between the type 2 diabetes patients and their controls . betatrophin belongs to the family of angiopoietin - like proteins and has besides betatrophin been given many different names : lipasin , hepatocellular carcinoma - associated protein - td26 , rifl , and angiopoietin - like protein 8 . overexpression of betatrophin in mice leads to an increase in serum triacylglycerol , and human genome - wide association studies have also shown that variations in the gene are linked with blood lipid levels . in the present study , there tended to be a negative correlation between betatrophin concentrations and total plasma cholesterol levels . however , the association between betatrophin and lipid values was difficult to interpret , since several of the study patients , especially among the patients with diabetes , were treated with lipid - lowering drugs ( statins ) . indeed , total plasma cholesterol , ldl , and hdl were all decreased in the type 2 diabetes patients when compared to the controls . since this study only included 45 patients , any subanalysis of betatrophin concentrations in patients with or without lipid treatment was difficult to perform with enough statistical power . nevertheless , there seemed to be no clear difference in plasma betatrophin concentrations between statin and nonstatin treated individuals . during the preparation of this paper , fenzl et al . reported no difference in plasma betatrophin levels between type 2 diabetes patients and nondiabetic controls in a retrospective study of stored plasma samples . this finding contradicts with the present results and previous findings on betatrophin gene expression in insulin - resistant mice . the reasons for the different results obtained are presently obscure , and any potential influence of long - term or variable storage time or occurrence of any repeated freeze - thaw cycles of samples was not reported . nevertheless , although their results showed no difference between nondiabetic and type 2 diabetic patients , there was , similar to in our study , at least no deficiency of betatrophin in the diabetic state . we conclude that plasma betatrophin concentrations are increased in type 2 diabetes patients when compared to age - , gender - , and bmi - matched controls with similar degree of insulin resistance . therefore , there is no obvious betatrophin deficiency to substitute in these diabetic individuals , and similar to our previous study in type 1 diabetes patients the increased plasma betatrophin concentrations seem insufficient to compensate for the development of disease by triggering a beta - cell mass expansion . future studies are clearly needed to delineate the exact role , if any , for betatrophin in regulating human beta - cell mass .\noutput:\n" }, { "from": "agent", "value": "betatrophin has recently been described as a key hormone to stimulate beta - cell mass expansion in response to insulin resistance and obesity in mice . the finding has generated an interest in the development of antidiabetic drugs with betatrophin as the active component . however , the circulating levels of betatrophin in patients with type 2 diabetes are not well known . betatrophin concentrations in plasma of 27 type 2 diabetes patients and 18 gender - , age - , and bmi - matched controls were measured . study participants were characterized with regard to bmi , waist and hip circumference , blood pressure , and fasting plasma blood lipids , creatinine , glucose , hba1c , and c - peptide . homa2 indices were calculated . betatrophin was 40 % higher in patients with type 2 diabetes ( 893 80 versus 639 66 pg / ml ) . betatrophin positively correlated with age in the controls and with hba1c in the type 2 diabetes patients . all study participants were insulin resistant with mean homa2b ir in both groups exceeding 2 and homa2 % s < 50 % . control individuals had impaired fasting glucose concentrations . in this report on betatrophin concentrations in type 2 diabetes and insulin resistance , elevated betatrophin levels were measured in the patients with type 2 diabetes . future studies are clearly needed to delineate the exact role , if any , of betatrophin in regulating human beta - cell mass ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: case reports and several retrospective studies have demonstrated possible teratogenicity , but the data in different studies is inconclusive . the risk for cardiovascular malformations , particularly ebstein 's anomaly and other congenital abnormalities have been reported . a 25 - year - old gravida 1 , para 1 woman at 38 weeks of gestation was admitted for an elective caesarean section . she had a history of bp for which she was treated with lithium 600 mg q12h in the first trimester of pregnancy . there was no familial history of birth defects , any antenatal infection or exposure to any other medications , alcohol , smoking , or x - rays . a baby boy ( 3500 g ) after 2 to 3 hours respiratory distress clinical picture and chest radiograph suggested diagnosis of congenital diaphragmatic hernia . lithium probably produces a defect in normal development of the diaphragm and may pose specific risk for an anomaly known as congenital diaphragmatic hernia ( cdh ) . unfortunately , all psychotropic medications diffuse across the placenta , which exposes the fetus to some degree of risk . on the other hand , a number of medications used to treat acute mania and to prevent episodes of depression and mania are associated with structural teratogenicity . lithium carbonate is used as a standard treatment for bd . in the last four decades , there has been much concern regarding the association between prenatal exposure to lithium and risk for major congenital anomalies . the risk for cardiovascular malformations , particularly ebstein 's anomaly , was initially proposed to be 400 times higher than the background baseline . herein , we suggest that lithium may pose specific risk for congenital diaphragmatic hernia ( cdh ) as a new abnormality in some pregnancies . we reviewed all published studies in english , including case reports and did not find any report pertaining to this association . a 25 - year - old gravida 1 , para 1 woman at 38 weeks of gestation was admitted for an elective caesarean section . she had a history of bd for which she was treated with lithium 600 mg q12h in the first trimester of pregnancy . there was no familial history of birth defects , any antenatal infection or exposure to any other medications , alcohol , smoking , or x - ray . after 2 to 3 hours of respiratory distress clinical picture and chest radiograph suggested diagnosis of congenital diaphragmatic hernia .1 ) showed air - filled intestine herniated into the left chest and the trachea and nasogastric tube displaced to the right side . the operation and repair of his diaphragm was preformed and patient discharged after 12 days . congenital diaphragmatic hernia to date , the management of bd during pregnancy remains one of the most daunting challenges of psychiatric practice . unfortunately , a number of medications used to treat acute mania and prophylaxis of bd are associated with structural teratogenicity . among the mood stabilizers , this drug is used mainly for the treatment of bd ; however , weinstein has shown that no placental barrier exists to free diffusion of lithium ions . case reports and several retrospective studies have demonstrated possible teratogenicity , but the discussion on the teratogenic effects of lithium in world literature has not reached a final conclusion . moreover , there is a low incidence of neonatal toxicity with lithium exposure . since 1950initial retrospective analyses suggested that lithium exposure was associated with a 400-fold increase in the rate of ebstein 's anomaly and a tricuspid valve malformation in offspring exposed in utero , but subsequent meta - analyses indicated that the risk ratio for cardiac malformations after lithium exposure is only 1.2 to 7.7 and the risk for ebstein 's anomaly rises from 1 in 20,000 to 1 in 1,000 . other congenital abnormalities reported include large volume for gestational age infants , anencephaly and oromandibular - limb hypogenesis . marathe showed in wistar rats a reduction in number and weight of the litter , wavy ribs , short and deformed bones of the limbs , or an increased incidence of incomplete ossification of sterne brae and wide bone separation in the skull . these important findings suggest the nature and extent of embryo toxicity and teratogenicity of lithium carbonate . in addition , exposure up to the third and fourth weeks of gestation can affect the development of the diaphragm . here , we have a neonate with congenital diaphragmatic hernia ( cdh ) which is a significant clinical problem , occurring once in every 2,500 to 3,000 human births . this condition continues to have a high mortality rate due to the lethal combination of pulmonary hyperplasia and pulmonary hypertension . our study suggests that lithium probably produces a defect in normal development of the diaphragm ; additional research is needed to provide information regarding this association . the risks and benefits need to be carefully balanced based on an accurate review of the evidence .\noutput:\n" }, { "from": "agent", "value": "backgroundlithium is used mainly for the treatment of bipolar disorder ( bd ) . case reports and several retrospective studies have demonstrated possible teratogenicity , but the data in different studies is inconclusive . the risk for cardiovascular malformations , particularly ebstein 's anomaly and other congenital abnormalities have been reported.case presentationa 25 - year - old gravida 1 , para 1 woman at 38 weeks of gestation was admitted for an elective caesarean section . she had a history of bp for which she was treated with lithium 600 mg q12h in the first trimester of pregnancy . there was no familial history of birth defects , any antenatal infection or exposure to any other medications , alcohol , smoking , or x - rays . a baby boy ( 3500 g ) was born . after 2 to 3 hours respiratory distress clinical picture and chest radiograph suggested diagnosis of congenital diaphragmatic hernia . repair of his diaphragm was preformed and patient discharged after 12 days.conclusionlithium probably produces a defect in normal development of the diaphragm and may pose specific risk for an anomaly known as congenital diaphragmatic hernia ( cdh ) ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ten humans ( 7 male and 3 female ; ages 5284 ) provided 14 postmortem eyes ( 8 right and 6 left ) from the san diego eye bank within 48 hours of death . listed causes of death included cancer ( leukemia , esophageal , and myelodysplastic syndrome ) , dementia , failure to thrive , liver failure , gastrointestinal bleed , myocardial infarction , and urinary tract injection . no subject was known to have a history of glaucoma . to summarize the information below , dextran experiments used 2 eyes , oct imaging used 1 eye , and trabecular bypass experiments used 11 eyes . eyes were always received as pairs , but some eyes were excluded as they were either open globes due to inadvertent trauma during procurement by the eye bank or because fluid leaks developed during experimentation such that iop was uncertain . eyes were trimmed of extraocular tissue , oriented by inferior oblique insertion location , and pinned to styrofoam . a lewicky anterior chamber ( ac ) maintainer ( bvi visitec , alcester , uk ) was inserted through a 1 - mm side port ( alcon , fort worth , tx , usa ) into the anterior chamber . balanced salt solution ( bss ; alcon ) was introduced for a 1 - hour preperfusion period at room temperature ( rt ) with a reservoir height set at 5 inches above the eye to provide a gravity - delivered pressure of 10 mm hg as previously described .25 % fluorescein ( akorn , lake forest , il , usa ) was diluted at rt in bss to 2.5 % . louis , mo , usa ) was dissolved with water into a 2 % stock solution , and icg was subsequently diluted in bss to 0.4 % . these concentrations were chosen because they have been described for clinical use in live humans as intraocular capsular stains for cataract surgery . in most cases , icg ( n = 11 ) was first introduced for aqueous angiography at 10 mm hg followed by fluorescein aqueous angiography in the same eye as previously done in cows ( saraswathy s , et al . alternatively , 3 - kd fixable and fluorescent dextrans ( life technologies , carlsbad , ca , usa ; diluted to 2.5 mg / ml in bss ) were used ( n = 2 ) at 10 mm hg . the eyes were placed in front of the spectralis hra + oct ( heidelberg engineering , heidelberg , germany ; fluorescein capture mode : excitation wavelength = 486 nm and transmission filter set at 500 nm ; icg capture mode : excitation wavelength = 786 nm and transmission filter set at 800 nm ) with fluorescent images taken with a 55 lens using a 25 - diopter focus . confocal scanning laser ophthalmoscopic ( cslo ) infrared images were taken to center the eye . prior to tracer application , cslo fluorescent angiographic images using the fluorescein or icg capture mode were taken to provide a standard pretracer intensity background image , which appeared black . subsequent fluorescein or icg capture mode images were taken at various time points in various positions or face - on after tracer introduction . to prevent image signal intensity saturation over time during prolonged imaging sessions , the laser sensitivity setting on the spectralis was adjusted with each image to set the central fluorescent signal in the anterior chamber to just under signal saturation . after aqueous angiography with fluorescent dextrans for 2 minutes in human eyes ( n = 2 ) , the intracameral fluorescent dextran solution was exchanged with 4 % paraformaldehyde ( pfa ) for 15 minutes at 10 mm hg . the entire globe was then placed in 4 % pfa for an additional 15 minutes of fixation . wedges including the angle were cut from angiographically positive and negative regions , dehydrated through ethanol steps , brought through xylenes , and paraffin embedded . five - micrometer - thick sections were cut on a leitz 1512 microtome ( leica biosystems , vista , ca , usa ) onto superfrost plus slides ( vwr , radnor , pa , usa ) and air dried . slides were mounted with a 4,6 - diamidino -2-phenylindole ( dapi ) - containing mounting medium ( vector labs , burlingame , ca , usa ) and viewed under a keyence bz - x700 digital imaging microscope ( keyence , chicago , il , usa ) . all images were taken using identical settings for illumination and image capture sensitivity ( keyence imaging software v. 1.51 ) . for fitc - dextrans ( ex bp 470/30 , dm 495 , em bp 520/35 ) and dapi ( ex bp 360/40 , dm 400 , em bp 460/50 ) , appropriate filters were used , respectively . briefly , fluorescence pixel intensity was determined in a region of interest centered on the angle ( photoshop cs5 v. 12x32 ; adobe , san jose , ca , usa ) . background - adjusted intensity values were obtained by subtracting the background in each image ( by sampling empty anterior chamber ) from the above fluorescence pixel intensity in each angle . statistical comparison of the background - adjusted intensity values was conducted with 2 - sample , equal - sized , unpaired , assumed normal variance student 's t - tests ( excel 2010 ; microsoft , redmond , wa , usa ) . after the initial icg aqueous angiography , regions with poor angiographic signal were marked and targeted for sham ( n = 5 ) versus trabecular bypass stents ( n = 6 ) . given the use of enucleated human eyes , the corneas were universally edematous , and despite various methods ( epithelial debridement , corneal dehydration , and external transillumination ) , visualization of the tm for intervention through a gonioprism was not possible . therefore , an alternative approach was devised whereby a full - thickness corneal incision was made with a 1 - mm side - port blade perpendicular to the proposed stent / sham site approximately 80 % of the limbal white - to - white distance in that meridian . careful consideration was made not to include the wound of the 1 - mm side port created for the lewicky ac maintainer . balanced salt solution was irrigated into the anterior chamber to wash out icg and improve visualization . wek - cel sponges ( bvi visitec , alcester , uk ) were used to remove excess fluid , and direct visualization of the angle and tm was made through a research - dedicated surgical microscope ( leica , buffalo grove , il , usa ) . sham treatment was achieved by touching the tm at the proposed site using an 18 - gauge ( g ) blunt fill needle ( bd , franklin lakes , nj , usa ) . the anterior chamber was refilled with bss and the corneal wound reapproximated with cyanoacrylate glue . anterior segment oct was taken over the region of stent placement ( see below ) . all eyes were then placed in 4 % pfa overnight at 4c . the eyes were prepared for histologic sectioning after removal of the stent much as explained above with hematoxylin and eosin staining for evaluation of the angle at the stent / sham location . trabecular bypass was performed using trabecular bypass stents ( provided by glaukos corporation , laguna hills , ca , usa ) . trabecular bypass stents ( generation 1 , g1 ) are food and drug administration ( fda ) approved for combined cataract and glaucoma surgery for iop lowering in cases of moderately advanced glaucoma . to facilitate placement , second - generation stents ( g2w ; istent inject ) 1 ) . second - generation stents are not currently fda approved and differ from g1 stents by shape and approach to theoretically allow for easier delivery . in these experiments , the handpiece of the g2w stent was advanced into the anterior chamber through the corneal wound until the trochar tip touched the tm at the proposed injection site . depression of the injection button allowed forward delivery of the stent past the tm without the sideways motion required for g1 stents . closure of the eye and subsequent fluorescein aqueous angiography were conducted as above for sham conditions . the generation 1 ( g1 ) stent is fda approved for moderate glaucoma combined with cataract surgery . with the snorkel - like shape , the stent is inserted into the trabecular meshwork so that one lumen is in front of and the other lumen is behind the trabecular meshwork . generation 2 ( g2 ) stents ( istent inject ) are non - fda approved currently and were used for these experiments because of the mushroom shape whereby the stent is directly injected into and past the trabecular meshwork straight on , such that the mushroom head with side ports is past the trabecular meshwork while the posterior flat flange with central lumen is in communication with the anterior chamber . images provided courtesy of rob liff , glaukos corporation . to quantify changes in angiographic signal from angle intervention or sham from each individual eye , icg and fluorescein aqueous angiography intensity over time was determined as previously described . aqueous angiographic images were opened in photoshop cs5 ( v. 12x32 ) for image processing and pixel intensity measurements . both sham and experimental eyes were pooled for this purpose given the cost and precious nature of enucleated human eyes for research . briefly , ( 1 ) angiographic signal within the anterior chamber and beyond the globe horizon for each eye was cropped out to create a total ring of angiographic data . average background pixel intensity from a region of interest in the center of each eye from the pretracer image mentioned above . ( 3 ) average pixel intensities for all rings were then obtained and background adjusted by subtracting out the average background pixel intensity . ( 4 ) to control for manual adjustments to the spectralis laser sensitivity settings during image acquisition , the background - adjusted average pixel intensity from each ring was divided by the numerical value on the spectralis laser sensitivity setting to yield a normalized intensity value . quantitative assessments of the trabecular bypass experiments were then based on comparing icg ( 3 minutes ) and fluorescein ( 45 seconds ) images at two time points that resided on relatively linear portions of their respective curves . tracer - specific intensity over background values ( ts - iob ) were calculated ( fig .2 ) . for each eye , pixel intensity was first measured using a 7575 - pixel test area that was placed over the region of interest next to the stent or sham treatment . this value was divided by another pixel intensity measure taken from a clearly signal - poor region from the same eye to determine the ratio of signal intensity of the region of interest ( next to the treatment area ) over background signal in each eye . the influence of the sham or trabecular bypass was then determined by dividing ts - iob ( fluorescein ) by ts - iob ( icg ) . statistical comparisons between sham and stent were conducted with 2 - sample , equal - sized , unpaired , assumed normal variance student 's t - tests . tracer - specific intensity over background ratio ( ts - iob ) . to quantify the change in angiographic outflow for each eye , the perilimbal signal intensity adjacent to the area of intervention ( sham or stent ; red arrows ) was recorded ( green box ) and divided by a region of interest ( red box ) in a clearly signal - poor region in the exact same image to calculate a tracer - specific ( indocyanine green [ icg ] or fluorescein [ f ] ) intensity over background ratio . anterior segment oct ( anterior segment module [ heidelberg engineering ] on scleral mode ) was concurrently conducted in one eye with icg aqueous angiography alone to determine if angiographically positive regions showed vessel anatomy compatible for aho . single line scans with a 15 scan angle ( 3.9 - m axial and 11 - m lateral resolution ; 4.5 mm ) were taken with oversampling ( automated real - time [ art ] = 20 ) in angiographically positive / negative regions . anterior segment oct was also performed in one case of stent placement as mentioned above . herea volume scan was taken with a heidelberg engineering provided custom script near the area of stent placement ( 152.5 scan angle ; 128 b - scans ; axial / lateral resolution of 3.8 / 11 m , respectively , b - scan to b - scan distance of 11 m ) . the anterior segment oct images in one of the stent cases were exported as a video per manufacturer instructions on the spectralis . images were opened in photoshop and brightness / contrast adjusted to enhance visualization of particulate debris located in the anterior chamber . the presence of this debris was likely secondary to the act of the trabecular bypass / sham procedure itself . ten humans ( 7 male and 3 female ; ages 5284 ) provided 14 postmortem eyes ( 8 right and 6 left ) from the san diego eye bank within 48 hours of death . listed causes of death included cancer ( leukemia , esophageal , and myelodysplastic syndrome ) , dementia , failure to thrive , liver failure , gastrointestinal bleed , myocardial infarction , and urinary tract injection . no subject was known to have a history of glaucoma . to summarize the information below , dextran experiments used 2 eyes , oct imaging used 1 eye , and trabecular bypass experiments used 11 eyes . eyes were always received as pairs , but some eyes were excluded as they were either open globes due to inadvertent trauma during procurement by the eye bank or because fluid leaks developed during experimentation such that iop was uncertain . eyes were trimmed of extraocular tissue , oriented by inferior oblique insertion location , and pinned to styrofoam . a lewicky anterior chamber ( ac ) maintainer ( bvi visitec , alcester , uk ) was inserted through a 1 - mm side port ( alcon , fort worth , tx , usa ) into the anterior chamber . balanced salt solution ( bss ; alcon ) was introduced for a 1 - hour preperfusion period at room temperature ( rt ) with a reservoir height set at 5 inches above the eye to provide a gravity - delivered pressure of 10 mm hg as previously described .25 % fluorescein ( akorn , lake forest , il , usa ) was diluted at rt in bss to 2.5 % . , st . louis , mo , usa ) was dissolved with water into a 2 % stock solution , and icg was subsequently diluted in bss to 0.4 % . these concentrations were chosen because they have been described for clinical use in live humans as intraocular capsular stains for cataract surgery . in most cases , icg ( n = 11 ) was first introduced for aqueous angiography at 10 mm hg followed by fluorescein aqueous angiography in the same eye as previously done in cows ( saraswathy s , et al . alternatively , 3 - kd fixable and fluorescent dextrans ( life technologies , carlsbad , ca , usa ; diluted to 2.5 mg / ml in bss ) were used ( n = 2 ) at 10 mm hg . the eyes were placed in front of the spectralis hra + oct ( heidelberg engineering , heidelberg , germany ; fluorescein capture mode : excitation wavelength = 486 nm and transmission filter set at 500 nm ; icg capture mode : excitation wavelength = 786 nm and transmission filter set at 800 nm ) with fluorescent images taken with a 55 lens using a 25 - diopter focus . confocal scanning laser ophthalmoscopic ( cslo ) infrared images were taken to center the eye . prior to tracer application , cslo fluorescent angiographic images using the fluorescein or icg capture mode were taken to provide a standard pretracer intensity background image , which appeared black . subsequent fluorescein or icg capture mode images were taken at various time points in various positions or face - on after tracer introduction . to prevent image signal intensity saturation over time during prolonged imaging sessions , the laser sensitivity setting on the spectralis was adjusted with each image to set the central fluorescent signal in the anterior chamber to just under signal saturation . after aqueous angiography with fluorescent dextrans for 2 minutes in human eyes ( n = 2 ) , the intracameral fluorescent dextran solution was exchanged with 4 % paraformaldehyde ( pfa ) for 15 minutes at 10 mm hg . the entire globe was then placed in 4 % pfa for an additional 15 minutes of fixation . wedges including the angle were cut from angiographically positive and negative regions , dehydrated through ethanol steps , brought through xylenes , and paraffin embedded . five - micrometer - thick sections were cut on a leitz 1512 microtome ( leica biosystems , vista , ca , usa ) onto superfrost plus slides ( vwr , radnor , pa , usa ) and air dried . slides were mounted with a 4,6 - diamidino -2-phenylindole ( dapi ) - containing mounting medium ( vector labs , burlingame , ca , usa ) and viewed under a keyence bz - x700 digital imaging microscope ( keyence , chicago , il , usa ) . all images were taken using identical settings for illumination and image capture sensitivity ( keyence imaging software v. 1.51 ) . for fitc - dextrans ( ex bp 470/30 , dm 495 , em bp 520/35 ) and dapi ( ex bp 360/40 , dm 400 , em bp 460/50 ) , appropriate filters were used , respectively . briefly , fluorescence pixel intensity was determined in a region of interest centered on the angle ( photoshop cs5 v. 12x32 ; adobe , san jose , ca , usa ) . background - adjusted intensity values were obtained by subtracting the background in each image ( by sampling empty anterior chamber ) from the above fluorescence pixel intensity in each angle . statistical comparison of the background - adjusted intensity values was conducted with 2 - sample , equal - sized , unpaired , assumed normal variance student 's t - tests ( excel 2010 ; microsoft , redmond , wa , usa ) . after the initial icg aqueous angiography , regions with poor angiographic signal were marked and targeted for sham ( n = 5 ) versus trabecular bypass stents ( n = 6 ) . given the use of enucleated human eyes , the corneas were universally edematous , and despite various methods ( epithelial debridement , corneal dehydration , and external transillumination ) , visualization of the tm for intervention through a gonioprism was not possible . therefore , an alternative approach was devised whereby a full - thickness corneal incision was made with a 1 - mm side - port blade perpendicular to the proposed stent / sham site approximately 80 % of the limbal white - to - white distance in that meridian . careful consideration was made not to include the wound of the 1 - mm side port created for the lewicky ac maintainer . balanced salt solution was irrigated into the anterior chamber to wash out icg and improve visualization . wek - cel sponges ( bvi visitec , alcester , uk ) were used to remove excess fluid , and direct visualization of the angle and tm was made through a research - dedicated surgical microscope ( leica , buffalo grove , il , usa ) . sham treatment was achieved by touching the tm at the proposed site using an 18 - gauge ( g ) blunt fill needle ( bd , franklin lakes , nj , usa ) . the anterior chamber was refilled with bss and the corneal wound reapproximated with cyanoacrylate glue . anterior segment oct was taken over the region of stent placement ( see below ) . all eyes were then placed in 4 % pfa overnight at 4c . the eyes were prepared for histologic sectioning after removal of the stent much as explained above with hematoxylin and eosin staining for evaluation of the angle at the stent / sham location . trabecular bypass was performed using trabecular bypass stents ( provided by glaukos corporation , laguna hills , ca , usa ) . trabecular bypass stents ( generation 1 , g1 ) are food and drug administration ( fda ) approved for combined cataract and glaucoma surgery for iop lowering in cases of moderately advanced glaucoma . to facilitate placement , second - generation stents ( g2w ; istent inject ) were used ( fig . second - generation stents are not currently fda approved and differ from g1 stents by shape and approach to theoretically allow for easier delivery . in these experiments , the handpiece of the g2w stent was advanced into the anterior chamber through the corneal wound until the trochar tip touched the tm at the proposed injection site . depression of the injection button allowed forward delivery of the stent past the tm without the sideways motion required for g1 stents . closure of the eye and subsequent fluorescein aqueous angiography were conducted as above for sham conditions . the generation 1 ( g1 ) stent is fda approved for moderate glaucoma combined with cataract surgery . with the snorkel - like shape , the stent is inserted into the trabecular meshwork so that one lumen is in front of and the other lumen is behind the trabecular meshwork . generation 2 ( g2 ) stents ( istent inject ) are non - fda approved currently and were used for these experiments because of the mushroom shape whereby the stent is directly injected into and past the trabecular meshwork straight on , such that the mushroom head with side ports is past the trabecular meshwork while the posterior flat flange with central lumen is in communication with the anterior chamber . to quantify changes in angiographic signal from angle intervention or sham from each individual eye , icg and fluorescein aqueous angiography intensity over time was determined as previously described . aqueous angiographic images were opened in photoshop cs5 ( v. 12x32 ) for image processing and pixel intensity measurements . both sham and experimental eyes were pooled for this purpose given the cost and precious nature of enucleated human eyes for research . briefly , ( 1 ) angiographic signal within the anterior chamber and beyond the globe horizon for each eye was cropped out to create a total ring of angiographic data . ( 2 ) the background fluorescein angiography signal was then established by determining average background pixel intensity from a region of interest in the center of each eye from the pretracer image mentioned above . ( 3 ) average pixel intensities for all rings were then obtained and background adjusted by subtracting out the average background pixel intensity . ( 4 ) to control for manual adjustments to the spectralis laser sensitivity settings during image acquisition , the background - adjusted average pixel intensity from each ring was divided by the numerical value on the spectralis laser sensitivity setting to yield a normalized intensity value . quantitative assessments of the trabecular bypass experiments were then based on comparing icg ( 3 minutes ) and fluorescein ( 45 seconds ) images at two time points that resided on relatively linear portions of their respective curves . tracer - specific intensity over background values ( ts - iob ) were calculated ( fig . pixel intensity was first measured using a 7575 - pixel test area that was placed over the region of interest next to the stent or sham treatment . this value was divided by another pixel intensity measure taken from a clearly signal - poor region from the same eye to determine the ratio of signal intensity of the region of interest ( next to the treatment area ) over background signal in each eye . the influence of the sham or trabecular bypass was then determined by dividing ts - iob ( fluorescein ) by ts - iob ( icg ) . statistical comparisons between sham and stent were conducted with 2 - sample , equal - sized , unpaired , assumed normal variance student 's t - tests . tracer - specific intensity over background ratio ( ts - iob ) . to quantify the change in angiographic outflow for each eye , the perilimbal signal intensity adjacent to the area of intervention ( sham or stent ; red arrows ) was recorded ( green box ) and divided by a region of interest ( red box ) in a clearly signal - poor region in the exact same image to calculate a tracer - specific ( indocyanine green [ icg ] or fluorescein [ f ] ) intensity over background ratio . anterior segment oct ( anterior segment module [ heidelberg engineering ] on scleral mode ) was concurrently conducted in one eye with icg aqueous angiography alone to determine if angiographically positive regions showed vessel anatomy compatible for aho . single line scans with a 15 scan angle ( 3.9 - m axial and 11 - m lateral resolution ; 4.5 mm ) were taken with oversampling ( automated real - time [ art ] = 20 ) in angiographically positive / negative regions . anterior segment oct was also performed in one case of stent placement as mentioned above . herea volume scan was taken with a heidelberg engineering provided custom script near the area of stent placement ( 152.5 scan angle ; 128 b - scans ; axial / lateral resolution of 3.8 / 11 m , respectively , b - scan to b - scan distance of 11 m ) . the anterior segment oct images in one of the stent cases were exported as a video per manufacturer instructions on the spectralis . images were opened in photoshop and brightness / contrast adjusted to enhance visualization of particulate debris located in the anterior chamber . the presence of this debris was likely secondary to the act of the trabecular bypass / sham procedure itself . as in pigs , aqueous angiography in human enucleated model eyes demonstrated segmental angiographic signal that reflected aho as evaluated by fluorescent dextran ( fig .4 ) . visual inspection of the initial aqueous angiography in all 14 eyes ( regardless of what tracers was used first [ fluorescein , icg , or fluorescent dextrans ] ) showed that 11/14 eyes ( 78.6 % ) had predominately nasal angiographic signal . angiographically positive ( a , d ; green lines ) or diminished ( a , d ; red lines ) regions were identified with aqueous angiography , marked , and prepared for paraffin sectioning . in the first eye ( a c ) , angiographically positive areas ( green line in [ a ] corresponds to [ b ] ) showed greater trapping of dextrans within outflow pathways compared to angiographically diminished ( red line in [ a ] corresponds to [ c ] ) regions . in the second eye ( df ) , angiographically positive areas ( green line in [ d ] corresponds to [ e ] ) also showed more trapping of dextrans in outflow pathways compared to angiographically diminished ( red line in [ d ] corresponds to [ f ] ) regions . note similar degree of nonspecific fluorescence seen in descemet 's membrane in all cases ( asterisks ) . sc , schlemm 's canal ; tm , trabecular meshwork ; ac , anterior chamber . scale bar : 100 m . indocyanine green ( icg ) aqueous angiography was conducted concurrent with anterior segment oct focused on the distal angiographic signal from the right eye of an 84 - year - old male ( listed cause of death , myelodysplastic syndrome ) . ( a ) angiographically positive regions ( yellow arrow and white arrows ) demonstrated ( b ) intrascleral lumens compatible with aqueous humor outflow on oct . ( c ) in an oct b - scan taken directly below the angiographic signal depicted in ( a ) , ( d ) intrascleral lumens were mostly absent . ( c ) this is true except one for one point on the left of the angiographic image ( yellow arrow ) where the oct image caught one branch of the angiographic pattern that ( d ) showed a single oval corresponding intrascleral lumen on oct . to look for differences in outflow in the tm and angle region , we used fixable and trappable dextrans . while unlikely imaging the tm itself in aqueous angiography , tm near - adjacent positive but not negative aqueous angiographic signal demonstrated trapping of the dextrans in aho pathways ( figs .3 ; asterisks ) . quantitative comparison of background - adjusted intensity values in angiographically positive compared to negative areas showed a statistically significant increase ( 100.7618.52 vs. 34.1913.21 ; background - adjusted intensity units ; average sd ; n = 12 sections for each condition ; p 0.0012 - tailed student 's t - test ) . anterior segment oct supported dextran results where icg angiographically positive but not negative areas showed intrascleral lumens reminiscent of aho pathways ( fig .4 ) . to assess whether trabecular bypass could improve regions of poor aqueous angiography signal , sequential aqueous angiography with icg followed by fluorescein was performed . areas of poor icg aqueous angiography signal were marked ( figs . 5 , 6 ; red arrows ) , and full - thickness cornea incisions were made for direct visualization of the tm for a sham treatment ( fig .5 ; n = 5 ) ( touching the tm with a blunt - tip 18 - g needle ) or trabecular bypass ( fig . 6 ; n = 6 [ of which 5 achieved full - thickness bypass ] ) with a trabecular bypass stent . corneal wounds were glued , and fluorescein aqueous angiography was performed to assess the influence of the intervention . for both sham and stent conditions ( figs .5 , 6 ) green arrows demonstrated similar aqueous angiography patterns between icg and fluorescein . after sham , regions initially devoid of icg aqueous angiography signal continued to be so with fluorescein aqueous angiography ( fig . 5 ) . however , after trabecular bypass , regions initially devoid of icg aqueous angiography signal demonstrated qualitative increased aqueous angiography signal intensity with fluorescein ( fig . sequential aqueous angiography with indocyanine green ( icg ) followed by fluorescein after sham intervention to the trabecular meshwork . ( a d ) icg aqueous angiography was first performed on the left eye of a 68 - year - old male ( listed cause of death , failure to thrive ) . this was followed by identification of a region of low signal ( red arrows ) , full - thickness corneal incision perpendicular to this site , sham touch of the trabecular meshwork by an 18 - g blunt needle , and cyanoacrylate glue closure of the wound . ( e h ) this procedure was followed by fluorescein aqueous angiography in the same eye demonstrating continued poor angiography signal at the sham site ( red arrows ) . ( a h ) green arrows demonstrate similar angiographic patterns between icg and fluorescein outside of the sham location . j ) representative images from icg and fluorescein aqueous angiography from the right eye of a 76 - year - old male ( listed cause of death , myocardial infarction ) . ( k , l ) representative images from icg and fluorescein aqueous angiography from the left eye of the same 76 - year - old male ( listed cause of death , myocardial infarction ) . all images were arranged such that superior is on top , and inferior is on the bottom of the image . for right eyes , nasal is on the right of the image , and temporal is on the left . sequential aqueous angiography with indocyanine green ( icg ) followed by fluorescein after trabecular bypass stent placement . ( a d ) icg aqueous angiography was first performed on the right eye of a 79 - year - old male ( listed cause of death , esophageal cancer ) . this was followed by identification of a region of low signal ( red arrows and white asterisks ) , full - thickness corneal incision perpendicular to this site , placement of a second - generation trabecular bypass stent under direct visualization , and cyanoacrylate glue closure of the wound . ( e h ) this procedure was followed by fluorescein aqueous angiography in the same eye demonstrating earlier and increased angiographic signal compared to before the stent placement ( red arrows and white asterisks ) . ( a h ) green arrows demonstrate similar angiographic patterns between icg and fluorescein in regions outside of stent placement . ( i , j ) representative images from icg and fluorescein aqueous angiography from the right eye of an 82 - year - old female ( listed cause of death , urinary tract infection ) . ( k , l ) representative images from icg and fluorescein aqueous angiography from the left eye of a 75 - year - old female ( listed cause of death , dementia ) . all images were arranged such that superior is on top , and inferior is on the bottom of the image . for right eyes , nasal is on the right of the image , and temporal is on the left . histologic sectioning in marked areas after sham treatment demonstrated normal - appearing tm and angle structures ( fighistologic sections of marked areas after trabecular bypass demonstrated successful and full - thickness tm ablation ( figs . interestingly , one case occurred in which after attempted trabecular bypass , only minimally improved fluorescent aqueous angiographic signal was seen with fluorescein ( fig . histology in that case showed unsuccessful stent placement whereby the tm was only partially bypassed ( fig . ( a c ) after sham experiments , eyes were perfusion fixed and the anterior segments prepared for paraffin sectioning and hematoxylin / eosin staining demonstrating intact trabecular meshwork . sc , schlemm 's canal ; tm , trabecular meshwork ; ac , anterior chamber . scale bar : 100 m . ( a c ) after trabecular bypass stent experiments , eyes were perfusion fixed and the anterior segments prepared for paraffin sectioning and hematoxylin / eosin staining . arrows ( d ) anterior segment optical coherence tomography in the same eye as in figures 6a through 6h and figure 8a demonstrated correct positioning of trabecular bypass stent . a ) sequential aqueous angiography was performed in the right eye of a 75 - year - old female ( listed cause of death , dementia ) , first with icg showing lack of signal superior ( red arrow ) even after a prolonged time period . ( b ) subsequent fluorescein aqueous angiography barely demonstrated improved angiographic outflow signal ( red arrow ) . ( c ) histologic sectioning over the stent placement site showed a cleft where the stent resided ( arrowhead ) with only partial tm bypass without full - thickness bypass achieved ( arrow ) . all images were arranged such that superior is on top and inferior is on the bottom of the image . in this right eye , nasal is on the right of the image , and temporal is on the left . sc , schlemm 's canal ; tm , trabecular meshwork ; ac , anterior chamber . orange scale bar : 5 mm . given the universally edematous corneas in all eyes , a modified surgical approach was developed in the sham and stent experiments . full - thickness corneal wounds , longer than routinely used for clinical surgeries in patient care , were employed , and irrigation using bss was required to wash out fluorescent tracers to directly visualize the tm . therefore , debris was found in some cases in the anterior chamber after stent placement . in one eye ( figs . h ) that had stent placement in an initially icg aqueous angiography poor region with additional histology and oct - confirmed successful trabecular bypass stent placement ( figs . video demonstration of these scans showed particulate matter flowing toward the trabecular bypass stent ( supplementary video s1 ) . to quantify aqueous angiographic changes in trabecular bypass experiments , experimental and sham eyes were pooled and total intensity of icg and fluorescein aqueous angiographic signal plotted over time ( fig . not unlike what was shown in a previous report , there was a steady increase . ( a , b ) aqueous angiography with fluorescein over time demonstrated accumulated signal intensity . ( c , d ) aqueous angiography with indocyanine green ( icg ) over time also demonstrated accumulated signal intensity . total normalized pixel intensity values from 11 eyes each for ( e ) fluorescein and ( f ) icg were recorded as a function of time at 10 mm hg . orange scale bars : 5 mm . to assess for regional changes in angiographic patterns after sham or stent , ts - iob ratios were calculated for icg and fluorescein images at 3 minutes and 45 seconds , respectively ( fig . these time points were chosen based on their positions at early and linear portions of each tracer 's respective curves ( figs . f ) . after dividing fluorescein ts - iob over icg ts - iob for sham and stent conditions , a statistically significant improvement was found for the stent trabecular bypass condition ( sham [ n = 5 ] : 1.020.46 versus stent [ n = 5 ] : 17.377.76 ; p = 0.043 ) .9 ) , an intermediate value of fluorescein ts - iob over icg ts - iob ( 1.66 ) was seen . as in pigs , aqueous angiography in human enucleated model eyes demonstrated segmental angiographic signal that reflected aho as evaluated by fluorescent dextran ( fig .4 ) . visual inspection of the initial aqueous angiography in all 14 eyes ( regardless of what tracers was used first [ fluorescein , icg , or fluorescent dextrans ] ) showed that 11/14 eyes ( 78.6 % ) had predominately nasal angiographic signal . angiographically positive ( a , d ; green lines ) or diminished ( a , d ; red lines ) regions were identified with aqueous angiography , marked , and prepared for paraffin sectioning . in the first eye ( a c ) , angiographically positive areas ( green line in [ a ] corresponds to [ b ] ) showed greater trapping of dextrans within outflow pathways compared to angiographically diminished ( red line in [ a ] corresponds to [ c ] ) regions . in the second eye ( df ) , angiographically positive areas ( green line in [ d ] corresponds to [ e ] ) also showed more trapping of dextrans in outflow pathways compared to angiographically diminished ( red line in [ d ] corresponds to [ f ] ) regions . note similar degree of nonspecific fluorescence seen in descemet 's membrane in all cases ( asterisks ) . sc , schlemm 's canal ; tm , trabecular meshwork ; ac , anterior chamber . scale bar : 100 m . indocyanine green ( icg ) aqueous angiography was conducted concurrent with anterior segment oct focused on the distal angiographic signal from the right eye of an 84 - year - old male ( listed cause of death , myelodysplastic syndrome ) . ( a ) angiographically positive regions ( yellow arrow and white arrows ) demonstrated ( b ) intrascleral lumens compatible with aqueous humor outflow on oct . ( c ) in an oct b - scan taken directly below the angiographic signal depicted in ( a ) , ( d ) intrascleral lumens were mostly absent . ( c ) this is true except one for one point on the left of the angiographic image ( yellow arrow ) where the oct image caught one branch of the angiographic pattern that ( d ) showed a single oval corresponding intrascleral lumen on oct . to look for differences in outflow in the tm and angle region , we used fixable and trappable dextrans . while unlikely imaging the tm itself in aqueous angiography , tm near - adjacent positive but not negative aqueous angiographic signal demonstrated trapping of the dextrans in aho pathways ( figs .3 ; asterisks ) . quantitative comparison of background - adjusted intensity values in angiographically positive compared to negative areas showed a statistically significant increase ( 100.7618.52 vs. 34.1913.21 ; background - adjusted intensity units ; average sd ; n = 12 sections for each condition ; p 0.0012 - tailed student 's t - test ) . anterior segment oct supported dextran results where icg angiographically positive but not negative areas showed intrascleral lumens reminiscent of aho pathways ( fig . to assess whether trabecular bypass could improve regions of poor aqueous angiography signal , sequential aqueous angiography with icg followed by fluorescein was performed . areas of poor icg aqueous angiography signal were marked ( figs . 5 , 6 ; red arrows ) , and full - thickness cornea incisions were made for direct visualization of the tm for a sham treatment ( fig .5 ; n = 5 ) ( touching the tm with a blunt - tip 18 - g needle ) or trabecular bypass ( fig . 6 ; n = 6 [ of which 5 achieved full - thickness bypass ] ) with a trabecular bypass stent . corneal wounds were glued , and fluorescein aqueous angiography was performed to assess the influence of the intervention . for both sham and stent conditions ( figs .5 , 6 ) green arrows demonstrated similar aqueous angiography patterns between icg and fluorescein . after sham , regions initially devoid of icg aqueous angiography signal continued to be so with fluorescein aqueous angiography ( fig . 5 ) . however , after trabecular bypass , regions initially devoid of icg aqueous angiography signal demonstrated qualitative increased aqueous angiography signal intensity with fluorescein ( fig . 6 ) . sequential aqueous angiography with indocyanine green ( icg ) followed by fluorescein after sham intervention to the trabecular meshwork . ( a d ) icg aqueous angiography was first performed on the left eye of a 68 - year - old male ( listed cause of death , failure to thrive ) . this was followed by identification of a region of low signal ( red arrows ) , full - thickness corneal incision perpendicular to this site , sham touch of the trabecular meshwork by an 18 - g blunt needle , and cyanoacrylate glue closure of the wound . ( e h ) this procedure was followed by fluorescein aqueous angiography in the same eye demonstrating continued poor angiography signal at the sham site ( red arrows ) . ( a h ) green arrows demonstrate similar angiographic patterns between icg and fluorescein outside of the sham location . ( i , j ) representative images from icg and fluorescein aqueous angiography from the right eye of a 76 - year - old male ( listed cause of death , myocardial infarction ) . ( k , l ) representative images from icg and fluorescein aqueous angiography from the left eye of the same 76 - year - old male ( listed cause of death , myocardial infarction ) . all images were arranged such that superior is on top , and inferior is on the bottom of the image . for right eyes , nasal is on the right of the image , and temporal is on the left . sequential aqueous angiography with indocyanine green ( icg ) followed by fluorescein after trabecular bypass stent placement . ( a d ) icg aqueous angiography was first performed on the right eye of a 79 - year - old male ( listed cause of death , esophageal cancer ) . this was followed by identification of a region of low signal ( red arrows and white asterisks ) , full - thickness corneal incision perpendicular to this site , placement of a second - generation trabecular bypass stent under direct visualization , and cyanoacrylate glue closure of the wound . ( e h ) this procedure was followed by fluorescein aqueous angiography in the same eye demonstrating earlier and increased angiographic signal compared to before the stent placement ( red arrows and white asterisks ) . ( a h ) green arrows demonstrate similar angiographic patterns between icg and fluorescein in regions outside of stent placement . ( i , j ) representative images from icg and fluorescein aqueous angiography from the right eye of an 82 - year - old female ( listed cause of death , urinary tract infection ) . , l ) representative images from icg and fluorescein aqueous angiography from the left eye of a 75 - year - old female ( listed cause of death , dementia ) . all images were arranged such that superior is on top , and inferior is on the bottom of the image . for right eyes , nasal is on the right of the image , and temporal is on the left . histologic sectioning in marked areas after sham treatment demonstrated normal - appearing tm and angle structures ( fig . histologic sections of marked areas after trabecular bypass demonstrated successful and full - thickness tm ablation ( figs . interestingly , one case occurred in which after attempted trabecular bypass , only minimally improved fluorescent aqueous angiographic signal was seen with fluorescein ( fig . histology in that case showed unsuccessful stent placement whereby the tm was only partially bypassed ( fig . ( a c ) after sham experiments , eyes were perfusion fixed and the anterior segments prepared for paraffin sectioning and hematoxylin / eosin staining demonstrating intact trabecular meshwork . sc , schlemm 's canal ; tm , trabecular meshwork ; ac , anterior chamber . scale bar : 100 m . ( a c ) after trabecular bypass stent experiments , eyes were perfusion fixed and the anterior segments prepared for paraffin sectioning and hematoxylin / eosin staining . arrows point out successful full - thickness trabecular bypass in all cases . ( d ) anterior segment optical coherence tomography in the same eye as in figures 6a through 6h and figure 8a demonstrated correct positioning of trabecular bypass stent . ( a ) sequential aqueous angiography was performed in the right eye of a 75 - year - old female ( listed cause of death , dementia ) , first with icg showing lack of signal superior ( red arrow ) even after a prolonged time period . ( b ) subsequent fluorescein aqueous angiography barely demonstrated improved angiographic outflow signal ( red arrow ) . ( c ) histologic sectioning over the stent placement site showed a cleft where the stent resided ( arrowhead ) with only partial tm bypass without full - thickness bypass achieved ( arrow ) . all images were arranged such that superior is on top and inferior is on the bottom of the image . in this right eye , nasal is on the right of the image , and temporal is on the left . sc , schlemm 's canal ; tm , trabecular meshwork ; ac , anterior chamber . orange scale bar : 5 mm . given the universally edematous corneas in all eyes , a modified surgical approach was developed in the sham and stent experiments . full - thickness corneal wounds , longer than routinely used for clinical surgeries in patient care , were employed , and irrigation using bss was required to wash out fluorescent tracers to directly visualize the tm . therefore , debris was found in some cases in the anterior chamber after stent placement . in one eye ( figs . h ) that had stent placement in an initially icg aqueous angiography poor region with additional histology and oct - confirmed successful trabecular bypass stent placement ( figs . video demonstration of these scans showed particulate matter flowing toward the trabecular bypass stent ( supplementary video s1 ) . to quantify aqueous angiographic changes in trabecular bypass experiments , experimental and sham eyes were pooled and total intensity of icg and fluorescein aqueous angiographic signal plotted over time ( fig . not unlike what was shown in a previous report , there was a steady increase . ( a , b ) aqueous angiography with fluorescein over time demonstrated accumulated signal intensity . ( c , d ) aqueous angiography with indocyanine green ( icg ) over time also demonstrated accumulated signal intensity . total normalized pixel intensity values from 11 eyes each for ( e ) fluorescein and ( f ) icg were recorded as a function of time at 10 mm hg . graphs show mean standard error . orange scale bars : 5 mm . to assess for regional changes in angiographic patterns after sham or stent , ts - iob ratios were calculated for icg and fluorescein images at 3 minutes and 45 seconds , respectively ( fig . these time points were chosen based on their positions at early and linear portions of each tracer 's respective curves ( figs . f ) . after dividing fluorescein ts - iob over icg ts - iob for sham and stent conditions , a statistically significant improvement was found for the stent trabecular bypass condition ( sham [ n = 5 ] : 1.020.46 versus stent [ n = 5 ] : 17.377.76 ; p = 0.043 ) .9 ) , an intermediate value of fluorescein ts - iob over icg ts - iob ( 1.66 ) was seen . optical coherence tomography evaluation of distal aqueous angiography signal showed episcleral lumens compatible with aho in angiographically positive but not negative regions . with sequential aqueous angiography , the sole manipulation of trabecular bypass improved aho as measured by fluorescein aqueous angiography in areas initially devoid of icg aqueous angiography . first , the meaning of aqueous angiography in this model system is limited by the fact that the eyes are enucleated . artifacts due to diminished cell viability and episcleral venous blood clotting could affect angiographic patterns . in particular , postmortem presence of distal episcleral venous blood clots could explain segmental patterns by sectorally blocking aho . however , since tm bypass alone resulted in improved aqueous angiography signal , segmental aho as seen by aqueous angiography could not be entirely and artifacticiously due to episcleral venous clots since these clots would reside distal to the tm . lack of angiographic signal could be due to outflow pathways diving deep into the sclera such that excitation / emission wavelengths become attenuated . since tm bypass alone , which did not influence the sclera or scleral depth , resulted in improved angiographic signal , segmental aho could not be entirely due to issues of depth . additionally , depth influences interpretation of aqueous angiography results . increased depth can attenuate light transmission through sclera ; and given the location where angiographic signal appears perilimbal but also posterior to the limbus , aqueous angiography signal represents the outflow result as influenced by the entire trabecular outflow pathway without directly imaging the tm . this is in contrast to microsphere or bead methods , which have the advantage of demonstrating precise segmental tm aho but used tissue processing not compatible with live imaging . second , improving aho by ablating the tm reemphasizes to clinicians and scientists the importance of the tm . variable results of clinical tm ablation / bypass migs naturally raised the possibility of outflow obstruction in the distal outflow pathways . while distal aho is likely relevant and a source of undiscovered biology and potential disease , the results of improved angiographic aho by only trabecular bypass reinforces the role of the tm in gating aho . also , the result of diminished aho improvement with partial tm bypass is important ( fig . . part of the variable clinical results from trabecular migs may come from improper surgical placement . a natural learning curve exists for all surgeries , and trabecular migs are no different . third , improving aho in regions initially devoid of aho expands on initial surgical approaches to migs . trabecular migs are typically placed in the nasal angle through a temporal clear cornea direction for several reasons . second , reports , including results here , suggest that aho is normally best nasal . however , if aho is already adequate in a particular region , it is possible that trabecular bypass to enhance aho in that region may limit further improvement due to a ceiling effect . alternatively , another approach is to place trabecular migs where aho is initially poor in an attempt to recruit these regions from a worse starting point . however , a counterargument to conducting migs in this way is that maybe the reason why aho was diminished in the first place was that the local region never had adequate outflow channels to support aho . this would be analogous to opening roads for vehicle traffic that ended up all being cul de sacs . therefore , demonstrating that regions of poor aho could be recruited for improved outflow opens the possibility of alternative surgical techniques . it is possible that better iop lowering could be achieved by placing trabecular migs in regions of initially low aho . methods such as aqueous angiography now allow ophthalmologists to test the effects of various surgical approaches such as these . additional testing needs to be done to attempt measurement of outflow facility concurrent with angiographic imaging . to do this , an aqueous humor dynamics rig will have to be situated and built around this clinical device as the center . with this , one could then test trabecular bypass in low versus high angiographic signal regions to determine if trabecular bypass in one area or the other really is better . further studies need to be conducted with aqueous angiography in live humans and animals to avoid the confounding factors related to using enucleated eyes . for example , in cases of successful trabecular bypass , the increase in fluorescein aqueous angiography was variable , with some cases rivaling native fluorescein angiographic signal in high - flow areas and in other cases to a lesser extent . this may have been due to either postmortem changes to distal outflow pathways giving a variable response to outflow recruitment for forward flow after trabecular bypass . alternatively , subtle native differences in distal outflow anatomy between different low - flow regions being accessed could have created this variability as well . additionally , while the aqueous angiography patterns and time course between fluorescein and icg were similar , they were not identical . this was likely secondary to differences in molecular properties ( e.g. , ph , molecular weight , protein binding ) . for example , the icg signal was slower , and we speculate that this could be due to lower concentration used ( icg solubility is limited ) or to the fact that icg was more protein bound such that icg aqueous angiography may model protein more than water movement . despite being limited in these experiments to fluorescein and icg by our commercial angiographer , given similar enough patterns and measurement of angiographic signal over specific regions of interest normalized for each dye with a ts - iob ratio , finer biochemical and molecular studies are planned that compare regions of initially greater or lesser aho to develop a better understanding of what causes more or less aho . as aho is better visualized through methods like aqueous angiography and more clinical experience with trabecular migsis gained , a better understanding of aho will arise and improved questions can be asked . ultimately , aho imaging may allow for improved glaucoma surgical results or facilitate development of novel pharmacologic or surgical treatments .\noutput:\n" }, { "from": "agent", "value": "purposeto assess the ability of trabecular micro - bypass stents to improve aqueous humor outflow ( aho ) in regions initially devoid of aho as assessed by aqueous angiography.methodsenucleated human eyes ( 14 total from 7 males and 3 females [ ages 5284 ] ) were obtained from an eye bank within 48 hours of death . eyes were oriented by inferior oblique insertion , and aqueous angiography was performed with indocyanine green ( icg ; 0.4 % ) or fluorescein ( 2.5 % ) at 10 mm hg . with an angiographer , infrared and fluorescent images were acquired . concurrent anterior segment optical coherence tomography ( oct ) was performed , and fixable fluorescent dextrans were introduced into the eye for histologic analysis of angiographically positive and negative areas . experimentally , some eyes ( n = 11 ) first received icg aqueous angiography to determine angiographic patterns . these eyes then underwent trabecular micro - bypass sham or stent placement in regions initially devoid of angiographic signal . this was followed by fluorescein aqueous angiography to query the effects.resultsaqueous angiography in human eyes yielded high - quality images with segmental patterns . distally , angiographically positive but not negative areas demonstrated intrascleral lumens on oct images . aqueous angiography with fluorescent dextrans led to their trapping in aho pathways . trabecular bypass but not sham in regions initially devoid of icg aqueous angiography led to increased aqueous angiography as assessed by fluorescein ( p = 0.043 ) . conclusionsusing sequential aqueous angiography in an enucleated human eye model system , regions initially without angiographic flow or signal could be recruited for aho using a trabecular bypass stent ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the online version of this article ( doi : 10.1007 / s00439 - 010 - 0939 - 8 ) contains supplementary material , which is available to authorized users . the concept of personalized medicine assumes that prediction of phenotypes based on genome information can enable better prognosis , prevention and medical care which can be tailored individually ( brand et al . however , practical application of genome - based information to medicine requires the disease risk to be predicted with high accuracy , while knowledge on genetics of common complex diseases is still insufficient to allow their accurate prediction solely from dna data ( alaerts and del - favero 2009 ; chung et al . knowledge gained on externally visible characteristics ( evc ) from genotype data obtained by examination of crime scene samples may be used for investigative intelligence purposes , especially in suspect - less cases ( kayser and schneider 2009 ) . the idea is based on using dna - predicted evc information to encircle a perpetrator in a larger population of unknown suspects . such approach could also be useful in cases pertaining identification of human remains by extending anthropological findings on physical appearance of an identified individual . one notable exception is eye ( iris ) color , where previous candidate gene studies and especially recent genome - wide association studies ( gwas ) revealed 15 genes involved ( eiberg et al .2002 ; kayser et al . 2008 ; liu et al . 2010 ; rebbeck et al . one of them , herc2 , harbors genetic variation most strongly associated with human eye color variation ( eiberg et al . 2008 ; kayser et al . moreover , a recent systematic study investigating the predictive value of eye color associated single nucleotide polymorphisms ( snps ) ( liu et al . 2009 ) found that a model with 15 snps from 8 genes predicts categorized blue and brown eye color with high accuracies with a subset of only 6 snps covering most of the predictive information . the irisplex system employing these six snps and a prediction model based on data from thousands of europeans was recently developed and validated for dna prediction of human eye color in forensic applications ( walsh et al . 2010a , b ) . furthermore , a recent gwas on quantitative eye color explained about 50 % of continuous eye color variation by genetic factors ( liu et al . the recent progress on dna prediction of human eye color raises expectations for the dna prediction of other human pigmentation traits , such as hair color . inheritance of one particular hair color in humans i.e. , red hair , has already been explained to a significant degree . ( 1995 ) have found that red hair color is mainly associated with polymorphisms in the mc1r gene . this information has been confirmed since in many other studies performed on various population samples ( box et al . mc1r snps are fairly indicative for red hair and thus have already been implemented in forensic science ( branicki et al . 2007 ; grimes et al .2001 ) , but the practical application of red hair color prediction ( without the ability to predict other hair colors ) strongly depends on the population it is applied to , given the strong differences in red hair color frequency between populations . additional data on red hair color inheritance came from a recent gwas in icelanders , which revealed two snps in the asip gene , representing a mc1r antagonist , as significantly associated with red hair color ( sulem et al . moreover , a position in the 3 - utr of the asip gene was previously associated with dark hair color in european populations ( kanetsky et al . the candidate gene approach also delivered two non - synonymous snps in slc45a2 ( matp ) with association to dark hair color in another study with several confirmation studies ( branicki et al .2005 ) . via several large gwass various snps in / nearby genes in addition to mc1r , asip and slc45a2 have been found with association to human hair color variation , such as oca2 , herc2 , slc24a4 , kitlg , tyr , tpcn2 , tyrp1 , irf4 , exoc2 , kif26a , and obscn ( han et al .2007 , 2008 ) . furthermore , two recently published studies tested for hair color association of snps from a large number of candidate genes , not only confirmed some previously known hair color genes , such as kitlg , oca2 , mc1r , tyrp1 , tyr , slc45a2 , herc2 , asip , but additionally reported association with quantitative measures of hair color of snps in additional genes , such as slc24a5 , myo5a , myo7a , mlph , gpr143 , dct , hps3 , gnas , prkaria , ercc6 , and dtnbp1 in one or both studies ( mengel - from et al .2010 ) . in the present study , we tested in polish europeans with single - observer hair color phenotype data the predictive power of 45 snps from 12 genes previously implicated with replicated evidence in human hair color variationthe study was approved by the ethics committee of the jagiellonian university , number kbet / 17 / b / 2005 and the commission on bioethics of the regional board of medical doctors in krakow number 48 kbl / oil / 2008 . samples were collected from patients attending dermatological consultations at the department of dermatology of the jagiellonian university hospital . hair color phenotypes were collected by a combination of self - assessment and professional single observer grading . a single dermatologist interviewed and assessed all the subjects . the questionnaire included basic information , such as gender and age as well as data concerning pigmentation phenotype . the study included 385 individuals ( 39.0 % male ) after genetic and phenotypic quality control . categorical hair color was assessed by examination of the scalp in majority of cases . in a rare number of elderly volunteers and volunteers with dyed hair at the time of inspection we used ihair color was classified into 7 categories : blond ( 16.4 % ) , dark - blond ( 37.7 % ) , brown ( 9.4 % ) , auburn ( 3.1 % ) , blond - red ( 11.2 % ) , red ( 10.6 % ) , and black ( 11.7 % ) . for some analyses , we grouped blond and dark - blond into one blond group ( 54.1 % ) and auburn , blond - red , and red into one red group ( 24.9 % ) resulting into 4 categories . notably , the frequency of red hair color in our study population is higher than expected in the general polish population because of an enrichment of red hair colored individuals in the sampling process . this was done to demonstrate prediction accuracy of red hair , similar to other hair color , as red hair normally is relatively rare in the polish population . hence , the color distribution of the selected samples in our study does not represent that of the general polish population ( a point not relevant for the purpose of our study ) . this study was based on 45 snps from 12 genes ( table 1 ) , including slc45a2 , irf4 , exoc2 , tyrp1 , tpcn2 , tyr , kitlg , slc24a4 , oca2 , herc2 , mc1r , and asip that were associated with human hair color variation in several previous studies ( duffy et al .2007 ; graf et al . 2005 ; han et al . 2008 ; kanetsky et al . 2002 , 2004 ; valverde et al . 1995 ; sulem et al . a subset of 25 snps were genotyped via mass spectrometry using sequenom multiplexing ( see supplementary table s1 for additional details about markers and methods ) . multiplex assay design was performed with the software massarray assay design version 3.1.2.2 ( sequenom inc . the results were two 7 - plexes and one 11 - plex ( see supplementary table 1 ) . a 2 ng of dried genomic dna in 384 - well plates ( applied biosystems ) was amplified in a reaction volume of 5 l containing 1 pcr buffer , 1.625 mm mgcl2 , 500 m dntps , 100 nm each pcr primer , 0.5 u pcr enzyme ( sequenom ) . the reaction was incubated in a geneamp pcr system 9700 ( applied biosystems ) at 94c for 4 min followed by 45 cycles of 94c for 20 s , 56c for 30 s , 72c for 1 min , followed by 3 min at 72c . to remove the excess dntps , 2 l sap mix containing 1 sap buffer and 0.5 u shrimp alkaline phosphatase ( sequenom ) this was incubated in a geneamp pcr system 9700 ( applied biosystems ) at 37c for 40 min followed by 5 min at 85c for deactivation of the enzyme . then 2 l of extension mix is added containing a concentration of adjusted extend primers varying between 3.5 and 7 m for each primer , 1 iplex buffer ( sequenom ) , iplex termination mix ( sequenom ) and iplex enzyme ( sequenom ) . the extension reaction was incubated in a geneamp pcr system 9700 ( applied biosystems ) at 94c for 30 s followed by 40 cycles of 94c for 5 s , 5 cycles of 52c for 5 s , and 80c for 5 s , then 72c for 3 min . after the extension reaction it is desalted by the addition of 6 mg clean resin ( sequenom ) and 16 l water , rotating the plate for 15 min and centrifuging . the extension product was spotted onto a g384 + 10 spectrochip ( sequenom ) with the massarray nanodispenser model rs1000 ( sequenom ) . the chip is then transferred into the massarray compact system ( sequenom ) where the data are collected , using typeranalyzer version 4.0.3.18 ( sequenom ) , spectroacquire version 3.3.1.3 ( sequenom ) , genoflex version 1.1.79.0 ( sequenom ) , and massarraycaller version 3.4.0.41 ( sequenom ) . the data were checked manually after the data collection . vaguely positioned dots produced by typeranalyzer 3.4 ( sequenom ) and all the wells that 50 % or more failed snps were excluded from analysis . blanks ( 2 % ) , controls ( 2 % ) , and duplicates ( 9 % ) were checked for any inconsistencies and false positives . furthermore , snps in the mc1r gene were analyzed by amplification and cycle sequencing of the complete mc1r exon using the procedure described in branicki et al . selected polymorphisms within genes asip ( rs6058017 ) , oca2 ( rs1800407 , rs1800401 , rs7495174 , rs4778241 , rs4778138 ) , slc45a2 ( rs16891982 , rs26722 ) , and herc2 ( rs916977 ) were analyzed using minisequencing procedure and snapshot multiplex kit . briefly , the pcr reaction was composed of 5 l of qiagen multiplex pcr kit ( qiagen , hilden , germany ) , 1 l of primer premix , 2 l of q solution , and 2 l ( approximately 5 ng ) of template dna . the temperature profile was as follows : { 94 for 15 min ( 94 for 30 s , 5860c for 90 s , and 72 for 90 s ) 32 , 72/10 min } 4c / . the pcr products were purified with a mixture of exoi and sap enzymes ( fermentas , vilnius , lithuania ) and subjected to multiplex minisequencing reactions with a snapshot multiplex kit ( applied biosystems , foster city , ca , usa ) . a 2 l of snapshot kit was combined with 1 l of extension primers premix , 1 l of the purified pcr product , and nuclease - free water up to 10 l . the products of extension reactions were purified with sap enzyme and analyzed on abi 3100 avant genetic analyzer ( applied biosystems , foster city , ca , usa ) . table 1single snp hair color association in a polish samplevariantchrpositiongeneabmafcoloror95 % lower ci95 % upper cip valotherrs16891982533987450slc45a2gc0 .02 black5 .111.7914.550.002 yesrs28777533994716slc45a2ac0 .02 black7 .052.2322.250.001 yesrs26722533999627slc45a2ga0 .02 black5 .531.6418.680.006 yesrs122035926341321irf4ct0 .08 black2 .351.224.540.011 yesrs93788056362727irf4ac0 .450.103 rs49592706402748exoc2ca0 .46 black0 .560.350.910.020 yesrs1408799912662097tyrp1ct0 .290.097 rs2733832912694725tyrp1tc0 .400.177 rs683912699305tyrp1ac0 .340.099 rs352648751168602975tpcn2at0 .230.158 rs38292411168611939tpcn2ga0 .370.183 rs23054981168623490tpcn2ga0 .270.230 rs10111761168690473tpcn2tc0 .360.096 rs10426021188551344tyrca0 .280.255 rs13933501188650694tyrga0 .25 brown1 .701.022.820.041 yesrs128212561287852466kitlgtc0 .090.052 rs128963991491843416slc24a4gt0 .440.064 rs49048681491850754slc24a4ct0 .46 blond0 .640.430.970.037 rs24021301491870956slc24a4ag0 .16 d - blond0.620.390.960.033rs18004071525903913oca2ct0.07red3.231.079.760.038rs18004011525933648oca2ct0.060.105rs169508211525957102oca2ct0.120.170rs71740271526002360oca2ct0.120.146rs47781381526009415oca2tc0.16brown1.801.023.190.043yesrs47782411526012308oca2gt0.180.078rs74951741526017833oca2tc0.050.069rs129138321526039213herc2ct0.22black3.331.995.574.3e06yesrs71838771526039328herc2ca0.070.124rs116358841526042564herc2tc0.010.135rs9169771526186959herc2ct0.15red0.340.180.650.001yesrs80391951526189679herc2tc0.11red0.300.140.640.002yesmc1r_r16mc1rwtr0.31 red12.647.0322.742.5e17yesmc1r_r16mc1rwtr0.20 red2 .501.354.310.003 yesrs18050051689985844mc1rgt0 .08 blond2 .991.525.860.001 yesy152och1689986122mc1rac0 .000.982 n29insa1689985753mc1r insa0 .01 red53 .601.292221.720.036 rs18050061689985918mc1rca0 .000.476 rs22284791689985940mc1rga0 .09 red0 .430.190.970.043 rs115474641689986091mc1rga0 .02 red3 .351.0410.760.042 rs18050071689986117mc1rct0 .11 red6 .693.5012.799.3 e09yesrs11104001689986130mc1rtc0 .020.314 rs18050081689986144mc1rct0 .16 red5 .693.319.783.2 e10yesrs8854791689986154mc1rga0 .03 blond2 .901.216.960.017 rs18050091689986546mc1rgc0 .01 red31 .852.61388.280.007 yesrs10153622032202273asipct0 .30 b - red1 .671.022.750.043 rs60580172032320659asipag0 .130.211 rs23782492032681751asipag0 .18 red2 .341.144.820.021 yesmaf minor allele frequency , color the most significantly associated color , or the allelic odds ratio for the minor b allele , shown only if p 0.05 , p val the p value adjusted for age and gender , other if the snp is also associated with other colors with p 0.05 single snp hair color association in a polish sample maf minor allele frequency , color the most significantly associated color , or the allelic odds ratio for the minor b allele , shown only if p 0.05 , p val the p value adjusted for age and gender , other if the snp is also associated with other colors with p 0.05 the frequency of hair color was compared between male and females using cross tabulation . mc1r polymorphisms are largely recessive when considered individually , but also interact with each other through the genetic mechanism known asr , include y152och , n29insa , d84e ( rs1805006 ) , r142h ( rs11547464 ) , r151c ( rs1805007 ) , r160w ( rs1805008 ) , d294h ( rs1805009 ) , and low - penetrance variants , as r , include v60l ( rs1805005 ) , v92 m ( rs2228479 ) , i155 t ( rs1110400 ) , r163q ( rs885479 ) . we followed the tradition and used the r and r variables by combining the information of all known causal variants in the mc1r gene in the association and the prediction analyses . the r variant was defined by the total number of the high - penetrance variants in the mc1r gene so that each individual has three possible genotype states , homozygote wildtype for all variants ( wt / wt ) , heterozygote for one high - penetrant variant ( wt / r ) , and homozygote for at least one or compound heterozygote for at least two high - penetrant variants ( r / r ) . the r variant was defined similarly by considering the low - penetrant variants in the mc1r gene ( wt / wt , wt / r , r / r ) . all ascertained snps including the r and r variants were tested for association with each hair color category ( binary coded 0 , 1 ) using logistic regression adjusted for gender and age . we derived the allelic odds ratios ( ors ) , where the snp genotypes were coded using 0 , 1 , or 2 number of the minor alleles ( table 1 ) . we also derived the genotypic ors , where the homozygote minor alleles and heterozygote genotypes were compared with homozygote wildtypes ( supplementary table s2 ) . we used a multinomial logistic regression model for the prediction analysis , and the modeling details follow closely the previous study of eye color ( liu et al . consider hair color , y , to be four categories blond , brown , red , and black , which are determined by the genotype , x , of k snps , where x represents the number of minor alleles per k snp . let 1 , 2 , 3 , and 4 denote the probability of blond , brown , red , and black , respectively . the multinomial logistic regression can be written as \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ text { logit } } ( \\ pr ( y = { \\ text { blond } } | x _ { 1 } \\ ldots x _ { k } ) ) = \\ ln \\ left ( { { \\ frac { { \\ pi _ { 1 } } } { { \\ pi _ { 4 } } } } } \\ right ) = \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } x _ { k } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ text { logit } } ( \\ pr ( y = { \\ text { brown } } | x _ { 1 } \\ ldots x _ { k } ) ) = \\ ln \\ left ( { { \\ frac { { \\ pi _ { 2 } } } { { \\ pi _ { 4 } } } } } \\ right ) = \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } x _ { k } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ text { logit } } ( \\ pr ( { { y } } = { \\ text { red } } | x _ { 1 } \\ ldots x _ { k } ) ) = \\ ln \\ left ( { { \\ frac { { \\ pi _ { 3 } } } { { \\ pi _ { 4 } } } } } \\ right ) = \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } x _ { k } } $ $ \\ end { document } where and can be derived in the training set . hair color of each individual in the testing set can be probabilistically predicted based on his or her genotypes and the derived and , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 1 } = { \\ frac { { \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) } } { { 1 + \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 2 } = { \\ frac { { \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) } } { { 1 + \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 3 } = { \\ frac { { \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } { { 1 + \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 4 } = 1 - \\ pi _ { 1 } - \\ pi _ { 2 } - \\ pi _ { 3 } . $ $ \\ end { document } categorically , the color category with the max ( 1 , 2 , 3 , 4 ) was considered as the predicted color . we evaluated the performance of the prediction model in the testing set using the area under the receiver operating characteristic ( roc ) curves , or auc ( janssens et al . auc is the integral of roc curves which ranges from 0.5 representing total lack of prediction to 1.0 representing perfect prediction . cross - validations were conducted 1,000 replicates ; in each replicate 80 % individuals were used as the training set and the remaining samples were used as the testing set . the average accuracy estimates of all replicates were reported . because of a relatively small sample size and rare mc1r polymorphisms with large effects , the cross - validation may give conservative estimates of the prediction accuracy . thus , we report both the results with and without cross - validations , i.e. using the whole sample for training and prediction . the selection of snps in the final model was based on the contribution of each snp to the predictive accuracy using a step - wise analysis by iteratively including the next largest contributor to the model . the contribution of each snp was measured by the gain of total auc of the models with and without that snp . the mc1r , r and r , and the oca2 snp , rs1800407 , were always included in the prediction model due to their known biological function . the herc2 snp , rs12193832 , was also always included because of its known extraordinary large effect on all human pigmentation traits . because the sample size included in the current study is relatively small , we estimated the effect of sample size on the accuracy of the prediction analysis using the data from a previously published study of eye color ( liu et al .2009 ) , in which a larger sample was available ( n = 6,168 ) . a sample of n individuals was randomly bootstrapped 1,000 times from the 6,168 participants of the rotterdam study , for whom the eye color information and genotypes of the six most important eye color snps were available . for each bootstrap , a binary logistic regression model was built in a randomly selected subsample ( 80 % of n individuals ) using the six most eye color predictive snps from liu et al . ( 2009 ) as the predictors and the blue eye color ( yes , no ) as the binary outcome . the logistic model was then used to predict the blue color in the remaining sample ( 20 % of n individuals ) , based on which an auc value was derived . the mean , the 95 % upper , and the 95 % lower auc values of the 1,000 bootstraps were reported . the bootstrap analysis was conducted for various n ranging from 100 to 800 ( supplementary figure s1 ) . further , we conducted a prediction analysis using the multinomial lasso regression model implemented in the r library glmnet v1 .1 - 4 ( friedman et al . 2010 ) . the cross - validations of lasso analysis were also conducted 1,000 replicates based on the 8020 % split . the study was approved by the ethics committee of the jagiellonian university , number kbet / 17 / b / 2005 and the commission on bioethics of the regional board of medical doctors in krakow number 48 kbl / oil / 2008 . samples were collected from patients attending dermatological consultations at the department of dermatology of the jagiellonian university hospital . hair color phenotypes were collected by a combination of self - assessment and professional single observer grading . a single dermatologist interviewed and assessed all the subjects . the questionnaire included basic information , such as gender and age as well as data concerning pigmentation phenotype . the study included 385 individuals ( 39.0 % male ) after genetic and phenotypic quality control . categorical hair color was assessed by examination of the scalp in majority of cases . in a rare number of elderly volunteers and volunteers with dyed hair at the time of inspection we used ihair color was classified into 7 categories : blond ( 16.4 % ) , dark - blond ( 37.7 % ) , brown ( 9.4 % ) , auburn ( 3.1 % ) , blond - red ( 11.2 % ) , red ( 10.6 % ) , and black ( 11.7 % ) . for some analyses , we grouped blond and dark - blond into one blond group ( 54.1 % ) and auburn , blond - red , and red into one red group ( 24.9 % ) resulting into 4 categories . notably , the frequency of red hair color in our study population is higher than expected in the general polish population because of an enrichment of red hair colored individuals in the sampling process . this was done to demonstrate prediction accuracy of red hair , similar to other hair color , as red hair normally is relatively rare in the polish population . hence , the color distribution of the selected samples in our study does not represent that of the general polish population ( a point not relevant for the purpose of our study ) . this study was based on 45 snps from 12 genes ( table 1 ) , including slc45a2 , irf4 , exoc2 , tyrp1 , tpcn2 , tyr , kitlg , slc24a4 , oca2 , herc2 , mc1r , and asip that were associated with human hair color variation in several previous studies ( duffy et al .2007 ; graf et al . 2005 ; han et al . 2008 ; kanetsky et al . 2002 , 2004 ; valverde et al . 1995 ; sulem et al . 2007 , 2008 ) . a subset of 25 snps were genotyped via mass spectrometry using sequenom multiplexing ( see supplementary table s1 for additional details about markers and methods ) . multiplex assay design was performed with the software massarray assay design version 3.1.2.2 ( sequenom inc . , san diego , usa ) . the results were two 7 - plexes and one 11 - plex ( see supplementary table 1 ) . a 2 ng of dried genomic dna in 384 - well plates ( applied biosystems ) was amplified in a reaction volume of 5 l containing 1 pcr buffer , 1.625 mm mgcl2 , 500 m dntps , 100 nm each pcr primer , 0.5 u pcr enzyme ( sequenom ) . the reaction was incubated in a geneamp pcr system 9700 ( applied biosystems ) at 94c for 4 min followed by 45 cycles of 94c for 20 s , 56c for 30 s , 72c for 1 min , followed by 3 min at 72c . to remove the excess dntps , 2 l sap mix containing 1 sap buffer and 0.5 u shrimp alkaline phosphatase ( sequenom ) this was incubated in a geneamp pcr system 9700 ( applied biosystems ) at 37c for 40 min followed by 5 min at 85c for deactivation of the enzyme . then 2 l of extension mix is added containing a concentration of adjusted extend primers varying between 3.5 and 7 m for each primer , 1 iplex buffer ( sequenom ) , iplex termination mix ( sequenom ) and iplex enzyme ( sequenom ) . the extension reaction was incubated in a geneamp pcr system 9700 ( applied biosystems ) at 94c for 30 s followed by 40 cycles of 94c for 5 s , 5 cycles of 52c for 5 s , and 80c for 5 s , then 72c for 3 min . after the extension reaction it is desalted by the addition of 6 mg clean resin ( sequenom ) and 16 l water , rotating the plate for 15 min and centrifuging . the extension product was spotted onto a g384 + 10 spectrochip ( sequenom ) with the massarray nanodispenser model rs1000 ( sequenom ) . the chip is then transferred into the massarray compact system ( sequenom ) where the data are collected , using typeranalyzer version 4.0.3.18 ( sequenom ) , spectroacquire version 3.3.1.3 ( sequenom ) , genoflex version 1.1.79.0 ( sequenom ) , and massarraycaller version 3.4.0.41 ( sequenom ) . the data were checked manually after the data collection . vaguely positioned dots produced by typeranalyzer 3.4 ( sequenom ) and all the wells that 50 % or more failed snps were excluded from analysis . blanks ( 2 % ) , controls ( 2 % ) , and duplicates ( 9 % ) were checked for any inconsistencies and false positives . furthermore , snps in the mc1r gene were analyzed by amplification and cycle sequencing of the complete mc1r exon using the procedure described in branicki et al . selected polymorphisms within genes asip ( rs6058017 ) , oca2 ( rs1800407 , rs1800401 , rs7495174 , rs4778241 , rs4778138 ) , slc45a2 ( rs16891982 , rs26722 ) , and herc2 ( rs916977 ) were analyzed using minisequencing procedure and snapshot multiplex kit . briefly , the pcr reaction was composed of 5 l of qiagen multiplex pcr kit ( qiagen , hilden , germany ) , 1 l of primer premix , 2 l of q solution , and 2 l ( approximately 5 ng ) of template dna . the temperature profile was as follows : { 94 for 15 min ( 94 for 30 s , 5860c for 90 s , and 72 for 90 s ) 32 , 72/10 min } 4c / . the pcr products were purified with a mixture of exoi and sap enzymes ( fermentas , vilnius , lithuania ) and subjected to multiplex minisequencing reactions with a snapshot multiplex kit ( applied biosystems , foster city , ca , usa ) . a 2 l of snapshot kit was combined with 1 l of extension primers premix , 1 l of the purified pcr product , and nuclease - free water up to 10 l . the products of extension reactions were purified with sap enzyme and analyzed on abi 3100 avant genetic analyzer ( applied biosystems , foster city , ca , usa ) . table 1single snp hair color association in a polish samplevariantchrpositiongeneabmafcoloror95 % lower ci95 % upper cip valotherrs16891982533987450slc45a2gc0 .02 black5 .111.7914.550.002 yesrs28777533994716slc45a2ac0 .02 black7 .052.2322.250.001 yesrs26722533999627slc45a2ga0 .02 black5 .531.6418.680.006 yesrs122035926341321irf4ct0 .08 black2 .351.224.540.011 yesrs93788056362727irf4ac0 .450.103 rs49592706402748exoc2ca0 .46 black0 .560.350.910.020 yesrs1408799912662097tyrp1ct0 .290.097 rs2733832912694725tyrp1tc0 .400.177 rs683912699305tyrp1ac0 .340.099 rs352648751168602975tpcn2at0 .230.158 rs38292411168611939tpcn2ga0 .370.183 rs23054981168623490tpcn2ga0 .270.230 rs10111761168690473tpcn2tc0 .360.096 rs10426021188551344tyrca0 .280.255 rs13933501188650694tyrga0 .25 brown1 .701.022.820.041 yesrs128212561287852466kitlgtc0 .090.052 rs128963991491843416slc24a4gt0 .440.064 rs49048681491850754slc24a4ct0 .46 blond0 .640.430.970.037 rs24021301491870956slc24a4ag0 .16 d - blond0.620.390.960.033rs18004071525903913oca2ct0.07red3.231.079.760.038rs18004011525933648oca2ct0.060.105rs169508211525957102oca2ct0.120.170rs71740271526002360oca2ct0.120.146rs47781381526009415oca2tc0.16brown1.801.023.190.043yesrs47782411526012308oca2gt0.180.078rs74951741526017833oca2tc0.050.069rs129138321526039213herc2ct0.22black3.331.995.574.3e06yesrs71838771526039328herc2ca0.070.124rs116358841526042564herc2tc0.010.135rs9169771526186959herc2ct0.15red0.340.180.650.001yesrs80391951526189679herc2tc0.11red0.300.140.640.002yesmc1r_r16mc1rwtr0.31 red12.647.0322.742.5e17yesmc1r_r16mc1rwtr0.20 red2 .501.354.310.003 yesrs18050051689985844mc1rgt0 .08 blond2 .991.525.860.001 yesy152och1689986122mc1rac0 .000.982 n29insa1689985753mc1r insa0 .01 red53 .601.292221.720.036 rs18050061689985918mc1rca0 .000.476 rs22284791689985940mc1rga0 .09 red0 .430.190.970.043 rs115474641689986091mc1rga0 .02 red3 .351.0410.760.042 rs18050071689986117mc1rct0 .11 red6 .693.5012.799.3 e09yesrs11104001689986130mc1rtc0 .020.314 rs18050081689986144mc1rct0 .16 red5 .693.319.783.2 e10yesrs8854791689986154mc1rga0 .03 blond2 .901.216.960.017 rs18050091689986546mc1rgc0 .01 red31 .852.61388.280.007 yesrs10153622032202273asipct0 .30 b - red1 .671.022.750.043 rs60580172032320659asipag0 .130.211 rs23782492032681751asipag0 .18 red2 .341.144.820.021 yesmaf minor allele frequency , color the most significantly associated color , or the allelic odds ratio for the minor b allele , shown only if p 0.05 , p val the p value adjusted for age and gender , other if the snp is also associated with other colors with p 0.05 single snp hair color association in a polish sample maf minor allele frequency , color the most significantly associated color , or the allelic odds ratio for the minor b allele , shown only if p 0.05 , p val the p value adjusted for age and gender , other if the snp is also associated with other colors with p 0.05 mc1r polymorphisms are largely recessive when considered individually , but also interact with each other through the genetic mechanism known as compound heterozygosity . the high - penetrance variants , traditionally coded as r , include y152och , n29insa , d84e ( rs1805006 ) , r142h ( rs11547464 ) , r151c ( rs1805007 ) , r160w ( rs1805008 ) , d294h ( rs1805009 ) , and low - penetrance variants , as r , include v60l ( rs1805005 ) , v92 m ( rs2228479 ) , i155 t ( rs1110400 ) , r163q ( rs885479 ) . we followed the tradition and used the r and r variables by combining the information of all known causal variants in the mc1r gene in the association and the prediction analyses . the r variant was defined by the total number of the high - penetrance variants in the mc1r gene so that each individual has three possible genotype states , homozygote wildtype for all variants ( wt / wt ) , heterozygote for one high - penetrant variant ( wt / r ) , and homozygote for at least one or compound heterozygote for at least two high - penetrant variants ( r / r ) . the r variant was defined similarly by considering the low - penetrant variants in the mc1r gene ( wt / wt , wt / r , r / r ) . all ascertained snps including the r and r variants were tested for association with each hair color category ( binary coded 0 , 1 ) using logistic regression adjusted for gender and age . we derived the allelic odds ratios ( ors ) , where the snp genotypes were coded using 0 , 1 , or 2 number of the minor alleles ( table 1 ) . we also derived the genotypic ors , where the homozygote minor alleles and heterozygote genotypes were compared with homozygote wildtypes ( supplementary table s2 ) . we used a multinomial logistic regression model for the prediction analysis , and the modeling details follow closely the previous study of eye color ( liu et al . consider hair color , y , to be four categories blond , brown , red , and black , which are determined by the genotype , x , of k snps , where x represents the number of minor alleles per k snp . let 1 , 2 , 3 , and 4 denote the probability of blond , brown , red , and black , respectively . the multinomial logistic regression can be written as \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ text { logit } } ( \\ pr ( y = { \\ text { blond } } | x _ { 1 } \\ ldots x _ { k } ) ) = \\ ln \\ left ( { { \\ frac { { \\ pi _ { 1 } } } { { \\ pi _ { 4 } } } } } \\ right ) = \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } x _ { k } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ text { logit } } ( \\ pr ( y = { \\ text { brown } } | x _ { 1 } \\ ldots x _ { k } ) ) = \\ ln \\ left ( { { \\ frac { { \\ pi _ { 2 } } } { { \\ pi _ { 4 } } } } } \\ right ) = \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } x _ { k } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ { \\ text { logit } } ( \\ pr ( { { y } } = { \\ text { red } } | x _ { 1 } \\ ldots x _ { k } ) ) = \\ ln \\ left ( { { \\ frac { { \\ pi _ { 3 } } } { { \\ pi _ { 4 } } } } } \\ right ) = \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } x _ { k } } $ $ \\ end { document } where and can be derived in the training set . hair color of each individual in the testing set can be probabilistically predicted based on his or her genotypes and the derived and , \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 1 } = { \\ frac { { \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) } } { { 1 + \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 2 } = { \\ frac { { \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) } } { { 1 + \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 3 } = { \\ frac { { \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } { { 1 + \\ exp ( \\ alpha _ { 1 } + \\ sum { \\ beta ( \\ pi _ { 1 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 2 } + \\ sum { \\ beta ( \\ pi _ { 2 } ) _ { k } } x _ { k } ) + \\ exp ( \\ alpha _ { 3 } + \\ sum { \\ beta ( \\ pi _ { 3 } ) _ { k } } x _ { k } ) } } } $ $ \\ end { document } \\ documentclass [ 12 pt ] { minimal } \\ usepackage { amsmath } \\ usepackage { wasysym } \\ usepackage { amsfonts } \\ usepackage { amssymb } \\ usepackage { amsbsy } \\ usepackage { mathrsfs } \\ usepackage { upgreek } \\ setlength { \\ oddsidemargin } { - 69 pt } \\ begin { document } $ $ \\ pi _ { 4 } = 1 - \\ pi _ { 1 } - \\ pi _ { 2 } - \\ pi _ { 3 } . $ $ \\ end { document } categorically , the color category with the max ( 1 , 2 , 3 , 4 ) was considered as the predicted color . we evaluated the performance of the prediction model in the testing set using the area under the receiver operating characteristic ( roc ) curves , or auc ( janssens et al . auc is the integral of roc curves which ranges from 0.5 representing total lack of prediction to 1.0 representing perfect prediction . cross - validations were conducted 1,000 replicates ; in each replicate 80 % individuals were used as the training set and the remaining samples were used as the testing set . the average accuracy estimates of all replicates were reported . because of a relatively small sample size and rare mc1r polymorphisms with large effects , the cross - validation may give conservative estimates of the prediction accuracy . thus , we report both the results with and without cross - validations , i.e. using the whole sample for training and prediction . the selection of snps in the final modelwas based on the contribution of each snp to the predictive accuracy using a step - wise analysis by iteratively including the next largest contributor to the model . the contribution of each snp was measured by the gain of total auc of the models with and without that snp . the mc1r , r and r , and the oca2 snp , rs1800407 , were always included in the prediction model due to their known biological function . the herc2 snp , rs12193832 , was also always included because of its known extraordinary large effect on all human pigmentation traits . because the sample size included in the current study is relatively small , we estimated the effect of sample size on the accuracy of the prediction analysis using the data from a previously published study of eye color ( liu et al .2009 ) , in which a larger sample was available ( n = 6,168 ) . a sample of n individuals was randomly bootstrapped 1,000 times from the 6,168 participants of the rotterdam study , for whom the eye color information and genotypes of the six most important eye color snps were available . for each bootstrap , a binary logistic regression model was built in a randomly selected subsample ( 80 % of n individuals ) using the six most eye color predictive snps from liu et al . ( 2009 ) as the predictors and the blue eye color ( yes , no ) as the binary outcome . the logistic model was then used to predict the blue color in the remaining sample ( 20 % of n individuals ) , based on which an auc value was derived . the mean , the 95 % upper , and the 95 % lower auc values of the 1,000 bootstraps were reported . the bootstrap analysis was conducted for various n ranging from 100 to 800 ( supplementary figure s1 ) . further , we conducted a prediction analysis using the multinomial lasso regression model implemented in the r library glmnet v1 .1 - 4 ( friedman et al . the cross - validations of lasso analysis were also conducted 1,000 replicates based on the 8020 % split . first , we tested the genotyped snps for hair color association in our study sample . although variation in mc1r is usually attributed to red hair color ( branicki et al . 2007 ; grimes et al . 2001 ; valverde et al . 1995 ) , the compound variant mc1r - r in our study was significantly associated with all but one ( auburn ) hair color category , albeit its association was strongest with red hair ( allelic or : 12.6 ; 95 % ci : [ 7.022.7 ] ; p = 2.510 ; table 1 ) . the lack of association of the mc1r - r variant with auburn hair color may be caused by the small sample size of the auburn category and / or problems with correct classification of this hair color as reported elsewhere ( mengel - from et al . furthermore , mc1r - r showed a clear recessive effect and a compound - heterozygote effect in that the r / r genotype carriers were much more likely to have red hair ( genotypic or : 262.2 ; 95 % ci : [ 65.21,055.3 ] ; p = 4.510 ) than the wt / r carriers ( genotypic or : 5.6 ; 95 % ci : [ 2.512.6 ] ; p = 4.010 ; supplementary table s2 ) . the stronger association of mc1r snps with red hair than with non - red hair colors as observed here was also found previously ( han et al . the snp rs12913832 in the herc2 gene was significantly associated with all hair color categories , most significantly with brown ( allelic or for t vs. c : 3.5 ; 95 % ci : [ 2.06.1 ] ; p = 1.310 ) and black ( allelic or : 3.3 ; 95 % ci : [ 2.05.6 ] ; p = 4.310 ; table 1 ) hair . the t allele of rs12913832 showed a dominant effect on darker hair color in that the heterozygote carriers had a further increased or of black hair ( genotypic or : 8.6 ; 95 % ci : [ 3.918.9 ] ; p = 7.210 ; supplementary table s2 ) . this snp was associated with total hair melanin in a recent study ( valenzuela et al . a previous study found herc2 snps significantly associated with non - red , but not with red , hair colors ( sulem et al .2007 ) , and another one reported herc2 association only with dark hair color ( mengel - from et al . 2009 ) . however , an additional study found herc2 association with all hair colors , albeit reported stronger association with non - red hair colors than with red hair ( han et al . , 2008 ) , in agreement with our findings . additional snps in mc1r and herc2 were also significantly associated with several hair colors ( table 1 ) . except for mc1r and herc2 genes , no significant evidence of a dominant or a recessive effects on hair colorsnps in slc45a2 ( rs28777 allelic or for c vs. g : 7.05 ; 95 % ci : [ 2.222.3 ] ; p = 0.001 ) , irf4 ( rs12203592 allelic or for t vs. c : 7.05 ; 95 % ci : [ 2.222.3 ] ; p = 0.01 ) , and exoc2 ( rs4959270 allelic or for a vs. c : 0.56 ; 95 % ci : [ 0.350.91 ] ; p = 0.02 ) were most significantly associated with black hair color ( table 1 ) , in line with the previous reports ( han et al . further , an association of slc45a2 with total hair melanin was reported ( valenzuela et al . snps in the asip gene were associated with red ( rs2378249 , p = 0.02 ) , dark blond ( rs2378249 , p = 0.02 ) , and blond - red ( rs1015362 , p = 0.04 ; table 1 ) . significant asip association with red hair was reported previously ( sulem et al . 2008 ) , as well as with total hair melanin ( valenzuela et al . the oca2 gene was most significantly associated with brown hair color ( rs4778138 , p = 0.03 ) , confirming previous findings of oca2 involvement in hair color variation ( han et al .2009 ; valenzuela et al . 2010 ) , although one previous gwas did not find significant evidence ( sulem et al . the tyr gene was significantly associated with brown ( rs1393350 , p = 0.02 ) and the slc24a4 gene with blond ( rs4904868 , p = 0.04 ) and dark blond ( rs2402130 , p = 0.03 ) . overall , at least one snp in 9 out of the 12 genes studied showed significant association with certain hair color categories in our sample ( table 1 ) . for three genes ( tyrp1 , tpcn2 , and kitlg ) the snps tested did not reveal statistically significant hair color association ( but see below for the predictive effects of two of these genes ) , although these genes have been implicated in human hair color variation elsewhere ( sulem et al .2007 , 2008 ; valenzuela et al . 2010 ; mengel - from et al . this discrepancy may be influenced by the relatively small sample size in our study and the putatively smaller effect size of these three genes relative to the other genes studied . the main goal of this study , however , was to investigate the predictive value of hair color associated snps as established in previous , and ( mostly ) confirmed in the present study . dna - based prediction accuracies for hair color categories were evaluated by means of the area under the roc curves ( auc ) , ranging from 0.5 ( random ) to 1 ( perfect ) prediction . our model revealed that 13 single or combined ( mc1r - r and mc1r - r ) genetic variants from all , but one ( tpcn2 ) of the 12 genes investigated contribute independently to the auc value ( table 2 ) for 4 ( fig . as may be expected from the association results , mc1r_r has the most predictive power on red hair ( auc 0.860.88 ) , and its predictive effect on non - red hair colors was considerably lower ( auc 0.630.68 , fig . 1 ) . the herc2 snp rs12913832 , when added to mc1r_r in the model , contributed most of all other genetic predictors to the accuracy for predicting all color categories ( auc 0.08 for blond , 0.12 for brown , 0.03 for red , and 0.13 for black , fig . 1 ) . adding the remaining 11 independent genetic predictors provides accuracy increase and usually with decreasing effects while increasing the number of markers ( fig . 1 ) . notably , some snps without statistically significant hair color association in our study ( p 0.05 ) did provide independent information toward hair color prediction ( such as rs1042602 in tyr , rs683 in tyrp1 , and rs12821256 in kitlg ) . only the non - synonymous snps from the tpcn2 gene tested did not contribute to the prediction model and did not show a statistically significant association with any hair color category . rs35264875 andrs3829241 in tpcn2 had been discovered recently as significantly associated with blond versus brown hair color in icelandic and replicated in icelandic and dutch people ( sulem et al . predicting each color type separately using binary logistic regression yield slightly lower accuracy compared to the multinomial model ( supplementary table s3 ) . table 2parameters of the prediction model based on multinomial logistic regression in a polish samplesnpgeneeffect4 hair color categories7 hair color categoriesallelerankb1b2b3rankb1b2b3b4b5b6constant1.701.262.620.501.291.261.934.316.96mc1r_rmc1rr11.110 .554.0911.700.980.541.845.416.02 rs12913832herc2t21.750.102.4922.581.550.100.894.683.21rs12203592irf4t31.291.151.1341.431.241.141.031.161.19rs1042602tyra40.390.301.2030.530.350.301.071.081.67rs4959270exoc2a50.770.851.1550.560.810.841.240.921.11rs28777slc45a2c61.6913.890.101213.781.3111.097.842.022.91rs683tyrp1c70.100.580.02100.210.210.570.490.090.24rs1800407oca2t80.491.140.1981.010.441.1210.321.021.26mc1r_rmc1rr90.460 .550.6160.740.400.550.531.221.69 rs2402130slc24a4g100 .480.090.5490.220.570.090.610.610.73 rs12821256kitlgc110 .690.010.87110.450.720.020.710.300.94 rs16891982slc45a2c120 .8211.783.48130.620.849.099.556.770.97 rs2378249asipg130 .180.160.4070.170.290.160.540.431.03 b1 , b2 , b3 in the 4 categories are the betas for blond , brown , and red , all versus black ; b1 to b6 in the 7 categories are the betas for blond , d - blond , brown , auburn , b - red , and red , all versus black ; rank , prediction rank with 1 having the highest and 13 having the lowest rank in the prediction analysisfig . auc was plotted against the number of snps included in the multinomial logistic model for predicting 4 ( a ) and 7 ( b ) hair color categories . snp annotation and prediction ranks are provided in table 2 parameters of the prediction model based on multinomial logistic regression in a polish sample b1 , b2 , b3 in the 4 categories are the betas for blond , brown , and red , all versus black ; b1 to b6 in the 7 categories are the betas for blond , d - blond , brown , auburn , b - red , and red , all versus black ; rank , prediction rank with 1 having the highest and 13 having the lowest rank in the prediction analysis accuracy of hair color prediction using dna variants in a polish sample . auc was plotted against the number of snps included in the multinomial logistic model for predicting 4 ( a ) and 7 ( b ) hair color categories . snp annotation and prediction ranks are provided in table 2 overall , hair color prediction with 13 dna components from 11 genes showed very good accuracy without cross - validation , such as auc for blond = 0.81 , brown = 0.82 , red = 0.93 , black = 0.87 in the 4 category model ( table 3 ; fig .1 a ) , and auc for blond = 0.78 , d - blond = 0.73 , brown = 0.82 , auburn = 0.82 , b - red = 0.92 , red = 0.94 , black = 0.88 ( table 3 ; fig . the mean accuracies derived from 1,000 cross - validations are somewhat lower for all hair color categories ( least so for red ) , likely because of sample size effects as the rare alleles with large effects are not well captured in the training sets ( table 3 ) . table 3hair color prediction accuracy using 13 genetic markers in a polish sampleaccuracy4 hair color categories7 hair color categoriesblondbrownredblackblondd - blondbrownauburnb - redredblackusing all sample auc0 .810.820.930.870.780.730.820.820.920.940.88 sensitivity0 .880.080.780.310.170.800.140.000.530.660.38 specificity0 .550.990.950.970.960.530.981.000.950.940.95 ppv0 .700.380.840.580.480.510.450.000.560.590.49 npv0 .800.910.930.910.860.820.920.970.940.960.92 average of 1,000 cross - validations auc0 .750.720.900.780.700.660.730.640.850.900.81 sensitivity0 .830.050.740.240.150.710.080.000.410.440.29 specificity0 .520.980.930.960.930.510.971.000.920.930.94 ppv0 .670.210.770.450.330.460.200.000.420.430.43 npv0 .720.910.910.900.850.750.910.970.920.930.91 auc the area under the roc curves , ppv positive predictive value , npv negative predictive value hair color prediction accuracy using 13 genetic markers in a polish sample auc the area under the roc curves , ppv positive predictive value , npv negative predictive value in general , the sensitivities for predicting brown , red , and black colors were considerably lower than the respective specificities , except for blond in the 4 categories and dark blond in the 7 categories ( table 3 ) . the very low sensitivities for brown may reflect uncertainties in distinguishing between the dark - blond and brown colors on one side , and between the auburn , red and blond - red colors on the other side during phenotyping , as well as an additional sample size effect for auburn representing the smallest hair color group in our study ( n = 12 ) however , the final model showed a good power to discriminate highly similar hair color categories , such as red and blond - red , as well as between blond and dark - blond ( table 3 ) , underlining the value of the genetic markers involved in our hair color prediction model . the roc curves from the final model ( fig .2 ) provide practical guides for the choices between desired false positive thresholds ( 1 - specificity ) and expected true positive rates ( sensitivity ) for predicting all color categories . for example , if the desired false positive threshold is 0.2 ( in other words , if we use the predicted probability of p 0.8 as the threshold for prediction , thus we know that we have at least 80 % chance to be correct ) , then the expected true positive rates ( or sensitivities ) are 0.61 for blond ( meaning that if a person has blond hair , our model provides a 61 % chance to predict him / her as blond ) , 0.69 for brown , 0.78 for black , and 0.88 for red . notably , incorrect predictions fall more frequently in the neighboring category than in a more distant category , so the predictive information can still provide useful information.fig .2 roc curves for the final model including 13 dna predictors for 4 ( a ) and 7 ( b ) hair color categories in a polish sample roc curves for the final model including 13 dna predictors for 4 ( a ) and 7 ( b ) hair color categories in a polish sample we noticed that the prediction accuracies for the blond and brown colors were somewhat lower than those for black and red colors . one reason for this difference may be in the environmental rather than genetic contribution to hair color variation . hair color changes in some individuals during adolescence and such change is most often from blond to brown ( rees 2003 ) . since in our study we used adult individuals , those volunteers who had experienced such specific hair color change when being younger were grouped most likely in the brown hair category , although they may have blond associated genotypes . consequently , these individuals would have lowered the prediction accuracy for brown relative to the brown - haired individuals who have not changed from blond . our study design did not allow recording age - dependent hair color change , but this factor may be considered and tested in future studies . although , volunteers in the red hair color group of our study was significantly younger at time of sampling than people in any other hair color category groups ( p 0.01 ) , including age in the prediction modeling had only very little impact on the accuracy ( auc change 0.01 ) . the age difference is most likely due to our targeted sampling procedure in which the red hair color category was over - sampled in young individuals ( see material section for further details ) . in this study , gender was not significantly associated with any hair color and had no significant impact on hair color prediction accuracy . model - based hair color prediction analysis was also performed in a previous study using snps from mc1r , oca2 / herc2 , slc24a4 , tyr , kitlg and a marker from the region 6p25 .3 ( sulem et al .2007 ) that is close to the irf4 and exoc2 hair color candidate genes ( han et al . 2008 ) . however , the prediction approach used by sulem et al . ( 2007 ) is not directly comparable with ours ; they applied a two - step approach and the steps did not only differ in the predicted hair colors , but also in the genetic markers used . first , they predicted red hair by only using the two most important red hair associated polymorphisms in mc1r ( rs1805007 and rs1805008 ) and found that from those icelandic individuals ( used for replication ) who were predicted with 50 % probability to have red hair , about 70 % indeed had red hair . to make these previous findings more comparable with ours , we performed red hair prediction in our data by using only rs1805007 and rs1805008 as used by sulem et al . notably , this value is considerably lower than the one we received for red hair using all markers analyzed in the present study ( 0.93 or 0.94 ) . hence , we can conclude that the additional snps we used in our full model , in particular the additional mc1r snps , improved red hair color prediction accuracy in our study . in a second step , ( 2007 ) used associated snps from all 6 loci to predict blond , dark blond / light brown , and brown / black hair color categories . they found in their icelandic replication set that among the individuals for whom brown hair color was predicted with 50 % probability , about 60 % indeed had brown / black hair . however , their prediction results were much less convincing for blond since , from the individuals predicted to be blond with only 40 % probability ( the highest threshold reported for blond ) , less than 50 % were indeed blond , but about 50 % were dark blond / brown and a few percentage were dark or red . performing auc prediction in our samples only with the snps used by sulem et al . ( 2007 ) resulted in auc values of 0.69 for blond , 0.71 for brown , and 0.75 for black . again , aucs for all non - red hair color categories as achieved in the present study considerably exceed those estimated from the markers used by sulem et al . ( 2007 ) , which demonstrates the extra value of the additional markers we included in our model for accurate prediction also of non - red hair colors . a recently published candidate gene study employed linear regression modeling using snps from hair color candidate genes and found that three snps in herc2 , slc45a2 and slc24a5 together explain 76 % of total hair melanin in the study population ( valenzuela et al . 2010 ) . it has been shown that the least absolute shrinkage and selection operator ( lasso ) approach ( tibshirani 1996 ) can be used to estimate marker effects of thousands of snps in linkage disequilibrium ( ld ) ( usai et al . were in ld , we additionally performed the multinomial lasso regression and compared the prediction results with those from our multinomial logistic regression model . the auc estimates from lasso using all samples ( auc blond = 0.88 , brown = 0.89 , red = 0.96 , black = 0.96 ) are slightly higher than the ones from the multinomial logistic regression ( table 3 ) . however , the average auc values from the 1,000 cross - validations of the lasso approach ( auc blond = 0.66 , brown = 0.62 , red = 0.86 , and black = 0.76 ) are considerably lower than the ones obtained from all samples with the same approach , and are also lower than the results from the multinomial logistic regression ( table 3 ) . this may indicate that there is a potential over - fitting problem in the lasso method and our data . because the sample size used in this study is relatively small ( n = 385 ) , we estimated the effect of the total sample size on the accuracy of pigmentation prediction using a bootstrap analysis of the eye color data published previously ( liu et al .2009 ) , in which a auc value of 0.91 was obtained for predicting blue eye color based on a large population sample ( n = 6,168 ) . as evident from supplementary figure s1 , if the total sample size is smaller than 300 individuals , the auc value for blue eye color tends to be under - estimated with large confidence intervals . for example , with only 100 samples the mean auc value from 1,000 bootstrap analyses was considerably lower ( auc = 0.85 , 95 % ci : [ 0.61.0 ] ; figure s1 ) than the value of 0.91 as achieved with thousands of samples ( liu et al . 2009 ) . however , this effect quickly diminishes when the sample size increases , and with about 350 samples the mean auc value was close ( auc = 0.90 , 95 % ci : [ 0.800.97 ] ; figure s1 ) to the value obtained from thousands of samples , and only increased marginally until 800 samples . from this example of blue eye colorwe may extrapolate that the aucs for hair color obtained from the 385 samples included in the present study ( which are similar to the auc obtained for blue eye color ) are unlikely to change drastically when more individuals are added to the hair color model . many genetic studies on hair color ( as well as eye and skin color ) use phenotypic information provided by self - assessment , i.e. questionnaires filled out by the individual participants ( e.g. sulem et al .2007 , 2008 ; han et al . 2008 ) , which may be expected not to be completely reliable . to avoid hair color phenotype uncertainties potentially generated by such multiple - observer approach , we performed single - observer hair color grading in the present study .2008 ) . however , it is not clear how these methods as well as self - assessment and single - observer hair color categorization compare to each other and what the impact on dna - based prediction accuracies is . on the one hand vaughn et al . ( 2008 ) in a phenotypic study found some differences between single - observer hair color grading and spectrophotometric measurement , but the sample size was low ( with about 100 individuals ) . on the other hand shekar ( 2008 ) in a genetic study could not confirm the utility of spectrophotometric estimation in relation to hair color rating . the single - observer grading approach we applied in the present study was found to be more accurate than using self - assessed hair color grading ( vaughn et al . , we demonstrated that human hair color categories can be accurately predicted from a relatively small number of dna variants . the prediction accuracies achieved here for red and black hair color were in the similarly high precision range as previously obtained for blue and brown eye color , for which practical applications has already been implemented ( walsh et al .2010 a , b ) . slightly lower prediction accuracies obtained here for blond and brown hair color , which were still higher than previously observed for non - blue / non - brown eye color ( liu et al .2009 ) , may be influenced by age - dependent hair color change during adolescence , which shall be investigated in more detail in future studies . although our example of using eye color to monitor the effect of sample size to the auc - based prediction accuracy of pigmentation traits indicate that the sample size used here for hair color prediction is large enough to obtain a reasonably accurate prediction model , our results may be further replicated in a larger study . furthermore , it shall be tested in future studies if and to what extent snps from other genes with recently reported hair color association not used here add to the hair color prediction accuracy as presented . overall , we evidently present hair color as the third externally visible characteristic that can be reliably predicted from dna data after iris color ( liu et al . 2009 ; walsh et al .2010 ) , and human age , the latter demonstrated recently using quantification of t - cell dna rearrangement ( zubakov et al . we therefore expect dna - based hair color prediction , e.g. using the markers suggested here , to be used in future practical applications , such as in the forensic context . furthermore , our study demonstrates that markers not statistically significantly associated with a trait in a study population can still independently contribute to the trait prediction in the same population , a notion that shall be considered in the design of future genetic prediction studies , including for diseases risks . below is the link to the electronic supplementary material . supplementary material 1 ( doc 519 kb )\noutput:\n" }, { "from": "agent", "value": "predicting complex human phenotypes from genotypes is the central concept of widely advocated personalized medicine , but so far has rarely led to high accuracies limiting practical applications . one notable exception , although less relevant for medical but important for forensic purposes , is human eye color , for which it has been recently demonstrated that highly accurate prediction is feasible from a small number of dna variants . here , we demonstrate that human hair color is predictable from dna variants with similarly high accuracies . we analyzed in polish europeans with single - observer hair color grading 45 single nucleotide polymorphisms ( snps ) from 12 genes previously associated with human hair color variation . we found that a model based on a subset of 13 single or compound genetic markers from 11 genes predicted red hair color with over 0.9 , black hair color with almost 0.9 , as well as blond , and brown hair color with over 0.8 prevalence - adjusted accuracy expressed by the area under the receiver characteristic operating curves ( auc ) . the identified genetic predictors also differentiate reasonably well between similar hair colors , such as between red and blond - red , as well as between blond and dark - blond , highlighting the value of the identified dna variants for accurate hair color prediction.electronic supplementary materialthe online version of this article ( doi : 10.1007 / s00439 - 010 - 0939 - 8 ) contains supplementary material , which is available to authorized users ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: her medical history included thyroid carcinoma ( papillary thyroid carcinoma ) treated with thyroidectomy , bipolar affective disorder , mild obstructive sleep apnoea and a previous caesarean section . on day 1 post surgeryshe was noted to be tachycardic , febrile and hypertensive with a drop in saturation 9293 % on room air along with abdominal pain . she had good bowel sounds , was passing flatus but had not opened her bowels . on day 2she had localized right lower quadrant tenderness with raised inflammatory markers of crp 163 , wcc 2110 / l and neutrophil count 1710 / l . the computed tomography ( ct ) scan of her abdomen / pelvis ( a / p ) showed evidence of ileus with dilated loops of bowel ( fig .2 ) . figure 1 : day 1 postoperative chest x - ray shows evidence of mild atelactesis . figure 2 : day 2 post op ct a / p with no evidence of intra - abdominal collection / foreign body . dilatation of entire intestine ( large bowel up to 9 cm ) most likely representing postsurgical ileus rather than a mechanical obstruction . day 2 post op ct a / p with no evidence of intra - abdominal collection / foreign body . dilatation of entire intestine ( large bowel up to 9 cm ) most likely representing postsurgical ileus rather than a mechanical obstruction . the next day she had fever with rigors , night sweats , ongoing abdominal pain and distension . she was treated for sepsis with likely respiratory source and commenced on intravenous antibiotics . on day 4 post op she woke up with severe right shoulder tip and right upper quadrant pain radiating to her back .3 ) . figure 3 : day 4 post op chest x - ray showed a large volume of free gas under both hemi - diaphragms with multiple abnormally dilated loops of large and small bowel - features consistent with perforation of a hollow viscus . day 4 post op chest x - ray showed a large volume of free gas under both hemi - diaphragms with multiple abnormally dilated loops of large and small bowel - features consistent with perforation of a hollow viscus . she proceeded to have an emergency laparotomy with ileocolic resection and a double - barrel stoma . operative findings were of perforation at base of caecum with mild faecal peritonitis and distended large bowel without evidence of malignancy or band adhesions ( pseudo - obstruction complicated by caecal perforation ) . finally 13 days post laparotomy she was discharged home with district nursing for wound management and stoma care . figure 4 : day 3 post laparotomy she developed ileus with significant gaseous distension involving the large and small bowel ; with multiple air - fluid levels on horizontal beam imaging . day 3 post laparotomy she developed ileus with significant gaseous distension involving the large and small bowel ; with multiple air - fluid levels on horizontal beam imaging . ogilvie syndrome or acute colonic pseudo - obstruction is characterized by acute dilatation of the colon usually involving caecum and right hemi - colon in the absence of any mechanical obstruction . it is usually associated with an underlying severe illness / infection or surgery , mostly caesarean section and rarely occurs spontaneously . disturbances of autonomic innervations of colon with imbalance in sympathetic and parasympathetic control of colon motility have been suggested as a potential contributing factor . compression of parasympathetic plexus by gravid uterus and increased sympathetic stimulation due to stretch of mechanoreceptors within the wall of the colon causing decrease motility have been suggested . other theories like hormonal imbalance , hypoperfusion , metabolic and pharmacological causes have also been implied . diagnosis is made by clinical presentation of abdominal distension , constipation , nausea and vomiting . plain films show colonic distension mostly of caecum and ascending colon and ct scans help to exclude mechanical obstruction . management is initially conservative with cessation of opioids , correction of electrolytes and active mobilization . administration of neostigmine or colonoscopic decompression should be considered in patients with caecal diameter of 9 cm . neostigmine is an anticholinesterase inhibitor and treatment targets ineffective colonic motility caused by either excessive sympathetic stimulation or parasympathetic dysfunction or both . it should be administered in icu with continuous cardiac monitoring due to risk of bradycardia , with atropine readily available for urgent reversibility if required . when the caecum is dilated 9 cm colonoscopic decompression is preferable as it reduces the risk of ischaemia and perforation . however , colonoscopic decompression has its own risks . it is not just a difficult procedure to perform in pseudo - obstruction ; it also itself has an increased risk of perforation in ogilvie 's syndrome when compared to general population , as well as the risk of recurrence . spontaneous perforation with increase in caecal diameter 9 cm has been reported in up to 15 % of patients with a very high mortality rate . if caecal diameter is 9 cm and findings are suggestive of bowel ischaemia , surgical intervention is urgently required . ogilvie syndrome if not treated can progress to bowel ischaemia and perforation with significant morbidity and mortality . if detected early , conservative management is the first line of treatment with neostigmine or colonoscopic decompression . failure of conservative management , caecal diameter of 9 cm and clinical suspicion of bowel ischaemia or perforation requires urgent surgical intervention .\noutput:\n" }, { "from": "agent", "value": "ogilvie syndrome or acute colonic pseudo - obstruction is characterized by acute dilatation of the colon usually involving caecum and right hemi - colon in the absence of any mechanical obstruction . it is usually associated with an underlying severe illness / infection or surgery , mostly caesarean section and rarely occurs spontaneously . identification of this condition is important due to the increased risk of bowel ischaemia and perforation particularly with caecal diameter > 9 cm . this is a case report of bowel perforation following caesarean section leading to urgent laparotomy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: during april 10may 15 , a total of 2,198 fecal , tissue , cloacal swab , and tracheal swab samples were collected from wild birds in shanghai . trained staff captured healthy birds with an approved trapping method , collected samples , and released the birds . information on bird species and sampling places are listed in technical appendix tables 1 and 2 ) . rna was extracted from each sample and tested by using influenza a universal real - time pcr according to the standard operating procedure of the world health organization ( 9 ) . influenza a virus positive specimens were further subtyped by reverse transcription pcr with an avian influenza a virus subtype primer set reported previously ( 10 ) . of the 2,198 samples , one tracheal sample from an apparently healthy tree sparrow was positive for the novel subtype h7n9 virus , whereas the cloacal swab samples from this bird were negative . the positive sample was inoculated into 11 - day - old specific pathogen free embryonated chicken eggs for virus isolation . the tree sparrow had been collected from a forest on chongming dongping forest park , which is 47 km from dongtan national nature reserve , a winter habitat for wild migratory birds ( figure 1 ) . location of tree sparrow from which novel avian influenza a ( h7n9 ) virus was isolated : chongming national dongping forest park of shanghai ( yellow solid circle ) , which is located in the australiacm , chongming district ; bs , baoshan district ; jd , jiading district ; sh center , changning , putuo and xuhui districts ; qp , qingpu district ; mh , minhang district ; sj , songjiang district ; pd , pudong district ; fx , fengxian district ; js , jinshan district . to explore the genetic relationships between this sparrow - derived influenza a ( h7n9 ) virus and other viruses from humans and poultry , we amplified total genomic segments by using viral rna directly isolated from the original specimen with the primer sets listed in technical appendix table 3 and sequenced by sunny biotech co. , ltd . the chinese national influenza center performed the sequencing by using rna from chicken embryonated cultured viruses in an abi 3730xl automatic dna analyzer ( life technologies , foster city , ca , usa ) . full - genome sequences from the original sample and the embryonated chicken eggs isolation were deposited in genbank under accession nos . kf609524kf609531 and kj508887 - kj508894 , respectively . to facilitate the phylogenetic analysis , we downloaded sequences of the novel subtype h7n9 viruses from 2013 and the avian subtype h7n9 viruses from before 2013 from the global initiative on sharing avian influenza data ( http://platform.gisaid.org/epi3/frontend#46b284 ) . sequence alignments were performed by using the megalign method of lagergene 7.01 software ( www.dnastar.com/t-megalign.aspx ) . phylogenetic analysis was analyzed by using the neighbor - joining method in mega software version 5.10 ( www.megasoftware.net ) . eight gene segments of the tree sparrow virus shared most ( 99.3 % ) similarities with subtype h7n9 virus isolates from humans . phylogenetic analysis of hemagglutinin genes revealed that subtype h7n9 viruses could be classified into eurasia and north america lineages . the subtype h7n9 virus in this study shared the same influenza lineage with all novel subtype h7n9 viruses from humans and poultry ( figure 2 ) . like the hemagglutinin genes , the other 7 genes showed the same evolutionary pattern ( technical appendix figure 1 ) . homology and phylogenetic analyses indicated that the genetic constellation of the tree sparrow derived subtype h7n9 virus is similar to that of novel subtype h7n9 avian influenza viruses isolated from humans and poultry in this region . phylogenetic tree of the hemagglutinin ( a ) and neuraminidase ( b ) genes of influenza a ( h7n9 ) viruses . multiple alignments were constructed by using the muscle algorithm of mega software version 5.10 ( www.megasoftware.net ) . phylogenetic trees were constructed by using the neighbor - joining method with bootstrap analyses of 1,000 replications . sequences of human influenza a ( h7n9 ) viruses are shown in purple , novel subtype h7n9 viruses from poultry ( chickens , ducks , and pigeons ) in blue , novel subtype h7n9 viruses from the environment in green , and novel subtype h7n9 viruses from wild birds in red . scale bar indicates base substitutions per site . according to genetic signatures , the tree sparrowderived subtype h7n9 virus acquired the ability to bind to human - like receptors , for which substitutions g186v and q226l in hemagglutinin protein ( h3 ) are responsible , similar to most human and avian subtype h7n9 viruses . a 69 - 73aa deletion was also found in its neuraminidase gene ( n2 ) . amino acid 292r was maintained in neuraminidase genes , indicating its sensitivity to neuraminidase inhibitors . asp at polymerase basic 2 protein ( pb2 ) residue 701 was associated with reduced transmissibility . mixed e / k at residue 627 in pb2 and v / i at residue 31 in matrix 1 protein were detected from the original sample ( technical appendix figure 2 ) . because all previously reported influenza a ( h7n9 ) viruses isolated from birds or the environment acquired pb2627e , the mixed amino acids of 627e / k from direct sequencing of the tree sparrow 's original tracheal swab sample suggested that the pb2 e627k substitution might have occurred during replication of the virus in birds . the high similarity of genes from the avian influenza a ( h7n9 ) virus from an apparently healthy tree sparrow in shanghai and influenza a ( h7n9 ) viruses from humans and poultry in this region indicate that avian influenza a ( h7n9 ) virus might be transmitted from poultry to tree sparrows or vice versa . earlier reports documented that influenza a viruses , including subtypes h5n1 and h3n2 , have been isolated from sparrows ( 11,12 ) . a serologic survey also suggested that rates of influenza a virus infection were high among sparrows ( 13 ) , which might result from abundant distribution of avian influenza virus receptor sa 2,3 gal in the respiratory tracts of sparrows ( 14 ) . the novel subtype h7n9 virus expands not only the number of influenza virus subtypes that infect tree sparrows but also range of hosts for subtype h7n9 viruses . our finding of only 1 subtype h7n9positive sample among 2,198 samples is consistent with recent findings that subtype h7n9 in wild birds is rare ( 15 ) . prevalence of avian influenza viruses among tree sparrows could increase opportunities for them to carry influenza viruses from aquatic birds to domestic farms and even to humans . hence , such expansion of influenza a ( h7n9 ) virus host ranges undoubtedly increased the seriousness of the threat of this novel subtype . tree sparrows have been shown to be susceptible to influenza a ( h5n1 ) viruses , and they might have the ability to disseminate subtype h5n1 viruses ( 11 ) . dongping national forest park , where the novel subtype h7n9positive tree sparrow was captured , is on chongming island , china 's third largest island , which is located in the australiadongping national forest park is adjacent to dongtan national nature reserve , where hundreds of species of migratory and domestic birds gather for winter . whether migratory birds became infected through contact with tree sparrows and then disseminated subtype h7n9 virus to other geographic regions merits further investigation . isolation of novel influenza a ( h7n9 ) virus in a tree sparrow emphasizes the need to expand influenza surveillance to not only domestic birds but also wild and terrestrial birds . sample sources ( tissue types and geographic locations ) and primer sets used for whole - genome pcr of influenza a ( h7n9 ) virus .\noutput:\n" }, { "from": "agent", "value": "in spring 2013 , influenza a ( h7n9 ) virus was isolated from an apparently healthy tree sparrow in chongming dongping national forest park , shanghai city , china . the entire gene constellation of the virus is similar to that of isolates from humans , highlighting the need to monitor influenza a ( h7n9 ) viruses in different species ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: microglia , the only immunocompetent cells in the cns , originate from progenitors derived from the yolk sac ( 1 , 2 ) . studies have shown that , after birth , microglia maintain their numbers under normal conditions by self - renewal without the recruitment of monocyte - derived microglia precursors ( 2 , 3 ) . although there is currently no specific marker for distinguishing resident microglia from monocyte - derived macrophages unequivocally , some studies have shown that microglia and peripheral blood cellderived macrophages can be distinguished by the presence of surface markers , such as ccr2 and cx3cr1 , even under inflammatory conditions ( 4 , 5 ) . moreover , a study has shown that human y chromosome bearing male cells can not differentiate into microglia in the cns of a female host after bone marrow transplantation ( 6 ) . by contrast , bone marrow stem cells and peripheral monocytes can differentiate into microglia - like cells in vitro ( 7 , 8 ) , suggesting that one of the most important barriers to the recruitment of microglial precursors from peripheral blood is the blood - brain barrier ( bbb ) . indeed , cranial irradiation or administration of the alkylating agent busulfan can disrupt the bbb , enabling bone marrow derived cells to invade the brain parenchyma and remain there ( 9 ) . stress was found to induce the recruitment of bone marrow derived monocytes to the brain parenchyma in mice ( 10 ) , but the results of many other studies did not clarify the origin of microglia in human adult brains . here , we report the findings of a human autopsy case in which umbilical cord blood stem cell derived cells differentiated into ramified microglia in the recipient brain parenchyma . a 51 - year - old japanese woman noticed swelling of her nasal floor at age 48 years ; she was diagnosed as having natural killer / t - cell lymphoma at our hospital . she received focal radiation therapy targeting the paranasal , maxillary , and ethmoid sinuses , the parotid glands , and the right and left orbits ( 40 gy ) , and novalis shaped beam surgery ( 12 gy ) . after radiation therapy , she received 3 courses of devic ( dexamethasone , etoposide , ifosfamide , and carboplatin ) chemotherapy . after treatment , she achieved complete remission ; 2 months after chemotherapy , she received a cord blood stem cell transplant ( cbsct ) from a male donor with whom she had 2 human leukocyte antigen ( hla ) mismatches ( donor : a * 31:01 , a * 33:03 , b * 51:01 , b * 40:03 , drb1 * 08:02 , drb1 * 14:05 ; recipient : a * 31:01 , a * 02:01 , b * 51:01 , b * 40:02 , drb1 * 08:02 , drb1 * 14:05 ) . acute graft - versus - host disease was mild and well controlled by oral administration of tacrolimus . four months after cbsct , the patient presented with shingles of the right 12th thoracic segment and was treated with acyclovir ; however , herpes zoster developed into cervical myelitis . combined therapy with steroid pulse treatment and intravenous administration of gamma globulin was effective . two years after cbsct , she experienced muscle weakness and sensory disturbance of the lower extremities . in addition , she was given a single intrathecal administration of methotrexate ( 15 mg ) 2 weeks before her death . she died 29 months after cbsct . a general autopsy was performed 3 hours after death . neuropathologic examination demonstrated the presence of lymphoma in the spinal cord ( including a lesion at c5 ) and inflammation of the left medulla , with no evidence of tumor in the cerebrum and cerebellum . multiple tissue blocks were embedded in paraffin , and 6 - m sections were cut and immunostained using a liquid dab substrate chromogen system kit ( dako , tokyo , japan ) and a tmb peroxidase substrate kit ( vector laboratories , burlingame , ca ) . primary antibodies included rabbit polyclonal anti - iba1 ( 1:8000 ; wako , osaka , japan ) , anti glial fibrillary acidic protein ( 1:10000 ; sigma , tokyo , japan ) , anti - cx3cr1 ( 1:100 ; abcam , tokyo , japan ) , rabbit monoclonal anti - ccr2 ( 1:4000 ; abcam ) , and mouse monoclonal antibriefly , 5 - m sections from formalin - fixed paraffin - embedded blocks were deparaffinized , rehydrated , and predigested with 1 drop of pepsin solution . the sections were incubated with hybridization solution containing zytodot cen yq12 probe ( zytovision , bremerhaven , germany ) overnight at 37c . the zytodot cish implementation kit ( zytovision ) a 51 - year - old japanese woman noticed swelling of her nasal floor at age 48 years ; she was diagnosed as having natural killer / t - cell lymphoma at our hospital . she received focal radiation therapy targeting the paranasal , maxillary , and ethmoid sinuses , the parotid glands , and the right and left orbits ( 40 gy ) , and novalis shaped beam surgery ( 12 gy ) . after radiation therapy , she received 3 courses of devic ( dexamethasone , etoposide , ifosfamide , and carboplatin ) chemotherapy . after treatment , she achieved complete remission ; 2 months after chemotherapy , she received a cord blood stem cell transplant ( cbsct ) from a male donor with whom she had 2 human leukocyte antigen ( hla ) mismatches ( donor : a * 31:01 , a * 33:03 , b * 51:01 , b * 40:03 , drb1 * 08:02 , drb1 * 14:05 ; recipient : a * 31:01 , a * 02:01 , b * 51:01 , b * 40:02 , drb1 * 08:02 , drb1 * 14:05 ) . acute graft - versus - host disease was mild and well controlled by oral administration of tacrolimus . four months after cbsct , the patient presented with shingles of the right 12th thoracic segment and was treated with acyclovir ; however , herpes zoster developed into cervical myelitis . combined therapy with steroid pulse treatment and intravenous administration of gamma globulin was effective . two years after cbsct , she experienced muscle weakness and sensory disturbance of the lower extremities . in addition , she was given a single intrathecal administration of methotrexate ( 15 mg ) 2 weeks before her death . she died 29 months after cbsct . a general autopsy was performed 3 hours after death . neuropathologic examination demonstrated the presence of lymphoma in the spinal cord ( including a lesion at c5 ) and inflammation of the left medulla , with no evidence of tumor in the cerebrum and cerebellum . multiple tissue blocks were embedded in paraffin , and 6 - m sections were cut and immunostained using a liquid dab substrate chromogen system kit ( dako , tokyo , japan ) and a tmb peroxidase substrate kit ( vector laboratories , burlingame , ca ) . primary antibodies included rabbit polyclonal anti - iba1 ( 1:8000 ; wako , osaka , japan ) , anti glial fibrillary acidic protein ( 1:10000 ; sigma , tokyo , japan ) , anti - cx3cr1 ( 1:100 ; abcam , tokyo , japan ) , rabbit monoclonal anti - ccr2 ( 1:4000 ; abcam ) , and mouse monoclonal antiwe used a commercial kit to identify the y chromosome . briefly , 5 - m sections from formalin - fixed paraffin - embedded blocks were deparaffinized , rehydrated , and predigested with 1 drop of pepsin solution . the sections were incubated with hybridization solution containing zytodot cen yq12 probe ( zytovision , bremerhaven , germany ) overnight at 37c . the zytodot cish implementation kit ( zytovision ) to study the migration of donor - derived cells into the patient s brain , we performed immunohistochemistry with anti hla - a2 antibody , which could distinguish donor - derived cells from host cells . interestingly , donor - derived hla - a2positive cells were found in the cortex and around vessels ( figs . invading hla - a2positive cells in the cortical region had a ramified morphology similar to that of microglia ( fig . by contrast , immunohistochemical staining of the c5 lesion with anti hla - a2 antibodies showed more hla - a2positive cells in the parenchyma ( figs . hla - a2positive cells in that area were round or ring - shaped but did not have a ramified morphology ( figs . ( a ) hla - a2positive cells accumulate in the cerebral cortex ( brown cells within the circle ) . ( c ) a round hla - a2positive cell around a vessel ( arrow ) . hla - a2positive cells with a round or ring morphology in the c5 lesion of the spinal cord at lower magnification ( d ) and at higher magnification ( e ) . we next performed double staining to investigate the differentiation of graft cells into microglia or astrocytes . hla - a2positive cells stained positive for iba1 , which is representative of microglia ( fig .2 a ) , but not for glial fibrillary acidic protein , which is specific for astrocytes ( fig .2 b ) . because these results suggested that graft cells differentiated into microglia , we also performed in situ hybridization with anti - yq12 probes . although most of the cells in the male positive control sample showed a brown dot in their nuclei , whereas cells in the female negative control sample had no brown dot in their nuclei , only a few cells in the transplant recipient sample had a brown dot in their nuclei , indicating y chromosome positive cells from the male donor ( figs . 2c e ) . moreover , in situ hybridization with anti - yq12 probes after immunohistochemistry with anti - iba1 antibodies showed that y chromosome positive cells from the male donor were iba1 - positive ( fig . double staining of donor - derived cells by immunohistochemistry ( a , b ) and in situ hybridization ( c f ) . ( a ) double staining of donor - derived cells with anti hla - a2 antibody ( brown ) and anti - iba1 antibody ( blue ) . ( b ) double staining of donor - derived cells with anti hla - a2 antibody ( brown ) and anti ( c ) in situ hybridization of the patient sample using anti - yq12 probes ( brown dot ) with counterstaining of nuclei by mayer hematoxylin solution . ( f ) double staining of donor - derived cells using anti - yq12 probes ( brown dot ) and anti - iba antibody ( blue ) . arrows show double - positive cells indicating donor origin ; arrowheads show iba1 - positive and yq12 - negative cells indicating host origin . scale bar = 100 m . because ccr2 and cx3cr1 are very important for distinguishing resident microglia from monocyte - originating microglia - like cells , we next explored the expression of ccr2 and cx3cr1 in hla - a2positive cells . approximately 60 % of hla - a2positive cells were ccr2 - negative , and most of the invading hla - a2positive cells were cx3cr1 - positive ( figs . ( a ) double staining of donor - derived cells with anti hla - a2 antibody ( brown ) and anti - ccr2 antibody ( blue ) . arrows indicate ccr2 - negative and hla - a2positive cells ; arrowheads indicate double - positive cells . ( b ) migrated hla - a2positive cells were counted in 3 independent sections ; the frequency of ccr2 - positive cells and ccr2 - negative cells is shown in the bar graph . ( c ) double staining of donor - derived cells with anti hla - a2 antibody ( brown ) and anti - cx3cr1 antibody ( blue ) . arrow indicates a double - positive cell indicating donor origin ; arrowhead indicates a cx3cr1 - positive and hla - a2negative cell indicating host origin . this case shows that umbilical cord blood stem cell derived precursors can differentiate into cx3cr1 - positive , ccr2 - negative , and iba1 - positive ramified microglia even without brain irradiation , whereas previous studies did not find that donor - derived cells entering the cns parenchyma can transform into microglia ( 6 ) . first , our patient had herpes zoster myelitis and relapse in the spinal cord , perhaps including meningitis of the whole brain . moreover , a lesion of the cortex in the left midfrontal gyrus ( data not shown ) may indicate that there had been a trace of herpes zoster virus induced encephalitis . indeed , donor - derived cells can enter the recipient brain and differentiate into microglia after severe streptococcal meningitis ( 11 ) . bacterial meningitis often destroys the bbb and pial membrane , thereby allowing donor - derived cells to enter the cns parenchyma . even after meningitismassengale et al ( 12 ) found that no donor - derived cells enter the cns parenchyma even with brain injury . ajami et al ( 13 ) reported that infiltrating monocytes at an inflammatory site have a short life span and do not contribute to the resident microglia pool . although it is possible that diffuse leptomeningeal involvement by lymphoma may have occurred at the time of clinical relapse in the spinal cord , our case showed no trace of meningitis at autopsy . our finding that donor - derived cells had not invaded the deep white matter of the recipient is consistent with the possibility that there was no brain irradiation , as has been shown in head - shielded mouse models ( 14 ) . indeed , we rarely observed donor - derived microglia in the deep white matter , thalamus , and basal ganglia , although we found donor - derived perivascular cells ; however , inflammation of the left medulla ( as reported in the final diagnosis ) might have been caused by the direct effects of focal irradiation . because the alkylating agent busulfan can cause bone marrow derived cells to penetrate the brain parenchyma ( 9 ) , devic chemotherapymay also disrupt the bbb . however , donor - derived ramified cells were rare in the deep region of the brain , suggesting that the bbb in our patient was sufficiently intact to prevent invasion of donor - derived cells . although unger et al ( 6 ) did not provide information pertaining to irradiation and chemotherapy , all patients likely received aggressive chemotherapy as pretreatment before bone marrow transplantation for leukemia or lymphoma . nevertheless , no donor - derived cells were found to have differentiated into ramified microglia . because donor - derived cells did not invade the deep white matter of the recipient in our case , we consider the possibility that chemotherapy had minimal effects . moreover , even if a single intrathecal administration of methotrexate had disrupted the bbb , we consider it highly improbable that invading cells differentiated into cx3cr1 - positive , ccr2 - negative , and iba1 - positive ramified microglia ( i.e. indicating the resting form ) within 2 weeks . in conclusion , we report an autopsy case in which cells derived from transplanted umbilical cord blood differentiated into ramified microglia in the host brain parenchyma . although the bbb and glia limitans seem to have prevented the invasion of these donor - derived cells , most of the invading donor - derived ramified cells remained in the cortical zone . this result suggests that the invasion of donor - derived cells occurs through the pial membrane .\noutput:\n" }, { "from": "agent", "value": "abstractrecent studies have indicated that microglia originate from immature progenitors in the yolk sac . after birth , microglial populations are maintained under normal conditions via self - renewal without the need to recruit monocyte - derived microglial precursors . peripheral cell invasion of the brain parenchyma can only occur with disruption of the blood - brain barrier . here , we report an autopsy case of an umbilical cord blood transplant recipient in whom cells derived from the donor blood differentiated into ramified microglia in the recipient brain parenchyma . although the blood - brain barrier and glia limitans seemed to prevent invasion of these donor - derived cells , most of the invading donor - derived ramified cells were maintained in the cerebral cortex . this result suggests that invasion of donor - derived cells occurs through the pial membrane ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: herpes simplex encephalitis has an incidence of 1 in 250,000 to 500,000 persons per year and is the most common sporadic fatal encephalitis in the western world . it typically presents with headache , fever , and confusion developing over hours to days . focal neurological findings including hemiparesis , cranial nerve deficits , visual field loss , and dysphasia . ct head imaging shows hypodense lesions of the temporal lobe and orbitofrontal regions and may demonstrate mass effect . t2 - weighted mri reveals hyperintensity corresponding to edematous changes in the temporal lobes , characteristically sparing the basal ganglia . t1 - weighted images show hypointense signal in the affected areas , and meningeal enhancement may be demonstrated following the administration of gadolinium . when csf can be obtained , it shows mononuclear cell pleocytosis in 97 % of cases , typically with a mildly elevated protein and a normal glucose . polymerase chain reaction ( pcr ) assays performed on specimens from patients with brain biopsy - proven herpes simplex encephalitis reveal a diagnostic sensitivity of 98 % at the time of clinical presentation as well as a specificity approaching 100 % . of note , negative pcr assay for hsv dna on the first or second day of illness may become positive on testing of a subsequent csf specimen . gliomas also demonstrate mri findings of hypointensity on t1 images and hyperintensity on t2 images . the clinical features of viral encephalitis , namely headache , fever , seizures , and encephalopathy , may be seen in patients with high - grade gliomas . in cases where imaging is ambiguous anda 54 - year - old female was evaluated for altered mental status in the emergency room . she had been feeling drowsy and unwell , but she had not been febrile . on the day she was taken to the emergency room , her sister had found her lethargic and verbalizing poorly . the patient had been having intermittent headaches for the past year associated with nausea and vomiting . initially , the patient was oriented to person and place although lethargic , not communicating well , with slurred speech , poor eye contact , and exhibiting decreased psychomotor activity . blood work did not reveal any leukocytosis ( white cell count was 6.5 thousand / l ) or electrolyte imbalance . erythrocyte sedimentation rate was 67 mm / hour , and crp was 7.74 mg / dl . a ct scan of the head showed left temporal lobe hypodensity , 8.3 centimeters in greatest diameter , with areas of hemorrhage within mesial left temporal lobe ( see figure 1 ) . levetiracetam was started as it was not clear that the patient whether seizure was responsible for her acute presentation . mri of the brain was obtained , showing a large lesion of the left temporal lobe with extension to the frontal lobe and noncontiguous ill - defined lesions of the right temporal lobe ( see figure 2 ) . mr spectroscopy demonstrated an increased choline peak at the level of the medial left temporal lobe , suggestive of neoplastic disease ( see figure 3 ) . mr perfusion demonstrated patchy areas of hyperperfusion within the left perisylvian region and left anterior temporal lobe , also supporting a diagnosis of neoplastic disease . one week after presentation , patient underwent left temporal craniotomy for open - brain biopsy . pathology revealed hsv positive nuclei in the cortex and subcortical white matter ( see figure 4 ) . she was released to a subacute rehabilitation facility , and a year after her symptoms , she was living at home , independent in her activities of daily living . on cognitive evaluation , the patient had some short - term memory and word comprehension difficulties . as she had no clinical seizures during her hospitalization and ambulatory eegthe diagnosis of hse can be clouded by confounding factors especially when csf can not be obtained . our patient had headaches and significant weight loss in the months prior to presentation , supportive of a diagnosis of malignancy . although crp and esr were elevated , these acute - phase proteins are not specific to etiology and may be elevated in response to tumor , stroke , and seizures as well as infection and inflammation . pronounced elevations in crp do not usually occur in malignancy alone . however , it is not uncommon for patients with malignancy to have concurrent illness including infection . therefore , the context of the case is important when interpreting these results . moreover , our patient was afebrile throughout her hospital course , which is uncommon in hse . temporal lobe involvement is classical for herpes encephalitis , and the abnormal focus can extend to multiple lobes , a pattern that can also be seen with infiltrative tumors . while the appearance of hemorrhage on imaging is typically petechial in hse , in this case , the appearance of frank hemorrhage on the initial ct was suspicious for malignancy . only patchy meningeal enhancement was seen although the literature suggests that meningeal enhancement may not be prominent early on in hse . typical mr spectroscopy findings in brain neoplasms include decreased n - acetylaspartate ( naa ) , a marker of neuronal integrity , increased choline ( cho ) , representing cell membrane and myelin turnover , and decreased creatine ( cr ) , which provides inorganic phosphates for atp production and hence represent energy stores . nonneoplastic disease processes in the cns including infection may result in reactive proliferation of cellular elements of the immune system and of glial tissue , producing mr spectroscopy profiles that are indistinguishable from cns neoplasms due to the neuron destroying nature of those lesions . in looking at the diagnostic accuracy of mr spectroscopy , one study revealed a sensitivity of 0.95 and a specificity of 1 , with an accuracy of 0.96 , as judged by 4 nonblinded readers asked to distinguish neoplastic from nonneoplastic spectra in 54 patients . when blinded , upon evaluation of 35 untreated patients , the values were 0.88 , 0.80 , and 0.86 , respectively . mr spectroscopy in hse generally shows decreased naa / cr ratios at various time intervals , which could be compatible with neuronal loss . an increased cho / cr ratio may be seen and is thought to reflect myelin breakdown . the appropriate workup ( including bloodwork , imaging , and mr spectroscopy ) and therapy ( with dexamethasone and acyclovir ) were undertaken . when confounding results occur , we feel that tissue diagnosis is essential to ensure appropriate disease management . in this case ,\noutput:\n" }, { "from": "agent", "value": "a 54 year old lady presented with lethargy and 15 kg weight loss over the past year . ct scan of the head revealed left temporal lobe hypodensity with a discrete area of hemorrhage within the left mesial temporal lobe . due to concerns about impending central herniation , lumbar puncture was not performed . mri of the brain showed a large lesion of the left temporal lobe , extending to the left frontal lobe , and very patchy meningeal enhancement . there was a noncontiguous lesion of the right insula . a differential diagnosis of herpes simplex encephalitis ( hse ) and multifocal infiltrative glioma was entertained . mr spectroscopy demonstrated an increased choline peak at the level of the medial left temporal lobe and mr perfusion demonstrated patchy areas of hyperperfusion within the left anterior temporal lobe , both suggestive of neoplastic disease . following open brain biopsy , pathology revealed herpes simplex virus ( hsv ) positive nuclei in the cortex and subcortical white matter . as both herpes simplex encephalitis and low - grade glioma demontrate mri findings of hypointensity on t1 images and hyperintensity on t2 images , the diagnosis of herpes encephalitis can be clouded by confounding factors , especially when cerebrospinal fluid ( csf ) can not be obtained ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: primary central nervous system lymphoma ( pcnsl ) comprises less than 3 % of all primary brain tumors . pcnsl usually appears on magnetic resonance imaging ( mri ) as unique or multiple mass lesions with homogeneous contrast enhancement . lymphomatosis cerebri ( lc ) is a rare variant of pcnsl , usually revealed by subacute dementia and gait disorders , and characterized on mri by a diffuse infiltration of the cerebral white matter without any contrast enhancement at the early stage , and with frequent extension of the lesions to the brainstem , thalamus , and basal ganglia . such mri features may mimic other white matter disorders such as gliomatosis cerebri , hypertensive encephalopathy , acute disseminated encephalomyelitis ( adem ) , and other infectious and autoimmune encephalitides . we report on a patient who developed such a leukoencephalopathic variant of pcnsl more than 4 years after a presumed post - cytomegalovirus ( cmv ) adem . a 29 - year - old immunocompetent woman presented with a subacute onset of gait ataxia , lower limb and right hand weakness , generalized dystonia , and transient vertical diplopia 3 weeks after a febrile episode in september 2006 . brain mri revealed extensive lesions within the deep white matter , impinging on central grey nuclei together with subcortical involvement in frontal areas ( fig . these lesions were more pronounced on the left side , appeared hyperintense on t2 , flair , and diffusion - weighted images , and did not enhance after gadolinium contrast injection . the other serological investigations were negative , including lyme disease , hiv , hsv , hzv , and ebv . the patient was treated with a 5 - day course of methylprednisolone ( 1 g / day ) . the clinical course was rapidly favorable and the white matter lesions had completely disappeared on repeat mris in december 2006 , march 2007 , and april 2008 . the neurological examination showed fluctuating spatiotemporal disorientation with dyscalculia , verbal deafness , gait ataxia , right hemianopia , and pyramidal signs in the four limbs . the cerebrospinal fluid examination was again normal , including the absence of oligoclonal igg bands . the brain mri demonstrated extensive t2 hyperintense white matter lesions within the parieto - occipital areas bilaterally , together with involvement of the splenium of the corpus callosum . prominent mass effect was present on the left side as well as bilateral gadolinium - enhanced areas within the subependymal white matter of the parietal lobes ( fig .2 a , b ) . autoimmune and antiviral ( hiv , hvc , hbs , ebv , hsv , hzv , ebv , and igm - cmv ) methylprednisolone ( 1 g / day intravenously for 10 days ) was prescribed for recurrent adem and , after significant clinical improvement , the patient left the hospital under decreasing doses of oral methylprednisolone . however , she was readmitted a few days later for spatiotemporal disorientation , headache , ataxia , and blurred vision . a brain mri revealed a bilateral extension of the previously described lesions with involvement of the fronto - callosal areas . she also presented with generalized tonic - clonic seizures and was transferred to the intensive care unit on april 7 , 2011 , with a glasgow coma score of 8 ( m5 , v2 , e1 ) , a left hemiparesis , and a right third cranial nerve palsy . high - dose methylprednisolone therapy ( 1 g / day for 10 days ) was combined to three courses of plasma exchanges . epilepsy was controlled with valproate and levetiracetam therapy , and the patient regained consciousness with the same deficits as previously described . a stereotactic biopsy was performed on april 26 , 2011 , and it revealed a massive parenchymatous infiltration by large ( cd20 + ) b lymphoid cells , showing numerous apoptotic bodies and mitotic figures . these cells were negative for gfap , olig2 , cd10 , and cycline d1 as well as for anti - cd21 and anti - cd23 antibodies . aberrant membranous bcl2 immunostaining and marked increased ki67 proliferation index were found . in situ hybridization research for epstein - barr virusthe diagnosis was primary cns large b - cell lymphoma , and more particularly , its infiltrative variant termed lc . the neurosurgical procedure was complicated by a hematoma within the left frontal lobe with intracranial hypertension and coma . after a prolonged intensive care unitstay and four courses of chemotherapy ( two with rituximab , methotrexate , vincristine , methylprednisolone , doxorubicin , and cyclophosphamide , and two with rituximab , methotrexate , and cytarabine ) , there was some neurological and radiological ( fig . radiotherapy was not considered after relapse as the patient remained in a poor neurological condition and palliative therapy was decided . lc is a rare leukoencephalopathic variant of pcnsl that can be misdiagnosed , particularly in young immunocompetent individuals . since the initial description of bakshi et al . in 1999 , less than 20 cases have been described in the literature . in a recent review dealing with 16 patients , the outcome seems very poor as most reported patients died within 6 months after the onset . our patient had a biopsy - proven lc occurring more than 4 years after a first episode of acute leukoencephalopathy that had first been considered a possible post - cmv adem with a rapid clinical and neurological response to a 5 - day course of high - dose methylprednisolone . however , the mri findings were also consistent with lc , showing a diffuse involvement of the deep white matter extending to the brainstem and basal ganglia as well as to subcortical frontal areas . considering the young age of the patient and her normal immune status , no brain biopsy was performed at this time . a first episode of lc could not be definitely ruled out , but seemed unlikely in regard to the prolonged remission . in rare instances , pcnsl can coexist with or be preceded by demyelinating lesions with an interval ranging from several months to years . for such tumefactive demyelinating lesions ( tdl ) , alderson et al . have introduced the term sentinel lesions , which define contrast - enhancing focal lesions preceding the histopathological diagnosis of pcnsl by several months . they can also take the appearance of diffuse leukoencephalopathy . in the case published by brecher et al . interestingly , the lesions did not initially enhance after contrast administration , but well 9 and 24 months after initial presentation . perfusion mri and mr spectroscopy were not performed in our patient , but may potentially be helpful for the diagnosis of such lesions . on perfusion mri , relative cerebral blood volume is usually reduced in tdl and increased in brain tumors such as pcnsl . on mr spectroscopy , a similarly reduced naa signal , an increased cho signal , and increased cho / naa ratiosare usually observed in both clinical entities , but increased glutamate / glutamine peaks are more consistent with tdl and not seen in an aggressive intracranial neoplastic process . otherwise , elevated signals in the lipid region of the spectrumthe definitive discrimination between pcnsl and tdl requires a brain biopsy . to our knowledge , there are no specific clinical , mri , or pathological features in tdl that predict the development of pcnsl . such lesions need careful monitoring and a repeat brain biopsy when there is no clinical or mri response to immunosuppressive therapy . pcnsl should be masked when an immunosuppressive treatment is given prior to the first brain biopsy or kept dormant by host immunity . the presence of infiltrating lymphocytes expressing t lymphocyte markers in sentinel lesions is probably reflecting a cell - mediated immune response to the first signs of cerebral lymphoma in immunocompetent patients . lymphocytic infiltrates in sentinel lesions may also undergo transformation to monoclonal malignant b cell populations . in conclusion , this case illustrates that the diagnosis of lc is a difficult challenge and can not be made on conventional mri alone . although extremely unusual , this diagnosis should be considered in the presence of extensive , non - enhancing white matter lesions , even after the first episode of acute leukoencephalopathy , in a young and immunocompetent patient . finally , the absence of an initial brain biopsy precluded the interpretation of the sentinel lesion that preceded lc .\noutput:\n" }, { "from": "agent", "value": "a 29 - year - old immunocompetent woman was admitted in 2006 with ataxia , limb weakness , generalized dystonia , and vertical diplopia that developed after a febrile episode . brain magnetic resonance imaging ( mri ) revealed the presence of extensive periventricular white matter lesions that did not enhance after gadolinium injection . as low titers of cytomegalovirus - igm antibodies were found in the serum , a presumed diagnosis of postviral acute disseminated encephalomyelitis ( adem ) was made , and the patient received a 5 - day course of 1 g methylprednisolone . the clinical and radiological outcome was very rapidly favorable , and subsequent brain mris in 2007 and 2008 were normal . in march 2011 , the patient was readmitted with the complaints of abnormal fatigue , imbalance , and speech disorder . the neurological examination showed fluctuating spatiotemporal disorientation with dyscalculia , verbal deafness , gait ataxia , right hemianopia , and pyramidal signs in the four limbs . the brain mri demonstrated extensive t2 hyperintense white matter lesions predominating in the left temporal and parieto - occipital lobes , with a pseudotumoral aspect enhancing with gadolinium contrast . a clinical improvement was transiently noted after pulse steroid therapy , but after relapse and radiological worsening , the diagnosis of recurrent adem was challenged . the brain biopsy confirmed the presence of primary central nervous system lymphoma ( pcnsl ) under the variant form of lymphomatosis cerebri . despite a partial response to chemotherapy , the patient died 8 months after the diagnosis . we discuss the role of sentinel lesions that may precede pcnsl for several years and insist on the importance to consider early brain biopsy in the presence of extensive , non - enhancing white matter lesions , even in a young and immunocompetent patient ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: adenosine 35 - cyclic monophosphate ( cyclic amp , camp ) was first identified as a small intracellular heat - stable factor mediating the effect of glucagon on the phosphorylation status of glycogen phosphorylase in the 1950s , and the concept of camp as an important mediator for many extracellular signaling molecules was rapidly developed ( beavo and brunton , 2002 ) . camp is present in every cell , where it is generated from atp by adenylate cyclases , acs , and can be induced more than twenty - fold upon activation of acs by extracellular signals ( hanoune and defer , 2001 ) . degradation of camp is mediated by camp phosphodiesterases , pdes , that hydrolyze camp into adenosine 5 - monophosphate and this event is important for controlling camp resting state levels ( omori and kotera , 2007 ) . so , intracellular concentration of camp results from the fine balance between the activities of synthesis and degradation by adenylate cyclases and camp phosphodiesterases , respectively . a large number of hormones , neurotransmitters and other signal substances utilize camp as an intracellular second messenger , so that the rate of camp production and degradation is sensitive to a wide range of extracellular and intracellular signals , and camp can directly regulate a variety of cell functions ( gancedo , 2013 ) . within each cell , camp may activate different proteins . an important additional effector system for camp signaling is achieved by the exchange proteins directly activated by camp 1 and 2 , epac1 and epac2 , also named camp - gefi and - ii . these guanine nucleotide exchange factors ( gefs ) are specific activators of the small gtpase rap1 ( schmidt et al . , 2013 ) . the camp - binding domain of epac can bind one molecule of camp , resulting in a conformational change of the protein , which will expose the active site of the catalytic domain , enabling the protein to bind to and activate rap1 ( de rooij et al . , however , the main intracellular target for camp in mammalian cells is the camp - dependent protein kinase ( pka ; ec 2.7.1.37 ) we will discuss on extensively below ( taskn et al . , 1997 ) . camp , either via a pka - dependent or pka - independent manner , affects numerous cellular functions such as metabolism , ion channel activation , cell growth and differentiation , gene expression and apoptosis ( antoni , 2012 ) . on the other hand , the camp pathway interacts with other intracellular signaling pathways , including cytokine and ras - raf - erk pathways ( yu et al . , 2013 ; kostenko et al . , 2011 ; , 2013 ; follin - arbelet et al . , 2013 ; tai et al . , 2014 ) . notably , these signaling connections play an important role in cancer biology and a combined blockade of such signaling pathways is considered a relevant strategy for therapeutic intervention ( awada and aftimos , 2013 ; colzani et al . , 2014 ) . the existence of different camp downstream effectors and some features of pka signaling pathway may contribute to explain how differential discrete effects of camp may be obtained ( skalhegg and tasken , 2000 ) . an important concept is that camp concentration and camp signaling can change and occur very locally , respectively ( edwards et al . , 2012 ; lefkimmiatis and zaccolo , 2014 ) . localized camp - mediated activity is explained by localized induction and degradation of camp by pdes in specialized cellular compartments such as caveolae and lipid rafts ( simons and ikonen , 1997 ) . also acs and gpcrsare not evenly distributed along the membrane ( willoughby and cooper , 2007 ; steinberg and brunton , 2001 ) . noteworthy , in the same cell , elevation of camp and subsequent pka activity by different agonists can lead to different physiological responses , even because receptors for extracellular signaling molecules can activate only a fraction of pka that are largely segregated in subcellular microdomains by a great number of pka anchoring proteins , akaps ( beene and scott , 2007 ) . akaps are bound to cytoskeletal proteins or organelles and bind regulatory subunits of the pka , so that the pka can be docked and concentrated close to crucial targets and , despite their broad substrate specificity , can phosphorylate only selected proteins ( gold et al . , 2006 ) . camp acts in mammalian cells by binding to two distinct isoforms of pka , defined pka - i and pka - ii . ( r ) subunits , termed ri in pka - i and rii in pka - ii , respectively . binding of two camp molecules to each of the regulatory subunits results in the release and activation of the catalytic subunits . these catalytic subunits will phosphorylate serine and threonine residues on specific substrate proteins both in the cytoplasm and in the nucleus ( skalhegg and tasken , 2000 ) . the major nuclear targets of pka are the transcription factors of the camp response element binding ( creb ) family ( mayr and montminy , 2001 ) . creb proteins bind optimally to palindromic cres ( sequence tgacgtca ) in promoters and upon phosphorylation by pka they recruit the coactivator , creb binding protein ( cbp ) to the promoter . such a phosphorylation event results in the induction of cellular gene expression ( sands and palmer , 2008 [ ref : 80 ] ) . the importance of creb for several physiological events has been confirmed by the high number of targets identified so far : up to 4000 genes involved in several cellular processes . moreover , several lines of evidence obtained from studies on leukemia , fusion oncoproteins , viral oncoproteins and endocrine tumors support the notion that creb is involved in oncogenesis ( siu and jin , 2007 ; sakamoto and frank , 2009 ) . the regulatory subunits are highly dynamic multi - domain proteins that interact with a variety of proteins in addition to serving as major receptors for camp ( kim et al . , 2007 ; although there are multiple isoforms ( i and i , ii and ii ) , all retain the same general architectural organization . all have a dimerization / docking ( d / d ) domain at the n - terminus , which is the docking site for the a kinase - anchoring proteins , akaps ( gold et al . , 2006 ) . the d / d domain is followed by an inhibitor site ( a pseudosubstrate for ri subunits and a substrate site for rii subunits ) and two camp binding domains ( cbds ) , referred to here as domains a and b. structures of the camp bound conformations of ri and rii revealed that the cbds were conserved motifs that resemble the catabolite gene activator protein ( cap ) in bacteria ( su et al . , 1995 ; diller et al . different subunit isoforms ( ri , ri , rii , and rii ) have different affinities for camp , thus originating holoenzymes ( pka type i or pka type ii with different subunit composition and affinity for camp and thus are activated at either low or high local concentrations of camp in the cell ( skalhegg and tasken , 2000 ) . typically pka type i holoenzyme have higher affinity for camp than type ii holoenzyme . when ri subunits are up - regulated , camp sensitivity of pka increases and thereby lowers the threshold for activation of camp - mediated downstream effects . furthermore , only pka - ii but not pka - i undergoes autophosphorylation ( rosen and erlichman , 1975 ) , which serves as a feed - forward signal by enhancing the camp responsiveness of pka - ii ( martin et al . , 2007 ) . the four types of regulatory subunits have different expression patterns in mammals ( skalhegg and tasken , 2000 ) . moreover , during both physiological and pathological conditions , the composition of the pka holoenzyme as well as their intracellular localization may change , inducing different effects . while ria has ubiquitous distribution , risimilarly , rii has ubiquitous distribution , while rii is expressed in brain , adipose , and some endocrine tissues . besides camp affinity , localization of the holoenzyme is also different , with pka type i enzymes beingthe akaps play an important role in differential targeting of pka types i and ii in the cell . the ri and ri subunits are dissimilar , but reveal high homology ( 81 % identity at the amino acid level ) as do the riia and rii subunits ( 68 % identity at the amino acid level ) . pka signaling and cancer section , pka type i is associated with growth and proliferation whereas pka type ii is associated with increased differentiation and decreased proliferation . in mammalian cellsthere are three isoforms of the c - subunit and the two major isoforms ( c and c ) have multiple splice variants that introduce diversity into the first exon ( skalhegg and tasken , 2000 ) . all the c subunits ( c , c , c ) have catalytic core motifs that are common to all protein kinases . the catalytic subunit is a nearly globular protein , of approximately 250 amino acids , with two lobes : a small and highly dynamic amino - terminal lobe ( n - lobe ) that is mostly beta strands , involved in mgatp - binding , and a larger mostly helical carboxy - terminal lobe ( c - lobe ) that contains much of the catalytic machinery as well as the major substrate docking sites . both mgatp and the peptide come together for catalysis in the cleft between the two lobes . in addition to the core , the c - subunit of pka is flanked by an n - terminal tail ( n - tail ) and a c - terminal tail ( c - tail ) . both are anchored to the n - and c - lobes of the core and thus can be thought of as cis - regulatory elements ( kim et al . the c - tail ( residues 301350 ) , in particular , is an integral part of the active enzyme . the crystal structure of the murine ca subunit was the first protein kinase crystal structure available and has served as a template for modeling of all the other kinases ( knighton et al . , 1991 ) . several converging data reveal that the camp / pka signaling pathway is altered in different cancers and may be exploited for cancer therapy and / or diagnosis ( naviglio et al . , 2009 ) . camp and pka play different roles in this process ( stork and schmitt , 2002 ) . low camp levels are detected at mitosis , while higher levels are present in g1 and early s ; on the other hand , pka phosphorylates macromolecular complexes responsible for the destruction of mitotic cyclins and separation of the sister chromatids at anaphase - metaphase transition ( ferrari , 2006 ) . pka may act synergistically with epac to induce mitogenesis in endocrine cells ( hochbaum et al . , , it is possible to affect the activation of pka ( and also of other camp effectors ) , that in turn can act on the ras / erk and / or other signaling pathways , involved in cell cycle progression ( waschek et al . , 2006 ; the camp / pka pathway has been reported to stimulate cell growth in many cell types while inhibiting it in others ( stork and schmitt , 2002 ; insel et al . , 2012 ) . an involvement of pka in neoplastic transformation and tumor growth , especially in the onset and maintenance of endocrine tumors ( hormone - responsive tissues ) , mainly of the corticotroph axis ( pituitary and adrenal cortex ) and the thyroid , is clearly indicated ( rivas and santisteban , 2003 ; mantovani et al . , 2008 ) . moreover , the ria expression , both at protein and mrna level , has been found to be up - regulated in a series of transformed cell lines and human tumors ( bradbury et al . , 1994 ; mcdaid et al . , 1999 ; miller , 2002 ; mantovani et al . , 2008 ; loilome et al . , indeed several studies have indicated that inhibition of ria expression through antisense oligonucleotides resulted in growth arrest of several tumor cell lines ( cho - chung , 2004 ) . on the other hand , overexpression of riiinhibits cancer cell growth and induces a reverted phenotype in various cancer cell lines ( nesterova et al . , 1996 ) , including prostate carcinoma cells . in prostate tumors , the camp pathway may also interact with the androgen receptor , by enhancing its activation ( merkle and hoffmann , 2011 ) . thus , uncontrolled proliferation and malignant transformation have been associated mainly with an increase of ri expression or changes in the ratio of pka - i and ii ( bossis and stratakis , 2004 ) . accordingly , the synthesis of ri and rii subunits and the relative abundance of pka - i and pka - ii isoforms are differentially regulated during differentiation , cell growth , and neoplastic transformation , with expression of pka - ii predominantly found in normal non - proliferating tissues and in growth - arrested cells , whereas enhanced levels of pka - i are detected steadily in tumor cells and transiently in normal cells exposed to mitogenic stimuli ( neary et al . , in addition , pka - i and its regulatory subunit ria are induced following transformation by certain oncogenes , such as ras ( neary et al . , on the other hand , ria - inactivating mutations ( germline or somatic mutations ) result in a higher pka activity by enzymatic studies , are associated with altered pka subunits expression and aberrant pka signaling , and have been found to cause primary pigmented nodular adrenocortical disease , the carney complex , a multiple neoplasia syndrome , and sporadic endocrine tumors ( kirschner et al . , 2000 ; bossis et al . , 2004 ; bourdeau et al . , moreover , ria null mouse embryonic fibroblasts ( mefs ) , showing a constitutive pka activation , became immortalized in correlation with up - regulation of d - type cyclins ( nadella and kirschner , 2005 ) and showed a decreased autophagy , a mechanism that can be associated with transformation inhibition ( mavrakis et al . , 2006 ; sharma et al . , 2014 ) . overall , overexpression of pka - i isoform , as compared with the pka - ii one , is considered a hallmark of most human tumors , correlating with more serious clinico - pathological features in several tumor types ( cho - chung and nesterova , 2005 ; tortora and ciardiello , 2002 ) . furthermore , pka catalytic subunit has been shown to be a direct transcriptional target of c - myc , and proposed as a crucial component of the program by which constitutive c - myc expression contributes to cell transformation ( wu et al . , the pka pathway has become of great interest to the study of aging , since mutations that cause a reduction in pka signaling have been shown to extend lifespan in yeast , and to both delay the incidence and severity of age - related disease , and to promote leanness and longevity in mice . there is increasing interest in the potential for the inhibition or redistribution of adiposity to attenuate aging and obesity - related diseases , including cancer , since obesity is associated with impaired function of most organ systems , and is a strong risk factor for both shortened life span and tumors . therefore , gene signaling pathways such as pka , that play a key role in the regulation of metabolism and triglyceride storage , are potential inhibitory targets for obesity and aging intervention ( enns and ladiges , 2010 ) . at this regard , it has been found that pka catalytic subunit is involved in diet - induced obesity , since c subunit null animals appear overtly normal when fed standard rodent chow , whereas they are protected from diet - induced obesity , steatosis , dyslipoproteinemia and insulin resistance , without any differences in caloric intake or locomotor activity ( enns et al . , notably , given the relevant role of obesity - linked cytokine leptin in breast cancer growth and metastasis , the leptin system has emerged as a new and promising therapeutic target for breast cancer and strategies to counteract biological effects of this obesity - linked cytokine are warranted ( gertler and solomon , 2013 ) . interestingly , our previous studies provided initial evidence for the efficacy of camp elevation against the oncogenic effects of leptin in triple negative breast cancer cells , via pka modulation ( spina et al . , 2013 ) . recently , we demonstrated that in mda - mb - 231 breast cancer cells , intracellular camp elevation completely abrogates both erk1 / 2 and stat3 phosphorylation in response to leptin , strongly lowers protein levels of both regulatory ria and catalytic subunits of pka , with a consistent reduction of creb phosphorylation , and inhibits both leptin - induced proliferation and migration ( naviglio et al . another function , in which pka may operate and may be dysregulated in cancer , is the actin - based cell migration , that involves cytoskeleton remodeling . pka regulates actin dynamics , by targeting structural proteins , like actin , integrins , vasp and myosin light chain , and regulatory proteins , like rho gtpases , src kinases , p21 - activated kinases , phosphatases and proteases ( howe , 2004 ) . the involvement of pka in migration of breast carcinoma cells has been described ( jiang et al . , 2009 ) and also in ovarian cancer cell migration and invasion ( mckenzie et al . , 2011recently , it has also been shown that hypoxia enhances pka activity by up - regulating pka gene expression in a hif dependent mechanism and that pka plays a key role in hypoxia - mediated emt , migration , and invasion in lung cancer cells ( shaikh et al . , 2012 ) . furthermore , pka has been clearly shown to be involved in drug resistance in human cancer cells ( gausdal et al . , 2013 ; de leeuw et al . , 2013 ) . additionally , recent clinical studies , either measuring autoantibodies for pka ( nesterova et al . ,2006 ) or its enzymatic activity ( wang et al . , 2007 ) in serum patients , strongly suggest that pka may function as a cancer marker for various human cancers and can be used in cancer detection and for monitoring response to therapy . overall , based on the above considerations , pka selective targeting in antitumour strategies has become very attractive and will be discussed below . camp acts in mammalian cells by binding to two distinct isoforms of pka , defined pka - i and pka - ii . ( r ) subunits , termed ri in pka - i and rii in pka - ii , respectively . binding of two camp molecules to each of the regulatory subunits results in the release and activation of the catalytic subunits . these catalytic subunits will phosphorylate serine and threonine residues on specific substrate proteins both in the cytoplasm and in the nucleus ( skalhegg and tasken , 2000 ) . the major nuclear targets of pka are the transcription factors of the camp response element binding ( creb ) family ( mayr and montminy , 2001 ) . creb proteins bind optimally to palindromic cres ( sequence tgacgtca ) in promoters and upon phosphorylation by pka they recruit the coactivator , creb binding protein ( cbp ) to the promoter . such a phosphorylation event results in the induction of cellular gene expression ( sands and palmer , 2008 [ ref : 80 ] ) . the importance of creb for several physiological events has been confirmed by the high number of targets identified so far : up to 4000 genes involved in several cellular processes . moreover , several lines of evidence obtained from studies on leukemia , fusion oncoproteins , viral oncoproteins and endocrine tumors support the notion that creb is involved in oncogenesis ( siu and jin , 2007 ; sakamoto and frank , 2009 ) . the regulatory subunits are highly dynamic multi - domain proteins that interact with a variety of proteins in addition to serving as major receptors for camp ( kim et al . , 2007 ; although there are multiple isoforms ( i and i , ii and ii ) , all retain the same general architectural organization . all have a dimerization / docking ( d / d ) domain at the n - terminus , which is the docking site for the a kinase - anchoring proteins , akaps ( gold et al . , 2006 ) . the d / d domain is followed by an inhibitor site ( a pseudosubstrate for ri subunits and a substrate site for rii subunits ) and two camp binding domains ( cbds ) , referred to here as domains a and b. structures of the camp bound conformations of ri and rii revealed that the cbds were conserved motifs that resemble the catabolite gene activator protein ( cap ) in bacteria ( su et al . , 1995 ; diller et al . different subunit isoforms ( ri , ri , rii , and rii ) have different affinities for camp , thus originating holoenzymes ( pka type i or pka type ii with different subunit composition and affinity for camp and thus are activated at either low or high local concentrations of camp in the cell ( skalhegg and tasken , 2000 ) . typically pka type i holoenzyme have higher affinity for camp than type ii holoenzyme . when ri subunits are up - regulated , camp sensitivity of pka increases and thereby lowers the threshold for activation of camp - mediated downstream effects . furthermore , only pka - ii but not pka - i undergoes autophosphorylation ( rosen and erlichman , 1975 ) , which serves as a feed - forward signal by enhancing the camp responsiveness of pka - ii ( martin et al . , 2007 ) . the four types of regulatory subunits have different expression patterns in mammals ( skalhegg and tasken , 2000 ) . moreover , during both physiological and pathological conditions , the composition of the pka holoenzyme as well as their intracellular localization may change , inducing different effects . while ria has ubiquitous distribution , risimilarly , rii has ubiquitous distribution , while rii is expressed in brain , adipose , and some endocrine tissues . besides camp affinity , localization of the holoenzyme is also different , with pka type i enzymes beingthe akaps play an important role in differential targeting of pka types i and ii in the cell . the ri and ri subunits are dissimilar , but reveal high homology ( 81 % identity at the amino acid level ) as do the riia and rii subunits ( 68 % identity at the amino acid level ) . pka signaling and cancer section , pka type i is associated with growth and proliferation whereas pka type ii is associated with increased differentiation and decreased proliferation . in mammalian cellsthere are three isoforms of the c - subunit and the two major isoforms ( c and c ) have multiple splice variants that introduce diversity into the first exon ( skalhegg and tasken , 2000 ) . all the c subunits ( c , c , c ) have catalytic core motifs that are common to all protein kinases . the catalytic subunit is a nearly globular protein , of approximately 250 amino acids , with two lobes : a small and highly dynamic amino - terminal lobe ( n - lobe ) that is mostly beta strands , involved in mgatp - binding , and a larger mostly helical carboxy - terminal lobe ( c - lobe ) that contains much of the catalytic machinery as well as the major substrate docking sites . both mgatp and the peptide come together for catalysis in the cleft between the two lobes . in addition to the core , the c - subunit of pka is flanked by an n - terminal tail ( n - tail ) and a c - terminal tail ( c - tail ) . both are anchored to the n - and c - lobes of the core and thus can be thought of as cis - regulatory elements ( kim et al . the c - tail ( residues 301350 ) , in particular , is an integral part of the active enzyme . the crystal structure of the murine ca subunit was the first protein kinase crystal structure available and has served as a template for modeling of all the other kinases ( knighton et al . , 1991 ) . several converging data reveal that the camp / pka signaling pathway is altered in different cancers and may be exploited for cancer therapy and / or diagnosis ( naviglio et al . , 2009 ) . camp and pka play different roles in this process ( stork and schmitt , 2002 ) . low camp levels are detected at mitosis , while higher levels are present in g1 and early s ; on the other hand , pka phosphorylates macromolecular complexes responsible for the destruction of mitotic cyclins and separation of the sister chromatids at anaphase - metaphase transition ( ferrari , 2006 ) . pka may act synergistically with epac to induce mitogenesis in endocrine cells ( hochbaum et al . , it is possible to affect the activation of pka ( and also of other camp effectors ) , that in turn can act on the ras / erk and / or other signaling pathways , involved in cell cycle progression ( waschek et al . , 2006 ; the camp / pka pathway has been reported to stimulate cell growth in many cell types while inhibiting it in others ( stork and schmitt , 2002 ; insel et al . , 2012 ) . an involvement of pka in neoplastic transformation and tumor growth , especially in the onset and maintenance of endocrine tumors ( hormone - responsive tissues ) , mainly of the corticotroph axis ( pituitary and adrenal cortex ) and the thyroid , is clearly indicated ( rivas and santisteban , 2003 ; mantovani et al . , 2008 ) . moreover , the ria expression , both at protein and mrna level , has been found to be up - regulated in a series of transformed cell lines and human tumors ( bradbury et al . , 1994 ; several studies have indicated that inhibition of ria expression through antisense oligonucleotides resulted in growth arrest of several tumor cell lines ( cho - chung , 2004 ) . on the other hand , overexpression of riiinhibits cancer cell growth and induces a reverted phenotype in various cancer cell lines ( nesterova et al . , 1996 ) , including prostate carcinoma cells . in prostate tumors , the camp pathway may also interact with the androgen receptor , by enhancing its activation ( merkle and hoffmann , 2011 ) . thus , uncontrolled proliferation and malignant transformation have been associated mainly with an increase of ri expression or changes in the ratio of pka - i and ii ( bossis and stratakis , 2004 ) . accordingly , the synthesis of ri and rii subunits and the relative abundance of pka - i and pka - ii isoforms are differentially regulated during differentiation , cell growth , and neoplastic transformation , with expression of pka - ii predominantly found in normal non - proliferating tissues and in growth - arrested cells , whereas enhanced levels of pka - i are detected steadily in tumor cells and transiently in normal cells exposed to mitogenic stimuli ( neary et al . , 2004 ) . in addition , pka - i and its regulatory subunit ria are induced following transformation by certain oncogenes , such as ras ( neary et al . , 2004 ) . on the other hand , ria - inactivating mutations ( germline or somatic mutations ) result in a higher pka activity by enzymatic studies , are associated with altered pka subunits expression and aberrant pka signaling , and have been found to cause primary pigmented nodular adrenocortical disease , the carney complex , a multiple neoplasia syndrome , and sporadic endocrine tumors ( kirschner et al . moreover , ria null mouse embryonic fibroblasts ( mefs ) , showing a constitutive pka activation , became immortalized in correlation with up - regulation of d - type cyclins ( nadella and kirschner , 2005 ) and showed a decreased autophagy , a mechanism that can be associated with transformation inhibition ( mavrakis et al . , 2006 ; sharma et al . , 2014 ) . overall , overexpression of pka - i isoform , as compared with the pka - ii one , is considered a hallmark of most human tumors , correlating with more serious clinico - pathological features in several tumor types ( cho - chung and nesterova , 2005 ; tortora and ciardiello , 2002 ) . furthermore , pka catalytic subunit has been shown to be a direct transcriptional target of c - myc , and proposed as a crucial component of the program by which constitutive c - myc expression contributes to cell transformation ( wu et al . , 2002 ) . the pka pathway has become of great interest to the study of aging , since mutations that cause a reduction in pka signaling have been shown to extend lifespan in yeast , and to both delay the incidence and severity of age - related disease , and to promote leanness and longevity in mice . there is increasing interest in the potential for the inhibition or redistribution of adiposity to attenuate aging and obesity - related diseases , including cancer , since obesity is associated with impaired function of most organ systems , and is a strong risk factor for both shortened life span and tumors . therefore , gene signaling pathways such as pka , that play a key role in the regulation of metabolism and triglyceride storage , are potential inhibitory targets for obesity and aging intervention ( enns and ladiges , 2010 ) . at this regard , it has been found that pka catalytic subunit is involved in diet - induced obesity , since c subunit null animals appear overtly normal when fed standard rodent chow , whereas they are protected from diet - induced obesity , steatosis , dyslipoproteinemia and insulin resistance , without any differences in caloric intake or locomotor activity ( enns et al . , 2009 ) . notably , given the relevant role of obesity - linked cytokine leptin in breast cancer growth and metastasis , the leptin system has emerged as a new and promising therapeutic target for breast cancer and strategies to counteract biological effects of this obesity - linked cytokine are warranted ( gertler and solomon , 2013 ) . interestingly , our previous studies provided initial evidence for the efficacy of camp elevation against the oncogenic effects of leptin in triple negative breast cancer cells , via pka modulation ( spina et al . , 2013 ) . recently , we demonstrated that in mda - mb - 231 breast cancer cells , intracellular camp elevation completely abrogates both erk1 / 2 and stat3 phosphorylation in response to leptin , strongly lowers protein levels of both regulatory ria and catalytic subunits of pka , with a consistent reduction of creb phosphorylation , and inhibits both leptin - induced proliferation and migration ( naviglio et al . another function , in which pka may operate and may be dysregulated in cancer , is the actin - based cell migration , that involves cytoskeleton remodeling . pka regulates actin dynamics , by targeting structural proteins , like actin , integrins , vasp and myosin light chain , and regulatory proteins , like rho gtpases , src kinases , p21 - activated kinases , phosphatases and proteases ( howe , 2004 ) . the involvement of pka in migration of breast carcinoma cells has been described ( jiang et al . , 2009 ) and also in ovarian cancer cell migration and invasion ( mckenzie et al . , 2011 ) . recently , it has also been shown that hypoxia enhances pka activity by up - regulating pka gene expression in a hif dependent mechanism and that pka plays a key role in hypoxia - mediated emt , migration , and invasion in lung cancer cells ( shaikh et al . , 2012 ) . furthermore , pka has been clearly shown to be involved in drug resistance in human cancer cells ( gausdal et al . , 2013 ; additionally , recent clinical studies , either measuring autoantibodies for pka ( nesterova et al . , 2006 ) or its enzymatic activity ( wang et al . , 2007 ) in serum patients , strongly suggest that pka may function as a cancer marker for various human cancers and can be used in cancer detection and for monitoring response to therapy . overall , based on the above considerations , pka selective targeting in antitumour strategies has become very attractive and will be discussed below . the interest in cyclic nucleotides as the - rapeutics against cancer started in the late 1980s , when cho - chung and colleagues discovered that 8 - cl - camp , a potent site - selective analog of camp , induced growth inhibition in vitro and in vivo in a broad spectrum of human carcinomas ( breast , colon , lung ) , fibrosarcomas , and leukemias at micromolar concentrations , and in animal models . since thenother camp analogs have been developed , but further studies have been mainly conducted with 8 - cl - camp , most readily available by synthesis and promising enough to be tested as a drug ( schwede et al . , 2000 ) .8 - cl - camp can discriminate between the two camp binding sites ( sites a and b ) on the r - subunits ( ri and rii ) of pka - i and ii .8 - cl - camp binds with similar high affinity to both sites a and b of ri . in contrast , it binds with high affinity to site b of rii , but with low affinity to site a , which may keep this isozyme in its nonactivated holoenzyme form ( schwede et al . , 2000 ) . as above focused , overexpression of pka - i isoform occurs in most human tumors and has been associated with cell transformation and proliferation while growth arrest and differentiation have been linked to a decreased ratio of ri / rii .8 - cl - camp was found to modulate ri and rii levels , leading to the restoration of a more natural ri / rii balance in cancer cells ( rohlff et al . , 1993 ; 8 - cl - camp is able to down - regulate ria , perhaps by facilitating the degradation of the protein after its dissociation from the pka holoenzyme , while rii expression is up - regulated at the transcriptional level or not affected , both leading to an increased rii / ri intracellular ratio . in preclinical studies , 8 - cl - camp was shown to inhibit the expression of c - myc and c - ras , to revert the transformed phenotype , and to cause inhibition of cancer cell growth through both anti - proliferation and pro - apoptotic mechanisms ( cho - chung and nesterova , 2005 ) . yet , despite the well - documented effects of 8 - cl - camp and the above pioneering studies by the group of yoon cho - chung , actually there is no common agreement on its mechanism of action , and the results of more recent studies suggest that the effects of 8 - cl - camp might be also mediated by its metabolite 8 - cl - adenosine and might be independent of pka activation and / or alterations of the ratio between type i and type ii r subunits ( robinson - white et al . , 2008 ; lucchi et al . , 2011 ; choi et al . however , although the mechanism of action of 8 - cl - camp is debated and it is still not completely clear whether 8 - cl - camp acts as a pharmacon itself or , at least in part , as a prodrug for 8 - cl - adenosine via a pka - independent manner , recently , it has been evaluated in phase i / ii clinical trials as an anticancer agent ( propper et al . , 1999 ; clear evidence that ri subunit of pka was a positive effector of cancer cell growth was provided by antisense strategy data ( cho - chung , 2004 ) . a synthetic ri antisense oligodeoxynucleotide ( odn ) corresponding to the n - terminus ( the first 21 bases ) of the human ria produced growth inhibition in human cancer cells of epithelial origin , including breast ( mcf - 7 ) , colon ( ls - 174 t ) , and gastric ( tmk - 1 ) carcinoma and neuroblastoma ( sk - n - sh ) cells , as well as hl - 60 leukemia cells with no sign of cytotoxicity . moreover , treatment with ria antisense phosphorothioate oligodeoxynucleotide ( ps - odn ) brought about a marked reduction in ria protein levels accompanied by an increase in rii protein levels due to an increase in rii protein half - life . this compensatory stabilization of rii protein represents an important biochemical mechanism of ri antisense that ensures both a depletion of growth - promoting ri subunit and an increase of rii , the growth - inhibitory and differentiation - inducing protein , leading to sustained inhibition of tumor cell growth ( nesterova et al . , 2000 ) . importantly , a single subcutaneous injection of ria antisense ps - odn to 8 - 13 codons of human ri into nude mice bearing ls - 174 t human colon carcinoma resulted both in a reduced ria expression and an almost complete suppression of tumor growth for up to 14 days of examination without apparent sign of systemic toxicity , whereas tumors in untreated , saline - treated , or control antisense - treated animals showed continued growth ( nesterova and cho - chung , 1995 ) . furthermore , a second - generation rna - dna mixed - backbone ( mbo ) ria antisense odn containing both phosphorothioate - modified nucleosides and ribonucleosides , more stable and resistant to nucleases , has been shown to cause growth arrest and differentiation in a variety of cancer cell lines in vitro and to exhibit antitumor effects in animal models of breast , colon , prostate and lung cancer ( cho - chung et al . , 1999 ; hensley et al . , 2011 ) . the rna - dna mixed - backbone ( mbo ) ria antisense has demonstrated increased biologic activity , minimal polyanionic or immunostimulatory side effects , improved in vivo stability , and , remarkably , synergizing effects with several class of cytotoxic drugs , oral efficacy ( wang et al . notably , the mbo as - pka - i ( defined gem 231 ) has recently been used for clinical studies ( mani et al . , 2003 ; goel et al . . as the second largest group after g - protein - coupled receptors , there are more than 500 protein kinases . because of their critical effects on cell function , their activity is tightly regulated , and thus abnormal phosphorylation is linked to various diseases , including cancer . accordingly , protein kinases have become very attractive drug targets ( arencibia et al . , 2013 ) . , a majority of protein kinase inhibitors with clinical applications have developed toward the atp - binding site ( han et al . , 2012 ) . although many atp - competitive small molecule inhibitors have demonstrated their potency , they have a limitation in their selectivity because of the highly conserved region of the atp - binding site and also because these inhibitors have to compete with high concentration of intracellular atp . on the other hand , substrate recognition by protein kinases exhibits remarkable specificity , despite their structural and sequence homologies in the catalytic domains ( pinna and ruzzene , 1996 ) . because the substrate - binding domain is much more diverse than the atp - binding site , substrate - competitive inhibitors are expected to show higher selectivity ( han et al . , 2012 ) . heat - stable protein kinase a inhibitor ( pki ) purified and characterized in the early 1970s became the first head in the development of peptide inhibitors of protein kinases . pki interacts specifically with the catalytic domain of pka , thereby inhibiting kinase activity with a ki of 0.2 nm in the presence of atp ( cheng et al . , 1986 ) . pki ( 5 - 24 ) is a potent , competitive , synthetic peptide inhibitor of pka derived from the active domain of the naturally - occurring heat - stable inhibitor protein pki . this pseudosubstrate inhibitor peptide mimics the protein substrate by binding to the catalytic site via the arginine - cluster basic subsite , which provides high specificity . pka catalytic subunit residues tyr235 and phe239 form a sandwich - like structure with residue phe10 of pki ( 5 - 24 ) ; this is a prominent enzyme - substrate interaction site ( knighton et al . , 1991 ) . despite their selectivity , clinical applications of such substrate - competitive inhibitors are frequently hampered by several obstacles including permeability into cells , susceptibility to proteases and potential immunogenicity . therefore , more efforts have been directed to the discovery and development of substrate competitive inhibitors , particularly considering the clinical applicability . generally , the design of substrate - competitive inhibitors requires comprehensive understanding of structural interaction of protein kinases with substrates or regulator proteins . pka was one of the first protein kinases to be discovered , the first to be sequenced and then cloned and the elucidation of its structure provided the first three dimensional template for this family ( knighton et al . moreover , the structures of the regulatory subunits of pka also have been elucidated previously ( su et al . , 1995 ; diller et al . , 2001 ) , but it is only recently that the structure solution of holoenzyme complexes have been resolved ( kim et al . , 2007the kinase has started to be considered as a scaffold , in addition to its role as a catalyst ; in fact every part of its surface seems committed to some type of protein : protein interaction and these interactions appear to be as essential to its function as is phosphoryl transfer . the regulatory and catalytic subunits have been considered as separate proteins for more than a decade where they served as prototypes for the protein kinase superfamily and for camp binding domains , respectively . now , instead , they can be considered as part of larger protein complexes and the understanding of how regulatory and catalytic subunits contribute to the assembly and disassembly of macromolecular signaling complexes will be made a great deal easier by these structures . in other words , by solving crystal structures of holoenzyme complexes of pka , the molecular features required for inhibition and for camp - induced activation and the entire range of strategies for designing inhibitors and interfering with pka signaling can be fully appreciated ( taylor et al . , thus , the approach to pka inhibitor design could be not aimed exclusively at molecules that target the atp binding pocket and substrate tethering sites for the catalytic subunit , but also inhibitors that target the activation of the kinase could be designed and are presumed very attractive as therapeutic agents . the regulatory subunits , for instance , undergo major conformational changes as they release camp and wrap around the catalytic subunit . in the process of binding to the catalytic subunit , the camp binding sites ( cbds ) are completely restructured . the phosphate binding cassette ( pbc ) where the ribose phosphate docks , for example , is far removed from the residues that cap the adenine ring in the holoenzyme complex . this provides a new paradigm for designing novel agonists or antagonists for pka ( taylor et al . , 2013 ) . the akaps introduce another level of complexity into pka signaling by localizing pka in close proximity to its physiological substrates . a strategy aimed at disrupting pka targeting to substratesfurthermore , with the structure solutions of targeting motifs , novel mechanisms for disrupting targeting are also being implemented ( trger et al . , 2012 ) . moreover , an additional strategy for targeting pka activity is to affect camp levels by manipulating its synthesis and / or degradation , via adenylyl cyclases and / or subtype - specific phosphodiesterase , respectively ( pavan et al . , 2009 ; maurice et al . , 2014 ) the interest in cyclic nucleotides as the - rapeutics against cancer started in the late 1980s , when cho - chung and colleagues discovered that 8 - cl - camp , a potent site - selective analog of camp , induced growth inhibition in vitro and in vivo in a broad spectrum of human carcinomas ( breast , colon , lung ) , fibrosarcomas , and leukemias at micromolar concentrations , and in animal models . since thenother camp analogs have been developed , but further studies have been mainly conducted with 8 - cl - camp , most readily available by synthesis and promising enough to be tested as a drug ( schwede et al . , 2000 ) .8 - cl - camp can discriminate between the two camp binding sites ( sites a and b ) on the r - subunits ( ri and rii ) of pka - i and ii .8 - cl - camp binds with similar high affinity to both sites a and b of ri . in contrast , it binds with high affinity to site b of rii , but with low affinity to site a , which may keep this isozyme in its nonactivated holoenzyme form ( schwede et al . , 2000 ) . as above focused , overexpression of pka - i isoform occurs in most human tumors and has been associated with cell transformation and proliferation while growth arrest and differentiation have been linked to a decreased ratio of ri / rii .8 - cl - camp was found to modulate ri and rii levels , leading to the restoration of a more natural ri / rii balance in cancer cells ( rohlff et al . , 1993 ; 8 - cl - camp is able to down - regulate ria , perhaps by facilitating the degradation of the protein after its dissociation from the pka holoenzyme , while rii expression is up - regulated at the transcriptional level or not affected , both leading to an increased rii / ri intracellular ratio . in preclinical studies , 8 - cl - camp was shown to inhibit the expression of c - myc and c - ras , to revert the transformed phenotype , and to cause inhibition of cancer cell growth through both anti - proliferation and pro - apoptotic mechanisms ( cho - chung and nesterova , 2005 ) . yet , despite the well - documented effects of 8 - cl - camp and the above pioneering studies by the group of yoon cho - chung , actually there is no common agreement on its mechanism of action , and the results of more recent studies suggest that the effects of 8 - cl - camp might be also mediated by its metabolite 8 - cl - adenosine and might be independent of pka activation and / or alterations of the ratio between type i and type ii r subunits ( robinson - white et al . , 2008 ; lucchi et al . , 2011 ; choi et al . however , although the mechanism of action of 8 - cl - camp is debated and it is still not completely clear whether 8 - cl - camp acts as a pharmacon itself or , at least in part , as a prodrug for 8 - cl - adenosine via a pka - independent manner , recently , it has been evaluated in phase i / ii clinical trials as an anticancer agent ( propper et al . , 1999 ; clear evidence that ri subunit of pka was a positive effector of cancer cell growth was provided by antisense strategy data ( cho - chung , 2004 ) . a synthetic ri antisense oligodeoxynucleotide ( odn ) corresponding to the n - terminus ( the first 21 bases ) of the human ria produced growth inhibition in human cancer cells of epithelial origin , including breast ( mcf - 7 ) , colon ( ls - 174 t ) , and gastric ( tmk - 1 ) carcinoma and neuroblastoma ( sk - n - sh ) cells , as well as hl - 60 leukemia cells with no sign of cytotoxicity . moreover , treatment with ria antisense phosphorothioate oligodeoxynucleotide ( ps - odn ) brought about a marked reduction in ria protein levels accompanied by an increase in rii protein levels due to an increase in rii protein half - life . this compensatory stabilization of rii protein represents an important biochemical mechanism of ri antisense that ensures both a depletion of growth - promoting ri subunit and an increase of rii , the growth - inhibitory and differentiation - inducing protein , leading to sustained inhibition of tumor cell growth ( nesterova et al . , 2000 ) . importantly , a single subcutaneous injection of ria antisense ps - odn to 8 - 13 codons of human ri into nude mice bearing ls - 174 t human colon carcinoma resulted both in a reduced ria expression and an almost complete suppression of tumor growth for up to 14 days of examination without apparent sign of systemic toxicity , whereas tumors in untreated , saline - treated , or control antisense - treated animals showed continued growth ( nesterova and cho - chung , 1995 ) . furthermore , a second - generation rna - dna mixed - backbone ( mbo ) ria antisense odn containing both phosphorothioate - modified nucleosides and ribonucleosides , more stable and resistant to nucleases , has been shown to cause growth arrest and differentiation in a variety of cancer cell lines in vitro and to exhibit antitumor effects in animal models of breast , colon , prostate and lung cancer ( cho - chung et al . , 1999 ; hensley et al . , 2011 ) . the rna - dna mixed - backbone ( mbo ) ria antisense has demonstrated increased biologic activity , minimal polyanionic or immunostimulatory side effects , improved in vivo stability , and , remarkably , synergizing effects with several class of cytotoxic drugs , oral efficacy ( wang et al . notably , the mbo as - pka - i ( defined gem 231 ) has recently been used for clinical studies ( mani et al . , 2003 ; goel et al . as the second largest group after g - protein - coupled receptors , there are more than 500 protein kinases . because of their critical effects on cell function , their activity is tightly regulated , and thus abnormal phosphorylation is linked to various diseases , including cancer . accordingly , protein kinases have become very attractive drug targets ( arencibia et al . , 2013 ) . , a majority of protein kinase inhibitors with clinical applications have developed toward the atp - binding site ( han et al . , 2012 ) . although many atp - competitive small molecule inhibitors have demonstrated their potency , they have a limitation in their selectivity because of the highly conserved region of the atp - binding site and also because these inhibitors have to compete with high concentration of intracellular atp . on the other hand , substrate recognition by protein kinases exhibits remarkable specificity , despite their structural and sequence homologies in the catalytic domains ( pinna and ruzzene , 1996 ) . because the substrate - binding domain is much more diverse than the atp - binding site , substrate - competitive inhibitors are expected to show higher selectivity ( han et al . , 2012 ) . heat - stable protein kinase a inhibitor ( pki ) purified and characterized in the early 1970s became the first head in the development of peptide inhibitors of protein kinases . pki interacts specifically with the catalytic domain of pka , thereby inhibiting kinase activity with a ki of 0.2 nm in the presence of atp ( cheng et al . , pki ( 5 - 24 ) is a potent , competitive , synthetic peptide inhibitor of pka derived from the active domain of the naturally - occurring heat - stable inhibitor protein pki . this pseudosubstrate inhibitor peptide mimics the protein substrate by binding to the catalytic site via the arginine - cluster basic subsite , which provides high specificity . pka catalytic subunit residues tyr235 and phe239 form a sandwich - like structure with residue phe10 of pki ( 5 - 24 ) ; this is a prominent enzyme - substrate interaction site ( knighton et al . , 1991 ) . despite their selectivity , clinical applications of such substrate - competitive inhibitors are frequently hampered by several obstacles including permeability into cells , susceptibility to proteases and potential immunogenicity . therefore , more efforts have been directed to the discovery and development of substrate competitive inhibitors , particularly considering the clinical applicability . generally , the design of substrate - competitive inhibitors requires comprehensive understanding of structural interaction of protein kinases with substrates or regulator proteins . pka was one of the first protein kinases to be discovered , the first to be sequenced and then cloned and the elucidation of its structure provided the first three dimensional template for this family ( knighton et al . moreover , the structures of the regulatory subunits of pka also have been elucidated previously ( su et al . , 1995 ; diller et al . , 2001 ) , but it is only recently that the structure solution of holoenzyme complexes have been resolved ( kim et al . the kinase has started to be considered as a scaffold , in addition to its role as a catalyst ; in fact every part of its surface seems committed to some type of protein : protein interaction and these interactions appear to be as essential to its function as is phosphoryl transfer . the regulatory and catalytic subunits have been considered as separate proteins for more than a decade where they served as prototypes for the protein kinase superfamily and for camp binding domains , respectively . now , instead , they can be considered as part of larger protein complexes and the understanding of how regulatory and catalytic subunits contribute to the assembly and disassembly of macromolecular signaling complexes will be made a great deal easier by these structures . in other words , by solving crystal structures of holoenzyme complexes of pka , the molecular features required for inhibition and for camp - induced activation and the entire range of strategies for designing inhibitors and interfering with pka signaling can be fully appreciated ( taylor et al . , 2013 ) . thus , the approach to pka inhibitor design could be not aimed exclusively at molecules that target the atp binding pocket and substrate tethering sites for the catalytic subunit , but also inhibitors that target the activation of the kinase could be designed and are presumed very attractive as therapeutic agents . the regulatory subunits , for instance , undergo major conformational changes as they release camp and wrap around the catalytic subunit . in the process of binding to the catalytic subunit , the camp binding sites ( cbds ) are completely restructured . the phosphate binding cassette ( pbc ) where the ribose phosphate docks , for example , is far removed from the residues that cap the adenine ring in the holoenzyme complex . this provides a new paradigm for designing novel agonists or antagonists for pka ( taylor et al . , 2013 ) . the akaps introduce another level of complexity into pka signaling by localizing pka in close proximity to its physiological substrates . a strategy aimed at disrupting pka targeting to substratesthe docking motifs are also valid targets for designing inhibitors that disrupt targeting . furthermore , with the structure solutions of targeting motifs , novel mechanisms for disrupting targeting are also being implemented ( trger et al . , 2012 ) . moreover , an additional strategy for targeting pka activity is to affect camp levels by manipulating its synthesis and / or degradation , via adenylyl cyclases and / or subtype - specific phosphodiesterase , respectively ( pavan et al . , 2009 ; maurice et al . , 2014 ) the protein kinases play a key regulatory role in cellular signaling pathways and their abnormal phosphorylation activity is inseparably linked with various human diseases , including cancer . accordingly , protein kinases have become invaluable drug targets and considerable effort has gone into the discovery of protein kinase inhibitors . pka targeting is largely known to control cell growth in many cancer types in vitro and in vivo ; remarkably , targeting pka by either site - selective camp analogs or antisense approaches has clearly shown antitumor activity in cancer patients . howeveralthough strategies including bioinformatics , computational modeling , and high - throughput screening are often employed for designing specific kinase inhibitors , an invaluable guidance in developing inhibitors and interfering with pka signaling will certainly rise from the structure solution of pka holoenzyme complexes .\noutput:\n" }, { "from": "agent", "value": "protein kinase a ( pka ) is a well known member of the serine - threonin protein kinase superfamily . pka , also known as camp - dependent protein kinase , is a multi - unit protein kinase that mediates signal transduction of g - protein coupled receptors through its activation upon camp binding . the widespread expression of pka subunit genes , and the myriad of mechanisms by which camp is regulated within a cell suggest that pka signaling is one of extreme importance to cellular function . it is involved in the control of a wide variety of cellular processes from metabolism to ion channel activation , cell growth and differentiation , gene expression and apoptosis . importantly , since it has been implicated in the initiation and progression of many tumors , pka has been proposed as a novel biomarker for cancer detection , and as a potential molecular target for cancer therapy . here , we highlight some features of camp / pka signaling that are relevant to cancer biology and present an update on targeting pka in cancer therapy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: only less than 5 cases of primary urethral angioleiomyomas are reported in literature mostly in females . angioleiomyomas are benign smooth muscle tumors that are commonly seen in subcutaneous location of the extremities . herein , we present a rare case of primary angioleiomyoma of urethra in a 72 years old male who presented with hematuria . a 72 year old male who is a known case of diabetes mellitus presented with gross hematuria of two day duration . his physical examination was unremarkable apart from markedly enlarged prostate that was identified on rectal examination . due to the persistent gross hematuria and passage of blood clots and presence of atypical cells in urine , clinical decision was made to do cystoscopy and at the same time do transurethral resection of prostate ( turp ) since the patient had a markedly enlarged prostate . cystoscopy showed an incidental urethral polypoid lesion that was excised in addition to random biopsies that were taken from the urinary bladder . the prostatic urethral polyp showed a well circumscribed nodule exhibiting scattered thick walled blood vessels that were surrounded by spindle cell proliferation ( fig . the cells were elongated , had eosinophilic cytoplasm , bland appearing nuclei , and lacked any cytologic atypia or increased mitotic activity ( fig . the smooth muscle walls of the blood vessels were strongly positive for actin ( fig . the patient had an uneventful postoperative course and 12 years later he had no recurrence of hematuria , atypical cells in urine , or evidence of recurrent urethral lesion . most urethral lesions encompass urethral caruncle , diverticulum , mucosal prolapse , skene duct cyst / abscess , cowper gland duct cyst , fibroepithelial polyp , and prostatic - type poly . marshall et al . reported a study of 394 lesions of female urethra revealing 372 benign lesions and only 22 malignant tumors . caruncle was found to be the most commonly encountered lesion accounting for 96 % and no leiomyoma or angioleiomyoma was reported in that study . subsequently , few leiomyomas were reported in literature with only rare cases of angioleiomyomas that arose from urethra . most of these angioleiomyomas were associated with obstructive symptoms as is the case with many other urethral lesions , however our patient presented only with gross hematuria and no symptoms of obstruction . angioleiomyomas are common deep dermal , or subcutaneous benign , well - circumscribed smooth muscle tumors that originate from the walls of blood vessels in particular veins . although the neoplasm can affect any age , it is commonly seen in adults between the age of 30 and 60 years of age . there is mild overall male predominance , however , larger studies show that there is female predominance when angioleiomyomas are seen involving lower extremities and male predominance in the head and neck region and upper extremities . typically , the lesion presents as a solitary , small ( less than 2 cm ) , slow growing , nodule affecting the extremities , and is often painful or tender on compression . only rare cases have been reported in literature that arise in urethral location . to our knowledge , less than five casesgrossly these lesions are sharply circumscribed white rubbery nodules that are mostly 12 cm in size . histologically , these are mostly round encapsulated lesions that are composed of many blood vessels of variably thickened walls that are surrounded by interlacing fascicles and bundles of uniform spindled cell . there may be areas of myxoid change , thrombosis , lipomatous metaplasia , or dystrophic calcifications . occasional cases may exhibit epithelioid changes of the cells and few cells with enlarged hyperchromatic nuclei , however , no increase in mitotic activity is seen in these cases . such atypia without mitotic activity is considered secondary to degenerative or reactive changes and does not indicate malignancy . true angiomyolipmas belong to the family of perivascular epithelioid cell tumor ( pecomas ) , however , angioleiomyomas are not related to pecomas and do not show the characteristic hmb - 45 positive staining of pecomas . three histologic variants have been recognized ; the most common one being capillary or solid type representing approximately 67 % of cases . identification of these histologic variants is important for pathologists to be able to identify them and recognize them as variants of the same benign entity , however , has no clinical significance . immunohistochemistry shows cells to be positive for smooth muscle actin , calponin , and h - caldesmin . cytogenetic studies show chromosomal imbalances , with most consistent finding being recurrent losses in chromosome 22q11 . surgical excision is the recommended treatment for any urethral lesion mainly to identify the lesion histologically , and to distinguish reactive from neoplastic , and benign from malignant tumors . examples include smooth muscle tumors to differentiate benign leiomyoma from leiomyosarcoma based on the number of mitotic figures and benign versus malignant urothelial neoplasms based on architectural and cytologic features . recurrence of angioleiomyoma after simple excision is extremely rare and malignant transformation has not been convincingly documented or reported in literature . in conclusion , we herein , report a case of a primary angioleiomyoma arising from a rarely encountered location , urethra , in a male patient who presented with only gross hematuria . angioleiomyomas are benign smooth muscle neoplasms of vessel walls that are commonly seen in subcutaneous and deep dermal tissue of extremities . only rare cases are reported to arise from other sites with only less than 5 cases reported in literature involving urethra .\noutput:\n" }, { "from": "agent", "value": "highlightsa rare presentation of angioleiomyoma arising in the urethra , with only less than 5 cases reported in literature in such a location.angioleiomyoma is a smooth muscle tumor commonly seen in the blood vessels of deep dermal and subcutaneous tissue.recommended treatment of a urethral lesion is surgical excision in order to be able to identify this lesion and distinguish between reactive , benign , and malignant conditions ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: q fever infections can be common in regions where people are in close contact with livestock . however , only a small proportion of those who have acute q fever develop the chronic form . chronic q fever has nonspecific manifestations , and diagnosis often occurs after serological testing and nonspecific cardiac findings . if left untreated , q fever endocarditis can be severe and potentially fatal . reviews of q fever endocarditis reported a prevalence of one in one million per year , and of 5 % in all infective endocarditis ( ie ) . scott et al . reported that q fever endocarditis accounts for about 1 % of all cases of endocarditis in the united states . the literature has reported numerous cases in western europe and the united states , and australia ; however , there are very few reports in the literature on q fever endocarditis in china . this study summarizes cases of q fever endocarditis diagnosed in blood culture negative endocarditis ( bcne ) patients in the peking union medical college hospital ( pumch ) , compares the risk factor for q fever among suspected and unsuspected patients , and discusses factors that may contribute to the low diagnostic rate . six hundred and thirty - seven consecutive cases of ie , between january 2006 and august 2016 , were identified from the pumch database and examined for cases of q fever endocarditis . before 2006 , q fever serological diagnostic testing available to our facility was the complement fixation method . the complement fixation method has been documented to be less specific , lack sensitivity , and be detected later than the immunofluorescence antibody assay ( ifaa ) . for this study , we focused on cases after 2006 , where ifaa to detect phase i and ii c. burnetii antibodies from the serum was accessible . all ifaas were done at the state key laboratory of pathogen and biosecurity of the institute of microbiology and epidemiology at the academy of military medical sciences ( beijing , china ) . all q fever endocarditis patients must satisfy the modified duke criteria for ie and have significant levels of immunoglobulin ( ig ) g titer antibodies against c. burnetii ( phase i igg titer 1:800 ) . the pumch institutional review board approved all procedures of this study , and each patient provided written informed consent for this study . the q fever endocarditis patients demographics , initial presentation , cardiovascular manifestations , other clinical features , laboratory results , serology , treatment , and follow - up were collected from each patient 's medical record . since q fever endocarditis patients are known to have uncommon presentations , the patients initial presentation and present history was particularly noted , and a short patient description was written for each patient . echocardiograms , aerobic and anaerobic pathogen blood cultures were performed in all patients . no blood or resected cardiac tissue culture for c. burnetii was performed in these patients . particular attention was also paid to the bcne patients as these patients may have risk factors warranting q fever screening . previous studies have identified the following presentations ( 1 ) cardiac valvulopathy or valvular prostheses defects , ( 2 ) fever without leukocytosis , ( 3 ) immunocompromised , ( 4 ) periprosthetic leak in the absence of vegetations - place bcne patients at risk of q fever endocarditis . the presence of q fever risk factors was analyzed in all bcne patients from 2006 to 2016 [ figure 1 ] . the reasons why some but not all patients were selected for q fever screening were noted to understand guideline adherence and daily practice . flowchart of the infective blood culture negative endocarditis and q fever endocarditis patient selection process . standard descriptive statistics ( including mean and standard deviation ) were used to describe q fever endocarditis patients . the differences in clinical risk factors between suspected and unsuspected bcne patients were analyzed with chi - squared test or chi - squared test with yates correction for continuity . the level of significance was set at p 0.05 . six hundred and thirty - seven consecutive cases of ie , between january 2006 and august 2016 , were identified from the pumch database and examined for cases of q fever endocarditis . before 2006 , q fever serological diagnostic testing available to our facility was the complement fixation method . the complement fixation method has been documented to be less specific , lack sensitivity , and be detected later than the immunofluorescence antibody assay ( ifaa ) . for this study , we focused on cases after 2006 , where ifaa to detect phase i and ii c. burnetii antibodies from the serum was accessible . all ifaas were done at the state key laboratory of pathogen and biosecurity of the institute of microbiology and epidemiology at the academy of military medical sciences ( beijing , china ) . all q fever endocarditis patients must satisfy the modified duke criteria for ie and have significant levels of immunoglobulin ( ig ) g titer antibodies against c. burnetii ( phase i igg titer 1:800 ) . the pumch institutional review board approved all procedures of this study , and each patient provided written informed consent for this study . the q fever endocarditis patients demographics , initial presentation , cardiovascular manifestations , other clinical features , laboratory results , serology , treatment , and follow - up were collected from each patient 's medical record . since q fever endocarditis patients are known to have uncommon presentations , the patients initial presentation and present history was particularly noted , and a short patient description was written for each patient . echocardiograms , aerobic and anaerobic pathogen blood cultures were performed in all patients . no blood or resected cardiac tissue culture for c. burnetii was performed in these patients . particular attention was also paid to the bcne patients as these patients may have risk factors warranting q fever screening . previous studies have identified the following presentations ( 1 ) cardiac valvulopathy or valvular prostheses defects , ( 2 ) fever without leukocytosis , ( 3 ) immunocompromised , ( 4 ) periprosthetic leak in the absence of vegetations - place bcne patients at risk of q fever endocarditis . the presence of q fever risk factors was analyzed in all bcne patients from 2006 to 2016 [ figure 1 ] . the reasons why some but not all patients were selected for q fever screening were noted to understand guideline adherence and daily practice . flowchart of the infective blood culture negative endocarditis and q fever endocarditis patient selection process . standard descriptive statistics ( including mean and standard deviation ) were used to describe q fever endocarditis patients . the differences in clinical risk factors between suspected and unsuspected bcne patients were analyzed with chi - squared test or chi - squared test with yates correction for continuity . the level of significance was set at p 0.05 . of the 637 cases of ie , six cases of q fever endocarditis were found . all identified q fever endocarditis patients were han chinese males and their ages ranged from 22 to 61 years old . demographic and clinical data of the six patients were summarized in tables 1 and 2 . clinical findings and relative incidence of finding in q fever endocarditispatients * some patient data unavailable ; exact percentages not calculated . ast : aspartate transaminase ; alt : alanine transaminsase ; alp : alkaline phosphatase ; ldh : lactate dehydrogenase ; esr : erythrocyte sedimentation rate ; tbil : total bilirubin ; n / a : not available . cases of q fever endocarditis reported in pumch from 2006 to 2016 * reported to be stable upon discharge , further details unknown . nyha : new york heart association ; smz tmp : sulfamethoxazole trimethoprim ; hcq : hydroxycholoroquine ; pumch : peking union medical college hospital ; n / a : not available . a 41 - year - old male cattle and sheep herdsman presenting with fever and jaundice was admitted in march 2008 . he occasionally consumed moderate amounts of alcohol ( approximately 100 ml of liquor daily ) over the past 15 years . his hepatitis screening , for the hepatitis b , c , and d virus antibodies , returned negative . a 22 - year - old male college student with intermittent cough , fever , and episodic chest pain for 1 year was admitted in march 2010 . he was diagnosed at a local hospital with viral myocarditis , acute hepatitis , and pneumonia . a 61 - year - old male civil servant was admitted in july 2009 for a fever and rash lasting 4 months . he began experiencing afternoon fever accompanied by chills , fatigue , sleep hyperhidrosis , and weight loss . he had undergone bioprosthetic aortic valve replacement due to chronic fever and congenital bicuspid aortic malformation 2 years prior in a local hospital . however , his fever relapsed 10 months after the operation , and five routine blood cultures were all negative . a 55 - year - old veterinarian with chronic exposure to livestock ( including cattle , sheep , and swine ) was admitted in february 2015 due to fever , low appetite and weight loss for 6 months . on admission , he was also diagnosed with rheumatic heart disease . a 58 - year - old man admitted in march 2014 due to recurring fever lasting over four years . in 2010 he underwent anti - tuberculosis treatment . over the next few years , vegetations were found , and he was placed on various antibiotics . he underwent aortic and mitral valvuloplasty , however , 8 months after the operation his recurring fever continued , and perivalvular leaks was found . four patients had congestive heart failure , ranging from class i to iii , according to the new york heart association classification . the vegetation was seen on the aortic leaflet while in one patient the vegetation was seen on the papillary muscle of the mitral valve . for all patients , the vegetation was also accompanied by some degree of insufficiency and regurgitation . all patients presented with fever and two patients had a high - grade fever . all patients repeatedly had negative blood cultures , on average 4.4 times per person . elevated liver enzymes , leukocytosis , leukopenia , anemia , and an increased erythrocyte sedimentation rate were observed as well . one patient ( case 3 ) had impaired t - cell function with weight loss , hepatosplenomegaly , acropachy , and rash . to confirm the diagnosis of q fever endocarditisall patients responded well except for patient 4 who continued to exhibit symptoms and high levels of phase i and ii antibodies . the patient experienced decompensated heart failure and later experienced periprosthetic valvular regurgitation and partial dehiscence [ figure 2a ] . histological examination of the bioprosthetic valve revealed fibrosis , inflammatory cell infiltration , and myxomatous degeneration . histological staining , including hematoxylin and eosin staining , gram staining , periodic acid - schiff staining , grocott 's methenamine silver staining and acid - fast staining , all returned negative . two weeks after receiving mechanical valvuloplasty , his titer of phase i antibody dropped from 1:3200 to 1:800 and the titer of phase ii antibody from 1:1600 to 1:200 [ figure 2b ] . ( a ) transthoracic echocardiogram showing a severe perivalvular regurgitation of the bioprosthetic aortic valve ( arrow ) . ( b ) serial serologic testing of immunoglobulin g against coxiella burnetii showed consistently high levels of phase i and ii antibodies prior to the valvuloplasty . the phase i antibody drop dramatically from 1:3200 to 1:800 and the phase ii from 1:1600 to 1:200 two weeks after the aortic bioprosthesis replacement . a follow - up examination was performed every 36 months ; each time a routine blood test , liver and kidney function test , echocardiogram and serological test were administered . four hundred and ninety cases had causative microorganisms identified through blood culturing or through tissue culturing . the remaining 147 ( 23.1 % ) cases were bcne on unknown cause , of which 11 patients ( 7.5 % of bcne cases ) were suspected of q fever and underwent q fever serological analysis by ifaa . the remaining 136 patients were unsuspected of q fever and did not undergo relevant testing . to understand the reasoning behind the low q fever endocarditis diagnostic rate , we examined the clinical characteristics of the bcne patients . it was found that among the 136 unsuspected patients , many possess risks warranting q fever suspicion and thus serological testing . fifty percent of the patients suspected of q fever had two or more risk factors , and this percentage was nearly identical ( 54 % , n = 74 ) in the unsuspected patients . the most and second most common risk factors were valvulopathy and fever without leukocytosis , respectively , in both groups . apart from perivalvular leakage , both groups had a comparable proportion of each q fever risk factor . furthermore , all patients suspected of q fever endocarditis were either admitted to or were consulted by the infectious diseases division while only 63 % of the unsuspected patients had consulted the infectious diseases division ( p = 0.03 ) . none of the unsuspected patients had undergone c. burnetii serological testing [ table 3 ] . clinical characteristics of blood culture negative endocarditis patients based on suspicion of q fever ( from 2006 to 2012 ) of the 637 cases of ie , six cases of q fever endocarditis were found . all identified q fever endocarditis patients were han chinese males and their ages ranged from 22 to 61 years old . demographic and clinical data of the six patients were summarized in tables 1 and 2 . clinical findings and relative incidence of finding in q fever endocarditispatients * some patient data unavailable ; exact percentages not calculated . ast : aspartate transaminase ; alt : alanine transaminsase ; alp : alkaline phosphatase ; ldh : lactate dehydrogenase ; esr : erythrocyte sedimentation rate ; tbil : total bilirubin ; n / a : not available . cases of q fever endocarditis reported in pumch from 2006 to 2016 * reported to be stable upon discharge , further details unknown . nyha : new york heart association ; smz tmp : sulfamethoxazole trimethoprim ; hcq : hydroxycholoroquine ; pumch : peking union medical college hospital ; n / a : not available . a 41 - year - old male cattle and sheep herdsman presenting with fever and jaundice was admitted in march 2008 . he occasionally consumed moderate amounts of alcohol ( approximately 100 ml of liquor daily ) over the past 15 years . his hepatitis screening , for the hepatitis b , c , and d virus antibodies , returned negative . a 22 - year - old male college student with intermittent cough , fever , and episodic chest pain for 1 year was admitted in march 2010 . he was diagnosed at a local hospital with viral myocarditis , acute hepatitis , and pneumonia . a 61 - year - old male civil servant was admitted in july 2009 for a fever and rash lasting 4 months . he began experiencing afternoon fever accompanied by chills , fatigue , sleep hyperhidrosis , and weight loss . he had undergone bioprosthetic aortic valve replacement due to chronic fever and congenital bicuspid aortic malformation 2 years prior in a local hospital . however , his fever relapsed 10 months after the operation , and five routine blood cultures were all negative . a 55 - year - old veterinarian with chronic exposure to livestock ( including cattle , sheep , and swine ) was admitted in february 2015 due to fever , low appetite and weight loss for 6 months . on admission , he was also diagnosed with rheumatic heart disease . a 58 - year - old man admitted in march 2014 due to recurring fever lasting over four years . in 2010 he underwent anti - tuberculosis treatment . over the next few years , vegetations were found , and he was placed on various antibiotics . he underwent aortic and mitral valvuloplasty , however , 8 months after the operation his recurring fever continued , and perivalvular leaks was found . four patients had congestive heart failure , ranging from class i to iii , according to the new york heart association classification . the vegetation was seen on the aortic leaflet while in one patient the vegetation was seen on the papillary muscle of the mitral valve . for all patients , all patients presented with fever and two patients had a high - grade fever . all patients repeatedly had negative blood cultures , on average 4.4 times per person . elevated liver enzymes , leukocytosis , leukopenia , anemia , and an increased erythrocyte sedimentation rate were observed as well . one patient ( case 3 ) had impaired t - cell function with weight loss , hepatosplenomegaly , acropachy , and rash . to confirm the diagnosis of q fever endocarditis , all six patients received serological testing for c. burnetii antigens by ifaa . all patients responded well except for patient 4 who continued to exhibit symptoms and high levels of phase i and ii antibodies . the patient experienced decompensated heart failure and later experienced periprosthetic valvular regurgitation and partial dehiscence [ figure 2a ] . histological examination of the bioprosthetic valve revealed fibrosis , inflammatory cell infiltration , and myxomatous degeneration . histological staining , including hematoxylin and eosin staining , gram staining , periodic acid - schiff staining , grocott 's methenamine silver staining and acid - fast staining , all returned negative . two weeks after receiving mechanical valvuloplasty , his titer of phase i antibody dropped from 1:3200 to 1:800 and the titer of phase ii antibody from 1:1600 to 1:200 [ figure 2b ] . ( a ) transthoracic echocardiogram showing a severe perivalvular regurgitation of the bioprosthetic aortic valve ( arrow ) . ( b ) serial serologic testing of immunoglobulin g against coxiella burnetii showed consistently high levels of phase i and ii antibodies prior to the valvuloplasty . the phase i antibody drop dramatically from 1:3200 to 1:800 and the phase ii from 1:1600 to 1:200 two weeks after the aortic bioprosthesis replacement . a follow - up examination was performed every 36 months ; each time a routine blood test , liver and kidney function test , echocardiogram and serological test were administered . four hundred and ninety cases had causative microorganisms identified through blood culturing or through tissue culturing . the remaining 147 ( 23.1 % ) cases were bcne on unknown cause , of which 11 patients ( 7.5 % of bcne cases ) were suspected of q fever and underwent q fever serological analysis by ifaa . the remaining 136 patients were unsuspected of q fever and did not undergo relevant testing . to understand the reasoning behind the low q fever endocarditis diagnostic rate , we examined the clinical characteristics of the bcne patients . it was found that among the 136 unsuspected patients , many possess risks warranting q fever suspicion and thus serological testing . fifty percent of the patients suspected of q fever had two or more risk factors , and this percentage was nearly identical ( 54 % , n = 74 ) in the unsuspected patients . the most and second most common risk factors were valvulopathy and fever without leukocytosis , respectively , in both groups . apart from perivalvular leakage , both groups had a comparable proportion of each q fever risk factorfurthermore , all patients suspected of q fever endocarditis were either admitted to or were consulted by the infectious diseases division while only 63 % of the unsuspected patients had consulted the infectious diseases division ( p = 0.03 ) . none of the unsuspected patients had undergone c. burnetii serological testing [ table 3 ] . to the best of our knowledge , our study reported the most cases of q fever endocarditis in the mainland of china . the patients had a high incidence of fever , abnormal liver function as exhibited by elevated liver enzymes , the telltale sign of valvular defects , and routine blood cultures were negative in all the patients . vegetative growth seen by echocardiography was observed in all patients despite being present in only about 12 % of chronic q fever patients . in this study , along with his persistently elevated phase i igg levels , the patient experienced deterioration in cardiac function and worsening of valve regurgitation . intriguingly , not only did his symptoms improve rapidly , but his phase i and ii igg levels fell dramatically after bioprosthesis replacement , suggesting that high levels of igg may be associated with c. burnetii residing in the bioprosthesis . compared to tetracycline and rifampin - cotrimoxazole or its combination , doxycycline plus hydroxychloroquine is an optimal therapeutic regimen with a lower relapse rate . in this study , three patients responded well to minocycline , doxycycline or doxycycline - cotrimoxazole therapy and had no symptoms at the 30 - month follow - up . it is suggested that follow - up should be conducted every month for the 1 year , then every 3 months for 18 months to 4 years , and a lifelong treatment of doxycycline may be appropriate . however , whether the serial serological testing can be used as a prognostic index is still controversial . in a report from spain , igg phase i antibody levels were monitored in patients with q fever endocarditis to see the association between the igg titers and prognosis . after three years of follow - up , the reduction of igg phase i antibody was rare and not related with cure or relapse . the first confirmed case of q - fever in china was reported in 1950 . however , very few cases of q fever endocarditis from the mainland of china have been reported in the literature . since the 1980s , there were approximately 28,000 cases of ie in the mainland of china , and only four other cases of q fever endocarditis were reported . thus far , estimating the incidence of q fever endocarditis in the mainland of china can not be accurately made , but it is clear that the number of confirmed cases is very low . despitethe few reported q fever endocarditis cases in the literature , reports have shown that q fever may be fairly common . among the 34 chinese provinces and municipalities ,24 have reported cases of q fever and outbreaks have also been reported in the inner mongolia , sichuan , xinjiang , yunnan , and tibet provinces . in these regions of china , a serological screening of over 3000 livestock found that the seroprevalence of q fever was 24.9 % in cattle and 13.5 % in sheep . based on a seroepidemiological survey , the positive rate of q fever serology ranges from 1.6 % to 28.7 % in healthy people living in the southwestern chinese provinces of guizhou , sichuan , yunnan , and tibet . the high positive rate of q fever serology and the low number of q fever endocarditis cases suggest that q fever endocarditis may be an underreported and under - identified disease in china . a few factors may attribute to the low diagnostic rate of q fever endocarditis among physicians at our facility and even throughout china . first , in our review of bcne patients , the presence of q fever risk factors was similar across unsuspected and suspected patient groups , suggesting special attention should be paid to bcne patients as a whole . fournier et al . reported that among 740 patients with bcne , 37 % had c. burnetti as the causative agent . in clinical guidelines , serological analysis for c. burnetti has been recommended in patients with ie , especially in patients with bcne . this study showed that when q fever endocarditis was suspected among bcne patients , the diagnostic rate through serological analysis was 55 % , comparable to that , 48 % , reported in the literature . however , in the present study , the serological testing for c. burnetii is performed in very few patients with bcne . of note , all bcne cases that underwent serological testing were consulted by physicians in the infectious diseases division . thus , guideline adherence and awareness may not be as stringent among physicians in divisions other than infectious diseases . this suggests that awareness of q fever endocarditis presentation , risk factors , and general guidelines is critical in the approach to bcne patients . second , notifiable or reportable disease surveillance is crucial for infectious disease prevention and control . in countries such as the united states , and australia , q fever infection is a notifiable disease with each country 's center for disease control or equivalent . in the people 's republic of china , according to the chinese infectious diseases prevention act ( 2013 update ) , there are 39 notifiable diseases and q fever is not among the list . in addition , for instance , only one clinical facility , the academy of military medical sciences , in northern china , covering a population of approximately 160 million , can conduct serological testing for c. burnetti . third , empirical antibiotic therapy may have also contributed to the low diagnostic rate of q fever . of the 147 cases with bcne of unknown cause , empirical therapy consists mainly of gentamicin or vancomycin to target the common etiologies of ie , thus , often rendering the diagnostic culturing and sampling inconclusive . if there lack systematic testing protocols for uncommon pathogens , proper diagnosis of q fever can easily be overlooked . due to the limited cases of q fever endocarditis found and few bcne patients undergoing q fever serological testinghowever , with the available data , we compared the risk factors to the literature including the ie guidelines released by the united states center for diseases control . we found that many patients had clinical indications where a q fever serological test was recommended but failed to receive one . in conclusion , this study found a low diagnostic rate of q fever among bcne patients . according to serological surveying and screening , the array of presentations and non - specific symptoms across patients remain the key challenge in diagnosing the disease . we noted limitations , specific to the mainland of china , hindering the identification , and management of this disease , among which we believe physician awareness of the risk factors and adherence to clinical guidelines play crucial roles . this work was supported by grants from the national natural science foundation of china ( no .81470426 ) , the scientific research foundation for the returned overseas chinese scholars , state education ministry ( srf for rocs , and sem ) , elite class , and pumch young and middle - aged investigation fund , key project ( no . this work was supported by grants from the national natural science foundation of china ( no .81470426 ) , the scientific research foundation for the returned overseas chinese scholars , state education ministry ( srf for rocs , and sem ) , elite class , and pumch young and middle - aged investigation fund , key project ( no .\noutput:\n" }, { "from": "agent", "value": "background : q fever endocarditis , a chronic illness caused by coxiella burnetii , can be fatal if misdiagnosed or left untreated . despite a relatively high positive rate of q fever serology in healthy individuals in the mainland of china , very few cases of q fever endocarditis have been reported . this study summarized cases of q fever endocarditis among blood culture negative endocarditis ( bcne ) patients and discussed factors attributing to the low diagnostic rate.methods : we identified confirmed cases of q fever endocarditis among 637 consecutive patients with infective endocarditis ( ie ) in the peking union medical college hospital between 2006 and 2016 . the clinical findings for each confirmed case were recorded . bcne patients were also examined and each bcne patient 's q fever risk factors were identified . the risk factors and presence of q fever serologic testing between bcne patients suspected and unsuspected of q fever were compared using the chi - squared or chi - squared with yates correction for continuity.results : among the ie patients examined , there were 147 bcne patients , of whom only 11 patients ( 7.5 % ) were suspected of q fever and undergone serological testing for c. burnetii . six out of 11 suspected cases were diagnosed as q fever endocarditis . for the remaining136 bcne patients , none of them was suspected of q fever nor underwent relevant testing . risk factors for q fever endocarditis were comparable between suspected and unsuspected patients , with the most common risk factors being valvulopathy in both groups . however , significantly more patients had consulted the infectious diseases division and undergone comprehensive diagnostic tests in the suspected group than the unsuspected group ( 100 % vs. 63 % , p = 0.03 ) . conclusions : q fever endocarditis is a serious yet treatable condition . lacking awareness of the disease may prevent bcne patients from being identified , despite having q fever risk factors . increasing awareness and guideline adherence are crucial in avoiding misdiagnosing and missed diagnosing of the disease ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: addictions are chronic relapsing health conditions associated with many negative consequences at individual and population levels . these include , but are not limited to , higher morbidity and mortality rates for the addicted person , health and financial damages for family or community members , and increased economic and social costs for society as a whole ( effertz & mann , 2013 ; mcginnis & foege , 1999 ; single , robson , xie , & rehm , 1998 ) . addictions are among the most prevalent mental disorders , especially when behavioral addictions are considered ( sussman , lisha , & griffiths , 2011 ) . although conceptualization , criteria , and categories of behavioral addictions have been vigorously debated , there is emerging consensus that they are similar to substance - related addiction problems insofar as they generate short - term rewards that promote behavioral persistence , despite knowledge of adverse consequences ( demetrovics & griffiths , 2012 ; grant , potenza , weinstein , & gorelick , 2010 ; karim & chaudhri , 2012 ; mudry et al . , 2011 ) . these range from behaviors that are now widely viewed as legitimate addictions [ e.g. , gambling and online gaming addiction ( hellman , schoenmakers , nordstrom , & van holst , 2013 ; wong & hodgins , 2014 ) ] through controversial behaviors [ e.g. , television , sex , and pornography addictions ( clarkson & kopaczewski , 2013 ; garcia & thibaut , 2010 ; sussman & moran , 2013 ) ] , to highly speculative addictions [ e.g. , love , tanning , or shoplifting addiction ( kourosh , harrington , & adinoff , 2010 ; shulman , 2003 ; sussman , 2010 ) ] . from a clinical perspective , loss of control over these behaviors can lead to neglect of role obligations and health - protective behaviors as well as interpersonal conflict and / or direct physical harm . the phenomenon of reduced self - control despite negative consequences is one of the key characteristics uniting this broader conception , making it plausible to view these different activities as behavioral ( or process ) addictions ( mudry et al . , 2011 ) . clinicians have noted that addictions frequently co - occur in the same individual and that there might be a systematic progression from having difficulties with one excessive behavior to struggling with another ( gossop , 2001 ; haylett , stephenson , & lefever , 2004 ) . moreover , compared with people experiencing only a single problematic addictive behavior , individuals with co - occurring addictions are at increased risk for negative outcomes including victimization , poorer physical health status , or even suicide ( rush , urbanoski , bassani , castel , & wild , 2010 ) . furthermore , when addictions co - occur , they can interact with each other , complicating both accurate assessment and effective treatment ; for instance , one excessive behavior might mask another addiction or addictions may alternate with each other ( freimuth et al . , 2008 ) . despite these considerations , addiction treatment providers and programs often do not explore comorbidity issues ( especially comorbid substance - related and behavioral addictions ) and as a result do not provide integrated interventions despite their clear advantage over services offered in parallel or successively ( rush et al . , 2010 ) . moreover , although high rates of co - occurring addictions have been discussed in the empirical literature , most of this work emphasizes co - occurring problems with substances and often excludes behavioral addictions . only a small body of research has addressed co - occurring substance - related and behavioral addictions . using a variable - centered ( i.e. , factor - analytic ) approach , stephenson , maggi , lefever , and morojele ( 1995 ) examined co - occurrences among 16 excessive behaviors in a clinical sample . the authors identified a nurturance factor ( e.g. , excessive eating , shopping , exercise , work , or caffeine use ) and a hedonism factor ( e.g. , use of alcohol , nicotine , recreational drugs , or gambling and excessive sexual behavior ) . ( 2004 ) attempted to replicate these findings using the same set of addictive behaviors and reported four groupings : a self - regarding nurturance ( e.g. , excessive eating , shopping , or caffeine use ) , an other - regarding nurturance ( e.g. , excessive work and compulsive helping ) , a sensation - seeking hedonism ( e.g. , use of recreational drugs , prescription drugs , and nicotine ) , and a dominance - related hedonism ( 2005 ) investigated another set of behaviors / disorders in a clinical sample and identified three groups characterized by reward deficiency ( e.g. , trichotillomania , pathological gambling , and hypersexual disorder ) , impulsivity ( e.g. , compulsive shopping , kleptomania , and excessive eating ) , andothers identified only two groups in a non - clinical sample of youth when analyzing the co - occurrence of 11 excessive behaviors : a generally non - addicted and a work hard , play hard group ( e.g. , excessive sexual behavior , exercise , or internet use ) ( sussman et al . , 2014 ) . extant research in this area is limited because of the use of small and / or age - specific samples ( sussman et al . , 2014 ; villella et al . , 2011 ; willoughby , chalmers , & busseri , 2004 ) , restricted coverage of substance - related and behavioral addiction problems ( freimuth et al . , 2008 ; sussman et al . ,2011 ) , and variable - centered ( i.e. , factor - analytic ) as opposed to person - centered ( e.g. , cluster analytic ) approaches . to address these limitations , the first aim of this study was to describe the prevalence of single versus multiple addiction problems using a large , representative sample and a broad range of behaviors and substances . in doing so , we adopted a lay epidemiology approach to co - occurring addictive behaviors ( konkol thege et al . , 2015 ) . lay epidemiology proposes that fields of symptomatology , nosology , aetiology , and epidemiology have identifiable counterparts in the thoughts and activities of people outside the formal medical communityfrom this perspective , systematic investigations of inferences made by the lay public about health conditions can provide important insights into how they construe risks and how to craft intervention strategies ( lawlor , frankel , shaw , ebrahim , & smith , 2003 ) . the second aim of this study was to identify distinct subgroups of people experiencing one or more substance - related and behavioral addiction problems and to explore whether and how members of separate addiction clusters differ in relation to sociodemographic characteristics and psychological well - being . first , an online survey of 4,000 alberta ( canada ) adult members ( 18 + years of age ) of an established research panel ( ipsos canadian online panel ) were recruited . target quotas , based on 2006 canadian census data , were set for age , gender and region , and a random , representative sample of panel members were sent invitations to take part in the survey . to widen the repertoire of methodology used , and balancing the possible bias resulted from online data collection ( granello & wheaton , 2004 ) , a computerized assisted telephone survey of an additional population - based sample of 2,000 alberta adults was also conducted in 2010 . further details of the survey methodology have been described elsewhere ( konkol thege et al . , 2015 ) . to address our first research aim , the combined online and telephone survey dataset ( n = 6,000 ) was used . both original data bases were independently weighted to ensure that regional , age , and gender composition reflected that of the actual alberta population aged 18 years or older according to 2006 census data . although sociodemographic characteristics ( with the exception of sex and income ) and the occurrence of problem behaviors ( with the exception of excessive shopping and work ) differed across the two data sets , the effect sizes of these differences fell in the negligible range ; the only exception was excessive sexual behavior where cramer s v ( 0.11 ) was just above the border of negligible and small effect size . a more detailed analysis of survey mode differences in these samples has been reported elsewhere ( konkol thege et al . , 2015 ) . to address our second research aim , we created an analytic subsample consisting of respondents who reported one or more addiction problems in the past year . the total sample ( n = 6,000 ) and the subsample used for clustering ( n = 2,728 ; 45.5 % ) differed across almost all sociodemographic characteristics ; however , the effect sizes of the differences fell again in the negligible or small range ( table 1 ) . furthermore , in the analytic sub - subsample , 1,850 individuals ( 67.8 % of the subsample ) were recruited as part of the online survey and 878 individuals ( 32.2 % of the subsample ) were participants of the telephone survey , which considering the original sample sizes of the telephone ( n = 2,000 , 33.3 % ) and online ( n = 4,000 , 66.6 % ) samples also indicates that the telephone and online samples were generally comparable in terms of addiction prevalence . sociodemographic characteristics of the total sample and the analytic subsample used for the cluster analysis are summarized in table 1 . sociodemographic characteristics of the samples the survey included items assessing participants sex , age , educational level , marital status , employment , and income ( table 1 describes response options for each of these sociodemographic items ) . in some of the analyses , sociodemographic variables were recoded into fewer categories to improve clarity ( table 3 ) . the survey also included questions regarding four substances ( alcohol , tobacco , marijuana , and cocaine use ) and six behaviors ( problematic gambling , eating , shopping , sexual behavior , video gaming , and work ) which were presented in random order for each respondent , regardless of survey mode . consistent with our emphasis on lay epidemiology , that is , views of the public about addiction problems rather than expert - derived signs and symptoms ( konkol thege et al . , 2015 ) , a definition was provided for each problem behavior ( table 2 ) , which was intended to broadly define self - attributed problems for the substances and behaviors without using the term addiction to avoid respondent reactivity . to assessthe occurrence of the excessive behaviors included , a single question ( thinking back over your life , have you ever personally had a problem with [ problem behavior ] ? ) was used with three available response categories ( no ; yes , but not in the past 12 months ; and yes , in the past 12 months ) . since , in this study we focused on the co - occurrence of past - year behaviors only , the first two response options were collapsed . definition of the problem behaviors provided to respondents sociodemographic characteristics in relation to number of self - reported addiction problems in the previous year ( n = 6,000 ) to assess general well - being of the respondents , the eight - item personal wellbeing index ( international wellbeing group , 2006 ) was administered . the scale contains eight areas of satisfaction , each rated on an 11 - point scale ( 0 = completely dissatisfied , 5 = neutral , 10 = completely satisfied ) : standard of living , health , achieving in life , relationships , safety , community - connectedness , future security , and spirituality . internal consistency of the scale was very good in the present sample ( cronbach s = 0.88 ) . statistical analyses were executed using spss 23.0 ( spss , chicago , il , usa ) . chi - square tests were employed to compare respondents reporting no , one , two , and three or more past - year problem behaviors across categorical sociodemographic variables ( e.g. , sex and marital status ) using cramer s v to quantify effect size . ordinal and non - normally distributed continuous sociodemographic characteristics ( e.g. , age and income ) and well - being scores of the groups were compared using the non - parametric kruskala multinomial logistic regression analysis was also run to model associations between sociodemographic variables and well - being scores and cluster membership . hierarchical cluster analysis using ward s method with squared euclidean distance as the distancing metric was employed to explore the patterns of co - occurring addictions . input for this analysis were the 10 variables indicating the past - year presence vs. absence of each of the problem behaviors investigated . number of clusters to retain was based on the approach of seeking for the largest change in agglomeration schedule coefficients [ cf . stopping rules ( clatworthy , buick , hankins , weinman , & horne , 2005 ) ] . cluster members were also compared across sociodemographic and well - being characteristics using the chi - square and kruskal wallis tests . first , an online survey of 4,000 alberta ( canada ) adult members ( 18 + years of age ) of an established research panel ( ipsos canadian online panel ) were recruited . target quotas , based on 2006 canadian census data , were set for age , gender and region , and a random , representative sample of panel members were sent invitations to take part in the survey . to widen the repertoire of methodology used , and balancing the possible bias resulted from online data collection ( granello & wheaton , 2004 ) , a computerized assisted telephone survey of an additional population - based sample of 2,000 alberta adults was also conducted in 2010 . further details of the survey methodology have been described elsewhere ( konkol thege et al . , 2015 ) . to address our first research aim , the combined online and telephone survey dataset ( n = 6,000 ) was used . both original data bases were independently weighted to ensure that regional , age , and gender composition reflected that of the actual alberta population aged 18 years or older according to 2006 census data . although sociodemographic characteristics ( with the exception of sex and income ) and the occurrence of problem behaviors ( with the exception of excessive shopping and work ) differed across the two data sets , the effect sizes of these differences fell in the negligible range ; the only exception was excessive sexual behavior where cramer s v ( 0.11 ) was just above the border of negligible and small effect size . a more detailed analysis of survey mode differences in these samples has been reported elsewhere ( konkol thege et al . , 2015 ) . to address our second research aim , we created an analytic subsample consisting of respondents who reported one or more addiction problems in the past year . the total sample ( n = 6,000 ) and the subsample used for clustering ( n = 2,728 ; 45.5 % ) differed across almost all sociodemographic characteristics ; however , the effect sizes of the differences fell again in the negligible or small range ( table 1 ) . furthermore , in the analytic sub - subsample , 1,850 individuals ( 67.8 % of the subsample ) were recruited as part of the online survey and 878 individuals ( 32.2 % of the subsample ) were participants of the telephone survey , which considering the original sample sizes of the telephone ( n = 2,000 , 33.3 % ) and online ( n = 4,000 , 66.6 % ) samples also indicates that the telephone and online samples were generally comparable in terms of addiction prevalence . sociodemographic characteristics of the total sample and the analytic subsample used for the cluster analysis are summarized in table 1 . the survey included items assessing participants sex , age , educational level , marital status , employment , and income ( table 1 describes response options for each of these sociodemographic items ) . in some of the analyses , sociodemographic variables were recoded into fewer categories to improve clarity ( table 3 ) . the survey also included questions regarding four substances ( alcohol , tobacco , marijuana , and cocaine use ) and six behaviors ( problematic gambling , eating , shopping , sexual behavior , video gaming , and work ) which were presented in random order for each respondent , regardless of survey mode . consistent with our emphasis on lay epidemiology , that is , views of the public about addiction problems rather than expert - derived signs and symptoms ( konkol thege et al . , 2015 ) , a definition was provided for each problem behavior ( table 2 ) , which was intended to broadly define self - attributed problems for the substances and behaviors without using the term addiction to avoid respondent reactivity . to assessthe occurrence of the excessive behaviors included , a single question ( thinking back over your life , have you ever personally had a problem with [ problem behavior ] ? ) was used with three available response categories ( no ; yes , but not in the past 12 months ; and yes , in the past 12 months ) . since , in this study we focused on the co - occurrence of past - year behaviors only , the first two response options were collapsed . definition of the problem behaviors provided to respondents sociodemographic characteristics in relation to number of self - reported addiction problems in the previous year ( n = 6,000 ) to assess general well - being of the respondents , the eight - item personal wellbeing index ( international wellbeing group , 2006 ) was administered . the scale contains eight areas of satisfaction , each rated on an 11 - point scale ( 0 = completely dissatisfied , 5 = neutral , 10 = completely satisfied ) : standard of living , health , achieving in life , relationships , safety , community - connectedness , future security , and spirituality . internal consistency of the scale was very good in the present sample ( cronbach s = 0.88 ) . statistical analyses were executed using spss 23.0 ( spss , chicago , il , usa ) . chi - square tests were employed to compare respondents reporting no , one , two , and three or more past - year problem behaviors across categorical sociodemographic variables ( e.g. , sex and marital status ) using cramer s v to quantify effect size . ordinal and non - normally distributed continuous sociodemographic characteristics ( e.g. , age and income ) and well - being scores of the groups were compared using the non - parametric kruskala multinomial logistic regression analysis was also run to model associations between sociodemographic variables and well - being scores and cluster membership . hierarchical cluster analysis using ward s method with squared euclidean distance as the distancing metric was employed to explore the patterns of co - occurring addictions . input for this analysis were the 10 variables indicating the past - year presence vs. absence of each of the problem behaviors investigated . number of clusters to retain was based on the approach of seeking for the largest change in agglomeration schedule coefficients [ cf . stopping rules ( clatworthy , buick , hankins , weinman , & horne , 2005 ) ] . cluster members were also compared across sociodemographic and well - being characteristics using the chi - square and kruskal wallis tests . more than half ( 50.8 % ) of the participants in the total sample of 6,000 respondents reported experiencing a problem with one or more of the substances and behaviors examined in the 12 months preceding the study ( prevalence rates for the individual addictive behaviors in this sample have been described elsewhere , see konkol thege et al . , 2015 ) . about one - third ( 29.8 % ) reported a problem with only one substance or behavior in the past year , while 13.1 % reported two problems , and 7.9 % reported problems with three or more substances and behaviors in the year before the study . members of these groups differed significantly across all sociodemographic characteristics as well as well - being scores ( table 3 ) . when entering the sociodemographic variables and well - being into a multinomial logistic regression model predicting whether respondents reported one , two , or three or more problems ( reference group = respondents reporting no addiction problems in the past year ) , age and well - being were the only consistently significant predictors ( each associated with decreased probability of excessive behaviors ) ; sex , educational attainment , and marital status were associated with group membership only occasionally , while income and employment status did not seem to have a role in distinguishing between the groups of individuals with no , one , two , and three or more addiction problems ( table 4 ) . results of the multinomial logistic regression investigating correlates of reporting no versus one , two , or three or more addiction problems ( odds ratios with 95 % confidence intervals ) * p .05 , * * p .01 , * * * p .001 . the results of the cluster analysis suggested a seven - cluster solution . as shown in table 5 , the first cluster ( 26.0 % of the sample used when conducting the clustering ) represented individuals with smoking as their shared problem behavior . the second cluster ( 21.8 % ) consisted of participants reporting excessive eating as their only problem behavior . the third cluster ( 16.2 % ) represented individuals with work problems , while the fourth cluster ( 13.0 % ) consisted of participants characterized by a large number of different addiction problems without a clearly dominant behavior . the fifth cluster ( 9.5 % ) represented mainly individuals reporting excessive sexual behavior , while the sixth ( 8.9 % ) and seventh ( 4.7 % ) clusters consisted of participants with shopping and video gaming as their shared behavioral problem , respectively . highest average number of past - year addictive behaviors was observed among excessive video game players ( cluster vii ) , while the lowest was found among excessive eaters ( cluster ii ) . detailed information on the addiction characteristics of each cluster are described in table 5 . prevalence ( % ) of each problem behavior in the addiction clusters ( n = 2,728 ) note . alc : problematic alcohol use , tob : tobacco use problems , mar : problems with marijuana use , coc : problematic cocaine use , gamble : gambling problems , shop : excessive shopping , video : problematic video gaming , eat : problematic eating , sex : excessive sexual behavior , and work : excessive work . cluster membership was significantly associated with sex : the proportion of males was 34.9 % , 27.7 % , 40.6 % , 47.7 % , 64.1 % , 20.6 % , and 44.1 % in the seven clusters , respectively . all of the ordinal level ( educational attainment ) or non - normally distributed continuous sociodemographic variables ( age and income ) were also associated with cluster membership . finally , cluster members significantly differed in terms of well - being as well : members of the excessive buyer , smoker , sex addict , and polyaddict clusters showed clearly ( indicated by non - overlapping confidence intervals ) lower well - being scores than workaholics and excessive eaters ( figure 1 ) . sociodemographic characteristics in relation to cluster membership ( n = 2,728 ) details on the measurement of income can be found in table 1 . means and 95 % confidence intervals of the personal wellbeing index in the seven clustersmore than half ( 50.8 % ) of the participants in the total sample of 6,000 respondents reported experiencing a problem with one or more of the substances and behaviors examined in the 12 months preceding the study ( prevalence rates for the individual addictive behaviors in this sample have been described elsewhere , see konkol thege et al . , 2015 ) . about one - third ( 29.8 % ) reported a problem with only one substance or behavior in the past year , while 13.1 % reported two problems , and 7.9 % reported problems with three or more substances and behaviors in the year before the study . members of these groups differed significantly across all sociodemographic characteristics as well as well - being scores ( table 3 ) . when entering the sociodemographic variables and well - being into a multinomial logistic regression model predicting whether respondents reported one , two , or three or more problems ( reference group = respondents reporting no addiction problems in the past year ) , age and well - being were the only consistently significant predictors ( each associated with decreased probability of excessive behaviors ) ; sex , educational attainment , and marital status were associated with group membership only occasionally , while income and employment status did not seem to have a role in distinguishing between the groups of individuals with no , one , two , and three or more addiction problems ( table 4 ) . results of the multinomial logistic regression investigating correlates of reporting no versus one , two , or three or more addiction problems ( odds ratios with 95 % confidence intervals ) * p .05 , * * p .01 , * * * p .001 . as shown in table 5 , the first cluster ( 26.0 % of the sample used when conducting the clustering ) represented individuals with smoking as their shared problem behavior . the second cluster ( 21.8 % ) consisted of participants reporting excessive eating as their only problem behavior . the third cluster ( 16.2 % ) represented individuals with work problems , while the fourth cluster ( 13.0 % ) consisted of participants characterized by a large number of different addiction problems without a clearly dominant behavior . the fifth cluster ( 9.5 % ) represented mainly individuals reporting excessive sexual behavior , while the sixth ( 8.9 % ) and seventh ( 4.7 % ) clusters consisted of participants with shopping and video gaming as their shared behavioral problem , respectively . highest average number of past - year addictive behaviors was observed among excessive video game players ( cluster vii ) , while the lowest was found among excessive eaters ( cluster ii ) . detailed information on the addiction characteristics of each cluster are described in table 5 . prevalence ( % ) of each problem behavior in the addiction clusters ( n = 2,728 ) note . alc : problematic alcohol use , tob : tobacco use problems , mar : problems with marijuana use , coc : problematic cocaine use , gamble : gambling problems , shop : excessive shopping , video : problematic video gaming , eat : problematic eating , sex : excessive sexual behavior , and work : excessive work . cluster membership was significantly associated with sex : the proportion of males was 34.9 % , 27.7 % , 40.6 % , 47.7 % , 64.1 % , 20.6 % , and 44.1 % in the seven clusters , respectively . all of the ordinal level ( educational attainment ) or non - normally distributed continuous sociodemographic variables ( age and income ) were also associated with cluster membership . finally , cluster members significantly differed in terms of well - being as well : members of the excessive buyer , smoker , sex addict , and polyaddict clusters showed clearly ( indicated by non - overlapping confidence intervals ) lower well - being scores than workaholics and excessive eaters ( figure 1 ) . sociodemographic characteristics in relation to cluster membership ( n = 2,728 ) details on the measurement of income can be found in table 1 . integrated treatment for multiple addictive disorders is important because failure to identify and treat comorbid addiction problems is associated with poorer outcomes ( substance abuse and mental health services administration , 2009 ) . unfortunately , treatment providers are most prone to recognize disorders that fit the focus of their training , which rarely includes behavioral addictions ( freimuth et al . , 2008 ) . therefore , the aim of the present study was to provide further information on how a relatively large number of substance and behavioral addictions co - occur to help inform treatment providers and service planners about typical combinations of addictions . our findings regarding the overall prevalence of addictive problems were consistent with us data indicating that about half of the adult population struggles with at least one excessive behavior in a given year ( sussman et al . , 2011 ) . results of the present study also demonstrated that about 30 percent of the adult population had difficulties with one addictive behavior , while an additional 21 % reported problems with two or more behaviors and / or substances . while many argue that the frequent co - occurrence of some forms of addiction suggests the presence of an underlying non - addiction specific proneness responsible for dependence ( shaffer et al . , 2004 ) , the present data showing that almost 60 % of those reporting addictive problems have difficulties only with one behavior does not provide a clear support for this syndrome model of addictions . however , it is also possible that many individuals reporting only one excessive behavior in the past year have had or will have problems in other areas but successively instead of simultaneously ( cf . in addition , our data revealed that the patterning of the excessive behaviors studied fitted best with a seven - cluster solution , which is greater than the number of groups or dimensions ( 24 ) typically reported in previous studies ( haylett et al . , 2004 ; lochner et al . , 2005 ; maclaren & best , 2010 ; stephenson et al . , 1995worthy of note , however , that direct comparison of the results across the investigations is problematic because of the large variability in study methodology including the number and type of addictions examined and the statistical methods employed ( factor analysis , cluster analysis , latent class analysis , and correlations among scales measuring addictions ) . one strength of this study is the use of two independent , relatively large canadian samples representative of the adult alberta population across sex , age group , and region . a further strength is the simultaneous assessment of a relatively large number of both substance - related and behavioral addictions , providing the opportunity of taking a broader look at the whole addiction field . on the other hand , there were several limitations of the present research that deserve to be highlighted . first , response rates were relatively low in both survey modes , which weakens the generalizability of our findings ( konkol thege et al . , 2015 ) . in addition , although the single question method for assessing problematic addictive behaviors is often employed in epidemiological surveys ( bowling , 2005 ; cook , 1987 ) , the reliability of single - item scales is generally weaker than that of multi - item scales . also , although previous research indicated that self - identification through a single question for an excessive behavior is a reliable and clinically meaningful tool in identifying persons with addictive disorders , these studies concentrated on substance addictions , pathological gambling , and video gaming ( cook , 1987 ; king , delfabbro , & griffiths , 2013 ; widyanto , griffiths , & brunsden , 2011 ) . the generalizability of the methodological appropriateness of this assessment method to all behavioral addictions is , therefore , questionable . our aim was to provide a brief behavioral description of each behavior that emphasized impairment and to avoid the use of terms such as addiction to minimize respondent reactivity . how exactly participants interpreted these items was not examined in this study , and it is possible that impairment was defined broadly in some instances . for example , problematic eating as defined for the respondents , can incorporate not only excessive eating of food addicts but also the restrictive behavioral patterns of anorexics , which despite its destructive nature is not classified as an addiction in the current nosological systems . despite these limitations , this study calls our attention to the considerable large number of individuals experiencing several addictive disorders simultaneously who thus need special consideration and the use of integrated treatment approaches when receiving mental health services . we hope that this work will assist in the accurate assessment and treatment of patients presenting addiction symptoms , encouraging professionals to consider the possibility of likely co - occurring substance and behavioral addictions above those emphasized initially by their clients . bkt conducted the literature searches and provided summaries of previous research studies , conducted the statistical analysis , and wrote the first draft of the manuscript . all authors had full access to all data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis .\noutput:\n" }, { "from": "agent", "value": "background and aimsthe aims of this study were ( a ) to describe the prevalence of single versus multiple addiction problems in a large representative sample and ( b ) to identify distinct subgroups of people experiencing substance - related and behavioral addiction problems.methodsa random sample of 6,000 respondents from alberta , canada , completed survey items assessing self - attributed problems experienced in the past year with four substances ( alcohol , tobacco , marijuana , and cocaine ) and six behaviors ( gambling , eating , shopping , sex , video gaming , and work ) . hierarchical cluster analyses were used to classify patterns of co - occurring addiction problems on an analytic subsample of 2,728 respondents ( 1,696 women and 1032 men ; mage = 45.1 years , sdage = 13.5 years ) who reported problems with one or more of the addictive behaviors in the previous year.resultsin the total sample , 49.2 % of the respondents reported zero , 29.8 % reported one , 13.1 % reported two , and 7.9 % reported three or more addiction problems in the previous year . cluster - analytic results suggested a 7 - group solution . members of most clusters were characterized by multiple addiction problems ; the average number of past year addictive behaviors in cluster members ranged between 1 ( cluster ii : excessive eating only ) and 2.5 ( cluster vii : excessive video game playing with the frequent co - occurrence of smoking , excessive eating and work ) . discussion and conclusionsour findings replicate previous results indicating that about half of the adult population struggles with at least one excessive behavior in a given year ; however , our analyses revealed a higher number of co - occurring addiction clusters than typically found in previous studies ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: although surgery is curative for localized disease , up to 30 % of patients with rcc present with metastatic disease at the time of diagnosis , and more than 25 % of patients with locally advanced rcc develop distant metastasis despite curative resection . since rcc is highly resistant to chemotherapy , high dose interleukin - 2 or interferon - alfa therapy is widely used as a first - line treatment of metastatic disease , but they provide only a modest response rate of less than 20 % . thus , the outcome of metastatic rcc is quietly depressing : the 5 - year overall survival rate is less than 10 % . effective systemic therapy for rcc is mandatory . in conventional rcc , the loss of von hippel - lindau protein function leads to overexpression of vascular endothelial growth factor ( vegf ) and platelet - derived growth factor that promote tumor angiogenesis . sunitinib is an orally active multi - targeted tyrosine kinase inhibitor that specifically inhibits vegf receptor ( vegfr ) , platelet - derived growth factor receptor ( pdgfr ) , fms - like tyrosine kinase - 3 ( flt - 3 ) , and stem c - kit protein ( c - kit ) . the efficacy on metastatic rcc has been confirmed in both phase ii and iii trials , where it was shown to improve the median progression - free survival ( pfs ) , yield a higher response rate ( rr ) , and afford a better quality of life over interferon - alfa [ 9 - 11 ] . based on current data , sunitinib is now the preferred drug for first - line treatment of metastatic rcc . although the nature of these variations and associated molecular basis is not demonstrated , it is reasonable to evaluate the efficacy of sunitinib on metastatic rcc in those of different ethnic backgrounds . therefore , we perfomed this retrospective study to assess the efficacy and safety of sunitinib in korean patients with metastatic rcc using an institutional treatment protocol . the medical records of patients treated with sunitinib for metastatic rcc were retrospectively reviewed between september 2007 and december 2009 . the inclusion criteria were as follows : histologically confirmed clear - cell rcc ; metastases measurable on computed tomography ( ct ) or magnetic resonance imaging ( mri ) ; a performance status of 0 - 2 based on eastern cooperative oncology group ( ecog ) criteria . patient demographics , prior therapy , best responses , and relevant toxicities were obtained from medical records , and survival data were collected by telephone interviews . risk factors associated with shorter survival were assessed according to the memorial sloan - kettering cancer center ( mskcc ) risk classification : a low serum hemoglobin level , an elevated corrected serum calcium level , an elevated serum lactate dehydrogenase level , a poor performance status , and an interval of less than 1 year between diagnosis and treatment . sunitinib was administered orally at a dose of 50 mg daily , consisting of 4 weeks of treatment followed by a 2 - week rest period in cycles of 6 weeks ( schedule 4 - 2 ) . dose reduction of sunitinib was allowed to 37.5 mg and then 25 mg daily depending on the type and severity of adverse events . treatment with sunitinib was continued until the occurrence of disease progression , unacceptable adverse events , or patient withdrawal . the primary end point of this study was the objective clinical response ( complete response , partial response , stable disease , or progressive disease ) , assessed by response evaluation criteria in solid tumors ( recist ) using regular physical examinations , ct / mri , and bone scans ( if bone metastases were present at baseline ) after each cycle for the first 4 cycles thereafter until the end of treatment . the secondary end points were progression free survival ( pfs ) and overall survival ( os ) rates . pfs was defined as the time from the start of treatment to the date of progressive disease or death . os was defined as the time from start of treatment to death or the date at which patients were last known to be alive . the adverse events secondary to treatment were evaluated at each visit according to the national cancer institute common terminology criteria for adverse events ( ctcae , version 3.0 ) . estimates of median pfs and os were calculated using the kaplan - meier method , and 95 % cis were considered statistically significant . the medical records of patients treated with sunitinib for metastatic rcc were retrospectively reviewed between september 2007 and december 2009 . the inclusion criteria were as follows : histologically confirmed clear - cell rcc ; metastases measurable on computed tomography ( ct ) or magnetic resonance imaging ( mri ) ; a performance status of 0 - 2 based on eastern cooperative oncology group ( ecog ) criteria . patient demographics , prior therapy , best responses , and relevant toxicities were obtained from medical records , and survival data were collected by telephone interviews . risk factors associated with shorter survival were assessed according to the memorial sloan - kettering cancer center ( mskcc ) risk classification : a low serum hemoglobin level , an elevated corrected serum calcium level , an elevated serum lactate dehydrogenase level , a poor performance status , and an interval of less than 1 year between diagnosis and treatment . sunitinib was administered orally at a dose of 50 mg daily , consisting of 4 weeks of treatment followed by a 2 - week rest period in cycles of 6 weeks ( schedule 4 - 2 ) . dose reduction of sunitinib was allowed to 37.5 mg and then 25 mg daily depending on the type and severity of adverse events . treatment with sunitinib was continued until the occurrence of disease progression , unacceptable adverse events , or patient withdrawal . the primary end point of this study was the objective clinical response ( complete response , partial response , stable disease , or progressive disease ) , assessed by response evaluation criteria in solid tumors ( recist ) using regular physical examinations , ct / mri , and bone scans ( if bone metastases were present at baseline ) after each cycle for the first 4 cycles thereafter until the end of treatment . the secondary end points were progression free survival ( pfs ) and overall survival ( os ) rates . pfs was defined as the time from the start of treatment to the date of progressive disease or death . os was defined as the time from start of treatment to death or the date at which patients were last known to be alive . the adverse events secondary to treatment were evaluated at each visit according to the national cancer institute common terminology criteria for adverse events ( ctcae , version 3.0 ) . estimates of median pfs and os were calculated using the kaplan - meier method , and 95 % cis were considered statistically significant . between july 2007 and march 2010 , all twenty - one patients who had metastatic rcc with a clear - cell component were included in the analysis ( table 1 , 2 ) . there were 17 males ( 81 % ) and 4 females ( 19 % ) , and the median age was 63.9 ( range , 46 - 75 years ) . of those patients , 4 patients ( 19.0 % ) had low - risk disease , 10 patients ( 47.6 % ) had intermediate - risk disease , and 7 patients ( 33.3 % ) had high - risk disease according to the mskcc criteria . the previous treatments were as follows : previous nephrectomy in 13 patients ( 61.9 % ) , cytokine therapy in 7 patients ( 33.3 % ) , and radiation therapy in 3 patients ( 14.3 % ) . the most prevalent sites of metastases were as follows : the lung in 15 patients ( 71.4 % ) , lymph nodes in 9 patients ( 42.9 % ) , bone in 7 patients ( 33.3 % ) , and liver in 3 patients ( 14.3 % ) . after a median of 17.4 months ( range , 5.7 - 33.1 months ) of treatment , 14 patients ( 66.7 % ) remained alive with the disease , and treatment was ongoing in 11 patients ( 52.4 % ) . reasons for discontinuing treatment were progressive disease in 2 patients and adverse events in 1 patient . according to assessment with the recist criteria , 11 patients ( 52.4 % ) had an objective response rate , with a complete response in 1 patient ( 4.8 % ) , and a partial response in 10 patients ( 47.6 % ) as the best tumor response rate ( table 3 ) . the median pfs was 13.4 months ( 95 % confidence interval [ ci ] , range , 12.3 - 14.5 months ) ( fig .1 ) , and the median os was 28.1 months ( 95 % ci , 21.8 - 34.4 months ) ( fig . all patients experienced adverse events of some sort : fatigue , diarrhea , and hand - foot syndrome were the most common adverse effects . however , the treatment protocol under study was well tolerated and most patients experienced reversible grade 1 or 2 toxicities ( table 4 ) . the most commonly observed severe adverse events were hand - foot syndrome , fatigue , and generalized edema ; hand - foot syndrome was observed in 4 patients ( 19.0 % ) , fatigue was observed in 3 patients ( 14.3 % ) , and generalized edema was observed in 3 patients ( 14.3 % ) as grade 3 or 4 . the most common laboratory abnormalities of grade 3 or 4 were neutropenia , thrombocytopenia , and anemia , with neutropenia in 6 patients ( 28.6 % ) , thrombocytopenia in 6 patients ( 28.6 % ) , and anemia in 4 patients ( 19.0 % ) . neutropenia was observed in 6 patients ( 28.6 % ) , but there was no occurrence of associated fever or sepsis . thrombocytopenia was observed in 6 patients ( 28.6 % ) , but there was no clinical significance such as bleeding tendencies . 1 patient ( 4.8 % ) experienced hypothyroidism and needed thyroid hormone replacement . a total of 6 patients ( 29 % ) required dose reduction from 50 mg / day to 37.5 mg / day with further reductions to 25 mg / day due to grade 3 or 4 adverse events , and 1 patient ( 4.8 % ) discontinued treatment due to severe adverse events . the remaining 14 patients ( 66.7 % ) tolerated and continued treatment with a standard dose of sunitinib . between july 2007 and march 2010 , all twenty - one patients who had metastatic rcc with a clear - cell component were included in the analysis ( table 1 , 2 ) . there were 17 males ( 81 % ) and 4 females ( 19 % ) , and the median age was 63.9 ( range , 46 - 75 years ) . of those patients , 4 patients ( 19.0 % ) had low - risk disease , 10 patients ( 47.6 % ) had intermediate - risk disease , and 7 patients ( 33.3 % ) had high - risk disease according to the mskcc criteria . the previous treatments were as follows : previous nephrectomy in 13 patients ( 61.9 % ) , cytokine therapy in 7 patients ( 33.3 % ) , and radiation therapy in 3 patients ( 14.3 % ) . the most prevalent sites of metastases were as follows : the lung in 15 patients ( 71.4 % ) , lymph nodes in 9 patients ( 42.9 % ) , bone in 7 patients ( 33.3 % ) , and liver in 3 patients ( 14.3 % ) . after a median of 17.4 months ( range , 5.7 - 33.1 months ) of treatment , 14 patients ( 66.7 % ) remained alive with the disease , and treatment was ongoing in 11 patients ( 52.4 % ) . reasons for discontinuing treatment were progressive disease in 2 patients and adverse events in 1 patient . according to assessment with the recist criteria , 11 patients ( 52.4 % ) had an objective response rate , with a complete response in 1 patient ( 4.8 % ) , and a partial response in 10 patients ( 47.6 % ) as the best tumor response rate ( table 3 ) . the median pfs was 13.4 months ( 95 % confidence interval [ ci ] , range , 12.3 - 14.5 months ) ( fig .1 ) , and the median os was 28.1 months ( 95 % ci , 21.8 - 34.4 months ) ( fig . all patients experienced adverse events of some sort : fatigue , diarrhea , and hand - foot syndrome were the most common adverse effects . however , the treatment protocol under study was well tolerated and most patients experienced reversible grade 1 or 2 toxicities ( table 4 ) . the most commonly observed severe adverse events were hand - foot syndrome , fatigue , and generalized edema ; hand - foot syndrome was observed in 4 patients ( 19.0 % ) , fatigue was observed in 3 patients ( 14.3 % ) , and generalized edema was observed in 3 patients ( 14.3 % ) as grade 3 or 4 . the most common laboratory abnormalities of grade 3 or 4 were neutropenia , thrombocytopenia , and anemia , with neutropenia in 6 patients ( 28.6 % ) , thrombocytopenia in 6 patients ( 28.6 % ) , and anemia in 4 patients ( 19.0 % ) . neutropenia was observed in 6 patients ( 28.6 % ) , but there was no occurrence of associated fever or sepsis . thrombocytopenia was observed in 6 patients ( 28.6 % ) , but there was no clinical significance such as bleeding tendenciesa total of 6 patients ( 29 % ) required dose reduction from 50 mg / day to 37.5 mg / day with further reductions to 25 mg / day due to grade 3 or 4 adverse events , and 1 patient ( 4.8 % ) discontinued treatment due to severe adverse events . the remaining 14 patients ( 66.7 % ) tolerated and continued treatment with a standard dose of sunitinib . rcc is one of the most challenging malignancies with a dismal prognosis because of the modest response to conventional cytotoxic chemotherapeutic agents and limited sensitivity to radiation therapy . cytokine therapy with interferon - alfa or il - 2 have been the main treatment options for metastatic disease , but these agents have limited efficacy and are associated with considerable toxic effects . recent advances in understanding the molecular biology of rcc have led to the development of several systemic therapeutic agents targeting the vegf and mammalian target of rapamycin ( mtor ) pathways as first and second line treatments for metastatic disease , with impressive improvements in oncologic outcome . sunitinib is one of several agents , including sorafenib , bevacizumab , and temsirolimus , which target the inhibition of pro - angiogenic growth factor activity and have shown favorable results in clinical trials against metastatic clear - cell rcc [ 15 - 17 ] . recent studies have confirmed the efficacy of sunitinib as a first line treatment for metastatic clear - cell rcc , but these series were mainly performed in different ethnicities in western countries . thus , the potential ethnic differences in the efficacy and safety of sunitinib have not been established . this study evaluated whether korean patients with metastatic rcc had comparable oncologic outcomes and safety as patients in previous randomized studies . in patients with a poor prognosis according to the mskcc criteria , temsirolimus is recommended as a first - line treatment , with sunitinib as a viable alternative , but temsirolimus is not available for korean patients because of problems related to the insurance system ; more patients with poor prognostic factors were included in this study . in terms of heconsidering the selection bias of randomized controlled trials which include relatively more favorable or intermediate risk group , the results of this study seem to reflect more reliable results in korean clinical practice . for the treatment outcome , sunitinib treatment showed an objective response rate of 39 % ( range , 34 - 44 % ) and a pfs of 11.0 months ( range , 10.7 - 13.4 months ) as well as an os of 26.4 months ( range , 23.0 - 32.9 months ) in previous phase iii randomized trials . in the current study , the objective response rate was 52.4 % , which included a complete response of 4.8 % , and a partial response of 47.6 % as the best response rates . the median pfs and os were 13.4 months and 28.1 months , respectively . even though it is difficult to directly compare this retrospective study with previous randomized trials , it is obvious that metastatic rcc patients benefitted from sunitinib treatment . all patients experienced treatment - related adverse events , the majority of which were grade 1 or 2 in severity . fatigue , diarrhea , and hand - foot syndrome were the most frequent adverse events , but grade 3 or 4 adverse events were not frequent and were manageable . most of patients were able to resume sunitinib treatment following dose reduction , and only 1 patient among all cases discontinued because of serious adverse events . previous trials have reported that side effects of sunitinib treatment were reversible and tolerable ; patients with grade 3 or 4 side effects did not exceed 10 % . nevertheless , routine monitoring such as evaluation of blood pressure / ejection fraction and a thyroid function test is recommended because there is possibility of serious adverse events . emerging safety data indicate that cardiotoxicity may be associated with sunitinib ; left ventricular dysfunction is the main cardiac side effect of sunitinib and might be partly a result of cardiomyocyte toxicity exacerbated by hypertension . therefore , blood pressure and left ventricular ejection fraction should be monitored , especially in patients with cardiac risk factors . it is reported that in patients treated with sunitinib , 85 % of patients had abnormal results on thyroid function tests , including elevation of thyroid stimulating hormone levels , decreased t3 levels , and less commonly , decreased t4 or free - thyroxine index levels . because an abnormal thyroid function test may rapidly progress from mild to profound , regular surveillance is warranted at baseline and every 2 - 3 months . in terms of adverse events , neutropenia , thrombocytopenia , and anemiawere the most frequent grade 3 or 4 laboratory abnormalities reported previously , and most of them were improved by dose reduction . neutropenia was observed in 6 patients ( 28.6 % ) , but there was no event of associated fever or sepsis ; thrombocytopenia was observed in 6 patients ( 28.6 % ) , but there was no clinical significance such as bleeding tendencies ; anemia increased amylase / lipase was observed in 7 patients ( 33.3 % ) , but there were no associated clinical manifestations of pancreatitis . compared to western trials , sunitinib treatment in korean patients achieved favorable oncological outcomes in terms of objective response rate , pfs , and os . it is interesting to note that the favorable outcomes of the current study are consistent with previous korean studies . although the underlying reason for such a discrepancy remains unclear at this time , one possible explanation is the inherent differences caused by ethnic backgrounds . further large prospective studies are required to clarify whether the ethnic background and its associated molecular mechanisms contribute to the difference in the efficacy of sunitinib across ethnic groups . in terms of adverse effects , a higher incidence of hand - foot syndrome and facial / generalized edema were observed relative to western trials , but they were mainly mild to moderate , and managed readily . this was a retrospective analysis of a small number of patients treated at a single institution , which allows for potential selection bias . furthermore , survival benefit may not be weighted properly because this was not a randomized controlled trial . sunitinib was efficacious and was well tolerated in korean patients ; the objective response rate , pfs , and os in korean patients were compatible with the oncologic outcomes in previous randomized trials . further large prospective investigations are required to clarify such favorable efficacy profiles in korean patients . sunitinib was efficacious in the treatment of metastatic clear - cell rcc , and was well tolerated in korean patients . the objective response rate , pfs , and os in korean patients were compatible with the benefits shown in previous randomized trials . although sunitinib treatment - related adverse events such as hand - foot syndrome and facial / generalized edema were observed in higher incidence than in western trials , they were mainly mild to moderate , and readily managed .\noutput:\n" }, { "from": "agent", "value": "purposewe assessed the efficacy and safety of the tyrosine kinase inhibitor sunitinib in korean patients with metastatic renal cell carcinoma ( mrcc ) . materials and methodsbetween september 2007 and december 2009 , all twenty - one patients who had mrcc with a clear - cell component were retrospectively reviewed . sunitinib was administered orally at a dose of 50 mg daily until disease progression or intolerance to treatment occurred . the primary end point of this study was the objective tumor response assessed by response evaluation criteria in solid tumors ( recist ) , and the secondary end points were progression - free survival ( pfs ) and overall survival ( os ) rates as well as assessment of adverse effects.resultsafter a median of 17.4 months ( range , 5.7 - 33.1 months ) of treatment , 11 patients ( 52.4 % ) had an objective response with a complete response in 1 patient ( 4.8 % ) , and a partial response in 10 patients ( 47.6 % ) as the best tumor response . the median pfs was 13.4 months ( 95 % confidence interval [ ci ] , range , 12.3 - 14.5 months ) , and the median os was 28.1 months ( 95 % ci , 21.8 - 34.4 months ) . all patients experienced adverse events of some sort , but the studied treatment protocol was well tolerated and most patients experienced reversible grade 1 or 2 toxicities.conclusionssunitinib was efficacious in the treatment of metastatic clear - cell rcc , and was well tolerated in korean patients . although sunitinib treatment - related adverse events such as hand - foot syndrome and facial / generalized edema were observed with a higher incidence than in western trials , they were mainly mild to moderate , and readily managed ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: sleep spindles are transient waxing - waning events ( 1115 hz ) that represent one of the principal electroencephalographic ( eeg ) hallmarks of nonrapid eye movements ( nrem ) sleep . spindle oscillations arise from the interaction between gabaergic inhibitory neurons of the thalamic reticular nucleus and thalamocortical networks . albeit their functional roleis not clearly understood , many evidences suggest that sleep spindles may be involved in cortical development , sleep maintenance , and cognitive functions including memory consolidation and intellectual ability . two main types of sleep spindles have been identified : fast ( 1315 hz ) centroparietal spindles , with a source located in the precuneus , and slow ( 1113 hz ) frontal spindles , with a source in the medial frontal region . albeit both kinds of spindles involve the activity of thalamus and superior temporal gyri , slow spindles are also related to the activity of the superior frontal gyrus , while fast spindles generation involves the activity of medial frontal cortex , hippocampus , and sensory - motor regions . fast parietal spindles seem to be involved in thalamocortical coupling , promoting the interaction between the hippocampus and the neocortex needed for memory consolidation . the function of slow frontal spindles is not yet clear , albeit a role in corticocortical interactions has been proposed . it should however be mentioned that others have questioned that a different generation mechanism is involved in the 1113 hz eeg activity . according to this view , slower and faster sleep spindles frequencieshave been attributed to a unitary mechanism , namely , the duration of the hyperpolarization - rebound sequence in the thalamocortical neurons : long hyperpolarization yielding slower , short hyperpolarization faster eeg frequencies ( e.g. , ) . cortical areas on which slow spindles have been detected are related to those thalamic nuclei in which the relay cells display long hyperpolarization ( m. steriade , personal communication ; cit . in ) . several evidences show that normal and pathological aging are characterized by changes in spindle activity . in normal aging , a reduction of spindle density , amplitude , and duration has been observed . changes of spindle activity become progressively more evident as age increases and have been interpreted as an eeg index of the age - related modifications of sleep pattern and / or cognitive functioning . in particular , reduced fast sleep spindles seem to be related to memory decline in older subjects . as far as pathological brain aging is concerned , a decrease in spindle density and amplitudehas been recently observed in patients with parkinson 's disease ( pd ) who developed dementia , compared with nondemented pd patients and healthy older subjects ; moreover , the reduction of spindle amplitude in posterior regions was related to lower visuospatial abilities . notably , by separating fast and slow spindles , the authors found a selective decrease of fast spindles in demented pd patients , strongly linking fast spindles alterations and cognitive decline . alzheimer 's disease , the most common age - related neurodegenerative disorder , is characterized by several sleep alterations . given the suggested role of sleep spindles in memory consolidation , intellectual abilities , and sleep maintenance , the study of spindle activity in ad patients should be of great interest . nevertheless , only few have tried to examine in depth the ad - related sleep spindles alterations , showing in ad patients an exacerbation of the spindles changes found in the normal elderly population . only rauchs andcoworkers have assessed separately fast and slow spindles , reporting a selective decrease of fast sleep spindles in ad patients compared to normal elderly , and a positive correlation between fast spindle intensity ( duration amplitude ) and impaired immediate recall in an episodic memory task . however , in this study , the topography of fast and slow spindles was not considered : both kinds of spindles were detected only at central derivations . given the observations that fast and slow sleep spindles show different cortical topography and undergo a local mechanism of regulation , the assessment of fast and slow spindles in the cortical regions where they exhibit their maximal expression is essential . since spindle changes characterize also normal aging , another important question concerns when , in the development of ad , a clear difference emerges between age - related and disease - related spindle alterations , and if these are linked with illness severity . this issue can be assessed by studying sleep spindles in people affected by amnesic mild cognitive impairment ( mci ) , a preclinical stage of ad characterized by memory impairment not reaching the criteria for the diagnosis of dementia . several sleep alterations have been observed in mci patients . forwhat concern sleep spindles , westerberg and coworkers found a significant decrease of frontal ( but not parietal ) fast spindles in mci patients compared with normal elderly , but this result is limited by a very small sample size ( 5 mci patients ) . no studies have compared fast and slow spindles in ad versus mci patients . in summary , the present literature suggests an alteration of fast rather than slow spindle oscillations in ad / mci , but the possible local specificity of this phenomenon , as well as its progression with illness severity , remains unclear . moreover , while previous studies have assessed fast and slow spindle count , to the best of our knowledge , fast and slow spindle density ( number of spindles divided by nrem sleep duration ) have never been considered in ad / mci . this issue does not seem trivial due to the existence of polysomnographic differences ( i.e. , in the amount of nrem sleep ) between ad / mci and healthy controls . with the aim to overcome some limits of the present literature on spindle activity in ad / mci , we have assessed whole range , fast , and slow spindle density in ad , amnesic mci , and healthy elderly controls ( hc ) in the cortical regions of their maximal expression , established by the empirical observation of their topography . moreover , we have evaluated the possible relation between spindle density and cognitive impairment severity . in the present study , 15 ad patients ( 5 males and 10 females ) , 15 amnesic mci patients ( 6 males and 9 females ) , and 15 healthy elderly control subjects ( hc , 10 males and 5 females ) were recruited . patients were selected among the elderly persons referred to the neuropsychology unit of the gemelli catholic university hospital of rome . the study was approved by the local institutional ethics committee and was conducted in accordance with the declaration of helsinki . all participants underwent cognitive screening by means of the minimental state examination ( mmse ) . moreover , the state trait anxiety index ( stai - y1 and stai - y2 ) and the hamilton depression rating scale ( hdrs ) were administered in order to exclude major psychiatric illness . neuropsychological investigation for ad and mci patients included a structured clinical evaluation , brain neuroimaging ( mri or ct ) , and a neuropsychological test battery for the assessment of specific cognitive functions such as memory , attention , executive function , visuoconstruction abilities , and language . in particular , memory assessment included rey 's auditory verbal learning ( ravlt ) , involving immediate recall ( ravltir ) , delayed recall ( ravltdr ) , and delayed recognition ( ravltrec ) , delayed recall of the rey figure , delayed recall of a three - word list , and delayed recall of a story . the functional status was assessed by the activities of daily living / instrumental activities of daily living ( adl / iadl ) questionnaire . ad patients were included according to the national institute on aging - alzheimer 's association workgroups and dsm - iv criteria . people with amnesic mci were enrolled according to guidelines and clinical standards . common exclusion criteria for all participants were presence of neurological , psychiatric , or vascular disorders , obesity , and history of alcoholism or drug abuse . the final enrollment in the study was based on the evaluation of regular sleep - waking cycle and on the absence of self - rated sleep disorders . the presence of other sleep disorders was objectively evaluated by nocturnal sleep recordings . in case of sleep disorder and / or respiratory diseases and obstructive sleep apnea syndrome ( osas ) , sleep quality and diurnal sleepiness of all participants were assessed by the italian version of the pittsburg sleep quality index ( psqi , ) , the epworth sleepiness scale ( ess , ) , and the karolinska sleepiness scale ( kss , ) . eeg signals were acquired with a sampling frequency of 256 hz and bandpass filtered at 0.5340 hz . the 19 unipolar eeg derivations of the international 1020 system ( c3 , c4 , cz , f1 , f2 , f3 , f4 , f7 , f8 , fz , o1 , o2 , p3 , p4 , pz , t3 , t4 , t5 , and t6 ) were recorded from scalp electrodes with average mastoid references ( a1 and a2 ) , using ag / agcl electrodes . electrooculogram ( eog ) was recorded from electrodes placed about 1 cm from the medial and lateral canthi of the dominant eye . finally , a pulse oximeter was placed on the right index finger with the aim to exclude sleep respiratory disorders . age , years of education , and clinical characteristics ( mmse , hdrs , stai y - 1 , stai y - 2 , and psqi scores ) of ad , mci , and hc were compared by means of one - way analyses of variance ( anovas ) , and post hoc comparisons were carried out by means of unpaired two - tailed t - tests . sleep stages of the baseline ( bsl ) night were scored visually in 20 seconds epochs , according to standard criteria , excluding ocular and muscle artifacts . the following were considered as dependent variables : ( a ) stage 1 latency ; ( b ) stage 2 latency ; ( c ) total sleep time ( tst ) , defined as the sum of time spent in stage 1 , stage 2 , sws , and rem ; ( d ) percentage of each sleep stage ( time spent in a sleep stage / tst 100 ) ; ( e ) wakefulness after sleep onset ( waso ) , in minutes ; ( f ) number of awakenings ; ( g ) number of arousals ; ( h ) total bed time ( tbt ) ; and ( i ) sleep efficiency index ( sei = tst / tbt 100 ) . an awakening was scored whenever eeg / emg activation occurred lasting more than 10 s. arousals have been scored whenever emg activation affected the eeg recording for periods shorter than 10 s. the polysomnographic eeg measures were submitted to one - way anovas comparing ad , mci , and hc , and post hoc comparisons were carried out by means of unpaired two - tailed t - tests . spindle detection was performed by means of a customized algorithm in matlab . nrem epochs were bandpass - filtered between 11 and 15 hz ( 3 db at 10 and 16 hz ) using a chebyshev type ii filter . the detection of a spindle occurred when the mean signal amplitude of each channel exceeded an upper threshold set at 6 times the mean single channel amplitude . the local amplitude maximum above the upper threshold was considered as the peak amplitude of the single spindle . the points at which the amplitude fell below a lower threshold ( 2 times the mean amplitude of each channel ) occurring at least 0.25 s from the peak were considered as the beginning and the end of the spindle ( maximum duration : 1.5 s ) . slow , while those falling in the 1315 hz range were considered as fast . spindle density was calculated as the number of spindles divided by artifact - free nrem sleep minutes . the eeg channels in which the maximum mean sleep density was detected for fast and slow spindles were considered for the statistical analysis . specifically , the maximum mean fast spindle density was observed at pz , while the slow spindles showed two similar maximum mean density values at f3 and f4 . for these derivations , group differences in spindle density ( for the whole spindle range and separately for fast and slow spindles ) were assessed by means of one - way anovas comparing ad , mci , and hc , and post hoc comparisons were carried out by means of unpaired two - tailed t - tests . preliminary analyses have also considered sex as a between factor , without any significant main effect or interaction involving this factor . for this reason , it was collapsed in the subsequent analyses . finally , in case of significant difference in whole range , fast , or slow spindle density between groups on a specific cortical derivation , pearson 's correlation coefficient was computed between spindle density in that derivation and mmse scores , in order to assess the relationship between sleep spindles and cognitive impairment . results of the one - way anovas and relative post hoc t - tests performed on demographic and clinical characteristics of ad , mci , and hc are reported in table 1 . mmse scores were significantly different between the three groups : post hoc t - tests show significantly higher mmse scores in hc compared with ad and mci ; moreover , mmse scores were significantly higher in mci compared with ad . a significant difference has been observed also for stai y - 1 scores : post hoc t - tests show higher state anxiety in ad patients , compared with mci patients and hc . results of the one - way anovas and post hoc t - tests performed on psg measures are reported in table 2 . a significant difference has been found for sws , and post hoc t - tests show a higher percentage of sws in hc compared to ad . figure 1 depicts the whole range ( 1115 hz ) , fast ( 1315 hz ) , and slow ( 1113 hz ) spindle density topographical scalp maps in ad , mci , and hc . considering the whole spindle range , a parietal predominance of spindle density ( particularly in correspondence of the midline derivation ) can be observed in hc , followed by two density peaks in the left and right frontal areas . also , ad and mci patients show a midline parietal and two frontal peaks , but with a generalized reduction of spindle density , in particular in the parietal region . fast spindle density shows a clear maximum peak in the parietal region in correspondence with the midline in all of the 3 groups , albeit this peak progressively decreases in mci and ad patients . the 3 groups show a similar topographical distribution of slow sleep spindles , with two density peaks in correspondence with the left and right frontal areas . figure 2 illustrates the comparisons of spindle density ( whole range , fast , and slow ) of ad , mci , and hc in the cortical derivations where the maximum mean density values were observed ( pz for fast spindles ; f3 and f4 for slow spindles ) . the results of the one - way anovas show a significant difference in the whole range spindle density ( f2 ,42 = 3.67 , p = 0.03 ) and fast spindle density ( f2 ,42 = 4.11 , p = 0.02 ) at pz , without difference in slow spindle density ( f2 ,42 = 0.04 , p = 0.96 ) . post hoc t - tests show a significantly higher whole range spindle density in hc compared to ad ( t = 2.74 , p = 0.01 ) and mci ( t = 2.07 , p = 0.05 ) , without differences between ad and mci ( t = 0.30 , p = 0.77 ) , and a significantly higher fast spindle density in hc compared to ad ( t = 2.80 , p = 0.009 ) and mci ( t = 2.15 , p = 0.04 ) without differences between ad and mci ( t = 0.36 , p = 0.72 ) . no significant differences have been found on f3 ( whole range spindle density : f2 ,42 = 0.28 , p = 0.76 ; fast spindle density : f2 ,42 = 0.33 , p = 0.72 ; slow spindle density : f2 ,42 = 0.13 , p = 0.88 ) and f4 ( whole range spindle density : f2 ,42 = 0.22 , p = 0.80 ; fast spindle density : f2 ,42 = 0.15 , p = 0.86 ; slow spindle density : f2 ,42 = 0.17 , p = 0.84 ) . since significant between - group differences in whole range and fast spindle density have been observed at pz , correlations between spindle density and degree of cognitive impairment have been assessed only in this derivation . figure 3 depicts the scatterplots of the correlations between mmse scores and whole range spindle ( a ) and fast spindle density ( b ) on pz , showing that whole range and fast spindle density were positively correlated ( whole range spindle density : r = 0.33 , p = 0.03 ; fast spindle density : r = 0.33 , p = 0.03 ) with mmse scores . the present study assessed for the first time the presence of topographic differences in spindle activity in ad , mci , and healthy elderly controls . results revealed in ad and mci patients a reduction of the whole range spindle density over the midline parietal area compared to hc . this difference can be ascribed to a significant decrease of fast parietal spindle density , while no significant alteration in slow spindle density has been observed , not even in the cortical area where slow spindles exhibit their maximum density peak ( i.e. , the frontal region ) . furthermore , both whole range and fast parietal spindle density were positively correlated with mmse scores . our findings confirm that the classically described topographical distribution of fast and slow sleep spindles ( with parietal and frontal maxima , resp . ) a reduction of sleep spindles in ad patients has been previously found , but only two studies have assessed separately sleep spindles with different frequency ranges , finding a selective decrease of the number of fast spindles in ad and mci . our results strengthen these evidences , showing that ( 1 ) not only fast spindles count but also fast spindle density is reduced in ad / mci ; ( 2 ) this reduction occurs specifically in the cortical region in which fast spindles show their maximum density , that is , the midline parietal area , empirically assessed ; ( 3 ) parietal fast spindle density is positively correlated with cognitive status ; and ( 4 ) spindle density does not differ between ad and mci . in line with our results , latreille and coworkers have recently found a generalized reduction of fast spindle density in patients with pd who developed dementia , compared with nondemented pd patients and normal older subjects . altogether , these findings suggest the existence of a strong and selective relation between fast spindles alteration and cognitive decline in demented patients . moreover , the present results suggest that pathology - related spindles alterations may arise in an early stage of disease , since mci and ad patients show a similar spindle density decrease , compared with hc . several studies suggested a role of sleep spindles in memory consolidation , intellectual abilities , sleep maintenance , and synaptic plasticity . in particular , fast spindles seem to be involved in sleep - dependent procedural and declarative learning . a fast prefrontal spindle density decrease related to impaired episodic learning and hippocampal activity has been recently observed in older adults , compared with young subjects . in addition , rauchs and coworkers reported a relation between fast central spindle intensity and impaired immediate episodic recall in ad patients . in demented pd patients ( compared with nondemented pd patients and normal elderly ) , a relation between decreased spindle amplitude in posterior regions and lower visuospatial abilities has been observed . these studies refer to different conditions ( normal aging , ad , and demented pd ) and found several specific spindle alterations in relation to specific cognitive dysfunctions , with different topographical specificity . however , taken together , these findings suggest a relation between altered spindle ( mainly fast ) activity and impaired cognitive functioning ( and in particular memory processes ) in normal and pathological aging . in this view , alterations in spindle activity may be considered as a marker of cognitive deterioration , not representative of a specific neurodegenerative disease . the topography of such alterations may be relevant for the discrimination of different conditions characterized by neurodegenerative processes . to assess this hypothesis , future studies should compare the topography of spindle activity in different neurodegenerative diseases . for what concern ad / mci patients , our findings confirm the existence of a selective relation between fast spindle alterations and general cognitive impairment , and this relation is specific for the parietal ( rather than frontal ) cortical region . sleep spindles are generated by the gabaergic cells in the thalamic reticular nucleus : their repetitive spike - bursts induce rhythmic inhibitory postsynaptic potentials in the thalamocortical network ; the postinhibitory spike - burst activity of the glutamatergic neurons produces excitatory postsynaptic potentials at a cortical level . this mechanism seems to support long - term potentiation and , as a consequence , memory consolidation . thalamic alterations have been observed in ad and mci . it is possible that thalamic damage may account for the spindle density decrease and its relation with impaired cognitive functioning in ad / mci patients . moreover , rauchs and coworkers suggest that fast spindle alterations in ad patients may be explained by the relation existing between fast sleep spindles and hippocampal activity . in fact , fast spindles generation involves hippocampal activation and hippocampal - cortical connectivity . moreover , a close temporal association between sleep spindles and hippocampal ripples ( high - frequency oscillations ) has been observed in rodents and a recent human study have found that parahippocampal ripples were primarily coupled with parahippocampal and fast parietal spindles , and only secondarily with slow frontal spindles . this spindle - ripple association is considered as an important mechanism for the communication between hippocampus and neocortex , finalized to sleep - dependent memory consolidation . coherently , the age - related fast sleep spindles decrease predicts impaired next day episodic learning and hippocampal activation . the strong and early hippocampal damage in ad patients is well known , and hippocampal alterations have been observed also in mci patients . the selective decrease of fast sleep spindles and its relation with cognitive decline in ad / mci , then , may also be explained in relation to the hippocampal damage . future neuroimaging studies should directly assess this hypothesis relating eeg and mri measures in ad / mci . our results shed light on sleep spindle changes in ad and amnesic mci patients , showing a selective parietal fast spindle density decrease in these patients compared with hc , in relation to decreased cognitive functioning . these findings suggest that ad - related spindle density changes are specific for frequency ( regarding fast rather than slow spindles ) and location ( parietal rather than frontal ) , may have an early onset ( mci and ad patients show a similar spindle density decrease ) , and are related to the severity of cognitive impairment . recently , alteration in spindle activity has been suggested as a possible biomarker for ( 1 ) regional brain aging , ( 2 ) future neurodegeneration in rem sleep behavior disorder , and ( 3 ) cognitive decline in demented pd patients . our results are in line with the view of altered sleep spindle activity as a marker of cognitive deterioration . however , more types of evidence are needed to better understand the relation between regional changes in spindle characteristics , specific cognitive impairment , and neurological damage in ad / mci , in order to further characterize the difference between age - related and pathology - related alteration in sleep spindles .\noutput:\n" }, { "from": "agent", "value": "several studies have identified two types of sleep spindles : fast ( 1315 hz ) centroparietal and slow ( 1113 hz ) frontal spindles . alterations in spindle activity have been observed in alzheimer 's disease ( ad ) and mild cognitive impairment ( mci ) . only few studies have separately assessed fast and slow spindles in these patients showing a reduction of fast spindle count , but the possible local specificity of this phenomenon and its relation to cognitive decline severity are not clear . moreover , fast and slow spindle density have never been assessed in ad / mci . we have assessed fast and slow spindles in 15 ad patients , 15 amnesic mci patients , and 15 healthy elderly controls ( hc ) . participants underwent baseline polysomnographic recording ( 19 cortical derivations ) . spindles during nonrapid eye movements sleep were automatically detected , and spindle densities of the three groups were compared in the derivations where fast and slow spindles exhibited their maximum expression ( parietal and frontal , resp . ) . ad and mci patients showed a significant parietal fast spindle density decrease , positively correlated with minimental state examination scores . our results suggest that ad - related changes in spindle density are specific for frequency and location , are related to cognitive decline severity , and may have an early onset in the pathology development ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the normal prostate luminal cells , which are the histological origin of most prostate malignancies , are physically separated from the stroma by the basal cells and basement membrane ( bm ) . basal cells are joined by intercellular junctions and adhesion molecules , constituting a continuous sheet encircling luminal cells 1 - 2 . the bm is composed of type iv collagen , laminins , and other molecules , forming a continuous lining surrounding and attaching to the basal cell layer 3 - 4 . the epithelium is normally devoid of blood vessels and lymphatic ducts , and totally relies on the stroma for its metabolic and even survival needs . because of these structural relationships ( fig 1 ) , the disruption of both the basal cell layer and the bm is a pre - requisite for prostate tumor invasion or metastasis . it is a commonly held belief that human prostate carcinogenesis is a multistage process , progressing sequentially from normal to hyperplasia , to prostatic intraepithelial neoplasia ( pin ) , and to invasive or metastatic stages 5 - 8 . progression from pin to invasion is believed to be triggered by overproduction of proteolytic enzymes primarily by cancer cells , which cause degradation of the bm 9 - 10 . these theories are consistent with results of studies in tissue cultures and animal models , whereas are hard to interpret the following critical facts : our previous studies revealed that some healthy men between 19 and 29 years old had a spectrum of proliferative lesions , including hyperplasia , pin , and incipient adenocarcinoma 11 - 13 . recent studies detected a dna phenotype that is identical to that of invasive prostate cancer in somehealthy men , and in morphologically normal prostate tissues adjacent to prostate cancer 14 - 17 . a vast majority of pinexpress high levels of proteolytic enzymes , while only 10 - 30 % of untreated pin progress to invasive lesions during patients ' lifetime 18 - 21 . unfortunately , none of the current approaches could predict which pin lesions will progress 22 - 25 . the only established approach to monitor pin progression is repeat biopsy 22 - 25 , which is costly and painful . together , these facts argue that alternative pathways may exist , because if the linear model of tumor progression and invasion is universally applicable , the normal prostate tissues of healthy subjects should not harbor malignant structural abnormalities . since over 90 % of prostate cancerrelated mortality result from invasion - related illness , and the incidence of pin could be up to 16.5 % - 25 % in prostate biopsies 24 - 28 , there is an urgent need to uncover the intrinsic mechanism of tumor invasion . promoted by the fact that the basal cell layer is the sole source of tumor suppressor p63 and maspin 29 - 32 , and that degradation of basal cell layers is a pre - requisite for tumor invasion , our initial study examined the physical integrity of basal cell layers in 50 patients with co - existing pre - invasive and invasive prostate tumors . of 2,047 ducts and acini examined , 197 were found to harbor focal disruptions ( the absence of basal cells resulting in a gap greater than the combined size of at least 3 basal cells ) in their basal cell layers . the frequency of focal basal cell layer disruptions ( fbcld ) varied from none in 22 ( 44 % ) cases to over 1/3 of the ducts or acini with fbcld in 17 ( 34 % ) cases ( table 1 ) 33 . of the 17 cases with a high frequency of fbcld , the basal cell layer had several unique alterations that were not or rarely seen in their morphologically similar counterparts in other cases 33 - 44 : a. significantly reduced expression of tumor suppressor p63 : in sections double immunostained for p63 and ck34e12 , an average of 87 % of the basal cells in non - disrupted layers expressed both molecules , while only 59 % of the basal cells in focally disrupted layers had p63 expression ( fig 3 ; table 2 ) . b. significantly reduced expression of proliferating cell nuclear antigen ( pcna ) : in sections double immunostained for pcna and ck4e12 , an average of 74 % of the normal basal cells showed pcna expression , but only 51 % of basal cells in disrupted basal layers were pcna positive ( fig . 4 ; table 3 ) . c. significantly elevated apoptosis and degeneration : of 78 ducts and acini with fbcld examined , 59 ( 75.6 % ) harbored apoptotic basal cells , compared to 9 ( 11.5 % ) in 78 similar structures with intact basal layers . under high magnification , basal cells near fbcld often had cytological signs of degeneration , including nuclear swelling , shrinkage , fragmentation , or rod - like structures of fused basal cells ( fig . d. significantly elevated leukocyte infiltration : in sections double immunostained for ck 34e12 and leukocyte common antigen ( lca ) , most ducts and acini with fbcld showed leukocyte infiltration , but most ducts and acini with non - disrupted layers had no leukocyte infiltration ( table 4 ) . e. a total loss of the expression of all basal cell phenotypic markers : in addition to focal alterations , the entire basal cell layer in some ducts and acini showed degenerative changes . these basal cell layers were morphologically distinct , surrounding pin or normal - appearing duct or acinar clusters ( fig 7 ) . all the basal cells , however , lacked the expression of basal cell specific markers ( fig 8 ) . in contrast , tumor cells in pin and normal - appearing duct or acinar clusters had enlarged nuclei and nucleoli . in addition , these basal cell layers were devoid of expression of pcna , in contrast to normal basal cells and associated tumor cells , which were strongly positive for pcna ( fig . ducts or acini with altered basal cell layers had a significantly higher frequency of mast cell infiltration ( fig 9 ; table 5 ) . together , these findings suggest that the basal cell layers in these patients have significantly higher degenerative alterations . asthe basal cell layer is the sole source of several tumor suppressors 29 - 32 , degenerated basal cells are very likely to have impaired or reduced functions . in contrast to degenerative alterations in basal cells , luminal cells overlying fbcld showed several proliferative alterations that were not seen in their adjacent counterparts distant from the disruptions : a. significantly elevated cell proliferation : in sections double immunostained for basal cell phenotypic and proliferation - related markers , these clusters had a significantly higher proliferation index than their counterparts without fbcld , and most proliferating cells were located near fbcld ( fig. 10 ) . of 78 ducts and acini with fbcld examined , 47 had clusters of multiple proliferating cells , compared to 8 in 78 morphologically similar ducts or acini with non - disrupted basal cell layers ( table 5 ) . b. significantly higher expression of malignancy - and tumor invasion - related molecules : elevated expression of prostate specific antigen ( psa ) and alpha - methylacyl - coa racemase ( amacr ) , are consistently seen in cells overlying fbcld ( fig. 11 . a & b ) , and also in normal appearing ducts that lacked the expression of basal cell phenotypic markers ( fig . in contrast , adjacent cells within the same duct , and adjacent ducts with intact basal cell layers were largely negative ( fig 11 ) . c. physical continuity with , andmorphological resemblance to , invasive prostate cancer : a vast majority of these normal appearing clusters were adjacent to , or blended within , invasive cancers . in some cases , cells overlying fbcld had significantly enlarged nuclei and nucleoli , and were in physical continuity with , or morphologically similar to , their adjacent invasive counterparts ( fig 12 ) . in some cases , multiple epithelial cell nests appeared to be budding from the same acinus or duct ( fig. 13 ) . these budding cells had a higher proliferation and were similar to adjacent invasive cancer cells . the only difference was that budding cells had residual basal cells ( fig 13 , thin arrows ) . d. significantly elevated expression of tumor invasion - related genes : in studies of gene expression profiling , cell clusters overlying fbcld consistently showed significantly higher expression of cell proliferation , apoptosis , angiogenesis , immuno - response , and stem cell related genes ( fig 14 ; table 6 ) . the above alterations were consistently seen in all 17 cases with a high frequency of fbcld , while were only seen in 1 ( 9.1 % ) of the 11 cases with a low frequency of fbcld , and in none of the 22 cases with non - disrupted basal cell layers . together , these findings suggest that the physical and functional status of the basal cell layer significantly impact the biological presentation of associated epithelial cells . these findings also suggest that fbcld may represent a trigger factor for prostate tumor progression and invasion . to our best knowledge , the most likely reasons are : 1 the enzyme theory has dominated the direction of researches in the field , and the roles of basal cells have been ignored ; 2 these alterations could be seen only by double immunohistochemistry to simultaneously elucidate both basal cells and other markers . based on the above findings , we have proposed that these normal appearing duct or acinar clusters represent a population of maturation arrested tumor progenitors derived from monoclonal proliferation of genetically damaged primitive stem cells at early stages of the prostate morphogenesis probably by trauma , radiation , inflammation , or other factors . these clusters retain the potential for unlimited cell proliferation or multi - lineage differentiation , and could progress directly to invasive lesions through two different pathways : ( 1 ) clonal in situ transformation ( cist ) , and ( 2 ) multi - potential progenitor mediated budding ( mpmb ) . these pathways are likely to contribute to early onset of prostate cancer at young ages , and to biologically and clinically more aggressive prostate tumors . our hypothesized main steps are the followings : at the early stage of prostate morphogenesis , the prostate of these patients exposed to external or internal insults , such as radiation , carcinogens , localized trauma , inflammation , or other factors , which caused permanent damages in the dna structures of some primitive stem cells . localized dna structural damages caused the inactivation of , or defects , in basal cell renewal - related genes , which impaired the basal cell replenishment process to replace the aged or injured basal cells , resulting in a. localized dna structural damages also caused the inactivation of , or defects in , apoptosis - , or cell cycle control related genes in the luminal cell population , which allow these cells to escape from programmed death , to continuously proliferate , and to generate their own vascular structures . deregulated proliferation in epithelial cells and impaired self - renewal in basal cells resulted in the overstretch and disassociation of the basal cell layer and the bm , which lead to focal breakdown and degeneration of these two structures . the degradation products of degenerated basal cells and the diffusible molecules of the overlying luminal cells function as self - epitopes to attract migration and infiltration of immunoreactive cells ( irc ) or auto - antibodies into the affected sites . the direct physical contact between irc and degenerated basal cells results in the discharge of the digestive enzymes from irc , leading to the physical destruction of altered basal cell layers and the local basement membrane , resulting in a focal disruption in these structures . since the ep is normally devoid of both blood vessels and lymphatic ducts , and the basal cell layer is the sole source of several tumor suppressors , a fbcld in a given basal cell layer could lead to several focal alterations , including : a ) a loss or reduction of tumor suppressors and the paracrine inhibitory functions , which allow the luminal cells to undergo elevated proliferation 45 - 49 . b ) alterations in the permeability for oxygen or growth factors , which selectively triggers the exit of stem or progenitor cells from quiescence , and favor proliferation of cells overlying fbcld 50 - 52 . c ) the exposure of luminal cells to different cytokines , which facilitates vasculogenic mimicry and tumor angiogenesis 53 - 54 . d ) the physical contact between luminal and stromal cells augments the expression of stromal mmp , facilitating epithelial - mesenchymal transition ( emt ) and cell motility 55 - 57 . e ) the physical contact between luminal and immunoreactive cells directly cause genomic or cellular damages that trigger a cascade reaction of malignant transformation 58 - 63 . these alterations could individually or collectively trigger elevated proliferation in luminal cells near fbcld , which leads to the enlargement of fbcld and stretching - out of the residual basal cells . eventually , the entire basal cell layer becomes dissociated or degenerated ( as those shown in figs .7 - 13 ) , which facilitates progression of these clusters directly to invasive prostate lesions through two different mechanisms : a ) clonal in situ transformation ( cist ) , in which the entire luminal cell population of these clusters completely lose their surrounding structures and transform directly to a new microenvironment that favors cell motility and epithelial - mesenchymal transition . although these cells might not possess all the properties of invasive cancer cells , the changed microenvironment may act as a second hit to trigger a cascade reaction of malignant transformation that rapidly alters the genetic and biochemical profiles of these cells . b ) multi - potential progenitor mediated budding , in which a subset of cell clusters overlying fbcld retain the properties of primitive stem cells . thus , they are able to constantly produce new cells and their own vascular structures through budding ( as those shown in fig. 13 ) , representing the source for biologically and clinically more aggressive prostate tumors . the above events may occur and progress immediately after the external or internal insults , leading to development of prostate cancer at young ages . on the other hand , cells of these normal appearing duct or acinar clustersmay become maturation - arrested after a few cycles of cell divisions , and remain idle until a new insult 64 , representing bad seeds for bad crops at later ages . based on our own and other findings , we had proposed that prostate tumor invasion is triggered by localized degeneration of the basal cells and leukocyte infiltration induced auto - immunoreactions , which selectively favor monoclonal proliferation and invasion of progenitor or stem cells overlying fbcld 43 . our hypothesis differs from the traditional theories of tumor invasion in 5 aspects : ( 1 ) the stage of tumor invasion , ( 2 ) the cellular origin of invasive lesions , ( 3 ) the significance of immunoreactive cells , ( 4 ) the significance of stromal cells , and ( 5 ) the potential approaches for interventions and prevention of tumor invasion . our new hypothesis is the expansion of our previous one with the following new points of views : a. the preservation of large clusters of genetically damaged stem or progenitor cells : our previous hypothesis proposes that cell clusters overlying fbcld represent tumor stem or progenitor cells , which undergo a series of immunohistochemical and morphologic changes , and finally transform into invasive lesions 43 . our current hypothesis suggests that it is also possible that multiple genetically damaged primitive stem or progenitor cells within the same site may form large duct or acinar clusters that harbor the same genetic defects . these clusters may be formed immediately after external or internal insults during the early stage of morphogenesis , and progress rapidly , leading to early onset of prostate cancer at young ages . these clusters could also become maturation arrested at patients ' early ages , while they retain the potential for unlimited proliferation and multi - lineage differentiation , representing bad seeds for bad crops at later ages . b.direct transformation of the entire duct or acinar cluster into invasive lesions : our previous hypothesis proposes that invasive cells are derived exclusively or preferentially from monoclonal proliferation of stem or progenitor cells overlying fbcld 43 . our current hypothesis suggests that , in addition to monoclonal proliferation , it is possible that the entire duct or acinar cluster may directly transform into invasive lesions after the disappearance of all surrounding basal cells and the basement membrane . c. angiogenesis by genetically altered tumor stem cells : our previous hypothesis proposes that a subset of luminal cell clusters overlying fbcld are in direct physical continuity with vascular - or lymphatic duct - like structures , which allows them to progress directly to metastasis 43 . our current hypothesis further suggests that some normal appearing duct or acinar clusters may retain genetically damaged primitive stem cells that could manufacture their own blood vessels or lymphatic ducts , which directly lead to metastasis . scientifically , it could lead to a new direction to explore novel approaches for early detection , intervention , and prevention of prostate tumor invasion . for example , as non - disrupted basal cell layers have significant inhibitory functions on epithelial cell growth , the development of therapeutic agents to stimulate basal cell growth or regeneration may provide a more effective approach for treatment and prevention of prostate cancer invasion . clinically , it could potentially bring the following benefits : better recognition of these clusters may avoid misdiagnosis and facilitate early interventions , which may significantly improve prognosis . double immunohistochemical staining to assess the physical integrity of the basal cell layer , or an quantitative measurement of basal cell degeneration - related molecules in the blood or biopsies , may facilitate early identification of individuals at greater risk to develop invasive lesions . as genetic alterations not only define the scope and extent of , but also precede , both biochemical and morphological alterations , elucidation of the genetic profile of these normal appearing duct or acinar clusters may lead to the identification of the specific molecules that trigger the initiation of prostate carcinogenesis , progression , and invasion . our technical approaches of assessing the physical and functional status of the basal cells may be used as a more reliable alternative for repeat biopsy to monitor prostate tumor progression and invasion . more importantly , our hypothesis may be also applicable to progression and invasion of other epithelium derived tumors .\noutput:\n" }, { "from": "agent", "value": "it is a commonly held belief that prostate carcinogenesis is a multi - stage process and that tumor invasion is triggered by the overproduction of proteolytic enzymes . this belief is consistent with data from cell cultures and animal models , whereas is hard to interpret several critical facts , including the presence of cancer in healthy young men and cancer dna phenotype in morphologically normal prostate tissues . these facts argue that alternative pathways may exist for prostate tumor invasion in some cases . since degradation of the basal cell layer is the most distinct sign of invasion , our recent studies have attempted to identify pre - invasive lesions with focal basal cell layer alterations . our studies revealed that about 30 % of prostate cancer patients harbored normal appearing duct or acinar clusters with a high frequency of focal basal cell layer disruptions . these focally disrupted basal cell layers had significantly reduced cell proliferation and tumor suppressor expression , whereas significantly elevated degeneration , apoptosis , and infiltration of immunoreactive cells . in sharp contrast , associated epithelial cell had significantly elevated proliferation , expression of malignancy - signature markers , and physical continuity with invasive lesions . based on these and other findings , we have proposed that these normal appearing duct or acinar clusters are derived from monoclonal proliferation of genetically damaged stem cells and could progress directly to invasion through two pathways : 1 ) clonal in situ transformation ( cist ) and 2 ) multi - potential progenitor mediated budding ( mpmb ) . these pathways may contribute to early onset of prostate cancer at young ages , and to clinically more aggressive prostate tumors ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: over the last decade , historians have become increasingly concerned with the veterinary past . in a recent review , saurabh mishra went as far as to proclaim that veterinary history has come of age , successfully transcending the older narratives of progress , civilisation and great men that had hitherto impaired the field . consequently , it is no longer possible to take a teleological view of veterinarians as a profession in - waiting . more appreciation has emerged about the diverse groups that produced veterinary knowledge and practised animal healing ; and research has shed light on veterinarians involvement in both epizootics and zoonoses . most of the critical literature referred to in mishra s article addresses developments in france , the netherlands , the united kingdom and the united states , and research into the colonies is also a recent concern . yet , circumstances in germany , one of europe s largest nations , have so far attracted neither proper attention nor careful scrutiny . given the important roles that german veterinarians played in cattle plague control , meat hygiene and research into communicable diseases between animals and humans , such an investigation is long overdue . building on the new veterinary history , the present article shows that diverse traditions , interests and conceptualisations of animal health shaped the german profession , conditioned its field of operation , influenced its choice of animals and diseases , and dictated the speed of reforms . one major difference between german and british veterinary history is the involvement of the state . at the end of the eighteenth century , the profession in both countries witnessed the foundation of veterinary schools , shared an overwhelming concern with horses , experienced difficulties creating trust with farmers and looked up to medical practitioners . the prussian state set up a veterinrpolizei ( veterinary police ) alongside a medizinische polizei ( medical police ) , necessitating the appointment of suitably qualified practitioners to operate as veterinary officers in order to contain cattle plague . in the 1880s , the german profession built on this foundation by carving out a role in the inspection of meat in newly constructed abattoirs . by contrast , in britain , minor involvement in state work emerged following the cattle plague outbreaks of 18657 , but veterinary participation , in relation to meat or milk inspection , remainedsporadic well into the 1930s . crucial to this difference was the role of the state in creating veterinary officers whose dominance muffled concerns about competition with other animal healers and facilitated a push for attaining parity with physicians . when bacteriology made its breakthrough , german veterinarians did not feel threatened in the way that british veterinarians did because they had successfully capitalised on their expertise into epizootics to claim new competency in zoonoses . recent work on veterinary history has also underlined the extent to which veterinary and human medicine were not separate but overlapping spheres . in particular , abigail woods and michael bresalier have shown , in their work on the history ofone health , how medical practitioners took an interest in comparative anatomy , conducted experiments on animals , treated animal diseases and offered their expertise on cattle plague in the eighteenth century . towards the end of the nineteenth century , the rising importance of zoonotic diseases disrupted this partnership , but woods and bresalier stress that the establishment of barriers between human and animal health did not follow immediately or inevitably upon the profession sprior to the establishment of veterinary schools , physicians investigated cattle plague , taught and researched veterinary medicine in universities and treated animal diseases as part of their work . in the early nineteenth century , johann peter frank , a pioneer of social medicine and public health , refused to see any distinction between the two fields ofthe pathologist rudolf virchow , credited as one of the founders of one health , continued in a similar vein , seeing links between human and animal diseases . as in britain , clearer barriers were erected between the two disciplines as the century unfolded but human and animal diseases were difficult to keep apart . bydemonstrating why veterinary and medical spheres overlapped , drifted apart and came together again , the present article also sheds light on the intertwined relationship between animal and human health . for obvious reasons , this paper can only present a preliminary overview : it is limited to developments during the long nineteenth century , tells a story based mainly on the prussian experience and relies overwhelmingly on printed material . more in - depth studies eg . , focusing on a particular disease might exploit the untapped yet rich archival sources , some of which appear in this article . even so , subsequent research should benefit from the broad context into which german veterinary history is placed , and future investigation into histories of medicine , agriculture , food or animals in germany would benefit from taking into consideration the impact of veterinisation.at least three diverse sources can be detected at the birth of the modern veterinary profession . in his work on french veterinary history , ronald hubscher pointed to the hippological , medical and popular traditions , and this observation can be fruitfully applied to the german context too . first , stretching back to at least the thirteenth century , riding masters , equerries and farriers employed within the courts represented the hippological tradition . they wrote treatises that dealt with the breeding , shoeing and curing of horses in the possession of the aristocracy , whose involvement with the military meant , in turn , concern with warhorses . spreading from renaissance italy , a body of hippological knowledge written in german developed during the seventeenth century and remained robust well into the twentieth . second , a separate , medical tradition also emerged in response to cattle plague during the eighteenth century . concerned with the damage wrought on livestock , monarchs turned to physicians , whose advice formed the basis on which states issued instructions to contain the spread of animal diseases . finally , the least conspicuous , though arguably the most widespread , was the popular tradition . due to the absence of written records , its origins are difficult to trace , but a significant number of popular writings about animal health originate in the sixteenth century . much of the expertise contained within these works reflects the experience of lay animal healers , such as shepherds and herdsmen , who heavily influenced the treatment of livestock well into the nineteenth century . these three relatively distinct traditions laid claims on the bodies of various animals , responded to demand from a diverse clientele and came to cast different shadows over the activities of the modern veterinarian . traditional german veterinary histories have tended to draw a direct line between contagious animal diseases and the establishment of veterinary schools . the saxon parliament in dresden suggested the setting up of a school that would conduct more reliable investigation : you see it is not unknown to his majesty how much the cattle plague in these lands has , despite all measures taken against it , wrought havoc for thirty years or more and that it is impossible to put forward reliable measures of prevention and cure without knowing for sure either the cause or , more importantly , the effects on the body of cattle . you see it is not unknown to his majesty how much the cattle plague in these lands has , despite all measures taken against it , wrought havoc for thirty years or more and that it is impossible to put forward reliable measures of prevention and cure without knowing for sure either the cause or , more importantly , the effects on the body of cattle . in nearby berlin , frederick the great went one step further , demanding , in 1767 , the opening of a school that would train specialists to tackle cattle disease . both calls , however , were to fail . in dresden , negotiations with the university of wittenberg broke down , with the need to create a school for midwives taking precedence . in berlin , enthusiasm also petered out ; a report politely conveyed that the establishment of a school should be postponed until sufficient funds become available . in munich , though , concerns about animal diseases were responsible for the opening of the thier - arzney - schule ( veterinary school ) , the main aim of which was , as the duke of bavaria proclaimed , to control cattle plague from breaking out . in general , despite evident willingness , the state struggled to bring veterinary schools into being . consistent with what it had done throughout the eighteenth century , the state tapped into the medical tradition , looking to physicians as experts in cattle plague to help found veterinary schools . in munich , anton will , a medical doctor from the university of ingolstadt , was persuaded to head up the school in 1790 , but academic physicians were , on the whole , hard to convince . both the prussian academy of sciences and the oberkollegium sanitatis a committee made up of medical officers refused to help when approached . one reason for their rejection was the increased amount of work . at the end of the eighteenth century , as ute frevert has observed , hopelessly overburdened . in the kurmark , a province of prussia , thirty medical officers were responsible for inspecting 114 apothecaries , 249 surgeons , 158 midwives and 114 doctors . in 1805 , c.f.l . wildberg , a mecklenburg court councillor and early pioneer of medical jurisprudence , referred to this workload in an open letter to the prussian senior medical councillor , complaining about the unfair amount of state veterinary work . status was a factor , too : in the same letter , wildberg charged thatincompatible , and expressed dismay that tending to animals harmed the reputation of physicians . among learned medical doctors , animal health was considered degrading : shepherds , butchers and cow - leeches were itspeople [ who ] have been bred with cattle , have grown up with them , they scoffed , are their true friends and know most about them . in practice , of course , doctors frequently treated animals in response to demand from owners , and a knowledge of animal diseases remained a prerequisite for becoming medical officers in prussia well into the nineteenth century . yet , as the standing of the profession rose in the mid - century , physicians yearned to be rid of animal healing . in 1857 , [ a ] nimal studies is not to be regarded as a coordinated and independent part of general healing ; therefore a knowledge of animal medicine is not necessary for the human doctor . one important exception to the apparent split between these two areas of healing is that medical doctors had fewer qualms about veterinary medicine in universities an outlook reflecting broader reservations about engaging in manual versus intellectual labour . as claudia huerkamp has noted , academic physicians shunned manual activities such as blood - letting , dressing wounds , drawing abscesses and the direct handling of animals would have fallen under this category . yet , a theoretical knowledge of animal health , as opposed to its practical applications , was acceptable , because teaching did not involve direct dealings with animal flesh . at the end of the eighteenth century , gttingen ( 1771 ) , freiburg ( 1783 ) , marburg ( 1788 ) and wrzburg ( 1793 ) offered the subject , and professorial chairs were also created . at the university of giessen , fromwhere a separate veterinary school came into being in 1829 , veterinary teaching stretched back to 1777 . medical doctors such as ernst schwabe , ludwig bojanus and christoph nebel imparted veterinary knowledge to future physicians , landowners and lawyers , who would , in their later careers , have to recommend measures about contagious animal diseases , know something about breeding and deliver legal verdicts on the value of livestock . later scientific and medical interest in animal diseases partly stems from this tradition ; it explains why veterinarians subsequently struggled to assert the validity of their expertise in public committees , at agricultural fairs and in courts . faced with medical reservations , the state looked to exploit the hippological tradition , turning to the military for help in setting up veterinary schools . at hannover , johann adam kersting , senior horse doctor to the royal army , was responsible for founding the first school in germany . king george iii made it clear that the school s priorities lay less on educating veterinarians with the knowledge to combat diseases of livestock than to train up regimental horse doctors with the practical know - how of shoeing ( and curing ) army horses . reflecting this emphasis , the school was placed under the auspices of the ober - hof - marschallamt ( senior court marshall office ) , initially called itself roarzney - schule ( school of equine medicine ) and kersting predominantly taught and wrote about horse - shoeing . in berlin , the military influence was equally pronounced : when its school opened in 1790 , some twenty years after initial plans , it was also aimed attraining up good horse doctors for the stable and the regiments . even though civilian pupils were accommodated , cavalry regiments reserved the right to send their own soldiers to be trained as farriers , and a further six places were earmarked for future stud officials . even at munich , the military influence grew because of difficulties attracting pupils . on its tenth anniversary , the prince - elector of bavaria , maximilian joseph , undertook efforts to attract physicians , surgeons and blacksmiths to enrol but he could not prevent the school s reorganisation in 1810 . placed in the hands of baron kessling , the oberstallmeister ( senior equerry ) , the main focus of the school was shifted to training farriers for the army a decision that proved to be long lasting . as late as 1861 , the bavarian parliament complained about the school s narrow focus on the treatment of sick horses , lamented the lack of a clinic that dissected cattle ( despite a burgeoning milk industry ) and criticised the scant attention paid to the health of sheep and goats . during this seminal period in the development of the german veterinary profession , medical and military traditions exhibited contrasting conceptualisations about animal health , where its knowledge should be constructed , the kind of people who should be trained and the types of animals that should be cared for . medical practitioners , who were already very much involved with cattle plague , were sceptical about becoming involved in veterinary schools . not least because associations with lay animal healers would be socially degrading , they preferred instead teaching in universities , where a theoretical knowledge of animal health could be imparted to future leaders . yet for army officers , priorities lay in the training up of farriers for the purposes of shoeing and curing horses an emphasis that precluded a broader engagement with the health of other animals and set back the possibilities of recruiting learned men as practitioners . in 1810 , wilhelm humboldt approached the extant veterinary school in the prussian capital with the intention of forging close ties with his new university of berlin . however , the philosopher s plans for introducing free scientific inquiry did not sit well with the militaristic culture of the berlin school . directed as it still was by the oberstallmeister and placed under the auspices of the marschallamt , the school rejected this overture . much of the effort at reform within germany during the second half of the century focused on weakening this military influence . bringing back a more medical as well as scientific interest in contagious animal diseases the state s initial plan became the aim . for those who chose , following their attendance at a veterinary school , to work as private practitioners rather than serve as military farriers , fierce competition awaited . in 1805 , the physician and naturalist ludwig bojanus , professor - elect of veterinary medicine at the university of vilnius , observed how newly trained veterinarians struggled against lay animal healers for a share of the pie : his office , which does not belong to the most respected , brings him constantly in relation with the common people , to whose ideas and conceptions he must adapt himself if he will not endanger his success and let it pass over into the hands of quacks and herdsmen . his office , which does not belong to the most respected , brings him constantly in relation with the common people , to whose ideas and conceptions he must adapt himself if he will not endanger his success and let it pass over into the hands of quacks and herdsmen . those who took the risk pointed to their training and knowledge in attempts to attract clientele . without a substantial previous record of treating animals , however , livestock owners found it difficult to trust them ; theirknowledge lacked the wealth of experience on which shepherds or herdsmen typically drew . with this in mind , bojanus issued a warning , calling upon the new veterinary schools to resist re - emerging ideas of trainingschools should instead select the veterinary aspirant from the mass of the people , to whom he will return ; he should feel at home in the circle in which he shall enter and should not be rejected as foreign by the class of people among whom he shall live and work . for bojanus , veterinarians should be practical men . contesting this view was the physician johann peter frank , author of the system einer vollstndigen medicinischen polizey ( 17791819 ) . mostly unremarked upon in standard medical histories , frank not only fleshed out ideas for a medical police in his influential books but also provided a blueprint for a veterinary equivalent . based on a belief that both the medical and veterinary fields should be categorised undergeneral healing , he argued passionately against the view that veterinary work should be left tounscientific people . his exhortation that medical men should assume responsibilities for both areas may have fallen on deaf earsit also left little room for the training up of veterinarians as a distinct group of experts but his proposal that educated men should be employed in veterinary public health , and the involvement of medical men in this set - up , left an indelible mark . his influence can be discerned in the courses on cattle plague and veterinary policing that were set up at the stuttgart ( 1810 ) , berlin ( 1822 ) , hannover ( 1824 ) and dresden ( 1845 ) schools . his views were also reflected in the works of bernard laubender ( 1805 ) , georg friedrich tscheulin ( 1821 ) and ludwig wagenfeld ( 1835 ) a mixture of doctors and veterinarians tasked with teaching in veterinary schools . in 1817though few in number , the departementstierarzt ( chief veterinary officers ) served a broad administrative area ; more numerous was the kreistierarzt ( district veterinary officers ) , who operated within narrower administrative areas . at the outset , veterinary officers were mere bystanders in the field of contagious animal diseases . demonstrating uncertainty about whether veterinary expertise could be trusted , the state privileged the opinions of surgeons and physicians . within the prussian state apparatus , district veterinary officers were placed on the lowest scale and thus had to obey orders not only from medical officers in general but also from the kreiswundarzt ( district surgeons ) a profession on the wane . chief veterinary officers were ranked higher than surgeons of any description , but they were still subordinate to district medical officers , who had the final say in matters of public health , broadly conceived . reporting animal diseases toa higher authority fell to veterinarians but no important decision could be made without the intervention of physicians , as higher - ranked officials . in her book on the rise of the medical profession , huerkamp observed that public appointments , while nothing more than technical positions with limited powers , nonetheless helped physicians win custom in a competitive medical marketplace . for veterinarians , farriers and animal doctors obtain a gewerbeschein ( trading licence ) from their local authority ; similar moves were undertaken in bavaria ( 1810 ) and hessen ( 1822 ) . born into the profession . during the 1830s , however , such protection was lifted . more likely is that the ruling made it difficult for farmers to continue to rely on self - appointed experts . how much resentment state moves could sow is shown in the counter - legislations that poured scorn on the notion that animal healers could betrained . for example , in the stade region , part of the kingdom of hannover , a ruling was passed in 1836 that sought to protect those born into the profession . lay animal healers , it was decreed , did not need to request a licence , butother people , veterinarians included , did : the practice of animal healing is to be left up to hangmen with regard to animals in general ; to blacksmiths and farriers with regard to horses ; to shepherds and other herdsmen with regard to those animals they are in charge of and without limitation to their own herds . all other people must obtain authorisation to conduct this questionable art the practice of animal healing is to be left up to hangmen with regard to animals in general ; to blacksmiths and farriers with regard to horses ; to shepherds and other herdsmen with regard to those animals they are in charge of and without limitation to their own herds . all other people must obtain authorisation to conduct this questionable art such a situation reflected the strength of feeling among farmers concerning their rights . as the state discovered to its cost , arrangements that had been attained between farmers and animal healers were not to be taken lightly . for conservative prussian estate owners , no doubt , the imposition of urban - trained veterinarians constituted an affront to their rural authority and a challenge to their traditional way of life . despite the lack of state protection , though , private practitioners such as johann schmager , who operated in the black forest between the 1830s and 1850s sought public works . the son of a surgeon , schmager originally attended the now - defunct veterinary school in karlsruhe in 1828 , and went on to study medicine at the university in freiburg . he then set up a practice in nearby lahr , a small town in the western part of the black forest . from the beginning , schmager found it difficult to ply his trade because of the minimal amount of work farmers were willing to provide . he thus looked for other openings to stabilise his income but here , too , encountered resistance . his journal entries frequently feature complaints about ferdinand frank , the local knacker , whose network of clients , accumulated over a period of three generations , made it next to impossible to make inroads . his rival s cosy relationship with the local authority , which allowed frank to monopolise the collection of animal carcasses , did not help either . eventually , schmager readily accepted a new role , offered by the town , of inspector , in which post he oversaw the vending of meat , turned in stray dogs and policed the local livestock market . he was also quick to defend his public role when frank attempted to muscle in . further research must assess how representative schmager s experiences were of the whole of germany , but they do hint at the kind of difficulties private practitioners encountered . seeking collaboration with authority was , even for private practitioners , a realistic survival strategy . such circumstances undoubtedly explain why , from the 1830s , veterinarians sought to make headway instead as veterinary officers , wresting control of contagious animal diseases away from their medical colleagues . one small , early success was in the investigation of mange a contagious skin disease . traditionally , surgeons had treated this malady , but in 1836 the state expressed its reservations about this : the examinations that district surgeons had to pass did not guarantee that they possessed the necessary knowledge to execute the affairs of veterinary police . consequently , the prussian government delivered a decree that replaced surgeons with veterinarians . such a decision , still rare at this time , represented a major advance . back in 1803 , a prussian directive mentioned veterinarians for the first time as agents in the state s fight against cattle plague . categorised alongside shepherds and herdsmen , however , they were merely asked to report outbreaks to the district medical officer . during the 1830s , however , veterinarians came to pose a threat to physicians . even though the latter were called on as higher authority in ambiguous and more important cases of cattle plague , the former , it seems , appear to have been less forthcoming about cases that needed the attention of higher - ranked experts . medical officers protested , complaining about the loss of emoluments because veterinarians were referring fewer cases to them . on this occasionfollowing pressure , one reminder , issued in 1837 , reprimanded district veterinary officers for doing as they pleased . compared with their counterparts in britain , veterinarians in the german states took on public roles early on in the evolution of their profession , and the veterinary police , as it developed in the first half of the nineteenth century , witnessed significant intermingling of veterinary and medical personnel . in england , as woods and matthews have pointed out , private practitioners held sway in debates about the direction of the profession . they argued that practical know - how , business sense and social skills were more important than expertise in science , education or gentlemanly comportment within an unforgiving marketplace . by contrast , within the german context , the voices of private practitioners and arguments for a more practical orientation , with a few early exceptions , are barely audible throughout the rest of the nineteenth century . once a state - centred model of professionalisation was established , commercial concerns about quacks became secondary , social fears regarding association with shepherds and herdsmen dissipated and attention shifted to obtaining parity with doctors . crucially , incorporation into the state apparatus removed veterinarians from the category of animal healer and placed them in the same category as medical practitioners . even though the relationship was a subordinate one , state involvement offered veterinarians a way to escape the marketplace , to insist on similarities with medical practice and , as medicine incorporated more science , to regard themselves as scientists too . in britain , a similar rallying cry for veterinarians to become more like physicians is detectable ; in germany , as the power of veterinary officers increased , it became the norm . when the london veterinary college ( 1791 ) and the berlin veterinary school ( 1792 ) were first founded , both institutions started out accepting anybody wishing to enter . there was no common rule by which these places selected school - leavers for admission , reflecting fears that drawing up conditions of entry would deter applicants . in 1838 , however , the berlin school took the decision to impose on aspirants the sekundareife : those interested in attending needed to have completed intermediate secondary school . in england , crucial to this difference was the existence of public appointments . at the completion of their studies , berlin students sat qualifying final examinations in order to become district veterinary officers , and then , after a further five years experience , they could apply to become chief veterinary officers . such a move to create a high standard of entry , however , encountered military opposition . nobody would , the army warned , want to become veterinarians if the academic hurdle was raised too high . conditions to a second track were thus lowered : school - leavers needed to have completed volkschule ( primary school ) , which equipped children to be able to read and write basic german and latin , but nothing morefollowing admission , these pupils were trained over a course of six semesters in practical aspects of curing and shoeing . much of the training took place in forges ; shoes were hammered out and placed on horses hooves . proletariat . in britain , the difference between various types of veterinarian was hazy ; in prussia , at least , it was stark . for the first half of the nineteenth century , statistics on the profession do not differentiate between private , public or military veterinarians , making it difficult to ascertain the respective proportions , but the fact that a high standard of entry was introduced , despite military opposition , indicates the rising power of veterinary officers . prior to the 1820s , fewer than 400 trained veterinarians operated in the whole of prussia . towards the end of the 1830s , however , numbers had picked up . a growing awareness that training at veterinary schools resulted in employment arguably raised incentives . thus , despite meagre increases in the equine population ( a reflection of the sluggish pace of industrialisation ) , the number of veterinarians witnessed a dramatic increase from the 1840s ( see table 1 ) . in the following two decades , chief veterinary officers were to be found in all ten provinces , and district veterinary officers operated in 169 of the 325 districts . berlin , for instance , appointed a full - time veterinarian in 1853 . by 1870 , the prussian capital was employing one chief veterinary officer and two district veterinary officers . table 1 : number of veterinarians versus number of horses registered in prussia , 182255 . yearno . of veterinariansno . of horses 182238713632471825395140235218283861385021183142813745941834465141528918375141472901184061315166191843749156455418468351614696184984315754171852951157956018559981550844source : statistische notizen , in wochenschrift fr thierheilkunde und viehzucht ( 1857 ) , 295 ; geheimes staatsarchiv preussischer kulturbesitz , pferdezucht und pferdebestand in preuen , 181655 , vi . statistische notizen , in wochenschrift fr thierheilkunde und viehzucht ( 1857 ) , 295 ; geheimes staatsarchiv preussischer kulturbesitz , pferdezucht und pferdebestand in preuen , 181655 , vi . strength in numbers brought increased powers . in 1842 , the prussian ministry of justice entrusted district veterinary officers with the surveillance of borders , ensuring that diseased livestock did not cross national boundaries . in 1849 , the ministry of education put an end to the ongoing conflict between veterinarians and physicians , with a senior bureaucrat writing : with regard to the question whether district veterinary officers should be tasked exclusively with matters of veterinary police , or whether they should be preferably conferred upon district medical officers , i am in agreement with his majesty s government that in all matters related to veterinary policing , district veterinary officers should be assigned in places where exceptional ones are employed and extended as a rule to all areas of veterinary police . with regard to the questionwhether district veterinary officers should be tasked exclusively with matters of veterinary police , or whether they should be preferably conferred upon district medical officers , i am in agreement with his majesty s government that in all matters related to veterinary policing , district veterinary officers should be assigned in places where exceptional ones are employed and extended as a rule to all areas of veterinary police . following this watershed decision , administrations across the german states took steps to separate the veterinary and medical police , with saxony ( 1856 ) , baden ( 18645 ) , wrttemberg ( 1868 ) and bavaria ( 1868/72 ) all introducing independent administrative organisations . fines were also imposed on those who meddled in veterinary affairs without the necessary qualifications . even though limited to safeguarding the activities of veterinary officers , the practice of healing , slaughter and inspection , when carried out in the duty of the state , became veterinarians exclusive domain . two pieces of legislation cemented the advance of veterinarians in the state apparatus . in 1869 , the rinderpestgesetz ( rinderpest law ) came into effect in the north german federation , placing veterinarians in exclusive charge of epizootics . in 1873 , the ministry of agriculture , under the stewardship of the energetic eduard marcard , stepped in to take over veterinary administration . two years later , marcard oversaw the creation of the prussian viehseuchengesetz ( contagious animal diseases law ) , which specified that the veterinary officer be immediately consulted . medical officers were excluded . in order to advise the state at the highest level , the technische deputation fr das veterinrwesen ( veterinary technical deputation ) was also created : composed of two medical doctors , three landowners and seven veterinarians , veterinarians thereby became influential in the decision - making process . by the time that the prussian law became an imperial one , following german unification , following amendments in 1894 , swine plague , avian plague and tuberculosis were added to the list of contagious animal diseases . new directives relating to healthy animals not just diseased ones also came into being . when reforms were implemented to the two - tier system in prussia in 1855 , elevating the prerequisite for study at veterinary schools to the acquisition of obersekundareife , or graduation without the taking of final examinations , the military chose to abide by different rules ; it came around to accepting this change only in 1866 . during this period , military farrierswere generally referred to as roarzt ( horse doctor ) , were tasked overwhelmingly with the shoeing of horses and had to ask for permission from their commanding officer to handle diseased horses . officers felt they knew better : [ a ] great part of the cavalry and artillery officers , one veterinarian complained , take it upon themselves to cure army horses , conduct it themselves and decide prescription , perceiving and using farriers only as a technical drudge . no wonder that the military class , especially in prussia , thought little about raising the status of horse doctors : the vet should be a farrier , a farrier can not be an officer , and therefore the vet can not be an officer . building on their growing influence within the profession , veterinarian officers stepped up the pressure on the military from the 1870s . shoeing became the main battleground , because of its association with manual as opposed to intellectual labour . in 1873 , anton ludwig sombart , a national liberal , supported a change to the status of military farriers . he argued in the reichstag that [ veterinarians ] can not today go about swinging the hammer on the anvil and then the next day use the same hand to operate the lancet , the microscope and the chemical balance . during another debate in the prussian parliament , it was pointed out that , in all other armies [ with the exception of prussia , ] shoeing is not the main thing but is strictly separated from veterinary medicine and the military vets merely oversee it . after german unification , the inertia to synchronise veterinary arrangements across the german states witnessed the introduction of veterinary inspection within the prussian army . those who had been oberrorzte ( senior horse doctors ) became obere militr beamte ( senior military officials ) ; standard rorzte became non - commissioned officers with the rank of wachmeister ; andunterrorzte ( junior horse doctors ) became sergeants . eventually , in 1910 , a decree placed veterinarians on an equal footing with medical doctors and confirmed the military veterinarian s powers to conduct cures and implement hygienic measures without interference from their commanding officer . tasked also with the organisation and administration of shoeing , which specialist farriers were now to carry out , veterinarians could concentrate on the treatment of diseases . during the 1870s and the 1880s , george fleming , a british army veterinarian , called on colleagues to involve themselves more with contagious animal diseases and the inspection of meat and milk . to be able to do so , he urged , veterinarians needed to become educated scientific men . in germany , there was no comparable , progressive military figure . rather , it was the army that played the conservative role , emphasising the importance of practical and manual labour against the view of veterinary officers , who insisted on the pursuit of intellectual and scientific inquiry . starting out with the introduction of higher standards of entry in 1838 , veterinary officers had , by the 1870s , established themselves as the most influential voice within the profession . such a position had been achieved on the back of increased numbers , the resolution of institutional subordination to medical officers in the state apparatus , the widening of the scope of their activities through inclusion of a variety of contagious animal diseases and the elevation of veterinarians as experts to the highest level of government . building on these advances , german veterinarians could capitalise on the increasing importance of zoonoses during the second half of the nineteenth century . during the 1860s , epidemics broke out that tested newly emerging boundaries of medical and veterinary knowledge . in britain , as michael worboys has demonstrated , the cattle plague outbreaks were a watershed event : medical practitioners took an interest in the epizootic and eventually came to challenge the veterinary model of control that had been put in place following the outbreaks of 18656 . in germany during a similar period , it was trichinosis , a zoonosis believed to be caused by the eating of raw pork , that proved formative . most of the epidemics took place in northern germany , and one of the most serious was recorded in 1862 in hedersleben , a small town 160 km south of berlin . some 337 inhabitants came down with the disease , of which 101 eventually died all from sharing one pig . despite a tradition of zoological interest in the parasite , trichinosis was an overwhelmingly medical event . both friedrich zenker and friedrich kchenmeister , who played key roles in demonstrating that the trichinae pathogens could transfer to humans , were physicians . medical practitioners were tasked with diagnosis either at the bedside or in the hospital . they were also responsible for sending specimens for microscopic testing by laboratory scientists . veterinarians were largely absent but , during the 1880s , as the number of abattoirs dramatically increased , they became the main scientific experts in meat hygiene . one influential pathologist who confirmed the existence of the disease in his laboratory was rudolf virchow . because trichinella could only be diagnosed after slaughter , virchow initially called for self - protection , urging households to purchase microscopes and to take hygienic measures in the kitchen . despite the seemingly simple advice to cook meat thoroughly , however , instances failed to die down . most medical observers placed the blame without much evidence on the strength of the north german custom of eating raw pork . in 1864 , the commission of the berlin medical society of which virchow was a member took this lesson on board as it recommended state intervention : certainly , explanations about the dangers can be very useful but they can not pervade all sections of the population so that a strong and securer control of slaughtered animals is required more than ever . following advice by the commission , the prussian schlachthofgesetz ( slaughterhouse law ) was passed in 1868 that prescribed the construction of abattoirs as the fundamental solution to trichinosis ; but the legislation did not specify who was to be placed in charge . nor was the law particularly effective : only thirteen public slaughterhouses were built as a result . for veterinarians , protecting the health of humans from transmissible animal diseases was still a contentious undertaking . even though a few veterinarians threw themselves into trichinosis research from the mid-1860s , especially in saxony , they hesitated about encroaching upon medical territory . one of the first veterinarians to write about the disease , the dresden professor g.c . haubner , balked at the opportunity to assess the health of meat and milk . bothundoubtedly belonged to the medical police like all other food , he argued ; only whenveterinary knowledge is absolutely necessary could the task be transferred to the veterinary police . nor did haubner particularly warm to either the idea of meat inspection , or the abattoir , because of the cost and time involved . one of the most influential advocates was andreas gerlach , who became director of the berlin school in 1870 . in his seminal work , die fleischkost der menschen ( the meat diet of humans ) , he called on fellow veterinarians to claim the neutral terrain between human and animal medicine . despite sharing the experience of trichinosis with haubner , gerlach became convinced of the need for stricter controls , along the lines virchow had advocated . his theory that rats were a major source of infection also shifted some of the responsibility to stockowners and breeders not just butchers or housewives for the spread of the disease . by doing so , gerlach helped to extend the frontline in the battle against trichinosis and paved the way for a veterinary model of policing zoonoses . during the 1870s , the veterinary profession embraced the abattoir as an institution through which the powers of veterinary police could be extended . at this time , farmers and regional politicians resented the heavy hand of veterinary officers in the control of rinderpest . from 1872 , the epizootic periodically made its way from the russian steppes , prompting an international conference , held in vienna , which floated the idea of constructing slaughterhouses on the east prussian border . due to the development of the railway , contagious animal diseasesspread more easily . building slaughterhouses on the eastern border , and killing the animals prior to transportation , or forcing local regions ( which were impoverished anyway ) to consume the meat from slaughter , would , it was argued , prevent infected animals from moving west . following the creation , in 1875 , of the veterinary technical deputation , of which both virchow and gerlach were founding members , discussions intensified . in 1877 , gerlach , as head of the deputation , issued a plea to the prussian parliament , calling for the revision of the 1868 slaughterhouse law . both epizootic and zoonotic arguments became important strands of the deliberations that took place . even though gerlach did not live to witness the debate he died later in 1877 virchow seconded his proposal . speaking in the prussian landtag ( state parliament ) , the pathologist delivered a eulogy that praised his friend s work on meat hygiene asthe best on the subject . thanks in part to virchow s support , the amended law came into being ; the argument that abattoirs could protect german agrarian interests from foreign imports also helped . by 1890 , 183 abattoirs had been opened in prussia alone ; in 1903 , 839 operated across germany . most of these new slaughterhouses employed veterinarians , who worked as directors , inspectors or assistants . one of the largest opened in berlin in 1881 , and hugo hertwig , a former district veterinary officer , became its chief of meat inspection . increasingly tasked not only with the administration but also with the construction of actual buildings , veterinarians quickly made abattoirs their new fiefdom . in 1893 , one of the self - titledsanitary veterinarians wrote that the purpose behind the statistical reports he compiled was not only to inform consumers about the health of meat , but also to provide farmers with information on infectious diseases , reflecting both epizootic and zoonotic concerns . in 1885 , robert ostertag , the founding father of modern systems of meat inspection , began his illustrious career at the berlin abattoir . there , he built his scientific reputation by dint of the extraordinarily large amount of specimens placed for dissection . cattle plague control had furnished veterinarians with only a limited and irregular supply of mainly diseased animals , but abattoirs had an almost limitless and regular supply of both healthy and diseased livestock . sanitary veterinarians published the results of their research in specialist journals : ostertag s own zeitschrift fr fleisch und milchhygiene ( journal of meat and milk hygiene ) was one major outlet . in 1893 , the slaughterhouse director at berlin claimed that sanitary veterinarians were superior to researchers at virchow s nearby institute of pathology :[ f ] ar richer specimens are available in fact , animal pathology is significantly advanced through the works of sanitary veterinarians , especially with regard to parasitology . such advances culminated in the reichsfleischbeschaugesetz ( imperial meat inspection law ) , which accorded veterinarians a central role . for ostertag , a chief architect of the legislation , veterinarians had been crucial in bringing it about . in his influential handbook of meat inspection , he boasted that the law was the direct result of the indefatigable efforts which the representatives of veterinary science have put forth for several decades toward introducing a general compulsory inspection of food animals [ sic ! ] and meat . one anomaly that remained , though , was medical involvement in trichinosis inspections . during the pre - abattoir era , most german states had designated educated laymen whose expertise was certified by medical officers to this task . responding to individual requests from butchers , hotels or restaurants that slaughtered their own pigs , inspectors would visit equipped with a microscope and logbook . only on rare occasions were veterinarians involved in this work . following the widespread construction of abattoirs , however , the process of trichinosis inspection was modified so that applications had to be made to the slaughterhouses . even so , as in the berlin slaughterhouse , medical officers were to be called in for dubious cases , and physicians resisted a handover in places such as kottbus ( 1891 ) , posen ( 1891 ) and kassel ( 1894 ) , rejecting what they saw as attempts at transforming this medical terrain into a veterinary one . for the veterinary profession as a whole , involvement in meat hygiene proved to be highly significant : it carved out new expertise in zoonoses and created additional sites of employment that built on advances made in the control of epizootics . during the 1860s , the debate over trichinosis generated medical demand for abattoirs , but enthusiasm for them was low , resulting in piecemeal legislation that focused just on trichinosis inspection through medically certified laymen . in the wake of the rinderpest outbreaks in the 1870s , however , as enthusiasm for abattoirs resurfaced , veterinarians successfully transformed them into a hub that undertook to address both epizootic and zoonotic concerns . bythe time robert koch made his bacteriological breakthrough in the 1880s , veterinarians were firmly institutionalised in meat inspection controls , and had no issues about introducing germ theory in the abattoir . [ m ] eat inspection is , ostertag quipped , nothing more or less [ sic ! ] than applied bacteriology . for german veterinarians , abattoirs were their laboratory . both healthy and unhealthy livestock could be assembled , dissected and investigated to produce veterinary knowledge . through the collection of biological and microscopic specimens , one representative boasted , science is advanced . in britain , veterinarians opposed the setting up of laboratories in the wake of the cattle plague outbreaks , and resented medical encroachment . they exploited the fact that the disease did not transfer between humans and animals to deny that there was much common ground between veterinary and human medicine . by contrast , in germany , veterinarians moved the other way , capitalising on their involvement in epizootics to claim new terrain in zoonoses . because of the awareness raised by trichinosis , german veterinarians also became interested in the dangers posed by bovine tuberculosis , as transmitted through the consumption of meat and milk . at the end of the eighteenth century , medical opinion had concluded that perlsucht , as bovine tuberculosis was traditionally called , posed little threat to human health , resulting in governmental action that sought to educate the public about its harmlessness . in 1865 , jean antoine villemin , however , overturned this orthodoxy , demonstrating that tuberculosis could cross the species barrier . his discovery that experimental animals developed tubercular alterations when fed with the meat of animals suffering from perlsucht convinced him that the meat could be a carrier of the disease . for gerlach , the main criterion on which decisions about edibilityshould be based was to establish whether the virus had affected the lymph , because this was proof that the disease had spread throughout the body . looking for clinical signs was deceptive : cattle that looked completely healthy could already be infected . even in ambiguous cases , he argued , veterinarians should err on the side of caution and eject the animal from trade . most veterinarians could not accept the amount of food that would have to be wasted , based on the mere suspicion of infection . following heated debate , the newly created deutscher veterinrrat ( german veterinary council ) passed a resolution in 1875 , declaring that research was still insufficient to justify a ban on everything that came from infected animals . following gerlach s death , the berlin veterinary school , when approached to give its own considered view , was equally sceptical : [ i ] t is not yet proven that the meat of an otherwise very fat and well - nourished cow suffering from generalised tuberculosis is unsuitable for human consumption . such negative reactions did not mean that communicability itself was doubted . in the 1880s , alfred johne , a professor at dresden , extended gerlach s investigations into bovine tuberculosis , rectifying the mistake gerlach had made in rejecting meat from the animal the moment the virus entered the lymph glands . he instead inferred that only when it reached the circulation of blood should the meat be regarded as unfit for human consumption . not until this point in time , he concluded , are we justified in unconditionally excluding from the market a given piece of meat . following the contemporaneous publication of the results of koch s investigation into tuberculosis , transmissibility between man and animal received bacteriological support , but the debate continued with regard to how the danger should be addressed . veterinarians dominated much of the discussion into the practicalities of what to do . at the international congress of veterinarians held in brussels in 1883 , august lydtin , chief veterinary officer in baden , succinctly presented three potential solutions : ( 1 ) heating , ( 2 ) confiscation and ( 3 ) the abattoir . for butchers and consumers , sterilisation through heatingcertainly , the kitchen served as an effective place of disinfection , lydtin acknowledged , but the experience of trichinosis had already cast doubt over the ability of the public to protect themselves . even if instructions were issued about how the meat should be heated , he added , people would be led to believe that all cooked meat would be safe to eat , when , in fact , heat can at times fail to penetrate deeply into all meat parts . confiscation of diseased meat , on the other hand , would be safer than cooking . even though this option would be unpopular , lydtin remarked , diagnosing the infection itself in the carcass was relatively easy . yet the problem with this approach was that the search for diseased meat necessitated majorinterventions into the private possession of butchers and breeders . imposing fines would be counterproductive ; parties would hide suspected cases for fear of incurring severe financial losses . for all of these reasons , lydtin concluded , the abattoir was the only realistic solution . not only did sanitary veterinarians have to carry out the difficult task of ascertaining exactly the spread and degree of the tubercular alterations , they also had to carefully remove the infected parts from the cadaver destined for consumption based on objective knowledge . only the veterinarian , who has practical experience in meat inspection , lydtin counselled , has this necessary knowledge . for sanitary veterinarians , this expertise was central to their mission of saving as much meat as possible . meat inspection was not only about the protection of human health ; it was also concerned with its improvement through preventing theunnecessary destruction of still useable , valuable nutritious material . nowhere was this interest more apparent than in moves to re - invent the freibank . originally , the freibank was a sixteenth - century institution widespread in southern germany and austria . the freibank was of interest because it could be refashioned to sell meat from cattle infected with localised tuberculosis . public sentiment would not allow for healthy meat to be sold alongside that saved from diseased animals , but it could be offered at lower prices without attracting any criticism of deception . thus , despite objections from butchers , veterinarians successfully implemented freibanks : by 1900 , 362 were in operation in prussia alone , all attached to the abattoir system . of all the cattle inspected during that same year , fifteen per cent were found to have tuberculosis ; however , thanks to veterinary expertise , only 2.7 per cent had to be condemned . pointing to this smaller loss through waste , veterinarians could further claim that they were making a major contribution to elevating the health of the nation , especially in urban areas . compared with their increased importance in towns and cities , such an impasse had beset the early history of the profession , driving practitioners into the arms of the state , but the subsequent and rapid rise in the number of veterinarians facilitated a shift in attitudes . in 1894 , lydtin called on his colleagues not to rest content with the healing of damages that occur to domestic animals or with the finding of measures to protect domestic animals from plague but to also look for ways to improve the performance of livestock in order to make animals more economically valuable . pointing to the lucrative livestock breeding industry , veterinarians should , he suggested , concern themselves more withdeath , ally themselves more with private interest than with that of the state , and reach out more to farmers than to physicians . he advised colleagues to join agricultural societies , write to breeders , socialise with them and hand out instructions on the construction and maintenance of stalls and barns . the german veterinary council agreed that veterinarians should be more involved in commissions for selecting superior breeding stock among stallions and bulls , a surveying process known as krung ; invited to act as inspectors of studs and foals , or as judges at livestock exhibitions and agricultural fairs ; and asked to provide their expertise at meetings of central agricultural societies . for a profession that had evolved as a state service , in which individual profit making took a backseat to the greater public good , this move to offer veterinary knowledge in the service of breeders represented a major departure . convincing farmers to accept veterinary expertise , however , proved difficult . at one livestock exhibition in hamburg , held in 1893 , not a single veterinarian was among the eighteen judges chosen to deliberate on the quality of horses . only in the section for cattlehe was , however , outnumbered by thirty - nine others who pronounced upon cattle as breeders , farmers and landowners . as one correspondent reported : unfortunately , the vast majority of people think that only healers of diseased animals were trained in the veterinary schools , and that veterinarians had little to offer livestock production . veterinarians charged that both chambers and schools of agriculture would choose their own officers , breeding inspectors , temporary instructors and school directors , and did not appoint state - recommended , prejudice - free experts such as district veterinary officers . some provinces , such as the rhineland , were receptive , but others , such as east prussia , were less so . for example , despite the efforts of dr arndt von plotz , the chief veterinary officer , to make headway , an organised opposition greeted his arrival : the large landowners east of the elbe view animal breeding as their innermost domain , and in my opinion it is fruitless to wage a campaign in this area . considered within this broader context , the recourse to the abattoir as a centre of zoonotic policing not only represented a success in extending veterinary influence over meat , it also signified a failure to gain influence over farmers , especially on the issue of bovine tuberculosis . in 1883 , johne observed how , for the past century , tuberculosis had been able to run riot because farmers were blind to its dangers . due to the relaxed rules concerning perlsucht , he observed , breeders cared less about the distance between livestock , paid less attention to the selection of breeds and became indifferent to the dangers posed by tuberculosis . nobody until today , he fumed , tried to stop [ a farmer ] from selling the milk of his tubercular cow . a major sticking point between veterinarians and agrarians was the reliability of diagnosis . in 1887 , the landwirtschaftsrat ( german agricultural council ) expressed doubts about the communicability of tuberculosis , contending that diagnosis was difficult . calling attention to experiments conducted in the berlin veterinary school , the council charged that extremely well - trained veterinary practitioners failed to establish correctly the existence of tuberculosis or other diseases in live cattle ; after slaughter , animals diagnosed with tuberculosis could turn out to have been free from the disease . veterinarians begged to differ , arguing that , only if they were offered more opportunity would chances of a more accurate diagnosis significantly increase , but such requests were rejected . even in bavaria , where the relationship between farmers and veterinarians was more cordial , a governmental campaign that started in 1895 to introduce tuberculin testing on live cattle quickly ran out of steam because farmers insistence on absolute diagnostic certainty could not be met . , koch declared that the bacteria responsible for tuberculosis was identical in both man and animal . confirming that the disease crossed species boundaries , he recommended draconian action : be the danger great or small that results from the consumption of perlsucht - infected meat or milk , it is there and must therefore be avoided . there was nothing original either in the bacteriologist s findings that bovine tuberculosis was communicable or in his suggestion that drastic measures were needed : in the 1870s , the veterinary community , sparked by gerlach s pronouncements , had already visited these issues , and proposed solutions , by the time koch made his intervention . as keir waddington has shown , british veterinarians , inspired by gerlach , also took an early interest , but the impact of koch s interference was decidedly different between the two countries . in the case of britain , investigators with medical or pathological backgrounds quickly dismissed veterinary contributions and defended their role in the assessment of the health of meat . in germany , however , veterinarians influence held firm thanks to their control of abattoirs . as the example of the freibank attests , they were also able to claim a major contribution to the improvement of society : their expertise once more helped salvage meat from infected cattle . even though the recourse to the abattoir could be seen as reflecting a failure to come up with reliable tools of diagnosis and generate trust with breeders , it was through the abattoir that the german veterinary profession made advances in the late nineteenth century , culminating in the passing of the imperial meat inspection law of 1900 . in 1938 , reinhold schmaltz published what remains the most comprehensive history of the german veterinary profession . for the former professor of the berlin school , who looked triumphantly back at the finished past , the history of his profession was a heroic story of veterinariansindependently achieving full equal rights with all equals . one aim of this article has been to present a more sober , less simplistic and more complicated interpretation of events , in line with recent treatments accorded to other countries . german veterinary medicine in the period under review did not shape itself but was swayed by a variety of influences , traditions and interests laying claim to different types of animal . political interests saw the need to solve epizootics among livestock at large ; military figures wanted to train up farriers who would serve the horse ; agricultural representatives preferred lay animal healers ; and a significant body of physicians wanted little involvement in a venture that risked undermining their social reputation . shaped by these conflicting influences and interests , veterinary medicine developed haphazardly . exploiting the hippological tradition , veterinary schools emerged with a strong interest in military horses . by the mid - nineteenth century , as the voice of veterinary officers became dominant , concerns about competition with lay animal healers died down . the focus shifted to combatting cattle plague and identification with physicians grew strong . building on their expertise in epizootics , veterinarians during the 1870s carved out new terrain in zoonosis , through their involvement with trichinosis , and then cemented their position through their later involvement with bovine tuberculosis . another major thread that has run through this articleeven though some physicians resisted involvement in the veterinary schools , they were happy to teach the subject at universities . following the foundation of the first generation of veterinary schools , discussion continued about the role of medicine in veterinary affairs , reflected in the ambiguous position medical officers assumed in veterinary police . what is clear is that veterinarians looked up to medical doctors . for this very reason , as medicine became increasingly scientific , veterinarians also wished to become scientific practitioners a status achieved through their involvement in meat hygiene . ultimately , the two healing professions differed in the degree to which they relied on the state . for veterinarians who struggled to win custom , especially in the countryside , involvement as public servants was integral to their survival , while , for medical practitioners , state appointments helped increase their competitiveness in private practice . exposed less to the rigours of the marketplace , german veterinary identity came to acquire a strong public service ethos . compared with the british experience , the state - centred nature of the german profession was stark . in britain , the private practitioners dominated the profession , which emphasised practical knowledge , business acumen and social skills . in germany , calls for a more practical orientation were made by the military , whose influence , while strong at the outset , diminished as the nineteenth century progressed . the voices of private practitioners are barely audible throughout the nineteenth century . for much of the period under review , they viewed the attainment of education and , in particular , scientific knowledge to be the way forward . their powers grew more pronounced as veterinarians became employed in abattoirs , which allowed them to dissect and investigate both healthy and diseased animals in a laboratory - like setting . crucially , while in britain veterinarians were slow to embrace bacteriology because they felt threatened by a new model of controlling epizootics , in germany veterinarians were more accommodating because of their secure position as sanitary investigators . they even claimed zoonotic diseases as part of their remit as the profession tried to expand its field of expertise . over the course of the nineteenth century , german veterinarians thus became important actors whose expertise informed the ways in which a modernising society should deal with animals . contagious animal diseases became a major issue , with veterinarians contributing to debates about how the spread of epizootics should be contained . concerns about meat hygiene offered veterinarians the opportunity to participate in discussions about how nutritious , healthy and safe foods could be tested , passed fit for consumption and delivered to a rapidly urbanising society . to make advances in both epizootics and zoonoses , veterinarians also sought to influence livestock breeding , persuading breeders to accept theirphysicians , butchers , farmers to name a few contested this process ofveterinisation because it threatened both ownership and traditional understanding of animal bodies . nonetheless , within rural and urban germany , in diverse fields such as health , food , military and medicine , veterinary expertise made significant inroads a development that became more marked during the twentieth century .\noutput:\n" }, { "from": "agent", "value": "medical historians have recently become interested in the veterinary past , investigating the development of animal health in countries such as france , the netherlands , the united kingdom and the united states . an appreciation of the german context , however , is still lacking a gap in the knowledge that the present article seeks to fill . providing a critical interpretation of the evolution of the veterinary profession , this investigation explains why veterinary and medical spheres intersected , drifted apart , then came back together ; it also accounts for the stark differences in the position of veterinarians in germany and britain . emphasis is placed on how diverse traditions , interests and conceptualisations of animal health shaped the german veterinary profession , conditioned its field of operation , influenced its choice of animals and diseases , and dictated the speed of reform . due to a state - oriented model of professionalisation , veterinarians became more enthusiastic about public service than private practice , perceiving themselves to be alongside doctors and scientists in status , rather than next to animal healers or manual labourers . building on their expertise in epizootics , veterinarians became involved in zoonoses , following outbreaks of trichinosis . they achieved a dominant position in meat hygiene by refashioning abattoirs into sites for the construction of veterinary knowledge . later , bovine tuberculosis helped veterinarians cement this position , successfully showcasing their expertise and contribution to society by saving as much meat as possible from diseased livestock . ultimately , this article shows how veterinarians were heavily entangled with the fields of medicine , food , agriculture and the military ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: dental plaque is a film of microorganisms on the tooth surface that plays an important role in the development of caries and periodontal diseases . corrective treatment for such infectious diseases requires the reduction and / or elimination of bacterial accumulations in the retentive sites on the top of the teeth ( occlusal surfaces ) and between teeth by daily toothbrushing and frequent dental cleanings or prophylaxis . several antibacterial agents including fluorides , phenol derivatives , ampicillin , erythromycin , penicillin , tetracycline , and vancomycin have been used widely in dentistry to inhibit bacterial growth . however , excessive use of these chemicals can result in derangements of the oral and intestinal flora and cause side effects such as microorganism susceptibility , vomiting , diarrhea , and tooth staining . these problems necessitate further search for natural antibacterial agents that are safe for humans and specific for oral pathogens . natural products have recently been investigated more thoroughly as promising agents to prevent oral diseases , especially plaque - related diseases such as dental caries . silymarin is a standardized extract obtained from the seeds of milk thistle ( silybum marianum ) , which contains approximately 7080 % of the silymarin flavonolignans . both silymarin and silibinin have been used as traditional drugs for 2000 years to treat a range of liver disorders , including hepatitis and cirrhosis , and to protect the liver against poisoning from exposure to chemical and environmental toxins , including insect stings , mushroom poisoning , and alcohol . recently , in vitro and in vivo studies have reported that silibinin possesses antioxidant , anti - inflammatory , and antiarthritic activities , and it has chemopreventive efficacy on lung carcinoma , prostate cancer , breast carcinoma , hepatic disorder , and colon carcinoma . in a previous study , silibinin showed antibacterial activity against the gram - positive bacteria bacillus subtilis and staphylococcus epidermidis . in this study , we investigated the synergistic antibacterial activity of silibinin in combination with the existing antimicrobial agents against oral bacteria . the oral bacterial strains used in this study were streptococcus mutans atcc 25175 , streptococcus sanguinis atcc 10556 , streptococcus sobrinus atcc 27607 , streptococcus ratti kctc ( korean collection for type cultures ) 3294 , streptococcus criceti kctc 3292 , streptococcus anginosus atcc 31412 , streptococcus gordonii atcc 10558 , actinobacillus actinomycetemcomitans atcc 43717 , fusobacterium nucleatum atcc 10953 , prevotella intermedia atcc 25611 , and porphyromonas gingivalis atcc 33277 . brain - heart infusion broth supplemented with 1 % yeast extract ( difco laboratories , detroit , mich ) was used for all bacterial strains except p. intermedia and p. gingivalis . for p. intermedia and p. gingivalis , the minimum inhibitory concentrations ( mics ) were determined for silibinin by the broth dilution method and were carried out in triplicate . the antibacterial activities were examined after incubation at 37c for 18 h ( facultative anaerobic bacteria ) , 24 h ( microaerophilic bacteria ) , and 1 - 2 days ( obligate anaerobic bacteria ) under anaerobic conditions . mics were determined as the lowest concentration of test samples that resulted in a complete inhibition of visible growth in the broth . following anaerobic incubation of mics plates , the minimum bactericidal concentrations ( mbcs ) were determined on the basis of the lowest concentration of silibinin that kills 99.9 % of the test bacteria by plating out onto each appropriate agar plate . ampicillin and gentamicin were used as standard antibiotics in order to compare the sensitivity of silibinin against test bacteria . the antibacterial effects of a combination of silibinin , which exhibited the highest antimicrobial activity , and antibiotics were assessed by the checkerboard test as previously described . serial dilutions of two different antimicrobial agents were mixed in cation - supplemented mueller - hinton broth . after 24 h of incubation at 37c , the mic was determined to be the minimal concentration at which there was no visible growth . the fractional inhibitory concentration index ( fici ) is the sum of the fics of each of the drugs , which in turn is defined as the mic of each drug when it is used in combination divided by the mic of the drug when it is used alone . the interaction was defined as synergistic if the fic index was less than or equal to 0.5 , additive if the fic index was greater than 0.5 and less than or equal to 1.0 , indifferent if the fic index was greater than 1.0 and less than or equal to 2.0 , and antagonistic if the fic index was greater than 2.0 . bactericidal activities of the drugs under study were also evaluated using time - kill curves on oral bacteria . tubes containing mueller - hinton supplemented to which antibiotics had been added at concentrations of the mic50 were inoculated with a suspension of the test strain , giving a final bacterial count 5610 cfu / ml . the tubes were thereafter incubated at 37c in an anaerobic chamber , and viable counts were performed at 0 , 0.5 , 1 , 2 , 3 , 4 , 5 , 6 , 12 , and 24 h after addition of antimicrobial agents , on agar plates incubated for up to 48 h in anaerobic chamber at 37c . antibiotic carryover was minimized by washings by centrifugation and serial 10-fold dilution in sterile phosphate - buffered saline , ph 7.3 . the solid media used for colony counts were brain - heart infusion ( bhi ) agar for streptococci and brain - heart infusion agar containing hemin and menadione for p. intermedia and p. gingivalis . the antibacterial activities and synergistic effects of silibinin alone or with antibiotics were evaluated in oral bacteria . the antibacterial activities of the atcc and kctc strains of oral bacteria to silibinin , ampicillin , and gentamicin alone and in combination are presented in table 1 . the mics / mbcs for silibinin were found to be either 0.1 / 0.2 or 3.2 / 6.4 g / ml , for ampicillin either 0.125 / 0.5 or 64/64 g / ml , and for gentamicin , either 2/4 or 256/512 g / ml . silibinin mic50 and mic90 values for oral cariogenic bacteria were 0.0250.2 g / ml and 0.10.8 g / ml , respectively , while for periodontopathogenic bacteria these values were 0.10.4 g / ml and 0.43.2 g / ml , respectively ( table 1 ) . in combination with silibinin , the mic for ampicillin was reduced to 48-fold in all tested bacteria , producing a synergistic effect as defined by fici 0.5 . the mbc for ampicillin has shown synergistic effects in all tested bacteria expect s. sanguinis , s. ratti , and p. intermedia ( table 2 ) . in combination with silibinin , the mic / mbc for gentamicin was reduced to 48-fold in all tested bacteria expect s. sanguinis and s. ratti by fici 0.75 ( table 3 ) . many articles have revealed that gram - positive bacteria was more sensitive to plant antimicrobials than gram - negative bacteria , suggesting that the results are due to the difference between the presence and absence of the outer membrane which can limit drug diffusion in harmony with multidrug transporters . in this study , silibinin also shows susceptibility on gram - positive bacteria as well as gram - negative bacteria . antibiotics such as ampicillin , chlorhexidine , erythromycin , penicillin , tetracycline , and vancomycin have been very effective in preventing dental caries . moreover , the antifungal activities have shown that neither silibinin nor silymarin ii had antifungal activity against yeast . the gram - positive bacteria - specific properties of silibinin are caused by the inhibition of rna and protein synthesis rather than by attacking the bacterial membrane . the bacterial effect of silibinin with ampicillin or gentamicin against oral bacteria was confirmed by time - kill curve experiments . the silibinin ( mic or mic50 ) alone resulted in a rate of killing increasing or not changing in cfu / ml at time - dependent manner , with a more rapid rate of killing by silibinin ( mic50 ) with ampicillin ( mic50 ) or gentamicin ( mic50 ) ( figures 1 and 2 ) . these findings suggest that silibinin fulfills the conditions required of a novel cariogenic bacteria and periodontal pathogens , particularly bacteroides species , drug and may be useful in the future in the treatment of oral bacteria .\noutput:\n" }, { "from": "agent", "value": "silibinin is a composition of the silymarin group as a hepatoprotective agent , and it exhibits various biological activities , including antibacterial activity . in this study , the antibacterial activities of silibinin were investigated in combination with two antimicrobial agents against oral bacteria . silibinin was determined with mic and mbc values ranging from 0.1 to 3.2 and 0.2 to 6.4 g / ml , ampicillin from 0.125 to 64 and 0.5 to 64 g / ml , gentamicin from 2 to 256 and 4 to 512 g / ml , respectively . the ranges of mic50 and mic90 were 0.0250.8 g / ml and 0.13.2 g / ml , respectively . the antibacterial activities of silibinin against oral bacteria were assessed using the checkerboard and time - kill methods to evaluate the synergistic effects of treatment with ampicillin or gentamicin . the results were evaluated showing that the combination effects of silibinin with antibiotics were synergistic ( fic index < 0.5 ) against all tested oral bacteria . furthermore , a time - kill study showed that the growth of the tested bacteria was completely attenuated after 26 h of treatment with the mbc of silibinin , regardless of whether it was administered alone or with ampicillin or gentamicin . these results suggest that silibinin combined with other antibiotics may be microbiologically beneficial and not antagonistic ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: mycoses of the glabrous skin are predominantly triggered by dermatophytes , while members of the trichophyton genus , including trichophyton rubrum , are among the most commonly diagnosed fungal pathogens in poland . raubitschekii are usually found in africa , southeast asia , australia and south america . in recent years , however , there have been a few cases in germany and italy ; hence , the pathogen should be considered as undoubtedly present in europe . to date , there has been no described case of an infection caused by this pathogen in poland . a 34 - year - old polish caucasian male was admitted to the dermatology clinic of the poznan university of medical sciences due to the presence of an erythematous , exfoliating , clearly distinct lesion located on the index finger of the right hand , spreading onto surrounding areas ( figs . 1 , 2 ) . fig . 1side of the index finger hospital admission datefigdate of the second sample acquisition during the follow - up appointment at the department of medical mycology , poznan university of medical sciences side of the index fingerdate of the second sample acquisition during the follow - up appointment at the department of medical mycology , poznan university of medical sciences the first signs of the disease had appeared in august 2012 , after a contact with raw fish the patient is a cook . due to a suspicion of erysipeloid , the patient underwent an antibiotic therapy ( intravenous clindamycin , 2600 mg daily , for the period of 5 days ) coupled with steroids administered topically . a swab for bacteriological , skin biopsy for histopathological and a sample for mycological examinations were acquired . other examinations , such as the mycological culture and histopathology , were awaited for during the stay of the patient at the clinic . due to the lack of significant improvement , the patient was discharged , while any further procedures were performed on an outpatient basis at the dermatology counseling service of the clinic . the results of the histopathological examination indicated a widened , swollen epidermis with a thickened stratum granulosum and a thick stratum corneum , in which there were numerous , round , fungal spores of 2.5 m in diameter ( figs . 3 , 4 ) . due to discrepancies in the results , a second sample for mycological examination was acquired during a follow - up appointment .3 a thickened , swollen epidermis . a thick stratum corneum with numerous pathogenic fungi . moderate , mixed inflammatory infiltrates present in the dermis . hematoxylin and eosin stain , objective lens magnification : 10fig . hematoxylin and eosin stain , objective lens magnification : 60 a thickened , swollen epidermis . a thick stratum corneum with numerous pathogenic fungi . hematoxylin and eosin stain , objective lens magnification : 10 numerous spores in the stratum corneum . hematoxylin and eosin stain , objective lens magnification : 60 itraconazole ( daily dose 100 mg ) was administered orally . the mycological cultures were maintained for 20 days at 25 c on two kinds of media : sabo sabouraud dextrose agar with chloramphenicol and sabo sabouraud dextrose agar with chloramphenicol and actidione . a fungal colony with a reddish brown color and a brownish reverse , strongly furrowed , suede - like surface and a raised center6 ) . a urease test , carried out on christiansen s medium , and dermatophyte test medium examination were both positive . since the strain matched the original description , it was identified as t. rubrum var . a 20 - day - old colony grown on sabouraud agar mediumfig . 6 trichophyton rubrum var . raubitschekii . microscopic image ( magnification 400 , lactophenol cotton blue ) . raubitschekii . microscopic image ( magnification 400 , lactophenol cotton blue ) . numerous macro - and microconidia the following 3 weeks brought a further improvement in the dermatological status ( fig . it was decided to continue the itraconazole treatment while the topical drug was switched to a pyridinone derivative . the patient received itraconazole for a period of 2 months , yet due to low tolerance to the topical drug , the pyridinone derivative was no longer administered . afterward , the patient showed no signs of the infection.fig . 7 top of the right hand after 3 weeks of itraconazole treatment top of the right hand after 3 weeks of itraconazole treatment in order to reassess the diagnosis , we analyzed a ribosomal rna genomic fragment and the urease gene of this isolate as described by hiruma et al . . because the isolate ceased to grow on any new media , we isolated its dna from a plate deposited for long - term storage at our clinic . one hundred and twenty milligrams of the colony was acquired from the deposited agar plate and ground in liquid nitrogen . dna was isolated with the use of the column - based genematrix plant & fungi dna purification kit ( eurx , poland ) that includes both rnase a and proteinase k. firstly , we analyzed a fragment containing partial 18s rrna gene , its1 , 5.8 s rrna gene , its2 and partial 28s rrna gene with the use of common its1 and its4 primers for pcr and sequencing . pcr was performed with the following ingredients : 25 pmol of its1 and its4 primers each , 0.5 l of faststart taq dna polymerase ( 2.5 u , roche ) , 10 l of 5 gc - rich solution , 5 l of 10 pcr buffer with 20 mm mgcl2 , 1 l of dntps ( 10 mm each ) , 5 ng of dna sample , all in a volume of 50 l . pcr was performed with the following program : pre - denaturation4 min , 95 c ; amplification35 [ denaturation : 1 min , 95 c ; annealing : 1 min , 55 c ; elongation : 1 min , 72 c ] ; cooling : 1 min , 40 c . gel electrophoresis and paired - end sequencing revealed a 692 - bp - long fragment , presenting a 100 % coverage with multiple genbank t. rubrum entries and with our own t. rubrum reference strain . secondly , urease gene fragment was amplified by pcr with the following ingredients : 25 pmol of trure1s and trure1r primers each , 0.5 l of faststart taq dna polymerase ( 2.5 u , roche ) , 10 l of 5 gc - rich solution , 5 l of 10 pcr buffer with 20 mm mgcl2 , 1 l of dntps ( 10 mm each ) , 0.5 l of dmso , 5 ng of dna sample , all in a volume of 50 l . touchdown pcr was performed with the following program : pre - denaturation4 min , 95 c ; amplification35 [ denaturation : 1 min , 95 c ; annealing 1 min , 6963 c , step size 0.5 c , step delay 0 ; elongation : 1 min , 72 c ] ; cooling1 min , 40 c . gel electrophoresis revealed that the product was approximately 330 bp long , suggesting a urease - positive t. rubrum rather than t. rubrum var . , the genomic sequence of a raubitschekii urease amplicon should also include a 68 - bp intron and a 9 - bp - long coding insertion ( ddbj ab719058 , cbs 100084 ) . this analysis revealed a sequence of 329 bp ( including primers ) presenting a 100 % coverage with xm_003233873 ( t. rubrum cbs 118892 urease ( terg_05790 ) mrna ) and with the corresponding genomic sequence ( nw_003456423.1 , gene i d : 10376003 ) . both the 68 - bp intron and the 9 - bp insertion , specific to the cbs 100084 raubitschekii strain , were missing . based on these results , it is more likely that the isolate was , in fact , a urease - positive t. rubrum.fig .8 gel electrophoresis of the urease gene pcr amplicon . left lane approximately 329 - bp fragment , right lane puc19 dna / mspi marker ( fermentas ) gel electrophoresis of the urease gene pcr amplicon . left lane approximately 329 - bp fragment , right lane puc19 dna / mspi marker ( fermentas ) initially , it had been described as a separate species trichophyton raubitschekii , yet molecular studies revealed it to be a variant of t. rubrum . it was described to differ from other t. rubrum variants by a limited growth , reddish brown color , the presence of numerous macro - and microconidia and the ability to produce urease . noteworthy , the polish taxonomic key in operation states that the urease activity is the criterion for differentiation between t. rubrum var . the characterization of urease - positive t. rubrum that are distinct from t. rubrum var . raubitschekii has clearly complicated the diagnostic process . the vast majority of t. rubrum var . raubitschekii cases originate in asia , africa and south america . furthermore , he did not claim contacts with anyone traveling to these regions , nor with people showing lesions that might be mycotic . furthermore , brasch et al . described a different german case , involving a 32 - year - old male cameroonian student with well distinct , erythematous , exfoliating lesions located on the abdomen as well as on both hands . a culture grown on sabouraud medium at 26 c and a urease test led to the diagnosis of t. rubrum var . both the cameroonian and the described polish patients responded well to their oral itraconazole treatments . to date , there have been eight described cases in central europe . the described polish case is exceptional , as it appears not to be linked with africa in any way . cultures and urease tests were performed on samples originating from different parts of the skin of 95 greek and 10 bulgarian patients . the pathogen originated from lesions of tinea manuum ( one case ) , tinea corporis ( one case ) , tinea cruris ( one case ) and tinea unguium ( three cases ) . the group originated from and resided in greece and bulgaria at the time of the study . they all had not traveled to the aforementioned endemic regions nor abroad for the past 6 months . raubitschekii will probably become the method of choice for distinguishing between the quite alike urease - positive t. rubrum and t. rubrum var . the procedure is straightforward and can easily be modified for probe or melting curve assays . for the time being , it has to be approached with caution as only one t. rubrum var . raubitschekii isolate ( cbs 100084 ) has been analyzed in this way so far . at the moment , public whole genome sequencing projects include multiple t. rubrum and two t. rubrum var . the results of these projects may answer the question whether the urease allele of the cbs 100084 strain is the specific marker of all t. rubrum var . raubitschekii isolates , as suggested by hiruma et al . in the meantime , we encourage other researchers to reassess their t. rubrum var . rubrum , there seems to be a necessity of including both into the polish and other central european diagnostic schemes , as their identification obviously poses a challenge at the moment . moreover , it is noteworthy that the histopathological examination turned out to be very useful , if not necessary , in the diagnostic process . it enabled the adequate treatment to be implemented even before the results of the mycological cultures and molecular studies were available .\noutput:\n" }, { "from": "agent", "value": "we report a case of a 34 - year - old polish caucasian male who was diagnosed with tinea manuum caused by trichophyton rubrum var . raubitschekii . it would be the first described case of a dermatophytosis caused by this fungus in poland and one of a few cases in central europe described so far . admittedly , it would be the first case in central europe with no evidence pointing to african origin . the clinical condition improved after administering itraconazole ( daily dose 100 mg orally ) supplemented with a topical treatment , while the patient was totally cured after 2 months . the histopathological examination turned out to be highly useful in the diagnostic process . the genetic analysis of the urease gene pointed to a urease - positive t. rubrum rather than t. rubrum var . raubitschekii ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: g protein - coupled receptors ( gpcrs ) , also known as 7 - transmembrane ( 7tm ) domain receptors , comprise the largest and most diverse gene super - family in humans 1 % of the total protein - coding human genome . estimates of the exact number of gpcr genes vary but a recent phylogenetic analysis identified over 800 ( 1 ) . of these , 701 were classified within the rhodopsin family ( type a ) including 241 non - olfactory receptors . many protein coding genes are alternatively spliced giving rise to isoforms so the true number of functionally unique receptors may be much higher than estimates based on gene numbers . these gpcrs sense extracellular molecules and , through their interaction with g proteins , activate downstream signal transduction pathways . gpcrs respond to a huge range of stimuli , including light , odours , hormones , neurotransmitters and peptides ( 2 ) . gpcrs represent around half of cell surface drug targets ( 3 ) and are a very successful therapeutic target family for the pharmaceutical industry accounting for the majority of best - selling drugs , 30 % of all prescription pharmaceuticals on the market ( 4 ) . the potential for further exploitation remains high , as only 10 % of gpcrs are targeted by these marketed drugs ( 5 ) . information in reactome is captured by expert curators and peer - reviewed by experts in their fields of biology . the data is extensively cross - referenced to databases such as ensembl [ http://www.ensembl.org/index.html ( 6 ) ] , go [ http://www.ebi.ac.uk/quickgo/ ( 7 ) ] , pubmed ( http://www.ncbi.nlm.nih.gov/pubmed ) , chebi [ http://www.ebi.ac.uk/chebi/index.jsp ( 8 ) ] , uniprot [ http://www.uniprot.org/ ( 9 ) ] and omim [ http://www.ncbi.nlm.nih.gov/omim ( 10 ) ] . reactions can be viewed in the context of their pathways and interaction data can be overlaid to further expand the data richness . tools are available in reactome to help users with analyses such as pathway over - representation ( enrichment ) and pathway differential expression , and data including tables of pairwise proteinprotein interactions computed from manually curated reactions and complexes can be downloaded in a range of formats . iuphar - db ( international union of basic and clinical pharmacology , http://www.iuphar-db.org/ ) is a database of receptor nomenclature and drug classification . its gpcr section is arranged according to the sequence homology and functional similarity of these receptors . these resources were used as a starting point to catalogue the gpcr project in reactome . in uniprot , a query was constructed to search for all manually annotated and reviewed human gpcrs . gpcrs whose ligands were identified from published experimental data were captured via the curator tool , an interface which allows the curator to annotate and structure data in accord with reactome s frame - based data model , and commit the results to a central repository ( 11 ) . data was organized into the three main gpcr families , a / 1 , b / 2 and c / 3 . within each family , details were further structured based on the type of ligand . attributes of a reaction captured by reactome are : input molecule ( s ) output molecule ( s ) catalyst ( where appropriate ) compartment where reaction takes placeliterature referencespecieslinks to preceding reactions ( e.g. the causal connection between ligand binding and g - protein interaction ) membership in a pathwaytext summary of reactioncuratorexpert reviewer catalyst ( where appropriate ) compartment where reaction takes place links to preceding reactions ( e.g. the causal connection between ligand binding and g - protein interaction ) membership in a pathway text summary of reaction input and output entities can be composed of proteins , simple chemicals or combinations of these entities ( complexes ) . useful information captured from iuphar - db by the curation team included : the type of ligand the receptor bound , which helped in the organization of the project in reactome . ligands were represented if they are generally accepted in the literature to be the endogenous or natural onesliterature references associated with human receptorswhere appropriate , orthologous proteins in other speciesthe primary transduction mechanism , i.e. the g protein ( s ) that coupled with the receptor : ligand complexreceptor nomenclature the type of ligand the receptor bound , which helped in the organization of the project in reactome . ligands were represented if they are generally accepted in the literature to be the endogenous or natural ones literature references associated with human receptors where appropriate , orthologous proteins in other species the primary transduction mechanism , i.e. the g protein ( s ) that coupled with the receptor : ligand complex receptor nomenclature as of october 2009 , there were 356 gpcrs captured by the iuphar database . orphans are proteins classified as gpcr protein family members based on sequence similarity but whose endogenous ligands are unknown . these were investigated by reactome curators to determine if recent advances assigned ligands to some of them . from uniprot , we retrieved records for the three main families of human gpcrs with the query : family : g - protein coupled receptor and organism : human and reviewed : yes the query resulted in 836 protein matches . of these , 797 proteins matched the three main families ( a / 1 , b / 2 and c / 3 ) . we then queried iuphar - db and searched published literature to identify ligands for these proteins , with the results class a / 1726 uniprot records ; ligands found for 519 class b / 249 uniprot records ; ligands found for 29 class c / 322 uniprot records ; ligands found for 15 tables 1 . ( class a / 1 ) and 2 ( classes b / 2 and c / 3 ) show the gpcrs , their gene names and accession numbers , and the g protein with which each one interacts . table 1 . family a gpcr names , accession numbers and g protein coupled ( receptor names link out to the corresponding reaction in reactome ) gpcr family a receptorsgene nameacc . no.g subunit ( s ) coupledgpcr family a receptorsgene nameacc . no.g subunit ( s ) oupled5 - hydroxytryptamine receptor 1ahtr1ap08908itype - 2 angiotensin ii receptor ( at2 ) agtr2p50052i , q / 115 - hydroxytryptamine receptor 1bhtr1bp28222iapelin receptoraplnrp35414i5 - hydroxytryptamine receptor 1dhtr1dp28221ib1 bradykinin receptorbdkrb1p46663i , q / 115 - hydroxytryptamine receptor 1ehtr1ep28566ib2 bradykinin receptorbdkrb2p30411i , q / 115 - hydroxytryptamine receptor 1fhtr1fp30939ic5a anaphylatoxin chemotacticreceptorc5ar1p21730i5 - hydroxytryptamine receptor 2ahtr2ap28223q / 11cholecystokinin receptor type acckarp32238q / 115 - hydroxytryptamine receptor 2bhtr2bp41595q / 11c - c chemokine receptor type 10ccr10p46092i5 - hydroxytryptamine receptor 2chtr2cp28335q / 11c - c chemokine receptor type 1ccr1p32246i5 - hydroxytryptamine receptor 4htr4q13639sc - c chemokine receptor type 2ccr2p41597i5 - hydroxytryptamine receptor 5ahtr5ap47898ic - c chemokine receptor type 3ccr3p51677i5 - hydroxytryptamine receptor 6htr6p50406sc - c chemokine receptor type 4ccr4p51679i5 - hydroxytryptamine receptorhtr7p34969sc - c chemokine receptor type 5ccr5p51681iadenosine receptor a1adora1p30542ic - c chemokine receptor type 6ccr6p51684iadenosine receptor a2aadora2ap29274sc - c chemokine receptor type 7ccr7p32248iadenosine receptor a2badora2bp29275sc - c chemokine receptor type 8ccr8p51685iadenosine a3 receptoradora3p33765ic - c chemokine receptor type 9ccr9p51686imuscarinic acetylcholine receptor m1chrm1p11229q / 11cysteinyl leukotriene receptor 1cysltr1q9y271q / 11muscarinic acetylcholine receptor m2chrm2p08172icysteinyl leukotriene receptor 2cysltr2q9ns75q / 11muscarinic acetylcholine receptor m3chrm3p20309q / 11cannabinoid receptor 1cnr1p21554imuscarinic acetylcholine receptor m4chrm4p08173icannabinoid receptor 2cnr2p34972imuscarinic acetylcholine receptor m5chrm5p08912q / 11cx3c chemokine receptor 1cx3cr1p49238unknownadrenocorticotropic hormone receptormc2rq01718shigh affinity interleukin - 8 receptor ail8rap25024i - 1a adrenergic receptoradra1ap35348q / 11high affinity interleukin - 8 receptor bil8rbp25025i - 1b adrenergic receptoradra1bp35368q / 11c - x - c chemokine receptor type 3cxcr3p49682i - 1d adrenergic receptoradra1dp25100q / 11c - x - c chemokine receptor type 4cxcr4p61073i - 2a adrenergic receptoradra2ap08913ic - x - c chemokine receptor type 6cxcr6o00574i - 2b adrenergic receptoradra2bp18089ic - x - c chemokine receptor type 7cxcr7p25106i - 2c adrenergic receptoradra2cp18825id ( 1a ) dopamine receptordrd1p21728s - 1 adrenergic receptoradrb1p08588sd ( 2 ) dopamine receptordrd2p14416i - 2 adrenergic receptoradrb2p07550sd ( 3 ) dopamine receptordrd3p35462i - 3 adrenergic receptoradrb3p13945sd ( 4 ) dopamine receptordrd4p21917itype - 1 angiotensin ii receptoragtr1p30556q / 11d ( 1b ) dopamine receptordrd5p21918sduffy antigen / chemokine receptordarcq16570unknownmelanocyte - stimulating hormone receptormc1rq01726sendothelin - 1 receptorednrap25101q / 11melatonin receptor type 1amtnr1ap48039iendothelin b receptorednrbp24530q / 11melatonin receptor type 1bmtnr1bp49286in - formyl peptide receptor 2fpr2p25090q / 11substance - p receptortacr1p25103q / 11follicle - stimulating hormone receptorfshrp23945ssubstance - k receptortacr2p21452q / 11galanin receptor type 1galr1p47211ineuromedin - k receptortacr3p29371q / 11galanin receptor type 2galr2o43603ineuromedin - b receptornmbrp28336q / 11galanin receptor type 3galr3o60755ineuropeptides b / w receptor type 1npbwr1p48145igastrin / cholecystokinin type b receptorcckbrp32239q / 11neuropeptides b / w receptor type 2npbwr2p48146igonadotropin - releasing hormone receptorgnrhrp30968q / 11neuropeptide ff receptor 1npffr1q9gzq6q / 11putative gonadotropin - releasing hormone ii receptorgnrhr2q96p88q / 11neuropeptide ff receptor 2npffr2q9y5x5q / 11g - protein coupled oestrogen receptor 1gperq99527ineuropeptide y receptor type 1npy1rp25929iuracil nucleotide / cysteinyl leukotriene receptorgpr17q13304i , q / 11neuropeptide y receptor type 2npy2rp49146iputative g - protein coupled receptor 44gpr44q9y5y4ineuropeptide y receptor type 4ppyr1p50391ig - protein coupled receptor 55gpr55q9y2t6ineuropeptide y receptor type 5npy5rq15761igastrin - releasing peptide receptorgrprp30550q / 11neurotensin receptor type 1ntsr1p30989q / 11histamine h1 receptorhrh1p35367q / 11neurotensin receptor type 2ntsr2o95665q / 11histamine h2 receptorhrh2p25021solfactoryreceptor 10a2or10a2q9h208olfhistamine h3 receptorhrh3q9y5n1iolfactory receptor 10a3or10a3p58181olfhistamine h4 receptorhrh4q9h3n8iolfactory receptor 10a4or10a4q9h209olfkiss - 1 receptorkiss1rq969f8q / 11olfactory receptor 10a5or10a5q9h207olflysophosphatidic acid receptor 1lpar1q92633i , q / 11olfactory receptor 10a6or10a6q8nh74olflysophosphatidic acid receptor 2lpar2q9hbw0i , q / 11olfactory receptor 10a7or10a7q8nge5olflysophosphatidic acid receptor 3lpar3q9uby5i , q / 11olfactory receptor 10ad1or10ad1q8nge0olflysophosphatidic acid receptor 4lpar4q99677q / 11olfactory receptor 10ag1or10ag1q8nh19olflysophosphatidic acid receptor 6lpar6p43657q / 11olfactory receptor 10c1or10c1q96kk4olflutropin - choriogonadotropic hormone receptorlhcgrp22888solfactory receptor 10g2or10g2q8ngc3olfleukotriene b4 receptor 1ltb4rq15722q / 11olfactory receptor 10g3or10g3q8ngc4olfleukotriene b4 receptor 2ltb4r2q9npc1q / 11olfactory receptor 10g4or10g4q8ngn3olfmelanocortin receptor 3mc3rp41968solfactory receptor 10g6or10g6q8nh81olfmelanocortin receptor 4mc4rp32245solfactory receptor 10g7or10g7q8ngn6olfmelanocortin receptor 5mc5rp33032solfactory receptor 10g8or10g8q8ngn5olfolfactory receptor 10g9or10g9q8ngn4olfolfactory receptor 2t10or2t10q8ngz9olfolfactory receptor 10h1or10h1q9y4a9olfolfactory receptor 2t11or2t11q8nh01olfolfactory receptor 10h2or10h2o60403olfolfactory receptor 2t12or2t12q8ng77olfolfactory receptor 10h3or10h3o60404olfolfactory receptor 2t27or2t27q8nh04olfolfactory receptor 10h4or10h4q8nga5olfolfactory receptor 2t29or2t29q8nh02olfolfactory receptor 10h5or10h5q8nga6olfolfactory receptor 2t33or2t33q8ng76olfolfactory receptor 10j1or10j1p30954olfolfactory receptor 2t34or2t34q8ngx1olfolfactory receptor 10j3or10j3q5jrs4olfolfactory receptor 2t35or2t35q8ngx2olfolfactory receptor 10j5or10j5q8nhc4olfolfactory receptor 4a15or4a15q8ngl6olfolfactory receptor 10k1or10k1q8ngx5olfolfactory receptor 4a16or4a16q8nh70olfolfactory receptor 10k2or10k2q6if99olfolfactory receptor 4a47or4a47q6if82olfolfactory receptor 10p1or10p1q8nge3olfolfactory receptor 4c45or4c45a6nmz5olfolfactory receptor 10q1or10q1q8ngq4olfolfactory receptor 4c46or4c46a6nha9olfolfactory receptor 10r2or10r2q8ngx6olfolfactory receptor 4f15or4f15q8ngb8olfolfactory receptor 10s1or10s1q8ngn2olfolfactory receptor 4f17or4f17q8nga8olfolfactory receptor 10t2or10t2q8ngx3olfolfactory receptor 4f21or4f21o95013olfolfactory receptor 10v1or10v1q8ngi7olfolfactory receptor 51a2or51a2q8ngj7olfolfactory receptor 10w1or10w1q8ngf6olfolfactory receptor 51a4or51a4q8ngj6olfolfactory receptor 14a2or14a2q96r54olfolfactory receptor 51a7or51a7q8nh64olfolfactory receptor 14c36or14c36q8nhc7olfolfactory receptor 51b2or51b2q9y5p1olfolfactory receptor 14i1or14i1a6nd48olfolfactory receptor 51b4or51b4q9y5p0olfolfactory receptor 14j1or14j1q9ugf5olfolfactory receptor 51b5or51b5q9h339olfolfactory receptor 14k1or14k1q8ngz2olfolfactory receptor 51b5or51b6q9h340olfolfactory receptor 2a12or2a12q8ngt7olfolfactory receptor 51d1or51d1q8ngf3olfolfactory receptor 2a14or2a14q96r47olfolfactory receptor 51e1or51e1q8tcb6olfolfactory receptor 2a25or2a25a4d2g3olfolfactory receptor 51e2or51e2q9h255olfolfactory receptor 2ag1or2ag1q9h205olfolfactory receptor 51f1or51f1a6ngy5olfolfactory receptor 2ag2or2ag2a6nm03olfolfactory receptor 51f2or51f2q8nh61olfolfactory receptor 2aj1or2aj1q8ngz0olfolfactory receptor 51g1or51g1q8ngk1olfolfactory receptor 2ak2or2ak2q8ng84olfolfactory receptor 51g2or51g2q8ngk0olfolfactory receptor 2ap1or2ap1q8nge2olfputative olfactory receptor 51h1or51h1pq8nh63olfolfactory receptor 2at4or2at4a6nnd4olfolfactory receptor 51i1or51i1q9h343olfolfactory receptor 51i2or51i2q9h344olfolfactory receptor 56a1or56a1q8ngh5olfolfactory receptor 51j1or51j1q9h342olfolfactory receptor 56a3or56a3q8nh54olfolfactory receptor 51l1or51l1q8ngj5olfolfactory receptor 56a4or56a4q8ngh8olfolfactory receptor 51m1or51m1q9h341olfolfactory receptor 56a5or56a5p0c7t3olfolfactory receptor 51q1or51q1q8nh59olfolfactory receptor 56b1or56b1q8ngi3olfolfactory receptor 51s1or51s1q8ngj8olfolfactory receptor 56b4or56b4q8nh76olfolfactory receptor 51t1or51t1q8ngj9olfolfactory receptor 5ac2or5ac2q9nzp5olfolfactory receptor 51v1or51v1q9h2c8olfolfactory receptor 5ak2or5ak2q8nh90olfolfactory receptor 52a1or52a1q9ukl2olfolfactory receptor 5an1or5an1q8ngi8olfolfactory receptor 52a5or52a5q9h2c5olfolfactory receptor 5ap2or5ap2q8ngf4olfolfactory receptor 52b2or52b2q96rd2olfolfactory receptor 5ar1or5ar1q8ngp9olfolfactory receptor 52b4or52b4q8ngk2olfolfactory receptor 5as1or5as1q8n127olfolfactory receptor 52b6or52b6q8ngf0olfolfactory receptor 5au1or5au1q8ngc0olfolfactory receptor 52d1or52d1q9h346olfolfactory receptor 5h14or5h14a6nhg9olfolfactory receptor 52e2or52e2q8ngj4olfolfactory receptor 5h15or5h15a6ndh6olfolfactory receptor 52e4or52e4q8ngh9olfolfactory receptor 6c65or6c65a6njz3olfolfactory receptor 52e5or52e5q8nh55olfolfactory receptor 6c68or6c68a6ndl8olfolfactory receptor 52e6or52e6q96rd3olfolfactory receptor 6c70or6c70a6nij9olfolfactory receptor 52e8or52e8q6ifg1olfolfactory receptor 6c74or6c74a6ncv1olfolfactory receptor 52h1or52h1q8ngj2olfolfactory receptor 6c75or6c75a6nl08olfolfactory receptor 52i1or52i1q8ngk6olfolfactory receptor 6c76or6c76a6nm76olfolfactory receptor 52i2or52i2q8nh67olfolfactory receptor 7e24or7e24q6ifn5olfolfactory receptor 52k1or52k1q8ngk4olfopsin - 3opn3q9h1y3tolfactory receptor 52k2or52k2q8ngk3olfmelanopsinopn4q9uhm6q / 11olfactory receptor 52l1or52l1q8ngh7olfopsin - 5opn5q6u736tolfactory receptor 52m1or52m1q8ngk5olf - type opioid receptoroprd1p41143iolfactory receptor 52n1or52n1q8nh53olf - type opioid receptoroprk1p41145iolfactory receptor 52n2or52n2q8ngi0olf - type opioid receptoroprm1p35372iolfactory receptor 52n4or52n4q8ngi2olfnociceptin receptoroprl1p41146iolfactory receptor 52n5or52n5q8nh56olfblue - sensitive opsinopn1swp03999tolfactory receptor 52r1or52r1q8ngf1olfrhodopsinrhop08100tolfactory receptor 52w1or52w1q6if63olfgreen - sensitive opsinopn1mwp04001tred - sensitive opsinopn1lwp04000tolfactory receptor 2b11or2b11q5jqs5olfvisual pigment - like receptor peropsinrrho14718tolfactory receptor 2c1or2c1o95371olfolfactory receptor 1a1or1a1q9p1q5olfolfactory receptor 2c3or2c3q8n628olfolfactory receptor 1a2or1a2q9y585olfolfactory receptor 2d2or2d2q9h210olfolfactory receptor 1b1or1b1q8ngr6olfolfactory receptor 2d3or2d3q8ngh3olfolfactory receptor 1c1or1c1q15619olfolfactory receptor 2f1or2f1q13607olfolfactory receptor 1d2or1d2p34982olfolfactory receptor 2f2or2f2o95006olfolfactory receptor 1f1or1f1o43749olfolfactory receptor 2g2or2g2q8ngz5olfolfactory receptor 1f12or1f12q8nha8olfolfactory receptor 2g3or2g3q8ngz4olfolfactory receptor 1g1or1g1p47890olfolfactory receptor 2g6or2g6q5tz20olfolfactory receptor 1i1or1i1o60431olfolfactory receptor 2h1or2h1q9gzk4olfolfactory receptor 1j1or1j1q8ngs3olfolfactory receptor 2h2or2h2o95918olfolfactory receptor 1j2or1j2q8ngs2olfputative olfactory receptor 2i1or2i1pq8ngu4olfolfactory receptor 1j4or1j4q8ngs1olfolfactory receptor 2j1or2j1q9gzk6olfolfactory receptor 1k1or1k1q8ngr3olfolfactory receptor 2j2or2j2o76002olfolfactory receptor 1l1or1l1q8nh94olfolfactory receptor 2j3or2j3o76001olfolfactory receptor 1l3or1l3q8nh93olfolfactory receptor 2k2or2k2q8ngt1olfolfactory receptor 1l4or1l4q8ngr5olfolfactory receptor 2l2or2l2q8nh16olfolfactory receptor 1l6or1l6q8ngr2olfolfactory receptor 2l3or2l3q8ng85olfolfactory receptor 1l8or1l8q8ngr8olfolfactory receptor 2l5or2l5q8ng80olfolfactory receptor 1m1or1m1q8nga1olfolfactory receptor 2l8or2l8q8ngy9olfolfactory receptor 1n1or1n1q8ngs0olfolfactory receptor 2l13or2l13q8n349olfolfactory receptor 1n2or1n2q8ngr9olfolfactory receptor 2m2or2m2q96r28olfolfactory receptor 1q1or1q1q15612olfolfactory receptor 2m3or2m3q8ng83olfolfactory receptor 1s1or1s1q8nh92olfolfactory receptor 2m4or2m4q96r27olfolfactory receptor 1s2or1s2q8ngq3olfolfactory receptor 2m5or2m5a3kft3olfolfactory receptor 2a2or2a2q6if42olfolfactory receptor 2m7or2m7q8ng81olfolfactory receptor 2a4or2a4o95047olfolfactory receptor 2s2or2s2q9nqn1olfolfactory receptor 2b2or2b2q9gzk3olfolfactory receptor 2t1or2t1o43869olfputative olfactory receptor 2b3or2b3o76000olfolfactory receptor 2t2or2t2q6if00olfolfactory receptor 2b6or2b6p58173olfolfactory receptor 2t3or2t3q8nh03olfputative olfactory receptor 2b8or2b8pp59922olfolfactory receptor 2t4or2t4q8nh00olfolfactory receptor 2t5or2t5q6iez7olfolfactory receptor 4e1or4e1p0c645olfolfactory receptor 2t6or2t6q8nhc8olfolfactory receptor 4e2or4e2q8ngc2olfolfactory receptor 2t8or2t8a6nh00olfolfactory receptor 4f3 / 4f16 / 4f29or4f3q6iey1olfolfactory receptor 2v1or2v1q8nhb1olfolfactory receptor 4f4or4f4q96r69olfolfactory receptor 2v2or2v2q96r30olfolfactory receptor 4f5or4f5q8nh21olfolfactory receptor 2w1or2w1q9y3n9olfolfactory receptor 4f6or4f6q8ngb9olfolfactory receptor 2w3or2w3q7z3t1olfolfactory receptor 4k1or4k1q8ngd4olfolfactory receptor 2y1or2y1q8ngv0olfolfactory receptor 4k2or4k2q8ngd2olfolfactory receptor 2z1or2z1q8ng97olfolfactory receptor 4k3or4k3q96r72olfolfactory receptor 3a1or3a1p47881olfolfactory receptor 4k5or4k5q8ngd3olfolfactory receptor 3a2or3a2p47893olfolfactory receptor 4k13or4k13q8nh42olfolfactory receptor 3a3or3a3p47888olfolfactory receptor 4k14or4k14q8ngd5olfolfactory receptor 3a4or3a4p47883olfolfactory receptor 4k15or4k15q8nh41olfputative olfactory receptor 4a4or4a4pq8ngn8olfolfactory receptor 4k17or4k17q8ngc6olfolfactory receptor 4a5or4a5q8nh83olfolfactory receptor 4l1or4l1q8nh43olfolfactory receptor 4a8or4a8pp0c604olfolfactory receptor 4m1or4m1q8ngd0olfolfactory receptor 4b1or4b1q8ngf8olfolfactory receptor 4m2or4m2q8ngb6olfolfactory receptor 4c3or4c3q8nh37olfolfactory receptor 4n2or4n2q8ngd1olfolfactory receptor 4c5or4c5q8ngb2olfolfactory receptor 4n4or4n4q8n0y3olfolfactory receptor 4c6or4c6q8nh72olfolfactory receptor 4n5or4n5q8ixe1olfolfactory receptor 4c11or4c11q6iev9olfolfactory receptor 4p4or4p4q8ngl7olfolfactory receptor 4c12or4c12q96r67olfolfactory receptor 4q2or4q2p0c623olfolfactory receptor 4c13or4c13q8ngp0olfolfactory receptor 4q3or4q3q8nh05olfolfactory receptor 4c15or4c15q8ngm1olfolfactory receptor 4s1or4s1q8ngb4olfolfactory receptor 4c16or4c16q8ngl9olfolfactory receptor 4s2or4s2q8nh73olfolfactory receptor 4d1or4d1q15615olfolfactory receptor 4x1or4x1q8nh49olfolfactory receptor 4d2or4d2p58180olfolfactory receptor 4x2or4x2q8ngf9olfolfactory receptor 4d5or4d5q8ngn0olfolfactory receptor 5a1or5a1q8ngj0olfolfactory receptor 4d6or4d6q8ngj1olfolfactory receptor 5a2or5a2q8ngi9olfolfactory receptor 4d9or4d9q8nge8olfolfactory receptor 5b2or5b2q96r09olfolfactory receptor 4d10or4d10q8ngi6olfolfactory receptor 5b3or5b3q8nh48olfolfactory receptor 4d11or4d11q8ngi4olfolfactory receptor 5b12or5b12q96r08olfolfactory receptor 5b17or5b17q8ngf7olfolfactory receptor 6a2or6a2o95222olfolfactory receptor 5b21or5b21a6nl26olfolfactory receptor 6b1or6b1o95007olfolfactory receptor 5c1or5c1q8ngr4olfolfactory receptor 6b2or6b2q6ifh4olfolfactory receptor 5d13or5d13q8ngl4olfolfactory receptor 6b3or6b3q8ngw1olfolfactory receptor 5d14or5d14q8ngl3olfolfactory receptor 6c1or6c1q96rd1olfolfactory receptor 5d16or5d16q8ngk9olfolfactory receptor 6c2or6c2q9nzp2olfolfactory receptor 5d18or5d18q8ngl1olfolfactory receptor 6c3or6c3q9nzp0olfolfactory receptor 5f1or5f1o95221olfolfactory receptor 6c4or6c4q8nge1olfolfactory receptor 5h1or5h1a6nkk0olfolfactory receptor 6c6or6c6a6nf89olfolfactory receptor 5h2or5h2q8ngv7olfolfactory receptor 6f1or6f1q8ngz6olfolfactory receptor 5h6or5h6q8ngv6olfolfactory receptor 6j1or6j1q8ngc5olfolfactory receptor 5i1or5i1q13606olfolfactory receptor 6k2or6k2q8ngy2olfolfactory receptor 5j2or5j2q8nh18olfolfactory receptor 6k3or6k3q8ngy3olfolfactory receptor 5k1or5k1q8nhb7olfolfactory receptor 6k6or6k6q8ngw6olfolfactory receptor 5k2or5k2q8nhb8olfolfactory receptor 6m1or6m1q8ngm8olfolfactory receptor 5k3or5k3a6net4olfolfactory receptor 6n1or6n1q8ngy5olfolfactory receptor 5k4or5k4a6nms3olfolfactory receptor 6n2or6n2q8ngy6olfolfactory receptor 5l1or5l1q8ngl2olfolfactory receptor 6p1or6p1q8ngx9olfolfactory receptor 5l2or5l2q8ngl0olfolfactory receptor 6q1or6q1q8ngq2olfolfactory receptor 5m1or5m1q8ngp8olfolfactory receptor 6s1or6s1q8nh40olfolfactory receptor 5m3or5m3q8ngp4olfolfactory receptor 6t1or6t1q8ngn1olfolfactory receptor 5m8or5m8q8ngp6olfolfactory receptor 6v1or6v1q8n148olfolfactory receptor 5m9or5m9q8ngp3olfolfactory receptor 6x1or6x1q8nh79olfolfactory receptor 5m10or5m10q6ieu7olfolfactory receptor 6y1or6y1q8ngx8olfolfactory receptor 5m11or5m11q96rb7olfolfactory receptor 7a5or7a5q15622olfolfactoryreceptor 5p2or5p2q8wz92olfolfactory receptor 7a10or7a10o76100olfolfactory receptor 5p3or5p3q8wz94olfolfactory receptor 7a17or7a17o14581olfolfactory receptor 5r1or5r1q8nh85olfolfactory receptor 7c1or7c1o76099olfolfactory receptor 5t1or5t1q8ng75olfolfactory receptor 7c2or7c2o60412olfolfactory receptor 5t2or5t2q8ngg2olfolfactory receptor 7d4or7d4q8ng98olfolfactory receptor 5t3or5t3q8ngg3olfolfactory receptor 7g1or7g1q8nga0olfolfactory receptor 5w2or5w2q8nh69olfolfactory receptor 7g2or7g2q8ng99olfolfactory receptor 7g3or7g3q8ng95olfprostaglandin f2 - receptorptgfrp43088q / 11olfactory receptor 8a1or8a1q8ngg7olfprostacyclin receptorptgirp43119solfactory receptor 8b3or8b3q8ngg8olfprolactin - releasing peptide receptorprlhrp49683unknownolfactory receptor 8b4or8b4q96rc9olfplatelet - activating factor receptorptafrp25105q / 11olfactory receptor 8b8or8b8q15620olfpyroglutamylated rfamide peptide receptorqrfprq96p65q / 11olfactory receptor 8b12or8b12q8ngg6olfrpe - retinal g protein - coupled receptorrgrp47804tolfactory receptor 8d1or8d1q8wz84olfsphingosine 1 - phosphate receptor 1s1pr1p21453iolfactory receptor 8d2or8d2q9gzm6olfsphingosine 1 - phosphate receptor 2s1pr2o95136i , q / 11olfactory receptor 8d4or8d4q8ngm9olfsphingosine 1 - phosphate receptor 3s1pr3q99500i , q / 11 , 12 / 13orexin receptor type 1hcrtr1o43613q / 11sphingosine 1 - phosphate receptor 4s1pr4o95977iorexin receptor type 2hcrtr2o43614q / 11sphingosine 1 - phosphate receptor 5s1pr5q9h228ioxoeicosanoid receptor 1oxer1q8tds5isomatostatin receptor type 1sstr1p30872ioxytocin receptoroxtrp30559q / 11somatostatin receptor type 2sstr2p30874ip2y purinoceptor 1p2ry1p47900q / 11somatostatin receptor type 3sstr3p32745ip2y purinoceptor2p2ry2p41231q / 11somatostatin receptor type 4sstr4p31391ip2y purinoceptor 4p2ry4p51582isomatostatin receptor type 5sstr5p35346ip2y purinoceptor 6p2ry6q15077q / 11thromboxane a2 receptortbxa2rp21731q / 11 , 13p2y purinoceptor 8p2ry8q86vz1unknowntrace amine - associated receptor 1taar1q96rj0sputative p2y purinoceptor 10p2ry10o00398q / 11trace amine - associated receptor 2taar2q9p1p5sp2y purinoceptor 11p2ry11q96g91s , q / 11putative trace amine - associated receptor 3taar3q9p1p4sp2y purinoceptor 12p2ry12q9h244itrace amine - associated receptor 5taar5o14804sp2y purinoceptor 13p2ry13q9bpv8itrace amine - associated receptor 6taar6q96ri8sp2y purinoceptor 14p2ry14q15391itrace amine - associated receptor 8taar8q969n4sproteinase - activated receptor 1f2rp25116q / 11trace amine - associated receptor 9taar9q96ri9sproteinase - activated receptor 2f2rl1p55085q / 11thyrotropin receptortshrp16473sproteinase - activated receptor 3f2rl2o00254q / 11vasopressin v1a receptoravpr1ap37288q / 11proteinase - activated receptor 4f2rl3q96ri0q / 11vasopressin v1b receptoravpr1bp47901q / 11prostaglandin d2 receptorptgdrq13258svasopressin v2 receptoravpr2p30518sprostaglandin e2 receptor ep1 subtypeptger1p34995q / 11chemokine xc receptor 1xcr1p46094q / 11prostaglandin e2 receptor ep2 subtypeptger2p43116sprostaglandin e2 receptor ep3 subtypeptger3p43115iprostaglandin e2 receptor ep4 subtypeptger4p35408s table 2 . family b and c gpcr names , accession numbers and g protein coupled ( gpcr names link out to the corresponding reactome reaction ) gpcr family 2 / b receptorsgene nameacc . no.g subunit ( s ) coupledgpcr family 3 / c receptorsgene nameacc . no.g subunit ( s ) coupledbrain - specific angiogenesis inhibitor 1bai1o14514unknownextracellular calcium - sensing receptorcasrp41180i , q / 11brain - specific angiogenesis inhibitor 2bai2o60241unknowngaba type b receptor 1subunit 1gabbr1q9ubs5ibrain - specific angiogenesis inhibitor 3bai3o60242unknowngaba type b receptor subunit 2gabbr2o75899icalcitonin receptorcalcrp30988sgpcr family c group 6 member agprc6aq5t6x5q / 11calcitonin gene - related peptide type 1 receptorcalcrlq16602smetabotropicglutamate receptor 1grm1q13255q / 11corticotropin - releasing factor receptor 1crhr1p34998smetabotropic glutamate receptor 2grm2q14416icorticotropin - releasing factor receptor 2crhr2q13324smetabotropic glutamate receptor 3grm3q14832igrowth hormone - releasing hormone receptorghrhrq02643smetabotropic glutamate receptor 4grm4q14833igastric inhibitory polypeptide receptorgiprp48546smetabotropic glutamate receptor 5grm5p41594q / 11glucagon - like peptide 1 receptorglp1rp43220smetabotropic glutamate receptor 6grm6o15303iglucagon - like peptide 2 receptorglp2ro95838smetabotropic glutamate receptor 7grm7q14831iglucagon receptorgcgrp47871q / 11 , smetabotropic glutamate receptor 8grm8o00222ipituitary adenylate cyclase - activating polypeptide type i receptoradcyap1r1p41586staste receptor 1 member 1tas1r1q7rtx1unknowntaste receptor 1 member 2tas1r2q8te23unknownparathyroid hormone receptor 1pth1rq03431staste receptor 1 member 3tas1r3q7rtx0unknownparathyroid hormone 2 receptorpth2rp49190ssecretin receptorsctrp47872svasoactive intestinal polypeptide receptor 1vipr1p32241svasoactive intestinal polypeptide receptor 2vipr2p41587sfrizzled - 10fzd10q9ulw2ifrizzled - 1fzd1q9up38ifrizzled - 2fzd2q14332ifrizzled - 3fzd3q9npg1ifrizzled - 4fzd4q9ulv1ifrizzled - 5fzd5q13467ifrizzled - 6fzd6o60353ifrizzled - 7fzd7o75084ifrizzled - 8fzd8q9h461ifrizzled - 9fzd9 ( fzd3 ) o00144ismoothened homologuesmo ( smoh ) q99835i family a gpcr names , accession numbers and g protein coupled ( receptor names link out to the corresponding reaction in reactome ) family b and c gpcr names , accession numbers and g protein coupled ( gpcr names link out to the corresponding reactome reaction ) of 797 gpcrs in families a / 1c / 3 screened from uniprot , we were able to catalogue 563 gpcrs that have ligands ( 70 % ) , supported by information from iuphar and appropriate literature references . we believe the remainder ( 234 ) to be true orphans i.e. no credible endogenous ligands have been determined for these receptors . the project can be viewed here : http://www.reactome.org/cgi-bin/eventbrowser?db=gk_current&id=372790 an on - line description of the features of these web pages and of additional pathway analysis tools that can be applied to the data is available here : http://www.reactome.org/userguide/usersguide.html for each class , there are further subdivisions of the hierarchy , organized into ligand types that bind particular gpcrs . first and foremost , this addition to reactome provides a computationally - accessible resource for information about ligand - binding gpcrs . the three main families in human are annotated , together with downstream signalling events mediated by coupling to the appropriate g protein . each receptor protein record has multiple link - outs to key databases related to sequence , genetic disorders , ontology and literature , further enriching the information a user can view . these annotations of gpcrs by protein family complement the extensive annotation by ligand specificity previously compiled by alexander and colleagues ( 12 ) . a total of 563 ligand - binding gpcrs were identified and included in reactome ; an additional 234 with no identifiable ligand were not . in many cases , these gpcrs have been identified and classified based on their interaction when expressed in a model cultured cell with members of a small set of standard test odorant molecules . these studies are generally accepted as establishing the olfactory receptor function of these gpcrs , albeit without identifying the odorant molecule ( s ) with which they interact under physiological conditions ( 13 ) . though the absence of any identified ligand presents problems for the pharmaceutical industry and for researchers wishing to study a receptor using a tool agonist , orphan receptors can be of interest when linked to a particular subcellular location and / or physiological process . for instance , the predominantly dorsal root ganglion expressed mrgx family of receptors have been extensively studied because of their narrow and therapeutically interesting expression profile ( 14 ) . the pathway contexts provided by reactome annotation provide an additional functional grouping that may be useful in generating testable hypotheses about roles of orphan gpcrs . orphan gpcrs have been the subject of intensive research including ligand screening by pharmaceutical companies for many years ( 15,16 ) , so why do so many gpcrs have no identified ligand ? there are several reasons why the endogenous ligands are still undetermined for some orphan gpcrs : they may be accessory proteins that enable another gpcr to function . the classic example of this is the gabab receptor , which functions as an obligate dimer ( 17 ) . dimerization may be the minimum functional state of gpcrs ( 18 ) and heterodimers may be common . some orphan receptors may only be functional when they form a heterodimer . this adds a level of complexity that has not been systematically addressed by ligand screening because of the difficulties inherent in simultaneously expressing two receptors.they themselves may need an as yet unknown accessory protein to respond to their ligand . the prime example of this is the amylin ( amy ) receptor which is a dimer composed of a calcitonin receptor and one of three ramps to create amy1 - 3 receptors ( 19,20 ) . other examples of accessory proteins that modify receptor surface expression include the reep and rtps ( 21 ) . they may not signal via g proteins i.e. they may have some other downstream effector . there are numerous examples of gpcr signalling that is independent of g proteins ( 22 ) ; a receptor that only signals via these mechanisms is unlikely to be identified by a ligand screening exercise using any of the established technologies.they may require the presence of an accessory protein for successful signalling ( 23 ) that is not present in the assay systems routinely used for ligand identification.ligand screening platforms used to date are unable to detect g12 / 13 coupled receptors , indeed g12 / 13 signalling is rarely measured directly , but inferred from remote downstream events ( 24 ) . the g12 / 13 signalling route has only recently been studied in any detail ( 25 ) so perhaps a portion of orphans fall into this category . this point could be extended to suggest that none of the ligand screening technologies are optimal for every receptor subtype . it could be that some ligand receptor interactions have been missed because the signal was not detectable using the technology available . newly emerging technologies such as surface plasmon resonance may help to address this ( 26 ) . the classic example of this is the gabab receptor , which functions as an obligate dimer ( 17 ) . dimerization may be the minimum functional state of gpcrs ( 18 ) and heterodimers may be common . this adds a level of complexity that has not been systematically addressed by ligand screening because of the difficulties inherent in simultaneously expressing two receptors . they themselves may need an as yet unknown accessory protein to respond to their ligand . the prime example of this is the amylin ( amy ) receptor which is a dimer composed of a calcitonin receptor and one of three ramps to create amy1 - 3 receptors ( 19,20 ) . other examples of accessory proteins that modify receptor surface expression include the reep and rtps ( 21 ) . they may not signal via g proteins i.e. they may have some other downstream effector . there are numerous examples of gpcr signalling that is independent of g proteins ( 22 ) ; a receptor that only signals via these mechanisms is unlikely to be identified by a ligand screening exercise using any of the established technologies . they may require the presence of an accessory protein for successful signalling ( 23 ) that is not present in the assay systems routinely used for ligand identification . ligand screening platforms used to date are unable to detect g12 / 13 coupled receptors , indeed g12 / 13 signalling is rarely measured directly , but inferred from remote downstream events ( 24 ) . the g12 / 13 signalling route has only recently been studied in any detail ( 25 ) so perhaps a portion of orphans fall into this category . this point could be extended to suggest that none of the ligand screening technologies are optimal for every receptor subtype . it could be that some ligand receptor interactions have been missed because the signal was not detectable using the technology available . newly emerging technologies such as surface plasmon resonance may help to address this ( 26 ) . overlaying protein protein interaction data e.g. from intact on the curated reactome gpcr dataset may provide a powerful approach for identifying candidate heterodimer partners and their potential functions and thus provides a novel tool for the study of orphan receptors ( 27 ) . overlaying protein - small molecule data from resources such as pubchem , chembl or proprietary sources may enable identification of cofactors or modulators and could identify novel lead compounds . reactome contains several tools for the analysis of large - scale data sets that the user can submit to the resource . results of such analyses are exportable in many formats from png images to systems biology data standards such as biopax and sbml . some key features of the data in reactome are : data in reactome is free and open - sourcedata can be analysed by the skypainter tool in reactome to perform pathway enrichment analysis or expression analysisreactome contains orthologue predictions to many model organisms , providing a template for analysing structure - function conservation in gpcr gene families across speciesbulk querying of reactome data can be easily performed using the biomart tool . features accessed from the pathway diagrams page ( entity level views or elvs ) protein : protein interaction overlays could potentially provide researchers with a starting point for novel drug targetsprotein : drug interaction overlays could help to distinguish potentially useful drugs that act on a narrow range of similar processes from ones likely to have adverse effects because they interact with many proteins or with proteins involved in a diverse range of processes . data in reactome is free and open - source data can be analysed by the skypainter tool in reactome to perform pathway enrichment analysis orexpression analysis reactome contains orthologue predictions to many model organisms , providing a template for analysing structure - function conservation in gpcr gene families across species bulk querying of reactome data can be easily performed using theprotein : protein interaction overlays could potentially provide researchers with a starting point for novel drug targets protein : drug interaction overlays could help to distinguish potentially useful drugs that act on a narrow range of similar processes from ones likely to have adverse effects because they interact with many proteins or with proteins involved in a diverse range of processes . national human genome research institute at the national institutes of health ( p41 hg003751 ) ; european union 6th framework programme enfin ( lshg - ct - 2005 - 518254 ) . funding for open access charge : national institutes of health ( p41 hg003751 ) .\noutput:\n" }, { "from": "agent", "value": "reactome is an open - source , freely available database of human biological pathways and processes . a major goal of our work is to provide an integrated view of cellular signalling processes that spans from ligand receptor interactions to molecular readouts at the level of metabolic and transcriptional events . to this end , we have built the first catalogue of all human g protein - coupled receptors ( gpcrs ) known to bind endogenous or natural ligands . the uniprot database has records for 797 proteins classified as gpcrs and sorted into families a / 1 , b / 2 and c / 3 on the basis of amino accid sequence . to these records we have added details from the iuphar database and our own manual curation of relevant literature to create reactions in which 563 gpcrs bind ligands and also interact with specific g - proteins to initiate signalling cascades . we believe the remaining 234 gpcrs are true orphans . the reactome gpcr pathway can be viewed as a detailed interactive diagram and can be exported in many forms . it provides a template for the orthology - based inference of gpcr reactions for diverse model organism species , and can be overlaid with protein protein interaction and gene expression datasets to facilitate overrepresentation studies and other forms of pathway analysis.database url : http://www.reactome.org" } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: probiotics are considered as live microorganisms which when administered in sufficient amounts bestow a health benefit on the host .1 they have been used to improve gastrointestinal health , and their fame has aggravated increased interest for their role in the promotion of oral health also . the concept of probiotics developed from elie metchnikoff 's proposal that the bacteria in fermented products could compete with ailment causing microbes , which are detrimental and health - compromising and thus minimize their ill - effects .2 probiotics can improve patient condition in medical disorders such as diarrhea , gastroenteritis , short - bowel syndrome , inflammatory intestinal diseases ( crohn 's disease and ulcerative colitis ) , cancer , immunosuppressive states , inadequate lactase digestion , pediatric allergies , growth retardation , hyperlipidemia , liver diseases , infections with helicobacter pylori and genitourinary tract infections .3 - 5 ingestion of probiotics in any type , such as in food substances ( cheese , yogurt , fermented milk , fruit juice or chewing gum ) or as available in tablets and capsules , has provoked a health gaining effect on oral tissues like reducing the incidence of dental caries , improved management of periodontitis , abridged halitosis and oral candidal infections .4 hence , this study was carried out to access the influence of probiotics in the form of curd , added to the daily diet of the study group to find the effect on the salivary levels of streptococcus mutans and lactobacilli at initial intervention and after 1 - year of follow - up . this prospective study was planned and carried out in the department of oral pathology in association with microbiology department . a verbal and signed inform consent was obtained from the children and the concerned personages ( teachers and parents ) were also notified regarding the same . government primary school children aged 10 - 15 years were examined and a total of 20 healthy children free from any form of mucosal or dental abnormalities and caries were included in the present study , out of which 15 were engaged as experimental group who were given curd containing probiotic bacteria approximately 200 g ( 1 bowl ) in their daily morning diet and 5 as control group who were denied of food containing probiotics over a period of 1 - year . the curd was procured commercially from the same manufacturer by the authors and was given to the experimental group . the counts of s. mutans and lactobacilli in saliva of these subjects were determined twice by using dentocult sm strip mutans and dentocult lactobacilli strip ( orion diagnostica , espoo , finland ) at the initial intervention and after a follow - up period of 1 - year . caries scores were recorded before the commencement of the study and after the period of 1 - year . to estimate s. mutans , children were instructed to swallow excess saliva and then the rough surface of round tipped strip was pressed against the saliva remaining on tongue . the strips were then placed in a selective culture broth supplied by the manufacturer ; which were then labeled and incubated in an upright position at 37c for 48 h. the cap was opened one - quarter of a turn to allow growth of the organisms as per the instructions given by the manufacturer ( figure 1 ) . after incubation , the presence of s. mutans was established by identifying light - blue to dark - blue raised colonies on the inoculated area of the strip . the results were assessed according to the manufacturer 's guidelines as follows : class 0 : 10,000 cfu / ml , class 1 : 100,000 cfu / ml , class 2 : 100,000 - 1,000,000 cfu / ml , class 3 : 1,000,000 cfu / ml ( figure 2 ) . light - blue to dark - blue , raised colonies on the inoculated surface of the streptococcus mutans strip and manufacturer 's guidelines for interpretation of s. mutans count . to estimate lactobacilli counts , the early morningchildren were mandated to avoid eating , drinking and brushing of teeth for 1 - 2 h. children were instructed to sit in a relaxed upright position until 1 - 2 ml of unstimulated whole saliva was collected in the floor of the mouth . saliva was then poured over the modified rogosa agar surface , screwed tightly , labeled and was placed in an incubator at 37c for 4 days ( figure 3 ) . the existence of lactobacillus after incubation was evidenced by white to transparent colonies on the modified rogosa agar surface . the results were assessed as specified by the manufacturer 's guidelines as class 0 : 103 cfu / ml , class 1 : 104 cfu / ml , class 2 : 105 cfu / ml , class 3 : 106 cfu / ml ( figure 4 ) . after 1 - year of follow - up , the saliva samples were again collected from both the groups as previously described . all the data thus accumulated were statistically analyzed using chi - square test and pearson correlation on spss software version 14 . manufacturer 's guidelines for interpretation of lactobacillus count and white to transparent colonies of lactobacillus on modified rogosa agar surface . the semiquantitative analysis of s. mutans count in experimental group under class 0 , i , ii and iii at the initial intervention of 0 month showed nil , nil , 5 ( 33 % ) and 10 ( 67 % ) ; at 12 months were 2 ( 13 % ) , 7 ( 47 % ) , 5 ( 33 % ) and 1 ( 7 % ) , respectively . the semiquantitative analysis of lactobacilli count inactive group under class 0 , i , ii and iii at the initial intervention of 0 month showed 2 ( 13 % ) , nil , 10 ( 67 % ) and 3 ( 20 % ) ; at 12 months were nil , 2 ( 13 % ) , 1 ( 7 % ) and 11 ( 73 % ) , respectively . during the 1 - year of follow - up , s. mutans decreased in 13 ( 87 % ) children , increased in 1 ( 7 % ) , remain unchanged in 1 ( 7 % ) children and lactobacillus increased in 10 ( 67 % ) children , decreased in 1 ( 7 % ) , remain unchanged in 4 ( 26 % ) children in experimental group ( table 1 ) . p value was not significant with p = 0.832 for decrease in s. mutans ( table 2 ) and was significant with p = 0.02 for increase in lactobacillus ( table 3 ) after 1 - year addition of probiotic in experimental group . whereas in the control group , within the 1 - year period of follow - up , s. mutans decreased in 2 ( 40 % ) children , increased in 1 ( 20 % ) and remain unchanged in 2 ( 40 % ) and lactobacillus decreased in 2 ( 40 % ) children , increased in 1 ( 20 % ) and remain unchanged in 2 ( 40 % ) . p value was insignificant in control group with p = 0.239 for s. mutans and p = 0.789 for lactobacillus . caries scores remain unchanged in 14 out of 15 children and was increased in 1 child in experimental group with insignificant pearson correlation ( r ) = 0.960 and significant p = 0.000 . in control group caries scores was unchanged in 4 children out of 5 and was increased in 1 child with insignificant pearson correlation ( r ) = 0.612 p = 0.272 . in experimental group cariesscore shifted in 1 subject from 0 to 1 in which s. mutans count was increased from class ii to class iii over a period of 1 - year . in control group cariesscore shifted in 1 subject from 0 to 1 in which s. mutans count was increased from class i to class ii over a period of 1 - year . shifting of counts of s. mutans in active group after 12 months of follow - up . probiotics are microbial cultures or living microorganisms which upon administration in required quantity promote and boost health benefits . an international life science institute europe consensus document suggested a simple and extensively acknowledged definition of probiotics as viable microbial food supplements , which beneficially influence the health of human . these bacteria should belong to the natural flora so that they could resist gastric secretion and survive during intestinal movement .6 in india , the occurrence of dental caries in children has been reported to be 87 % . in low socio - economic class , the prevalence of caries was reported to be higher ( 96.2 % ) than high socio - economic class .7 a major part of the population in india resides in rural areas ( 70 % ) where there is little awareness about the oral health especially for children who have unhealthy eating habits with large quantities of cariogenic products in their diet . for research to be successful in indiait has to be directed towards cost effectiveness and easy availability of products for health .8 the subjects selected in this prospective study were in the 10 - 15 years age group , which was important for the present study in two - ways . first , this is the period during which permanent teeth are erupting and new surfaces would be colonized by pathogenic bacteria . any measure directed towards prevention against early colonization might be beneficial in the long - term for the prevention of dental disease . the second reason for selecting this age group was the intellectual ability of the child . in accordance with jean piaget at the age of 7 years a child largely corresponds to an increase in cognitive development whereby the child develops a sense of semi - logical reasoning to infer physical cause - effect relationships .8 thus , in this age group a positive compliance could be expected from a child . the subjects selected for the study was on the volunteer basis , those included in the control group was children who disliked milk products , even hated to eat curd and was ready not to consume curd and other fermented products for 1 - year whereas the subjects selected for the experimental group was those who liked to have curd . thus , the large discrepancy was presented between experimental and control group . the parents and teacherswere consulted regarding the same and subjects was monitored and regularly followed for 1 - year by the authors . the results of the present study after supplementation of probiotic in the type of curd over a period of 1 - year in daily diet in experimental group showed decrease in streptococcus count in 87 % and increase in lactobacillus count in 67 % of the study subjects . , after intake of probiotic in the type of cheese over a period of 3 weeks .9 in a in - vitro study , yoghurt with live bacteria showed selective anti - mutans activity , suggesting that the overall decrease in mutans streptococci in - vivo could be due to a bactericidal effect on s. mutans .10 cagler and kargula have also shown a reduced s. mutans level in the oral cavity of patients receiving fluid or tablet in the form of probiotics .11 the previous studies present in the literature concerning intervention of probiotics are short - term studies according to us this is the first study carried out for a long period of 1 - year . the lactobacilli as a probiotic are believed to have antimicrobial activity and ability to interfere with pathogens on epithelial cells .12,13 they are also able to stimulate the immune system and alter the ph milieu of the host .1 when lactic acid bacteria are ingested in milk stuff , the buffering capability of milk hampers the bacterial acidogenity .14 the availability of calcium and other constituents may also safeguard tooth surfaces and inhibit the attachment of dental pathogens .15 standard homemade yogurt refers to those made with lactobacillus bulgaricus and streptococcus thermophilus . here in this study , , it can be suggested that it has been evolved in turkey as the term yoghurt has been derived from a turkish verb jugurt that means to be curdled or coagulated .16 thus from the word curdled the word curd is derived . lactobacilli have been used to deliver vaccine components for active immunization in vivo .1 the mechanism of interfering involves the release of bio - surfactants , a structurally diverse group of surface active molecules synthesized by microorganisms and are able to inhibit adhesion of various other microorganisms . in a study carried by arezoothey showed that the bio - surfactant derived from probiotic bacteria ( lactobacillus acidophilus , lactobacillus fermentum and lactobacillus rhamnosus ) could reduce the adhesion of s. mutans to the surfaces .12 nase et al . , reported reduced caries in kindergarten children on long - term intake of milk containing the probiotic l. rhamnosus cg strain .17 in order to evaluate whether naturally prevailing oral lactobacilli show probiotic features , lactobacilli were isolated from saliva and plaque from children and adolescents , with or without caries lesions , 23 lactobacillus species entirely repressed the growth of all mutans streptococci tested .1 the use of chewing gum containing lactobacillus reuteri as a probiotic bacteria also showed reduction in levels of pro - inflammatory cytokines in gingival crevicular fluid and the use of lactobacillus brevis decreased matrix metalloproteinases ( collagenase ) activity and various other inflammatory markers in saliva .18 the studies so far carried showed short term effects of different formulations of probiotics . earlier studies have demonstrated a beneficial effect of probiotic lozenges , chewing gums and medical devices on oral health .19,20 however , none of these formulations is available in india . though the cost of these probiotic preparations may be within the reach for a population in developed countries , it is beyond the reach of an average indian . the cost of the probiotic lozenges is about one us dollars , but the curd used in our present study is easily available preparation in the market as well as in almost every home in india . thus , our study aimed to find a cost - effective and easily accessible alternative to probiotic lozenges and gums . manufacturing of curd is an old technique , which dates back to thousands of years , and the knowledge has transferred generation to generation . the word curd is the generalized process of curd making is comprised of modifying the original composition of milk , pasteurizing the yogurt mix , fermentation at thermophilic temperatures ( 40 - 45c ) followed by cooling .16 bacteriotherapy in the form of probiotics seems to be a natural manner to uphold health and protect oral tissues from disease due to significant reduction in levels of cariogenic as well as periodontal pathogens .14 the small sample size and the large discrepancy between the experimental and control group are the limitation of the study as large sample size could not be adequately followed for such long time . although authors regularly visited parents and teachers of the study subjects on the regular basis , but there could be chances of error due to long monitoring and follow - up period . probiotics are transpiring as an interesting field in oral health .6 there was decrease in s. mutans count and increase in lactobacillus count observed in oral microbial flora within the experimental study group after consumption of probiotics in the type of curd over a span of 1 - year . however , although the results were insignificant may be due to small sample size but the study could be a pathfinder toward a new concept of food supplements in place of medicines . efforts should be made to enlarge the cognizance of the general dental practitioners with this respect of oral disease therapy and persuade the implementation of the concept of food rather than medicine .10\noutput:\n" }, { "from": "agent", "value": "background : probiotics are defined as live microorganisms which when taken in adequate amounts provide a health benefit on the host . they have been used to improve gastrointestinal health , and their popularity has prompted increased interest for their role in the promotion of oral health also . the study was undertaken to evaluate the influence of diet alteration on oral microflora with the addition of probiotics in the form of curd in the diet.materials and methods : sample pool included total 20 children , 15 in experimental group ; who were given curd containing probiotic bacteria in their diet daily and 5 children in control group ; who were contradicted of food containing probiotics . all the children were followed for over a period of 1 - year . a pre and post quantitative analysis of streptococcus mutans and lactobacilli were done in the saliva of both active and control groups , and caries score was recorded . statistical analysis used : the data thus compiled were statistically evaluated using chi - square test and pearson correlation on spss software version 14 . results : in experimental group , 87 % children showed decrease and 7 % showed increase in s. mutans count ( p = 0.83 ) , whereas 67 % showed increase and 7 % decrease in lactobacilli count ( p = 0.002 ) after 1 - year of follow - up.conclusions : probiotics are upcoming as an intriguing field in oral health . efforts should be made to increase the knowledge of the general dental practitioners with this facet of oral disease therapy and promote the implementation of the concept of food rather than medicine ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: prompt revascularization with percutaneous coronary intervention ( pci ) has significantly reduced the incidence of cardiogenic shock ( cs ) and improved survival in the setting of acute myocardial infarction ( ami ) .1,2 however , when it occurs , cs remains a highly fatal complication following an ami ,3 despite aggressive revascularization and other adjunctive therapies .3,4 percutaneous ventricular assist devices ( pvads ) have been shown to provide superior hemodynamic support compared to intraaortic balloon pump ( iabp ) counterpulsation .4,5 in light of the recently reported studies that have failed to show a hemodynamic or survival benefit of iabp in the setting of post - ami cs ,610 physicians might adopt a reflexive strategy to use pvads in this setting more often . while prospective randomized and adequately powered clinical trials remain warranted to evaluate the potential benefits of these new devices , real - world observational data can be useful to provide clinical insights on their use in daily routine practice . in the present study , we sought to evaluate the current use of impella 2.5 in patients with confirmed cs complicating an ami undergoing pci . in particular , we were interested in evaluating the outcomes of patients who received hemodynamic support with impella 2.5 ( abiomed , inc . , danvers , ma , usa ) , prior to pci versus those who received impella 2.5 after pci . a total of 154 consecutive unselected patients who were reported in the uspella registry to have undergone a pci and impella 2.5 hemodynamic support for a confirmed ami with a cs indication were included in our study . the uspella registry is an on - going multicenter voluntary registry open to all sites in the united states that have used the impella 2.5 for all indications in more than 10 patients . sites were invited to report all their consecutive impella 2.5 cases without pre - selection of indication or patients . between june 2009 and march 2012 , 47 us sites had joined the uspella registry . of these , 38 sites had contributed 1 or more cases of patients who met the study inclusion criteria of cs complicating an ami who underwent pci . the remaining 9 sites reported no patients who met the study ami with cs definition . the diagnosis of ami was confirmed by electrocardiographic changes indicative of new or presumed new ischemia ( significant new st - t changes or new left bundle branch block ) , the presence of elevated cardiac biomarker values or based on coronary angiography . cs was defined by the presence of the following criteria : ( 1 ) systolic blood pressure 90 mmhg for 30 min or the need for vasopressor and / or inotropic therapy and / or iabp to maintain a systolic blood pressure greater than 90 mmhg ; ( 2 ) signs of organ hypoperfusion such as oliguria / anuria , altered mental status , or cold extremities . patients who underwent other means of revascularization than pci or etiologies of shock other than ami were not included in this analysis . timing of impella insertion was left at the operating physician s discretion . coronary angiography and pcipatients were treated with drug - eluting stents and / or bare metal stents and / or percutaneous transluminal coronary angioplasty according to individual experience and local institutional guidelines . the number of vessels and lesions treated and the use of adjunctive therapies were left at the physician s discretion . the primary end - point aimed to assess the potential difference in survival rate to discharge between patients who received impella 2.5 pre - pci and those who received it post - pci . the secondary end - points included the assessment of patients hemodynamics with impella 2.5 support and in - hospital incidence of myocardial reinfarction , stroke , repeat revascularization , renal insufficiency , bleeding , hemolysis , limb ischemia , vascular complications requiring surgical repair , and infection . myocardial reinfarction was defined as the recurrence of an mi distinct from the index event . stroke was defined as an ischemic or hemorrhagic cerebrovascular accident that persisted beyond 24 hours or less than 24 hours associated with infarction on an imaging study . renal insufficiency was defined as abnormal kidney function requiring dialysis ( including hemofiltration ) in patients who did not require dialysis prior to implant , or a rise in serum creatinine of greater than 2.5 mg / dl or greater than 2 times baseline . hemolysis was defined by abnormal plasma free hemoglobin values greater than 40 mg / dl or presence of hematuria . limb ischemia was reported whenever noted in the patient s chart as new incidences of hypoperfusion of the leg requiring treatment and marked by such symptoms as decreased skin temperature of the limb or decreased peripheral pulses . vascular complication requiring surgical repair was defined as a surgical intervention on a pseudoaneurysm , an arteriovenous fistula , a vessel dissection / perforation , or an access site thrombosis . infection was defined as a clinical infection accompanied by pain , fever , drainage , and / or leukocytosis treated with nonprophylactic antimicrobial agents . survival rate was reported at 30 - day post - impella implant when available at the time of data collection . the impella 2.5 device ( abiomed , inc . ) has been described in detail elsewhere .11 briefly , the 12 fr microaxial pump is mounted on a 9 fr catheter . the pump is advanced retrogradely across the aortic valve into the left ventricle under fluoroscopy guidance . it generates up to 2.5 l / min of forward flow directly in the ascending aorta . heparinized dextrose fluid is purged through the pump and released in the general circulation at the usual rate of 412 ml / hr to prevent clot formation in the motor and early pump wear . the manufacturer recommends an activated thrombin time ( act ) of 160180 seconds during pump support . the uspella registry was designed by an executive steering committee and supervised by a scientific advisory board that oversaw its ongoing conduct . the registry protocol was reviewed and approved by the institutional review board at each site . investigators were asked to report in the registry all patients who had been supported with impella 2.5 at their institution regardless of indication . data were abstracted retrospectively from the medical record onto a standard case report form by the sites study coordinators who were centrally trained . information was collected retrospectively on patient s demographic characteristics , medical history , clinical presentation , hemodynamic , echocardiographic , and angiographic characteristics , treatment during hospitalization , hospital discharge status , and 30 - day follow - up when available at the time of data collection . all patients reported in the registry that met the above definition of ami cs and underwent pci were included in the current analysis without pre - selection of patients or sites . an independent clinical event committee , consisting of 1 cardiovascular surgeon and 2 interventional cardiologists , adjudicated the in - hospital study end - points ( all - cause of death , reinfarction , stroke , repeat revascularization , renal insufficiency , and vascular complications requiring surgical repair ) . data are expressed as mean standard deviation ( sd ) , median with quartiles or frequencies and percentages , as appropriate . univariate analysis comparing impella pre - pci versus impella post - pci was performed with a chi - square test on discrete variables and with student s t - test or wilcoxon rank sum test for independent samples for continuous variables , as appropriate . survival to discharge is reported as the proportion of patients who were discharged alive from the hospital . as a supporting analysis , a kaplan - meier estimate with a log - rank testwas used to compare survival rates up to 30 days between patients who received impella prior to pci ( pre - pci ) versus those who received impella after pci ( post - pci ) . surviving patients were censored at 30 days or last known follow - up , whichever is earlier in this analysis . pre - pci time interval was defined as time preceding the first pci balloon inflation . a multivariate forward stepwise logistic regression analysis was performed to identify the strongest independent predictors for in - hospital mortality while adjusting for potential confounding variables ; the model included baseline , procedural , and hemodynamic characteristics known to impact patient s outcome ( see results section for list of variables included in the model ) . a p - value of 0.05 was set as a forward stepping criterion to add sequentially variables from the model . data analysis was performed using jmp version 10.0 and sas version 9.2 statistical software packages ( sas institute , inc . , cary , nc , usa ) . a total of 154 consecutive unselected patients who were reported in the uspella registry to have undergone a pci and impella 2.5 hemodynamic support for a confirmed ami with a cs indication were included in our study . the uspella registry is an on - going multicenter voluntary registry open to all sites in the united states that have used the impella 2.5 for all indications in more than 10 patients . sites were invited to report all their consecutive impella 2.5 cases without pre - selection of indication or patients . between june 2009 and march 2012 , 47 us sites had joined the uspella registry . of these , 38 sites had contributed 1 or more cases of patients who met the study inclusion criteria of cs complicating an ami who underwent pci . the remaining 9 sites reported no patients who met the study ami with cs definition . the diagnosis of ami was confirmed by electrocardiographic changes indicative of new or presumed new ischemia ( significant new st - t changes or new left bundle branch block ) , the presence of elevated cardiac biomarker values or based on coronary angiography . cs was defined by the presence of the following criteria : ( 1 ) systolic blood pressure 90 mmhg for 30 min or the need for vasopressor and / or inotropic therapy and / or iabp to maintain a systolic blood pressure greater than 90 mmhg ; ( 2 ) signs of organ hypoperfusion such as oliguria / anuria , altered mental status , or cold extremities . patients who underwent other means of revascularization than pci or etiologies of shock other than ami were not included in this analysis . timing of impella insertion was left at the operating physician s discretion . coronary angiography and pcipatients were treated with drug - eluting stents and / or bare metal stents and / or percutaneous transluminal coronary angioplasty according to individual experience and local institutional guidelines . the number of vessels and lesions treated and the use of adjunctive therapies were left at the physician s discretion . the primary end - point aimed to assess the potential difference in survival rate to discharge between patients who received impella 2.5 pre - pci and those who received it post - pci . the secondary end - points included the assessment of patients hemodynamics with impella 2.5 support and in - hospital incidence of myocardial reinfarction , stroke , repeat revascularization , renal insufficiency , bleeding , hemolysis , limb ischemia , vascular complications requiring surgical repair , and infection . myocardial reinfarction was defined as the recurrence of an mi distinct from the index event . stroke was defined as an ischemic or hemorrhagic cerebrovascular accident that persisted beyond 24 hours or less than 24 hours associated with infarction on an imaging study . renal insufficiency was defined as abnormal kidney function requiring dialysis ( including hemofiltration ) in patients who did not require dialysis prior to implant , or a rise in serum creatinine of greater than 2.5 mg / dl or greater than 2 times baseline . hemolysis was defined by abnormal plasma free hemoglobin values greater than 40 mg / dl or presence of hematuria . limb ischemia was reported whenever noted in the patient s chart as new incidences of hypoperfusion of the leg requiring treatment and marked by such symptoms as decreased skin temperature of the limb or decreased peripheral pulses . vascular complication requiring surgical repair was defined as a surgical intervention on a pseudoaneurysm , an arteriovenous fistula , a vessel dissection / perforation , or an access site thrombosis . infection was defined as a clinical infection accompanied by pain , fever , drainage , and / or leukocytosis treated with nonprophylactic antimicrobial agents . survival rate was reported at 30 - day post - impella implant when available at the time of data collection . the impella 2.5 device ( abiomed , inc . ) has been described in detail elsewhere .11 briefly , the 12 fr microaxial pump is mounted on a 9 fr catheter . the pump is advanced retrogradely across the aortic valve into the left ventricle under fluoroscopy guidance . it generates up to 2.5 l / min of forward flow directly in the ascending aorta . heparinized dextrose fluid is purged through the pump and released in the general circulation at the usual rate of 412 ml / hr to prevent clot formation in the motor and early pump wear . the manufacturer recommends an activated thrombin time ( act ) of 160180 seconds during pump support . the uspella registry was designed by an executive steering committee and supervised by a scientific advisory board that oversaw its ongoing conduct . the registry protocol was reviewed and approved by the institutional review board at each site . investigators were asked to report in the registry all patients who had been supported with impella 2.5 at their institution regardless of indication . data were abstracted retrospectively from the medical record onto a standard case report form by the sites study coordinators who were centrally trained . information was collected retrospectively on patient s demographic characteristics , medical history , clinical presentation , hemodynamic , echocardiographic , and angiographic characteristics , treatment during hospitalization , hospital discharge status , and 30 - day follow - up when available at the time of data collection . all patients reported in the registry that met the above definition of ami cs and underwent pci were included in the current analysis without pre - selection of patients or sites . an independent clinical event committee , consisting of 1 cardiovascular surgeon and 2 interventional cardiologists , adjudicated the in - hospital study end - points ( all - cause of death , reinfarction , stroke , repeat revascularization , renal insufficiency , and vascular complications requiring surgical repair ) . data are expressed as mean standard deviation ( sd ) , median with quartiles or frequencies and percentages , as appropriate . univariate analysis comparing impella pre - pci versus impella post - pci was performed with a chi - square test on discrete variables and with student s t - test or wilcoxon rank sum test for independent samples for continuous variables , as appropriate . survival to discharge is reported as the proportion of patients who were discharged alive from the hospital . as a supporting analysis , a kaplan - meier estimate with a log - rank testwas used to compare survival rates up to 30 days between patients who received impella prior to pci ( pre - pci ) versus those who received impella after pci ( post - pci ) . surviving patients were censored at 30 days or last known follow - up , whichever is earlier in this analysis . pre - pci time interval was defined as time preceding the first pci balloon inflation . a multivariate forward stepwise logistic regression analysis was performed to identify the strongest independent predictors for in - hospital mortality while adjusting for potential confounding variables ; the model included baseline , procedural , and hemodynamic characteristics known to impact patient s outcome ( see results section for list of variables included in the model ) . a p - value of 0.05 was set as a forward stepping criterion to add sequentially variables from the model . data analysis was performed using jmp version 10.0 and sas version 9.2 statistical software packages ( sas institute , inc . , cary , nc , usa ) . between july 2008 and may 2012 , a total of 154 consecutive unselected patients from 38 us hospitals received mechanical hemodynamic support with impella 2.5 for cs complicating an ami . of the 154 patients , 63.4 % were in cs at admission , 48.9 % were transferred from an outlying facility to the institution where they received impella 2.5 , and 22.5 % had sustained 1 or multiple witnessed out - of - hospital cardiac arrests ( ohca ) . at the time of impella insertion , 88.3 % continued to be in sustained cs despite high - dose inotropes and / or iabp support . in the remaining patients ( 11.7 % ) , the use of inotropes or iabp could not be documented in the case report forms . [ correction added on 2 jan 2014 , after first online publication : in the first paragraph of the results section , impella 2.5 % has been changed to impella 2.5 . ] baseline characteristics cabg , coronary artery bypass grafting ; copd , chronic obstructive pulmonary disease ; egfr , estimated glomerular filtration rate ; iabp , intra - aortic balloon pump ; iqr , inter - quartile range ; lvef , left ventricular ejection fraction ; pci , percutaneous coronary intervention ; pvd , peripheral vascular disease ; sd , standard deviation ; stemi , st elevation myocardial infarction ; sts , society of thoracic surgeons . a total of 63 patients received impella 2.5 support prior to pci ( pre - pci group , 40.9 % ) and 91 patients received impella post - pci ( post - pci group , 59.1 % ) . patients presenting with an st - segment elevation myocardial infarction ( stemi ) were more likely to receive impella after pci ( 87.9 % vs. 55.6 % , p 0.0001 ) . the pre - pci and post - pci groups were similar in terms of baseline characteristics , duration of shock , extent of the infarct size ( as determined by baseline plasma troponin level ) , and pci success rate as measured by post - pci timi grade flow 01 , except for higher rate of diabetes ( 56.7 % vs. 36.4 % , p = 0.02 ) , peripheral vascular disease ( pvd ) ( 32.2 % vs. 13.6 % , p = 0.0008 ) , chronic obstructive pulmonary disease ( copd ) ( 22.9 % vs. 10.7 % , p = 0.05 ) , and prior stroke ( 15.3 % vs. 5.1 % , p = 0.04 ) in the pre - pci group ( table 1 ) . both groups had poor hemodynamics prior to impella support but with a greater magnitude when the impella insertion was delayed to after pci despite the more frequent use of iabp in this group ( table 2 ) . mechanical ventilation was required more often when impella insertion was delayed after pci ( 54.8 % vs. 73.3 % , p = 0.02 ) . more extensive revascularization was performed in patients who received impella pre - pci with more lesions ( 2.331.40 vs. 1.771.02 , p = 0.006 ) , more vessels treated ( 1.570.67 vs. 1.300.57 , p = 0.01 ) , and more stents placed ( 1.941.15 vs. 1.470.85 , p = 0.007 ) compared with patients who received impella post - pci . trends for more complete revascularization in pre - pci group were similar in both stemi and nstemi groups . procedural characteristics pci , percutaneous coronary intervention ; timi , thrombolysis in myocardial infarction ; sd , standard deviation . door - to - balloon time data are presented when available for patients admitted with stemi or diagnosed with stemi on admission . patients hemodynamics improved significantly after initiation of hemodynamic support with impella 2.5 to the same magnitude in both groups ( table 3 ) . the median duration of support was similar between the 2 groups ( table 2 ) . sbp , systolic blood pressure ; dbp , diastolic blood pressure ; map , mean arterial pressure ; pcwp , pulmonary capillary wedge pressure . a higher survival rate was observed in the pre - pci group as compared with post - pci group ( 65.1 % vs. 40.7 % , p = 0.003 ) . thirty - day follow - up data was reported for 145 ( 94.2 % ) patients ( nine patients were lost to follow - up at 30 - day visit ) . the kaplan - meier analysis confirmed the difference in mortality trends in favor of the pre - pci group up to 30 days ( 57.4 % vs. 38.2 % , log - rank test p = 0.004 , fig . the odds ratio of discharge survival for impella post - pci versus pre - pci was 0.37 ( 95 % ci : 0.190.72 ) , again indicating lower survival for impella post - pci vs. pre - pci . odds ratios remained consistently favorable to the impella pre - pci group , either significantly or with strong favorable trends , within subgroups based on baseline , procedural , and hemodynamic variables that could be perceived as confounding variables ( fig . cs , cardiogenic shock ; dbp , diastolic blood pressure ; map , mean arterial pressure ; mv , mechanical ventilation ; nstemi , non - st elevation myocardial infarction ; pvd , peripheral vascular disease ; sbp , systolic blood pressure . cs , cardiogenic shock ; dbp , diastolic blood pressure ; map , mean arterial pressure ; mv , mechanical ventilation ; nstemi , non - st elevation myocardial infarction ; pvd , peripheral vascular disease ; sbp , systolic blood pressure . a multivariate forward stepwise logistic regression analysis was conducted to identify independent predictors of mortality in our study . the multivariate analysis model included the following as candidates for entry : age , gender , history of chronic obstructive pulmonary disease , diabetes , pvd or prior stroke , stemi versus nstemi presentations , cardiac arrest prior to admission , onset and duration of cs , patient transfer from outlying facility , evidence of anoxic brain injury pre - impella support , need for mechanical ventilation , systolic and diastolic blood pressure levels pre - impella support , level of inotropic support pre - impella support and potential use of iabp prior to impella support , and baseline serum creatinine levels . timing of initiation of impella support ( pre - pci vs. post - pci ) was also included as a candidate for entry in the model . the timing of initiation of impella 2.5 support relative to pci was identified as an independent predictor of improved survival to hospital discharge ( p = 0.01 ) while older age ( or 1.05 , 95 % ci : 1.021.08 , p = 0.003 ) , number of inotropes ( p = 0.01 ) , cs onset prior to admission ( p = 0.03 ) , and need for mechanical ventilation ( p = 0.0003 ) were found to be independent predictors for increased in - hospital mortality ( table 4 ) . there was no difference between the pre - pci group and the post - pci group in the occurrence of in - hospital complications included in the secondary end - point ( table 5 ) . this is the largest cohort to date documenting the use of impella 2.5 in the setting of ami complicated by cs . the analysis provides insight into the presentation , management , and outcomes of patients supported with impella 2.5 at a large number of high - and low - volume pci centers over multiple years , thus providing a fair representation of the current use of the device in routine practice in ami cs across the united states . the results of our study showed that : ( 1 ) the use of impella 2.5 was primarily restricted to a rescue population that failed to respond to conventional measures including inotropic and iabp support ; and ( 2 ) although the risk for imminent death remained particularly high in this selected population , our findings suggest that the prompt use of impella prior to pci may significantly improve survival . our study showed that patients who received impella 2.5 in daily routine practice presented with greater risk features than those who were reported in recent ami cs randomized trials , reflecting a higher mortality observed in routine practice .12 indeed , 21 % of our study patients presented with anoxic brain damage and 38.2 % had a shock duration 12 hours prior to impella support . thus , at least 38.2 % of the patients included in our study would have been considered too sick and not eligible for enrollment in the iabp - shock ii trial .6 moreover , at presentation , the incidences of diabetes ( 44.6 % vs. 35.4 % , p = 0.05 ) , prior mi ( 38.6 % vs. 23.7 % , p 0.0001 ) , and prior coronary artery bypass graft ( 14.2 % vs. 6.7 % , p = 0.01 ) , prior pci ( 38.5 % vs. 21.1 % , p 0.0001 ) were significantly higher in the patients included in our study compared to the patients randomized in the iabp - shock ii trial .6 more importantly , 88.4 % of our patients received impella after the first - line therapy with inotropes and / or iabp failed to stabilize their hemodynamics . despite these high - risk features , the overall survival rate was favorable in our study when compared to other ami cs series .1214 in our study , survival was significantly higher in the pre - pci group compared with the post - pci group . we hypothesized that active unloading of the left ventricle , hemodynamic stabilization of the patients with the impella prior to undergoing pci , and more complete revascularization may have led to improved outcomes in our study of ami cs . indeed , nonculprit intervention in the setting of cs is a reasonable approach after careful consideration , but may be limited in the clinical setting by worsening hemodynamics . considering the limitations inherent to the retrospective nature of our investigation , one may argue that patients in the post - pci group were simply sicker accounting for the higher in - hospital mortality observed in this group . therefore , the validity of our hypothesis rests largely on the determination of whether : ( 1 ) the pre - pci and post - pci groups were comparable with respect to baseline characteristics , and ( 2 ) whether the prompt initiation of hemodynamic support with impella may have resulted in treatment differences that may have influenced outcomes . in our series , patients who received impella prior to pci appeared to be as sick as those who received impella after pci while accounting for baseline characteristics , although they presented more often with higher - risk features such as diabetes , copd , pvd , or prior stroke compared to the latter group . patients in the pre - pci group had also more extensive coronary artery disease burden , a parameter that has been shown to be associated with increased mortality in cs .15,16 our results suggest that early hemodynamic support prior to pci has the potential to improve outcomes by enabling stable hemodynamics during the intervention and therefore probably allowing for more complete revascularization . this notion is supported by recent studies in the setting of ami cs that showed improved outcomes associated with a more complete revascularization strategy .17 the current societal guidelines support nonculprit pci at the time of primary pci in the setting of cs complicating an ami2 in the case of severe stenosis in arteries supplying large territory of myocardium . additionally , active left ventricular unloading and increased forward flow to the systemic circulation may have prevented further hemodynamics deterioration and progression of the downward spiral of shock and increased risk of peri procedural death . this might explain also the large difference in death events between the 2 groups observed within the first 48 hours of pci ( fig .3 ) . the survival to discharge rate in the post - pci group was comparable to the results reported in the shock registry ( 40.7 % vs. 39.8 % , p = 0.87 ) 12 the euroshock impella registry reported by lauten et al. 13 or the single - site experience reported by engstrm et al. 14 in the shock registry ,12 iabp was used as the predominant means of hemodynamic support . unfortunately , iabp use has not been shown to significantly improve hemodynamics7 or clinical outcomes in the setting of ami cs .6,8,9 in our study , patients in the post - pci group had poor outcomes whether medical therapy alone or combined with iabp was used to support the patient hemodynamics during pci ( fig. 5 ) . in the euroshock impella registry , an overall survival rate of 35.8 % to 30 days was reported by lauten et al . in a series of 144 patients with refractory cs who had failed first - line therapy with inotropes and iabp support .13 the authors of this series concluded that impella 2.5 was implanted in patients with a particularly poor hemodynamic profile and as a last - resort option . moreover , the number of lesions treated in this study was also comparable to the one observed in the post - pci group in our study ( 1.71.2 vs. 1.81.0 ) ; however , the timing of impella insertion relative to the revascularization procedure was not specified . in the engstrmet al. 14 series , the authors reported that the decision to implant impella was delayed to after pci and dependent upon the diagnosis of profound cs and confirmed to be refractory to inotropic and iabp support . where time to reperfusion has become a quality metric , physicians may adopt a reflexive approach to minimize door - to - balloon time and therefore delay impella insertion , despite the fact that in general this quality metric does not apply to patients in cs . the results of our study showed that stemi patients who received impella pre - pci had a door - to - balloon time about an hour longer compared with those who received impella post - pci , yet had better outcomes . this may further reinforce the assumption that the pre - pci patients were perhaps more hemodynamically embarrassed and required more time to be stabilized before a pci could be undertaken compared to the post - pci group . indeed , it would not be reasonable for a physician to explant an iabp to insert an impella and delay the reperfusion if the patient had been stable enough with iabp therapy and conventional measures prior to pci . in our study , a majority of patients were admitted in cs and were in shock for more than 6 hours before revascularization with a large number of them being transferred from an outlying facility . these patients do not represent the typical stemi patients in whom the door - to - balloon time metric has been shown to correlate with outcomes . indeed , the extended door - to - balloon time did not seem to be a determinant factor in outcomes in this rescue population , suggesting that early stabilization of patients with effective hemodynamic support prior to pci would be a more appropriate goal rather than the current door - to - balloon time performance metric to affect the outcomes of these sick patients . our study includes several limitations to be considered : ( 1 ) the observational approach of our investigation can not infer a definitive causal relationship between the use of impella pre - pci and subsequent reduced mortality ; thus , our results will need to be confirmed by a prospective investigation ; ( 2 ) we can not exclude the presence of potential patient or site selection biases ; and ( 3 ) the timing of impella 2.5 insertion , the completeness of revascularization , and all adjunctive therapies were left to the discretion of the physician . thus , we can not totally eliminate the risk of potential treatment biases , and finally , ( 4 ) the duration of the follow - up was limited to the in - hospital phase and long - term follow - up could not be obtained . our study includes several limitations to be considered : ( 1 ) the observational approach of our investigation can not infer a definitive causal relationship between the use of impella pre - pci and subsequent reduced mortality ; thus , our results will need to be confirmed by a prospective investigation ; ( 2 ) we can not exclude the presence of potential patient or site selection biases ; and ( 3 ) the timing of impella 2.5 insertion , the completeness of revascularization , and all adjunctive therapies were left to the discretion of the physician . thus , we can not totally eliminate the risk of potential treatment biases , and finally , ( 4 ) the duration of the follow - up was limited to the in - hospital phase and long - term follow - up could not be obtained . the results of our study suggest that early initiation of hemodynamic support prior to pci with impella 2.5 is associated with more complete revascularization and improved survival in the setting of refractory cs complicating an ami .\noutput:\n" }, { "from": "agent", "value": "objectivesto evaluate the periprocedural characteristics and outcomes of patients supported with impella 2.5 prior to percutaneous coronary intervention ( pre - pci ) versus those who received it after pci ( post - pci ) in the setting of cardiogenic shock ( cs ) complicating an acute myocardial infarction ( ami ) . backgroundearly mechanical circulatory support may improve outcome in the setting of cs complicating an ami . however , the optimal timing to initiate hemodynamic support has not been well characterized.methodsdata from 154 consecutive patients who underwent pci and impella 2.5 support from 38 us hospitals participating in the uspella registry were included in our study . the primary end - point was survival to discharge . secondary end - points included assessment of patients hemodynamics and in - hospital complications . a multivariate regression model was used to identify independent predictors for mortality.resultsboth groups were comparable except for diabetes ( p = 0.02 ) , peripheral vascular disease ( p = 0.008 ) , chronic obstructive pulmonary disease ( p = 0.05 ) , and prior stroke ( p = 0.04 ) , all of which were more prevalent in the pre - pci group . patients in the pre - pci group had more lesions ( p = 0.006 ) and vessels ( p = 0.01 ) treated . these patients had also significantly better survival to discharge compared to patients in the post - pci group ( 65.1 % vs. 40.7 % , p = 0.003 ) . survival remained favorable for the pre - pci group after adjusting for potential confounding variables . initiation of support prior to pci with impella 2.5 was an independent predictor of in - hospital survival ( odds ratio 0.37 , 95 % confidence interval : 0.170.79 , p = 0.01 ) in multivariate analysis . the incidence of in - hospital complications included in the secondary end - point was similar between the 2 groups.conclusionsthe results of our study suggest that early initiation of hemodynamic support prior to pci with impella 2.5 is associated with more complete revascularization and improved survival in the setting of refractory cs complicating an ami ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the pathophysiology of irritable bowel syndrome ( ibs ) seems to involve disturbances at many levels of the so - called gut - brain axis .1 recent research has emphasized the role of food in abdominal symptom generation ,2 in particular low - digestible carbohydrates .3 our group has previously shown that the ingestion of the unabsorbable , but fermentable disaccharide lactulose provokes more symptoms in patients with ibs than in healthy individuals .4,5 intriguingly , the symptoms provoked by lactulose were similar to the patients habitual complaints .4 fermentable carbohydrates that escape digestion and absorption within the small intestine are metabolized by colonic microbiota . hunter6 has previously suggested that the disturbances of colonic fermentation play a significant role in ibs symptom generation , and has proposed the term enterometabolic disorder to describe such alterations . colonic fermentation yields short - chain fatty acids ( scfas ; mainly acetic , propionic , and butyric acids ) and gases ( mainly co2 , h2 , and ch4 ) . hence , the efficacy of the fermentation may be evaluated by scfa analysis . due to regional differences regarding the availability of fermentable substrates and abundance of saccharolytic microbes , fermentation of low - digestiblecarbohydrates takes place mainly in the cecum and the proximal colon , rather than in the distal parts .7 a correlation has previously been demonstrated between cecal levels of scfa and portal and aortic blood levels of scfa in rats ,8 and assessment of scfa in peripheral venous blood may be considered as an indirect measure of colonic fermentation .9 the aim of the present study was to compare serum scfa levels in patients with ibs and healthy controls before and after the ingestion of lactulose . since a previous study has shown that the mean orocecal transit time of a 10 g lactulose solution is approximately 90 minutes ,10 and that the onset of symptoms after a meal often occurs within 90 minutes ,11 we chose this time point for evaluating the lactulose - stimulated response . patients with ibs were included consecutively from the outpatient clinic of one of the authors at lovisenberg diaconal hospital ( oslo , norway ) . the individuals were diagnosed with ibs according to the rome iii criteria ,12 and divided into subgroups according to phenotypes based on the rome iii questionnaire for functional bowel disorders : diarrhea predominant ibs , constipation predominant ibs , and ibs with equally diarrhea and constipation . they were included if they considered themselves to be healthy , and were not otherwise medically examined . however , they were excluded if they met the rome iii criteria for ibs based on our questionnaires . all participants gave written , informed consent , and the study was carried out according to the declaration of helsinki and approved by the regional committee for medical research ethics ( rek sr - st ; reference number 2011/2474 ) . the participants met ( individually ) at the outpatient clinic at 08:00 in the morning after an overnight fast . venous blood samples , from the antecubital vein of the non - dominant arm , were collected and the subjects filled in a questionnaire to quantify their habitual ibs symptoms . the participants then underwent a lactulose provocation test , as described previously .4 briefly , the subjects ingested 10 g of lactulose dissolved in 200 ml of tap water . ninety minutes after the intake of the lactulose solution , another blood sample was collected , and the subjects filled in a questionnaire to grade their lactulose - induced symptoms . the participants were not allowed to drink , eat , or smoke during the test , but their activities were otherwise not restricted . habitual symptoms were assessed using the ibs severity scoring system .13 the maximum achievable score of this system is 500 points , and the questionnaire allows grading of symptom severity as follows : mild ( 75175 points ) , moderate ( 175300 points ) , and severe ( 300 points ) . increase in symptoms following the lactulose ingestion , as compared to baseline , was graded from 0 to 3 for abdominal borborygmi , bloating , and pain , as well as a feeling of sickness and freezing , giving a maximum achievable sum score of 15 points . after collection , the samples were centrifuged and the serum was immediately placed in a freezer at 20c until analysis . serum was thawed at room temperature and scfa ( acetic , propionic , butyric , iso - butyric , valeric , and iso - valeric acids ) were analyzed by using a method developed by zhao et al. 14 this method enables the detection of serum concentrations of scfa down to as little as 0.04 m , as described by jakobsdottir et al. 9 all samples were analyzed at least in duplicate . in addition , the ratios of individual scfa concentrations to the total scfa concentrations were calculated . based on the work of tjellstrm et al15 on fecal samples , we calculated two fermentation indices , as follows : fermentation index a , reflecting the fermentation of carbohydrates and conceivably the pro - inflammatory properties of scfa , was calculated as acetic acid concentrations minus propionic and butyric acid concentrations divided by the total concentration of scfa . fermentation index b , reflecting the fermentation of proteins and conceivably the anti - inflammatory properties of scfa was calculated as the sum of iso - butyric and iso - valeric acids . paired t - test was used for comparisons within groups and unpaired t - tests for comparing means between groups . all tests were two - tailed , and p - values less than 0.05 were set as a limit for statistical significance . patients with ibs were included consecutively from the outpatient clinic of one of the authors at lovisenberg diaconal hospital ( oslo , norway ) . the individuals were diagnosed with ibs according to the rome iii criteria ,12 and divided into subgroups according to phenotypes based on the rome iii questionnaire for functional bowel disorders : diarrhea predominant ibs , constipation predominant ibs , and ibs with equally diarrhea and constipation . they were included if they considered themselves to be healthy , and were not otherwise medically examined . however , they were excluded if they met the rome iii criteria for ibs based on our questionnaires . all participants gave written , informed consent , and the study was carried out according to the declaration of helsinki and approved by the regional committee for medical research ethics ( rek sr - st ; reference number 2011/2474 ) . the participants met ( individually ) at the outpatient clinic at 08:00 in the morning after an overnight fast . venous blood samples , from the antecubital vein of the non - dominant arm , were collected and the subjects filled in a questionnaire to quantify their habitual ibs symptoms . the participants then underwent a lactulose provocation test , as described previously .4 briefly , the subjects ingested 10 g of lactulose dissolved in 200 ml of tap water . ninety minutes after the intake of the lactulose solution , another blood sample was collected , and the subjects filled in a questionnaire to grade their lactulose - induced symptoms . the participants were not allowed to drink , eat , or smoke during the test , but their activities were otherwise not restricted . habitual symptoms were assessed using the ibs severity scoring system .13 the maximum achievable score of this system is 500 points , and the questionnaire allows grading of symptom severity as follows : mild ( 75175 points ) , moderate ( 175300 points ) , and severe ( 300 points ) . increase in symptoms following the lactulose ingestion , as compared to baseline , was graded from 0 to 3 for abdominal borborygmi , bloating , and pain , as well as a feeling of sickness and freezing , giving a maximum achievable sum score of 15 points . after collection , the samples were centrifuged and the serum was immediately placed in a freezer at 20c until analysis . serum was thawed at room temperature and scfa ( acetic , propionic , butyric , iso - butyric , valeric , and iso - valeric acids ) were analyzed by using a method developed by zhao et al. 14 this method enables the detection of serum concentrations of scfa down to as little as 0.04 m , as described by jakobsdottir et al. 9 all samples were analyzed at least in duplicate . in addition , the ratios of individual scfa concentrations to the total scfa concentrations were calculated . based on the work of tjellstrm et al15 on fecal samples , we calculated two fermentation indices , as follows : fermentation index a , reflecting the fermentation of carbohydrates and conceivably the pro - inflammatory properties of scfa , was calculated as acetic acid concentrations minus propionic and butyric acid concentrations divided by the total concentration of scfa . fermentation index b , reflecting the fermentation of proteins and conceivably the anti - inflammatory properties of scfa was calculated as the sum of iso - butyric and iso - valeric acids . paired t - test was used for comparisons within groups and unpaired t - tests for comparing means between groups . all tests were two - tailed , and p - values less than 0.05 were set as a limit for statistical significance . a total of 22 patients with ibs and 20 healthy controls were included in the study . the groups were comparable regarding age , body mass index , and sex ( table 1 ) . patients with ibs reported more symptoms in response to lactulose ingestion than healthy controls ( figure 1 ) . abdominal symptoms ( borborygmi , bloating , and pain ) were most pronounced , with a mean sum score of 3.2 points ( maximum achievable score 9 points ) , while systemic symptoms ( sickness and freezing ) had a sum score of 2.2 points ( maximum achievable score 6 points ) . levels of scfa in serum obtained in the fasted state were not significantly different between patients with ibs and healthy controls , for any of the scfa . the results ( in m ) were as follows : total scfa 249.663.9 vs 279.953.4 ( p = 0.1 ) ; acetic acid 172.548.9 vs 191.140.0 ( p = 0.2 ) ; pro - pionic acid 10.81.7 vs 11.52.3 ( p = 0.3 ) ; and butyric acid 12.03.2 vs 16.04.2 ( p = 0.4 ; figure 2a ) . similar results , with no significant differences , were seen for iso - butyric ( 13.54.8 vs 15.35.0 ; p = 0.2 ) , iso - valeric ( 39.05.4 vs 47.414.0 ; p = 0.07 ) and valeric acids ( 1.20.5 vs 1.30.6 ; p = 0.4 ) . the levels of scfa in serum 90 minutes after lactulose ingestion were significantly lower in patients with ibs than in healthy controls for all the major scfa : total scfa 228.043.9 vs 285.945.1 ( p = 0.0002 ) ; acetic acid 157.237.2 vs 195.443.7 ( p = 0.005 ) ; propionic acid 10.21.2 vs 12.01.5 ( p = 0.0001 ) ; and butyric acid 13.34.5 vs 16.73.2 ( p = 0.01 ; figure 2b ) . significant differences were also seen for iso - butyric ( 35.912.8 vs 47.811.9 ; p = 0.01 ) , iso - valeric ( 35.912.8 vs 47.414.0 ; p = 0.004 ) and valeric acids ( 1.30.4 vs 1.10.2 ; p = 0.08 ) . no correlation was seen between the levels of scfa in serum obtained 90 minutes after lactulose ingestion and the degree of symptoms , ibs severity scoring system , age , sex , or body mass index . fermentation index a was similar in patients with ibs and healthy controls and did not change following lactulose ingestion . fermentation index b was similar in patients with ibs and healthy controls in the fasting state . however , a significant decline in index b was seen in patients with ibs after the lactulose ingestion ( p = 0.01 ) . a total of 22 patients with ibs and 20 healthy controls were included in the study . the groups were comparable regarding age , body mass index , and sex ( table 1 ) . patients with ibs reported more symptoms in response to lactulose ingestion than healthy controls ( figure 1 ) . abdominal symptoms ( borborygmi , bloating , and pain ) were most pronounced , with a mean sum score of 3.2 points ( maximum achievable score 9 points ) , while systemic symptoms ( sickness and freezing ) had a sum score of 2.2 points ( maximum achievable score 6 points ) . levels of scfa in serum obtained in the fasted state were not significantly different between patients with ibs and healthy controls , for any of the scfa . the results ( in m ) were as follows : total scfa 249.663.9 vs 279.953.4 ( p = 0.1 ) ; acetic acid 172.548.9 vs 191.140.0 ( p = 0.2 ) ; pro - pionic acid 10.81.7 vs 11.52.3 ( p = 0.3 ) ; and butyric acid 12.03.2 vs 16.04.2 ( p = 0.4 ; figure 2a ) . similar results , with no significant differences , were seen for iso - butyric ( 13.54.8 vs 15.35.0 ; p = 0.2 ) , iso - valeric ( 39.05.4 vs 47.414.0 ; p = 0.07 ) and valeric acids ( 1.20.5 vs 1.30.6 ; p = 0.4 ) . the levels of scfa in serum 90 minutes after lactulose ingestion were significantly lower in patients with ibs than in healthy controls for all the major scfa : total scfa 228.043.9 vs 285.945.1 ( p = 0.0002 ) ; acetic acid 157.237.2 vs 195.443.7 ( p = 0.005 ) ; propionic acid 10.21.2 vs 12.01.5 ( p = 0.0001 ) ; and butyric acid 13.34.5 vs 16.73.2 ( p = 0.01 ; figure 2b ) . significant differences were also seen for iso - butyric ( 35.912.8 vs 47.811.9 ; p = 0.01 ) , iso - valeric ( 35.912.8 vs 47.414.0 ; p = 0.004 ) and valeric acids ( 1.30.4 vs 1.10.2 ; p = 0.08 ) . no correlation was seen between the levels of scfa in serum obtained 90 minutes after lactulose ingestion and the degree of symptoms , ibs severity scoring system , age , sex , or body mass index . fermentation index a was similar in patients with ibs and healthy controls and did not change following lactulose ingestion . fermentation index b was similar in patients with ibs and healthy controls in the fasting state . however , a significant decline in index b was seen in patients with ibs after the lactulose ingestion ( p = 0.01 ) . in the present study , we found that patients with ibs had significantly lower serum levels of scfa following lactulose ingestion than healthy controls . this might be surprising since the levels of scfa in serum reflect the levels of scfa in cecum and the proximal colon , that is , the actual site for fermentation ,8 and prior studies have reported increased ( not decreased ) levels of scfa in feces of patients with ibs .16 lack of prior data concerning scfa in serum in patients with ibs might be due to the shortage of appropriate analytical methods . however , the present method , recently developed by zhao et al ,14 enables accurate quantification of scfa , including iso - butyric , iso - valeric , and valeric acids , in serum . it may be speculated that it would have been better to collect several blood samples instead of only one single blood sample after 90 minutes ,17 especially since the assessment of orocecal transit time was not included in the present study . however , previous studies evaluating the effects of lactulose in patients with ibs have concluded that 90 minutes after lactulose intake is the average time point at which lactulose reaches the cecum .10 additionally , this is the average time point for the onset of symptoms after a meal .11 the mechanism by which symptoms are evoked is not known , but lactulose provocation likely overloads the fermentation capacity of the proximal colon . an overload of indigestible carbohydrates in the colon may act osmotically to recruit fluid into the gut lumen . scfa stimulate the uptake of salt and water ,18 and decreased fluid absorption in the proximal colon conceivably contributes to rectal overload and diarrhea . however , we found no correlation between the symptom development in patients with ibs and the serum levels of scfa . however , we acknowledge that lack of statistically significant differences might also be due to the small patient material . we have previously shown that lactulose causes abnormal accumulation of fluid in the small intestine in patients with ibs ,19 a phenomenon that might indicate the presence of an underlying motility disorder . when the buildup of fluid in the small intestine enters the cecum , symptoms may be evoked due to poor cecal accommodation ,20 particularly if the influx occurs in unregulated flushes , thereby overloading the colonic fermentation and salvaging capacity .21 logically , microbial fermentation will continue distally throughout the colon as long as substrates remain . indeed , a recent study may indicate that fermentation , measured as ph , persists throughout the whole colon in patients with ibs .22 increased levels of scfa in feces in patients with ibs16 may thus indicate a distal displacement of colonic fermentation . hence , the levels of scfa in patients with ibs may be different from healthy subjects throughout the colon , from abnormally low in the proximal part to abnormally high in the distal part . distal displacement of colonic fermentation may have several clinical consequences .23 for example , scfa stimulate the enterochromaffin cells in the colorectal mucosa to increase the production of serotonin ,24 a neurotransmitter exerting important physiological effects on both sensory and motoric neural transmission . in addition , scfa from the distal colon bypasses the portal circulation , enabling systemic access and activation of specific scfa receptors present in both the autonomic and somatic nervous system .25 however , delayed fermentation could be positive since many of the diseases that occur in the gastrointestinal tract are located in the lower part , like colorectal cancer and inflammation , and regarding these conditions , high concentrations of scfa could be protective .26 a widespread treatment method for ibs is dietary advice , guiding patients to avoid foods high in low - digestible and fermentable short - chain carbohydrates ( fodmap ; fermentable oligo - , di - and mono - saccharides , and polyols ) . the rationale behind this treatment concept is probably to reduce the fermentation burden on the colon .27 however , a low fodmap diet is probably not a measure to improve the colonic fermenting capacity . indeed , recent studies suggest that fodmap restriction may induce unfortunate changes of gut microbiota .28 in the present study , we calculated two fermentation indices according to tjellstrm et al : 15 index a , reflecting the fermentation of carbohydrates ( high index suggesting a trend toward a pro - inflammatory condition ) and index b , indicating the fermentation of proteins ( high index suggesting a trend toward an anti - inflammatory condition ) . according to these indicators , we found that the fermentation of proteins decreases in the postprandial state in patients with ibs compared with healthy controls . this might suggest that the colonic content in patients with ibs has pro - inflammatory properties , conceivably related to subclinical inflammation , as reported in patients with ibs by other groups .29 however , we acknowledge that the two proposed fermentation indices have not yet been formally validated . we found that the fermentation of lactulose leads to lower serum levels of scfa in patients with ibs than in healthy controls , suggesting impaired colonic fermentation . when developing new treatments , it might be wise to target the fermentation process itself .\noutput:\n" }, { "from": "agent", "value": "backgroundingestion of low - digestible carbohydrates triggers symptoms in patients with irritable bowel syndrome ( ibs ) . these carbohydrates become substrates for microbial fermentation in the colon , yielding short - chain fatty acids ( scfas ) that are readily absorbed . aiming to compare colonic fermentation in patients with ibs and healthy controls , we analyzed the concentrations of scfa in serum at fasting and 90 minutes following ingestion of an unabsorbable , but fermentable carbohydrate , lactulose.methodspatients with ibs according to rome iii criteria ( n = 22 ) and healthy controls ( n = 20 ) ingested 10 g lactulose dissolved in water . symptoms were graded by questionnaires and scfa were analyzed using hollow fiber - supported liquid membrane extraction coupled with gas chromatography.resultslactulose induced more symptoms in patients with ibs than in healthy controls ( p = 0.0001 ) . fasting serum levels of scfa did not differ between patients with ibs and controls . however , the postprandial levels of total scfa ( p = 0.0002 ) , acetic acid ( p = 0.005 ) , propionic acid ( p = 0.0001 ) , and butyric acid ( p = 0.01 ) were significantly lower in patients with ibs compared with healthy controls . there was no correlation between the levels of serum scfa and symptom severity.conclusionlow - serum levels of scfa after lactulose ingestion may indicate impaired colonic fermentation in patients with ibs . conceivably , this disturbance is related to symptom generation , but the mechanism is not clear ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: tumor - bearing animals offer a variety of xenograft - based cancer models may greatly help understanding cancer biology , especially for the interactions among cancer cells and normal cells in vivo situation . for this purposethe need of tumor - bearing animal models that can be elucidating the behaviour of cancer cells when faced to the host immunity pressure . for example , the use of total lymphoid irradiation , transgenic mice , or rats showed a high take rate of cancer after having been xenografted with human cancer cells . the migration of endothelial cells from surrounding tissues to the point where cancer cells were inoculated was found during two weeks after human cancer cells were implanted into animals . these events can be clearly visualized by the immunohistochemical staining of endothelial cells and hematoxylin - eosin staining of red blood cells as well as leucocytes accumulation found outside the blood vessels of the tissue . then these solid tumors had rapidly grown and could be clearly measured using vernier calipers . in our research groups , the tumor diameter of about 1.5 cm usually obtained after 1 month in athymic nude mice xenografted with mdb - 435 human breast cancer cells . it should be noted that the tumor was rapidly increased in size reach to the limit of the animal use guideline ; the animals must be terminated . thus the interaction / behaviour of cancer cells in normal microenvironments in particularly under the pressure of host antibody can not be detected . indeed these models are useful for a variety of studies such as in testing drugs or radiation sensitivities and targeting of biomarkers for cancers . there is evidence that the tumor formation in irreversible immunosuppressed animal models takes very short time that will be limitation for investigation of the interaction of cancer cells with normal cells in the microenvironment of normal tissue . therefore , a temporally immunosuppressed animal model that will not reject human cancer cells at the starting period where afterwards a reversible suppressant can be achieved after withdrawal is crucial for understanding the phenomenon . . showed that wistar rats treated with cyclosporin a develop a state of immune suppression that permits the growth of tumor xenografts . it was also demonstrated that in these models there was no alteration in the tumor doubling time or histological morphology of the xenografts in the adapted host when compared to those in the donor tumors . the tumor growth curve showed a pattern of initial growth and a period of stagnation , followed by a steady , but slower growth phase . it should be noted that animals were continuously given cyclosporin a throughout the experimental periods . since cyclosporin a is a potent reversible immunosuppressive agent , it can facilitate the induction of immunologic tolerance in vivo in a variety of animal models . it was shown that the reversible suppressant activity affected both humoral and cellular immunity and did not cause myelosuppression . its mechanism of action appears to be selective for lymphocytes and may interrupt the necessary cellular signals required for proliferation of alloreactive t - cells . in this study , we prepared temporally immunosuppressed wistar rats by consecutive intraperitoneal injections of cyclosporin a ( 200 mgkg ) for 4 days prior to the human small cell lung carcinoma ( glc4 and glc4 / adr ) xenografts . since the immunosuppression mediated by cyclosporin a is known to be a reversible process and after withdrawing cyclosporin a , the rat 's immune system fully recovered within one week . in this condition , on one hand the cancer cells might have enough time to depart from their point of origin of xenograft to various organs and prepare the stromal structure for adhering and caused leakage of red blood cells and leucocytes to outside the blood vessels of a tissue following inflammation . on the other hand the glc4 and clc4 / adr cells themselves are characterized as hypoxic cells and are strong triggers of angiogenesis which is clearly observed by immunohistochemistry of the lung tissue [ the results were presented in wmic 2012 ] . the results of histological studies revealed various sites of inflammation that were not observed in similar series of experiment performed using athymic nude mice . therefore , the temporally immune - suppressed animal appears as a very good model that appropriately studies hypoxic and inflammation of microenvironment during the early stages of lung cancer . it is well accepted that an accumulation of red blood cells and leucocytes outside the blood vessels of a tissue is evidence of an early stage of angiogenesis . the accumulation of red blood cells outside the blood vessels for long time causes an increase in old red blood cells that underwent phagocytosis by the tissue macrophages or an old red blood cell lysis which may lead to a subsequent release of the prooxidant haemoglobin . then the haemoglobin was oxidized in met - haemoglobin and liberates heme and hemin within tissues . an increase in iron accumulation in tissue will trigger an immune - inflammatory response and hypoxic microenvironment is known as an early event of cancerous tissue formation . evidence is rapidly accumulating that chronic inflammation may contribute to carcinogenesis through the increase of cell proliferation , angiogenesis , and metastasis in a number of neoplasms , including colorectal carcinoma . in fact hemin is a prominent biomarker of the immune - inflammatory response and hypoxic microenvironment that can be noninvasively visualized by using ferrioxamine magnetic resonance imaging . complexation of ferric - dfo was done using stoichiometry one mole of dfo with one mole of ferric ion ; ka of the complexation of ferric with dfo is 10 mole . the interaction of dfo and hemin was investigated and the binding constant of dfo hemin ( 1 : 1 complex ) was calculated to be 1010 m at various temperatures . in this studyit is also verified that the ferrioxamine can specifically bind to heme neither without decomplexation nor reduction of ferric ion . ferrioxamine can enhance the sensitivity of proton relaxation signal detection of a tissue equivalent phantom by 1000-fold higher than without the complex condition , indicating that the ferrioxamine mr imaging might be able to determine the number of molecules ( 10 m ) of water participating in the excitation and relaxation processes . an administration of ferrioxamine in animal models and the specific interaction of heme - ferrioxamine complex allow investigating the chronic inflammation site original of lung cancer . the smallest dimension of foci that can clearly be visualized is about 0.1 mm that is sensitive enough to visualize the inflammation and angiogenesis of the early stages of cancer tissue . iron ( iii ) chloride anhydrous ( fecl3 ) was obtained from fluka ; desferrioxamine mesylate , hemin , and pirarubicin were from sigma . the presence of contaminating metals in reagents can lead to unpredictable change in any additional enhancement of proton signals due to the exchange of contaminating metals with iron , which may affect the rates of proton relaxation . therefore , in order to remove trace amounts of adventitious metals in water , chelating resin ( chelex 100 ) was used as previously described . chelex 100 resin was added to double - distillated water ( 5 mg / 100 ml ) and stirred gently for 1 hour . next , the water was filtered from the resin using filter paper for quantitative analyses ( mn 615 , macherey - nagel ) . the glassware was washed with 10 % nitric acid and rinsed three times with metal - free water . the buffer solution contained 20 mm hepes buffer supplemented with 132 mm nacl , 3.5 mm kcl , 0.5 mm mgcl2 , and 5 mm glucose , ph 7.25 . the stock solution of 0.01 m ferric ions ( in 0.4 m h2so4 ) was prepared extemporaneously . the stock solutions of 0.01 m desferrioxamine were prepared in metal - free water and stored at 20c . to obtain the desired concentration of desferrioxamine , the stock solution was diluted with a buffer . experiments were conducted in a 1 - cm quartz cuvette containing 2 ml of solution that was continuously stirred . the temperature was kept constant at 25c using a peltier temperature control , cell holder model 89090a . the concentration of ferric ion was determined using a molar extinction coefficient at 304 nm equal to 2204 mcm . dfo in an aqueous solution is colorless while ferric ions have a bright yellow color . a reddish color appears immediately after the solution of dfo comes in contact with ferric ions . the solution mixture possessed an absorption spectrum from 350 to 450 nm with a maximum absorbance at 427 nm . the concentration of ferrioxamine was determined using a molar extinction coefficient at 427 nm equal to 1670200 mcm . , we had checked that ferrioxamine neither can bind to hemin without releasing nor underwent reduction of ferric ion . the human small cell lung cancer , glc4 , and its mrp1 - overexpressing glc4 / adr cell lines were routinely cultured in rpmi 1640 medium supplemented with 10 % fetal calf serum ( gibco biocult , ltd . ) . the resistant glc4 / adr cells were cultured in the presence of 100 nm doxorubicin until two weeks before the experiments . for the assays , a culture was initiated at a density of 510 cellsml in order to have cells in the exponential growth phase . the cultured cells were used 24 hours later , when the culture had grown to a density of approximately 810 cellsml . the cytotoxicity assay was performed as follows : 510 cellsml were incubated in the presence of various concentrations of compounds ranging from 0 to 100 m . ic50 was determined by plotting the percentage of cell growth inhibition versus the concentration : ic50 was the concentration of compounds which inhibits cell growth by 50 % when measured at 72 hours . a resistance factor ( rf ) a total of 9 male wistar rats ( outbred : national laboratory animal center , mahidol university , thailand ) each being 4 weeks of age were housed in sterile isolation unit and fed rodent chow and water ad libitum and were treated in accordance with institutional guidelines for animals . rats were intraperitoneally injected with cyclosporin a ( 200 mgkg ) for 4 consecutive days prior to the implantation of glc4 and glc4 / adr cells . the cancer cells ( 10 of each cell line in 200 l dpbs ) were subcutaneously implanted at the lower limbs ; left site for glc4 ; and right site for glc4 / adr cells . the xenografted rats were examined by monitoring the plasma metabolites using a 400 mhz nuclear magnetic resonance spectrometer , for the formation of cancer tissue at the implanted sites , with mr imaging being done every month . rats were anesthetized by intraperitoneal injection with 2 mgkg of nembutal ( ovation pharmaceutical inc . , deerfield , illinois , usa ) . the tail was intravenously punctured with a catheter 24 g , and a drip of nss was administered . the anesthetized rats were placed and fixed in a prone position inside an in - house made bed ( to keep at a constant temperature of 25c ) equipped with a head coil . the mr images were performed using a 1.5 t mri instrument ( achieva , philips ) . the coronal and sagittal plan surveys were obtained using the same scout techniques that were applied to both t1w - se ( tr = 535 ms ; te = 10 ms ) and t2w - tse ( tr = 2500 ms ; te = 115 ms ) . the ferrioxamine imaging was performed at 20 seconds and then was performed at 2 , 4 , 6 , 15 , 45 , and 60 minutes after a 50 mol kg injection in the tail vein had been administered . signal intensity values at each time point were obtained from regions of interest ( rois ) and were determined using a series of cross section images as a function of time . signal intensities from three rois taken from different sections of each tissue of interest were averaged , and the mean si was used as a basis for further calculations . the signal from a spin echo sequence is as follows : s = k ( 1 e ) e , where k is a constant related to magnetization density ; tr and te are the sequence repeat time and echo time , respectively . with respect to the protocol of t1w - imaging , trte , where te had the lowest value , the signal intensity obtained from the scanning becomes s = k ( 1 e ) . the equation can be arranged by replacing the signal intensity ( s ) and k by i and i0 , respectively : ( 1 ) i = i01etr / t1.thus , the density of t1w - images can be written as ( 2 ) density = logi0i = 0.3623 trt1.the relationship between relaxation rates and contrast agent concentration can then be predicted by the solomon - bloembergen equations : ( 3 ) 1t1postcon = 1t1precon + r1m , where r1 is the longitudinal relaxation being equal to 1.050.4 mms and [ m ] is the concentration of ferrioxamine . the ferrioxamine enhanced spatial image contrast was measured using the following equation : ( 4 ) densitypostcon0 .3623 tr = densityprecon0 .3623 tr + r1 m . immediately after sacrificing the rats , organs were harvested , weighed , and cut into small pieces . fragments were fixed with 4 % formalin and processed in paraffin in the usual way , and 5 - m sections were stained with hematoxylin - eosin . endothelial cells were specifically stained with gsl - 1 lectin ( vector laboratories , burlingame , ca ) in the previously described manner . for each gsl -1-labeled sectionthe fields which were indicated by the hematoxylin staining were randomly selected for analysis . the percentage area of endothelial cellswas then calculated as a ratio of the labeled area : the total viewed area 100 . tissue accumulation of iron was determined by perls ' prussian blue with hematoxylin counterstain method . in order to apply ferrioxamine as a molecular probe for mr imaging of lung tissue inflammation , the cytotoxicity of the compound against human small cell lung carcinoma glc4 and glc4 / adr was performed . dfo alone is moderately toxic against small cell lung carcinoma ( glc4 ; ic50 = 306 m ) and its corresponding multidrug resistant cells which overexpressed mrp1 - protein ( ic50 = 503 m ) compared with pirarubicin , ( glc4 , ic50 = 103 nm and glc4 / adr , ic50 = 425 nm ) . ferrioxamine exhibited cytotoxicity against the same cell lines 4 times lesser than those of dfo alone . ferrioxamine at a subtoxic dose of 50 mol kg was intravenously injected to the rats and was sufficient to enhance the image contrast , without inducing any adverted effects during experiments . as can be observed in figure 1 , t1w - and t2w - images of wistar rats after administering the paramagnetic agent clearly showed an increase in the t1 - signal intensity while they showed a decrease in the t2w - signal intensity in various tissues such as the vascular systems and urinary system ( including renal cortex and pelvis , ureters and bladder , brains , and muscles ) . due to limitation of mri instrument , the fastest dynamic imaging protocol can performed at 20 seconds and then at one - minute time intervals . the first pass of ferrioxamine to heart and aorta can not be determined by using dynamic enhance contrast mri ; however this can clearly be determined by ct . in the conditions of experiments , ferrioxamine ( bolus of 50 mole ) which was administrated in the tail vein was reached to the heart and ejected via aorta for first pass within 2022 seconds . the compound reached the kidneys and bladder at 4 and 6 minutes , respectively . figure 3 showed that ferrioxamine penetrated across the endothelial cell layer and resides into the tissues . the tissue concentration of ferrioxamine determined by mr imaging technique was 0.020.01 molekg of rat weight for muscle , 0.01 molekg of rat weight for lung , and 0.02 molekg of rat weight for brain . t1w - images showed the typical results of biodistribution of ferrioxamine in xenografted rats . the 3d images of whole body of rats can clearly elucidate the tissue distribution pattern and accumulation of ferrioxamine in xenografted rats ( figure 4 ) . the arterial phase of ferrioxamine was recorded within 20 to 40 seconds and then following the venous phase at 6 to 15 minutes and the equilibrium phase at 45 to 60 minutes . as can be seen in figure 4 , the images of xenografted rats ( 3 months after xenografted ) with injection of ferrioxamine compared with those without revealed that there were bright spots distributed throughout the lung and a loss of signal area at the anterior of left ventricle ( figure 5 ) . it should be noted that these bright spots are very small and the average diameter was approximately 0.60.1 mm . these bright spots should correspond to the infiltration of lung tissue indicative of an inflammation which is the early event of cancer . it is very difficult to determine the tissue concentration of ferrioxamine in lung tissue by excluding the bright spots in these series of experiments . but concentration of ferrioxamine of the bright spots of lung tissue was around 0.050.02 mole per kg of rat weight . figure 6 ( a ) shows that the changes in lung tissue structure and yellow pale to white color spots were found in both lobs of lung and no solid tumors were observed . the micrograph of lung tissue sections showed that there were spots where the blood cells were found outside of the vasculature ( figure 6 ( b ) ) and the endothelial cells were found within these spots . perls ' prussian blue with hematoxylin counterstain method confirmed that hemin was abundantly accumulated in those of infiltrative points . inflammation caused by an accumulation of red blood cells and leucocytes outside the blood vessel of the tissue which leads to angiogenesis was traditionally studied by biochemical methods called analyzing frozen cross sections of tumor tissues by using high - resolution microscopy . however , situations and conditions in such studies are forthcoming arising that requires dynamic imaging of live animals . therefore , this study examined the potential use of ferrioxamine as a targeted mri contrast agent for visualizing and determining any inflammation related to angiogenesis formation in temporally immunosuppressive rats xenografted with human small cell lung carcinoma . as clearly showed ferrioxamine exhibits cytotoxicity against small lung carcinoma cells 4 times lesser than desferrioxamine . reported that ferrioxamine was eliminated from healthy subjects by fast decline ( t1 / 2 = 2.4 h ) and slow decline ( t1 / 2 = 5.9 h ) processes . the same authors also determined the renal clearances which is equal to 516 ml hkg in healthy subjects . thus the injection of ferrioxamine in animals and human should be relatively safe . as a matter of fact , ferrioxamine is an efficient t1 - contrast agent that can increase the sensitivity of proton imaging in a range of submicromolar concentration . the concentration of ferrioxamine at a given tissue was obtained by measuring the density of images by roi technique . the density data were calculated in ferrioxamine concentration using ( 4 ) . the wash - in and wash - out of a given tissue can be determined ( see figure 2 ) . the results of this study also indicated that a majority ( 80 % ) of ferrioxamine was found in the vasculature system while a fraction ( 20 % ) resided in the tissues . not found in normal rats are the bright spots present in both lung lobes of the xenografted rats . these bright spots might be caused by the interaction of ferrioxamine with hemin liberated from the old red blood cell lysis or from a high vasculature density ( lots of blood vessels over a small area ) . however , the same results were not observed when similar series of experiments were performed using gd - dtpa ( data were presented in poster session at wmic 2012 ) . it should be noted that ferrioxamine has higher permeability than gd - dtpa suggesting that an enhancement of t1w - images should primarily have the result of the hemin accumulation at the inflammation points . this study gets successful to develop immunocompromised rat model of lung cancer and demonstrates that by using hemin as biomarker and ferrioxamine as targeted mr probe . we can examine the inflammation sites that correlate very well with histological study using high - resolution microscope . however , the preparation procedure of the immune - compromised rat model of lung cancer can also be applied for another type of cancer strictly with respect to the protocol as follows . the animal model required for such studyshould initially be immune suppressed by 4 consecutive days of intraperitoneal injection of cyclosporin a ( 200 mgkg ) which caused a depletion of immunity prior to cancer cell implantation . we had found that these immune - compromised rats did not reject the implanted human cancer cell . the recovery of rat immunity should decrease the growth and invasion rat of cancer cells . as can be seen the cancer tissue appearance was taken about 4 to 6 months later . during this period , the human cancer cells should progressively prepare their microenvironments by interacting with the host cells resulting in a cancer stromal structure for adhering and caused leakage of red blood cells and leucocytes to outside the blood vessels of a tissue following inflammation . by following the procedure of this study , seven out of nine rats ( 77 % ) have developed lung inflammation within 3 months . it should be noted that the cancer tissues obtained at the end of series of experiment were covered by a very dense and elastic tissue that distinguishes human cancer tissue from those of rats . it is a model of cancer that very closely resembles developments that take place in the human body . overall the results of this study suggest that ferrioxamine is a suitable molecular probe for mr imaging of hemin accumulation that caused the inflammation of tissues , particularly at the very early stages of cancer .\noutput:\n" }, { "from": "agent", "value": "physiological responses such as chronic inflammation and angiogenesis could be used as biomarkers for early detection of cancer with noninvasive imaging modalities . the present study reports the application of magnetic resonance imaging instrument to image the binding of ferrioxamine with hemin that allows visualizing the chronic inflammation foci of lung tissue of immunocompromised rats xenografted using small cell lung carcinoma . a low concentration of ferrioxamine ( 0.05 0.02 mkg1 of rat weight ) deposited on tissue outside the vasculature was found to diffuse across the capillary walls to the interstitial space and inflammation foci , which provided a clear enhancement of t1 - weighted gradient - echo sequence images . ferrioxamine imaging allowed the determination of inflammatory sites and their localization in 3d fat - suppressed maximum intensity projections . the smallest dimension of foci that can be clearly determined is about 0.1 mm3 . in concomitant to the in vivo imaging , analysis of histological tissue section showed the development of inflammatory sites . this study provides evidence that medical imaging instrument such as mri scanner allows researchers to correlate images taken with mri with those using high - resolution microscopy . moreover , ferrioxamine is a useful molecular probe for determining chronic inflammation particularly at the very early stages of cancer ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: streptococcus pneumoniae is a common etiological agent of serious invasive infections and the most common cause of pneumonia , which is a major cause of mortality throughout the world ( 1 , 2 ) . on the verge of the antibiotic era , clinical isolates ofs . pneumoniae showed a high sensitivity to antibiotics such as benzylpenicillin , which had an exceptionally low ( 5 - 10 ng / ml ) minimum inhibitory concentration ( mic ) against these strains . the emergence of drug - resistant s. pneumoniae posed a new difficult challenge for treatment of these infections ( 3 ) . the initial incidence of clinically important penicillin - resistant isolates has since been reported worldwide . the spread of penicillin and multidrug resistance among s. pneumonia has become an important universal issue and a challenge for the present treatment strategies ( 4 ) . - lactams are the most widely used antibiotics ; however , extensive resistance has evolved among most common pathogens such as s. pneumoniae ( 5 , 6 ) . , haemophilus influenzae , staphylococcus aureus , s. pneumoniae , and s. pyogenes confirmed that antimicrobial resistance is still a limited issue ( 7 ) . penicillin and macrolide resistance in s. pneumoniae are considered as a serious concern globally , particularly , in asian countries ( 8 ) . the - lactam antibiotics are broadly utilized to treat community and healthcare - associated infections , and the appearance and spread of antimicrobial resistance to this family of drugs is a significant threat to human health ( 9 ) . several resistance mechanisms have been reported , including expression of drug - destroying enzymes such as - lactamases ( 10 , 11 ) , altered drug targets such as conformational changes in pbps ( 10 ) , decreased bacterial permeability ( 10 ) , and increased drug efflux ( 12 ) . understanding the principles for resistance mechanisms is essential and important for surveillance and control of infections . furthermore , appropriate antimicrobial use is also of importance , for instance penicillins and cephalosporins ( members of b - lactam antibiotics ) inhibit pbps , which are vital for bacterial cell wall biogenesis . pathogenic bacteria have developed efficient antibiotic resistance mechanisms which in gram - positive bacteria , includes mutations in pbp genes that facilitate avoidance of b - lactam inhibition ( 13 ) . resistance of s. pneumoniae to - lactams is due to reduced affinity of pbps , particularly pbp1a , pbp2b andpbp2x . s. pneumoniae contains the mosaic pbp sequence , which has high homology with pbp in oral streptococci ( 14 ) . resistance of s. pneumoniae to - lactams results from homologous recombination of pbp with the pbp genes of - lactam - resistant oral streptococci ( 15 - 19 ) . thus , molecular epidemiological analysis , antimicrobial susceptibilities and resistance genes analysis are crucial in prevention and therapy of infectious diseases such as drug resistance in s. pneumoniae . therefore , clinical laboratories should consider screening selected isolates to determine their susceptibility to macrolides , - lactams , vancomycin or clindamycin . this study aimed to investigate the true prevalence of - lactam resistance among clinically important isolates of s. pneumoniae and to examine susceptibility of s. pneumoniae to various antimicrobial agents including benzylpenicillin , imipenem , oxacillin and ceftazidim . in addition , the distribution of pbp genes of pbp1a , pbp2b , and pbp2x was investigated . furthermore , the changes in mic and dispensation of the antimicrobial - resistance genes were compared . isolates of s. pneumoniae ( n = 55 ) were collected from outpatients seen at the medical center of hamadan . clinical samples were cerebro - spinal fluid ( csf ) ( 6 ) , sputum ( 20 ) , otorrhea ( 1 ) , pharynx ( 8 ) and others ( 2 ) . all isolates were identified according to the method summarized by the centers for disease control ( 21 ) . gram - positive cocci - hemolytic colonies on blood agar plates supplemented with 5 mg / ml gentamycin were collected with a wire loop and subcultured on blood agar plates . an optochin disk with a diameter of 6 mm ( 5 mg ethylhydrocupreine ) was placed aseptically on the streak of inoculum . the plate was incubated at 37c in a 5 % co2 atmosphere for 18 - 24 hours . isolates with an inhibition zone of 14 mm in diameter , which were susceptible to optochin , were selected . strains with inhibition zones ranging from 9 mm to 13 mm were tested for bile solubility using 2 % sodium deoxycholate ( bile salt ) ( oxoid , basingstoke , hamsphire , england ) . finally isolates were confirmed by polymerase chain reaction ( pcr ) for autolysin ( lyta ) gene ( 22 - 24 ) . isolates were stored in 15 % glycerol at -80 c until used for pcr and e - test ( 25 , 26 ) . the drug susceptibility of confirmed samples with microbial tests was determined using antibiotic e - test strips ( himedia laboratories pvt . antibiotics employed in this study were : benzylpenicillin , imipenem , oxacillin , and ceftazidim . inocula were prepared by direct suspension of colonies grown overnight on sheep blood agar in muller - hinton broth to achieve turbidity equivalent to a 0.5 mc - farland opacity standard . the 100 - mm - diameter agar plates were inoculated by confluent swabbing of the surface with the adjusted inoculum suspensions . after application of the e - test strips , pneumococcal test plates were incubated in ambient air at 35c for 20 to 22 hours ( 25 - 28 ) . e - test mics were interpreted by noting the point of intersection of the growth ellipse margin with the mic scale on the e - test strip when viewed from the upper agar surface with the plate lids removed ( figure 1 ) . isolates were grown in blood agar medium containing 5 % sheep blood agar ( merck , darmstadt , germany ) with 5 % co2 at 37c for 48 hours . a single colony of s. pneumoniae was removed and suspended in lysis solution as reported previously and cells were lysed for 10 minutes at 60c followed by 5 minutes at 94c ( 22 , 28 ) . each reaction tube contained 20 l solutions that included 10 x buffer ( 2 l ) , mgcl225 mm ( 0.4 l ) , dntps 10 mm ( 0.8 l ) , distilled water ( 13.7 l ) , taq 5 u / l ( 0.2 l ) , dna ( 1 l ) , primer 1 ( 10 pm ) ( 1 l ) and primer 2 ( 10 pm ) ( 1 l ) . amplification of pbp1a , pbp2b , and pbp2x were examined by pcr using the primers reported by ubukata and co - workers ( 22 , 29 ) . to raise the percentage of prsp strains and to compensate for the variety of gene mutations , primers were designed to amplify the genes of susceptible strains but not of resistant strains . primer pairs used included : for lyta , 5 ' - tgaagcggattatcatggc - 3 ' and 3 ' - gctaaactccct gtatcaagcg - 5 ' ( 273bp ) ; for pbp1a , 5 ' - aaacaa ggtcggactcaacc - 3 ' and 5 - ' aggtgctacaaattgagagg - 3 ' ( 430 bp ) ; for pbp2x , 5 ' - ccaggttcc actatgaaagtg - 3 ' and 5 ' - catccgtcaaacc gaaacgg - 3 ' ( 292bp ) ; for pbp2b , 5 ' - caatctagagtc tgctatgga - 3 ' and 5 - ' ggtcaattcctgtcgc agta - 3 ' ( 77 bp ) . pcr conditions were as follows : initial denaturation step at 94c for 3 minutes followed by 30 cycles at 94c for 20 seconds , 57c for 20 seconds and 72c for 15 seconds , and a final extension step at 72c for 7 minutes ( 21 ) . isolates of s. pneumoniae ( n = 55 ) were collected from outpatients seen at the medical center of hamadan . clinical samples were cerebro - spinal fluid ( csf ) ( 6 ) , sputum ( 20 ) , otorrhea ( 1 ) , pharynx ( 8 ) and others ( 2 ) . all isolates were identified according to the method summarized by the centers for disease control ( 21 ) . gram - positive cocci - hemolytic colonies on blood agar plates supplemented with 5 mg / ml gentamycin were collected with a wire loop and subcultured on blood agar plates . an optochin disk with a diameter of 6 mm ( 5 mg ethylhydrocupreine ) was placed aseptically on the streak of inoculum . the plate was incubated at 37c in a 5 % co2 atmosphere for 18 - 24 hours . isolates with an inhibition zone of 14 mm in diameter , which were susceptible to optochin , were selected . strains with inhibition zones ranging from 9 mm to 13 mm were tested for bile solubility using 2 % sodium deoxycholate ( bile salt ) ( oxoid , basingstoke , hamsphire , england ) . finally isolates were confirmed by polymerase chain reaction ( pcr ) for autolysin ( lyta ) gene ( 22 - 24 ) . isolates were stored in 15 % glycerol at -80 c until used for pcr and e - test ( 25 , 26 ) . the drug susceptibility of confirmed samples with microbial tests was determined using antibiotic e - test strips ( himedia laboratories pvt . ltd , india ) . antibiotics employed in this study were : benzylpenicillin , imipenem , oxacillin , and ceftazidim . inocula were prepared by direct suspension of colonies grown overnight on sheep blood agar in muller - hinton broth to achieve turbidity equivalent to a 0.5 mc - farland opacity standard . the 100 - mm - diameter agar plates were inoculated by confluent swabbing of the surface with the adjusted inoculum suspensions . after application of the e - test strips , pneumococcal test plates were incubated in ambient air at 35c for 20 to 22 hours ( 25 - 28 ) . e - test mics were interpreted by noting the point of intersection of the growth ellipse margin with the mic scale on the e - test strip when viewed from the upper agar surface with the plate lids removed ( figure 1 ) . a , sensitive ; b , resistant . isolates were grown in blood agar medium containing 5 % sheep blood agar ( merck , darmstadt , germany ) with 5 % co2 at 37c for 48 hours . a single colony of s. pneumoniae was removed and suspended in lysis solution as reported previously and cells were lysed for 10 minutes at 60c followed by 5 minutes at 94c ( 22 , 28 ) . each reaction tube contained 20 l solutions that included 10 x buffer ( 2 l ) , mgcl225 mm ( 0.4 l ) , dntps 10 mm ( 0.8 l ) , distilled water ( 13.7 l ) , taq 5 u / l ( 0.2 l ) , dna ( 1 l ) , primer 1 ( 10 pm ) ( 1 l ) and primer 2 ( 10 pm ) ( 1 l ) . amplification of pbp1a , pbp2b , and pbp2x were examined by pcr using the primers reported by ubukata and co - workers ( 22 , 29 ) . to raise the percentage of prsp strains and to compensate for the variety of gene mutations , primers were designed to amplify the genes of susceptible strains but not of resistant strains . primer pairs used included : for lyta , 5 ' - tgaagcggattatcatggc - 3 ' and 3 ' - gctaaactccct gtatcaagcg - 5 ' ( 273bp ) ; for pbp1a , 5 ' - aaacaa ggtcggactcaacc - 3 ' and 5 - ' aggtgctacaaattgagagg - 3 ' ( 430 bp ) ; for pbp2x , 5 ' - ccaggttcc actatgaaagtg - 3 ' and 5 ' - catccgtcaaacc gaaacgg - 3 ' ( 292bp ) ; for pbp2b , 5 ' - caatctagagtc tgctatgga - 3 ' and 5 - ' ggtcaattcctgtcgc agta - 3 ' ( 77 bp ) . pcr conditions were as follows : initial denaturation step at 94c for 3 minutes followed by 30 cycles at 94c for 20 seconds , 57c for 20 seconds and 72c for 15 seconds , and a final extension step at 72c for 7 minutes ( 21 ) . fifty five out of 400 samples were positive for s. pneumoniae with microbial test and pcr ( figure 2 ) . gel electrophoresis with autolysin gene ( l = marker 50 bp , agarose le 3 % , a = negative control with distilled water , b = negative control with e. coli , c = positive control with s. pneumoniae ( ptcc no. 1240 ) , d - j = lyta gene ( 273bp ) ) all 55 strains were classified into following six genotypes , according to pcr for pbp1a , pbp2x , pbp2b genes : pssp with three normal genes ( n = 0 % ) ; pisp with abnormal pbp2x ( n = 100 % ) ; pisp with abnormal pbp2b ( n = 100 % ) ; pisp with abnormal pbp1a ( n = 85.5 % ) ; pisp ( pbp2x +2 b ) with abnormal pbp2x and pbp2b ( n = 100 % ) ; pisp ( pbp1a +2 x ) with abnormal pbp1a and pbp2x ( n = 100 % ) ; pisp ( pbp1a +2 b ) with abnormal pbp1a and pbp2b ( n = 100 % ) ; prsp with three abnormal pbp genes ( n = 85.5 % ) . e - test results revealed that 94.5 % of isolates were resistant to penicillin , 100 % to oxacillin , 100 % to imipenem , and 21.8 % to ceftazidime . furthermore , 85.5 % of the samples with prsp genotype had all three mutant genes and none of the samples were sensitive to penicillin . figure 3 indicates the relationship between distributions of antimicrobial minimum inhibitory concentrations for s. pneumoniae in mutations of pbp genes . in addition , 94.5 % of samples were resistant to penicillin , imipenem and oxacillin , while 21 % of samples were resistant to all tested antibiotic e - test strips . the most frequent penicillin resistance genes were pbp2x and pbp2b while 85.5 % of the samples had the prsp genotype ( had all three mutated genes ) . furthermore , no penicillin sensitive strain was detected and 100 % of the samples had at least two penicillin resistance genes and those with one or two penicillin resistance genes had intermediate penicillin resistance ( pisp ) . pneumococci have remained as important human pathogens despite the introduction of penicillin and the new generation of antibiotics . our results showed that the incidence of penicillin - resistant strains among iranian clinical isolates is alarmingly high . the rate of resistance to penicillin in our isolates was higher than the resistance rates reported from other countries , underlining the necessity for more attention to be paid to antibiotic therapy for pneumococcal infections . a detailed study from brazil indicated that the prevalence of resistant strains increased during the six years of the study period according to analysis of mics ( 30 ) . the present study showed a 94.5 % prevalence rate for penicillin resistant s. pneumoniae . this is higher than the 67.8 % reported from tanzania ( 31 ) and 64 % from kuwait ( 32 ) and very higher than the 9.5 % reported from zahedan , iran ( 33 ) . pcr is a rapid and simple technique with high sensitivity and specificity for detection of microorganisms ( 34 - 37 ) . since the first cases of invasive pneumococcal infections caused by prsp were reported in 1977 , penicillin - nonsusceptible strains have become a global concern ( 38 ) . several reports have determined a high prevalence of pneumococcal resistance to penicillin as well as other antibiotics , such as cephalosporins and macrolides . a recent survey in the united states showed that 18.4 % of isolates were resistant to penicillin ( 20 ) . furthermore , the overall proportion of the isolates which were resistant to three or more classes of drugs was reported to be increased ( 39 ) . some studies have documented the emergence of decreased susceptibility of s. pneumoniae to fluoroquinolones ; in addition , a failure in therapy of cases with pneumococcal pneumonia treated with oral levofloxacin has been reported ( 40 , 41 ) . a number of factors have been reported to play a role in carriage and transmission of penicillin resistant . other risk factors for resistant pneumococcal carriage include young age , attendance to day care centers , and human immunodeficiency virus ( hiv ) infections in some populations ( 42 , 43 ) . autolysins are enzymes that degrade different bonds in the peptidoglycan which ultimately result in the lysis and death of the cell . the s. pneumoniae contains a powerful autolytic enzyme that has been described as an n - acetylmuramoyl - l - alanine amidase ( 44 , 45 ) . the autolysin lyta is responsible for release of lipoteichoic and teichoic acids , which are host inflammatory response mediators . neuraminidase ( 45 ) is a choline - binding protein which is found in the cytoplasm of s. pneumoniae and released when the cells undergo autolysis . cell wall autolysin may have a function in pathogenesis of s. pneumoniae through lysing a proportion of the invading pneumococci , which causes the release of potentially lethal toxins . earlier studies have revealed that autolysin releases extremely inflammatory cell wall breakdown products , which eventually contribute to pathogenesis ( 44 , 45 ) . in addition , autolysin - deficient s. pneumoniae were shown to have a degree of attenuated virulence in one of the previous reports ( 44 ) . therefore , it can be presumed that autolysin contributes to early pathogenesis of the pneumococcal disease . in the present study , all of our isolates were positive for lyta , irrespective of the kind of disease they were causing . all the isolates from both invasive and ocular infections were lyta positive suggesting that irrespective of site of isolation and kind of infection , autolysin is a necessity for the s. pneumoniae isolates . in the current work , examination of mics for - lactams , including penicillin , imipenem , oxacillin , ceftazidim , showed a trend in s. pneumoniae resistance to - lactams . the existence of mutant pbp genes affected the mic of - lactam resistance since the occurrence of these genes in resistant was higher compared to the sensitive isolates ( figure 3 ) . the lower affinity of pbps , 1a , 2b and 2x are involved in - lactams - resistance in s. pneumoniae . furthermore , we used pcr with primers specific to susceptible alleles for the detection of mutations in pbp genes , which demonstrated that 85 % of isolates had mutations in the pbp genes . the comparison of these results with results of e - test demonstrated that there are other pbp genes , which are involved in low frequency of resistance . previous studies have shown strong associations between the use of antimicrobial agents in the community and emergence of antimicrobial resistance in a number of organisms ( 46 , 47 ) . this might be due to selection of the resistant strains which have mutations in the pbp genes that result from - lactam utilization . the increase in - lactam resistant s. pneumoniae might be associated with the increase in highly resistant strains and rapid transfer of cloned resistance which in turn could be due to introduction and administration of new - lactam and macrolide antibiotics as well as high population and travel to affected areas . a number of strategies including simultaneous multiple drug therapy , which have been reported to be effective in reducing the development of resistance in pathogens such as hiv and mycobacterium tuberculosis are not practical for s. pneumoniae due to within - host development of resistance during treatment ( 48 ) . in the united states and europe , decreased resistance by judicious antibiotic use has been reported ( 48 ) . however , this strategy is not practical in for developing country such as iran where antibiotics are sold without prescription over the counter . the present results suggest that it is important to appraise the changes in mic values as well as genetic mutations in order to evaluate the prevalence of resistance to antimicrobial agents in s. pneumoniae . furthermore , penicillin is not suitable for treatment of pneumococcal infections ; instead a range of macrolides can be administrated to successfully treat strains with intermediate resistance to penicillin in serious infections . however , the necessity of using macrolides should be considered due to the increased macrolides resistance in this family . for strains with high resistance to penicillin , vancomycin and fluoroquinolones including sparfloxacinare selected as antimicrobial agents . in addition , selected antibiotics should be administrated to treat pneumococcal bacterial infection based on the pattern of pneumococcal drug resistance in the area . thus , in isolates assumed to be s. pneumoniae , examination of three pbp and lyta together gives value to predict the susceptibility within two hours which finally leads to a selective treatment for infectious diseases caused by s. pneumonia ( 37 ) . consequently , the increase in antibiotic resistance among s. pneumoniae strains in iran seems to be alerting and the treatment of infections should be further analyzed and investigated and thus presently antibiotics used for practical treatment of certain s. pneumoniae infections may need to be further reviewed .\noutput:\n" }, { "from": "agent", "value": "background : - lactams resistant streptococcus pneumoniae are an emerging problem throughout the world . several resistance mechanisms have been reported , including expression of drug - destroying enzymes such as - lactamases , altered drug targets such as conformational changes in pbps , decreased bacterial permeability , and increased drug efflux.objectives : the present study aimed to determine the relationship between the results of polymerase chain reaction identification of the pbp1a , pbp2b and pbp2x genes ( penicillin - binding proteins ) and susceptibilities of - lactam antibiotics against s. pneumoniae.materials and methods : fifty five isolates of s. pneumoniae were obtained from clinical samples with antimicrobial tests . the susceptibilities of isolates to benzylpenicillin , imipenem , oxacillin , ceftazidime were determined . the resistance genotype was determined by the polymerase chain reaction with primers designed for the pbp genes.results : the number of s. pneumoniae isolates resistant to benzylpenicillin , imipenem , oxacillin and ceftazidime were 94.5 % , 100 % , 100 % , and 21.8 % , respectively . analysis of mutation in the genes for pbp showed that 85 % of isolates had mutations in pbp2x , pbp2b and pbp1a . susceptibility to benzylpenicillin was decreased once the number of mutated pbp genes in s. pneumonia increased . according to the results of this study , s. pneumoniae isolates showed reduced susceptibility due to accumulation of resistance genes.conclusions : we suggest that studies should be performed to evaluate changes in minimum inhibitory concentration ( mic ) values as well as genetic mutations in order to determine prevalence of s. pneumoniae resistance against antimicrobial agents ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: in 2002 , overactive bladder syndrome ( oab ) was defined by the international continence society as \" denoting urgency with or without urge incontinence , usually with frequency and nocturia in the absence of urinary infection or another identifiable disease \" . the prevalence of this syndrome in adults varies between 12 % and 17 % and rises with age . in europe , the prevalence ranges from 12 to 22 % , in the united states the prevalence is around 16 % , and in spain it is 21 % [ 2 - 4 ] . oab negatively impacts the patients ' quality of life , especially when they present with symptoms of bladder filling , such as micturitional urgency and its associated incontinence . treatment with anticholinergic drugs acting on the detrusor muscarinic receptors are , in most cases , the first - choice treatment for this type of patient , although a significant percentage of patients do not respond to this treatment owing either to lack of adherence or lack of efficacy or tolerability . when treatment with antimuscarinic drugs is not effective , other treatment alternatives include the following : conduction therapies , the use of drugs such as uroselective alpha - blockers , neuromodulation , intravesical botulinum toxin , and even posterior tibial nerve stimulation ( ptns ) . the purpose of our study was to assess in an objective way both the efficacy and the results of ptns in patients with oab in which treatment with anticholinergics ( antimuscarinics ) was not clinically effective . we designed a unique cohort study of 14 patients ( before and after study ) to assess the efficacy of treatment with ptns in patients with oab in which treatment with anticholinergics was not effective for 6 months previously . fourteen female patients were diagnosed with oab according to the definitions set out by the international continence society in 2002 . before stimulation , all patients had been treated with maximum - dose anticholinergics ( solifenacin or fesoterodine ) and presented with no clinical improvement according to their pre - and post - treatment micturitional diary in which diurnal micturitional frequency , nocturnal micturitional frequency , urgency episodes , and urge incontinence episodes were recorded and compared . after a minimum 2 - month washout period after the oral anticholinergic treatment , the ptns treatment was started . the treatment protocol consisted of 14 sessions per patient conducted as follows : 8 weekly sessions , 4 sessions every 15 days , and 2 monthly sessions . before starting treatment , a urodynamic study was performed and a 48 - hour micturitional calendar was provided to assess diurnal micturitional frequency , nocturnal micturitional frequency , urgency episodes , and urge incontinence episodes . after 14 ptns sessions , every patient turned in this 48 - hour micturitional calendar in which the same aforementioned variables were assessed . we also assessed adherence to treatment , satisfaction or subjective feeling of improvement , and collateral side effects and complications of the treatment . we performed statistical study of the results by applying the wilcoxon test for nonparametric sample comparison , with statistical significance established as p0 .05 . for the statistical analysis , we used spss ver . 17.0 ( spss inc . , the hospital ethics committee authorized the use of ptns in oab and approved this work . a total of 14 women diagnosed with oab with a mean age of 60.8 years were treated . every patient underwent 14 sessions of ptns , although two patients did not complete the treatment owing to a lack of subjective improvement . of the 14 patients included in this study , only 1 presented with oab with a known cause ( multiple sclerosis ) . we conducted urodynamic study in all the patients before starting the ptns treatment , and nine of the patients presented with detrusor hyperactivity waves . the 48 - hour micturitional calendar provided by the patients before starting the ptns treatment showed the following means : diurnal micturitional frequency , 12.6 times ; nocturnal micturitional frequency , 3.1 times ; urgency episodes , 10.9 times ; and urge incontinence episodes , 5.2 times . at the completion of treatment ( 14 sessions ) , the patients were again requested to submit their 48 - hour micturitional diary , which documented the following : diurnal micturitional frequency , 10.2 episodes ; nocturnal micturitional frequency , 2.7 episodes ; urgency , 6 episodes , and urge incontinence , 2.5 episodes ( fig .1 ) . after applying the wilcoxon test for paired samples and analyzing these four variables , we observed statistically significant improvement in the diurnal micturitional frequency ( p = 0.05 ) , urgency episodes ( p = 0.003 ) , and urge incontinence episodes ( p = 0.004 ) but no significant improvement in the nocturnal micturitional frequency ( p = 0.472 ) ( table 1 ) . when we analyzed the patients ' subjective feelings of improvement regarding the treatment , we found that 50 % reported improvement and another 50 % reporting feeling no difference . when we compared this result with the anticholinergic treatment in these patients previously ( for which 100 % of patients felt no subjective difference ) , the results were statistically significant ( p 0.05 ) . of the two patients who did not complete all 14 sessions , one showed improvement when we considered the micturitional calendar filled out after the 8th session ( the last one for this patient ) . the other patient did not show improvement after filling out the calendar at the 6th session , which was the last one applied . ten patients reported pain in the electrode application zone during the treatment that was not an obstacle to completing the treatment . no complications or side effects were reported after ptns in these 14 patients with oab . after a mean of 8.5 months of follow - up , the patients ' symptoms had stabilized and no progression of symptoms was shown . treatment of oab with anticholinergics ( antimuscarinic ) can have a lack of benefit in up to 60 % of cases depending on the kind of patient and the sex of the patient . accordingly , many patients express a wish to change their treatment to another anticholinergic drug or another type of therapeutic . generally , the most common reasons for a change of the medication are a lack of therapeutic response , new medications , side effects , and the acceptance , by some patients , that their pathology is not going to improve no matter which treatment they receive . analyzing the symptoms experienced by these patients , which result in often drastic measures taken in an attempt to lead a relatively normal life , brings to light the enormity of the problems that arise from this syndrome and explains why these patients often demand a solution to their problem or feel there is unacceptable improvement of their symptoms with the prescribed treatment . hence , it is necessary to give these patients other therapeutic alternatives with the intention of improving and controlling their symptoms . it is within this diagnostic - therapeutic framework that ptns was born as a possible alternative for the treatment of oab . ptns via surface electrodes was proposed in 1983 and , later , in 1987 , in animal experimentation , it was proven that it could inhibit detrusor hyperactivity as well as control urge incontinence . ptns is the electrostimulation of the sacral roots ( s2 - s4 ) that produce an activation of the sacral plexus that controls the visceral organs and the pelvic floor muscles , thereby improving bladder control [ 12 - 14 ] . since then , some studies have been conducted to prove the efficacy of ptns versus other treatments and placebo for the treatment of oab . conducted a randomized clinical trial comparing ptns with placebo in 37 women and reported significant improvement regarding frequency and nocturia after the stimulation , although both quality of life , as assessed by questionnaire , and micturitional urgency improved in both groups without significant differences . . carried out a study with 44 patients with oab treated with ptns , without a control group , and reported improvement in urodynamic parameters , both in the maximum cystometric capacity and in the time of onset of the first involuntary detrusor contraction . peters et al . in 2009 published a clinical trial in which they compared tolterodine with ptns in 100 patients with oab . ptns showed clinical improvement in 79.5 % of the patients versus improvement in 54.8 % of patients who took tolterodine 4 mg . in a group of 43 patients with oab that did not respond to medical treatment with anticholinergics , yoong et al . tested a protocol of ptns for 6 weeks ( 6 sessions ) and saw a positive response in 69.7 % of the patients . in those who responded to the treatment , significant decreases in nocturia and micturitional urgency were observed and quality of life improved , although the therapy duration in this study needs to be clearly defined , a point that is currently not clear . analyzed the urodynamic changes in oab patients treated with ptns and found an objective improvement rate of 56 % of the patients , with an increase in bladder capacity . in a small percentage of cases , bladder hyperactivity decreased , leading to the conclusion that ptns treatment may cause an increase in cystometric capacity as other clinical studies seem to suggest . proved , in a controlled clinical trial with placebo , that ptns leads to improvement in 71 % of patients versus 0 % in a control group , and there was also improvement in the treatment group for the number of incontinence episodes , micturitional volume , and quality of life compared with the placebo . in relation to the aforementioned results , our study showed clinically significant improvements in diurnal micturitional frequency , micturitional urgency , and urge incontinence , but not in nocturia , which is one of the symptoms that most affects the patients ' quality of life . also , the subjective improvement of the patients was 50 % , similar to previous studies in which the rate ranged between 56 % and approximately 70 % . however , in patients with no objective improvement , we did observe clinical improvement when the patients handed over their 48 - hour micturitional calendar . one of the discussions about this therapy , apart from its clinical efficacy , is the application time and whether maintenance treatment must be applied . regarding this , it seems that treatment with at least 12 continuous sessions leads to improvement of symptoms that can last for at least 12 months . some authors even recommend that if the ptns treatment has been effective , it must be maintained , because it seems to stabilize the disease and improve the quality of life of these patients . in conclusion , ptns in patients with oab refractory to treatment with anticholinergics is currently a valid and safe alternative , with an acceptable success rate , and does not increase the morbidity of the patient nor prevent the patient from undergoing another kind of treatment .\noutput:\n" }, { "from": "agent", "value": "purposeoveractive bladder ( oab ) is a clinical syndrome that is currently treated initially with anticholinergics , although some other therapeutic alternatives exist , such as neuromodulation , botulinum toxin , and posterior tibial nerve stimulation ( ptns ) . the purpose of this study was to assess the efficacy of ptns in patients with oab refractory to anticholinergics.materials and methodswe present a cohort study of 14 women with oab to whom we applied ptns . we assessed ( before and after the treatment ) the diurnal micturitional frequency , the nocturnal micturitional frequency , urgency episodes , and urge incontinence episodes . results were analyzed by using the wilcoxon test for nonparametric samples.resultswe observed statistically significant improvement in the diurnal micturitional frequency ( p = 0.05 ) , in episodes of micturitional urgency ( p = 0.03 ) , and in episodes of urge incontinence ( p = 0.004 ) . a total of 50 % of the patients felt subjective improvement from their pathology.conclusionsptns is a valid , minimally invasive treatment option with minimum morbidity for patients with oab refractory to treatment with anticholinergics ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: obviously , there are many predisposing conditions leading to atelectasis . in addition to aspiration of materials or accumulation of endobronchial secretions , we have to consider not only endobronchial lesions , such as mucosal edema , fibrous tissue , granuloma , and maligant tumor , but also extrabronchial pathology compressing an airway . however , it is not so easy to determine the cause of bronchial stenosis or obstruction unless bronchofiberscopic examinations are indebted . since bronchogenic cancer seems to be on the increase , we often regard certain cases of atelectasis discover as complications of bronchogenic malignancy , but later it was disclosed endobronchial tuberculosis after examination with the flexible bronchoscope . moreover , we emphasize that bronchofiberscopic examination is a very important tool for detecting endobronchial tuberculosis and making a differential diagnosis . fifty three patients with endobronchial tuberculosis ( 4.7 % ) out of 1,132 subjects who had a flexible bronchofiberscopic examination at the department of internal medicine of hanyang university hospital between the beginning of march 1982 and the end of december 1985 are included in this study . for diagnostic confirmation , positive stainings of acid - fast bacilli were identified on the tissue sections , sputum , and / or specimens aspirated through endoscopic biopsy and brushing or washing - out for cytology and culture . prior to the bronchofiberscopic examination , after topical application of 4 % lidocaine around the upper airway , a fujinon dro - i or fujinon dro - il fiberoptic bronchoscope was inserted for endoscopic observation . stainings for acid - fast bacilli were positive in the sputum and / or bronchial washings of 67.9 % of the patients . the remaining 32.1 % of the patients , diagnoses were confirmed by culture or positive staining for afb , or bronchofiberscopic biopsy specimens ( table 2 ) . as shown in table 3 , chest pain was complained of 20.8 % of the patients , and production of mucus , dyspnea , hemoptysis , and fever were complained of in 18.9 , 17 , 17 , and 9.4 % of the cases , respectively . findings on the chest x - ray were abnormal in twenty three out of 53 patients . no predilective lesion site was apparent on chest x - ray films ( table 4 ) . the left lower and upper bronchi , however , are the most frequently involved , obstructive sites observed by means of bronchofiberscopy ( table 5 ) . endoscopic pictures of endobronchial tuberculosis showed mucosal swelling , edema , redness , erosion , or occasional ulceration and loss of light reflex from granulation , along with narrowing of the lumen . occasionally a light yellowish - white colored miliary nodule was observed . cicatrical stenosis or obstruction covered by whitish pseudomembrane was a common finding in the patient with atelectasis caused by endobronchial tuberculosis . after the pseudomembrane was desquamated , tenaceous secretions which had been exposed around the opened site were visible . pathological findings were essentially chronic granulomatous inflammation showing caseation necrosis , or nonspecific chronic inflammation . the barking cough was not responsive to antitussive medication but it did respond well to steroids along with antituberculous combination chemotherapy . although the early detection of endobonchial tuberculosis by identification of acid - fast bacilli is highly desirable , it is not easy to accomplish , because features of the initial chest films are usually nonspecific . therefore , it is thought that the bronchofiberscopic approach is mandatory for the diagnosis of endobronchial tuberculosis . the most common initial lesion of endobronchial tuberculosis is infiltration of lymphocytes into the bronchial mucosa , and the next is partial stenosis by considerable mucosal congestion and edema . development of caseous necrosis with formation of tuberculous granuloma can be found at the mucosal surface . fibrotic change of the lamina propria as well as healing of mucosal ulcerations or erosions with or without squamous metaplasia formerly would progress to cicartrical stenosis . the spectrum of endobronchial tuberculosis we encountered in this series of patients was somewhat characteristic . a five to six times higher incidence in females than in males was noted . these results are quite different from those of another report , in which the peak incidence was noticed in old and weak females beyond 50 years of age . however , in our study also , a lage peak was noted one in the 7th decade . it is thought that the initial peak in the third decade is representative of the general situation in korea where tuberculosis is endemic , and that the late peak of old age occurs , not because of reinfection , but as a result of the reactivation of the primary lesion when the patient is in an immunocompromised states . old age , alcoholism , prolonged therapy with steroids , diabetes mellitus , and silicosis are known as risk factors for reactivation of the primary lesion . bronchofiberscopically , whitish pseudomembrane causing stenosis or obstruction of bronchi was characteristic finding in the patients with atelectasis caused by endobronchial tuberculosis . this means , in turn , that bronchofiberscopy is a very useful tool in relieving atelectasis caused by cicartrical obstruction . since the squamous metaplasia and nonspecific chronic inflammatory change could be associated with other diseases , microbiological confirmation from bronchofiberscopic brushing and / or washings is required . the other feature that was nearly universal in our patients was evidence of the usefulness of medication with steroid for relieving the barking cough as also noted in other literature . in view of the fact that tuberculosis is one of the common endemic diseases in korea , young , female patients , whose coughing is barking in nature and resistant to general antitussive agents , should be considered to possibly have endobronchial tuberculosis . furthermore , we would like to emphasize that the bronchofiberscopic approach is a substantially useful means of making a differential diagnosis in atelectasis in old patients of cancer - risk age .\noutput:\n" }, { "from": "agent", "value": "the clinical and bronchofiberscopic features of endobronchial tuberculosis in 53 patients were investigated . these patients comprised 4.7 % of some 1,132 subjects who had undergone flexible bronchofiberscopic examinations . the peak incidence occurred in the third and fourth decades , a secondary peak appeared in the seventh decade , a five to six times higher incidence was noted in the female than in the male . staining for acid - fast bacilli was positive in 67.9 % of the patients sputums and or specimens of bronchial washings . a barking cough was the most common chief complaint . next in order were chest pain , production of mucus , dyspnea , hemoptysis , and fever . twenty - three out of 53 patients showed abnormalities on their chest films.the flexible bronchoscope revealed tuberculous lesions characterized by mucosal swelling or edema , redness , erosion , ulceration , hypertrophy with luminal narrowing , and cicartical stenosis due to whitish pseudomembrane . the left lower and upper bronchi were involved most frequently.the majority of the patients who were suffering from a barking cough were resistant to antitussive agents but were responsive to steroid combination chemotherapy with antituberculous drugs.in conclusion , the bronchofiberscopic approach is not only helpful in the differentiation of endobronchial tuberculosis from bronchogenic cancer but it can also be used for relieving atelectasis ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the most common electrolyte abnormality that develops in patients with subarachnoid hemorrhage ( sah ) is hyponatremia and has a prevalence ranging from 30 % 56 % . the most common non - traumatic or spontaneous cause of sah is a ruptured cerebral aneurysm ( figure 1 ) , resulting in extravasation of blood into the space between the pia and arachnoid mater ( figure 2 ) . although previously defined as a serum sodium concentration level of less than 135 meq / l , severe or significant hyponatremia has recently been redefined as serum sodium less than 131 meq / l . hyponatremia following sah is most commonly associated with syndrome of inappropriate antidiuretic hormone secretion ( siadh ) . other associated causes include acute cortisol insufficiency , cerebral salt wasting syndrome ( csw ) , excessive fluid therapy and / or diuretic therapy . regardless of the underlying etiology , hyponatremia in sah patients is associated with a longer hospital course , increased morbidity and risk of vasospasm . hyponatremia post - sah can develop within a few days to within a few weeks and be associated with drastic fluctuations in sodium levels with treatment ( figure 3 ) . because hyponatremia is associated with a poor outcome in patients with sah , anticipation , timely detection and appropriate treatment are necessary to improve patient outcomes . in this article , we review recent outcome studies and discuss current trends for underlying causes , risk factors , clinical implications and treatment of hyponatremia in patients following sah . in most studies , siadh was categorized as the most frequent cause of severe hyponatremia among patients with aneurysmal sah . in siadh , excessive secretion of antidiuretic hormone is caused by stimulation of the hypothalamus with various traumatic or ischemic factors , resulting in the enhancement of water reabsorption in the distal convoluted tubule of the kidney , causing fluid retention and dilutional hyponatremia . nonetheless , the etiology of hyponatremia after sah is diverse . in addition to siadh , csw , acute cortisol insufficiency , excessive intravenous fluid therapy , diuretic therapy or a combination of these entities may contribute to increased natriuresis . appropriate therapy must be targeted for the correct etiology of hyponatremia to be effective in diminishing morbidity or mortality associated with hyponatremia in sah patients . in csw , the secretion of antidiuretic hormone ( adh ) in the plasma is normal , but is characterized by urinary sodium excretion , as well as reductions of extracellular fluid and circulating blood volume , causing hyponatremia . reported 34.5 % of severe hyponatremia to be due to siadh , while 23 % were considered to be due to csw . of note , the patients included in this study had more severe sah than in the comparative studies , and the inclusion criterion was a plasma na 130 meq / l . although there is considerable dispute regarding the incidence of the various etiologies of hyponatremia in sah , siadh has clearly been established as the most common cause of hyponatremia post - sah . in patients with csw , previous studies supporting a higher incidence of csw in sah investigated plasma concentrations of atrial natriuretic peptide ( anp ) and brain natriuretic peptide ( bnp ) concentrations , which rise after sah . more recent data suggest that elevated bnp concentrations do not mediate the development of hyponatremia . the separation between siadh and csw may not be clear in pathologies , such as sah . multiple abnormalities occurring in combination , including an increase in natriuretic peptide secretion , an inhibition of the renin - aldosterone system and excessive adrenergic activity , may contribute to hyponatremia . unlike siadh and csw , the incidence of electrolyte imbalance as a result of cortisol deficiency has not been well investigated in sah patients . routine examination of adrenocorticotropic hormone ( acth ) / cortisol dynamics is not typically part of sah work - up and management . investigated pituitary function post - sah and found that between 7.1 % and 12 % of patients are cortisol - deficient at the time of presentation with sah . acute cortisol deficiency may still be underestimated in the sah patient population , as is also seen in the traumatic brain injury patient population . a transient cortisol deficiency may easily be missed with a single cortisol measurement due to the usual physiologic fluctuations of plasma cortisol levels through the course of a day . based on specific clinical assessment protocols , the current suggested etiologies for hyponatremia in sah include siadh in over 70 % of patients , followed by incorrect or injudicious intravenous fluid use ( e.g. , administration of 0.45 % saline ) in 10 % , volume depletion in 10 % and acute cortisol deficiency in 8 % . in the first study to evaluate vasopressin levels in hyponatremic sah patients , hannon et al . found that in the siadh group of sah patients , adh was significantly higher before and during the hyponatremic period compared with adh levels measured once hyponatremia had resolved . moreover , urine volumes fell as plasma adh concentration rose in the group , a pattern suggesting a causative role for adh in the development of hyponatremia and supporting the diagnosis of siadh . adh levels were suppressed in patients with dilutional hyponatremia , and adh concentrations were also lower in the acth - deficient and volume - depleted groups in comparison to the siadh group . other peptides released after sah , such as adrenomedullin and endothelin , possess vasoconstrictive or vasodilatory properties . these peptides and their association with other natriuretic peptides may explain the suggested link between hyponatremia and increased risk of cerebral vasospasm . overall , the most common cause of hyponatremia from aneurysmal sah is clearly siadh , although acute cortisol deficiency does account for a small , but clinically important fraction of cases of hyponatremia . up to one - half of patients suffering from aneurysmal sah develop hyponatremia during their clinical course . neurological disease processes and the postoperative period are established risk factors for hyponatremia and contribute to the high prevalence of hyponatremia seen post - sah . a recent article investigating the outcomes of hyponatremia in 59 aneurysmal sah patients determined a prevalence of 37 % and a mean lowest sodium level of 126.97 meq / l for a median duration of two days . frequently observed during the acute phase after aneurysmal sah , hyponatremia following sah may be more common in patients who are more than 50 years old . where serum sodium values are from 115120meq / l , signs and symptoms associated with hyponatremia can include fever , headache , nausea and vomiting , muscle cramps , muscle weakness and confusion . with valuesless than 110 meq / l , more severe neurological symptoms of stupor , seizures and coma can occur . sudden decreases in serum sodium elicit more severe symptoms than gradual decreases that occur over days to weeks . a difference seen between various retrospective studies is the time period for the development of hyponatremia after sah . hyponatremia developed later in the hospital course , at about seven days post - sah in some studies , while other recent cohort studies identified hyponatremia early in the hospital course . noted in their series of 100 patients that 73.4 % of hyponatremic sah patients developed hyponatremia between post - hemorrhage days 1 and 3 , that 12.2 % developed it between days 4 and 7 after sah and that 14.3 % developed hyponatremia more than seven days after sah . no correlation could be drawn between the severity / grade ( measured by either hunt and hess scale or fisher grade ) of sah and the development of hyponatremia . the location of aneurysmal rupture may be associated with the incidence of post - sah hyponatremia . hyponatremia was seen in 52.4 % of patients with anterior communicating artery ( acoma ) aneurysms , followed by 33.3 % of patients with middle cerebral artery and posterior communicating artery aneurysms and only 27.7 % of patients with internal carotid artery aneurysms and multiple aneurysms . the rupture of an acoma aneurysm may be associated with a higher incidence of hyponatremia , because the hypothalamus is supplied by perforating vessel branches of the acoma . when associated vasospasm in this areaoccurs , hypothalamic ischemic damage is caused , thereby resulting in hormone secretion abnormalities and hyponatremia . a larger series , however , did not find any significant difference in the incidence of hyponatremia and the anatomic territory of the ruptured aneurysm . no difference in the incidence of hyponatremia was seen between those patients who had craniotomy and clipping of the cerebral aneurysm versus endovascular coiling , and no significant difference was noted between patients that had intervention and those that did not . hyponatremia and associated hypotonicity result in a shift of water from the extracellular to intracellular space and can worsen cerebral edema and intracranial hypertension in patients with sah , further increasing the risk of seizures and neurological injury . uncontrolled prospective studies suggest a relationship between hyponatremia and excessive natriuresis and volume contraction . volume contraction has been shown to be associated with symptomatic vasospasm , and hyponatremia and fluid restrictionin a cohort study of 580 patients with sah , hyponatremia was less frequently associated with poor outcome than hypernatremia . because sah patients frequently require therapeutic infusion of hyperosmolar fluids to help mitigate intracranial hypertension , the resultant hypernatremia is linked with poor outcomes in this patient population . currently , normonatremia is considered the conservative , but safe management strategy for sah patients . determination of the cause of hyponatremia from clinical examination and biochemical hormone measurement is essential to ensure timely and effective treatment of the hyponatremia . patients with aneurysmal sah are monitored in an intensive care setting , preferably with specialized neurointensive care , for at least 14 to 21 days post - sah , to allow for close clinical monitoring of signs and symptoms of cerebral vasospasm . along with vasospasm monitoring , comprehensive monitoring of electrolytes andfluid balance on a daily basis ensures early detection and efficient management of hyponatremia after sah , thereby reducing morbidity and mortality . a daily check of electrolytes is typical and should be routine . patients who require intravenous hypertonic therapy require more frequent sodium checks ( every 4 to 6 h ) . any changes in mental status , large fluctuations of fluid balance and / or polyuria should prompt urgent investigation of serum sodium levels ( figure 4 ) . correcting hyponatremia too rapidly can result in central pontine myelinolysis ; on the other hand , insufficient correction of hyponatremia can result in cerebral edema , seizures , coma or death . fluid restriction to correct hyponatremia is potentially more deleterious in patients with sah with possible associated increased risk of cerebral vasospasm . when hyponatremia is treated promptly and appropriately , patients sodium levels are normalized without deleterious effects . assessed the endocrinological response to severe sah and found changes in plasma concentration of several hormones : adh , aldosterone , renin , angiotensin , anp and bnp . although changes in these hormone levels are noted during the first 12 days post - sah , it is not practical to rapidly and accurately obtain hormone measurements , because their profile changes frequently . the authors suggested that measuring bedside fluid and sodium balance is the most valuable and cost - effective method for preventing and managing hyponatremia in patients with sah . traditionally , patients with cerebral insults , like sah , are maintained on sodium chloride - based fluids ( i.e. , 0.9 % saline ) for baseline and fluid replacement requirements . such intravenous solutions avoid cerebral edema caused by fluid shifts across a damaged blood - brain barrier . the current guidelines of the neurocritical care society for the management of patients with sah recommend avoiding large amounts of free water intake and avoiding fluid restriction to treat hyponatremia . in addition , the guidelines of the american heart association recommend that volume contraction be treated with isotonic fluids ( class iia , level b evidence ) and that large volumes of hypotonic fluids should generally be avoided in patients with sah . the guidelines , however , did not address or make recommendations on the composition of baseline fluid administration in sah patients . recently published the results of a small , randomized study suggesting that administration of balanced crystalloids and colloid solutions ( those with electrolyte compositions similar to plasma ) in sah patients did not result in more frequent hyponatremia or hypo - osmolality . balanced solutions in the early sah period may prevent electrolyte imbalance associated with saline - based intravenous fluids , such as hyperchloremia , hyperosmolality and extreme positive fluid balances . siadh is best treated by fluid restriction to less than 500 ml / day ; however , such treatment may not be feasible in sah patients , because many of these patients are not fully conscious and require enteral tube feeding , resulting in a daily fluid intake of 12 l. in addition , hypovolemia from fluid restriction is associated with an increased risk of vasospasm and subsequent cerebral ischemia . a number of alternative therapies have been tried , but overall efficacy still remains somewhat controversial without randomized clinical control trials . hypertonic saline , usually administered as a 2 % or 3 % solution , can increase plasma sodium concentration efficiently and very rapidly , but it also increases blood volume and the risk of pulmonary edema and heart failure ; associated neurological complications are suspected , but further investigation regarding the overall safety profile is necessary . the effects of hypertonic saline are generally transient , because the physiological stimuli for water retention and secondary natriuresis remain present . the effects of albumin in limiting natriuresis have been reported in a few trials , but its effectiveness remains controversial . fludrocortisone may enhance sodium retention through its mineralocorticoid properties , but studies suggest that its ability to correct hyponatremia is limited and is associated with complications of fluid overload . alternatively , vasopressin receptor antagonists ( e.g. , conivaptan ) have been proposed and trialed in small studies , but have not become routine therapy , due to the potential for harmful , rapid and drastic changes in plasma sodium . in one study , a single dose of conivaptan increased plasma sodium by at least 4 meq / l in most patients and maintained the sodium improvement for three days . another study using conivaptan demonstrated increased plasma sodium of 6 meq / l with maintenance of the effects for an average of 13 h . in both studies , the number of sah patients was only 12 patients , and patients were simultaneously treated with fludrocortisone or hypertonic saline in some cases . conivaptan s efficacy and safety profile remain controversial , because one - third of the patients in the study proceeded to become hyponatremic again after its discontinuation , and both studies limited the administration of the drug to a single bolus . urea acts by inducing osmotic water elimination and by promoting passive sodium resorption in the ascending limb of the loop of henle of the nephron . still , the impact of low - dose corticosteroid therapy still requires further investigation in this population for two reasons . first , it is not clear whether acute relative adrenal insufficiency after aneurysmal sah is responsive to corticosteroid therapy or whether resolution of the cortisol deficiency is related to the expected clinical course of adrenal insufficiency post - sah . secondly , treatment with corticosteroids , theoretically , could have a role in the management of cerebral vasospasm in these patients . natriuresis after sah induces osmotic diuresis and decreases blood volume , increasing the risk of cerebral vasospasm . a randomized controlled trial of hydrocortisone in patients with sah demonstrated that treatment with hydrocortisone prevented excess natriuresis and potentially decreased the incidence of cerebral vasospasm ; however , the study did not demonstrate a statistically significant difference in the incidence of symptomatic cerebral vasospasm or in overall outcome . overall , the management of hyponatremia in sah patients requires further investigation of treatment options that avoid fluid restriction , and additional studies will help standardize optimal care . other studies did not find such an association , but rather , found an association with a longer length of stay in the intensive care unit . reported rates of poor outcome , based on the glasgow outcome score , either severe disability or death , is 22 % 32 % in hyponatremic patients with aneurysmal sah . in fact , patients with aneurysmal sah with hyponatremia are 15 - times more likely to have a poor outcome compared to their normonatremic counterparts . hyponatremia is seen in a considerable number ( 30 % 56 % ) of patients with aneurysmal sah . although it is a readily diagnosable and treatable condition , patient morbidity is significantly increased in this population . the etiology of hyponatremia after aneurysmal sah remains controversial , but likely stems from multiple causes , including siadh , fluid imbalances and acute cortisol insufficiency . adequate understanding of the underlying etiology of hyponatremia is essential for safe , effective and timely management of hyponatremia following aneurysmal sah .\noutput:\n" }, { "from": "agent", "value": "hyponatremia is the most common , clinically - significant electrolyte abnormality seen in patients with aneurysmal subarachnoid hemorrhage . controversy continues to exist regarding both the cause and treatment of hyponatremia in this patient population . lack of timely diagnosis and / or providing inadequate or inappropriate treatment can increase the risk of morbidity and mortality . we review recent literature on hyponatremia in subarachnoid hemorrhage and present currently recommended protocols for diagnosis and management ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the gram - negative diplococcus neisseria gonorrhoeae is the causal agent of gonorrhoea , one of the two most common sexually transmitted diseases . infection susceptibility and colonization mechanisms of gonococcus have been studied using different models that have determined that gonococcal membrane components , such as pili , opa , and lipooligosaccharide ( los ) , are highly relevant to infection . infection by gonococcus is associated with several clinical manifestations , such as cervicitis and urethritis , as well as pelvic inflammatory disease , ectopic pregnancy , chronic pelvic pain , and infertility . strikingly , infections frequently occur without any clinical manifestations that is , more than half of infected women and a significant percentage of infected men never develop symptoms . in women , this is also related to persistency and infection to the upper genital tract . in regard to immune response , it has been determined that humoral immunity against gonococcus is highly limited and t cells undergo a transient reduction during infection . clinical data also indicates that previous infections with n. gonorrhoeae do not improve immune response in patients with reinfection , thus suggesting that immunological memory is not induced by gonococcus . it has been hypothesized that it could be the sum of different mechanisms , one of which could be related to genital tissue properties , such as inmune privileged site in the female tract , while the other could involve evasion mechanisms intrinsically developed by the bacteria , an idea supported by several lines of evidence ; that is , it has been demonstrated that the bacterium undergoes phase and antigenic variations and shows epitope mimicry and phagosome subversion to overcome immune defense . moreover , gonococci seem to directly interfere with the onset of the adaptive immune response as opa proteins can inhibit cd4 + t - cell proliferation and the bacteria induce il - 10 production , an important regulatory cytokine involved in the differentiation of type 1 t regulatory cells ( tr1 ) . more interestingly , data obtained from the murine model of experimental infection showed an increase of cd4 + foxp3 + cd25 + regulatory t lymphocytes ( tregs ) in the lymph nodes draining of the genital tract . this increase correlated with an augmenting of tgf -1-positive cells in the uterine stroma of infected animals . recent studies in the murine model of gonococcal genital tract infection showed that n. gonorrhoeae enhances tgf - 1 production and thereby promotes th17 - dependent response with the consequent deployment of th1 / th2 protective response . the current data suggest that n. gonorrhoeae is able to suppress the protective immune response at different levels , such as b and t lymphocytes . recently , duncan et al . demonstrated that n. gonorrhoeae potently inhibits the ability of antigen primed bone - marrow - derived dendritic cells ( bmdc ) to trigger t - cell proliferation by inducing expression of both immunosuppressive cytokines and tolerance - inducing cell surface protein . however , until now there have been no reports on the potential effects of gonococcus on macrophages . macrophages are an essential component of innate immunity and play a central role in inflammation and host defence . cells of the monocyte - macrophage lineage are characterized by considerable diversity and plasticity . in response to various signals , macrophages may undergo classical m1 activation ( stimulated by toll - like receptor ligands and ifn - ) or alternative m2 activation ( stimulated by il - 4 / il - 13 ) . recently , studies have considered macrophages as a continuum with a range of overlapping functions in which classically activated and regulatory macrophages can influence immune response . here , we demonstrate that gonococcus conditions macrophage cell line phenotype and its functionality , producing a shift towards anti - inflammatory cytokine production , inefficient upregulation in molecules involved in antigen presentation and t - cell activation , and weak allogeneic t - cell stimulatory activity . the neisseria gonorrhoeae p9 - 17 strain used in this study was kindly provided by dr . myron christodoulides ( university of southampton , uk ) . in particular , p9 - 17 ( pil opab ) variant of n. gonorrhoeae containing the red - shift mutant gfp ( rs - gfp ) plasmid was used . bacterial growth and analysis of colony morphologybriefly , gonococcal variants were taken from frozen stocks , plated in gc agar plates ( difco , becton dickinson ) containing bbl isovitalex ( becton dickinson , sparks , md , usa ) , and cultured at 37c in 5 % co2 for 18 to 20 h to obtain single colonies . male or female 6 to 8 - week - old c57bl / 6 mice were obtained from the usach research facility . animals were euthanized by cervical dislocation , spleens were removed under sterile conditions , and splenocytes were obtained free of erythrocytes by treatment with ack lysis buffer . splenocytes were cultured in rpmi 1640 medium ( invitrogen corporation , carlsbad , ca , usa ) supplemented with 10 % fbs ( biological industries ltd . , kibbutz haemek 25115 , israel ) , 50 u / ml penicillin - streptomycin , and 2.5 g / ml amphotericin b ( sigma - aldrich , st . research was conducted in accordance with institutional guidelines and the international guiding principles for biomedical research involving animals of the society for the study of reproduction . raw 264.7 murine macrophages ( american type culture collection , rockville , md , usa ) were cultured in rpmi - 1640 medium ( gibco invitrogen co. , carlsbad , ca , usa ) with 10 % fetal bovine serum ( fbs , hyclone laboratories , inc . , logan , ut , usa ) , 50 units / ml penicillin , and 50 g / ml streptomycin ( gibco invitrogen co ) at 37c , in 95 % air and 5 % co2 . neisseria gonorrhoeae p9 - 17 ( pil , opab ) or fluorescent variant was suspended in phosphate - buffered saline ( pbs ) and the number of colony forming units ( cfu ) was determined by optical density at 600 nm . macrophages were grown in 24 - well plates ( or in cover slips ) using cell - culture medium lacking antibiotics . nearly confluent monolayers of cells were challenged with neisseria gonorrhoeae at a multiplicity of infection ( moi ) of 10 and incubated for the indicated period of times at 37c with 5 % co2 . after bacterial challenge , cell monolayers were washed five times with media and then fixed for confocal microscopy in 1 % paraformaldehyde in pbs ( ph 7.4 ) . in order to visualize apc cells , raw monolayers were immunostained with a phycoerythrin - ( pe - ) conjugated anti - mouse cd11b antibody ( 1 : 50 santa cruz biotechnology ) . association of gfp - fluorescent bacteria with the immunostained apcs was determined microscopically using confocal microscopy ( axiovert 100 m microscope , zeiss ) . in addition , confocal orthogonal analysis was used to identify internalized bacteria . in this case , z - plane slices were obtained and orthogonal views and three - dimensional images were generated from isolated cells . briefly , to quantify the total number of macrophage - associated gonococci , treated cells were washed 35 times to remove nonadherent bacteria and then lysed with 1 % saponin ( sigma , st louis , mo , usa ) in pbs for 30 min . to quantify the number of internalized gonococci , 100 g / ml of gentamicin ( us biological , swampscott , ma , usa ) was added 1 h prior to the preparation of lysates to kill the extracellular adherent bacteria . the lysates were collected , serially diluted , and aliquots were seeded onto supplemented gc agar plates . after 24 h incubation at 37c and 5 % co2 , colony - forming units were counted . supernatants were collected after 24 h incubation of macrophages with the bacteria . in each case , stimulation of apcs with lps from e. coli ( serotype 055 : b5 ; sigma ) was used at 1 g / ml as positive control . briefly , plates were coated with 100 l / well of the captured antibody and incubated at 4c overnight . the captured antibodies were anti - il - 10 from clone jes5 - 16e3 ( e - bioscience , ca , usa ) and anti - tnf - from clone 1f3f3d4 ( e - bioscience ) . after washing and blocking , samples and standard cytokines were added and plates were incubated for 2 h. then , plates were washed and 100 l of the polyclonal antibodies was added . after 1.5 h incubation , plate contents were eliminated , wells were washed several times and biotin - conjugated anti - il - 10 antibody clone jes5 - 2a5 ( e - bioscience ) or biotin - conjugated anti - tnf - antibody clone xt3 / xt22 ( e - bioscience ) were added . after 1.5 h incubation , streptavidin - hrp ( 1 : 5000 ) was added and again incubated 30 min at 37c . cells were collected and 510 cells were then incubated with an anti - tgf - 1 polyclonal antibody ( 1 : 100 , santa cruz biotechnology ) for 1 h at 4c . cells were washed several times with pbs containing 2 % fcs and then incubated with a pe - conjugated polyclonal anti - rabbit igg ( 1 : 150 ; sigma chemicals ) for 1 h at 4c . raw cells were stained with anti - cd11b pe - conjugated ( 1 : 50 ; santa cruz biotechnology ) for 1 h at room temperature , anti - mhc class ii fitc - conjugated ( anti i - a , 1 : 300 ; becton dickinson ) for 1 h at room temperature and also with anti - cd86 fitc - conjugated ( 1 : 200 ; becton dickinson ) for 1 h at room temperature . cells were routinely washed with pbs containing 2 % fcs and centrifuged at 600 g for 8 min and then resuspended in pbs containing 2 % fcs . splenocytes ( 510 / well ) were labeled with cfse ( 5 mm per 110 cells ) ( renovar , usa ) for 15 min at 37c . cells were washed extensively and 210 cells / well were cultured with 410 mitomycin - treated ( 16 g / ml ) raw cells in round - bottomed 96 - well plates in cultured in rpmi - 1640 medium ( gibco invitrogen co , carlsbad , ca ) with 10 % fetal bovine serum ( fbs , hyclone laboratories , inc . , logan , ut ) , 50 units / ml penicillin and 50 g / ml streptomycin ( gibco invitrogen co ) at 37c , in 95 % air and 5 % co2 for 5 days . proliferation analysis was performed analysis was performed by cyflogic analysis software package version 1.2.1 ( http://www.cyflogic.com/ ) . the kruskal - wallis test and subsequently dunn 's multiple comparison test were used to evaluate differences among the groups . the phenotype of antigen presenting cells and the cytokine milieu can modulate and define the type of immune response elicited against a pathogen . therefore , considering that for their part , microorganisms can modulate the phenotype of apc , we wanted to determine the effects that gonococcus might have on the phenotype of macrophages . therefore , we challenged the raw 264.7 murine macrophages with variants of n. gonorrhoeae fluorescent strain p9 - 17 ( pil , opab ) . raw cells and the corresponding bacterial variant were incubated for 1 , 2 , 3 h at 37c with 5 % co2 . associated bacteria were then evaluated by confocal microscopy . bacteria were observed to be associated with raw cells in a time - dependent form ( figures 1 ( a ) 1 ( c ) ) . bacterial uptake by macrophages was visualized by sequential cross - sectional images and an orthogonal view of the macrophages ( midplane z - section , height 1.25 m ) ( figure 1 ( d ) ) . in addition , gonococcus internalization was determined by a standard gentamicin protection assay , demonstrating that a significant number of viable bacteria were recovered from the inner compartment of macrophages ( figure 1 ( e ) ) and those represent approximately 10 % of total macrophage - associated bacteria . our next aim was to evaluate the type of response induced by the bacteria in comparison to a strong inflammatory stimulus , such as lipopolysaccharide . thus , macrophage cell line were challenged with p9 - 17 variant for 24 h. il - 10 and tnf levels in culture supernatants were compared to lps - elicited response . data obtained from 6 independent experiments showed that p9 - 17 induced the production of the pro - inflammatory cytokine tnf ( figure 2 ( a ) ) at similar levels that to those of lps . otherwise , the results of 5 independent experiments indicate that the anti - inflammatory cytokine il - 10 was induced under all experimental conditions , although in this case p9 - 17 induced the highest levels compared to the lps and medium ( figure 2 ( b ) ) . to better assess the effect of gonococcal infection on immunoregulatory cytokine expression , membrane tgf - 1 in raw cells was measured in 7 independent experiments by flow cytometry . geomean data from histograms were obtained in each experiment and are shown normalized against lps treatment . the results demonstrate that tgf - 1 was highly induced in response to gonococcal variant p9 - 17 ( figure 2 ( c ) ) . the ratio of tnf to il - 10 and to tgf - changes was 1.9 and 3.8 , respectively . in summary , when raw 264.7 murine macrophages were infected , neisseria gonorrhoeae was able to upregulate production of the immunoregulatory cytokines il - 10 and tgf - 1 . we also sought to determine whether gonococcus changes the activation status of macrophage cell line . as expected for macrophages , the raw 264.7 cell line responded to lps treatment upregulating the expression of mhc class ii and cd86 with 2 - and 4-fold increases , respectively ( figures 3 ( a ) and 3 ( b ) ) . in contrast , p9 - 17 just slightly increased the expression of mhc class ii , although differences did not reach statistical significance ( figure 3 ( a ) ) compared with cells in medium only . interestingly , the gonococcal variant p9 - 17 did not stimulate expression of cd86 ( figure 3 ( b ) ) and levels of expression were significantly different from those reached by lps stimulation ( figure 3 ( b ) ) . effectiveness of the immune response is conditioned by the number of mhces : peptide that cells express ( signal 1 ) , the nature of their costimulation ( signal 2 ) , and instruction by cytokines that these cells are capable of delivering to the t lymphocyte ( signal 3 ) . consequently , we found that gonococcal variant p9 - 17 treated raw cells inhibit cd4 + t cell proliferation ( figure 4 ) . pathogenic microorganisms have developed multiple mechanisms of immune evasion to avoid eradication by the host . several mechanisms have been described for bacterial evasion of immune response , such as prevention of opsonization , toxin secretion , disruption of mucosal barriers , modification of pattern molecules , uptake induction and phagosome escape , persistency within endosomes , interference with cytokine secretion , interference with antigen presentation , and inhibition of t - and b - cell functions , among others . in thisregard , neisseria gonorrhoeae does not seem to be the exception , and , in particular , it is able to interfere directly with adaptive immune response , as occurs with antigenic variation and phagosome subversion . as well , it inhibits cd4 + t - cell proliferation , preventing adaptive immune response . we recently reported that during experimental infection of the mouse , gonococcus induces an increase of regulatory t cells and infiltration of tgf - 1 positive cells in the uterine stroma of infected animals , which may also be a mechanism of immune evasion as this type of t cells induces tolerance . other , studies in a murine model demonstrated that n. gonorrhoeae enhances tgf - 1 production and thereby promotes th17 - dependent response , with the consequent deployment of th1 / th2 protective response . recent studies by duncan and colleagues showed that n. gonorrhoeae suppresses the ability of dendritic cells ( dc ) to induce cd4 + t - cell proliferation and leads to upregulation of cell surface and secreted proteins with immunosuppressive properties . the present report has focused on responses elicited by gonococcus on antigen - presenting cells such as macrophages , which trigger adaptive immunity during initial interactions with the bacteria . here , for the first time we have demonstrated that , although gonococcus induces proinflammatory cytokines , as well as regulatory cytokines in murine macrophage cell line , a shift towards anti - inflammatory cytokine production occurs . in addition , gonococcus was highly inefficient in upregulating mhc and cd86 , two of the most important molecules involved in antigen presentation and t - cell activation . consequently , we showed that infected macrophages have weak allogeneic t - cell stimulatory activity . in particular , gonococcus induces the secretion of the proinflammatory cytokines tnf - and il - 6 in apcs . this suggests that dc and macrophages , which are usually located in the stroma of the genital tract of the mouse , are at least in part responsible for the increased levels of tnf - and il - 6 observed in the vaginal secretions of balb / c mice after gonococcal infection . mouse spleen cells or genital tract tissue explants , stimulated with n. gonorrhoeae secrete il - 17 , il - 22 , and il - 6 , but not other inflammatory cytokines typical of th1 or th2 response . however , gonococcus also induces an increase in regulatory cytokines , il - 10 , and tgf - 1 in mouse macrophage cell line . recently , important populations of macrophages have come to light which play a role in limiting inflammation during innate and adaptive immune response . these regulatory macrophages produce high levels of il - 10 and have a potent t - cell suppressive function . it is well established that il - 10 inhibits tlr - induced t - cell activation by commensal and pathogenic microorganisms and antigen presentation through the repression of inflammatory cytokine production and inhibition of expression of mhc class ii and costimulatory molecules . secretion of il - 10 by n. gonorrhoeae - exposed dc suppresses antigen - induced t - cell proliferation . this mechanism is also observed in chlamydia trachomatis infections and commensal bacteria in other mucosal surfaces . moreover , the environments of genital tract tissues of the mouse and human likely contribute to anti - inflammatory shifting , as they express important levels of regulatory cytokines . these data correlate well with human studies that have demonstrated that il - 10 concentration measured in endocervix and cervical mucus was higher in women infected with n. gonorrhoeae . complementarily , tgf - 1 controls immune response by direct inhibition of t helper ( th1 and th2 ) , in fact when mice are treated with anti - tgf - antibody during infection with gonococcus ; the duration of infection is shortened by about 4 days . therefore , because the first encounter between the bacteria and the immune system occurs in the infecting mucosa , data suggest that local induction of this cytokine profile can initiate a tolerogenic type of response that might explain asymptomatic infection , low levels of antibody production , and induction of treg cells that has been reported to occur in balb / c mice infected with n. gonorrhoeae . we also found that the bacterium was unable to induce significant upregulation of the cell surface costimulatory molecule cd86 in macrophages , which further indicates the anti - inflammatory or regulatory effects of gonococcus on apcs . this suggests that , although neisseria gonorrhoeae is actually phagocytosed by macrophages , the bacteria can weaken antigen - presenting functions because cd86 / cd28 costimulatory pathway control of immune responses , such as antibody responses and induction of cytotoxic t - cell responses , is impaired in the absence of cd28 signaling . gonococcus is also unable to induce up - regulation of mhc class ii in macrophages , which are involved in antigen capture , processing , and presentation . this implies that macrophages , which can phagocytose gonococcus , do not have a proper antigen - presenting function . in line with this evidence , we showed that infected macrophages have weak allogeneic t - cell stimulatory activity , which strongly suggests that one of the most likely mechanisms is anergy induction , due to the lack of sufficient first and second activation signals . altogether , our results indicate that gonococcus controls the immune response at the macrophage level , inducing a tolerogenic phenotype that includes regulatory cytokines and low proliferative response , which may contribute to infection without symptoms , as occurs in women and female mice .\noutput:\n" }, { "from": "agent", "value": "neisseria gonorrhoeae is the etiological agent of gonorrhoea , which is a sexually transmitted disease widespread throughout the world . n. gonorrhoeae does not improve immune response in patients with reinfection , suggesting that gonococcus displays several mechanisms to evade immune response and survive in the host . n. gonorrhoeae is able to suppress the protective immune response at different levels , such as b and t lymphocytes and dendritic cells . in this study , we determined whether n. gonorrhoeae directly conditions the phenotype of raw 264.7 murine macrophage cell line and its response . we established that gonococcus was effectively phagocytosed by the raw 264.7 cells and upregulates production of immunoregulatory cytokines ( il - 10 and tgf - 1 ) but not the production of proinflammatory cytokine tnf - , indicating that gonococcus induces a shift towards anti - inflammatory cytokine production . moreover , n. gonorrhoeae did not induce significant upregulation of costimulatory cd86 and mhc class ii molecules . we also showed that n. gonorrhoeae infected macrophage cell line fails to elicit proliferative cd4 + response . this implies that macrophage that can phagocytose gonococcus do not display proper antigen - presenting functions . these results indicate that n. gonorrhoeae induces a tolerogenic phenotype in antigen - presenting cells , which seems to be one of the mechanisms to induce evasion of immune response ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ultra - high magnification endoscopy , also known as endocytoscopy ( ec ) or endomicroscopy , enables assessment of the muscularis propria ( mp ) or myenteric plexus in vivo through a submucosal tunnel 123 . this technique is expected to be applicable for clinical use for the treatment of neuromuscular diseases because the nidus of such diseases is under the mucosa , a location that is difficult to assess using conventional endoscopy . achalasia is an idiopathic esophageal motility disorder characterized by a lack of peristalsis in the esophageal body and absent or incomplete relaxation of the lower esophageal sphincter ( les ) 45 . the novel procedure , peroral endoscopic myotomy ( poem ) , has become one of the best treatment options for achalasia because it is safe , offers long - lasting symptom control , and is less invasive than surgery 678 . moreover , the submucosal tunnel created during poem allows insertion of the endoscope under the mucosa and access to the mp . during poem , thick muscle at the middle to lower esophagus , as well as thin muscle at the les area , can be identified ( fig . 1 ) , although there are variations among patients with achalasia 910 . during peroral endoscopic myotomy , thick muscle is observed at the mid - to lower - esophagus ( a ) , whereas thin muscle is observed at the les ( b ) . the histopathology of achalasia has been insufficiently investigated because of the low prevalence of this condition , and because the mainstream treatment for achalasia has been balloon dilatation , which does not allow tissue sampling . surgical myotomy may allow access to the mp at the les but , because of the limited treatment window ( difficult to pull the mid - esophagus into the abdominal cavity ) , using surgical myotomy to assess the mid - esophagus is technically difficult . the approach to and examination of the esophageal mp was difficult until the introduction of poem . the purpose of the current study , therefore , is to determine the feasibility of ec for real - time histopathologic examination of the mp in a clinical setting , and to provide more knowledge about the histopathologic features of esophageal tissues features of esophageal tissues in achalasia . this study was performed at showa university northern yokohama hospital , a tertiary referral center in japan . enrollment began in december 2013 and patients with consecutive achalasia who were candidates for poem were recruited for this study . patients younger than 18 years and those whose health was not favorable for enrollment because of severe comorbidity in organs such as the heart or lungs were excluded from this study . in instances where full - thickness myotomy was performed , ec examination was not performed , and these patients were also excluded from the analysis . the current study was approved by the institutional review board ( no . 1311 - 05 ) . written informed consent was obtained from all participants , and the study was conducted according to the declaration of helsinki . , esophageal contents were cleared by endoscopic suction using a 3.7 - mm channel endoscope ( gif - 1t240 ; olympus co. , tokyo , japan ) under intravenous anesthesia to prevent aspiration caused by intubation . under general anesthesia with positive pressure ventilation , after submucosal injection at the level of the mid - esophagus , a 2 - cm longitudinal mucosal incision was created as the point of entry . a one - third circumferential submucosal tunnel was created from entry down to the les and into approximately 23 cm of the gastric side . dissection of the circular muscle ( from 2 cm distal to the mucosal entry ) was performed at the center of the submucosal tunnel . after myotomy , a totally relaxed c ( egj ) was confirmed by inserting an endoscope into the natural lumen down to the gastric side , and by a retroflex view from the gastric side to egj ( fig . 2 ) . the mucosal entry was closed with hemostatic clips . as compared to pre - poem ( a ) , a totally relaxed esophagogastric junction is seen on retroflex view from the gastric side with poem ( b ) . all ec examinations were performed using the integrated - type endocytoscope gif - y0002 ( prototypes from olympus co. ) . gif - y0002 has one lens that can consecutively increase the magnification from the conventional endoscopy level to 380 magnification ( tissue field of view , 700600 m ) using a hand lever . the gif - y0002 allows gradual magnification at the center of the monitor , thus ensuring accurate localization of the area being viewed . for ec , a mixture of 0.1 % methylene blue was used to stain the tissues and to obtain images similar to those obtained in conventional pathology examination . ec examination was performed after poem and prior to closure of the mucosal entry site . after staining with 2 ml of methylene blue , the ec examination was started from the proximal 2 cm of circular muscle through remnant circular muscle into the gastric side . two biopsy specimens were obtained from the proximal circular muscle and at the les area ( high - pressure zone ) for histopathological assessment as confirmation of in vivo diagnosis . ec findings were assessed according to the previous in vivo report and histopathology reports 11112 . ec findings of the mp were classified as : atrophy , normal , or hypertrophy . this study was performed at showa university northern yokohama hospital , a tertiary referral center in japan . enrollment began in december 2013 and patients with consecutive achalasia who were candidates for poem were recruited for this study . patients younger than 18 years and those whose health was not favorable for enrollment because of severe comorbidity in organs such as the heart or lungs were excluded from this study . in instances where full - thickness myotomy was performed , ec examination was not performed , and these patients were also excluded from the analysis . the current study was approved by the institutional review board ( no . 1311 - 05 ) . written informed consent was obtained from all participants , and the study was conducted according to the declaration of helsinki . this study was performed at showa university northern yokohama hospital , a tertiary referral center in japan . enrollment began in december 2013 and patients with consecutive achalasia who were candidates for poem were recruited for this study . patients younger than 18 years and those whose health was not favorable for enrollment because of severe comorbidity in organs such as the heart or lungs were excluded from this study . in instances where full - thickness myotomy was performed , ec examination was not performed , and these patients were also excluded from the analysis . the current study was approved by the institutional review board ( no . 1311 - 05 ) . written informed consent was obtained from all participants , and the study was conducted according to the declaration of helsinki . esophageal contents were cleared by endoscopic suction using a 3.7 - mm channel endoscope ( gif - 1t240 ; olympus co. , tokyo , japan ) under intravenous anesthesia to prevent aspiration caused by intubation . under general anesthesia with positive pressure ventilation , after submucosal injection at the level of the mid - esophagus , a 2 - cm longitudinal mucosal incision was created as the point of entry . a one - third circumferential submucosal tunnel was created from entry down to the les and into approximately 23 cm of the gastric side . dissection of the circular muscle ( from 2 cm distal to the mucosal entry ) was performed at the center of the submucosal tunnel . after myotomy , a totally relaxed c ( egj ) was confirmed by inserting an endoscope into the natural lumen down to the gastric side , and by a retroflex view from the gastric side to egj ( fig . 2 ) . the mucosal entry was closed with hemostatic clips . as compared to pre - poem ( a ) , a totally relaxed esophagogastric junction is seen on retroflex view from the gastric side with poem ( b ) . all ec examinations were performed using the integrated - type endocytoscope gif - y0002 ( prototypes from olympus co. ) . gif - y0002 has one lens that can consecutively increase the magnification from the conventional endoscopy level to 380 magnification ( tissue field of view , 700600 m ) using a hand lever . the gif - y0002 allows gradual magnification at the center of the monitor , thus ensuring accurate localization of the area being viewed . for ec , a mixture of 0.1 % methylene blue was used to stain the tissues and to obtain images similar to those obtained in conventional pathology examination . ec examination was performed after poem and prior to closure of the mucosal entry site . after staining with 2 ml of methylene blue , the ec examination was started from the proximal 2 cm of circular muscle through remnant circular muscle into the gastric side . two biopsy specimens were obtained from the proximal circular muscle and at the les area ( high - pressure zone ) for histopathological assessment as confirmation of in vivo diagnosis . ec findings were assessed according to the previous in vivo report and histopathology reports 11112 . ec findings of the mp were classified as : atrophy , normal , or hypertrophy . seven patients with achalasia who underwent poem were enrolled in this study and underwent concomitant ec examination . the mean ( sd ) age of the participants was 35.018.1 years , and the study population consisted of four male and three female patients . the duration of achalasia symptoms was 5.57.5 years , and ranged from 3 to 20 years . according to chicago classification criteria 1314 , manometric findings were classified as type i in one patient and type ii in four patients ; in two patients , manometry was not completed because of difficulty in inserting the catheter through the les . the total length of the endoscopic myotomy was 122.2 cm with a mean of 102.0 cm in the esophagus and 3.00.69 cm in the stomach ( table 1 ) . nothing particular manometry : manometric findings according to chicago classification criteria 1314 : manometry was not completed endocytoscopy ( ec ) images showed no evidence of atrophy or hypertrophy , which was consistent with the diagnosis established by histopathology . favorable ec images were obtained , and spindle - shaped smooth muscle cells were observed . a strong staining nucleus , surrounding cell bodies , and vessels in the muscular layer were visualized . however , none of these structures showed particularly notable changes , that is , non - atrophy and non - hypertrophy of the mp ( fig .4 ) . in other words , changing patterns such as atrophy or hypertrophy were not identified on the biopsy specimens . on postoperative day 2 , a liquid diet was started , and on day 4 , all the patients were discharged on a normal diet . in vivo images of the muscularis propria of circular and longitudinal muscle in achalasia obtained by endocytoscopy . spindle - shaped smooth muscle cells , including the nucleus and cell bodies , are clearly identified . conventional microscopic analysis of the muscularis propria shows the smooth muscle layer from one of the achalasia patients with well - preserved spindle - shaped , smooth muscle cells . to our knowledge , this is the first study to report in vivo histopathology of the mp in patients with achalasia . first , ec can be used for in vivo real - time assessment not only for intestinal mucosa but also for mp via a submucosal tunnel created after poem . in poem for achalasia , real - time histopathological assessment of mpmay be helpful to identify the morbid lesion preoperatively , although no atrophy or hypertrophy was identified in our small cohort . the intermittent and time - consuming biopsy method , which also includes adverse event risks such as bleeding , can not substitute for the continuous and real - time ec assessment . furthermore , if ec can be performed by resecting the mucosal / submucosal layer using endoscopic mucosal resection / endoscopic submucosal dissection , ec is potentially effective for the diagnosis of other disorders with a nidus located in the mp . second , the endocytoscopic morphology of the mp showed no evidence of hypertrophy or atrophy of smooth muscle cells despite a thick or thin appearance on a conventional endoscopic view , and the ec findings were confirmed by histology . this result suggests that the thick or thin appearance of mp in achalasia is caused by the changing histopathology rather than hypertrophy or atrophy , or that such change requires long - term symptoms . previous studies have examined muscle biopsies from patients with achalasia treated at an earlier stage of disease . these studies have detected intact mp in these patients who had a shorter duration of symptoms and a non - dilated esophagus 151617 , findings that are almost consistent with our results . first , the staining technique used in this series allowed the evaluation of cell structure , cytoplasm , and nuclei alone . the nerve plexuses were not visualized in this setting because of a lack of neuron - specific fluorescent stain available for safe use in humans . development of stains and methods to evaluate stain toxicity and long - term effects are essential . in the current study , the nerve plexus was not identified by biopsy , probably because the tissue sampling should be nonconsecutive , and with a small specimen . in addition , achalasia and the other esophageal motility disorders have multidimensional etiology and pathogenesis . the most familiar histomorphologic change is a loss of ganglion cells in the auerbach plexus of smooth muscle ; however , controversy exists regarding the trigger , extent , and degree of the change 101819 . further studies involving a larger series , particularly including participants with a longer duration of symptoms , is warranted . however , the application of this technique should remain limited and performed only in select centers so that poem and ec can be performed safely . in conclusion , in vivo real - time assessment of the mp is possible using ec\noutput:\n" }, { "from": "agent", "value": "background : the histopathology of the muscularis propria ( mp ) is unknown in patients with achalasia . endocytoscopy ( ec ) was developed as an ultra - high magnification endoscopy , and the submucosal tunnel created during peroral endoscopic myotomy ( poem ) not only provides access to the mp but also enables subsequent endoscopic assessment of the mp . patients and methods : in seven patients with achalasia ( mean sd ; 35 18.1 years ; men : women , 4:3 ) who underwent poem ( myotomy length : 12 2.2 cm ) , subsequent ec examination was performed from the mid - esophagus to the gastric side . ec images were compared to the results of histopathologic examination ( two biopsies from the mid - esophagus and lower esophageal sphincter ) , which was the standard . results : in all patients , favorable ec images were obtained , and spindle - shaped smooth muscle cells were detected . in our series , we observed no notable features such as atrophy or hypertrophy of smooth muscle cells . in addition , the ec assessment was consistent with the results of biopsy . no complications were encountered during any of the procedures . conclusion : in a clinical setting , real - time assessment of the mp using ec is feasible . this technique may play an important role in determining the pathology of achalasia and other diseases that affect gastrointestinal function ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: the first thing to be discussed in this respect would be the definition of the ideal treatment . this may be fairly dependent on the point of view of the involved people , that is , patients versus medical personnel including surgeons , versus health insurance providers . two recent studies on a group of surgically treated asd patients demonstrated that the perception of adverse events ( and potentially treatment results ) may be significantly different between patients and surgeons . until recently , the most quantifiable aspect of treatment ( radiological parameters ) had been the milestone in defining the success or failure of a given treatment . on the other hand , our understanding of any health condition has now evolved into measuring the hrqol status and / or changes provided by the treatment thereof , and this approach will be used in the definition of what is ideal . this problem has been tackled by several authors . a systematic review by everett and patel on the results of non - surgical treatment failed to demonstrate any evidence better than level iii for any non - surgical treatment modality . bridwell and co - workers retrospectively analysed the clinical results of symptomatic adult lumbar scoliosis patients and concluded that while non - surgical treatment was hardly associated with any real change in hrqol , surgery on the other hand provided significant improvement in this regard at two years follow - up . a recent study by scheer and co - workers has investigated the effect of treatment ( surgical versus non - surgical ) on the quality adjusted life years ( qaly ) incurred by the treatment and concluded that surgical treatment provided significantly better qalys compared to non - surgical treatment . we have also looked for a possible definitive answer to the problem of identifying the ideal treatment in asd using a decision - analysis tool . from a multi - centric prospective database , the patient population consisted of a total of 535 patients who had completed the one - year follow - up , with 371 treated non - surgically and 164 treated surgically . surgical treatment consisted of any combination of anterior and posterior surgery , fusion , instrumentation and decompression , whereas non - surgical treatment referred to follow - up under observation and / or analgesic or nsaid prescriptions in the majority of patients , with 12 out of 371 patients having been referred to a structured physical therapy programme and only six to injections or other forms of invasive treatment . all of these patients had complete radiological data in addition to records of all complications and unplanned hospitalisations as well as hrql measures ( srs22 , odi and sf - 36 ) taken at baseline ( entry to the registry ) and at six and 12 months . for the purposes of the present study , out of a bank of four years data collection , a 12 - month set of patient data having at least one year of follow - up was used , so as to construct the decision - analysis model . demographic characteristics as well as hrqol data of the enrolled patients can be seen in table 1 . demographic characteristics and baseline and follow - up odi data the methodology of decision - analysis consisted of investigating the likelihood ( probability ) of certain outcomes , for example improvement , no change or deterioration ( improvement defined as a decrease in the odi score by 8 or more points and deterioration as an increase by 8 or more points ) and the burden associated with treatment quantified as the utility of this treatment , ranging between 0 and 1.0 ( 0 being the highest burden , i.e. death or total paralysis ; 1.0 being perfect health ) . these are then incorporated in a decision tree that demonstrates the qaly associated with each possible outcome . the results of this study demonstrated that the likelihood of improvement was significantly higher for patients treated surgically , compared to those treated non - surgically ( table 2 ; table 4 ) to the extent that the likelihood of improvement in the odi score was 54.2 % in the surgical group compared to the 9.7 % in the non - surgical group . it can easily be argued that this is to be expected , after all , as most patients in the non - surgical groups tend to be patients who did not receive any significant treatment at all ; how can we expect them to get better by themselves ? this argument being very accurate , the more interesting finding in this analysis was the probability of ending up with significant deterioration by the end of the first year post - treatment . as can be seen in table 2 , unexpectedly , the probability of deterioration appears to be higher in the non - surgical group . as a summary at this stage , we can say that surgical treatment of asd results in a significantly higher probability of improvement , and a lesser chance of deterioration . overall treatment results of the entire study population regardless of complications , diagnosis , patient age and pre - treatment level of disability for the definitions of improvement , no change and deterioration , please see text . it has to be kept in mind , though , that another very important facet of this discussion is the burden associated with these treatment modalities . if the burden associated with surgery is much higher than that of non - surgical treatment , and the procedure itself ( and the follow - up ) does not effectively decrease this burden , one may argue that the higher rates of improvement can only be achieved with considerable suffering . this is a valid argument and we have to revert to the utility part of decision - analysis in order to provide an accurate answer to it . as described above , utility is a measure of the burden of any disease at a given time ( as it is mapped from sf36 ) , and may range between 0 ( extremely bad health , death or total paralysis by definition ) and 1.0 ( perfect health ) . tables 3 and 4 summarise the utilities calculated for the general population ( table 3 ) and for specific subsets based on age , disability level at the time of enrolment and diagnosis ( table 4 ) . baseline and final utilities and final qale for an entire patient population default life expectancy accepted as 100 ; thereby the qale = final utility * 100 baseline and final utilities and final qale for a ) patients aged = 50 years , b ) patients aged 50 years , c ) degenerative deformity , d ) idiopathic deformity , and e ) patients with baseline odi 25 default life expectancy accepted as 100 ; thereby the qale = final utility * 100 as can be seen from this study , it appears that the surgical group started with a significantly higher burden compared to the non - surgical , and finished with a significantly higher burden at the first year . but it is only in this group that the burden of the disease could be significantly decreased , while the overall disease burden in the non - surgical group had not changed . in the light of these results , returning to the discussion referred to above , we can conclude that at the end of the follow - up period , surgical patients carried a higher burden of disease compared to non - surgical patients , but this disadvantage has probably been decreased from a significantly higher proportion to a lesser ( but still significant ) proportion . in summary , analysis of the relevant literature as well as the decision - analysis suggests that surgery may be more akin to being the ideal treatment for asd compared to non - surgical treatment . but then , this may lead to a subsequent set of questions on identifying the sub - populations in whom there may be differences ; for example could surgery be associated with a higher burden in the older population ? should it be reserved for the relatively younger patients as a result ? what about patients with significant disability at the time of presentation - does surgery help them at all ? what about the degenerative deformity patients compared with those with so - called idiopathic deformity ? table 4 summarises the answers to these questions based on the decision - analysis performed . as can be expected , older patients had been presenting with a higher burden but ended up at a significantly improved and almost similar burden level to the group of patients who had surgical treatment . non - surgical patients did not demonstrate any significant changes in time regardless of their age group ( table 4a and b ) . a recent study by sciubba and co - workers has also reported similar findings in regard to the outcomes of surgical or non - surgical treatment in patients over 75 years of age , and concluded in elderly patients greater than 75 years of age , reconstructive surgery provides significant improvements in pain and disability over a two - year period . furthermore , surgically treated patients were more likely to reach mcid than non - operative patients . when analysed for the effect of diagnosis ( degenerative deformity versus idiopathic ) it was seen that an almost similar pattern arises here as well , with the exception that in both sub - groups , surgical treatment not only provided significant decreases in disease burden but also a better level at the end of the follow - up ( table 4c and d ) . finally for patients with significant disability at the time of enrolment ( defined as odi 25 % ) , it was seen that although both groups had started the treatment at the same level of disease burden , significant improvement could only be achieved in the surgical group and , in fact , this group had achieved a better ( although not significant ) burden level at the end of the follow - up period ( table 4e ) . based on these findings , we can state that under the light of current evidence ( level iii ) , surgical treatment of asd appears to yield a better chance in terms of both the hrqol and overall disease burden , albeit being associated with a higher burden at time points at both ends . we have also looked for a possible definitive answer to the problem of identifying the ideal treatment in asd using a decision - analysis tool . from a multi - centric prospective database , the patient population consisted of a total of 535 patients who had completed the one - year follow - up , with 371 treated non - surgically and 164 treated surgically . surgical treatment consisted of any combination of anterior and posterior surgery , fusion , instrumentation and decompression , whereas non - surgical treatment referred to follow - up under observation and / or analgesic or nsaid prescriptions in the majority of patients , with 12 out of 371 patients having been referred to a structured physical therapy programme and only six to injections or other forms of invasive treatment . all of these patients had complete radiological data in addition to records of all complications and unplanned hospitalisations as well as hrql measures ( srs22 , odi and sf - 36 ) taken at baseline ( entry to the registry ) and at six and 12 months . for the purposes of the present study , out of a bank of four years data collection , a 12 - month set of patient data having at least one year of follow - up was used , so as to construct the decision - analysis model . demographic characteristics as well as hrqol data of the enrolled patients can be seen in table 1 . demographic characteristics and baseline and follow - up odi data the methodology of decision - analysis consisted of investigating the likelihood ( probability ) of certain outcomes , for example improvement , no change or deterioration ( improvement defined as a decrease in the odi score by 8 or more points and deterioration as an increase by 8 or more points ) and the burden associated with treatment quantified as the utility of this treatment , ranging between 0 and 1.0 ( 0 being the highest burden , i.e. death or total paralysis ; 1.0 being perfect health ) . these are then incorporated in a decision tree that demonstrates the qaly associated with each possible outcome . the results of this study demonstrated that the likelihood of improvement was significantly higher for patients treated surgically , compared to those treated non - surgically ( table 2 ; table 4 ) to the extent that the likelihood of improvement in the odi score was 54.2 % in the surgical group compared to the 9.7 % in the non - surgical group . it can easily be argued that this is to be expected , after all , as most patients in the non - surgical groups tend to be patients who did not receive any significant treatment at all ; how can we expect them to get better by themselves ? this argument being very accurate , the more interesting finding in this analysis was the probability of ending up with significant deterioration by the end of the first year post - treatment . as can be seen in table 2 , unexpectedly , the probability of deterioration appears to be higher in the non - surgical group . as a summary at this stage , we can say that surgical treatment of asd results in a significantly higher probability of improvement , and a lesser chance of deterioration . overall treatment results of the entire study population regardless of complications , diagnosis , patient age and pre - treatment level of disability for the definitions of improvement , no change and deterioration , please see text . it has to be kept in mind , though , that another very important facet of this discussion is the burden associated with these treatment modalities . if the burden associated with surgery is much higher than that of non - surgical treatment , and the procedure itself ( and the follow - up ) does not effectively decrease this burden , one may argue that the higher rates of improvement can only be achieved with considerable suffering . this is a valid argument and we have to revert to the utility part of decision - analysis in order to provide an accurate answer to it . as described above , utility is a measure of the burden of any disease at a given time ( as it is mapped from sf36 ) , and may range between 0 ( extremely bad health , death or total paralysis by definition ) and 1.0 ( perfect health ) . tables 3 and 4 summarise the utilities calculated for the general population ( table 3 ) and for specific subsets based on age , disability level at the time of enrolment and diagnosis ( table 4 ) . baseline and final utilities and final qale for an entire patient population default life expectancy accepted as 100 ; thereby the qale = final utility * 100 baseline and final utilities and final qale for a ) patients aged = 50 years , b ) patients aged 50 years , c ) degenerative deformity , d ) idiopathic deformity , and e ) patients with baseline odi 25 default life expectancy accepted as 100 ; thereby the qale = final utility * 100 as can be seen from this study , it appears that the surgical group started with a significantly higher burden compared to the non - surgical , and finished with a significantly higher burden at the first year . but it is only in this group that the burden of the disease could be significantly decreased , while the overall disease burden in the non - surgical group had not changed . in the light of these results , returning to the discussion referred to above , we can conclude that at the end of the follow - up period , surgical patients carried a higher burden of disease compared to non - surgical patients , but this disadvantage has probably been decreased from a significantly higher proportion to a lesser ( but still significant ) proportion . in summary , analysis of the relevant literature as well as the decision - analysis suggests that surgery may be more akin to being the ideal treatment for asd compared to non - surgical treatment . but then , this may lead to a subsequent set of questions on identifying the sub - populations in whom there may be differences ; for example could surgery be associated with a higher burden in the older population ? should it be reserved for the relatively younger patients as a result ? what about patients with significant disability at the time of presentation - does surgery help them at all ? what about the degenerative deformity patients compared with those with so - called idiopathic deformity ? table 4 summarises the answers to these questions based on the decision - analysis performed . as can be expected , older patients had been presenting with a higher burden but ended up at a significantly improved and almost similar burden level to the group of patients who had surgical treatment . non - surgical patients did not demonstrate any significant changes in time regardless of their age group ( table 4a and b ) . a recent study by sciubba and co - workers has also reported similar findings in regard to the outcomes of surgical or non - surgical treatment in patients over 75 years of age , and concluded in elderly patients greater than 75 years of age , reconstructive surgery provides significant improvements in pain and disability over a two - year period . furthermore , surgically treated patients were more likely to reach mcid than non - operative patients . when analysed for the effect of diagnosis ( degenerative deformity versus idiopathic ) it was seen that an almost similar pattern arises here as well , with the exception that in both sub - groups , surgical treatment not only provided significant decreases in disease burden but also a better level at the end of the follow - up ( table 4c and d ) . finally for patients with significant disability at the time of enrolment ( defined as odi 25 % ) , it was seen that although both groups had started the treatment at the same level of disease burden , significant improvement could only be achieved in the surgical group and , in fact , this group had achieved a better ( although not significant ) burden level at the end of the follow - up period ( table 4e ) . based on these findings , we can state that under the light of current evidence ( level iii ) , surgical treatment of asd appears to yield a better chance in terms of both the hrqol and overall disease burden , albeit being associated with a higher burden at time points at both ends . complications have always been the major concern with regard to any treatment modality in asd , and have very commonly been defined as a major parameter in decision - making . as discussed above , interestingly , when treatment complications are evaluated , most care providers and decision - makers think of the complications of surgical treatment and very commonly visualise non - surgical treatments ( including observation ) as devoid of any adverse effects and / or complications . as this is probably not the case , we tend to think that a more holistic approach , following up both surgically - and non - surgically - treated patients , and reporting all complications and their effects on the outcomes , is needed . in order to achieve this and understand the magnitude of the problem of complications , a critical review of literature pertaining to asd with special emphasis to treatment complications was performed as an integral component of our decision - analysis . a computerised query of the pubmed and scopus databases was performed to identify any articles published between 1950 and 2014 that were pertinent to the aforementioned clinical questions . an initial search using the keywords adult spine deformity , adult spine deformity surgery , adult spine surgery complications , adult scoliosis , adult scoliosis surgery and adult scoliosis surgery complications was performed . based on this , after all abstracts were reviewed , 149 articles were selected for detailed review . in the full text assessment , we excluded studies which include case reports , small series ( 20 patients reported ) , single anatomical region deformity studies , revision case series , series in which complication incidences and results were not clearly documented and studies which did not meet the inclusion criteria . additionally , review articles were excluded if they did not add significantly over an expert opinion level of evidence . using these criteria ,98 studies were excluded and 52 studies were identified so as to be evaluated for a detailed review of methodology and results . for each article , the study design ( retrospective or prospective ) , year of publication , number of patients , mean patient age , mean follow - up , complication types ( pre - op , intra - op and post - op ) and incidences were analysed and noted . in addition , clinical outcome data , based on complications that can be classified as life - threatening ( lt ) / non - life - threatening ( nlt ) or major / minor , were also recorded when available . of the 52 studies that met inclusion criteria , none were randomised controlled trials ; the majority were retrospective database case series , and all were on surgical treatment . summarised cumulative probabilities for lt and nlt complications from these studies and specifically from studies that were selected as focussing on complications can be viewed in table 5 . as can be seen , there is a very wide variance in the incidences reported , especially with regard to pseudoarthrosis and implant failures ( ranging between 0.5 % and 54.0 % ) . the probability table for life - threatening ( lt ) and non - life - threatening ( nlt ) complications obtained through the systematic review of the literature for surgical intervention apart from these , three recent papers have specifically reported on the effects of complications on treatment outcomes . daubs et al have investigated the complications and outcomes of 46 patients over the age of 60 years , who underwent thoracic or lumbar arthrodesis of five or more levels , with a mean follow - up of 4.2 years . they concluded that the overall complication rate in this patient population was 37 % ( with a major complication rate of 20 % ) , and patients over the age of 69 years had yet higher complication rates . in spite of this , clinical outcomes at final follow - up were significantly improved in odi scores . glassman et al have also reported on the effect of treatment complications on 46 adult deformity patients undergoing surgery . there were 47 major and 62 minor complications , and it was seen that major complications had adversely affected the outcome as evidenced by the sf12 general health scores at one year follow - up . in another study , scheer et al have investigated the effect of complication on the recovery of patients using an integrated health score ( ihs ) and concluded , [ t ] here was a significantly protracted mental recovery phase associated with patients that had at least one complication , as well as either a minor and major complication . the addition of a reoperation also adversely affected the mental recovery as well as overall satisfaction . likewise , a study by ayhan et al focusing on spinal osteotomies in asd patients demonstrated that complications do not necessarily affect the clinical outcomes in this sub - population of patients . it needs to be noted that , again , both of these studies as well as the studies referred to above have not compared the treatment modalities for complications . that being the status of the available base of knowledge , the second part of our decision - analysis was performed with the specific questions of whether complications affect the outcomes of treatment and if so , to what extent . using the same patient population and methodology described above , it was seen that in this group of 535 patients ( 371 non - surgical , 164 surgical ) , there were 78 ( 14.6 % ) nlt 12 ( 2.2 % ) lt complications and three ( 0.6 % ) deaths / paralyses ( 1 death , 2 patients with total paralysis ) . in addition , as can be expected , the rate of lt was much higher in patients treated surgically ( p 0.001 ) and there were no deaths or progression to paralysis in the non - surgical group . based on these findingswe can conclude that although non - surgical treatment is also associated with complications , surgical treatment of asd is more prone to complications in general and much more prone to major and devastating complications . incidences of complications in surgical and non - surgical patient groups nlt = non - life threatening complications ; lt = life - threatening complications ; death = death or paralysis . these findings are important in underlining that for patients who had surgical treatment , complications do have an effect on the clinical outcomes . the probability of improvement decreases by the presence of complications , especially if these complications are lt whereas likewise , the probability of clinical deterioration increases with the presence and severity of complications . on the other hand , on the non - surgical side we see that the presence and / or severity of complications have little if any effect on clinical outcomes ( with the exception of lt complications which is a statistical error secondary to less populated cells ) . overall treatment results of the entire study population grouped by complications regardless of diagnosis , patient age and pre - treatment level of disability for the definitions of improvement , no change and deterioration please see text . finally , the utilities and associated qaly values for all possible outcomes ( that is , three possible clinical outcomes , two groups and three potential complication statuses ) can be seen in table 8 . final table with clinical outcomes in three categories and probabilities and utilities associated with these outcomes based on this , it can be seen that the lt complications in particular add a very heavy burden for the involved patients in both groups . this burden is even heavier in patients who had experienced deterioration , and in this regard it might be more reasonable to state that the presence of lt complications may have played an integral role in the clinical deterioration of these patients . based on these findings we can state that any treatment in asd is prone to complications , and complications can affect surgical outcomes adversely . patients with complications have a decreased likelihood of getting better compared to those with no complications , and they carry a heavier burden of the disease ; potentially even heavier than their baseline status . specifically , surgical treatment is significantly more prone to complications and therefore the above - mentioned effects of complications are probably more pronounced in the surgical patients . on the other hand , when we compare the probability of getting clinically better at the end of the first year of treatment between the surgical and non - surgical patients , we can see that surgical patients who had encountered complications during their treatment still have a higher chance of improvement compared to their non - surgical counterparts . in summary , the end result of the decision - analysis study suggests that the two facets of treatment outcomes , improvement versus no change / deterioration and the burden of the disease ( utilities ) may affect the eventual decision - making in different directions . when we look at the probability of getting better by treatment , surgery appears to be the obvious treatment of choice . on the other hand , surgery is more prone to complications ( which affect the outcome ) and associated with a heavier treatment burden as well . stated in a different way , analysis of the results of this study as well as the others in the literature enables the drawing of several conclusions : treatment of asd is prone to complications ; more so in surgical treatment ( 31.7 % ) than non - surgical treatment ( 11.1 % ) . these complications affect the clinical outcomes of treatment regardless of whether it is surgical or non - surgical . however , as the complication rate is higher in the surgical group , this effect may be more pronounced . . this burden may be even heavier in surgical patients who were found to start the treatment with significantly higher burdens . on the other hand , it appears that only surgical treatment can decrease the burden of this specific medical condition . the chance of improvement following treatment is significantly higher in patients who have undergone surgery . this effect is more pronounced in patients without any complications but still persists in those who have had complications as well . although the level of evidence is not beyond level iii , all controlled and non - controlled studies on the treatment of asd uniformly suggest that at this point in time , surgical treatment may provide better chances of improvement when compared with non - surgical treatment . that being said , much work needs to be done to improve our understanding of asd and how to evaluate and treat patients with this condition . in thisregard , future work should focus on : investigating non - surgical treatment modalities that may effectively change the natural history of the disease for longer periods of time , if not permanently . providing better definition of surgical indications . what type of surgery for whom ? providing a better definition of the timing of surgery / interventions . when is a good time for a patient with asd and clinical disability to have treatment , rather than leaving the patient to the natural history of the disease ? establishing means to decrease the rate of complications radically . in order to achieve this goal : we need to identify patients who would be more prone to complications with certain treatment modalities and divert these patients to other treatment modalities . we need to stratify our patients for their risks and interventions for their aggressiveness so as to be able to match them . we need to keep on working on new surgical technologies that would improve patient safety and decrease complications . the priority in this regard may be developing new fusion and implant technologies as the rates of mechanical failure are still unacceptably high in asd . we need to identify patients who would be more prone to complications with certain treatment modalities and divert these patients to other treatment modalities . we need to stratify our patients for their risks and interventions for their aggressiveness so as to be able to match them . we need to keep on working on new surgical technologies that would improve patient safety and decrease complications . the priority in this regard may be developing new fusion and implant technologies as the rates of mechanical failure are still unacceptably high in asd . the decision - analysis project referred to in this manuscript was funded by the spine society of europe ( eurospine ) .\noutput:\n" }, { "from": "agent", "value": "adult spinal deformity ( asd ) is a very diverse condition that affects the quality of life of the involved individuals deeply . there is an ongoing discussion as to whether treatment should be surgical ( which is potentially dangerous ) or non-surgical . in addition to a systematic review of literature on the surgical treatment of asd with special emphasis on complications , a decision - analysis was performed using the patient information within a european multi - centric database of asd.the probabilities of improvement and complications as well as associated disease burden ( utility ) were calculated at the baseline and at first - year follow - up.decision - analysis suggests that the chances of clinical improvement are significantly higher with surgical treatment . though surgical treatment is significantly more prone to complications , the likelihood of improvement remains higher than that offered by non - surgical treatment.surgical treatment of asd appears to be associated with a higher likelihood of clinical improvement . future work needs to focus on refining the criteria for appropriate patient selection and decreasing the incidence of complications.cite this article : acaroglu e , european spine study group . decision - making in the treatment of adult spinal deformity . efort open rev 2016 ; 1:167 - 176 . doi : 10.1302 / 2058 - 5241.1.000013 ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: concurrently , tumor thrombus , or the extension of the rcc into the renal vein and inferior venal cava ( ivc ) , also occurs frequently in this patient population , at a reported rate of 510 % 3 . venous tumor thrombus disrupts vascular integrity and disturbs venous blood flow , which could potentially increase the risk of vte . the clinical impact of a tumor thrombus and its potential association with an increased risk of vte in rcc patients awaiting radical nephrectomy and thrombectomy are unknown . currently , no evidence or guidelines are available to direct clinical management , and the use of anticoagulant therapy is variable among practitioners . we sought to determine the incidence of vte in rcc patients with gross tumor thrombus on imaging diagnosis prior to radical nephrectomy and thrombectomy . a retrospective cohort study was conducted of all late - stage ( stage 34 excluding t12 n0m0 ) rcc patients who underwent a radical nephrectomy at our institution , the ottawa hospital , between 1 january 2005 and 1 july 2012 . tumor thrombus was defined as the presence of an intraluminal filling defect in the renal vein , hepatic vein , portal vein or ivc directly extending from a renal mass detected on computed tomography . the remaining patients , including those with pathology reports subsequently showing vascular involvement , became thethe date of imaging diagnosis was defined as the first diagnostic imaging report of suspected rcc . patients on anticoagulation therapy or with a vte event prior to or at cancer diagnosis were excluded . the primary outcome was the incidence of vte during the time interval between ( i ) the diagnosis of cancer on imaging and ( ii ) radical nephrectomy . vte was defined as proximal lower limb ( popliteal vein or more proximal ) deep vein thrombosis ( dvt ) or pulmonary embolism . a two - sided fisher exact test was used to compare the incidence of vte between patients in the tumour thrombus and control groups . in 1140 charts reviewed of patients diagnosed with kidney cancer , we identified 212 patients with stage 3 or 4 rcc who underwent radical nephrectomy . of the 212 patients , 36 were excluded : 30 because of vte prior to or at the time of cancer diagnosis ; three because of thrombophilia ; and three because prophylactic anticoagulation was used between the time of diagnosis and surgery . the proportion of patients with stage 3 rcc was 51.4 % ( table 1 ) . fifty - three ( 30.1 % ) patients had tumor thrombus diagnosed on imaging , and were included in thetumour thrombus group ; the remaining 123 patients ( 69.9 % ) , including six patients ( 4.9 % ) with no tumor thrombus on radiographic imaging but evidence of vascular involvement on pathology , were included in the control group . the median times from imaging diagnosis to radicalnephrectomy were 24 days ( range : 1213 days ) in the tumor thrombus group and 46 days ( range : 02055 days ) in thetumour thrombus group ( 5.7 % ; 95 % confidence interval [ ci ] 1.416.8 ) developed a vte while awaiting radical nephrectomy , whereas none ( 0 % ; 95 % ci 02.9 ) of the patients in theall three vte events were then treated with low molecular weight heparin prior to surgery . times from tumor thrombus diagnosis to vte were 5 , 15 and 21 days . baseline characteristics dvt , deep vein thrombosis ; ivc , inferior vena cava ; ns , non - significant ; sd , standard deviation ; vte , venous thromboembolism . this is the first study demonstrating an increased risk of vte in stage 3 or 4 rcc patients with tumor thrombus awaiting radical nephrectomy . the risk of vte in our patient population is similar to those reported in other high - risk populations . in a large randomized controlled trial comparing the efficacy of thromboprophylaxis ( enoxaparin 20 or 40 mg daily ) with that of placebo in hospitalized medically ill patients , the rates of symptomatic dvt in patients receiving placebo were 0.5 % and 1.5 % at 12 and 110 days , respectively 4 . the american college of chest physician guidelines recommend anticoagulant thromboprophylaxis for acutely ill hospitalized medical patients at increased risk of vte 5 . therefore , the presence of tumor thrombus in patients with stage 3 or 4 rcc could potentially identify a high - risk subgroup of patients who might benefit from thromboprophylaxis for the limited time period while awaiting surgery . currently , there are studies ongoing to assess the role of neoadjuvant tyrosine kinase inhibitor therapy prior to surgical resection . this could prolong the time between diagnosis and surgery , and theoretically increase the risk for vte in patients with tumor thrombus . however , prospective studies are required to confirm these findings . it is important to recognize significant limitations of this study resulting from the retrospective design , leading to potential bias , incomplete information , or misdiagnosis . we tried to minimize selection bias by including all consecutive patients assessed at our institution and fully reviewing the charts in duplicate ( two independent reviewers ) to ensure proper identification of patients and adjudication of outcome events . furthermore , the number of events is relatively small , and larger studies are needed to provide more reliable estimates . similarly , the difference in the median time from imaging diagnosis to radical nephrectomy between the two groups is caused by one patient in the tumor thrombus group who waited 2055 days before undergoing surgery . finally , it is important to emphasize that , although the results of this study show that the presence of tumor thrombus increases the rate of vte , we can not draw any conclusions regarding the potential benefit of primary thromboprophylaxis in this patient population . to conclude , tumor thrombus on imaging is a frequent finding among late - stage rcc patients awaiting radical nephrectomy . larger prospective studies are required to confirm these findings and assess the role of thromboprophylaxis in rcc patients with tumor thrombus . m. carrier and d. yokom designed and performed research , collected , analyzed and interpreted data , performed statistical analysis , and wrote the manuscript . g. le gal analyzed and interpreted data , provided vital reviews of the manuscript , and wrote the manuscript . p. moretto , n. reaume , and c. canil collected , analyzed and interpreted data , and provided a vital review of the manuscript .\noutput:\n" }, { "from": "agent", "value": "backgroundthe clinical impact of a tumor thrombus in renal cell carcinoma ( rcc ) patients awaiting radical nephrectomy and thrombectomy is unknown.objectiveto determine the incidence of venous thromboembolism ( vte ) in rcc patients with tumor thrombus prior to nephrectomy.patients and methodswe conducted a retrospective cohort study including all late - stage ( stage 34 excluding t12 n0m0 ) rcc patients who underwent radical nephrectomy at our institution between 1 january 2005 and 1 july 2012 . tumor thrombus was defined as the presence of an intraluminal filling defect in the renal vein , hepatic vein , portal vein , or inferior vena cava , directly extending from a renal mass detected on computed tomography.resultsa total of 176 patients were included in the study . fifty - three ( 30.1 % ) patients had tumor thrombus diagnosed on imaging three patients with tumor thrombus ( 5.7 % ; 95 % confidence interval [ ci ] 1.416.8 ) developed a vte while awaiting radical nephrectomy , whereas none ( 0 % ; 95 % ci 02.9 ) of the patients without a tumor thrombus had an event ( p = 0.026 ) . all three events were deep vein thrombosis . times from tumor thrombus diagnosis to vte were 5 , 15 and 21 days.conclusionstumor thrombus on imaging is a frequent finding among rcc patients awaiting nephrectomy . the presence of tumor thrombus in these patients increases the incidence of preoperative vte ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: ebstein 's anomaly is a congenital malformation of the heart that is characterized by apical displacement of the septal and posterior tricuspid valve leaflets . this condition leads to atrialization of the right ventricle , with a variable degree of malformation and displacement of the anterior leaflet . ebstein 's anomaly has a prevalence of 0.20.5 % of all cardiac malformations 1 , 2 . onethird of prenatally diagnosed patients with ebstein 's anomaly will die in utero and the 1 year survival rate is only 15 % 3 , 4 . we present a case of fetal severe ebstein 's anomaly that was diagnosed by fetal echocardiography in monochorionica 21yearold gravida 1 , para 0 woman at 10 weeks ' gestational age was referred for prenatal management for a monochorionicthe patient was suspected as having discordant twin growth with ebstein 's anomaly in the larger fetus at 20 weeks ' gestation . in the smaller fetus , we observed oligohydramnios and biometry at the first percentile , with normal structural anatomy . in the larger fetus , the findings were consistent with ebstein 's anomaly with severely downward displaced tricuspid valve leaflets tethered at the muscular ventricular septum ( including the trabecular portion of the right ventricle ) ( fig .1 a ) , right ventricular atrialization , a small effective right ventricular cavity , and cardiomegaly ( cardiothoracic area ratio : 40 % ) . the patient received periodic sonographic evaluation for changes in cardiac function . both fetuses grew according to gestational age with 4045 % of estimated fetal body weight discordancy ( fig . the amniotic fluid pocket of the smaller fetus gradually increased and caught up to the larger fetus at 27 weeks of gestation ( fig .2 c ) , the ejection fraction of the left ventricle was less than 80 % ( fig .2 d ) , and the preload index was increased to greater than 50 % ( fig . cardiac function was deteriorated in accordance with progression of gestational age , which indicated cardiac failure of the larger fetus ( table 1 ) . cesarean section was performed at 31 + 2 weeks ' gestation because of the high risk of intrauterine demise owing to cardiac failure of the larger fetus . this procedure was performed because of profound consequences for the outcome of the healthy twin . the larger neonate had a birth weight of 1301 g ( 25th percentile ) and apgar scores of 3 and 9 at 1 and 5 min , respectively , with cyanosis . the smaller neonate had a birth weight of 819 g ( 10th percentile ) and apgar scores of 5 and 7 at 1 and 5 min , respectively . an echocardiogram showed severe ebstein 's anomaly with pulmonary stenosis , severe tricuspid valve regurgitation ( grade 4 ) , and atrial enlargement . the smaller infant was provided nasal continuous positive airway pressure for 2 days and supplemental oxygen for one further day . during the neonatal intensive care unit stay , change in parameters with gestational age efbw , estimated fetal body weight ; mca , middle celebral artery ; af , amniotic fluid ; uma , umbilical artery ; ctar , cardiothoracic area ratio ; ri , resistant index ; ef , ejection fraction ( of left ventricle ) ; pli , preload index . many cases of ebstein 's anomaly involve some degree of tricuspid regurgitation and stenosis . increased right atrial pressure and volume enlarge the right atrium , resulting in a righttoleft shunt if a pathway exists 1 , 2 . singletons have a prevalence of congenital heart disease of 2 % compared with 1.77.5 % in all twin pregnancies . monochorionic twins have a higher prevalence of congenital heart disease than dichorionic twins 6 , 7 . unequal division of the embryonic cell mass could be a risk factor for development of congenital heart disease in monochorionic twins . monochorionic twins are associated with a high perinatal mortality and morbidity 8 , 9 , 10 . abnormal vascular connections between infant twins and blood volume fluctuations or ischemia cause damage in multiple organs 8 , 9 , 10 , especially in twintotwin transfusion syndrome . doppler parameters were introduced to investigate blood flow in fetus to evaluate the fetal wellbeing and useful for decision making of the optimal time for termination the pregnancy . umbilical artery and middle cerebral artery doppler findings appear to be abnormal in the early stage of placental insufficiency . the preload index reflects ductus venous flow abnormalities and has been described as a late marker . this is because these abnormalities occur within the last week before delivery , reflecting an adverse perinatal outcome and neurological damage 11 , 12 , 13 , 14 . fetal cardiac function analysis in twins shows their hemodynamic status and this finding may improve understanding of the development of growth discordance . when one twin dies , a sufficient amount of thromboplastin from dead tissues may be released , causing generalized clotting problems in the survivor 15 . neurological abnormalities of a surviving cotwin occur in 18 % of monochorionic twins 16 . to avoid intrauterine fetal death in our case , we assessed fetal cardiac function . fetal wellbeing was assessed by a biophysical profiling score , fetal blood flow analysis ( middle cerebral artery resistance index , umbilical artery resistance index ) , and fetal cardiac functional evaluation , including the cardiothoracic area ratio , ejection fraction of the left ventricle , preload index of the inferior vena cava , and severity of tricuspid valve regurgitation . the amniotic fluid pocket of the smaller fetus gradually increased and caught up to the larger fetus at 27 weeks of gestation . in conclusion , a smaller twin fetus of discordant growth increases the risk of an adverse pregnancy outcome by prematurity 17 . the patient 's parents provided consent for the publication of this case report and any accompanying images .\noutput:\n" }, { "from": "agent", "value": "key clinical messageour patient was diagnosed as having discordant twin growth with ebstein 's anomaly in the larger fetus . cardiac function was deteriorated in accordance with progression of gestational age . our observation indicated cardiac failure of the larger fetus . the most important issue in this situation is management of the timing of delivery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: macroautophagy ( conventionally called autophagy ) , which is complementary to the ubiquitin proteasome system , is responsible for the vast majority of regulated protein recycling , in addition to the capture and degradation of mitochondria , golgi complexes , polyribosomes , endoplasmic reticulum ( er ) , and other intracellular constituents , such as proteins , aggregates , and building blocks .14 the process of autophagy occurs continuously at basal levels in healthy cells to eliminate long - lived , misfolded , and damaged constituents through autolysosomes ( autophagolysosome ) .2 lysosomes are responsible for the degradation of extracellular macromolecules taken up by the cells through endocytosis or phagocytosis , as well as those from the cytoplasm through merging with autophagosomes . autophagy is characterized by the formation of double - layer membrane vesicles called autophagosomes that capture intracellular components and subsequently merge with lysosomes , leading to digestion of the cargo .3 the process is used by normal and cancer cells as mechanisms of recycling building blocks and conserving energy , in addition to eliminating toxic materials for homeostasis and survival .4 autophagy can be selective through the formation of autophagosomes around protein aggregates or damaged organelles by actions of autophagosomal membrane receptors ( eg , nbr1 , p62 / sqstm1 , nix ) .4 there are two other forms of autophagy in eukaryotic cells called microautophagy and chaperone - mediated autophagy , which can also specifically target organelles , including mitochondria and intracellular molecules .3 microautophagy , the nonselective lysosomal degradation process , is involved in the maintenance of organelle size , membrane homeostasis , and cell survival .5 chaperone - mediated autophagy is mediated by a chaperone protein called heat shock cognate 70 ( hsc70 ) , which binds to specific proteins containing certain amino acid sequences or motifs and targets them into the lysosome through the lysosome - associated membrane protein type 2a ( lamp2a ) receptor .6 selective removal of mitochondria , er , or peroxisomes by autophagy is referred to as mitophagy , erphagy , and peroxyphagy , respectively .7 mitophagy is an important mitochondrial quality control mechanism that eliminates damaged mitochondria .7 bnip3 is also degraded upon formation of the autophagolysosome , and thus reduction of bnip3 is considered an indication of mitophagic and erphagic flux . pink1 and parkin selectively bind to damaged mitochondria , and target these organelles for autophagic degradation through the ubiquitination of mitochondrial protein .7 autophagy - based degradation pathways may lead to autophagy - associated cell death , which is important for development , differentiation , aging , and cellular remodeling under certain environmental stress conditions .811 all of these forms of autophagy can be induced by nutrient deprivation , hypoxia , and other cellular stresses including metabolic and therapeutic stress such as chemotherapy , radiation , natural polyphenolic compounds , and inhibitors of mammalian target of rapamycin ( mtor ) kinase activity ( ie , rapamycin ) .9,10 thus , dysregulation of autophagy disrupts physiological processes and has been implicated in the pathogenesis of various conditions , including cancer and neurological diseases , such as alzheimer , parkinson s , and huntington s diseases .11 when functioning properly , the autophagic process in neuronal cells prevents neurodegeneration by eliminating the accumulation of abnormal intracellular proteins . thus , well - balanced regulation of autophagic machinery is critical for prevention against some neurological diseases and cancer . the regulation of autophagy is an evolutionarily conserved and highly complex process , consisting of several basic phases , including 1 ) initiation ; 2 ) nucleation ; 3 ) maturation ; and 4 ) merging with lysosomes , resulting in the degradation of sequestered material . the successive steps are regulated by about 30 autophagy - associated genes / proteins ( atg / apg ) in conjunction with various signaling pathways ( figure 1 ) .12 the initiation phase is regulated by a complex consisting of atg1 , ulk1 , and atg13 .13 this is the point where a cell s nutritional status and signaling through mtor and adenosine monophosphate ( amp ) kinase ( ampk ) can regulate the rate of autophagic vessel formation .14 nucleation is controlled by a class 3 phosphatidylinositol -3-kinase ( pi3k ) called vacuolar protein sorting 34 ( vps34 ) , which binds to a complex consisting of atg6 / beclin - 1 , p150 , and atg14l .15 inhibition of vps34 with 3 - methyl adenine ( 3 - ma ) or small interfering ( si ) rna to beclin - 1 is commonly used as an experimental tool to inhibit autophagy . maturation ( elongation , curvature , and closure ) is regulated via ubiquitin - like conjugation systems , which regulate lc3 ( also known as atg8 / microtubule - associated protein 1 light chain 3 [ lc3 ] - i / ii ) . the first system generates lc3 - ii , which is the cleaved and lipidated ( phosphatidylethonolamine [ pe ] ) form of lc3 that is inserted into the autophagosomal membrane and often monitored by western blot or immunocytochemistry as a marker for evaluating autophagy . the second system consists of atg12 bound to atg5 and atg16l , which recruits lc3 - ii to the developing autophagosomal membrane . lc3 binding to the membranes is important for transport and maturation of the autophagosome , which later fuses its external membrane with lysosomes to degrade its cargo . lc3 - ii also binds to the adaptor protein p62 / sequestosome - 1 ( sqstm1 ) , which is involved in trafficking proteins into the proteasome and serves to facilitate the autophagic degradation of ubiquitinated protein aggregates . late events in autophagy involve the final maturation and fusion of autophagosomes with lysosomes to form an autolysosome , a step that requires small rab gtpases and lysosome - associated membrane protein 2 ( lamp2 ) . the observation that coculture of cancer cells with fibroblasts results in reduced numbers of mitochondria in the fibroblasts and increased numbers of mitochondria in cancer cells has led to the reverse warburg effecttheory .13 this theory postulates that cancer cells induce a redox environment in the stroma , which induces mitophagy in the cancer - associated fibroblasts . the mitophagy releases glutamate from the fibroblast , which feeds the tca cycle in cancer cells to efficiently produce adenosine triphosphate ( atp ) . a by - product of the tca cycle , ammonia , released from the cancer cells continues to stimulate stromal cell mitophagy . guidelines for the use and interpretation of assays for monitoring autophagy has recently been published in autophagy by a group of autophagy experts under the leadership of dr daniel klionsky .13 although lc3 - ii expression , gfp - lc3 punctate formation , and transmission electron microscopy ( tem ) are used commonly in in vitro studies , in clinical samples , autophagy is mostly evaluated by examining lc3 - ii and beclin - 1 expression by immunohistochemistry and autophagy genes by quantitative reverse - transcription polymerase chain reaction .13 although tem is the gold standard method to monitor autophagy , it is labor intensive ; thus , evaluation of autophagy marker proteins in tissues using standard immunohistochemical techniques has become common practice . increases in lc3 - ii levels are commonly used to detect the induction of autophagy in vitro and in vivo , but they can be misinterpreted if autophagy is blocked at the level of lysosomal fusion resulting in the buildup of autophagosomal vessels . to demonstrate autophagic flux , meaning autophagy that proceeds through to lysosomal degradation without blockage , inhibitors of lysosomal acidification and function , such as bafilomycin a , chloroquine ( cq ) , and hydroxychloroquine ( hcq ) , are commonly utilized in in vitro settings .13 autophagic flux is confirmed if lc3 - ii is further increased in the presence of these inhibitors , but often , an additional molecule called p62 ( also called sqstm1 ) is evaluated to confirm this conclusion . the p62 protein binds to proteins that have been targeted for autophagosomal degradation by conjugation with single ubiquitin moieties or ubiquitin chains that are branched on lys63 , and that also , but with lower affinity , binds to proteins targeted for proteasomal degradation by conjugation with poly - ubiquitination chains that are branched on lys48 .17,18 the ubiquitinated proteins are then brought into the developing autophagosome by p62 , which binds to lc3 - ii on the inner autophagosomal membrane .17,19 upon fusion with the lysosome , p62 is degraded inside the autophagosome and , therefore , reduction of p62 is considered a biomarker of autophagy . while these manipulations provide interpretable endpoints in tissue culture studies , total levels of p62 in tissue are less meaningful due to simultaneous induction of p62 by stresses that induce autophagy and the reduction of p62 by autophagic flux .20 immunohistochemical analysis of either the a or b alleles of lc3 , namely lc3a or lc3b , respectively , have been used to probe for the level of autophagy occurring in tissue .21,22 although early studies suggested that only lc3b was involved in autophagy , more recent studies have indicated a role for lc3a in this process .23,24 while autophagy appears to engulf areas of the cytoplasm , specificity for individual molecules and organelles can be conferred by p62 and other molecules , such as bcl - 219 kda interacting protein ( bnip3 ) . in the presence of organelle damage , bnip3 located on the cytoplasmic side of the mitochondria and er membranes forms homodimers that have high affinity for lc3 - ii on the inside of autophagosomal membranes .25 an increasing body of evidence indicates that autophagy may be deregulated , suppressed , or overactivated in tumors . whether autophagy is a prosurvival ( oncogenic ) process or a prodeath ( tumor - suppressive ) pathway is still controversial .2632 however , studies indicate that this discrepancy depends on the cellular context ( ie , mutations , genetic alterations ) , the status of activated or deactivated signaling pathways , and the extent of cellular stress . in breast cancer cells , beclin - 1 protein levels are often found to be low or undetectable , but high in all normal breast epithelial cells .33 beclin - 1 is monoallelically deleted in 40 % 70 % of cases of human breast , prostate , and ovarian cancers .3336 although biallelic mutations of beclin - 1 have not yet been demonstrated in human cancer cells , the monoallelic deletion of the beclin - 1 gene has also been observed in other cancer types , and autophagy is commonly inhibited in some of the aggressive tumors including ovarian and prostate cancer .37,38 the first evidence linking dysfunctional autophagy and cancer was demonstrated by a study where the disruption of beclin - 1 ( becn1 ) increased cellular proliferation and the frequency of spontaneous malignancies ( ie , lung cancer , liver cancer , and lymphomas ) , as well as mammary hyperplasia , and accelerated the development of carcinogen - induced ( ie , hepatitis b virus ) premalignant lesions .33 furthermore , disruption of beclin - 1 resulted in reduced autophagy in mice , indicating that beclin - 1 is a haplo - insufficient tumor suppressor gene , providing evidence that autophagy is a novel mechanism of cell growth control and tumor suppression . these findings suggest that disruption of the function of beclin - 1 and other autophagy genes may contribute to the pathogenesis of human cancers . later studies have demonstrated that defective autophagy leads to a reduction in degraded cellular contents , the induction of reactive oxygen species ( ros ) , dna damage , genetic instability , and inflammation , providing conditions for transformation and carcinogenesis .35 the process of autophagy is thought to play a role in cancer initiation and progression , invasion and metastasis , and cancer stem cells and tumor dormancy . the induction of autophagy could lead to the survival of cancer cells in the highly metabolically challenged tumor microenvironment . in this environment , various stresses , including hypoxia , acidity ( low ph ) , increased metabolic products , reduced availability of nutrients due to high mitotic activity , and limited angiogenesis , activate autophagic scavenging of long - lived proteins and organelles to provide recycled components for reuse and repair . extensive degradation by autophagy could lead to the degradation and loss of critical cellular components , which would cause a form of cell death ( autophagic cell death ) , leading to the elimination of defective cells .4 a major regulator of autophagy is the mtor pathway , downstream of protein kinase b ( pi3k / akt ) , which is often found to be overactivated in various human cancers . high levels of amp - active ampk , which inhibits mtor , induces autophagy .14 it is becoming clear that many signaling pathways and critical cellular proteins , including class 3 pi3k ( vps34 ) , ampk , ras , raf , mek , erk , jnk , p53 , pten , p70s6k , eef - 2 kinase ( ef2k ) , nuclear factor - kappa b ( nf - b ) , and others , are involved in the regulation of autophagy .29 as previously stated , class 3 pi3k forms a complex with beclin - 1 and regulates nucleation .3941 both bcl - 2 and bcl - xl antiapoptotic proteins can regulate autophagy by binding and inhibiting beclin - 1 , and may calibrate autophagy to levels that are compatible with survival .42 class 1 pi3k , the pi3k / akt / mtor pathway , inhibits autophagy , whereas inhibitors of this pathway such as pten , torch1 , ampk , and rapamycin ( a pharmacological mtor inhibitor ) induce autophagy .39,43 tor has been shown to inhibit atg1 / ulk1 . rapamycin induces autophagy by restoring atg1 s kinase activity .44 the ras / raf / mek / erk pathway can also promote autophagy .45 recent findings suggest that nf - b inhibition can lead to an autophagic cell death .46,47 tumor necrosis factor - alpha ( tnf ) , insulin - like growth factor - 1 , and 7 - ketocholesterol can regulate the expression of atg genes , including lc3 and beclin - 1 . in addition , p53 tumor suppressor protein is a transcription factor that responds to cellular stress and inhibits tumor formation . recent studies also suggest that cytoplasmic p53 may inhibit autophagy , and that damage - regulated autophagy modulator ( dram ) , a p53 target , can modulate autophagy .48 constitutive ras activation induces autophagy to promote cell survival and tumor growth by altering mitochondrial function , underlying the role of ras in tumors , which have mutated k - ras ( ie , 90 % 100 % of pancreatic cancers ) .49 these observations represent critical findings regarding how signaling pathways control autophagy , and modulation of autophagy by targeting these pathways may be used as a therapeutic intervention depending on the cellular context . emerging data derived from in vitro and in vivo studies suggest that autophagy plays a critical role in maintaining cellular homeostasis and survival under stress conditions by eliminating damaged or malfunctioning organelles and toxic proteins , as well as by recycling building blocks and generating resources for atp and energy . autophagy is induced by various conditions in the harsh tumor microenvironment , including hypoxia ( hif -1-dependent and - independent ) , metabolic stress , anticancer therapeutics , and radiation therapy .5059 thus , autophagy also plays a role in tumor cell survival and progression , as well as in response to anticancer therapies , which led to the hypothesis that the modulation of autophagy can be used as a therapeutic modality or can enhance the efficacy of cancer therapeutics . currently , various clinical trials are investigating autophagy inhibitors in combination with cytotoxic chemotherapies and targeted agents in solid and hematological cancers ( table 1 ) . in vitro and in vivo studies demonstrated that the pharmacological inhibition ( by hcq , cq , or 3 - methyladenine [ 3 - ma ] ) and genetic knockdown of autophagy genes augment the efficacy of various cancer therapeutics and targeted therapies . these studies led to the hypothesis that suppression of the autophagic pathway can be used as a sensitizing strategy for anticancer therapeutics .4,12,29 these include a number of antineoplastic therapies , dna - damaging agents ( eg , doxorubicin , temozolomide , etoposide ) , radiation therapy , histone deaceltylase ( hdac ) inhibitors , suberoylanilide hydroxamic acid inhibitors , arsenic trioxide , tnf , interferon - , imatinib , rapamycin , and antiestrogen hormonal therapy ( eg , tamoxifen ) , which have been shown to induce autophagy in some human cancer cell lines .5059 in addition , recent data showed that human cancer cell lines with h - ras - or k - ras - activating mutations have high basal levels of autophagy and increased ros levels , and that suppression of autophagy inhibits cell growth , indicating that autophagy is required for tumor cell survival , and that inhibition of this process in ras - driven cancers may be an effective treatment approach .61 in cancer cells that survive after chemotherapy and / or radiation therapy , autophagy induction leads to tumor dormancy in residual cancer cells that may contribute to tumor recurrence .60 thus , targeting autophagy may prevent the dormant state and provide an effective strategy to induce better antitumor efficacy . clinical trials of autophagy inhibitors are using united states food and drug administration ( fda ) - approved antimalarial drugs such as hcq and cq , lysosmal inhibitors , which are known to inhibit autophagy ( table 1 ) . the early results of some of these clinical studies indicate that autophagy inhibition in combination with anticancer therapies seem to be safe and can augment the efficacy of various anticancer therapies .6266 one of the clinical trials evaluated whether blocking autophagy with hcq enhanced cell death induced by alkylating chemotherapy in patients with advanced solid malignancies and melanoma ( 49 patients [ 73 % ] had metastatic melanoma ) .62 these patients were given oral hcq ( 2001,200 mg daily ) in combination with temozolimide ( oral 150 mg / m daily ) for 12 weeks . this study evaluated the maximum tolerated dose ( mtd ) , safety , pharmacokinetics , and pharmacodynamics of hcq in combination with temozolomide . patients tolerated the hcq and temozolimide combination well with no dose - limiting toxicities .62 for the phase ii study , patients were given 600 mg hcq in combination with temozolomide twice daily , and some toxicities including grade 2 fatigue ( 55 % of patients ) , nausea ( 48 % ) , anorexia ( 28 % ) , constipation ( 20 % ) , and diarrhea ( 20 % ) were observed . overall , 3/22 ( 14 % ) and 6/22 ( 27 % ) patients with metastatic melanoma had partial responses and stable disease .62 two out of six patients with refractory braf wild - type melanoma experienced a near complete response and prolonged stable disease . the study also evaluated and demonstrated the induction of autophagy in patient - derived peripheral blood mononuclear cells in response to combined therapy . overall , the study indicated that the inhibition of autophagy by temozolomide may provide beneficial outcomes in melanoma patients . the inhibition of autophagy has been shown to significantly augment the anticancer efficacy of the hdac inhibitor , vorinostat .63 the combination of the autophagy inhibitor hcq ( taken orally on a daily basis from days 221 of a 21 - day cycle ) and vorinostat ( 400 mg , days 121 ) in patients with advanced solid tumors ( 27 patients ) resulted in some side effects , including grade 1 to 2 nausea , diarrhea , fatigue , weight loss , anemia , and elevated creatinine . fatigue and gastrointestinal side effects were the dose - limiting toxicities , and 600 mg hcq and 400 mg vorinostat was established as the mtd and recommended phase ii regimen . in the treatment group , one patient with renal cell carcinoma had a durable partial response and two patients with colorectal cancer had prolonged stable disease . currently , additional clinical studies are being conducted to further investigate the clinical significance of autophagy inhibition as a new strategy to enhance the efficacy of hdac inhibitors . another preclinical study in multiple myeloma demonstrated that autophagy inhibition with hcq significantly potentiates the efficacy of the proteasome inhibitor , bortezomib .75 in a phase i study ,64 a hcq and bortezomib combination was evaluated in relapsed or refractory myeloma patients ( 25 patients ; eleven ( 44 % ) refractory to prior bortezomib treatment ) . patients received hcq ( 600 mg twice daily ) with standard doses of bortezomib ,51 and of 22 patients evaluable for response , three ( 14 % ) had partial responses , three ( 14 % ) had minor responses , and ten ( 45 % ) had prolonged stable disease . the combined therapy showed therapy - associated increases in autophagy , and indicated the treatment s feasibility and potential benefits as a useful strategy for improving outcomes in myeloma patients . another phase i study65 evaluated the safety and preliminary clinical activity of the hcq and temsirolimus ( an mtor inhibitor ) combination in patients with advance solid tumors , following preclinical demonstration that hcq enhanced cell death in combination with temsirolimus ( cci - 779 ) . this dose escalation study evaluated the effects in an initial set of 27 patients , followed by a cohort of 12 patients with metastatic melanoma . patients receiving the combination of hcq and temsirolimus experienced grade 3 or 4 toxicity of anorexia ( 7 % ) , fatigue ( 7 % ) , and nausea ( 7 % ) . although the mtd was not reached for hcq , a phase ii study was conducted with a dose of 600 mg hcq ( twice daily ) in combination with 25 mg weekly of temsirolimus . patients experienced grade 1 or 2 toxicities , such as rash , stomatitis , and weight loss . overall , 14/21 ( 67 % ) of all patients and 14/19 ( 74 % ) of patients with melanoma achieved stable disease . thirteen melanoma patients treated with hcq 1,200 mg / day in combination with tem had a median progression - free survival of about 3.5 months . evaluation of peripheral blood monocytes and tumor biopsies demonstrated autophagy inhibition only in patients treated with the highest dose of hcq ( 1,200 mg daily ) . this study suggested that the combination of hcq with temsirolimus was safe and well tolerated and , more importantly , it demonstrated significant antitumor activity and stable disease in 75 % of cases of metastatic melanoma , indicating that autophagy inhibition is a feasible and promising strategy in these patients . another phase i clinical study66 conducted among newly diagnosed glioblastoma ( gb ) patients evaluated the mtd and efficacy of hcq in combination with radiation therapy and temsirolimus . patients received hcq ( oral daily doses from 200800 mg ) , radiation therapy , and temsiroliumus . the mtd for hcq was 600 mg / day in the three - regimen combination . the subsequent phase ii cohort ( number [ n ] = 76 ) was also conducted , and in this study , patients had a median survival of 15.6 months . another randomized , double - blind , placebo - controlled study67 for gb multiforme patients ( n = 30 ) evaluated the benefits of adding cq ( 150 mg / day ) beginning on postoperative day 5 for 12 months to the treatments ( chemotherapy or radiotherapy ) . cq cotherapy seemed to improve midterm survival when given in addition to conventional therapy for gb multiforme . cq cotherapy and radiation improved the response of brain metastasis with no increase in toxicity ; however , cq alone did not improve the response rate or overall survival .68 these results suggest that larger studies of cq are needed to make firm conclusions , and that the efficacy can be achieved with consistent inhibition of autophagy with cq , rather than with hcq . in a clinical trial in dogs ( n = 30 ) ,69 hcq and doxorubicin chemotherapy appeared to provide clinical benefit in non - hodgkin s lymphoma with a ~ 30 % complete remission rate . overall , in vivo preclinical studies with animals and clinical trials with patients indicate that autophagy inhibitors may enhance the efficacy of conventional therapies in various cancers , including hematological cancers . however , larger clinical trials and a comprehensive analysis of the data will eventually provide more definitive answers regarding the effects of manipulation of authophagy in patients . because mtor is a major negative regulatory axis for autophagy , several drugs that directly inhibit mtor ( rapamycin , temsirolimus , everolimus ) and its pathways have been used to induce autophagy . the inhibition of mtor mimics cellular starvation by blocking signals required for cell growth and proliferation .70 some studies demonstrate that the pi3k / akt / mtor pathway promotes melanoma tumor growth and survival .70,71 knockdown of the expression of the essential autophagy gene ( atg7 ) results in cell death , indicating that the survival of melanoma cells is autophagy - dependent . conversely , inhibition of mtor with temsirolimus induces autophagy , which can promote tumor survival , and thus these agents may potentially limit their own efficacy .71 in support of this , inhibition of autophagy with hcq synergizes with temsirolimus and leads to melanoma cell death via apoptosis .71 combination treatments with temsirolimus and hcq suppressed melanoma growth and induced cell death in both spheroid cultures and in tumor xenografts .71 these data suggest that inhibition of the mtor and autophagy pathways promotes apoptosis and could be a new therapeutic paradigm for the treatment of melanoma . for instance , knockdown of bcl - 2 expression by sirna induces autophagic cell death in breast cancer cell lines and in vivo in orthotopic xenograft models of er ( ) and er ( + ) breast cancer .72,73 also , targeting protein kinase c ( pkc ) delta and tissue transglutaminase , which inhibits autophagy in pancreatic cancer cells , can increase apoptosis .74 inhibition of nf - kb , mapk , jnk , p38 , or the induction of erk ( another regulator of autophagy ) has been used to modulate autophagy in different cancer models to alter responses to the various therapies , including chemo and radiation therapy . overall , data suggest that the multiple and different strategies for the modulation of autophagy could improve therapy in some tumors , and that they can be utilized as cotherapy . recent findings suggested that autophagy is a promising target in the context of cancer therapy . autophagy is thought to act as a prosurvival pathway that protects cancer cells from various stresses and anticancer therapy - induced stress , thus the inhibition of autophagy is considered in combination with some of the anticancer therapeutic strategies . the results of the first clinical trials conducted with autophagy inhibition along with conventional therapies indicate some clinical benefits in some cancers . overall , these studies suggest that the efficacy of standard therapies may be enhanced when combined with autophagy inhibitors , which warrant further evaluation . further understanding of the pathways regulating autophagy will likely offer new targets for the treatment of certain aggressive forms of tumors . once the results of current clinical trials are obtained and analyzed , the role of autophagywill be better understood in tumors , and it would indicate whether modulation of the autophagic process or its related pathways that protect cancer cells from undergoing autophagy may be added to conventional therapies for better efficacy . in addition to currently available autophagy inhibitors , such as us fda - approved malaria drugs ( ie , hcq , cq ) , identification of novel , highly specific , and effective compounds to negatively regulate autophagy in cancer cells are needed .\noutput:\n" }, { "from": "agent", "value": "autophagy is a highly regulated catabolic process involving lysosomal degradation of intracellular components , damaged organelles , misfolded proteins , and toxic aggregates , reducing oxidative stress and protecting cells from damage . the process is also induced in response to various conditions , including nutrient deprivation , metabolic stress , hypoxia , anticancer therapeutics , and radiation therapy to adapt cellular conditions for survival . autophagy can function as a tumor suppressor mechanism in normal cells and dysregulation of this process ( ie , monoallelic beclin - 1 deletion ) may lead to malignant transformation and carcinogenesis . in tumors , autophagy is thought to promote tumor growth and progression by helping cells to adapt and survive in metabolically - challenged and harsh tumor microenvironments ( ie , hypoxia and acidity ) . recent in vitro and in vivo studies in preclinical models suggested that modulation of autophagy can be used as a therapeutic modality to enhance the efficacy of conventional therapies , including chemo and radiation therapy . currently , more than 30 clinical trials are investigating the effects of autophagy inhibition in combination with cytotoxic chemotherapies and targeted agents in various cancers . in this review , we will discuss the role , molecular mechanism , and regulation of autophagy , while targeting this process as a novel therapeutic modality , in various cancers ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: protein phosphorylation plays an essential role in cell signaling events , and its dysregulation can have pathologic consequences . much effort has been focused on the global analysis of protein phosphorylation sites and on the enzymes that control phosphosite occupancy . while the most well - studied phosphorylated amino acid residues are serine , threonine , and tyrosine , phosphorylation of other amino acids has been observed and in some cases has been known for many decades . in particular , phosphohistidine ( phis ) was first discovered over 50 years ago in bovine liver mitochondria , and has since been detected in other eukaryotic and prokaryotic systems . in prokaryotes , phis plays important roles in two - / multicomponent signaling systems and in facilitating sugar uptake through the phosphoenolpyruvate phosphotransferase system ( pts ) . in eukaryotes , phis has been observed as a dynamic regulatory modification or a direct enzymatic participant in the context of chromatin , central carbon metabolism , and ion channel activity . nonetheless , in contrast to phosphoserine ( pser ) , phosphothreonine ( pthr ) , and phosphotyrosine ( ptyr ) , still relatively little is known about the phis modification . progress in the study of phis has been significantly hindered by the lack of available research tools due in large part to the labile nature of the phis phosphoramidate moiety . hydrolysis of the phosphoramidate in phis releases roughly twice the energy of the phosphoester of pser , pthr , or ptyr ( g of hydrolysis 12 to 13 kcal / mol vs 6.5 to 9.5 kcal / mol ) . accordingly , under acidic conditions , phis is rapidly hydrolyzed to phosphoric acid and histidine , with a half - life of 30 s in 1 m hcl . thus , the facile dephosphorylation of phis has made studies of phis biology extremely difficult . to overcome these limitations , initially , we developed a sequence - specific rabbit polyclonal antibody to phosphorylated histone h4 , employing a synthetic histone h4 peptide with the stable analogue , phosphoryltriazolyl alanine ( ptza ) . more recently , we generated a sequence - independent ( pan ) phis antibody using the small molecule , phosphoryltriazolyl ethylamine ( ptze ) , as a hapten . using this pan - phis antibody , together with mass spectrometric ( ms ) analyses , we characterized histidine phosphorylation of escherichia coli pep synthase ( ppsa ) and the changes in the levels of this modification as a function of cell state . during the course of that study , we noticed that phis peptide ions consistently displayed a set of distinct neutral losses upon fragmentation by collision - induced dissociation ( cid ) . specifically , we observed a prominent neutral loss of 98 da by cid , consistent with previous observations by others , with ancillary losses of 80 and 116 da . indeed these neutral losses often dominated the ion current in the ms / ms spectra , leading to reduced efficiency of peptide backbone fragmentation and downstream identification by database search engines . the neutral loss of phosphoric acid ( 98 da ) by cid has long been recognized as a hallmark of peptides bearing pser and pthr . loss of phosphoric acid occurs at the pser or pthr residue site by - elimination , or a charge - directed mechanism , which has been exploited to determine the site of phosphorylation on the phosphopeptide . for phis peptides , the cid - induced neutral loss of 80 da is not surprising , as this constitutes loss of hpo3 upon fragmentation of the labile phowever , the observation of 98 da as the most prominent cid - induced neutral loss for phis peptides is puzzling . it suggests that , in addition to losing hpo3 ( 80 da ) by fragmentation at the labile pn bond , an additional water moiety ( 18 da ) is somehow concomitantly lost from the peptide at a location other than the histidine residue . to resolve this enigma , here we explored the gas - phase reaction mechanism of the phis peptide 98 da neutral loss , using isotopic labeling and peptide fragmentation under cid conditions . furthermore , we have exploited the pattern of phis peptide neutral losses that we observe by cid ( dominant loss of 98 da and accompanying losses of 80 and 116 da ) to enhance our ability to detect and characterize phis peptides from proteomic samples . for this purpose , we developed a software tool , which we call triplet , to identify ms / ms spectra that exhibit the characteristic cid neutral loss triplet pattern ( 98 , 80 and 116 da ) of phis peptides . we also designed an ms - based workflow that incorporates this software tool in two ways : ( 1 ) to aid in the database search assignment of cid ms / ms spectra to phis peptides , and ( 2 ) to flag potential phis peptides for subsequent reanalysis by lcms using alternative fragmentation techniques . finally , we employed this workflow in conjunction with the first reported peptide - level enrichment of phis by immunoprecipitation using a pan - phis antibody to achieve a global ms - based phis proteomic analysis of e. coli cells . as an example of the phis neutral loss phenomenon , we show in figure 1 the cid ms / ms spectrum of a tryptic peptide containing a phis site from the protein ptsi , a known phis - containing protein in the e. coli pts pathway . the spectrum displays a dominant base peak derived from the neutral loss of 98 da from the parent ion , along with ions of lesser intensity derived from losses of 80 and 116 da . these neutral loss species dominate the ms / ms ion current , and the observed backbone fragment intensity is low to minimal . this ms / ms analysis was performed by cid in the linear ion trap ( lit ) of the orbi elite instrument used in this study ( see supporting information ) . we could also observe similar neutral loss species for the peptide by higher - energy collisional dissociation ( hcd ) on the same instrument , though their production was subject to large variation by small alterations in hcd parameter settings ( data not shown ) . therefore , we expect that these phis peptide neutral losses would be readily observed on any instrument platform , particularly those with trap - based cid , albeit to a greater or lesser extent depending on collision cell parameters . ms / ms spectrum of a phis tryptic peptide , tsphtsimar , from the endogenously phosphorylated e. coli protein ptsi . ms / ms was performed by linear ion trap cid , during which prominent species derived from the neutral loss of 98 , 80 , and 116 da dominate the ion current . major b - and y - ion backbone fragments and species derived from neutral losses off the precursor ( m ) are indicated in red , blue , and purple , respectively . inset into the spectrum is a summary sequence , flagged to indicate the detected b - and y - ions , also shown in the sequence ladder above the spectrum . to determine whether the observed pattern of neutral losses in ptsi might be a general phenomenon of all phis tryptic peptides , we conducted lcms / ms analysis using cid on a diverse array of phis peptides from multiple sources . these include : ( 1 ) a known phis protein ( dham ) overexpressed and endogenously phosphorylated in e. coli , ( 2 ) a known phis protein ( ppsa ) enzymatically histidine - phosphorylated in vitro , ( 3 ) synthetic phis peptides ( aaasphyaar , tsphysimar , tsphtsimar ) , and ( 4 ) bovine serum albumin ( bsa ) that had been chemically phosphorylated on histidine residues and then digested with trypsin . each of these phis peptides displayed the same triplet neutral loss of 98 , 80 , and 116 da as the ptsi phis peptide ( figure 2 ) . interestingly , this neutral loss pattern did not appear to depend on the position of the histidine residue in the peptide sequence and was observed both for 2 + and for 3 + phis peptide ions ( figure 2b ) . neutral losses of 98 , 80 , and 116 da in cid ms / ms spectra of diverse phis peptides . prominent neutral loss triplets ( 98 , 80 , and 116 da ) were observed in the cid ms / ms spectra for ( a ) tryptic peptides from known phis proteins ( dham , ppsa ) and chemically phosphorylated synthetic peptides , respectively , and ( b ) phis peptides derived from chemically phosphorylated bsa . the 116 , 98 , and 80 da product ion species are indicated in purple with each peak labeled with a green , red , or blue diamond , respectively . precursor peptide sequences , charge state , and m / z values are shown to the right of each spectrum . ms / ms spectra showing the full recorded m / z range for these cid experiments are shown in figure s1 . we next sought to understand the gas - phase ion chemistry involved in the cid - induced neutral loss of 98 da from phis peptides . this phenomenon involves the loss of water ( 18 da ) in addition to the loss of hpo3 ( 80 da ) expected from the breakage of the labile pthis additional loss of water clearly must occur at a location different from the phis residue itself . the sequence diversity of phis peptides showing this 98 da loss ( figure 2a and b ) implied that a sequence - independent peptide functional group was likely the source of the additional water loss . this reasoning led us to consider the carboxylate moiety of either the peptide c - terminus ( - carboxyl group ) or aspartate / glutamate residue side chains , if present , as the potential source of the water loss . by analogy to bacterial two - component signaling systems , in which the phosphoryl group from phis in a histidine kinase is transferred to an aspartate side chain , we hypothesized that a similar intramolecular phosphoryl transfer from phis to the - carboxyl group or a carboxylate side chain within the peptide , to give an acyl - phosphate , may be occurring in the gas phase cid reaction ( figure 3a and 3c ) . to test this idea , we subjected a synthetic phis ptsi peptide that is free of carboxylate side chains , tsphtsimar , to c - terminal o labeling using trypsin in the presence of o - water . cid of the doubly o - labeled species ( tsphtsimar - cooh , + 4 da ) resulted in the prominent neutral loss of 100 da ( figure 3b ) , without observable loss of 98 da . an identical trend was observed for two other o - labeled phis peptides that do not contain aspartate / glutamate residues ( mgphagaiiaggk - cooh , liphgqvatr - cooh ) , where prominent neutral loss of 100 da , and not 98 da , occurred upon cid fragmentation ( figure s2 and s3 ) . this loss of 100 da ( hpo3 + h2o ) from the c - terminally labeled peptide provides direct mechanistic evidence for participation of the - carboxyl in the gas - phase phosphoric acid loss of phis peptides . in contrast , cid ms / ms analysis of the doubly o - labeled pser - version of the ptsi peptide ( tpshtsimar - cooh , + 4 da ) resulted in detection of only 98 and 116 da ion species ( figure s4 ) . this implies that phosphoric acid loss from pser peptides does not involve water - loss from the peptide c - terminus . to explorewhether a side chain carboxylate group can also participate in cid - induced 98 da neutral losses for phis peptides , we performed a similar experiment as above , wherein aspartate / glutamate - containing phis peptides were c - terminally o - labeled labeled and subjected to cid fragmentation . we found that cid of a phosphopeptide from the sensor histidine kinase dcus ( sphefmnk - cooh ) resulted in prominent neutral loss of 98 da , and not the 100 da that we observed in peptides lacking asp / glu residues ( figure 3d and vide supra ) . an identical trend was observed for two other o - labeled phis peptides containing asp / glu residues ( ttltdltphslk , phgesqwnk ) , where prominent neutral loss of 98 da , and not 100 da , occurred upon cid fragmentation ( figure s5 and s6 ) . this prominent loss of 98 da ( hpo3 + h2o ) in the presence of an o - labeled labeled c - terminus indicates that a side chain carboxylate group can take priority over the - carboxyl group in the gas - phase phosphoric acid loss of phis peptides . in considering the mechanism of phosphoric acid loss from phis peptide ions , we wondered whether the acyl phosphate moiety generated upon phosphoryl transfer might undergo a - elimination process to afford a ketene species ( figure s7 ) . to probe this hypothesis , we substituted the c - terminal - hydrogen atom of a phis peptide with deuterium . elimination in this case would lead to a loss of 99 da ( h2dpo4 ) during cid . note that it has been previously shown that - deuteration of phosphoserine leads to a loss of 99 da through - elimination during cid , albeit at low levels presumably due to the isotope effect . accordingly , we prepared a synthetic phis peptide with a c - terminal deuterated alanine , tsphtsima ( d4 - a ) , and then subjected it to cid . the cid ms / ms spectrum of this peptide revealed the formation of only the 98 da neutral loss species with no evidence for a loss of 99 da ( figure s7 ) . this argues against a - elimination process in this context , although we can not rule out suppression of this pathway due to a strong isotope effect . nonetheless , there appears to be an alternate pathway for phosphoric acid loss from the c - terminal acyl phosphate intermediate , which we speculate involves nucleophilic attack on the acyl phosphate by a side chain or backbone group , leading to loss of phosphoric acid and generation of the corresponding cyclic peptide fragment species ( figure s7 ) . neutral loss of 98 da from phis peptides occurs predominantly through the c - terminal or a side chain carboxylate . ( a ) proposed model showing loss of phosphoric acid from phis peptides via the c - terminal carboxylate during cid . ( b ) cid ms / ms of the [ m + 2h ] phis peptide tsphtsimar - cooh ion showing the prominent neutral loss of 100 da . inset into the spectrum is a high resolution ms spectrum of the precursor species at m / z 544.23763 ( left panel ) and a high resolution ms / ms spectrum showing species corresponding to the primary loss of 100 da and less prominent losses of 80 , 118 , and 116 da ( right panel ) . ( c ) proposed model showing loss of phosphoric acid from phis peptides via a side chain carboxylate during cid . ( d ) cid ms / ms of the [ m + 2h ] phis peptide sphefmnk - cooh ion showing the prominent neutral loss of 98 da . inset into the spectrum is a high resolution ms spectrum of the precursor species at m / z 488.69006 ( left panel ) and a high resolution ms / ms spectrum showing species corresponding to the primary loss of 98 da and less prominent losses of 80 , 118 , and 116 da ( right panel ) . we next investigated whether this triplet pattern could be used to distinguish phis peptides from other common phosphopeptide types by ms / ms . serine , threonine , and tyrosine phosphopeptide ions are well - known to undergo facile neutral loss upon cid - type fragmentation , resulting in major neutral loss species of 116 and 98 da for phosphoserine / threonine , and 80 da for phosphotyrosine . to ascertain whether the observed triplet of neutral losses could act as a distinguishing feature of phis peptides , we prepared an initial series of isobaric phosphopeptides based on the sequence tshysimar , where the phosphorylation site was either on ser2 , his3 , or tyr4 ( tpshysimar , tsphysimar , tshpysimar ) . all three phosphopeptides displayed neutral losses upon cid ; however , the pattern of these losses was distinctly different ( figure 4 ) . while the phis variant showed the expected triplet losses of 98 , 80 , and 116 da , the pser version displayed only loss of 98 and 116 da , and the ptyr variant displayed only a minor loss species at 80 da . we confirmed these observations through an additional set of lc ms experiments using model phosphopeptides aaapshyaar , aaasphyaar , and aaashpyaar , which showed neutral loss patterns identical to their tshysimar counterparts ( figure s8 ) . these two examples suggest that the neutral loss triplet ( 98 , 80 da , and 116 ) and their relative abundance pattern may serve as a distinguishing feature of phis peptides , at least under the conventional lit cid conditions employed in this study . cid fragmentation of phis , ptyr , and pser peptides display distinct neutral loss patterns . cid ms / ms spectra of a family of phosphopeptides containing the same underlying peptide sequence , tshysimar . the phis peptide tsphysimar exhibited the distinct cid - induced neutral loss pattern of 98 , 80 and 116 da . this triplet neutral loss pattern was not observed for the isobaric pser ( tpshysimar ) and ptyr ( tshpysimar ) peptides . b - and y - ions and neutral loss species are indicated in the spectra , as in figure 1 . precursor peptide sequences are as labeled . to further explore whether this triplet neutral loss pattern is a selective feature of phis peptides , we prepared a 45 - member phosphopeptide library derived from nine previously described phis sites in e. coli . in this library , nine tryptic peptide sequences were synthesized to contain phis at the endogenous phis site . alternatively , the phis site was replaced with his , pser , pthr , or ptyr , resulting in 45 peptides in total ( figure 5a ) . cid ms / ms analysis of the phis peptides from this library resulted in the identical triplet neutral loss pattern as reported for other phis peptides above ( figure s9s11 ) . to investigate whether the cid - induced triplet neutral loss pattern could be detected for other members of the peptide library , and to evaluate their comparative prevalence , we calculated the percentage of triplet neutral loss - positive ms / ms spectra with respect to the total number of ms / ms spectra for each phosphopeptide type . to tally the triplet neutral loss - positive ms / ms spectra , we developed a software tool in house , which we call triplet ( tool for retrieving ids of phosphopeptides by their neutral loss fingerprints ) , in which ms / ms spectra from lc ms experiments can be searched and filtered for those that possess the phis neutral loss fingerprint ( figure s12 ) . this tool builds on the concept of previous software for detection of neutral loss species ; however , we have added the capability to filter for multiple co - occurring neutral losses with independent abundance thresholds , so as to capture unique patterns of losses that may be characteristic of particular classes of peptides . this software is instrument vendor neutral , as the input for it consists of processed ms / ms peaklist files from lc ms runs . additionally , triplet possesses an ms / ms spectrum viewer , so that candidate spectra that meet the pattern filtering criteria may be visually inspected ( see supporting information for more details on triplet ) . using the triplet software filter , we found that , as expected , phis peptides displayed a much higher percentage of triplet neutral loss production than for pser , pthr , and ptyr peptides ( figure 5b ) . notably , the latter group had low , but nonzero levels of triplet neutral loss formation , although precise levels were subject to slight variation based on chosen cutoff threshold parameters in triplet for m / z error tolerances and 116 / 80 da peak intensities ( figure s13 ) . thus , while the triplet neutral losses can be detected at low frequencies in the ms / ms spectra of pser , pthr , ptyr peptides , their pattern can be largely distinguished from the phis peptide neutral loss pattern under the appropriate , user - defined settings , demonstrating the potential of triplet as a bioinformatic filter for phis peptide mass spectra . this discrimination of phis peptides was not possible when we employed only the 98 neutral loss as an ms / ms spectra filtering criterion ( figure 5b ) . we next investigated whether the triplet neutral loss pattern could be used in combination with other phis peptide enrichment methods to further enhance the specificity of global phis proteomic analysis . given the power of phosphopeptide enrichment in proteomic analyses and the impact that it has had on the field , we focused our efforts on developing a peptide - based phis immunoprecipitation methodology for integration into a workflow for phis proteomic analyses . we used the previously described ptze hapten to prepare a second - generation pan - phis antibody capable of specifically immunoprecipitating phis - containing peptides , a property that the previous antibody lacked . the specificity of this antibody for the phis epitope was analyzed by dot blot and was found to be highly selective for phis peptides over pser , pthr , and ptyr species ( figure 5c and figure s14 ) . the antibody was also shown to be effective at immunoprecipitation , and its sensitivity threshold for recovering authentic phis signal from a complex e. coli lysate peptide matrix was measured through spike - in titration experiments to be 1 pmol phis peptide ( figure s15 ) . moreover , we demonstrated that the use of phis peptide immunoprecipitation in combination with the triplet software , led to significant enrichment of phis peptides from the phosphopeptide library ( figure 5d ) . this suggests that the phis antibody and triplet software can be used in tandem to improve the specificity of detection of phis peptides from a complex mixture such as a lysate . it is important to note that while cid fragmentation in our workflow provides a means to generate the phis triplet neutral loss pattern , it does not alone provide optimal phis peptide ms / ms spectra for identification purposes , due to reduced levels of peptide backbone fragmentation . to overcome this , we incorporated follow - up ms / ms analyses by alternate fragmentation methods for improved peptide ion identification ( see next section ) and potentially to aide in phosphosite localization ( see figure s16 for an exploration of the effect of different fragmentation methodologies on phosphosite localization scoring ) . specificity of a second - generation phis antibody and its use for phis peptide immunoprecipitation in combination with triplet neutral loss filtering for highly selective discrimination of phis from pser / pthr / ptyr peptide analogues . ( a ) phosphopeptide library sequences , consisting of tryptic peptides containing the known phis sites of 9 e. coli proteins . the library was diversified by replacing the phis site with pser , pthr , ptyr , or his residues . ( b ) library peptides were analyzed by cid ms / ms , and the percentage of individual ms / ms spectra displaying the 98 , 80 , and 116 da neutral loss pattern ( black bars ) or the 98 neutral loss ( gray bars ) was calculated for each phosphotype . note that these neutral losses were not observed for any of the nonphosphorylated peptides ( not shown ) . ( c ) dot blot analysis of the library of phosphopeptides in ( a ) , pooled by phosphotype , using a newly developed - phis antibody and an - ptyr antibody ( 4g10 , millipore ) ( see figure s14 for loading control ) . ( d ) library peptides from ( a ) were analyzed by cid ms / ms before and after immunoprecipitation with the - phis antibody . tallies of ms / ms spectra displaying the triplet neutral loss pattern were generated for each of the library constituents by the triplet software , and the results were grouped according to phis , pser , pthr , or ptyr phosphotype . we envisioned the triplet analysis could play an important role in global phis proteomic analysis in two ways ; ( i ) to validate cid peptide spectral matches to phis peptides from standard database searches , ( ii ) to screen cid lc ms / ms runs for spectra indicative of potential phis peptides so as to place these peptides onto inclusion lists ( parent ion lists ) for subsequent targeted reanalysis by lcms / ms using alternative fragmentation methodologies , such as multistage activation ( msa ) or electron transfer dissociation ( etd ) . these fragmentation methods , despite their additional costs in terms of sensitivity and instrument duty - cycle time , can improve ms / ms analysis of phosphopeptides by generating more informative backbone fragments for peptide identification . importantly , this follow - up targeted reanalysis of potential phis peptides allows for the dedication of valuable instrument resources to phis peptides which are likely to be sparse , present at low levels , or poorly matched in the database search of results from the first round of analysis . to demonstrate the feasibility of a phis proteomic workflow incorporating triplet to inform and direct phis peptide ms / ms analyses , we prepared a test set of diverse phis peptides from bsa that had been chemically phosphorylated on multiple histidine residues ( phis - bsa ) using potassium phosphoramidate . this phis - bsa sample was subjected to proteomic sample workup consisting of thiol reduction and alkylation , and trypsinolysis using a standard protocol slightly modified for phis compatibility ( see supporting information ) . ms / ms with cid , and the ms / ms spectra peaklist files were screened using the triplet software for spectra that contained the characteristic phis neutral loss fingerprint . these triplet - positive spectra were then matched to the results of a mascot search against a bsa protein database using the same peaklist files . additionally , the list of precursor species associated with these triplet - positive spectra was then used as a parent ion list for a second , targeted lcms / ms run using msa , and this data was also subjected to a mascot search against the bsa database . the complete set of phis peptides identified through this process is listed in table 1 , with their corresponding initial cid - derived match and subsequent msa - derived match mascot ion scores . importantly , we observed that the follow - up msa analysis on triplet - positive species markedly increased the mascot score for nearly all of the identified phis peptides . indeed , some of the peptides for which no mascot match was initially possible ( above an ion score threshold of 15 ) based on the cid data became identifiable with substantial confidence through targeted reanalysis by msa . phosphosites are indicated in red in the peptide sequences , and mascot ion scores are highlighted according to the scale inset into the table . finally , as a demonstration of the utility of our analytical methodology , we applied it to the context of a global e. coli phis phosphoproteomics experiment . we undertook phis proteomic analysis of lysate from nitrogen - limited , glycerol - or mannitol - fed e. coli , since those conditions led to the detection of multiple endogenous phis - positive bands by western blotting using the pan - phis antibody ( figure s17 ) . for this analysis , we subjected the lysate samples to thiol reduction and alkylation , trypsinolysis , and desalting with slight modifications to standard methods to enhance phis compatibility ( see supporting information ) . the resultant phis containing peptides were immunoprecipitated from the lysates using the pan -- phis antibody and then analyzed by lcms / ms peak list files were screened using triplet for those containing the phis neutral loss fingerprint . these same cid peak lists were also searched using mascot against the swissprot e. coli protein database . phis peptides matched by mascot and also found by triplet to contain the phis neutral loss fingerprint are listed in table 2 , together with their mascot scores derived from the cid data . ms / ms , using a parent ion list to target triplet - positive peptides for fragmentation by msa . these msa - derived spectra were then searched against the swissprot e. coli database using mascot . phis match results from this triplet - targeted msa analysis are also shown in table 2 . we were able to characterize 21 distinct endogenous phis peptides ( plus their derivatives , such as alternative charge states , oxidation products , etc . ) representing a total of 15 phis sites from 14 e. coli proteins ( table 2 ) . as a negative control for this proteomic experiment , we performed immunoprecipitation without antibody ( mock - ip ) on glycerol - fed e. coli and conducted an identical set of lcms / ms and triplet analyses . we were not able to match any phis peptides from this mock - ip sample using our approach ( figure s18 ) . similar analyses of an acid - treated phis ip sample also resulted in no matches to phis peptides ( figure s18 ) . given the possibility that some phis peptides might fragment productively by cid without prominent triplet neutral loss formation , we examined our cid - derived mascot database search results for any high scoring matches to phis peptides that did not display the characteristic phis neutral loss triplet . we failed to find a match to any additional such peptide that had not been already identified by our triplet neutral loss screening approach . thus , all of the phis peptides found in our samples displayed triplet neutral loss formation by cid , which led to positive identification through our strategy of targeted reanalysis . the peptide sequences for each identified protein are listed with the phis sites shown in red . identified from glycerol - grown lysates . identified from mannitol - grown lysates . displayedare peptide sequences with identified phosphosites indicated in red and mascot ion scores from cid ms / ms matches compared to those from follow - up targeted msa reanalysis . the table is colored to indicate whether the identified phis site had been previously experimentally validated ( blue ) , inferred by similarity ( green ) , or novel ( purple ) . of the 15 phis sites detected , 8 had been experimentally verified in the past , while five of the sites , those that we characterized on the proteins ptsp , ptsn , nage , manx , and frub had only been inferred as phis sites by analogy to other known phis proteins . eight of the 15 phis protein sites were identified in both e. coli growth conditions we examined . notably , we detected phis modification of mtla , a phosphotransferase protein involved in mannitol uptake , only in the context of mannitol - fed cells , suggesting that the mannitol growth conditions stimulated involvement of phis modification of mtla and phosphotransfer to internalized mannitol . the two novel phis peptides we identified here , belonging to the proteins , aldehyde - alcohol dehydrogenase ( adhe ) and pyruvate kinase ( pykf ) , were only detected in the mannitol - fed e. coli growth conditions . to further validate our novel phis peptide assignments in the adhe and pykf proteins , we compared the cid ms / ms spectra of our endogenously derived peptides to those of synthetic peptide standards . we found that the synthetic adhe phis peptide ( fatphggyllqgk ) accurately matched the cid fragmentation pattern observed for the endogenous adhe phis peptide from the proteomic sample , particularly in the triplet neutral loss region ( figure 6a ) . to exclude the possibility that the phosphorylation site may be on the neighboring threonine residue , which is the only other potential phosphorylation site in this peptide , we also analyzed a synthetic adhe pthr peptide ( fapthggyllqgk ) and found it to be a poor match to the proteomic adhe peptide , with a notable absence of the 80 neutral loss peak ( figure s19 ) . ms / ms and , as expected for a phis peptide , observed complete disappearance of the ahde phis peptide peak ( figure 6b ) . this acid - treatment was sufficient to cause complete loss of detection of a known phis peptide ( ptsp ) , but not that of non - phis peptides that were also present in the immunoprecipitation sample ( figure s20 ) . the acid - sensitivity of the putative adhe phis peptide , together with its fragmentation pattern match to that of the synthetic peptide standard , support the conclusion that this peptide is an authentic novel phis modification of the adhe protein . we observed a similar trend for the pykf phis peptide : the endogenous peptide derived from the proteomic sample was acid - sensitive and also displayed a fragmentation pattern that matched well to that of the synthetic pykf phis peptide standard ( figures 6c and 6d ) , but not to an isomeric synthetic standard peptide in which the phosphorylation site was moved to the sole serine in the sequence ( figure s21 ) . interestingly , while the phis chemical phosphorylation conditions used to phosphorylate the synthetic pykf peptide , which contains 2 histidines , should result in phosphorylation of either or both histidine residues ( lnfsphgdyaehgqr or lnfshgdyaephgqr ) , we found the monophosphorylated form ( s ) of this synthetic peptide had phis localization almost exclusively at the his5 residue , as assessed by phosphors with 100 % likelihood . thus , his5 may be a preferred site of chemical phosphorylation for this peptide , or alternatively , phosphors may have difficulty in distinguishing between the fragmentation pattern differences caused by modification at h5 and h11 residues . phosphors showed a similarly high phis localization confidence to the h5 residue for the endogenous pykf peptide . consequently , while it is most likely that the authentic phis modification of the endogenous pykf protein resides on the h5 residue of the peptide , as specified by phosphors , we can not formally exclude the possibility that either of the histidines may contain the phosphorylation mark . validation of adhe and pykf phis ms / ms peptide assignments . ( a ) cid ms / ms spectrum of the endogenous e. coli adhe phis peptide annotated withinset into the spectrum is an enlargement of the neutral loss pattern for the endogenous vs the synthetic phis peptide . ( b ) extracted ion chromatogram of the [ m + 2h ] adhe phis peptide ion from e. coli lysate ( top ) and from the acid - treated lysate ( bottom , red trace ) . inset into the spectrum is a high resolution ms spectrum of the precursor species at m / z 686.32679 . ( c ) cid ms / ms spectrum of the endogenous e. coli pykf phis peptide , with the prominent matched b - and y - type ions as indicated . inset into the spectrum is an enlargement of the neutral loss pattern for the endogenous vs the synthetic phis peptide . ( d ) extracted ion chromatogram of the [ m + 3h ] pykf phis peptide ion from e. coli lysate ( top ) and from the acid - treated lysate ( bottom , red trace ) . inset into the spectrum is a high resolution ms spectrum of the precursor species at m / z 570.90574 . in this paper we analyzed the behavior of phis peptide fragmentation by cid and then used this information to develop a strategy to enhance ms / ms analysis and assignment of phis peptides . like other phosphopeptides , we observed that phis - containing peptides readily undergo neutral loss upon cid fragmentation . under our fragmentation conditions ( particularly those of lit cid ) , phis peptides consistently displayed neutral losses of 98 , 80 , and 116 da , with the 98 da loss being the most dominant . we find that pser , pthr , and ptyr peptides can also display a triplet neutral loss pattern under our cid conditions , albeit to a significantly lesser extent . however , their patterns can be distinguished from the phis neutral loss pattern using our newly developed , open source triplet software , by adjusting thresholds for the intensities and m / z error tolerances of the 116 and 80 da peaks . given that ms instrument type and / or instrument settings will likely factor into the cid - induced triplet neutral loss pattern of phis peptides , user optimization of the triplet software parameters may be required to effectively screen for phis peptide ms / ms spectra . in addition , we found that filtering ms / ms spectra only for the 98 da neutral loss ( figure 5b ) is insufficient to uniquely distinguish phis peptides . relying only on a doublet neutral loss pattern ( 98 and 80 ) for filtering of phis peptides results in more false ms / ms spectral matches compared to triplet neutral loss filtering ( data not shown ) , presumably due to the extra specificity afforded by the additional product ion detection criterion . we explored the mechanisms behind the formation of the 98 , 80 , and 116 da neutral loss species by cid for phis peptides . the loss of 80 da is explained by the loss of hpo3 via fragmentation of the labile pformation of the 98 and 116 da neutral loss species are more perplexing and imply that , in addition to hpo3 , one or two water molecules ( 18 da or 36 da ) from the peptide are involved in the neutral loss process . there are three possible sources for loss of water from a peptide : ( 1 ) loss from the side chain of a ser , thr , tyr , asp , or glu residue , ( 2 ) loss from the peptide c - terminal carboxylate , or ( 3 ) loss from the peptide backbone itself . using c - terminally labeled o - labeled peptides free of acidic residues with carboxylate side chains ( tsphtsimar - cooh , mgphagaiiaggk - cooh , liphgqvatr - cooh ) we were able to show directly that the most prominent neutral loss occurred in the form of o - labeled phosphoric acid mediated through loss of hpo3 plus a heavy water molecule coming from the peptide - carboxylate , rather than a light water moiety from unlabeled amino acid side chains or the peptide backbone ( figures 3b , s2 , and s3 ) . however , when an acid residue side chain carboxylate moiety was present in the context of a c - terminal o - labeled peptide sequence , we observed that the phis peptide lost 98 da most prominently , as we show for sphefmnk - cooh , ttltdltphslk - cooh , and phgesqwnk - cooh peptides ( figures 3d , s5 , and s6 ) . these observations are consistent with recent work from schmidt and co - workers , in which they provide some evidence for water loss at the c - terminus of a phis peptide by conducting ms3 analysis of the 98 da neutral loss species . the 116 da neutral loss species presumably originates from the loss of phosphoric acid ( 98 da ) and an additional water molecule ( 18 da ) . interestingly , tsphtsimar - cooh , mgphagaiiaggk - cooh , and sphefmnk - cooh peptides gave rise to both 118 and 116 da neutral species ( figure 3b , 3d , and s2 ) . loss of 118 can be accounted for by losing a combination of h3poo3 ( 100 da ) and light water , in the case of tsphtsimar - cooh and mgphagaiiaggk - cooh , or in the case of sphefmnk - cooh losing a combination of h3poo3 ( 98 da ) and heavy water ( 20 da ) or hpo3 ( 80 ) and both a heavy and light water . the 116 da neutral loss species is harder to account for in tsphtsimar - cooh and mgphagaiiaggk - cooh peptides because it can not be from the combination of heavy phosphoric acid loss ( 100 da in this case ) and water . conceivably , the 116 da neutral loss could result from the combined loss of hpo3 and two light water molecules . interestingly , the fact that a peptide free of hydroxyl bearing side chains ( mgphagaiiaggk - cooh ) can undergo cid - induced loss of 116 da and 118 da provides support for the idea that that additional water losses can come from backbone oxygens . under our lit cid conditions we did not observe intermolecular transfer of the phosphoryl group to a peptide of the same or different sequence leading to a doubly phosphorylated species . however , recently gonzalez - sanchez et al . detected low levels of cid - induced intermolecular phosphate transfer within a phis peptide homodimer , indicatingwe also found that the position of the his residue in the peptide does not appear to drastically influence the production of the neutral loss pattern ( figure 2b ) . since all tryptic peptides possess a free - carboxylate , we expect that the neutral loss of phosphoric acid by cid is a generalized , sequence - independent phenomenon , at least for peptides of 2 + and 3 + charge states . as noted in figure 3d , an amino acid side chain carboxylate is also capable of promoting neutral loss of phosphoric acid from phis peptides . in the peptides we tested , this fragmentation pathway was favored over the - carboxylate - mediated phosphoric acid neutral loss . this is supported by previous work where cid fragmentation of a model phis peptide resulted in dehydration of a neighboring aspartate side chain , presumably as a result of phosphoryl transfer from phis , followed by loss of phosphoric acid . on the basis of the above studies , we developed a phis proteomics workflow which exploits the unique cid fragmentation signature of phis - containing peptides ( figure s22 ) . this methodology also caters to the labile chemical nature of the phis modification itself . thus , both high temperature and acidic conditions are minimized or avoided whenever possible . critically , the workflow also includes a tryptic peptide enrichment step using a second generation pan - phis antibody compatible with immunoprecipitation ; this type of affinity capture is a common feature of phosphoproteomics , but until now has not been possible for phis . the enriched sample is analyzed by lcms / ms and the ms / ms peak list files are then subjected to a database search to match potential phis peptides and also subjected to additional screening for the phis peptide neutral loss fingerprint , using the software triplet . follow - up targeted lc ms / ms analysis is then employed with alternative fragmentation ( e.g. , msa , hcd or etd ) , using a parent ion list containing the triplet - positive precursor species . final database search of the targeted , alternative fragmentation data provides additional high confidence matches to phis peptides . it is important to note that the triplet algorithm could be built into the ms instrument control software , such that on - the - fly decision making could be carried out . since current instrument control software is incapable of screening for multiple concurrent neutral losses , it was necessary for us to write our own software tool ( triplet ) for this screen off - line , and then to conduct a reanalysis of samples with a second round of lc ms / ms . we tested our phis proteomic approach on nitrogen - limited , glycerol - or mannitol - fed e. coli . the e. coli proteome contains 63 proteins that are either reported to have phis sites , or that have been inferred to contain the modification based on homology to other known sites ( table s1 ) . of these proteins ,27 are involved in the pts pathway , and it was expected that our growth conditions would lead to buildup of phis on these proteins due to the absence of pts - dependent sugars as the carbon source . indeed , we were able to identify phis on 10 unique pts proteins , over a third of the proteins in the pathway . this is the first direct experimental evidence for phis modification for five of these proteins , namely , ptsp , ptsn , nage , manx , and frub . given that phis is a common enzymatic intermediate in central metabolism in both prokaryotic and eukaryotic cells , our results raise the intriguing possibility that phis proteomics will provide useful information on the metabolic state of a cell , perhaps even aiding the identification of metabolic changes associated with disease . indeed , e. coli grown on different carbon sources display different phis protein band signatures as detected by western blotting with the phis antibody ( figure s23 ) . notably , we did not detect any phis peptides derived from histidine kinases in this study . this might seem surprising given the prevalence of multicomponent signaling systems in bacteria ( 29 histidine kinases in e. coli , table s1 ) . conceivably , the sequence context of phis in tryptic peptides derived from kinases might prevent recognition by our antibody . however , we have previously shown that our pan - phis antibody can recognize phosphorylated histidine kinases in vitro , and we find that our phis antibody can immunoprecipitate as little as 1 pmol of a tryptic phis peptide derived from the histidine kinase , phor , arguing against this possibility . a more likely explanation , therefore , is that levels of these proteins , and / or their phosphosite occupancy , are extremely low in general or under our particular e. coli growth conditions . for example , the copy number of histidine kinase envz is reported to be about 60100 molecules per cell in e. coli , depending on growth conditions . meanwhile , baseline phosphorylation levels for e. coli histidine kinases have been estimated to range from below 0.01 % up to 5 % , indicating that very few molecules of phosphorylated histidine kinases may exist per cell , resulting in phis peptide levels below the 1 pmol detection limit of our antibody . in contrast , pts proteins are much more abundant in e. coli ( 1000020000 molecules per cell ) and may have a higher degree of phosphorylation occupancy depending on the metabolic state . hence , it is likely to be more challenging to detect phosphorylated histidine kinases than phosphorylated metabolic proteins , at least in e. coli . interestingly , in our immunoprecipitation of phis peptides from e. coli lysate , we detected two novel phis sites on enzymes of central carbon metabolism : on adhe at his268 and on pykf at his36 . we were able to show that the ms / ms spectra of both endogenous phis peptides matched those of synthetic phis peptide standards and that the phis peptide signal for both peptides was sensitive to acid treatment . while it is not immediately clear why these two proteins would be histidine phosphorylated under mannitol - growth conditions , we note that the novel phis sites on both adhe and pykf are located in regions of the proteins that have been previously implicated in their function . additional studies will be required to explore the idea that histidine phosphorylation of these proteins plays a role in regulating their activity , perhaps under specific growth conditions . in conclusion , this study has provided a number of contributions to the field of phis proteomics . we have investigated the particular cid fragmentation behavior of phis peptides and exploited their distinguishing neutral loss signature to enhance phis peptide identification by ms . to achieve this , we have created a software tool , triplet , which can be used to screen ms / ms spectra for characteristic neutral losses . in addition , we have demonstrated the first use of a pan - phis antibody in a peptide - level phis immunoprecipitation as an enrichment step prior to lc ms analysis . our streamlined workflow , which combines all of these strategies , allowed us to characterize endogenous phis sites , including two novel sites , in e. coli . we envision that this workflow can be usefully applied to study the phis proteome of any organism . further phis proteomic studies , including the investigation of phis proteins from mammalian cells , are currently underway .\noutput:\n" }, { "from": "agent", "value": "protein histidine phosphorylation is increasingly recognized as a critical posttranslational modification ( ptm ) in central metabolism and cell signaling . still , the detection of phosphohistidine ( phis ) in the proteome has remained difficult due to the scarcity of tools to enrich and identify this labile ptm . to address this , we report the first global proteomic analysis of phis proteins , combining selective immunoenrichment of phis peptides and a bioinformatic strategy based on mechanistic insight into phis peptide gas - phase fragmentation during lc ms / ms . we show that collision - induced dissociation ( cid ) of phis peptides produces prominent characteristic neutral losses of 98 , 80 , and 116 da . using isotopic labeling studies , we also demonstrate that the 98 da neutral loss occurs via gas - phase phosphoryl transfer from phis to the peptide c - terminal - carboxylate or to glu / asp side chain residues if present . to exploit this property , we developed a software tool that screens lc ms / ms spectra for potential matches to phis - containing peptides based on their neutral loss pattern . this tool was integrated into a proteomics workflow for the identification of endogenous phis - containing proteins in cellular lysates . as an illustration of this strategy , we analyzed phis peptides from glycerol - fed and mannitol - fed escherichia coli cells . we identified known and a number of previously speculative phis sites inferred by homology , predominantly in the phosphoenolpyruvate : sugar transferase system ( pts ) . furthermore , we identified two new sites of histidine phosphorylation on aldehyde - alcohol dehydrogenase ( adhe ) and pyruvate kinase ( pykf ) enzymes , previously not known to bear this modification . this study lays the groundwork for future phis proteomics studies in bacteria and other organisms ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: it has been more than 51 years since the first successful human kidney transplantation at the peter ben brigham hospital in boston ( merrill et al 1956 ) . it is the outcome of the natural response of the immune system to a foreign substance , or antigen . this complex process is mainly t - lymphocyte mediated , although it involves serial interactions between foreign antigens , t lymphocytes , macrophages , cytokines ( also known as lymphokines or interleukins ) , adhesion molecules ( ie , co - stimulatory molecules ) , and membrane proteins that enhance binding of t lymphocytes and b lymphocytes ( halloran and miller 1996 ; valente and alexander 1998 ) . the goal of immunosuppressive therapy is to prevent and treat organ rejection as well as prolong graft and patient survival . with the development of immunosuppressive agents ( table 1 ) , kidney transplantation has become one of the most important renal replacement therapies nowadays ( morris 2004 ) . during the azathioprine era from the 1960s to the early 1980s , 1 - year cadaveric graft survival rate was around 60 % ( morris 2004 ; sayegh and carpenter 2004 ) . with the introduction in 1978 of cyclosporine , a calcineurin inhibitor ( cni ) , the 1 - year graft survival rate increased to more than 80 % ( sayegh and carpenter 2004 ) . in the 1990s , the availability of several other immunosuppressive agents with different mechanisms of action ( tacrolimus , mycophenolate mofetil , and sirolimus ) made combination immunosuppressive therapy a general modality in organ transplantation . however , due to the potency of these agents and inter - and intra - individual variability in pharmacokinetics , dose individualization is required to maintain adequate immunosuppression while minimizing adverse reactions . pharmaceutical companies have been formulating insoluble drugs into commercially available products and minimizing the problem of large intra - and inter - individual variability in pharmacokinetic profiles . a limited number of methods such as generation of ionized drugs , co - solvents , surfactants , soft - gel technology , micronization , and nanotechnology have been utilized in formulating water - insoluble drugs . in addition , other particular drug carriers , such as emulsion , liposome , and polymeric micelle , are considered as alternative methods to deliver water insoluble drugs ( yokoyama 2005 ) . for example , cyclosporine has been emulsified by bile salts to form micelles and further modified into microemulsion from the olive oil - based solution to enhance bioavailability ( thomas et al 2005 ) . the liposomal formulation of tacrolimus also has been demonstrated as an effective strategy to increase efficacy and decrease toxicity ( mcalister et al 1999 ; alemdar et al 2004 ) . the formulation of amphiphilic block co - polymer micelles has been used to prepare injectable formulations of the highly lipophilic sirolimus ( ashok et al 2004 ; forrest et al 2006 ) . after the introduction of tacrolimus ( a cni with a potency 32100 times that of cyclosporine ) , less variation in bioavailability and not requiring bile salts for oral absorption made tacrolimus a better choice than cyclosporine ( sandimmune , novartis ) in liver transplantation ( scott et al 2003 ) . this forced a reformulation of cyclosporine to retain its market share . the new formulation of cyclosporine ( neoral , novartis ) is a microemulsion utilizing 9.5 % w / v alcohol , corn oil - mono - di - triglyceride , polyoxyl 40 hydrogenated castor oil , and polyethylene glycol as vehicle ( pdr 2006 ) . this is an application of microtechnology to drug delivery , a breakthrough in the 1990s . in the 2000s , a more advanced technology called nanotechnologywas applied to medicine , which led to the emergence of nanomedicine ( weber 1999 ) . more broadly , it is the process of applying molecular tools and molecular knowledge of the human body in diagnosis , treatment , and prophylaxis of disease , as well as preserving and improving human health ( freitas 2005 ) . many nanomedicine technologies have been developed and are close to fruition . among them , nanostructured materials such as fullerenes have been used in pharmaceuticals ( freitas 2005 ) . wyeth - ayerst , philadelphia , pa , usa ) tablet is another example of the successful application of nanotechnology in pharmaceuticals to overcome the problems of formulation , poor bioavailability , and erratic absorption . sirolimus is a triene marcolide antibiotic isolated from streptomyces hygroscopicus ( vezina et al 1975 ; sehgal 1998 ) . it is challenging to formulate sirolimus into either an intravenous or oral dosage form due to its water insolubility and a logp ( log of the octanol - water partition coefficient , a measure of a drug s lipophilicity ) of greater than 5 . the solubility of sirolimus is 2.6 g / ml , which is far below the target solution concentration of 1 mg / ml ( simamora et al 2001 ) . it is impossible to enhance the solubility of sirolimus by the generation of a salt form because of the lack of an ionizable group of sirolimus in the ph range of 110 ( simamora et al 2001 ) . the solubility of sirolimus in a single organic solvent , such as ethanol , - butyrolactone , dimethyl isosobide , and glycerol formal ( a mixture of 5 - hydroxy -1,3-dioxane and 4 - hydroxymethyl -1,3-dioxolane in a ratio of 60:40 ) , increases thousands - fold to greater than 90 mg / ml . although a thousand - fold decrease in the solubility of sirolimus was observed in single cosolventwater mixtures , the solubility could be increased to more than 10 mg / ml when it was prepared in multiple cosolvent and hydrotrope mixtures , such as 10 % ethanol , 40 % propylene glycol , 5 % benzyl alcohol , and 3 % 5 % benzoate buffer ( simamora et al 2001 ) . in 1999 , the first commercially available product of sirolimus was thus an oral solution with a concentration of 1 mg / ml in phosal 50 pg ( a dispersion of 50 % phosphatidylcholine in a propylene glycol / ethanol carrier ) and polysorbate 80 ( pdr 2003 ) . the taste , and the requirement for refrigerator storage , protection from light , and disposal of the oral syringe after a single use make the oily solution an inconvenient dosage form ( vasquez 2000 ) . to deliver sirolimus orally in a solid dosage form , the major problem of the dissolution of sirolimus from the dosage form had to be overcome , as well as its permeability across the biological barrier , such as first - pass effect via intestinal and hepatic metabolism and efflux transporter p - glycoprotein ( figure 1 ) . it took one more year to explore the oral tablet formulation of sirolimus using nanocrystal technology acquired by elan corporation ( rosen and abribat 2005 ) . this product , launched in 2002 , offers greater palatability and convenience of administration and storage ( at 2025c ) . sirolimus is formulated as nanometer - sized drug crystals by nanocrystal technology using high - shear media mills . according to the noyes - whitney equation of dissolution ( noyes and whitney 1897 ) , the rate of dissolution is proportional to the effective surface area ( a ) and the difference ( cs c ) / h : adhdissolution rate = ( cs - c ) . where d is the diffusion coefficient of the drug , h is the thickness of diffusion boundary layer , cs is the saturation solubility of the drug , and c is the concentration of drug in the medium . nanocrystalline sirolimus not only increases the effective surface area ( a ) , but also increases the saturation solubility ( cs ) and decreases the thickness of the diffusion boundary layer ( h ) ( muller et al 2001 ; merisko - liversidge et al 2003 ; muller and keck 2004 ) . the saturation solubility can be increased only when the particle size is reduced in a submicron range ( muller and keck 2004 ) . in addition , it possesses long - term physical stability without ostwald ripening ( the tendency for larger particles to grow in diameter over time , while the smaller particles dissolve in a highly dispersed systems ) due to the uniform nanometer - sized particles ( muller and keck 2004 ) . high adhesiveness on biological surfaces and high endocytosis of nanocrystalline drugs were also reported ( kayser 2000 ; muller and keck 2004 ) . therefore , nanocrystalline sirolimus may provide a range of improvements in bioavailability , dose proportionality , absorption variability , and absorption rate . in the process of sirolimus nanocystallization , generally recognized as safe ( gras ) stabilizers were added to avoid the agglomeration / aggregation of the drug crystals due to surface energy of nanocrystalline particles ( figure 2 ) ( merisko - liversidge et al 2003 ) . a mixture of non - ionic and ionic stabilizers , such as cellulosics , poloxamer , polysorbates , lecithin , sodium glycocholate and polyvinylpyrrolidones , is required to create a steric barrier and an electrostatic repulsion among particles , respectively ( patravale et al 2004 ) . the inactive ingredients of sirolimus tablet include microcrystalline cellulose , polyethylene glycol 8000 , polyethylene glycol 20000 , poloxamer 188 , sucrose , lactose , calcium sulfate , pharmaceutical glaze , talc , titanium dioxide , magnesium stearate , povidone , glyceryl monooleate , carnauba wax , and other ingredients ( pdr 2003 ) . some of the disclosed and concealed inactive gras ingredients were the essential components in the process of sirolimus nanocrystallization . sirolimus , with a chemical structure related to tacrolimus , is one of the most potent immunosuppressive agents for prevention of rejection ( sehgal 1998 ; vasquez 2000 ) . when combined with cyclosporine - or tacrolimus - based regimen in kidney transplantation , sirolimus increases immunosuppressive activity through a sequential synergistic mechanism . like cyclosporine and tacrolimus , sirolimus binds to cytosolic receptors , an intracellular protein , known as immunophilins ( figure 3 ) . cyclosporine binds to cyclophilin of the immunophilin family , forming a complex that then engages calcinueurin ( clipstone and crabtree 1992 ) . both sirolimus and tacrolimus engage another immunophilin called fk - binding protein - 12 ( fkbp - 12 ) . tacrolimus - fkbp complex , like cyclosporine - cyclophilin complex , inhibits the catalytic activity of calcineurin - calcium - calmodulin complex . the inhibition of calcineurin activity decreases the production of il - 2 and other cytokines , thereby blocking their activation of t - lymphocytes in the g0 and g1 phases of cell cycle . in contrast , sirolimus - fkbp complex binds to the mammalian target of rapamycin ( mtor ) , thereby inhibiting t - lymphocyte proliferation through inhibition of interleukin -2-mediated ( il -2-mediated ) signal transduction in mid to late g1 phase and preventing cell - cycle progression from the g1 phase to the s phase ( vathsala et al 1990 ; sehgal 1998 ) . it also inhibits il - 2 dependent and independent b - lymphocyte proliferation and antibody production ( aagaard - tillery and jelinek 1994 ) . sirolimus oral solution has an oral bioavailability of about 15 % and distributes widely in tissue ( volume of distribution 19 l / kg ; yatscoff 1996 ; mahalati and kahan 2001 ) . the mean oral bioavailability of sirolimus tablets is not significantly different from that of oral solution ( kelly et al 1999 ; hariharan and zimmerman 2000 ; kelly et al 2000 ; pdr 2003 ) . however , clinical equivalence has been demonstrated at the 2 - mg dose level ( vanburen 2000 ; pdr 2003 ) . at doses between 3 and 12 mg / m , there is a linear correlation between the whole - blood concentration and dosage of sirolimus solution within the same transplant individuals ( pdr 2003 ) . the mean time - to - peak concentration ( tmax ) is about 1 hour after a single dose in healthy volunteers and 2 hours after multiple oral doses in renal transplant recipients ( pdr 2003 ) . a study by kelly et al ( 1999 ) indicated that there were no differences between the liquid and tablet in trough concentrations ( c0 ) and area under the concentrationhowever , tablets had a lower whole - blood peak concentration ( cmax ) and dose corrected cmax . the tmax of tablets was longer , but was significant only at 4 weeks post - conversion . the inter - individual variability and percentage fluctuation of sirolimus serum concentration were less in tablets than in liquids ( kelly et al 2000 ) . these results indicate that sirolimus tablets provide more consistent immunosuppressive exposure over the dosing interval in each individual than the liquid formulation . sirolimus is metabolized extensively by liver enzymes , with only 2.2 % excreted unchanged in urine ( pdr 2003 ) . a study by wu et al ( 2005 ) found that the dose - adjusted trough concentration of sirolimus in patients with persistent liver enzyme elevation was significantly higher than in those with normal liver function . like cyclosporine and tacrolimus , sirolimus is a substrate for both cytochrome p450 ( cyp ) 3a and p - glycoprotein ( p - gp ) ( sattler et al 1992 ; turgeon et al 1994 ; lampen et al 1995 ; fricker et al 1996 ; yatscoff 1996 ; lown et al 1997 ; masuda et al 2000 ) , and thus has potential drug interactions similar to those of cnis . in addition , the potential drug interactions between cnis and sirolimus have been a concern . sirolimus did not significantly affect the pharmacokinetics of either an olive oil - based or the microemulsion - formulated cyclosporine in human studies ( zimmerman and kahan 1997 ; kahan et al 1998 ; macdonald et al 2000 ) . a limited number of available studies did not reveal an effect of tacrolimus on the pharmacokinetics of sirolimus ( macdonald et al 2000 ; mcalister et al 2002 ; kuypers et al 2003 ; undre 2003 ) . however , both an olive oil - based or the microemulsion - formulated cyclosporine may increase the bioavailability of sirolimus ( pdr 2003 ) . in addition , the bioavailability and trough concentrations of sirolimus are significantly higher when microemulsion - formulated cyclosporine and sirolimus are administered concomitantly than when they are staggered by 4 hours ( kaplan et al 1998 ; macdonald et al 2000 ; pdr 2003 ) . thus , the manufacturer of sirolimus , wyeth ayerst ( philadelphia , pa ) , has suggested that the two drugs be given 4 hours apart . however , a randomized , parallel - group study has shown that during multiple - dose administration , the bioavailability and trough concentration of sirolimus were , respectively , 1.46 and 1.42 times higher in the cyclosporine group than in the tacrolimus group , even though sirolimus was administered 6 hours after cnis ( wu et al 2005 ) . in september 1999 , sirolimus was approved by the us food and drug administration ( fda ) for use in combination with cyclosporine and steroids . in november 2000 , the drug was registered by the european agency as an alternative to cni for maintenance therapy . in april 2003 , the fda approved a new regimen to reduce the use of cyclosporine by substituting higher doses of sirolimus ( kahan 2004 ) . the safety and efficacy of sirolimus oral solution and tablets for the prevention of graft rejection following kidney transplantation has been compared in a 477 - patient , randomized , multicenter , controlled trial . there was no significant difference between the oral solution and tablet formulation for rejection , graft , and patient survival at 3 , 6 , and 12 months after transplantation ( vanburen 2000 ; pdr 2003 ) . the incidences of acute rejection , chronic graft failure , and graft loss associated with this sirolimus - based therapy were 19 % , 14 % , and 10 % , respectively ( kahan 2004 ) . the long - term benefits with sirolimus - based therapy after early cyclosporine withdrawal have been demonstrated by kreis et al ( 2004 ) . lipid profiles were similar between groups , while blood pressures and incidence of abnormal kidney function , edema , hyperuricemia , hyperkalemia , gingival hyperplasia , and herpes zoster were significantly lower in the sirolimus - based therapy . recipients with low to moderate rejection risk may consider stopping cyclosporine 24 months after transplantation ( halloran 2004 ; kreis et al 2004 ) . compared with other immunosuppressive agents , regimens containing sirolimus have a lower incidence of cytomegalovirus ( cmv ) and bk polyoma virus infection ( halloran 2004 ; kahan 2004 ) . different from other immunosuppressive agents , m - tor inhibitors may have antineoplastic and arterial protective effects . sirolimus slows the growth of established experimental tumors ( guba et al 2002 ) . according to kahan s study group ( kahan 2004 ) , sirolimus therapy oughtweighs other immunosuppressive agents in the low incidence of malignancy . compared with the general us population , the sirolimus / cyclosporine therapy showed equal incidence of skin cancers , and a 4-fold increase in post - transplant lymphoproliferative disorder ( ptld ) and renal cell carcinoma . it was also reported to inhibit the progression of dermal kaposi s sarcoma in kidney - transplant recipients while providing effective immunosuppression ( stallone et al 2005 ) . the incidence of kaposi s sarcoma among solid organ recipients is about 500 times that in the general population ( hayward 2003 ) . three months after switching from cyclosporine to sirolimus in 15 kidney - transplant recipients who had biopsy - proven kaposi s sarcoma , all cutaneous kaposi s sarcoma lesions disappeared in all patients ( guba et al 2002 ) . incorporation of sirolimus into coronary stents inhibits restenosis ( morice et al 2002 ; dibra et al 2005 ) . combination of everolimus with cnis reduced the incidence of graft coronary artery disease associated with heart transplantation ( eisen et al 2003 ) . however , the potential arterial protective effects of m - tor inhibitors must be weighed against their hyperlipidemia side - effect ( blum 2002 ) . the major adverse reactions of sirolimus include hyper - lipedemia , thrombocytopenia , and impaired wound healing ( pdr 2003 ) . delayed recovery from acute tubular necrosis in kidney transplants , aggravation of proteinuria , mouth ulcers , pneumonitis , and skin lesions were also reported ( halloran 2004 ) . theoretically , sirolimus should not cause nephrotoxicity due to lack of cni activity ( sehgal 1998 ) . its combination with cnis was expected to decrease nephrotoxicity of cnis due to dose reduction of cnis ( mcalister et al 2000 ; kahan and camardo 2001 ) . however , the combinations have been reported to increase nephrotoxicity , the hemolytic - uremic syndrome , and hypertension ( gonwa et al 2003 ; halloran 2004 ) . it should be noted that the dose and whole - blood concentrations of cnis and sirolimus should be taken into consideration in interpreting these data . for example , in the study by gonwa et al ( 2003 ) , there was no difference between the two groups in median tacrolimus whole - blood trough concentration ( 8.5 ng / ml and 8.7 ng / ml in the sirolimus - and mycophenolate - treatment groups , respectively ) . that is , there was no dose reduction of tacrolimus in the sirolimus - treatment group . the median sirolimus dose was 3 mg / day with a corresponding median whole - blood trough concentration 7.3 ng / ml at 6 months , which was higher than 2 mg / day ( the dosage usually recommended ) . dose reduction of cnis as well as minimizing the dose of sirolimus is crucial to minimize toxicity of this combination . withdrawing one of the drugs in the combination of a m - tor inhibitor and cyclosporine can also reduce renal dysfunction and hypertension , with a small increase in rejection episodes ( johnson et al 2001 ) . with the help of the nanotechnology , tablet formulation of sirolimus was successfully introduced onto the market one year after the launch of the oil - based liquid formulation . patient satisfaction is greater with sirolimus tablet than oil - based liquid form because of improvement in palatability , less restricted storage conditions , and greater convenience of administration . tablet sirolimus is now the preferred dosage form except in those who require a lower dose or can not take tablets . sirolimus has been recognized as a potent immunosuppressive agent with less nephrotoxicity than cnis , such as tacrolimus and cyclosporine . the cost - effectiveness and cost - utility studies of sirolimus versus tacrolimus and cyclosporine in kidney transplant patients have been reported by mcewan et al ( 2005 , 2006 ) . a stochastic simulation model was developed using clinical trial and observational data to forecast the incidence of graft failures , hemodialysis , peritoneal dialysis , retransplants , and acute rejections . using historical data on 937 renal transplant recipients , the costs of the different events from the perspective of the uk national health service , valued at 2003 prices with discount , were then used to evaluate both cost - effectiveness and cost - utility over 10 and 20 years after transplantation ( mcewan et al 2005 , 2006 ) . treatment with sirolimus was projected to gain 0.72 and 1.8 discounted years of functioning graft over tacrolimus over 10 - year and 20 - year time horizons , respectively ( mcewan et al 2005 ) . similarly , when compared with cyclosporine , sirolimus gained 0.6 and 1.59 discounted years of functioning graft and a cost saving of us $ 486 and us $ 13033 per patient over 10 - year and 20 - year time horizons , respectively ( mcewan et al 2006 ) . sirolimus is one of the most potent immunosuppressive agents in transplantation which is useful in combination with cni or as an alternative to cni for maintenance therapy . although sirolimus is correlated with higher incidence of hyperlipedemia , thrombocytopenia , impaired wound healing , delayed graft function , proteinuria , mouth ulcers , pneumonitis , and skin lesions , it has antineoplastic and arterial protective effects , and is associated with lower incidence of cmv infection in transplant recipients . with the application of nanotechnology , nanocrystalformulation overcomes the problems of formulation , poor bioavailability , and erratic absorption of sirolimus . the tablet formulation has a better palatability , and is more convenient for long - term use . in addition , cost - effectiveness and cost - utility analysis also demonstrated the benefits of long - term use of sirolimus in kidney transplantation . using nanocrytalline sirolimus as a successful prototype , nanotechnology is a prominent approach in the formulation of water - insoluble drugs for clinically applicable dosage forms in the future .\noutput:\n" }, { "from": "agent", "value": "nanomedicine , known as the application of nanotechnology in medicine , has been applied to overcome the problems of poor bioavailability , in vitro and in vivo stability , and targeted delivery in the preparation of pharmaceutical products . sirolimus , a water - insoluble immunosuppressant , has been formulated into an oral solid dosage form by using nanocrystal technology to increase the water solubility and thereby the bioavailability . the efficacy , safety , and pharmacokinetic properties are not significantly different between liquid and solid formulations except that less fluctuation of sirolimus blood concentration was observed in solid dosage form . the tablet formulation offers the advantages of better palatability and more convenience for long - term use . sirolimus tablets are not only a successful example of nanomedicine , but also a more cost - effective treatment in renal transplantation than cyclosporine and tacrolimus ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: rice is an important model plant because it is one of the fundamental foods for mankind and its genome has syntenic relationships with other major cereal crops ( 1 ) . the rice genome research program ( rgp ) has been pursuing the sequencing of the rice genome since 1998 in collaboration with the international rice genome sequencing project ( irgsp ) . a clone - by - clone shotgun sequencing strategy has been adopted so that each sequenced clone could be associated with a specific position on the genetic map . the irgsp also adheres to the immediate release of the genome sequence data to the public domain ( 2 ) . thus a high - throughput sequence production during the last six years has resulted in the accumulation of a huge amount of sequence data and annotation information ( url : http://rgp.dna.affrc.go.jp/cgi-bin/statusdb/status.pl ) . as we approach the post genome - sequencing era , it is indispensable that the accumulated annotation information should be integrated with other genomic data to facilitate map - based informatics . towards this goal , the japanese ministry of agriculture , forestry and fisheries ( maff ) initiated the rice genome simulator project ( http://www.nias.affrc.go.jp/project/inegenome_e/simulator/simulator_outlook_e.htm ) to coordinate the data produced from extensive genome analysis and other aspects of rice research with emerging technologies in computational biology . the main target of this research project is to establish simulation as a tool that would allow plant researchers and breeders to develop highly desirable varieties of rice . this will utilize a network that will link all fundamental rice databases and an informatics infrastructure including specialized softwares that will allow integration , visualization and simulation of genome information . we have developed a contig - oriented annotation database called the rice annotation database ( rad ) to integrate all relevant information on the structure and function of the rice genome with other databases on rice research . similar rice genomics databases such as the whole rice genome automated annotation database of tigr ( 3 ) and rice information system of beijing genomics institute ( 4 ) which focus on an integrated facility for data - mining and comparative genomics are already available online . however , rad provides a comprehensive database of manually curated annotation information as well as the results of analysis of various features of the annotated genes . in this paper , we present the concept , architecture and usability of rad . the primary concept of rad is to provide a contig - oriented administration of the sequenced p1 - derived artificial chromosome ( pac ) and bacterial artificial chromosome ( bac ) clones generated by the international sequencing collaboration . rad is a relational database , which facilitates storage , query and visualization of annotation information such as sequence data , predicted genes and homology analysis of each pac / bac clone . these information are managed in contig or chromosome level to provide timely and general view of the data . all the manual annotation information are sheared into genomic entities and converted into a contig every time a new dataset is inserted . the genes of the overlapping - region are consistently aligned with genes from the north clone preceding genes fromthis merge - system facilitates not only the efficient management of the annotation data but also provides updates on the gene structure as more annotation data are incorporated into the database . we used an oracle database software for database administration server and the cgi - perl package programs for database interface and application programs . the genome sequencing of chromosomes 1 ( 5 ) , 4 ( 6 ) and 10 ( 7 ) have been completed and the predicted genes have been manually curated . in addition to chromosome 1 , the genome sequence of chromosomes 2 , 6 , 7 , 8 and 9 assigned to rgp have almost been completed as well . as an initial analysis step , we utilize an automated annotation system called ricegaas ( 8 ) , which combines the results of 14 kinds of gene prediction and analysis programs including the homology searches against rice full - length cdna ( 9 ) , rice expressed sequence tag ( est ) and the ncbi non - redundant protein database . subsequent manual curation ( http://rgp.dna.affrc.go.jp/genomicdata/annsystem.html ) facilitates accurate gene modeling of predicted genes based on available evidences . the data for other chromosomes from the participating irgsp members were obtained from the public database . we have integrated the flat files for the completed chromosomes into rad thereby providing a central annotation database for irgsp sequences . , the database contains a total of 215 mb sequence with relevant annotation results including 30000 manually curated genes . the annotation information with sequence data can be viewed in a user - friendly numerical and graphical web presentation form . this facilitates map - based informatics particularly in associating a genome sequence with a specific position in a genetic map . on the top page of rad , users can initially view the status of annotation for each chromosome . by clicking a contig on the chromosome , users can access the merged contig - level annotation page as shown in figure 2 . the merged contigs are visualized at the center frame and the viewing region is highlighted as yellow on chromosome image at the upper frame . the contig - level annotation page also contains information of the predicted genes , pseudogenes , ests , ltrs , and the results of various prediction programs such as ricehmm , genescan , genscan + , fgenesh and genemark . the position of genetic marker is indicated on the map that can be adjusted to various window sizes ( 2 m , 1 m , 500k , 200k , 100k and 50k ) . pointing on a gene shows the gene attributes such as gene i d , strand , position , identification , etc . on a table in the lower frame . these genomic , amino acid and dna sequences displayed on the screen are downloadable . by clicking a clone on a particular contigthe page contains a graphical display ( middle frame ) and a tabular form ( lower frame ) of the annotation data as well as the pac / bac sequence and its quality information ( upper frame ) . the annotation data contain the predicted genes , protein homology , est and the rice full - length cdna hits with links to respective public databases . the quality file describes the sequence data with a phrap score of 30 and other specific features such as repeats and ltr . the pac / bac sequence data are also downloadable . by subsequently clicking on a gene on the tabular form links the gene annotation , where users can view further information of gene attributes such as the position of exons , number of exons , gene identification , est hit , rice full - length cdna hit , mrna , gc , gene length , etc . the results of homology searches such as blastp and blastx , as well as full - length cdna hits are tabulated with corresponding links to the entries in public databases . a text - based keyword search function allows overall survey of specific genes and clones throughout the genome on the top page . gene search can be carried out using gene accession , gene name , est hit as well as full - length cdna hit . clone search can be performed based on clone accession and clone name . moreover , advanced search functions allow gene search based on homology level classifications such as a same protein , putative protein , similar protein , unknown or hypothetical protein , as well as clone search based on marker positions and other features . the statistical analyses of various features of the sequence such as the gc - content , the length of exon and intron , splice site sequence , base / codon usage to the predicted genes , etc . are provided in rad . these analyses facilitate a general characterization of the predicted gene models and the entire genome . moreover , the gene ontology ( go ) annotations ( 10 ) obtained using interpro ( 11 ) can be viewed as a pie chart . similarly , the classification of the gene function based on a criterion of mips ( http://mips.gsf.de/about/ ) can be viewed . genome - wide similarity search ( blast ) these analyses give an overview of the various features of the genome sequence and allow correlation of the sequence information with gene expression , go pathways , as well as genome - wide comparison with other organisms . rad has been developed by keeping pace with the progress of the rice genome sequencing project . the manually curated annotation dataset of all chromosomes will be incorporated as well to provide an overview of all the genes that comprise the rice genome . also , rad will be improved to facilitate data mining of elucidated genes and provide a robust tool for understanding gene networks in the post - genome era . we gratefully acknowledge the support of all members of the rice genome research program especially dr kyozo eguchi for advice and encouragement . we also appreciate the technical support of mitsubishi space software co. , ltd , and the nias dna bank for providing the server for rad . this work was funded by a grant from the ministry of agriculture , forestry and fisheries of japan ( rice genome simulator project sy - 1102 ) .\noutput:\n" }, { "from": "agent", "value": "a contig - oriented database for annotation of the rice genome has been constructed to facilitate map - based rice genomics . the rice annotation database has the following functional features : ( i ) extensive effort of manual annotations of p1 - derived artificial chromosome / bacterial artificial chromosome clones can be merged at chromosome and contig - level ; ( ii ) concise visualization of the annotation information such as the predicted genes , results of various prediction programs ( ricehmm , genscan , genscan + , fgenesh , genemark , etc . ) , homology to expressed sequence tag , full - length cdna and protein ; ( iii ) user - friendly clone / gene query system ; ( iv ) download functions for nucleotide , amino acid and coding sequences ; ( v ) analysis of various features of the genome ( gc - content , average value , etc . ) ; and ( vi ) genome - wide homology search ( blast ) of contig - and chromosome - level genome sequence to allow comparative analysis with the genome sequence of other organisms . as of october 2004 , the database contains a total of 215 mb sequence with relevant annotation results including 30 000 manually curated genes . the database can provide the latest information on manual annotation as well as a comprehensive structural analysis of various features of the rice genome . the database can be accessed at http://rad.dna.affrc.go.jp/ ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: cancer is a major public health problem in the united states and worldwide . in 2010the united states had an estimated 1.53 million new cancer cases for all sites with nearly 570,000 cancer - related deaths . as the second leading cause of death for all age groups in the united states , continued efforts to improve cancer therapy are critical to improve patient quality of life and survival outcomes . traditional clinical trial design was primarily developed in the 1970s when few cancer therapies were available . this traditional design is derived from an evidence - based medicine module treating patient populations with similar tumor tissue types . development of a therapeutic agent with intent to obtain approval from the federal drug administration ( fda ) tends to progress stepwise through preclinical testing for proof of concept and pharmacologic testing included in or followed by phase 1 testing of drug dosing and safety , phase 2 study of clinical efficacy , and phase 3 studies that traditionally demonstrate a clinical benefit compared to placebo or current standard of care . historically this pattern of clinical investigation has been time consuming , taking 20 years or more to complete from development of concept to proof of clinical benefit , has been expensive , and depends on patient resources as the number of patients able and willing to participate in clinical trials , especially early when safety and pharmacokinetic trials are limited . overall survival ( os ) is often acknowledged as the traditional endpoint for phase 3 clinical trials leading to fda approval . initially , in the early 1980s approval of drugs by the fda was based on tumor response , but the risk of toxicity from cancer therapy did not support this endpoint leading to a requirement of improvement in survival or patient symptoms . between january 1 , 1990 , and november 1 , 2002 , nonsurvival endpoints were the basis of approval for 75 % of oncology drug approvals including tumor response , time to progression ( ttp ) , and relief of tumor - related symptoms . in this paperwe will review how development of targeted agents has changed from the discovery of the first targeted therapy , imatinib , to the approval of new targeted therapies in prostate cancer . we will also discuss potential ways to expedite development of new therapy as the landscape of cancer treatment progresses beyond traditional cytotoxic chemotherapy to improved targeted agents that require biomarker identification and patient stratification that allows matching of the right patients to the right therapy . the hematologic stem cell disorder chronic myeloid leukemia ( cml ) was first described in 1845 . early treatments included potassium arsenate , interferon alpha , hydroxyurea , and busulfan with modest results in the chronic phase of the disease and limited benefit in advanced disease . through high - resolution karyotyping , a small deletion at the end of chromosome 22 was identified and the first direct link between a specific chromosomal abnormality and any malignancy was made with the discovery of the philadelphia chromosome by peter nowell and david hungerford in1960 . ten years later , 1973 , janet rowley discovered the reciprocal translocation t ( 9 ; 22 ) ( q34 ; 11 ) through the technique of chromosomal banding . almost another ten years passed before the bcr - abl fusion gene was discovered in 1982 and nearly another decade later was identified as the cause of cml in mice in 1990 . a 2 - phenylaminopyrimidine derivative cgp53716 was found to inhibit the pdgf receptor and v - abl in vitro and in vivo and became known as signal transduction inhibitor 571 ( sdi571 ) as studies demonstrated its inhibition of cellular growth in cml . in june 1998a phase 1/2 clinical trial in chronic phase cml patients resistant to interferon therapy was initiated and along with a follow - up phase ii trial showed that sdi571 was very effective in treating chronic phase cml and had palliative effects in the acute blast crisis phase . by an accelerated approval process , sdi571 or imatinib was approved by the fda in may 2001 which was the end of a 50 - year effort from the discovery of the philadelphia chromosome to approval of the first targeted therapy . the first solid organ malignancy to have an fda approved targeted therapy was breast cancer . the discovery that avian erythroblastosis tumor viruses encoded the oncogene her - 1 implicated receptor tyrosine kinases in cancer development in the 1980s . this was followed by the discovery of the neu gene from chemically induced rat neuron / glioblastomas which was found to have homology with the erbb receptor tyrosine kinases . the human counterpart to the rat neu oncogene was localized to chromosome 7q21 and named her2 in 1985 and that same year was found to be overamplified in human mammary carcinoma . overexpression is found on 20 % of breast cancer cells , the majority due to gene amplification . this discovery of her - 2 and its association with a poor prognosis prompted the investigation of this tyrosine kinase receptor for targeted therapy . murine monoclonal antibodies targeting the extracellular domain of her2 created by the then young pharmaceutical company genentech inc . inhibited the growth of cell lines that overexpressed her2 in vitro and in vivo . to reduce the immunogenicity of this antibody , the first phase 1 study of trastuzumab began in 1992 followed by additional phase 1 trials and small phase 2 studies . pivotal , large multinational phase 2 studies completed at the same time confirmed the efficacy and safety of trastuzumab . enrolling 222 women between april 1995 and september 1996 with her2 overexpressing , pretreated , metastatic breast cancer from 7 different countries , cobleigh et al . completed a phase 2 study with a primary endpoint of tumor response . similar to the smaller , earlier studies the orr was 15 % , median duration of response was 9 months , and the median survival was 13 months . the responses in these studies were significant due to enrollment of patients with poor risk factors . the synergy of trastuzumab with cytotoxic chemotherapy agents seen in early studies led to the pivotal multinational phase 3 study comparing chemotherapy in combination with trastuzumab to chemotherapy alone . among 12 countries , the first patient was enrolled june 12 , 1995 and accrued a total of 469 patients with her2 - positive metastatic breast cancer . the primary endpoint for median ttp for chemotherapy and trastuzumab was 7.4 months compared to 4.6 months for chemotherapy alone . the addition of trastuzumab to anthracycline therapy increased orr from 42 % to 56 % , while addition of trastuzumab to paclitaxel increased orr from 17 % to 41 % . the os combining both groups was 20 months for chemotherapy and 25 months for combination therapy . these pivotal multinational trials were followed by a phase 2 study of trastuzumab as first - line monotherapy in her -2-positive metastatic breast cancer . as seen in the preceding studies , patients with 3 + immunohistochemical staining for her - 2 or fish for gene amplification had the higher responses . in september 1998the fda approved trastuzumab for use in women with metastatic breast cancer whose tumors overexpress the her - 2 protein . fda - approved indications included treatment of patients as first - line therapy in combination with paclitaxel and as a single agent after prior chemotherapy . this initial approval for trastuzumab was followed in december 2000 by enrollment into phase 3 trials using trastuzumab in the adjuvant treatment of early - stage her -2-positive breast cancer . these studies were sponsored by the national cancer institute and conducted by researchers of the national surgical adjuvant breast and bowel project ( nsabp b - 31 ) and the north central cancer treatment group ( ncctg n9831 ) . a third adjuvant trial , the herceptin adjuvant trial ( hera ) , started enrolling in europe in march 2001 . the results of all three trials were reported in the same edition of the new england journal of medicine in 2005 . reported the joint analysis of the results of the nsabp b - 31 and ncctg n9831 trials as their designs were similar , comparing doxorubicin and cyclophosphamide followed by paclitaxel with or without trastuzumab . the dfs in the trastuzumab arm 4 years after randomization was 85.3 % versus 67.1 % in the control arm . the hera trial reported the interim analysis results of 1 year of trastuzumab versus observation administered after completion of all chemotherapy and radiation therapy . over 5,000 women were enrolled to evaluate a primary endpoint of dfs which was 85.8 % versus 77.4 % in the control arm . based on the joint analysis of the nsabp b - 31 and ncctg n9831 trials , the fda approved trastuzumab as part of a treatment regimen containing doxorubicin , cyclophosphamide , and paclitaxel for adjuvant treatment of patients with early - stage her2 - positive , node - positive breast cancer in november 2006 . based on the hera interim analysis , the fda added approval as a single agent in her2 - positive , node - positive breast cancer or node - negative breast cancer with high - risk features following chemotherapy . the most recent approval for trastuzumab in breast cancer came in may 2008 based on the results of the breast cancer international research group 006 ( bcirg - 006 ) trial that was published earlier in 2011 in the new england journal of medicine . this is the fourth large multinational trial evaluating anthracycline chemotherapy alone versus trastuzumab with anthracycline or docetaxel chemotherapy again demonstrating a dfs and os benefit with combination therapy . the discovery of the her2 gene in 1984 to the last fda - approved indication for trastuzumab in breast cancer in 2008 spanned almost 25 years . clinical trial design and momentumhas become more streamlined than the cumbersome process experienced with the development of early targeted agents imatinib and trastuzumab . the development , study , and approval process of these drugs were prolonged for many reasons including dependency on newly developed technology , inexperience with the new targeted agents , patients willingness to be involved in clinical trials , and large - scale development requirements on pharmaceutical companies . we are seeing a more efficient process of development of both chemotherapy agents and targeted agents , highlighted recently by the advances made in prostate cancer therapeutics . taxanes are cytotoxic chemotherapy agents in use for at least the past 20 years for treatment of solid organ malignances as either a single agent or as part of a multiagent regimen . a limitation to their use , especially with first - generation taxanes , is their binding affinity to multidrug resistance ( mdr ) proteins or efflux pumps . the taxane xrp6258 was selected for development for its low affinity binding to these mdr proteins . in phase 1 study of 25 pretreated patients with advanced solid tumors , there were two patients in which anticancer activity was noted , both with refractory prostate cancer . cabazitaxel was well tolerated amongst the patients treated in the phase 1 trial . the phase 2 dosing of 20 mg / m was chosen as patients had grade 4 neutropenia at the 25 mg / m dosing following the traditional 333 phase 1 clinical trial design . early recognition of response in the prostate cancer population led to a critical decision to advance to phase 3 study without a preceding phase 2 evaluation . the tropic trial opened january 2007 and completed september 2009 enrolling 755 patients from 26 countries comparing prednisone plus cabazitaxel versus mitoxantrone for metastatic castration - resistant prostate cancer after progression following docetaxel treatment and previous hormone therapy . the primary endpoint was os which was 15.1 months with median progression - free survival ( pfs ) of 2.8 months in the cabazitaxel group compared to os of 12.7 months with pfs of 1.4 months in the mitoxantrone group . the phase 1 data for cabazitaxel was presented at the american society of clinical oncology conference may 2001 , and 9 years later the fda approved cabazitaxel for use in combination with prednisone for hormone refractory prostate cancer after or during docetaxel chemotherapy in june 2010 . the second recent prostate cancer therapy to receive approval by the fda was the immunotherapy sipuleucel - t . the early promise of immunotherapy with autologous dendritic cells was demonstrated in sequential phase 1 and phase 2 studies published in december 2000 after clinical studies in the late 1990s demonstrated that dendritic cell therapy could elicit a clinically beneficial immune response . . demonstrated that the treatment was well tolerated . in the phase 2 study , patients received sipuleucel - t from a leukapheresed product after phase 1 infusion of increasing doses . in this trialthe ttp correlated with the development of an immune response and with the dose of dendritic cells received . this preliminary evidence warranted further exploration with several phase 3 clinical trials that its may 2010 fda approval was based upon , ten years after the phase 1 and 2 clinical studies . the first , published in 2006 , enrolled 127 patients with asymptomatic metastatic hormone refractory prostate cancer and randomized them in a 2 : 1 fashion to receive sipuleucel - t or placebo with ttp as the primary endpoint . the study did not achieve statistical significance for this endpoint ; however , it did suggest a survival advantage in the therapeutic group . integrated data from 2 randomized phase 3 trials with the primary endpoint of ttp and a secondary survival analysis after a 36 - month followup in the intention to treat population supported this observation . the median survival was 23.2 months for sipuleucel - t and 18.9 months for placebo ; however , again the studies did not meet statistical significance for the primary endpoint , demonstrating a trend to delay in disease progression . finally the immunotherapy for prostate adenocarcinoma treatment study ( impact ) was published in 2010 , enrolling 512 patients to treatment or placebo in a 2 : 1 fashion with a primary endpoint of os . there was a statistically significant 4 - month improvement in median survival for sipuleucel - t treated patients , 25.8 months versus 21.7 months . again , no effect on ttp was observed . in 2011 the oral selective and irreversible inhibitor of cyp17 , abiraterone acetate , was approved in combination with prednisone for castrate - resistant prostate cancer after treatment with docetaxel chemotherapy . after preclinical studies demonstrated evidence of 17a - hydroxylation inhibition in the late 1980s and early 1990s , abiraterone acetate was tested for the first time in a series of phase 1 clinical trials in both castrate and noncastrate males demonstrating further suppression of testosterone in castrate males and compensatory hypersecretion of luteinising hormone that overcome testosterone suppression in the noncastrate males . the activity of abiraterone acetate in castrate resistant prostate cancer was again seen in phase 1/2 clinical trial design by attard et al . in chemotherapy - nave patients where a 50 % decline in psa was seen in a majority of patients along with a decrease in measurements of circulating tumor cells and evidence of radiologic responses . additional analysis demonstrated reversal of resistance in 33 % of patients with the addition of dexamethasone at disease progression . similar response in psa decline was also seen in patients who previously received ketoconazole therapy . further encouraging evidence of the therapeutic efficacy of abiraterone acetate was seen in two multicenter phase 2 trials both with primary end points of 50 % reduction in psa in patients with castrate resistant prostate cancer previously treated with docetaxel . the randomized , placebo - controlled , multicenter , phase 3 trial that led to fda approval enrolled 1195 patients to receive abiraterone acetate with prednisone or placebo with prednisone in a 2 : 1 ratio . treatment was given until there was a 25 % increase in psa which defined disease progression , unacceptable toxicity , or withdrawal . the interim analysis after 552 deaths demonstrated a statistically significant improvement in os and the updated survival analysis after 774 deaths confirmed the survival benefit . the interim analysis demonstrated a median survival of 14.8 months for abiraterone acetate versus 10.9 months for placebo ; the updated analysis also demonstrated a 4 - month median survival advantage of 15.8 months versus 11.2 months . the future of cancer therapy development and expedited drug approval will likely be based to a greater extent on identification of small subsets of patients to whom targeted therapy can be designed and clinical trials tailored to rapid identification of clinical benefit . this pathway of drug development is exemplified by the recent discovery and approval of the anaplastic lymphoma kinase ( alk ) inhibitor crizotinib . the identification of the eml4 - alk fusion gene in nonsmall cell lung cancer ( nsclc ) was reported in 2007 , and within 3 years orr of 57 % and median 6 months pfs of 72 % in pretreated patients with nsclc with the eml4 - alk translocation was reported . there was also early identification of mechanisms of resistance . within 4 years , after presentation at the 2011 american society of clinical oncology annual meeting of initial phase 2 study results of crizotinib in alk - positive nsclc , the fda approved for treatment of locally advanced or metastatic disease in august 2011 . this timeline from proof of concept to proof of clinical efficacy is in stark contrast to the decades it took to develop early targeted agents including imatinib and trastuzumab described earlier . from inception of concept to phase 3 trial design , it took an average of 10 years for fda approval of these new prostate cancer drugs which is an improvement in providing earlier access to innovative therapy but still indicates that there is continued room for improvement . factors that may decrease time to drug approval include improved biomarker identification to identify small subsets of target patients as was seen in the development of crizotinib . identification of such biomarkers will allow for trials designed and directed to particular patient populations increasing the likelihood of a clinical outcome rather than phase 1 trials designed to search for target patient populations , a daunting task for the multitude of therapies in phase 1 trial design at any given time . identification of patients for enrollment into clinical trial may also improve , not only with identification of patients that harbor target biomarkers but also with early discussions with patients about willingness to enroll in clinical trials and early collection of this information . clinical trial designs can adopt a more integrated model that is adaptive to available knowledge shared during the development of studies and adaptive to improved knowledge regarding genomic heterogeneity of tumors . in addition information sharing amongst investigators can be beneficial to avoid re - creation or reporting of identical clinical trials allowing for earlier trial design advancement leading to an expedited pathway of therapy discovery to validation .\noutput:\n" }, { "from": "agent", "value": "no single therapy benefits the majority of patients in the practice of oncology as responses differ even among patients with similar tumor types . the variety of response to therapy witnessed while treating our patients supports the concept of personalized medicine using patients ' genomic and biologic information and their clinical characteristics to make informed decisions about their treatment . personalized medicine relies on identification and confirmation of biologic targets and development of agents to target them . these targeted agents tend to focus on subsets of patients and provide improved clinical outcomes . the continued success of personalized medicine will depend on the expedited development of new agents from proof of concept to confirmation of clinical efficacy ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: since watanabe et al . initially applied imaging methods in the prostate , the value of transrectal ultrasound ( trus ) for the detection and evaluation of prostate cancer ( pca ) has been reported . although the efficacy of screening for pca is under continuous debate , the advent of trus has improved visualization of prostate lesions . hypoechoic lesions found during trus , as well as high levels of serum prostate - specific antigen ( psa ) and abnormal digital rectal examination ( dre ) findings , are the typical findings considered to be suspicious for pca , and trus - guided prostate biopsy is generally recommended . there has been some controversy over trus owing to its low specificity and sensitivity ; hence , new methods and imaging techniques are being intensely explored by investigators [ 6 - 9 ] . however , as previously reported in many studies , trus - guided biopsy is a widely practiced method for histological diagnosis in men with suspected pca . although trus has significantly improved the diagnostic rate , the correlation between findings on trus and clinically significant pca is incompletely understood . the aim of this study was to investigate the relationship of trus findings with the pathological characteristics of pca . a total of 996 patients who had lesions suspected of being pca ( with a psa level 4.0 ng / ml , a palpable nodule upon dre , or a hypoechoic lesion upon trus ) underwent trus - guided prostate biopsy between january 2004 and december 2010 . men were excluded from the analysis if they had previously undergone prostate biopsy , had received a prior diagnosis of pca , or had undergone prostate surgery or radiation treatment . a total of 970 men met the criteria and constituted the study cohort . according to the approval of the institutional review board of the hospital ( irb no . the rectum was cleaned with 10 % povidone iodine and prophylactic antibiotics were administered before the trus - guided biopsy . all biopsies were performed with an automatic 18 - gauge biopsy needle ( bard urological division , covington , ga , usa ) in conjunction with a hawk 2102exl medical ultrasound scanner ( bk medical a / s , herlev , denmark ) . the biopsy specimens were examined for the presence of cancer and were categorized by gleason score by a pathologist . the factors we evaluated for the risk of high - grade pca included age , abnormal dre result , psa , prostate volume , transitional zone ( tz ) volume , psa density ( psad ) , psad of the tz ( psad - tz ) , and hypoechoic lesion on trus . continuous variables were expressed as either the meanstandard deviation or the median ( interquartile range ) . student t - test and the pearson chi - square test were used for statistical comparisons of continuous and categorical variables , respectively . simple and multiple logistic regressions with a backward variable selection procedure were performed to identify independent predictors of high - grade pca . all statistical outcomes were presented as the odds ratio and the 95 % confidence interval based on a two - sided test using spss 12.0 ( spss inc . , pca was detected in 163 patients among 371 patients who had hypoechoic lesions on trus ( positive predictive value , 43.9 % ) , which was higher than the cancer detection rate in patients without hypoechoic lesions ( 21.4 % , p 0.001 ) . of the 163 patients with pca who had hypoechoic lesions , 122 patients had a gleason score of 7 or more . of 128 patients with pca who did not have hypoechoic lesions , 68 men had a gleason score of 7 or more ( p0 .001 ) . the detailed results of the patients ' characteristics and pathologic findings of pca are described in table 1 . a comparison was made among the 291 patients in whom pca was diagnosed according to gleason scores ( table 2 ) . there were more patients with hypoechoic findings on trus among the patients with a gleason score of 7 or more than among those with lower gleason scores ( p 0.001 ) . patients with high - grade pca also had higher ages , more abnormal dre findings , and higher levels of psa , psad , and psad - tz ( p 0.05 ) . logistic regression analysis was also performed among the 291 patients . in the simple logistic regression analysis , age , abnormal dre findings , psa , prostate volume , tz volume , psad , psad - tz , and hypoechoic lesions on trus were significant factors for high - grade pca ( gleason score 7 , table 3 ) . in the multiple logistic regression analysis , abnormal dre findings and hypoechoic lesions on trus were identified as significant factors . the numbers of biopsied men with a psa level 4 ng / ml , normal dre findings , and a hypoechoic lesion on trus were 37 . among them , only one case with pca with a gleason score of 6 was diagnosed . the incidence of pca has been rapidly increasing and this phenomenon is currently a major health issue worldwide . because early detection of pca has been a primary concern in the last several decades , various studies of pca screening have been performed [ 11 - 13 ] . however , although previous studies of pca screening have demonstrated the improvements in pca diagnosis , overdiagnosis of clinically insignificant pca is considered to be the major problem causing increased costs and burden . recent pca studies have focused on the current issues in identifying clinically significant pca [ 14 - 16 ] . in our study , patients with pca who had hypoechoic lesions on trus had more aggressive pathological disease than did those who did not have hypoechoic lesions . concluded that prostate volume is inversely associated with high - grade pca as well as extraprostatic extension and positive surgical margins . we also identified small prostate volume and small tz volume of the prostate as significant risk factors for high - grade pca in the simple logistic regression analysis ; however , they were not significant by multiple logistic regression analysis . another study suggested that the results of contrast - enhanced sonography with micro flow imaging are associated with the aggressiveness of pca . hence , all hypoechoic lesions within the peripheral zone should be noted and included in the biopsy material . however , lack of a hypoechoic area does not preclude proceeding with biopsy , because 40 % of cancers are isoechoic or hyperechoic on trus . trus biopsies are presently the method of choice for determining pca [ 20 - 22 ] . chang et al . reported that 55 % to 60 % of all small hypoechoic lesions in the posterior prostate ultimately prove to be benign and , therefore , refinement of the ultrasound criteria for identifying the lesions to which immediate attention should be paid is necessary . reported that performing biopsy of only hypoechoic sectors would have misdiagnosed 24.6 % of the patients with pca and that only 6.3 % of patients with normal dre results and a psa level of less than 4.0 ng / ml demonstrated pca on biopsy . in the present study , more than half of the patients with hypoechoic lesions on trus did not have pca and 2.7 % of patients with normal dre results and psa levels of less than 4.0 ng / ml were diagnosed as having pca on biopsy . babaian et al . suggested the relationship of psa levels to other detection techniques and to the finding of cancer . in that analysis , pca that was diagnosed by trus alone was least likely to be cancer ( positive predictive values , 5.4 % ) . therefore , the present study demonstrates that trus may not be a screening method for pca and that hypoechoic lesions on trus do not guarantee the presence of pca . however , once pca exists in the prostate , hypoechoic lesions on trus could imply its pathological aggressiveness . several studies have shown that abnormal dre findings are related with more progressive forms of pca . . found that a substantial proportion of pca detected by dre at psa levels less than 4 ng / ml has features associated with clinically aggressive tumors and concluded that dre is useful in diagnosing biologically aggressive pca and provides important prognostic information . according to gosselaar et al . , men who had an abnormal dre result would have a high chance of detection of aggressive pca ( gleason score 7 ) , indicating that an abnormal dre finding is associated with clinically significant pca . patients with pca who had hypoechoic lesions on trus had more aggressive pathological disease than did those who did not have hypoechoic lesions . thereforealthough the widespread use of screening methods has led to increased diagnosis of pca , the issue of overdiagnosis has been raised recently . additional studies are required for determining the pathological features and the clinical significance of pca . with the rapid advent of new technologies , combining new strategies and guidelines will be suggested to improve the quality of pca evaluation .\noutput:\n" }, { "from": "agent", "value": "purposeto investigate the relationship of transrectal ultrasound ( trus ) findings with the pathological characteristics of prostate cancer ( pca ) . materials and methodsthe study was conducted retrospectively by analyzing the data for 970 patients who underwent prostate biopsies . gleason scores and other clinical variables were compared between pca patients with and without hypoechoic lesions on trus.resultsof the 970 patients , pca was diagnosed in 291 ( 30 % ) . of these , high - grade pca ( gleason score of 7 or more ) was diagnosed in 190 ( 65 % ) . the cancer detection rate was higher in patients with hypoechoic lesions ( 43.9 % ) than in those without hypoechoic lesions ( 21.4 % , p < 0.001 ) . high - grade pca was detected more often in patients with hypoechoic lesions than in those without hypoechoic lesions ( p < 0.001 ) . independent predictors for high - grade pca by logistic regression analysis included hypoechoic lesions on trus and abnormal digital rectal examination findings.conclusionspatients with pca who had hypoechoic lesions on trus had more aggressive pathological disease than did those without lesions . therefore , hypoechoic lesions on trus could be a marker for clinically significant pca ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: diabetes mellitus is a chronic metabolic disorder and the risk of death in diabetic patients could be much more than that of healthy people in the same age group . it is associated with several complications including vascular changes , which result in chronic renal failure , stroke , myocardial infarction , and retinopathy . it is well - established that stringent glycemic control decreases microvascular and probably macrovascular complications in diabetic patients . treatment of patients to achieve stringent glycemic control needs various strategies including physical activity , nutritional therapy , and medication . in thisregard , intensive insulin therapy is effective but it is important that insulin dosage should be adjusted to balance physical activity and diet in order to maintain the blood glucose ( bg ) within normal limits . on the other hand , adhering to a specific diet is often difficult for most patients because of personal preferences and habits , cultural food choices , and lifestyle schedules . carbohydrates can affect postprandial bg regarding the amount ( carbohydrate unit ) and properties ( glycemic index ) in it . it means that for proper control of postprandial bg , the dose of short or rapid acting insulin should be adjusted based on the carbohydrate unit of the planned food . so detecting carbohydrate intake and carbohydrate counting ( carbo count ) is a key principle and a mandatory step for obtaining stringent glucose control . this method uses multiple daily injections ( mdis ) of insulin adjusted based on carbohydrate intake and exercise , and resembles normal insulin secretion in the bodyadditionally , it allows more adherence and dietary management of patients because the patients have a greater variety of food consumption . carb count frequently is performed by the insulin - to - carbohydrate ratio ( i : cho ) technique . this technique estimates the amount of carbohydrates in each meal by grams and then calculates the needed bolus insulin dose before the meal based on an insulin sensitivity measure . in fact , in this method , what the patient wants to eat is defined , and how much insulin he / she should inject to cover what has been eaten . although carbo count is a flexible strategy , there are some limitations including difficulties in understanding the strategy by patients , the need for intense education of patients about the nutritional facts of foods , specifically their carbohydrate content and the amount of time and effort , which is required for counting the carbohydrate content at each meal . to minimize the rate of counting mistakes and facilitating this technique for patients , the calculation of required insulin based on meals carbohydrate facts and premeal bg can be performed by automated programs . recent studies on automated bolus calculator was conducted by calculator devices and resulted in favorable outcomes in glycemic control and treatment satisfaction . in this study , we used a bolus advisor mobile app , which can be used more easily and nearly in all of situations by patients . we investigated the effect of bolus calculation by mobile - based bolus calculator on glycemic control in adult patients . this study is a nonrandomized , controlled clinical trial with two parallel arms including bolus advisor and usual treatment ( estimating the premeal insulin doses and using correction boluses empirically ) , which was performed in 2013 - 2014 . it has been registered in the iranian registry of clinical trials ( number irct201502011181n2 ) . the study followed the declaration of helsinki on biomedical research involving human subjects and was approved by the ethics committee of the isfahan university of medical sciences . the subjects were selected from diabetic patients who were referred to the endocrinology clinic of noor ( khorshid ) hospital , isfahan , isfahan province , iran . the diagnosis of diabetes was made based on the american diabetes association 's criteria for diagnosis of type 1 and type 2 diabetes mellitus . all subjects met the following inclusion criteria : age 18 - 65 years ; more than 1 year duration of type 1 or type 2 diabetes ; treatment with mdi technique , using rapid - and long - acting insulin analogs ; willing and able to comply with study procedures ; andwilling and able to provide written informed consent . more than 1 year duration of type 1 or type 2 diabetes ; treatment with mdi technique , using rapid - and long - acting insulin analogs ; willing and able to comply with study procedures ; and willing and able to provide written informed consent . unmet criteria were as follows : any serious medical condition that might interfere with safe study participation ; current lactation , pregnancy , or inadequate contraception ; gastroparesis or celiac disease ; using of or former training in carb count ; problems with using mobile programs . any serious medical condition that might interfere with safe study participation ; current lactation , pregnancy , or inadequate contraception ; gastroparesis or celiac disease ; using of or former training in carb count ; problems with using mobile programs . a total of 83 individuals were screened . at the screening visit , after recording demographic data , the subjects underwent physical examination and blood urea nitrogen ( bun ) , creatinine ( cr ) , and urine pregnancy tests to ensure that the results did not preclude involvement in the study . finally , 62 eligible subjects were allocated to two groups by a simple method based on the above criteria ( i.e. , those who could not or were not interested to work with the software or whose mobile was not compatible with that were put in the control group ) . it was planned such that the case group would use our mobile - based bolus advisor and the control group would undergo treatment as usual with the mdi method . six patients dropped out in the study process because of noncompliance [ figure 1 ] . before the intervention , the long - acting insulin dose was adjusted based on preprandial and postprandial bg assessments in a 1 - week period . all of the participants received a 5 - h group teaching , which was delivered by an educated physician . the educational topics were the basic knowledge of diabetes including different types of insulin , measuring and monitoring of bg , general food recommendations , appropriate methods of exercise , symptoms and treatment of hyper - and hypoglycemia , and principles of daily insulin dosage adjustment according to amount of meal and pre - prandial bg . in the bolus advisor arm , patients also received additional education about the principles of carbo count ( theory and practical exercises ) , working with mobile program , and estimating individual insulin sensitivity factors ( isfs ) and insulin - to - carbohydrate ratios ( icrs ) using the rule of 1800 and 500 , respectively . after the group 's educational session , the study was performed in a 12 - week period . patients in the control arm used mdi technique as usual by estimating the premeal insulin doses and using correction boluses empirically . control patients used insulin according to physician recommendations about meal dose and the dose also was adjusted if the meal size was different from the patient 's average meal or the premeal bg was out of optimal range . the adjustment was done by reducing or adding two units of rapid acting insulin accordingly . in the bolus advisor armtoo , patients used mdi technique but with aid of an application , which was installed on their mobile phone or tablet for measuring the needed insulin dose for each meal . the application was designed as a bolus calculator on the basis of current bg , target bg , insulin sensitivity factor ( isf ) , insulin to carbohydrate ratio ( icr ) , time of day , insulin on board , exercise level , and amount of ingested carbohydrates . the patients were visited every 2 weeks for readjusting the dosage of long - and rapid - acting insulin according to a 3 - day diabetes worksheet and estimating isfs and icrs . all of participants were asked to check three bg tests per day during the study . the mean bg level and mean hba1c were assessed before and just after the study . the data were analyzed by chi - square test for qualitative and independent t - test for quantitative demographic and clinical differences between the two groups . we used paired sample t - test for evaluation of changes of variables during the study in each group . mann - whitney test was used for evaluation of side effect differences between the two groups . the data were analyzed using the statistical package for the social sciences version 20.0 ( spss inc . , chicago , illinois , usa ) and a p 0.05 was considered as statistically significant . this study is a nonrandomized , controlled clinical trial with two parallel arms including bolus advisor and usual treatment ( estimating the premeal insulin doses and using correction boluses empirically ) , which was performed in 2013 - 2014 . it has been registered in the iranian registry of clinical trials ( number irct201502011181n2 ) . the study followed the declaration of helsinki on biomedical research involving human subjects and was approved by the ethics committee of the isfahan university of medical sciences . the subjects were selected from diabetic patients who were referred to the endocrinology clinic of noor ( khorshid ) hospital , isfahan , isfahan province , iran . the diagnosis of diabetes was made based on the american diabetes association 's criteria for diagnosis of type 1 and type 2 diabetes mellitus . all subjects met the following inclusion criteria : age 18 - 65 years ; more than 1 year duration of type 1 or type 2 diabetes ; treatment with mdi technique , using rapid - and long - acting insulin analogs ; willing and able to comply with study procedures ; andwilling and able to provide written informed consent . more than 1 year duration of type 1 or type 2 diabetes ; treatment with mdi technique , using rapid - and long - acting insulin analogs ; willing and able to comply with study procedures ; and willing and able to provide written informed consent . unmet criteria were as follows : any serious medical condition that might interfere with safe study participation ; current lactation , pregnancy , or inadequate contraception ; gastroparesis or celiac disease ; using of or former training in carb count ; problems with using mobile programs . any serious medical condition that might interfere with safe study participation ; current lactation , pregnancy , or inadequate contraception ; gastroparesis or celiac disease ; using of or former training in carb count ; problems with using mobile programs . a total of 83 individuals were screened . at the screening visit , after recording demographic data , the subjects underwent physical examination and blood urea nitrogen ( bun ) , creatinine ( cr ) , and urine pregnancy tests to ensure that the results did not preclude involvement in the study . finally , 62 eligible subjects were allocated to two groups by a simple method based on the above criteria ( i.e. , those who could not or were not interested to work with the software or whose mobile was not compatible with that were put in the control group ) . it was planned such that the case group would use our mobile - based bolus advisor and the control group would undergo treatment as usual with the mdi method . six patients dropped out in the study process because of noncompliance [ figure 1 ] . before the intervention , the long - acting insulin dose was adjusted based on preprandial and postprandial bg assessments in a 1 - week period . all of the participants received a 5 - h group teaching , which was delivered by an educated physician . the educational topics were the basic knowledge of diabetes including different types of insulin , measuring and monitoring of bg , general food recommendations , appropriate methods of exercise , symptoms and treatment of hyper - and hypoglycemia , and principles of daily insulin dosage adjustment according to amount of meal and pre - prandial bg . in the bolus advisor arm , patients also received additional education about the principles of carbo count ( theory and practical exercises ) , working with mobile program , and estimating individual insulin sensitivity factors ( isfs ) and insulin - to - carbohydrate ratios ( icrs ) using the rule of 1800 and 500 , respectively . after the group 's educational session , the study was performed in a 12 - week period . patients in the control arm used mdi technique as usual by estimating the premeal insulin doses and using correction boluses empirically . control patients used insulin according to physician recommendations about meal dose and the dose also was adjusted if the meal size was different from the patient 's average meal or the premeal bg was out of optimal range . the adjustment was done by reducing or adding two units of rapid acting insulin accordingly . in the bolus advisor arm too , patients used mdi technique but with aid of an application , which was installed on their mobile phone or tablet for measuring the needed insulin dose for each meal . the application was designed as a bolus calculator on the basis of current bg , target bg , insulin sensitivity factor ( isf ) , insulin to carbohydrate ratio ( icr ) , time of day , insulin on board , exercise level , and amount of ingested carbohydrates . the patients were visited every 2 weeks for readjusting the dosage of long - and rapid - acting insulin according to a 3 - day diabetes worksheet and estimating isfs and icrs . all of participants were asked to check three bg tests per day during the study . the mean bg level and mean hba1c were assessed before and just after the study . the data were analyzed by chi - square test for qualitative and independent t - test for quantitative demographic and clinical differences between the two groups . we used paired sample t - test for evaluation of changes of variables during the study in each group . mann - whitney test was used for evaluation of side effect differences between the two groups . the data were analyzed using the statistical package for the social sciences version 20.0 ( spss inc . , chicago , illinois , usa ) and a p 0.05 was considered as statistically significant . fifty - six patients , out of which 33 ( 58.9 % ) were male participants and 23 ( 41.1 % ) female participants completed the study . the mean [ standard deviation ( sd ) ] age was 36 ( 18.7 ) years , ranging 12 - 80 years . the mean ( sd ) of disease duration was 10.16 ( 2.55 ) years , ranging 6 - 17 years . the mean ( sd ) of bg was 225.64 ( 49.1 ) mg / dl and the mean ( sd ) of hba1c was 8.38 ( 1.4 ) % . the two groups were similar regarding sex ratio , educational level , body mass index , and diabetes duration but as expected , the age and diabetes type were significantly different between the groups . demographics and baseline characteristics of the subjects ( n = 56 ) as the control of bg and a1c was the main objective in this study and they were exactly the same in type 1 and 2 diabetic participants ( a1c 8.38 versus 8.37 , p = 0.991 , mean glucose 225 versus 226 , p = 0.901 ) at the baseline , we did not consider diabetes type as a confounding factor . the mean ( sd ) of bg were 220.57 ( 43.7 ) and 231.5 ( 55 ) in the carb count and the control group , respectively , and the difference between the two groups was not significant ( p = 0.411 ) . also , the mean ( sd ) of hba1c was 8.39 ( 1.5 ) and 8.37 ( 1.33 ) in the carb count group and the control group , respectively ; there was no significant difference between the two groups ( p = 0.965 ) . after treatment , in the bolus advisor group , mean bg and hba1c decreased significantly ( p = 0.001 and p = 0.001 , respectively ) . in the control group , the changes in mean scores was significant for bg ( p = 0.049 ) but not significant for hba1c ( p = 0.06 ) . between group analyses between the groups showed that the mean bg after treatment and the differences between in bg before and after treatment were significantly different between the two groups ( p = 0.003 and p = 0.039 , respectively ) . the mean hba1c after treatment and the differences in hba1c between before and after treatment were not significantly different between the two groups ( p = 0.137 and p = 0.141 , respectively ) [ table 2 ] . changes of mean blood glucose and mean hba1c between the two groups after treatment the mean episodes of hypoglycemia were 2.13 ( 1.3 ) and 1.62 ( 1 ) in the bolus advisor group and control group , respectively . there was no significant difference between the two groups in episodes of hypoglycemia during the treatment period ( mann - whitney test , p = 0.854 ) . fifty - six patients , out of which 33 ( 58.9 % ) were male participants and 23 ( 41.1 % ) female participants completed the study . the mean [ standard deviation ( sd ) ] age was 36 ( 18.7 ) years , ranging 12 - 80 years . the mean ( sd ) of disease duration was 10.16 ( 2.55 ) years , ranging 6 - 17 years . the mean ( sd ) of bg was 225.64 ( 49.1 ) mg / dl and the mean ( sd ) of hba1c was 8.38 ( 1.4 ) % . the two groups were similar regarding sex ratio , educational level , body mass index , and diabetes duration but as expected , the age and diabetes type were significantly different between the groups . demographics and baseline characteristics of the subjects ( n = 56 ) as the control of bg and a1c was the main objective in this study and they were exactly the same in type 1 and 2 diabetic participants ( a1c 8.38 versus 8.37 , p = 0.991 , mean glucose 225 versus 226 , p = 0.901 ) at the baseline , we did not consider diabetes type as a confounding factor . the mean ( sd ) of bg were 220.57 ( 43.7 ) and 231.5 ( 55 ) in the carb count and the control group , respectively , and the difference between the two groups was not significant ( p = 0.411 ) . also , the mean ( sd ) of hba1c was 8.39 ( 1.5 ) and 8.37 ( 1.33 ) in the carb count group and the control group , respectively ; there was no significant difference between the two groups ( p = 0.965 ) . after treatment , in the bolus advisor group , mean bg and hba1c decreased significantly ( p = 0.001 and p = 0.001 , respectively ) . in the control group , the changes in mean scores was significant for bg ( p = 0.049 ) but not significant for hba1c ( p = 0.06 ) . between group analyses between the groups showed that the mean bg after treatment and the differences between in bg before and after treatment were significantly different between the two groups ( p = 0.003 and p = 0.039 , respectively ) . the mean hba1c after treatment and the differences in hba1c between before and after treatment were not significantly different between the two groups ( p = 0.137 and p = 0.141 , respectively ) [ table 2 ] . the mean episodes of hypoglycemia were 2.13 ( 1.3 ) and 1.62 ( 1 ) in the bolus advisor group and control group , respectively . there was no significant difference between the two groups in episodes of hypoglycemia during the treatment period ( mann - whitney test , p = 0.854 ) . our controlled study showed that the use of bolus advisor by the mobile bolus calculator leads to better control of bg compared with usual mdi treatment . both groups improved in glycemic control after treatment butthis results shows that flexible intensive insulin therapy with mdi , either as usual or with bolus advisor software , is an effective method for controlling bg . this is consistent with previous studies , which showed that mdi has similar effects to that of continuous subcutaneous insulin infusion on glycemic control in type 1 and type 2 diabetes mellitus . in our study , hba1c was not significantly different before and after treatment in the control group . on the other hand , several studies had revealed that monitoring of total ingested carbohydrates by counting of food nutritional facts helps to estimate the dose of rapid acting insulin appropriately . bolus calculation is usually performed manually , which needs considerable time and effort by patients and intense education of them about the nutritional facts of foods . so recent studies has used automatic bolus calculators for measuring of rapid acting insulin doses . schmidt et al . , used a bolus calculator device to compare glycemic control in three parallel groups including treatment with mdi as usual , treatment with manual carbo count , and treatment with carbo count and bolus calculation by automated device . they measured the hba1c differences between the groups and concluded that there was no significant difference between different treatment methods . our results with the mobile - based bolus calculator also showed that the difference in hba1c was not significant but mean bg difference was significant between the two groups . the nonsignificance of hba1c could be because of the relatively small duration of our study ( 12 weeks ) as well as the study of schmidt et al . , in an 18 - month study on children , revealed that the use of an automated bolus calculator compared with mdi treatment without bolus calculator improves hba1c significantly after 18 months of treatment but not 6 months . bazik et al . , also showed that in a 3 - month study , patients who used a bolus calculator had more improvement in 2 - h postprandial bg . the mean episodes of hypoglycemia were not significantly different between the two groups in our study as well as in the study of bazik et al . previous studies used an automated device for bolus calculation , which might not be available in any clinical setting and the patients need to pay for that . but we prepared a mobile - based application which is free , easy to use , and available everywhere because of the widespread use of smartphones in the world . considering that strict glycemic control , especially in hba1c would lead to fewer microvascular and macrovascular complications in diabetes mellitus , long - term use of the bolus calculator method by an available application can improve the well - being and quality of life of diabetic patients . first , it was limited by the relatively short time of follow - up ( 12 weeks ) . second , the control and case groups were not matched in age and type of diabetes . first , it was limited by the relatively short time of follow - up ( 12 weeks ) . second , the control and case groups were not matched in age and type of diabetes . in conclusion , this study revealed that mobile - based bolus advisors can reduce better the mean bg in patients who are planned to have tight glycemic control as a feasible and available method and may improve hba1c in the long term a larger , long - term study is suggested to evaluate the long - term effects of this method on hba1c and treatment adherence of patients . ms contributed to the conception and design of the work , conduct the study , software design , data analysis , revision of the draft , approval of the final version of the manuscript , and agreed with all aspects of the work . mt contributed to the conception of the work , data acquisition , draft of the work , approval of the final version of the manuscript , and agreed with all aspects of the work . ma contributed to the conception of the work , draft of the work , approval of the final version of the manuscript , and agreed with all aspects of the work .\noutput:\n" }, { "from": "agent", "value": "background : we investigated the efficacy of a mobile - based bolus advisor app in comparison with the usual multiple daily injections ( mdis ) in diabetic patients.materials and methods : in a nonrandomized , controlled clinical trial , 62 diabetic patients were selected to receive a 12 - week intensive glycemic control by either a mobile - based bolus advisor ( app ) or mdi in the usual manner . we compared mean blood glucose ( bg ) and hba1c before and just after the treatment program . the data were analyzed using paired sample t - test and analysis of variance ( anova ) . results : fifty - six patients ( 30 cases and 26 controls ) completed the study . the mean [ standard deviation ( sd ) ] of bg was 220.57 ( 43.7 ) and 231.5 ( 55 ) in the app group and control group , respectively . mean bg decreased 38 mg / dl in the app and 16 mg / dl in the control group ( p = 0.001 and 0.049 respectively ) . changes of mean bg were different between the two groups significantly ( p = 0.039 ) . hba1c decreased from 8.4 % to 7.6 % in the case and from 8.4 % to 8 % in the control group ( p = 0.001 and 0.06 , respectively ) . changes of hba1c were not different between the two groups ( p = 0.141 ) . the mean episodes of hypoglycemia were not different between the groups significantly ( p = 0.108 ) . conclusion : in conclusion , this study revealed that mobile - based bolus advisors can reduce mean bg better in patients who are planned to have a tight glycemic control as a feasible and available method and may improve hba1c in the long term ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: traumatic spinal cord transection is uncommon . in a study of 62 patients with spinal cord injuring who underwent magnetic resonance imaging ( mri ) , 7 had cord transections ( 1 ) . in contrast to children in who closed spinal cord trauma may occur in the absence of skeletal injury , most cord injuries in adults are associated with major musculoskeletal injuries , such as vertebral fractures and / or dislocations ( 2 - 6 ) . in the subaxial cervical spine , hyperextension injuries without facet dislocations are well known as central cord syndromes , but cervical cord transection has not been described in the literature ( 7 - 10 ) . we report a patient with a cervical cord transection in the absence of a vertebral dislocation secondary to air bag deployment without the use of a seat belt and discuss the mechanism of this type of injury . a 33 - yr - old male was admitted through the emergency room with neck pain , and loss of sensation and inability to move all four extremities . he had crashed his car into the post of a traffic signal , was not wearing a seat belt , and the front air bag deployed . on neurologic examination , the patient had flaccid paralysis of all four extremities , a sensory level at c4 , no sphincter control or rectal tone , an absent anal wink , no sacral sparing , and a positive bulbocavernosus reflex . he was fully alert with mild hypotension ( systolic arterial pressure 100 mm hg ) . plain radiographic evaluation of his cervical spine showed c5 , c6 wedge compression fractures and minimal c5 retrolisthesis on c6 ( fig . a computed tomographic ( ct ) scan also demonstrated c5 , c6 vertebral body vertical fractures with laminar fractures , and a c3 spinous process fracture ( fig . the fractured c5 lamina was depressed into the spinal canal through the lamina - facet junctions . a mri revealed a linear area of abnormal signal intensity running horizontally through the spinal cord at the c5 - 6 disc space level , which was thought to represent a spinal cord transaction ( fig . the patient had no brain , thoracic , or abdominal abnormalities on plain films and ct scans . the patient underwent surgery via a posterior approach 5 days after his injury . a c5 laminectomy with a posterior fusion and lateral mass screw fixation at the c4 - c7 levels4 ) . during this procedure , disruption of the c4 - 5 supraspinous and interspinous ligaments were noted , but the facet joint capsules were intact at the c4 - c7 levels in the operative field . he was transferred to the rehabilitation department 1 month post - operatively and no neurologic improvement had been observed 4 months after the injury . there have been no reports of traumatic spinal cord transections in adults other than fracture - dislocation injuries in the subaxial spine . although berlot et al . ( 11 ) described a delayed post - traumatic cervical cord transection in a spinal cord injury without radiologic abnormalities ( sciwora ) , the initial mri revealed only focal swelling of the spinal cord and several patch areas of cord contusions ; indeed , an initial incomplete lesion may have progressed to transection in the absence of fixation . our patient 's injury appeared to have occurred when his torso overrode the air bag , which resulted in acute hyperextension of the cervical spine . this potential mechanism has been shown in crash simulations using human cadavers and dummies positioned opposite airbags when unbelted ( 12 ) . but in such simulations , the velocities were between 32 and 48 km / hr . the velocity in our patient was more than 60 km / hr , so a more extreme hyperextension injury may have occurred . during the episode of hyperextension , rupture of the anterior longitudinal ligament andthe disc caused marked backward displacement of the c5 vertebral body against the cord ( 13 ) . also , our patient had a c5 laminar fracture , which may have exacerbated the hyperextension and posterior displacement . although there was no facet disruption , this circumstance could result in a c5 / 6 spinal cord transection . because the spine returned to its normal position by the elastic recoil of the vertebral muscles when the head is in the neutral position or in flexion ( 14 ) , subtle c5 retrolisthesis on c6 . the above mechanism of injury could explain the cord transection and injuries involving the posterior vertebral column . however , c5 , c6 vertebral body fractures are unresolved . according to allen 's classification of subaxial cervical fractures and dislocations ( 15 ) , our patent 's injury was a distractive extension stage 2 lesion . in this type of injury , however , there was no co - existing vertical fracture centrum . therefore , we propose the hypothesis that during the initial short moment of the collision , the airbag was just in contact with the torso , but not with the face of the patient . as a result , compressive flexion force interacted at the cervical spine , resulting in c5 , c6 vertebral body fractures .5 . the course of treatment in this patient is of less interest than the proposed mechanism of injury . distractive extension stage 2 lesions must be surgically stabilized , usually with an anterior approach . however , in the presence of cord involvement by laminar fragments with preservation of lordotic sagittal alignment , a posterior approach is also useful ( 16 ) . in this case reportfour months after the operation , no cervical instability was observed while the patient ambulated in a wheelchair . although there is a constant search for ways and means to enhance recovery of spinal cord injury , this patient 's prognosis is very poor . according to data of the model spinal cord injury systems ( 17 ) , 94.4 % of patients with neurological complete spinal cord injuries remained so at the 5 - yr post - injury evaluation . nevertheless , kirshblum et al . reported approximately 20 % showed some improvement in motor power and neurologic level of injury from year 1 to year 5 ( 18 ) . therefore medical rehabilitation service should be provided sufficiently and continuously for the sake of this patient 's recovery . although this report describes just a single case of spinal cord transection by motor vehicle accident , it emphasizes the importance of proper use of seat belts especially in the circumstance of airbag deployment . the authors ' proposed hyperflexion - hyperextension mechanism can result in significant neurologic deficits , but subtle radiographic abnormalities might be seen on plain films . so clinicians in emergency centers should have the possibility of cord transection in the acutely injured patient in mind because it is important for both prognostic and therapeutic reasons .\noutput:\n" }, { "from": "agent", "value": "a patient is presented with a cervical spinal cord transection which occurred after a motor vehicle accident in which the air bag deployed and the seat belt was not in use . the patient had complete quadriplegia below the c5 level and his imaging study showed cervical cord transection at the level of the c5 / 6 disc space with c5 , c6 vertebral bodies and laminar fractures . he underwent a c5 laminectomy and a c4 - 7 posterior fusion with lateral mass screw fixation . previous reports have described central cord syndromes occurring in hyperextension injuries , but in adults , acute spinal cord transections have only developed after fracture - dislocations of the spine . a case involving a post - traumatic spinal cord transection without any evidence of radiologic facet dislocations is reported . also , we propose a combined hyperflexion - hyperextension mechanism to explain this type of injury ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: central serous chorioretinopathy ( cscr ) is a relatively frequent ocular disorder characterized by the accumulation of subretinal fluid at the posterior pole , causing a circumscribed area of retinal detachment . the detachment frequently involves the macular area , such that patients usually complain of metamorphopsia , micropsia , macropsia , or central scotoma . visual acuity is often moderately decreased and , in most cases , the cscr spontaneously resolves within a few months . the pathophysiology remains unclear . a 28 - year - old man presented at the department of ophthalmology , university clinic hospital of valladolid , with a 3 - month history of progressive bilateral vision loss , blurred vision , and metamorphopsia in both eyes . he denied any remarkable past medical history and concurrent systemic treatment ; he also denied a history of abuse of tobacco , alcohol , or illegal drugs . his best - corrected visual acuity was 20/25 in the right eye and 20/40 in the left eye . fundus oculi evaluation revealed retinal pigmentary abnormalities in the macula of both eyes ( fig . there was also a serous detachment of the neurosensory retina associated with a small retinal pigment epithelium ( rpe ) detachment in the left eye .1 c , d ) by optical coherence tomography ( 3d oct - 1000 ; topcon , tokyo , japan ) . there was no evidence of intraocular inflammation , retinal holes , tears , or retinal choroidal neovascularization . autofluorescence images ( trc - 50ex , imaginet 2000 ; topcon ) showed diffuse areas of increased autofluorescence and reduced intensity in the macular and peripapillary areas . upon fluorescein angiography , there were multiple pinpoint areas of hyperfluorescence in the macula and peripapillary areas . there were also areas of independent leakage with a mottled appearance and low activity from early stages without later changes ( fig . no specific treatment was prescribed for the cscr , and 6 months later it remained unchanged . the patient 's best - corrected visual acuity and fundus oculi evaluation revealed minimal changeshowever , he suffered progressive systemic changes , including a 10 - kg increase in body weight , supraclavicular fat accumulation around the neck and face ( moon face ) , dorsocervical fat pad ( buffalo hump ) , purple striae , and thin skin ( fig . a tentative diagnosis of hypercortisolism was made , and the patient was sent to the endocrinology department of the university clinic hospital to confirm the diagnosis . his urinary free cortisol was 264.7 g / 24 h , confirming the tentative diagnosis of hypercortisolism . a low - dose ( 1 mg ) dexamethasone suppression testwas performed , revealing a mean cortisol level of 19.94 g / 100 ml . a follow - up high - dose ( 8 mg ) dexamethasone suppression test was performed , and a suppressed adrenocorticotropic hormone serum level assay value of 5 pg / ml confirmed the previous dexamethasone suppression test . subsequently , an abdominal ct scan without contrast was performed and revealed the presence of a left adrenal oval - shaped mass with irregular enhancement ( fig . following these tests , the patient was treated with ketoconazole and steroid replacement therapy before consulting surgeons performed a laparoscopic left adrenalectomy . hydrocortisone was administered after surgery to restore the physiologic hypothalamic - pituitary - adrenal axis . one month after surgery , the patient 's best - corrected visual acuity improved to 20/20 in both eyes . the fundus examination showed only rpe abnormalities , but there were no signs of cscr . psychological stress , hormonal changes in pregnancy , and glucocorticoid treatments can all contribute to the development of cscr , though the influence each of these circumstances has on cscr is not well understood . corticosteroids may inhibit collagen synthesis and increase choriocapillaris fragility and permeability by altering ion transport across the rpe . other proposed mechanisms of corticosteroid - dependent increases in capillary fragility and permeability include inhibition of fibroblast proliferation , alteration of leukocyte migration , and release of proteolytic enzymes . corticosteroids could also cause local ischemia by reducing choroidal fibrinolysis , leading to choroidal endothelial and rpe injury with consequent increased permeability . cscr has been reported in only 5 % of patients with cushing 's syndrome , all of whom had a pituitary adenoma . in each of these cases , the cscr occurred during the period of active , untreated disease while plasma cortisol levels were high . however , 2 new cases of cscr have been reported as a result of hypercortisolism due to an adrenocortical adenoma . because both cscr and adrenocortical adenomas are not very common diseases , a coincidental association is highly improbable . furthermore , considering the resolution of cscr in our patient without any systemic treatment following the adrenocortical adenoma resection , we suggest that hypercortisolism could be an important risk factor for cscr . our case underscores the importance of considering the possibility of a diagnosis of endogenous cushing 's syndrome in patients with cscr as an initial symptom .\noutput:\n" }, { "from": "agent", "value": "a 28 - year - old man with bilateral central serous chorioretinopathy ( cscr ) and body weight gain was diagnosed with cushing 's syndrome secondary to an adrenocortical adenoma . the patient had high levels of free cortisol and the tumor was confirmed by histopathology . after surgery , cortisol levels decreased and the cscr spontaneously resolved . this case highlights the role of cortisol in the pathogenesis of cscr . a diagnosis of endogenous cushing 's syndrome should be considered in patients with cscr as an initial symptom ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: improvements in hepatobiliary and pancreas ( hpb ) surgery over the past 2 decades have resulted in low surgical mortality ( 1 to 5 % ) and morbidity rates ( 4 to 20 % ) in high - volume centers . however , bleeding ( specifically diffuse oozing from the raw resection surface ) and bile leakage continue to be problematic in these operations , both intraoperatively , as well as , in the postoperative period . while there are thousands of publications available in various surgical fields regarding the use of hemostats , glues , and sealants ; a very small number have focused on hpb surgery . differing requirements and needs for each surgical specialty should lead one to apply caution before inferring equal appropriateness and efficacy of hemostatic ( and bilostatic ) agents across specialties . a very thorough update and comparison of fda - approved topical hemostats ( capable of clotting blood ) , sealants ( provide a sealing barrier in the presence or absence of blood ) , and adhesives ( bond tissues together ) in the surgical toolboxthese authors have previously discussed five performance categories that should be considered in the evaluation of any potential hemostatic agent : safety , efficacy , usability , cost , and approvability . furthermore , it is stressed that hemostatic agents must be used / applied appropriately so that maximum efficacy can be achieved . they also note that currently , the indications for usage and choice of agents are heterogeneous and for the most part based on the individual surgeon 's preference . likewise , others also note this selection and application is often done without in - depth knowledge of pharmacodynamic characteristics and specific strengths of various agents . table 1 list all topical hemostatics and sealants currently approved by the fda as per their website ( http://www.fda.gov/ ) as of december 2011 . it is important to note that only a few of the approved hemostatics have a specific indication for hpb surgery . other fda approved hemostatics are also frequently used off - label in hpb surgery , as in other subspecialities . the goal of this paper is to briefly discuss the use of current routine hemostatic agents in hpb surgery and then to perform an in - depth examination of a novel carrier - bound fibrin sealant that permits the simultaneous application of collagen , fibrin , and thrombin ( tachosil , nycomedgmbh , linz , austria ) . current literature concerning the utilization and effectiveness of topical hemostatic ( and bilostatic ) agents was reviewed . a comprehensive search for studies and reviews on the use of hemostatic agents in hpb surgery was performed including an october 2011 electronic search of medline via pubmed and embase databases and browsing references . hemostat , hepatobiliary , pancreas , liver , bile duct , fibrin , also , an in - depth evaluation of a novel carrier - bound fibrin sealant ( tachosil ) was carried out with search terms of tachosil , tachocomb , and tachocombh in conjunction with hepatobiliary and pancreas . articles were excluded if their focus was not the use of a hemostatic agent , the agent was only mentioned in a description of a procedure , the hemostatic agent was not topical , or hemostasis discussed was not related to hepatobiliary and pancreas surgery . the cochrane database of systematic reviews was then cross - checked to confirm that no similar reviews have already been undertaken . the mainstay of topical hemostatic agents in hpb surgery have included absorbable gelatin sponges ( e.g. , gelfoam , pfizer , new york , ny ) , oxidized regenerated cellulose ( e.g. , surgicel ethicon , inc . , summerville , nj ) , gelatin - thrombin matrix ( e.g. , floseal , baxter healthcare corporation , hayward , ca , usa ) , collagen and thrombin combinations ( e.g. , costasis surgical hemostat , cohesion technologies inc . , palo alto , ca ) , synthetic sprayable polymeric matrix ( e.g. , coseal , baxter healthcare corporation , hayward , ca ) , and / or fibrin glue homemade or manufactured ( e.g. , tisseel , baxter healthcare corporation , westlake village , ca , and crosseal , omrix biopharmaceuticals ltd . , kiryat ono , israel , now replaced in the usa by evicel , johnson and johnson , somerville , nj ) . these hemostatics have been used separately and in different combinations with varying success ( 10 to 60 % bleeding complications and 4 to 8 % bile leaks reported ) . application of these agents is carried out routinely and without any particular standardized indication . as we progress further into the modern surgical era , the search for an ideal hemostatic agent for hepatobiliary and pancreas procedures , although elusive , continues . finding this ideal hemostatic agent is important , because reduced blood loss and ensuing reduction in blood transfusions has been demonstrated to result in superior surgical outcomes in hpb operations . furthermore , not only can these agents decrease bleeding , but they may also reduce operative time , improve quality of surgical tissue management and decrease the occurrence of biliary , pancreatic and enteric anastomotic leaks . in patients undergoing a liver resection , decreased liver reserve and cirrhosis need to be taken into account as this can further complicate the achievement of hemostasis following resection . specifically , in regards to hemostasis in hpb surgery , a numerical bleeding score analysis after liver biopsy in a heparinized swine model demonstrated statistically significant hemostatic superiority of porcine gelatin sponge with human thrombin in comparison to porcine gelatin sponge and saline . this superiority was demonstrated in a second study which looked at grade iv - v liver and splenic lacerations in a hemorrhagic shock porcine model where bovine gelatin granules and thrombin ( floseal ) were utilized and found to be effective at achieving hemostasis in all animals . clot integration was also demonstrated at 48 hours on histological examination . also , chapman et al . in a randomized controlled trial of 76 patients undergoing hepatic resection , demonstrated that a mixture of bovine collagen and bovine thrombin is more effective in controlling and stopping diffuse hepatic bleeding than a collagen alone . while value of fibrin as a hemostatic agent was first noted by bergel in 1909 ; it was not made commercially available in europe until 1972 , and in 1998 became the first fibrin product approved by the fda for use in the us . fibrin sealants remain the only products available in the us with fda approval for hemostatic , sealant and adhesive bonding indications . in a randomized controlled trial of 121 patients undergoing hepatic resection ,58 patients were randomized to treatment with a 2 - component fibrin sealant ( crosseal , johnson and johnson , new brunswick , nj ) and 63 patients to standard topical hemostatic agents such as gelfoam or surgicel , used alone or in combination . fibrin sealant was shown to significantly improve the time to hemostasis in comparison to standard topical hemostatic agents ( p = 0.003 ) . consideration for the usage of topical agents in the prevention of bile leakage in liver surgery is controversial with a plethora of studies supporting both sides of the argument . likewise , application of tissue sealants and adhesives to seal the transected edge of the pancreas in order to prevent a pancreatic fistula also remains controversial . in a recent prospective randomized study of 300 patients undergoing liver resection , with 150 being treated with fibrin glue after hemostasis was achieved ; the primary objective was to determine if fibrin sealant could decrease postoperative blood loss and blood transfusion . secondary objectives addressed postoperative drainage , incidence of biliary fistula , frequency of reoperation secondary to bleeding or biliary leakage , and frequency of intra - abdominal abscess requiring percutaneous drainage . tissucol ( name under which tisseel was marketed in some countries ; baxter - immuno , vienna , austria ) in aerosol form was applied to the raw liver surface , followed by application of an absorbable collagen sponge ( johnson & johnson , somerville , nj ) , with concomitant manual pressure . in comparison to the control group in which no hemostatic agents were utilized , no statistically significant differences were noted for postoperative outcomes , hospital mortality , or overall postoperative morbidity . the authors concluded that application of fibrin sealant on the raw surface of the liver does not seem justified and suggest that discontinuation of routine use of fibrin sealant in these cases . tachosil is a ready - to - use fixed combination hemostatic agent consisting of a white honeycomb - like collagen patch coated with the coagulation factors , human fibrinogen , and human thrombin on one side ( colored yellow with riboflavin for orientation ) ( figures 2 and 3 ) . the patch design takes advantage of the mechanical support of a collagen fleece , as well as the hemostatic and adhesive properties of the coagulation factors i and iia . fibrinogen and thrombin are delivered directly to the site of bleeding in order to form a fibrin network effectively gluing the patch to the desired surface ( wound , cut liver edge , or anastomosis ) . the coagulation cascade is locally activated mimicking the final steps of natural blood clotting to seal tissue ( figure 4 ) . degradation and reabsorption of the patch and resultant fibrin clot is achieved during the normal healing process . tachosil represents the most current formulation of a unique carrier - bound fibrin sealant and differs from its precursors , tachocomb and tachocombh , as earlier components of bovine origin have been eliminated ( aprotinin ) . these precursors were previously approved for use in europe and japan ( tachocombh is still in use in some countries but is being phased out and replaced with tachosil ) . in the usa , tachosil was granted approval in 2010 for use as an adjunct to hemostasis for use in cardiovascular surgery when control of bleeding by standard surgical techniques ( such as suture , ligature , or cautery ) is ineffective or impractical . tachosil should not be used in the renal pelvis or near the ureter , for skin closures , or neurosurgical procedures . outside the usa , the current ema approved indication for tachosil is for use in adults as supportive treatment in surgery for improvement of hemostasis to promote tissue sealing and for suture support in vascular surgery where standard techniques are insufficient . in addition , tachosil has also been shown to have multiple other applications including prevention of adhesions and erosions , protection of nerves , and occlusion of structures such as bronchioles , lymph vessels , and bile ducts . again specifically in this paper , we focus on evaluation of the efficacy and safety of tachosil and its precursors in hpb surgery . following extensive hpb surgery , hemostasis following hepatic or portal vein reconstruction can be challenging . this can result from inherent liver disease that is frequently present in this patient population , or in the presence of invasive tumors in the pancreas and duodenum which can be technically difficult to excise predisposing to large volume hemorrhage if injury / laceration occurs . an alternative approach to the traditional repair of vein lacerations using vascular sutures has been studied in the preclinical setting with the use of tachosil transposed onto a peritoneal patch . in this series , tachosil was shown to be efficacious in repairing induced inferior vena cava defects in a swine model ; the use of a peritoneal patch helps to prevent lumen thrombosis by serving as a barrier from the coagulant portion of the tachosil sheet . it has also been employed as reinforcement for the sutured anastomosis of the portal vein and has been shown to be useful in the repair of hepatic artery pseudoaneurysm when it develops as a postoperative complication following pancreaticoduodenectomy . another application of tachosil for vasculature reconstruction has been described by shimamoto and colleagues for aortic arch repair . in this study , tachosil combined pledget stitches which significantly helped to control suture hole bleeding as compared with conventional pledget stitches . this novel application of tachosil could likely be transferred to intra - abdominal aortic or other large vessel repairs . the preclinical evaluation of tachosil has provided evidence for a variety of uses in the field of liver surgery . early investigations with the tachosil precursor tachocomb , a collagen fleece patch with fibrinogen , thrombin and aprotinin , have demonstrated initial clinical efficacy for hemostasis following experimentally produced penetrating liver and spleen injury models . adding to our understanding of hemostasis following liver hemorrhage , tachosil has also been investigated in an animal model of coagulopathy with blunt liver injury . in this investigation , blunt liver injury was then induced and the injury treated with either cotton placebo patch or tachosil fibrinogen / thrombin ( ft ) patch . all animals treated with the ft patch survived , whereas , all animals in the control group died prior to the end of the observation period . these results demonstrate the efficacy of the tachosil patch in effectively controlling hemorrhage in the presence of severe coagulopathy . in a head - to - head trial , tachosil was compared with a regenerated oxidized cellulose compress ( surgicel , johnson and johnson , somerville , nj ) and a bovine collagen - based compress ( sangustop , b. braun aesculap ag , tuttlingen , germany ) . liver resection margins were created in a swine model and each of the three compresses applied to different areas of resection margin . the bovine collagen product performed the best in this series with the lowest bleeding time and fewest numbers of compresses required to stop hemorrhage . a second comparative trial of advanced hemostatic dressings evaluated nine different products in a swine model of induced liver venous hemorrhage injury . four products in this series were excluded from further study secondary to exclusion criteria of no survival or no hemostasis . of the remaining productsevaluated , the american red cross fibrinogen and thrombin dressing ( currently only available in the usa military ) on an absorbable polyglactin mesh were the most favorable in terms of posttreatment blood loss and percentage of animals in which hemostasis was obtained as compared with the tachocomb - s and other hemostatic dressings . in overall , survival during the experimental time period tachocomb - s ranked third . to examine the effectiveness of tachosil in sealing of bile ducts , a swine model was utilized in which a medial left liver resection was completed and the cut surface treated with either the fibrin collagen patch or the liquid fibrin sealant ( tissucol duo 500 , baxter hyland immuno , uden , the netherlands ) . after increasing pressure into the common bile duct , the fibrin collagen patch was found to resist significantly higher intrabiliary pressures prior to bile leakage as compared with the liquid fibrin sealant . use of fibrin - based hemostatic agents and sealants in open liver resection has gained support through numerous publications citing its efficacy in adjunctive hemorrhage control , decrease in postoperative drain fluid output and biliostasis . a prospective controlled trial from briceo and colleagues compared outcomes of 115 patients undergoing major and minor hepatectomies with or without tachosil as a carrier bound fibrin sealant hemostatic agent . in this series , the tachosil group was found to be associated with decreased drainage volume ( p 0.01 ) , lower volume drain output per day ( p 0.01 ) , decreased postoperative blood transfusion rate ( p = 0.04 ) , shorter mean hospital stay ( p = 0.03 ) , and fewer moderate to severe postoperative complications ( p = 0.03 ) . this study 's findings are in direct contrast to results published in 2007 in which a comparative cohort study of liver resections performed in 173 patients with tachocomb and 222 patients without tachocomb . no significant differences were seen between groups in rates of postoperative blood transfusion , biliary fistula , or reoperation for postoperative hemorrhage . currently , a prospective multicentered randomized controlled trial in austria and germany is enrolling patients to compare tachosil , being described as the gold standard , standardization is achieved through resection technique , devices used in surgery , and methods for primary hemostasis . patients are blinded to group selection and will be followed for three months for postoperative complications and adverse events . additionally , two european trials have demonstrated the hemostatic efficacy of tachosil as compared with argon beam coagulation ( abc ) in liver resection . frilling and colleagues published results in 2005 following a trial comparing abc to tachosil as secondary hemostatic treatment in 121 patients who underwent planned liver resection . in this series , tachosil performed significantly better in regards to time and to hemostasis ( measured from time to application to no visible bleeding evident ) , 3.9 minutes versus 6.3 minutes , respectively ( p 0.01 ) . the investigators also noticed a decrease in drain hemoglobin concentration the second day after surgery in the tachosil group as compared with the abc group ( p = 0.012 ) . a follow - up study published by fischer and colleagues in 2011 , was able to replicate some of these findings . in 10 tertiary care centers , 119 patients undergoing liver resection were randomized to receive either abc or tachosil . similar to the frilling study , the mean time to hemostasis in the tachosil group was significantly lower than the abc group ( p 0.01 ) . this study did not report however , differences in postoperative drainage volume , drainage fluid , or drainage duration between the two groups . it is important to note that both of these studies were regulatory phase iii trials that were aimed at providing data on the hemostatic capability of tachosil and therefore were not sufficiently powered to determine if any differences exist in postoperative parameters . unique considerations exist in the field of liver transplantation as hemostasis , both intraoperative and postoperative can be difficult to achieve and biliary leaks from anastomotic suture lines or cut donor liver surfaces can cause severe postoperative complications . from the pediatric liver transplant literature , the use of tachosil has been found to be both safe and effective in controlling hemorrhage from split liver donor grafts . application is directed at all cut - liver surfaces with mild - to - moderate bleeding after primary hemostasis has been achieved . tachosil has also been found to be effective in decreasing the frequency of bile duct leaks after adult split liver transplantation . from two consecutive cohorts of 16 patients , groups were treated either with the tachosil or fibrin glue on the cut surface of the donor liver . bile leaks were found to be significantly fewer in the tachosil cohort as compared with the fibrin glue cohort ( 6.25 % versus 43.75 % , resp . , application of fibrin sealants and hemostatic agents have gained an increasing presence in the field of laparoscopic liver surgery as new designs for product delivery have been constructed specifically for laparoscopy . tachosil is approved for laparoscopic surgery in europe , however its application in laparoscopic liver surgery remains somewhat challenging and depends on individual surgical skill sets for mainly two reasons : ( 1 ) the active components can be disrupted from the collagen sheet , particularly when passed through a laparoscopic port and ( 2 ) the fibrinogen and thrombin coated sheet , once in contact with blood or body fluids , is activated immediately and thus becomes difficult to manipulate due to its sticky consistency . innovative techniques for intracorporeal tachocomb delivery have been previously published including a fan - shaped device or small rubber tube to introduce small strips of the hemostatic agent . carbon and colleagues have also published results of successful hemorrhagic spleen repair using sheets of tachocomb delivered through a special minimally invasive applicator system . at this time , the majority of published reviews of tachosil in laparoscopic abdominal surgery have been limited to urologic surgery or splenic repair . a report from low and colleagues , describes the use of a liquid fibrin sealant and tachosil to control a spontaneous splenic capsule rupture during a laparoscopic liver resection for colorectal metastasis . in this case , pringle maneuver was applied in addition to the hemostatic agents to gain hemostatic control and allow for splenic salvage . additional studies are needed to further evaluate the role of tachosil in laparoscopic liver surgery and to compare topical hemostatic agents and their use in laparoscopy . to date , evidence regarding the use of tachosil in pancreatic surgery stems largely from retrospective reviews and small case series . anecdotally , this evidence has supported the idea that tachosil may decrease rates of pancreatic fistula formation secondary to its tissue sealant properties . investigative reviews however , have not definitively supported these conclusions and conflicting recommendations have resulted . lorenz and colleagues have reported on a retrospective analysis of 46 distal pancreatic resection comparing stapled versus sutured closure of the pancreatic stump in which tachocomb was applied to approximately 50 % of cases in both groups . no significant differences were found in postoperative morbidity or pancreatic fistula rate between groups , but improved outcomes tended to be superior with staple closure , with and without tachocomb . specifically , even though there were no statistically significant differences , there were fewer leaks ( 1 versus 7 ) and none requiring surgical revision in the staple closure group ( versus 2 patients with suture closure ) . no subset analysis was performed of patients who received tachocomb in the suture closure and staple closure groups for determination of pancreatic fistula rate . in another series , patients undergoing open pancreaticoduodenectomy , a roux - en - y pancreaticojejunostomy reconstruction was reinforced with tachosil on the pancreaticojejunal suture line . there were 27 patients in each group ; three patients in the non - tachosil group had a postoperative pancreatic fistula ( popf ) while only one in the tachosil group did . while the results were not statistically significant , investigators have suggested that tachosil may help prevent popf . from the laparoscopic experience , rosk andcolleagues have reported a 10 % pancreatic fistula rate following laparoscopic pancreatic resections including distal pancreatectomy and pancreatic enucleation . beginning in 2005 , the investigators began sealing the resection margin of remaining pancreas with tachosil ; however , they did not report a change in fistula formation following this addition . a second review of laparoscopic distal pancreatic resections in 121 patients by this group found that the addition of the tachosil patch to the distal pancreatic resection line ( also starting in 2005 ) did not affect occurrence of popf or the length of hospital stay . however , supportive evidence has been described for the use of collagen fleece products for hemostatic control in pancreas surgery and in the setting of surgery for acute pancreatitis . preclinical testing involving animal models have been used to study the hemostatic and sealant abilities of tachosil under hyperfibrinolytic conditions such as acute pancreatitis . a swine model of acute pancreatitiswas induced by retrograde injection of bile into the pancreatic duct with subsequent duct ligation . hemostatic efficacy was assessed immediately and at 72 hours and was found to be equally effective . even under conditions of increased intraorgan pressure created by ligation of the splenic vein and administration of adrenaline , hemostasis , and tissue sealing efficacy were not adversely affected by severe hyperfibrinolytic conditions . furthermore , initial clinical experience with tachocomb , published in 1990 , reviewed patients undergoing pancreatic resection for pancreatic carcinoma , necrotizing pancreatitis , and chronic pancreatitis . in this series of 30 patients , collagenic fleece was useful in controlling bleeding from the retroperitoneum and pancreatic bed following resection . a comprehensive review of fibrin sealants in pancreatic surgery published in 2009 highlights the fact that the body of the current literature does not provide conclusive evidence of the utility of fibrin sealants in pancreatic surgery . at this point , the ability of fibrin sealants to decrease pancreatic fistula rate remains at best , speculative . randomized large - scale trials are necessary to provide conclusive evidence as to the use of tachosil and other fibrin sealants in pancreatic surgery . one is currently underway in france and results are expected in mid - to - late 2012 . currently , a randomized , open label , parallel group , multicenter trial is underway in the united states to evaluate the use of tachosil in open liver surgery . in this study , the efficacy and safety of tachosil will be compared with surgicel original for secondary treatment of local bleeding in open hepatic resection surgery . the primary objective is to show that tachosil is superior to surgicel original as a secondary hemostat when conducting hepatic resections . the primary endpoint is intraoperative hemostasis 3 minutes after the application of the randomized treatment . other endpoints considered in this study are the need for additional agents to reach adequate hemostatic control , the number and type of agents applied , and the failure rate with regard to achieving hemostasis . this trial is currently enrolling patients and primary results from this study are anticipated in late 2012 . in conclusion , progress continues to be made in topical hemostatic agents for hepatobiliary and pancreas surgery ; however , the search for the ideal agent continues . tachosil is a promising hemostatic agent which is a third generation equine collagen fleece patch , delivering human fibrinogen and human thrombin directly to the site of bleeding for hemostasis and tissue sealing . its applications in hepatobiliary and pancreas surgery have proven effectiveness in hemostasis and excellence as a tissue sealant . future randomized controlled trials are needed to determine its ability to control biliary leakage and pancreatic fistula output . further studies to delineate the role of tachosil and other fibrin sealants in laparoscopic surgery are also needed to demonstrate improved effectiveness and applicability .\noutput:\n" }, { "from": "agent", "value": "background . despite progress in surgical techniques applied during hepatobiliary and pancreas ( hpb ) surgery , bleeding and bile leak remain significant contributors to postoperative mortality and morbidity . topical hemostatics have been developed and utilized across surgical specialties , but data regarding effectiveness remains inconsistent and sparse in hpb surgery . methods . a comprehensive search for studies and reviews on hemostatics in hpb surgery was performed via an october 2011 query of medline , embase , and cochrane library . in - depth evaluation of a novel carrier - bound fibrin sealant ( tachosil ) was also performed . results . the literature review illustrates multiple attempts have been made at developing different topical hemostatics and sealants to aid in surgical procedures . in hpb surgery , efforts have been directed at decreasing bleeding , biliary leakage , and pancreatic fistula . conflicting scientific evidence exists regarding the effectiveness of these agents . critical evaluation of the literature demonstrates tachosil is a valuable tool in achieving hemostasis , and possibly biliostasis and pancreatic fistula prevention . conclusion . while progress has been made in topical hemostatics for hpb surgery , an ideal agent has not yet been identified . tachosil is promising , but larger randomized , controlled clinical trials are required to more fully evaluate its efficacy in reducing bleeding , biliary leakage , and pancreatic fistulas in hpb surgery ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: population is aging in the united states and nearly worldwide . the us census bureau projects that the very elderly population ( age 80 ) will grow from 5.8 million ( 1.8 % of the population ) in 2012 to 13 million ( 3.2 % ) by 2050 . heart valves are well known to degenerate with aging , affecting up to 13.2 % patients age 75 years . with limited nonsurgical treatment options for valvular heart diseases and significant clinical morbidity and mortality , it is foreseeable that valve replacement operations will be performed for more elderly in the future . with limited organ function reserve , increasing comorbidities , and reduced adaptive capacity , the elderly are at high risk for postoperative complications such as aki . aging alone is a significant risk factor for aki , and the severity of aki is proportional to the poor outcomes including morbidity and mortality . data on the incidence , severity , and outcomes of aki in octogenarians undergoing heart valve surgery is , however , scarce . the aim of this study is to determine aki occurrence , severity , and outcomes in a cohort of octogenarians undergoing valve replacement surgery . the institutional review board approved the study . between 2002 and 2003 , 210 octogenarians with symptomatic cardiac valve disease underwent valve replacement surgery who were not on hemodialysis and without kidney transplant . survival was censored based on death dates in the institutional records and publically accessible social security death index http://www.genealogybank.com / gbnk / ssdi / . preexisting chronic kidney disease ( ckd ) was defined based on primary physician 's documentation within six months of the surgery . baseline serum creatinine ( s.cr , in mg / dl ) was defined as the s.cr measurement within three months of the index admission . estimated gfr was calculated based on the chronic kidney disease epidemiology collaboration ( ckd - epi ) . acute kidney injury ( aki ) was defined as an abrupt ( within 48 hours ) increase in s.cr 0.3 mg / dl or s.cr increase by 50 % from baseline within seven days postoperatively . the akin criteria classify aki into the following : stage 1 , s.cr elevation 1.5 times the baseline s.cr ; stage 2 , 2 times the baseline s.cr ; stage 3 , 3 times the baseline s.cr , s.cr 4.0 mg / dl or complete loss of kidney function requiring renal replacement therapy . net fluid balance equaled to fluid input minus fluid output ( in liters ) . statistical analysis was performed using jmp version 10.0.0 . for categorical variables , fisher 's exactfor continuous variables , student 's t - test was applied for comparison between the aki and non - aki cohorts . the results are reported as percentage frequencies and means standard deviation ( sd ) . stepwise backward logistic regressions were performed to derive the final multivariate model taking into consideration colinearity , interaction , and number of patients who expressed the outcome of interest . cox proportional hazard regression modeling was used to compare survival in the two cohorts adjusted for age and comorbidity . the 209 octogenarians represented 16 % of the total patients undergoing valve replacement surgery at mayo clinic rochester in 2002 and 2003 .184 ( 88.0 % ) of the 209 underwent aortic valve replacement ( avr ) , 13 ( 6.2 % ) mitral valve replacement ( mvr ) , 2 ( 1.0 % ) tricuspid valve replacement ( tvr ) , and 10 ( 4.8 % ) combined valve replacement ( 6 av - mv , 1 av - tv , 2 mv - tv , and 1 pv - tv ) . preoperative characteristics of the cohort showed a median age of 84.1 years and a mean charlson comorbidity score of 2.631.76 ( table 1 ) .127 ( 60.8 % ) patients had preexisting hypertension and 35 ( 16.7 % ) patients had a prior myocardial infarction . thirty - four ( 16.3 % ) patients had a diagnosis of ckd with a mean s.cr of 1.70.31 mg / dl corresponding to an egfr of 34.310.0 ml / min / bsa , whereas 175 non - ckd patients had s.cr of 1.150.20 mg / dl , egfr of 52.811.0 ml / min / bsa , p 0.0001 ( table 2 ) . ninety - eight of 209 patients ( 46.8 % ) developed postoperative aki , of which 13 ( 6.2 % ) required renal replacement therapy ( 7 from the ckd group and 6 from the non - ckd group ) . patients with preexisting ckd were at higher risk for postoperative aki , 26 ( 76.5 % ) versus 72 ( 41.1 % ) in non - ckd , p = 0.0002 . aki in ckd patients were more severe , 26.9 % versus 9.7 % in stage 3 ( table 2 ) . prior studies show that , among octogenarians undergoing avr , age 84 years had the highest odds ratio for 6 - month mortality . the egfr was different , 52.5 ml / min / bsa in those age 84 ( n = 101 ) and 47.2 ml / min / bsa in age 84 ( n = 108 ) , p = 0.003 . however , the aki occurrence between the two age groups did not differ , 44.4 versus 49.5 % , p 0.05 . the proportion of aki patients in stages 1 , 2 , and 3 was also not different in the two age groups . the 6 - month mortality rate was likewise comparable , 12.9 versus 12.0 % , p 0.05 . we also compared those with and without concomitant coronary artery bypass grafting ( cabg ) , as previous studies had shown conflicting results on the effect of concomitant cabg on mortality . in our cohortone - year mortality rate in the two groups was comparable , 13.9 % with cabg versus 21.8 % without cabg , p = 0.14 . the number of bypassed vessels did not affect the 30 - day , 6 - month , or 1 - year mortality ( data not shown ) . aki patients tended to have preexisting ckd , prior myocardial infarction , higher charlson comorbidity index , and lower preoperative hemoglobin ( table 3 ) . intraoperative factors associated with aki included longer surgical duration , intra - aortic balloon pump use , lower intraoperative nadir hemoglobin , and higher volume of blood transfusion and fluids / saline infusion ( table 3 ) . additionally , aki patients were possibly more likely to have a higher bmi and atherosclerotic vascular diseases , although p value did not reach statistical significance . univariate analysis showed prior mi , ckd , higher charlson comorbidity index , lower preoperative hemoglobin , longer surgical duration , blood transfusion , and intraoperative fluid and saline administration as potential risk factors . 0.001 ) , intraoperative fluid administration ( or 1.10 , ci 1.011.21 , p = 0.03 ) and intraoperative saline infusion ( or 1.52 , ci 1.052.24 , p = 0.02 ) were shown as independent predictors for aki ( tables 4 ( a ) and 4 ( b ) ) . length of hospital stay ( los ) was longer for aki patients 14.011.7 days versus 9.24.2 days for non - aki patients , p 0.0001 . patient disposition was different in octogenarians with and without aki ( figure 1 , p = 0.001 ) . more aki patients discharged to skilled nursing facilities ( 41.8 % aki versus 30.6 % non - aki ) and fewer to home ( 33.7 % aki versus 53.2 % non - aki ) , reflecting a higher level of functional impairment in patients with aki , which is known to be associated with a high long - term mortality rate . the disposition to a swing bed , another hospital adjacent to patient 's home , was not different between the aki and non - aki groups . among surviving aki patients , s.cr at the time of hospital discharge was higher in aki patients , 1.460.56 mg / dl versus 1.090.25 mg / dl in non - aki patients , p 0.0001 . long - term follow - up for s.cr values after hospitalization was limited by our hospital being a large referral center . many patients received their nonsurgical care at local care facilities geographically removed from mayo clinic . for those who continued regular nonsurgical follow - up with us , a persistent separation ofs.cr values between the aki and non - aki groups was observed ( figure 2 ( a ) ) . . in - hospital mortality in aki patients was 10-fold higher than the mortality in non - aki octogenarians , 12.2 % versus 0.9 % , p = 0.0003 .30 - day postsurgery mortality for aki group was 10.2 % versus 0.9 % in non - aki groups , p = 0.003 . for the 13 aki patients who required dialysis , 46 % died within 30 days after surgery , 84.6 % died within 1 year , and 92.3 % died within 5 years ( figure 2 ( b ) ) . only two of the dialysis patients were able to come off dialysis at the time of discharge . aki patients showed a 1 - year mortality of 23.5 % versus 11.7 % in non - aki patients , p = 0.02 . figure 2 ( c ) shows 1 - year survival in non - aki and aki ( stages 13 ) octogenarians . kaplan - meier analysis of survival in non - aki and aki octogenarians with a mean follow - up of 3.944.04 years demonstrates a higher mortality rate in postoperative aki octogenarians than those without aki , p = 0.02 ( figure 2 ( d ) ) . unadjusted cox proportional hazard model showed that aki stage 3 was a significant contributor to 1 - year patient mortality and aki stage 2 was nearly significant ( table 5 ( a ) ) . cox proportional hazard model adjusted for age and charlson comorbidity score showed that aki stage 3 independently contributed to the 1 - year mortality , hr 13.6 , 95 % ci : 5.433.9 , p 0.0001 ( table 5 ( b ) ) . in this study of octogenarians undergoing heart valve replacement surgery , we show that the incidence of postoperative aki was nearly 50 % . moreover , aki occurrence is associated with a prolonged hospital stay , increased need for higher level of care following discharge , persistently reduced kidney function , and reduced short - term and long - term patient survival . demand for heart valvular surgery in octogenarians is expected to increase as the population ages . studies have shown that valve replacement surgeries have acceptable mortality rates in the very elderly . at mayo clinic rochester , over 16 % of valve replacement surgeries in 2002 and 2003 were performed for octogenarians . although less invasive transcatheter aortic valve implantation ( tavi ) has recently been introduced into practice , there has been wide center - to - center variation in the rates of postprocedural complications ( aki , stroke , and mortality ) , 4.7 to over 20 % , and the procedure is limited to the aortic valve replacement . older age and preexisting ckd are major risk factors for aki . aki in hospitalized patients tends to progress to end - stage renal failure , especially for the elderly , and raises mortality . available studies examine primarily postoperative mortality ; when renal impairments are mentioned , no specific definitions , such as akin / rifle criteria , were applied . the 30 - day mortality rates in most studies range from 3.4 to 8.5 % after aortic valve replacement and 18.2 to 18.5 % after mitral valve replacement . the current study , involving all valve replacement surgeries in 209 octogenarians , shows a 30 - day mortality of ~ 5 % and 1 - year mortality of 17 % , roughly in line with previous study results . new to the existing literature is that deaths in this cohort of octogenarians occurred almost exclusively in those with aki ( table 5 ( a ) ) . notably , a small preoperative s.cr difference of ~ 0.5 mg / dl between non - ckd and ckd patients reflected an egfr difference of ~ 20 ml / min / bsa ( from 52.8 to 34.3 ml / min / bsa ) and nearly a doubling of aki occurrence . moreover , longer follow - up allowed for long - term outcome assessment , showing a persistently poor kidney function and higher mortality among aki octogenarians . predictors for aki by univariate analysis in this cohort of octogenarians were a higher charlson comorbidity index , preexisting ckd , prior myocardial infarction , preoperative anemia , surgical duration , intraoperative fluid administration , low intraoperative hemoglobin , and blood transfusion . stepwise multivariate analysis adjusting for relevant univariate risk factors showed that chf , ckd , total intraoperative fluids , and saline infusion are independent predictors for postoperative aki in this cohort of octogenarians ( tables 4 ( a ) and 4 ( b ) ) . excessive intravenous fluids , especially 0.9 % saline , have been associated with the development of postoperative complications and aki . volume overload in the setting of aki has been shown to be associated with poor clinical outcomes including mortality . cox proportional hazard regression was performed to explore survival differences between aki and non - aki octogenarians adjusted for age and comorbidity ( table 5 ) . mortality rates in aki octogenarians were ~ 10 % , 25 % , and 50 % in 30 days , 1 year , and 5 years , respectively . although difficult to make a direct comparison , our results are not inferior to the mortality rates in previous studies inclusive of adult aki patients of all ages showing in - hospital mortality rates of ~ 2050 % . among 13 dialysis octogenarians in the current study , 46 % died at 30 days after operation . despite a high mortality rate , it is not inferior to the results generated in nonelderly adult aki - dialysis patients of 55 % . in the current study , concomitant cabg or number of coronary vessels bypassed did not increase the rate of aki ( table 2 ) or mortality , consistent with previous studies showing no mortality impact in concomitant cabg to valve surgery . there were , however , also studies showing an increase or decrease in mortality in valve surgery with cabg . reported mortality rates of 8.4 % at 30 days , 15.2 % at 6 months , and 26 % at 1 year in octogenarians undergoing avr . we did not find age 84 to have been associated with higher aki or mortality . this discrepancy could have been due to a small difference in egfr and similar charlson index in our cohorts . showed that the predictors for mortality in octogenarians following avr are poor preoperative ef and heart failure . our data did not show these being the significant risks for aki or mortality , although our study patients might be different from theirs . no studies , however , have explored in detail the relationship between post - valve - surgery aki and patient 's outcomes including disposition , long - term kidney function , and patient survival in octogenarians , as shown in the current study . approximately two - thirds of aki progress to a severe stage , which is associated with a further increase in mortality . our results support the early involvement of nephrology in the care of octogenarians with aki , especially for those with reduced preoperative egfr and those with a small increase in postsurgery s.cr ( 0.3 mg / dl ) . in practice , that said , confirmatory evidence of the beneficial effects of nephrology involvement should be further studied . first , the nature of the observational cohort study limited consistency in the timing of laboratory testing for creatinine and hemoglobin values , which could influence their values . however , surgical patients are unique in that we knew precisely the time of insult ( surgery ) . furthermore , a single center study prevented large variation in practice and routine blood draws were relatively fixed in time of day . second , our data were collected in 2002 and 2003 , which may not precisely reflect present - day outcomes . however , there has not been a major practice change in valve replacement surgery , and data over an uninterrupted period allowed longitudinal follow - up of patients ' outcomes . third , the majority of our patients are caucasian , with only one black patient and a few patients of other races , which limits the application of our results to other races . fourth , aki patients received more intravenous fluids , which could dilute s.cr and underestimate aki severity . however , even with this limitation , we still found significant poor clinical outcomes associated with aki . fifth , data on the administration of hydroxyethyl starch ( he s ) and aprotinin , known to be associated with aki , were not analyzed because these agents were used occasionally and unlikely to have affected the results . lastly , the association between aki and poor clinical outcomes could potentially be affected by the preexisting ckd . the strong effect of ckd may hinder the determination of true impact of aki on patients ' outcomes . nonetheless , severe aki stood out as an independent risk factor for mortality in our cohort . we believe that even mild - to - moderate degrees of aki could potentially exert negative impact on patient survival , although the signal may have been overwhelmed by the extraordinarily strong effect of preexisting ckd . taken together , ckd is a strong reason for increased mortality after aki , but aki independently contributed to the poor patient outcomes . overall , our data show that octogenarians are able to tolerate heart valve replacement surgery . however , the aki occurrence rate is substantial and aki impacts patients ' mortality and morbidity . better patient selection , preoperative preparation , and avoidance of operative risk factors can minimize the aki risk and adverse consequences .\noutput:\n" }, { "from": "agent", "value": "background . the study investigates the occurrence , severity , and outcomes of acute kidney injury ( aki ) in octogenarians following heart valve surgery . methods . all patients , age > 80 years , not on dialysis and without kidney transplant , undergoing heart valve replacement at mayo clinic , rochester , in the years 2002 - 2003 were enrolled . aki was diagnosed based on akin criteria . results . 209 octogenarians ( 88.0 % aortic valve , 6.2 % mitral valve , 1.0 % tricuspid valve , and 4.8 % multivalve ) with ( 58.4 % ) and without cabg were studied . 34 ( 16.3 % ) had preexisting ckd . after surgery , 98 ( 46.8 % ) developed aki . 76.5 % of the aki were in stage 1 , 9.2 % in stage 2 , and 14.3 % in stage 3 . 76.5 % ckd patients developed aki . length of hospital stay was longer for aki patients . more aki patients were discharged to care facilities . patient survival at 30 days and 1 year for aki versus non - aki was 88.8 versus 98.7 % , p = 0.003 , and 76.5 versus 88.3 % , p = 0.025 , respectively . with follow - up of 3.94 0.28 years , kaplan - meier analysis showed a reduced survival for aki octogenarians . preexisting ckd and large volume intraoperative fluid administration were independent aki predictors . conclusions . nearly half of the octogenarians developed aki after valve replacement surgery . aki was associated with significant functional impairment and reduced survival ." } ]

[ { "from": "human", "value": "***task***\nthe task is to summarize an input biomedical literature in six sentences\n\n***input***\nthe input is a biomedical literature\n\n***output***\nthe output is the summary of an input biomedical literature in six sentences\n\n***documentation***\n\n***examples***\n\ninput: since the popularization of the concept of hmos during the 1970s , there has been concern that this approach to financing and organizing health services would not fit in the rural environment ( appel and schlenker , 1976 ) . although from the beginning there have been proponents who have suggested that hmos provide increased access to care in rural communities ( hillis and miller , 1974 ; less , 1975 ; ross , 1975 ) , an early analysis of the potential for rural hmos concluded that the prepaid managed - care concept was not feasible in rural locations from a competitive standpoint ( cattani et al . , 1975 ) . despite the longstanding and continuing existence of hmos completely in rural areas ( nycz et al . , 1976 ; korczyk and witte , 1992 ) , concern remains among rural health planners as it has become evident that the prevailing trend in medical economics is toward a complete dominance of the market by managed - care systems . unlike traditional indemnity plans , some types of hmos ( such as staff models ) require a threshold number of subscribers to support the capital needs of the staffed delivery system or to provide some actuarial basis for distributing risk . a recent study of 23 hmos by mathematica policy research , inc . observed that hmos tend to expand into new areas based on both the potential for growth in enrollment and also the potential for access to services for the new enrollees ( felt , frazer , and gold , 1994 ) . because of the need for both a threshold population to meet actuarial requirements and the demand for adequate provider resources to serve the people brought into the plan , there has been concern that hmos may not represent viable health care delivery systems in many rural areas of the united states , a conclusion that was echoed when the promise of managed competition for rural areas was assessed ( kronick et al . , this article examines the expansion of hmo service areas into rural areas geographically and by type of hmo . the study attempts to answer two questions : ( 1 ) how do the patterns of rural county inclusion in hmo service areas differ across hmo models ( i.e. , staff , ipa , etc . ) ? ( 2 ) what are the characteristics that distinguish rural counties that are served by hmos from those that are not ? the analysis is intended to guide policymakers who are assessing the potential for managed care to improve access and affordability for all americans no matter where they live . rural prepaid systems were in place as early as 1842 ( ross , 1975 ) and one of the earliest examples of the modern concept of prepayment was established in a rural area by michael shadid and the farmers union in elk city , oklahoma ( starr , 1982 ) . rural health cooperatives were set up in the 1930s with the support of the farm security administration , enrolling as many as 600,000 low - income people . these attempts to meet the health care needs of rural populationswere abandoned for reasons that kept prepaid systems from emerging throughout the period prior to 1970 , primarily opposition from organized medicine . in an outline of the development of hmos in rural areas , christianson ( 1989 ) and christianson and grogan ( 1990 ) emphasized both the exceptional nature of these hmos and the very small number of persons actually enrolled in the few operating rural hmos . there is no single authoritative source that tracks the penetration of managed - care programs into rural places . states individually license and monitor companies providing health insurance ( including managed care ) , and may or may not require detailed geographic information on markets to be reported . christianson et al . ( 1986 ) used a 1984 census of hmos conducted by interstudy , inc . to assess the degree of hmo penetration in rural counties and to briefly discuss the change in penetration between 1981 and 1984the authors identified 118 hmos serving rural areas in 34 states , a 50 - percent increase from an earlier survey . this analysis indicated the number of hmos and counties being served but did not differentiate the penetration of staff versus other types of managed - care organizations . the group health association of america ( ghaa ) ( 1993a ) produces an annual national directory of hmos which contains basic descriptive information provided by each hmo , including organizational type and service area . this data source was used in the article by serrato , brown , and bergeron ( 1995 ) in this issue in their analysis of hmo coverage for rural medicare beneficiaries . out of the 592 hmos listed in 1990 , the authors identified 301 hmos that had at least one rural ( non - metropolitan ) county in their service area and 11 which served only non - metropolitan counties . however , the study was focused on medicare plans and did not fully examine all rural hmos . serrato , brown , and bergeron did find that overall penetration of medicare coverage into rural areas was low and that this penetration was selective ; medicare enrollees were more likely to be offered coverage by hmos serving rural areas with higher payment rates under the adjusted average per capita cost ( aapcc ) system , greater potential demand , and more medical resources . descriptive statistics using data from the ghaa national directory of hmos ( group health association of america , 1993a ) were presented in a congressional research service ( crs ) paper discussing managed competition in rural areas ( fuchs , 1994 ) . the crs study identified a total of 541 hmos which were in operation in 1992 . of these , 56 ( 10.3 percent ) were staff models , 67 ( 12.4 percent ) were groups , 87 ( 16.1 percent ) were networks , and 331 ( 61.2 percent ) were ipas ( group health association of america , 1993b ) . this listing is by primary type ; overall , 6 percent of all hmos are a mixture of types , with 49 percent staff , 28 percent network , 13 percent group , and 8 percent of ipa hmos mixed with some other type . the fuchs review also cited an unpublished 1992 study conducted by wholey which assessed adjacency as a predictor of inclusion of a rural county in an hmo service area . his results indicated that hmos served 845 rural ( non - metropolitan ) counties and that non - metropolitan counties adjacent to metropolitan areas were almost 2.5 times more likely to be included in an hmo market area than were counties not adjacent to metropolitan areas . even though the potential for rural hmos remains an open question ( serrato , brown , and bergeron , 1995 ) , the congress has encouraged policies to support the development of rural managed - care systems . this is evidenced by the funding for managed - care demonstrations in rural america which is included in appropriations for the agency for health care policy and research ( ahcpr ) ( u.s . that program has funded five projects intended to demonstrate the advantages of managed care for rural communities which , in the words of ahcpr administrator clifton gaus , are of proven value and available in metropolitan areas , but are frequently unavailable to rural populationsthis study uses the methods employed by serrato , brown , and bergeron ( 1995 ) of abstracting information from the ghaa national directory of hmos ( 1993a ) . the name , type , age , medicare coverage status , and county - defined service area for each hmo were entered into a data base . where the service areas were not listed as counties , the hmo was contacted and counties were identified and entered . where cities were identified , the county or counties including the city were listed as the service area . the former because it is treated as one county ; the latter because of its unique health care environment . variables representing county characteristics were drawn primarily from the area resource file and special files provided by the office of shortage designation , bureau of primary health care , hrsa , dhhs . bureau of health professions to track health professions ' supply and trends and includes numerous county - level descriptors drawn from other data bases including the u.s . census , the american medical association physician masterfile , the american hospital association annual survey , medicare and medicaid files , and other sources that compile county - level data . these files were linked to the hmo inventory file through common federal information processing standard ( fips ) codes . for the purpose of identifying non - metropolitan counties and assigning degree of rurality to them , this study made use of a county - level classification system developed by the u.s . department of agriculture the urbanicity code or parker - ghelfi system ( ghelfi et al . , this system is particularly appropriate here because , in addition to considering the population of the county itself , it also differentiates non - metropolitan counties according to their relationship to larger metropolitan areas , which allows the analysis to consider both size and adjacency as factors affecting market choices . counties are categorized into six levels : large metropolitan , small metropolitan , non - metropolitan adjacent to large metropolitan , non - metropolitan adjacent to small metropolitan , non - metropolitan non - adjacent with city 10,000 population , and non - metropolitan non - adjacent with no city 10,000 . the classification system depends upon 1990 u.s . census data and 1990 office of management and budget classification of counties . the classification of counties by the office of management and budget as metropolitan and non - metropolitan is not done according to any set schedule and changes may be made at any time during the year . because of this , the total number of counties listed as non - metropolitan may not agree with extant listings unless the dates of the classifications coincide . descriptive statistics across county types , hmo model types , and states were generated using the sas data management and statistical system ( version 6.1 ) . maps of the locations of the hmo service areas and the change in those service areas were created using the mapinfo mapping software ( version 3.0 ) . the maps differentiate only between metropolitan and non - metropolitan counties ; for technical reasons , service areas were not mapped across all dimensions of rurality . in the large counties of the western states , the classificationsrural communities and remote populations are often included in counties which also have very large , densely settled urban areas and are classified as metropolitan . the geographic and cartographic examination of the distribution of the hmos was supplemented by a multivariate regression analysis in order to identify those county characteristics which predict inclusion in an hmo service area . two versions of a logistic regression with the county as the unit of analysis were estimated using the stata statistical software ( version 3.1 ) . the first model estimated the probability of inclusion in any hmo service area , and the second model estimated the probability of inclusion in staff , group , or network hmos , with ipa models excluded . to assess the association between rurality and the probability of being in an hmo service area , dummy variables for each urbanicity codeit was also hypothesized that counties which were more populous , wealthier , had more medical resources , and were adjacent to more urban counties were more likely to be included in an hmo service area . therefore , additional independent variables included : designation as a part - or whole - county health professional shortage area ( hpsa ) at any time between 1978 and 1990 or designation as a chronic hpsa ( with no hpsa at any point as the comparison category ) ; the county 's medically underserved area ( mua ) index in 1992 ; the population as reported by the u.s . bureau of the census in 1990 ( natural log ) ; the population density in 1990 ( natural log ) ; the mean per capita income for the county in 1990 ( natural log ) ; the percentage of workforce unemployed in 1990 ( natural log ) ; the percentage of the population minority ( natural log ) ; and the population in 1990 of the largest adjacent county ( natural log ) . the inclusion of the population of the largest adjacent county was considered to account for multi - county market influences , with the population standing in for potential complexity of the market and of hmo activity . although it would have been desirable to also include measures of provider and hospital bed availability , these variables were found to be endogenous to the model . a final estimation problem was the inability to control for differences in state - level policies . differing degrees of regulation , oversight , or support for hmos might have caused a variable level of service area inclusion across individual states . however , the hmo service areas in some states include all counties , and those states would be eliminated from the analysis due to perfect prediction . in an attempt to control for the differing degrees of receptivity towards hmos across states , a final dummyvariable was included which indicated whether the county was in a state with three or more operating hmos in 1980 . serrato , brown , and bergeron ( 1995 ) found that the aapcc rate was a strong indicator of a county having a medicare hmo option . however , because the aapcc rates are highly volatile and potentially not a stable factor in market decisions ( physician payment review commission , 1995 ) , the aapcc rate was not included in the model . this study uses the methods employed by serrato , brown , and bergeron ( 1995 ) of abstracting information from the ghaa national directory of hmos ( 1993a ) . the name , type , age , medicare coverage status , and county - defined service area for each hmo were entered into a data base . where the service areas were not listed as counties , the hmo was contacted and counties were identified and entered . where cities were identified , the county or counties including the city were listed as the service area . the former because it is treated as one county ; the latter because of its unique health care environment . variables representing county characteristics were drawn primarily from the area resource file and special files provided by the office of shortage designation , bureau of primary health care , hrsa , dhhs . bureau of health professions to track health professions ' supply and trends and includes numerous county - level descriptors drawn from other data bases including the u.s . census , the american medical association physician masterfile , the american hospital association annual survey , medicare and medicaid files , and other sources that compile county - level data . these files were linked to the hmo inventory file through common federal information processing standard ( fips ) codes . for the purpose of identifying non - metropolitan counties and assigning degree of rurality to them , this study made use of a county - level classification system developed by the u.s . department of agriculture the urbanicity code or parker - ghelfi system ( ghelfi et al . , this system is particularly appropriate here because , in addition to considering the population of the county itself , it also differentiates non - metropolitan counties according to their relationship to larger metropolitan areas , which allows the analysis to consider both size and adjacency as factors affecting market choices . counties are categorized into six levels : large metropolitan , small metropolitan , non - metropolitan adjacent to large metropolitan , non - metropolitan adjacent to small metropolitan , non - metropolitan non - adjacent with city 10,000 population , and non - metropolitan non - adjacent with no city 10,000 . the classification system depends upon 1990 u.s . census data and 1990 office of management and budget classification of counties . the classification of counties by the office of management and budget as metropolitan and non - metropolitan is not done according to any set schedule and changes may be made at any time during the year . because of this , the total number of counties listed as non - metropolitan may not agree with extant listings unless the dates of the classifications coincide . descriptive statistics across county types , hmo model types , and states were generated using the sas data management and statistical system ( version 6.1 ) . maps of the locations of the hmo service areas and the change in those service areas were created using the mapinfo mapping software ( version 3.0 ) . the maps differentiate only between metropolitan and non - metropolitan counties ; for technical reasons , service areas were not mapped across all dimensions of rurality . in the large counties of the western states , the classificationsrural communities and remote populations are often included in counties which also have very large , densely settled urban areas and are classified as metropolitan . the geographic and cartographic examination of the distribution of the hmoswas supplemented by a multivariate regression analysis in order to identify those county characteristics which predict inclusion in an hmo service area . two versions of a logistic regression with the county as the unit of analysis were estimated using the stata statistical software ( version 3.1 ) . the first model estimated the probability of inclusion in any hmo service area , and the second model estimated the probability of inclusion in staff , group , or network hmos , with ipa models excluded . to assess the association between rurality and the probability of being in an hmo service area , dummy variables for each urbanicity code were included in the model , with large metropolitan as the reference category . it was also hypothesized that counties which were more populous , wealthier , had more medical resources , and were adjacent to more urban counties were more likely to be included in an hmo service area . therefore , additional independent variables included : designation as a part - or whole - county health professional shortage area ( hpsa ) at any time between 1978 and 1990 or designation as a chronic hpsa ( with no hpsa at any point as the comparison category ) ; the county 's medically underserved area ( mua ) index in 1992 ; the population as reported by the u.s . bureau of the census in 1990 ( natural log ) ; the population density in 1990 ( natural log ) ; the mean per capita income for the county in 1990 ( natural log ) ; the percentage of workforce unemployed in 1990 ( natural log ) ; the percentage of the population minority ( natural log ) ; and the population in 1990 of the largest adjacent county ( natural log ) . the inclusion of the population of the largest adjacent county was considered to account for multi - county market influences , with the population standing in for potential complexity of the market and of hmo activity . although it would have been desirable to also include measures of provider and hospital bed availability , these variables were found to be endogenous to the model . a final estimation problem was the inability to control for differences in state - level policies . differing degrees of regulation , oversight , or support for hmos might have caused a variable level of service area inclusion across individual states . however , the hmo service areas in some states include all counties , and those states would be eliminated from the analysis due to perfect prediction . in an attempt to control for the differing degrees of receptivity towards hmos across states , a final dummy variable was included which indicated whether the county was in a state with three or more operating hmos in 1980 . serrato , brown , and bergeron ( 1995 ) found that the aapcc rate was a strong indicator of a county having a medicare hmo option . however , because the aapcc rates are highly volatile and potentially not a stable factor in market decisions ( physician payment review commission , 1995 ) , the aapcc rate was not included in the model . the inventory of hmos indicated that , of the 544 total hmos included in the analysis file , 218 ( 40.1 percent ) were located strictly in metropolitan counties and did not claim non - metropolitan counties in their service areas ; only 5 ( 1 percent ) were serving solely non - metropolitan counties while 321 ( 59 percent ) included both metropolitan and non - metropolitan counties in their service areas . the lighter shaded areas identify non - metropolitan counties that are not included in the service areas identified by hmos in 1992 . the pattern of markets indicates differences based on state regulation , population density , and regional hmo market activity . table 1 lists the numbers of non - metropolitan counties included in hmo service areas by state and type of hmo . the table illustrates the widespread penetration of the ipa model and the very local and concentrated penetration of the staff model . group / network and mixed models are present in intermediate numbers of counties . figures 2 and 3 break the distribution down by type of hmo and the number of competing hmos in each non - metropolitan county . again , there are marked state by state differences in distribution of hmos and the degree of potential competition among hmos serving non - metropolitan areas . figure 3 reiterates the point made by table 1 that staff and group / network hmos are present in a limited number of non - metropolitan counties and concentrated in a few states , including ohio , tennessee , wisconsin , california , and oregon . although hmos have been extant for more than 20 years and were originally targeted for rural areas in the enabling federal legislation , the spread into rural areas is considered to be a recent phenomenon ( knight , 1994 ; lawrence , 1994 ; christianson et al . , 1986 ) . figures 4 and 5 indicate that the older hmos are more likely to include non - metropolitan counties in their service and market areas than the newer organizations . these findings suggest that a substantial period of time elapses between the establishment of a plan in metropolitan areas and the subsequent spread of service areas into the adjacent rural counties . , 1993 ) classification system to examine patterns of hmo service areas by non - metropolitan county location and city size . it is apparent that staff models , which are the more complex and resource - dependent type of hmos , are an urban phenomenon . that pattern does not hold as well for group and network model hmos , where 11 to 32 percent of the rural classification counties are included in service areas . the ipa hmos include the greatest number of non - metropolitan counties in their service areas . over 40 percent of the smallest and most isolated counties are included in a service area , which , though relatively fewer than the more adjacent and larger counties , indicates that the very small and remote counties are being considered and included in hmo markets . the nearly uniform decline in service area penetration by urbanicity code indicates that this classification system clearly captures market complexity . recently , the federal government has turned to managed care in an attempt to stem the rise of costs in the medicare program . the geographic distribution of hmos which offer coverage for medicare enrollees is mapped in figure 6 . non - metropolitan counties which are adjacent to large metropolitan counties are more likely than other rural counties to be included in the service area of hmos offering medicare coverage . the two models , one estimating the probability of being in any hmo service area and one estimating the probability of service by a non - ipa hmo , are displayed side by side to allow for contrast between the two estimations . in general , the individual model results agreed with the informal hypotheses presented earlier , with some important exceptions . in both models , all classes of county urbanicity had a lower probability of being in an hmo service area than the largest metropolitan counties , the reference or omitted category . population was not significant but population density was a positive and significant predictor of service area inclusion . county economic characteristics were not significant , with the exception of unemployment , which was significantly associated with the risk of being in a non - ipa hmo service area . however , the proportion of minority county population was negatively correlated with the county being in an hmo service area . as expected , the greater the population in the largest adjacent county , the greater the odds that a county would be included in a service area . the association between the dependent variable and the dummy variable that identified states that had early , relatively extensive , experience with hmos was particularly interesting . having this experiencewas significantly associated with decreased odds of being part of the service area of any hmo , but the odds of being in a service area of a staff , group , or network hmo were increased . also unexpected was the result that counties that are or were a hpsa were more likely to be in an hmo service area ( significant for all types of hmos , only significant for non - ipa in the counties which had persistent or chronic designation as hpsas ) . the variable penetration of hmo service areas into non - metropolitan counties reflects differences in state regulatory environments and the importance of state boundaries in hmo market decisions . companies which must meet the requirements of each state insurance regulator see differences in market opportunities from state to state . in addition to this insurance regulatory process , the policy environment for managed care reflects the extent to which individual states or state professional societies have encouraged or restricted group or corporate forms of health care delivery . there are also regional variations within and across states which influence decisions that are potentially more related to market potential than regulatory issues in some non - metropolitan areas . because the early and mid - term development of hmos was restricted to specific regions initially california and the west coast , the upper mid - west , arizona , and selected citiesthe pattern of expansion of hmo markets is uneven and highly dependent on the regulatory environment and the history of earlier hmo establishment . overall , it is clear that the managed - care industry sees a benefit to including many non - metropolitan communities in their service area ; the inclusion of a substantial number of non - metropolitan counties in more than one hmo service area indicates that the direst prediction that all non - metropolitan areas will not benefit from competition - based financing systems ( kronick et al . , 1994 ) may not be the case . however , the degree to which inclusion in a service area represents actual access to hmo services is not known ; it is possible that a county which is included in a service area does not have an hmo provider , or has ready access only to primary - care providers . even if a substantial number of rural counties in hmo service areas actually have reasonable access to service , there are still problems for these rural communities when it comes to being included in the managed - care market . the difference in penetration when ipas are excluded from the analysis is stark . given that the structure and operation of hmos differ widely according to their model type ( luft , 1981 ) , with staff - model hmos requiring substantial capital and personnel investment , group or network hmos requiring a range of infrastructure , and ipa or preferred provider organization ( ppo ) models requiring minimal capital or organizational structure , the lack of penetration of non - ipa hmo service areas into rural counties is not surprising . the finding implies that , while many rural areas may participate in managed - care systems , the choice of model type available to either employers or individuals may be limited . the least populous and most remote counties are not at all likely to be included in hmo markets . the two most rural classes of counties include 22.3 million people ; 55 percent of those ( 12.3 million ) are in counties that are not served by hmos . an additional 5.5 million people in the other two non - metropolitan county classifications were not included in any hmo service area in 1992 . if managed care is the guarantor of reasonable cost savings , then 17.8 million rural americans may not be able to benefit from this market - driven advantage . it is important to note that these population estimates may either understate or overstate the current population that actually has access to hmo services . to the extent that the inclusion of a county in a service area does not necessarily represent easy access to an hmo provider , however , this tendency of service areas ' to understate actual coverage could be somewhat offset by the rapid expansion occurring in the hmo market . as hmos expand their markets over time , many of the counties that were designated as service areas but did not have reasonable access to providers in 1992 may now have such access . the process of selection of rural counties for inclusion in hmo markets is not necessarily clarified by the multivariate analysis previously described . it makes sense that more populous and wealthier areas are more likely to be targeted as markets for an insurance product but the general propensity for counties in an hmo service area to be more often identified as areas with shortages of professionals does not fit the notion of a desirable market when that factor is combined with the negative relationship between hmo market inclusion and the proportion of the population minority , it might seem that the inclusion of underserved areas may be selective . when hmos make their market plans they may avoid areas with fundamental problems in their social and economic make up , but may serve areas that have effective demand for services that might be met by providers in adjacent counties .\noutput:\n" }, { "from": "agent", "value": "this study analyzes the 1993 national directory of hmos to determine the extent to which rural counties are included in health maintenance organization ( hmo ) service areas . two specific questions are addressed : ( 1 ) how do the patterns of service areas differ across hmo model types ? ( 2 ) what are the characteristics that distinguish rural counties served by hmos from those that are not ? although a majority of rural counties are in hmo service areas , substantially fewer are served by non - individual practice association ( non - ipa ) models . access to hmo services is found to decrease with county population density , and adjacency to metropolitan areas is an important predictor of inclusion in service areas ." } ]