Datasets:

autoevaluate

/

autoeval-staging-eval-project-c967fc98-8385124

like 0

ridge augmentation refers to the procedure that was performed for cases with insufficient vertical or horizontal volume of bone to augment the height or width of the alveolar ridge by executing particulated or block bone graft . ridge augmentation is a type of onlay graft , and thus , the possibility of bone resorption after grafting and dehiscence of the upper soft tissues is high . the procedure involves one wall of the bony defect , and the healing of grafted tissues is dependent on the blood supply from the recipient bone tissues . the maxillary sinus is wrapped well within its walls , and maxillary sinus bone graft shows healing similar to the wound created by tooth extraction . nevertheless , for cases whose residual bone volume is definitely insufficient and cases with poor blood supply , or to shorten the healing period , autogenous bone graft is recommended2,3 . nonetheless , due to several problems associated with the harvest of autogenous bone , recently , the possibility that autogenous tooth bone graft may be a substitution for autogenous bone graft has been suggested4 . autogenous tooth bone grafts always require that the tooth of the patient be extracted , and thus , its use is limited in many cases . therefore , familial tooth bone grafts that treat the extracted teeth of immediate family members as bone - graft materials have been introduced . a 45-year - old male patient was transferred from another dental clinic for maxillary anterior horizontal ridge augmentation . the dentist planned to insert a 6-unit fixed prosthesis after implant placement in the # 13 and # 23 areas . the condition of the # 13 and # 23 areas involved an alveolar ridge of insufficient width.(fig . 1 ) the decision was made to extract the lower right 3rd molar ( # 48 ) of the patient and to treat this tissue as autogenous tooth bone graft material . the dentist planned to extract two impacted 3rd molars from the patient 's daughter , prepare them as blocks and powder , and use them as graft materials.(figs . 2 , 3 ) on april 10th , 2010 , the lower right 3rd molar of the patient was extracted and prepared as powder - type graft material . on the same day , the impacted 3rd molars of the daughter were extracted , prepared as block and powder graft materials , and stored . on april 26th , 2010 , in the maxillary anterior edentulous area ( # 13-#23 ) , a flap was elevated by crestal incision . block graft materials were grafted to the labial side of the maxillary canine area ( # 13 and # 23 labial area ) , and additionally , powder graft materials were grafted to the vicinity with tissue adhesive ( greenplast ; green cross corp . , the area was covered with an absorbable collagen membrane ( ossix plus ; orapharma inc . , louis drive warminster , pa , usa ) , and the wound was sutured . good bone healing without special complications was observed , and the patient was returned to the referred dental clinic for implant placement.(fig . 7 ) eight months after the surgery , implantation was performed at a local clinic . the condition of horizontal ridge augmentation was good , and thus 4 implants were placed in the # 13 , # 12 , # 22 , and # 23 areas . 8 , 9 ) the final prosthesis was carried out in local clinic successfully , further follow up was not performed . a 49-year - old male patient visited our clinic for pain in the maxillary left 2nd premolar ( # 25 ) and the treatment of implants in the 1st and 2nd molar areas ( # 26-#27 ) . after diagnosis of an abscess in the # 25 root apex , tooth extraction was decided upon . the patient was scheduled to undergo extraction of the mandibular right impacted 3rd molar ( # 48 impacted molar ) . this tooth and an impacted tooth from his son were prepared as graft materials , and maxillary bone graft was performed in the # 26-#27 areas . 10 , 11 ) on april 22nd , 2010 , the # 48 was extracted , and the left impacted 3rd molar of the patient 's 22-year - old son was extracted . may 7th , 2010 , the prosthesis between the # 24-#25 area was cut , and the # 25 was extracted . a flap was elevated by performing crestal incision on the # 25-#27 area , and maxillary sinus bone graft was performed by lateral approach . autogenous and familial tooth bone graft in powder form were used as bone - graft materials . on august 3rd , 2010 , implants ( osstem ts iii sa ; osstem , seoul , korea , # 25 : 4 diameter/11.5 length , # 27 : 5 diameter/11.5 length ) were placed in the # 25 and # 27 area , in a non - submerged type . the primary stability value measured by the osstell mentor ( integration diagnostics ab , savedalen , sweden ) was shown to be # 25 : 67 implant stability quotient ( isq ) and # 27 : 71 isq , respectively.(fig . 12 ) prior to implant placement , a bony specimen was harvested from the # 27 area using a 2.0 mm diameter trephine bur . a healing abutment was connected , and the wound was sutured . on december 30 , 2010 , a final prosthesis was installed ( prosthetic treatment was performed by dr . 13 ) the bone tissue specimens collected after 3 months were examined under light microscope . it was confirmed that in the sinus bone graft area , new bone had formed actively in the vicinity of graft materials . new bones formed along the border of the graft material were woven bones , and some bones had already formed short trabecular patterns . in some areas , they formed loose anastomosis with other trabecular new bones formed along the border of other graft materials . the more developed new trabecular bones were connected to the residual alveolar bone in a pattern that was more densely anastomosed.(figs . a 45-year - old male patient was transferred from another dental clinic for maxillary anterior horizontal ridge augmentation . the dentist planned to insert a 6-unit fixed prosthesis after implant placement in the # 13 and # 23 areas . the condition of the # 13 and # 23 areas involved an alveolar ridge of insufficient width.(fig . 1 ) the decision was made to extract the lower right 3rd molar ( # 48 ) of the patient and to treat this tissue as autogenous tooth bone graft material . the dentist planned to extract two impacted 3rd molars from the patient 's daughter , prepare them as blocks and powder , and use them as graft materials.(figs . 2 , 3 ) on april 10th , 2010 , the lower right 3rd molar of the patient was extracted and prepared as powder - type graft material . on the same day , the impacted 3rd molars of the daughter were extracted , prepared as block and powder graft materials , and stored . on april 26th , 2010 , in the maxillary anterior edentulous area ( # 13-#23 ) , a flap was elevated by crestal incision . block graft materials were grafted to the labial side of the maxillary canine area ( # 13 and # 23 labial area ) , and additionally , powder graft materials were grafted to the vicinity with tissue adhesive ( greenplast ; green cross corp . , the area was covered with an absorbable collagen membrane ( ossix plus ; orapharma inc . , louis drive warminster , pa , usa ) , and the wound was sutured . good bone healing without special complications was observed , and the patient was returned to the referred dental clinic for implant placement.(fig . 7 ) eight months after the surgery , implantation was performed at a local clinic . the condition of horizontal ridge augmentation was good , and thus 4 implants were placed in the # 13 , # 12 , # 22 , and # 23 areas . 8 , 9 ) the final prosthesis was carried out in local clinic successfully , further follow up was not performed . a 49-year - old male patient visited our clinic for pain in the maxillary left 2nd premolar ( # 25 ) and the treatment of implants in the 1st and 2nd molar areas ( # 26-#27 ) . after diagnosis of an abscess in the # 25 root apex , tooth extraction was decided upon . the patient was scheduled to undergo extraction of the mandibular right impacted 3rd molar ( # 48 impacted molar ) . this tooth and an impacted tooth from his son were prepared as graft materials , and maxillary bone graft was performed in the # 26-#27 areas . 10 , 11 ) on april 22nd , 2010 , the # 48 was extracted , and the left impacted 3rd molar of the patient 's 22-year - old son was extracted . may 7th , 2010 , the prosthesis between the # 24-#25 area was cut , and the # 25 was extracted . a flap was elevated by performing crestal incision on the # 25-#27 area , and maxillary sinus bone graft was performed by lateral approach . autogenous and familial tooth bone graft in powder form were used as bone - graft materials . on august 3rd , 2010 , implants ( osstem ts iii sa ; osstem , seoul , korea , # 25 : 4 diameter/11.5 length , # 27 : 5 diameter/11.5 length ) were placed in the # 25 and # 27 area , in a non - submerged type . the primary stability value measured by the osstell mentor ( integration diagnostics ab , savedalen , sweden ) was shown to be # 25 : 67 implant stability quotient ( isq ) and # 27 : 71 isq , respectively.(fig . 12 ) prior to implant placement , a bony specimen was harvested from the # 27 area using a 2.0 mm diameter trephine bur . a healing abutment was connected , and the wound was sutured . on december 30 , 2010 , a final prosthesis was installed ( prosthetic treatment was performed by dr . 13 ) the bone tissue specimens collected after 3 months were examined under light microscope . it was confirmed that in the sinus bone graft area , new bone had formed actively in the vicinity of graft materials . new bones formed along the border of the graft material were woven bones , and some bones had already formed short trabecular patterns . in some areas , they formed loose anastomosis with other trabecular new bones formed along the border of other graft materials . the more developed new trabecular bones were connected to the residual alveolar bone in a pattern that was more densely anastomosed.(figs . it has been reported that in allogenic tooth graft between parents and children and between siblings , specific immune reactions are delayed or reduced if tissue - located histocompatibility antigens ( h - antigens ) are compatible . kim et al.5 have reported that if the teeth of 9 to 11-year - old children whose orthodontic therapy was planned were transplanted to the defect area of their parents or siblings , good results can be anticipated . through a treatment process similar to that used for autogenous tooth bone - graft materials , the teeth extracted from immediate family members were preserved , treated , and stored . tooth material was prepared as bone graft material ; this could be donated , distributed , and grafted to the family for therapeutic purposes . here , the term " family " refers to brothers , sisters , parents or children . the extraction and the tooth to be donated were teeth that could not be saved by dental treatments , the deciduous teeth , and the wisdom teeth . when a tooth is extracted from a family member and donated or received , the dental clinic obtains the individual 's consent for donation as well as consent for transplantation . the consent is signed by the patients themselves or guardians , and a written agreement for treatment of the extracted tooth is signed . donors are submitted to basic tests for venereal diseases and acquired immunodeficient virus if requested by the donor or the recipient . the recipient should prepare a document that proves the family relationship and sign agreement to transplantation6 . isograft refers to the graft between genetically identical individuals ( e.g. , monozygotic twins ) . it has been reported that monozygotic twins have identical major histocompatibility complexes , and thus graft rejection reactions never occur . the genetic combination involved in tooth bone graft among immediate family members is not 100% identical ; nonetheless , it shows a similar trend and the risk for immune rejection reactions is almost removed by the treatments ( i.e. , decalcification and freeze - drying ) . allogenic bone - graft materials treated with decalcification processes do not require tissue compatibility tests such as abo typing . because familial tooth bone - graft materials are also treated with the decalcification process , special tissue compatibility tests are not required7 . barrett and reade8 performed tooth isograft in murine renal subcapsular sites and histologically evaluated the results . it has been reported that in teeth in which the root was not completely formed , the formation of alveolar bone and periodontal ligaments was observed . however , in the teeth with complete roots , formation of neither alveolar bone nor periodontal ligaments was observed . in this study , after the isograft of incomplete teeth , the alveolar bones were formed . in addition , in 1982 , experimental studies were conducted on the isograft of immature molars in the intraosseous as well as extraosseous areas in mice . bone formation was observed not only in the tibial area but also in the kidney area9 . steidler and reade10 examined the effect of the extracorporeal time involved in tooth isograft in rodents . it was observed that if the extracorporeal time was longer than 30 minutes , pulp degeneration , necrosis of the cementum , resorption of the roots , and osseointegration occurred . in this study , the new bone formation was observed in the vicinity of tooth isograft in the tibia . barrett and reade11,12 have reported the following results of animal experiments that were performed for the immunological examination of tooth isograft . the 3rd molar tooth of mature mice was grafted to the tibial shaft medulla and the renal subcapsular kidney site . it was observed that in both sites , early pulp degeneration was detected , and the continuous regeneration process associated with the formation of dentin was observed . tibial shaft isografts were surrounded by bones , and continuous resorption initiated by the coronal dentin was observed . the teeth grafted to the subcapsular kidney site were not surrounded by bones , and coronal resorption findings were not shown . in other words , with regard to the tooth isograft transplanted in the intraosseous area , diverse levels of root resorption and osseointegration were observed . we used familial tooth bone - graft materials for alveolar ridge augmentation and maxillary bone graft and obtained good clinical outcomes . the impacted third molars of the patients themselves were extracted and prepared as autogenous tooth bone - graft materials . nonetheless , the volume was not sufficient , and thus , the bone - graft materials prepared from the impacted third molar of their children were used in parallel . four months after alveolar ridge augmentation and 3 months after maxillary bone graft , implants were placed secondarily . bone healing was good , and the early stability of implants could be obtained readily . the results of histological tests of the specimens collected from case 2 showed excellent new bone formation and bone remodeling phenomena . in this study , only 2 cases were presented , and a mixture of autogenous tooth bone materials and family tooth bone materials was used . the problem of case 1 was that further follow up was not performed in our hospital after completion of final prosthesis in local clinic . the grafted bone in sinus and peri - implant bone were maintained well in case 2 . thus , it is difficult to perform an accurate clinical evaluation of familial tooth bone graft .

recently , clinical application of autogenous tooth bone - graft materials has been reported . autogenous tooth bone graft has been used in implant surgery . familial tooth bone graft is a more advanced procedure than autogenous teeth bone graft in that extracted teeth can be used for bone graft materials of implant and teeth donation between siblings is possible . we used autogenous tooth and familial tooth bone - graft materials for ridge augmentation and sinus bone graft and obtained satisfactory results . the cases are presented herein .

prompt multidisciplinary management of hand infections is essential to prevent stiffness , loss of function and long - term disability . although hand infections are relatively common in young patients particularly males engaged in sports , recurrent hand infections are not . panton - valentine leukocidin ( pvl ) is a toxin produced by some strains of s. aureus and usually implicated in skin and soft tissue infections . it can also cause invasive infections , in particular haemorrhagic pneumonia . to date , there is only one previous case describing recurrent hand infections associated with panton - valentine leukocidin - positive staphylococcus aureus ( pvl - sa ) . this case highlights the need for multidisciplinary management of these patients as the diagnosis of pvl - sa may have been missed with potentially devastating consequences . a 25-year - old right - hand dominant male warehouse operative presented to the emergency department ( ed ) with a three - day history of redness , pain and swelling in the right palm . he removed a wooden splinter from the palmar aspect of the metacarpophalangeal joint of his right middle finger 24 h before the symptom onset . in his past medical history , he had childhood - onset eczema and recalled always having cracked hands he was not currently managing his eczema with medical therapy but described several flare - ups of his eczema since childhood . there was no recent history of skin and soft tissue infection in his household contacts . he was on noregular medications , had no allergies and smoked 10 cigarettes a day . on examination , his temperature was 37.5c and he had tenderness , swelling and overlying erythema localised to his palm and extending to the proximal interphalangeal joint of his middle finger . admission blood tests showed a serum white cell count of 10.71 10/l ( reference range 3.510.5 10/l ) and c - reactive protein of 14.1 mg / specimens cultured methicillin susceptible s. aureus ( mssa ) for which he completed a 14-day course of intravenous flucloxacillin 1 g qds . following surgical drainage the wound was left open and dressed daily with bethidine wicks . twelve weeks later he represented to his general practitioner ( gp ) with a four - day history of increasing pain , redness and swelling over his dorsal left wrist . he was referred to the ed 48 h later when he failed to respond to oral flucloxacillin . on examination he had a 3 3 cm fluctuant swelling over his dorsal wrist with surrounding cellulitis ( figure 2a ) . g / l and c - reactive protein of 57.8 mg / l . figure 2.(a ) patient s second presentation with abscess dorsal left wrist and surrounding erythema . ( a ) patient s second presentation with abscess dorsal left wrist and surrounding erythema . further investigations were requested in the context of a recurrent infection in a healthy , young patient . these included an oral glucose tolerance test , a mantoux test , serum hiv antibodies , immunoglobulin levels , complement levels , antibodies to atypical infections and a transesophageal echocardiogram . similar to his previous admission , he required incision and drainage of the abscess followed by daily bethidine wick dressings ( figure 2b ) . on this occasion pus was sent to the national methicillin resistant s. aureus ( mrsa ) reference laboratory and was reported positive for pvl - sa . the patient completed a 10-day course of intravenous flucloxacillin 1 g qds with five days of clindamycin 600 mg qds for anti - toxin cover . a decolonization regimen of five days 4% chlorhexidine wash and intranasal mupirocin was prescribed once his wounds had fully healed . he was advised not to share bedding or towels and the same decolonisation regimen was advised for his household contacts . he was discharged following completion of antibiotic therapy and followed - up in the outpatient clinic ( figure 3 ) . pvl is a cytotoxin produced by 5% of staphylococci ( both mssa and mrsa ) . it primarily occurs sporadically in young healthy patients and as a consequence can be missed . although , predominately detected in isolates causing skin and soft tissue infections , pvl - sa strains can become invasive leading to necrotising fasciitis , purpura fulminans and necrotising pneumonia with a high mortality rate ; up to 75% in necrotising pneumonia despite medical treatment . pvl - sa infections are thought to be more highly transmissible than pvl - negative infections . healthcare workers , contact sports players and closed communities are considered as high - risk groups for transmission . pvl - sa infections have been described since the 1930s , but within the last decade their incidence in the community is rapidly increasing . although surveillance and improved case recognition may have contributed , this rapid increase is of growing international concern . in the united states , mrsa isolates increased from 24% to 54% and mssa isolates overall increased from 9% to 12% . in ireland , an increased prevalence of pvl - positive mrsa ( from 0.2% to 8.8% ) and a decrease in pvl - positive mssa ( from 20% to 2.5% ) from 2004 to 2011 have been reported . this contrasts to uk where pvl - positive mrsa infections are rare ( 0.8% of all isolates ) but pvl - positive mssa are more common ( 9.0% of all specimens ) . mssa isolates are not routinely referred to the reference laboratory for analysis in ireland , which may partially explain these discrepancies . to date , one case of recurrent pvl - sa hand abscesses has been reported in the literature . in 2013 , described a pvl - sa right palmar abscess in a healthy 24-year - old who developed a second abscess six weeks later in the contralateral palm . although pvl - positive mrsa was identified , the age , immune status and clinical course were comparable to this case . similar to wearn et al . , we consider our patient 's second presentation to be a recurrence of pvl - sa . following the initial infection he likely remained colonised with pvl - sa and his eczematous skin then facilitated further entry of pvl - sa with development of the second abscess . in addition to appropriate surgical and antibiotic management of this infection , management of his underlying skin condition , patient education regarding appropriate hygiene and decolonisation of the patient and his contacts facilitated prevention of a further recurrence . clinical suspicion of pvl production is key and if suspected , advice should be sought from the clinical microbiological service regarding patient management and referral of positive specimens to a reference laboratory for pvl testing . the recommended management of pvl - sa infection includes treatment of infection ( abscess drainage and antibiotic therapy ) , decolonisation of the index patient , increased individual ( covering wounds and hand hygiene ) and environmental hygiene and appropriate management of close contacts . the main strategy to prevent reinfection with or transmission of pvl - sa is stringent hygiene combined with decolonisation treatment . in this case guidance from the centers for disease control and prevention it refers to the five cs of risk factors for pvl - related infection : contaminated items , close contact , crowding , cleanliness , and cuts and compromised skin integrity . particular emphasis was placed on the management of our patient s eczema to optimise skin integrity . health protection agency ( hpa ) guidelines recommend that all patients and their close contacts undergo decolonisation ( chlorhexidine wash 4% with intranasal mupirocin ) , although internationally there is no consensus on this approach . this relates to individual countries testing policies for the pvl toxin . in the uk where cases are considered rare and severe , testing is recommended as it is an aggressive approach to treatment including decolonisation . despite these published guidelines , risk factors and recommendations to prevent recurrence recurrent primary hand abscesses in the young , healthy patient are uncommon and should raise suspicion of an underlying condition , atypical infection or pvl - sa . prompt multidisciplinary management of these infections is needed to prevent stiffness , loss of function and long - term disability . the authors report no conflicts of interest . the authors alone are responsible for the content and writing of this article .

a 25-year - old male right - hand dominant warehouse operator presented with two hand infections within 12 weeks both requiring surgical drainage and antimicrobial therapy . subsequent testing confirmed panton - valentine leukocidin - positive staphylococcus aureus ( pvl - sa ) . this case highlights the need for prompt multidisciplinary management of hand infections to consider , diagnose and manage atypical infections .

all animals ( charles river , yokohama , japan ) were housed under controlled temperature ( 25 1c ) and 12 hr : 12 hr light : dark conditions ( lights on at 07:00 hr ) with food and water available ad libitum . all of the procedures were performed in accordance with the guidelines for animal care stipulated by the japanese physiological society and approved by the ethics committees of miyazaki university . all efforts were made to minimize animal pain and suffering , and the number of animals used . in the first set of experiments , adult female wistar rats ( approximately 10 weeks old ) were used . from 1 week prior to sample collection , vaginal smears were taken daily from the rats for determination of the estrous cycle , and accordingly , the animals were subdivided into 4 groups : diestrus ( n=9 ) , proestrus ( n=7 ) , estrus ( n=9 ) and metestrus ( n=16 ) . we showed the plasma amino acid concentration with supplemental table , and the percentage concentration ratios for the various amino acids were also presented as circular profiles relative to the amino acid concentrations of diestrus . in the next experiment , adult female rats were mated on the day of proestrus , and the day after mating was counted as day 1 of pregnancy ( p1 ) . blood samples were taken every 5 days ( p5 , 10 , 15 and 20 ; n=4 ) . after delivery and during lactation , blood samples were taken from the dams in the same way ( l1 , 5 , 10 , 15 and 20 ; n=4 ) , and we take the samples from the female pups just after weaning ( n=6 ) . the percentage concentration ratios for the various amino acids were also presented as circular profiles relative to the concentrations determined just before pregnancy ( proestrus ) . all blood samples were collected into heparinized capillary tubes by the tail tip incision method , and these were centrifuged immediately at 4c and 14,000 rpm for 4 min . we think that the possibility of contamination of amino acids derived from erythrocyte by hemolysis is almost none , since we paid scrupulous attention not to hemolyze at the blood sampling and hemolyzed sample was excluded from the assay . the resulting plasma samples were mixed with 2 volumes of 5% ( w / w ) trichloroacetic acid and centrifuged immediately at 4c and 10,000 rpm for 20 min to remove the precipitated protein . ufc5010bk , millipore , billerica , ma , u.s.a . ) , and the plasma amino acid concentrations were measured using an automatic amino acid analyzer ( l-8800a ; hitachi , tokyo , japan ) . we focused on the 20 amino acids that are the components of proteins : valine ( val ) , leucine ( leu ) , isoleucine ( ile ) , alanine ( ala ) , methionine ( met ) , proline ( pro ) , tryptophan ( trp ) , phenylalanine ( phe ) , tyrosine ( tyr ) , threonine ( thr ) , glutamine ( gln ) , asparagine ( asn ) , serine ( ser ) , glycine ( gly ) , cysteine ( cys ) , lysine ( lys ) , arginine ( arg ) , histidine ( his ) , aspartic acid ( asp ) and glutamic acid ( glu ) . briefly , amino acids were separated by cation - exchange chromatography and detected spectrophotometrically after post - column reaction with ninhydrin reagent . all sample collections were performed at the same time ( 11:3012:30 hr ) to minimize any influence of circadian rhythm . all data were expressed as the mean standard error of the mean ( sem ) . in the first experiment , differences between groups at the various stages of the estrous cycle were analyzed by one - way anova and post hoc tukey s test . in the other experiment , data for amino acid levels were analyzed by one - way repeated anova , and changes between time points during the experimental period were analyzed by tukey s test . the sexual difference ( fig . 3d ) were analyzed by student s t - test . to visualize the results , the concentrations of amino acids among the experimental groups for the 2-dimensional circular plane figures , we plotted the percentage concentration of each amino acid relative to the control level ( at diestrus or proestrus ) . in the three - dimensional figures , principal components analysis ( pca ) was performed to reduce the dimensionality of the data set and to identify new meaningful underlying variables . to obtain a more accurate result in the latter analysis , we used 40 kinds of amino acids and their metabolic intermediates , including taurine , sarcosine , citrulline , ornithine and hydroxyproline , for pca analysis . the actual concentrations of the various amino acids in plasma are shown in tables 1table 1alterations in plasma amino acid concentrations during the estrous cycle in female rats and age - matched male ratsamino acids(mol / l)diestrus(n=9)proestrus(n=7)estrus(n=9)metestrus(n=16)age - matched male(n=4)valine175.8 6.2182.0 12.1168.9 5.6189.6 4.3157.8 4.8leucine124.4 3.8129.3 7.5126.0 4.0135.2 4.6110.5 4.2isoleucine72.8 2.077.7 5.174.7 2.378.9 1.465.9 3.4alanine408.9 10.7459.5 27.3453.2 24.7444.0 13.4349.1 31.2*methionine66.6 3.363.4 4.964.1 1.774.5 2.956.3 3.4proline223.7 8.9217.6 17.0215.1 9.1238.4 5.9170.5 6.5*tryptophan141.9 6.8129.9 7.0130.1 6.3145.3 3.6106.1 7.4*phenylalanine67.0 2.171.4 4.170.9 2.073.0 1.866.7 1.8tyrosine67.6 2.574.4 5.669.3 2.874.6 3.091.2 4.7*threonine320.4 18.0357.3 40.1332.4 25.5363.9 15.4265.5 5.0glutamine650.5 30.4637.5 25.6619.1 20.5689.8 18.4556.3 16.6asparagine51.0 3.248.2 4.244.4 2.153.1 2.244.5 2.8serine261.6 11.2275.4 19.4267.8 9.8283.9 9.8197.5 7.9*glycine281.1 13.1283.1 17.5263.8 7.9282.3 8.8255.2 3.8cysteine1.5 0.41.4 0.41.7 0.71.4 0.3ndlysine491.2 19.2479.6 30.4461.9 21.9521.9 20.7336.8 21.5*arginine178.5 12.6176.5 4.8196.5 9.0251.7 28.1125.8 14.0*histidine58.3 2.359.8 3.157.0 1.662.3 1.851.3 0.6aspartate10.8 1.711.8 1.312.7 1.714.6 1.67.0 1.0glutamate91.3 8.286.4 7.894.3 6.999.7 7.681.6 13.4the data represent the mean standard error of the mean ( sem , n=716 ) . * ; p<0.05 vs. diestrus by student s t - test . , 2table 2alterations in plasma amino acid concentrations during pregnancyamino acids ( mol / l)proestrus ( p0)p5p10p15p20valine172.3 17.9247.3 83.1305.8 85.3211.1 61.1201.1 64.6leucine123.6 11.0124.5 6.0119.6 4.0107.5 2.6103.1 9.6isoleucine73.3 7.674.9 3.671.6 2.266.3 1.068.5 7.4alanine414.3 26.3361.6 14.6348.2 15.7373.8 49.7510.6 33.6methionine59.3 4.360.3 4.167.5 4.457.8 5.654.0 3.2proline191.6 12.3186.3 13.0171.7 8.8175.2 12.6184.1 9.1tryptophan119.3 6.2100.6 1.2106.2 6.5101.8 4.362.4 5.5*phenylalanine67.8 3.661.1 2.364.5 3.258.8 3.159.8 4.9tyrosine74.8 5.264.0 3.274.4 6.751.9 5.8 * 50.3 4.9*threonine276.0 16.1235.1 13.9240.6 21.0268.7 13.8292.1 23.9glutamine601.1 11.4614.6 20.7623.2 36.4631.1 39.5598.8 24.3asparagine43.1 5.040.1 1.637.4 1.637.7 2.550.9 3.2serine246.4 17.6230.7 6.2207.5 5.3 * 202.8 8.8 * 221.8 6.3glycine272.2 21.2259.5 9.3232.2 14.0158.1 7.9 * 127.6 3.6*cysteinendndndndndlysine435.8 19.8422.1 48.3418.6 31.2527.4 30.9623.4 60.3*arginine160.8 20.0174.6 9.4166.2 4.4162.1 24.8140.4 8.7histidine59.3 4.658.9 1.557.8 3.144.8 3.2 * 36.6 2.1*aspartate11.9 2.310.3 2.18.3 0.89.2 1.19.0 0.6glutamate87.6 12.582.8 15.478.1 10.480.2 10.183.3 10.6the data represent the mean standard error of the mean ( sem , n=4 ) . * ; p<0.05 vs. non - pregnant female rats group . , 3table 3alterations in plasma amino acid concentrations during lactation in dams and the pups just after weaningamino acids(mol / l)proestrus ( p0)l1l5l10l15l20pupsvaline172.3 17.9130.5 32.2154.6 12.0182.8 1.4168.7 9.8129.2 24.4206.8 10.2leucine123.6 11.097.5 10.9115.6 8.4133.6 3.5129.6 6.5117.7 18.2146.5 8.8isoleucine73.3 7.666.1 4.273.6 5.985.5 1.679.8 4.074.2 11.297.0 3.8alanine414.3 26.3739.3 50.2 * 621.8 41.0585.1 35.2608.9 61.9572.1 44.2738.9 33.5methionine59.3 4.370.0 6.682.5 3.7 * 98.7 4.2 * 99.3 5.3 * 90.5 6.4 * 86.1 2.7proline191.6 12.3288.6 27.7 * 268.7 18.7 * 259.0 8.9 * 268.7 14.9 * 239.4 15.3358.2 39.7tryptophan119.3 6.2106.1 12.8113.3 2.5118.1 7.2115.4 9.9113.7 8.999.5 4.9phenylalanine67.8 3.666.3 4.867.7 4.770.9 2.171.8 6.465.0 6.476.4 5.6tyrosine74.8 5.285.0 8.387.4 10.681.9 6.384.4 7.569.0 9.8148.1 17.3threonine276.0 16.1386.4 60.6390.9 21.2377.4 20.5347.2 17.1316.8 23.4219.5 12.7glutamine601.1 11.4818.9 40.7 * 704.7 43.1711.7 37.1752.6 35.3 * 688.8 25.6626.0 46.6asparagine43.1 5.090.5 9 * 71.4 2 * 84.3 3.1 * 91.7 1.9 * 76.5 2.2 * 75.7 12.9serine246.4 17.6422.5 29.7 * 372.0 30.4 * 366.3 12.4 * 353.0 12.1 * 321.4 15.1300.6 24.0glycine272.2 21.2400.6 34 * 421.6 41.6 * 465.5 20.6 * 461.7 22.7 * 381.3 14.7613.2 25.6cysteinendndndndndndndlysine435.8 19.8686.5 100.8 * 521.1 34.9550.1 30.8489.6 2.6459.8 32.2232.9 16arginine160.8 20213.8 20.8196.5 17.3194.9 8.6182.5 5.5178.7 13.9240.2 26.6histidine59.3 4.656.3 4.566.2 3.378.6 3.4 * 72.3 3.263.2 6.7119.4 7.7aspartate11.9 2.311.4 2.013.4 5.85.5 1.47.2 0.76.8 1.216.9 2.2glutamate87.6 12.576.8 1.793.1 16.766.1 5.865.7 4.871.1 6.6119.3 7.8the data represent the mean standard error of the mean ( sem , n=4 , 6 ) . * ; p<0.05 vs. non - pregnant female rat group , ; p<0.05 vs. dams on day 20 of lactation group .. to compare the types of amino acid changes occurring during the estrous cycle , pregnancy or lactation , we displayed the ratios of the respective amino acids at each stage in the form of circular profiles relative to the corresponding values for diestrus or proestrus . the data represent the mean standard error of the mean ( sem , n=716 ) . * ; p<0.05 vs. diestrus by student s t - test . the data represent the mean standard error of the mean ( sem , n=4 ) . * ; p<0.05 vs. non - pregnant female rats group . the data represent the mean standard error of the mean ( sem , n=4 , 6 ) . * ; p<0.05 vs. non - pregnant female rat group , ; p<0.05 vs. dams on day 20 of lactation group . the levels of the individual amino acids in plasma were almost the same among proestrus , estrus , metestrus and diestrus , and their circular profiles showed no significant differences ( fig . 1.alterations in plasma amino acids concentrations ( a c , f ) , body weight ( d ) and daily food intake ( e ) at various stages of the estrous cycle in female rats and also in age - matched male rats . the concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in diestrus females . a : results for proestrus ( red line ) , b : estrus ( yellow line ) , c : metestrus ( green line ) and f : age - matched males ( blue line ) . the data for body weight and food intake represent the mean standard error of the mean ( sem ) . d , diestrus ( white bar ) ; p , proestrus ( black bar ) ; e , estrus ( gray bar ) ; m , metestrus ( diagonal bar ) . amino acids indicated by red shading and asterisks showed a significant difference vs. diestrus females ( p<0.05 ) . , table 1 ) . on the other hand , the shapes of the circular profiles changed during the course of pregnancy ( fig . 2.temporal alterations in plasma amino acid concentrations ( a , red line ) , body weight ( b ) and food intake ( c ) during pregnancy in female rats ( n=4/group ) . the concentrations of individual plasma amino acids are shown as a percent ratio relative to the concentrations in non - pregnant female rats ( proestrus ; n=4 , black line ) . amino acids indicated by red shading and asterisks showed a significant difference vs. non - pregnant females ( p<0.05 ) . , table 2 ) . the plasma ser level decreased significantly in mid and late ( p10 and 15 ) pregnancy , and tyr , gly and his decreased significantly at the late and end stages ( p15 and 20 ) of pregnancy , whereas trp and lys significantly decreased and increased at the end of pregnancy , respectively . alterations in plasma amino acids concentrations ( a c , f ) , body weight ( d ) and daily food intake ( e ) at various stages of the estrous cycle in female rats and also in age - matched male rats . the concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in diestrus females . a : results for proestrus ( red line ) , b : estrus ( yellow line ) , c : metestrus ( green line ) and f : age - matched males ( blue line ) . the data for body weight and food intake represent the mean standard error of the mean ( sem ) . d , diestrus ( white bar ) ; p , proestrus ( black bar ) ; e , estrus ( gray bar ) ; m , metestrus ( diagonal bar ) . amino acids indicated by red shading and asterisks showed a significant difference vs. diestrus females ( p<0.05 ) . temporal alterations in plasma amino acid concentrations ( a , red line ) , body weight ( b ) and food intake ( c ) during pregnancy in female rats ( n=4/group ) . the concentrations of individual plasma amino acids are shown as a percent ratio relative to the concentrations in non - pregnant female rats ( proestrus ; n=4 , black line ) . amino acids indicated by red shading and asterisks showed a significant difference vs. non - pregnant females ( p<0.05 ) . much larger changes in the circular profiles of plasma amino acids were observed during the lactation period ( fig . 3.temporal alterations in plasma amino acid concentrations ( a , red line ) , body weight ( b ) and food intake ( c ) during lactation in female rats ( n=4/group ) . the concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in non - pregnant females ( proestrus ; n=4 , black line ) . d shows the results of the pups just after weaning ( n=6 , blue line ) compared with the dams on the day 20 of lactation ( n=4 , red line ) . amino acids indicated by red shading and asterisks showed a significant difference vs. each control group ( p<0.05 ) . , table 3 ) : many amino acids showed significant increases , and none showed a significant decrease . plasma pro , ser and gly levels increased continuously from day 1 until day 15 of lactation . the levels of asn and met increased significantly from days 1 and 5 respectively until the end of lactation , ala and lys were increased significantly only on day 1 of lactation , his was increased on day 10 , and gln was increased on days 1 and 15 . 3d shows the results of the pups just after weaning compared with the dams on day 20 of lactation . many amino acids ( val , ala , pro , tyr , gly , his , asp and glu ) showed significant increases , and only 2 amino acids ( thr and lys ) were decreased . temporal alterations in plasma amino acid concentrations ( a , red line ) , body weight ( b ) and food intake ( c ) during lactation in female rats ( n=4/group ) . the concentrations of individual plasma amino acids are shown as a percentage ratio relative to the concentrations in non - pregnant females ( proestrus ; n=4 , black line ) . d shows the results of the pups just after weaning ( n=6 , blue line ) compared with the dams on the day 20 of lactation ( n=4 , red line ) . amino acids indicated by red shading and asterisks showed a significant difference vs. each control group ( p<0.05 ) . pca analysis revealed clear differences in the 3d plots among the groups ( fig . 4a and 4bfig . 4.principal component analysis ( pca ) plots from amino acid concentration data of individuals ( a ) and median ( b ) in each experiment . black plot ; male rats age - matched with females in the estrous cycle experiment , blue plot ; estrous cycle experiment , red plot ; pregnancy period and green plot ; lactation period . ) . on the pca plot , we added the plasma amino acid levels for an age - matched male group ( n=4 ) to confirm whether or not a sex difference was evident . the positions of each sample were plotted against the axes of the first three components ( pc1 , pc2 and pc3 ) in a 3d space and were colored according to each experimental group ( black plot ; male rats age - matched with the females used in the estrous cycle experiment , blue plot ; estrous cycle experiment , red plot ; pregnancy period and green plot ; lactation period ) . pca analysis allowed visual identification of data patterns and highlighted similarities and differences among the reproductive stages in female rats . the dispersion of the points assembled in each group . principal component analysis ( pca ) plots from amino acid concentration data of individuals ( a ) and median ( b ) in each experiment . black plot ; male rats age - matched with females in the estrous cycle experiment , blue plot ; estrous cycle experiment , red plot ; pregnancy period and green plot ; lactation period . presentation of the amino acid profiles in a 2-dimensional circular plane , using the levels of amino acids during diestrus or proestrus as controls , demonstrated that the profiles changed during pregnancy and lactation in dams , but not during the estrous cycle . in addition , 3-dimensional pca analysis revealed a different distribution of plasma amino acid levels among reproductive stages or sex , especially in late pregnancy and early lactation in dams . these observations suggest that the levels of amino acids in female rats differ from those in males and that they change according to reproductive stage . generally , it has been considered that protein metabolism differs between males and females , since the sexes differ considerably in muscle mass and energy consumption . some of these differences may be correlated with sex steroid hormones : testosterone and estrogen stimulate and inhibit protein synthesis , respectively [ 14 , 27 ] . also , it has been reported that ovariectomy causes an increase of bcca and a decrease of ala in plasma . changes in the circular amino acid profiles in dams during pregnancy or lactation may result from transitional changes in the plasma levels of steroid . on the other hand , in rats during the estrous cycle , there were no significant differences in the circular profiles , even though plasma steroid hormone levels do vary during the cycle . although the reason for this unexpected result is unknown , it may be results of short term change of steroid levels in estrus cycle . another possibility is that pregnant or lactating dams have a higher nutritional demand and food intake in comparison with normal rats . the present study also demonstrated an increase of food intake in pregnant and lactating dams . in spite of the increase of food intake during pregnancy , most of the significant changes in plasma amino acid levels were falls , rather than increases . in addition , most of the amino acids that showed reduction during pregnancy were glycogenic amino acids . in pregnant rats , increase of insulin and ketone body , and decrease of glucose are observed in peripheral blood [ 5 , 13 ] . therefore , decrease of glycogenic amino acid during pregnancy may be due to promoting the gluconeogenesis for supply of glucose to the fetus . another possible reason for the reduction in many plasma amino acid levels may have been an increase in the plasma progesterone level . it has been reported that administration of progesterone to humans causes a marked reduction of many amino acids in plasma . however , if progesterone is the main reason for the decrease of amino acids , this does not explain why many amino acids showed increases in their levels in lactating dams , whose plasma progesterone level is high . the only amino acid that showed an increased level in plasma at the end of pregnancy was lys ( a ketogenic amino acid ) . although the reason for this is unclear , lys is utilized for acetyl - coenzyme a , some of which is employed for cholesterol synthesis . furthermore , it has been reported that dietary lys and arg are related to plasma cholesterol levels and that a decrease in the ratio of arg to lys is associated with an increase in the plasma cholesterol level . cholesterol may be necessary for the rapid increase in the level of estrogen at the end of pregnancy for initiation of lactation . in contrast with pregnant dams , all of the amino acids that showed significant changes in lactating dams increased . all of these , except for lys and met , were non - essential and glycogenic amino acids . during the lactation in comparison with pregnancy , therefore , these non - essential and glycogenic amino acids may be for supplying sufficient glucose or amino acid to product the milk in the mammary gland . the increase in the lys level on the initial day of lactation may have been due to the increase observed at the end of pregnancy . ala was significantly increased in early lactation ( l1 ) and showed a tendency to increase as lactation proceeded . it has also been reported that the expression of amino acid transporter ( aat ) and lipid synthesis - related genes in the mammary gland is increased more during lactation than during pregnancy in the mouse . in addition , the amino acid concentrations in secreted milk during lactation are different from those of maternal plasma . in the fetus immediately before delivery , amino acid levels are known to be higher than in the mother . on the basis of these observations , we expected that the plasma amino acid levels in rats just after weaning might be higher than in mature rats , and measured the plasma amino acid levels in pups just after weaning . as expected , many kinds of amino acid in plasma showed levels markedly higher than in the dam ( fig . it might be generally believed that the increase of food intake results in increase of amino acid levels in blood . certainly , increase of food intake brings about increase of plasma amino acid levels in hyperphagic animals like the ob / ob mouse . however , this correlation between food intake and plasma amino acid levels did not apply to pregnant rats , since main change in amino acid level in pregnant rats was decrease , but not increase , nevertheless , food intake increased . in lactating dam , however , some amino acids concomitant with food intake increased in the present study also . but , the rises of bcaa were not recognized in lactating dam . therefore , we supposed that the plasma amino acid levels in lactating dam were influenced by not only food intake , but also metabolic change . in the present study , we showed that imbalance of amino acid profiles strongly reflects the metabolic changes occurring in vivo and that such data would be applicable to various fields , such as diagnosis , treatment with infusion to patient , nutrition for the pregnant women and production of artificial milk .

we measured the plasma levels of amino acids at various reproductive stages in female rats , including the estrous cycle , pregnancy and lactation , and compared the resulting amino acid profiles using two- or three - dimensional figures . these figures revealed that the amino acid profiles of pregnant and lactating dams differed considerably from those during the estrous cycle or in male rats . the plasma levels of individual amino acids were almost the same between proestrus , estrus , metestrus and diestrus , and their profiles did not differ significantly . however , the amino acid profiles changed during pregnancy and lactation in dams . the plasma ser level decreased significantly in mid and late pregnancy , whereas tyr , gly and his decreased significantly in the late and end stages of pregnancy , and trp and lys significantly decreased and increased at the end of pregnancy , respectively . much larger changes in amino acid profiles were observed during lactation , when the levels of many amino acids increased significantly , and none showed a significant decrease . plasma pro , ser and gly levels increased continuously from day 1 until day 15 of lactation , whereas asn and met increased significantly from days 1 and 5 respectively until the end of lactation . these results suggest that the profiles of plasma amino acids show characteristic changes according to reproductive stage and that it may be necessary to consider such differences when performing amino acid - based diagnosis .

preliminary tests revealed ch2cl2 as a suitable extraction solvent for the roots of k. lappacea in order to maximize the yield of lignan derivatives and to minimize the vegetable tannin content in the resultant extract . eleven previously known lignan derivatives , comprising neolignans , norneolignans , and 7,7-epoxy lignans , were isolated using different chromatographic techniques . identity in each case was verified by determination of the optical activity , 1d- and 2d - nmr experiments , and mass spectrometry , by comparison with published data , as 5-(3-hydroxypropyl)-2-(2-methoxy-4-hydroxyphenyl)benzofuran ( 1 ) , ( )-larreatricin ( 2 ) , meso-3,3-didemethoxynectandrin b ( 3 ) , ( 2s,3s)-2,3-dihydro-3-hydroxymethyl-2-(4-hydroxyphenyl)-5-(e)-propenylbenzofuran ( 4 ) , 2-(2-hydroxy-4-methoxyphenyl)-5-(3-hydroxypropyl)benzofuran ( 5 ) , 2-(2,4-dihydroxyphenyl)-5-(e)-propenylbenzofuran ( 6 ) , ( + ) -conocarpan ( 7 ) , 2-(4-hydroxyphenyl)-5-(e)-propenylbenzofuran ( 8) , rataniaphenol iii ( 9 ) , rataniaphenol i ( 10 ) , and rataniaphenol ii ( 11 ) . the topical anti - inflammatory effect of the ch2cl2 extract of k. lappacea roots as well as of the isolated lignan derivatives was determined as antiedema activity 6 h ( the maximum of edema formation in control mice ) after induction of dermatitis.(17 ) the extract exhibited a potent dose - dependent inhibition of edema , which ranged from 24% at the lowest dose ( 30 g / cm ) to 86% for the highest administration ( 300 g / cm ) . all isolated lignan derivatives significantly reduced the edematous response from about 15% ( 0.1 mol / cm ) to about 80% ( 1.0 mol / cm ) , in a dose - dependent manner . the same doses of the nonsteroidal anti - inflammatory drug ( nsaid ) indomethacin reduced the induced edema formation between 25% and 80% , while the glucocorticoid hydrocortisone showed edema inhibition from 29% to 77% , at 10 times lower doses ( table 1 ) . to evaluate the anti - inflammatory potency of the extract as well as of the isolated compounds , id50 values were assessed . the lignan derivatives showed id50 values in the range 0.310.60 mol / cm , corresponding to 80160 g / cm , which were comparable to indomethacin ( id50 0.29 mol / cm , corresponding to 104 g / cm ) and about 10 to 20 times less potent compared to hydrocortisone ( id50 0.03 mol / cm , corresponding to 11 g / cm ) ( table 1 ) . the anti - inflammatory activities of the most promising compounds , 5 and 7 , at 0.4 mol / cm , a dose leading to about 50% edema reduction at 6 h , were investigated further with regard to both edema development and leukocyte infiltration up to 48 h after dermatitis induction and were compared to indomethacin ( 0.4 mol / cm ) and hydrocortisone ( 0.04 mol / cm ) . the time - dependent effect of the test compounds on edema formation is represented in figure 1 . control animals developed an edematous response still measurable after 48 h , with a maximum 6 h after croton oil application , followed by a progressive decrease . compounds 5 and 7 exerted a significant inhibitory activity at each observation time , showing reductions in the ranges of 2889% and 2561% , respectively . interestingly , despite the similar activity profile , compound 5 provoked maximum edema reduction after 3 h ( 89% ) , which declined to 29% reduction at 48 h. in contrast , ( + ) -conocarpan ( 7 ) exhibited a long - lasting steady anti - inflammatory effect , with a maximum response after 6 h ( 61% ) and a still - pronounced activity at 48 h with edema reduction by 41% . the effect of an equimolar dose of indomethacin was significant only 3 and 6 h after the induction of dermatitis , when it reduced the edematous response by 84% and 76% , respectively . indomethacin then lost its antiedematous effect substantially , as previously observed.(17 ) hydrocortisone ( 0.04 mol / cm ) reduced edema formation at all observation times significantly , from 79% ( 6 h ) to 60% ( 12 h ) ( figure 1 ) . effect of compounds 5 and 7 and the reference drugs , indomethacin and hydrocortisone , on the time course of the edematous response up to 48 h ( controls ; 0.4 mol / cm compound 5 ; 0.4 mol / cm compound 7 ; 0.4 mol / cm indomethacin ; 0.04 mol / cm hydrocortisone ) ; * p < 0.05 in the analysis of variance , as compared to controls . the activity profile of the two benzofuran derivatives 5 and 7 and of the reference drugs on the whole edematous response up to 48 h was quantified by calculating the ratio between the aucs for mice treated with these compounds and the aucs of control animals . compounds 5 and 7 reduced the global edematous response by the same extent ( 47% , and 45% , respectively ) , exerting an effect 2-fold more potent than that of indomethacin ( 24% reduction ) but significantly lower compared to hydrocortisone ( 69% reduction ) ( see table s1 , supporting information ) . the effect of the test compounds on leukocyte infiltration up to 48 h is represented in figure 2 . the recruitment of leukocytes in the inflamed ear tissue of control animals , measured as myeloperoxidase activity , was already detectable 3 h after induction of dermatitis . it increased up to 24 h and slightly decreased until 48 h. compounds 5 and 7 caused a significant reduction of leukocyte infiltration at all observation times , ranging from 24% to 35% and 27% to 44% inhibition , respectively . indomethacin and hydrocortisone exerted comparable effects ( 2749% and 3556% reductions , respectively ) , which were significant at each observation time ( figure 2 ) . effect of compounds 5 and 7 and the reference drugs , indomethacin and hydrocortisone , on the time - course of leukocyte infiltration measured as myeloperoxidase activity up to 48 h ( controls ; 0.4 mol / cm compound 5 ; 0.4 mol / cm compound 7 ; 0.4 mol / cm indomethacin ; 0.04 mol / cm hydrocortisone ) ; * p < 0.05 in the analysis of variance , as compared to controls . the effects of the benzofurans on the global granulocyte infiltrate calculated from the aucs represented in figure 2 ( 32% and 37% reduction ) were comparable to those of the reference drugs indomethacin ( 42% reduction ) and hydrocortisone ( 51% reduction ) ( see table s1 , supporting information ) . the anti - inflammatory effects of compounds 5 and 7 and of the reference compounds were evaluated additionally by the histological examination of ear tissues . ear dermal tissue of the control mice showed degranulated mast cells visible as soon as 3 h after dermatitis induction ( see figure s1b , supporting information ) . dilated blood vessels and dermal swelling were also observable , becoming more evident after 6 h ( figure 3b ) and progressively attenuating after 9 h. moreover , an increased number of infiltrated neutrophilic granulocytes was visible after 6 h , then increasing up to 24 h ( see figure s2b , supporting information ) and being still sustained after 48 h. ears of mice treated with compound 5 or compound 7 ( 0.4 mol / cm ) showed a general reduction of these vascular and cellular changes due to inflammation , including the presence of mast cells preserved from degranulation ( figures 3c , s1c , s2c ; 3d , s1d , s2d , supporting information ) . similarly , ear tissues from mice treated with indomethacin ( 0.4 mol / cm ) showed reduced mast cell degranulation and leukocyte infiltration at all observation times . however , after 9 h the dermal swelling was comparable to that of control mice ( figure 3e , figures s1e , and s2e , supporting information ) . ear biopsies from animals treated with hydrocortisone ( 0.04 mol / cm ) revealed an attenuation of all the vascular and cellular signs of inflammation ( figure 3f , figures s1f , and s2f , supporting information ) . sections of mouse ears 6 h after the induction of the croton oil dermatitis ( a : untreated ear ; b : control ; c : 0.4 mol / cm compound 5 ; d : 0.4 mol / cm compound 7 ; e : 0.4 mol / cm indomethacin ; f : 0.04 mol / cm hydrocortisone ) . hematoxylin and eosin staining , 25 magnification . to obtain insight into the molecular mechanism(s ) of the observed in vivo effects , the k. lappacea root ch2cl2 extract was tested initially for its potential to inhibit nf-b transactivation activity in tnf--stimulated hek-293 cells stably transfected with a nf-b - driven luciferase reporter gene . since this crude extract showed a pronounced activity ( > 50% inhibition ) at a concentration of 10 g / ml , ic50 values for all isolated lignan derivatives ( 111 ) were determined . interestingly , all compounds significantly reduced nf-b - dependent luciferase activity in a concentration - dependent manner . four compounds ( 5 , 6 , 8 , and 11 ) were able to inhibit nf-b activation in the low micromolar range , comparably to the positive control , parthenolide ( ic50 1.4 m ) , with ic50 values ranging from 1.4 to 6.4 m . another four isolates ( 1 , 2 , 4 , 10 ) showed ic50 values between 11.6 and 14.7 m . only three compounds ( 3 , 7 , 9 ) exhibited low nf-b inhibition with ic50 values higher than 20 m ( table 2 ) . although the compounds tested show different substitution patterns , no clear structure activity relationship conclusions could be deduced . since luciferase reporter gene expression reflects a downstream event of the nf-b signaling cascade that did not permit conclusions to be made regarding direct targets of the respective test compounds , all compounds were tested also for their potential to inhibit ikk2 ( inhibitor of nf-b kinase subunit beta ) activity , as previously described.(18 ) however , none of the compounds inhibited ikk2 at a concentration of 10 m ( data not shown ) , thereby excluding this kinase as a direct target of the lignans . for comparison , the reference compound used as a positive control in the ikk2 test , ikk2 inhibitor iv , is known to have an ic50 in the low nm range and in our hands completely suppressed ikk2 enzymatic activity to the background level when applied at a concentration of 400 nm . since gr as well as ppar and - are known to have nf-b - antagonist action , the potential of all lignan derivatives to activate these receptors using luciferase reporter gene assays specific for ppar , ppar , and gr was assessed . given that none of the compounds tested showed activities in any of the three assays ( data not shown ) at 10 m , effects at these three nuclear receptors can be excluded . for comparison , the reference compound used for gr activation , dexamethasone , induced around a 10-fold signal induction at 2.5 m . troglitazone used as a reference ppar activator induced a 6-fold activation with an ec50 of 0.4 m , and the positive control for ppar activation , gw7647 , induced a 2.8-fold activation , with an ec50 of 0.6 nm . reactive oxygen species are known to be involved in the activation of nf-b . to check the potential radical - scavenging activity of the lignan derivatives , a dpph assay was performed . the k. lappacea root extract significantly inhibited free - radical formation with an ic50 value of 42.4 6.3 g / ml . compounds 24 , 7 , 8 , and 11 had no effect in this assay up to 100 m . five compounds ( 1 , 5 , 6 , 9 , and 10 ) showed free - radical scavenging activity in a concentration - dependent manner with ic50 values ranging from 22 to 42 m . a structure activity relationship comparison revealed that all the compounds active in the dpph assay have a methoxy ( 1 and 9 ) or hydroxy ( 5 , 6 , and 10 ) group located at the ortho - position in relation to the benzofuran scaffold . although these values are in the same range as the radical - scavenging activity of the positive control ascorbic acid ( ic50 24.2 5.1 m ) ( table 2 ) , there was no apparent correlation between the dpph - radical - scavenging potential of the compounds and their nf-b inhibitory potential . to clarify the impact of the k. lappacea lignans on further targets , the isolated constituents were investigated for their potential to interfere with another crucial pathway in the inflammatory response , namely , the arachidonic acid cascade , which is responsible for the formation of pro - inflammatory prostaglandins and leukotrienes . important enzymes are cox-1 and -2 and mpges-1 , catalyzing the formation of pgg2 and pge2 , and 5-lo , which is responsible for the production of leukotrienes via the intermediate molecule 5-hpete . initial screening experiments of the ch2cl2-soluble k. lappacea root extract ( 50 g / ml ) revealed inhibition of cox-1 and cox-2 , with inhibition rates of 82.5 8.9% and 83.9 5.8% . four ( 6 , 8 , 9 , 11 ) of the 11 isolated lignan constituents ( 50 m ) inhibited these enzymes to an extent of 57.2% and 83.3% ( data not shown ) . ic50 value determination of the most potent substances revealed that compounds 6 , 9 , and 11 had no isoform - specificity since they showed almost identical ic50 values , 2.73.8 m for cox-1 and 1.77.6 m for cox-2 , comparable to the reference drugs indomethacin ( ic50 value cox-1 , 2.1 m ) and ns-398 ( ic50 value cox-2 , 2.1 m ) . in contrast , compound 8 inhibited preferentially cox-2 ( ic50 value cox-2 , 2.0 m ; ic50 value cox-1 , 18.3 m ) ( table 2 ) . accordingly , the 5-(e)-propenylbenzofuran moiety with an unsaturated furan ring and a para - hydroxy group seems to be essential for this activity . investigation of the plant ch2cl2 extract ( 50 g / ml ) and the 11 pure compounds ( 50 m ) revealed a significant inhibition of leukotriene formation by the extract ( 69.5 4.1% ) as well as by three of the 11 lignan derivatives ( 1 , 5 , 7 ; 80.2% to 94.6% inhibition , data not shown ) . ( + ) -conocarpan ( 7 ) showed the strongest activity , with an ic50 value of 18.4 m , followed by compounds 5 ( ic50 27.2 m ) and 1 ( ic50 41.4 m ) . m ) , only compound 7 showed a relevant activity in the ex vivo in vitro setup ( table 2 ) . in addition to the previous experiments , the isolated lignan derivatives were assessed for their ability to interfere with mpges-1 in a cell - free assay . therefore , an initial screening experiment with all pure compounds at a concentration of 10 m was performed , resulting in the identification of compounds 6 and 8 as potent inhibitors of mpges-1 . both compounds blocked pge2 formation in a concentration - dependent manner , with ic50 values of 7.4 and 5.3 m , respectively ( table 2 ) . as a reference , compounds 4 , 5 , 7 , and 911 showed moderate inhibitions , with ic50 values ranging from 11.0 to 42.0 m . the 7,7-epoxy lignans ( 2 , 3 ) as well as compound 1 were regarded as inactive in this model ( ic50 values > 50 m ) . taken together it has been shown that several of the lignan derivatives investigated possess a pronounced topical anti - inflammatory activity in vivo , comparable to that of indomethacin , and about 7 times less compared to hydrocortisone . an attempt to clarify the mode of action of the pure compounds revealed two relevant pathways , namely , the nf-b - pathway , where almost all investigated compounds showed activity , and selected enzymes of the arachidonic acid cascade , which were influenced by only some of the benzofuran derivatives . since the in vivo and in vitro effects determined , especially for the most in vivo active compounds , 5 and 7 , did not always correspond , it can be concluded that additional inflammatory mediators might contribute to the anti - inflammatory activities observed . the elucidation of the responsible target(s ) within the nf-b pathway as well as the possible impact on other inflammatory cascades is part of an ongoing study . the present findings support the medicinal use of the roots of k. lappacea in the treatment of oropharyngeal inflammation as well as the contribution of lignan derivatives to the anti - inflammatory activity of this herbal product . the actions of the pure compounds isolated on multiple targets may explain the promising anti - inflammatory activity of the ch2cl2-soluble extract of k. lappacea roots . considering its potency ( higher than indomethacin ) , this extract may be able to be developed as a pharmaceutical agent for the treatment of topical inflammatory processes , after suitable standardization and clinical safety evaluations . the optical rotations were measured in meoh using a perkin - elmer 341 polarimeter ( wellesley , ma ) at 25 c . 1d and 2d nmr experiments were recorded on a bruker drx 300 ( bruker biospin rheinstetten , germany ) operating at 300.13 mhz ( h ) and 75.47 mhz ( c ) at 300 k in acetone - d6 with 0.03% tms ( eurisotop , gif - sur - yvette , france ) , which was used as internal standard . esims were obtained on an esquire 3000 mass spectrometer ( bruker daltonics , bremen , germany ) , using the following parameters : split , 1:5 ; alternating mode ; spray voltage , 4.5 kv , 350 c ; dry gas , 10.0 l / min ; nebulizer 40 psi ; full scan mode , m / z 1001500 . 690 ) hsccc instrument with a gilson 302/803 c pump system model 302 ( villiers - la - bel , france ) as well as a dionex system with a p580 pump , asi-100 autosampler , uvd 170u detector , and a gilson 206 fraction collector ( semipreparative hplc ) were used . all solvents used for isolation were purchased from vwr international ( darmstadt , germany ) . ultrapure water was produced by a sartorius arium 611 uv water purification system ( gttingen , germany ) . croton oil , indomethacin , hydrocortisone , tetramethylbenzidine ( tmb ) , hexadecylammonium bromide ( htab ) , and 96-well microtiter plates were purchased from sigma - aldrich ( milan , italy ) . ketamine hydrochloride ( inoketam 100 ) was purchased from virbac srl ( milan , italy ) . other chemicals used for in vivo experiments were of analytical grade and purchased from carlo erba ( milan , italy ) . dulbecco s modified eagle s medium ( dmem ) containing 4.5 g / l glucose was purchased from lonza group ag ( basel , switzerland ) . chemicals used to measure nf-b transactivation activity were purchased from sigma - aldrich ( vienna , austria ) . a stable nf-b luciferase 293 reporter cell line ( hek-293/nfb - luc ) was purchased from panomics ( redwood city , ca ) , and the plasmid pegfp - c1 was from clontech ( st - quentin - en - yvelines , france ) . parthenolide was obtained from alexis biochemicals / enzo life sciences ( lrrach , germany ) . prostaglandin h synthase 1 and 2 and ns-398 were purchased from cayman chemical company ( ann arbor , mi ) , while the competitive pge2 eia kit was purchased from assay designs inc . indomethacin was purchased from icn ( aurora , oh ) , and zileuton was a product from sequoia ( oxford , uk ) . dexamethasone , 2,2-diphenyl-1-picrylhydrazyl ( dpph ) , and ascorbic acid were from sigma - aldrich ( vienna , austria ) . mk-886 ( 3-[1-(4-chlorobenzyl)-3-tert - butylthio-5-isopropylindol-2-yl]-2,2-dimethylpropanoic acid ) was purchased from cayman chemical company ( ann arbor , mi ) , and a549 cells were from dr . dried , ground roots of k. lappacea ( 500 g ; kl 6269 ) were purchased from mag . identity as well as quality was in accordance with the monograph of the european pharmacopoeia . a voucher specimen ( kl 6269 ) authenticated by dr . daniel remias , university of innsbruck , austria , is deposited at the institute of pharmacy / pharmacognosy , university of innsbruck ( austria ) . ground roots ( 300 g ) were exhaustively extracted with ch2cl2 in a soxhlet apparatus for five days . the extract was evaporated to dryness , yielding 16.3 g. a portion ( 15.5 g ) of the obtained extract was separated by flash silica gel 60 ( 4063 m , merck , darmstadt , germany ; 270 g , 50 4 cm ) column chromatography , using petroleum ether / ch2cl2/etoac gradient mixtures of increasing polarity , yielding 29 fractions ( a1a29 ) . fraction a23 ( ch2cl2/etoac , 70:30 ; 2.3 g ) was chromatographed further by flash silica gel cc ( 70 g , 30 2.5 cm ) , using a hexane / etoac gradient with an increasing amount of etoac , yielding 18 fractions ( b1b18 ) . mg ) was fractionated further over sephadex lh-20 ( pharmacia biotech , uppsala , sweden ) ( 75 1.5 cm ) , using a ch2cl2/acetone mixture ( 85:15 ) as mobile phase , yielding 83.6 mg of compound 5 ( 915975 ml elution volume ) and 60.5 mg of compound 1 ( 11001160 ml elution volume ) . fraction b5 ( hexane / etoac , 65:35 ; 68.3 mg ) was purified by sephadex lh-20 cc ( 40 1.0 cm ) , using a ch2cl2/acetone mixture ( 85:15 ) as mobile phase , affording 43.0 mg of compound 2 ( 3542 ml elution volume ) . fraction b6 ( hexane / etoac , 6535 ; 175.1 mg ) was fractionated by sephadex lh20 cc ( 70 1.5 cm ) using acetone as mobile phase , yielding 12 fractions ( c1c12 ) . compound 3 ( 20.1621.70 min retention time ; 12.2 mg ) was obtained by separation of fraction c7 ( 260275 ml elution volume ; 35.8 mg ) by semipreparative hplc ( phenomenex synergy max - rp column ( 10 m ; 250 10 mm ) ; 48% acetonitrile / methanol ( 75:25 ) , 52% water , isocratic ; flow 4.00 ml / min ; 30 c ) . fraction b7 ( hexane / etoac , 6040 ; 82.1 mg ) was purified further by sephadex lh-20 cc ( 75 1.5 cm ) using ch2cl2/acetone ( 85:15 ) as mobile phase , resulting in 24.4 mg of compound 4 ( 370475 ml elution volume ) . mg ) was rechromatographed by sephadex lh-20 cc ( 70 1.5 cm ) using acetone as mobile phase , yielding 12 fractions ( d1d12 ) . fractions d9 and d10 ( 290350 ml elution volume ; total 297.0 mg ) were combined and purified by sephadex lh-20 cc ( 75 1.5 cm ) using ch2cl2/acetone ( 85:15 ) as mobile phase , affording 64.0 mg of compound 6 ( 885925 ml elution volume ) . fraction a11 ( petroleum ether / ch2cl2/etoac , 55:42.7:2.3 ; 1.3 g ) was further separated by sephadex lh-20 cc ( 70 1.5 cm ) using acetone as mobile phase , resulting in 13 fractions ( e1e13 ) . purification of fraction e6 ( 240250 ml elution volume ; 339.7 mg ) by sephadex lh-20 cc ( 75 1.5 cm ) using a ch2cl2/acetone mixture ( 85:15 ) resulted in 265.6 mg of compound 7 ( 508534 ml elution volume ) . fraction a10 ( petroleum ether / ch2cl2/etoac , 60:38:2 ; 1.6 g ) was rechromatographed by sephadex lh-20 cc ( 75 1.5 cm ) using ch2cl2/acetone ( 85:15 ) , affording 17 fractions ( f1f17 ) . fraction f15 ( 11651260 ml elution volume ; 81.6 mg ) was recrystallized from acetone / hexane , yielding 33.2 mg of off - white crystals . these were further purified by semipreparative hplc ( phenomenex aqua c18 column ( 5 m , 250 10 mm ) ; 70% acetonitrile , 30% water , isocratic ; flow 3.00 ml / min ; 40 c ) . purification of the collected peak ( 15.2517.91 min retention time , 23.1 mg ) by sephadex lh-20 cc ( 35 1.0 cm ) , using acetone as mobile phase , yielded 12.0 mg of compound 8 ( 2452 ml elution volume ) . fraction e10 ( 305330 ml elution volume ; 294.3 mg ) was further separated by sephadex lh-20 cc ( 70 1.5 cm ) , using ch2cl2/acetone ( 85:15 ) as mobile phase , resulting in eight fractions ( g1g8 ) . compound 9 ( 460480 ml elution volume ; 22.5 mg ) was obtained by separation of combined fractions g4 and g5 ( 250320 ml elution volume ; total 192.3 mg ) by hsccc . parameters : hexane / etoac / meoh / ch3cn , 10:3:3:5 ; upper phase used as mobile phase ; tail to head mode ; coil volume 230 ml ; flow 1 ml / min ; 800 rpm . fraction a6 ( petroleum ether / ch2cl2/etoac , 75:23.7:1.3 ; 130.5 mg ) was further purified by sephadex lh-20 cc ( 75 1.5 cm ) using a ch2cl2/acetone mixture ( 85:15 ) as mobile phase , yielding 84.7 mg of compound 10 ( 350430 ml elution volume ) . fraction a9 ( petroleum ether / ch2cl2/etoac , 65:33.2:1.8 ; 227.5 mg ) was separated by sephadex lh-20 cc ( 70 1.5 cm ) using acetone as mobile phase , yielding 120.3 mg of compound 11 ( 255335 ml elution volume ) . the identities of the isolated compounds were confirmed by physical and spectroscopic methods ( optical rotation , 1d- and 2d - nmr , and lc - ms ) and by comparison with published data . male cd-1 mice weighing 2832 g were supplied by harlan laboratories ( san pietro al natisone , italy ) . topical inflammation was induced on the right ear ( surface : about 1 cm ) of anesthetized mice ( 145 mg / kg ketamine hydrochloride , intraperitoneally ) applying 80 g of croton oil dissolved in 15 l of acetone . the left ear remained untreated , since preliminary experiments showed that the vehicle ( acetone ) neither affected the inflammatory response nor induced irritation . control animals received only the irritant solution , whereas other animals received both the irritant and the test substances dissolved in acetone.(17 ) at different times after dermatitis induction , animals were sacrificed and a punch ( 6 mm ) was taken from both ears to evaluate the edematous response . all animal experiments complied with the italian d.l . n. 116 of january 27 , 1992 , and associated guidelines in the european communities council directive of november 24 , 1986 ( 86/609 ecc ) , concerning animal welfare and appendix a of the european convention ets 123 . edema was quantified by the difference in weight between the punches taken from the treated and untreated ( opposite ) ears . the antiedema activity was expressed as percent inhibition of the edematous response in animals treated with the test substances in comparison to edema of control animals treated with the irritant alone.(17 ) the overall effect of the test substances on edema development up to 48 h was quantified by calculating the areas under the curves ( aucs ) representing the edematous response up to 48 h and , subsequently , by the ratio between the aucs of these animals and the aucs of controls . the cellular infiltrate was quantified by measuring myeloperoxidase activity , as an index of the presence of neutrophilic granulocytes , in the same plug of treated ears used to measure edema . myeloperoxidase was extracted by htab , according to the method of bradley et al.,(21 ) and the enzyme activity was measured by a colorimetric assay using tmb as chromogen.(22 ) each ear plug , suspended in 1 ml of buffered saline ( 0.1 m sodium acetate buffer at ph 4.2 ) , containing 0.1% htab ( w / v ) , was homogenized by ultra - turrax ( ika - werk , staufen , germany ) for 5 s at 20 000 rpm . the homogenate was centrifuged at 15000 g for 5 min , and the supernatant was used for the colorimetric assay , because preliminary experiments revealed that the pellet contained less than 5% of total myeloperoxidase activity . in each well of a 96-well microplate , 25 l of the supernatant were mixed with 50 l of the chromogen solution ( 2.83 mm tmb dissolved in 0.1 m sodium acetate buffer at ph 4.2 , containing 0.1% ( w / v ) htab ) . the enzyme reaction was started by adding 75 l of 0.7 mm hydrogen peroxide . after 5 min of incubation at 25 c , the reaction was blocked by 50 l of 4 m acetic acid , containing 10 nm sodium azide . the absorbance was read at 620 nm using an automated microplate reader ( bio - tek instruments , winooski , vt ) . one unit of peroxidase activity was defined as the amount of enzyme oxidizing 1 nm of tmb / min . the global effect of the tested substances on the whole cellular infiltrate up to 48 h was quantified by calculating the aucs representing the time course of myeloperoxidase activity up to 48 h and , subsequently , the ratio between aucs of these animals and aucs of controls . ear biopsies , fixed in 10% formalin , were dehydrated in ascending grades of ethanol , cleared in xylene , and embedded in paraffin wax . sections ( 10 m ) were stained with hematoxylin - eosin or giemsa and evaluated using a light microscope ( zeiss axiophot , with photometrics cool snaps camera and the rs - image program ) . hek-293/nfb - luc cells were maintained at 37 c and 5% co2 in dmem with phenol red supplemented with 2 mm glutamine , 100 u / ml benzylpenicillin , 100 g / ml streptomycin , and 10% fetal bovine serum . g / l ) medium supplemented with heat - inactivated fetal calf serum , 10% v / v , 100 u / ml penicillin , and 100 g / ml streptomycin at 37 c and 5% co2 . hek-293 cells stably transfected with a nf-b luciferase reporter were seeded in 10 cm dishes and transfected with 5 g of pegfp - c1 . six hours later , the cells were seeded in 96-well plates and incubated at 37 c and 5% co2 overnight . on the next day , the medium was exchanged with a serum - free dmem and cells were treated with the respective test compounds dissolved in dimethyl sulfoxide ( dmso ) . to avoid nonspecific effects of the solvent , one hour after the treatment the cells were stimulated with 2 ng / ml human recombinant tnf- for 6 h , and , after a lyses step , the luminescence of the firefly luciferase and the fluorescence of egfp were quantified on a geniospro plate reader ( tecan ; grdig , austria ) . the luciferase signal derived from the nf-b reporter was normalized by the egfp - derived fluorescence to account for differences in the cell number or transfection efficiency . cyclooxygenase-1 ( cox-1 ) and cyclooxygenase-2 ( cox-2 ) inhibition assays were performed in a 96-well - plate format with purified prostaglandin h synthase 1 ( pghs-1 ) from ram seminal vesicles for cox-1 and purified pghs-2 from sheep placental cotyledons for cox-2 , as previously described.(23 ) the concentration of prostaglandin e2 ( pge2 ) , the main arachidonic acid metabolite in this reaction , was determined using a competitive pge2 eia kit . indomethacin ( ic50 cox-1 , 2.1 m ) and ns-398 ( ic50 cox-2 , 2.1 m ) were used as positive controls . the bioassay for inhibition of 5-lo - mediated leukotriene b4 ( ltb4 ) formation was carried out in a 96-well - plate format with stimulated human neutrophilic granulocytes , as described by adams et al.(24 ) with slight modifications.(25 ) zileuton ( ic50 6.3 m ) was used as positive control . determination of mpges-1 activity was performed as described previously.(26 ) in brief , a549 cells were treated with 1 ng / ml interleukin-1 for 48 h at 37 c and 5% co2 . after cell harvesting and sonification , the homogenate was subjected to differential centrifugation at 10000 g for 10 min and 174000 g for 1 h at 4 c . the obtained pellet ( microsomal fraction ) was resuspended in 1 ml of homogenization buffer ( 0.1 m potassium phosphate buffer ph 7.4 , 1 mm phenylmethylsulfonyl fluoride , 60 g / ml soybean trypsin inhibitor , 1 g / ml leupeptin , 2.5 mm glutathione , and 250 mm sucrose ) , and the total protein concentration was determined . microsomal membranes were diluted in potassium phosphate buffer ( 0.1 m , ph 7.4 ) containing 2.5 mm glutathione . test compounds , mk-886 ( reference inhibitor ) , or vehicle was added , and after 15 min at 4 c , the reaction ( 100 l total volume ) was initiated by addition of pgh2 ( 20 m , final concentration , unless stated otherwise ) . after 1 min at 4 c , the reaction was terminated using stop solution ( 100 l ; 40 mm fecl2 , 80 mm citric acid , and 10 m 11-pge2 as internal standard ) . pge2 was separated by solid - phase extraction and analyzed by rp - hplc as described.(26 ) pharmacological in vivo data were analyzed by one - way analysis of variance , followed by dunnett s test for multiple comparisons of unpaired data . the dose giving a 50% inhibition of the edematous response ( id50 ) was calculated by graphic interpolation of the logarithmic dose effect curves . to calculate the ic50 values regarding nf-b inhibition , at least three different concentrations measured in quadruplicate in three independent transfection experiments were used utilizing nonlinear regression with data analysis toolbox software ( mdl information systems inc . , nashville , tn ) . for the determination of ic50 values in the remaining in vitro assays , samples were tested in at least three different concentrations ( duplicates ; at least three independent experiments ) . calculation of ic50 values was performed by nonlinear regression using sigmaplot 9.0 ( systat software inc .

the roots of krameria lappacea are used traditionally against oropharyngeal inflammation . so far , the astringent and antimicrobial properties of its proanthocyanidin constituents are considered to account for the anti - inflammatory effect . the aim of the present study was to characterize pharmacologically a lipophilic extract of k. lappacea roots and several isolated lignan derivatives ( 111 ) in terms of their putative anti - inflammatory activity . the dichloromethane extract ( id50 77 g / cm2 ) as well compounds 111 ( id50 0.310.60 mol / cm2 ) exhibited topical antiedematous properties comparable to those of indomethacin ( id50 0.29 mol / cm2 ) in a mouse ear in vivo model . two of the most potent compounds , 2-(2-hydroxy-4-methoxyphenyl)-5-(3-hydroxypropyl)benzofuran ( 5 ) and ( + ) -conocarpan ( 7 ) , were studied regarding their time - dependent edema development and leukocyte infiltration up to 48 h after croton oil - induced dermatitis induction , and they showed activity profiles similar to that of hydrocortisone . in vitro studies of the isolated lignan derivatives demonstrated the inhibition of nf-b , cyclooxygenase-1 and -2 , 5-lipoxygenase , and microsomal prostaglandin e2 synthase-1 as well as antioxidant properties , as mechanisms possibly contributing to the observed in vivo effects . the present findings not only support the ethnopharmacological use of k. lappacea roots but also reveal that the isolated lignan derivatives contribute strongly to the anti - inflammatory activity of this herbal drug .

they form an integral part of indian diet , especially for those who have type 2 diabetes for whom white rice is considered less desirable because of its high gi . chapattis and other flatbreads are popular in europe also where they form a part of daily diet among members of ethnic minority groups who follow traditional dietary patterns . chapattis are made from whole - wheat flour and cooked on hot flat open griddles . they can also be prepared by substituting wheat flour with other cereal or legume flours at different levels . incorporation of cereal brans at proportions up to 10% has resulted in good quality chapattis . the color and appearance of chapattis were found to be good with substitution of wheat flour with up to 10% cereal brans . generally , chapatti is prepared from whole - wheat flour obtained by grinding wheat in a disk mill ( locally known as chakki ) . chapatti quality can be assessed from its softness and flexibility which may be affected by flour protein quantity and quality . the chapatti quality is also influenced by the dough consistency , which in turn depends mainly on the quantity of water added . bran is the hard outer layer of cereal grains , rich in a myriad of healthy phytochemicals , namely , phenolics , flavonoids , glucans , and pigments . unfortunately , these nutrition - rich components are often discarded during milling out of ignorance , organoleptic reasons , and rancidity problems . knowing the phytochemical constituents and pharmacological profile of bran is expected to give insight to their potential application in promotion of health . cereal brans , the by - products obtained in large amounts in grain milling industry , considered as inedible material for humans , is mostly used as animal feed . however , brans are concentrated source of dietary fibre and other nutrients ( proteins , b - vitamins , and minerals ) . brans are generally composed mainly of insoluble cellulose and hemicellulose , with only about 5 percent soluble fibre , and have little hypercholesterolemia effect . bran contributes a pleasing , sweet , nutty flavour when added as a flavour enhancer in a variety of food products . commercial wheat flour and oat bran ( baggry 's india ltd . , new delhi , india ) were purchased from local market . chappati was prepared by the addition of cereal brans ( wheat , oat , and rice ) singly and in combination ( w : r : o : : 2 : 1.5 : 1.5 ) to wheat flour at 5 and 10% bran supplementation . chapatti . cereal brans singly and in combination at 5 and 10% level were added to wheat flour and required quantity of water which were mixed manually to obtain dough of suitable consistency . the dough was divided into four equal parts and moulded into circular chapattis of 15.0 cm in diameter with rolling pin and board . traditional home baking procedure was followed to bake chapattis on iron plate ( tawa ) . chapattis were cooled and comparative evaluation was done using the following criteria which also included observations on dough handling properties . characteristic score grade dough handling nonsticky sticky slightly sticky very sticky puffing of chapatti full partial nil . the instrument was calibrated with the user supplied black plate calibration standard that was used for zero setting . the instruments were placed on the plate and three exposures at different places were conducted . readings were displayed as a , b , and l color parameters according to the cielab system of color measurement . the a value ranges from 100 ( redness ) to + 100 ( greenness ) and the b value ranges from 100 ( blueness ) to + 100 ( yellowness ) , while the l value , indicating the measure of lightness , ranges from 0 ( black ) to 100 ( white ) . was evaluated by using texture analyser ( stable micro systems , model ta - hdi , uk ) . one strip at a time was placed on the centre of the sample holder and the blade was allowed to cut the chapatti strip . the force ( n ) required to cut chapatti strip into two pieces was recorded . bran enriched products such as extruded snacks , breakfast cereal - porridge , and chapatti were evaluated for sensory attributes ( appearance , colour , texture , flavor , and overall acceptability ) through a panel of semi - trained judges using 9-point hedonic scale . water activity of bran enriched products was estimated using water activity meter having hygrolab 3 bench - top indicator ( rotrogenic company ) . standard aoac procedure was followed for free fatty acids determination in cereal bran enriched products . product sample ( 5 g ) was taken in flask and 50 ml benzene was added and kept for 30 min for extraction of free fatty acids . after extraction , 5 ml extract , 5 ml benzene , 10 ml alcohol , and phenolphthalein as indicator were taken in flask and titrated against 0.02 n koh till light pink colour disappeared : ( 1)%ffa ( % oleic acid ) = 2820.02 n kohml of alkali useddilution factor1000wt of sample taken 100 , moisture content by method of aacc 2000 , total plate count by method of maturin and peeler . moisture content by method of aacc 2000 , total plate count by method of maturin and peeler . data collected from the aforesaid experiments was subjected to statistical analysis for standard error and duncan 's multiple range test using minitab software . the quality evaluation of chapattis prepared by different bran enriched levels is mentioned in table 1 . the pooled scores obtained by the various bran enriched levels of chapattis for appearance , color , texture , and flavor were 7.92 , 7.18 , 7.68 , and 8.10 for wheat bran , rice bran , oat bran , and bran in combination enriched chapattis , respectively . the overall acceptability at 5 and 10 percent level of supplementation was 7.65 and 7.80 , respectively . reported that chapattis , prepared by the addition of 10% bran , showed better performance and were quite comparable with whole - wheat flour regarding the proximate components and sensory attributes . dough handling characteristics of bran enriched chapattis do not show much variation with respect to type of bran used . except for rice bran incorporated dough for chapatti ( slightly sticky ) , all others showed nonsticky behavior during dough development . all types of bran enriched chapattis showed full puffing except 10% rice bran enriched chapattis in which partial puffing during chapatti preparation was visualised . the data presented in table 2 depicted color and texture analysis of bran enriched chapatti . statistically significant ( p 0.05 ) difference was observed in l value of bran enriched chapatti . l value of various cereal bran enriched chapattis was 64.37 , 59.12 , 60.04 , and 61.92 for wheat , rice , oat , and bran in combination , respectively . l value showed decreasing trend with increase in level of supplementation of cereal brans in chapattis . the l value of 66.83 , 61.59 , and 61.14 was observed at 0 , 5 , and 10% level of supplementation , which means slightly lower brightness at higher levels of supplementation . a value of wheat , rice , oat , and bran in combination was 4.18 , 5.24 , 4.71 , and 4.28 , respectively . with increase in level of supplementation , a value ( redness ) increased from 3.14 at 0% level of supplementation to 5.11 at 10% level . altan et al . stated that , among the color parameters , the l and a values showed marked changes due to addition of tomato pomace . an increase in tomato pomace level decreased the l value of the sample and increased the a value of samples . also , increasing bran level supplementation resulted in a decrease in the b value of chapattis . a negative correlation was found between a value and b value of the enriched chapattis . cutting force ( n ) reflects the texture of the chapattis and it stimulates the biting action of the human teeth on chapattis . cutting force ( n ) of various bran enriched chapattis varied as 6.56 n , 5.92 n , 5.30 n , and 5.99 cutting force increased due to presence of more fibres at higher enrichment levels . at 0 , 5 , and 10 percent level of supplementation , the corresponding cutting force ( n ) was 5.25 , 5.91 , and 5.97 n , respectively . manu and prasada rao reported that cutting force of chapattis prepared from different wheat varieties ranged from 4.22 to 6.96 n. hemalatha et al . also reported that the cutting force ( n ) for chapattis made from different wheat varieties ranged between 4.22 and 6.67 . the variation in cutting force might be because of variation in protein and fibre content of brans which determine the resistance offered by the samples . increase in fibre content might have increased the water holding capacity of chapattis and hence increased moisture content ( % ) with addition of bran . reported that moisture content ( % ) of bran enriched chapattis was 31.0 percent while control had moisture content of 30.2 percent . maximum water activity was observed in rice bran enriched chapattis ( 0.462 ) which was statistically at par with water activity of bran in combination enriched chapattis ( 0.455 ) . water activity of oat and wheat bran enriched chapattis was 0.429 and 0.406 , respectively . it was observed from data that water activity of samples was positively correlated with moisture content and followed the same pattern . manthey et al . reported that water activity of bran / fibre enriched pasta increased with bran supplementation over control . the increase in water activity is correlated with increase in moisture content at higher levels of bran supplementation . the data pertaining to free fatty acids ( % ) is presented in table 3 . the free fatty acids ( % ) of bran enriched chapattis ranged from 0.057 to 0.085 . the highest free fatty acids were recorded in rice bran enriched chapattis ( 0.085% ) , being the lowest in wheat bran enriched chapattis ( 0.057 ) . it is also evident from the table that , with increase in level of bran supplementation , free fatty acids increased significantly . the free fatty acids ( % ) at 5 and 10 percent level of supplementation were 0.067 and 0.079 percent , respectively . khan et al . reported similar results regarding free fatty acids while studying development and evaluation of long shelf life ambient stable chapattis . a significant variation ( p 0.05 ) was observed in total plate count of bran extruded chapattis . total plate count of enriched chapattis varied from 6.5 to 17 10 cfu / g . it is also evident from the table that with increase in bran supplementation level , a slight increase in total plate content was observed . the mean value of total plate content for 5 and 10% level of supplementation was 10.25 10 and 12.5 10 cfu / g , respectively . frazier and westhoff reported that total plate content increased from 2.3 10 to 3.4 10 cfu / g for flour . quality characteristics for chapatti revealed that dough handling and puffing of bran enriched chapattis prepared by 5 and 10% level of bran supplementation did not vary significantly . all types of bran enriched chapattis except rice bran enriched chapattis showed nonsticky behavior during dough handling . rice bran enriched chapatti recorded maximum moisture ( % ) , water activity , and free fatty acids ( % ) . with increase in level of supplementation , moisture , water activity , and free fatty acids increased . the future emphasis can be given on development of functional flatbreads which has got increased demand due to increase in health conscious consumer base .

cereal brans singly and in combination were blended at varying levels ( 5 and 10% ) for development of chapattis . cereal bran enriched chapattis were assessed for quality and physicochemical characteristics . on the basis of quality assessment , 10% enrichment level for chapatti was the best . moisture content , water activity , and free fatty acids remained stable during the study period . quality assessment and physicochemical characteristics of bran enriched chapattis carried out revealed that dough handling and puffing of bran enriched chapattis prepared by 5 and 10% level of bran supplementation did not vary significantly . all types of bran enriched chapattis except rice bran enriched chapattis showed nonsticky behavior during dough handling . bran enriched chapattis exhibited full puffing character during preparation . the sensory attributes showed that both 5 and 10% bran supplemented chapattis were acceptable .

dexamethasone is a glucocorticoid with a relevant clinical use mainly due to its anti - inflammatory and immunosuppressive effects . however , the great number of side effects , such as hypertension , hydroelectrolytic disorders , hyperglycemia , peptic ulcers , and glucosuria , restricts the use of dexamethasone in prolonged therapy . topical administration of dexamethasone is clinically used for the treatment of many ocular disorders , or diseases , like uveitis , allergic conjunctivitis , and corneal postoperative period , as well as for the treatment of skin disorders such as atopic dermatitis , [ 5 , 6 ] allergic dermatitis , eczematous dermatitis , [ 6 , 7 ] psoriasis , acne rosacea , and phimosis . over the last years many efforts have been made not only to improve the efficacy and bioavailability of drugs but also to reduce their adverse effects by means of the development of novel drug carrier systems . in the past few decades , considerable attention has been focused on the development of new drug delivery system ( ndds ) . when the new drug or existing drug is given by altering the formulation and administered through different route , this process is called the novel drug delivery system . firstly , it should deliver the drug at a rate directed by the needs of the body , over the period of treatment . conventional dosage forms including prolonged release dosage forms are unable to meet none of these . at present , no available drug delivery system behaves ideally , but sincere attempts have been made to achieve them through various novel approaches in drug delivery . an increasing number of drugs are being added to the list of therapeutic agents that can be delivered into systemic circulation , in clinically effective concentrations , via the skin portal . it has been documented and reported that unsaturated fatty acids such as oleic acid and linoleic acid have a tendency to form vesicles in the aqueous environment . after about a decade of research it was conferred that saturated fatty acids with carbon atoms in the range of 812 undergo self - assemblage into vesicles in a ph - dependent manner . fatty acids being highly soluble tend to partition into artificial as well as natural membranes quite rapidly . it has also been documented that fatty acid vesicles enhance the absorption of therapeutic molecules through the git , probably by forming mixed micelles or through chylomicron(s ) , thus enhancing the bioavailability of the bioactives . it is well established fact that free fatty acids act as penetration enhancers for the bioactives through the stratum corneum . the penetration enhancement effect of fatty acid bears direct relation with the chain length ; however direct relationship correlates up to carbon number 18 , that is , c18 . the skin permeation property of unsaturated fatty acids is higher than the corresponding saturated fatty acid . further , fatty acid(s ) containing cis double bond exhibited higher penetration potential as compared to trans form . the problem of skin irritation , however , could be addressed by using fatty acid vesicles as drug bearing carriers such as ufasomes . it has been shown that bilayer membrane possesses a fusogenic tendency due to its capability to lower the phase transition temperature of the lipids in the biological membrane . the vesicular membrane fuses with skin lipid bilayers , releasing its contents . thus , it is hypothesized that fatty acid vesicles will act as a suitable carrier to enhance the penetration of bioactive agents through the stratum corneum with reduced toxicity . moreover , fatty acid vesicles seem advantageous as they are easy to prepare as well as cost effective . the present study involves the use of oleic acid vesicles to encapsulate dexamethasone and evaluates , its potential as an alternative drug delivery system for effective topical application . all other solvents used were of analytical grade , unless otherwise mentioned , and purchased from cdh . oleic acid vesicles were formulated by film hydration method , as reported earlier by with slight modification . different batches of ufasomes were formulated using different ratios of oleic acid , drug , and surfactant . briefly , in a clean , dry , round bottom flask , the accurately weighed oleic acid of strength 80 mm , span 20 , and dexamethasone were dissolved in methanol followed by solvent evaporation under vacuum using a rotary evaporator ( perfit equipments , ambala , india ) under reduced pressure at 40c to remove even the last traces of organic solvent . a dried film is formed in rotary evaporator and was left overnight for the removal of any possible traces of methanol and also to prevent the formation of emulsion due to the residual organic solvent . the dried film was then hydrated with pbs ( ph 7.4 ) at ambient temperature for 1 h followed by sonication to form the uniform size vesicular dispersion . optimization was performed by varying the ratios of oleic acid and dexamethasone ( table 1 ) . unentrapped drug was estimated by using dialysis method ( molecular weight cut of 12,00014,000 , himedia , ltd . ) . briefly , 1% w / v of carbopol 940 was dispersed into purified water with the help of a vortex shaker ( tarsons , kolkata , india ) and allowed to hydrate for 4 - 5 h. the ph value of the gel was adjusted to 7.4 using triethanolamine . during preparation of the gel , the solution was agitated slowly to obviate any air entrapment . plain drug gel was prepared by using an equivalent amount of dexamethasone solution into the previously made carbopol gel in a 2 : 1 ratio under gentle mechanical mixing for 5 min . ufasomal formulations were characterized for different parameters like drug entrapment efficiency , vesicle shape , vesicle size , and size distribution , turbidity , zeta potential , and permeation across cellophane membrane and rat skin . fatty acid vesicles were visualized by using moragagni 268d tem with an accelerating voltage of 100 kv . a drop of the optimized formulation was placed onto a carbon - coated copper grid and it was negatively stained with 1% phosphotungstic acid ( pta ) . the grid was allowed to air - dry thoroughly and the samples were viewed on a transmission electron microscope . a thin film of uf was spread on a slide and after placing cover slip it was observed under the optical microscope ( olympus ch20i bimf , 8f03730 ) ( figures 1(a ) and 1(b ) ) . the size and size distribution of vesicles with different composition shown in table 1 after sonication the vesicle size was determined by dynamic light scattering method ( dls ) , using a computerized inspection system ( malvern zetamaster , zem 5002 , malvern , uk ) and figure 2 shows vesicle size distribution of optimized formulation . for vesicles size measurement the vesicular preparation was mixed with appropriate medium ( for ufasomal formulation with 7% v / v ethanol ) and filtered through 0.2 m polycarbonate membrane to minimize interference from particular matter . the measurements were conducted in triplicate in a multimodal mode of 200 and each at a medium stable count rate . entrapment efficiency of dexamethasone from the uf-1 , uf-2 , and uf-3 formulations were estimated using dialysis method ( molecular weight cut of 12,00014,000 , hi media , ltd . ) . optimized formulation was dissolved in pbs ( ph 7.4 ) at a concentration of 1 mg / ml ( the same concentration of dexamethasone as 1 mg / ml pure drug solution ) . this solution ( 2 ml in volume ) was transferred to a dialysis bag ( size cut off = 2.5 nm ) immediately . the dialysis bag was placed in a 50 ml - beaker containing 40 ml pbs ( ph 7.4 ) . the absorbance of the outer phase was monitored at 241 nm using a spectrophotometer ( systronics electronic limited , ahmedabad , india , au-2701 ) in order to characterize the concentration of dexamethasone . the entrapment efficiency of prepared ufasomes was determined by subtracting the unentrapped drug from the total amount of drug used for the preparation of ufasomes . one has ( 1)percentage entrapment= entrapped drug ( g)total drug added ( g ) 100 . the entrapment efficiency calculated for various molar ratios oleic acid vesicles were diluted with distilled water to give a total lipid concentration of 0.312 mm . after rapid mixing by sonication for 5 minutes the turbidity was measured as absorbance at 241 nm with an uv - visible spectrophotometer . the zeta potential of the all ufasomal formulations was determined in a malvern zetasizer using reagent blank . for zeta potential measurement vesicular suspension was mixed with the appropriate medium ( for ufasomes with 7% v / v ethanol ) and measurements were conducted in triplicate ( table 1 ) . in vitro release behavior of dexamethasone from vesicular formulations containing oleic acid and span 20 was investigated using locally fabricated franz glass diffusion cell and through the cellophane membrane ( molecular weight cut of 12,00014,000 , hi media , ltd . ) . pure dexamethasone was dissolved in pbs ( ph 7.4 . ) at a concentration of 1 mg / ml and used as control . the prepared complex was dissolved in pbs ( ph 7.4 ) at a concentration of 1 mg / ml ( the same concentration of dexamethasone as 1 mg / ml pure drug solution ) . this solution ( 2 ml in volume ) was transferred to a dialysis bag ( size cut off = 2.5 mm ) immediately . the dialysis bag was placed in a 50 ml - beaker containing 40 ml pbs ( ph 7.4 ) . the absorbance of the outer phase was monitored at 241 nm spectrophotometrically in order to characterize the concentration of dexamethasone ( figure 3 ) . the effect of ph on the stability and on the drug release behavior was monitored by incubating optimized vesicular dispersion with buffers of ph 8.5 , 7.4 , 6.5 , and 5.5 . at predetermined time intervals the amount of drug leached was then calculated by the following formula : ( 2)%drug diffused = amount of free drugtotal drug100 . simultaneously , the incubated vesicles were observed for any change in morphology and size using an optical microscope . as the ph of skin is 7.4 so as to make the formulation compatible with skin , the ph of the dispersion was adjusted . the unentrapped drug was separated from the formulation by dialysis method ( molecular weight cut of 12,00014,000 , himedia , ltd . ) . , 1% w / v of carbopol 940 was dispersed into purified water with the help of a vortex shaker ( tarsons , kolkata , india ) and allowed to hydrate for 4 - 5 h. the ph value of the gel was adjusted to 7.4 using triethanolamine . during preparation of the gel , plain drug gel was prepared by using an equivalent amount of dexamethasone solution into the previously made carbopol gel in a 2 : 1 ratio under gentle mechanical mixing for 5 min . albino rat 5 - 6 weeks old weighing 100120 g was sacrificed by chloroform inhalation . the hair of test animals was carefully trimmed short ( < 2 mm ) with a pair of scissors and the abdominal skin was separated from the underlying connective tissue using scalpel . the excised skin was placed on aluminium foil and the dermal side of the skin was gently teased off for any adhering fat and/or subcutaneous tissue . the skin was then carefully checked through a magnifying glass to ensure that samples were free from any surface irregularities such as tiny holes or cervices in the portion that was used for transdermal permeation studies . the skin was washed with physiological buffer saline ( ph 7.4 ) and freshly obtained skin was used in all experiments . the in vitro skin permeation of dexamethasone from different formulations the donor compartment was maintained at 37 1c with constant stirring at 125 rpm . the uf-2 ( 2 ml ) was applied to the epidermal surface of the rat skin . samples were withdrawn through the sampling port of the diffusion cell at predetermined time intervals over 24 hr and analyzed . the in vitro drug release study of ufasomal formulation was repeated with a cellophane membrane by using the same method as described above . experiments were conducted to optimize the amount of dexamethasone that can be incorporated into the vesicles and to optimize the uf-2 formulation . the cumulative amount of drug permeated per unit area was plotted as a function of time , and the steady state permeation rate ( jss ) and lag time ( lt , h ) were calculated from the slope and x - intercept of the linear portion , respectively . the permeability coefficient ( ps , cm / hr ) and other parameters were calculated from the following equation : ( 3)lt = h26d , jss = pscd , where h = thickness of rat skin , cd = amount of drug in donor compartment . the enhancement ratio ( er ) was calculated from following equation : ( 4)er = transdermal flux from vesicular formulationtransdermal flux from plain drug . determination of amount of drug deposited into the skin . in this method the in vitro drug permeation study was performed in two stages using the same locally fabricated diffusion cell . in the first stage pbs ( ph 7.4 ) was used as the receptor medium and method as described above for skin permeation was carried out . samples were withdrawn through the sampling port of the diffusion cell at predetermined intervals over 10 hr and analyzed . the receptor phase was immediately replenished with equal volume of fresh buffer . at the end of 10 hr the second stage used 50% v / v ethanol as the receptor solution for a further period of 12 hr and performed without any donor phase . during this stage an ethanolic receptor will diffuse into the skin disrupting the vesicular structure of any uf-2 that may have penetrated and deposited in the tissue and thus releasing both uf bound and free dexamethasone for collection by receptor fluid ( figure 6 ) . use of 50% ethanol as receptor fluid can slightly reduce the barrier nature of stratum corneum ; hence , the second stage was performed after removal of the donor to avoid any excess permeation due to penetration enhancing activity of ethanol . for the evaluation of mechanism of better skin permeation ability of optimized oleic acid vesicles , the vesicle - skin interaction of optimized ufasomal formulation ( uf-2 ) was evaluated by scanning electron microscopy technique and ft - ir . sem studies using rat skin was conducted in order to explain the effect of oleic acid formulation on the surface morphology of skin . figure 7 shows the sem photomicrograph of rat skin treated with pbs ( ph 7.4 ) acting as control , plain ufasomal gel , liposomal formulation , and plain gel . in rat skin the vesicular suspension formed networks and stacks of lipid bilayers at the interface of the stratum corneum ( figure 7 ) . intracellular vesicular structures were observed in superficial layers of the stratum corneum and their appearance might be explained by desquamating corneocytes with a leaky membrane , through which oleic acid vesicles penetrate . after skin permeation study of 24 hr sc ( stratum corneum ) was cut into small circular discs . the ft - ir spectra of dexamethasone , rat skin , and dummy formulation were measured on perkin elmer , usa ( model 1600 ) ( figure 8) . the data was obtained in the range of 4004000 cm for each sample . the study was carried out on male wistar rats ( 150200 g , n = 15 ) according to protocol number [ iaec / ccp/12/pr-008 ] . thirty minutes before the intraperitoneal injection of each compound , the basal volume of the hind paws was measured by means of a mercury plethysmometer ( ugo basile ) . afterwards , the gel formulations were applied topically on the rat skin at the dose of 1 mg / kg : ( a ) plain gel ; ( b ) ufasomal gel formulation 0.5% w / w ( 1 square cm area ) ; ( c ) marketed formulation topically 0.5% w / w . thirty minutes after the treatment , carrageenin ( 0.05 ml of 1% suspension in saline ) was injected intraplantarly into the right hind paw of each rat to induce inflammation and 0.05 ml of saline into the contralateral paw . paw volumes up to the ankle joints were measured before and at hourly intervals for 6 h following carrageenin administration . the basal volume of each rat paw was taken as 100% and variations from this volume were given as percent difference . the purpose of the study is to determine the effect of storage at different temperature conditions on stability of ufasomes . physical stability studies were conducted by monitoring the change in mean vesicle size and the leakage of encapsulated drug from ufasomal formulations at different time intervals up to 30 days . the formulations were placed in tightly sealed vials flushed with nitrogen gas and stored at 4 1c and ambient temperature ( 28 1c ) . statistical analysis was carried out employing the student 's t - test using the software prism ( graphpad ) . film hydration method was used for preparation of multilamellar oleic acid vesicles by varying ratios of oleic acid to dexamethasone followed by hydration at ambient temperature for 1 h. the thickness and uniformity of the film depends on speed of rotation . uniform thin lipid film was formed at the rotation speed of 120 rpm while lower and higher rate of rotation resulted in detectable nonvesicular aggregated artifacts . the formed ufasomal formulations were further characterized for size , entrapment efficiency , and zeta potential studies ( table 1 ) . the photomicrographs showed that oleic acid vesicles formed were spherical in nature ( figure 1(a ) ) . further , to detect the multilamellarity of vesicles , tem study was conducted ( figure 1(b ) ) . the size of the ufasomal formulations before sonication was observed in the range of 4 to 5 m while after sonication the vesicle size was in the range of 100200 nm . for better skin permeation hence , the result indicates that vesicle size was dependent on the composition of lipid bilayer . as the concentration of fatty acid in the oleic acid vesicular formulation however , reduction in vesicle size was observed when oleic acid concentration was increased above 15% w / w . this was due to the formation of micellar structure instead of vesicles , which has smaller size than vesicles [ 27 , 28 ] . the result of the vesicle size measurement was well correlated with the report of that vesicle size decreased as surfactant concentration was increased ( table 1 ) . the mean average diameter of ufasomes and traditional liposomes vesicles was 100 nm and was transparent colloidal dispersions ( figure 2 ) ( table 1 ) . the ufasomes were homogenized by extrusion through a 100 and 200 nm polycarbonate membrane filters which result in the formation of monodispersed particles because of the low polydispersity index , that is , less than 1 ( table 1 ) . the size of ufasomal formulation should be less than 50 nm so that it can be used for topical purpose . to support above facts we optimized and reported two parameters which can be related to stability of vesicular formulation . sonication time of ufasomal formulation in size range of 100 nm was optimized at 40 w output frequency at various time intervals of 5 , 10 , 15 , 20 , and 25 min and the size was determined using dls method . the sonication time required for preparing ufasomal formulation of size 100 the studies carried out showed no significant difference in the entrapment efficiency ; however the mean entrapment efficiency of the fatty acid vesicles was found to be increased on increasing the molar quantity of dexamethasone up to 8 : 2 oleic acid - to - dexamethasone ratio ( 65.2 3.8% ) . beyond this ratio the size of fatty acid vesicles was obtained in the range of 400 nm to 1 m . the oleic acid vesicular formulations were mostly poly disperse in nature . at 8 : 2 oleic acid - to - dexamethasone ratios the dispersity was recorded to be 0.534 0.026 . the photomicrographs showed that oleic acid vesicles formed were spherical in nature ( figure 2(a ) ) . further , to detect the multilamellarity of vesicles , tem study was conducted ( figure 2(b ) ) . transformation of fatty acid vesicles to mixed micelles is concentration and ph dependent process and was governed mainly by progressive formation of mixed micelles within the bilayer . to support the above fact the results of turbidity measurement studies ( table 1 ) support the fact that micelles were formed at higher concentration of fatty acid . this can be observed due to fact that at low concentration of surfactant partition coefficient favors the lipid phase and caused expansion of lipid bilayer resulting in increased turbidity of vesicle dispersion . at the same time , surfactant also causes fluidization of bilayer , which is also responsible for increasing the turbidity . after an optimum concentration , conversion of lipid vesicles into mixed micelles begins which have negligible turbidity . the fatty acid vesicles were evaluated to assess their efficacy in delivering the bioactives to and through stratum corneum of the skin . the major consideration in the formulation of fatty acid vesicles is ph of the formulation ; this being a critical factor that controls the degree of ionization of fatty acid [ 14 , 31 ] and is hence responsible for the formation of vesicle . the fatty acid ( oleic acid ) assembled into vesicles only if ph equals the pka of the acid ( 8.5 ) . at this ph , ~50% of the carboxylic acid is ionized and transforms into ionized amphiphile(s ) with a tendency to form vesicles / aggregates . the acid is present as ionic rcoo as well as neutral rcooh species . in such conditions each ionized group is stabilized through a strong hydrogen bond formed with the neutral molecules . the negative charge present on the ionized carboxylic group is shared between two adjacent fatty acid molecules , that is , ionized and unionized , and thus results in the formation of typical dimmers . the hydrophobic hydrocarbon chain of so formed dimmers protects itself from the aqueous compartment and thus orients to form an enclosed bilayer structure that minimizes the interaction between the hydrocarbon chain and water . the ratio of protonated and deprotonated group seems also critical in the process of vesiculation . this is possible only if the concentration of the fatty acid in aqueous dispersion exceeds the critical vesicle concentration ( cvc ) , which is reportedly 80 mm for oleic acid . the stability of the vesicles is attributed to the strong hydrogen bond - based interactions between the protonated and deprotonated groups , namely , rcoo hoocr [ 13 , 3335 ] , the effect of drug : oleic acid ration on the encapsulation of the dexamethasone was studied . it was seen that the drug bearing capacity of the oleic acid vesicles depends upon the molar ratio of oleic acid and dexamethasone . the entrapment efficiency increased up to oleic acid : drug molar ratio 8 : 2 ; beyond this ratio further increase in the amount of drug reduced the degree of drug encapsulation . further addition of drug could have destabilized the vesicle membrane leading to the leakage of content . since the 8 : 2 vesicles showed the best physicochemical characteristics ( high homogeneity , high entrapment efficiency ) , the respective formulation was selected for further studies . different ufasomal formulations were subjected to in vitro drug release studies using cellophane membrane . for the optimization of drug concentration that could be incorporated into the vesicles , these ufasomal formulations were subjected to in vitro drug release through cellophane membrane and the % amount of drug permeated was calculated . values of % amount of dexamethasone permeated across cellophane membrane are shown in figure 3 . by comparing the release from various oleic acid vesicles based formulations ( prepared using different oleic acid and dexamethasone molar ratios ) , it was deduced that there was no considerable difference in the release in terms of kinetic pattern , although drug release exhibited a concentration - dependent behavior . these results are in agreement with the release kinetic reported by other research workers who documented that drug release from vesicles is affected by diffusion [ 36 , 37 ] . the release rate of dexamethasone from ufasomes was slow , controlled and uniform than drug solution . after 4 h 98.5% drug was released from drug solution . in comparison at 8 hr , about 34.3% and , in 24 the ph - dependent stability behavior substantiates that drug diffusion across the skin may increase with a decrease in the ph of the vesicles dispersion . thus , the increased diffusion of drug from the vesicles at low ph may have resulted due to decreased stability of the vesicles at lower ph . this further suggests that vesicles tend to fuse when they are exposed to low ph . it also provided useful information on topical drug delivery potential and characteristics of oleic acid vesicles since the ph of skin is 7.2 . it was observed that the release from vesicles is highly ph - dependent and on lowering the ph from 8.5 to 5.5 , only 30% of the drug remained in vesicles to be released after 8 h of incubation in buffer of ph 5.5 as compared to residual drug estimated , that is , 71% at ph 8.5 ( figure 4 ) . the differences in drug diffusion recorded at ph 8.5 and 7.4 were not significant ( p > 0.01 ) . therefore , further studies were continued by adjusting the ph of vesicles suspension to 7.4 , since higher ph values may cause skin irritation and may not be acceptable for topical application . simultaneously , morphological changes in vesicles size and shape were also observed with changing ph . the results displayed an increase in the size of the vesicles at low ph values ( figure 5 ) . the skin permeation study was conducted on optimized formulation prepared at 8 : 2 fatty acid : drug ratio ( ph 7.4 ) ( highest entrapment efficiency and more uniform sized vesicles ) . to normalize the effect of ph on skin permeation , the plain ph of drug gel was also adjusted to ph 7.4 . a significant increase in the skin permeation of dexamethasone was recorded from oleic acid vesicle dispersion in comparison to plain gel ( figure 6 ) . the drug penetration following application of an equivalent amount of drug in vesicular dispersion was significantly high , that is , 34.75% . the permeation parameters were calculated by plotting a curve between cumulative amounts of drug permeated per unit area ( g / cm ) versus time . the transdermal permeation rate constants obtained were higher for oleic acid vesicle dispersions ( 18 1.48 g / h / cm ) than the plain drug gel ( 3.8 0.8 g / h / cm ) ( table 2 ) . sem studies using rat skin were also conducted in order to explain the effect of fatty acid vesicles on the surface morphology of skin . after 24 hr application of optimized ufasomal formulation ( uf-2 ) on to rat skin sem photomicrographs were taken . the vesicular suspension formed networks and stacks of lipid bilayers at the interface of the stratum corneum . intracellular vesicular structures were observed in superficial layers of the stratum corneum and their appearance might be explained by desquamating corneocytes with a leaky membrane , through which liposomes penetrate . these vesicular suspensions are more flexible and can easily pass through skin pores . in comparison to control skin , vesicle treated skin was more smooth and some vesicular structures were present on the surface . the morphology of cell was changed and some partial disappearance of intercellular lipid was observed . figure 8 shows the ftir spectra of untreated skin ( control ) and skin treated with optimized formulation ( uf-2 ) . in pure dexamethasone spectra , the characteristic absorption bands at 3390 and 1268 f bonds , respectively ; the stretching vibration at 1706 , 1662 , and 1621 cm were due to c = o and double bond framework conjugated to c = o bonds . ft - ir spectrum of untreated sc ( control ) showed various peaks due to molecular vibration of proteins and lipids present in sc ( figure 8(a ) ) . the absorbtion bands in the wave number of 30002700 cm were seen in untreated sc . the bands at 2922.26 cm and 2852.98 cm were due to the asymmetric -ch2 and symmetric -ch2 vibrations of long chain hydrocarbons of lipids , respectively . the bands at 2955 cm and 2870 cm were due to the asymmetric and symmetric ch3 vibrations , respectively . these narrow bands were attributed to the long alkyl chains of fatty acids , ceramides , and cholesterol which are the major components of the sc lipids . the sharp peak at 1708 cm was due to the -c = o stretching vibrations of sc proteins . there was clear difference in the ftir spectra of untreated and treated sc with prominent decrease in asymmetric and symmetric ch- stretching of peak height and area ( figure 8(b ) ) . the rate limiting step for topical drug delivery is lipophilic part of sc in which lipids ( ceramides ) are tightly packed as bilayers due to the high degree of hydrogen bonding . the amide i group of ceramide is hydrogen bonded to amide ii group of another ceramide and forming a tight network of hydrogen bonding at the head of ceramides . this hydrogen bonding makes stability and strength to lipid bilayers and thus imparts barrier property to sc . when skin was treated with ufasomal formulation ( uf-2 ) , ceramides got loosened because of competitive hydrogen bonding leading to breaking of hydrogen bond networks at the head of ceramides due to penetration of ufasomes into the lipid bilayers of sc . treatment with ufasomes resulted in either double or single peak at 1708 cm ( figure 8(b ) ) which suggested breaking of hydrogen bonds by ufasomes . due to the best results observed in the physicochemical characterization , figure 9 shows the increase in edema volume ( % ) using the method of acute edema inhibition produced by carrageenin injection , as a function of time . the evaluation of the anti - inflammatory activities was performed by the comparison of uf-2 with a dexamethasone commercial injection product ( decadron ) used as reference . when dexamethasone was associated with fatty acid vesicles and its anti - inflammatory activity evaluated by inhibition , carrageenan edema a significant reduction of edema ( p < 0.10 ) was measured in comparison to the commercial product . stability of the product may be defined as the capability of a particular formulation to remain with the physical , chemical , therapeutic , and toxicological specifications . the optimized formulation ( uf-2 ) was selected for stability study on the basis of its in vitro performance and stored in tightly closed glass vials at room temperature and in refrigerator ( 4 2c ) . following parameters were evaluated at different time intervals ( 10 , 20 , and 30 days ) . the formulations were stored in 10ml glass vials at refrigeration temperature ( 4 2c ) and room temperature for a period of one month . the samples were analyzed at predetermined time intervals visually and under optical microscope for the change in consistency and appearance of drug crystals . the magnitude of drug retained within the vesicles ultimately governs the shelf life of the formulation . the fatty acid - based vesicles formulations when stored at ambient and refrigerated conditions have shown that the vesicles are stable at 4 1c . this is because the vesicles sizes at this temperature remain stable and unchanged ; thus the leakage from the vesicles was minimal . , the phase transition temperature of oleic acid is exceeded ; hence they tend to fuse [ 39 , 40 ] . the drug leakage studies carried out also suggested better stability of fatty vesicles at refrigerated conditions . based upon above results it can be concluded that encapsulation of drug in fatty acid vesicles can serve as potential carriers for the delivery of anti - inflammatory drug . cost effectiveness , therapeutically viability , and sustained release behaviour along with drug retention in the deeper part of skin might be beneficial for the long - term effects of drugs . the fatty acid in addition may serve as a penetration enhancer , thus by avoiding the stratum corneum barrier potential they may lead to better permeation of the drug molecules .

the purpose of study is to formulate and evaluate ufasomal gel of dexamethasone . ufasomal suspension was made by sonication method using different concentrations of span 80 , span 20 and cholesterol along with 25 mg of drug . ufasomal gel was formulated by hydration method using carbopol 940 . ufasomal vesicles appeared as spherical and multilamellar under transmission electron microscope . ufasomal formulation prepared with drug to oleic acid molar ratio 8:2 ( uf-2 ) produced greater number of vesicles and greater entrapment efficiency . uf-2 was optimized for further evaluation . the transdermal permeation and skin partitioning of from optimized formulation was significantly higher ( p < 0.05 ) as compared to plain drug and plain gel formulation which is due to presence of surfactant acting as permeation enhancer . permeation of optimized formulation was found to be about 4.7 times higher than plain drug gel . anti - inflammatory activity evaluated by inhibition carrageenan induced rat paw edema model . significant reduction of edema ( p < 0.10 ) was observed in comparison to the commercial product . hence oleic acid based vesicles can be used as alternate carrier for topical delivery .

minimal change nephropathy ( mcn ) accounts for 25% of adults presenting with a nephrotic syndrome . although most patients respond to corticosteroid therapy , a significant number relapse frequently and may present a real therapeutic difficulty . we present a case of apparently refractory relapsing mcn that was successfully treated with a combination of sirolimus and cyclosporin . in 1989 , a 35-year - old female presented acutely with heavy proteinuria ( 22 g/24 h ) and normal renal function . she was commenced on oral prednisolone ( 60 mg od ) , and achieved complete remission within weeks . however , multiple relapses followed on reduction of the corticosteroid dose . azathioprine , cyclosporin , mycophenolate mofetil , tacrolimus and chlorambucil were all tried unsuccessfully , but neither the relapse rate nor the steroid requirements improved . in 2003 , cyclosporin was re - introduced to minimize steroid exposure with trough plasma levels of 149 g / l . in the preceding 14 years , the prednisolone dose had rarely been below 15 mg / day , and there had typically been two to three relapses per year . in 2006 , sirolimus 2 mg / day was added to her prednisolone ( 15 mg / day ) , and cyclosporin ( 6 mg / kg / day)she was also prescribed primidone since childhood for epilepsy . at review , the trough plasma levels of cyclosporin and sirolimus were 153 g / l and 2.9 g / l , respectively . steroids were gradually reduced and subsequently completely discontinued 24 months after sirolimus was added with no relapses in the last 30 months . mcn is predominantly a steroid - responsive disease , with around 75% of adult patients achieving remission by 8 weeks . unfortunately , 3060% will suffer at least one episode of relapse and around 25% will do so more frequently . a variety of immunosuppressive medications , each with its own side effect profiles , have been trialled as steroid - sparing agents with variable success . frequently relapsing minimal change disease the first documented use of sirolimus in combination with tacrolimus as a therapeutic option in mcn was published in 2005 by patel et al . . in conclusion , we have detailed a case of relapsing mcn , which has only been controlled by the combined use of sirolimus and cyclosporin . this has not only resulted in the longest period of remission , but has also allowed for the discontinuation of corticosteroids . this is the second documented use of sirolimus in this manner that we are aware of and the first that has trialled the combination of sirolimus and cyclosporin .

minimal change nephropathy ( mcn ) accounts for around 25% of adults presenting with a nephrotic syndrome . although most patients respond to corticosteroid therapy , a significant number relapse frequently and may present a real therapeutic difficulty . we present a case of apparently refractory relapsing mcn that was successfully treated with a combination of sirolimus and cyclosporin , resulting in the longest period of steroid free remission that the patient has ever experienced . to our knowledge , this is the first documented use of this combination in this manner .

obesity is one of the major cardiovascular disease ( cvd ) risk factors and is a common health problem both in adults and in children . not only do obese children have a higher risk of becoming obese adults , childhood bmi is independently associated with later coronary heart disease as well . visceral fat in particular is related to an adverse metabolic profile and increased cvd risk through the production and secretion of metabolic active compounds like adipokines and cytokines , with effects on insulin sensitivity , lipid metabolism , and inflammation among others . from a cvd prevention point of view , early prevention of intra - abdominal fat accumulation growth patterns in early life have been suggested to be important for later fat distribution . several studies determined an association between weight gain in the first 2 - 3 years of life and central adiposity , mostly assessed by larger waist circumference , in both adulthood and early childhood [ 813 ] . imaging techniques such as magnetic resonance imaging , ultrasonography [ 10 , 11 ] , or computed tomography have seldom or never been used to assess the association between postnatal growth and later central adiposity . while in these studies weight gain in the first years of life was studied , the importance of particularly the first 3 months of life in the development of central adiposity was addressed in other studies in children and adults [ 1517 ] . weight gain in the first 3 postnatal months is thought to comprise predominantly fat mass accumulation ; fat mass as percentage of body weight increases until 36 months of age , followed by a gradual decline . most of the previous studies did not account for length gain in infancy , while weight gain relative to length gain might reflect adiposity better than weight gain alone [ 19 , 20 ] . whether particularly rapid weight gain for length gain in the first 3 postnatal months , so excess weight gain relative to length gain , is related to differences in intra - abdominal fat , measured ultrasonographically , in childhood we set out to measure intra - abdominal and subcutaneous fat ultrasonographically in healthy 5-year - old children , to study whether differences in growth in the first 3 postnatal months , in particular increased weight gain accounting for length gain , are associated with increased central adiposity in early childhood . the present study is part of the wheezing illnesses study leidsche rijn ( whistler ) study , an ongoing population - based birth cohort on determinants of wheezing illnesses , initiated in 2001 . healthy newborns in leidsche rijn , a new residential area near utrecht city , were enrolled . exclusion criteria were gestational age < 36 weeks , major congenital abnormalities , and neonatal respiratory disease . all five - year - olds ( n = 1124 on april 26th , 2011 ) were invited according to the last - known telephone number and address , for follow - up measurements . 215/1124 ( 19% ) subjects were lost to follow - up , due to incorrect telephone numbers and addresses , and 54/1124 ( 5% ) were not yet contacted . of the remaining 855 subjects , 285 ( 33% ) declined to take part and 570 ( 67% ) were willing to participate of whom 517 were measured before april 26th 2011 . abdominal ultrasonography was performed and intra - abdominal fat and subcutaneous fat were measured successfully in 434/517 ( 84% ) and 463/517 ( 90% ) subjects , respectively . in the remaining participants the focus was solely on respiratory measures . complete data on postnatal weight gain relative to length gain and abdominal fat distribution were available for 360/517 children ( 70% ) , and in addition on birth size for 316/517 ( 61% ) . whistler - cardio was approved by the paediatric medical ethical committee of the university medical center utrecht . parents visited the clinic when their offspring was approximately four weeks of age for lung function measurements , not further described here . birth weight in 359/360 ( 99.7% ) children and birth length in 317/360 ( 88% ) children were measured standardized in the hospital or by midwifes using a standard electronic scale and an infant stadiometer . this questionnaire inquired for maternal age at childbirth and gestational age among others as well . in the netherlands infants we asked parents to report these measurements in monthly questionnaires for a period of 12 months . exclusively breastfed if the only milk their infant had received during the month of interest was breast milk . data on parental characteristics , like parental bmi , ethnicity and level of education among others , were obtained from the linked database of the utrecht - health - project ( uhp ) , a large health monitoring study in leidsche rijn . weight , height , and waist circumference were measured with the participants wearing indoor clothes without shoes . standing with the feet slightly spread waist circumference was measured in duplicate at the level midway the lowest rib border and the iliac crest and hip circumference at the widest level over the major trochanter to the nearest mm . in addition , intra - abdominal and subcutaneous fat were measured using ultrasound according to a previously described procedure [ 26 , 27 ] with a picus pro system ( esaote , italy ) , using a ca 421 convex transducer . for intra - abdominal fat , the distances between the posterior edge of the abdominal muscles and distances were measured from 3 different angles : medial , left , and right lateral , with the transducer placed longitudinally on a straight line drawn between the left and right midpoint of the lower rib and iliac crest . placing the probe transversely at the level of the umbilicus subcutaneous fat was measured with electronic callipers , from the external face of the rectus abdominis mucle ( linea alba ) to just below the skin . all measurements were performed by two of the investigators and a trained research nurse all blinded to infancy weight and length gain . intraclass correlation coefficients ( icc ) based on measurements by one observer in 10 and , respectively , 11 subjects on 2 different occasions for intra - abdominal and subcutaneous fat were 0.67 and 0.96 , respectively . iccs for subcutaneous fat on the three measurements per child on the same occasion were 0.94 , 0.94 , and 0.97 for the three observers . in addition , information on child and parental characteristics , like smoking habits among others , with respect to the previous years was collected by questionnaires . we used weight gain rate , length gain rate , and particularly weight gain rate adjusted for length gain rate as measures of growth in the first 3 postnatal months . these measures were studied separately , as length gain might reflect lean mass accumulation , while weight gain , and particularly weight gain accounting for length gain , might reflect fat mass accumulation . for each child with at least two anthropometric measurements available in the first 3 postnatal months , weight gain and length gain rates were estimated using the monthly anthropometrics , to reduce an effect of measurement error and individual variation over time ( regression to the mean ) . since the number of weight and length measurements ( median count : 3 ) and the age at which these were measured differed per child , the association between age , and both weight and length was assessed using linear mixed modelling , allowing for individual variation in birth weight or height and growth rate . subsequently , to obtain weight gain rates for each child individually , linear regression modelling on the predicted weight and length values of the linear mixed model was performed stratified by child . because of the small time window , weight and length gain rate were assumed constant in the first 3 postnatal months . wlg was assessed by deriving z - scores internal to our study population for weight gain , conditioned on length gain , by using the standardized residuals from the linear regression model with weight gain as the dependent variable and length gain as the independent variable . a z - score of + 1 sd wlg indicates that the weight gain of a certain child is one standard deviation larger than the mean weight gain in the population based on the length gain of that child . furthermore , size at birth was assessed by calculating internal z - scores for birth weight , adjusted for birth length , gestational , age and gender . means and dispersion measures of parent and child characteristics were calculated by tertiles of z - score wlg . differences by tertiles of z - score wlg were tested using analysis of variance , or kruskal wallis test in case of skewed data , for continuous variables and chi - squared tests or fisher 's exact tests for frequencies ( table 1 ) . for analyzing the associations between postnatal growth and fat distribution we used generalized linear modelling . bmi , waist circumference , intra - abdominal fat , and subcutaneous fat were used as dependent variables in separate models . weight gain rate , length gain rate , and z - score wlg were used as independent variables in separate models . after univariable analysis , adjustments for age at follow - up and gender were made . in the analyses of intra - abdominal and subcutaneous moreover , adjustments for current height were made , as achieved height can be considered as confounder when studying the association between early weight gain and wlg and fat distribution . parental characteristics , like smoking and bmi , and infant nutrition , were not considered as confounders , as to our view these factors might explain the associations between growth and later fat distribution and might therefore be in the causal pathway . since an association between postnatal growth and fat distribution might be modified by fetal growth as well , we analyzed whether interaction on an additive scale was present between birth size , as proxy for fetal growth , and early postnatal growth on fat distribution . we therefore imputed birth length using multiple imputation technique in spss version 17.0 for windows and repeated the analyses on the 10 imputed datasets as sensitivity analysis . all results are expressed as linear regression coefficients with 95% confidence intervals ( 95%-ci ) and corresponding p values . median bmi , waist circumference , subcutaneous fat , and mean intra - abdominal fat were 15.1 kg / m ( interquartile range ( iqr ) : 14.316.1 ) , 52.5 mm ( iqr : 50.554.8 ) , 6.3 mm ( iqr : 5.07.9 ) , and 36.4 6.5 mm , respectively . no differences in infant feeding type and parental characteristics were determined across growth tertiles , except for parental smoking habits and maternal gestational diabetes : parents of children with lower wlg smoked more often in the 5 years after birth and all three infants of the mothers who have had gestational diabetes belonged to the highest z - score wlg tertile . postnatal wlg was positively associated with weight and height of the children at the follow - up visit at 5 years of age ( table 1 ) . in table 2 the associations between early postnatal growth and body fat distribution at the age of 5 years are shown . after correcting for confounders , size at birth was positively associated with bmi and waist circumference , but not with intra - abdominal and subcutaneous fat . with respect to postnatal growth , both weight gain and z - score wlg were significantly positively associated with bmi , waist circumference , and subcutaneous fat at the age of 5 years . no significant associations between both weight gain and wlg with intra - abdominal fat were observed . size at birth did not modify the associations between postnatal growth and body fat distribution . after multiple imputation of birth length , to have complete data on size at birth for all 360 children in which an ultrasound was successfully performed and growth data was available , the associations between postnatal wlg and bmi , waist circumference , and subcutaneous fat strengthened . regarding intra - abdominal fat , a trend towards significance was observed : per 1 unit increase in z - score wlg , intra - abdominal fat was 0.51 mm higher ( 95%-ci : 0.14 , 1.2 , p value : 0.12 ) . again , no interaction between size at birth and postnatal growth on body fat distribution was present . the present study contributes to current knowledge in showing that excess weight gain relative to length gain in the first 3 months after birth is associated with central adiposity . in addition , these results suggest an increase in intra - abdominal fat as well . some remarks have to be made . whistler is a population - based cohort and families with a healthier lifestyle might be more willing to participate . moreover , children with follow - up measurements tended to have a higher birth weight and were larger at birth ( data not shown ) compared to those lost to follow - up . since data on birth size was not available for all children , birth length was imputed using multiple imputation . missing birth length was associated with lower gestational age and the imputed birth lengths were smaller than those nonimputed . multiple imputation strengthened the observed associations between postnatal growth and adiposity measures in young childhood , indicating an effect of selection on the results from the complete case analyses . we consider our study population to be representative of a healthy pediatric population , as the mean weights and lengths in infancy are in line with the who growth charts . we derived internal z - scores for weight gain rate conditioned on length gain rate , as references values for comparable z - scores are not available . since data on fetal growth have not been collected as part of the present study , birth size was used as proxy . therefore , birth weight adjusted for birth length and gestational age might be a better indicator of intrauterine exposures . besides age , gender , current height , and sonographer , we did not consider other factors , like parental bmi , infant feeding , tobacco smoke exposure among others as confounders , as these factors might precede the studied association and might therefore be in the causal pathway . whether or not to adjust for achieved height is topic of discussion [ 29 , 30 ] . however , when comparing absolute fatness of individuals of different heights , adjustment for height is indicated [ 19 , 20 ] . since the ultrasonography was performed blinded to infancy characteristics , the probability of information bias to have occurred is negligible . additionally , we adjusted for sonographer , to further rule out the possibility of observer bias . although ct is currently the most accurate method to measure intra - abdominal fat , ultrasonography is a good , child friendly , and practical alternative in population studies , which has been shown to correlate well with results from ct and mri . when the data collection of the present study started , we chose to use ultrasonographically measured intra - abdominal depth to assess visceral fat [ 26 , 27 ] . more recently , validation studies of this method in children provided conflicting results [ 32 , 33 ] and another ultrasonographic method for measuring intra - abdominal fat has been described [ 34 , 35 ] and validated in infants . although we previously found an association between intra - abdominal depth and vascular characteristics in the 5-year - olds of our study population as well , it should be kept in mind that consensus regarding the best , feasible method for measuring intra - abdominal fat in children , has not yet been reached . previously , associations between weight gain in the first 2 years of life and childhood bmi [ 8 , 9 ] , waist circumference [ 8 , 12 , 13 ] , intra - abdominal fat , and both subcutaneous and preperitoneal fat have been described . in the present study , we focused on excess weight gain relative to length gain the first 3 postnatal months , as the importance of particularly this period in the development of increased waist circumference in adulthood [ 1517 ] and childhood was addressed in previous studies . associations between excess early postnatal weight gain and bmi , waist circumference , and abdominal subcutaneous fat were indeed observed in this study , and some evidence for an association with intra - abdominal fat was found as well . the difference in precision of the ultrasonographic fat measurements might explain why the association with intra - abdominal fat was less pronounced than the association with subcutaneous fat . the observed differences in adiposity associated with excess weight gain in early infancy might be explained by increased accumulation of fat mass in the early postnatal period . weight gain for length gain in the first months after birth primarily reflects accumulation of fat mass , since fat mass increases from approximately 13% of total body weight to 31% between 0.5 and 36 months of age . according to the developmental origins of human health and disease hypothesis [ 37 , 38 ] increased postnatal weight gain for length gain might be a reflection of metabolic programming following a period of relative growth impairment . however , in the present study no interaction between postnatal weight gain for length gain and size at birth was observed in the associations with adiposity at 5 years of age . this indicates that the association between increased weight gain for length gain and fat distribution is not only present for those infants who were growth restricted in pregnancy , but also for infants with normal fetal growth . we found some evidence for an association between excess early postnatal weight gain and intra - abdominal fat . besides these differences in quantity of intra - abdominal fat , the previously observed adverse metabolic consequences later in life associated with increased postnatal growth , adipose tissue dysfunction might be even more important than quantity alone in the development of cvd . further research is needed to study whether excess weight gain in early infancy leads to changes in adipose tissue functioning in early childhood . while the observed differences in fat distribution are relatively small from an individual perspective , they are relevant from a population perspective . however , we should be careful in extrapolating these finding to growth interventions , as rapid postnatal growth might have benefits as well [ 3941 ] . moreover , to date it remains unknown how to modify infant growth in a way that avoids adverse outcomes . based on current knowledge , prevention of known causes of impaired fetal growth and rapid postnatal growth , such as maternal smoking during pregnancy , is indicated . in conclusion , variations in postnatal growth are associated with abdominal fat in early childhood . over the whole range of birth size , excess early postnatal weight gain relative to length gain is associated with increased general and central adiposity , characterized by higher bmi , larger waist circumference , more abdominal subcutaneous fat , and likely more intra - abdominal fat at 5 years of age .

background . increased childhood weight gain has been associated with later adiposity . whether excess early postnatal weight gain plays a role in childhood abdominal fat is unknown . design . in the ongoing wheezing illnesses study leidsche rijn ( whistler ) , birth cohort weight and length from birth to age 3 months were obtained . in the first 316 five - year - olds , intra - abdominal and subcutaneous fat were measured ultrasonographically . individual weight and length gain rates were assessed in each child . internal z - scores of weight for length gain ( wlg ) were calculated . multiple imputation was used to deal with missing covariates . results . per-1-unit increase in z - score wlg from birth to 3 months , bmi , waist circumference , and subcutaneous fat were significantly higher ; 0.51 kg / m2 , 0.84 cm , and 0.50 mm , respectively . after multiple imputation , a trend towards significance was observed for intra - abdominal fat as well ( 0.51 mm / sd ) . in the associations with 5-year adiposity , no interaction between postnatal z - score wlg and birth size was found . conclusion . excess early postnatal weight gain is associated with increased general and central adiposity , characterized by more subcutaneous and likely more intra - abdominal fat at 5 years of age .

in modern society , the fashion of wearing tight clothes for stylish dressed states or comeliness is getting very popular1 . however , specialists reported that excessively pressing certain areas of the human body could cause many problems in the cardiovascular systems and visceral organs1 . in addition to this pressure inflicted on the human body may deform muscles , the skeletal system , and even the overall body type2 , 3 . jeans that are too tight compress a nerve that cuts off sensation to the thighs , and this is consistent with human anatomy and physiology4 . trousers that are too tight can squeeze a sensory nerve under the hip bone , causing a tingling , burning sensation called paresthesia1 , 4 , 5 . with this as the background , the present study aimed to understand the hazards of the habit of wearing tightly fitting clothes in relation to deformations of the musculoskeletal system and the movement of the lumbar spine and pelvis for the purpose of providing basic data regarding proper habits in wearing clothes for the prevention of pain in the musculoskeletal systems2 , 3 . so the present study evaluated the effect of wearing tight pants on the trunk flexion and pelvic tilting angles in stand - to - sit movement and in a seated posture . this study was performed on nine males aged 2027 years ( 23.22.0 years , meansd ) whose height and weight were 175.13.2 cm and 62.13.4 kg , respectively . subjects with conditions that might affect trunk mobility , such as injury or neurologic deficits of the hip and lower extremities during the past year , were excluded from study . the study purpose and methods were explained to all the subjects , who provided informed consent according to the principles of the declaration of helsinki before participating . data were collected at a sampling rate of 100 hz with a motion capture system ( vicon mx , oxford metrics , oxford , uk ) that consisted of eight infrared cameras . sixteen reflective markers were attached to the lower body according to the plug - in - gait marker set ( oxford metrics ) using double - sided tape . the software used for kinematic data collection was nexus 1.4.1 ( oxford metrics ) , and the data were analyzed with the polygon 3.1 software ( oxford metrics ) . the experimental protocol required the completion of two stand - to - sit trials for each of the two pants conditions . the worn pants were made from the same material , cotton , woven into a rugged cotton textile . we used general and tight pants from the same company ( g company ) . the pants were worn under two conditions in this study : ( 1 ) general pants , worn with sizes equivalent to 105110% of the subjects hip , thigh , and calf circumferences , and ( 2 ) tight pants , worn with sizes equivalent to 9095% of the subjects hip , thigh , and calf circumferences . each subject was asked to stand up at a self - selected speed from a seated posture and to stand in an erect spine posture . for time normalization , the time required for a complete stand - to - sit movement cycle , that is , from movement onset to completion , was considered to be 100% ; values were determined for each 2% of the movement , beginning at 0% . the changes in trunk flexion and pelvic posterior tilting angles were calculated based on the difference between the maximal and initial angles . as the analysis was performed with a withwn - subject design , the paired t - test was conducted to test for differences in pelvic and trunk kinematics values during the maneuver . all significance levels were set at p<0.05 , and spss version 12.0 ( spss , chicago , il , usa ) was used for statistical analyses . the change in the posterior pelvic tilting angle ( 9.3 4.1 ) during the stand - to - sit movement when wearing the tight pants increased significantly compared with that when wearing the general pants ( 7.0 3.3 ) ( p<0.05 ) . the change of the trunk flexion angle ( 19.3 5.4 ) during the stand - to - sit movement when wearing the tight pants increased significantly compared with that when wearing the general pants ( 12.0 3.8 ) ( p<0.05 ) . the change in the posterior pelvic tilting angle ( 13.3 3.2 ) in the seated posture when wearing the tight pants increased significantly compared with that when wearing of the general pants ( 10.3 2.9 ) ( p<0.05 ) . the change in the trunk flexion angle ( 25.3 6.1 ) in the seated posture when wearing the tight pants increased significantly compared with that when wearing of the general pants ( 20.1 5.4 ) ( p<0.05 ) . park and yoo reported that the tightness of a waist belt might restricts forward movement of the center of mass and that pelvic inclination might be increased as a compensatory mechanism2 . they showed that the wearing a tight belt could interrupt normal lumbo - pelvic coordination , which might contribute to muscle imbalance2 . elevated abdominal pressure has been shown to cause multidirectional stiffness of the spine5 , 6 . a previous study that used a wide belt reported that the intramuscular pressure on the erector spinae could influence spinal stiffness separately from muscle7 . the results of the present study showed that the trunk flexion and posterior pelvic tilting angles during the stand - to - sit movement when wearing tight pants significantly increased when compared with wearing general pants . also , the trunk flexion and posterior pelvic tilting angles in the seated posture when wearing tight pants significantly increased when compared with those when wearing of general pants . the lumbar and hip rhythm and interaction between the lumbar spine and hip are important kinematic factors that are used not only in experimental research but also in clinical examination8 , 9 . wearing tight jeans induced excessive lumbar flexion during stand to sit movement and in the seated posture . the exaggerated lumbar flexion may overstretch posterior connective tissues , such as the interspinous ligament , apophyseal joint capsule , and thoracolumbar fascia , or increase stress on discs and apophyseal joints5 . posterior pelvic tilt decreases lordosis via flexion of the lumbar spine , causes posterior movement of the nucleus pulposus , and increases the diameter of the intervertebral foramina5 , 8 . slump sitting reduces the activation of the spinal stabilizing muscles and is associated with increases in loading on the intervertebral disc and connective tissue8 , 9 . therefore , wearing tight pants could produce musculoskeletal disorders via abnormal movement and posture in the lumbar spine and pelvis . so the effects of wearing tight pants need to be investigated in further studies to reveal their direct relationship to musculoskeletal problems . the effects of tight clothes and accessory items on the human body should also be investigated in order to provide basic data for proper use . further studies will become the starting point for studies regarding the effects of wearing tight clothes and tight fashion accessories on the musculoskeletal system .

[ purpose ] the purpose of this study was to evaluate the effect of wearing the tight pants on the trunk flexion and pelvic tilting angles in the stand - to - sit movement and a seated posture . [ subjects ] nine male subjects were recruited . [ methods ] the trunk flexion angle and pelvic posterior tilting angle were measured using a motion - capture system during the stand - to - sit movement and in a seated posture . [ results ] the trunk flexion and the posterior pelvic tilting angles during the stand - to - sit movement and in the seated posture when wearing tight pants significantly increased compared with those when wearing of general pants . [ conclusion ] therefore , wearing tight pants could produce musculoskeletal disorders via abnormal movement and posture in the lumbar spine and pelvis . so the effects of wearing tight pants need to be investigated in further studies to reveal their direct relationship to musculoskeletal problems .

the importance of early and intensive control of blood glucose levels in improving outcomes for people with type 2 diabetes mellitus ( t2 dm ) was established in the uk prospective diabetes study ( ukpds ) . despite differences in glucose levels between the intensive and standard treatment groups disappearing soon after completion of the active study intervention , the benefits of earlier intensive glycaemic control in reducing diabetic complications were found to persist in long - term ( 10-year ) follow - up . combined with evidence that even short periods ( i.e. weeks ) of hyperglycaemia increase the risk for developing diabetic complications , this highlights the importance of trying to establish good glycaemic control as early as possible . subsequent large - scale intervention studies have confirmed the benefit of intensive glycaemic control in reducing microvascular risk , but the findings regarding cardiovascular disease and overall mortality have been less conclusive . of note , what constitutes intensive therapy has evolved over the two decades since the ukpds as new antihyperglycaemic agents have become available . the newer agents , particularly those associated with a low risk of hypoglycaemia compared with sulphonylureas and insulin , offer new options for combination therapy aimed at achieving better glycaemic control . the global partnership for effective diabetes management was an early advocate for adoption of tailored targets and treatment in t2 dm , and subsequent guidelines have evolved to reflect the evidence , with universal glycaemic targets and treatment algorithms replaced with recommendations to individualize targets and treatment . while it seems clear that individualized targets are needed to optimize care , it is critical that good glycaemic control , as defined by individualized hba1c targets , is pursued without delay and with commitment . however , it is widely recognized that glucose levels are not well controlled in many people with t2 dm . through a review of recently published data , we aimed to summarize current standards of glycaemic control globally . we also sought to identify the factors that may contribute to poor rates of glycaemic control . searches were performed , last updated in july 2015 , in the us national library of medicine / national institutes of health pubmed database . abstracts of the publications identified by the searches were reviewed manually and included in the review if they reported ( 1 ) original data related to proportions of people with t2 dm achieving glycaemic control or ( 2 ) obstacles or barriers contributing to suboptimal glycaemic control . publications were excluded from the review if they were ( 1 ) published before 2011 or ( 2 ) published in a language other than english . manuscripts written originally in a language other than english but where an english translation is available were included . the search of the pubmed database was complemented by a manual search of online abstracts from recent ( 20132015 ) diabetes conferences including those from the european association for the study of diabetes and the american diabetes association annual meetings . terms used in the pubmed search were also entered into the google search engine , and the results were reviewed manually to identify any additional relevant data from credible sources that might inform the analysis and review . a meta - analysis was not performed owing to the diverse nature of the data collected . a total of 45 relevant publications were identified by the search strategy and included in the literature review and analysis . the results of the literature review suggest that suboptimal glycaemic control is a common and widespread problem . the proportion of patients not achieving hba1c targets in 12 studies published between 2011 and 2015 inclusive is summarized in table 1 . even in the study reporting the best rate of control , one in every three patients was above the hba1c target . a multi - centre , cross - sectional study of ~5800 people with t2 dm from nine european countries found that hba1c exceeded the target of 7.0% ( 53 mmol / mol ) in 37% of cases , with rates for individual countries ranging from 26% in the netherlands up to 52% in turkey . tidm : type 1 diabetes mellitus ; t2 dm : type 2 diabetes mellitus . target hba1c 7.0% ( 53 mmol / mol ) , other than for the study of laiteerapong et al . which used individualized targets of hba1c < 6.5% , < 7.0% or < 8.0% ( < 48 mmol / mol , < 53 mmol / mol or < 64 mmol / mol ) based on patient characteristics . nine european countries : belgium , france , germany , greece , italy , the netherlands , spain , turkey and the united kingdom . other publications show that hba1c levels are markedly above target in a large proportion of people with t2 dm . in a registry - based study of > 10,000 people undergoing care for t2 dm in specialist clinics in canada , 62% were not at target [ hba1c 7.0% ( 53 mmol / mol ) ] and 15% had an hba1c level of 9.0% ( 75 mmol / mol ) or above . a puerto rican study of 600 adults with type 1 or type 2 diabetes reported that just 37% were at the recommended hba1c target . a survey of > 200,000 people with diabetes in taiwan found hba1c > 9.0% ( 75 mmol / mol ) in nearly one in every four people and 30% of outpatients with t2 dm attending a medical college in rural india had hba1c 9.5% ( 80 mmol / mol ) . there was some evidence to suggest that suboptimal control occurred more frequently in low- and middle - income countries compared with wealthier countries , with the highest rate of 87% for non - achievement of hba1c target reported in rural india . however , high proportions of people in high - income , resource - rich settings also had inadequate control of hyperglycaemia . suboptimal glycaemic control is often accompanied by poor control of other cardiometabolic risk factors . in a prospective cohort study of more than 3000 people with t2 dm in canada , the proportion of people with hba1c , blood pressure and low - density lipoprotein ( ldl ) cholesterol at target on study entry was 47% , 46% and 36% , respectively . all three risk factors were controlled to target in just 19% of people , and only 7% maintained good control of glycaemia , blood pressure and ldl cholesterol throughout the 12-month study . a canadian study of more than 5000 people with t2 dm seen by 479 primary care physicians found that the proportions achieving targets were 50% for hba1c , 36% for blood pressure and 57% for ldl cholesterol , with only 13% reaching all three targets . similar results were found in more than 25,000 outpatients with t2 dm in china , with the proportions of patients achieving targets for hba1c , blood pressure and lipids of 48% , 28% and 36% , respectively . importantly , nearly all of the studies reviewed assessed the quality of glycaemic control against a single target of hba1c 7.0% ( 53 mmol / mol ) . within the context of individualized targets now recommended in guidelines , a somewhat higher target [ e.g. hba1c 7.5% ( 59 mmol / mol ) ] may have represented optimal management based on factors such as age , presence of cardiovascular comorbidities and duration of diabetes . this is unlikely to account for the large proportion of patients not controlled to hba1c 7.0% ( 53 mmol / mol ) and certainly should not justify the sizeable proportion of people with hba1c levels exceeding 9.0% ( 75 mmol / mol ) . however , it highlights that a single target is unlikely to represent optimal management for all people . the review provides strong evidence that in all regions of the world , many people with t2 dm are not achieving good glycaemic control . although there is considerable heterogeneity in the studies and the data generated , rates of uncontrolled glycaemia are typically in the range of 40%60% . consequently , many people are left at increased risk of diabetic complications and the associated burden of illness and mortality , as well as consequent economic costs . recent studies examining barriers to the achievement of good glycaemic control are summarized in table 2 . tidm : type 1 diabetes mellitus ; t2 dm : type 2 diabetes mellitus ; hcps : healthcare professionals . prescribers often identify poor patient motivation and self - management as leading barriers to achieving glycaemic targets . the second diabetes , attitudes , wishes and needs ( dawn2 ) study , included an online survey of 4785 healthcare professionals ( hcps ) ( ~40% primary care clinicians , 30% diabetes specialists , 20% nurses and 10% dieticians ) from 17 countries across four continents . the majority of the respondents ( 60% ) indicated a need for improvements in self - management by people with diabetes , particularly in the area of diet and exercise . resistance to lifestyle measures was also identified as a leading barrier by 252 primary care physicians , nurse practitioners and physician assistants in the united states , with 52% of hcps indicating that it was often or almost always a factor contributing to chronic lack of glycaemic control . other leading patient - related barriers identified by the hcps included psychosocial issues ( 34% ) , reluctance to use insulin ( 31% ) and non - compliance ( 30% ) . a study in the united kingdom examining the reasons for very poor glycaemic control [ hba1c 10% ( 86 mmol / mol ) ] in 128 people with t2 dm attending three primary care centres found poor adherence to lifestyle measures to be most frequently involved . other factors included infrequent clinic attendance ( 16% ) , side effects ( 16% ) , poor compliance with pharmacotherapy ( 14% ) , lack of knowledge of diabetes ( 14% ) , lack of titration of insulin ( 13% ) and insulin refusal ( 12% ) . poor patient motivation and adherence were also identified as barriers to good glycaemic control in qualitative studies with hcps . interviews with a small number ( n = 9 ) of hcps in the united arab emirates revealed a tendency to view patient attitudes and behaviours as the origin of poor glycaemic control and to believe that if patients were more knowledgeable about diabetes , cooperated with hcps and were adherent with treatment , then they could achieve their glycaemic targets . the studies reviewed also revealed that a number of healthcare system - level factors are often seen as important barriers to good glycaemic control . the dawn2 study , for example , found that only 30% of the hcps surveyed believed that healthcare was well organized for the management of chronic conditions . participants from western european countries and china were more likely to feel that healthcare was well organized than those from north or south america , eastern europe , india or japan ( figure 1 ) . approximately half of the participants considered the healthcare remuneration system to be a barrier and most ( ~60% ) indicated a need for better access to qualified nurse educators / specialist diabetes nurses and psychologists / psychiatrists . proportion of healthcare professionals reporting that healthcare in their country is well organized for the management of chronic conditions , including debates . a survey of 47 european countries found that while all had guidelines in place for managing diabetes , only 7 ( 15% ) had protocols for monitoring their implementation . the majority ( 83% ) of countries had or were developing national plans for diabetes , but these were often not comprehensive . there was substantial variability in the provision of multidisciplinary care . while 80% reported that nurses play an important role in providing education for self - management , diabetes specialist nursing was recognized as a speciality in only 19 countries ( 40% ) . despite the widespread belief that patients need to be more engaged and effective in self - management , only 25% of the countries recommended continuous education for all people with diabetes . lack of effective self - management education was also identified as a barrier in a qualitative study involving focus group discussions with 25 primary care clinicians in the united states , along with a persistent focus on acute care , poor integration of diabetes care , lack of clinical information and inadequate public health support . lack of coordination in care and limited access to secondary resources were also identified as important barriers by studies in the netherlands and ireland . limitations on the time available to manage patients are often identified as an obstacle to good glycaemic control . in the survey of 252 us primary care physicians , lack of time for treating complex patients was reported as often or always a factor in failure to achieve good glycaemic control by 41% of the physicians . treatment costs were much less frequently seen as a barrier , with 25% of the hcps indicating that it made no contribution and most ( 58% ) saying that it was a factor in only a minority ( 20%40% ) of cases of poor glycaemic control . other studies have also suggested that hcps in primary care often feel that they lack the time or other resources needed to manage diabetes effectively . this raises particular concerns , given that health policy in some countries involves shifting more of the responsibility for diabetes management onto primary care . compared with patient- and system - related barriers to effective glycaemic control , there is limited information available regarding physician - related barriers . however , there is evidence to suggest that a lack of diabetes - focused education may be contributing to failure to achieve therapeutic targets . for example , one in five of the hcps surveyed in the dawn2 study indicated that they had received no formal postgraduate diabetes training , and in a uk survey , only 35% of 2149 trainee doctors felt that their postgraduate training had prepared them adequately to optimize treatment of diabetes and only 41% reported that they would take the initiative to optimize glycaemic control . a survey of 209 primary care clinicians in australia identified gaps in knowledge relating to the medical management of t2 dm , with 46% self - reporting a need for education on pharmacological management . it appears that prescribers often lack confidence in the use of insulin , particularly with more complex regimens . people with diabetes often continue in poor glycaemic control for extended periods of time without appropriate action being taken . a retrospective cohort study of > 80,000 people with t2 dm in the united kingdom revealed substantial delays in intensifying treatment when glycaemic control was suboptimal . for people who were inadequately controlled on one oral glucose lowering agent , the median time from hba1c being above a threshold of 7.0% ( 53 mmol / mol ) to treatment intensification with an additional oral agent was nearly 3 years , and even when hba1c was 8.0% ( 64 mmol / mol ) , intensification was delayed by a median of 1.6 years . there were even longer delays ( median of ~67 years ) in intensifying treatment with the addition of a third oral agent or the initiation of insulin . mean hba1c at intensification ranged from 8.7%9.7% ( 7283 mmol / mol ) . in a study of nearly 20,000 people with t2 dm initiated on basal insulin at hospitals across china , a study of primary care records of > 17,000 patients with t2 dm being treated with oral glucose lowering agents in france found that > 3000 of the patients were not at glycaemic target and required treatment intensification . however , treatment was actually intensified in only 39% of the patients requiring it and the majority ( ~60% ) of changes were delayed by 6 months or more and a substantial proportion ( ~40% ) by more than a year . the diattitude study ( table 3 ) also looked at therapeutic inertia in the care of > 2000 people with t2 dm by 236 primary care physicians and found that among patients with uncontrolled glycaemia , representing 41% of all the patients studied , only 7% had their treatment intensified . the most common ( 60% ) reason given for not intensifying treatment was that the patient s hba1c was satisfactory . other leading reasons given included that lifestyle advice was more of a priority than changing medication ( 20% ) , the decision was postponed until the next clinic visit ( 11% ) and that hba1c had decreased since the previous clinic visit ( 7% ) , although in the majority ( 58% ) of these cases , an hba1c reduction was not confirmed by the available records . the problem appears to be common and widespread , with further studies in bahrain , croatia , spain , taiwan and the united states reporting high rates ( typically 30%60% ) of clinical inertia when managing elevated glucose levels in people with diabetes . summary of studies reporting rates of and factors contributing to therapeutic inertia in the management of type 2 diabetes . ldl : low - density lipoprotein ; t2 dm : type 2 diabetes mellitus ; hcps : healthcare professionals . a number of studies have attempted to explore the factors that may act as obstacles to action in addressing inadequate glycaemic control . in an online survey completed by 508 primary care physicians who provided data on 770 elderly patients ( > 65 years ) , the leading reason for not initiating glucose - lowering medication , given as the first - ranked reason for 58% of the patients and a contributory factor in nearly all patients , was that they were treated with diet and exercise , and presumably , this was believed to be adequate management ( figure 2 ) . however , 33% of the patients were not at target hba1c , suggesting substantial clinical inertia in this population . other reasons given for not starting drug treatment included that hyperglycaemia was mild ( 84% ) , patient concerns ( 61% ) , physician concerns about glucose - lowering agents ( 49% ) and presence of comorbidities and polypharmacy ( 37% ) . when asked to identify a threshold for initiating treatment with glucose - lowering agents in the elderly population , the mean hba1c threshold value stated was 7.1% ( 54 mmol / mol ) . in approximately 20% of the cases , the physicians indicated that they were planning to initiate glucose - lowering therapy within the next month , but more than half ( 54% ) of these patients already had an hba1c level above the physician - stated threshold . results from an online survey of 508 us primary care physicians providing clinical date for 770 patients . a qualitative study of 20 hcps in the united kingdom found a pattern of seeking to lessen their own sense of accountability for clinical inertia by emphasizing patient - level barriers such as comorbidities , motivation and self - management capabilities as well as health system level barriers , especially time constraints . there was also a tendency for the hcps to overestimate the achievement of targets in their primary care centres . factors contributing to therapeutic inertia in the initiation of insulin treatment for t2 dm were investigated in the translating research into action for diabetes ( triad ) project using structured interviews with primary care hcps in the united states . the majority of the 83 clinicians interviewed supported guideline recommendations on glycaemic targets , with 69% choosing an hba1c < 7% ( < 53 mmol / mol ) as the ideal target for good glycaemic control . at the same time , the most frequently cited reasons for setting higher individualized hba1c targets included advanced age or short life expectancy ( 54% ) , poor self - management capacity due to poor cognitive abilities ( 35% ) , presence of comorbidities ( 34% ) , low educational level or poor health literacy ( 34% ) and patients unwillingness to self - manage their diabetes ( 33% ) . the most frequent reasons cited by the clinicians for not initiating insulin treatment were patient refusal or resistance ( 64% ) and lack of patient self - management skills ( 43% ) . factors determining initiation of insulin were also investigated using data for 1933 people with t2 dm from the french national health and wellness survey , an annual internet - based survey among french adults . early initiation of insulin therapy was almost 10 times more likely to be prescribed by an endocrinologist or diabetologist than by a primary care physician . early versus late insulin initiation was also more likely in patients who were younger , had diabetes - related complications or smoked . insulin - treated patients were more likely to be adherent , and there was no apparent deterioration in quality of life associated with insulin use . in focus group discussions with 114 primary care physicians in belgium , many of the physicians found the concept of clinical inertia interesting , but some also found it insulting and felt it implied that they were passive in their work . they also noted that it was important to differentiate between cases where there was a conscious decision to not pursue lower targets based on a consideration of the individual patient factors and those where there was genuine inertia . it was acknowledged that genuine clinical inertia was a real risk in primary care , but there was a tendency to ascribe this risk to patient- and system - level barriers rather than physician - level behaviours and practices . in summary , recent studies suggest that clinical inertia is a common and widespread problem , typically affecting the care of 30%50% of people with t2 dm . the causes are diverse and complex , but surveys of hcps tend to emphasize patient - level barriers to treatment intensification , such as patient reluctance to start insulin therapy , or system - level barriers , such as disconnects between what is recommended in guidelines and what is reimbursed in practice . however , it also appears that hcps sometimes delay taking necessary action and may be willing to tolerate periods of it also appears that many hcps , while recognizing the importance of good glycaemic control , have low expectations for their patients . the issue of clinical inertia needs to be better understood if it is to be addressed effectively , particularly regarding the patient- , hcp- and system - level factors that underlie it . this is challenging as clinical inertia as defined in studies typically captures a range of behaviours , some of which may not reflect suboptimal care . however , studies of clinical inertia often apply a single glycaemic threshold [ typically hba1c = 7% ( 53 mmol / mol ) ] across a broad range of patients . guidelines for management of t2 dm have traditionally advocated a stepwise approach to management , in which treatment is started with diet and exercise , followed by the addition of oral antihyperglycaemic monotherapy , then combination therapy and eventually insulin . however , when applied systematically without considering individual factors such as the patient s current hba1c level , it can lead to treatment futility with people receiving therapy that has little chance of lowering glucose levels sufficiently to achieve their glycaemic target . several recent publications have indicated potential benefits of early , intensive intervention with pharmacotherapy , including combinations of oral glucose lowering agents and/or insulin . the treatment options for type 2 diabetes in adolescents and youth ( today ) study compared metformin alone , metformin plus a thiazolidinedione and metformin plus intensive lifestyle intervention as initial therapy for new - onset t2 dm in people aged 1017 years and with obesity . the proportion of people who maintained glycaemic control over 5 years was significantly higher with the combination pharmacotherapy than either metformin alone or metformin plus intensive lifestyle measures . the combination pharmacotherapy was also associated with greater improvements in insulin sensitivity and -cell function compared with the other two approaches . the results lend support to early , intensive intervention with combination therapy , at least in this population of young people with new - onset t2 dm . early intensive therapy was also studied in older ( mean age = 45 years ) people with newly diagnosed t2 dm who started treatment for 3 months with metformin plus insulin and were then randomized to either continuing metformin plus insulin therapy or triple oral glucose lowering therapy with metformin , glyburide and pioglitazone . good glycaemic control was maintained for over 6 years with no significant difference between the groups ( end of study hba1c = 7.3% for metformin plus insulin and 6.4 for triple oral combination ; p = 0.4 ) . a review of the health records for nearly 3000 people with t2 dm in the united states found that early initiation of metformin ( within 6 months of diagnosis ) significantly reduced hba1c ( 0.36% ; p < 0.001 ) and bmi ( 0.46 kg / m ; p < the likelihood of achieving hba1c 7% was doubled and the likelihood of requiring therapy intensification was reduced by 28% with early versus delayed initiation of metformin . another study in the united states looking at medical records for 5870 people with t2 dm found a similar pattern for early introduction of combination oral glucose early intensification was defined as addition of a second oral drug to metformin therapy within 3 months of treatment failure ( hba1c 7.5% ) and late intensification as the introduction of combination therapy 1015 months after loss of glycaemic control . people who received early intensification were 38% more likely to achieve good glycaemic control at 1.52 years than those with late intensification . in the advance trial of 11,140 patients with t2 dm , therapeutic intensification with addition of an oral glucose lowering agent doubled the chance of achieving good glycaemic control , and with intensification with insulin , the odds were increased 2.5-fold . a total of 45 relevant publications were identified by the search strategy and included in the literature review and analysis . the results of the literature review suggest that suboptimal glycaemic control is a common and widespread problem . the proportion of patients not achieving hba1c targets in 12 studies published between 2011 and 2015 inclusive is summarized in table 1 . even in the study reporting the best rate of control , one in every three patients was above the hba1c target . a multi - centre , cross - sectional study of ~5800 people with t2 dm from nine european countries found that hba1c exceeded the target of 7.0% ( 53 mmol / mol ) in 37% of cases , with rates for individual countries ranging from 26% in the netherlands up to 52% in turkey . target hba1c 7.0% ( 53 mmol / mol ) , other than for the study of laiteerapong et al . which used individualized targets of hba1c < 6.5% , < 7.0% or < 8.0% ( < 48 mmol / mol , < 53 mmol / mol or < 64 mmol / mol ) based on patient characteristics . nine european countries : belgium , france , germany , greece , italy , the netherlands , spain , turkey and the united kingdom . other publications show that hba1c levels are markedly above target in a large proportion of people with t2 dm . in a registry - based study of > 10,000 people undergoing care for t2 dm in specialist clinics in canada , 62% were not at target [ hba1c 7.0% ( 53 mmol / mol ) ] and 15% had an hba1c level of 9.0% ( 75 mmol / mol ) or above . a puerto rican study of 600 adults with type 1 or type 2 diabetes reported that just 37% were at the recommended hba1c target . a survey of > 200,000 people with diabetes in taiwan found hba1c > 9.0% ( 75 mmol / mol ) in nearly one in every four people and 30% of outpatients with t2 dm attending a medical college in rural india had hba1c 9.5% ( 80 mmol / mol ) . there was some evidence to suggest that suboptimal control occurred more frequently in low- and middle - income countries compared with wealthier countries , with the highest rate of 87% for non - achievement of hba1c target reported in rural india . however , high proportions of people in high - income , resource - rich settings also had inadequate control of hyperglycaemia . suboptimal glycaemic control is often accompanied by poor control of other cardiometabolic risk factors . in a prospective cohort study of more than 3000 people with t2 dm in canada , the proportion of people with hba1c , blood pressure and low - density lipoprotein ( ldl ) cholesterol at target on study entry was 47% , 46% and 36% , respectively . all three risk factors were controlled to target in just 19% of people , and only 7% maintained good control of glycaemia , blood pressure and ldl cholesterol throughout the 12-month study . a canadian study of more than 5000 people with t2 dm seen by 479 primary care physicians found that the proportions achieving targets were 50% for hba1c , 36% for blood pressure and 57% for ldl cholesterol , with only 13% reaching all three targets . similar results were found in more than 25,000 outpatients with t2 dm in china , with the proportions of patients achieving targets for hba1c , blood pressure and lipids of 48% , 28% and 36% , respectively . importantly , nearly all of the studies reviewed assessed the quality of glycaemic control against a single target of hba1c 7.0% ( 53 mmol / mol ) . within the context of individualized targets now recommended in guidelines , a somewhat higher target [ e.g. hba1c 7.5% ( 59 mmol / mol ) ] may have represented optimal management based on factors such as age , presence of cardiovascular comorbidities and duration of diabetes . this is unlikely to account for the large proportion of patients not controlled to hba1c 7.0% ( 53 mmol / mol ) and certainly should not justify the sizeable proportion of people with hba1c levels exceeding 9.0% ( 75 mmol / mol ) . however , it highlights that a single target is unlikely to represent optimal management for all people . the review provides strong evidence that in all regions of the world , many people with t2 dm are not achieving good glycaemic control . although there is considerable heterogeneity in the studies and the data generated , rates of uncontrolled glycaemia are typically in the range of 40%60% . consequently , many people are left at increased risk of diabetic complications and the associated burden of illness and mortality , as well as consequent economic costs . recent studies examining barriers to the achievement of good glycaemic control are summarized in table 2 . tidm : type 1 diabetes mellitus ; t2 dm : type 2 diabetes mellitus ; hcps : healthcare professionals . prescribers often identify poor patient motivation and self - management as leading barriers to achieving glycaemic targets . the second diabetes , attitudes , wishes and needs ( dawn2 ) study , included an online survey of 4785 healthcare professionals ( hcps ) ( ~40% primary care clinicians , 30% diabetes specialists , 20% nurses and 10% dieticians ) from 17 countries across four continents . the majority of the respondents ( 60% ) indicated a need for improvements in self - management by people with diabetes , particularly in the area of diet and exercise . resistance to lifestyle measures was also identified as a leading barrier by 252 primary care physicians , nurse practitioners and physician assistants in the united states , with 52% of hcps indicating that it was often or almost always a factor contributing to chronic lack of glycaemic control . other leading patient - related barriers identified by the hcps included psychosocial issues ( 34% ) , reluctance to use insulin ( 31% ) and non - compliance ( 30% ) . a study in the united kingdom examining the reasons for very poor glycaemic control [ hba1c 10% ( 86 mmol / mol ) ] in 128 people with t2 dm attending three primary care centres found poor adherence to lifestyle measures to be most frequently involved . other factors included infrequent clinic attendance ( 16% ) , side effects ( 16% ) , poor compliance with pharmacotherapy ( 14% ) , lack of knowledge of diabetes ( 14% ) , lack of titration of insulin ( 13% ) and insulin refusal ( 12% ) . poor patient motivation and adherence were also identified as barriers to good glycaemic control in qualitative studies with hcps . interviews with a small number ( n = 9 ) of hcps in the united arab emirates revealed a tendency to view patient attitudes and behaviours as the origin of poor glycaemic control and to believe that if patients were more knowledgeable about diabetes , cooperated with hcps and were adherent with treatment , then they could achieve their glycaemic targets . the studies reviewed also revealed that a number of healthcare system - level factors are often seen as important barriers to good glycaemic control . the dawn2 study , for example , found that only 30% of the hcps surveyed believed that healthcare was well organized for the management of chronic conditions . participants from western european countries and china were more likely to feel that healthcare was well organized than those from north or south america , eastern europe , india or japan ( figure 1 ) . approximately half of the participants considered the healthcare remuneration system to be a barrier and most ( ~60% ) indicated a need for better access to qualified nurse educators / specialist diabetes nurses and psychologists / psychiatrists . proportion of healthcare professionals reporting that healthcare in their country is well organized for the management of chronic conditions , including debates . a survey of 47 european countries found that while all had guidelines in place for managing diabetes , only 7 ( 15% ) had protocols for monitoring their implementation . the majority ( 83% ) of countries had or were developing national plans for diabetes , but these were often not comprehensive there was substantial variability in the provision of multidisciplinary care . while 80% reported that nurses play an important role in providing education for self - management , diabetes specialist nursing was recognized as a speciality in only 19 countries ( 40% ) . despite the widespread belief that patients need to be more engaged and effective in self - management , only 25% of the countries recommended continuous education for all people with diabetes . lack of effective self - management education was also identified as a barrier in a qualitative study involving focus group discussions with 25 primary care clinicians in the united states , along with a persistent focus on acute care , poor integration of diabetes care , lack of clinical information and inadequate public health support . lack of coordination in care and limited access to secondary resources were also identified as important barriers by studies in the netherlands and ireland . limitations on the time available to manage patients are often identified as an obstacle to good glycaemic control . in the survey of 252 us primary care physicians , lack of time for treating complex patients was reported as often or always a factor in failure to achieve good glycaemic control by 41% of the physicians . treatment costs were much less frequently seen as a barrier , with 25% of the hcps indicating that it made no contribution and most ( 58% ) saying that it was a factor in only a minority ( 20%40% ) of cases of poor glycaemic control . other studies have also suggested that hcps in primary care often feel that they lack the time or other resources needed to manage diabetes effectively . this raises particular concerns , given that health policy in some countries involves shifting more of the responsibility for diabetes management onto primary care . compared with patient- and system - related barriers to effective glycaemic control , there is limited information available regarding physician - related barriers . however , there is evidence to suggest that a lack of diabetes - focused education may be contributing to failure to achieve therapeutic targets . for example , one in five of the hcps surveyed in the dawn2 study indicated that they had received no formal postgraduate diabetes training , and in a uk survey , only 35% of 2149 trainee doctors felt that their postgraduate training had prepared them adequately to optimize treatment of diabetes and only 41% reported that they would take the initiative to optimize glycaemic control . a survey of 209 primary care clinicians in australia identified gaps in knowledge relating to the medical management of t2 dm , with 46% self - reporting a need for education on pharmacological management . it appears that prescribers often lack confidence in the use of insulin , particularly with more complex regimens . prescribers often identify poor patient motivation and self - management as leading barriers to achieving glycaemic targets . the second diabetes , attitudes , wishes and needs ( dawn2 ) study , included an online survey of 4785 healthcare professionals ( hcps ) ( ~40% primary care clinicians , 30% diabetes specialists , 20% nurses and 10% dieticians ) from 17 countries across four continents . the majority of the respondents ( 60% ) indicated a need for improvements in self - management by people with diabetes , particularly in the area of diet and exercise . resistance to lifestyle measures was also identified as a leading barrier by 252 primary care physicians , nurse practitioners and physician assistants in the united states , with 52% of hcps indicating that it was often or almost always a factor contributing to chronic lack of glycaemic control . other leading patient - related barriers identified by the hcps included psychosocial issues ( 34% ) , reluctance to use insulin ( 31% ) and non - compliance ( 30% ) . a study in the united kingdom examining the reasons for very poor glycaemic control [ hba1c 10% ( 86 mmol / mol ) ] in 128 people with t2 dm attending three primary care centres found poor adherence to lifestyle measures to be most frequently involved . other factors included infrequent clinic attendance ( 16% ) , side effects ( 16% ) , poor compliance with pharmacotherapy ( 14% ) , lack of knowledge of diabetes ( 14% ) , lack of titration of insulin ( 13% ) and insulin refusal ( 12% ) . poor patient motivation and adherence were also identified as barriers to good glycaemic control in qualitative studies with hcps . interviews with a small number ( n = 9 ) of hcps in the united arab emirates revealed a tendency to view patient attitudes and behaviours as the origin of poor glycaemic control and to believe that if patients were more knowledgeable about diabetes , cooperated with hcps and were adherent with treatment , then they could achieve their glycaemic targets . the studies reviewed also revealed that a number of healthcare system - level factors are often seen as important barriers to good glycaemic control . the dawn2 study , for example , found that only 30% of the hcps surveyed believed that healthcare was well organized for the management of chronic conditions . participants from western european countries and china were more likely to feel that healthcare was well organized than those from north or south america , eastern europe , india or japan ( figure 1 ) . approximately half of the participants considered the healthcare remuneration system to be a barrier and most ( ~60% ) indicated a need for better access to qualified nurse educators / specialist diabetes nurses and psychologists / psychiatrists . proportion of healthcare professionals reporting that healthcare in their country is well organized for the management of chronic conditions , including debates . a survey of 47 european countries found that while all had guidelines in place for managing diabetes , only 7 ( 15% ) had protocols for monitoring their implementation . the majority ( 83% ) of countries had or were developing national plans for diabetes , but these were often not comprehensive . there was substantial variability in the provision of multidisciplinary care . while 80% reported that nurses play an important role in providing education for self - management , diabetes specialist nursing was recognized as a speciality in only 19 countries ( 40% ) . despite the widespread belief that patients need to be more engaged and effective in self - management , only 25% of the countries recommended continuous education for all people with diabetes . lack of effective self - management education was also identified as a barrier in a qualitative study involving focus group discussions with 25 primary care clinicians in the united states , along with a persistent focus on acute care , poor integration of diabetes care , lack of clinical information and inadequate public health support . lack of coordination in care and limited access to secondary resources were also identified as important barriers by studies in the netherlands and ireland . limitations on the time available to manage patients are often identified as an obstacle to good glycaemic control . in the survey of 252 us primary care physicians , lack of time for treating complex patients was reported as often or always a factor in failure to achieve good glycaemic control by 41% of the physicians . treatment costs were much less frequently seen as a barrier , with 25% of the hcps indicating that it made no contribution and most ( 58% ) saying that it was a factor in only a minority ( 20%40% ) of cases of poor glycaemic control . other studies have also suggested that hcps in primary care often feel that they lack the time or other resources needed to manage diabetes effectively . this raises particular concerns , given that health policy in some countries involves shifting more of the responsibility for diabetes management onto primary care . compared with patient- and system - related barriers to effective glycaemic control , there is limited information available regarding physician - related barriers . however , there is evidence to suggest that a lack of diabetes - focused education may be contributing to failure to achieve therapeutic targets . for example , one in five of the hcps surveyed in the dawn2 study indicated that they had received no formal postgraduate diabetes training , and in a uk survey , only 35% of 2149 trainee doctors felt that their postgraduate training had prepared them adequately to optimize treatment of diabetes and only 41% reported that they would take the initiative to optimize glycaemic control . a survey of 209 primary care clinicians in australia identified gaps in knowledge relating to the medical management of t2 dm , with 46% self - reporting a need for education on pharmacological management . it appears that prescribers often lack confidence in the use of insulin , particularly with more complex regimens . people with diabetes often continue in poor glycaemic control for extended periods of time without appropriate action being taken . a retrospective cohort study of > 80,000 people with t2 dm in the united kingdom revealed substantial delays in intensifying treatment when glycaemic control was suboptimal . for people who were inadequately controlled on one oral glucose lowering agent , the median time from hba1c being above a threshold of 7.0% ( 53 mmol / mol ) to treatment intensification with an additional oral agent was nearly 3 years , and even when hba1c was 8.0% ( 64 mmol / mol ) , intensification was delayed by a median of 1.6 years . there were even longer delays ( median of ~67 years ) in intensifying treatment with the addition of a third oral agent or the initiation of insulin . mean hba1c at intensification ranged from 8.7%9.7% ( 7283 mmol / mol ) . in a study of nearly 20,000 people with t2 dm initiated on basal insulin at hospitals across china , mean hba1c at the time of insulin initiation was 9.6% . a study of primary care records of > 17,000 patients with t2 dm being treated with oral glucose lowering agents in france found that > 3000 of the patients were not at glycaemic target and required treatment intensification . however , treatment was actually intensified in only 39% of the patients requiring it and the majority ( ~60% ) of changes were delayed by 6 months or more and a substantial proportion ( ~40% ) by more than a year . the diattitude study ( table 3 ) also looked at therapeutic inertia in the care of > 2000 people with t2 dm by 236 primary care physicians and found that among patients with uncontrolled glycaemia , representing 41% of all the patients studied , only 7% had their treatment intensified . the most common ( 60% ) reason given for not intensifying treatment was that the patient s hba1c was satisfactory . other leading reasons given included that lifestyle advice was more of a priority than changing medication ( 20% ) , the decision was postponed until the next clinic visit ( 11% ) and that hba1c had decreased since the previous clinic visit ( 7% ) , although in the majority ( 58% ) of these cases , an hba1c reduction was not confirmed by the available records . the problem appears to be common and widespread , with further studies in bahrain , croatia , spain , taiwan and the united states reporting high rates ( typically 30%60% ) of clinical inertia when managing elevated glucose levels in people with diabetes . summary of studies reporting rates of and factors contributing to therapeutic inertia in the management of type 2 diabetes . ldl : low - density lipoprotein ; t2 dm : type 2 diabetes mellitus ; hcps : healthcare professionals . a number of studies have attempted to explore the factors that may act as obstacles to action in addressing inadequate glycaemic control . in an online survey completed by 508 primary care physicians who provided data on 770 elderly patients ( > 65 years ) , the leading reason for not initiating glucose - lowering medication , given as the first - ranked reason for 58% of the patients and a contributory factor in nearly all patients , was that they were treated with diet and exercise , and presumably , this was believed to be adequate management ( figure 2 ) . however , 33% of the patients were not at target hba1c , suggesting substantial clinical inertia in this population . other reasons given for not starting drug treatment included that hyperglycaemia was mild ( 84% ) , patient concerns ( 61% ) , physician concerns about glucose - lowering agents ( 49% ) and presence of comorbidities and polypharmacy ( 37% ) . when asked to identify a threshold for initiating treatment with glucose - lowering agents in the elderly population , the mean hba1c threshold value stated was 7.1% ( 54 mmol / mol ) . in approximately 20% of the cases , the physicians indicated that they were planning to initiate glucose - lowering therapy within the next month , but more than half ( 54% ) of these patients already had an hba1c level above the physician - stated threshold . results from an online survey of 508 us primary care physicians providing clinical date for 770 patients . a qualitative study of 20 hcps in the united kingdom found a pattern of seeking to lessen their own sense of accountability for clinical inertia by emphasizing patient - level barriers such as comorbidities , motivation and self - management capabilities as well as health system level barriers , especially time constraints . there was also a tendency for the hcps to overestimate the achievement of targets in their primary care centres . factors contributing to therapeutic inertia in the initiation of insulin treatment for t2 dm were investigated in the translating research into action for diabetes ( triad ) project using structured interviews with primary care hcps in the united states . the majority of the 83 clinicians interviewed supported guideline recommendations on glycaemic targets , with 69% choosing an hba1c < 7% ( < 53 mmol / mol ) as the ideal target for good glycaemic control . at the same time , the most frequently cited reasons for setting higher individualized hba1c targets included advanced age or short life expectancy ( 54% ) , poor self - management capacity due to poor cognitive abilities ( 35% ) , presence of comorbidities ( 34% ) , low educational level or poor health literacy ( 34% ) and patients unwillingness to self - manage their diabetes ( 33% ) . the most frequent reasons cited by the clinicians for not initiating insulin treatment were patient refusal or resistance ( 64% ) and lack of patient self - management skills ( 43% ) . factors determining initiation of insulin were also investigated using data for 1933 people with t2 dm from the french national health and wellness survey , an annual internet - based survey among french adults . early initiation of insulin therapy was almost 10 times more likely to be prescribed by an endocrinologist or diabetologist than by a primary care physician . early versus late insulin initiation was also more likely in patients who were younger , had diabetes - related complications or smoked . insulin - treated patients were more likely to be adherent , and there was no apparent deterioration in quality of life associated with insulin use . in focus group discussions with 114 primary care physicians in belgium , many of the physicians found the concept of clinical inertia interesting , but some also found it insulting and felt it implied that they were passive in their work . they also noted that it was important to differentiate between cases where there was a conscious decision to not pursue lower targets based on a consideration of the individual patient factors and those where there was genuine inertia . it was acknowledged that genuine clinical inertia was a real risk in primary care , but there was a tendency to ascribe this risk to patient- and system - level barriers rather than physician - level behaviours and practices . in summary , recent studies suggest that clinical inertia is a common and widespread problem , typically affecting the care of 30%50% of people with t2 dm . the causes are diverse and complex , but surveys of hcps tend to emphasize patient - level barriers to treatment intensification , such as patient reluctance to start insulin therapy , or system - level barriers , such as disconnects between what is recommended in guidelines and what is reimbursed in practice . however , it also appears that hcps sometimes delay taking necessary action and may be willing to tolerate periods of it also appears that many hcps , while recognizing the importance of good glycaemic control , have low expectations for their patients . the issue of clinical inertia needs to be better understood if it is to be addressed effectively , particularly regarding the patient- , hcp- and system - level factors that underlie it . this is challenging as clinical inertia as defined in studies typically captures a range of behaviours , some of which may not reflect suboptimal care . however , studies of clinical inertia often apply a single glycaemic threshold [ typically hba1c = 7% ( 53 mmol / mol ) ] across a broad range of patients . guidelines for management of t2 dm have traditionally advocated a stepwise approach to management , in which treatment is started with diet and exercise , followed by the addition of oral antihyperglycaemic monotherapy , then combination therapy and eventually insulin . however , when applied systematically without considering individual factors such as the patient s current hba1c level , it can lead to treatment futility with people receiving therapy that has little chance of lowering glucose levels sufficiently to achieve their glycaemic target . several recent publications have indicated potential benefits of early , intensive intervention with pharmacotherapy , including combinations of oral glucose lowering agents and/or insulin . the treatment options for type 2 diabetes in adolescents and youth ( today ) study compared metformin alone , metformin plus a thiazolidinedione and metformin plus intensive lifestyle intervention as initial therapy for new - onset t2 dm in people aged 1017 years and with obesity . the proportion of people who maintained glycaemic control over 5 years was significantly higher with the combination pharmacotherapy than either metformin alone or metformin plus intensive lifestyle measures . the combination pharmacotherapy was also associated with greater improvements in insulin sensitivity and -cell function compared with the other two approaches . the results lend support to early , intensive intervention with combination therapy , at least in this population of young people with new - onset t2 dm . early intensive therapy was also studied in older ( mean age = 45 years ) people with newly diagnosed t2 dm who started treatment for 3 months with metformin plus insulin and were then randomized to either continuing metformin plus insulin therapy or triple oral glucose good glycaemic control was maintained for over 6 years with no significant difference between the groups ( end of study hba1c = 7.3% for metformin plus insulin and 6.4 for triple oral combination ; p = 0.4 ) . a review of the health records for nearly 3000 people with t2 dm in the united states found that early initiation of metformin ( within 6 months of diagnosis ) significantly reduced hba1c ( 0.36% ; p < 0.001 ) and bmi ( 0.46 kg / m ; p < 0.001 ) compared with when introduction of pharmacotherapy with metformin was delayed . the likelihood of achieving hba1c 7% was doubled and the likelihood of requiring therapy intensification was reduced by 28% with early versus delayed initiation of metformin . another study in the united states looking at medical records for 5870 people with t2 dm found a similar pattern for early introduction of combination oral glucose early intensification was defined as addition of a second oral drug to metformin therapy within 3 months of treatment failure ( hba1c 7.5% ) and late intensification as the introduction of combination therapy 1015 months after loss of glycaemic control . people who received early intensification were 38% more likely to achieve good glycaemic control at 1.52 years than those with late intensification . in the advance trial of 11,140 patients with t2 dm , therapeutic intensification with addition of an oral glucose lowering agent doubled the chance of achieving good glycaemic control , and with intensification with insulin , the odds were increased 2.5-fold . recently published evidence highlights that many people with t2 dm do not achieve good control of blood glucose leaving them at increased and avoidable risk of serious complications . a tendency to focus on patient - related obstacles may fail to consider issues arising from the attitudes , perceptions and behaviours of healthcare providers . in particular , there are often delays in the implementation of appropriate interventions to achieve glycaemic targets due to a complex range of negative factors that exacerbate the situation . an improved understanding of these factors would better inform strategies to assist hcps in more timely treatment of inadequately controlled glycaemia . despite a wide range of therapeutic options available , insufficient numbers of people with type 2 diabetes are reaching their glycaemic targets and large numbers are exposed to prolonged periods of hyperglycaemia . a number of obstacles exist globally that must be addressed and overcome if we are to improve the outcomes for patients . despite a wide range of therapeutic options available , insufficient numbers of people with type 2 diabetes are reaching their glycaemic targets and large numbers are exposed to prolonged periods of hyperglycaemia . a number of obstacles exist globally that must be addressed and overcome if we are to improve the outcomes for patients .

background : glycaemic control is suboptimal in a large proportion of people with type 2 diabetes who are consequently at an increased and avoidable risk of potentially severe complications . we sought to explore attitudes and practices among healthcare professionals that may contribute to suboptimal glycaemic control through a review of recent relevant publications in the scientific literature.methods:an electronic search of the pubmed database was performed to identify relevant publications from january 2011 to july 2015 . the electronic search was complemented by a manual search of abstracts from key diabetes conferences in 2014/2015 available online.results:recently published data indicate that glycaemic control is suboptimal in a substantial proportion ( typically 40%60% ) of people with diabetes . this is the case across geographic regions and in both low- and higher - income countries . therapeutic inertia appears to be an important contributor to poor glycaemic control in up to half of people with type 2 diabetes . in particular , prescribers are often willing to tolerate extended periods of mild hyperglycaemia as well as having low expectations for their patients . there are often delays of 3 years or longer in initiating or intensifying glucose - lowering therapy when needed.conclusion:many people with type 2 diabetes are failed by current management , with approximately half not achieving or maintaining appropriate target blood glucose levels , leaving these patients at increased and avoidable risk of serious complications.review criteria : the methodology of this review article is detailed in the methods section .

upper gastrointestinal bleeding ( ugib ) is a major cause of mortality and morbidity accounting for about 56.5/100,000 hospitalization with a mortality rate of 8.2% . aorto - esophageal fistula ( aef ) , an abnormal anatomical communication between the aorta and esophagus is a rare cause of ugib . as the thoracic aneurysm grows in size , the increasing tension on its wall will erode the aorta and rupture into the surrounding esophagus leading to uncontrolled bleeding . as ulcer related or variceal bleeding constitutes for most of the ugib bleeding , even in elderly who are at risk of aef and the inability of the esophagogastroduodenoscopy ( egd ) to detect most cases , aef is often not diagnosed timely . all these factors make the timely diagnosis of aef challenging , and at times missed altogether leading to catastrophic consequences . we present a case of aef which was initially treated as variceal bleeding and later promptly diagnosed with computed tomography ( ct ) . a 70-year - old male patient with hypertension with regular ethanol use , presented to a local hospital with complaints of hematemesis and melena from the past 1-day . he was hemodynamically stable on presentation with initial hemoglobin level of 7.2 g / dl . he underwent timely egd , which showed grade 1 mid and distal esophageal varices without any active bleeding . subsequently , his condition deteriorated with the development of hypotension and transferred to our medical center for further management . weiss tear without active bleeding along with the presence of large blood clots in the gastric fundus . as the source of bleeding was not clear despite two egd and clinical evidence of gi bleeding , he underwent emergent colonoscopy which once again failed to detect any source lower gi bleeding . however , later in the day , he developed massive hematemesis and hematochezia leading to persistent hemorrhagic shock . emergent intubation was done for airway protection , massive transfusion protocol was initiated , and a ct angiogram was performed . it revealed type b aortic dissection with rupture and the active extravasation of blood into the esophagus , confirming the diagnosis of aef [ figure 1 ] . he underwent emergency percutaneous thoracic endovascular aortic repair with aortic stent placement [ figure 2 ] . his shock resolved hemoglobin stabilized and did not have any more episodes of bleeding thereafter . repeat egd showed a 3-cm opening in the midesophagus with ragged and irregular borders , not seen earlier egds . his hospital course was complicated by the infection of the endograft which was replaced and fortified with an omental flap and being is presently being , followed by for reconstruction surgeries . ( a ) communication and extravasation between aortia and esophagus ( blue arrow head ) in the arterial phase . ( b ) accumulation of blood in lower esophagus in venous phase ( yellow arrow head ) . ( c ) significant accumulation of blood in the stomach in the kidney delay images ( red arrow head ) . ( d ) sagittal reconstruction images shows commination ( blue arrow ) and extravasation ( yellow arrow ) of blood between aorta and esophagus endovascular graft in the thoracic aorta aorto - esophageal fistula is an abnormal anatomical communication between the aorta and esophagus . in 1818 , dubrueil described this condition for the 1 time in a french soldier who ingested a beef rib , leading to massive hematemesis . almost a century later , chiari described the triad of midthoracic pain , herald hemorrhage , and fatal hematemesis seen in these patients . the exact incidence of this condition is not known , as the vast majority of these patients die before a definitive diagnosis can be made . in the past , infections such as tuberculosis and syphilis , leading to aortitis were the common cause of this condition . in this antibiotics era , thoracic aortic aneurysm constitutes for more than half of these cases . other causes described in the literature are cancer , acid reflux disease , trauma , caustic ingestion , and esophageal biopsies . aefs are classified as primary if they are caused by the spontaneous erosion of the aortic wall into the esophagus and as secondary if they occur as a complication following aortic or esophageal surgeries . owing to the increasing number of interventions of the aorta , secondary aef is 10 times more common than primary . the herald bleeding described by chiari is only seen in half of these patients . once the bleeding starts , rapid extravasation from aorta will cause a sudden drop in blood pressure . , the blood pressure will raise again dislodging the fresh and loose clot around the aef leading to terminal bleeding . commonly used resuscitation fluids including pseudo random binary sequence lack adequate clotting factors add to the compromise of clot integrity . unlike in other structures , the lax mediastinum around the aorta and esophagus prevent autotamponade , to prevent persistent extravasation of blood . these factors can contribute to torrential bleeding , the final hematemesis as described by chiari . the risk of aortic aneurysm increases with age , with an incidence of 12.5% in elderly americans . the sensitivity of egd to identify the source of bleeding in other causes of ugib is 90% , but for aef it is < 10% . it may show pulsatile mass , bluish discoloration , or simply blood clotting in the esophagus in one - third of cases . a ct arteriogram is diagnostic in most cases , which show active extravasation of blood from the aorta to esophagus . once diagnosed , aef should be treated with emergent aortic stenting to control the bleeding . owing to contamination from the gi tract , one - quarter of stents become infected . apart from broad - spectrum antibiotics and antifungals , once the infection is controlled , the complex aortic and esophageal reconstruction is done in multiples stages . aef , once considered to be uniformly fatal , is now a treatable condition with timely intervention . aorto - esophageal fistula is a rare , but life - threatening condition presenting as ugib . a high level of suspicion is needed , as routine tests performed for ugib typically only detect one - third of cases . avoiding over - resuscitation can be helpful in preventing subsequent hemorrhages .

aorto - esophageal fistula is a rare cause of upper gastrointestinal bleeding . thoracic aneurysm , the most common cause of this condition , will slowly increase over time and can erode the wall of the aorta creating a fistula and leading to torrential bleeding . high clinical suspicion is required for timely diagnosis as common investigations routinely done for gastrointestinal ( gi ) bleeding , including esophagogastroduodenoscopy , fails to detect most cases . the classical triad of midthoracic pain , herald bleeding and fatal hematemesis described in this condition is seen in only one - third of cases . physician should be wary of this condition , especially in elderly patients with uncontrolled gi bleeding and who are also at risk of thoracic aneurysm . computed tomography angiogram detects most cases and emergent endovascular repair with stents controls the initial bleeding . later , both the aorta and the esophagus are repaired and reconstructed in staged procedures .

errors in the administration of chemotherapeutic agents have been reported in the literature . the majority of these reports concern the overdose of a single agent during combination chemotherapy . mistakes are usually decimal point errors or occur by confounding drugs with similar names . although combination chemotherapy is the treatment of choice for many forms of cancer , accidental overdose of multiple chemotherapeutic agents has not been reported so far . this 35-year - old man was diagnosed as having non - hodgkin s lymphoma in april 1986 . a cervical lymph node biopsy was compatible with the diagnosis of a low grade non - hodgkin s lymphoma which was diffuse centroblastic centrocytic according to the kiel classification . he was treated with three cycles of the chop regimen followed by daily oral leukeran for 6 months . in may 1987 , progression of the disease in the abdomen trials with daily prednimustine therapy as well as 3 cycles of vp-16 therapy were unsuccessful and the disease was progressing . in november 1988 , he was hospitalized for a more aggressive chemotherapy . a macop - b - type regimen of adriamycin and cyclophosphamide , alternating with vincristine and bleomycin every other week , combined with daily oral prednisone , ketoconazole and bactrim was scheduled . due to a misunderstanding , the following doses were administered : adriamycin 50 mg / m per day and cyclophosphamide 350 mg / m intravenously for 6 days followed by vincristine 1 mg / m and bleomycin 10 mg / m intravenously for 4 days , resulting in a total of 600 mg adriamycin , 4200 mg cyclophosphamide , 80 mg bleomycin and 8 mg vincristine within 10 days . on the 10th day of chemotherapy , the patient developed fever , generalized weakness and malaise , severe oral and anal discomfort , epistaxis and loss of fresh blood per anus . the patient was severely ill , hypotensive with a bp of 110/50 , pr of 114 and febrile with a temperature of 39.2c . the following laboratory data were obtained : hb 8.4 g / l , hct 25% , wbc 11.98010/1 with 97% lymphocytes and 0.8% pmn . the boen marrow aspiration on admission showed an absent normal hemopoiesis but still massive infiltration with b4 , b1 , hla - dr , surface igg , igd and lambda light chain positive lymphocytes compatible with the diagnosed lymphoma . he was treated with broad spectrum antibiotics , initially with kefzol , tobramycin and azlocillin , which was changed to tienamycin , amikacin and metronidazole because of persistent fever . recombinant human granulocyte macrophage colony stimulating factor ( rhgm - csf ) was given 400 ug daily as a continuous infusion for 17 days . an episode of intractable severe oral mucosal bleeding leading to hemorrhagic shock was treated with an intravenous infusion of 8-ornithine - vasopressin . he required a total of 21 units of packed red cells and 14 units of single donor platelet concentrates during hospitalization . a bone marrow examination one week after admission and rhgm - csf therapy showed three lineage hemopoiesis and only a few remaining small lymphocytes . by this time , the spleen was no longer palpable and the signs of ileus had improved . during the whole hospitalization , recovery of the first granulocytes was observed after 10 days of rhgm - csf infusion , corresponding to the 26th day after chemotherapy . his wbc count was 2.210/1 with 60% pmn s and his platelet count was 2110/1 . physical examination was normal with the exception of minimal splenomegaly and the absence of the deep tendon reflexes . the reevaluation of the disease status showed areas of lymphocytic infiltration in the bone marrow aspirates and still significant retroperitoneal , mesenteric and iliac lymphadenopathy on abdominal computed tomography . this patient was treated with 600 mg adriamycin , 4200 mg cyclo - phosphamide , 80 mg bleomycin and 8 mg vincristine within 10 days and suffered mainly from life - threatening pancytopenia , mucositis and ileus . our major concern upon admission was adriamycin toxicity because he had received six time the scheduled dose of adriamycin on 6 subsequent days ; this in combination with the other drugs . the maximum tolerated dose of adriamycin in human beings is not known . in mice , intravenous administration of adriamycin at a dose of 20 to 40 mg / kg is lethal within four days after injection . a single intravenous dose of 10 mg / kg causes a well defined acute cardiac pathology leading to diffuse chronic cardiomyopathy within fifty days . our patient did not show any signs of acute cardiac decompensation nor signs of arrhythmia . the echocardiographic findings of minimal cardiac dilatation after discharge may be the effects of this acute overdose as well as those of the previous adriamycin therapy . activated charcoal hemoperfusion has been suggested in reducing blood levels of adriamycin in patients with hepatic disease or accidental overdosage . since 5 days had already passed since the last dose , we did not perform hemoperfusion . it is possible , although not certain , that rhgm - csf has accelerated granulocyte recovery in this patient . it could have been spontaneous recovery 26 days after chemotherapy and 10 days after initiation of rh - gm - csf infusion . the tumor response of this refractory lymphoma with a spleen enlarged up to the pelvis prior to therapy was impressive but not complete . it remains to be seen whether low grade lymphoma can be treated at an earlier stage with high dose chemotherapy or by allogeneic bone marrow transplantation . in conclusion , this case demonstrates the danger of prescribing anticancer agents by in experienced physicians and underlines the need for specialized institutions for such therapies in order to allow control of dose and concentration and to minimize the possibility of such an accident .

a 35-year - old man with refractory low grade diffuse centroblastic centrocytic non - hodgkin s lymphoma was treated accidentally with an overdose of multiple chemotherapeutic agents . he was given adriamycin 50 mg / m2 and cyclophosphamide 350 mg / m2 for 6 days followed by 4 days of vincristine 1 mg / m2 and bleomycin 10 mg / m2 . he was transferred when he developed pancytopenia , fever , severe mucositis , ileus and peripheral neuropathy . he was treated with broad spectrum antibiotics , red cell and single donor platelet transfusions and strict parenteral nutrition . in addition , he was given a continuous infusion of 400 ug daily human recombinant granulocyte macrophage - colony stimulating factor ( rh gm - csf ) for 17 days . intractable severe bleeding from his oral mucositis necessitated treatment with a continuous infusion of 8-ornithine - vasopressin for 8 days . he recovered and could be discharged home after 36 days of hospitalization with normal blood counts and without severe sequelae .

familial glucocorticoid deficiency ( fgd ) is a rare autosomal recessive disorder resulting from adrenal unresponsiveness to adrenocorticotropic hormone ( acth ) . this disease is characterized by low serum cortisol concentrations in the presence of grossly elevated plasma acth levels . affected individuals typically present with hyperpigmentation , hypoglycemic seizures , failure to thrive , failure to thrive and recurrent infections . causal mutations of fgd have been identified in mc2r , mrap , mcm4 , txnrd2 , star and nnt . mc2r accessory protein ( mrap ) , a 19-kda single - transmembrane domain protein , is essential for trafficking of mc2r from the endoplasmic reticulum ( er ) to the cell surface and subsequent signaling in response to acth . mutations in mrap are responsible for 1520% of fgd cases , named fgd type 2 . until now , this mutation has not been reported in chinese han cases of fgd . in the current paper , we describe a chinese han child who presented with isolated hyperpigmentation at birth and a homozygous splice mutation ( c.106 + 1delg ) in mrap . a female infant was referred to our neonatal unit at the age of nine days for evaluation of hyperpigmentation of the skin . she was the product of an uncomplicated pregnancy and was born by caesarian section for concerning cardiotocographic changes during labor . her sibling had died on the third day of life with hyperpigmentation of the skin . birth size was normal ( weight 2800 g , 0.99 sds ; length 46 cm , 1.69 sds ; head circumference 33 cm , 0.74 sds ) and apgar scores was 8 and 9 at 1st and 5th minute , respectively . on physical examination , weight was 2740 g ( 1.31 sds ) , length 47 cm ( 2.47 sds ) , and head circumference was 34.5 cm ( 1.5 sds ) . endocrine investigations revealed low baseline 8 am serum cortisol ( < 1.0 g / dl ) with extremely elevated acth ( 1250 pg / ml ) . testosterone , 17-oh progesterone , estradiol , progesterone , luteinizing hormone , folliculin , and prolactin , free t4 , and tsh levels were normal . based on these findings , a familial glucocorticoid deficiency was suspected and oral hydrocortisone treatment at dose of 20 mg / m per day was started . hydrocortisone dose ( varying from 10 to 15 mg / m per day ) adjustment was based on acth and cortisol concentrations . after 4 weeks , acth level was 278.0 pg / ml and cortisol level was 42.4 g / dl , and hydrocortisone dose was reduced to 15 mg / m per day ( given in divided doses twice daily ) . the acth level was suppressed to slightly above the normal limit and the cortisol level is normal during the follow - up period . on her most recent visit , at the age of 12 months , hydrocortisone dose was 11 mg / m per day ( 5 mg was give once daily in the morning ) , the acth level was 25.10 pg / ml and cortisol level was 33.4 g / dl , and her skin was slightly lightened ( fig . her weight was 10 kg ( 0.84 sds ) , length 70 cm ( 1.67 sds ) , and head circumference was 46.5 cm ( 1.12 sds ) . genomic dna was extracted from peripheral blood leucocytes from the infant and her family after informed consent was obtained . for the molecular diagnosis , a custom panel - based next - generation sequencing approach has been used to sequence all known adrenal gland diseases - associated genes in this child . we found a homozygous deletion of one nucleotide at the canonical 5 donor splice site ( c.106 + 1delg ) in intron 3 of mrap gene . this would result in the skipping of exon 3 and a prematurely terminated translation product ( ( 1 ) ) . her parents and maternal grandmother were found to be heterozygous carrier for the same mutation ( fig . we report a case of fgd with homozygous mutation of mrap in a chinese han neonate . this girl presented with isolated hyperpigmentation , have low cortisol and high acth with normal electrolytes . a homozygous splice mutation ( c.106 + 1delg ) of mrap confirmed the diagnosis of fgd type 2 . her parents and maternal grandmother had the same mutation . until now , this mutation has not been reported in chinese han cases of fgd . fgd is a rare autosomal recessive disorder characterized in laboratory testing by glucocorticoid deficiency and markedly elevated acth levels . patients with fgd usually present during neonatal period to late childhood with symptoms related to cortisol deficiency and acth excess . in the neonatal period , these symptoms may include hyperpigmentation , hypoglycemia , irritability , jitteriness , lethargy , respiratory distress , cyanosis , apnea , hypotonia , seizures , shock , or sudden death . newborns can present with a positive family history of early - unexplained infant deaths or other affected family members supports a diagnosis . the severe pigmentation of the skin is due to the over - stimulation of mc1r ( cutaneous msh receptors ) by high circulating msh which is a byproduct of acth synthesis from proopiomelanocortin . this hyperpigmentation fades once proper treatment is initiated with glucocorticoids , which reduce acth concentrations . this would suggest that the fetal corticotrophs could produce excessive plasma acth in response to low fetal cortisol , which in turn acts on melanocytes to promote eumelanin synthesis before birth . in most of the fgd patients suppression of acth levels is difficult , and therefore is not used as a goal for therapy . in this case , replacement treatment with hydrocortisone suppressed acth level to slightly above the normal limit and partially resolved the hyperpigmentation . acquired causes of adrenal insufficiency such as adrenal hemorrhage , trauma and infections were excluded by history and laboratory findings . congenital adrenal hyperplasia was excluded by hormone analysis ; congenital adrenal hypoplasia was also unlikely , because she had normal serum 17-oh progesterone and no mutation of the dax1 gene . mrap , located at 21q22.1 , is a small single - pass transmembrane domain protein , which is essential for the processing of the acth receptor ( melanocortin 2 receptor , mc2r ) and its trafficking from the er to the cell surface . this mutation will lead to skipping of exon 3 and early truncation of the protein and the absence of the mc2r interacting transmembrane domain . as a result , mc2r is retained within the er and fails to reach the cell surface which lead to acth resistance and adrenal insufficiency . mutations in mrap causing fgd2 were first described in 2005 . so far over 9 different mutations of mrap in fgd type 2 patients have been documented all of which are splice site or nonsense mutations and are predicted to produce proteins lacking the transmembrane domain essential for interaction with mc2r , . in our patient , we found a newborn with fgd type 2 , presenting with severe hyperpigmentation . she was found to have a splice - site mutation in the mrap gene , hence explaining the early presentation seen in the case . in their study , metherell et al . identified the 1-bp deletion , c. 106 + 1delg , in 6 individuals from 5 families with glucocorticoid deficiency , making this the second frequent mutation causing fgd unrelated to defects in the mc2r gene . to our current knowledge , 1-bp deletion ( c. 106 + 1delg ) in intron 3 of mrap gene , identified in the dna of the patient , cases of the condition have been reported in white , , black , indian , and middle eastern populations . to our knowledge , our patient is the first reported chinese han patient with fgd type 2 , with a known mrap mutation . the patient was the offspring of non - consanguineous parents and her sibling had died in the neonatal period , possibly due to glucocorticoid insufficiency . prolonged acth excess or glucocorticoid deficiency increases linear growth , while early diagnosis and appropriate therapy in this case enabled the patient to achieve normal developmental milestones . further studies describing new cases and mutations causing fgd will contribute to understanding the mechanism of this rare and potentially life - threatening disease .

familial glucocorticoid deficiency ( fgd ) is a rare autosomal recessive disorder in which the adrenal cortex fails to respond appropriately to stimulation by adrenocorticotropic hormone ( acth ) to produce cortisol . the disease is characterized in laboratory testing by glucocorticoid deficiency and markedly elevated acth levels . fgd may present in infancy or early childhood with symptoms related to low cortisol and high acth , such as hyperpigmentation , severe hypoglycemia , failure to thrive and recurrent infections . mutations in the mc2r accessory protein ( mrap ) cause fgd types 2 , which accounts for approximately 1520% of fgd cases . here , we report a female neonate of chinese han origin , who presented with noted hyperpigmentation at birth . laboratory investigations revealed hypocortisolaemia ( cortisol < 1.0 g / dl ) and elevated plasma acth ( 1051 pg / ml ) . she responded to hydrocortisone treatment . genetic studies confirmed the diagnosis showing homozygous deletion ( c. 106 + 1delg ) in intron 3 of mrap gene , a mutation already reported as responsible for fdg type 2 . this mutation can cause complete lack of acth response thus explaining the early presentation in this case . her parents and maternal grandmother were heterozygous for the same mutation . to our knowledge , this is the first chinese han patient reported with fgd type 2 due to a known mrap mutation .

cardiovascular disease ( cvd ) is the leading cause of mortality in both men and women in developed countries . nonetheless , sex - associated differences regarding the age of cvd onset and its progression are observed worldwide . incidence of cvd in premenopausal women is markedly lower than age - matched men in epidemiological studies ( messerli et al . , 1987 ; bairey merz et al . , 2006 ; shaw et al after menopause , however , the incidence is comparable or even higher in women than in men ( lerner and kannel , 1986 ; eaker et al . , 1993 ) , making cvd the primary cause of death in postmenopausal women ( 55 versus 43% in men ) , exceeding all cancer deaths ( rosamond et al . , 2008 ) . the lower cvd risk among fertile women is often attributed to the protective role of estrogens at the vascular level . according to epidemiological observations and extensive basic research , estrogen and other sex steroids estrogen modulates a myriad of molecular pathways that improve vascular function , whether at the physiological level or when administered as hormone replacement therapy ( hrt ; grodstein et al . , 2000 , 2001 ; miller and duckles , 2008 ) nevertheless , some clinical studies have questioned the protective value of hrt against vascular disease . two randomized clinical trials , the women s health initiative ( whi ; rossouw et al . , 2002 ) and the heart and estrogen / progestin replacement study ( hers i and ii ; gambacciani et al . , 2002 ) , indicate that hrt may increase cvd risk and events in postmenopausal women . the reason for this paradox could be attributable to many patient characteristics , including age . although aging occurs progressively in both men and women , the onset of menopause marks a sudden increase in the appearance of aging - associated signs in women , and more specifically in the progress of vascular aging . information about the role of age and menopause in the development of cvd in women is scarce . this review of clinical and experimental data on the effects of aging , estrogens , and hrt on vascular function of females aims to clarify how menopause and aging contribute jointly to vascular aging and how estrogen modulates vascular response at different ages . the numerous vascular effects of estrogens are triggered by complex genomic and non - genomic mechanisms . they include modulation of vascular function and inflammatory response as well as metabolic and hemodynamic effects . estradiol , the most abundant and potent estrogen in humans , mainly binds and activates estrogen receptors ( ers ) . vascular estrogen signaling involves at least three ers identified in both vascular smooth muscle and endothelium , reinforcing the idea that estrogen has a key role in controlling vascular function . the classical subtypes er ( soloff and szego , 1969 ) and er ( kuiper et al . , 1996 ) vary not only in their tissue distributions , but also in their agonist / antagonist profile with respect to several compounds ( cano and hermenegildo , 2000 ) . these er subtypes belong to the intracellular receptors classically defined as nuclear ligand - activated transcription factors . activation of these receptors by the corresponding hormones affects gene expression by acting on estrogen - response elements in the target genes and modulating transcriptional events ( beato et al . , 1995 ) . estrogen binding to er and er regulates gene expression in a time- and tissue - dependent manner , generating controversy about the type of receptor involved in vascular protection ( murphy , 2011 ) . in the cardiovascular system , both er and er have been identified in the endothelium , smooth muscle cells , adventitia , and adrenergic nerve endings of arteries from various territories and several species , including humans ( karas et al . , 1994 ; kim - schulze et al . , 1996 ; although it has been reported that cultured endothelial cells do not express er ( toth et al . , 2009 ) , other investigators have demonstrated the presence of both er and er mrna in endothelium ( wagner et al . , 2001 ) and data from our group demonstrate the protein expression of both er and er in huvec ( sobrino et al . , 2009 , 2010 ) . in addition to their classic nuclear location , er can also target the plasma membrane , enabling estrogen activation of several signaling pathways , including those involved in calcium mobilization ( zhang et al . prakash et al . , 1999 ) and the phosphatidylinositol-3-kinase ( pi3k ) pathway ( hisamoto et al . , a third type of er , g - protein coupled , and mainly located in the plasma membrane , was initially named gpr30 ( takada et al . , 1997 ) , then renamed gper by the international union of basic and clinical pharmacology , iuphar ( alexander et al . , 2008 ) . gper is expressed in both endothelial and smooth muscle cells of human arteries and veins ( haas et al . , gper activates rapid signaling cascades such as extracellular signal - related kinase and pi3k ( meyer et al . , 2011 ) . several rapid and non - genomic estrogen effects formerly attributed to er have now been described as gper - mediated ( prossnitz and barton , 2011 ) . the vascular protection conferred by estrogen may be mediated indirectly by its influence on the metabolism of lipoproteins or by a direct action on the modulation of molecular pathways in the vessel wall , and more specifically on endothelial cells ( hermenegildo et al . , 2002 ) . vascular endothelium not only regulates vascular tone through flow - mediated mechanisms , but also confers antithrombotic and antiinflammatory properties to the blood vessel . nitric oxide ( no ) , the primary endothelial - derived mediator , is involved in many physiological processes , including vasodilation and inhibition of thrombosis , cell migration , and proliferation ( dudzinski and michel , 2007 ; lamas et al . estrogen is known to increase no bioavailability by mechanisms that either directly increase no generation ( figure 1 ) or decrease superoxide anion o2 concentration , thereby attenuating o2-mediated no inactivation . mechanisms involved in estrogen - induced increases in no availability include : ( 1 ) transcriptional stimulation of endothelial no synthase ( enos ) gene expression ( huang et al . , 1997 ; sumi and ignarro , 2003 ) ; ( 2 ) non - genomic activation of enzyme activity via a pi3k / phosphokinase b ( pkb / akt)-mediated signaling pathway ( hisamoto et al . , 2001 ) ; ( 3 ) increased intracellular free ca concentration ( [ ca]i ) in endothelial cells ( rubio - gayosso et al . , 2000 ) ; ( 4 ) decreased production of asymmetric dimethylarginine ( adma ) , the enos endogenous inhibitor ( monsalve et al . , 2007 ) ; and ( 5 ) attenuated o2 concentrations ( wassmann et al . estradiol effects on enos - mediated nitric oxide ( no ) production include both genomic and non - genomic effects . genomic effects include the classical intracellular estrogen receptors ( er ) , which after binding of e2 interact with estrogen - response element ( ere ) in dna , resulting in an increased enos expression . moreover , e2 binding to gper leads to activation of different transcriptional factors such as camp response element ( cre ) which also induces enos expression . among non - genomic effects , er and gper regulate the e2-induced enos activity ( modified from sobrino , 2011 ) . estrogens such as 17-estradiol , estrone , and estriol have been described to act as reactive oxygen species ( ros ) scavengers by virtue of the hydrogen - donating capacity of their phenolic molecular structure ( halliwell and grootveld , 1987 ; dubey and jackson , 2001 ) . however , in these studies the direct effect of estrogens as scavengers can only be observed at concentrations above 1 m ( arnal et al . , 1996 ; kim et al . , 1996 ) . considering that plasma concentrations of estrogen in physiological conditions are within the nanomolar range , it is likely that direct scavenger action is not estrogen s main antioxidant mechanism . estrogen modulates ros concentration through a mechanism that involves interaction with its estrogenic nuclear receptors to decrease oxidative proteins and/or increase antioxidant enzymes expression . many studies have associated changes in estrogen levels with altered levels of antioxidant enzymes including glutathione peroxidase , catalase , and superoxide dismutase ( capel et al . , 1981 ; robb and stuart , 2011 ; sivritas et al . , 2011 ) . moreover , estrogen modulates nadh / nadph oxidases and at1 receptor gene expression , both of which are major sources of o2 production ( wassmann et al . , 2001 ; dantas et al . , estrogen also has a modulating effect on constrictive factors and positively upregulates the production of endothelium - derived relaxing factors such as pgi2 ( sobrino et al . , 2009 , 2010 ) and the endothelium - derived hyperpolarizing factors ( golding and kepler , 2001 ) , both of which are important mediators of vascular relaxation in resistance - sized arteries . the beneficial effects of estrogen on the endothelium can be partially explained by an inhibitory effect on the production or action of the cyclooxygenase ( cox)-derived vasoconstrictor agents prostaglandin h2 , pgh2 , and thromboxane a2 , txa2 ( davidge and zhang , 1998 ; dantas et al . , 1999 ; novella et al . , 2010 ) , and of endothelin-1 ( et-1 ; david et al . , 2001 ) . it regulates contractile responses by a direct modulation of ca mobilization into the vascular smooth muscle cells . direct interaction of estradiol with voltage - gated maxi - k channel subunit beta , which confers higher ca sensitivity , may modulate vascular smooth muscle ( valverde et al . , 1999 ) . estrogen does not inhibit ca release from the intracellular stores ( crews and khalil , 1999 ; murphy and khalil , 1999 ) . however , supraphysiological concentrations of estrogen impede ca influx from the extracellular space ( han et al . , 1995 ; crews and khalil , 1999 ; murphy and khalil , 1999 ) by inhibiting ca entry through voltage - gated ca channels ( freay et al . , 1997 ; kitazawa et al . , 1997 ; crews and khalil , 1999 ; murphy and khalil , 1999 ) . expression of the l - type ca channels in cardiac muscle is substantially increased in er - deficient mice ( johnson et al . , 1997 ) , suggesting er - mediated regulation of ca mobilization . estrogen also exerts direct modulation on the components of the renin - angiotensin system ( ras ) , a key regulator of blood pressure and smooth muscle cell growth . production of angiotensin ii ( ang ii ) , the active hormone of the ras , is reduced by estrogen inhibition of angiotensin - converting enzyme ( ace ) expression . in animal models of menopause and in postmenopausal women , chronic estrogen replacement reduces ace activity in the circulation and in tissues including the kidney and aorta ( brosnihan et al . , 1999 ; seely et al . , 2004 ) . furthermore , estrogen attenuates expression of and tissue response to type 1 angiotensin receptor ( at1 ) in the aorta , heart , and kidney ( silva - antonialli et al . vascular aging is associated with endothelial dysfunction , arterial stiffening and remodeling , impaired angiogenesis , defective vascular repair , and an increasing prevalence of atherosclerosis ( lakatta and levy , 2003 ; erusalimsky , 2009 ) . aging - associated changes in structure and function of large elastic arteries are seen even in the absence of clinical cvd ( moreau et al . , 2003 ) . although aging per se has detrimental effects in the vasculature , the lack of estrogen due to menopause may add an aggravating cvd risk factor in women , compared to arterial aging in men . in middle - aged females , aging - associated vascular dysfunction is potentiated by lack of estrogen due to menopause or ovariectomy and improves with estrogen replacement ( harman , 2004 ; stice et al . , 2009 ; novella et al . , 2010 unfortunately , the onset of menopause coincides with a time when aging - associated damage may be noted , making it particularly difficult to distinguish between the contributions of aging and the lack of estrogen . vascular aging is a natural phenomenon that could be simply described as a consequence of physical stress , beginning early in life . arteries are elastic tissues , susceptible to fatigue , and fracture over time as a consequence of extension - relaxation cycles during heartbeats ( avolio et al . , 1983 ) . in cross - sectional studies , postmenopausal females taking hrt have less arterial stiffness than their non - treated peers ( moreau et al . , 2003 ; radial artery distensibility fluctuates in accordance with estrogen levels during menstrual cycles ( giannattasio et al . , 1999 ) . basic research using animal models of estrogen withdrawal and aging suggests a modulatory role for estrogen in the molecular mechanisms to prevent arterial stiffening ( zhang et al . , 2000 ) a recent study reported that hrt improves arterial compliance , an effect related in part to estrogen actions in the control of endothelial - dependent vasodilatory tone ( moreau et al . , 2012 ) . collagen and elastin content of arterial walls is a key factor in arterial thickening and stiffening . it is mostly regulated by matrix metalloproteinases ( mmp ) , enzymes capable of degrading components of the extracellular matrix . during estrogen replacement in ovariectomized rats increases mmp activity and restores aged arteries to structural properties similar to those of younger animals studied ( zhang et al . , 2000 ) . dysfunction of both endothelial and smooth muscle molecular signaling appears during the aging process and favors vasospasm , thrombosis , inflammation , and abnormal cell migration and proliferation ( lakatta and levy , 2003 ; briones et al . endothelial dysfunction in the elderly has been associated with malfunctioning of vascular tissue , resulting in atherosclerosis , hypertension , and coronary artery disease ( lakatta and levy , 2003 ; herrera et al . , 2010 ) , renal dysfunction ( schmidt et al . , 2001 ; erdely et al . , 2003 ) , and alzheimer disease ( price et al . , 2004 ) . in women , a slight age - related decrease in endothelium - dependent relaxation persists until middle age ( around 50 years ) . after that , the declining response to the endothelium - dependent vasodilator hastens , even exceeding the rate experienced by men ( taddei et al . , the mechanisms for age - associated endothelial dysfunction are multiple , although most are associated with decreased no bioavailability ( hayashi et al . , 2008 ; santhanam et al . , 2008 ; erusalimsky , 2009 ; kim et al . , reduced endothelium - dependent and no - mediated vasodilation has been described in both human and animal models of aging ( kim et al . , 2009 ; virdis et al . lower no production in the elderly may be based on decreased no synthesis or increased no degradation . suggested mechanisms to explain reduced no production include : ( 1 ) decreased expression of enos ( briones et al . , 2005 ; yoon et al . , 2010 ) ; ( 2 ) a lack of no precursor ( l - arginine ; santhanam et al . , 2008 ) and enos cofactor tetrahydrobiopterin ( bh4 ; yoshida et al . , 2000 ; eskurza et al . , 2005 ; meyer et al . , 2011 ) ; and ( 3 ) increased endogenous enos inhibitor adma ( xiong et al . , 2001 ; kielstein et al . , on the other hand , strong evidences support the hypothesis that age - associated increase in oxidative stress and consequent production of o2 is a potent contributor to lower no bioavailability and increased endothelial dysfunction ( jacobson et al . , 2007 ; rodriguez - manas et al . , there is little information to correlate the progression of aging with the production / degradation of no in women . although several studies have described decreased expression of enos in senile female rats and mice ( wynne et al . , 2004 ; novensa et al . , 2011 ) , aging - associated effects on enos in women can be easily confounded with the effects of lack of estrogen , since most of these studies grouped women into just two time - points : premenopausal and menopausal groups . even though the decline in no bioavailability could sufficiently explain most of the changes in the functioning of vascular cells , other molecules crucial to control of vascular function are also modified by aging . in the regulation of vascular tone , cox - derived factors are particularly important as they can induce both vascular relaxation ( pgi2 ) and contraction ( txa2 and pgh2 ) . some studies have reported a prevalence in the production of relaxing cox factors in the vasculature of young and healthy individuals ( tang and vanhoutte , 2008 ) . with aging , cox - dependent vasoconstrictors production becomes evident , leading to increased vascular contraction ( taddei et al . however , the cox isoform involved in the generation of contractile prostanoids remains unclear . in functional studies developed in femoral arteries of aged rats , oxygen free radicals participate in the augmented endothelium - dependent contractions mediated by cox - derived prostanoids . both the constitutive and inducible isoforms of cox contribute to this endothelial dysfunction ( shi et al . molecular studies performed in endothelial cells from aged rats showed an increase in mrna levels of cox-1 , cox-2 , and other enzymes involved in the synthesis of prostanoids ( tang and vanhoutte , 2008 ) , demonstrating the importance of the arachidonic acid cox cascade in the endothelial and vascular dysfunction associated with aging . moreover , functional studies have demonstrated an interaction between no and prostanoids pathways . in aorta from aged female mice , no bioavailability increases when the cox pathway is inhibited ; both gene and protein expression of cox-1 are increased ( novella et al . , 2011 ) . furthermore , activation of inflammatory pathways in the vascular wall plays a central role in the process of vascular aging . even in the absence of traditional risk factors for atherosclerosis , an age - associated shift to a proinflammatory gene expression profile , known as endothelial activation , induces upregulation of cellular adhesion molecules and cytokines , which increases endothelial leukocyte interactions and permeability , mechanisms considered crucial to initial steps in the development of atherosclerosis ( herrera et al . , 2010 ; seals et al . , 2011 ) . accordingly , a sex - associated difference in inflammatory responses during aging has been proposed . inflammatory atherosclerosis and associated acute coronary heart disease develop earlier in life in men than in women ( roger et al . , 2011 ) and are associated with earlier death , although men and women present the same overall plaque burden ( frink , 2009 ) . in animal models of atherosclerosis , male sex contributes to a faster and more severe progression of lipid deposition , remodeling , and aortic lesions ( pereira et al . with the wide - ranging data from experimental research , estrogens might appear to promise protection against the progression of vascular aging and cvd in women . epidemiological observational studies also suggest that postmenopausal women on hrt are less likely to develop cvd than non - users at the same age ( grodstein et al . , 2000 , 2001 ) nevertheless , these studies contrast with the large prospective clinical trials , hers and whi , which failed to show reduced cardiovascular events in postmenopausal women on hrt . in fact , whi suggested that hrt was associated with increased risk to the cardiovascular system ( rossouw et al . , 2002 ) . possible reasons for this discrepancy have been extensively discussed and include the average age of women entering most hrt clinical trials , 65 years and older , which results in a study population with some degree of aging - associated vascular damage . in addition , participants had been estrogen - deficient for an average of 10 years before starting hrt , a relatively late start that could modify the status of ers and molecular signaling so as to attenuate the benefits of estrogen . for instance , during aging ers can undergo posttranslational modifications such as methylation , which decreases their expression and activity . we recently reported that aging contributes to increased dna methylation in female mice aorta , which could be associated with the decrease in the modulatory effects of estrogen ( novensa et al . , 2011 ) . a few clinical studies also provide evidence for aging - associated dysregulation of er methylation and suggest that focal epigenetic changes in er could contribute to decreased estrogen activity and to the development of atherosclerosis in elderly women ( post et al . , 1999 ; detailed examination of whi data reveals that early initiation of estrogen replacement produces more favorable results than the later average initiation employed in the whi studies overall ( grodstein et al . , 2006 ; these findings , together with observational studies , have led scientists to create the so - called timing hypothesis that estrogen - mediated benefits to prevent cvd only occur when treatment is initiated before the detrimental effects of aging are established on vascular walls ( harman , 2006 ) . these effects include endothelial dysfunction and pathophysiological actions , such as increased vascular calcification and generalized stiffening of the arterial tree that increase the prevalence of hypertension and atherosclerosis ( lakatta and levy , 2003 ; erusalimsky , 2009 ; kovacic et al . , 2011 ) . little information is available on whether and how vascular effects of estrogen are modified with aging in females . aging has been associated with significant reductions in the direct estrogen - mediated mechanisms of vascular relaxation ( wynne et al . , 2004 ; the lack of estrogen responses in these animal studies was not related to age - associated changes in the plasma levels of estrogen or activity of er , but rather to possible age - related changes in estrogen - mediated signaling pathways in the vasculature . modifications in the ratio between er and er in older female mice are associated with the lack of protective effects of estrogen on no production and with a reversal in its antioxidant effect to a pro - oxidant profile ( novensa et al . , 2011 ) . moreover , clinical studies have revealed that cvd risk factors in postmenopausal women were lower among women aged 5059 years at hrt initiation ( manson et al . these studies clearly establish the complexity of estrogen effects , which may be influenced by pathophysiological conditions including aging and subclinical cvd . despite convincing arguments by the followers of the timing hypothesis the potential extrapolation of the protective effects of estrogen replacement , well described in young females , to older women remains controversial . the field still lacks detailed experimental and clinical research on the long - term effects of estrogen and how it modulates cardiovascular function during aging . our society is aging progressively , and increased life expectancy enhances the risks for diseases associated with the natural fatigue of the body , including cvd . despite this undeniable reality , there is evidence that vascular aging in women does not follow the same chronology as in men . the vascular protective effects exerted by estrogens have been proposed as the major reason for reduced signs of vascular aging and cvd risk in premenopausal women , compared to men . when natural estrogen withdrawal occurs and a woman enters her climacteric stage , effects of sudden vascular aging become evident , leading to vascular dysfunction and increased risk of a cardiovascular event . the lack of crucial information from clinical trials and the discrepancies in the available data on the regulation of the female cardiovascular system can lead to inappropriate diagnosis and treatment of cvd in older women . women have been treated like men , despite the notable sex - associated differences in the elements of aging and disease processes . much research effort is still needed to understand age- and sex - related differences in cardiovascular control , establish the impact of the menstrual cycle and hrt on vascular function , and propose new therapeutic strategies to improve cvd diagnosis and treatment and the overall management of vascular senescence in women . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

aging is associated with structural and functional changes in the vasculature , including endothelial dysfunction , arterial stiffening and remodeling , impaired angiogenesis , and defective vascular repair , and with increased prevalence of atherosclerosis . cardiovascular risk is similar for older men and women , but lower in women during their fertile years . this age- and sex - related difference points to estrogen as a protective factor because menopause is marked by the loss of endogenous estrogen production . experimental and some clinical studies have attributed most of the protective effects of estrogen to its modulatory action on vascular endothelium . estrogen promotes endothelial - derived no production through increased expression and activity of endothelial nitric oxide synthase , and modulates prostacyclin and thromboxane a2 release . the thromboxane a2 pathway is key to regulating vascular tone in females . despite all the experimental evidence , some clinical trials have reported no cardiovascular benefit from estrogen replacement therapy in older postmenopausal women . the timing hypothesis , which states that estrogen - mediated vascular benefits occur only before the detrimental effects of aging are established in the vasculature , offers a possible explanation for these discrepancies . nevertheless , a gap remains in current knowledge of cardiovascular aging mechanisms in women . this review comprises clinical and experimental data on the effects of aging , estrogens , and hormone replacement therapy on vascular function of females . we aim to clarify how menopause and aging contribute jointly to vascular aging and how estrogen modulates vascular response at different ages .

chlamydia genital infection is the most common bacterial infection sexually transmitted in the world ( 1 ) . the highest age - specific rate was reported in females aged 15 - 35 years . the majority of the females are asymptomatic ( 2 ) , thus , providing a continuous reservoir for the infection ( 3 ) . it is estimated that 5 - 12% of sexually active adults in the age group of 16 - 34 years in the united kingdom are infected with chlamydia trachomatis ( 4 ) . according to the world health organization ( who ) , 101.5 million people with chlamydia infection are detected globally each year ( 5 ) . the infection risk factors include being young or adolescent , having new or frequent sexual contacts , inconsistent use of barrier contraception , history of prior sexual transmitted infection , and low educational and socioeconomic levels ( 6 ) . thus , the prevalence of c. trachomatis may differ among racial groups because of differences in sexual risk behavior and cultural backgrounds ( 7 ) . untreated chlamydial infections may lead to pelvic inflammatory disease ( pid ) , ectopic pregnancy , premature delivery , spontaneous abortion , low birth weight , tubal infertility and subsequent scarring of the fallopian tubes ( 8) . during pregnancy , chlamydial infection can cause miscarriage , premature rupture of membranes , preterm labor , low birth weight , infant mortality , neonatal chlamydial infection , and postpartum endometritis ( 9 ) . screening , early diagnosis and treatment is considered the main policy to prevent complications and further transmission of the infection ( 10 ) . conventional laboratory diagnosis of c. trachomatis infection is done by cell culture or antigen detection . commercially available naats using methods such as polymerase chain reaction ( pcr ) , and ligase chain reaction ( lcr ) , are now the gold standard tests for genital chlamydia infection ( 11 ) . pcr has good sensitivity ( 100% ) and specificity ( 99.3% ) for endocervical samples compared with urethral culture . it is the preferred test and the most commonly used method of diagnosis , which amplifies c. trachomatis dna sequences ( 12 ) . there are no accurate data regarding the prevalence of c. trachomatis infection in kashan and few studies from iran examined the prevalence of genital chlamydia infection based on age . the current study aimed to assess the prevalence of endocervical c. trachomatis infection in a population of females aged 17 - 35 years in kashan , iran . endocervical swab samples were collected by the gynecologists from 255 married females aged 17 - 35 years , with or without symptoms , referring to the obstetrics and gynecology clinics of kashan , iran , from december 2012 to july 2013 . the study was approved by the regional research ethics committee of kashan university of medical sciences ( p 2331 ) , and all participants signed informed consent forms prior to enrolment in the study . demographics , sexual behavior , method of contraception , previous history of sexually transmitted infections ( stis ) and symptoms were assessed by a questionnaire routinely used in the clinic . cervical samples were collected from the endocervical region after inserting a sterile speculum into the vagina . mucus was cleaned with a sterile cotton swab without causing any bleeding or using antiseptics . dacron swabs were used to collect endocervical specimens . the specimen placed into sterile collection tubes containing 2 ml of transport buffer ( nah2po4 20 mm , na2hpo4 20 mm , sucrose 20 mm , glutamin 5 mm , gentamycin 50 g / ml , vancomycin 100 g / ml , amphotericin b 25 g / ml supplemented with 10% of inactivated fetal calf serum ) and transported to the laboratory for further processing . pcr was set up using positive control dna from c. trachomatis serovar l2 type strain 434/bu ( atcc vr-902b ) . for the negative control , the dna was isolated using a kiaspin pcr template purification kit , ( kiagen , iran ) according to the manufacturer s instructions . briefly , samples were vortexed and centrifuged for 30 minutes at 14000 g. then , dna purification was performed , 200 l of each specimen was transferred and mixed with 300 l of buffer lb and 2 l of dna / rna carrier and 5 l of proteinase k in a 1.5 ml microcentrifuge tube and incubated at 65c for 10 minutes . after incubation , 100 l of isopropanol was added to the tubes , mixed and centrifuged for 2 minutes at 5000 g. the supernatant was applied to the spin column and centrifuged at 12000 g for 1 minute , after which the filtrate was discarded and 500 l of buffers irb and 600 l of wb were added to each spin column and centrifuged again at 12000 g for 1 minute . chlamydia trachomatis was detected by a pcr designed in the laboratory to amplify a sequence in the cryptic plasmid generating a fragment of about 512 base pair . primers were hl1 forward , 5-tagagataggaaaccaactc-3and hl2 reverse , 5ctcgggttaatgttgcatga-3 ( 13 ) ( cinnagen , tehran , iran ) . amplification reactions were performed in a final volume of 25 l containing 5 l of sample , 12.5 l of the master mix pcr solution ( cinnagen , tehran , iran ) , and 1 l of each reverse and forward primers . the reaction mixture was incubated for 5 minutes at 94c , followed by 40 cycles of 1 minute at 94c , 1 minute at 45c , and 1 minute at 72c , and a final elongation step of 7 minutes at 72c . the pcr products were analyzed by electrophoresis in the 1% tbe buffer through 1.5% agarose gel , stained with ethidium bromide 0.5 g / ml and dna bands were visualized using a uv transilluminator ( figure 1 ) . lane m : marker ; lane 1 : negative control ; lane 2 : positive control ; lane 3 - 6 : positive samples ; 7 : negative sample . data were analyzed using spss version 16 and the outcome variables including prevalence rates and their 95% confidence intervals ( cis ) were calculated . the chi - square or fisher s exact test was used to analyze the categorical data . endocervical swab samples were collected by the gynecologists from 255 married females aged 17 - 35 years , with or without symptoms , referring to the obstetrics and gynecology clinics of kashan , iran , from december 2012 to july 2013 . the study was approved by the regional research ethics committee of kashan university of medical sciences ( p 2331 ) , and all participants signed informed consent forms prior to enrolment in the study . demographics , sexual behavior , method of contraception , previous history of sexually transmitted infections ( stis ) and symptoms were assessed by a questionnaire routinely used in the clinic . cervical samples were collected from the endocervical region after inserting a sterile speculum into the vagina . mucus was cleaned with a sterile cotton swab without causing any bleeding or using antiseptics . dacron swabs were used to collect endocervical specimens . the specimen placed into sterile collection tubes containing 2 ml of transport buffer ( nah2po4 20 mm , na2hpo4 20 mm , sucrose 20 mm , glutamin 5 mm , gentamycin 50 g / ml , vancomycin 100 g / ml , amphotericin b 25 g / ml supplemented with 10% of inactivated fetal calf serum ) and transported to the laboratory for further processing . pcr was set up using positive control dna from c. trachomatis serovar l2 type strain 434/bu ( atcc vr-902b ) . for the negative control , sterile deionized water was used as the pcr template instead of nucleic acid . the dna was isolated using a kiaspin pcr template purification kit , ( kiagen , iran ) according to the manufacturer s instructions . briefly , samples were vortexed and centrifuged for 30 minutes at 14000 g. then , dna purification was performed , 200 l of each specimen was transferred and mixed with 300 l of buffer lb and 2 l of dna / rna carrier and 5 l of proteinase k in a 1.5 ml microcentrifuge tube and incubated at 65c for 10 minutes . after incubation , 100 l of isopropanol was added to the tubes , mixed and centrifuged for 2 minutes at 5000 g. the supernatant was applied to the spin column and centrifuged at 12000 g for 1 minute , after which the filtrate was discarded and 500 l of buffers irb and 600 l of wb were added to each spin column and centrifuged again at 12000 g for 1 minute . chlamydia trachomatis was detected by a pcr designed in the laboratory to amplify a sequence in the cryptic plasmid generating a fragment of about 512 base pair . primers were hl1 forward , 5-tagagataggaaaccaactc-3and hl2 reverse , 5ctcgggttaatgttgcatga-3 ( 13 ) ( cinnagen , tehran , iran ) . amplification reactions were performed in a final volume of 25 l containing 5 l of sample , 12.5 l of the master mix pcr solution ( cinnagen , tehran , iran ) , and 1 l of each reverse and forward primers . the reaction mixture was incubated for 5 minutes at 94c , followed by 40 cycles of 1 minute at 94c , 1 minute at 45c , and 1 minute at 72c , and a final elongation step of 7 minutes at 72c . the pcr products were analyzed by electrophoresis in the 1% tbe buffer through 1.5% agarose gel , stained with ethidium bromide 0.5 g / ml and dna bands were visualized using a uv transilluminator ( figure 1 ) . lane m : marker ; lane 1 : negative control ; lane 2 : positive control ; lane 3 - 6 : positive samples ; 7 : negative sample . data were analyzed using spss version 16 and the outcome variables including prevalence rates and their 95% confidence intervals ( cis ) were calculated . the chi - square or fisher s exact test was used to analyze the categorical data the age of the 255 subjects ranged 17 - 35 years with a mean of 27.3 4.37 years . the majority of them were married or living with a partner ( 98% ) , had high school education or higher ( 74% ) . the prevalence of c. trachomatis was 2.4% ( 95% confidence interval [ ci ] 0.54 - 4.26% ) with a mean of 25.8 6.17 years ; 50% ( 3/6 ) of the subjects with a positive chlamydia test result were under the age of 25 . of the 92 subjects in the 25-year - old group , 3 ( 3.3% ) were positive for c. trachomatis compared to three out of 163 ( 1.8% ) in the > 25-year - group ; 83.3% ( 5/6 ) of the subjects with a positive chlamydia test result were older than 16 at first sexual encounter and all of the infected subjects lived in the city . the most general symptoms among c. trachomatis infected young subjects were vaginal discharge ( 66.6% ) and lumbar pain ( 50% ) . no significant relationships were found between c. trachomatis infection and the risk factors , probably reflecting the small number of those who were positive in the test . the prevalence of c. trachomatis genital infections among young females in kashan , iran was 2.4% . the previous published reports from iran showed various prevalence of 2% to 11% ( 14 ) . the study by chamani - tabriz et al . on the prevalence of chlamydia infection in females aged 15 - 42 attending obstetrics and gynecology clinics in tehran , from may 2003 to october 2003 showed that 12.6% were positive for chlamydia by pcr ( 15 ) . in another study on the females < 45 years attending gynecology clinics in babol , iran , european centre for disease prevention and control ( ecdc ) described the prevalence ranging from 1.4% to 3.0% among females aged 15 - 40 years ( 17 ) . the prevalence of c. trachomatis infection and the risk factors in individuals < 35 years old attending sexual health clinics in barcelona province , spain , in 2006 was 3.8% and the prevalence was significantly higher in those under 25 years ( 5.8% ) compared with the ones aged 25 - 35 ( 1.6% ) ( 18 ) . another study in melbourne , australia , showed that the chlamydia prevalence was 3.7% among sexually active females aged 18 - 24 years compared with 0.2% among 25 - 35-year - old ones ( 19 ) . a study among the brazilian females referred to sexually transmitted diseases ( std ) clinic showed that 68% of the infected ones aged 15 - 25 year ( 13 ) . in the current study , the c. trachomatis prevalence in females 25 years ( 3.2% ) was similar to those of reported in australia 4.9% ( 20 ) , spain 4% ( 21 ) , france 3.6% ( 22 ) and the united kingdom 3% ( 23 ) . the current cdc guidelines recommend annual screening for chlamydia in sexually active females 25 years and the ones > 25 years old who are at increased risk ( 24 ) . screening is especially important in pregnant females who are at risk of transmission of their infection to the fetus ( 25 ) . chlamydia trachomatis infection is the main causative agent of abortion ( 26 ) . in the current study , abortions were reported by 16.7% of females with positive test results . early detection and appropriate treatment of c. trachomatis can prevent the development of the disease after abortion ( 27 ) . prevalence of c. trachomatis was found to be low among females in kashan , iran . the reason for c. trachomatis infection low prevalence in the population under study was the scarcity of pre - marriage sexual intercourse frequency in females , having stable sexual intercourse only after marriage . to date it was the first study in kashan to determine the prevalence of endocervical c. trachomatis infection in young females . there were several limitations to the study , which should be considered in the interpretation of the results . data on sexual behavior was not specifically collected for the current study . knowing a patient s number of sexual partners , sexual activity before and after sti diagnosis , and frequency of condom use may help identify the patients who are at increased infection risk . chlamydia prevalence was low in young sexually - active females , but there is a significant difference regarding chlamydia infection in females younger than 25 years . the new information provides evidence for the need to implement active opportunity to screen young sexually active females and the patients in all socioeconomic groups . all sexually active females should be offered a c. trachomatis test when attending a physician .

background : chlamydia trachomatis is one of the major bacterial agents of the sexually transmitted diseases worldwide , especially among young females . there is no data regarding the prevalence of genital chlamydia infection among young females in kashan , iran.objectives:the current study aimed to determine the prevalence of endocervical c. trachomatis infection among females aged 17 - 35 years in kashan , iran.patients and methods : in the current descriptive study , 255 endocervical swab samples were collected from the obstetrics and gynecology clinics of kashan , iran from december 2012 to july 2013 . cervical swabs were placed in transport media and sent to the laboratory . to identify c. trachomatis in the samples polymerase chain reaction ( pcr ) was performed to amplify a sequence in the cryptic plasmid , generating a fragment of about 512base pair . demographic data was collected considering the relevant risk factors by a standard questionnaire.results:a total of 255 females were tested . the prevalence of genital c. trachomatis was 2.4% ( 95% confidence interval [ ci ] 0.54% - 4.26% ) ; 3.2% of the females in the 25-year - old group were positive versus 1.8% in the 26 - 35-year - old group . the most general presented symptoms of genital c. trachomatis infection were vaginal discharge ( 66.6% ) and lumbar pain ( 50% ) . no significant relationships were found between c. trachomatis infection and the risk factors.conclusions:to the authors knowledge this is the first study to describe endocervical c. trachomatis infection in this area . the obtained results also emphasized the importance of routine diagnosis of c. trachomatis to control of the infection .

it is widely believed that the rate of mortality associated with anesthesia is steadily decreasing , and that anesthesia today is very safe indeed . however , this assertion has been questioned by lagasse , who argues that the definitions of anesthetic mortality used in different studies over the years have not been consistent . perhaps the best data on anesthesia mortality come from australia , where the state - based anesthetic mortality review committees have followed a relatively consistent approach with clear definitions ( table 1 ) for 20 years . case mix clearly makes a substantial difference to the risk of anesthesia , but the sequential triennial reports of these committees do suggest that anesthesia has become safer over time and that the risk of death definitely and entirely attributable to anesthesia today is close to 1 in 200,000 in patients who are essentially healthy and undergoing minor or moderate surgical procedures . it is disappointing , however , that even these data relate primarily to deaths within either 24 or 48 hours of anesthesia , whereas most people would probably be more interested in knowing their chances of actually going home from hospital and surviving for a reasonable period thereafter ( 30 days post - surgery , for example ) . there is very little information on this , although at least one european study suggests that these risks may be much higher than generally appreciated . this european study also confirms earlier evidence suggesting that anesthesia makes an important contribution to outcome after surgery . fundamental to any discussion of the safety of anesthesia is the matter of when mortality should be attributed to anesthesia . the australian mortality committees have provided definitions by which perioperative deaths can be attributed to one of eight categories , three of which relate to anesthesia ( table 1 ) . the critical words are : caused by the anesthesia or other factors under the control of the anesthetist . it is these other factors that have largely been overlooked in efforts to estimate the true incidence of mortality ( let alone morbidity ) attributable to anesthesia . perioperative myocardial ischemia is a case in point : clearly it may be attributable or amenable to factors under the control of the anesthetist ; its consequences often manifest several days postoperatively so are easily overlooked , particularly in studies that focus on the first 24 or 48 hours after surgery ; and it may contribute to death , although often only some time later . in a study by the study of perioperative ischemia research group , patients surviving a postoperative in - hospital myocardial infarction had a 28-fold increase in the rate of subsequent cardiac complications within 6 months following surgery , a 15-fold increase within 1 year , and a 14-fold increase within 2 years . are these extra deaths attributable to anesthesia ? we would argue that they are . in the perioperative ischemic evaluation ( poise ) study , a multicentre prospective blinded controlled trial involving 8,351 patients , the incidence of perioperative myocardial infarction in patients randomized to receive metoprolol was 4.2% compared with 5.7% in those receiving placebo ( confirming the value of beta - blockers in protecting the heart ) , but the overall mortality was 3.1% and 2.3% , respectively . in other words , the perioperative use of beta - adrenergic blocking drugs , a factor very much under the control of anesthetists , was associated with an excess mortality rate of 0.8% . the wider question of how and when to use beta - blockers during anesthesia , and of the other factors relevant to optimal management , is of course complex , which is exactly why anesthetists are rebranding themselves as experts in perioperative medicine . however , one can not have it both ways : the fact that the overall management of patients perioperatively can make a substantial difference to outcome is strong endorsement of the argument for a central role for well - resourced medically qualified practitioners in the provision of anesthesia , but it also makes a nonsense out of blanket claims that the risk of dying from an anesthetic is very low . there are many parts of the world in which anesthesia mortality rates are many multiples of those in high income countries such as the usa , europe , and australia [ 11 - 13 ] . clearly , many advances that have been made in the safety of anesthesia have not been realized everywhere . even worse , many patients do not receive desperately needed surgical and anesthetic services at all . the number of surgical operations undertaken around the world every year has only recently been estimated , and , at about 234 million , actually exceeds the number of births . unfortunately , these operations are very unevenly distributed , with only 3.5% being undertaken amongst those 34.8% of the global population who live in countries spending $ 100 or less per person on healthcare . it seems that about 11% of the global burden of disease measured in disability - adjusted life years arises from conditions amenable to surgery , so access to appropriate surgery is clearly essential , and obviously depends on equal access to safe anesthesia . even in high income countries there is substantial variance in access to services : more disturbingly , there is astonishing variance in practices over and above the variance attributable to resource differences . furthermore , there is ongoing evidence that even those patients who actually do receive appropriate healthcare ( including surgery and anesthesia ) are at unacceptable risk of harm from avoidable errors [ 17 - 20 ] . the safe surgery saves lives initiative of the world health organization has developed a surgical safety checklist to address some of these errors through a cost - effective tool applicable to surgery and anesthesia everywhere . in a study undertaken in eight pilot sites around the world , introduction of this checklist significantly and substantially reduced harm associated with surgery . the pilot study was not a randomized controlled trial , but it was prospective and large ( data from almost 4,000 patients collected at baseline were compared with data from a similar number after the introduction of the checklist ) . it will not eliminate errors , but it is highly likely to reduce them and , through enhanced teamwork , to improve outcomes more generally . there is now a considerable onus on senior clinicians to promote the use of the checklist in a meaningful manner involving the engaged participation of all members of the operative team . there is also considerable onus on the organizations associated with anesthesia to continue to support initiatives to improve the training and resources available for anesthesia in resource - limited regions of the world . the world federation of societies of anaesthesiologists has provided strong leadership in this regard and in recent years the support for anesthesia from the world health organization has increased considerably . as with so many things , the sophistication and accuracy of the way in which we measure outcome has increased in parallel with other advances in anesthesia . this has the effect of highlighting risks of anesthesia that , in previous years , may not have been appreciated at all . so is anesthesia becoming safer ? certainly - and this is self evident to anyone who has practiced for more than three decades . certainly not , especially in higher - risk patients , and in low - income regions of the world . we are making commendable progress , but there is a long way to go to achieve the goal that no patient shall be harmed by anaesthesia . the authors have financial interests in safer sleep llc , which produces a system to promote safety in anesthesia .

in well - resourced areas of the world anesthesia has become safer over the past decades , and anesthesia mortality does seem to be reducing . however , there is a lack of international agreement over definitions of anesthetic mortality and , therefore , difficulty in knowing exactly what the rate of anesthetic mortality is . avoidable harm from error is still a problem , and sophisticated analysis suggests that more deaths than generally appreciated may be attributable to factors under the control of anesthetists . mortality rates in low income areas of the world are unacceptably high . there is more to be done if anesthesia is to become truly safe for all patients .

many potential therapies for severe and/or chronic wounds fail as a result of poor vasculature . hence , strategies to improve blood vessel supply into a wound bed are thought to promote wound healing . transplantations of mesenchymal stem cells ( mscs ) have shown great potential as a therapeutic agent for the treatment of a range of disorders , including wound healing , and have become the subject of numerous clinical trials . however , whilst the safety of msc transplantation does not seem to be an issue , the effectiveness of such treatment has exhibited considerable variability . this variation in effect is problematic when translating preclinical research into msc - based clinical therapy . we recently demonstrated that human msc - conditioned medium ( msc - cm ) was stimulatory to epidermal and fibroblast cell adherence and migration . other reports suggest that msc are pro - angiogenic also through their paracrine activity on endothelial cells . whilst there are reports that msc are capable of endothelial differentiation , engraftment into new vasculature is low in vivo . hence , these and other studies have contributed to recent thought that the predominant regenerative activity of mscs is due to their secretion of factors that stimulate endogenous cells at wound sites . in this investigation , we have examined the effects of msc - cm on endothelial cells , using the cell line eahy-926 as a model system . we report that msc - cm promotes endothelial cell adhesion and migration , but that these effects show considerable donor - donor variability . further , we have identified extracellular matrix ( ecm ) proteins that are secreted by mscs using maldi / tof - tof mass spectrometry . we provide data to suggest that ecm composition plays a major role in the donor - donor variation we have seen . these findings demonstrate proof of principle of the need to screen the msc secretome in order to optimise the application of mscs in the clinic . cell culture and mass spectrometry of conditioned medium eahy-926 endothelial cells were maintained in dmem / f12 culture medium ( invitrogen , paisley , uk ) supplemented with 10% ( v / v ) fetal calf serum ( fcs ) ( invitrogen ) and 1% ( v / v ) penicillin and streptomycin ( invitrogen ) , incubated at 37c and in a humidified atmosphere containing 5% ( v / v ) co2 . passaging was performed at ~90% confluence and cells were re - seeded at 1 x 10 cells / cm . mscs were isolated from the iliac crest biopsies of bone marrow donors following ethical approval and with informed consent , as previously described . the adherent cell population obtained was consistent with the characteristics of mscs laid out by the international society for cellular therapy ( isct ) . conditioned medium was generated from msc cultures of equal cell number in serum free conditions , using dmem / f12 supplemented with insulin , transferrin and selenium ( invitrogen ) . protein content of msc cm was determined by maldi - tof / tof mass spectrometry as previously described . characterization of msc after three passages in culture , bone marrow derived cells were assessed by immunoprofiling for cd markers and by examining their differentiation potential to form osteoblasts , adipocytes and chondrocytes , by staining with alkaline phosphatase , oil red o , and toluidine blue respectively as per the criteria established for a msc phenotype by the isct . coating of culture plates culture plates were coated with msc - cm or type - i collagen , decorin , or fibronectin ( all sigma - aldrich ) . protein solutions were diluted in pbs to 0.2mg / ml and added to each well ( 50l for 96-well plates , 500l for 24-well plates ) . these were refrigerated for 24 hours before being rinsed with pbs immediately prior to use . cell adherence / spreading coated 24-well tissue culture plates were seeded with 2x10 eahy-926 endothelial cells in dmem / f12 supplemented with 1% penicillin / streptomycin ( sigma - aldrich ) and 1% its - x ( sigma - aldrich ) and incubated for 2 hours at 37c and 5% co2 before digital images were captured ( progres cf , jenoptik ) and analysed using image - j software . scratch assays were established using previously published methods , in protein - coated tissue culture plates ( as described above ) . cell migration was automatically captured and analysed at hourly intervals using an incucyte live - cell imaging system ( essen bioscience ) . data were tested for significance using the mann - whitney u test . those differences that fell within a 95% , 99% or 99.9% confidence interval were considered to be significant , indicated by asterisks within figures ( * p<0.05 * * p<0.01 * * * p<0.001 ) . bone marrow cells obtained from iliac crest biopsies showed characteristics consistent with those expected of msc ( figure 1 ) . msc - cm coating of culture plates resulted in the significant enhancement of the spreading of eahy-926 endothelial cells upon the culture surface . this result was subject to a marked inter - donor variability , with conditioned media generated by both msc-1 and msc-3 resulting in a significantly greater degree of eahy-926 endothelial cell spreading than that generated by msc-2 ( figure 2a , 2b ) . eahy-926 endothelial cell adherence on fibronectin coated plates was most advanced after two hours , compared to plates coated in either type i collagen or with decorin ( figure 3 ) . on type i collagen - coated plates , the presence of msc - cm appeared to enhance the rate of eahy-926 endothelial cell migration into scratch - wounds compared to unconditioned media ( figure 4a , left ) . eahy-926 endothelial cells in msc - cm closed scratch - wounds to a significantly greater degree than those in unconditioned media over a 12-hour time course ( figure 4b , left ) . once again , the degree of this msc - cm mediated enhancement of eahy-926 endothelial cell migration was subject to inter - donor variability . conditioned medium generated by msc-1 ( and msc-3 ) elicited a greater degree of scratch - wound closure than msc-2 over 12 hours ( figure 4b , left ) . cells isolated from bone marrow meet the minimum criteria for identification as msc.cells are immunoreactive for cd73 , cd90 and cd105 , whilst lacking immunoreactivity for cd14 , cd34 and cd45 , as shown by histograms obtained by flow cytometry , and readily differentiate to form osteoblasts , adipocytes and chondrocytes in vitro . representative phase contrast images are shown of cells following tri - lineage differentiation and staining with alkaline phosphotase , oil red o , and toluidine blue ( top , left to right ) . msc - cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading.a : msc - cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading . after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with msc - cm than on plates coated with unconditioned ( control ) medium . b : after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on msc - cm coated culture plates and 389m2 than those cells on unconditioned ( control ) medium coated culture plates . data shown are means sem in relative units ( * * * = p<0.001 mann whitney u test ) . ecm protein coating of culture plates influences eahy-926 endothelial cells adherence and spreading.after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with fibronectin than on plates coated with type i collagen or decorin . b : after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on fibronectin compared to those cells on either type i collagen or decorin . data shown are means sem in relative units ( * * = p<0.01 , * * * = p<0.001 , mann whitney u test ) . eahy-926 endothelial cells closed scratch wounds faster in msc - cm than in unconditioned medium on type i collagen , fibronectin , and decorin coated culture plates . a : eahy-926 cells on fibronectin coated culture plates closed scratch wounds significantly faster than those on either type i collagen or decorin . b : after 12 hours eahy-926 endothelial cells in msc - cm had closed scratch wounds by a significantly greater degree than those in unconditioned control medium . 12 hours post - scratching , eahy-926 endothelial cells on plates coated fibronectin had closed scratch wounds by a significantly greater degree than those on either type i collagen or decorin . on fibronectin and decorin , medium conditioned by msc-2 on type one collagen , medium conditioned by msc-2 was associated with significantly reduced scratch closure compared to msc-1 . all three were found to contain fibronectin , collagen type i , collagen type vi , and lumican , whilst cartilage oligomeric matrix protein ( comp ) and sparc were present in two out of three msc - cm and laminin , decorin , heparan sulphate proteoglycan ( hspg ) and igfbp-1 were each only observed in one msc - cm ( table 1 ) . of these , hence , not only was there clear inter - donor variability in the ecm components of the msc secretome , but the presence of these proteoglycans seemed to be associated with a reduction in the efficacy of msc - cm . when type i collagen , decorin and fibronectin were used as culture substrata , the degree of eahy-926 endothelial cell spreading appeared to be similar upon both type i collagen and decorin and greatly enhanced upon fibronectin ( figure 2a , 2b ) . similarly , scratch - wound closure by eahy-926 endothelial cells in unconditioned media appeared to be similar upon type i collagen and decorin , but markedly greater upon fibronectin ( figure 4a , 4b ) . in the presence of each ecm substrate the presence of msc - cm resulted in significantly enhanced scratch wound closure compared to unconditioned media ( figure 4b ) . as seen previously upon type i collagen coated culture plates , the degree of closure upon both decorin and fibronectin coated plates was either significantly or near significantly ( p=0.057 by mann whitney u test ) less in the presence of medium conditioned by msc-2 , compared to medium conditioned by either msc-1 or msc-3 ( figure 4b ) . mass spectrometry of msc - cm from 3 separate donors.maldi-tof/tof mass spectrometry of msc - cm detected variable protein content between media conditioned by msc from three different patient donors . we have previously shown that msc - cm promotes the migration of skin cells in a wound healing model , and identified numerous potentially beneficial factors that may contribute to this effect . in vivo wound healing is , however , a complex process influenced by a host of cellular events , including angiogenesis . if msc can stimulate endothelial cells as suggested here and elsewhere this supports their potential use in the treatment of cutaneous wounds . in these experiments , this is similar to previous studies in which msc - cm has been shown to stimulate angiogenesis , supporting the investigation of msc - cm as a pro - angiogenic agent . although it is possible for proliferation of eahy-926 endothelial cells to have contributed somewhat to the closure of the scratch wounds , these scratch assay experiments were performed over the course of 12 hours . the reported doubling time for these cells is over 25 hours . to significantly affect the rate of scratch wound closure , those cells at the leading edge of the scratch margins would be required to undergo repeated doublings , and this is unlikely to have had a major influence on scratch wound closure over the time course of these studies . mass spectrometry of msc - cm revealed numerous factors ( including fibronectin and collagen ) in medium conditioned by each of the three msc examined and some , including laminin and decorin , in one or two but not all three of the msc - cm samples . of these ecm components , fibronectin , collagen and laminin are known to promote or support angiogenesis . unusually , in these experiments collagen did not seem to induce any observable cell response when compared to decorin . fibronectin and collagen contain protein motifs are known to mediate angiogenesis by integrin receptor signaling in vivo and in vitro . decorin inhibits endothelial cell migration and tubule formation in vitro and inhibits the pro - angiogenic effects of vegf . lumican interferes with 21 receptor activity and inhibits angiogenesis both in vitro and in vivo . whilst lumican was present in each of the msc - cm used in these investigations , decorin was only found within the msc - cm that consistently showed significantly less enhancement of eahy-926 endothelial cell migration . as the method ( maldi - tof / tof mass spectrometry ) used to detect these protein components within msc - cm was not quantitative , it was not possible to determine whether differences in concentrations of each ecm component were related to efficacy of the conditioned media . msc - cm coating of culture plates enhanced eahy-926 endothelial cell adherence , as did coating with fibronectin . cell adherence to these substrata was examined in an indirect fashion , by assessing the average area of cells in the immediate - early period after seeding . as cells settle upon a permissive substrate they spread out from the rounded morphology observed in suspension to adopt a flattened morphology that is usually seen in vitro in adherent cell populations . after prolonged periods of time , cells in culture , including endothelial cells , synthesize matrix molecules that may also promote cell adhesion , potentially masking the initial effects of the original substrate being investigated . of the matrix proteins detected in msc - cm by maldi - tof / tof mass spectrometry , fibronectin was observed to have a profound effect upon cell adherence , similar to those findings concerning cell migration . however , the addition of msc - cm to endothelial cell scratch assays performed upon fibronectin coated culture plates resulted in a further enhancement of endothelial cell migration , suggesting that fibronectin may not be solely responsible for the entire effect . further experiments investigating the effects of msc secreted growth factors and cytokines individually , and in combination , may reveal their relative contribution to the enhancement of endothelial cell migration . the relatively low number of individual donors examined during this study is a clear limitation , and although the results presented support the conclusions that ( i ) msc donor variation and secretome composition may account for differential effects of mscs on endothelial cells , and ( ii ) that this variation should be taken into consideration in msc - based regenerative medicine , subsequent investigation of greater numbers of samples is required to further authenticate these findings . angiogenesis depends on endothelial cell migration and the actions of endothelial cell chemotactic factors , e.g. vegf and il-8 , and ecm proteins such as collagens , fibronectin and laminin . many of these pro - angiogenic factors have been found to be present within the msc secretome both within this investigation and in previous studies . these experiments have showed that msc - cm enhances both the rate of endothelial cell migration and the adherence of these cells to their culture surface , and that this effect was , in part , mediated by the presence of fibronectin . the effects of msc - cm upon endothelial cell migration were not entirely induced by fibronectin , as suggested by the further enhancement of eahy-926 endothelial cell migration by msc - cm in the presence of exogenous fibronectin . factors such as interleukin ( il)-8 , vegf , and laminin have all been shown to be stimulatory to endothelial cells and these factors have been shown to be present within msc - cm . it seems likely that these known mediators of angiogenesis might contribute to the effects of msc - cm upon eahy926 endothelial cells observed in these investigations . overall , the data presented here support the hypothesis that msc may stimulate the formation of new vasculature , and that this may be an important aspect of msc - mediated enhancement of wound healing .

mesenchymal stem cells ( mscs ) stimulate angiogenesis within a wound environment and this effect is mediated through paracrine interactions with the endothelial cells present . here we report that human msc - conditioned medium ( n=3 donors ) significantly increased eahy-926 endothelial cell adhesion and cell migration , but that this stimulatory effect was markedly donor - dependent . maldi - tof / tof mass spectrometry demonstrated that whilst collagen type i and fibronectin were secreted by all of the msc cultures , the small leucine rich proteoglycan , decorin was secreted only by the msc culture that was least effective upon eahy-926 cells . these individual extracellular matrix components were then tested as culture substrata . eahy-926 cell adherence was greatest on fibronectin - coated surfaces with least adherence on decorin - coated surfaces . scratch wound assays were used to examine cell migration . eahy-926 cell scratch wound closure was quickest on substrates of fibronectin and slowest on decorin . however , eahy-926 cell migration was stimulated by the addition of msc - conditioned medium irrespective of the types of culture substrates . these data suggest that whilst the msc secretome may generally be considered angiogenic , the composition of the secretome is variable and this variation probably contributes to donor - donor differences in activity . hence , screening and optimizing msc secretomes will improve the clinical effectiveness of pro - angiogenic msc - based therapies .

peptide- and protein- hydration is the dominant factor in the stabilization of spatial molecular structure , in the process of protein folding by gating hydrophobic residues , and in the mechanisms of peptide and protein mediated reactions [ 14 ] . water molecules , therefore , can be considered as an integral component of biomolecular systems with dynamic , functional , and structural roles [ 47 ] . investigation of the structural and functional role of water molecules , bound to proteins and peptides , requires a sufficient understanding of the hydration process of their building blocks [ 1 , 2 ] . the hydration of amino acids and their derivatives at a molecular level , therefore , is of great importance and has been extensively studied with x - ray crystallography [ 1 , 3 ] and a variety of spectroscopic techniques including multinuclear magnetic resonance spectroscopy [ 2 , 813 ] , ir and raman spectroscopy [ 1416 ] , icr mass spectrometry , and laser ablation in combination with microwave spectroscopy . we present here , for the first time in the international literature , a comparative investigation of literature d , c , n , and o nmr and crystallographic data in order to provide a coherent hydration model of amino acids and selected derivatives at different ionization states in aqueous solution and in the crystal state . o nmr has received little attention in amino acid and peptide research [ 2 , 12 , 13 , 19 , 20 ] . this neglect is due to the fact that of the three naturally occurring oxygen isotopes , only o possesses a nuclear spin ( i = 5/2 ) . owing to its electric quadrupole moment ( qe = 2.6 10 em ) and , thus , broad line widths , and its low absolute sensitivity compared with that of h ( ~1.1 10 ) , the o- isotope is one of the more difficult to observe by nmr spectroscopy [ 12 , 13 , 21 , 22 ] . o nmr studies , therefore , of compounds at natural abundance require high concentrations ( > 0.1 m ) and extensive signal averaging . recording of spectra can be greatly facilitated by the use of o enriched samples [ 2327 ] . figure 1(a ) illustrates the natural abundance o nmr spectrum of glutamic acid , 0.1 m in o - depleted water at 40c . despite the extensive signal averaging ( number of scans ( ns ) =3 10 ) and the total experimental time of 4.2 hours , the achievable signal - to - noise ( s / n ) ratio is very poor and practically prohibitive for the accurate determination of chemical shifts and line widths . figure 1(b ) illustrates the clear advantages of working with o - labelled glutamic acid ( o enrichment 1 at.% ) . o shieldings of various chemical functional groups are very sensitive for studying hydrogen bonding interactions because of the large chemical shift range of the o nucleus [ 12 , 13 ] . the effect of solvent - induced hydrogen bonding interactions on (o ) of the carboxyl groups is , however , rather small compared with the substantial sensitivity of over 80 ppm to hydrogen bonding interaction of (o ) of amide and carbonyl oxygens [ 12 , 13 ] . only a single o resonance absorption is observed for the carboxylic group since the shifts of the individual resonance absorptions (c = o ) and (oh ) are averaged out by rapid intermolecular proton transfer with protic solvents , traces of h2o , and/or through hydrogen bonding aggregates of the cooh groups in organic solvents [ 12 , 13 , 23 , 24 , 26 , 28 ] . reuben from dilution studies of acetic acid in 1,2-dichloroethane estimated a deshielding effect of ~12 ppm due to breaking of a hydrogen bond involving the carbonyl oxygen of the acid and a shielding effect of 6 ppm due to breaking of a oho hydrogen bond . therefore , a total shift of only + 6 ppm is expected for the monomeric acetic acid in apolar media ( dichloroethane ) compared with the dimeric form . despite the relatively low sensitivity of the o shieldings of the carboxyl group to hydrogen bond interactions , spisni and collaborators attempted to estimate the solvation state of the -carboxyl group of amino acids in the different ionization states . figures 2(a ) and 2(b ) show the dependence of (o ) of l - alanine and l - proline as a function of molar fraction of dmso in the ph range 7 - 8 and 12 - 13 . since dmso can not form a hydrogen bond interaction with the carboxylate group , contrary to the case of h2o , the shielding difference of 1017 ppm between the two solvents was interpreted with the hypothesis that the carboxylate group of these amino acids is hydrated by two water molecules in aqueous solution with one hydrogen bond per carboxylate oxygen . in the acidic ph range ( figures 2(c ) , 2(d ) ) , a nonlinear behaviour of the chemical shift at high dmso molar fractions was observed . for dmso molar fractions up to 0.6 , a linear dependence of the chemical shift was observed which , on extrapolation to 100% dmso , results in a shielding of 1517 ppm , the same as in the neutral ph . this was interpreted with the hypothesis that two hydrogen bonds ( one to each oxygen ) are being ruptured . when the dmso molar fraction is between 0.6 and 0.8 , it was suggested that a third molecule of water , which is hydrogen bonded to the hydroxyl hydrogen , is dissociated due to the interaction with dmso . this might explain the deflection from linearity and the plateau - like dependence of the o shielding . the protonated form , therefore , of the carboxyl group of the amino acids is more hydrated with an access of a bound molecule of h2o than the deprotonated form . this conclusion is in qualitative agreement with multinuclear nmr relaxation data ( see below ) . for quadrupolar nuclei , such as d , n , and o , the longitudinal ( t1 ) and transverse ( t2 ) relaxation times are essentially due to quadrupolar interaction ( 1)1t1=1t2(1+23)2f(,d ) , where is the nuclear quadrupole coupling constant . the asymmetry parameter varies from 0 to 1 and describes the deviation of the electric field gradient from axial symmetry , and f( , d ) is the correlation function , which depends on the rotational diffusion constant d and its relative orientation with respect to the principal axes of the field gradient tensor [ 12 , 13 ] . when isotropic reorientation is assumed , f( , d ) reduces to a single overall correlation time mol which is given by the stokes - debye formula ( 2a)mol = vmkbt , where vm is the molecular volume , the viscosity of the solution , kb the boltzman constant , and t the absolute temperature . vm can be estimated as ( 2b)vm=0.74mwn0 , where n0 is the avogadro 's number and mw and are the molecular weight and the density of the solute ( amino acid ) , respectively . the removal , therefore , of these impurities is necessary in studies of t2 and t1 relaxation times . figure 3 illustrates the ph dependence of the o line widths of 0.1 m glycine in h2o . this o line width minimum has been previously explained by a decrease of the molecular tumbling time attributable to a reduction in hydration and , thus , intermolecular association of glycine in the zwitterionic form . in the high ph region , a broad maximum at ph 11 was observed . addition of 2 mm ethylenediamine - n , n , n,n-tetraacetate ( edta ) to the original solution resulted in no line width variation in the neutral and high ph region . it can , therefore , be concluded that this broad minimum at ph 11 should be attributed to the effect of paramagnetic impurities and not to a hydration change of glycine in the neutral and high ph region . d t1 relaxation times of cd2 of glycine at acidic ph were shown to be shorter relative to those at neutral ph . this shortening in t1 implies an increase in mol and , thus , in the effective molecular weight mw ( ( 1 ) , ( 2a ) , and ( 2b ) ) , which was interpreted with an increase in the hydration state in the cationic form . tritt goc and fiat investigated in detail the viscosity and temperature dependence of the o nmr line width of glycine , alanine , proline , leucine , histidine , and phenylalanine at ph 2 , 7 , and 12.5 . the experimentally observed viscosity / temperature ( /t ) dependence of the reorientation correlation time was compared with various hydrodynamic models . a model of the hydration state in the primary solvation sphere of the carboxylic group of amino acids in their cationic state was suggested in which two water molecules are hydrogen bonded to the oxygens and one to the hydrogen of the oh group . in the zwitterionic and anionic states , the hydration model of the carboxylate group can be presented by a structure in which one water molecule is hydrogen bonded to each of the oxygens . the o [ 10 , 11 ] and n nmr line widths of several protein amino acids were measured in aqueous solution to investigate the effect of molecular weight on the line widths ( table 1 ) . the n and o line widths , under composite proton decoupling , increase with the bulk of the amino acid , and increase at low ph . assuming an isotropic molecular reorientation of a rigid sphere and , thus , a single correlation time from overall molecular reorientation ( mol ) , then , the line width 1/2 can be expressed in the following form : ( 3)1/2=1t2=0+1mw , where mw is the molecular weight , 1 is the contribution to the line width of the quadrupolar coupling constant , density and temperature , ( 1 ) , ( 2a ) , and ( 2b ) , and 0 is the solvent viscosity - independent contributions to the line width due to the primary hydration sphere of the amino acids . the linear correlation between 1/2 and mw at ph 6 for both n and o nuclei ( figure 4 ) is in agreement with the hydrodynamic model of ( 3 ) . furthermore , the (o ) of the amino acid is independent of both the ionization and the degree of hydration of the carboxyl group . the increase in the o line widths at acidic ph ( ~100 31 hz ) , relative to those at neutral ph , was interpreted by a change in the rotational correlation time and , thus , effective mw of the amino acids , ( 3 ) . this implies that the cationic form of the amino acids is more hydrated by an access of 1.3 to 2.5 molecules of water relative to that in the zwitterionic form with lifetimes that are longer than the overall molecular rotational correlation time , presumably 210 ps . in the case of a stochastic diffusion of the amino and carboxyl groups comprising contributions from internal ( int ) and overall ( mol ) motions , the correlation time c for n or o is given by ( 4a)c=mol[a+(b+c)(12/r)intmol+(12/r)int ] with ( 4b)a=34(3cos21)2 , b=3sin2cos2 , c=34sin4,where is the angle between the rotation axis and the main field gradient ( r denotes an r - fold jump mechanism ) . since the sum of a , b , and c is equal to 1 , ( 4a ) can be rewritten as(5a)c=molamol+imol+i , where ( 5b)i = ( 12r)int.equations ( 5a ) and ( 5b ) can be rewritten as ( 6)c=(1a)i+amol(1a)i2mol+i . since a and i can be assumed to be constant for all the amino acids , ( 4a ) and ( 4b ) can be written as ( 7)1/2=0+1mw+2mw+3 , where 03 are constants . the minimization of ( 7 ) on the basis of the o experimental data gave the mean difference of 35.8 17.3 in mw between ph 0.5 and 6.0 for three different 1/2 values : 250 , 350 ( figure 4(b ) ) , and 500 hz . the difference in the n line widths at the two ionization states ( figure 4(a ) ) should be attributed to differences in the correlation times and to a decrease in the (n ) on deprotonation of the carboxyl group . in the case of the linear model , the influence of variations of values of the (n ) to the line width , 1/2 , is less for small molecular weights . therefore , for 1/2 = 70 hz ( figure 4(a ) ) , the difference in mw will be a reasonable approximation of the difference in hydration in the two states . the calculated value was found to be 45.2 7.4 , which corresponds to an excess of 2 - 3 water molecules in the cationic form compared to that in the zwitterionic form , in reasonable agreement with the o nmr data . more recently , takis et al . investigated the cc longitudinal relaxation times ( t1 ) and n line widths ( 1/2 ) of amino acids and acetyl - amino acids in aqueous solutions at acid and neutral ph . both c and n values indicate that amino acids and acetyl - amino acids at acid ph interact with an access of one water molecule with respect to their deprotonated form at neutral ph . on the contrary , c and n values of betaines ( r3nch(r)coo ) crystal structure databases provide a rich source of information to extract details on the architectures and interactions of molecules . this kind of search provides the opportunity to examine the formation of intramolecular and intermolecular hydrogen bond in small molecule crystal structures [ 33 , 34 ] . propensities for the hydration of the -carboxylate group of amino acids and their derivatives were derived on the basis of exhaustive searches in the cambridge crystallographic database ( csd ) . since intermolecular hydrogen bonds are preferred when five- or six - membered conjugated rings are formed , particular attention has been given to the hydrogen bond patterns in the vicinity of the carboxylate group that involves two simultaneous hydrogen acceptors . the concept of five- and six - membered conjugated rings , along with three - center ( bifurcated ) and 4-center ( trifurcated ) hydrogen bonds , has been acknowledged and accepted widely as an important factor in determining the structure and function of molecules ranging from inorganic to organic and biological molecules [ 1 , 3539 ] . furthermore , port and pullman studied theoretically the formate ion - water interaction as a prototype of the carboxylate group . three energetically favourable hydration sites were obtained , two equivalent sites on the carboxylate oxygens at the exterior of the ion and one water bridging the two oxygen atoms . the conquest 1.13 program was used for all the statistical analysis described in this paper . specifically , the csd version 5.32 ( november 2010 ) for small molecules was searched , with the following general search flags : r > 0.5 , , and only organic . in order to extract the number of entries present in the current database that form six - membered conjugated rings between the two oxygens of the -carboxylate and the carboxylic group with a molecule of water in the vicinity , the following geometric cut - offs were used : upper limits d = 3 for ( ow)ho = c and ( ow)ho c , and d = 3.5 for owo = c and owo c 44 hits were obtained for the carboxylate state ( figure 5 ) , whereas only one was derived for the protonated form . figure 5 demonstrates that the oxygen of water , ow , is reasonably close to the carboxylate oxygens and displays a significant preference for the o1c there is a general correlation between hydrogen bond lengths and hydrogen bond angles ( figure 6 ) similar to that observed by jeffrey and maluszynska in the case of water molecules in the hydrates of small biological molecules . furthermore , crystallographic database searches were performed to identify the propensity for the formation of intramolecular hydrogen bond interaction in the carboxylate ( nho ) and the carboxylic acid ( nho = c ) state . interestingly , 946 and 118 hits were retrieved for the carboxylate and 621 and 6 hits for the carboxylic form in the absence and presence of two molecules of water , respectively . it is evident from figure 7 that in the presence of two bound water molecules there is a significant reduction in the number of structures with intramolecular hydrogen bond interaction for the carboxylate group and , concurrently , a significant increase in the distance ( nho ) . it is important to note that no intramolecular nh3ooc hydrogen bonds were observed for 82 amino acid carboxylates with sp - hybridized c - atoms in agreement with an early survey of amino acid structures determined by neutron diffraction . o shielding changes of amino acids as a function of molar fraction of dmso / h2o , the decrease in the longitudinal relaxation times ( t1 ) of c d and c , and the increase in line widths of n and o at acidic ph relative to those at neutral ph may be interpreted with the hypothesis that the cationic form of amino acids is more hydrated by 1 to 3 molecules of water than the zwitterionic form . similar behaviour was also observed for acetylated derivatives of amino acids , but not for betaines , between the protonated and deprotonated carboxyl group . although the precise hydration differences observed for various nuclei deviate somehow , it may be concluded that these hydrated complexes have lifetimes that are shorter than the nmr chemical shift time scale , but presumably longer than the overall molecular rotational correlation time of 210 ps . an exhaustive search in the cambridge crystallographic database ( csd ) demonstrates a strong tendency of the two oxygens of the deprotonated carboxylate group to form hydrogen bonds with a single molecule of water . even though statistical analysis of structural parameters in crystals can not be used in a straightforward way to derive quantitative structural models in solution , it is of interest to note that this mode of six - membered conjugated ring , which is absent in the case of the carboxylic group , might result in a more compact and , thus , less hydrated structure in aqueous solution , in accordance with the nmr data ( figure 8) . furthermore , it may be concluded that the bound molecules of water alleviate the nho interaction and very probably this effect is even more pronounced in aqueous solution . from the above , it is evident that the reduced hydration of the carboxylate group , relative to the carboxylic group , should be attributed mainly to the strong tendency of the carboxylate group to form a six - membered conjugated ring with a single molecule of water . constructively , the tentative models illustrated in figure 8 should be further validated by in silico and experimental approaches . computational methods complement the experimental results by providing information on the microscope and physicochemical details on the interplay between water and the biomolecule of interest [ 4447 ] . for example , introduction of solvent effects into molecular dynamics can provide an atomic description of the folding and unfolding of a protein . furthermore , there is an array of theoretical approaches that have been utilized for treating nmr shieldings in solution , that can be classified as continuum models [ 49 , 50 ] and molecular dynamics simulations . experimental approaches could involve o nmr both in powders and in the crystal state with varying degrees of hydration .

2d , 13c , 14n , and 17o nmr and crystallographic data from the literature were critically evaluated in order to provide a coherent hydration model of amino acids and selected derivatives at different ionization states . 17o shielding variations , longitudinal relaxation times ( t1 ) of 2d and 13c and line widths ( 1/2 ) of 14n and 17o , may be interpreted with the hypothesis that the cationic form of amino acids is more hydrated by 1 to 3 molecules of water than the zwitterionic form . similar behaviour was also observed for n - acetylated derivatives of amino acids . an exhaustive search in crystal structure databases demonstrates the importance of six - membered hydrogen - bonded conjugated rings of both oxygens of the -carboxylate group with a molecule of water in the vicinity . this type of hydrogen bond mode is absent in the case of the carboxylic groups . moreover , a considerable number of structures was identified with the propensity to form intramolecular hydrogen bond both in the carboxylic acid ( nho = c ) and in the carboxylate ( nh o ) ionization state . in the presence of bound molecules of water this interaction is significantly reduced in the case of the carboxylate group whereas it is statistically negligible in the carboxylic group .

recently , there has been a focus on evaluating the association between the nutritional quality of dietary intake and health outcomes . several studies have reported an inverse association between higher diet quality , all - cause , and chronic disease - specific mortality . our recent systematic review demonstrated a significant association between poor diet quality and greater weight gain . a recent study demonstrated , in a nationally representative sample in the united states , that younger adults have poorer diet quality when compared with both children and older adults . the evidence indicates that early adulthood is a high - risk period for weight gain , especially for females [ 4 , 5 ] . for example , the australian longitudinal study on women 's health ( alswh ) data shows that when young women reach their forties , they will be heavier than middle - aged women are now . however , our systematic review found limited studies that have specifically examined the association between diet quality and weight gain amongst young women . greater understanding of the association between diet quality and weight gain among young women may assist with the development of strategies for preventing weight gain during this life stage . in this study we are analysing the relationship between three different approaches of diet quality indices including : index based on the food groups , which is the australian recommended food score ( arfs ) , and nutrients - based approach , the diet quality index ( dqi ) . in addition , we developed a new brief index that , based on consumption frequency and variety of fruits and vegetables items , is called the fruit and vegetables index ( favi ) . this tool can help to reduce the burden to both participants and researchers in terms of measuring diet quality . it can be used to predict weight change and therefore weight gain prevention or treatment interventions . evidence suggests that greater consumption of fruit and vegetables in adults is associated with lower weight gain in longitudinal studies and greater weight reduction in the intervention studies . notably , two studies exploring the association between diet quality and weight gain among middle - aged women have shown mixed results . a longitudinal study , conducted in an american middle - aged population , demonstrated that those who achieved the highest score on the dqi had a smaller weight gain ( 3 pounds ) than those who achieved the lowest dqi score ( 58 pounds ) during eight years of followup . in contrast , we have previously demonstrated that overall diet quality measured using the arfs did not predict weight gain in a sub - sample of middle - aged women from the alswh . therefore , the aim of this study was to investigate the relationship between diet quality and weight gain in young women from the alswh , using three different diet quality indices , arfs , australian - dqi ( aus - dqi ) , and the fruit and vegetable index ( favi ) . alswh recruited women into three cohorts according to age at baseline ( young , middle - aged , and older ) . baseline ( 2003 , aged 27.6 1.5 years ) and the six - year followup ( f / u ) ( 2009 , aged 33.7 1.5 years ) were the two data time points selected for the current analyses . participants were excluded if they had been diagnosed by a doctor as having diabetes , heart disease , or cancer ( excluding skin cancer ) , or if they were currently pregnant . of the 9081 young women at baseline , the response rate at followup totalled n = 8,200 young women , with n = 5856 eligible for inclusion . complete baseline and followup data for weight , diet , and confounders were available for 4,287 women ( figure 1 ) . weight was self - reported at baseline ( 2003 ) and at followup ( 2009 ) , in stones or kilograms ( kg ) to the nearest pound or gram , respectively . weight change ( ) was calculated as the absolute difference ( kg ) in weight at followup from baseline . participants self - reported their frequency of walking , moderate and strenuous physical activity ( pa ) . there are two questions taken from the national health surveys which are validated and show reliability . the questions were used to derive a pa score in metabolic equivalents ( mets ) per minute ( metmins ) at baseline . the total met minutes were calculated as follows : ( 3 minutes walking ) + ( 4.0 minutes moderate activities ) + ( 7.5 minutes vigorous activities ) . the cut points of pa were as follows : nil / sedentary 0 < 40 met minutes / week , low 40 < 600 met minutes / week , moderate 600 < 1200 met minutes / week , and high physical activity 1200 met minutes / week . the highest qualification obtained was self - reported as no formal qualifications , school certificate , higher school certificate , trade / apprenticeship , university degree or higher university degree . numbers of births were classified as : no births , one to two births , and three births . the location of residence definitions used in the alswh dataset are taken from the abs classifications . for this study , each region was classified as : urban ( with 100,000 or more people ) , rural ( with 200999 people ) and remote ( < 200 people ) . participants self - reported smoking status as current smoker , never smoker , or ex - smoker . the study was approved by the university of newcastle and the university of queensland human ethics committees and the current analysis on 13/10/2011 ( eoi a342 ) . baseline self - reported dietary intake was assessed using a food frequency questionnaire ( dietary questionnaire for epidemiological studies version 2 ( dqes v2 ) , cancer council of victoria ) . the dqesv2 has been previously validated [ 1214 ] and assesses intake of 74 food items over the past 12 months . usual consumption frequency of each food item is indicated on a ten - point likert scale , ranging from never up to three or more per day . additional questions assessed the total number of daily serves of fruit , vegetables , bread , dairy products , eggs , fat spreads , and sugar , as well as the type of bread , dairy products , and fat spreads used . nutrient intakes were computed using a food composition database of australian foods ( nuttab 1995 , australian government publishing service , canberra , australia ) and software developed by the cancer council of victoria . the arfs is a food - based index adapted to the australian adult population by collins et al . ( 2008 ) from the original us version of the recommended food score by kant et al . . the arfs ranges from zero to a maximum score of 74 , with a higher score indicating greater diet quality . the seven subscales with different maximum points include vegetables ( 22 points ) , fruits ( 14 points ) , protein foods ( 14 points ) , grains ( 14 points ) , dairy ( seven points ) , fats ( one point ) , and alcohol beverages ( two points ) . each food item is scored as one or zero , with an additional score for food quality . scoring is independent of reported amounts of food , such that items consumed less than once a week scored zero and those consumed once a week or more scored one . more details about the scoring methods and items of the arfs can be found in the supplementary material ( see appendix 1 in supplementary material available online at http://dx.doi.org/10.1155/2013/525161 ) . the dqi was chosen as studies have shown that higher scores on this index are associated with lower weight gain . a longitudinal study , conducted in a middle - aged us population , demonstrated that those who achieved the highest diet quality index ( dqi ) scores had a smaller weight gain ( 3 pounds ) than those who achieved the lowest dqi score ( 58 pounds ) after eight years of followup as part of the adaptation of the us dqi to the aus - dqi , the scoring was adjusted to incorporate the australian nutrient reference values ( aus nrvs ) [ 16 , 17 ] . the original dqi was designed to evaluate adherence to the fourth edition of the dietary guidelines for americans , and each participant achieved one point for each of the following nutrients : total fat ( < 30% kcal ) , saturated fat ( < 10% kcal ) , cholesterol ( < 300 mg / d ) , sodium ( < 2400 mg / d ) , and carbohydrate ( > 50% kcal ) . the aus - dqi was adapted to australian recommendations . however , given that there is currently no australian recommendation for the intake of cholesterol , this subscale was omitted . in the aus - dqi , each participant gets a maximum of one point for each of the four sub - scales : total fat < 35% kj , saturated fat 7% kj , carbohydrate 45% kj , and sodium < 2300 mg / d . these targets were set according to australian and new zealand nutrient reference values . evidence suggests that greater consumption of fruit and vegetables in adults is associated with lower weight gain in longitudinal studies and greater weight reduction among overweight and obese participants in the intervention studies . fruit and vegetable consumption data , derived from the baseline dqesv2 , were used to inform the development of the favi . the favi is divided into two sub - scales : the fruit sub - scale , which contains 13 items , including canned or frozen fruit and fruit juices , and 11 types of fresh fruit , such as oranges , apples , and pears , and the vegetable sub - scale which contains 24 items , including potatoes cooked without fat , tomato , zucchini , mushroom , celery , and beans . consumption frequency of all fruit and vegetable items was scored using the full range of the ffq likert scale from zero to nine , with never 3 times per day scored as nine points . in the favi score zero point are awarded for those who consume no items of fruit and vegetables . one point is awarded for consuming each fruit or vegetable item less than once per month , two points for one to three times per month , and three points for once per week , with an additional point awarded on an increasing scale for each additional frequency response category up to a maximum of nine points for consuming an item three or more times per day . the maximum possible score is 117 for the fruit sub - scale and 216 for the vegetable sub - scale , giving a maximum total favi score of 333 points . a higher favi score indicates a greater variety and frequency of usual fruit and vegetable consumption . results were considered statistically significant if p < 0.05 . weight and macronutrient variables were treated as continuous variables . each dietary quality index was categorised into tertiles based on the distribution of the total number of participants included in the study , to give approximately equal numbers in each tertile . for each diet quality index , multivariate linear regression was used to predict six - year weight change ( 95% confident interval , p value ) . the diet quality index of interest was the independent variable(s ) , with the first tertile being the reference value . to address misreporting and try to identify the subgroup least likely to have under- or over - reported total energy intake ; the ratio of energy intake ( ei ) to basal metabolic rate was calculated . basal metabolic rate ( bmr ) for each woman was calculated using the schofield equations . using the goldberg equations for a moderate physical activity level of 1.55 for this group then a tei of 1.272.1 times bmr can be considered plausible [ 19 , 20 ] . three different regression models were applied to both the total sample and the subsample with plausible total energy intakes : ( 1 ) crude model : unadjusted ; dependent variable = weight ; independent variable = baseline diet quality index of interest . ( 2 ) the second model is adjusted specifically for the most important covariates that were available in the alswh data set , the specifically adjusted model : adjusted for physical activity , education , number of births , location of residence , marital status , smoking , and weight at baseline . ( 3 ) the final model : sought to evaluate the impact of energy intake on the model and included all the co - variates as per model 2 above , but also included total energy intake ( tei ) . all statistical analyses were carried out using stata ( version 11.1 for windows , 2009 , statacorp lp , usa ) . the total number of women included in this analysis , with complete baseline and followup data on weight change and diet , was n = 4,287 . overall , the mean weight change from 2003 to 2009 was + 3.6 1.5 kg . a comparison of diet quality scores and co - variates for those with and without complete data on weight change from 2003 to 2009 indicated that there were no differences in diet quality score , measured by all three indexes : education , pa , and smoking status , p > 0.05 ( data not shown ) . for those who had missing data on ffq there was no significant difference across tertiles of arfs for mean weight change , but there were significant differences in the means of energy intake ( kj / d ) , fibre ( g / d ) , carbohydrate ( % ) , and protein ( % ) intakes total fat ( % ) and saturated fat ( % ) intakes observed across arfs tertiles ( table 2 ) . in the plausible tei sub - sample , the top tertile of arfs had the lower mean weight gain ( 2.9 7.9 ) kg ; however , this was not significantly different compared to the second and lowest tertiles ( 3.4 7.7 kg and 4.0 7.9 kg , resp . ) . the top tertile of arfs had greater total energy intake ( tei ) ( kj / d ) , fibre ( g / d ) , carbohydrate ( % ) and protein ( % ) intakes and lower total fat ( % ) and saturated fat ( % ) intakes compared with other tertiles ( table 2 ) . there was no significant difference in the mean weight change across the aus - dqi tertiles ( table 3 ) . aus - dqi tertile 3 had lower tei ( kj / d ) , fat ( % ) , saturated fat ( % ) , protein ( % ) , and fibre ( g / d ) intakes and higher carbohydrate intakes ( % ) , compared with the other aus - dqi tertiles ( table 3 ) . in the plausible tei sub - sample , there was no significant difference in weight changes between tertiles of aus - dqi . there were significant differences in means of carbohydrate ( % ) , fiber ( g / d ) , energy intake ( kj / d ) , total fat ( % ) , saturated fat ( % ) , and protein ( % ) intakes . there was a significant difference in mean weight change across the favi tertiles ( p = 0.003 ) , with the third tertile of favi gaining the least amount of weight during the six years of followup compared with the other tertiles ( table 4 ) . the intakes of fat ( % ) and saturated fat ( % ) were significantly lower , while tei , protein ( % ) , carbohydrate ( % ) , and fibre ( g / d ) intakes were significantly higher in the third favi tertile . in the plausible tei sub - sample , those in the lower tertile of favi had significantly greater weight gain than those in the second and the top tertiles of arfs ( table 4 ) . in the plausible tei , the top tertile of favi had lower total fat ( % ) and saturated fat ( % ) but greater intakes of carbohydrate ( % ) , fiber ( g / d ) . there were no significant differences between tei and protein intake across favi tertiles . in the plausible tei sub - sample , only those in the top tertile of the arfs had significantly less weight gain ( 1.6 kg ) compared with those in the lower tertile of the arfs . in the fully adjusted model , those who were in the top tertile of the arfs had significantly lower weight gain compared with the lower tertile for the plausible tei sub - sample , ( = 1.6 , ci : 2.67 to 0.56 , p = 0.003 ) . baseline favi was a statistically significant negative predictor of weight gain in this group of young women , while arfs and aus - dqi were not statistically significant predictors of weight change ( table 5 ) . compared with the first tertile of favi , women in the third tertile had the lowest weight gain over six years ( = 0.72 , ci : 1.4 to 0.03 , p = 0.04 ) in the fully adjusted model . in the plausible tei sub - sample , we found that those in the second and third tertiles of favi had significantly less weight gain compared with the first tertile . more specifically , we found that , in the fully adjustmed model , those who were in the top tertile of favi gained the lowest weight compared with other tertiles ( = 1.6 , ci : 2.4 to 0.3 , p = 0.01 ) . the second tertile of favi : ( = 1.5 , ci : 2.4 to 0.2 , p = 0.02 ) , also had lower weight gain than the first tertile . the current study tested three different diet quality indices as predictors of weight change over the subsequent six - year period in a cohort of young women participating in the alswh . it demonstrated that higher scores on either a food variety and frequency index ( arfs ) or an index based on fruit and vegetable variety and frequency alone ( favi ) , predicted lower six - year weight gain in this group of women . in the whole sample the arfs showed no relationship with prospective weight gain , while the aus - dqi showed no relationship in either the whole or the plausible tei sub - sample . the main findings of this study support the role of increased fruit and vegetable consumption as a key strategy to prevent weight gain , particularly for young women . vioque et al . found that those in the highest quartile of vegetable and fruit consumption ( > 698 g / d ) at baseline , as assessed by a ffq , had a reduced risk of weight gain ( 3.41 kg ) compared with those who were in the lowest quartile of vegetable and fruit consumption during 10 years of followup ( or 0.22 , 95% ci 0.06 to 0.81 , p trend = 0.022 ) . another prospective study conducted by kahn et al . ( 1997 ) in 79,236 healthy white non - hispanic american adults found that greater consumption of vegetables ( highest quintile ) was associated with a smaller gain in bmi over 10 years of followup ( = 0.12 ; p = 0.09 , 0.012 ) for women and men , respectively . a systematic review of experimental studies supports increasing fruits and vegetables to support weight management . a randomised controlled trial in 97 obese adults aimed to assess the effect of two approaches to weight loss , a decreased dietary fat intake , or an increased intake of fruit and vegetables plus decreased dietary fat intake over one year ( both groups reduced fat by the same amount ) . the main finding demonstrated that those who increased their consumption of fruit and vegetables and decreased dietary fat achieved significantly greater weight loss , 7.9 0.9 kg compared with 6.4 0.9 kg for the other group . a trial carried out in brazil in 80 overweight people found that those who increased their fruit and vegetable intakes by 100 g / d experienced lower weight gain ( 300 g cf . 550 g ) over six months compared with those who did not change their intakes for fruits and vegetables . in the whole sample , we found that higher tei was associated with the highest favi score . however , we also found that higher favi scores were associated with the lowest weight gain . however , in the plausible tei sub - sample , there was no significant difference between tei across the tertiles of favi , as shown in table 4 . one possible explanation for this is that there are only a limited number of energy - dense , nutrient - poor foods in the ffq , meaning that tei from these items may not be well captured . those with a lower tei may have higher energy intakes from these non - ffq items . although the arfs and favi were strongly positively correlated with each other ; the arfs in the full sample did not predict weight gain , while favi did in both the whole and plausible energy intake samples . this suggests that neither the arfs nor the favi captures the association between foods that are energy dense , nutrient poor , and weight change . in the current study , the focus was to examine the association between the healthful , nutrient - dense food items , and weight change . higher diet quality index scores have been shown in a review to predict the risk of future morbidity and mortality . the aus - dqi failed to predict weight gain during the followup period in this sample of young women , even though it incorporates sub - scales for the percentage energy from total fat , saturated fat and carbohydrate intakes , and total sodium intake . the limited scoring scale and that it had not been previously validated limit the interpretation of this result . this also may be due to the limited list of energy - dense , nutrient - poor foods , particularly soda , and other sweetened beverages within the dqes which is to be expected given that it was developed more than 20 years ago . thus , an assumption and limitation are that tei may be partly underestimated due to the items in the ffq . in the whole population , we found that the lowest intake of fiber across the aus - dqi tertiles was for the top tertile , or highest diet quality scores . among those women with plausible tei however , we found that the highest aus - dqi tertile was associated with higher intakes of fiber . this difference is likely due to misreporting of tei and we expect that the results in the plausible tei sub - sample are more likely to be more accurate . the alswh cohort is a representative sample of the population of australian women , and the weight change data from the current study indicate that weight gain is common among young women . the mean diet quality score in the highest tertile of each index was not high , indicating that interventions seeking to optimise diet quality in this age group are warranted as has been suggested previously [ 2628 ] . in addition , a recent systematic review has highlighted that intervention studies specifically targeting body weight are needed to prevent the development of overweight and obesity in this age group . this includes that there are a large number of women with missing data on weight or dietary intake at baseline and follow - up . furthermore , a limitation that needs to be acknowledged is loss to follow up . in the alswh study , attrition is the most common in participants with a lower education , those not born in australia and those with poorer health or who smoke . the potential impact of this attrition is that there may be selective loss of those whose weight change is greater and/or have poorer dietary intake than in those who have been retained . this potentially underestimates the ability of diet quality indexes to detect a relationship between dietary patterns and weight change . in addition , dietary intake was only measured once over this time period , and we are therefore not able to evaluate how or whether the women changed their eating habits over time . furthermore , all data were self - reported including weight which introduces a potential reporting bias . a previous validation study of self - reported weight on mid - aged women from the alswh demonstrated that there was no clinical difference between self - reported weight and measured body weight . while a similar validation has not been done for the young cohort of the alswh , it might be expected to give similar results . another limitation that must be considered is that the aus - dqi was not validated but was adapted from the original usa dqi which was based on american nrvs not australian nrv 's . as a consequence the strengths of this study include the use of a healthy representative sub - sample derived from alswh population , with an adequate followup period . in addition , we used appropriate and rigorous statistical analyses and three different approaches to the measurement of diet quality to reflect the national dietary guidelines for australia , including two based on established methods and one new index based only on fruit and vegetable intakes . this new tool provides a simple approach to diet quality assessment and successfully predicted weight change in this cohort of young women . further research evaluating and validating the performance of favi in other age and gender groups is warranted . frequency and variety of fruit and vegetable intakes , and overall diet quality predicted weight gain over six years in this healthy population group of young women . strategies to encourage young women to more frequently consume a greater variety of fruit , and vegetables are required and may assist to prevent weight gain in this age group .

this study investigates the relationship between diet quality and weight gain in young women . young women ( n = 4,287 , with 1,356 women identified as plausible subsample aged 27.6 1.5 years at baseline ) sampled from the australian longitudinal study on women 's health study completed food frequency questionnaires in 2003 , which were used to evaluate diet quality using three indices : australian recommended food score ( arfs ) , australian diet quality index ( aus - dqi ) , and fruit and vegetable index ( favi ) . weight was self - reported in 2003 and 2009 . multivariate linear regression was used to examine the association between tertiles of each diet quality index and weight change from 2003 to 2009 . the arfs and favi were significant predictors of 6-year weight change in this group of young women , while aus - dqi did not predict weight change ( p > 0.05 ) . in the fully adjusted model , those who were in the top tertile of the arfs significantly gained lower weight gain compared with the lower tertile for the plausible tei sub - sample ( = 1.6 kg ( 95% ci : 2.67 to 0.56 ) , p = 0.003 ) . in the fully adjustment model , young women were classified in the highest favi tertile and gained significantly less weight than those in the lowest tertile for the plausible tei ( = 1.6 kg ( 95% ci : 2.4 to 0.3 ) p = 0.01 ) . in conclusion , overall diet quality measured by the arfs and the frequency and variety of fruit and vegetable consumption may predict long - term weight gain in young women . therefore , health promotion programs encouraging frequent consumption of a wide variety of fruits and vegetables are warranted .

measurement is one of the cornerstones of the scientific research ( 1 ) . in the health studies , the best and most important indicators for measurement are the quality and quantity of provided services for the patients as well as their satisfaction of received services ( 2 ) . patients ' satisfaction , which is a key indicator of quality in the healthcare organizations ( 3 ) , is the responses of the patients receiving the services to the provided services and reflects their overall perceptions of service quality ( 4 ) . in addition , increasing patients ' satisfaction is important because it can ensure the patient participation in the care and services ( 5 ) . therefore , the healthcare organizations need to develop and implement quality improvement plans for their survival and success . measuring quality in the healthcare competitive environment is an undeniable necessity for these organizations , which will improve patient satisfaction ( 6 , 7 ) . high quality of the health sectors and their services is also considered as a desirable goal from the viewpoints of health planners and policymakers because healthy people in any society provide the opportunity for its economic development ( 8 - 10 ) . service quality is a strategic factor for healthcare organizations ' productivity and is considered as a competitive advantage that should be continuously measured and improved ( 11 ) . when customers have a good understanding of the quality of health services , they will probably attend the hospital again in the future , if needed , and suggest it to their family and friends ( 11 ) . thus , healthcare has a special place among other services because of its risky and precarious nature and therefore , the lack of patients ' awareness of received services should be evaluated ( 12 ) . generally , measuring the quality of services in the health sector service quality in health has a multi - dimensional structure ( 10 , 13 ) , which was measured in the traditional approach using some objective indicators such as mortality and morbidity rates . although these indicators are essential tools for assessing and evaluating the quality of clinical services , nowadays it is common to use more subjective assessments and indicators . it can be said that the field of healthcare is moving from providing services to evaluating the quality of services and consequently , the patients ' role in defining the quality of services becomes evident more than ever ( 14 ) . it has led to the increasing uses and high acceptance of the measurement of service quality from the viewpoint of patients ( 15 - 17 ) . in addition to relying on economic criteria to maintain and improve the quality of health services , managers can use customers ' expectations and perceptions as an important tool to determine the healthcare system 's weaknesses ( 18 ) . as a result , service providers are trying to apply client - centered assessment tools ( 19 ) . there are different measurement models for assessing the quality of services , including kano , fornel and scamper , the european foundation for quality management ( efqm ) , and servqual ( 20 ) . in the present study , the servqual model , introduced in the mid-1980s by parasuraman et al . this instrument measures the customers ' perceptions and expectations of services in five dimensions , including tangibility , reliability , responsiveness , assurance , and empathy . several studies have been conducted using servqual model , including studies by al - borie and damanhouri ( 22 ) , camgz - akdag et al . . chronic kidney disease ( ckd ) endangers physical health as well as other aspects of health . therefore , making accurate and comprehensive plans for the rehabilitation of patients affected by ckd is inevitable ( 30 ) . however , this disease is a global public health concern ( 31 , 32 ) and the number of patients with the ckd is increasing worldwide . this disease treatment is very costly , especially in developing countries , and these patients are forced to use hemodialysis ( hd ) . they usually receive hd services two to three times a week , and three to four hours in each session . measuring the quality of services among patients on hd is of paramount importance and can offer appropriate opportunities for improving provided services for these patients . therefore , it is essential to continuously measure and improve the quality of provided services for this group of patients who spend long hours in hd centers . the present study aimed to measure the quality of provided services for patients with ckd in kerman in 2014 . this cross - sectional descriptive - analytic study was conducted from 23 january 2014 to 14 february 2014 in all four hd centers affiliated to kerman university of medical sciences , including two general hospitals ( afzalipour and shafa ) , javad - ol - aeme specialty clinic , and samen - ol - hojaj charity ( a specific patient treatment center ) . all of patients on chronic hd ( n = 195 ) who were referred to these centers were selected and studied using census method . patients in all studied centers were admitted for hd in two shifts of six days a week , morning shifts from 9 a.m. to midday and afternoon shifts from 3 p.m. to 6 p.m. ; one patient was being admitted per each dialysis bed in each shift . among the studied patients , 11 patients refused to participate in the study . the frequency of performing hd for referred patients was three times a week each of which took four hours . all of studied patients had attended for hd at least 15 times and therefore , they were completely familiar with the centers and its staff . the required data were collected using the standard questionnaire of servqual model ( 21 ) , consisting of two parts . the first part included questions regarding the patients ' demographic characteristics such as age , sex , marital status , education level , income level , and duration of dialysis . the second part included 28 items to measure the patients ' expectations and perceptions of the five dimensions of service quality as follows : tangibility ( 6 items ) ; the conditions and physical space of the service delivery environment , including equipment , having adorned and groomed staff , furniture , toilets , and bathrooms , payment process , cleanliness and quality of the materials used in the treatment , and the existence of car parking . reliability ( 8 items ) ; the ability to provide the committed services dependably and accurately through providing treatment at the predetermined time , listening to the patients ' expectations , clear nurses ' descriptions of the provided services , disease prevention and the treatment processes , the explanation of the treatment processes , proper maintenance of patients ' records , the lack of duplication , and the effectiveness of services . responsiveness ( 6 items ) ; the willingness to help customers through decreasing admission time , quick and easy process of providing services , attracting patients ' trust , employees ' accountability to arranging an appointment for hd , clear physicians ' descriptions of patient 's disease , and employees ' willingness to response to the patients . assurance ( 4 items ) ; ability to serve reliably through having polite employees and respecting patients ' privacy , employees ' awareness of the new medical techniques , ensuring the medical staff 's skills , and the center reputation from the patients ' viewpoints . empathy ( 4 items ) ; the provision of caring , individualized attention to customers through small time interval between admission and the start of dialysis , listening to the patients ' comments and ideas , nurses ' attention to the patients ' needs , and paying attention to the patients ' financial costs ( 33 ) . a five - point likert scale was used to measure the patients ' expectations and perceptions of service quality whereby one referred to very poor and five to excellent . considering the nature of the dialysis centers and their services , it was necessary to make minor changes to the questionnaire . after making those changes , the validity of the questionnaire was approved through getting the opinions of ten faculty members , including four nephrologists , four nurses and two experts in health services management . in addition , the reliability of the questionnaire was confirmed using the inter - item consistency scores ( = 0.77 and = 0.70 for patients ' expectations and perceptions , respectively ) . in the expectations section , patients answered to the questions about the ideal or desirable status of services and in the perception section , they answered to the questions about the current status of services . to determine the quality gap , the scores of patients ' perceptions of the quality of services provided were compared with the scores of patients ' expectations of service quality . if the difference between the patients ' perceptions and expectations was positive , it would indicate that the provided services for the patients had been more than their expectations and if it was negative , it would indicate that the provided services for the patients had not meet their expectations . finally , if there was not any difference between the patients ' perceptions and expectations , it would indicate that the provided services was at the level of patients ' expectations , i.e. the provided services were at the level of patients ' expectations . an approval for conducting this study was received from the ethic committee of kerman university of medical sciences . the verbal consent was obtained from all participants and all of them were assured of the confidentiality of their responses . moreover , the collected data were analyzed using spss 21.0 ( ibm corporation , armonk , ny , usa ) through some statistical tests , including independent - samples t test , one - way anova , and paired - samples t test . the results showed that 109 patients were male ( 59.2% ) , 117 ( 63.6% ) were married , 112 ( 60.9% ) were older than 40 years , 61 ( 33.2% ) were illiterate , 83 ( 45.1% ) were unemployed , 122 ( 66.3% ) had sufficient income for hd , and 70 ( 38% ) had been treated with hd for one to three years ( table 1 ) . furthermore , the results showed that the means of patients ' expectations were more than the current status and their perceptions of the quality of provided services in all dimensions of service quality . in addition , the highest and the lowest means of the patients ' perception dimensions were respectively related to assurance ( 4.30 0.36 ) and empathy ( 3.84 0.34 ) . the highest and the lowest means of the patients ' expectations dimensions were related to assurance ( 4.72 0.27 ) and tangibility ( 4.30 0.35 ) , respectively . after computing the differences between the means of expectations ( ideal status ) and the perceptions ( the current status ) , the results revealed that there were gaps in all dimensions . the highest and lowest means of negative gaps were related to empathy ( -0.52 0.48 ) and tangibility ( -0.29 0.51 ) . the differences between the patients ' perceptions and expectations ( gaps ) in all five dimensions of hd services quality were statistically significant ( p > 0.001 ) ( table 2 ) . in addition , among the patients ' demographic characteristics and the five dimensions of service quality , only the difference between the patients ' income levels and the gap in assurance was statistically significant ( p < 0.001 ) ; in other words , the decrease in the income levels resulted in the significant decrease in the absolute values of gap means ( table 3 ) . measuring the quantity and quality of provided services to identify their weaknesses is one of the most important and most effective strategies of healthcare managers to improve the quality of services . in addition , due to the effects of services quality on the patients ' satisfaction , quality measurement from their viewpoints is considered as an important indicator ( 16 , 17 ) . accordingly , the present study aimed to measure the quality of provided services for patients with ckd , who were referred to all four hd centers in kerman , using the servqual instrument . the results of the present study showed that patients ' expectations were more than the current status of the provided services in all dimensions . in addition , there were negative gaps and statistically significant differences between the means of patients ' expectations and their perceptions ( gap ) in all five dimensions of hd service quality , indicating that the patients ' expectations in all five studied dimensions were more than their perceptions of the current status of provided services . although there were gaps between patients ' expectations and perceptions of services , these gaps were not very large , indicating that the studied centers had paid special attention to the quality of provided services and overall , the level of services was acceptable . however , they should make efforts to reach an optimal level . butt and de run ( 34 ) , lin et al . ( 35 ) , bakar et al . ( 37 ) concluded that there were negative gaps between patients ' perceptions and expectations in all dimensions of service quality , which were in agreement with the results of the present study . the results of the mentioned studies indicate that the provided services in the studied hospitals and centers had not been consistent with the patients ' expectations and their managers should do proper planning and priority setting for improving all dimensions of services quality . therefore , hearing the voice of customers is an important tool in modern organizations management and the studied hospital managers should re - engineer the processes and use the improvement techniques with regard to the patients ' feedback and comments . in the present study and among the available gaps in the studied dimensions of quality , as mentioned above , the tangibility had the smallest gap indicating that the studied centers had a clean environment , adorned and groomed staff , adequate physical resources and facilities such as furniture , toilets , and bathrooms , car parking , and modern and updated technologies and equipment , all of which had led to greater patients ' satisfaction in this dimension than other dimensions . however , because the hospital physical environment plays an important role in improving the service quality and patients ' evaluations of service quality , attractive environment and appropriate hospital hoteling services are considered as one of the most important reasons for referring patients to a hospital ( 33 , 38 ) . therefore , hospital managers should provide more amenities and facilities based on the patients ' needs in order to decrease the gap between patients ' perceptions and expectations in the tangibility admission . lee and yom found that tangibility had the smallest gap , which was in accordance with our results ( 11 ) . in contrast to our results , zarei et al . reported the largest and smallest gaps in the tangibility and empathy dimensions , respectively ( 39 ) . furthermore , the largest negative gap was in the empathy , indicating that service providers did not have enough attention to the patients ' views and comments and did not apply their opinions and comments in their planning and programs . it seems that the high volume of work in the hd wards and downplaying the proper patient - physician relationships had led to physicians low opportunities to express their empathy , listen to , and understand the patients ' opinions and comments . moreover , the large gap in the empathy could be due to physicians , nurses and employees ' poor communication with patients . efforts in this area should , also be made to improve staff behavior and communication with patients . unlike the results of jabnoun and chaker ( 40 ) , the results of huang and li 's study ( 41 ) were similar to our results . because the services are inherently untouchable , interpersonal interaction during the process of service delivery has an important effect on the patients ' perceptions of service quality . in addition , the results of several studies have shown that human factors have greater effect on the patients ' perceptions of the quality of services than non - human factors , and interpersonal interaction and relationship is one of the most important factors affecting the patients ' perceptions of service quality ( 42 - 44 ) . therefore , physicians and staff should recognize and pay attention to the patients ' social and emotional needs and wants and should be available for patients when needed . a gap in one dimension can have synergistic effect on other dimensions of service quality and lead to the decrease in those dimensions ( 45 ) . therefore , in addition to focusing on dimensions with the largest gap , managers and service providers should consider the improvement of other dimensions . in the present study , the means of service quality dimensions did not have significant associations with sex , age , and marital status . some of the previous studies have reported higher expectations in women than in men ( 35 , 46 ) , which was inconsistent with our results . in the current study , there was no significant association between the means of service quality dimensions and the patients ' education levels ; however , the gap in the patients with academic and university education and degrees was larger than that in the illiterate patients . it seems that the patients ' expectations had become more reasonable by increasing their education level , and their expectations had been decreased by increasing their knowledge and awareness of treatment processes . ( 36 ) showed that the expectations of patients with academic and university education and degrees were higher than that of other patients . in other service quality dimensions , except for reliability , the expectations of patients with sufficient income levels were higher than expectations of patients with insufficient income levels . one explanation might be that the paid hospital costs by the patients with sufficient income levels did not put any considerable pressure on their economic conditions ; hence , they expected the hospitals to meet their expectations completely . ( 36 ) found that the uninsured patients were less satisfied with the quality of hospital services compared with the insured patients . one of the limitations of the present study was using only patients ' perspectives to determine the quality of provided services . it is essential to investigate the viewpoints of physicians , nurses , and other employees on the service quality because most of patients are not fully aware of the treatment processes . another limitation of the present study was using a questionnaire to determine the patients ' perceptions and expectations . although servqual questionnaire is valid and reliable , the researchers can not investigate all dimensions of the service quality using only a questionnaire ; in that regard , some qualitative studies should also be performed . overall , the results of the present study showed that the expectations of patients on hd were higher than their perceptions and the level of provided services . the healthcare providers and employees should pay more attention to the patients ' opinions and comments and use their feedback and suggestions in order to solve the workplace problems and improve the quality of provided services . moreover , training the health staff to meet the patients ' emotional needs and expectations is recommended . one of the limitations of the present study was using only patients ' perspectives to determine the quality of provided services . it is essential to investigate the viewpoints of physicians , nurses , and other employees on the service quality because most of patients are not fully aware of the treatment processes . another limitation of the present study was using a questionnaire to determine the patients ' perceptions and expectations . although servqual questionnaire is valid and reliable , the researchers can not investigate all dimensions of the service quality using only a questionnaire ; in that regard , some qualitative studies should also be performed . overall , the results of the present study showed that the expectations of patients on hd were higher than their perceptions and the level of provided services . the healthcare providers and employees should pay more attention to the patients ' opinions and comments and use their feedback and suggestions in order to solve the workplace problems and improve the quality of provided services . moreover , training the health staff to meet the patients ' emotional needs and expectations is recommended .

background : the healthcare organizations need to develop and implement quality improvement plans for their survival and success . measuring quality in the healthcare competitive environment is an undeniable necessity for these organizations and will lead to improved patient satisfaction.objectives:this study aimed to measure the quality of provided services for patients with chronic kidney disease in kerman in 2014.patients and methods : this cross - sectional , descriptive - analytic study was performed from 23 january 2014 to 14 february 2014 in four hemodialysis centers in kerman . all of the patients on chronic hemodialysis ( n = 195 ) who were referred to these four centers were selected and studied using census method . the required data were collected using the servqual questionnaire , consisting of two parts : questions related to the patients ' demographic characteristics , and 28 items to measure the patients ' expectations and perceptions of the five dimensions of service quality , including tangibility , reliability , responsiveness , assurance , and empathy . the collected data were analyzed using spss 21.0 through some statistical tests , including independent - samples t test , one - way anova , and paired - samples t test.results:the results showed that the means of patients ' expectations were more than their perceptions of the quality of provided services in all dimensions , which indicated that there were gaps in all dimensions . the highest and lowest means of negative gaps were related to empathy ( -0.52 0.48 ) and tangibility ( -0.29 0.51 ) . in addition , among the studied patients ' demographic characteristics and the five dimensions of service quality , only the difference between the patients ' income levels and the gap in assurance were statistically significant ( p < 0.001).conclusions : overall , the results of the present study showed that the expectations of patients on hemodialysis were more than their perceptions of provided services . the healthcare providers and employees should pay more attention to the patients ' opinions and comments and use their feedback to solve the workplace problems and improve the quality of provided services . in addition , training the health staff to meet the patients ' emotional needs and expectations is suggested .

privacy is an individual right , which covers situations related to the intimacy of each person , to respect for dignity , and to family and social relationships . when hospitalized , people find themselves in a situation of extreme fragility , in which they often need care that invades their intimacy . being ill generates some feelings , such as incapacity , dependency , insecurity , and a feeling of loss of control over oneself . patients face hospitalization as a depersonalization factor , since they recognize the difficulty in maintaining their identity , intimacy , and privacy . observing the practice of care , a lack of concern regarding body exposure is noted in many situations , along with little preoccupation with the patient s modesty . this person , who should be perceived as the subject of care , becomes an object , losing his / her identity . ethical and technical aspects should always be observed by the players involved in patient care . the situation of exposure of the patient s body at the time of medical care has been reported as a moment of potential breach of a patient s privacy . however , healthcare professionals should be attentive to one more action which can compromise the patient s dignity : the registration of images . the use of the cell phone with photographic camera by many healthcare professionals has facilitated the capture and reproduction of images of patients with a compromise of the level of consciousness . particularly in the emergency scenario , filming raises specific ethical issues , since the patients are often vulnerable , many times without the capacity to consent , or they feel under pressure to give their consent . one international study analyzed the commercialization of images of medical care in the hospital settings . as a result , it was shown that many times filming violated the privacy of patients , which generally could be avoided with the adequate consent from the individual . we point out , however , that patients could feel obligated or compelled by the person who was in command of his / her care and well - being . in brazil , the legislation is very clear as to the right to images . according to the federal constitution of 1988 , article 5 , item x , intimacy , private life , honor , and the image of persons are inviolable , assuring the right to compensation for the material or moral damage resulting from its violation . although the federal constitution and some professional boards prohibit making and/or using images of patients without their consent , within the hospital setting this is still a frequent practice on the part of some professionals . in times when technology is highly popularized , and when most professionals have cell phones with photographic cameras , the capture and reproduction of patient images are facilitated . it is believed that the evaluation of knowledge of the healthcare professionals as to the rights of images and privacy of the patient is important , since it generates a basis for conducting educational interventions on the theme . to evaluate the knowledge of healthcare professionals as to the capture and reproduction of patient images within a hospital environment . this is an observational and cross - section study , carried out at the teaching hospital of the universidade federal de so paulo , in the city of so paulo ( sp ) , during the period from february 2013 to july 2013 . the study sample was made up of nurses , licensed practical nursing and nursing technicians , medical residents , and physical therapists that performed their activities in the hospital environment . based on the estimate of a population proportion of 2,590 professionals , the formula for determination of sample size of 335 individuals was used , with a confidence interval of 95% and sample error of 5% . a subject characterization questionnaire was used with the purpose of investigating some sociodemographic aspects ( sex , age , profession , time of professional experience , type of professional bond , and unit where they worked ) and those related to capture and reproduction of images within the hospital setting . data collection was carried out during the period of february to july , 2013 . before the collection , the informed consent form was presented to the study participants , and upon their agreement to participate in the research , they were presented with the data collection instruments . the data were presented by means of descriptive statistics . to compose the variables of interest , the test was used , and when this was not appropriate , the likelihood ratio was used . the project was approved by the research ethics committee of the universidade federal de so paulo , under caae number 09250112.2.0000.5505 . of the 360 healthcare professionals interviewed , there was a 72.8% predominance of females , 89.7% were aged 40 years , 31.4% were nurses , 36.7% reported a professional experience time of 1 to 3 years , 43.9% ( n=158 ) were residents , and regarding the place of work in the hospital , 43.0% worked at inpatients units . most participants ( 81.3% ) declared that they had witnessed other healthcare professional making images of patients , 9.7% of which had seen this once , 23.3% from two to four times , 48.3% more than four times , 5.3% reported not remembering , and 13.3% were not witnesses . when asked if the professional had photographed or filmed patients over the previous year , 57.8% answered yes , and 71.1% declared they had not photographed or filmed anyone who was unconscious . among the professionals who responded positively as to having captured images ( n=147 ) , most reported having requested verbal authorization ( 61.2% ) and the minority requested written authorization ( 10.9% ) ( table 1 ) . table 1aspects of the authorization to make images ( n=147)questionsauthorization to make images total n ( % ) yesnonot enough timedoes not remembern ( % ) n ( % ) n ( % ) n ( % ) 1 . did you request verbal authorization from the patient or guardian to make these images?90 ( 61.2)34 ( 23.1)11 ( 7.5)12 ( 8.2)147 ( 100)2 . did you request written authorization from the patient or guardian to make these images?16 ( 10.9)109 ( 74.2)14 ( 9.5)8 ( 5.4)147 ( 100)3 . did you confirm the existence in the medical records of authorization from the patient or guardian for capturing images?10 ( 6.8)115 ( 78.2)9 ( 6.1)13 ( 8.8)147 ( 100 ) in questioning if they considered it important to request authorization from the patient to capture the images , 90% ( n=324 ) responded yes , and 8.8% ( n=32 ) responded yes , but that frequently there was not enough time to request it . when the participant was questioned as to if they thought making images of a person without their prior authorization had legal implications , 97.5% ( n=351 ) responded yes . of the 147 participants that affirmed having made images , 41.5% ( n=61 ) used them for the presentation of clinical cases and studies , 12.2% ( n=18 ) showed friends and relatives outside of work , and 0.7% ( n=1 ) published them on social networks . the results as to knowledge of the professionals on capturing images demonstrated that most professionals knew of the prohibition of making images ( 97.5% ) and of the need to preserve the individual s image ( 98.1% ) ( table 2 ) . table 2aspects as to the preservation of the image and legal implications ( n=360)questionsknowledge of professionals total n ( % ) yesnoi do not known ( % ) n ( % ) n ( % ) 1 . do you think that making images of a person without prior authorization has legal implications?351 ( 97.5)3 ( 0.8)6 ( 1.7)360 ( 100)2 . do you think that the individual s image should be preserved?353 ( 98.1)4 ( 1.1)3 ( 0.8)360 ( 100)3 . in the brazilian federal constitution , civil code , and penal code do you know about any item that provides for the capture and use of the images of persons?126 ( 35.0)168 ( 46.7)66 ( 18.3)360 ( 100)4 . in the code of ethics of your profession , do you know about any legislation that provides for the capture and use of images of patients?167 ( 46.4)116 ( 32.2)77 ( 21.4)360 ( 100 ) in making the association of sociodemographic variables with taking images , the test was used , which showed that the male professionals made more images / films ( p=0.0058 ) , and in the age group 41 years , a significant number of professionals had not made images ( p=0.000 ) . in order to obtain the list of the professional category with the number of individuals who captured images , the test was also used , which demonstrated that in the category of nursing technicians / licensed practical nursing , there was a significantly greater number of individuals who did not photograph / film patients relative to the other professionals ( p=0.0000 ) . additionally , the same statistical test revealed that professionals with an experience of more than 5 years photographed / filmed significantly less relative to the employees with less time of experience ( p=0.0022 ) . as to a bond , medical residents photographed / filmed significantly more relative to those with other bonds ( p=0.0287 ) ( table 3 ) . table 3association between sociodemographic characteristics and making patient s images ( n=360)variablefrequency totalp valueonce2 - 4 times>4 timesi do not rememberi did not film and i did not photographsex * 0.0058male882935098female2736347158262 total35446310208360 age , years * 0.000040354361101743234101203437 total35446310208360 profession * 0.0000nurse121817165113nursing technician / licensed practical nursing936489111physician9163033795physical therapist571021741 total35446310208360 time of professional experience , years * 0.0022<1469342641 - 31426333561323 - 556612543>512615385121 total35446310208360 bond * 0.0287[employed under ] clt131119476123resident142836476158specializing112149approved in public contest74615270 total35446310208360 * test . clt : consolidated labor laws . as to knowledge of any item in the brazilian federal constitution , civil code , and penal code as to the capture of images of persons currently , technology has given great support to the work of healthcare professionals . nevertheless , the fact that the majority of healthcare professionals has access to new technologies , such as cell phones with photographic cameras , has created a new ethical confrontation in healthcare organizations , since situations experienced by the patients are easily captured and reproduced , with rare obtaining of prior consent from the patient . patients should have a chance to give or not give their consent for making of images . this should be documented in a way that fulfills the recommendations of the code of ethics and of the patient s data and confidentiality protection . once the subject photographed authorizes the use of the image , it is important to observe that the consent should be interpreted restrictively , since acceptance to be photographed may not include its publication ; in the same way , the agreement for publication does not include other uses . in this study , as well as in the similar study result the institute of medical illustrators published , in 2006 , a manual on obtaining consent for images of patients , which emphasizes that obtaining consent is the responsibility of the professional . this term should have specified the purpose of the images , so that the patient may agree or not agree with its use . it is a common practice to offer three levels of authorization : for use only in the medical records ; for use in teaching healthcare professionals and students ; for publication and public domain . good practices indicate that the consent for publication should only be obtained for one specific use ; it is not a comprehensive release . if the publication is in a journal , book , electronic media , or the internet , the patient should receive the orientation that , once published , the consent can not be withdrawn , especially for publication on the internet , since the images are in public domain . some experts on civil law still defend that the right to image includes cases in which the image might be violated without there being any graphic reproduction of it , not restricting it only to the physical form of the subject . the image - picture and the image - attribute compose the identity of each individual , and its violation may cause moral damage to the person . they support that every and any lesion that affects the individual s being will have enough characteristics to be considered as moral damage . despite moral damages and invasion of privacy , there are law researchers defending that public interest is a directive of extreme importance and therefore , if the divulging of an image is justified in this , the law of freedom of expression prevails . others consider that public interest should be presumed in a democratic rule - of - law state , in order to make feasible the free circulation of ideas . although this study verified that the participating professionals used verbal authorization , the consent process should be in written form . it is important to have documented proof to support a legal defense , when necessary . written consent is the requirement of many journals before publication and edition of photographs with consent forms from the patients . it is important to point out that , in the institution where the study was developed , there is no policy for image capture , with the exception of the burn unit , where at the time of admission the patient or guardian is requested authorization for capturing images . the results of this study allow inferring there are gaps in knowledge of the healthcare professionals during the undergraduate course relative to the right to image , since 46.7% said they were not aware of any item in the brazilian federal constitution , civil code , and penal code as to this capture , as well as to the use of images of the individuals . the lack of information on the right of images by healthcare professionals can be directly related to the absence of formal orientation for the lecturers on this topic . according to a study that evaluated the orientation given by universities of the united states and the united kingdom to their lecturers on the topic of consent for images and publications , it was identified that of the nine participating european universities , only one issued specific orientation for the faculty as to how to show photographs of patients in their presentations . and of the three american participants , none gave orientation , although the legislation of the united states refers to confidentiality . this study revealed that the capture and reproduction of patient images within a hospital environment are carried out by a considerable part of the professionals investigated , despite most being aware of the prohibition of this practice and the need to preserve the individual s image . nurse technicians and licensed pratical nursing , as well as professionals with longer time of experience perform the capture and reproduction of images with less frequency . residents of the various fields of health made up the category that most captured and reproduced images and that showed the least amount of knowledge as to the items provided for in the brazilian federal constitution , civil code , and penal code . avaliar o conhecimento dos profissionais da sade sobre a captao e a reproduo de imagens de pacientes em ambiente hospitalar . estudo observacional e seccional , realizado com 360 profissionais de sade ( equipe de enfermagem , fisioterapeutas e mdicos ) , que atuam em um hospital universitrio localizado no municpio de so paulo ( sp ) . foi aplicado um questionrio com informaes sociodemogrficas e relacionados captao e reproduo de imagens no ambiente hospitalar . dos 360 entrevistados , 142 haviam captado imagens de pacientes no ltimo ano , e 312 afirmaram ter visto outro profissional fazendo imagens de pacientes . dos participantes que captaram imagens , 61 disseram que as utilizaram para estudos e apresentao de casos clnicos , e 168 profissionais relataram no conhecer nenhuma legislao do cdigo penal brasileiro a respeito de captao e do uso de imagens . h uma lacuna na formao dos profissionais de sade em relao ao uso da imagem de pacientes , sendo necessrio incluir , na graduao , disciplinas que contemplem essa temtica , assim como a regulamentao por parte das instituies de sade . a privacidade um direito individual , que abrange situaes relacionadas intimidade de cada um , ao respeito dignidade , e aos relacionamentos familiares e sociais . as pessoas , quando hospitalizadas , encontram - se em uma situao de extrema fragilidade , na qual , muitas vezes , necessitam de cuidados que invadem sua intimidade . as condies de enfermidade geram sentimentos como incapacidade , dependncia , insegurana e sensao de perda do controle sobre si mesmo . os pacientes encaram a hospitalizao como fator de despersonalizao , por reconhecerem a dificuldade para manter sua identidade , intimidade e privacidade . observando a prtica assistencial , percebem - se , em muitas situaes , a falta desvelo com a exposio corporal e pouca preocupao com o pudor do paciente . este , que deveria ser percebido como sujeito do cuidado , torna - se objeto , perdendo sua identidade . aspectos ticos e tcnicos devem sempre ser observados pelos atores envolvidos na assistncia ao paciente . a situao de exposio do corpo do paciente no momento do cuidado tem sido relatada como um momento de potencial infrao da privacidade do paciente . entretanto os profissionais da sade devem ficar atentos a mais uma ao que pode comprometer a dignidade do paciente , o registro de imagens . o uso do telefone celular com cmera fotogrfica por muitos profissionais da sade tem facilitado a captura e a reproduo de imagens dos pacientes no momento de seu atendimento , principalmente dos pacientes com comprometimento do nvel de conscincia . particularmente no cenrio de emergncia , as filmagens trazem questes ticas especficas , pois os pacientes esto vulnerveis , muitas vezes sem a capacidade de consentir ou sentem - se sob presso para dar o consentimento . como resultado , encontrou que , muitas vezes , a filmagem violava a privacidade dos pacientes e isso , geralmente , podia ser evitado com o consentimento adequado do indivduo . ressalta - se , no entanto , que os pacientes podiam sentir - se obrigados ou compelidos por quem estava no comando de seu cuidado e bem - estar . no brasil , a legislao bem clara quanto o direito imagem . de acordo com a constituio federal de 1988 , art . 5 , inciso x , so inviolveis a intimidade , a vida privada , a honra e a imagem das pessoas , assegurado o direito a indenizao pelo dano material ou moral decorrente de sua violao . embora a constituio federal e os conselhos de algumas profisses probam fazer e / ou usar imagens de pacientes sem a autorizao dos mesmos , no ambiente hospitalar pode - se observar que essa ainda uma prtica frequente por parte de alguns profissionais . em tempos em que a tecnologia est altamente popularizada , e que a maioria dos profissionais tm celular com cmera fotogrfica , a captao e a reproduo de imagens do paciente so facilitadas . a avaliao do conhecimento dos profissionais de sade sobre os direitos de imagem e privacidade do paciente importante , uma vez que gera subsdios para a conduo de intervenes educativas sobre o tema . avaliar o conhecimento dos profissionais da sade sobre a captao e a reproduo de imagens de pacientes em ambiente hospitalar . trata - se de um estudo observacional e transversal , realizado no hospital de ensino da universidade federal de so paulo , na cidade de so paulo ( sp ) , no perodo de fevereiro de 2013 a julho de 2013 . a amostra do estudo foi constituda por enfermeiros , auxiliares e tcnicos de enfermagem , mdicos residentes e fisioterapeutas , que desempenhavam suas atividades no ambiente hospitalar . com base na estimativa da proporo populacional de 2.590 profissionais , foi utilizada a frmula para determinao do tamanho da amostra de 335 indivduos , com nvel de confiana de 95% e erro amostral de 5% . foram includos 360 questionrios , por meio de amostra de convenincia . foi utilizado um questionrio de caracterizao dos sujeitos com a finalidade de investigar aspectos sociodemogrficos ( sexo , idade , profisso , tempo de experincia profissional , tipo de vnculo profissional e unidade de atuao ) e aqueles relacionados captao e reproduo de imagens no ambiente hospitalar . antes da realizao da coleta , foi apresentado o termo de consentimento livre e esclarecido aos participantes do estudo e , mediante sua concordncia em participar da pesquisa , foram apresentados os instrumentos de coleta de dados . para comparar as variveis de interesse , foi utilizado o teste e , quando este no era apropriado , utilizou - se o teste da razo de verossimilhana . o projeto foi aprovado pelo comit de tica em pesquisa da universidade federal de so paulo sob nmero caae 09250112.2.0000.5505 . dos 360 profissionais de sade entrevistados , houve predominncia de 72,8% do sexo feminino , 89,7% possuam idade 40 anos , 31,4% eram enfermeiros , 36,7% relatavam experincia profissional de 1 a 3 anos , 43,9% ( n=158 ) eram residentes e , em relao ao local de atuao no hospital , 43,0% trabalhavam em unidade de internao . a maior parte dos participantes ( 81,3% ) afirmou que presenciou algum outro profissional de sade fazendo imagens de pacientes , dos quais 9,7% haviam presenciado uma vez , 23,3% de duas a quatro vezes , 48,3% mais de quatro vezes , 5,3% relataram no lembrar e 13,3% no presenciaram . quando perguntado se o profissional j havia fotografado ou filmado pacientes no ltimo ano , 57,8% afirmaram que sim , e 71,1% disseram no ter fotografado ou filmado algum inconsciente . dentre os profissionais que responderam afirmativamente sobre ter captado imagens ( n=147 ) , a maioria relatou ter solicitado autorizao verbal ( 61,2% ) e a minoria solicitou autorizao escrita ( 10,9% ) ( tabela 1 ) . tabela 1aspectos sobre a autorizao para realizao das imagens ( n=147)questesautorizao para realizao de imagens total n ( % ) simnono houve tempo hbilno lembron ( % ) n ( % ) n ( % ) n ( % ) 1 . voc pediu autorizao verbal ao paciente ou responsvel por ele para fazer essas imagens?90 ( 61,2)34 ( 23,1)11 ( 7,5)12 ( 8,2)147 ( 100)2 . voc pediu autorizao escrita ao paciente ou responsvel por ele para fazer essas imagens?16 ( 10,9)109 ( 74,2)14 ( 9,5)8 ( 5,4)147 ( 100)3 . voc confirmou a existncia no pronturio de autorizao do paciente ou responsvel para captao de imagens?10 ( 6,8)115 ( 78,2)9 ( 6,1)13 ( 8,8)147 ( 100 ) ao questionar se consideravam importante solicitar autorizao do paciente para captar as imagens , 90% ( n=324 ) responderam que sim e 8,8% ( n=32 ) responderam que sim , porm frequentemente no havia tempo hbil para solicit - la . quando o participante era questionado se achava que fazer imagens de algum sem sua prvia autorizao tinha implicaes legais , 97,5% ( n=351 ) responderam que sim . dos 147 participantes que afirmaram ter feito imagens , 41,5% ( n=61 ) usaram para apresentao de casos clnicos e estudos , 12,2% ( n=18 ) mostraram para amigos e parentes fora do trabalho , e 0,7% ( n=1 ) publicou em redes sociais . os resultados sobre o conhecimento dos profissionais sobre a captao de imagens demonstrou que a maioria dos profissionais sabia da proibio da realizao de imagens ( 97,5% ) e da necessidade de preservar a imagem do individuo ( 98,1% ) ( tabela 2 ) . tabela 2aspectos quanto preservao da imagem e implicaes legais ( n=360)questesconhecimento dos profissionais total n ( % ) simnono sein ( % ) n ( % ) n ( % ) 1 . voc acha que fazer imagens de algum sem sua prvia autorizao tem implicaes legais?351 ( 97,5)3 ( 0,8)6 ( 1,7)360 ( 100)2 . voc acha que a imagem do indivduo deve ser preservada?353 ( 98,1)4 ( 1,1)3 ( 0,8)360 ( 100)3 . voc conhece , na constituio federal , no cdigo civil e no cdigo penal brasileiro , algum dispositivo que disponha sobre a captao e o uso de imagem de pessoas?126 ( 35,0)168 ( 46,7)66 ( 18,3)360 ( 100)4 . voc conhece , no cdigo de tica da sua profisso , alguma legislao que disponha sobre a captao e o uso de imagem de pacientes?167 ( 46,4)116 ( 32,2)77 ( 21,4)360 ( 100 ) ao realizar a associao de variveis sociodemogrficas com a realizao de imagens , foi utilizado o teste , que evidenciou que os profissionais do sexo masculino realizaram mais imagens / filmagens ( p=0,0058 ) , assim como na faixa etria 41 anos se observou um nmero significativo de profissionais que no realizaram imagens ( p=0,000 ) . para obter a relao da categoria profissional com o nmero de indivduos que captaram imagens , tambm foi utilizado o teste , que demonstrou que , na categoria de tcnicos / auxiliares de enfermagem , havia um nmero significativamente maior de indivduos que no fotografaram / filmaram os pacientes em relao as demais profisses ( p=0,0000 ) . alm disso , o mesmo teste estatstico revelou que profissionais com tempo de experincia maior que 5 anos fotografaram / filmaram significativamente menos em relao aos funcionrios com menor tempo de experincia ( p=0,0022 ) . no que se referia ao vnculo , residentes fotografaram / filmaram significativamente mais em relao aos profissionais com outros vnculos ( p=0,0287 ) ( tabela 3 ) . tabela 3associao entre as caractersticas sociodemogrficas e a realizao de imagens de pacientes ( n=360)varivelfrequncia totalvalor de p1 vez2 - 4 vezes>4 vezesno lembrono filmei e no fotografeisexo masculino882935098 * 0,0058feminino2736347158262 total35446310208360 idade , anos 4035436110174323 * 0,00004101203437 total35446310208360 profisso enfermeiro121817165113 * 0,0000tcnico / auxiliar de enfermagem936489111mdico9163033795fisioterapeuta571021741 total35446310208360 tempo de experincia profissional , anos < 146934264 * 0,00221 - 31426333561323 - 556612543>512615385121 total35446310208360 vnculo clt131119476123 * 0,0287residente142836476158especializando112149concursado74615270 total35446310208360*teste . clt : consolidao das leis do trabalho . no que se refere ao conhecimento de algum dispositivo existente na constituio federal , no cdigo civil e no cdigo penal brasileiro sobre a captura de imagens de pessoas , os residentes foram os que relataram menor conhecimento ( p=0,0465 ) . atualmente , a tecnologia tem dado um grande suporte para atuao dos profissionais de sade . no entanto , o fato de a maioria dos profissionais de sade ter acesso a novas tecnologias , como celulares com cmeras fotogrficas , criou um novo confronto tico nas instituies de sade , uma vez que situaes vivenciadas pelos pacientes so facilmente capturadas e reproduzidas , com rara obteno de consentimento prvio do paciente . os pacientes devem ter a chance de conceder ou no o consentimento para realizao de imagens . isso deve ser documentado de forma que se cumpram as recomendaes do cdigo de tica e de proteo de dados e confidencialidade do paciente . uma vez que o sujeito fotografado autoriza a utilizao da imagem , importante observar que o consentimento deve ser interpretado restritivamente , uma vez que o aceite em permitir a fotografia pode no incluir a publicao da mesma ; tampouco a concordncia em publicao no inclui outros usos . neste estudo , bem como no resultado de estudo semelhante , foi identificado que a principal finalidade das imagens foi o ensino . o institute of medical illustrators publicou , em 2006 , um manual sobre a obteno de consentimento de imagens dos pacientes , no qual est frisado que a obteno do consentimento de responsabilidade do profissional . esse termo deve ter especificada a finalidade das imagens , para que o paciente possa ou no concordar com seu uso . prtica comum oferecer trs nveis de autorizao : para uso nos pronturios apenas ; para uso no ensino de profissionais de sade e estudantes ; para a publicao e domnio pblico . a boa prtica indica que o consentimento para a publicao s deve ser obtido para um uso especfico , no sendo uma liberao abrangente . caso a publicao seja em um jornal , livro , mdia eletrnica ou internet , o paciente deve receber a orientao de que , uma vez publicado , o consentimento no pode ser retirado , visto que as imagens passam a ser de domnio pblico , principalmente para a publicao na internet . alguns estudiosos de direito civil defendem ainda que o direito imagem inclui casos em que a imagem possa ser violada sem haver reproduo grfica da mesma , no restringindo - se apenas forma fsica do sujeito . a imagem - retrato e a imagem - atributo compem a identidade de cada indivduo , e sua violao pode acarretar danos morais pessoa : toda e qualquer leso que atinja o ser do indivduo ter caractersticas suficientes para considerar - se como dano moral . apesar dos danos morais e da invaso de privacidade , h pesquisadores de direito que defendem que o interesse pblico diretriz de extrema importncia e , portanto , se a divulgao de uma imagem encontra nele sua justificativa , prevalece liberdade de expresso . outros consideram que o interesse pblico deve ser presumido em um estado democrtico de direito , a fim de viabilizar a livre circulao de ideias . embora este estudo tenha verificado que os profissionais participantes usaram autorizao verbal , o processo de consentimento deve se dar de forma escrita . . o consentimento escrito exigncia de muitas revistas antes da publicao e da edio de fotografia com formulrios de consentimento dos pacientes . vale ressaltar que , na instituio em que foi desenvolvido o estudo , no h politica para a captao de imagens , com exceo da unidade de tratamento de queimados , onde solicitada ao paciente ou responsvel , no momento da internao , autorizao para captao de imagens . os resultados deste estudo permitem inferir que h lacuna de conhecimento dos profissionais da sade durante o curso de graduao em relao ao direito imagem , pois 46,7% disseram desconhecer algum dispositivo na constituio federal , no cdigo civil e no cdigo penal brasileiro sobre a captao , bem como sobre o uso de imagens dos indivduos . a falta de informao sobre direito de imagem por parte dos profissionais de sade pode estar diretamente relacionada ausncia de orientao formal para aos professores sobre esse assunto . segundo estudo que avaliou as orientaes dadas por universidades dos estados unidos e do reino unido a seus professores , sobre o termo de consentimento para imagens e publicaes , foi identificado que , das nove universidades europeias participantes , apenas uma emitiu orientaes especficas para docentes sobre como mostrar fotografias dos pacientes em suas apresentaes e , das trs participantes americanas , nenhuma dava orientaes , embora a legislao dos estados unidos refira - se confidencialidade . este estudo revelou que a captao e a reproduo de imagens de pacientes em ambiente hospitalar so realizadas por parte considervel dos profissionais investigados , apesar de a maioria ter conhecimento sobre a proibio dessa prtica e da necessidade de preservar a imagem do indivduo . auxiliares e tcnicos de enfermagem e profissionais com maior tempo de experincia realizaram a captao e a reproduo de imagens com menos frequncia . residentes das diversas reas da sade consistiram na categoria que mais captou e reproduziu imagens e que apresentou menos conhecimento sobre os dispositivos existentes na constituio federal , no cdigo civil e no cdigo penal brasileiro .

objectiveto assess knowledge of healthcare professionals about capture and reproduction of images of patients in a hospital setting.methodsa cross - sectional and observational study among 360 healthcare professionals ( nursing staff , physical therapists , and physicians ) , working at a teaching hospital in the city of so paulo ( sp ) . a questionnaire with sociodemographic information was distributed and data were correlated to capture and reproduction of images at hospitals.resultsof the 360 respondents , 142 had captured images of patients in the last year , and 312 reported seeing other professionals taking photographs of patients . of the participants who captured images , 61 said they used them for studies and presentation of clinical cases , and 168 professionals reported not knowing of any legislation in the brazilian penal code regarding collection and use of images.conclusionthere is a gap in the training of healthcare professionals regarding the use of patients images . it is necessary to include subjects that address this theme in the syllabus of undergraduate courses , and the healthcare organizations should regulate this issue .

the advent of titanium implants resulted in a treatment modality with a high level of applicability in several clinical situations . although the original protocol was initially designed for the treatment of completely edentulous patients , the need arose to extrapolate treatment alternatives with osseointegrated implants to partially dentate patients . implant dentistry added a new alternative in oral rehabilitation , but at no time , have osseointegrated implants been capable of resembling natural teeth with regard to their characteristics . this combination was applied to partially edentulous patients , contradicting branemark 's protocol , which was based on isolating implants from natural teeth . however , the distribution of the teeth in the arch may induce the adoption of combined prostheses . for decades , tooth - implant - supported dentures have been questioned because of the differences of mobility between the abutments , the risk of intrusion of the natural abutment , as well as the atrophy of the periodontal ligament , and the high general risk of technical complications . the great difference between an osseointegrated implant and a natural tooth is the form of the structural union with the bone and the different mechanism of absorption and dissipation of force , which makes the tooth - implant bond a biomechanical dilemma . the possibility of connecting implants to teeth in fixed denture , with a favorable prognosis has been studied by several authors who concluded that the tooth - implant bond does not have a negative influence on the marginal bone and soft tissues . therefore , it was not possible to show any greater risk of deficiency for fixed tooth - implant - supported dentures ( ftisd ) when compared with implant - supported dentures , which were well accepted , particularly by patients in unfavorable financial situations , who were unable to have the ideal number of implants placed . nevertheless , the connection of natural teeth and osseointegrated implants in a rigid denture caused concern and publications , with studies and guidelines for both extremes . there is a significant difference in the absorption and distribution of force between natural teeth and implants . this occurs because in tooth - supported dentures there is a system of cushioning causing a micro - movement of 100 to 300 m due to the presence of the periodontal ligament , as load will be transmitted to the bone with beneficial stimulation by transforming the stresses of pressure into uniform traction on the alveolar cortical . in implants , the resultant stress is concentrated on the bone crest , and this different dissipation of force may cause a lever arm , which depends on the length of the pontic producing torque on the implant , causing loosening or fracture of the retention screw . in view of such a situation , the use of semi - rigid connections has been recommended , taking into consideration that this type of connection could be more efficient in terms of compensating for the difference in mobility between the abutments . nevertheless , other authors have reported that the semi - rigid connections are rarely indicated in unilateral fixed dentures . this type of connection does not improve the stress distribution between the abutments , and are the cause of migration of the natural teeth . ideal tooth - implant supported fixed dentures ( tisfds ) are those in which the space is small , including one tooth and one implant with the possibility of a maximum of two pontics . nevertheless , other authors have reported that the ideal tisfds are those with a larger number of natural abutments to promote greater rigidity of this denture . the aim of this study was to use finite element method ( fem ) to evaluate the generation of stresses in a fixed tooth - implant - supported denture with a rigid connection , when varying the number of teeth used as abutments . over the last few years , fem applied to biomechanics has become an extremely useful tool for numerically assessing stresses and deformations associated with the mechanical behavior of biomaterials and human tissues . in this study , the 3-d model of the fem is an approximate representation of an in vivo geometry , with the physical characteristics of a real model . in this study , the ansys revision 5.7 program was used to develop a model of a partially edentulous maxilla , conceived by means of 3-d fem , in which an implant - tooth supported fixed denture was constructed . representative volumes of the implants , abutments , prosthetic crowns and cortical and spongy bone were created . connection of this denture was simulated by means of a metal surface of a non - noble nicr alloy , varying the number of teeth connected to an osseointegrated iti strauman implant , 10.00 mm long , 4.1 mm in diameter , with a 4.8 mm platform . to compose this denture , metal - ceramic crowns were constructed in the shape of premolars , which were connected by means of a pontic , using rigid connection , in order to be analyzed in two configurations : the first configuration contemplated one tooth and one implant ( model 1 ) , and the second configuration contemplated two teeth and one implant ( model 2 ) . from the basic geometry created , the elastic properties of the various materials were attributed , using approximate values found in the literature ( table 1 ) . the elastic properties of the materials were adopted in a linear system , whose hypothesis is that the deformation of elastic bodies is proportional to the force applied . furthermore , these properties were considered constant and isotropic ( equal in all directions ) . elastic properties of several materials that compose the model from the creation of the basic geometry , the finite element mesh composed of 297.096 knots and 213.129 elements for the model with one tooth and one implant ( model 1 ) and 529.930 knots and 383.670 elements for the model with two teeth and one implant ( model 2 ) were generated , according to figures 1 and 2 . finite element mesh model 1 finite element mesh model 2 the study of biomechanics is , however , an analysis of the distribution of forces to the bone when teeth are occluding . it has been observed in tests that the intensity of the bilateral and unilateral physiological force is 569 n and 430 n respectively and clinical observations have shown that lateral forces are not well tolerated by the dental and bone structures , as occurs with axial forces . in this model , a vertical load of 100 n was applied on the occlusal face of the entire prosthetic set , distributed uniformly according to the number of elements of the respective surfaces ( figures 3 and 4 ) . nodal load of 100 n on the denture containing 3 elements nodal load of 100 n on the denture containing 4 elements this model was designed and submitted to a vertical load , in which its effect was assessed quantitatively in n / mm ( mpa ) and qualitatively . the images generated by the program used in the present study made it possible to gain a broad and significant understanding of the distribution of these stresses in the bone tissue , as well as in the prosthetic components and associated structures . the quantitative results are summarized in table 2 with plotting of the von mises stress ( seqv ) for the tooth - implant - supported dentures with one and two teeth . the table also shows the results of maximum displacement ( dmx ) of the set . quantitative analysis seqv = von mises stress ; dmx = maximum displacement in a qualitative analysis , it may be observed that the vertical displacement of tooth - implant - supported dentures with one tooth and one implant , the tooth showed greater movement in the apical direction ( figure 5 ) . however , when a tooth was added in the mesial region of this denture , a reduction in its vertical movement was observed ( figure 6 ) . movement of the set in the occlusal - gingival direction ( model 1 ) movement of the set in the occlusal - gingival direction ( model 2 ) in the analysis of the seqv stresses , it was observed that the maximum stress in the tisfds containing one tooth ( model 1 ) was 47.84 mpa , whereas for the denture containing two teeth ( model 2 ) the maximum stress was 35.82 mpa , both located in the region between the tooth and the pontic , as shown in figures 7 and 8 . in selecting the images , when the structures that compose the prosthetic crowns are removed , we can verify that the maximum seqv stress occurred on the mesial side of the implant neck region , at the junction with the cortical bone , with values of 12.15 and 8.85 mpa for models 1 and 2 respectively , as illustrated in figures 9 and 10 . it can be verified that in the denture containing two teeth , the load is practically absorbed by the implant with a slight increase in tension on the tooth closest to the pontic , however , these loads can be considered insignificant . von mises stress ( seqv ) in model 1 von mises stress ( seqv ) in model 2 von mises stress ( seqv ) in the implant region in model 1 von mises stress ( seqv ) in the implant and teeth in model 2 in the analysis of equivalent stresses of von mises ( seqv ) generated in metal , we note that the maximum stress is found in the same region between the natural abutment and pontic for both the models , with values of 50.0 mpa for model 1 and 34.14 mpa for model 2 ( figures 11 and 12 ) . this location of the maximum value in metal indicates that there is greater flexion of the metal bar in the region between the tooth and pontic . von mises stress ( seqv ) in the metallic infrastructure ( model 1 ) von mises stress ( seqv ) in the metallic infrastructure ( model 1 ) in the electromyography study to assess the intensity of the bilateral and unilateral physiological force , the result found for bilateral force was 569 n and 430 n when measured unilaterally . thus , according to table 3 , one may make a comparison for functional loads from the flow limit of the materials . this table allows one to observe that the porcelain with specific properties used in this study , when submitted to load in model 1 , showed admissible values for occlusal loads ( kx100n ) lower than the one found for maximum physiological load . maximum von mises stress ( seqv ) values compared with the se flow stresses and admissible occlusal loads for the materials starting from a real principle proposed in the literature , the connection between teeth and implants must not be considered as the first alternative for rehabilitation and it is preferable to adopt planning of isolated implant - supported dentures . nevertheless , in case of anatomic limitations that may require advanced surgical techniques at high costs or if teeth already require restorative interventions and are favorably distributed in the arch , a combination between teeth and implants may be adopted with success rates similar to those of fixed implant - supported dentures . there is a vast amount of literature with regard to the biomechanical challenge of the connection between teeth and implants . authors have reported that this complication is due to the difference in mobility between them , different mechanisms of absorption and dissipation of forces and mechanical - receptor properties . however , biomechanical responses in the face of a force are completely different , and in tooth - implant - supported dentures , special care must be taken in planning to compensate this difference . nevertheless , according to the literature it is conclusive that in fixed tooth - implant - supported dentures , connections of the semi - rigid type generate more stress in the denture components so that the rigid connection has been preferred instead of the semi - rigid type . from analysis of the results , the present study allows one to observe that there was a reduction in the displacement of the prosthetic set , as well as a lower stress , when a natural abutment was added , confirming previous findings that if the placement of only one implant were possible , then two natural abutments must be used as retainers to support a pontic thereby improving the rigidity of the set . this difference in stresses can also be explained by the fact that although the loading value had been equal , the loads were better distributed in model 2 . according to the literature , the resulting stress in implants is concentrated on the bone crest , which is in agreement with the results obtained in this study , in which the maximum seqv stresses occurred on the mesial side in the neck region of the implant , as reported elsewhere . it has been stated that the ideal tooth - implant supported fixed dentures are those in which the space between the abutments is small , including only one tooth and one implant , with the possibility of a maximum of two pontics . this configuration is necessary because the flexion of the bar is proportional to the cube of the length of the edentulous space , in agreement with the findings of this study , in which it was observed a greater displacement in the pontic region , and higher tension located between the pontic and the abutments . according to the quantitative and qualitative analysis of the present study , it may be concluded that : tooth - implant - supported prostheses must be limited with regard to the edentulous space and it is a feasible and biomechanically predictable treatment option ; the placement of additional teeth decrease the resultant stress values ; the type of alloy used in the metallic infrastructure plays a key role in denture displacement , and preference should be given to those with the highest modulus of elasticity . the internal connection type of implant provides greater rigidity to the set ( abutment / implant ) mechanically presenting lower stress levels .

objectivesin some clinical situations , dentists come across partially edentulous patients , and it might be necessary to connect teeth to implants . the aim of this study was to evaluate a metal - ceramic fixed tooth / implant - supported denture with a straight segment , located in the posterior region of the maxilla , when varying the number of teeth used as abutments . materials and methodsa three - element fixed denture composed of one tooth and one implant ( model 1 ) , and a four - element fixed denture composed of two teeth and one implant ( model 2 ) were modeled . a 100 n load was applied , distributed uniformly on the entire set , simulating functional mastication , for further analysis of the seqv ( von mises ) principal stresses , which were compared with the flow limit of the materials . resultsin a quantitative analysis , it may be observed that in the denture with one tooth , the maximum seqv stress was 47.84 mpa , whereas for the denture with two teeth the maximum seqv stress was 35.82 mpa , both located in the region between the pontic and the tooth . conclusionlower stresses were observed in the denture with an additional tooth . based on the flow limit of the materials , porcelain showed values below the limit of functional mastication .

previously we reported that deletion of neutral endopeptidase ( nep ) provides protection from obesity- and diabetes - induced neural complications . we have also shown that treating obese and streptozotocin - diabetic mice with the vasopeptidase inhibitor ilepatril prevented neural complications including slowing of nerve conduction velocity , thermal hypoalgesia , and decreased intraepidermal nerve fiber density . vasopeptidase inhibitors are drugs that simultaneously inhibit nep and angiotensin - converting enzyme ( ace ) activity . recent studies have shown increased expression of angiotensin - ii - forming enzymes in adipose tissue and increased activity of the renin - angiotensin system being implicated in the development of insulin resistance and type 2 diabetes . nep is found in many tissues including vascular and renal tissue and its activity is increased by fatty acids and glucose in human microvascular cells [ 59 ] . in the peripheral nervous system nep is located in schwann cell membranes surrounding dorsal root ganglion cells and nerve fibers [ 10 , 11 ] . nep degrades many vaso- and neuroactive peptides including natriuretic peptides , adrenomedullin , bradykinin , and calcitonin - gene - related peptide [ 12 , 13 ] . therefore , inhibition of ace and nep activity would be expected to improve vascular and neural function . in this regard we have demonstrated that treating type 1 and type 2 diabetic rats as well as a genetic rat model of obesity with ilepatril improves vascular and neural dysfunction [ 1416 ] . however , little information is available about the effect of vasopeptidase inhibitors in animal models of diet - induced obesity . in order to further elucidate the effects of vasopeptidase inhibitors in peripheral nerve dysfunction associated with obesity we examined the effect of diet - induced obesity on nerve conduction velocity and thermal response latency in the hindpaw of c57bl/6j mice and mice deficient in nep treated with ilepatril , enalapril , ace inhibitor , or candoxatril , nep inhibitor [ 1 , 2 ] . unless stated otherwise all chemicals used in these studies were obtained from sigma chemical co. ( st . louis , mo ) . c57bl/6jj breeding pairs of neutral endopeptidase - deficient ( nep ) mice were provided by drs . these mice have been bred and a colony created at the veterans affairs medical center , iowa city , ia . deficiency of nep activity was confirmed in nep mice by measuring the specific activity of nep in kidney homogenates using the method described by ayoub and melzig with modification . activity of nep in kidney from c57bl/6j and nep mice was 0.35 0.02 and 0.02 0.02 mm 7-amido-3-methylcoumarin ( amc)/min / mg protein , respectively ( p < 0.001 versus c57bl/6j by unpaired t - test ) . this test was performed on all mice used in these studies in order to confirm that nep was functionally knocked out in the nep mice . mice were housed in a certified animal care facility and food ( harlan teklad , no . adequate measures were taken to minimize pain or discomfort and all of the experiments were conducted in accordance with international standards on animal welfare and were compliant with all institutional and national institutes of health guidelines for use of animals ( acurf protocol 1101009 ) . for the prevention protocol c57bl/6j and nep mice at 12 weeks of age were divided into five groups . a second group was fed a high - fat diet containing 24 gm% fat , 24 gm% protein , and 41 gm% carbohydrate ( d12451 ; research diets , new brunswick , nj ) . the primary source of the increased fat content in the diet was soybean oil and lard . the control and high - fat diet contained 0.4 and 0.3% sodium chloride , respectively . the average fat content of the control diet was 4.25 gm% ( harlan teklad , no . the third through fifth groups were fed the high - fat diet containing ilepatril ( 500 mg / kg in the diet ) , candoxatril ( 30 mg / kg in the diet ) , or enalapril ( 500 mg / kg in the diet ) . we have found that these doses provide maximal inhibition of nep and/or ace activity in vivo [ 2 , 19 ] . for the intervention study the same five groups of c57bl/6j and nep mice at 12 weeks of age were fed the control diet ( group 1 ) or high - fat diet ( groups 25 ) for 12 weeks . afterwards , the four groups of high - fat - fed mice were fed a high - fat diet with no additions ( group 2 ) or high - fat diet containing ilepatril , candoxatril , or enalapril ( groups 35 ) for 12 weeks . after an overnight fast mice were injected with a saline solution containing 2 g / kg glucose , i.p . immediately prior to the glucose injection and for 120 minutes afterwards blood samples were taken to measure circulating glucose levels with the use of glucose - dehydrogenase - based reagent strips ( aviva accu - chek , roche , mannheim , germany ) . blood samples ( 0.6 l ) were taken from a tail vein that was lanced once . thermal nociceptive response in the hindpaw was measured using the hargreaves method with instrumentation provided by iitc life science , woodland hills , ca ( model 390 g ) as previously described . the test was performed in a blind manner . thermal nociceptive responses were measured by placing the mouse in the observation chamber on top of the thermal testing apparatus and allowing it to acclimate to the warmed glass surface ( 33c ) and surroundings for a period of 15 min . the mobile heat source was maneuvered so that it was under the heal of the hindpaw and then activated , a process that starts a timer and locally warms the glass surface , when the mouse withdrew its paw , the timer , and the heat source was turned off . following an initial recording , which was discarded , two measurements were made for each hindpaw , with a rest period of 5 min between each set of measurements . the mean of the measurements , reported in seconds , was used as a measure of the thermal nociceptive response latency . , abbott laboratories , north chicago , il ) and sensory nerve conduction velocities were determined as previously described [ 1 , 2 ] . briefly , sensory nerve conduction velocity was recorded in the digital nerve to the second toe by stimulating with a square - wave pulse of 0.05 ms duration using the smallest intensity current that resulted in a maximal amplitude response ( grass s44 stimulator ; grass medical instruments , quincy , ma ) . the maximal sensory nerve conduction velocity was calculated by measuring the latency to the onset / peak of the initial negative deflection and the distance between stimulating and recording electrodes ( measured in millimeters using a vernier caliper ) . biopsies of skin of the right hindpaw were fixed , dehydrated , and embedded in paraffin . sections ( 7 m ) were collected and immunostained with anti - pgp9.5 antibody ( rabbit anti - human no . 7863 - 0504 ( this antibody cross - reacts with rat , mouse guinea pig , and other species ) , abd serotic , morpho sys us inc . , raleigh , nc ) overnight followed by treatment with secondary antibody alexa fluor 546 goat anti - rabbit ( invitrogen , eugene , or ) . profiles were imaged using a zeiss 710 confocal microscope with a 40x objective and were counted by two individual investigators that were blinded to the sample identity . length of the epidermis was determined by drawing a polyline along the contour of the epidermis and recording its length in mm . comparisons between the groups for body weight , blood glucose , sensory nerve conduction velocity , thermal nociception , and intraepidermal nerve fiber profiles were conducted using a one - way anova and bonferroni 's test for multiple comparisons ( prism software ; graphpad , san diego , ca ) . presented in table 1 are weight and blood glucose changes for c57/bl6j and nep mice used in the prevention study . at 12 weeks of age when fed a high - fat diet c57bl/6j and nep mice both gained a similar amount of weight . treating the high - fat diet with ilepatril or enalapril but not candoxatril completely prevented the gain in weight . the mass of the epididymal fat pad was significantly increased in high - fat - fed mice and mice fed the high - fat diet treated with candoxatril compared to control mice or mice fed the high - fat diet containing ilepatril or enalapril . when calculating the epididymal fat pad mass as a percent of total body weight epididymal fat pad mass was significantly increased in high - fat - fed c57bl/6j mice and mice fed a high - fat diet containing candoxatril compared to control . treating the high - fat diet with ilepatril and to a greater extent enalapril prevented the increase in epididymal fat pad mass when presented as percent of final body weight . nonfasting blood glucose levels were not significantly different between c57bl/6j and nep mice fed the control or high - fat diets and not affected by ilepatril , candoxatril , or enalapril treatment . in the intervention study all mice fed the high - fat diet for the initial 12 weeks of the experimental design gained a significant amount of weight ( table 2 ) . when transferred to a high - fat diet containing ilepatril or enalapril for an additional 12 weeks c57bl/6j and nep mice lost weight . mice remaining on the high diet or high - fat diet containing candoxatril continued to gain weight . the epididymal fat mass decreased after c57bl/6j or nep mice , fed a diet containing high fat for 12 weeks , were given a high - fat diet containing enalapril . the epididymal fat mass also was decreased after nep mice but not c57bl/6j mice were fed a high - fat diet treated with ilepatril . treating high - fat - fed c57bl/6j or nep mice with candoxatril did not reduce epididymal fat mass . a similar trend was observed when the epididymal fat mass data was presented as percentage of final body weight . nonfasting blood glucose levels were not changed in c57bl/6j or nep mice fed control or high - fat diets with or without ilepatril , candoxatril , or enalapril . in the prevention study c57bl/6j ( figure 1 ) and nep ( figure 2 ) mice fed the high - fat diet or high - fat diet containing candoxatril had an impaired glucose clearance curve compared to control mice . in contrast , the glucose clearance curve was near normal in c57bl/6j and nep mice fed a high - fat diet containing ilepatril or enalapril . in the intervention study feeding c57bl/6j ( figure 3 ) or nep ( figure 4 ) mice for 24 weeks a high - fat diet caused an impaired glucose clearance curve . treating high - fat - fed c57bl/6j or nep mice with enalapril for the last 12 weeks of the 24-week period partially corrected glucose utilization . treating nep mice with ilepatril treating c57bl/6j mice with ilepatril did not improve glucose utilization nor did treating c57bl/6j or nep with candoxatril . data in figure 5 ( left ) demonstrate that sensory nerve conduction velocity was significantly decreased in high - fat - fed c57bl/6j mice compared to control mice and that this was prevented by treating high - fat - fed mice with ilepatril or candoxatril using a prevention protocol . data in figure 5 ( center ) demonstrate that thermal nociception was significantly decreased in c57bl/6j mice after 12 weeks of a high - fat diet compared to control mice as indicated by an increase in paw withdrawal latency . treatment with ilepatril or candoxatril and to a lesser extent enalapril for the 12-week period prevented thermal hypoalgesia in high - fat - fed c57bl/6j mice . data in figure 5 ( right ) demonstrate that the number of intraepidermal nerve fiber profiles was significantly decreased in high - fat - fed c57bl/6j mice and that treatment of these mice with ilepatril or candoxatril but not enalapril for 12 weeks prevented the significant decrease . sensory nerve conduction velocity , thermal nociception , and intraepidermal nerve fiber density were not impaired in nep mice fed a high - fat diet ( figure 6 , left , center , and right , resp . ) . we also determined the effect of treating high - fat - fed c57bl/6j and nep mice using an intervention protocol ( figures 7 and 8 , resp . ) . in this study design high - fat - fed mice were untreated for 12 weeks followed by 12 weeks of a high - fat diet with or without treatment . feeding c57bl/6j mice a high - fat diet for 24 weeks caused a significant decrease in sensory nerve conduction velocity ( figure 7 , left ) . treating these mice for the last 12 weeks of the 24-week period with ilepatril , candoxatril , or enalapril the decrease in thermal nociception in high - fat - fed c57bl/6j mice was reversed by treating mice with ilepatril or candoxatril but not enalapril ( figure 7 , center ) . treating high - fat - fed c57bl/6j mice with ilepatril , candoxatril , or enalapril reversed the decrease in intraepidermal nerve fiber profiles ( figure 7 , right ) . feeding nep mice a high - fat diet for 24 weeks with or without treatment had no effect on sensory nerve conduction velocity , thermal nociception , or intraepidermal nerve fiber density ( figure 8 , left , center , and right , resp . ) . the main findings from these studies were that diet - induced obesity caused significant weight gain and impaired glucose utilization in c57bl/6j and nep mice that was improved when the mice were treated with ilepatril or enalapril using a prevention protocol . using the intervention protocol enalapril but not ilepatril treatment was effective improving glucose utilization by c57bl/6j mice . treating c57bl/6j or nep mice with candoxatril did not improve weight gain or glucose utilization . these data suggest that inhibition of ace and not nep activity was responsible for improving weight gain and glucose utilization in high - fat - fed mice . diet - induced obesity also caused slowing of sensory nerve conduction velocity , thermal hypoalgesia , and decrease in epidermal nerve fiber density in the paw of the hindlimb in c57bl/6j mice but not nep mice . the impairment in sensory nerve function endpoints in c57bl/6j mice fed a high - fat diet was prevented / improved when the mice were treated with ilepatril or candoxatril and to a much lesser extent enalapril using either the prevention or intervention protocol . these data suggest that increased nep activity / expression but not ace activity contributes to diet - induced obesity - related deficits in sensory nerve function . previous studies have shown that diet - induced obesity in rodent models can be prevented by ace inhibitors and angiotensin ii receptor blockers [ 2124 ] . in addition , diet - induced weight gain and fat mass are reduced , energy expenditure increased , and glucose tolerance improved in mice lacking ace or the angiotensin ii type 1a receptor [ 25 , 26 ] . the mechanisms proposed for the improvement in obesity and glucose tolerance with treatment of rodent models with ace inhibitors are increased energy expenditure , liver and adipose tissue metabolic modulation , lower concentration of leptin , improved insulin signaling , and increased glucose and fatty acid utilization by muscle [ 2130 ] . in a study comparing the effects of ramipril , an ace inhibitor , to ilepatril in jcr : la - cp rats , an obese , insulin - resistant , hyperinsulinemic , normoglycemic model , it was found that both compounds reduced the surge of plasma insulin in a meal tolerance test by about 50% but ilepatril was more beneficial in improving vascular reactivity . in our study we found that enalapril trended to be more effective than ilepatril preventing / reducing fat pad mass . this could be because enalapril at the dosage used was a more effective ace inhibitor than ilepatril in target tissues . in another study using obese zucker rats it was found that dual inhibition of ace and nep improved insulin - mediated glucose disposal more effectively than monotherapy and this effect was linked to increased activation of the kinin - nitric oxide pathway . in a similar independent study it was found that omapatrilat , a vasopeptidase inhibitor , induced insulin sensitization and increased myocardial glucose uptake in obese zucker rats and that the effect of omapatrilat was greater than ramipril in part due to stimulation of the b2 receptor . later this group reported that treatment of obese zucker rats with a vasopeptidase inhibitor increased muscle glucose uptake independent of insulin signaling . in two of these studies protection of bradykinin from degradation by nep interestingly , it has been shown that natriuretic peptides promote muscle mitochondrial biogenesis and fat oxidation as to prevent obesity and glucose intolerance . the natriuretic peptides are also degraded by nep . because nep is expressed in skeletal muscle in relatively large amounts and being located on the cell surface , nep is able to hydrolyze peptides in the vicinity of their receptors thereby neutralizing their bioactivity [ 34 , 36 ] . however , inhibition of ace may also lead to protection of bradykinin levels by inhibiting kininase - ii - mediated degradation of this nonapeptide . reported that ace inhibition by captopril improved glucose transport in insulin - resistant muscle of the obese zucker rat . they attributed the improvement to modulation of insulin action by bradykinin mediated through b2 receptors and by an increase in nitric oxide production . since bradykinin and natriuretic peptides may have a role in enhancing insulin action and regulating glucose and fatty acid metabolism by muscle protecting their bioactive function by preventing degradation through inhibition of ace and/or nep may be a therapeutic approach for treatment of obesity and insulin resistance [ 34 , 36 , 38 ] . we have previously shown that treating diabetic rats with enalapril improved vascular and nerve endpoints but enalapril was less effective in rats fed a high - fat diet [ 19 , 36 , 39 , 40 ] . in contrast , we found that treating obese or diabetic rats with ilepatril was more effective than enalapril in improving peripheral nerve dysfunction [ 19 , 36 , 40 ] . we have shown that treating diabetic or diet - induced obese rodents with ilepatril improves vasodilation of blood vessels that provide circulation to the sciatic nerve by reducing oxidative stress and preventing degradation of vasoactive peptides by nep including calcitonin gene - related peptide and c - type natriuretic peptide thereby maintaining endoneurial blood flow and preventing ischemia . since nep degrades both calcitonin gene - related peptide and substance p , peptides important in pain signaling pathways , it is likely that blocking nep activity or mice deficient in nep would maintain higher levels of both of these neuroactive peptides and perhaps be more sensitive to painful stimuli . data from clinical trials clearly suggest that activation of the renin - angiotensin - aldosterone system plays an important role in the pathophysiology of the metabolic syndrome through interaction of a wide range of physiological and molecular mechanisms . more recently in humans activity of nep has been shown to correlate with body mass index and measures of insulin resistance with increasing activity found in subjects with multiple cardiovascular risk factors . in these studies we found that feeding mice a high - fat diet causes weight gain , impaired glucose tolerance , and sensory nerve dysfunction . inhibition of ace was effective in reducing weight gain and improving glucose utilization but generally noneffective in improving sensory nerve dysfunction . in contrast , inhibition of nep improved sensory nerve dysfunction and had no effect in improving weight gain or glucose utilization . treating high - fat - fed mice with a vasopeptidase inhibitor improved weight gain , glucose utilization , and sensory nerve function . thus , we conclude that increased activity of nep is associated with sensory nerve dysfunction in an animal model of diet - induced obesity and that dual inhibition of ace and nep may be more effective than monotherapy in reducing insulin resistance and the sensory nerve complications associated with metabolic syndrome .

we have demonstrated that treating diet - induced obese ( dio ) mice with the vasopeptidase inhibitor ilepatril improved neural function . vasopeptidase inhibitors block angiotensin - converting enzyme ( ace ) and neutral endopeptidase ( nep ) activity . we propose that increased activity of ace and nep contributes to pathophysiology of dio . to address this issue c57bl/6j mice or mice deficient in nep were fed a high - fat diet and treated with ilepatril , enalapril , ace inhibitor , or candoxatril , nep inhibitor , using both prevention and intervention protocols . endpoints included glucose utilization and neural function determination . in the prevention study glucose tolerance was impaired in dio c57bl/6j mice and improved with ilepatril or enalapril . sensory nerve conduction velocity , thermal nociception , and intraepidermal nerve fiber density were impaired in dio c57bl/6j mice and improved with ilepatril or candoxatril . in the intervention study only enalapril improved glucose tolerance . sensory nerve conduction velocity and intraepidermal nerve fiber density were improved by all three treatments , whereas thermal nociception was improved by ilepatril or candoxatril . in nep - deficient mice dio impaired glucose utilization and this was improved with enalapril . nerve function was not impaired by dio in nep - deficient mice . these studies suggest that ace and nep play a role in pathophysiology associated with dio .

several types of studies have suggested that infectious agents may play a role in atherosclerosis and coronary heart disease ( chd ) . atherosclerosis in chickens is exacerbated by infection with marek 's disease virus , a member of the herpes virus family 12 , and numerous studies have suggested an association of viral pathogens such as cmv and bacterial pathogens such as helicobacter and chlamydia with human atherosclerosis 345 . most 678 though not all 910 studies have found that patients with chd are more likely to carry anti - chlamydia antibodies than healthy subjects , and several studies have demonstrated that chlamydia can be detected immunohistologically in > 70% of atherosclerotic lesions , whereas it is virtually undetectable in undiseased arteries 5678 . c. pneuomonia is a gram - negative bacteria that may produce persistent infection through intracellular growth in macrophages 11 , a cell type that plays a dominant and necessary role in atherosclerotic lesions 1213 . these observations have led to the hypothesis that chlamydia may play a causal role in atherosclerosis and chd 1415161718 . this hypothesis is made plausible by studies on the association of helicobacter pylori and duodenal ulcer 1920 . this condition was originally thought to be caused by excess gastric acid and was treated by reducing or neutralizing acid . it is now clear that ulcers are most commonly caused by infection with h. pylori , and the most effective treatment involves antibiotics . in the same way , atherosclerosis is currently thought to be caused by excess plasma cholesterol and is treated by agents that reduce cholesterol levels . if chlamydia or any other pathogen causes atherosclerosis , then a more effective treatment may be an antibiotic or vaccine . we have sought evidence for a causal role of infectious agents in atherosclerosis using the murine apolipoprotein ( apo ) e ( deficient ) model . because of the deficiency of apo e , these animals have high levels of plasma cholesterol and develop atherosclerosis with a reproducible time course 212223 . in a first experiment , we bred the apo e with a strain of mouse that is unable to respond to bacterial lps , but found no alteration in the rate or extent of atherogenesis . in a second study we conclude that neither the response to infectious agents nor the presence of infectious agents themselves is absolutely necessary for atherogenesis . mice with the lps gene crossed onto a c57bl background ( c57bl/10scn ) were the gift of dr . these mice exhibited minimal increases in serum levels of tnf- and il-6 in response to intraperitoneal injection of 50 g of lps , whereas c57bl and apo e animals exhibited > 100-fold elevations in both ( not shown ) . c57bl/10scn mice were crossed with apo e mice on a c57bl/6 background ( jackson laboratories ) . apo e/lpsanimals were identified in the f2 progeny by the presence of plasma cholesterol levels > 500 mg / dl and the absence of plasma elevations of tnf- 90 min after injection of 50 g lps . germ - free and control apo e mice were generated and maintained at taconic farms . offspring were weaned at 4 wk of age onto a high - fat western - type diet containing 21.22% ( g/100 g ) fat , 17.01% protein , 48.48% carbohydrate , and 0.15% cholesterol ( td88137 ; harlan teklad ) and maintained on the diet for the remainder of the study . autoclaved food and water were provided ad libitum . the institutional animal care and use committee of merck research laboratories approved the animal use for experimentation , and all animals were cared for in accordance with the guide for the care and use of laboratory animals ( 1996 , national research council ) . to measure aortic cholesterol and cholesteryl ester , mice were killed and gently perfused through the left ventricle with cold pbs with 5 mm edta . all branches and any adipose tissue connected to the aorta were removed , and each aorta was carefully excised from the aortic root to the right renal artery . the aortas were blotted dry , minced , and extracted with chloroform / methanol ( 2:1 ) according to the method used by folch et al . 24 . total and free cholesterol in the aortic extracts were determined using an enzymatic fluorometric assay modified from previously described methods 2526 , and data are expressed on a per aorta basis . plasma cholesterol and triglyceride levels were determined using standard enzymatic kits ( sigma chemical co. ) . for histology , mouse hearts were perfused in situ with pbs and removed with 1 mm of proximal aorta attached . the top half of the heart was embedded in o.c.t . embedding medium ( fisher scientific ) and prepared for cryosectioning . 6-m sections were collected of the aortic root area , defined as having aortic valve leaflets present , and mounted on 10-well masked slides . additional sections were immunolabeled with mab l3t4 for cd4 or m1/70 for cd11b ( pharmingen ) using the horseradish peroxidase method with 3 - 3-diamino benzadine as substrate . the time course of atherosclerogenesis in apo e mice was followed by measuring aortic cholesteryl ester ( fig . 1 ) , a parameter that tracks with histological progression of atherosclerosis ( 23 ; data not shown ) . to determine a role for gram - negative bacteria such as chlamydia , we first used lps mice 27 , animals with a congenital deficiency in responses to the principal inflammatory component of these bacteria , lps ( endotoxin ) . lps is known to stimulate expression of cytokines ( tnf , monocyte chemotactic protein 1 [ mcp-1 ] , and others ) , adhesion molecules ( vascular cell adhesion molecule 1 [ vcam-1 ] , intercellular adhesion molecule 1 [ icam-1 ] , 2 integrins ) , and enzymes ( inducible nitric oxide synthetase [ inos ] , matrix metalloproteinase 9 [ mmp9 ] ) observed in atherosclerotic lesions 28 and is a prime candidate to mediate possible proatherogenic effects of chlamydia . lps mice fail to respond to lps because of a deficiency in toll - like receptor 4 ( tlr-4 [ 29 , 30 ] ) , a transmembrane protein with homology to the il-1 receptor . the inability of these animals to respond to lps was verified by measurements of plasma tnf in response to lps challenge , and their deficiency in apo e was verified by measurements of plasma cholesterol ( described in materials and methods ) . we observed that development of atherosclerotic lesions in mice fed a high - fat western - type diet was not altered by the deletion of tlr-4 ( fig . further studies showed that plasma cholesterol was also not affected by the absence of tlr-4 ( data not shown ) . this result suggests that responses to gram - negative bacterial products are not critical for murine atherogenesis . to more thoroughly ascertain the role of infectious agents in atherogenesis , we generated a germ - free colony of apo e mice . founder germ - free apo e pups were delivered by caesarian section and reared by germ - free foster mothers . the colony resulting from these founders was maintained germ free : weekly tests showed that no bacteria could be grown from feces , bedding , or swabs of the isolator . in addition , animals chosen at random showed no antibodies against any of several viral pathogens . the absence of intestinal bacteria is known to cause enlargement of the caecum 31 , and dramatically enlarged caeca were observed in all of the animals from the colony . the progress of hyperlipidemia and atherogenesis in germ - free animals was compared with that of a second set of animals taken from the germ - free colony and reared with ambient pathogens . as expected , control apo e animals exhibited extremely high levels of plasma cholesterol and moderately high triglyceride at both 22 and 32 wk of age ( fig . germ - free animals showed an essentially identical plasma lipid profile , and lipid changes are thus unlikely to obscure effects of gnotobiosis on atherogenesis . in both male and female animals , we observed that the exclusion of infectious agents caused no consistent differences in the rate or extent of free cholesterol or cholesteryl ester accumulation in the aorta ( fig . 2c and fig . d ) . we did observe slightly reduced aortic cholesterol ester in the germ - free animals that attained statistical significance at 22 wk of age . however , these small differences disappeared upon correction for reduced body weight observed in the germ - free animals at the 22-wk time point ( 28 0.6 g for germ - free males vs. 34 0.8 g for control males , and 22 .02 g for germ - free females vs. 24 0.6 g for controls ; p = 0.001 ) . the values for aortic cholesteryl ester in germ - free mice were also similar to those seen in a control colony that had never been made germ free ( values in fig . the similarity of atherogenesis in control and germ - free animals was confirmed by histologic examination of the aortic root in animals taken at the 22-wk time point . well - developed lesions with necrotic cores , large foam cells , and fibrous caps were observed in both control and germ - free specimens ( fig . b ) , and neither quantitative nor qualitative differences could be detected in observations of either male or female lesions . a difference in aortic size reflecting the smaller body size of the germ - free animals 31 was readily detected histologically . t cells are found in human and murine atherosclerotic lesions 1223 , suggesting activity of the adaptive immune system . we identified t cells by immunohistochemistry in both control and germ - free animals ( fig . 3c and fig . d ) , indicating that pathogens are not required to drive the influx of t cells into atherosclerotic lesions . the observations presented here indicate that infectious agents , whether bacterial , viral , or fungal , are not necessary for murine atherogenesis . infectious agents do not appear necessary either for initiation or progression of atherosclerosis , nor does the presence of infectious agents alter the morphology or cellular composition of the atherosclerotic lesions . finally , the presence of infectious agents does not appear to alter the pattern of distribution of lesions along the aorta ( not shown ) . rather , it appears that the high - circulating cholesterol levels in the apo e animals are sufficient to initiate and drive atherogenesis . we conclude that koch 's postulates can not be fulfilled for any infectious agent in murine atherosclerosis . atherosclerosis in apo e mice closely resembles that in humans with respect to histology , progression , and dependence on circulating cholesterol 23 , and we may thus speculate that infectious agents may not be necessary for the development of human atherosclerosis . we wish to emphasize that the observations reported here relate to atherogenesis , not to plaque rupture , thrombus formation , or myocardial infarction . it is possible that infectious agents play an important role in one or more of these acute processes . several current studies are seeking to define a role for bacterial infection in human chd by studying endpoints such as myocardial infarction in patients randomized to placebo or antibiotic therapy of varying duration . the largest of these studies to report results thus far has failed to demonstrate a decline in cardiovascular events in the 6 mo after treatment with antibiotic 32 . although our results suggest that pathogens do not serve as etiologic agents for atherosclerosis , they may still have a role in exacerbating the disease . recent reports suggest that inoculation of atherosclerosis - prone mice with high doses of chlamydia may cause an approximately twofold increase in the size of atherosclerotic lesions 3334 . it is important to note that stresses such as infection provoke a set of physiological responses that are uniformly proatherogenic 353637 . these include insulin resistance and hyperglycemia , elevation of plasma triglycerides , elevated white blood cell counts , elevated acute phase reactants ( e.g. , c - reactive protein and fibrinogen ) , and depression of high density lipoprotein ( hdl ) cholesterol levels . it is thus possible that infection may exacerbate atherosclerogenesis , and antibiotics may ameliorate atherogenesis not through the action of an etiologic agent , but through indirect effects on metabolism and known risk factors .

recent work has revealed correlations between bacterial or viral infections and atherosclerotic disease . one particular bacterium , chlamydia pneumoniae , has been observed at high frequency in human atherosclerotic lesions , prompting the hypothesis that infectious agents may be necessary for the initiation or progression of atherosclerosis . to determine if responses to gram - negative bacteria are necessary for atherogenesis , we first bred atherosclerosis - prone apolipoprotein ( apo ) e/ ( deficient ) mice with animals incapable of responding to bacterial lipopolysaccharide . atherogenesis was unaffected in doubly deficient animals . we further tested the role of infectious agents by creating a colony of germ - free apo e/ mice . these animals are free of all microbial agents ( bacterial , viral , and fungal ) . atherosclerosis in germ - free animals was not measurably different from that in animals raised with ambient levels of microbial challenge . these studies show that infection is not necessary for murine atherosclerosis and that , unlike peptic ulcer , koch 's postulates can not be fulfilled for any infectious agent in atherosclerosis .

alcohol dependence is the most prevalent substance use disorder that can lead individuals with the disorder to serious health - related and social problems . according to a report by nutt and colleagues ( 2007 ) , the level of potential harm and risk of alcohol use and misuse was among the top five with heroin and cocaine . the 12-month prevalence of alcohol dependence is reported to be approximately 2% to 6% in the general populations . in part reflecting the high potential harm and high prevalence of alcohol dependence , there have been a number of studies on how chronic alcohol use or alcohol dependence interacts with the structure of the brain of animals and humans . overall brain atrophy , including the lesser volumes of gray matter and white matter with increased cerebrospinal fluid , in patients with alcohol use disorders , has consistently been reported . deficits in the prefrontal cortex , temporal cortex , cerebellum , striatum , hippocampus and amygdala have also been reported in patients with alcohol dependence . neuropathological studies have shown that the alcohol - related neuronal and glial loss would preferentially involve the prefrontal cortex among cortical regions . functional neuroimaging studies demonstrated altered metabolism or activation of the frontal cortex in association with the deteriorated neuropsychological functioning . cortical thickness analysis , a reliable and valid method , can capture important information on cortical structures . durazzo and colleagues exhibited that alcohol - dependent adults had thinner cortical regions in the left anterior cingulate cortex , bilateral frontal cortex , and bilateral insula than healthy controls . other researchers found that alcohol - dependent adults had reduced cortical thickness in the widespread brain regions of the superior frontal , precentral , postcentral , middle frontal , middle and superior temporal , middle temporal , and the lateral occipital cortex than healthy comparison participants . in the report by momenan and colleagues , participants with alcohol dependence exhibited thinner cortical regions that encompass the medial superior frontal cortex , insula , precentral and the precuneus of the right hemisphere as well as the superior frontal gyrus of the left hemisphere , in comparison with the healthy controls . previous studies have reported widespread cortical deficits without covarying out the effects associated with the global atrophy of the brain . among these widespread regions that show alcohol - related atrophy , we wanted to localize the cortical regions that may be particularly vulnerable to alcohol consumption . we therefore undertook the cortical thickness analysis adjusting for the hemispheric average cortical thickness , in 21 detoxified alcohol - dependent patients and matched 22 healthy comparison subjects . the objective of this study was to identify brain regions with cortical thickness alterations that exceed the level of global alterations in alcohol dependence . we used the whole brain - wise cortical thickness analysis , which is validated histologically and with manual outlining method . we also investigated whether the magnitude of deficits are correlated with the alcohol use - related variable . given the studies that suggest the preferential involvement of prefrontal cortex among brain structural and functional alterations in alcohol dependence , we hypothesized that patients with alcohol dependence would have thinner prefrontal cortex in comparison with healthy comparison subjects , after correcting for the global cortical thinning associated with alcohol dependence . patients with alcohol dependence were enrolled from the inpatient unit of the department of neuropsychiatry in a university - affiliated hospital , seoul , south korea . age - matched healthy comparison subjects were recruited from the community via the local advertisement during the same study period . inclusion criteria for alcohol dependence group were ( 1 ) age between 20 and 70 , and ( 2 ) diagnosis of alcohol dependence according to the diagnostic and statistical manual of mental disorders - iv by 2 board - certified psychiatrists . exclusion criteria for both alcohol dependence and control groups were ( 1 ) any symptoms or signs of confusion , major medical disorders including kidney disease and chronic liver disease , and/or malnutrition , ( 2 ) presence or history of neurological disorders , ( 3 ) presence or history of any mental disorders other than alcohol dependence or comorbid depressive disorders , including alcohol - induced persistent dementia , alcohol - induced amnestic disorder , or alcohol withdrawal delirium ( 3 ) history of head injury , and ( 4 ) any contraindications to magnetic resonance imaging ( mri ) such as pace makers , claustrophobia , or metal implants . additional exclusion criteria for control group were ( 1 ) presence or history of mental disorders including alcohol abuse and ( 2 ) current alcohol consumption greater than 14 equivalent standard drinks for men , 7 for women , per time . after being detoxified for 2 weeks , all patients underwent physical examination by a physician and the routine laboratory tests to screen out any major medical disorders . t1 and t2 weighted mr images were obtained using 1.5 tesla siemens whole body scanner . repetition time [ tr]=2,050 ms , echo time [ te]=4.39 ms , inversion time [ ti]=1,100 ms , number of excitation [ nex]=2 , flip angle [ fa]=15 , slice thickness=1.3 mm , field of view [ fov]=180180 mm , acquisition matrix=256180 . t1 weighted images of 7 subjects were obtained with slightly different image acquisition protocol ( tr=1,960 ms , te=4.38 ms , ti=1,100 ms , nex=2 , flip angle [ fa]=15 , slice thickness=1.5 mm , fov=250 x 250 , acquisition matrix=256 x 180 ) . t2 weighted images were acquired in order to screen for gross brain abnormality ( tr=9,710 ms , te=120 ms , nex=2 , flip angle [ fa]=170 , slice thickness=3 mm ) . smoothing processes were conducted using an iterative nearest - neighbor averaging procedure with the full - width half maximum ( fwhm ) 15 mm 2-d gaussian kernel . for calculating statistical difference maps of cortical thickness between alcohol dependence and healthy comparison groups , general linear model ( glm ) with cortical thickness at each vertex as the dependent variable has been used . non - cortical areas of medial wall and corpus callosum were excluded from the model building . hemispheric average cortical thickness was included in the model as a covariate since there was a significant difference in hemispheric average cortical thickness between groups and our aim was to identify the particularly vulnerable cortical regions beyond the global brain atrophy associated with alcohol dependence . 5,000 permutation simulations have been performed with random group - label shuffling , with a threshold for a significant vertex of p<0.05 . clusters with the size that would pass the family - wise error rate correction were considered significant . thickness values of the surface point with highest z values ( local maxima ) within the cluster , where significant group differences of cortical thickness were found , were extracted for post hoc analyses . pair - wise correlations were used to test whether there were associations between the magnitude of cortical thickness deficits in patients with alcohol dependence and the duration of alcohol use . considering the relatively modest sample size , sensitivity analyses to rule out the possibility that the current results may be modulated by other confounding factors such as comorbid depression , anxiety symptoms and scan parameter difference were performed . local maxima thickness values within the cluster extracted as described above were subjected to linear regression models that included the scan parameter difference , the presence of comorbid depression as defined by 19 or more scores on the 17-item hamilton depression rating scale ( hdrs ) , or the presence of anxiety as defined by 40 or more scores on the state - trait anxiety inventory ( stai - t ) as additional covariates . computations were performed using stata version 11 ( stata corp . , college station , tx , usa ) . patients with alcohol dependence were enrolled from the inpatient unit of the department of neuropsychiatry in a university - affiliated hospital , seoul , south korea . age - matched healthy comparison subjects were recruited from the community via the local advertisement during the same study period . inclusion criteria for alcohol dependence group were ( 1 ) age between 20 and 70 , and ( 2 ) diagnosis of alcohol dependence according to the diagnostic and statistical manual of mental disorders - iv by 2 board - certified psychiatrists . exclusion criteria for both alcohol dependence and control groups were ( 1 ) any symptoms or signs of confusion , major medical disorders including kidney disease and chronic liver disease , and/or malnutrition , ( 2 ) presence or history of neurological disorders , ( 3 ) presence or history of any mental disorders other than alcohol dependence or comorbid depressive disorders , including alcohol - induced persistent dementia , alcohol - induced amnestic disorder , or alcohol withdrawal delirium ( 3 ) history of head injury , and ( 4 ) any contraindications to magnetic resonance imaging ( mri ) such as pace makers , claustrophobia , or metal implants . additional exclusion criteria for control group were ( 1 ) presence or history of mental disorders including alcohol abuse and ( 2 ) current alcohol consumption greater than 14 equivalent standard drinks for men , 7 for women , per time . after being detoxified for 2 weeks , all patients underwent physical examination by a physician and the routine laboratory tests to screen out any major medical disorders . t1 and t2 weighted mr images were obtained using 1.5 tesla siemens whole body scanner . repetition time [ tr]=2,050 ms , echo time [ te]=4.39 ms , inversion time [ ti]=1,100 ms , number of excitation [ nex]=2 , flip angle [ fa]=15 , slice thickness=1.3 mm , field of view [ fov]=180180 mm , acquisition matrix=256180 . t1 weighted images of 7 subjects were obtained with slightly different image acquisition protocol ( tr=1,960 ms , te=4.38 ms , ti=1,100 ms , nex=2 , flip angle [ fa]=15 , slice thickness=1.5 mm , fov=250 x 250 , acquisition matrix=256 x 180 ) . t2 weighted images were acquired in order to screen for gross brain abnormality ( tr=9,710 ms , te=120 ms , nex=2 , flip angle [ fa]=170 , slice thickness=3 mm ) . smoothing processes were conducted using an iterative nearest - neighbor averaging procedure with the full - width half maximum ( fwhm ) 15 mm 2-d gaussian kernel . for calculating statistical difference maps of cortical thickness between alcohol dependence and healthy comparison groups , general linear model ( glm ) with cortical thickness at each vertex as the dependent variable has been used . non - cortical areas of medial wall and corpus callosum were excluded from the model building . hemispheric average cortical thickness was included in the model as a covariate since there was a significant difference in hemispheric average cortical thickness between groups and our aim was to identify the particularly vulnerable cortical regions beyond the global brain atrophy associated with alcohol dependence . 5,000 permutation simulations have been performed with random group - label shuffling , with a threshold for a significant vertex of p<0.05 . clusters with the size that would pass the family - wise error rate correction were considered significant . thickness values of the surface point with highest z values ( local maxima ) within the cluster , where significant group differences of cortical thickness were found , were extracted for post hoc analyses . pair - wise correlations were used to test whether there were associations between the magnitude of cortical thickness deficits in patients with alcohol dependence and the duration of alcohol use . considering the relatively modest sample size , sensitivity analyses to rule out the possibility that the current results may be modulated by other confounding factors such as comorbid depression , anxiety symptoms and scan parameter difference were performed . local maxima thickness values within the cluster extracted as described above were subjected to linear regression models that included the scan parameter difference , the presence of comorbid depression as defined by 19 or more scores on the 17-item hamilton depression rating scale ( hdrs ) , or the presence of anxiety as defined by 40 or more scores on the state - trait anxiety inventory ( stai - t ) as additional covariates . computations were performed using stata version 11 ( stata corp . , college station , tx , usa ) . there were no significant differences in age and sex between diagnostic groups ( table 1 ) . patients with alcohol dependence drank alcohol more frequently and more heavily than healthy comparison subjects ( table 1 ) . patients with alcohol dependence had general cortical thinning ( left hemispheric average cortical thickness ( mm ) : 2.440.07 [ healthy comparison subjects ] vs 2.240.27 [ patients with alcohol dependence ] , t=3.35 , p=0.002 ) ( right hemispheric average cortical thickness ( mm ) : 2.450.07 [ healthy comparison subjects ] vs 2.250.23 [ patients with alcohol dependence ] , t=3.77 , p<0.001 ) . in order to identify regionally specific cortical deficits in patients with alcohol dependence compared to healthy comparison subjects , hemispheric average cortical thickness was added as a covariate in the whole brain vertex - wise analysis . in the glm model that includes age and average cortical thickness as covariates , significant cortical thickness deficits in patients with alcohol dependence , compared to healthy comparison subjects , were noted in the left superior frontal cortex , after correcting for multiple comparisons with the permutation method ( fig . 1 ) ( cluster size=1489.5 mm ; number of vertices in the cluster=2,035 ; talairach coordinates = x [ -15.3 ] , y [ 61.8 ] , z [ 5.0 ] ; cluster p value=0.024 ) . given that different scanning parameter may influence on the cortical thickness variations , analysis was re - run with scan parameter as a covariate . when analysis was repeated covarying for comorbid depression that may be associated with thinner prefronto - temporal cortex , the diagnostic group effect remained significant ( p=0.001 ) . when analysis was repeated covarying for comorbid anxiety that may also be associated with thinner prefronto - temporal cortex , the diagnostic group effect remained significant in the left superior frontal cluster ( p=0.017 ) . post hoc correlation analysis between cortical thicknesses in the left superior frontal cluster of significant group difference and duration of alcohol use in alcohol dependence group demonstrated the significant association ( r=-0.55 ; p=0.02 ) ( fig . cortical thicknesses in the left superior frontal cluster was also correlated with the clinical institute withdrawal assessment for alcohol scores ( r=-0.548 , p=0.028 ) . otherwise we found no significant results between cortical thicknesses in the left superior frontal cluster and audit scores ( r=0.048 , p=0.859 ) ; and calculated alcohol use ( alcohol dose x frequency x duration ) ( r=-0.193 , p=0.509 ) . in the current study , we have identified the brain region with altered cortical thickness in patients with alcohol dependence . the region of cortical thickness deficits in patients with alcohol dependence encompassed primarily the superior frontal cortex , after adjusting for the effects on the global cortical atrophy induced by alcohol dependence ( fig . this is consistent with prior reports indicating that chronic alcohol use may have the most detrimental effects on prefrontal cortical regions . the level of n - acetyl aspartate , the viability marker of neurons , was decreased in prefrontal brain regions in chronic alcohol abusers . neuronal and glial loss has consistently been noted in the prefrontal cortical regions , particularly in the superior frontal cortex . alcohol use has been associated with the decreased performances in executive and attention tasks that are important function of the prefrontal cortex . pre - existing vulnerability in these regions may predispose individuals to alcohol dependence , since the function of these regions are to executively control over drug craving and seeking . these regions may be associated with the compulsive substance - related behaviors , which is also in line with our finding that shows the association between duration of alcohol use with the magnitude of the cortical deficits in this region . the current findings do not provide information regarding whether the pre - existing prefrontal cortical deficits have rendered individuals vulnerable to alcohol dependence , whether neurotoxicity of chronic alcohol use , including the oxidative stress , have damaged the cortex , or whether both processes have contributed to the observed findings . supporting evidence for the neurotoxicity as the cause of prefrontal deficits may come from the reports that show patients with longer abstinence have lesser deficits . it has also been suggested that subjects with alcohol dependence may have prefrontal cortex that are less recuperative from toxic effects and may undergo vicious cycle after initial exposure to substances . considering that alcohol dependence can be divided into two subtypes , type 1 more environmentally influenced , and type 2 more genetically induced , a comparison between type 1 and type 2 alcohol dependent patients in a study with larger sample with balanced composition of type 1 and type 2 alcohol dependence may provide an opportunity to approach this question . longitudinal brain imaging study that follows up patients with alcohol dependence would also provide important insights . this study alone does not provide direct information as to cellular level mechanisms that may underlie the observed deficits of the cortical thickness . however , there is a vast literature describing the impact of chronic alcohol on the brain . miguel - hidalgo and colleagues ( 2002 ) reported , in their study with the postmortem brain of alcohol - dependent patients without wernicke or korsakoff syndromes , that the glial pathology of reduced size and density was the most characteristic finding . kril and colleagues ( 1997 ) have shown selective loss of non - gabaergic pyramidal neurons . selective dendritic retraction , rather than cellular death , has been suggested as main pathology related to the volume loss of the gray matter . there is a study that examined the cortical thickness differences in subjects with fetal alcohol syndrome or prenatal alcohol exposure , compared to control subjects , which demonstrated deficits in prefronto - temporo - parietal regions . however , few studies have examined cortical thickness in alcohol - dependent adults . the cortical thickness analysis has been reported to provide information on an important aspect of the gray matter structure , complementary to the conventional volumetry or the vbm . for example , highly folded regions could have high gray matter density in vbm analysis since there would be more voxels of gray matter within a fixed radius , but thinner cortical thickness . this is the first study that used cortical thickness analysis in patients with alcohol dependence excluding comorbid substance use , which showed regionally specific cortical thickness deficits in alcohol dependence . large age range , though covaried in the statistical model , can be another weakness of the study . with the current study of a cross - sectional design , information on whether the observed cortical deficits would be progressive and nicotine dependence , which is highly comorbid with alcohol dependence , has also been reported to be associated with cortical atrophy , particularly that in frontal cortex . now that we neither were able to exclude participants with co - morbid nicotine dependence nor delineate the effects of alcohol dependence from those of nicotine dependence , the current results may have been confounded by the effects of chronic nicotine use . intellectual ability has also been reported to be associated with the prefrontal cortical development . the fact that the intelligence quotient was not included in the statistical model for comparisons of cortical thickness measures , is also an important limitation of the current study . future studies in larger samples with narrow age range and with neuropsychological assessments for the frontal lobe function , would provide valuable information . although there could be challenges in following up patients with alcohol dependence , long - term prospective longitudinal study is also warranted .

alcohol dependence is a serious disorder that can be related with a number of potential health - related and social consequences . cortical thickness measurements would provide important information on the cortical structural alterations in patients with alcohol dependence . twenty - one patients with alcohol dependence and 22 healthy comparison subjects have been recruited and underwent high - resolution brain magnetic resonance ( mr ) imaging and clinical assessments . t1-weighted mr images were analyzed using the cortical thickness analysis program . significantly thinner cortical thickness in patients with alcohol dependence than healthy comparison subjects was noted in the left superior frontal cortical region , correcting for multiple comparisons and adjusting with age and hemispheric average cortical thickness . there was a significant association between thickness in the cluster of the left superior frontal cortex and the duration of alcohol use . the prefrontal cortical region may particularly be vulnerable to chronic alcohol exposure . it is also possible that the pre - existing deficit in this region may have rendered individuals more susceptible to alcohol dependence .

the idea of a constitutively expressed death machinery in each cell has given way to the notion that survival factors repress this machinery and , if such factors are unavailable , cells default into death [ 1 , 2 , 3 ] . this theory is supported by findings showing that many forms of programmed cell death do not require mrna or protein synthesis . in fact , mrna and protein synthesis inhibitors can induce apoptosis , suggesting that in some cases transcriptional activity might actually impede cell death [ 4 , 5 ] . to identify genes that are transcriptionally regulated in cells undergoing apoptosis by survival factor deprivation gene trapping involves introduction of a reporter gene into a random collection of chromosomal sites , including transcriptionally active regions . by selecting for gene expression , recombinants are obtained in which the reporter gene is fused to the regulatory elements of an endogenous gene . transcripts generated by these fusions faithfully reflect the activity of a disrupted cellular gene and serve as a molecular tag to clone any gene linked to a specific function [ 6 , 7 ] . to identify genes that are transiently expressed during a biological process , we developed a strategy , which makes use of the site - specific recombination system cre / loxp . by combining gene trap mutagenesis with site - specific recombination , it is possible to uncouple a trapped cellular promoter from a transduced reporter gene . this enables the recovery of recombinants even in the absence of an active cellular promoter and thus allows selection for integrations into transiently expressed genes [ 8 , 9 ] . we employed this strategy to isolate genes induced in hematopoietic cells ( fdcp1 ) undergoing apoptosis by growth factor withdrawal . briefly , the interleukin-3 ( il-3)-dependent hematopoietic cells ( floxil3 ) expressing a reporter plasmid encoding hsv - thymidine - kinase , neomycin - phosphotransferase and murine il-3 , were transduced with a retroviral gene trap vector carrying coding sequences for cre recombinase ( cre ) in the u3 region . activation of cre expression from integrations into active genes resulted in a permanent switching between the selectable marker genes that converted the floxil3 cells to factor independence . selection for autonomous growth yielded recombinants in which cre sequences in the u3 region were expressed from upstream cellular promoters . as the expression of the marker genes is independent of the trapped cellular promoter , genes could be identified that were transiently induced by il-3 withdrawal ( figure 1 ) . ( a ) u3cre gene trap activation from integrations in genes induced by il-3 withdrawal excises the tkneo fusion gene , which is flanked by loxp sites from the reporter plasmid pgklxtkneoil3 . this places the il-3 cdna immediately downstream of the pgk promoter and enables its expression . cre , cre recombinase ; pol ii , rna polymerase ii ; pgk , phosphoglycerate kinase promoter ; lx , loxp target sequence for cre recombinase ; tkneo , hsv - thymidine - kinase / neomycin - phosphotransferase fusion gene ; pa , bovine growth hormone polyadenylation sequence ; il-3 , murine interleukin-3 cdna . u3cre - infected floxil3 cells were first selected in g418 to eliminate integrations into constitutively expressed genes . the g418-resistant cells were then plated into semisolid ( agar ) cultures in the absence of il-3 . analysis of several recombinants obtained by this method indicated that cells upregulate survival genes before committing to cell death . as a result , cells receiving a transient apoptotic stimulus exhibit improved survival in a growth factor deficient environment . from a floxil3 gene trap integration library consisting of approximately 2 10 unique proviral integrations , we have isolated 125 individual clones that converted to factor independence upon il-3 withdrawal . cellular sequences adjacent to u3cre integration sites ( gene trap sequence tags , gtsts ) were obtained from 102 clones by inverse pcr or 5'race using cre - specific primers . ninety clones yielded informative gtsts ( > 30 nucleotides ) , of which 15 ( 17% ) belonged to known genes , 10 ( 11% ) matched single ests or full cdnas with unknown function and 65 ( 72% ) had no match within the public databases ( figure 2 ) . interestingly , the frequency of unknown genes recovered with this method was significantly higher than that obtained with a standard gene trap protocol and a similar gene trap vector . for example , only 782 ( 46% ) of 1,687 gtsts recovered from embryonic stem ( es ) cells expressing a u3 geo gene trap virus were novel . this difference is consistent with the ability of the cre / loxp approach to enrich for transiently expressed genes that are difficult to isolate by standard methodology and therefore underrepresented in the nucleotide databases . figure 3a shows the structure of the proviral integration sites in the 15 previously characterized genes . like earlier studies involving retroviral gene trap vectors with a reporter gene in the u3 region of the long terminal repeat ( ltr ) , most integrations occurred in or near 5 ' exons , although integrations further downstream were observed occasionally . to confirm transcriptional induction by il-3 withdrawal , polyadenylated rnas were isolated from fdcp1 cells after various intervals of factor deprivation and hybridized on northern blots to gene - specific probes . ( a ) gene trap position in previously characterized genes . gtsts were either obtained by 5'race or inverse genomic pcr . exon / intron boundaries were either available from the databases or were determined by rt - pcr reactions using mrna from fdcp1 cells and exon - specific primers . polyadenylated rnas ( 5 g per lane ) extracted from fdcp1 cells at various intervals following il-3 withdrawal were fractionated on formaldehyde - agarose gels , blotted onto nylon filters and hybridized to p -labeled gene- or exon ( net1)-specific probes . as summarized in table 1 , a significant number of the trapped known genes encode proteins involved in cell growth and survival . for example , the guanine nucleotide exchange factors ( gefs ) for the rho - family gtpases net1 and h - pem2 ( kiaa0424 ) [ 10 , 11 ] belong to a large family of proteins that regulate cell growth and can transform cells in culture . transformation is dependent on the highly conserved dbl homology ( dh ) domain and in most cases requires amino - terminal truncation of the protein [ 13 , 14 ] . interestingly , a novel splice variant of net1 , net1a , which was isolated in these experiments , encodes an amino - terminally truncated protein that is transforming in its native form ( table 1 ) . thus , when overexpressed in nih3t3 fibroblasts , net1a but not net1 produces transformed foci with typical rho morphology ( f.w . and h.v.m . in addition to the dh domain , rho - gefs have a pleckstrin homology domain that connects the rho signal transduction pathway to the phosphatidylinositol-3-phosphate kinase ( pi3 kinase ) signal transduction pathway . the latter is responsible for mediating survival signals , particularly in hematopoietic cells , and is directly activated by il-3 . surprisingly , two members of this pathway , the phosphatidylinositol 4/5 phosphate kinases ( pip5 kinases ) type i ( which corresponds to human pip5 kinase type i ) and type i , were induced by il-3 withdrawal ( table 1 ) . pip5 kinase converts the lipid phosphatidylinositol-4-phosphate to phosphatidylinositol-4,5-phosphate ( pip2 ) , which enhances cell survival by at least three mechanisms . moreover , overexpression of pip5 kinase type i in cultured cells prevents apoptosis induced by caspase 9 or tumor necrosis factor- ( tnf- ) . second , pip2 is phosphorylated by pl3 kinase to give phosphatidylinositol 3,4,5 phosphate ( pip3 ) , which activates the survival kinase akt . akt prevents cell death by phosphorylating and inactivating the proapoptotic proteins bad , caspase 9 and the forkhead family transcription factor fkhrl1 , which induces the expression of fas ligand [ 17 , 18 , 19 , 20 ] . third , pip5 kinase activates atp - dependent potassium channels and thereby helps to maintain the polarity of the cell membrane . as shown previously , apoptotic signals can cause membrane depolarization , which leads to cell death by directly inhibiting potassium channels . summary of previously characterized genes disrupted by gene trap mutagenesis another gene with a putative survival function encodes the cell - cycle - regulated protein p38 - 2g4 ( ebp1 ) . although less well characterized than the above proteins , p38-g4 is absent from go cells and may stimulate cell - cycle progression [ 23 , 24 ] . it includes the il-12 receptor , which inhibits fas - mediated apoptosis in certain types of t lymphocytes and the transcription factor yb-1 , which represses fas gene expression . interestingly , yb-1 also activates the expression of the multidrug resistance gene ( mdr1 ) whose product , the p glycoprotein , is an efflux pump that eliminates a variety of toxins from the cell , including proapoptotic anticancer drugs . similarly cytoprotective is vmat2 , the protein product of the vesicular monoamine transporter gene , which moves cytoplasmic monoamine transmitters into secretory vesicles and prevents cell death by sequestering proapoptotic molecules such as mpp and histamine [ 28 , 29 ] . finally , il-3 withdrawal induced transcription of several dna repair genes . these were the mouse homologs of the bacterial alkb gene and of the yeast rec8 and rad50 genes . while alkb protects dna from damage by alkylating agents , rec8 and rad50 are dna double - strand break repair proteins [ 31 , 32 , 33 ] . only a few genes upregulated by il-3 withdrawal ( 4 out of 15 ) were not directly related to cell death or survival and their induction may reflect some secondary events occurring during apoptosis ( table 1 ) . however , the low frequency with which such genes were recovered underscores the specificity of the gene trap approach . to further study transcriptional regulation during growth factor starvation , we analyzed the expression patterns of a large number of previously characterized genes in fdcp1 cells undergoing apoptosis by il-3 withdrawal using atlas mouse cdna arrays ( clontech ) . atlas arrays contain cdna probes for 588 genes involved in development , oncogenesis , dna repair , tumor suppression and apoptosis . figure 4a shows that of the 588 genes displayed on the arrays , only 12 were differentially expressed after factor deprivation . differential expression of these genes was reproducible in independent array experiments and could be confirmed by northern blotting ( figure 4c ) . ( a ) comparative atlas array hybridization with cdna probes derived from fdcp1 cells after 0 h ( left ) and 2 h ( right ) of il-3 deprivation . filters were scanned with a phosphoimager ( molecular dynamics ) and analyzed with the atlasimage 1.5 software . ( b ) relative changes in gene expression on a log scale . 1 , no regulation ; > 1 , upregulation ; < 1 , downregulation . note that the apparent downregulation of bcl-2 could not be confirmed on northern blots . induction of c - kit and chop10 ( asterisked ) was observed only on arrays hybridized to cdna recovered from cells after 8 h of factor deprivation . ( c ) northern blot analysis of transcripts identified as differentially expressed by the atlasimage 1.5 software . poly(a ) rna ( 2.5 g ) prepared after 0 , 2 , 4 , 6 and 8 h of il-3 deprivation was fractionated on formaldehyde gels , blotted onto nylon filters and hybridized with p - labeled gene - specific probes . similar to the trapping results , several genes with survival functions were upregulated in the absence of il-3 . among these were the survival kinase akt , the c - kit receptor tyrosine kinase , the potent inhibitor of apoptosis flipl , and the il-3-receptor itself [ 34 , 35 , 36 ] . moreover , survival functions seemed to be strengthened by the transient downregulation of the proapoptotic activin receptor [ 37 , 38 ] . in confirmation of previous results , however , the expression of several survival genes appeared il-3 dependent . thus , transcripts for antiapoptotic pim-1 , c - myc and bcl - xl proteins were repressed in the absence of il-3 . finally , only two genes with arguably proapoptotic functions ( that is , jund and chop10 ) were upregulated in these experiments ( figure 4c ) . taken together , the gene trap and cdna array results suggested that the transcriptional changes at the onset of apoptosis should favor cell survival rather than cell death . the activation of protective mechanisms during the early stages of programmed cell death suggested that a transient exposure to an apoptotic stimulus might be favorable for cell survival . accordingly , a transient factor deprivation should , by upregulating anti - apoptotic gene expression , reduce the fdcp1 cell 's need for il-3 . to test this , we evaluated the ability of il-3-deprived and non - deprived cells to form colonies in agar cultures that contained suboptimal amounts of il-3 . figure 5a shows that cells pre - exposed to factor deprivation generated significantly more colonies than their non - exposed counterparts , indicating that survival mechanisms were induced by factor deprivation . whereas growth stimulation was highest in cultures containing il-3 at concentrations that normally fail to support colony formation , it gradually subsided with prolonged il-3 deprivation . after incubation for 0 , 1 , 2 and 4 h , il-3 was added at the indicated concentrations . 1 10 cells were deprived of il-3 for 1 and 2 h , respectively . after re - adding il-3 for 4 h , cells were washed and incubated without il-3 . after 6 , 9 and 12 h factor deprivation , the cells were stained with annexin and the frequency of apoptotic cells was estimated by flow cytometry . , we directly tested whether cells pre - exposed to factor deprivation develop increased apoptotic tolerance to subsequent factor starvation . to this end , il-3 was initially withdrawn from fdcp1 cells for 1 or 2 hours . subsequently , il-3 was re - added for 4 hours only to be removed again for 6 , 9 and 12 hours . at these time points cells figure 5b shows that pretreated cells died significantly more slowly that their non - pretreated counterparts , indicating that apoptotic prestimulation increases resistance to factor deprivation . like the clonal survival assays , the cell protective effect was highest after a prestimulation of 2 hours . on the basis of these results , we conclude that cell protective mechanisms are activated following growth factor withdrawal and transiently prevail prior to irreversible commitment to death . from a floxil3 gene trap integration library consisting of approximately 2 10 unique proviral integrations , we have isolated 125 individual clones that converted to factor independence upon il-3 withdrawal . cellular sequences adjacent to u3cre integration sites ( gene trap sequence tags , gtsts ) were obtained from 102 clones by inverse pcr or 5'race using cre - specific primers . ninety clones yielded informative gtsts ( > 30 nucleotides ) , of which 15 ( 17% ) belonged to known genes , 10 ( 11% ) matched single ests or full cdnas with unknown function and 65 ( 72% ) had no match within the public databases ( figure 2 ) . interestingly , the frequency of unknown genes recovered with this method was significantly higher than that obtained with a standard gene trap protocol and a similar gene trap vector . for example , only 782 ( 46% ) of 1,687 gtsts recovered from embryonic stem ( es ) cells expressing a u3 geo gene trap virus were novel . this difference is consistent with the ability of the cre / loxp approach to enrich for transiently expressed genes that are difficult to isolate by standard methodology and therefore underrepresented in the nucleotide databases . figure 3a shows the structure of the proviral integration sites in the 15 previously characterized genes . like earlier studies involving retroviral gene trap vectors with a reporter gene in the u3 region of the long terminal repeat ( ltr ) , most integrations occurred in or near 5 ' exons , although integrations further downstream were observed occasionally . to confirm transcriptional induction by il-3 withdrawal , polyadenylated rnas were isolated from fdcp1 cells after various intervals of factor deprivation and hybridized on northern blots to gene - specific probes . ( a ) gene trap position in previously characterized genes . gtsts were either obtained by 5'race or inverse genomic pcr . exon / intron boundaries were either available from the databases or were determined by rt - pcr reactions using mrna from fdcp1 cells and exon - specific primers . polyadenylated rnas ( 5 g per lane ) extracted from fdcp1 cells at various intervals following il-3 withdrawal were fractionated on formaldehyde - agarose gels , blotted onto nylon filters and hybridized to p -labeled gene- or exon ( net1)-specific probes . as summarized in table 1 , a significant number of the trapped known genes encode proteins involved in cell growth and survival . for example , the guanine nucleotide exchange factors ( gefs ) for the rho - family gtpases net1 and h - pem2 ( kiaa0424 ) [ 10 , 11 ] belong to a large family of proteins that regulate cell growth and can transform cells in culture . transformation is dependent on the highly conserved dbl homology ( dh ) domain and in most cases requires amino - terminal truncation of the protein [ 13 , 14 ] . interestingly , a novel splice variant of net1 , net1a , which was isolated in these experiments , encodes an amino - terminally truncated protein that is transforming in its native form ( table 1 ) . thus , when overexpressed in nih3t3 fibroblasts , net1a but not net1 produces transformed foci with typical rho morphology ( f.w . and h.v.m . , unpublished data ) . in addition to the dh domain , rho - gefs have a pleckstrin homology domain that connects the rho signal transduction pathway to the phosphatidylinositol-3-phosphate kinase ( pi3 kinase ) signal transduction pathway . the latter is responsible for mediating survival signals , particularly in hematopoietic cells , and is directly activated by il-3 . surprisingly , two members of this pathway , the phosphatidylinositol 4/5 phosphate kinases ( pip5 kinases ) type i ( which corresponds to human pip5 kinase type i ) and type i , were induced by il-3 withdrawal ( table 1 ) . pip5 kinase converts the lipid phosphatidylinositol-4-phosphate to phosphatidylinositol-4,5-phosphate ( pip2 ) , which enhances cell survival by at least three mechanisms . moreover , overexpression of pip5 kinase type i in cultured cells prevents apoptosis induced by caspase 9 or tumor necrosis factor- ( tnf- ) . second , pip2 is phosphorylated by pl3 kinase to give phosphatidylinositol 3,4,5 phosphate ( pip3 ) , which activates the survival kinase akt . akt prevents cell death by phosphorylating and inactivating the proapoptotic proteins bad , caspase 9 and the forkhead family transcription factor fkhrl1 , which induces the expression of fas ligand [ 17 , 18 , 19 , 20 ] . third , pip5 kinase activates atp - dependent potassium channels and thereby helps to maintain the polarity of the cell membrane . as shown previously , apoptotic signals can cause membrane depolarization , which leads to cell death by directly inhibiting potassium channels . summary of previously characterized genes disrupted by gene trap mutagenesis another gene with a putative survival function encodes the cell - cycle - regulated protein p38 - 2g4 ( ebp1 ) . although less well characterized than the above proteins , p38-g4 is absent from go cells and may stimulate cell - cycle progression [ 23 , 24 ] . it includes the il-12 receptor , which inhibits fas - mediated apoptosis in certain types of t lymphocytes and the transcription factor yb-1 , which represses fas gene expression . interestingly , yb-1 also activates the expression of the multidrug resistance gene ( mdr1 ) whose product , the p glycoprotein , is an efflux pump that eliminates a variety of toxins from the cell , including proapoptotic anticancer drugs . similarly cytoprotective is vmat2 , the protein product of the vesicular monoamine transporter gene , which moves cytoplasmic monoamine transmitters into secretory vesicles and prevents cell death by sequestering proapoptotic molecules such as mpp and histamine [ 28 , 29 ] . finally , il-3 withdrawal induced transcription of several dna repair genes . these were the mouse homologs of the bacterial alkb gene and of the yeast rec8 and rad50 genes . while alkb protects dna from damage by alkylating agents , rec8 and rad50 are dna double - strand break repair proteins [ 31 , 32 , 33 ] . only a few genes upregulated by il-3 withdrawal ( 4 out of 15 ) were not directly related to cell death or survival and their induction may reflect some secondary events occurring during apoptosis ( table 1 ) . however , the low frequency with which such genes were recovered underscores the specificity of the gene trap approach . to further study transcriptional regulation during growth factor starvation , we analyzed the expression patterns of a large number of previously characterized genes in fdcp1 cells undergoing apoptosis by il-3 withdrawal using atlas mouse cdna arrays ( clontech ) . atlas arrays contain cdna probes for 588 genes involved in development , oncogenesis , dna repair , tumor suppression and apoptosis . figure 4a shows that of the 588 genes displayed on the arrays , only 12 were differentially expressed after factor deprivation . differential expression of these genes was reproducible in independent array experiments and could be confirmed by northern blotting ( figure 4c ) . ( a ) comparative atlas array hybridization with cdna probes derived from fdcp1 cells after 0 h ( left ) and 2 h ( right ) of il-3 deprivation . filters were scanned with a phosphoimager ( molecular dynamics ) and analyzed with the atlasimage 1.5 software . ( b ) relative changes in gene expression on a log scale . 1 , no regulation ; > 1 , upregulation ; < 1 , downregulation . note that the apparent downregulation of bcl-2 could not be confirmed on northern blots . induction of c - kit and chop10 ( asterisked ) was observed only on arrays hybridized to cdna recovered from cells after 8 h of factor deprivation . ( c ) northern blot analysis of transcripts identified as differentially expressed by the atlasimage 1.5 software . poly(a ) rna ( 2.5 g ) prepared after 0 , 2 , 4 , 6 and 8 h of il-3 deprivation was fractionated on formaldehyde gels , blotted onto nylon filters and hybridized with p - labeled gene - specific probes . similar to the trapping results , several genes with survival functions were upregulated in the absence of il-3 . among these were the survival kinase akt , the c - kit receptor tyrosine kinase , the potent inhibitor of apoptosis flipl , and the il-3-receptor itself [ 34 , 35 , 36 ] . moreover , survival functions seemed to be strengthened by the transient downregulation of the proapoptotic activin receptor [ 37 , 38 ] . in confirmation of previous results , however , the expression of several survival genes appeared il-3 dependent . thus , transcripts for antiapoptotic pim-1 , c - myc and bcl - xl proteins were repressed in the absence of il-3 . finally , only two genes with arguably proapoptotic functions ( that is , jund and chop10 ) were upregulated in these experiments ( figure 4c ) . taken together , the gene trap and cdna array results suggested that the transcriptional changes at the onset of apoptosis should favor cell survival rather than cell death . the activation of protective mechanisms during the early stages of programmed cell death suggested that a transient exposure to an apoptotic stimulus might be favorable for cell survival . accordingly , a transient factor deprivation should , by upregulating anti - apoptotic gene expression , reduce the fdcp1 cell 's need for il-3 . to test this , we evaluated the ability of il-3-deprived and non - deprived cells to form colonies in agar cultures that contained suboptimal amounts of il-3 . figure 5a shows that cells pre - exposed to factor deprivation generated significantly more colonies than their non - exposed counterparts , indicating that survival mechanisms were induced by factor deprivation . whereas growth stimulation was highest in cultures containing il-3 at concentrations that normally fail to support colony formation , it gradually subsided with prolonged il-3 deprivation . after incubation for 0 , 1 , 2 and 4 h , il-3 was added at the indicated concentrations . 1 10 cells were deprived of il-3 for 1 and 2 h , respectively . after re - adding il-3 for 4 h , cells were washed and incubated without il-3 . after 6 , 9 and 12 h factor deprivation , the cells were stained with annexin and the frequency of apoptotic cells was estimated by flow cytometry . , we directly tested whether cells pre - exposed to factor deprivation develop increased apoptotic tolerance to subsequent factor starvation . to this end subsequently , il-3 was re - added for 4 hours only to be removed again for 6 , 9 and 12 hours . at these time points cells were stained with annexin and apoptosis was quantified by flow cytometry . figure 5b shows that pretreated cells died significantly more slowly that their non - pretreated counterparts , indicating that apoptotic prestimulation increases resistance to factor deprivation . like the clonal survival assays , the cell protective effect was highest after a prestimulation of 2 hours . on the basis of these results , we conclude that cell protective mechanisms are activated following growth factor withdrawal and transiently prevail prior to irreversible commitment to death . a gene trap strategy was used to identify genes induced in hematopoietic cells undergoing apoptosis by growth factor withdrawal . this approach enables identification of transiently expressed genes that are difficult to isolate by standard methodology . a comparatively large proportion of unknown genes were recovered , which underscores the strategy 's potential for isolating novel genes . in contrast to conventional gene trapping , which tags and disrupts random genes , the cre / loxp approach allows enrichment for genes induced by specific biological stimuli . as most regulatory genes are expressed in a temporally and spatially restricted manner , we believe that the combination of gene trap mutagenesis and site - specific recombination provides a sound alternative for functional gene analysis in the post - genomic era . as judged by the small fraction of recombinants recovered after growth factor deprivation ( that is , 124 of 2 10 or 0.006% ) and by the identity of the trapped known genes , the strategy seems highly specific for regulatory genes induced during programmed cell death . accordingly , the majority of genes upregulated by il-3 withdrawal were associated with cell death and survival . although this was similar on the cdna arrays , the differentially expressed genes recovered with the two methods were quite different . thus , with the exception of yb1 and rad50 , none of the genes displayed on the arrays were tagged by gene trap mutagenesis . moreover , yb1 and rad50 , despite being recovered in the gene trap approach as induced by il-3 withdrawal , appeared constitutively expressed or even downregulated on both arrays and northern blots , respectively ( figures 3,4 ) . first , the integration library used here covered only 25% of the genome . as only seven genes were induced on the arrays ( those encoding akt , il-3 receptor , glutathione - s - transferase , flipl , c - kit , jund and chop10 ) their recovery from an unsaturated library was unlikely . second , transient gene trapping as opposed to cdna hybridization has no bias towards highly expressed genes . third , the gene trap strategy selects for real gene inductions and , unlike the arrays and northern blots , is independent of pre - existing steady - state mrna levels subjected to post - transcriptional regulation . taken together , these considerations suggest that for the functional analysis of the mammalian genome , gene trapping effectively complements cdna - based strategies , including cdna arrays , which are unable to distinguish between transcriptional and/or post - transcriptional changes in gene expression . in terms of apoptosis whereas in most cells conflicts between prosurvival and apoptotic signals are carried out post - translationally by well characterized proteins ( for example , bcl-2 family members , caspases ) , there is increasing evidence for transcriptional regulators of apoptosis capable of tilting the balance between the constitutively expressed pro- and anti - apoptotic proteins [ 20 , 41 ] . these transcriptional regulators of apoptosis - still largely unknown - are likely to confer tissue specificity on the apoptotic process . the identity of such regulators is of considerable interest as they could provide valuable targets for prospective anti - neoplastic and/or anti - degenerative drugs . most genes identified in this study encode cell protective and/or pro - survival functions . in line with this , the biological experiments described here have shown such functions to materialize in cells exposed to apoptotic prestimulation . accordingly , cells receiving stimulation exhibited improved survival and reduced apoptosis in a growth factor deprived environment . interestingly , a similar cytoprotective phenomenon known as ischemic preconditioning has been observed in animal models . in this , a short , sublethal period of ischemia induces profound resistance to subsequent ischemic events . thus , induction of anti - apoptotic gene expression prior to a lethal stimulus seems to raise the threshold required for that stimulus to be effective . this provides an additional safety mechanism that can prevent unwanted loss of cells exposed only accidentally to apoptotic stimulation . in summary , the present experiments have shown that hematopoietic cells undergoing apoptosis by il-3 withdrawal activate survival genes that do impede cell death . this suggests that apoptosis in hematopoietic cells is the end result of a conflict between death and survival signals , rather than a simple death by default . inverse pcr from genomic dnas was performed using the cre - specific primers described previously and a combination of the blunt end restriction enzymes sspi and hincii . 5'race was performed with 1 g of total rna using the 5'race kit from gibco - brl and the manufacturer 's instructions . amplification reactions were performed in a perkin elmer thermocycler and cloned into the p - gemt - vector ( promega ) as described previously . fdcp1 cells were propagated at concentrations of 2 10 cells / ml in dulbecco 's modified eagle 's medium ( dmem ; gibco ) , supplemented with 10% ( v / v ) fetal bovine serum ( boehringer - mannheim ) and 5 ng / ml recombinant mouse il-3 ( peprotech ) unless indicated otherwise . agar cultures were an equal volume mixture of double - strength dmem supplemented with 40% ( v / v ) fetal bovine serum and 0.6% ( w / v ) bacto - agar ( difco ) in double distilled water as previously described . apoptosis was measured in a facscan flow cytometer after staining the cells with annexin using the annexin - v - fluos detection kit ( roche ) and the manufacturer 's instructions . poly(a ) rna samples from fdcp-1 cells were reverse transcribed in the presence of p - labeled datp and hybridized to atlas mouse cdna expression array ( clontech ) according to the manufacturer 's instructions . filters were scanned with a phosphoimager ( molecular dynamics ) and analyzed with the atlasimagetm 1.5 software ( clontech ) . for northern blots , 2.5 g of poly(a ) was fractionated in 1% formaldehyde - agarose gels , transferred onto hybond n membranes ( amersham ) and hybridized to specific p - dctp - labeled probes produced by random priming ( rediprime , amersham ) . cellular sequences adjacent to proviral integrations ( gene trap sequence tags ; gtsts ) were searched in the ncbi / nih genomic databases using the blastn algorithm . inverse pcr from genomic dnas was performed using the cre - specific primers described previously and a combination of the blunt end restriction enzymes sspi and hincii . 5'race was performed with 1 g of total rna using the 5'race kit from gibco - brl and the manufacturer 's instructions . amplification reactions were performed in a perkin elmer thermocycler and cloned into the p - gemt - vector ( promega ) as described previously . fdcp1 cells were propagated at concentrations of 2 10 cells / ml in dulbecco 's modified eagle 's medium ( dmem ; gibco ) , supplemented with 10% ( v / v ) fetal bovine serum ( boehringer - mannheim ) and 5 ng / ml recombinant mouse il-3 ( peprotech ) unless indicated otherwise . agar cultures were an equal volume mixture of double - strength dmem supplemented with 40% ( v / v ) fetal bovine serum and 0.6% ( w / v ) bacto - agar ( difco ) in double distilled water as previously described . apoptosis was measured in a facscan flow cytometer after staining the cells with annexin using the annexin - v - fluos detection kit ( roche ) and the manufacturer 's instructions . poly(a ) rna samples from fdcp-1 cells were reverse transcribed in the presence of p - labeled datp and hybridized to atlas mouse cdna expression array ( clontech ) according to the manufacturer 's instructions . filters were scanned with a phosphoimager ( molecular dynamics ) and analyzed with the atlasimagetm 1.5 software ( clontech ) . for northern blots , 2.5 g of poly(a ) was fractionated in 1% formaldehyde - agarose gels , transferred onto hybond n membranes ( amersham ) and hybridized to specific p - dctp - labeled probes produced by random priming ( rediprime , amersham ) . cellular sequences adjacent to proviral integrations ( gene trap sequence tags ; gtsts ) were searched in the ncbi / nih genomic databases using the blastn algorithm . this work was supported in part by grants from deutsche krebshilfe and the deutsche forschungsgemeinschaft , bonn to h.v.m and by schering ag , berlin .

backgroundthe existence of a constitutively expressed machinery for death in individual cells has led to the notion that survival factors repress this machinery and , if such factors are unavailable , cells die by default . in many cells , however , mrna and protein synthesis inhibitors induce apoptosis , suggesting that in some cases transcriptional activity might actually impede cell death . to identify transcriptional mechanisms that interfere with cell death and survival , we combined gene trap mutagenesis with site - specific recombination ( cre / loxp system ) to isolate genes from cells undergoing apoptosis by growth factor deprivation.resultsfrom an integration library consisting of approximately 2 106 unique proviral integrations obtained by infecting the interleukin-3 ( il-3)-dependent hematopoietic cell line - floxil3 - with u3cre gene trap virus , we have isolated 125 individual clones that converted to factor independence upon il-3 withdrawal . of 102 cellular sequences adjacent to u3cre integration sites , 17% belonged to known genes , 11% matched single expressed sequence tags ( ests ) or full cdnas with unknown function and 72% had no match within the public databases . most of the known genes recovered in this analysis encoded proteins with survival functions.conclusionswe have shown that hematopoietic cells undergoing apoptosis after withdrawal of il-3 activate survival genes that impede cell death . this results in reduced apoptosis and improved survival of cells treated with a transient apoptotic stimulus . thus , apoptosis in hematopoietic cells is the end result of a conflict between death and survival signals , rather than a simple death by default .

deep venous thrombosis ( dvt ) is a common condition that affects approximately 1 in 1000 persons / year . dvt has a prevalence of 10.5 - 11.9% in patients who are admitted in intensive care unit ( icu ) among indian patients . upper limb dvt is increasingly being recognized as a clinical entity with potential for considerable morbidity . it usually refers to thrombosis of the axillary or subclavian veins , occurs spontaneously or sometimes develops as a complication of pacemaker use , long - term central venous catheter ( cvc ) use , or cancer . approximately , 10% of all cases of deep - vein thrombosis involve the upper extremities , resulting in an annual incidence of 0.4 - 1 case/10,000 people . here , we are presenting two cases who had developed upper limb dvt while resolving phase of their sepsis with reactive thrombocytosis . a 37-year - old man referred to our icu with acute respiratory distress syndrome ( ards ) and septic shock on the 23 day of his illness . he had h1n1 influenza viral infection , confirmed by reverse transcription polymerase chain reaction method . at admission , vitals were : heart rate 140/min , blood pressure ( mean ) 70 mmhg on noradrenaline infusion ( 20 g / min ) . his ventilatory requirement was positive end - expiratory pressure ( peep ) of 14 cm h2o and fio2 of 0.70 with pao2/fio2(p / f ) ratio 160 . his laboratory parameters on admission was hemoglobin 12 g / dl , total leukocyte count ( tlc ) 18,000 and platelet count of 165 ( 10/l ) . before admission , he had platelet count ranging from 83 to 163 ( 10/l ) . lung protective ventilation was continued and prone position ventilation sessions were given to improve p / f ratios . by day 7 of icu stay his hemodynamics improved with no further need of vasopressor . during follow - up , he had thrombocytosis during 2 week ( 622 - 707 10/l ) . he was receiving dvt prophylaxis in appropriate doses . on day 14 of his stay swelling , was noted in the right upper limb . bedside doppler ultrasonography of bilateral jugular veins revealed thrombosed right internal jugular vein ( ijv ) suggestive of acute thrombus with no flow along entire length of cervical ijv extending into right subclavian vein . magnetic resonance imaging venogram confirmed the findings ; and thromboelastography ( teg ) was done , which showed hypercoagulability [ figure 1 ] . he was started on injection enoxaparin 60 mg subcutaneous 12 hourly , with antiplatelet ( aspirin ) . later on , he had an uneventful course in the icu and was discharged on oral anti - coagulant . the thrombus had recanalized with no residual limb edema and his platelet counts were back to normal . ( a ) the magnetic resonance venogram depicting thrombus in right internal jugular vein extending to right subclavian vein . ( b ) thromboelastogram showing hypercoagulability the second case is about a 29-year - old male patient who was admitted on the 12 day of his illness with acute viral encephalitis . on admission in icu , vitals were : heart rate 110/min , mean blood pressure 82 mm of hg ( on noradrenaline infusion 10 g / min ) . he required ventilatory support due to encephalopathy , and kept on synchronized intermittent mandatory ventilation mode with peep of 6 of cm h2o . his arterial blood gas showed ph 7.34 , po2100 mmhg and pco242 mmhg on fio2 of 0.4 with p / f ratios around 250 . he was fluid resuscitated along with other supportive care , which resulted in improvement in shock and stopping of vasopressor within 48 h of admission . his laboratory parameters were hemoglobin 10 g / dl , tlc 13,000 , platelet 140 ( 10/l ) , creatinine 0.7 mg / dl . he continued to stay in the icu in the view of difficult weaning due to his muscle weakness . he showed persistent thrombocytosis ( 537 - 827 10/l ) after 2 weeks of admission . on day 46 in icu swelling was noted in his right arm . doppler of his upper limb showed evidence of thrombosis in both right subclavian vein and right ijv [ figure 2 ] . he was started on therapeutic doses of low molecular weight heparin along with aspirin . in at follow - up after 1-month , his thrombosis gradually resolved with recanalization of the vein , decrease in limb edema , and he is still on oral anti - coagulant . ( a ) doppler ultrasonography showing thrombus in right internal jugular vein with no flow . a 37-year - old man referred to our icu with acute respiratory distress syndrome ( ards ) and septic shock on the 23 day of his illness . he had h1n1 influenza viral infection , confirmed by reverse transcription polymerase chain reaction method . at admission , vitals were : heart rate 140/min , blood pressure ( mean ) 70 mmhg on noradrenaline infusion ( 20 g / min ) . his ventilatory requirement was positive end - expiratory pressure ( peep ) of 14 cm h2o and fio2 of 0.70 with pao2/fio2(p / f ) ratio 160 . his laboratory parameters on admission was hemoglobin 12 g / dl , total leukocyte count ( tlc ) 18,000 and platelet count of 165 ( 10/l ) . before admission , he had platelet count ranging from 83 to 163 ( 10/l ) . lung protective ventilation was continued and prone position ventilation sessions were given to improve p / f ratios . by day 7 of icu stay his hemodynamics improved with no further need of vasopressor . during follow - up , he had thrombocytosis during 2 week ( 622 - 707 10/l ) . he was receiving dvt prophylaxis in appropriate doses . on day 14 of his stay swelling , was noted in the right upper limb . bedside doppler ultrasonography of bilateral jugular veins revealed thrombosed right internal jugular vein ( ijv ) suggestive of acute thrombus with no flow along entire length of cervical ijv extending into right subclavian vein . magnetic resonance imaging venogram confirmed the findings ; and thromboelastography ( teg ) was done , which showed hypercoagulability [ figure 1 ] . he was started on injection enoxaparin 60 mg subcutaneous 12 hourly , with antiplatelet ( aspirin ) . later on , he had an uneventful course in the icu and was discharged on oral anti - coagulant . the thrombus had recanalized with no residual limb edema and his platelet counts were back to normal . ( a ) the magnetic resonance venogram depicting thrombus in right internal jugular vein extending to right subclavian vein . ( b ) thromboelastogram showing hypercoagulability the second case is about a 29-year - old male patient who was admitted on the 12 day of his illness with acute viral encephalitis . on admission in icu , vitals were : heart rate 110/min , mean blood pressure 82 mm of hg ( on noradrenaline infusion 10 g / min ) . he required ventilatory support due to encephalopathy , and kept on synchronized intermittent mandatory ventilation mode with peep of 6 of cm h2o . his arterial blood gas showed ph 7.34 , po2100 mmhg and pco242 mmhg on fio2 of 0.4 with p / f ratios around 250 . he was fluid resuscitated along with other supportive care , which resulted in improvement in shock and stopping of vasopressor within 48 h of admission . his laboratory parameters were hemoglobin 10 g / dl , tlc 13,000 , platelet 140 ( 10/l ) , creatinine 0.7 mg / dl . he continued to stay in the icu in the view of difficult weaning due to his muscle weakness . he showed persistent thrombocytosis ( 537 - 827 10/l ) after 2 weeks of admission . on day 46 in icu swelling was noted in his right arm . doppler of his upper limb showed evidence of thrombosis in both right subclavian vein and right ijv [ figure 2 ] . he was started on therapeutic doses of low molecular weight heparin along with aspirin . in at follow - up after 1-month , his thrombosis gradually resolved with recanalization of the vein , decrease in limb edema , and he is still on oral anti - coagulant . ( a ) doppler ultrasonography showing thrombus in right internal jugular vein with no flow . a 37-year - old man referred to our icu with acute respiratory distress syndrome ( ards ) and septic shock on the 23 day of his illness . he had h1n1 influenza viral infection , confirmed by reverse transcription polymerase chain reaction method . at admission , vitals were : heart rate 140/min , blood pressure ( mean ) 70 mmhg on noradrenaline infusion ( 20 g / min ) . his ventilatory requirement was positive end - expiratory pressure ( peep ) of 14 cm h2o and fio2 of 0.70 with pao2/fio2(p / f ) ratio 160 . his laboratory parameters on admission was hemoglobin 12 g / dl , total leukocyte count ( tlc ) 18,000 and platelet count of 165 ( 10/l ) . before admission , he had platelet count ranging from 83 to 163 ( 10/l ) . lung protective ventilation was continued and prone position ventilation sessions were given to improve p / f ratios . by day 7 of icu stay his hemodynamics improved with no further need of vasopressor . during follow - up , he had thrombocytosis during 2 week ( 622 - 707 10/l ) . he was receiving dvt prophylaxis in appropriate doses . on day 14 of his stay swelling , was noted in the right upper limb . bedside doppler ultrasonography of bilateral jugular veins revealed thrombosed right internal jugular vein ( ijv ) suggestive of acute thrombus with no flow along entire length of cervical ijv extending into right subclavian vein . magnetic resonance imaging venogram confirmed the findings ; and thromboelastography ( teg ) was done , which showed hypercoagulability [ figure 1 ] . he was started on injection enoxaparin 60 mg subcutaneous 12 hourly , with antiplatelet ( aspirin ) . later on , he had an uneventful course in the icu and was discharged on oral anti - coagulant . the thrombus had recanalized with no residual limb edema and his platelet counts were back to normal . ( a ) the magnetic resonance venogram depicting thrombus in right internal jugular vein extending to right subclavian vein . the second case is about a 29-year - old male patient who was admitted on the 12 day of his illness with acute viral encephalitis . on admission in icu , vitals were : heart rate 110/min , mean blood pressure 82 mm of hg ( on noradrenaline infusion 10 g / min ) . he required ventilatory support due to encephalopathy , and kept on synchronized intermittent mandatory ventilation mode with peep of 6 of cm h2o . his arterial blood gas showed ph 7.34 , po2100 mmhg and pco242 mmhg on fio2 of 0.4 with p / f ratios around 250 . he was fluid resuscitated along with other supportive care , which resulted in improvement in shock and stopping of vasopressor within 48 h of admission . his laboratory parameters were hemoglobin 10 g / dl , tlc 13,000 , platelet 140 ( 10/l ) , creatinine 0.7 mg / dl . he continued to stay in the icu in the view of difficult weaning due to his muscle weakness . he showed persistent thrombocytosis ( 537 - 827 10/l ) after 2 weeks of admission . on day 46 in icu swelling was noted in his right arm . doppler of his upper limb showed evidence of thrombosis in both right subclavian vein and right ijv [ figure 2 ] . he was started on therapeutic doses of low molecular weight heparin along with aspirin . in at follow - up after 1-month , his thrombosis gradually resolved with recanalization of the vein , decrease in limb edema , and he is still on oral anti - coagulant . ( a ) doppler ultrasonography showing thrombus in right internal jugular vein with no flow . thrombocytosis , that is , platelet count more than 450 10/l , can be primary or reactive ( secondary ) in etiology . reactive thrombocytosis is common and reported in various conditions such as inflammation , postsplenectomy , hematopoietic disorder , surgery and cancer . in these conditions , elevated endogenous levels of interleukin-6 ( il-6 ) , interferon gamma ( ifn- ) are responsible for the thrombocytosis . il-6 contributes to inflammatory thrombopoiesis predominantly by stimulating the hepatic production of thrombopoietin ( tpo ) ; while , ifn- has its effect on megakaryocytes growth . furthermore , there is enhanced production of tpo , messenger ribonucleic acid and protein by stimulation of hepatocytes with il-6 . in icu patients ' thrombocytosis is a commonly seen phenomenon , it 's found in nearly 21% of patients admitted to an icu . due to relatively lesser platelet count and smaller mean platelet volume , pathologic thrombus is not so common in reactive thrombocytosis in comparison to primary thrombocytosis ; unless it is aggravated by underlying disease process or any condition peculiar to the patient , e.g. arthrosclerosis . in the pathogenesis of dvt of upper extremity , presence of the indwelling catheter ( cvcs , pacemaker , or defibrillator leads ) , cancer , surgery or trauma of the arm or shoulder are common and major risk factors . the prevalence of cvc - related upper limb dvt in cancer patients varies from 11.7% to 44% . in presented both cases , cvc were inserted in both neck vessels ( ijv and subclavian vein ) before diagnosis of dvt , and were not inserted after diagnosis of thrombosis and managed with catheter in the femoral vein . presented both cases , though patients had a risk factor of having cvcs previously at the site of thrombosis ; the association of increased platelet count can not be ruled out in pathogenesis of thrombosis . in further evaluation , teg had increased maximum amplitude : 77.8 mm in the first patient and 78.1 mm in the second patient with a reference range 5166 mm . the angle was within normal limits depicting that the hypercoagulability is due to platelet and not enzyme activity . after the detection of dvt these patients were given the therapeutic doses of anti - coagulant for dvt along with anti - platelet ( aspirin ) . there was no evidence of any more dvt or any other site of thrombosis in both these patients . intensive care unit patient having reactive thrombocytosis during the recovery phase of sepsis must be kept in priority for screening to rule out dvt , so that timely therapeutic intervention could avoid a life - threatening pulmonary embolism .

deep venous thrombosis ( dvt ) is not an uncommon condition in the intensive care unit ( icu ) , and having high morbidity and mortality . upper limb dvt also is increasingly being recognized as a clinical entity . the presence of the indwelling catheter in neck veins is a risk for developing venous thrombus , which may be further aggravated by presence of thrombocytosis . in icu patients with sepsis , reactive thrombocytosis has been found during the recovery phase . here , we are presenting two cases , having thrombocytosis and central venous catheter who developed upper limb dvt .

cancer cachexia occurs most frequently in malignancy and is associated with more than 20% of cancer deaths . patients with upper gastrointestinal cancer are especially likely to suffer from substantial weight loss , and patients with pancreatic cancer have the highest frequency of developing a cachectic syndrome . thus the research groups and physicians dealing with pancreatic cancer are very interested in finding an effective treatment for cachectic patients . but there is still little known about this clinical issue , and our knowledge grows slowly . much more research and many more clinical trials are needed to increase our understanding of the syndrome and to develop therapeutic strategies for one of the major symptoms of cancer . the word " cachexia " comes from the greek words " kakos " and " hexis " , meaning " bad conditions " . cachexia is a complex metabolic status with progressive weight loss and depletion of host reserves of adipose tissue and skeletal muscle . cachexia should be suspected if involuntary weight loss of greater than five percent of premorbid weight occurs within a six - month period . cachexia represents the clinical consequence of a chronic , systemic inflammatory response , with high hepatic synthesis of acute - phase proteins resulting in depletion of essential amino acids . in contrast , in starvation only fat metabolism is increased while the organism tries to conserve lean body mass . in addition to metabolic changes , cachexia is often associated with anorexia . in cancer patients there can be mechanical interference such as obstructions , as well as treatment - related toxicity . in patients receiving chemotherapy or radiation , subsequent nausea , vomiting and diarrhea can contribute to weight loss . but the lack of nutrients alone can not explain the metabolic changes seen in cachexia . in clinical trials , nutritional supplementation and dietary counseling failed to increase body weight . several appetite - stimulating drugs have been tested in an attempt to increase the food intake of cachexia patients , but most of them had little or no effect on body weight . only limited treatment options exist for patients with clinical cancer cachexia . in one trial , corticosteroids improved the sensation of well - being and led to increased food intake , but this effect lasted only a few weeks . body composition analysis showed that the weight gain resulted only from increased body fat and fluid , with no change in lean body mass . additionally , therapy with progestogens led to a decline in the response rate to chemotherapy and an increase in the frequency of thrombembolic events . demonstrated that neuropeptid y ( npy ) , the most potent feeding - stimulatory peptide in this cycle , is deregulated in the hypothalamic orexigenic network , leading to decreased energy intake but high metabolic demand for nutrients . high levels of leptin , a hormone secreted by adipocytes , block the release of npy . in cachexia the leptin feedback loop seems to become out of control , altering the neuropeptidergic control cycles . the second theory is based on the idea that tumor - derived factors maintain the cachectic syndrome . postulated a factor that was extracted from the urine of cachectic patients and which induces protein degradation in skeletal muscle by upregulation of the ubiquitin - proteasome pathway . this proteolysis - inducing factor ( pif ) is closely related to weight loss in cachexia , and in a recent study it was shown that pif is produced in human colon cancer . a second factor extracted from the urine of cachectic patients lipid mobilizing factor ( lmf ) is closely related to weight loss and induces lipolysis in murine adipocytes . lmf produces a significant increase in the ucps in brown adipose tissue , skeletal muscle and liver . mitochondrial uncoupling proteins ( ucps ) 1 , 2 , and 3 are involved in the control of energy metabolism through thermogenesis in brown adipose tissue and possibly in skeletal muscle tissue in humans . in many animal models , overexpression of ucps ( especially ucp 2 ) in white adipocytes and in muscle and liver tissue was associated with cachexia . however , it is still uncertain how they interact and whether they come into play at the beginning or at the end stage of the disease . despite the controversial discussion of cachexia - inducing mechanisms uncertainty over what causes cachexia , it is quite clear that proinflammatory cytokines are linked to all pathways that induce cachexia . as mentioned , cachexia is associated with a chronic systemic inflammatory response and the elevation of acute phase proteins . high serum levels of il-1 , il-6 and inf gamma are present in many cancer patients , and the levels of these cytokines seem to correlate with tumor progression . these cytokines stimulate the expression of leptin and/or mimic the hypothalamic effect of negative feedback from leptin by disarranging the signaling pathway of npy , resulting in long - term inhibition of food intake . il-1 antagonizes npy induced feeding in rats and disrupts the orexigenic pathway of npy . on the other hand , central corticotropin - releasing factor ( crf ) , which is upregulated by il-1 , seems to influence satiety , and is a potent anorexigenic signal . tumor necrosis factor alpha ( tnf- ) also increases the mrna levels of ucp2 and 3 . in combination with inf tnf- activates the transcription factor nfb that leads to reduction of myo d , a transcription factor essential for repairing damaged muscle tissue . although il-6 is one of the key cytokines involved in the development of cachexia , the definite mechanisms have not yet been clarified . improvements in appetite and weight gain through decreased cytokine expression after the application of corticosteroids or special antagonists like il-6 antibodies were seen over short periods , but further investigations of the cytokine system are necessary to elucidate the interaction between host and tumor - derived cytokines and to determine their effect on biochemical mechanisms . many trials have been performed in the search for a treatment for cachexia , but most therapies have not fulfilled expectations . currently , eicosapaentanoic acid is being tested in cachectic patients . eicosapaentanoic acid seems to interfere with the signaling pathway of pif , and first results are promising . although in recent years our understanding of cachexia has increased , we are still in the fledgling stages . the scientists and clinicians dedicated to finding an effective treatment for cachectic patients have their work cut out for them . mem and pk drafted the paper . hf provided comments and suggestions for its finalization .

in recent years many efforts of researchers and clinicians were made to improve our knowledge of cachexia syndrome . not only cancer , but also many chronic or end - stage diseases such as aids , chronic obstructive pulmonary disease ( copd ) , rheumatoid arthritis , tuberculosis and crohn 's disease are associated with cachexia , a condition of abnormally low weight , weakness , and general bodily decline which deteriorates quality of life and reduces the prognosis of the patients who suffer from it . in the present editorial we will focus cachexia related on cancer and provide some insight into this prognosis - limiting syndrome .

a well - established theoretical framework for the evolution of cooperative interactions contrasts partner fidelity and partner choice as the most important mechanisms promoting and maintaining cooperation . previous studies have empirically shown that partner choice via host sanctions or differential rewards can stabilize cooperation in environmentally transmitted symbioses like mycorrhizal fungi or nitrogen - fixing rhizobia of plants , while the specialized intracellular symbioses of insects are generally assumed to be stabilized by partner fidelity . it remains unknown , however , which factors contribute to the maintenance and specificity of the vast majority of symbiotic associations in animals that involve facultative microbial associates , which contribute significantly to the ecological success of insects as well as many other organisms . beewolves are solitary digger wasps of the genera philanthus , trachypus , and philanthinus ( hymenoptera , crabronidae ) that hunt other hymenoptera and provision them as prey for their developing offspring in subterranean brood cells . female beewolves cultivate symbiotic bacteria in specialized gland reservoirs in the antennae and secrete them into the brood cells prior to oviposition . the larvae later transfer the symbionts to the cocoon silk , where they provide protection during subsequent development which is often not completed until the following year by producing a mixture of at least 9 different antimicrobial substances . recent phylogenetic analyses indicated that the symbionts are descendants of soil - dwelling streptomycetes that were acquired by the insects at least 68 million years ago ( fig . the external route of vertical symbiont transmission from mothers to daughters resulted in host - symbiont co - diversification , but also allowed for horizontal exchange of symbionts among hosts . artificial infection of beewolf females with opportunistic soil bacteria revealed that these bacteria can grow in the antennal reservoirs but are not transmitted to the offspring , providing strong evidence for partner choice via host control over symbiont transmission . we previously discussed the importance of partner choice for the long - term stability of the beewolf - streptomyces mutualism and will focus here on the implications of its biogeographic history . node ages in the host phylogeny ( left ) are shown in million years ago ( mya ) with 95% highest posterior density ( hpd ) interval bars . values at the nodes of the symbiont phylogeny ( right ) are local support values from the fasttree analysis ( gtr model ) , bootstrap values from phyml , and bayesian posteriors , respectively . branches are color - coded according to the geographic distribution of the host species ( see world map , hatched yellow and red branches indicate occurrence in africa and/or eurasia ) . colored boxes around host and symbiont names denote host genera ( green = philanthinus , blue = philanthus , red = trachypus ) . node ages in the host phylogeny ( left ) are shown in million years ago ( mya ) with 95% highest posterior density ( hpd ) interval bars . values at the nodes of the symbiont phylogeny ( right ) are local support values from the fasttree analysis ( gtr model ) , bootstrap values from phyml , and bayesian posteriors , respectively . branches are color - coded according to the geographic distribution of the host species ( see world map , hatched yellow and red branches indicate occurrence in africa and/or eurasia ) . colored boxes around host and symbiont names denote host genera ( green = philanthinus , blue = philanthus , red = trachypus ) . the reconstruction of the beewolf phylogeny and a calibration based on the fossil record allows for proposing hypotheses on the biogeographic history of these solitary wasps and their symbiotic association with streptomyces . however , as the fossil record underlying the dating analyses is rather sparse ( 2 philanthini , one cercerini , and one bembicinae fossil ) , age estimates are characterized by broad confidence intervals , so the exact timing of biogeographic events remains speculative . nevertheless , the phylogeny of philanthinae reveals eurasia or africa as the probable origin of beewolves , because philanthinus and the oldest nodes in philanthus all have palearctic or paleotropical distributions ( fig . the radiation of beewolves likely followed those of angiosperms and their most important pollinators , the bees , as adult beewolves feed on the nectar of angiosperms and predominantly use bees as larval provisions . bees originated during the early to middle cretaceous in the southern hemisphere ( gondwana ) , most likely in africa , and the majority of extant philanthus species are african ( 77 of 137 ) , so an african origin of beewolves seems likely . interestingly , the south indian philanthus species ( philanthus pulcherrimus , philanthus sp . in - e010 , and philanthus cf . basalis ) are interspersed among asian and african taxa in the phylogeny , suggesting that the indian subcontinent was colonized from both africa and asia . after spreading across the paleotropics and palearctic , beewolves colonized the americas about 37 mya ( 95% ci : 2551 mya ) . as the de geer and thulean bridges broke up around 63 and 56 mya , respectively , colonization via beringia during the warm climate of the late eocene seems most likely , which has previously been suggested for other insect taxa ( e.g. aphids ) . the colonization of south america may have occurred via the aves ridge or island arc ( 34 mya ) , which existed roughly around the time of the estimated split between the south american trachypus and the north american philanthus clade ( about 30 mya , 95% ci : 1941 mya , see fig . 1 ) . a plausible scenario assumes a single colonization event with a subsequent radiation of the trachypus clade in south america . however , the current range of trachypus extends north to southern texas , and although it is possible that the northern species have arisen since the emergence of the panamanian land bridge , the phylogenetic relationships of these taxa have yet to be investigated and they may date from an earlier time . despite a monophyletic origin of the beewolf symbiont clade , it shows many discrepancies with the beewolf phylogeny , indicating frequent horizontal transfer of symbiont lineages among host species . such transfer could conceivably occur through interspecific predation or nest reuse , or by infection from an environmental reservoir of symbiont spores , all of which require the co - occurrence of a host and its horizontally acquired symbiont . surprisingly , the symbiont strains show only a moderate degree of clustering according to their hosts ' geographical distribution ( fig . this pattern is unlikely to be explained by poor resolution or phylogenetic errors , because the phylogeny is based on the sequences of 5 different genes and was recently corroborated by an independent analysis using genome - wide aflp markers . four mutually non - exclusive hypotheses may explain the occurrence of closely related symbionts in geographically widely separated host taxa : ( i ) the host taxa colonizing new geographical areas may have carried a mixture of symbionts , which were subsequently exchanged among hosts , and individual symbiont strains were subsequently lost in different host lineages . although possible , this scenario seems unlikely , as recent analyses suggest a high degree of homogeneity in symbiont populations within individual beewolves . furthermore , given the ancient separation of old and new world species , biogeographic patterns would still be expected in the symbiont phylogeny under this scenario . ( ii ) the symbionts may be dispersed via wind or water over large distances ( even across continents and oceans ) and infect novel hosts . although recent studies provide increasing evidence for dispersal limitation and biogeographic patterns in microorganisms , some microorganisms indeed appear to be globally dispersed , and dormancy can be expected to facilitate long - range dispersal and successful colonization of new habitats . in fact , trans - oceanic dispersal events of microorganisms in dust clouds have been well documented , particularly from africa to the americas . previous studies have shown that the beewolf symbionts undergo morphological differentiation on the beewolf cocoon and thereby survive inhospitable conditions as dormant cells for at least 9 months , and possibly much longer . seed banks of ancient symbiont spores in the environment , thereby obscuring apparent biogeographic patterns among supposedly extant symbiont lineages . ( iv ) it is conceivable that the symbionts are only facultatively associated with beewolves and occur as free - living bacteria in the environment , which would provide ample opportunities for horizontal transfer and at least partially obscure biogeographic patterns ( although isolation by distance would still be expected , if dispersal is limited ) . possibly , the symbiotic ancestors were already globally distributed , and subsequent vicariance events and host switches resulted in the diversification of bacterial strains and led to the observed phylogenetic patterns , with closely related symbiont strains occurring in geographically distant host taxa . the recent isolation of closely related streptomyces strains from moroccan soil and from chilli pepper rhizosphere in thailand could provide evidence for the environmental occurrence of the beewolf symbionts , although the phylogenetic affiliation of these isolates with the symbiont clade is currently based on 16s rdna only and needs confirmation by multi - locus sequencing . beewolves and antibiotic - producing streptomyces bacteria participate in a defensive symbiosis involving both vertical and horizontal symbiont transmission . the biogeographic history of beewolves is well defined , but that of the symbionts is only loosely concordant with it , suggesting global dispersal or vicariance . could greatly advance our understanding of the biogeographic history of the ancient association between beewolves and streptomyces , and thereby illuminate larger questions about the relative importance of animal - vectored and free - living dispersal in shaping the distribution of microorganisms in nature . we gratefully acknowledge financial support from the max planck society ( mk ) and the german science foundation ( dfg - str532/2 - 2 [ es / mk ] and dfg - ka2846/2 - 1 [ mk ] ) .

mutualistic microorganisms play important roles in nutrition , reproduction and defense of many insects , yet the factors contributing to their maintenance and dispersal remain unknown in most cases . theory suggests that collaboration can be maintained by repeated interaction of the same partners ( partner fidelity ) or by selective discrimination against non - cooperative partners ( partner choice ) . in the defensive mutualism between solitary beewolf wasps and their antibiotic - producing streptomyces bacteria , partner choice by host control of vertical symbiont transmission reinforces partner fidelity and has helped to maintain this highly specific association since it originated in the late cretaceous . however , co - phylogenetic and biogeographic analyses suggest that there has also been considerable horizontal transmission of the symbionts . while the beewolves clearly have a paleotropic or palearctic origin , with later colonization of the nearctic and neotropics via beringia and the aves ridge , respectively , the bacteria show only weak geographical clustering , implying global dispersal or vicariance within the confines of an otherwise apparently exclusive symbiotic relationship . we discuss several hypotheses that may explain these patterns . future studies investigating the occurrence of beewolf symbionts in the environment could yield broadly applicable insights into the relative impact of animal - vectored and free - living dispersal on the distribution of microorganisms in nature .

although global gene content and detailed sequence similarity comparisons with the previously described megaviridae members clearly classify pgv within the family ( including the partially sequenced organic lake phycodnaviruses ( olpv ) , chrysochromulina erecina virus , and phaoecystis pouchetti virus ) , the finding of a pgv - associated virophage came as a surprise . complete virophage genomes have now been described , but only 3 correspond to identified and isolated the pgv virophage ( pgvv ) is the third , and presumably not the last , of a rapidly growing series . except for their genome size in the 20 kb range , these new types of satellites viruses have little in common in terms of gene content , although they all code for a major capsid protein and one dna primase . consistent with the fact that it was never observed in pgv - infected cultures , pgvv is the first example of a virophage lacking the information to make a capsid protein , the essential building block of a virus particle . once multiplied in the pgv virus factory , the pgvv genome is thus packaged ( in multiple copies ) alongside the pgv genome , and propagated through the pgv virion , either as an integrated or free viral plasmid . the precise molecular structure(s ) the finding of a virophage associated to pgv is already teaching us the important lesson that virophages are not solely associated to dna viruses with micron - sized particles and 1 mb genome sizes , but can be found with large dna viruses of more reasonable ( poxvirus - like ? ) proportion . it is thus likely that many of such associations have been overlooked in the past , and that virophages might have played a fundamental role in the evolution of many more viruses than just the megaviridae . if this is true , they could be ( and have been ) the main vehicle of gene transfers between eukaryotic viruses , and indirectly between these viruses and their hosts . they may also be responsible for the sporadic occurrences of mobiles elements such as self - splicing introns , inteins , and transpovirons . another lesson is that , like all parasites , the virophages are submitted to the irreversible phenomenon of reductive evolution , condemning them to disappear as individual biological entities , eventually saving some of their genes by integrating them into the genome of their companion virus , themselves undergoing a similar process vis - - vis their cellular host . the first published phylogenetic tree including mimivirus 2 and using a concatenation of 7 universally conserved protein sequences , already pointed out that : we could now build a tentative tree of life , within which mimivirus appears to define a new branch distinct from the three other domains . elsewhere in the same article , mimivirus was also shown to be part of the broad family of the nucleocytoplasmic large dna viruses ( ncldv ) , branching near the middle of the previously defined iridovirus , phycodnaviruses , poxviruses , and asfarviruses lineages . put together , these 2 results suggested in a subliminal way that all the large dna viruses were in fact defining a domain distinct from the 3 established cellular domains . as additional genomes of megaviridae became available , molecular phylogenies computed with an increasing number of universal proteins associated to basic functions ( dna clamp loaders , ribonucleotide reductases , aminoacyl - trna synthetases , dna polymerases ) kept clustering the megaviruses in their own clade , clearly separate from the cellular domains , thus contributing an additional domain rooted in between archaea and eukarya in the tree of life . despite receiving increasing support from various authors , others remain strongly opposed to this view . in agreement with the notion of a fourth domain of life anchored by the largest dna viruses , the dna polymerase of pgv nicely clusters with the other megaviridae homologs , exhibiting no affinity with any of the main cellular lineages ( fig . 1 ) . based on the presence of a vestigial protein translation system , i previously argued that the genome of today 's giant viruses derived from an ancestral cellular organism through the irreversible process of reductive evolution experienced by all parasites . dna viruses exhibiting a whole range of genomic complexity could have been generated through this continuous process : viruses would have lost translation first ( the ribosome ) , then transcription ( the rna polymerase ) , then dna replication ( the dna polymerase ) , following an evolutionary scenario whereby they become increasingly dependent from their host . the vast range of size and complexity among today 's dna viruses might thus be the results of differences in their evolution rates ( the largest ones experiencing the least evolutionary pressure ) . in this context , the lack of affinity of the giant viruses with any of today 's cellular domains , as well as the huge proportion of the viral genes without cellular homolog , would suggest that the lineage of the ancestral cellular organism that gave rise to giant viruses became extinct as a cellular life form , and only managed to survive as a parasitic fourth domain . the recently described giant pandoravirus might represent an independent instance of the same scenario . the tree was produced using the default option on the mafft server ( url : mafft.cbrc.jp ) from the multiple alignment of 25 dna polymerase b sequences ( 510 ungapped positions , excluding the inteins ) . branches with bootstrap values < 80 are collapsed . despite infecting eukaryotic hosts from vastly divergent phyla , the viruses do not show any phylogenetic affinity with a specific eukaryotic group , and cluster ( in red ) separately from the 3 cellular domains : eukarya ( green ) , archaea ( purple ) , and eubacteria ( blue ) . this strongly supported topology suggests that the common ancestor of the megaviridaelargely predated the radiation of the eukaryotes .

the viral nature of the first giant virus , mimivirus , was realized in 2003 , 10 y after its initial isolation from the water of a cooling tower in bradford , uk . soon after its genome was sequenced , the mining of the global ocean sampling environmental sequence database revealed that the closest relatives of mimivirus , only known to infect acanthamoeba , were to be found in the sea . these predicted marine mimivirus relatives remained elusive until 2010 , with the first genomic characterization of a virus infecting a heterotrophic unicellular eukaryote , the microflagellate grazer cafeteria roenbergensis . the genome analysis of a virus ( pgv ) infecting the common unicellular algae phaeocystis globosa now shows that it is a bona fide member of the mimivirus family ( i.e. , the megaviridae ) , extending the realm of these giant viruses to abundant blooming phytoplankton species . despite its smaller genome size ( 460 kb encoding 434 proteins ) , pgv exhibits the most intriguing feature of the previously characterized megaviridae : an associated virophage . however , the 19-kb virophage genome , devoid of a capsid gene , is packaged in the pgv particle and propagated as a viral plasmid , the first ever described . the pgv genome also exhibits the duplication of core genes , normally present as single copies and a putative new type of mobile element . in a dna polymerase phylogeny including representatives of the three cellular domains , pgv and the other megaviridae cluster into their own clade deeply branching between domains archaea and eukarya domains , thus exhibiting the topology of a fourth domain in the tree of life .

treatment of metastatic kidney cancer has changed dramatically over the past years with the use of vegf - targeted therapies and mtor inhibitors . however , resistance occurs . we report here two cases of patients who benefited from the addition of bevacizumab to temsirolimus . a 48-year - old man presented with several episodes of loss of consciousness in 2005 . the brain metastases were treated with gamma - knife radiosurgery . in 2006 , he developed lung metastases and mediastinal lymph nodes . in march 2007 , the mediastinal lymph nodes increased and he was started on sunitinib ( 50 mg 4 weeks on treatment and 2 weeks off ) . the lesions were stable but the lymphangitic infiltration was extensive and the patient still experienced dyspnoea . he improved dramatically , his oxygen consumption decreased . on the ct scan the mediastinal lymph nodes and the lymphangitic carcinomatosis lesions improved . a 54-year - old man presented with hematuria revealing a left kidney tumour in january 2004 . the pathological examination showed a pt2 clear cell carcinoma , furman grade ii tumour . in march 2005 , he progressed with liver and lung metastases and he was enrolled in the phase iii study comparing interferon to sunitinib . he had slowly progressive disease on interferon and crossed over to sunitinib in march 2006 . he had a partial response . in july 2008 , the lung and liver lesions were stable but he developed peritoneal carcinomatosis with ascitis . he was started on temsirolimus : ascitis was less abundant , the other lesions were stable . there were probably several causes to his anaemia ( a side effect of temsirolimus and the disease ) . in january 2009 , the liver lesions increased and he was started on a combination of bevacizumab ( 10 mg / kg every 2 weeks ) and temsirolimus ( 20 mg iv weekly ) . his general condition improved , the anaemia disappeared , the lesions were stable and the ascitis much less abundant . he felt that he had fewer side effects on the combination treatment than on temsirolimus alone . these two cases show the effect of adding bevacizumab to temsirolimus for patients who were progressing on the mtor inhibitor . treatment of metastatic kidney cancer has changed dramatically in the past years with the use of vegf - targeted therapies and mtor inhibitors . the vegfr tyrosine kinase inhibitor , sunitinib , is usually used in the first - line setting . another tyrosine kinase inhibitor or an mtor inhibitor can be used in the second - line setting , after progression on initial treatment . resistance to vegf pathway inhibition can be caused by upregulation of alternative pro - angiogenic factors ( fgf , angiopoietin ) , inadequate target inhibition or enhanced receptor signalling . there are a few cases in the literature of patients who were progressing on sunitinib and who benefited from the adjunction of bevacizumab ; however , the first data show that these combinations are very toxic . this could drive upregulation of mtorc2 and further activation of akt and hif2. this could therefore lead to increase of expression of hif2 target genes , such as vegf . combining vegf - blocking agents with mtor inhibitors could contribute to reversing resistance when used in a sequential manner . however , results from the torava phase ii randomized trial show no improvement of non - progression rates with the upfront combination of bevacizumab and temsirolimus but increased toxicity leading to a high drop - out rate . there is no data in the literature on why patients should feel fewer side effects when adding bevacizumab to temsirolimus . however , some reports already mention the development of polyglobulia with anti - angiogenesis agent . this effect may correct a pre - existing anaemia [ 4 , 5 , 6 ] .

treatment of metastatic kidney cancer has changed dramatically in the past years with the use of vegf - targeted therapies and mtor inhibitors . however , resistance occurs . we report here two cases of patients who benefited , both on disease control and side effects , from the addition of bevacizumab to temsirolimus , after progression on the mtor inhibitor alone .

recently , a group of small - molecule compounds have been identified as tyrosine receptor kinase ( trk ) receptor agonists that had profound pro - neuronal effects on neurogenesis and neuronal regeneration [ 14 ] . these compounds hold great clinical importance for neurodegenerative diseases as they may easily penetrate blood - brain - barrier , and have great potency with half - effective concentration ( ec50 ) lower than 1 m . among those small - molecule compounds , a new compound , 7,8,3-trihydroxyflavone ( 7,8,3-thf ) , was created as the derivative of 7,8-dihydroxyflavone but with better potency . in the peripheral auditory system , thf was shown to rescue noise - damaged or chemically - injured auditory nerves both in vitro and in vivo . however , the role of thf in spinal cord dorsal root ganglion ( drg ) neurons has not been characterized . spinal cord drg neurons are subject to local anesthetics - induced neurotoxicity , which may contribute to various types of neurologic complications in young patients with regional anesthesia . specifically , bupivacaine , one of the commonly used local anesthetics , is shown to induce neuronal apoptosis , growth cone collapse , and neurite retraction in drg neurons in animal models . studies also showed that several of the neuronal signaling pathways , such as mitogen - activated protein kinase ( mapk ) and phosphatase and tensin homolog ( pten ) pathways , were closely associated with the regulation of bupivacaine - induced neurotoxicity in drg neurons . member of the trk receptors trkb receptor , and its ligand brain - derived neurotrophic factor ( bdnf ) are both upregulated in drg neurons after spinal cord injury [ 1416 ] , suggesting that there might be functional roles of the trkb signaling pathway in regulating drg neuron injury , but the exact role of trkb receptor in regulating local anesthetics - induce neurotoxicity remains elusive . in this study , we used an explant model to culture neonatal mouse drg neurons in vitro to mimic the biological conditions of young spinal cord sensory neurons . we first investigated the pro - neuronal effect of thf on the growth of neonatal drg neurons by examining its effect on drg neuron neurite outgrowth . the potential protective effect of thf and the involvement of trkb signaling pathways were examined by apoptosis assay , neurite outgrowth assay , and western blot assay . the results of our study may further our understanding on the possible pro - neuronal mechanisms of small - molecule trkb agonists in spinal cord sensory neurons . doral root ganglion ( drg ) neurons were prepared from postnatal 23-day-(p2~p3 ) old c57bl/6j mice ( jackson lab , usa ) . briefly , drg clumps were quickly dissected into cold ( 4c ) 1x hbss ( invitrogen , usa ) . they were then transferred into dissociation medium with warm ( 37c ) dulbecco s modified eagle medium ( dmem , invitrogen , usa ) , 10% fetal bovine serum ( fbs , invitrogen , usa ) , 1 x b27 neuronal supplement ( invitrogen , usa ) , and 0.25% trypsin ( invitrogen , usa ) for 20 min . dissociated cells were prepared by continuously triturating drg clumps in - and - out of 1 ml pipette tips for 10 min . they were then re - suspended in serum - free culture medium containing neurobasal medium ( invitrogen , usa ) , penicillin / streptomycin ( penstrep , invitrogen , usa ) , and 1 x b27 neuronal supplement ( invitrogen , usa ) in a tissue culture chamber with 5% co2 at 37c overnight . on the second day , the floating non - neuronal cells were removed . drg neurons were maintained in culture medium for 2~7 days , depending on the requirement of designated experiments . cultured drg neurons were fixed with 4% paraformaldehyde ( pfa , sigma - aldrich , usa ) and 0.3% triton ( sigma - aldrich , usa ) in 1x pbs ( invitrogen , usa ) for 30 min , then incubated with a rabbit anti - neurofilament 2000 ( nf-2000 ) polyclonal antibody ( santa cruz , usa ) at 37c over night . on the second day , the culture was incubated with alexafluor 488 anti - rabbit secondary antibody at room temperature for 2 h. the green fluorescent images were viewed under an upright fluorescent microscope ( bx51 , olympus , japan ) . for each experimental condition , the averaged length of the longest 50~80 neurites were measured among at least three repeats , and then normalized to control condition . in drg neuron culture , various concentrations ( 2 , 5 , 10 , 20 , 50 , 100 , 250 , 500 , 1000 , 1500 , 2000 nm ) of 7 , 8 the effect of thf on drg neuron growth was estimated by the neurite outgrowth assay . drg neurons were collected from cultures and treated with a lysis buffer ( 50 mm tris at ph 7.6 , 150 mm nacl , 1 mm edta , 10% glycerol , 0.5% np-40 and protease inhibitor cocktail , millipore , usa ) . after checking with concentrations , proteins were separated by electrophoresis on 12% sds - page gel , and transferred to pvdf membranes . the membranes were blocked with 5% non - fat dry milk and 1% bsa for 2 h , followed by incubation with primary antibodies of rabbit polyclonal anti - trkb ( 1:500 , novus biological , usa ) and rabbit polyclonal anti - p - trkb ( 1:200 , novus biological , usa ) overnight at 4c . on the second day , membranes were incubated with horseradish peroxidase - conjugated goat anti - rabbit secondary antibody ( 1:5,000 , novus biological , usa ) for 2 h at room temperature . the blots were then visualized by enhanced chemiluminescence ( pierce , usa ) according to the manufacturer s protocol . in drg neuron culture , briefly , 10 mm bupivacaine was added into culture for 2 h to induce substantial neuronal apoptosis . the culture was washed with fresh medium 3 times ( 10 min / time ) , and maintained for another 24 h before further evaluation . drg culture was quickly washed with pbs , and fixed by 4% paraformaldehyde ( pfa , sigma - aldrich , usa ) for 30 min . the apoptosis of drg neurons was examined by a terminal deoxyribonucleotidyl transferase ( tdt)-mediated biotin-16-dutp nick - end labeling ( tunel ) apoptosis kit ( r&d systems , usa ) according to the manufacturer s protocol . a mouse monoclonal neun antibody ( millipore , usa ) was used to identify the drg neurons . fluorescent images were then examined under an upright fluorescent microscope ( bx51 , olympus , japan ) . relative apoptosis was quantified as the percentage of tunel - positive cells among all neun - positive cells for each experimental condition . statistical comparisons between means were examined by two - tailed unpaired student s t test on spss software ( version 13.0 , spss , usa ) . doral root ganglion ( drg ) neurons were prepared from postnatal 23-day-(p2~p3 ) old c57bl/6j mice ( jackson lab , usa ) . briefly , drg clumps were quickly dissected into cold ( 4c ) 1x hbss ( invitrogen , usa ) . they were then transferred into dissociation medium with warm ( 37c ) dulbecco s modified eagle medium ( dmem , invitrogen , usa ) , 10% fetal bovine serum ( fbs , invitrogen , usa ) , 1 x b27 neuronal supplement ( invitrogen , usa ) , and 0.25% trypsin ( invitrogen , usa ) for 20 min . dissociated cells were prepared by continuously triturating drg clumps in - and - out of 1 ml pipette tips for 10 min . they were then re - suspended in serum - free culture medium containing neurobasal medium ( invitrogen , usa ) , penicillin / streptomycin ( penstrep , invitrogen , usa ) , and 1 x b27 neuronal supplement ( invitrogen , usa ) in a tissue culture chamber with 5% co2 at 37c overnight . on the second day , the floating non - neuronal cells were removed . drg neurons were maintained in culture medium for 2~7 days , depending on the requirement of designated experiments . cultured drg neurons were fixed with 4% paraformaldehyde ( pfa , sigma - aldrich , usa ) and 0.3% triton ( sigma - aldrich , usa ) in 1x pbs ( invitrogen , usa ) for 30 min , then incubated with a rabbit anti - neurofilament 2000 ( nf-2000 ) polyclonal antibody ( santa cruz , usa ) at 37c over night . on the second day , the culture was incubated with alexafluor 488 anti - rabbit secondary antibody at room temperature for 2 h. the green fluorescent images were viewed under an upright fluorescent microscope ( bx51 , olympus , japan ) . for each experimental condition , the averaged length of the longest 50~80 neurites were measured among at least three repeats , and then normalized to control condition . in drg neuron culture , various concentrations ( 2 , 5 , 10 , 20 , 50 , 100 , 250 , 500 , 1000 , 1500 , 2000 nm ) of 7 , 8 , 3-trihydroxyflavone ( thf ) were added for 2 days . the effect of thf on drg neuron growth was estimated by the neurite outgrowth assay . drg neurons were collected from cultures and treated with a lysis buffer ( 50 mm tris at ph 7.6 , 150 mm nacl , 1 mm edta , 10% glycerol , 0.5% np-40 and protease inhibitor cocktail , millipore , usa ) . after checking with concentrations , proteins were separated by electrophoresis on 12% sds - page gel , and transferred to pvdf membranes . the membranes were blocked with 5% non - fat dry milk and 1% bsa for 2 h , followed by incubation with primary antibodies of rabbit polyclonal anti - trkb ( 1:500 , novus biological , usa ) and rabbit polyclonal anti - p - trkb ( 1:200 , novus biological , usa ) overnight at 4c . on the second day , membranes were incubated with horseradish peroxidase - conjugated goat anti - rabbit secondary antibody ( 1:5,000 , novus biological , usa ) for 2 h at room temperature . the blots were then visualized by enhanced chemiluminescence ( pierce , usa ) according to the manufacturer s protocol . in drg neuron culture , treatment of bupivacaine was conducted according to the method described before . briefly , 10 mm bupivacaine was added into culture for 2 h to induce substantial neuronal apoptosis . the culture was washed with fresh medium 3 times ( 10 min / time ) , and maintained for another 24 h before further evaluation . drg culture was quickly washed with pbs , and fixed by 4% paraformaldehyde ( pfa , sigma - aldrich , usa ) for 30 min . the apoptosis of drg neurons was examined by a terminal deoxyribonucleotidyl transferase ( tdt)-mediated biotin-16-dutp nick - end labeling ( tunel ) apoptosis kit ( r&d systems , usa ) according to the manufacturer s protocol . a mouse monoclonal neun antibody ( millipore , usa ) was used to identify the drg neurons . fluorescent images were then examined under an upright fluorescent microscope ( bx51 , olympus , japan ) . relative apoptosis was quantified as the percentage of tunel - positive cells among all neun - positive cells for each experimental condition . statistical comparisons between means were examined by two - tailed unpaired student s t test on spss software ( version 13.0 , spss , usa ) . we first investigated the possible pro - neuronal effect of thf on drg neuron growth . the cultured mouse neonatal ( p2~p3 ) drg neurons were treated with various concentrations of thf ( 2 , 5 , 10 , 20 , 50 , 100 , 250 , 500 , 1000 , 1500 , and 2000 nm ) for 2 days . images of green - fluorescence - positive drg neuron neurites showed that thf significantly promoted neurite growth in a dose - dependent manner ( figure 1a ) . the relative lengths of drg neuron neurites , corresponding to different thf concentrations , were compared in neurite outgrowth assay and fit with a hill equation ( figure 1b ) . the ec50 concentration was determined to be 67.4 nm we then investigated the molecular pathway associated with pro - neuronal effect of thf on promoting drg neurite outgrowth . we used western blot assay to examine the protein level of trb receptor , as well as phosphorylated trkb ( p - trkb ) . it showed that protein levels of trkb were unchanged by treatment of different concentrations of thf , but levels of p - trkb were significantly unregulated with the applications of higher concentrations of thf ( figure 1c ) . thus , our data strongly suggests that thf promoted drg neuron growth by acting as a trkb agonist . one of the commonly used anesthetics , bupivacaine , was shown to induce neurotoxicity in drg neurons in a concentration - dependent manner . as we showed thf had pro - neuronal effect on drg neuron growth , we wondered whether thf could also rescue bupivacaine - induced neurotoxicity in drg neurons . to test this hypothesis , we maintained drg culture for 3 to 5 days , followed by pre - treatment of thf for 24 h. we then used a high concentration of bupivacaine 10 mm ( 2 h ) to induce significant neuronal apoptosis in drg neurons . twenty - four hours after bupivacaine treatment , a tunel assay was conducted to evaluate the apoptosis among drg neurons . a neun neuronal - antibody was used alongside tunel assay to precisely identify the neuronal population in the culture . the immunohistochemical results demonstrated that while there was no thf pre - treatment ( control ) , most of the drg neurons ( neun - positive ) were apoptotic ( tunel - positive ) due to bupivacaine - induced neurotoxicity ( figure 2a , left column ) . however , when drg neurons were pre - treated with 50 nm or 1 m thf , bupivacaine - induced neuronal apoptosis was markedly reduced ( figure 2a , right two columns ) . quantified measurement of tunel assay showed that the percentage of apoptotic drg neurons was significantly reduced , from 85.34.5% with no thf pre - treatment ( control ) , to 45.27.3% with 50 nm thf pre - treatment , then to 19.65.7% with 1 m thf ( figure 2b , p<0.05 ) . thus , our data suggest that thf pre - treatment was effective in reducing bupivacaine - induced neuronal apoptosis in drg neurons . we then evaluated the protective effect of thf pre - treatment on bupivacaine - induced neurite retraction in drg neurons . at 24 h after bupivacaine treatment , immunohistochemical results with a neurite outgrowth assay demonstrated that there was no thf pre - treatment ( control ) , but bupivacaine introduced significant neurite retraction in drg neurons ( figure 3a , left column ) however , when drg culture was treated with either 50 nm or 1 m thf , neurite retraction was markedly rescued ( figure 3a , right two columns ) . quantified measurement by neurite outgrowth assay indicated that drg neurite lengths were increased by 37933% with 50 nm thf pre - treatment , and by 157179% with 1 m thf , compared to the neurite length under control condition ( figure 3b , p<0.05 ) . we also evaluated whether the protection of thf on drg neurite retraction was correlated with the activation of the trkb signaling pathway . the result of western blot confirmed this hypothesis by showing that , in bupivacaine - injured drg neurons , phosphorylated trkb ( p - trkb ) was increased by thf pre - treatment in a concentration - dependent manner , whereas trkb protein levels were unaltered ( figure 3c ) . thus , our data suggest that thf pre - treatment was also effective in protecting bupivacaine - induced neurite retraction in drg neurons , very likely through activation of the trkb signaling pathway . we first investigated the possible pro - neuronal effect of thf on drg neuron growth . the cultured mouse neonatal ( p2~p3 ) drg neurons were treated with various concentrations of thf ( 2 , 5 , 10 , 20 , 50 , 100 , 250 , 500 , 1000 , 1500 , and 2000 nm ) for 2 days . images of green - fluorescence - positive drg neuron neurites showed that thf significantly promoted neurite growth in a dose - dependent manner ( figure 1a ) . the relative lengths of drg neuron neurites , corresponding to different thf concentrations , were compared in neurite outgrowth assay and fit with a hill equation ( figure 1b ) . the ec50 concentration was determined to be 67.4 nm we then investigated the molecular pathway associated with pro - neuronal effect of thf on promoting drg neurite outgrowth . we used western blot assay to examine the protein level of trb receptor , as well as phosphorylated trkb ( p - trkb ) . it showed that protein levels of trkb were unchanged by treatment of different concentrations of thf , but levels of p - trkb were significantly unregulated with the applications of higher concentrations of thf ( figure 1c ) . thus , our data strongly suggests that thf promoted drg neuron growth by acting as a trkb agonist . one of the commonly used anesthetics , bupivacaine , was shown to induce neurotoxicity in drg neurons in a concentration - dependent manner . as we showed thf had pro - neuronal effect on drg neuron growth , we wondered whether thf could also rescue bupivacaine - induced neurotoxicity in drg neurons . to test this hypothesis , we maintained drg culture for 3 to 5 days , followed by pre - treatment of thf for 24 h. we then used a high concentration of bupivacaine 10 mm ( 2 h ) to induce significant neuronal apoptosis in drg neurons . twenty - four hours after bupivacaine treatment , a tunel assay was conducted to evaluate the apoptosis among drg neurons . a neun neuronal - antibody was used alongside tunel assay to precisely identify the neuronal population in the culture . the immunohistochemical results demonstrated that while there was no thf pre - treatment ( control ) , most of the drg neurons ( neun - positive ) were apoptotic ( tunel - positive ) due to bupivacaine - induced neurotoxicity ( figure 2a , left column ) . however , when drg neurons were pre - treated with 50 nm or 1 m thf , bupivacaine - induced neuronal apoptosis was markedly reduced ( figure 2a , right two columns ) . quantified measurement of tunel assay showed that the percentage of apoptotic drg neurons was significantly reduced , from 85.34.5% with no thf pre - treatment ( control ) , to 45.27.3% with 50 nm thf pre - treatment , then to 19.65.7% with 1 m thf ( figure 2b , p<0.05 ) . thus , our data suggest that thf pre - treatment was effective in reducing bupivacaine - induced neuronal apoptosis in drg neurons . we then evaluated the protective effect of thf pre - treatment on bupivacaine - induced neurite retraction in drg neurons . at 24 h after bupivacaine treatment , immunohistochemical results with a neurite outgrowth assay demonstrated that there was no thf pre - treatment ( control ) , but bupivacaine introduced significant neurite retraction in drg neurons ( figure 3a , left column ) however , when drg culture was treated with either 50 nm or 1 m thf , neurite retraction was markedly rescued ( figure 3a , right two columns ) . quantified measurement by neurite outgrowth assay indicated that drg neurite lengths were increased by 37933% with 50 nm thf pre - treatment , and by 157179% with 1 m thf , compared to the neurite length under control condition ( figure 3b , p<0.05 ) . we also evaluated whether the protection of thf on drg neurite retraction was correlated with the activation of the trkb signaling pathway . the result of western blot confirmed this hypothesis by showing that , in bupivacaine - injured drg neurons , phosphorylated trkb ( p - trkb ) was increased by thf pre - treatment in a concentration - dependent manner , whereas trkb protein levels were unaltered ( figure 3c ) . thus , our data suggest that thf pre - treatment was also effective in protecting bupivacaine - induced neurite retraction in drg neurons , very likely through activation of the trkb signaling pathway . in the present study we discovered that , 7 , 8 , 3-trihydr - oxyflavone , a potent trkb agonist small molecule , had a profound pro - neuronal effect on neuronal growth , as well as protecting against local anesthetic - induced neurotoxicity in spinal cord drg neurons . we demonstrated that thf promoted neurite growth in neonatal drg neuron culture in a concentration - dependent manner . the calculated ec50 was calculated to be 67.4 nm , in line with other studies showing low thf ec50 . this finding was particularly encouraging as it suggests that thf can promote spinal cord neuronal development with great potency . we also demonstrated that the thf - activated trkb signaling pathway works by phosphorylating trkb in drg neurons , possibly acting as a trkb agonist . recently , a relative of thf 7,8-dihydroxyflavone ( dhf ) was shown to promote spinal cord motoneuron embryonic development , as well as inducing functional recovery in myotrophic lateral sclerosis . interestingly , dhf seemed to act through the akt signaling pathway rather than directly on the bdnf / trkb signaling pathway in motoneurons . therefore , it seems that complex signaling pathways may be differentially associated with thf ( or dhf ) in regulating spinal cord drg neurons and motoneurons . studies have shown that epigenetic regulation of microrna , as well as pten / akt signaling pathways , are involved in local anesthetics - induced neurotoxicity in drg neurons . in addition , p38 mitogen - activated protein kinase ( mapk ) was reported to be a critical component contributing to lidocaine - induced neurotoxicity in adult drg neurons . in the present study we demonstrated that thf had a protective effect on bupivacaine - induced neurotoxicity in drg neurons by rescuing neuronal apoptosis and neurite retraction . also , we showed that the trkb signaling pathway was activated in accordance with thf treatment in bupivacaine - injured drg neurons . although our data suggest that thf likely acts as a survival factor through a trkb - dependent manner in bupivacaine - injured drg neurons , future experiments would help to elucidate the direct involvement of the bdnf / trkb signaling pathway , as well as its association with other molecular pathways in anesthetics - induced neurotoxicity in drg neurons . overall , in the present study we revealed new mechanism of 7 , 8 , 3-trihydroxyflavone as a pro - neuronal small molecule in promoting neuronal growth and protecting against bupivacaine - induced neurotoxicity in spinal cord drg neurons . the associated signaling pathway of thf in drg neurons is very likely through trkb activation . these findings may help to identify novel molecular targets to be applied in future clinical settings to benefit patients with spinal cord disorders or injuries .

background7 , 8 , 3-trihydroxyflavone ( thf ) is a novel pro - neuronal small molecule that acts as a trkb agonist . in this study , we examined the effect of thf on promoting neuronal growth and protecting anesthetics - induced neurotoxicity in dorsal root ganglion ( drg ) neurons in vitro.material/methodsneonatal mouse drg neurons were cultured in vitro and treated with various concentrations of thf . the effect of thf on neuronal growth was investigated by neurite outgrowth assay and western blot . in addition , the protective effects of thf on bupivacaine - induced neurotoxicity were investigated by apoptosis tunel assay , neurite outgrowth assay , and western blot , respectively.resultsthf promoted neurite outgrowth of drg neurons in dose - dependent manner , with an ec50 concentration of 67.4 nm . western blot analysis showed thf activated trkb signaling pathway by inducing trkb phosphorylation . thf also rescued bupivacaine - induced neurotoxicity by reducing apoptosis and protecting neurite retraction in drg neurons . furthermore , the protection of thf in bupivacaine - injured neurotoxicity was directly associated with trkb phosphorylation in a concentration - dependent manner in drg neurons.conclusionsthf has pro - neuronal effect on drg neurons by promoting neurite growth and protecting against bupivacaine - induced neurotoxicity , likely through trkb activation .

a substantial amount of research has focused on biomarkers that identify people at higher risk of developing cardiovascular disease.1 one indicator that seems to play a pivotal role is dysfunction of the autonomic nervous system . specifically , increased sympathetic and/or decreased parasympathetic activity has been associated with increased risk for a number of cardiac outcomes such as sudden cardiac death , heart failure , ventricular arrhythmias , or hypertension.2 , 3 heart rate variability ( hrv ) is a valid noninvasive technique for estimating the characteristics of the autonomic nervous system and for quantifying modulation of the sympathetic and parasympathetic inputs.4 , 5 decreased hrv has been linked to increased mortality in cardiac patients6 , 7 and increased risk of coronary heart disease and cardiac mortality in general populations.8 , 9 establishing the associations between hrv and coronary heart disease remains problematic because a number of cofactors may wholly or partially account for the increased risk of coronary heart disease among persons with decreased hrv . these factors include age , poor health , physical inactivity , and medication use as well as socioeconomic status ( ses ) and ethnicity . hrv is believed to decline as people age , but a key scientific question is whether falls in hrv occur naturally with age as a result of the aging process itself or as a result of pathogenic processes and/or medication use . a number of studies have documented the normal changes in hrv that accompany aging10 , 11 , 12 , 13 , 14 , 15 , 16 and hrv changes due to chronic diseases or healthrelated conditions.17 , 18 , 19 , 20 , 21 these studies , however , have significant limitations including a reliance on crosssectional data or lack of statistical adjustment for important factors . the evidence of agerelated hrv changes is based primarily on crosssectional studies of different age groups,10 , 12 , 13 , 14 , 15 , 16 making it difficult to identify withinperson change . differences between age groups in crosssectional studies could be related to selective survival among older people rather than genuine effects . a small number of longitudinal studies on agerelated hrv changes have been conducted.11 , 17 , 18 , 19 , 20 , 21 of these , only a few are population based,18 , 19 , 20 , 21 and others have relied on small samples of elderly participants.12 , 13 no studies with large sample sizes have conducted > 2 repeated hrv measurements . medication use and/or the existence of prevalent cardiometabolic problems such as diabetes or stroke may be related to hrv changes over time . cardiac autonomic modulation has been found to be significantly influenced by sex.10 , 12 , 14 , 16 on average , women have been shown to have reduced sympathetic influence and enhanced parasympathetic influence on heart rate ( hr ) relative to men.22 over time , different ways of responding to health conditions and medication may influence the shape of hrv changes between men and women . another relevant factor that contributes to accelerated aging processes and development and prognosis of cardiovascular disease outcomes is ses.23 it is well documented that persons from lower ses groups have higher risk of cardiovascular disease outcomes and reduced hrv and parasympathetic activity than persons from higher ses groups.24 , 25 it remains unclear how the associations between ses and hrv change as people age . similarly , ethnicity is associated with hrv levels . on average , people of white ethnic origin have been shown to have lower hrv than african americans,26 whereas studies of differences in hrv levels between people of south asian and european origin have shown inconsistent results.27 , 28 evidence of ethnic differences in changes in hrv over time is limited . finally , physical activity has been proposed as a further important determinant of hrv.29 maintenance of physical activity as part of the aging process may have a positive effect on the rate of change in hrv over time . using unique data from a large , longitudinal uk populationbased cohort study with 3 measurements of shortterm hrv over a 10year period , we sought to test whether hrv changes were largely normative or caused by pathological changes with aging . we also examined whether changes in hrv over time varied systematically by ses , ethnicity , and habitual physical activity . the whitehall ii cohort study is an ongoing longitudinal study of 10 308 civil servants ( 6895 men and 3413 women ) based in london , united kingdom.30 all civil servants aged 35 to 55 years and employed in 20 londonbased white collar civil service departments were invited to participate in this study , and recruitment took place from 1985 to 1988 . subsequent data collection alternated between postal questionnaires alone and postal questionnaires accompanied by clinical examination . hr and hrv were measured at the fifth ( 19971999 ) , seventh ( 20022004 ) , and ninth ( 20072009 ) phases of data collection . at phase 5 , all study members known to be alive and resident in the united kingdom were invited to attend a screening clinic . although 6554 participants ( 1909 women ) attended the clinic ( 67% of participants ) , hr was recorded for only 3365 participants because of staff availability . no hrv recordings were collected on 69 days during screening , accounting for the majority of missing hrv data at phase 5 . participants who did not undergo hrv recordings at phase 5 did not differ significantly from those who did with respect to age , sex , and employment grade.24 to focus on the estimation of withinperson change in hr and hrv levels , we restricted the analytical sample to the subset of participants with at least 2 hrv measurements . the analytical sample for this study comprised 4414 participants ( 3176 men ) with at least 2 hrv measurements . the university college london medical school committee on the ethics of human research approved the whitehall ii study . whitehall ii data , protocols , and other metadata are available to bona fide researchers for research purposes . details on the assessment of hr and hrv in whitehall ii can be found elsewhere.20 , 24 briefly , 5minute supine resting 12lead ecgs were obtained after 5 minutes of rest . kardiosis cardiologic diagnostic systems ) , a seer mc recorder ( ge medical systems ) , and a getemed recorder ( getemed teltow ) were used at phases 5 , 7 , and 9 , respectively . five minutes of beattobeat hr data were sampled at 500 hz frequency to obtain a digitized sequence of r waves . using an automatic algorithm,31 ecg abnormalities including ectopic beats , right bundlebranch block , respiratory arrhythmia , blocked atrial extrasystole , and highamplitude and wide t waves were identified , and normal qrs complexes suited for a reliable hrv analysis were detected . hrv was analyzed both in the time domain ( standard deviation of all intervals between r waves with normaltonormal conduction [ sdnn ] ) and in the frequency domain using a blackmantukey algorithm . frequencydomain components were computed by integrating the power spectrum within 2 frequency bands : 0.04 to 0.15 hz ( lowfrequency power [ ms ] ) and 0.15 to 0.4 hz ( highfrequency power [ ms ] ) . lowfrequency power ( lowfrequency hrv [ lfhrv ] ) reflects both parasympathetic and sympathetic hr modulations ; high frequency ( highfrequency hrv [ hfhrv ] ) is an index of parasympathetic modulation of hr.4 , 5 in addition , we used lfhrv in normalized units ( lfnu [ % ] ) , which was computed as lf/(lf+hf ) . to avoid redundancy , the hfhrv in normalized units , being equal to 100% minus lfnu ( % ) , was not analyzed . these ratiobased hrv measures have been proposed as indices of sympathovagal balance.4 , 5 age at phase 5 ( 19971999 ) was categorized into 4 groups ( 4449 , 5054 , 5559 , and 6069 years ) . ses , assessed by the british civil service employment grade , was categorized into 3 groups in order of decreasing salary and work role : administrative ( high ) , professional / executive ( middle ) , and clerical / support ( low ) . ethnicity was defined according to the office for national statistics 1991 census categories , and participants were initially categorized into 4 ethnic groups : white european , south asian , african caribbean , and other . numbers were too small to examine age and sexspecific hr and hrv trajectories for nonwhite minority ethnic groups . physical activity was categorized according to whether participants adhered to the world health organization ( who ) physical activity guidelines of at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week.32 these guidelines are widely used and have been quantitatively validated for cardiovascular outcomes.33 habitual physical activity over the 10year period was categorized as hardly ever ( once or less through followup ) , sometimes ( in 2 phases ) , or always ( in all 3 followup phases ) meeting the who guidelines . cardiometabolic problems at each phase were assessed as the presence of any of the following chronic disease or healthrelated conditions : diagnosed coronary heart disease including heart failure,9 , 34 stroke,35 hypertension,18 , 20 diabetes,19 , 29 and obesity.20 these factors were chosen as covariates based on systematic literature review as likely to profoundly influence hrv . at each screening , participants provided details of current medications taken in the previous 14 days ( generic name , brand name , or both ) . prescribed medication included all drugs taken in the previous 14 days that were prescribed by a doctor such as analgesics , antihyperlipidemic agents , antidiabetic agents , psychotropic agents , and antibiotics . we distinguished between beta blockers ( british national formulary codes , chapter 2.4 ) and other prescribed medications because previous studies have shown the former to have a beneficial effect on hrv levels.36 other cardiovascular and central nervous system related medications have been shown to decrease or have no effect on hrv levels.17 , 18 analyses were performed in stata 13.1 ( statacorp ) . sdnn , lfhrv , and hfhrv were transformed by natural logarithm because their distributions were skewed . outliers ( mean3 sd ) were trimmed to 3 sd from the mean prior to transformation . ageadjusted arithmetic and geometric means and 95% cis were calculated for the subset of 1658 participants with complete hr and hrv measurements at each phase of data collection . for this subset of participants , the change in hr between the first and third measurements was defined as hr at phase 9 minus hr at phase 5 , scaled to a time difference of 10 years . for hrv measurements , spearman rank correlation coefficient was used to examine the correlations between the hr and hrv measures at phase 5 . two sets of linear mixed models were used to estimate change in hr and hrv over 10year followup . this method of estimation uses all available data over followup , takes into account the intraindividual correlation between repeated measurements , and can handle missing data . the intercept was fitted as a random effect , allowing participants to have different hrv values at baseline.37 the first set of models was used to examine agespecific hrv trajectories without adjusting for any covariates . the dependent variable was the 3 repeated measurements of hr and hrv , and the independent variables were time ( exact time in years between phases , included as a continuous variable , divided by 10 to yield estimates of change over 10 years ) , age at phase 5 ( included as a categorical variable ) , and interaction between time and age ( thereby enabling the rate of change to vary by age at baseline ) . interaction terms suggested sex difference in the association between age and hr trajectories ( p=0.074 ) , leading us to stratify all analyses by sex . in the second set of models , 5 key covariates ( cardiometabolic problems , medication use [ other than beta blockers ] versus those not on medication , ses , ethnicity , and adherence to who physical activity guidelines ) were included to explore their temporal association with hr and hrv . the following 3 ageadjusted coefficients were of interest , using cardiometabolic condition incidence as an example : ( 1 ) the coefficient for time represented the 10year change in hr or hrv for participants in the reference category ( ie , no cardiometabolic condition ) , ( 2 ) the coefficient for cardiometabolic condition represented the difference in hr or hrv between the no cardiometabolic condition and cardiometabolic condition groups at baseline ( phase 5 ) , and ( 3 ) the coefficient for the interaction between time and cardiometabolic condition represented the difference in the 10year rate of change between participants with and without cardiometabolic condition . as we focused on medications associated with potential decreases in hrv , we excluded participants using beta blockers in primary analyses . in secondary analyses , we focused specifically on the rates of change in hr and hrv for the participants who reported use of beta blockers at any phase over the 10year period . sensitivity analyses were also run focusing specifically on a subset of healthy participants , namely , those who were free of a cardiometabolic condition and had no reported medication use over the 10year period . the whitehall ii cohort study is an ongoing longitudinal study of 10 308 civil servants ( 6895 men and 3413 women ) based in london , united kingdom.30 all civil servants aged 35 to 55 years and employed in 20 londonbased white collar civil service departments were invited to participate in this study , and recruitment took place from 1985 to 1988 . subsequent data collection alternated between postal questionnaires alone and postal questionnaires accompanied by clinical examination . hr and hrv were measured at the fifth ( 19971999 ) , seventh ( 20022004 ) , and ninth ( 20072009 ) phases of data collection . at phase 5 , all study members known to be alive and resident in the united kingdom were invited to attend a screening clinic . although 6554 participants ( 1909 women ) attended the clinic ( 67% of participants ) , hr was recorded for only 3365 participants because of staff availability . no hrv recordings were collected on 69 days during screening , accounting for the majority of missing hrv data at phase 5 . participants who did not undergo hrv recordings at phase 5 did not differ significantly from those who did with respect to age , sex , and employment grade.24 to focus on the estimation of withinperson change in hr and hrv levels , we restricted the analytical sample to the subset of participants with at least 2 hrv measurements . the analytical sample for this study comprised 4414 participants ( 3176 men ) with at least 2 hrv measurements . the university college london medical school committee on the ethics of human research approved the whitehall ii study . whitehall ii data , protocols , and other metadata are available to bona fide researchers for research purposes . details on the assessment of hr and hrv in whitehall ii can be found elsewhere.20 , 24 briefly , 5minute supine resting 12lead ecgs were obtained after 5 minutes of rest . kardiosis cardiologic diagnostic systems ) , a seer mc recorder ( ge medical systems ) , and a getemed recorder ( getemed teltow ) were used at phases 5 , 7 , and 9 , respectively . five minutes of beattobeat hr data were sampled at 500 hz frequency to obtain a digitized sequence of r waves . using an automatic algorithm,31 ecg abnormalities including ectopic beats , right bundlebranch block , respiratory arrhythmia , blocked atrial extrasystole , and highamplitude and wide t waves were identified , and normal qrs complexes suited for a reliable hrv analysis were detected . hrv was analyzed both in the time domain ( standard deviation of all intervals between r waves with normaltonormal conduction [ sdnn ] ) and in the frequency domain using a blackmantukey algorithm . frequencydomain components were computed by integrating the power spectrum within 2 frequency bands : 0.04 to 0.15 hz ( lowfrequency power [ ms ] ) and 0.15 to 0.4 hz ( highfrequency power [ ms ] ) . lowfrequency power ( lowfrequency hrv [ lfhrv ] ) reflects both parasympathetic and sympathetic hr modulations ; high frequency ( highfrequency hrv [ hfhrv ] ) is an index of parasympathetic modulation of hr.4 , 5 in addition , we used lfhrv in normalized units ( lfnu [ % ] ) , which was computed as lf/(lf+hf ) . to avoid redundancy , the hfhrv in normalized units , being equal to 100% minus lfnu ( % ) , was not analyzed . age at phase 5 ( 19971999 ) was categorized into 4 groups ( 4449 , 5054 , 5559 , and 6069 years ) . ses , assessed by the british civil service employment grade , was categorized into 3 groups in order of decreasing salary and work role : administrative ( high ) , professional / executive ( middle ) , and clerical / support ( low ) . ethnicity was defined according to the office for national statistics 1991 census categories , and participants were initially categorized into 4 ethnic groups : white european , south asian , african caribbean , and other . numbers were too small to examine age and sexspecific hr and hrv trajectories for nonwhite minority ethnic groups . physical activity was categorized according to whether participants adhered to the world health organization ( who ) physical activity guidelines of at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week.32 these guidelines are widely used and have been quantitatively validated for cardiovascular outcomes.33 habitual physical activity over the 10year period was categorized as hardly ever ( once or less through followup ) , sometimes ( in 2 phases ) , or always ( in all 3 followup phases ) meeting the who guidelines . cardiometabolic problems at each phase were assessed as the presence of any of the following chronic disease or healthrelated conditions : diagnosed coronary heart disease including heart failure,9 , 34 stroke,35 hypertension,18 , 20 diabetes,19 , 29 and obesity.20 these factors were chosen as covariates based on systematic literature review as likely to profoundly influence hrv . at each screening , participants provided details of current medications taken in the previous 14 days ( generic name , brand name , or both ) . prescribed medication included all drugs taken in the previous 14 days that were prescribed by a doctor such as analgesics , antihyperlipidemic agents , antidiabetic agents , psychotropic agents , and antibiotics . we distinguished between beta blockers ( british national formulary codes , chapter 2.4 ) and other prescribed medications because previous studies have shown the former to have a beneficial effect on hrv levels.36 other cardiovascular and central nervous system related medications have been shown to decrease or have no effect on hrv levels.17 , 18 sdnn , lfhrv , and hfhrv were transformed by natural logarithm because their distributions were skewed . outliers ( mean3 sd ) were trimmed to 3 sd from the mean prior to transformation . ageadjusted arithmetic and geometric means and 95% cis were calculated for the subset of 1658 participants with complete hr and hrv measurements at each phase of data collection . for this subset of participants , the change in hr between the first and third measurements was defined as hr at phase 9 minus hr at phase 5 , scaled to a time difference of 10 years . for hrv measurements , spearman rank correlation coefficient was used to examine the correlations between the hr and hrv measures at phase 5 . two sets of linear mixed models were used to estimate change in hr and hrv over 10year followup . this method of estimation uses all available data over followup , takes into account the intraindividual correlation between repeated measurements , and can handle missing data . the intercept was fitted as a random effect , allowing participants to have different hrv values at baseline.37 the first set of models was used to examine agespecific hrv trajectories without adjusting for any covariates . the dependent variable was the 3 repeated measurements of hr and hrv , and the independent variables were time ( exact time in years between phases , included as a continuous variable , divided by 10 to yield estimates of change over 10 years ) , age at phase 5 ( included as a categorical variable ) , and interaction between time and age ( thereby enabling the rate of change to vary by age at baseline ) . interaction terms suggested sex difference in the association between age and hr trajectories ( p=0.074 ) , leading us to stratify all analyses by sex . in the second set of models , 5 key covariates ( cardiometabolic problems , medication use [ other than beta blockers ] versus those not on medication , ses , ethnicity , and adherence to who physical activity guidelines ) were included to explore their temporal association with hr and hrv . the following 3 ageadjusted coefficients were of interest , using cardiometabolic condition incidence as an example : ( 1 ) the coefficient for time represented the 10year change in hr or hrv for participants in the reference category ( ie , no cardiometabolic condition ) , ( 2 ) the coefficient for cardiometabolic condition represented the difference in hr or hrv between the no cardiometabolic condition and cardiometabolic condition groups at baseline ( phase 5 ) , and ( 3 ) the coefficient for the interaction between time and cardiometabolic condition represented the difference in the 10year rate of change between participants with and without cardiometabolic condition . as we focused on medications associated with potential decreases in hrv , we excluded participants using beta blockers in primary analyses . in secondary analyses , we focused specifically on the rates of change in hr and hrv for the participants who reported use of beta blockers at any phase over the 10year period . sensitivity analyses were also run focusing specifically on a subset of healthy participants , namely , those who were free of a cardiometabolic condition and had no reported medication use over the 10year period . of the 10 308 participants at phase 1 ( 19851988 ) , 306 died and 752 dropped out of the study before the start of hr and hrv data collection at phase 5 ( 19971999 ) . of the 9250 remaining participants , hr and hrv measures were obtained from 3365 , 4095 , and 5624 participants at phases 5 , 7 , and 9 , respectively . a total of 6410 participated in 1 of the 3 hr and hrv assessments over 10 years ; 4414 had 2 assessments of hr and hrv over the 10year followup . twothirds ( 2756 ) of the 4414 participants in the analytical sample contributed 2 waves of hr and hrv data , and 1658 ( 37.6% ) contributed all 3 waves . the analytical sample was composed of more men than women ( 70.8% versus 59.9% ; p<0.001 ) and persons from the high employment grade ( 43.2% versus 35.1% ; p<0.001 ) . in participants with only 1 measure , the mean estimates of hr and lfhrv were slightly higher and lower , respectively , for both sexes at phase 5 compared with the main analysis . table s1a compares the characteristics at phase 5 for participants with 1 hr and hrv assessment versus 2 assessments . compared with participants with 1 assessment , the analytical sample was composed of more men than women ( 72.0% versus 68.4% ; p=0.004 ) , more persons in the youngest age category ( 22.9% versus 20.3% aged 4449 years at phase 5 ; p<0.001 ) , and persons from the high employment grade ( 45.1% versus 38.6% ; p<0.001 ) . table 1 presents the descriptive characteristics of the analytical sample at phases 5 , 7 , and 9 by age , civil service grade , ethnicity , presence of cardiometabolic problems , medication use , and adherence to who physical activity guidelines . table s1b presents the spearman rank correlation coefficients between hr and hrv at phase 5 . strong positive correlations were found between all hrv measures except for lfnu , ranging from 0.74 ( lfhrv and hfhrv ) to 0.90 ( lfhrv and sdnn ) . correlations between hrv and hr were negative and lower in magnitude : r=0.47 for sdnn , r=0.37 for lfhrv , and r=0.42 for hfhrv . descriptive characteristics of analytical sample by data collection phase and sex whitehall ii study participants with 2 assessments of heart rate and heart rate variability over 10year followup . chd indicates coronary heart disease ; cns , central nervous system ; cvd , cardiovascular disease ; who , world health organization . presence of any of the following cardiometabolic conditions : diagnosed chd , stroke , heart failure , diabetes , obesity , and hypertension . habitual physical activity over the 10year period was categorized as hardly ever ( once or less through followup ) , sometimes ( in 2 phases ) , or always ( in all 3 followup phases ) meeting the who guidelines . table 2 presents the ageadjusted means at phases 5 , 7 , and 9 for the subset of 1658 participants with hr and hrv measurements at all 3 phases . average levels of hr , sdnn , and lf and hfhrv decreased consistently for men but increased for women from phase 5 to 7 . these hrv measures , however , declined significantly for both sexes over the 10year followup . hfhrv , for example , decreased by 30.6% for men and 32.8% for women over the 10year period . ageadjusted heart rate and heart rate variability means ( 95% ci ) at baseline and 5 and 10year followup by sex whitehall ii study participants with assessment of hr and hrv at each phase over the 10year followup . bpm indicates beats per minute ; hfhrv , highfrequency heart rate variability ; hr , heart rate ; lfhrv , lowfrequency heart rate variability ; lfnu , lowfrequency heart rate variability in normalized units ; sdnn , standard deviation of all intervals between r waves with normaltonormal conduction . table 3 presents the results from the mixed models that estimated associations between age at baseline and hr and hrv trajectories . agespecific rates of change over the 10year followup estimated from each model are presented in table 4 . results indicated significant decreases in sdnn , lfhrv , hfhrv , and hr ; however , the interaction terms between age at baseline and time showed significant differences in the rate of decline in lfhrv for women , in hfhrv for men and for women , and in lfnu for men . younger participants at baseline experienced faster decline in hfhrv than their older counterparts ( p=0.001 and p=0.020 for the timeage interaction term for men and for women , respectively ) . change in hfhrv for men aged 60 years at baseline , for example , was 13% over 10 years compared with 52% for men aged 44 to 49 years ( see table 4 ) . in the case of lfnu , older men at baseline ( aged 5459 and 60 years ) experienced decreases in lfnu compared with no change in the youngest men ( aged 4449 years ) . declines in hr and sdnn for women showed marginally significant differences in the rate of change across age groups ( p=0.063 and p=0.060 ) ( table 3 ) . associations ( mixedmodels analyses ) between age at baseline and heart rate and heart rate variability trajectories by sex whitehall ii study participants with 2 assessments of hr and hrv over the 10year followup hfhrv indicates highfrequency heart rate variability ; hr , heart rate ; lfhrv , lowfrequency heart rate variability ; lfnu , lowfrequency heart rate variability in normalized units ; sdnn , standard deviation of all intervals between r waves with normaltonormal conduction . p value from adjusted wald test . estimated agespecific 10year rates of change ( 95% cis ) in heart rate and heart rate variability trajectories by sex hfhrv indicates highfrequency heart rate variability ; hr , heart rate ; lfhrv , lowfrequency heart rate variability ; lfnu , lowfrequency heart rate variability in normalized units ; sdnn , standard deviation of all intervals between r waves with normaltonormal conduction . table 5 presents results from the mixedmodels analysis undertaken to assess associations among cardiometabolic condition , medication use ( other than beta blockers ) , and hr and hrv trajectories . at baseline , cardiometabolic condition was significantly associated with lower values of sdnn , lfhrv , and hfhrv for both sexes and lower values of lfnu for men . for men , cardiometabolic condition had no significant effect on the rate of decline in hrv measures . for women , cardiometabolic condition was associated with faster rates of decline in sdnn , lfhrv , and lfnu . at baseline , reported use of prescribed medication ( other than beta blockers ) was associated with significantly lower values of sdnn , lfhrv , and hfhrv for men and for women and with higher values of hr for men . differences in the rate of change in hr and hrv by medication group were not significant for either sex . the dynamics of hr and hrv change over time by cardiometabolic condition and reported medication use ( other than beta blockers ) are presented in figures 1 and 2 respectively . associations ( mixedmodels analyses ) between cardiometabolic condition and medication use and heart rate and heart rate variability trajectories by sex estimates were obtained from mixed models including time , age at baseline , timeage , cardiometabolic condition or medication use , and timecardiometabolic condition or medication use . the interaction term for models including cardiometabolic condition shows the estimated difference in the 10year rate of change between the no cardiometabolic condition and cardiometabolic condition groups . likewise , the interaction term for models including medication use shows the estimated difference in the 10year rate of change between participants reporting and not reporting use of prescribed medication . hfhrv indicates highfrequency heart rate variability ; hr , heart rate ; lfhrv , lowfrequency heart rate variability ; lfnu , lowfrequency heart rate variability in normalized units ; sdnn , standard deviation of all intervals between r waves with normaltonormal conduction . modelpredicted trajectories of agerelated change in hr and hrv measures in men ( a ) and women ( b ) aged 44 to 69 years ( 19971999 ) with and without reported cardiometabolic condition over a 10year followup period . the trajectories for each age group at phases 5 , 7 , and 9 were predictions from a linear mixed model including time , age at baseline , timeage , cardiometabolic condition , and timecardiometabolic condition . hr indicates heart rate ; hrv , heart rate variability ; hf , highfrequency heart rate variability ; lf , lowfrequency heart rate variability ; lfnu , lowfrequency heart rate variability in normalized units ; sdnn , standard deviation of all intervals between r waves with normaltonormal conduction . modelpredicted trajectories of agerelated change in hr and hrv measures in men ( a ) and women ( b ) aged 44 to 69 years ( 19971999 ) with and without reported medication use ( other than beta blockers ) over a 10year followup period . the trajectories for each age group at phases 5 , 7 , and 9 were predictions from a linear mixed model including time , age at baseline , timeage , use of prescribed medication , and timemedication use . hr indicates heart rate ; hrv , heart rate variability ; hf , highfrequency heart rate variability ; lf , lowfrequency heart rate variability ; lfnu , lowfrequency heart rate variability in normalized units ; sdnn , standard deviation of all intervals between r waves with normaltonormal conduction . in secondary analyses , reported use of beta blockers at baseline was associated with significantly lower values of hr , lfhrv , and lfnu for men and for women and significantly higher values of hfhrv for women . reported use of beta blockers over 10 years was significantly associated with faster declines in sdnn and lfhrv for women ( p=0.029 and p=0.032 ) but not for men ( data not shown ) . at each phase , average levels of sdnn for men in the high employment grade were highest and average levels of hr were lower than for men in the middle and low grades . differences in the rate of change in hr and hrv across ses were not statistically significant ( table s2a and s2b ) . for both sexes , average values of lfnu were significantly higher , and for men , values of hfhrv were significantly lower for participants of white ethnic origin . differences in the rate of change across the white and nonwhite ethnic minority groups were not statistically significant ( table s3a and s3b ) . for men who consistently adhered to the who physical activity guidelines ( at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week ) over the 10year period , average levels of sdnn , lfhrv , and hfhrv were higher and average levels of hr were lower than for men who met the guidelines on 1 occasion . differences in the rate of change across the physical activity groups were not significant for hrv in either sex and were not significant for hr for men . for women , levels of adherence to who guidelines were associated with differences in the rate of change in hr . compared with women who met the guidelines on 1 occasion throughout 10year followup , women who met the guidelines on each occasion showed a faster pace of decline in hr ( table s4a and s4b ) . at each phase , average levels of sdnn for men in the high employment grade were highest and average levels of hr were lower than for men in the middle and low grades . differences in the rate of change in hr and hrv across ses were not statistically significant ( table s2a and s2b ) . for both sexes , average values of lfnu were significantly higher , and for men , values of hfhrv were significantly lower for participants of white ethnic origin . differences in the rate of change across the white and nonwhite ethnic minority groups were not statistically significant ( table s3a and s3b ) . for men who consistently adhered to the who physical activity guidelines ( at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week ) over the 10year period , average levels of sdnn , lfhrv , and hfhrv were higher and average levels of hr were lower than for men who met the guidelines on 1 occasion . differences in the rate of change across the physical activity groups were not significant for hrv in either sex and were not significant for hr for men . for women , levels of adherence to who guidelines were associated with differences in the rate of change in hr . compared with women who met the guidelines on 1 occasion throughout 10year followup , women who met the guidelines on each occasion showed a faster pace of decline in hr ( table s4a and s4b ) . the main finding in this large longitudinal uk populationbased study is that hrv decreased with aging independent of pathological conditions or medication use , potentially suggesting that cardiac autonomic modulation diminishes due to normative aging . men and women showed similar rates of hrv decline , with faster decline in younger age groups . crosssectionally , average levels of hrv were lower for men than for women , for participants with cardiometabolic condition , and for participants reporting the use of prescribed medications other than beta blockers . we further observed that women with a cardiometabolic condition experienced faster decline in sdnn , lfhrv , and lfnu compared with women without a cardiometabolic condition . ses , ethnicity , and habitual physical activity did not show statistically significant associations with longitudinal hrv trajectories . finally , women who met the who physical activity guidelines on each occasion over 10year followup showed a faster pace of decline in hr than women who met the guidelines on 1 occasion . average levels of sdnn , lfhrv , and hfhrv in this large uk middleaged cohort were similar to levels seen in populationbased studies in the united states19 and germany38 based on shortterm hrv recordings measured using similar procedures . given the dearth of longitudinal studies of patterns of hrv changes with aging , it is important that our current study replicated most of the crosssectional evidence of hrv declines with aging.10 , 12 , 13 , 14 our study is unique in demonstrating agerelated hrv changes based on shortterm recordings . most of the crosssectional10 , 11 , 14 , 15 and longitudinal17 , 22 evidence on agerelated changes in hrv has been based on 24hour hrv recordings that provide different physiological information than shortterm recordings during which conditions are controlled and stable.5 consequently , we can compare our findings with only 1 other longitudinal populationbased study . in the atherosclerosis risk in communities ( aric ) study , the mean annual decrease in sdnn for > 6000 middleaged men and women ( aged 4564 years ) was similar to our results.8 , 18 , 19 no studies of aric data have reported on longitudinal changes of frequencydomain hrv or on differences in hrv trajectories according to sex and/or across age groups . an earlier study using whitehall ii data based on 2 shortterm hrv recordings20 showed that hrv declined for men but increased for women over the 5year followup period . using additional followup of hrv measurements for the same cohort , we no longer observed increases in mean hrv for women over the 10year period . moreover , our analyses revealed similarities in the temporal course and rate of decline in hrv measures for both sexes . we examined the influence of a number of factors that could have accounted for the unexpected increase in hrv levels for women from phase 5 to 7 , including use of hormone replacement therapy and oral contraceptives or menopausal status . these factors did not explain the 5year increase in hrv or the longer term decline in hrv over the 10year period ( data not shown ) . the crosssectional associations found in our study between cardiometabolic conditions ( history of coronary heart disease , heart failure , stroke , diabetes , hypertension , and obesity ) and/or cardiovascularrelated medications ( other than beta blockers ) and hrv levels were also in line with previous studies.9 , 18 , 19 , 20 , 21 , 34 , 35 participants reporting use of beta blockers had similar or slightly more favorable hr and hrv levels compared with untreated participants . hr and hrv levels were much more favorable for participants using beta blockers compared with those on other medications ; however , the beneficial effects of beta blockers on sympathetic nervous system activity36 declined for women over the 10year followup , as reflected by their faster rate of decline in sdnn compared with those not taking medication . this finding should be treated with caution because small sample sizes meant that our study lacked sufficient power to detect small differences in the rate of change in hr and hrv according to beta blocker use . although hrv decreases were influenced by cardiometabolic condition for women , none of the 5 key covariates fully explained the declining trend in hrv as both men and women aged over the 10year period . our sensitivity analysis focusing specifically on a subset of healthy participants those without cardiometabolic condition and with no reported medication use at any of the 3 data collection phases produced largely similar results of declining hrv trajectories . although the biological interpretation of hrv indices is complex , the decreasing sdnn and hfhrv trajectories may suggest that both normative and potentially pathological aging is accompanied by gradual reduction of overall fluctuation in cardiac autonomic input and by gradual reduction in parasympathetic modulation . mechanisms underlying changes in parasympathetic modulation with aging may be related to changes in cholinergic and muscarinic pathways through which vagal signal is carried . this may include disturbed cardiac acetylcholine release response to stimulation,39 decreases in muscarinic receptor activity,40 and reductions in m2 muscarinic receptor density with aging,41 all of which have been shown to decrease with aging in clinical trials . loss of protective vagal reflexes seems to hinder physical and psychological functioning and capacity to respond flexibly to efferent stimuli , resulting in increased vulnerability to the diseases2 , 42 that are often prevalent at older ages.43 trajectories in lfhrv , measured in the supine position in our study , changed in the same direction and in a similar pattern to hfhrv , suggesting that lfhrv not only is a measure of sympathetic activity , as reported in some studies , but also represents the variation in rr interval caused by more graduated interplay between sympathetic and parasympathetic activities.5 our results may also provide possible insight into plausible biological pathways of sex differences in cardiac autonomic functioning . in addition , we observed differences in lfnu trajectories by sex that may reflect sexspecific differences in balance between the 2 branches of autonomic nervous system with aging . a number of authorities22 , 44 have suggested that the parasympathetic and sympathetic branches of the autonomic nervous system operate differently for men and for women to achieve homeostasis . the observed sex differences in our study may thus be related to different biological ways of responding to stress44 and/or health conditions.45 the exact mechanisms underlying sex differences in cardiac autonomic functioning , however , are poorly understood.22 a key strength of our investigation is the use of participantlevel longitudinal data with 3 repeated measures of hrv over a decade in a nonclinical setting . multiple measures of shortterm hrv in both the time and frequency domains allowed us to attribute hrv changes to parasympathetic or / and sympathetic modulation changes and generally to changes in cardiac autonomic function . we used repeated measures of covariates , not just baseline measures , allowing the presence of cardiometabolic condition and reported medication use to vary over the 10year period . the analytical sample for our study was reduced in size due to death and nonresponse or withdrawal from the study prior to the start of hr and hrv data collection in phase 5 and through staff not being available for 2 months at phase 5 . in addition , we restricted the analytical sample to the subset of participants with at least 2 hrv measurements to estimate withinperson change in hr and hrv levels . although the sizeable amount of missing data at phase 5 has been shown to be random,24 the observed declines in hrv are most likely underestimated to some extent in our study because of a healthy survival bias ( selective attrition in the cohort ) ; those with the presence of risk factors or low hrv levels may be more likely to drop out.46 sample sizes were too small to examine the age and sexspecific trajectories for nonwhite minority ethnic groups such as people of south asian and african caribbean origin . we can not rule out the contribution of device effects because different recording equipment was used in each phase ; however , the hrv protocols were consistent across all data collection phases . although 5minute hrv recordings are highly repeatable47 and considered representative of 24hour ambulatory hrv recordings,48 longterm recordings may offer more comprehensive and accurate evaluation of hrv changes over time . finally , the whitehall ii study is an occupationbased cohort and thus is healthier on average than the general population . nevertheless , etiological findings from the whitehall ii cohort have been shown to be comparable to other populationbased studies.49 a key strength of our investigation is the use of participantlevel longitudinal data with 3 repeated measures of hrv over a decade in a nonclinical setting . multiple measures of shortterm hrv in both the time and frequency domains allowed us to attribute hrv changes to parasympathetic or / and sympathetic modulation changes and generally to changes in cardiac autonomic function . we used repeated measures of covariates , not just baseline measures , allowing the presence of cardiometabolic condition and reported medication use to vary over the 10year period . the analytical sample for our study was reduced in size due to death and nonresponse or withdrawal from the study prior to the start of hr and hrv data collection in phase 5 and through staff not being available for 2 months at phase 5 . in addition , we restricted the analytical sample to the subset of participants with at least 2 hrv measurements to estimate withinperson change in hr and hrv levels . although the sizeable amount of missing data at phase 5 has been shown to be random,24 the observed declines in hrv are most likely underestimated to some extent in our study because of a healthy survival bias ( selective attrition in the cohort ) ; those with the presence of risk factors or low hrv levels may be more likely to drop out.46 sample sizes were too small to examine the age and sexspecific trajectories for nonwhite minority ethnic groups such as people of south asian and african caribbean origin . we can not rule out the contribution of device effects because different recording equipment was used in each phase ; however , the hrv protocols were consistent across all data collection phases . although 5minute hrv recordings are highly repeatable47 and considered representative of 24hour ambulatory hrv recordings,48 longterm recordings may offer more comprehensive and accurate evaluation of hrv changes over time . finally , the whitehall ii study is an occupationbased cohort and thus is healthier on average than the general population . nevertheless , etiological findings from the whitehall ii cohort have been shown to be comparable to other populationbased studies.49 our study shows that normative hrvdeclining trajectories exist largely independently of cardiometabolic conditions or reported use of medication . we have further described the agerelated progression of hrv according to sex , ethnicity , ses , and habitual physical activity , and that information could help improve understanding of cardiac autonomic functioning in aging populations . the whitehall ii study is supported by grants from the uk medical research council ( k013351 ) , british heart foundation ( rg/07/008/23674 ) , stroke association , national heart lung and blood institute ( hl036310 ) and national institute on aging ( ag13196 and ag034454 ) . jandackova was supported by a university of ostrava award ( sgs23/lf/2015 ) and by a young investigator of moraviansilesian region award ( 02679/2014/rrc ) . baseline characteristics of participants with 1 assessment of heart rate ( hr ) and hr variability ( hrv ) and the analytical sample ( 2 assessments of hr and hrv ) table s1b . measures of heart rate and heart rate variability and their intercorrelations at baseline ( n=2718 ) table s2a . associations ( mixedmodels analyses ) between age at baseline and civil service employment grade and heart rate and heart rate variability trajectories by sex table s2b . estimated agespecific 10year rates of change ( 95% cis ) in heart rate and heart rate variability trajectories by civil service employment grade table s3a . associations ( mixedmodels analyses ) between age at baseline and ethnicity and heart rate and heart rate variability trajectories by sex table s3b . estimated agespecific 10year rates of change ( 95% cis ) in heart rate and heart rate variability trajectories by ethnicity table s4a . associations ( mixedmodels analyses ) between age at baseline and habitual physical activity and heart rate and heart rate variability trajectories by sex table s4b . estimated agespecific 10year rates of change ( 95% cis ) in heart rate and heart rate variability trajectories by habitual physical activity click here for additional data file .

backgroundno study to date has investigated longitudinal trajectories of cardiac autonomic modulation changes with aging ; therefore , we lack evidence showing whether these changes occur naturally or are secondary to disease or medication use . this study tested whether heart rate variability ( hrv ) trajectories from middle to older age are largely normative or caused by pathological changes with aging in a large prospective cohort . we further assessed whether hrv changes were modified by socioeconomic status , ethnicity , or habitual physical activity.methods and resultsthis study involved 3176 men and 1238 women initially aged 44 to 69 years ( 19971999 ) from the uk whitehall ii populationbased cohort . we evaluated time and frequencydomain hrv measures of shortterm recordings at 3 time points over a 10year period . random mixed models with timevarying covariates were applied . crosssectionally , hrv measures were lower for men than for women , for participants with cardiometabolic conditions , and for participants reporting use of medications other than beta blockers . longitudinally , hrv measures decreased significantly with aging in both sexes , with faster decline in younger age groups . hrv trajectories were not explained by increased prevalence of cardiometabolic problems and/or medication use . in women , cardiometabolic problems were associated with faster decline in the standard deviation of all intervals between r waves with normaltonormal conduction , in lowfrequency hrv , and in lowfrequency hrv in normalized units . socioeconomic status , ethnicity , and habitual physical activity did not have significant effects on hrv trajectories.conclusionsour investigation showed a general pattern and timing of changes in indices of cardiac autonomic modulation from middle to older age . these changes seem likely to reflect the normal aging process rather than being secondary to cardiometabolic problems and medication use .

holt - oram syndrome ( hos ) is an autosomal dominant condition with complete penetrance . manifested in 1:1 , 00 , 000 live births and characterized by forelimb deformities , congenital heart disease and/or cardiac conduction abnormalities . it is linked to a single - gene tbx5 protein - producing mutation with gene map locus 12q24 and is the most commonly occurring heart - hand syndrome . congenital cardiac and upper limb malformations frequently occur together and are classified as heart hand syndromes . the most common among the heart hand disorders is hos , which is characterized by cardiac septation defects and preaxial radial ray abnormalities . this condition with a high rate ( 3085% ) of new non - familial cases was first described by holt and oram in 1960 in a 4-generation family with atrial septal defects ( asd ) and thumb abnormalities . the most common cardiac disorder is an ostium secundum asd , followed by ventricular septal defect ( vsd ) and ostium primum asd . electrocardiogram ( ecg ) abnormalities such as various degrees of atrioventricular ( av ) block have also been reported . a full term female neonate born out of a nonconsanguineous marriage by cesarean section ( indication - previous cesarean section with polyhydramnios ) to a 25-year - old ( weight 58 kg , height 155 cm ) booked g3p1l1a1 with unremarkable antenatal history . family history revealed that the father has radial ray deformity of left upper limb without any cardiac anomaly . physical examination revealed an active baby weighing 2790 g and length of 49 cm , heart rate of 146/min , blood pressure of 70/30 mm of hg , respiratory rate of 40/min , and systemic oxygen saturation of right upper limb being 83% in room air and that of right lower limb being 74% in room air [ figure 1 ] . on musculoskeletal examination , left upper limb shortening was noticed with absent radius bone , radial flexion deformity of the wrist and also absent thumb [ figure 2 ] . no obvious deformities were noticed elsewhere . on cardio - vascular system examination , the pansystolic murmur of grade iii at the mitral and left parasternal area was heard picture showing the baby of holt - oram syndrome left upper limb showing radial ray deformity with absent thumb right hand showing triphalangeal thumb on further investigation , chest x - ray showed normal thoracic situs with cardiomegaly , plain radiograph of both upper limbs revealed absent radius on left side with absent carpal bones and absent first metacarpal bone and phalanges ( thumb ) , right side showing absent carpal bones and triphalangeal thumb [ figure 4 ] . plain radiograph showing the bony deformities of the upper limb with cardiomegaly the baby developed cyanosis couple of hours after delivery , following which an ecg was done which was normal and a 2d echocardiography was done which revealed severe aortic atresia with hypoplastic arch , large perimembranous vsd and asd as well [ figure 5 ] . the neonate was referred to a cardiac center for further management , however due to lack of resources the baby died on day 4 of life . holt - oram syndrome is an autosomal dominant disorder characterized by distinctive malformation of bones of the upper limbs and abnormalities of the heart . cardinal manifestations of hos are dysplasia of upper limb that ranges from minor findings including hypoplasia of thumb , clinodactyly , brachydactyly , triphalangeal thumbs , carpal bone dysmorphism , shortness of ulna , shortness of humerus , aplasia of radius to phocomelia and cardiac abnormalities . although bilateral , left side is often affected more significantly . in a study of 98 subjects with hypoplastic thumbs , 16% proved to be the cases of hos . there are many well described heart - hand syndromes characterized by deformities of the radial ray and congenital heart defects such as thrombocytopenia absent radius syndrome , roberts syndrome , thalidomide embryopathy , and fanconi anemia . the unique feature that helps to differentiate these from hos is that the radial aplasia is associated with hypoplasia / absence of the thumb without any hematological abnormalities and there is often a family history of heart and limb defects . the associated congenital heart defects are the most important determining factors in morbidity and mortality in these patients . other cardiac associations include pulmonary stenosis , mitral valve prolapse and arrhythmias in the form of atrioventricular blocks . more complex cardiac lesions such as tetralogy of fallot , endocardial cushion defects , and total anomalous pulmonary venous return are observed in 18% of subjects with hos . the association with aortic atresia is extremely rare . as per best of our knowledge , till date there were no cases reported in the literature having a description of hos with aortic atresia . the electrocardiographic abnormalities such as variable degree of av blocks have also been reported , but in our case no conduction defects were noted . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .

holt - oram syndrome ( hos ) is a rare autosomal dominant disorder that causes abnormalities of the upper limbs and heart . it is seen in 1:1 , 00 , 000 live births . it is linked to a single - gene tbx5 protein - producing mutation with gene map locus 12q24 . most commonly it is characterized by the cardiac septation defects and pre - axial radial ray abnormalities . we are reporting a case of hos with aortic atresia which is a rare association .

the binding of il-6 to its receptor induces the activation of multiple signal transduction pathways such as jak / stats ( janus tyrosine kinase / signal transducers and activators of transcription ) pathway , ras / erk ( extracellular signal - regulated kinase ) pathway , and pi 3-k ( phosphotidylinositol 3-kinase)/akt pathway via gp130 tyrosine phosphorylation . the roles of jak / stats pathway and ras / erk pathway in the biological effects of il-6 have been extensively investigated . however , what role pi 3-k / akt plays in il-6 signaling is less clear . akt is a serine ( ser)/threonine ( thr ) protein kinase which resides within the cytosol in a catalytically inactive state in quiescent or serum - starved cells . after stimulation of cells with growth factors and cytokines , akt is catalytically activated by phosphorylation at thr308 and ser473 . activated akt in turn phosphorylates downstream target molecules and induces the expression of anti - apoptosis proteins , which promote induction of its anti - apoptosis effect . recently , growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells [ 3 - 6 ] . still , whether pi 3-k / akt plays the same role in il-6-dependent growth of 7td1 mouse - mouse b cell hybridoma is not known . in our previous work , we showed that erk cascade but not stat3 contributed to il-6-dependent growth of 7td1 cells . here we report that il-6 triggers activation of pi3-k / akt signaling in 7td1 cells , and that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . -mercaptoethanol and recombinant human il-6 ( 10u / mg ) were added to the medium at final concentration of 5 10mol / l and 5 ng / ml , respectively . wortmannin ( sigma ) was dissolved in dmso to 2.5 mm and stored at -20c . dmso was added to control cells to keep concentrations of dmso ( < 0.1% ) equal in all samples . the cells were pretreated with wortmannin for 30 min at 37c before il-6 was added to the medium . the cells were seeded into 96-well plate and cultured in the presence of different dose of il-6 for 72 h. afterwards , 10 l mtt ( sigma , 5 mg / ml ) was added to each well , 4 h later , an equal volume of 10%sds-10 mm hcl was added to dissolve the blue crystals of formazan . the samples were measured at od 570 nm by an elisa reader ( dynatech laboratories , inc . u.s.a . ) . after protein determination , total cell lysates ( 5 10cell / sample ) were boiled in 2 reducing sds loading buffer of equal volume for 10 min . after electrophoresis , proteins were transferred to a 0.45 3 m pore - size nitrocellulose membrane at 40 v for 2 h. non - specific binding sites on the nitrocellulose membrane were blocked by incubation in blocking buffer ( 5% w / v , non - fat dried milk ) for 1 h at 37c . the blots were washed once with tris - buffered saline ( 10 mm tris / hcl ph 7.5 , 150 mm nacl ) and incubated with the primary antibody for 1 h at 37c or overnight at 4c . after the removal of excess primary antibody with three washes , the blots were incubated with a secondary antibody ( goat anti - mouse or goat anti - rabbit antibodies conjugated with horseradish peroxidase ) . the membrane was developed with enhanced chemiluminescence reagent and exposed to hyperfilm - ecl(amersham life science corp . ) for detection . akt and phospho - akt ( ser473 ) antibodies were products of new england biolabs ( beverly , ma , u.s.a . ) . anti-(human xiap ) antibody was a product of medical and biological laboratories ( naka , nagoya , japan ) . anti - bcl-2 and anti - caspase-3 antibodies were obtained from santa cruz biotechnology ( santa cruz , ca , u.s.a . ) . -mercaptoethanol and recombinant human il-6 ( 10u / mg ) were added to the medium at final concentration of 5 10mol / l and 5 ng / ml , respectively . wortmannin ( sigma ) was dissolved in dmso to 2.5 mm and stored at -20c . dmso was added to control cells to keep concentrations of dmso ( < 0.1% ) equal in all samples . the cells were pretreated with wortmannin for 30 min at 37c before il-6 was added to the medium . the cells were seeded into 96-well plate and cultured in the presence of different dose of il-6 for 72 h. afterwards , 10 l mtt ( sigma , 5 mg / ml ) was added to each well , 4 h later , an equal volume of 10%sds-10 mm hcl was added to dissolve the blue crystals of formazan . the samples were measured at od 570 nm by an elisa reader ( dynatech laboratories , inc . u.s.a . ) . after protein determination , total cell lysates ( 5 10cell / sample ) were boiled in 2 reducing sds loading buffer of equal volume for 10 min . after electrophoresis , proteins were transferred to a 0.45 3 m pore - size nitrocellulose membrane at 40 v for 2 h. non - specific binding sites on the nitrocellulose membrane were blocked by incubation in blocking buffer ( 5% w / v , non - fat dried milk ) for 1 h at 37c . the blots were washed once with tris - buffered saline ( 10 mm tris / hcl ph 7.5 , 150 mm nacl ) and incubated with the primary antibody for 1 h at 37c or overnight at 4c . after the removal of excess primary antibody with three washes , the blots were incubated with a secondary antibody ( goat anti - mouse or goat anti - rabbit antibodies conjugated with horseradish peroxidase ) . the membrane was developed with enhanced chemiluminescence reagent and exposed to hyperfilm - ecl(amersham life science corp . ) for detection . akt and phospho - akt ( ser473 ) antibodies were products of new england biolabs ( beverly , ma , u.s.a . ) . anti-(human xiap ) antibody was a product of medical and biological laboratories ( naka , nagoya , japan ) . anti - bcl-2 and anti - caspase-3 antibodies were obtained from santa cruz biotechnology ( santa cruz , ca , u.s.a . ) . il-6 induced phosphorylation ( ser473 ) of akt , a downstream effector of pi 3-k , in 7td1 cells . this activation by il-6 occurred as early as 5 min , and was dependent on the dose of il-6 . il-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of different dose of il-6 for 5 min or in the presence of 1 ng / ml il-6 for 0 , 5 , 10 , 30 , 60 min respectively . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . this figure is representative of 3 separate experiments . to investigate what role pi 3k / akt plays in the signal transduction of il-6 in 7td1 hybridoma cells , we determined the effects of wortmannin , a pi 3-k specific inhibitor at 10100 nmol / l , on il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . it was found that wortmannin significantly antagonized il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells and the inhibitory effects of wortmannin were dependent on its concentration . these data confirm that activation of akt is mediated by a pi 3-k - dependent mechanism and suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells ( fig . effects of wortmannin on il-6-induced phosphorylation of akt ( a ) and il-6-dependent growth of 7td1 cells ( b ) . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . ( after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . ( b ) the cells were seeded into 96-well plate ( 2 10cells per well ) and cultured in the presence of different dose of il-6 for 72 h. afterwards , mtt assay was performed to determine the effect of wortmannin on il-6-dependent growth of 7td1 cells . the preceding experiments suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . recent evidence has indicated that proteins of the inhibitor of apoptosis ( iap ) family , whose expression might be under the regulation of nf-b , can block apoptotic events by directly binding and inhibiting selected caspases . a potent mammalian iap is x - linked iap ( xiap ) , for which the mechanism of action involves the direct binding and inhibition of caspase-3 and caspase-7 , two key effector proteases of apoptosis . it is reported that the level of bcl-2 , but not bcl - xl and mcl-1 , decreased after il-6 deprivation . to examine the effects of il-6-induced pi3-k / akt activation on these apoptosis - related proteins , we further studied il-6-induced expression of bcl-2 as well as xiap and caspase-3 in 7td1 cells by western - blotting assay with bcl-2 , xiap , and caspase-3 antibodies , with or without wortmannin . untreated 7td1 cells displayed significant levels of these apoptosis - related gene products ( fig . 3 ) . il-6 significantly up - regulated the levels of xiap and bcl-2 but had little effect on the level of caspase-3 . . taken together , these data suggest that il-6 might induce up - regulation of xiap through pi 3-k / akt activation . effects of il-6 and wortmannin on the expression of apoptosis - related proteins in 7td1 cells . ( a ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of 1 ng / ml il-6 for various periods as indicated . at the end of the incubation period , whole - cell extracts were prepared and subjected to western - blotting assay . ( b ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . the cells were cultured for 1 h in the presence of il-6 . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . il-6 induced phosphorylation ( ser473 ) of akt , a downstream effector of pi 3-k , in 7td1 cells . this activation by il-6 occurred as early as 5 min , and was dependent on the dose of il-6 . il-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of different dose of il-6 for 5 min or in the presence of 1 ng / ml il-6 for 0 , 5 , 10 , 30 , 60 min respectively . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . to investigate what role pi 3k / akt plays in the signal transduction of il-6 in 7td1 hybridoma cells , we determined the effects of wortmannin , a pi 3-k specific inhibitor at 10100 nmol / l , on il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . it was found that wortmannin significantly antagonized il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells and the inhibitory effects of wortmannin were dependent on its concentration . these data confirm that activation of akt is mediated by a pi 3-k - dependent mechanism and suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells ( fig . effects of wortmannin on il-6-induced phosphorylation of akt ( a ) and il-6-dependent growth of 7td1 cells ( b ) . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . ( after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . ( b ) the cells were seeded into 96-well plate ( 2 10cells per well ) and cultured in the presence of different dose of il-6 for 72 h. afterwards , mtt assay was performed to determine the effect of wortmannin on il-6-dependent growth of 7td1 cells . the preceding experiments suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . recent evidence has indicated that proteins of the inhibitor of apoptosis ( iap ) family , whose expression might be under the regulation of nf-b , can block apoptotic events by directly binding and inhibiting selected caspases . a potent mammalian iap is x - linked iap ( xiap ) , for which the mechanism of action involves the direct binding and inhibition of caspase-3 and caspase-7 , two key effector proteases of apoptosis . it is reported that the level of bcl-2 , but not bcl - xl and mcl-1 , decreased after il-6 deprivation . to examine the effects of il-6-induced pi3-k / akt activation on these apoptosis - related proteins , we further studied il-6-induced expression of bcl-2 as well as xiap and caspase-3 in 7td1 cells by western - blotting assay with bcl-2 , xiap , and caspase-3 antibodies , with or without wortmannin . untreated 7td1 cells displayed significant levels of these apoptosis - related gene products ( fig . 3 ) . il-6 significantly up - regulated the levels of xiap and bcl-2 but had little effect on the level of caspase-3 . . taken together , these data suggest that il-6 might induce up - regulation of xiap through pi 3-k / akt activation . effects of il-6 and wortmannin on the expression of apoptosis - related proteins in 7td1 cells . ( a ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of 1 ng / ml il-6 for various periods as indicated . at the end of the incubation period , ( b ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . the cells were cultured for 1 h in the presence of il-6 . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . il-6 inhibits physiological cell death and allows expansion of populations of serum - stimulated cells . how il-6 can promote the growth of 7td1 cells remains elusive . in our previous work , we showed that erk cascade but not stat3 contributed to il-6-dependent growth of 7td1 cells . however , activation of erk cascade seems not to be sufficient since mek inhibitor pd098059 pretreatment resulted in partial blockade of il-6-induced growth of 7td1 cells although il-6-induced activity of erk cascade can be completely blocked by pd098059 of the same concentration . in this work , we show that il-6-induced pi 3-k / akt activation is also essential for the optimal growth of 7td1 cells . taken together , our data suggest that il-6 promotes the growth of 7td1 cells via activation of multiple signal transduction pathways including erk cascade and pi 3-k / akt pathway . recently , growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells [ 3 - 6 ] . our data are consistent with these findings , further confirming the important roles of pi 3-k / akt in il-6 signaling . furthermore , we found that xiap , but not bcl-2 , might be a downstream target molecule of akt since both constitutive and il-6-induced expression of xiap , but not bcl-2 , in 7td1 cells was inhibited by wortmannin . recent evidence has indicated that the expression of xiap might be under the regulation of nf-b . pi 3-k / akt pathway is thought to be involved in the full activation of nf-b through phosphorylation of the rel proteins . this is the first report that xiap is involved in il-6-mediated anti - apoptosis mechanism .

backgroundrecently , growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells . however , whether pi 3-k / akt plays the same role in il-6-dependent growth of 7td1 mouse - mouse b cell hybridoma is not known.methodswe investigated the activation status of akt in 7td1 cells induced by il-6 . with pi 3-k specific inhibitor wortmannin , we also investigated the biological roles of akt activation in 7td1 cells.resultsil-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . wortmannin significantly reduced il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . furthermore , wortmannin blocked il-6-induced up - regulation of xiap , but not bcl-2 in 7td1 cells.conclusionthe data suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells through up - regulation of anti - apoptosis proteins such as xiap .

emergency peripartum hysterectomy ( eph ) is a major surgical venture invariably performed in the setting of life threatening hemorrhage during or immediately after abdominal and vaginal deliveries [ 15 ] . despite advances in medical and surgical fields , post partum hemorrhage continues to be the leading cause of maternal morbidity and mortality . eph is the most dramatic operation in modern obstetrics and is generally performed when all conservative measures have failed to achieve haemostasis in the setting of life threatening hemorrhage . the unplanned nature of the surgery and the need for performing it expeditiously , compound matters . moreover the acute loss of blood renders the patient in a less than ideal condition to undergo emergency surgical intervention . the predominant indications for eph are placenta previa / accreta and uterine atony and eph in some of them is unavoidable . however recognizing and assessing patients at risk and appropriate and timely intervention would go a long way in ensuring a better outcome in this otherwise difficult situation . hysterectomy following cesarean section ( cs ) was first described by porro , and was used to prevent maternal mortality due to post partum hemorrhage . the reported incidence of eph varies from 0.24 to 8.9 per 1000 deliveries [ 16 ] , ranging from 0.33(netherland ) , 0.2 ( norway ) , 0.3 ( ireland ) , 0.5 ( israel ) , 0.63 ( saudi arabia ) and 1.2 to 2.7 per 1000 deliveries in usa [ 25810 ] . a difference in the incidence of eph is noted following vaginal delivery and cesarean section . while the incidence of eph after vaginal delivery varies from 0.1 to 0.3/1000 deliveries and is rather constant between european and us studies , the incidence of eph following cs varies widely between 0.17 and 8.7/1000 deliveries . this is attributed to the proportion of women with previous cs with the concomitant risk of placenta previa andaccreta [ 16 ] . the risk factors for post partum hemorrhage include coagulopathies , uterine atony , retained products of conception , precipitate or prolonged labor , fetal macrosomia or multiparity , maternal obesity and previous primary post partum hemorrhage [ 16814 ] . according to one report the indication for eph which was uterine atony in 43.45% and placenta previa or accreta in 33.9% cases in 1984 changed 9 years later to placenta accreta ( 45% ) and uterine atony in 20% of the cases . similar findings are reported by others with abnormal placentation as the predominant indication , the incidence ranging from ( 45 to 73.3% ) ; and uterine atony in ( 26.6% to 35.6% ) [ 18815 ] . in recent years , abnormal placentation has become a more common indication due to the greater number of pregnant women with previous cesarean section deliveries [ 16 ] . the incidence of previous cesarean section ranges between 59.8% in patients with adherent placenta and 75% in patients with placenta previa . in view of several such reports , association between abnormal placentation and cesarean delivery has been suggested and the high incidence of eph is directly related to the increasing number of cesarean sections [ 1616 ] . this was further substantiated by another report where the incidence of placenta previa which was 1.9/1000 after one previous cs , increased by 47 fold to 91/1000 in patients with four previous cs . patients with placenta previa and scarred uterus had 16% risk of undergoing eph compared to 3.6% in patients with unscarred uterus . advancing age and parity are also reported to be important risk factors in developing placenta previa and accrete . the incidence of eph was higher in patients with placenta previa and accreta than in patients with placenta previa alone . the combination of factors including high parity , number of previous cesarean sections , abortion , previous curettage , strongly increased the likelihood of placenta previa and increased risk of abnormal adherent placenta . therefore , it appears prudent for the obstetrician to prepare for the possibility of eph for massive hemorrhage in patients undergoing cesarean section with these risk factors . of concern however , is the limited experience of performing emergency hysterectomy among the younger obstetricians as according to one report from netherlands , the average chance of performing one eph is once in 11 years . the decreasing rate of abdominal hysterectomy for gynecological conditions in recent years does not help matters with regard to gaining this valuable experience . this implies that more effort should be undertaken to recognize the potential risk of patients requiring eph and the need for involvement of an experienced obstetrician in the management at an early stage . eph being performed by an experienced surgeon is reported to significantly reduce the operating time , number of units of blood transfusion and hospital stay . the predisposing risk factors can be determined to a certain extent by performing antenatal ultrasound with color doppler and magnetic resonance imaging ( mri ) [ 1820 ] . however , the limiting factor is the high cost of mri and extensive experience needed . the measures include uterotonic drugs , uterine or hypogastric artery embolisation , hemostatic sutures , uterine or internal iliac artery ligation . conservative management is of particular importance in patients who are young , have low parity and who are haemodynamically stable . however while there are reports of 96% success rate following uterine artery ligation there are others who have achieved success in only 39.4% of these cases . the choice between conservative management and eph should be individualized . in situations where conservative treatment is likely to fail or has failed , there should be no further delay in performing eph as delay leads to increase in blood loss , transfusion requirement , operative time , dic , and increased possibility of admission to icu [ 16 ] . uterine atony is an indication for eph in 20.6% to 43% of the cases [ 16817 ] . while this was traditionally the leading cause for eph the incidence has reduced due to the use of newly developed pharmacologic treatment strategies including prostaglandins . multiparity and oxytocin use for uterine stimulation were found to be the risk factors for uterine atony requiring eph [ 16 ] . combs et al in their large case control study of patients with post partum hemorrhage reported that pre - eclampsia , nulliparity , twins , induction , prolonged labor and augmentation were all identified as independent risk factors for uterine atony . patients with uterine rupture as an indication for eph ranged from 11.4% to 45.5% . the risk factor for this would be multiple previous cesarean sections with a scarred uterus ( figure 1 ) . total hysterectomy is the recommended surgical method of eph due to the potential risk of malignancy developing in the cervical stump and the need for regular cytology and other associated problems such as bleeding or discharge associated with the residual cervical stump . currently the proportion of subtotal hysterectomy performed for eph ranges from 53% to 80% . the proponents of subtotal hysterectomy report a lesser blood loss , a reduced need for blood transfusion , reduced operating time and reduced intra and postoperative complications . total hysterectomy should however be considered when active bleeding occurs from lower uterine segment as the cervical branch of uterine artery may remain intact . the final decision to perform subtotal or total hysterectomy would be influenced by patient 's condition . hence , while total abdominal hysterectomy is a more convenient procedure , subtotal eph may be a better choice in certain conditions where surgery needs to be completed in a shorter time . uterine atony is an indication for eph in 20.6% to 43% of the cases [ 16817 ] . while this was traditionally the leading cause for eph the incidence has reduced due to the use of newly developed pharmacologic treatment strategies including prostaglandins . multiparity and oxytocin use for uterine stimulation were found to be the risk factors for uterine atony requiring eph [ 16 ] . combs et al in their large case control study of patients with post partum hemorrhage reported that pre - eclampsia , nulliparity , twins , induction , prolonged labor and augmentation were all identified as independent risk factors for uterine atony . the risk factor for this would be multiple previous cesarean sections with a scarred uterus ( figure 1 ) . uterine rupture with life threatening hemorrhage managed by peripartum hysterectomy . total hysterectomy is the recommended surgical method of eph due to the potential risk of malignancy developing in the cervical stump and the need for regular cytology and other associated problems such as bleeding or discharge associated with the residual cervical stump . currently the proportion of subtotal hysterectomy performed for eph ranges from 53% to 80% . the proponents of subtotal hysterectomy report a lesser blood loss , a reduced need for blood transfusion , reduced operating time and reduced intra and postoperative complications . total hysterectomy should however be considered when active bleeding occurs from lower uterine segment as the cervical branch of uterine artery may remain intact . the final decision to perform subtotal or total hysterectomy would be influenced by patient 's condition . hence , while total abdominal hysterectomy is a more convenient procedure , subtotal eph may be a better choice in certain conditions where surgery needs to be completed in a shorter time . uterine atony is an indication for eph in 20.6% to 43% of the cases [ 16817 ] . while this was traditionally the leading cause for eph the incidence has reduced due to the use of newly developed pharmacologic treatment strategies including prostaglandins . multiparity and oxytocin use for uterine stimulation were found to be the risk factors for uterine atony requiring eph [ 16 ] . combs et al in their large case control study of patients with post partum hemorrhage reported that pre - eclampsia , nulliparity , twins , induction , prolonged labor and augmentation were all identified as independent risk factors for uterine atony . the risk factor for this would be multiple previous cesarean sections with a scarred uterus ( figure 1 ) . total hysterectomy is the recommended surgical method of eph due to the potential risk of malignancy developing in the cervical stump and the need for regular cytology and other associated problems such as bleeding or discharge associated with the residual cervical stump . currently the proportion of subtotal hysterectomy performed for eph ranges from 53% to 80% . the proponents of subtotal hysterectomy report a lesser blood loss , a reduced need for blood transfusion , reduced operating time and reduced intra and postoperative complications . total hysterectomy should however be considered when active bleeding occurs from lower uterine segment as the cervical branch of uterine artery may remain intact . the final decision to perform subtotal or total hysterectomy would be influenced by patient 's condition . hence , while total abdominal hysterectomy is a more convenient procedure , subtotal eph may be a better choice in certain conditions where surgery needs to be completed in a shorter time . the complications included blood transfusion ( 88% ) , febrile episodes ( 26.5% ) , perinatal death ( 22.8% ) , bladder injuries ( 8.8% ) , wound infection , dic , ileus , vaginal cuff bleeding and adnexectomy . the maternal mortality ranged from 0 to 12.5% with a mean of 4.8% [ 168192124 ] . although no risk assessment system can predict all instances where cesarean delivery will be needed , a significant percentage of the patients who are at high risk for severe hemorrhage and the subsequent need of emergency hysterectomy can be identified before surgery . the presence of preoperative risk factors should facilitate consultation , referral or transfer of patients before surgery to a tertiary care facility . due to the complexity of the surgery and decision making , proper surgical measures such as hemostatic sutures or uterine or hypogastric artery ligation or embolization are options in attempting uterine conservation particularly in patients who are young and in whom future fertility is important and who are relatively haemodynamically stable . when conservative treatment is not feasible or has failed , prompt eph is performed failing which the delay would contribute to the maternal morbidity and in unfortunate cases mortality .

background : peripartum hysterectomy is a major operation and is invariably performed in the presence of life threatening hemorrhage during or immediately after abdominal or vaginal deliveries.material and methods : a medline search was conducted to review the recent relevant articles in english literature on emergency peripartum hysterectomy . the incidence , indications , risk factors and outcome of emergency peripartum hysterectomy were reviewed.results:the incidence of emergency peripartum hysterectomy ranged from 0.24 to 8.7 per 1000 deliveries . emergency peripartum hysterectomy was found to be more common following cesarean section than vaginal deliveries . the predominant indication for emergency peripartum hysterectomy was abnormal placentation ( placenta previa / accreta ) which was noted in 45 to 73.3% , uterine atony in 20.6 to 43% and uterine rupture in 11.4 to 45.5 % . the risk factors included previous cesarean section , scarred uterus , multiparity , older age group . the maternal morbidity ranged from 26.5 to 31.5% and the mortality from 0 to 12.5% with a mean of 4.8% . the decision of performing total or subtotal hysterectomy was influenced by the patient 's condition.conclusion:emergency peripartum hysterectomy is a most demanding obstetric surgery performed in very trying circumstances of life threatening hemorrhage . the indication for emergency peripartum hysterectomy in recent years has changed from traditional uterine atony to abnormal placentation . antenatal anticipation of the risk factors , involvement of an experienced obstetrician at an early stage of management and a prompt hysterectomy after adequate resuscitation would go a long way in reducing morbidity and mortality .

recent advances in obstetrical and neonatal intensive care management have increased the survival rates of very low birth weight infants . in these infants , artificial ventilation is related to potential iatrogenic lung damage and therefore reduced to a minimum . the introduction of new strategies of surfactant therapy includes a very short period of mechanical ventilation ( insure ) or even avoidance of endotracheal intubation in newborns with respiratory distress syndrome . as a consequence , noninvasive respiratory therapy has become increasingly important and is used in even the youngest neonates . in these infants , apnoea has emerged as a major clinical problem , manifested by an unstable respiratory rhythm reflecting the immaturity of the respiratory control systems . methylxanthines , such as theophylline and caffeine , are the mainstay pharmacological treatment for apnoea and have proven to reduce chronic lung disease and long - term outcome [ 5 , 6 ] . in line with current international consensus in the 2 reporting nicus , caffeine base is given with a loading dose of 10 mg / kg and a maintenance dose of 5 mg / kg / day . published very reassuring data [ 7 , 8 ] on short - and long - term outcome of high dose caffeine , more data are needed to change the existing caffeine dosing protocol . if apnoea persists under methylxanthines , doxapram may be considered as the therapy of last resort before endotracheal intubation and mechanical ventilation . doxapram is a respiratory stimulant that encourages breathing by stimulating both peripheral and central chemoreceptors [ 911 ] . doxapram was introduced more than 25 years ago into neonatology to treat neonates struggling with persistent idiopathic apnoea of prematurity [ 12 , 13 ] . some randomized controlled trials studied doxapram , but none were placebo controlled [ 1719 ] . a number of observational trials suggested potential short - and long - term side effects such as hypertension and irritability . the most devastating , however , were the suggested negative effects of doxapram on cerebral oxygenation and long - term mental development [ 2022 ] . these concerns about long - term outcome and important improvements of neonatal care such as the introduction of surfactant therapy and maternal corticosteroids pushed the use of doxapram in preterm infants to the background . nevertheless , we recently noticed a reintroduction of doxapram use in our departments in premature infants with superficial breathing patterns and apnoeas that are unresponsive to methylxanthines . in this situation of persistent apnoea and imminent neonatal respiratory insufficiency , doxapram is used as rescue medication . doxapram is administered in order to prevent preterm neonates from endotracheal intubation and mechanical ventilation . however , doxapram is still off - label in premature infants and evidence about efficacy and safety is lacking . we therefore performed an audit on doxapram use and the effects of doxapram use in two dutch tertiary nicus during the last 5 years . due to the retrospective nature of our audit , the committee of medical ethics of lumc and the medical ethical committee of vu university medical center have declared that formal approval was not required . data of patients who received doxapram were analyzed from two tertiary neonatal intensive care units ( leiden university medical center , leiden , center 1 ; vu university medical center amsterdam , center 2 ) in the netherlands . from prospectively collected drug databases all eligible patients from 2006 till 2011 were selected in both centers . data on total numbers of patients admitted per gestational age group in both centers were also collected . in both centers , neonates were treated with caffeine base formulations . a loading dose of 10 mg / kg was given , with daily subsequent doses of 5 caffeine was occasionally switched to theophylline with a dose of 68 mg / kg / day . although promising data regarding higher daily caffeine doses were published in 2004 and 2011 , both nicus chose to use standard dosing regimens [ 7 , 8 ] . the doxapram treatment policies of both centers were different during the study period . in center 1 , intravenous and oral doxapram were used until 2011 and dosed based on personal experience of the attending physician . during doxapram treatment , , doxapram was incorporated into a written apnoea policy from 2010 . before 2010 , it was used and dosed based on personal experience of the attending physician . the written policy advised intravenous use of doxapram with a starting dose of 0.5 mg / kg / hr that could be increased every the protocol advised to consider the use of doxapram after persistent apnoea with maximal noninvasive ventilatory support and caffeine therapy . data about pregnancy , delivery , and baseline patient characteristics were analysed in order to determine which group of patients received doxapram . the use of doxapram was evaluated by its duration , dosage , route of administration and efficacy . doxapram therapy was defined as successful if no endotracheal intubation due to apnoea was necessary . no criteria for respiratory insufficiency or endotracheal intubation were included in the protocols of both centers . outcome of patients was analyzed by collecting data about mortality , short - term morbidity ( incidence of necrotizing enterocolitis , intraventricular hemorrhage , periventricular leukomalacia , retinopathy of prematurity , and persistent ductus arteriosus ) and pulmonary condition . background characteristics ; doxapram data and morbidity of patients who were successfully and unsuccessfully treated with doxapram were compared using chi - square and fisher 's exact tests as well as non - parametric mann - whitney u statistical tests wherever appropriate . from 2005 to 2010 , 122 out of 1,501 admitted premature infants with a gestational age less than 32 weeks in the two centers received doxapram ( 8.13% ) . all neonates received caffeine with a loading dose of 10 mg / kg and daily maintenance doses of 5 mg / kg . until 2010 , doxapram was most often used in the youngest neonates with 26.7% , 21.4% , and 26.6% of all preterms born after 24 , 25 , and 26 weeks of gestation , respectively . doxapram was more frequently used in center 1 ( 84/802 ; 10.5% ) than in center 2 ( 38/699 ; 5.4% ) . there was a wide variation in the doxapram doses used and in the duration of therapy ( table 2 ) . median postconceptional age at the start of doxapram therapy was 27.3 weeks with the youngest infant being 24 4/7 weeks and the oldest being 31 3/7 weeks at the start of doxapram therapy . doxapram was initiated at a median postnatal age of 13.5 days ( iqr 11 days ) and patients received doxapram for a median duration of 108 hrs ( iqr 147 hours ) . nine patients ( 7.4% ) received a doxapram loading dose ( median 2.5 mg / kg ) . in all other patients , the cumulative dose of doxapram ranged from 0.33 mg to 781.5 mg doxapram per kg bodyweight . twenty - nine newborns ( 24% ) received 2 courses of doxapram ; 2 patients ( 1,6% ) received a third course of doxapram therapy . outcomes of the patients who received doxapram are shown in table 3 . in 6 cases , it could not be determined if doxapram was successful , as it was unclear if the patient was intubated because of persistent apnoea or because of other reasons , such as infection . in 79 out of 116 neonates ( 64.8% ) , baseline characteristics were comparable between patients in whom doxapram was successful compared to those with unsuccessful treatment ( table 1 ) . if doxapram treatment was successful , it was used longer ( median ( iqr ) : 5.5 ( 5.7 ) days versus 1 ( 4.65 ) day ; mann - whitney u 722 , p < 0.001 ) but in lower average dosages ( median ( iqr ) : 0.97 ( 0.62 ) mg / kg / hr versus 1.38 ( 0.94 ) , mann - whitney u 952 , p < 0.003 ) . patients who received doxapram therapy for a long period of time , incidence of necrotizing enterocolitis , intraventricular hemorrhage , periventricular leukomalacia , retinopathy of prematurity , persistent ductus arteriosus , or worsening of pulmonary condition did not increase . their stay at the neonatal intensive care unit was shorter ( median ( iqr ) : 33 ( 26 ) versus 42 ( 34 ) days ; mann - whitney u 815 , p = 0.002 ) . off all the included patients , 49.2% received doxapram intravenously , 41.5% received doxapram orally and 9.3% received doxapram via both routes . if intravenous doxapram was effective and the neonates did not need an intravenous route anymore , doxapram was given through the nasogastric tube in center 1 only . doxapram therapy was successful in 67% of intravenously treated and 70% of orally treated neonates . if both routes were used subsequently , the success rate was 55% ( chi - square test : p = 0.63 ) . almost two third of all treated newborns did not progress to ventilatory support although they were suffering from frequent apnoea before treatment with doxapram . these data suggest a potential important role for doxapram in the treatment of apnoea of prematurity . however , it is remarkable that underlying evidence about the efficacy and safety from well - designed clinical trials is almost completely lacking . for 50 years , doxapram has been used as an emergency agent in adults suffering from life - threatening respiratory insufficiency . it was the anesthesiologist gupta who first reported the successful administration of doxapram in newborns with breathing difficulties after birth and from the 1980s on doxapram became popular for the treatment of neonates struggling with persistent idiopathic apnoea of prematurity [ 12 , 13 ] . in the past 30 years , only three randomized controlled trials compared doxapram with other therapeutic strategies in a total of 86 neonates . peliowski and finer compared doxapram with theophylline and placebo in a crossover design in 31 preterm newborns with apnoea . they found a short - term doxapram treatment success rate of 64 percent in neonates with a mean gestation of 31 weeks . eyal et al . found success rates of , respectively , 53 and 55 percent comparing doxapram monotherapy with aminophylline monotherapy . if doxapram was used in addition to aminophylline , it was successful in 8 out of 10 patients compared to 0 out of 9 placebo treated newborns . studied the effects of doxapram after extubation and found a reintubation rate of 21% compared to 47% of placebo treated newborns . in analogy with our data , they suggested that doxapram is successful in treating apnoea of prematurity in at least a considerable part of the premature neonates . a wide variation in used doxapram dosages varying from 0.18 up to 4 milligram per kg bodyweight per hour was found in the current study . as suggested by barrington et al . , most patients started with a dose of 0.5 mg / kg / hr . the same study also showed increasing success rates of doxapram with increasing dosages up to 2.5 mg / kg / hr . a dose effect relationship might be apparent but has until now not been studied sufficiently . a prospective doxapram dose finding study and randomised placebo controlled analysis of the effectiveness of doxapram with a sufficient number of patients is needed to determine the actual efficacy and effective dosages of doxapram on apnoea in premature newborns . as this was not a randomized controlled trial , hard conclusions can not be drawn . however , retrospectively , we found positive results in almost 65% of infants treated with doxapram . response to doxapram therapy seemed to be associated with a shorter stay in the neonatal intensive care unit without serious side effects . protecting newborns from reintubation and ventilation might theoretically protect them against bronchopulmonary dysplasia but the doxapram responders merely depict the neonates who initially had less severe lung problems . the most important and potentially dangerous suggested side effect consists of decreased cerebral oxygenation and blood flow velocity . this might result in decreased cerebral perfusion and damage to the developing brain leading to long - term developmental delay [ 20 , 21 ] . as our study was not a randomised controlled trial doxapram is given to a specific category of preterm neonates with pulmonary problems , therefore no representative control could be found in the rest of the patients on our wards during the study period . routine follow - up of the doxapram treated premature infants has not shown long - term safety issues at this time . the reintroduction of doxapram can be explained by the introduction of new techniques aimed at minimizing invasive ventilation of premature neonates . techniques such as insure , cpap , nasal intermittent mandatory ventilation , and surfactant without intubation may ultimately lead to an increased use of doxapram as pointed out by kribs et al . . surfactant administration through a nasogastric tube resulted in doxapram use in 28 percent of the surfactant treated neonates via a nasogastric tube compared to 17 percent of patients receiving standard surfactant therapy . in the coming years therefore , this study shows that doxapram as off - label drug is frequently used in premature neonates in neonatal nurseries and especially in the youngest infants . as increased use of doxapram is to be expected , prospective well - designed studies are needed to address the issues of short- and long - term safety . until then , doxapram should be used with caution .

apnoea of prematurity is treated with noninvasive respiratory therapy and methylxanthines . for therapy unresponsive apnoea doxapram is often prescibed in preterm neonates . the duration , dosage and route of administration of doxapram together with its efficacy was evaluated in two dutch neonatal intensive care . outcome concerning short - term safety and neonatal morbidity were evaluated . during 5 years , 122 of 1,501 admitted newborns < 32 weeks of gestational age received doxapram . 64.8% of patients did not need intubation after doxapram . 25% of treated neonates were < 27 weeks of gestation . a positive response to doxapram therapy on apnoea was associated with longer duration of doxapram usage ( p < 0.001 ) , lower mean doses ( p < 0.003 ) , and less days of intensive care ( median 33 versus 42 days ; p < 0.002 ) . no patients died during doxapram therapy . incidence of necrotizing enterocolitis , intraventricular hemorrhage , periventricular leukomalacia , retinopathy of prematurity , persistent ductus arteriosus , or worsening of pulmonary condition did not increase during doxapram therapy . doxapram is frequently used for apnoea of prematurity , despite a lack of data on short - term efficacy and long - term safety . until efficacy and safety are confirmed in prospective trials , doxapram should be used with caution .

forty percent of the world 's severely under - nourished under - five children live in india . major underlying causes for this under - nutrition are inadequate access to food , insufficient health services and unhealthful environment . integrated child development services ( icds ) scheme was launched in india in 1975 with a prime objective of improving the nutrition status of underprivileged children , by providing supplementary nutrition , through the network of anganwadi centers ( awcs ) and anganwadi workers ( aww ) . it is the central point for the deliverance of icds services to children below 6 years of age , expecting women , lactating mothers and adolescent girls at community levels . the existing population norm for awc is : one awc per 1000 population in rural and urban project and one awc per 700 persons in the tribal project . each awc is run by an aww supported by a helper in integrated service delivery . together aww and awc works for better linkages of the community with the health system ; as well as escalating the capability of community and women , particularly mothers for childcare , survival , and development . as per the revised guidelines of the icds , supplementary nutrition worth 500 kcal and 12 - 15 g of protein is distributed to all children of 6 - 72 months age . severely under - nourished children aged 6 - 72 months of age are provided additional 300 kcal and 8 - 10 g of protein . moreover , growth monitoring and nutrition surveillance of these children is also carried out with the help of growth chart . growth chart is a vital appraisal tool for the evaluation of growth and development of child , which could be further used to detect early growth faltering and take preventive interventions accordingly . a new initiative in gujarat for under - nourished children is setting up of child development and nutrition centers ( cdnc ) . severely under - nourished ( red category ) child are referred to such centers for rehabilitation . at such centers , mother and child stays together ; the child is treated for infection if any and is provided nutritious dietary supplementation with active participation of mother . child is discharged from the center once he / she starts gaining weight . despite being most widely studied program the present study was therefore undertaken with the objective of assessing the progress in growth of under - nourished children under icds and the factors associated with it in the tapi district of gujarat . tribal population has higher rates of under - nutrition because of dependence on agricultural practices for food supply , discrimination in terms of socio economic status as well as neglect in the national programs . assessment of nutritional status of children under icds is considered as a measure of effectiveness of the program and it is necessary for planners to understand the program and nutrition situation among the vulnerable tribal population of tapi region . hence , far adequate literature is not available from the region on the subject matter . the study was conducted with priori permission from the health and family welfare department , government of gujarat . this was a retrospective cohort study where cohort of study participants was identified retrospectively from the awc data and follow - up assessment of them was carried out up to the day of the survey . tapi is predominantly a tribal district of southern gujarat with agriculture being its principal economy . the study was conducted in 50 awc under 25 primary health centers ( phc ) of tapi giving equal representation to each of its five blocks . however , due to time constraint and certain national health program activities like intensive pulse polio immunization round and mass drug administration for filariasis , we were finally able to cover only 25 phcs . equal representations was given to all the five blocks of the district , selecting five phcs from each block . in the first phase of sampling , list of awc was used as sampling frame for each phc and two awc from each phc were selected using the simple random sampling ( srs ) , thus , total 50 awc were selected . under the icds scheme , these growth charts are based on world health organization growth standards for weight for age for boys and girls . three color coded categories are given in it : green for normal , yellow for under - weight ( 2 sd to 3 sd ) and red for severely under - weight ( < 3 sd ) child . for the second phase of sampling , list of all children aged one to five years , who were in red or yellow category of growth chart of awc before 1 year , was prepared . the month of february 2011 was considered for selecting children before 1 year . for each selected awc , on an average , ten under - nourished children of 1 to 5 years of age were selected randomly from the above list by srs . in case pretesting and piloting was carried out for checking practicability of the questionnaire and necessary corrections were made accordingly . general information like age , sex , education status of parents as well as service utilization of awc was assessed by personal interview of mothers . in case mother current growth status of child including current weight ( kg ) and mid upper arm circumference ( muac ) ( cm ) was measured using standard technique . from the past records of growth chart plotting , analysis was carried out to understand the advancement of growth status and factors associated with it , using independent sample t - test using epi info 2007 . the study was conducted with priori permission from the health and family welfare department , government of gujarat . this was a retrospective cohort study where cohort of study participants was identified retrospectively from the awc data and follow - up assessment of them was carried out up to the day of the survey . tapi is predominantly a tribal district of southern gujarat with agriculture being its principal economy . the study was conducted in 50 awc under 25 primary health centers ( phc ) of tapi giving equal representation to each of its five blocks . initially all the phcs were decided to be included in the study . however , due to time constraint and certain national health program activities like intensive pulse polio immunization round and mass drug administration for filariasis , we were finally able to cover only 25 phcs . equal representations was given to all the five blocks of the district , selecting five phcs from each block . in the first phase of sampling , list of awc was used as sampling frame for each phc and two awc from each phc were selected using the simple random sampling ( srs ) , thus , total 50 awc were selected . under the icds scheme , these growth charts are based on world health organization growth standards for weight for age for boys and girls . three color coded categories are given in it : green for normal , yellow for under - weight ( 2 sd to 3 sd ) and red for severely under - weight ( < 3 sd ) child . for the second phase of sampling , list of all children aged one to five years , who were in red or yellow category of growth chart of awc before 1 year , was prepared . for each selected awc , on an average , ten under - nourished children of 1 to 5 years of age were selected randomly from the above list by srs . in case pretesting and piloting was carried out for checking practicability of the questionnaire and necessary corrections were made accordingly . general information like age , sex , education status of parents as well as service utilization of awc was assessed by personal interview of mothers . in case mother current growth status of child including current weight ( kg ) and mid upper arm circumference ( muac ) ( cm ) was measured using standard technique . from the past records of growth chart plotting , analysis was carried out to understand the advancement of growth status and factors associated with it , using independent sample t - test using epi info 2007 . in current study , from the growth chart registers of awc , total of 529 under - nourished children falling into red 162 ( 30.6% ) and yellow 367 ( 69.4% ) category before 1 year ( february 2011 ) were included . follow - up weighing and categorizing of the same children after 1 year showed that 39 ( 7.4% ) were in green category , 273 ( 51.6% ) were in yellow category and 217 ( 41% ) were in red category . it was observed that 89 ( 16.9% ) of the 529 children had shown improvement in their growth in 1 year , while 334 ( 63.1% ) and 106 ( 20% ) of the children had shown stagnancy and faltering in their growth respectively . number of children migrating from yellow / red category to green , yellow , and red category in 1 year was as seen in figure 1 . mean weight gain in 1 year for all under - nourished children was 1.7 ( 1.4 sd ) kg . there was no statistically significant difference between past and current weight in both yellow and red category children ( p = 0.44 ) [ table 1 ] . categories of under nourished children : present and before one year ( n = 529 ) association of demographic profile of under - nourished children with weight gain ( n=529 ) moreover , looking at the growth chart it was evident that out of total 529 under - nourished children , only 114 ( 21.6% ) children had fallen in to green category at any point of time during past 1 year . only 19 ( 16.7% ) out of 114 were able to maintain the green category up until the end of the year . according to the current muac , 73 ( 13.9% ) of the children were severely under - nourished ( muac < 12.5 cm ) , 242 ( 45.7% ) were mild and moderately under - nourished ( muac = 12.5 - 13.5 cm ) and 214 ( 40.4% ) were in normal grade ( muac > 13.5 cm ) ( kappa agreement for categorization of under - nutrition in to three categories between use of growth chart method and muac measurement was 0.029 , [ p = 0.20 ] ) . out of total 529 under - nourished children , 257 ( 48.6% ) were male and 272 ( 51.4% ) were female . gender - wise no difference in terms of mean weight gain in 1 year was seen between the two ( p = 0.42 ) . furthermore , in the study , 151 ( 28.5% ) children were in one to 3 years and 378 ( 71.5% ) in 3 to 6 years age group with mean weight gain in younger children higher than older children [ p = 0.004 , table 1 ] . around 140 ( 26.4% ) fathers and 176 ( 33.3% ) mothers of under - nourished children were illiterate with mean weight gain of children of illiterate mother being lower than literate mothers ( p = 0.02 ) , though no such difference was seen with education level of fathers ( p = 0.14 ) [ table 1 ] . majority 480 ( 90.7% ) of 529 under - nourished children had regular attendance in awc and only 49 ( 9.3% ) children had irregular visits ( absence in last 2 weeks ) . the major reasons for irregular visits given by mothers can be seen from figure 2 . self - reported reasons given by mothers for irregular visit of their under nourished children to awc ( n = 49 ) on checking for drop outs ( weighing not carried out for 1 month or more in last year as seen from growth chart registers ) , one quarter that is 132 ( 25% ) of children had drop - outs . major reasons for drop - out were family being out of station as stated by 78.2% mothers , irregular running of awc as stated by 7.3% mothers , far away location of awc from home as given by 5.5% mothers , consistently ill child as given by 3.6% mothers , no one to accompany child to awc , no faith in awc services and no felt need of awc service as said by 1.8% mothers each . in 77 mothers most of the 516 ( 97.5% ) children were eating supplementary meals given from awc . major reasons for not eating supplementary feed in rest 13 ( 2.5% ) children were : bad taste of food for 46.2% , not aware about the awc services for 7.7% , family being out of station for 7.7% , and child 's unwillingness to attend awc for 7.7% mothers . in three children as seen from table 2 , mean weight gain was not found to be associated with regularity in awc visit ( p = 0.99 ) , drop - outs ( p = 0.99 ) or eating supplementary feeding given from awc ( p = 0.61 ) . association of icds services utilization indicators by under - nourished children with weight gain ( n=529 ) on observing growth chart registers at awc , 519 ( 98.1% ) children 's weight was plotted regularly , i.e. , monthly . one important finding is that almost 120 ( 22.7% ) parents were not explained about their child 's under - nourished status and category by aww . children whose parents were explained about their child 's nutrition status had gained higher mean weight than their counterparts ( p = 0.01 ) . as seen from figure 3 , only half of the children 285 ( 53.9% ) were referred to higher health facility for treatment of under - nourishment by aww , from which 231 ( 81% ) were actually taken to higher health facility by the parents . as seen from table 3 mean weight gain of children who were taken to higher centers ( p = 0.03 ) and treated for under - nutrition ( p = 0.009 ) was higher than others . out of total 162 red category children before 1 year , 150 ( 92.6% ) children were advised to visit cdnc by aww [ figure 3 ] . average weight gain during cdnc visit was 0.7 ( sd = 0.5 ) kg . there was no difference in weight gain between cdnc attendees and non - attendees ( p = 0.11 ) [ table 3 ] . referral , compliance and outcome of under nourished children to health facilities ( n= 529 ) association of referral of under - nourished children with weight gain ( n=529 ) out of all the under - nourished children , more than three - fourth of the children in yellow / red category had not come into the green category even a single time during the 1 year . besides , in 1 year , growth faltered in one - fifth children and remained stagnant in three - fifth children despite being covered under the icds . a number of previous studies have also questioned the actual impact of icds on nutrition of children due to major implementation problems such as inadequately trained , supervised and supported aww ; erratic provision of food supplies , and leakage in food procurement ; poor quality bad taste food ; and poorly targeted food supplementation not confined to under - nourished children . furthermore , the highly focused approach of the program on the supplementary nutrition leads to neglection of other important interventions for reducing childhood under - nutrition like environment hygiene which directly curtails the exposure to the disease , hence breaking the vicious cycle of infection , and under - nutrition . the objectives of the icds program to enhance the capability of the mother and family to look after the health and nutrition needs of the child through community interaction as well as nutrition and health education , also remains largely unfulfilled . one more finding is that more than one fourth of the mothers of under - nourished children were illiterate with mean weight gain of these children lesser than their counterparts . another national level survey has shown the share of under - weight boys amongst mothers with no education of 54% , compared with 32% among mothers with secondary or higher levels of education . an icds study from rohtak have also reported significant association between under - weight and maternal education of primary or less ( p < 0.001 ) . in the present study , no association was found between father 's education and mean weight gain . this could be explained by the fact that in typical indian family the child rearing is solely the mother 's responsibility while the father remains busy in outdoor activities . second point is that in present study almost equal representation was found of boys and girls among under - nourished children with no difference amongst them in mean weight gain in 1 year ; whereas kumar et al . as well as bhalani and kotecha . had found the condition unfavorable to girls due to societal and cultural propagated gender discrimination . mean weight gain was also found to be higher for younger children , which could be explained by physiological slow down of growth by increasing age . in healthy children in normal circumstances weight increases by seven kg during 1 year , 2.5 kg during 2 year and 2 kg / year afterwards . though , more than 90% surveyed children attend awc regularly which indicates a very good utilization of services , 25% of surveyed children reported to drop - out for more than 1 month during last 1 year in the study . the important reason stated for the same , was that the awc runs irregularly and they have lost the faith in awc . this indicates poor rapport of awws among the community in general and mothers in particular , which can be fatal for any program . moreover , another major reason stated by mothers for irregular visits to awc was that child is too young . this is supported by the fact that under the icds mothers are permitted to take the supplementary food of their small children at home and so children under 3 years rarely attend the centers . this is supported by the fact that tapi is a rural district where many parents migrate in sugarcane farm seasonally for harvesting and young children of theirs usually accompany them . another valuable reason given by some mothers was , far away location of awc from home , which should not be overlooked . important point is that similar to present study one another study also did not found any association between nutritional status of children and duration of stay at awc ( p = 0.56 ) . the same study also showed overall percentage of deterioration ( 14 - 21% ) in nutritional status among the children under icds twice that of improvement ( 5 - 12% ) . however , one finding of that karnataka based study of greater improvement for children with baseline higher grade of under - nutrition was in contrast to present study . in current study , around three quarter mothers were explained about the under - nutrition status of their child and hence they were aware about the same . in another study for evaluating icds , awareness about current status of child overall in the study , children whose parents were aware about their child 's under - nutrition status had higher average weight gain , which is similar to abbi et al . this highlights the fact that , in addition to mere weighing of child , information of parents about their child 's progress in terms of weight gain and proper counseling on how to improve and maintain their child 's nutrition is more helpful in overall weight gain . in current study , more than 90% of the children referred by aww to cdnc had attended cdnc for the complete 10 days and most of these children gained weight during their cdnc stay . however , more than two - third of them lost weight again in their follow - up visits post cdnc stay . this exposed the actuality that proper attention was not given to nutrition of the child in follow - up , which reversed the benefit gained from cdnc . this is also the reason why at the end of 1 year no difference in mean weight gain was found between cdnc attendees and non attendees . the higher mean weight gain was found in children who were refereed and treated for under - nutrition in current study ; which emphasis the importance of referral of all under - nourished children to community health center or other higher facilities . follow - up on whether the child parents actually take the child to referral center is also needed to be kept by aww . muac in place of weight for age is widely used in population surveys to check nutritional status of under - five children because of its feasibility . attempt to check kappa agreement between muac and weight for age based classification of under - nutrition was made in current study . however , no agreement was found between two . there is also lack of clarity regarding the appropriate cut - off for muac to detect under - nutrition . one zimbabwe based study using 15.5 cm as cut - off found to perform it poorly in comparison to other standard indices for detecting under - nutrition . further research to check for validity and reliability of muac , as well as standardizing appropriate cut off to achieve maximum sensitivity and specificity for detecting under - nutrition , needs to be carried out in large sample . overall the current study shows important finding from the under studied tribal region in the area of under - nutrition , though it fails to take into consideration important confounders such as immunization , peri natal conditions , breast feeding , and other co - morbid conditions like diarrhea . this is the limitation of present study . in the background of knowledge gained from the current study regarding growth flattering of children despite attending awc , further operational research from the region is needed in areas of strengthening icds services ; exact caloric content of food given to the children with respect to their requirement at awc ; role of parental awareness ; role of under - nutrition treatment ; cdnc visit ; and interventions to maintain the weight gained in cdnc . overall the current study shows important finding from the under studied tribal region in the area of under - nutrition , though it fails to take into consideration important confounders such as immunization , peri natal conditions , breast feeding , and other co - morbid conditions like diarrhea . this is the limitation of present study . in the background of knowledge gained from the current study regarding growth flattering of children despite attending awc , further operational research from the region is needed in areas of strengthening icds services ; exact caloric content of food given to the children with respect to their requirement at awc ; role of parental awareness ; role of under - nutrition treatment ; cdnc visit ; and interventions to maintain the weight gained in cdnc . more than three quarter under - nourished children have shown either growth stagnation or faltering at the end of 1 year despite attending awc . this indicates the need of early identification and special nutritional care of yellow / red category children as early as possible by the aww along with strengthening of icds services . literate mothers as well as parents who were counseled about the nutritional status of their child are better off in taking appropriate care of their under - nourished child . hence , regular weighing and plotting in growth chart for each child must be done and this information must be shared by the aww to the parents . improvement in taste of supplementary foods may be helpful to increase its consumption by children . referral to the higher center in case of under - nourished children must be ensured by aww . follow - up must be taken regarding whether the child was actually taken to the referred health facility , since it was found to be an important contributing factor in improving growth status of these children . additionally , aww should also follow - up children attending cdnc and should ensure that they avail services of awc once they return back to their home . this is an important step to prevent re - slipping of child towards red category . supplementary feeding as a long run solution to country 's under - nutrition problem and its actual benefits should be studied in detail with alternative innovative solutions .

background : india shares the largest burden of under - nutrition in world . the aim of this study was to conduct follow - up assessment of under - nourished children attending anganwadi center ( awc).methods : this was a retrospective cohort study conducted in 50 awc of tapi district . total 529 children aged 1 - 6 years diagnosed as under - nourished before 1 year were included . pre - structured questionnaire was used for present day assessment of these children followed by epi - info mediated analysis.results:children of literate mothers had higher weight gain . ninety percent of children attended anganwadi regularly , however 25% of children dropped out for more than 1 month . in 1 year , growth had faltered in 20% children and was stagnant in 63% of them . children who were treated for under - nutrition ; that completed course at child development and nutrition center ; and whose parents were counseled about the under - nourished status of child had higher weight gain than their counterparts.conclusions:parents of under - nourished children must be counseled about the nutritional status of their child . in cases of under - nourished child , referral to higher center must be ensured by health worker . supplementary feeding as a long - term solution to country 's under - nutrition problem should be studied in detail with the alternative solutions .

numerical investigations of cosmological spacetimes can be categorized into two broad classes of calculations , distinguished by their computational ( or even philosophical ) goals : 1 ) geometrical and mathematical principles of cosmological models , and 2 ) physical and astrophysical cosmology . in the former , the emphasis is on the geometric framework in which astrophysical processes occur , namely the cosmological expansion , shear , and singularities of the many models allowed by the theory of general relativity . in the latter , the emphasis is on the cosmological and astrophysical processes in the real or observable universe , and the quest to determine the model which best describes our universe . the former is pure in the sense that it concerns the fundamental nonlinear behavior of the einstein equations and the gravitational field . the latter is more complex , since it addresses the composition , organization and dynamics of the universe from the small scales ( fundamental particles and elements ) to the large ( galaxies and clusters of galaxies ) . however , the distinction is not always so clear , and geometric effects in the spacetime curvature can have significant consequences for the evolution and observation of matter distributions . any comprehensive model of cosmology must therefore include nonlinear interactions between different matter sources and spacetime curvature . a realistic model of the universe must also cover large dynamical spatial and temporal scales , extreme temperature and density distributions , and highly dynamic atomic and molecular matter compositions . in addition , due to all the varied physical processes of cosmological significance , one must draw from many disciplines of physics to model curvature anisotropies , gravitational waves , electromagnetic fields , nucleosynthesis , particle physics , hydrodynamic fluids , etc . these phenomena are described in terms of coupled nonlinear partial differential equations and must be solved numerically for general inhomogeneous spacetimes . the situation appears extremely complex , even with current technological and computational advances . as a result , the codes and numerical methods that have been developed to date are designed to investigate very specific problems with either idealized symmetries or simplifying assumptions regarding the metric behavior , the matter distribution / composition or the interactions among the matter types and spacetime curvature . it is the purpose of this article to review published numerical cosmological calculations addressing issues from the very early universe to the present ; from the purely geometrical dynamics of the initial singularity to the large scale structure of the universe . there are three major sections : 2 where a brief overview is presented of various defining events ocurring throughout the history of our universe and in the context of the standard model ; 3 where brief summaries of early universe and fully relativistic cosmological calculations are presented ; and 4 which focuses on structure formation in the post - recombination epoch and on testing cosmological models against observations . with current observational constraints , the physical state of our universe , as understood in the context of the standard , or friedmann - robertson - lematre - walker ( flrw ) model , can be crudely extrapolated back to the planck epoch 10 seconds after the big bang , beyond which the classical theory of general relativity is invalid due to quantum corrections . at the earliest times , the universe was a plasma of relativistic particles consisting of quarks , leptons , gauge bosons , and higgs bosons represented by scalar fields with interaction and symmetry regulating potentials . it is believed that several spontaneous symmetry breaking ( ssb ) phase transitions transpired in the early universe as it expanded and cooled , including : the grand unification transition ( gut ) at 10 seconds after the big bang ( here , the strong nuclear force split off from the weak and electromagnetic forces . this also marks an era of inflationary expansion and the origin of matter - antimatter asymmetry through baryon , charge conjugation , and charge + parity violating interactions and nonequilibrium effects . ) ; the electroweak ( ew ) ssb transition at 10 secs ( when the weak nuclear force split from the electromagnetic force ) ; and the chiral ( qcd ) symmetry breaking transition at 10 secs during which quarks condensed into hadrons . the most stable hadrons ( baryons , or protons and neutrons comprised of three quarks ) survived the subsequent period of baryon - antibaryon annihilations , which continued until the universe cooled to the point at which new baryon - antibaryon pairs could no longer be produced . a period of primordial nucleosynthesis followed from 10 to 10 secs during which light element abundances were synthesized to form 24% helium with trace amounts of deuterium , tritium , helium-3 , and lithium . by 10 secs , the matter density became equal to the radiation density , identifying the start of the current matter - dominated era and the beginning of structure formation . later , at 10 secs ( 3 10 years ) , the free ions and electrons combine to form atoms , decoupling the matter from the radiation field as the universe continued to expand and cool . this decoupling or post - recombination epoch marks the surface of last scattering and the boundary of the observable ( via photons ) universe . assuming a hierarchical ( cdm - like ) structure formation scenario , the subsequent development of our universe is characterized by the growth of structures with increasing size . for example , the first stars are likely to form at t 10 years from molecular gas clouds when the jeans mass of the background baryonic fluid is approximately 10 m , as indicated in figure 1 . this epoch of pop iii star generation is followed by the formation of galaxies at t 10 years and then galaxy clusters . the solid and dotted lines potentially track the jeans mass of the average baryonic gas component from the recombination epoch at z 10 to the current time . a residual ionization fraction of nh+/nh 10 following recombination allows for compton interactions with photons to z 200 , during which the jeans mass remains constant at 10 m. the jeans mass then decreases as the universe expands adiabatically until the first collapsed structures form sufficient amounts of hydrogen molecules to trigger a cooling instability and produce pop iii stars at z 20 . star formation activity can then reheat the universe and raise the mean jeans mass to above 10 m. this reheating could affect the subsequent development of structures such as galaxies and the observed lyman - alpha clouds . the solid and dotted lines potentially track the jeans mass of the average baryonic gas component from the recombination epoch at z 10 to the current time . a residual ionization fraction of nh+/nh 10 following recombination allows for compton interactions with photons to z 200 , during which the jeans mass remains constant at 10 m. the jeans mass then decreases as the universe expands adiabatically until the first collapsed structures form sufficient amounts of hydrogen molecules to trigger a cooling instability and produce pop iii stars at z 20 . star formation activity can then reheat the universe and raise the mean jeans mass to above 10 m. this reheating could affect the subsequent development of structures such as galaxies and the observed lyman - alpha clouds . the isotropic and homogeneous flrw cosmological model has been so successful in describing the observable universe that it is commonly referred to as the standard model . furthermore , and to its credit , the model is relatively simple ; it allows for calculations and predictions to be made of the very early universe , including primordial nucleosynthesis at 10 seconds after the big bang , and even particle interactions approaching the planck scale at 10 seconds . at present , observational support for the standard model includes : the expansion of the universe as verified by the redshifts in galaxy spectra and quantified by measurements of the hubble constant h0 = 100h km sec mpc with hubble parameter 0.5 < h < 1;the deceleration parameter observed in distant galaxy spectra ( although uncertainties about galactic evolution , intrinsic luminosities , and standard candles prevent even a crude estimate);the large scale isotropy and homogeneity of the universe based on temperature anisotropy measurements of the microwave background radiation and peculiar velocity fields of galaxies ( although the light distribution from bright galaxies seems more tenuous);the age of the universe which yields roughly consistent estimates between the look - back time to the big bang in the flrw model and observed data such as the oldest stars , radioactive elements , and cooling of white dwarf stars;the cosmic microwave background radiation suggests that the universe began from a hot big bang and the data is consistent with a black body at temperature 2.7 k;the abundance of light elements such as h , he , he and li , as predicted from the flrw model , are consistent with observations and provides a bound on the baryon density and baryon - to - photon ratio;the present mass density , as determined from measurements of luminous matter and galactic rotation curves , can be accounted for by the flrw model with a single density parameter to specify the metric topology;the distribution of galaxies and larger scale structures can be reproduced by numerical simulations in the context of inhomogeneous perturbations of the flrw models . the expansion of the universe as verified by the redshifts in galaxy spectra and quantified by measurements of the hubble constant h0 = 100h km sec mpc with hubble parameter 0.5 < h < 1 ; the deceleration parameter observed in distant galaxy spectra ( although uncertainties about galactic evolution , intrinsic luminosities , and standard candles prevent even a crude estimate ) ; the large scale isotropy and homogeneity of the universe based on temperature anisotropy measurements of the microwave background radiation and peculiar velocity fields of galaxies ( although the light distribution from bright galaxies seems more tenuous ) ; the age of the universe which yields roughly consistent estimates between the look - back time to the big bang in the flrw model and observed data such as the oldest stars , radioactive elements , and cooling of white dwarf stars ; the cosmic microwave background radiation suggests that the universe began from a hot big bang and the data is consistent with a black body at temperature 2.7 k ; the abundance of light elements such as h , he , he and li , as predicted from the flrw model , are consistent with observations and provides a bound on the baryon density and baryon - to - photon ratio ; the present mass density , as determined from measurements of luminous matter and galactic rotation curves , can be accounted for by the flrw model with a single density parameter to specify the metric topology ; the distribution of galaxies and larger scale structures can be reproduced by numerical simulations in the context of inhomogeneous perturbations of the flrw models . because of these successes , most work in the field of physical cosmology ( see 4 ) has utilized the standard model as the background spacetime in which the large scale structure evolves , with the ambition to further constrain the cosmological parameters and structure formation scenarios through numerical simulations . the reader is referred to for a more in - depth review of the standard model . this section is organized to track the chronological events in the history of the early or relativistic universe ; we focus mainly on four defining moments in our current understanding of the classical picture : 1 ) the big bang singularity and the dynamics of the very early universe ; 2 ) inflation and its generic nature ; 3 ) qcd phase transitions ; and 4 ) primordial nucleosynthesis and the freeze - out of the light elements . the late or post - recombination epoch is reserved to a separate section 4 . belinsky , lifshitz and khalatnikov ( blk ) [ 11 , 12 ] and misner discovered that the einstein equations in the vacuum homogeneous bianchi type ix ( or mixmaster ) cosmology exhibit complex behavior and are sensitive to initial conditions as the big bang singularity is approached . in particular , the solutions near the singularity are described qualitatively by a discrete map [ 10 , 11 ] representing different sequences of kasner spacetimes 1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d{s^2 } = - d{t^2 } + { t^{2{p_1}}}d{x^2 } + { t^2}^{{p_2}}d{y^2 } + { t^2}^{{p_3}}d{z^2},$$ \end{document}ds2=dt2+t2p1dx2+t2p2dy2+t2p3dz2 , with time changing exponents pi , but otherwise constrained by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${p_1 } + { p_2 } + { p_3 } = p_1 ^ 2 + p_2 ^ 2 + p_3 ^ 2 = 1$\end{document}p1+p2+p3=p12+p22+p32=1 . because this discrete mapping of kasner epochs is chaotic mixmaster behavior can be studied in the context of hamiltonian dynamics , with the hamiltonian 2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2{\mathcal h } = - p_\omega ^2 + p _ + ^2 + p _ - ^2 + { e^{4\omega}}(v - 1),$$ \end{document}2=p2+p+2+p2+e4(v1 ) , and a semi - bounded potential arising from the spatial scalar curvature ( whose level curves are plotted in figure 2 ) 3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$v = 1 + { 1 \over 3}{e^{- 8{\beta _ + } } } + { 2 \over 3}{e^{4{\beta _ + } } } \left [ { \cosh ( 4\sqrt 3 { \beta _ - } ) - 1 } \right ] - { 4 \over 3}{e^{- 2{\beta _ + } } } \cosh ( 2\sqrt 3 { \beta _ -}),$$ \end{document}v=1 + 13e8++23e4+[cosh(43)1]43e2+cosh(23 ) , where e and are the scale factor and anisotropies , and p and p are the corresponding conjugate variables . figure 2contour plot of the bianchi type ix potential v , where are the anisotropy canonical coordinates . seven level surfaces are shown at equally spaced decades ranging from 10 to 10 . for large isocontours ( v > 1 ) , the potential is open and exhibits a strong triangular symmetry with three narrow channels extending to spatial infinity . for v contour plot of the bianchi type ix potential v , where are the anisotropy canonical coordinates . seven level surfaces are shown at equally spaced decades ranging from 10 to 10 . for large isocontours ( v > 1 ) , the potential is open and exhibits a strong triangular symmetry with three narrow channels extending to spatial infinity . for v a solution of this hamiltonian system is an infinite sequence of kasner epochs with parameters that change when the phase space trajectories bounce off the potential walls , which become exponentially steep as the system evolves towards the singularity . several numerical calculations of the dynamical equations arising from ( 2 ) and ( 3 ) have indicated that the liapunov exponents of the system vanish , in apparent contradiction with the discrete maps [ 17 , 31 ] . however , it has since been shown that the usual definition of the liapunov exponents is ambiguous in this case as it is not invariant under time reparametrizations , and that with a different time variable one obtains positive exponents [ 13 , 27 ] . although blk conjectured that local mixmaster oscillations might be the generic behavior for singularities in more general classes of spacetimes , this conjecture has yet to be established . however , weaver et al . have , through numerical investigations , established evidence that mixmaster dynamics can occur in ( at least a restricted class of ) inhomogeneous spacetimes which generalize the bianchi type vi0 with a magnetic field and two - torus symmetry . as noted in 3.1.1 , an interesting and ( as yet ) unresolved issue is whether or not the generic cosmological singularity is locally of a mixmaster or blk type , with a complex oscillatory behavior as the singularity is approached . most of the other bianchi models , including the kasner solutions ( 1 ) , are characterized by either open or no potentials in the hamiltonian framework , and exhibit essentially monotonic or asymptotically velocity term dominated ( avtd ) behavior , the opposite dynamics to the complex blk oscillations . considering inhomogeneous spacetimes , isenberg and moncrief proved that the singularity in the polarized gowdy model is avtd type . this has also been conjectured to be the case for more general gowdy models , and numerical simulations of one - dimensional plane symmetric gowdy spacetimes support the notion . furthermore , a symplectic numerical method has been applied to investigate the avtd conjecture in even more general spacetimes , namely t r spacetimes with u(1 ) symmetry . although there are concerns about the solutions due to difficulties in resolving the steep spatial gradients near the singularity , the numerical calculations find no evidence of blk oscillations . berger attributes this to several possibilities : 1 ) the blk conjecture is false ; 2 ) the simulations have not been run long enough ; 3 ) mixmaster behavior is present but hidden in the variables ; or 4 ) the initial data is insufficiently generic . in any case , the inflation paradigm is frequently invoked to explain the flatness ( 1 ) of the universe , attributing it to an era of exponential expansion at about 10 seconds after the big bang . the mechanism of inflation is generally taken to be an effective cosmological constant from the dominant stress - energy of the inflaton scalar field that regulates gut symmetry breaking , particle creation , and the reheating of the universe . in order to study whether inflation can occur for arbitrary anisotropic and inhomogeneous data , many numerical simulations have been carried out with different symmetries , matter types and perturbations . kurki - suonio et al . extended the planar cosmology code of centrella and wilson [ 22 , 23 ] ( see 3.5 ) to include a scalar field and simulate the onset of inflation in the early universe with an inhomogeneous higgs field and a perfect fluid with a radiation equation of state p = /3 . their results suggest that whether inflation occurs or not can be sensitive to the shape of the potential . in particular , if the shape is flat enough and satisfies the slow - roll conditions ( essentially upper bounds on v/ and v/ near the false vacuum 0 ) , even large initial fluctuations of the higgs field do not prevent inflation . they considered two different forms of the potential : a coleman - weinberg type 4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$v(\phi ) = \lambda { \phi ^4}\left [ { \ln \left({{{{\phi ^2 } } \over { { \sigma ^2 } } } } \right ) - { 1 \over 2 } } \right ] + { { \lambda { \sigma ^4 } } \over 2}$$ \end{document}v()=4[ln(22)12]+42 which is very flat close to the false vacuum and does inflate ; and a rounder type 5\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$v(\phi ) = \lambda { ( { \phi ^2 } - { \sigma ^2})^2}$$ \end{document}v()=(22)2 which , for their parameter combinations , does not . goldwirth and piran studied the onset of inflation with inhomogeneous initial conditions for closed , spherically symmetric spacetimes containing a massive scalar field and radiation field sources ( described by a massless scalar field ) . in all the cases they considered , the radiation field damps quickly and only an inhomogeneous massive scalar field remains to inflate the universe . they find that small inhomogeneities tend to reduce the amount of inflation and large initial inhomogeneities can even suppress the onset of inflation . suitable initial values over a domain of several horizon lengths in order for inflation to begin . investigated the simplest bianchi model ( type v ) background that admits velocities or tilt in order to address the question of how the universe can choose a uniform reference frame at the exit from inflation , since the desitter metric does not have a preferred frame . however if inflation persists , the wave behavior eventually freezes in and all velocities go to zero at least as rapidly as tanh r , where is the relativistic tilt angle ( a measure of velocity ) , and r is a typical scale associated with the radius of the universe . their results indicate that the velocities eventually go to zero as inflation carries all spatial variations outside the horizon , and that the answer to the posed question is that memory is retained and the universe is never really desitter . in addition to the inflaton field , one can consider other sources of inhomogeneity , such as gravitational waves . although linear waves in desitter space will decay exponentially and disappear , it is unclear what will happen if strong waves exist . shinkai & maeda investigated the cosmic no - hair conjecture with gravitational waves and a cosmological constant in 1d plane symmetric vacuum spacetimes , setting up gaussian pulse wave data with amplitudes \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$0.02\lambda \le \max ( \sqrt i ) \le 80\lambda$\end{document}0.02max(i)80 and widths 0.08lh l 2.5lh , where i is the invariant constructed from the 3-riemann tensor and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${l_h } = \sqrt { 3/\lambda}$\end{document}lh=3/ is the horizon scale . they also considered colliding plane waves with amplitudes \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$40\lambda \le \max ( \sqrt i ) \le 125\lambda$\end{document}40max(i)125 and widths 0.08lh l 0.1lh . they find that for any large amplitude and/or small width with inhomogeneity in their parameter sets , the nonlinearity of gravity has little effect , and the spacetime always evolves into a desitter spacetime . the previous paragraphs discussed results from highly symmetric spacetimes , but the possibility of inflation remains to be established for more general inhomogeneous and nonperturbative data . to address this issue , kurki - suonio et al . investigated fully three - dimensional inhomogeneous spacetimes with a chaotic inflationary potential v( ) = /4 . they considered basically two types of runs : small and large scale . in the small scale run , the grid length was initially set equal to the hubble length so the inhomogeneities are well inside the horizon and the dynamical time scale is shorter than the expansion or hubble time . as a result , the perturbations oscillate and damp while the field evolves and the spacetime inflates . in the large scale run , they maintain their shape without damping and , because larger values of lead to faster expansion , the inhomogeneity in the expansion becomes steeper in time , since the regions of large and high inflation stay correlated . the standard picture of cosmology assumes that a phase transition ( associated with chiral symmetry breaking after the electroweak transition ) occurred at approximately 10 seconds after the big bang to convert a plasma of free quarks and gluons into hadrons . although this transition can be of significant cosmological importance , it is not known with certainty whether it is of first order or higher , and what the astrophysical consequences might be on the subsequent state of the universe . for example , the transition may give rise to significant baryon number inhomogeneities which can influence the outcome of primordial nucleosynthesis as evidenced in the distribution and averaged light element abundances . the qcd transition and baryon inhomogeneities may also play a significant and potentially observable role in the generation of primordial magnetic fields . considered a first order phase transition and the nucleation of hadronic bubbles in a supercooled quark - gluon plasma , solving the relativistic lagrangian equations for disconnected and evaporating quark regions during the final stages of the phase transition . they numerically investigated a single isolated quark drop with an initial radius large enough so that surface effects can be neglected . the droplet evolves as a self - similar solution until it evaporates to a sufficiently small radius that surface effects break the similarity solution and increase the evaporation rate . their simulations indicate that , in neglecting long - range energy and momentum transfer ( by electromagnetically interacting particles ) and assuming that the baryon number is transported with the hydrodynamical flux ) , the baryon number concentration is similar to what is predicted by chemical equilibrium calculations . kurki - suonio and laine studied the growth of bubbles and the decay of droplets using a spherically symmetric code that accounts for a phenomenological model of the microscopic entropy generated at the phase transition surface . incorporating the small scale effects of the finite wall width and surface tension , but neglecting entropy and baryon flow through the droplet wall , they also find that evaporating droplets do not leave behind a global rarefaction wave to dissipate any previously generated baryon number inhomogeneity . observations of the light elements produced during big bang nucleosynthesis following the quark / hadron phase transition ( roughly 10 10 seconds after the big bang ) are in good agreement with the standard model of our universe ( see 2.2 ) . however , it is interesting to investigate other more general models to assert the role of shear and curvature on the nucleosynthesis process . rothman and matzner considered primordial nucleosynthesis in anisotropic cosmologies , solving the strong reaction equations leading to he . they find that the concentration of he increases with increasing shear ; this is due to time scale effects and the competition between dissipation and enhanced reaction rates from photon heating and neutrino blue shifts . their results have been used to place a limit on anisotropy at the epoch of nucleosynthesis . kurki - suonio and matzner extended this work to include 30 strong 2-particle reactions involving nuclei with mass numbers a 7 , and to demonstrate the effects of anisotropy on the cosmologically significant isotopes h , he , he and li as a function of the baryon to photon ratio . they conclude that the effect of anisotropy on h and he is not significant , and the abundances of he and li increase with anisotropy in accord with . furthermore , it is possible that neutron diffusion , the process whereby neutrons diffuse out from regions of very high baryon density just before nucleosynthesis , can affect the neutron to proton ratio in such a way as to enhance deuterium and reduce he compared to a homogeneous model . however , plane symmetric , general relativistic simulations with neutron diffusion show that the neutrons diffuse back into the high density regions once nucleosynthesis begins there thereby wiping out the effect . as a result , although inhomogeneities influence the element abundances , they do so at a much smaller degree then previously speculated . the numerical simulations also demonstrate that , because of the back diffusion , a cosmological model with a critical baryon density can not be made consistent with helium and deuterium observations , even with substantial baryon inhomogeneities and the anticipated neutron diffusion effect . gravitational waves are an inevitable product of the general einstein equations , and one can expect a wide spectrum of wave signals propagating throughout our universe due to shear anisotropies , primordial metric and matter fluctuations , collapsing matter structures , ringing black holes , and colliding neutron stars , for example . the discussion here is restricted to the pure vacuum field dynamics and the fundamental nonlinear behavior of gravitational waves in numerically generated cosmological spacetimes . centrella and matzner [ 20 , 21 ] studied a class of plane symmetric cosmologies representing gravitational inhomogeneities in the form of shocks or discontinuities separating two vacuum expanding kasner cosmologies ( 1 ) . by a suitable choice of parameters , the constraint equations can be satisfied at the initial time with an euclidean 3-surface and an algebraic matching of parameters across the different kasner regions that gives rise to a discontinuous extrinsic curvature tensor . they performed both numerical calculations and analytical estimates using a green s function analysis to establish and verify ( despite the numerical difficulties in evolving discontinuous data ) certain aspects of the solutions , including gravitational wave interactions , the formation of tails , and the singularity behavior of colliding waves in expanding vacuum cosmologies . shortly thereafter , centrella and wilson [ 22 , 23 ] developed a more general plane symmetric code for cosmology , adding also hydrodynamic sources . in order to simplify the resulting differential equations , they adopted a diagonal 3-metric of the form 6\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\gamma _ { ij } } = { a^2}(t , \ , z)\,\,\left({\begin{array}{*{20}c } 1 & 0 & 0 \\ 0 & { { h^2}(t , \ , z ) } & 0 \\ 0 & 0 & 1 \\ \end{array } } \right),$$ \end{document}ij = a2(t , z)(1000h2(t , z)0001 ) , which is maintained in time with a proper choice of shift vector . the metric ( 6 ) allows an overall conformal factor a to simplify the initial value problem , and a dynamical transverse wave component in the variable h. the hydrodynamic equations are solved using artificial viscosity methods for shock capturing and barton s method for monotonic transport . the evolutions are fully constrained ( solving both the momentum and hamiltonian constraints at each time step ) and use the mean curvature slicing condition . [ 1 , 3 ] , implementing more robust numerical methods and an improved parametric treatment of the initial value problem . in applications of these codes , centrella investigated nonlinear gravity waves in minkowski space and compared the full numerical solutions against a first order perturbation solution to benchmark certain numerical issues such as numerical damping and dispersion . a second order perturbation analysis was also used to model the transition into the nonlinear regime . considered small and large perturbations in the two degenerate kasner models : p1 = p3 = 0 or 2/3 , and p2 = 1 or 1/3 respectively , where pi are parameters in the kasner metric ( 1 ) . carrying out a second order perturbation expansion and computing the newman - penrose ( np ) scalars , riemann invariants and bel - robinson vector , they demonstrated , for their particular class of spacetimes , that the nonlinear behavior is in the coulomb ( or background ) part represented by the leading order term in the np scalar and not in the gravitational wave component . for standing - wave perturbations , the dominant second order effects in their variables are an enhanced monotonic increase in the background expansion rate , and the generation of oscillatory behavior in the background spacetime with frequencies equal to the harmonics of the first order standing - wave solution . a unique approach to numerical cosmology ( and numerical relativity in general ) is the method of regge calculus in which spacetime is represented as a complex of 4-dimensional , geometrically flat simplices . the principles of einstein s theory are applied directly to the simplicial geometry to form the curvature , action and field equations , in contrast to the finite difference approach where the continuum field equations are differenced on a discrete mesh . a 3-dimensional code implementing regge calculus techniques was developed recently by gentle and miller and applied to the kasner cosmological model . they also describe a procedure to solve the constraint equations for time asymmetric initial data on two spacelike hypersurfaces constructed from tetrahedra , since full 4-dimensional regions or lattices are used . the new method is analogous to york s procedure where the conformal metric , trace of the extrinsic curvature , and momentum variables are all freely specifiable . although additional work is needed to apply ( and develop ) regge calculus techniques to more general spacetimes , the early results of gentle and miller are promising . in particular , their evolutions have reproduced the continuum kasner solution , achieved second order convergence , and sustained numerical stability . the phrase physical cosmology is generally associated with the large ( galaxy and cluster ) scale structure of the post - recombination epoch where gravitational effects are modeled approximately by newtonian physics on an uniformly expanding , matter dominated flrw background . a discussion of the large scale structure is included in this review since any viable model of our universe which allows a regime where strongly general relativistic effects are important must match onto the weakly relativistic ( or newtonian ) regime . also , since certain aspects of this regime are directly observable , one can hope to constrain or rule out various cosmological models and/or parameters , including the density ( 0 ) , hubble ( h0 = 100h km sec mpc ) , and cosmological ( ) constants . due to the vast body of literature on numerical simulations of the post - recombination epoch , it is possible to mention only a small fraction of all the published papers . hence , the following summary is limited to cover just a few aspects of computational physical cosmology , and in particular those that can potentially be used to discriminate between cosmological model parameters , even within the realm of the standard model . the cosmic microwave background radiation ( cmbr ) , which is a direct relic of the early universe , currently provides the deepest probe of cosmological structures and imposes severe constraints on the various proposed matter evolution scenarios and cosmological parameters . although the cmbr is a unique and deep probe of both the thermal history of the early universe and the primordial perturbations in the matter distribution , the associated anisotropies are not exclusively primordial in nature . important modifications to the cmbr spectrum can arise from large scale coherent structures , even well after the photons decouple from the matter at redshift z 10 , due to the gravitational redshifting of the photons through the sachs - wolfe effect arising from potential gradients [ 49 , 5 ] 7\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{\delta t } \over t } = { \phi _ e } - { \phi _ r } - \int\nolimits_r^e { { { 2\overrightarrow l \cdot \nabla \phi } \over a}dt,}$$ \end{document}tt=erre2ladt , where the integral is evaluated from the emission ( e ) to reception ( r ) points along the spatial photon paths \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$\vec l,\phi$\end{document}l, is the gravitational potential , t / t defines the temperature fluctuations , and a(t ) is the cosmological scale factor in the standard flrw metric . also , if the intergalactic medium ( igm ) reionizes sometime after the decoupling , say from an early generation of stars , the increased rate of thomson scattering off the free electrons will erase sub - horizon scale temperature anisotropies , while creating secondary doppler shift anisotropies . to make meaningful comparisons between numerical models and observed data , all of these effects ( and others , see for example 4.1.3 ) must be incorporated self - consistently into the numerical models and to high accuracy in order to resolve the weak signals . many computational analyses based on linear perturbation theory have been carried out to estimate the temperature anisotropies in the sky ( for example see and the references cited in ) . although such linearized approaches yield reasonable results , they are not well - suited to discussing the expected imaging of the developing nonlinear structures in the microwave background . an alternative ray - tracing approach has been developed by anninos et al . to introduce and propagate individual photons through the evolving nonlinear matter structures . they solve the geodesic equations of motion and subject the photons to thomson scattering in a probabilistic way and at a rate determined by the local density of free electrons in the model . since the temperature fluctuations remain small , the equations of motion for the photons are treated as in the linearized limit , and the anisotropies are computed according to 8\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${{\delta t } \over t } = { { \delta z } \over { 1 + z}},$$ \end{document}tt=z1+z , where 9\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$1 + z = { { { { ( { k^\mu}{u_\mu})}_e } } \over { { { ( { k^\mu}{u_\mu})}_r}}},$$ \end{document}1+z=(ku)e(ku)r , and the photon wave vector k and matter rest frame four - velocity u are evaluated at the emission ( e ) and reception ( r ) points . applying their procedure to a hot dark matter ( hdm ) model of structure formation , anninos et al . find the parameters for this model are severely constrained by cobe data such that 0h 1 , where 0 and h are the density and hubble parameters . in models where the igm does not reionize , the probability of scattering after the photon - matter decoupling epoch is low , and the sachs - wolfe effect dominates the anisotropies at angular scales larger than a few degrees . however if reionization occurs , the scattering probability increases substantially and the matter structures , which develop large bulk motions relative to the comoving background , induce doppler shifts on the scattered cmbr photons and leave an imprint of the surface of last scattering . the induced fluctuations on subhorizon scales in reionization scenarios can be a significant fraction of the primordial anisotropies , as observed by tuluie et al . . they considered two possible scenarios of reionization : a model that suffers early and gradual ( eg ) reionization of the igm as caused by the photoionizing uv radiation emitted by decaying neutrinos , and the late and sudden ( ls ) scenario as might be applicable to the case of an early generation of star formation activity at high redshifts . considering the hdm model with 0 = 1 and h = 0.55 , which produces cmbr anisotropies above current cobe limits when no reionization is included ( see 4.1.1 ) , they find that the eg scenario effectively reduces the anisotropies to the levels observed by cobe and generates smaller doppler shift anisotropies than the ls model , as demonstrated in figure 3 . figure 3the top two images represent temperature fluctuations ( i.e. , t / t ) due to the sachs - wolfe effect and doppler shifts in a standard critically closed hdm model with no reionization and baryon fractions 0.02 ( plate 1 , 4 4 , rms=2.8 10 ) and 0.2 ( plate 2 , 8 8 , rms=3.4 10 ) . the bottom two plates image fluctuations in an early and gradual reionization scenario of decaying neutrinos with baryon fraction 0.02 ( plate 3 , 4 4 , rms=1.3 10 ; and plate 4 , 8 8 , rms = 1.4 10 ) . the top two images represent temperature fluctuations ( i.e. , t / t ) due to the sachs - wolfe effect and doppler shifts in a standard critically closed hdm model with no reionization and baryon fractions 0.02 ( plate 1 , 4 4 , rms=2.8 10 ) and 0.2 ( plate 2 , 8 8 , rms=3.4 10 ) . the bottom two plates image fluctuations in an early and gradual reionization scenario of decaying neutrinos with baryon fraction 0.02 ( plate 3 , 4 4 , rms=1.3 10 ; and plate 4 , 8 8 , rms = 1.4 10 ) . the ls scenario of reionization is not able to reduce the anisotropy levels below the cobe limits , and can even give rise to greater doppler shifts than expected at decoupling . additional sources of cmbr anisotropy can arise from the interactions of photons with dynamically evolving matter structures and nonstatic gravitational potentials . considered the impact of nonlinear matter condensations on the cmbr in 0 1 cold dark matter ( cdm ) models , focusing on the relative importance of secondary temperature anisotropies due to three different effects : 1 ) time - dependent variations in the gravitational potential of nonlinear structures as a result of collapse or expansion ; 2 ) proper motion of nonlinear structures such as clusters and superclusters across the sky ; and 3 ) the decaying gravitational potential effect from the evolution of perturbations in open models . they applied the ray - tracing procedure of to explore the relative importance of these secondary anisotropies as a function of the density parameter 0 and the scale of matter distributions . they find that the secondary temperature anisotropies are dominated by the decaying potential effect at large scales , but that all three sources of anisotropy can produce signatures of order t / t 10 as shown in figure 4 . figure 4the top two images represent the proper motion and rees - sciama effects in the cmbr for a critically closed cdm model ( upper left ) , together with the corresponding column density of voids and clusters over the same region ( upper right ) . the bottom two images show the secondary anisotropies dominated here by the decaying potential effect in an open cosmological model ( bottom left ) , together with the corresponding gravitational potential over the same region ( bottom right ) . the rms fluctuations in both cases are on the order of 5 10 , though the open model carries a somewhat larger signature . the top two images represent the proper motion and rees - sciama effects in the cmbr for a critically closed cdm model ( upper left ) , together with the corresponding column density of voids and clusters over the same region ( upper right ) . the bottom two images show the secondary anisotropies dominated here by the decaying potential effect in an open cosmological model ( bottom left ) , together with the corresponding gravitational potential over the same region ( bottom right ) . the rms fluctuations in both cases are on the order of 5 10 , though the open model carries a somewhat larger signature . in addition to the effects discussed in the previous paragraphs , many other sources of secondary anisotropies ( such as gravitational lensing , the vishniac effect accounting for matter velocities and flows into local potential wells , and the sunyaev - zeldovich distortions from the compton scattering of cmb photons in the hot cluster medium ) can also be significant . see reference for a more complete list and thorough discussion of the different sources of cmbr anisotropies . observations of gravitational lenses provide measures of the abundance and strength of nonlinear potential fluctuations along the lines of sight to distant objects . since these calculations are sensitive to the gravitational potential , they may be more reliable than galaxy and velocity field measurements as they are not subject to the same ambiguities associated with biasing effects . also , since different cosmological models predict different mass distributions , especially at the higher redshifts , lensing calculations can potentially be used to confirm or discard competing cosmological models . as an alternative to solving the computationally demanding lens equations , cen et al developed a more efficient scheme to identify regions with surface densities capable of generating multiple images accurately for splittings larger than three arcseconds . they applied this technique to a standard cdm model with 0 = 1 , and found that this model predicts more large angle splittings ( > 8 ) than are known to exist in the observed universe . their results suggest that the standard cdm model should be excluded as a viable model of our universe . a similar analysis for a flat low density cdm model with a cosmological constant \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$({\omega _ 0 } = 0.3,\,\,\lambda/3h_0 ^ 2 = 0{.}7)$\end{document}(0=0.3,/3h02=0.7 ) suggests a lower and perhaps acceptable number of lensing events . however , an uncertainty in their studies is the nature of the lenses at and below the resolution of the numerical grid . they model the lensing structures as simplified singular isothermal spheres ( sis ) with no distinctive cores . large angle splittings are generally attributed to larger structures such as clusters of galaxies , and there are indications that clusters have small but finite core radii rcore 20 30h kpc . core radii of this size can have an important effect on the probability of multiple imaging . flores and primack considered the effects of assuming two different kinds of splitting sources : isothermal spheres with small but finite core radii \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$\rho \propto { ( { r^2 } + r_{core}^2)^{- 1}}$\end{document}(r2+rcore2)1 , and spheres with a hernquist density profile r(r + a ) , where rcore 20 30h kpc and a 300h kpc . they find that the computed frequency of large - angle splittings , when using the nonsingular profiles , can potentially decrease by more than an order of magnitude relative to the sis case and can bring the standard cdm model into better agreement with observations . they stress that lensing events are sensitive to both the cosmological model ( essentially the number density of lenses ) and to the inner lens structure , making it difficult to probe the models until the structure of the lenses , both observationally and numerically , is better known . in cdm cosmogonies , the fluctuation spectrum at small wavelengths has a logarithmic dependence at mass scales smaller than 10 solar masses , which indicates that all small scale fluctuations in this model collapse nearly simultaneously in time . furthermore , the cooling in these fluctuations is dominated by the rotational / vibrational modes of hydrogen molecules that were able to form using the free electrons left over from recombination and the ones produced by strong shock waves as catalysts . the first structures to collapse may be capable of producing population iii stars and have a substantial influence on the subsequent thermal evolution of the intergalactic medium , as suggested by figure 1 , due to the radiation emitted by the first generation stars as well as supernova driven winds . to know the subsequent fate of the universe and which structures will survive or be destroyed by the uv background , it is first necessary to know when the first stars formed . ostriker and gnedin have carried out high resolution numerical simulations of the reheating and reionization of the universe due to star formation bursts triggered by molecular hydrogen cooling . accounting for the chemistry of the primeval hydrogen / helium plasma , self - shielding of the gas , radiative cooling , and a phenomenological model of star formation , they find that two distinct star populations form : the first generation pop iii from h2 cooling prior to reheating at redshift z 14 ; and the second generation pop ii at z < 10 when the virial temperature of the gas clumps reaches 10 k and hydrogen line cooling becomes efficient . star formation slows in the intermittent epoch due to the depletion of h2 by photo - destruction and reheating . in addition , the objects which formed pop iii stars also initiate pop ii sequences when their virial temperatures reach 10 k through continued mass accretion . the lyman - alpha forest represents the optically thin ( at the lyman edge ) component of quasar absorption systems ( qas ) , a collection of absorption features in quasar spectra extending back to high redshifts . qas are effective probes of the matter distribution and the physical state of the universe at early epochs when structures such as galaxies are still forming and evolving . although stringent observational constraints have been placed on competing cosmological models at large scales by the cobe satellite and over the smaller scales of our local universe by observations of galaxies and clusters , there remains sufficient flexibility in the cosmological parameters that no single model has been established conclusively . the relative lack of constraining observational data at the intermediate to high redshifts ( 0 < z < 5 ) , where differences between competing cosmological models are more pronounced , suggests that qas can potentially yield valuable and discriminating observational data . several combined n - body and hydrodynamic numerical simulations of the lyman forest have been performed recently [ 26 , 41 , 60 ] , and all have been able to fit the observations remarkably well , including the column density and doppler width distributions , the size of absorbers , and the line number evolution . despite the fact that the cosmological models and parameters are different in each case , the simulations give similar results , provided that the proper ionization bias is used ( bion ( bh)/ , where b is the baryonic density parameter , h is the hubble parameter and is the photoionization rate at the hydrogen lyman edge ) . a theoretical paradigm has thus emerged from these calculations in which lyman - alpha absorption lines originate from the relatively small scale structure in pregalactic or intergalactic gas through the bottom - up hierarchical formation picture in cdm - like universes . the absorption features originate in structures exhibiting a variety of morphologies commonly found in numerical simulations ( see figure 5 ) , including fluctuations in underdense regions , spheroidal minihalos , and filaments extending over scales of a few megaparsecs . figure 5distribution of the gas density at redshift z = 3 from a numerical hydrodynamics simulation of the lyman - alpha forest with a cdm spectrum normalized to second year cobe observations , a hubble parameter of h = 0.5 , a comoving box size of 9.6 mpc , and baryonic density of b = 0.06 composed of 76% hydrogen and 24% helium . the isosurfaces represent baryons at ten times the mean density and are color coded to the gas temperature ( dark blue = 3 10 k , light blue = 3 10 k ) . the higher density contours trace out isolated spherical structures typically found at the intersections of the filaments . a single random slice through the cube is also shown , with the baryonic overdensity represented by a rainbow - like color map changing from black ( minimum ) to red ( maximum ) . the he mass fraction is shown with a wire mesh in this same slice . to emphasize fine structure in the minivoids , the mass fraction in the overdense regions has been rescaled by the gas overdensity wherever it exceeds unity . distribution of the gas density at redshift z = 3 from a numerical hydrodynamics simulation of the lyman - alpha forest with a cdm spectrum normalized to second year cobe observations , a hubble parameter of h = 0.5 , a comoving box size of 9.6 mpc , and baryonic density of b = 0.06 composed of 76% hydrogen and 24% helium . the isosurfaces represent baryons at ten times the mean density and are color coded to the gas temperature ( dark blue = 3 10 k , light blue = 3 10 k ) . the higher density contours trace out isolated spherical structures typically found at the intersections of the filaments . a single random slice through the cube is also shown , with the baryonic overdensity represented by a rainbow - like color map changing from black ( minimum ) to red ( maximum ) . the he mass fraction is shown with a wire mesh in this same slice . to emphasize fine structure in the minivoids , the mass fraction in the overdense regions has been rescaled by the gas overdensity wherever it exceeds unity . clusters of galaxies are the largest gravitationally bound systems known to be in quasi - equilibrium . this allows for reliable estimates to be made of their mass as well as their dynamical and thermal attributes . the richest clusters , arising from 3 density fluctuations , can be as massive as 10 10 solar masses , and the environment in these structures is composed of shock heated gas with temperatures of order 10 10 degrees kelvin which emits thermal bremsstrahlung and line radiation at x - ray energies . also , because of their spatial size 1h mpc and separations of order 50h mpc , they provide a measure of nonlinearity on scales close to the perturbation normalization scale 8h mpc . observations of the substructure , distribution , luminosity , and evolution of galaxy clusters are therefore likely to provide signatures of the underlying cosmology of our universe , and can be used as cosmological probes in the easily observable redshift range 0 z 1 . thomas et al . have investigated the internal structure of galaxy clusters formed in high resolution n - body simulations of four different cosmological models , including standard , open , and flat but low density universes . they find that the structure of relaxed clusters is similar in the critical and low density universes , although the critical density models contain relatively more disordered clusters due to the freeze - out of fluctuations in open universes at late times . the profiles of relaxed clusters are very similar in the different simulations , since most clusters are in a quasi - equilibrium state inside the virial radius and follow the universal density profile of navarro et al . . there does not appear to be a strong cosmological dependence in the profiles , as suggested by previous studies of clusters formed from pure power law initial density fluctuations . however , because more young and dynamically evolving clusters are found in critical density universes , thomas et al . suggest that it may be possible to discriminate among the density parameters by looking for multiple cores in the substructure of the dynamic cluster population . they note that a statistical population of 20 clusters can distinguish between open and critically closed universes . the evolution of the number density of rich clusters of galaxies can be used to compute 0 and 8 ( the power spectrum normalization on scales of 8h mpc ) when numerical simulation results are combined with the constraint \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}${\sigma _ 8}\omega _ 0^{0.5 } \approx 0.5$\end{document}800.50.5 , derived from observed present - day abundances of rich clusters . bahcall et al . computed the evolution of the cluster mass function in five different cosmological model simulations and found that the number of high mass ( comalike ) clusters in flat , low 8 models ( i.e. , the standard cdm model with 8 0.5 ) decreases dramatically by a factor of approximately 10 from z = 0 to z 0.5 . for low 0 , high 8 models , the data results in a much slower decrease in the number density of clusters over the same redshift interval . comparing these results to observations of rich clusters in the real universe , which indicate only a slight evolution of cluster abundances to redshifts z 0.5 1 , they conclude that critically closed standard cdm and mixed dark matter ( mdm ) models are not consistent with the observed data . the models which best fit the data are the open models with low bias ( 0 = 0.3 0.1 and 8 = 0.85 0.5 ) , and flat low density models with a cosmological constant ( 0 = 0.34 0.13 and 0 + = 1 ) . the evolution of the x - ray luminosity function , and the size and temperature distribution of rich clusters of galaxies are all potentially important discriminants of cosmological models . investigated these properties in a high resolution numerical simulation of a standard cdm model normalized to cobe . although the results are highly sensitive to grid resolution ( see for a discussion of the effects from resolution constraints on the properties of rich clusters ) , their primary conclusion , that the standard cdm model predicts too many bright x - ray emitting clusters and too much integrated x - ray intensity , is robust , since an increase in resolution will only exaggerate these problems . cosmological sheets , or pancakes , form as overdense regions collapse preferentially along one axis . originally studied by zeldovich in the context of neutrino - dominated cosmologies , sheets are ubiquitous features in nonlinear structure formation simulations of cdm - like models with baryonic fluid , and manifest on a spectrum of length scales and formation epochs . gas collapses gravitationally into flattened sheet structures , forming two plane parallel shock fronts that propagate in opposite directions , heating the infalling gas . sheets are characterized by essentially five distinct components : the preshock inflow , the postshock heated gas , the strongly cooling / recombination front separating the hot gas from the cold , the cooled postshocked gas , and the unshocked adiabatically compressed gas at the center . several numerical calculations [ 15 , 51 , 8 ] have been performed of these systems which include the baryonic fluid with hydrodynamical shock heating , ionization , recombination , dark matter , thermal conductivity , and radiative cooling ( compton , bremstrahlung , and atomic line cooling ) , in both one and two spatial dimensions to ascert the significance of each physical process and to compute the fragmentation scale . in addition , it is well known that gas which cools to 1 ev through hydrogen line cooling will likely cool faster than it can recombine . this nonequilibrium cooling increases the number of electrons and ions ( compared to the equilibrium case ) which , in turn , increases the concentrations of h and h , the intermediaries that produce hydrogen molecules h2 . if large concentrations of molecules form , excitations of the vibrational / rotational modes of the molecules can efficiently cool the gas to well below 1 ev , the minimum temperature expected from atomic hydrogen line cooling . because the gas cools isobarically , the reduction in temperature results in an even greater reduction in the jeans mass , and the bound objects which form from the fragmentation of h2 cooled cosmological sheets may be associated with massive stars or star clusters . anninos and norman have carried out 1d and 2d high resolution numerical calculations to investigate the role of hydrogen molecules in the cooling instability and fragmentation of cosmological sheets , considering the collapse of perturbation wavelengths from 1 mpc to 10 mpc . they find that for the more energetic ( long wavelength ) cases , the mass fraction of hydrogen molecules reaches h2/nh 3 10 , which cools the gas to 4 10 ev and results in a fragmentation scale of 9 10 m. this represents reductions of 50 and 10 in temperature and jeans mass respectively when compared , as in figure 6 , to the equivalent case in which hydrogen molecules were neglected . figure 6two different model simulations of cosmological sheets are presented : ( a ) a six species model including only atomic line cooling , and ( b ) a nine species model including also hydrogen molecules . the evolution sequences in the images show the baryonic overdensity and gas temperature at three redshifts following the initial collapse at z = 5 . in each figure , the vertical axis is 32 kpc long ( parallel to the plane of collapse ) and the horizontal axis extends to 4 mpc on a logarithmic scale to emphasize the central structures . differences in the two cases are observed in the cold pancake layer and the cooling flows between the shock front and the cold central layer . when the central layer fragments , the thickness of the cold gas layer in the six ( nine ) species case grows to 3 ( 0.3 ) kpc and the surface density evolves with a dominant transverse mode corresponding to a scale of approximately 8(1 ) kpc . assuming a symmetric distribution of matter along the second transverse direction , the fragment masses are approximately 10 ( 10 ) solar masses . two different model simulations of cosmological sheets are presented : ( a ) a six species model including only atomic line cooling , and ( b ) a nine species model including also hydrogen molecules . the evolution sequences in the images show the baryonic overdensity and gas temperature at three redshifts following the initial collapse at z = 5 . in each figure , the vertical axis is 32 kpc long ( parallel to the plane of collapse ) and the horizontal axis extends to 4 mpc on a logarithmic scale to emphasize the central structures . differences in the two cases are observed in the cold pancake layer and the cooling flows between the shock front and the cold central layer . when the central layer fragments , the thickness of the cold gas layer in the six ( nine ) species case grows to 3 ( 0.3 ) kpc and the surface density evolves with a dominant transverse mode corresponding to a scale of approximately 8(1 ) kpc . assuming a symmetric distribution of matter along the second transverse direction , the fragment masses are approximately 10 ( 10 ) solar masses this review is intended to provide a flavor of the variety of numerical cosmological calculations that have been performed to investigate different phenomena throughout the history of our universe . the topics discussed range from the strong field dynamical behavior of spacetime geometry at early times near the big bang singularity and the epoch of inflation , to the late time evolution of large scale matter fluctuations and the formation of clusters of galaxies . although many problems have been addressed , the complexity of the varied physical processes in the extreme time , spatial , and dynamical scales of our universe guarantees that many more interesting and unresolved issues remain . indeed , even the background cosmological model which best describes our universe is essentially unknown . the topology of our universe , the generic singularity behavior , the fundamental nonlinear field and gravitational wave interactions , the existence and role of a cosmological constant , the correct structure formation scenario , and the origin and spectrum of primordial fluctuations , for example , are uncertain . however the field of numerical cosmology has matured , in the development of computational techniques , the modeling of microphysics , and in taking advantage of current computing technologies , to the point that it is now possible to perform reliable comparisons of numerical models with observed data .

in order to account for the observable universe , any comprehensive theory or model of cosmology must draw from many disciplines of physics , including gauge theories of strong and weak interactions , the hydrodynamics and microphysics of baryonic matter , electromagnetic fields , and spacetime curvature , for example . although it is difficult to incorporate all these physical elements into a single complete model of our universe , advances in computing methods and technologies have contributed significantly towards our understanding of cosmological models , the universe , and astrophysical processes within them . a sample of numerical calculations addressing specific issues in cosmology are reviewed in this article : from the big bang singularity dynamics to the fundamental interactions of gravitational waves ; from the quark - hadron phase transition to the large scale structure of the universe . the emphasis , although not exclusively , is on those calculations designed to test different models of cosmology against the observed universe .

the 2,6-bis ( 1.1-dimethylethyl)-4-methylphenol ( bht ) , also known as butylhydroxytoluene , is a lipophilic ( fat soluble ) organic compound that is primarily used as an antioxidant food additive as well as in cosmetics , pharmaceuticals , jet fuels , rubber , petroleum products , and electrical transformer oil . bht is prepared by the reaction of p - cresol ( 4-methylphenol ) with isobutylene ( 2-methylpropene ) catalysed by sulfuric acid . the species mesembryanthemum crystallinum ( family : aizoaceae , order : caryophyllales ) , also termed the common ice plant , has emerged as a model organism in plant molecular physiology . the plant 's rise to relative fame started with the serendipitous discovery of a stress - inducible switch from c3 photosynthesis to crassulacean acid metabolism ( cam ) [ 5 , 6 ] . a second major area of interest centres on the plant 's extreme stress tolerance , particularly tolerance to high salinity . the plant thrives in coastal area under climatic conditions characterized by short , cool , moist winters and long dry summers . mesembryanthemum crystallinum shows five distinct growth phases during its life cycle ( i.e. , germinating seedlings , juvenile , adult , flowering , and seed forming ) . historically , physicians used leaf juice to soothe inflammation of the mucous membranes of the respiratory or urinary system . in europe , the fresh juice has been used to treat water retention and painful urination and to soothe lung inflammation . during normal metabolism , plants generate reactive oxygen species ( ros ) , including superoxide radical ( o2 ) , hydrogen peroxide ( h2o2 ) , hydroxyl radical ( ho ) , and singlet oxygen ( o2 ) . ros are overproduced in plants under stress , including drought and desiccation , salt stress , chilling , heat shock , heavy metals , ultraviolet radiation , air pollutants , such as ozone and so2 , mechanical stress , nutrient deprivation , pathogen attack and high light stress . to mitigate the oxidative damage initiated by ros , the aim of this study is to select a method for a better extraction of bht from the leaves of the halophyte plant mesembryanthemum crystallinum . the leaves of the halophyte plant mesembryanthemum crystallinum were collected from their natural biotope in the two periods june 2007 and december 2008 ( figures 1 and 2 ) . method 1 ( sanches et al . ) 10 g of plant leaves were mixed in the presence of acetonitrile ( 2 ml ) and hexane ( 20 ml ) , after centrifugation 10 minat 1,036 g , organic fraction was suppressed . the bht concentration of the extract was determined in the different plant growth stages in parallel with the antioxidant activity . 10 g of plant leaves were mixed in the presence of acetonitrile ( 2 ml ) and hexane ( 20 ml ) , after centrifugation 10 minat 1,036 g , organic fraction was suppressed . the bht concentration of the extract was determined in the different plant growth stages in parallel with the antioxidant activity . method 2 ( bouftira et al . ) 25 g of plant leaves were mixed in the presence of methanol 80% containing ascorbic acid 50 mm . after centrifugation , 14000 g , at 4c , the supernatant was collected . 25 g of plant leaves were mixed in the presence of methanol 80% containing ascorbic acid 50 mm . after centrifugation , 14000 g , at 4c , the supernatant was collected . free radical scavenging activity of plant extract was determined by using a stable free radical , ( 1,1-diphenyl-2-picryl - hydrazyl ) dpph . dpph solution was prepared at a concentration of 0.024 mg / ml in ethanol . during assay , 1 ml of the crude extract was mixed with 1 ml dpph solution . the mixture was incubated in the room temperature for 30 min ; absorbance was recorded at 517 nm ( cam spec m230/330 uv visible spectrophotometer , uk ) . synthetic butylated hydroxytoluene ( bht ) was used as a standard for the investigation of the antiradical activity . the percentage of remaining dpph ( % dpph rem ) at the steady state was determined as follows : % dpph rem = 100 cdpph / cdpph ( t = 0 ) , where cdpph ( t = 0 ) is the initial dpph concentration and cdpph is the dpph concentration at the steady state . a hewlett packard 1100 analytical hplc was used with a gradient elution method ; within 2 min , the mobile phase was acetonitrile - water ( 65 + 35 ) , after which the acetonitrile was raised to 100% within 15 min . the total runtime of each analysis was 30 min to ensure cleaning of the column between samples . the flow rate was 1 ml / min and the injection volume 20 l . bht was identified by comparison of its retention time and uv spectra with those of an injected pure standard in the hplc method . the concentration of bht was determined in g / ml / g of fresh leaves ( figure 1 ) . bht spectra were detected at 280 nm by analytical hplc ( figure 2 ) ; the different spectra were compared between the plant growth stage and the bht standard ( 10 mg / ml ) . the results ( figure 3 ) , by using method 1 of extraction showed that the seedlings stage has the highest antiradical activity ( 65,24 0,27 ) . figure 4 showed the comparison of antiradical activity between the two methods ( method 1 and 2 ) . at the same plant growth stage ( floraison ) , the extraction by method 1 has higher antiradical activity ( 51 0,82 ) in comparison with method 2 ( 32,33 2,05 ) . the results showed that mesembryanthemum crystallinum extract at seeds stage has the highest bht concentration . at this period , the plant leaves are purple resulting from tolerance to stress of environment . in the seeds stage the light stress can attribute in part to stimulate the plant for the synthesis of bht . it was proved that m. crystallinum after irradiation with high light irradiance displays a rapid cell - specific accumulation of plant secondary metabolites in the upper leaf epidermis : a phenomenon that is not detectable with salt or drought stress . the results of this study showed also that the method of extraction influences the yield of bht . the method using hexane and acetonitrile is better than that using methanol 80% for bht extraction . the extraction method must allow complete extraction of the compounds of interest , and it must avoid their chemical modification . water and aqueous mixture of ethanol , methanol , and acetone are commonly used for plant extraction . the purple - coloured dpph is a stable free radical , which is reduced to a , a - diphenyl - b - picrylhydrazine ( yellow coloured ) by reacting with an antioxidant . antioxidants interrupt free radical chain oxidation by donating hydrogen from hydroxyl groups to form a stable end product , which does not initiate or propagate further oxidation of lipids . the data obtained showed that the antioxidant activity was higher at seedlings stage in comparison with the other plant stages . in fact , m. crystallinum accumulates more bht at floraison stage in comparison with seedlings stage . the plant accumulates , at seedlings stage , other antioxidant compounds which work in association with bht . at the floraison stage , this study also showed that the method of extraction is in relation with the antioxidant activity . the method using hexane and acetonitrile ( 51 0,82 ) for extraction showed higher antioxidant activity than those using methanol 80% ( 32,33 2,05 ) . many medicinal plants are investigated for their antioxidant activity in relation with the methods of extraction and the solvent used . it was found that higher amounts of polyphenols and anthocyanins are found in methanol and ethanol extracts than in water extracts . it means that they are more efficient in cell walls which have unpolar character and cause polyphenols to be released from cells . more useful explanation for the decrease is ascribed to the enzyme polyphenol oxidase , which degrades polyphenols in water extracts whereas in methanol and ethanol they are inactive . in conclusion , the results of this study are very important ; we obtained a better method for bht extraction .

a naturally occurring bht was identified in the leaves of the halophyte plant mesembryanthemum crystallinum . this phenol was extracted in this study by two methods at the different plant growth stages . one of the methods was better for bht extraction ; the concentration of this phenol is plant growth stage dependent . in this study , the floraison stage has the highest bht concentration . the antioxidant activity of the plant extract was not related to bht concentration . the higher antioxidant activity is obtained at seedlings stage .

an unprecedented outbreak of ebola virus disease ( evd ) is occurring in west africa . in addition to the morbidity and mortality effects on the population at large , there is a significant impact on healthcare providers in the region . although many healthcare worker exposures may occur prior to evd being suspected and appropriate isolation implemented , exposures can occur in spite of isolation procedures and ppe use . although there is anecdotal evidence regarding the efficacy of ppe , a review of literature reveals few controlled studies of ppe ensembles relevant to evd . field studies of ppe in the setting of evd are difficult because of ethical and safety concerns . it is thought a high level of training is required to safely don , use , and doff ppe . introducing a new ppe ensemble into the field could increase exposure risk of participants who are already well - trained on a current ppe ensemble . there may be some hesitancy among participants to try an unproven ppe set . finally , in a high disease prevalence area , with a relatively small number of events , a very large study population would be required to account for the possibility of evd acquisition from non - work exposures or activities ( i.e. non - medical contacts within the community ) . the possibility that exposures can occur in spite of ppe utilization is evident from recent disease acquisition by two healthcare workers in the united states . these regulatory standards are material standards so that testing of individual components ( gloves , gown , etc . ) result in a rating for the tested component . some ppe ensemble testing has been performed , so called man - in - suit - testing ( mist ) ) but this has primarily focused on radiation , thermal or chemical exposures where exposure risk is dose - dependent , or in aerosol scenarios . zamora et al . compared two personal protective systems ( ensembles ) for biological exposures in 2006 and found significant differences in contamination rates . in 2010 the institute of medicine released a report regarding certification of personal protective technologies , noting that additional testing of ppe ensembles should be performed . given the large number and variations of individual ppe components , it would not be feasible to test all potential combinations of ppe commercially available . additionally , the recent surge in ppe purchasing in response to evd has caused significant shortages of some ppe components and manufacturers with a history of field use . some healthcare facilities have had to develop ppe protocols based on the best use of locally available components ( author , personal communication ) . ideally , a ppe ensemble would be evaluated at the local level by the staff anticipated to wear the equipment . doffing or removal of ppe after a patient encounter may be a particularly high risk activity . appropriate testing of ppe ensembles should include mist type testing to confirm product efficacy in real world scenarios . fluorescent agents have been used in training for hand - washing , and environmental decontamination , as well as ppe ensembles , . non - toxic and mixed with an appropriate carrier , these agents can potentially mimic the natural contamination which occurs with an infectious agent spread by contact route . the purpose of our study was to compare two ppe ensembles used by volunteers with minimal prior training , and to evaluate the feasibility of fluorescent markers as an assessment tool for ppe effectiveness . eight healthcare providers ( six registered nurses and two physicians ) volunteered for this preliminary study . the study protocol was approved by the texas tech university health science center institutional review board . the participants were randomized to one of two ppe ensembles that meet current ( as of 10/20/14 ) cdc recommendations for ppe . one ppe ensemble ( standard ) utilized commercial components that meet current cdc recommendations . the other ppe ensemble ( alternate ) was composed of components already available at local hospitals or retail stores . 1 ) included a neck - to - ankle coverall with overlying water impermeable surgical gown , knee - length impermeable leggings , and stryker hood ( stryker , kalamazoo , mi , usa ) . 2 ) ensemble included two plastic gowns ( worn over the front and back of the torso ) , rain - suit pants , a rain - suit hood cut from a rain jacket , ankle length shoe covers , and a plastic spark - shield commonly used for metal working to cover the face . both ppe ensembles utilized double gloving , with the outermost glove a forearm length surgical glove and n-95 masks . when complete , both ppe ensembles met the cdc recommendations for ppe and no skin was exposed in either group . subjects were then randomized to standard or high volume exposures ( hve ) to simulate fluid splash . subjects randomized to standard exposure came into contact with a training mannequin contaminated with fluorescent agents to simulate bodily fluids . subjects randomized to hve had standard exposure , but then also had an additional 100 ml of fluorescent agent splashed onto the front torso of their garment . the fluorescent agents used included fluorescent powder ( glogerm glogerm co , moab , ut , usa ) , liquid clothes detergent with bleach alternative ( tide proctor & gamble inc . , providence , ri , usa ) , and dissolvable fluorescent tablets ( bright dyes orange dye kingscote chemicals , miamisburg , oh , usa ) . a base mixture of 500 ml of liquid detergent , 500 ml of water and three fluorescent tablets was used to create body fluids . the base mixture was combined with oatmeal , chocolate powder and crushed cereal to simulate different bodily fluids . the testing area was divided into four areas , a ppe donning area ( staging area ) , patient encounter room , ppe doffing area , and a separate dark room for black light photography . , participants worked in pairs to perform a series of clinical tasks to care for the evd patient . participants were asked to clean the contaminated mannequin , change the mannequin gown , place an automated bp cuff , and check and record the temperature . after completing the tasks , finally , the de - gowned participants were examined under black light for fluorescence indicative of possible contamination . an led black light panel , ( chauvet led shadow , model dmx-512 led uv , chauvet lighting , sunrise , florida ) was used to illuminate . one participant in each ppe ensemble arm had evidence of contamination under black light examination ( fig . the participant contaminated in the standard arm felt the exposure occurred because of a splash under her hood during hve . the trainer felt she may have inadvertently touched a contaminated portion of her leggings and subsequently touched her neck during ppe removal . the participant contaminated in the alternate group likely had a gap appear between her front and back gowns while placing a blood pressure cuff . this event was not noted at occurrence , but was noticed under black light examination . the contamination in the alternate ppe ensemble arm likely could have been prevented if a larger range of gown sizes was available . it may be helpful to consider the body habitus of evd responder when selecting ppe . clinical activities as part of the assessment process , as the contamination likely would not have occurred without the provider manipulating the mannequin to place the blood pressure cuff . it could be helpful to videotape exercises such as this to better identify the timing of contamination such as that which occurred in the standard arm . pin - pointing the conditions of contamination may allow the development of new mechanisms for prevention . in preparation for this exercise , we found it notable that taping gloves circumferentially is routinely shown in the lay press , but current guidelines do not make this recommendation . in our study , circumferential taping did not result in contamination , but greatly impaired the ease of ppe removal . on the other hand , a single strip of taped placed longitudinally along the sleeve and glove allowed the glove to be removed with the garment as a seamless piece . current recommendations do not comment on hair or jewelry , perhaps making the assumption that these will be taken care of as a matter of course . for our study , we did not specifically ask participants to pull back their hair . although we did not note any contamination specific to this , long hair , rings and watches adversely affected the ease of ppe placement and removal and may be an additional risk factor for exposure . it may be useful for future recommendations to include stipulations about such accouterments . in this very small study , ppe ensembles made from readily available components ( approximately $ 36 per outfit ) performed as well as the commercial ppe ensemble . additionally , it must be borne in mind that increased complexity of ppe may be self - defeating , as the complexity of ppe removal may offset gains made by complexity of ppe . it is difficult to assess the actual effectiveness of fluorescents as a proxy for ev exposure in this study . it is possible that small volume contamination occurred that was unable to be visualized , and the clinical relevance of such a small exposure is unknown . how an exposure on intact skin correlates with risk of subsequent evd development remains to be determined . the florescent mixtures used in this study were intended to mimic the mechanical effects of bodily fluids during a patient interaction . in spite of widespread use , it is unknown how these mixtures compare with actual bodily fluids considering the unique chemical and biochemical attributes of blood . the limitations of this type of testing prevent any assumptions of risk of evd development for a healthcare worker in the field . this type of testing could , however , allow comparison of different ppe ensembles and protocols under the assumption that more fluorescent exposures equates to higher risk of evd development . another use of this system could be to identify ppe ensembles with lower expense and equivalent testing attributes . finally , fluorescent markers can be used for training and proficiency testing of ppe ensembles for evd preparedness and even determine minimal standards of training repetition to achieve proficiency . as fluorescent agents and black lights are readily available for purchase in retail stores and over the internet , it is feasible for testing and training to be performed at a local level with ppe ensembles available at hand . beyond the current evd outbreak , this concept is applicable to training for other infectious diseases , such as methicillin - resistant staphylococcus aureus or multidrug resistant gram - negative bacteria , spread primarily by direct contact . the concept could also be used for some pathogens with a significant respiratory mode of transmission , such as pandemic influenza and novel pathogenic corona viruses , which have a recommended contact component of ppe .

the recent ebola virus disease ( evd ) outbreak has created interest in personal protective equipment ( ppe ) content and usage . ppe testing has historically been done by individual component , rather than as a bundle for contact isolation . fluorescent agents are commonly used in training for infection control techniques . the purpose of our study was to compare 2 ppe bundles and to evaluate the feasibility of fluorescent markers as an assessment tool for ppe effectiveness . eight healthcare providers volunteered for this preliminary study . participants were randomized to 1 of 2 ppe bundles that meet current ( october 20 , 2014 ) cdc recommendations . one ppe bundle utilized commercial evd - recommended components . the other ppe bundle used components already available at local hospitals or retail stores . participants were also randomized to standard or high volume exposures ( hve ) to simulate fluid splash . each participant was assisted in ppe donning and doffing by an experienced trainer . a training mannequin was contaminated with fluorescent agents to simulate bodily fluids . participants were then given clinical tasks to care for the evd patient . de - gowned participants were examined under black light for fluorescence indicative of contamination . one participant in each ppe arm had evidence of contamination . one of the contamination events was suspected during the patient care exercise . the other contamination event was not suspected until black light examination . in spite of a large difference in cost of ppe , the two bundle arms performed similarly . bundle testing using fluorescent markers could help identify optimal ppe systems .

congenital anomalies of the oval window are due to malformations of the second branchial arch , in which there is not a full connection between the stapes and otic capsule , thereby preventing the oval window from being formed normally.1 ) congenital anomalies of the oval window have been reported in 0.5 - 1.2% of children with conductive hearing loss.2 ) various treatments for this anomaly have been introduced : hearing aids,3,4 ) vestibulotomy,5 ) fenestration of the horizontal semicircular canal,6,7 ) and formation of a neo - oval window.8 ) also , as fisch9 ) reported , incudostapedotomy and malleostapedotomy have been used successfully to treat patients with congenital oval window anomalies.10 ) however , in patients with accompanying malformations of the ossicles or abnormal routes of the facial nerve , the hearing improvement with previous procedures has not been sufficient . in our institute , instead of incudostapedotomy , we have performed malleostapedotomy , a safe and effective procedure for patients with oval window anomalies with accompanying ossicular malformations or facial nerve abnormalities . here , we report two cases of malleostapedotomy performed in patients with hearing loss due to congenital anomalies of the oval window . a 40-year - old male visited our outpatient clinic with right - sided hearing loss since childhood . the patient had no previous history of trauma , and showed conductive hearing loss with an air - bone gap ( abg ) of 50 db ( 60/10 db ; fig . temporal bone computed tomography ( tbct ) showed normal images of the malleus , but revealed atresia of the right - side oval window , with abnormal placement of the facial nerve ( fig . first , ossiculoplasty using a total ossicular replacement prosthesis ( torp ) was performed , with no hearing improvement . the tympanic cavity was exposed through an endaural approach and the posterior wall of the external auditory canal was leveled down with a mallet and gauge to expose the stapes . during the operation , a normal structure of the malleus was noted , but the long process of the incus was short . additionally , the stapes was missing , and the facial nerve was covering the oval window . the facial nerve was displaced towards the cephalic side using a fine swab , and a 0.6-mm window was drilled in the obstructed oval window using a 0.4-mm skeeter drill . the facial nerve was then put back in the original position . because the malleus was placed anterior to the stapes footplate , the piston wire prosthesis was bent 20 , modified to a 7-mm length , and fixed on the normal malleus ( fig . following the operation , pure tone audiometry showed improvement of the abg , from 50 to 30 db ( fig . a 10-year - old male visited our outpatient clinic with bilateral hearing loss for several years . 2a ) , and tbct revealed bilateral atresia of the oval window , with an abnormal array of the facial nerve ( fig . explo - tympanoplasty was performed primarily on the left ear with an ossiculoplasty using a torp ; there was no hearing improvement . the malleus showed normal images , but the long process of the incus was short . in addition , the stapes were missing , and the facial nerve was lying over the obstructed oval window . the facial nerve was cephalically rotated using the " facial roll " method , and a 0.6-mm window was created at the center of the stapes footplate using a 0.4-mm skeeter drill . a 7-mm - long piston wire was fixed on the malleus and tightened with piston forceps ( fig . immediately postoperatively , the patient showed no dizziness or loss of taste , but mild facial palsy , house - brackmann grade iii , was noted . by 1 month later , the facial palsy had recovered , to grade i , and the abg was reduced , from 40 db ( pre - operative ) to 15 db ( 6 month post - operative ) on pure tone audiometry ( fig . a 40-year - old male visited our outpatient clinic with right - sided hearing loss since childhood . the patient had no previous history of trauma , and showed conductive hearing loss with an air - bone gap ( abg ) of 50 db ( 60/10 db ; fig . temporal bone computed tomography ( tbct ) showed normal images of the malleus , but revealed atresia of the right - side oval window , with abnormal placement of the facial nerve ( fig . first , ossiculoplasty using a total ossicular replacement prosthesis ( torp ) was performed , with no hearing improvement . the tympanic cavity was exposed through an endaural approach and the posterior wall of the external auditory canal was leveled down with a mallet and gauge to expose the stapes . during the operation , a normal structure of the malleus was noted , but the long process of the incus was short . additionally , the stapes was missing , and the facial nerve was covering the oval window . the facial nerve was displaced towards the cephalic side using a fine swab , and a 0.6-mm window was drilled in the obstructed oval window using a 0.4-mm skeeter drill . the facial nerve was then put back in the original position . because the malleus was placed anterior to the stapes footplate , the piston wire prosthesis was bent 20 , modified to a 7-mm length , and fixed on the normal malleus ( fig . following the operation , pure tone audiometry showed improvement of the abg , from 50 to 30 db ( fig . a 10-year - old male visited our outpatient clinic with bilateral hearing loss for several years . 2a ) , and tbct revealed bilateral atresia of the oval window , with an abnormal array of the facial nerve ( fig . explo - tympanoplasty was performed primarily on the left ear with an ossiculoplasty using a torp ; there was no hearing improvement . the malleus showed normal images , but the long process of the incus was short . in addition , the stapes were missing , and the facial nerve was lying over the obstructed oval window . the facial nerve was cephalically rotated using the " facial roll " method , and a 0.6-mm window was created at the center of the stapes footplate using a 0.4-mm skeeter drill . a 7-mm - long piston wire was fixed on the malleus and tightened with piston forceps ( fig . 2c ) . immediately postoperatively , the patient showed no dizziness or loss of taste , but mild facial palsy , house - brackmann grade iii , was noted . by 1 month later , the facial palsy had recovered , to grade i , and the abg was reduced , from 40 db ( pre - operative ) to 15 db ( 6 month post - operative ) on pure tone audiometry ( fig . congenital anomalies of the oval window are rare ; they are found in 0.5 - 1.2% of children with conductive hearing loss.1,2 ) cremer classified this congenital anomaly into four groups according to the abnormal structure of the middle ear.8 ) type i was defined as fixation of the stapes footplate alone , and type ii with stapes footplate fixation accompanied by other ossicular anomalies . mobile stapes footplates with anomalies of other ossicles were classified as type iii , aplasia of the oval or round window as type iva , and an anomaly with dysplasia as type ivb . here , patient 1 had a unilateral anomaly of type iva , and patient 2 was also type iva , but bilateral . several methods have been suggested to treat patients with congenital anomalies of the oval window and stapes . herman used bone - anchored hearing aids in five patients with aplasia of the oval window,3 ) and reiber and schwaber4 ) proposed using bilateral hearing aids in patients with ossicular anomalies , preserving the facial nerve . several surgical treatments , such as vestibulotomy , fenestration of the horizontal semicircular canal , and formation of a neo - oval window , were introduced subsequently . lambert5 ) performed vestibulotomies in six patients with congenital anomalies of the oval window by making a hole in the oval window and reconstructing the ossicles . yi , et al.7 ) reported two cases with improved hearing after perforating the horizontal semicircular canal in patients with aplasia of the stapes and the oval window . teunissen and cremers8 ) reported 14 cases with aplasia of the oval window : a neo - oval window was formed in four patients , and teflon inserts were placed with successful results in two patients . de alarcon , et al.11 ) described 17 patients ; of them , 9 of 17 showed hearing improvement after neo - oval window formation and ossiculoplasties . finally , stapes surgery has been performed in cases of congenital anomalies of the oval window . three patients underwent incudostapedotomies , and only one ( 33% ) showed an abg improvement , of 20 db . the abg improved , with a 46-db difference , but in the other patient , the footplate of the stapes was obstructed and the malleus was broken . stapedotomies , including incudostapedotomy and malleostapedotomy , are usually performed in otosclerosis patients and congenital ossicular anomaly patients . malleostapedotomy involves connecting the malleus directly to the vestibule through the oval window , instead of connecting the incus and the stapes . this operation is used in cases where an incudostapedotomy is not possible because the malleus head or the incus is missing or fixed . it can also be used in cases that need a second operation after an ossiculoplasty or where the lenticular process is necrotized after an incudostapedotomy.12 ) in 90% of stapedotomy cases , the facial nerve is exposed with no problem , but in a few cases the facial nerve covers the oval window , blocking the approach to the stapes footplate . in these cases , the " facial roll " method , rolling the facial nerve gently upwards , can be used to ease the approach to the oval window . even if the facial nerve is abutting the piston wire prosthesis , it is known to cause no facial nerve or hearing dysfunction.13 ) in both cases in this report , we used the facial roll method to expose the oval window ; mild facial palsy was noted in the second case , but recovered fully . if attention is paid to minimizing nerve traction in this procedure , good exposure can be achieved without facial palsy . there has been no previous report in korea of the results of the malleostapedotomy technique in patients with congenital oval window anomalies and accompanying ossicular malformations and abnormal routes of the facial nerve . the follow - up period after the surgery was short in these two cases , and longer - term follow - up assessments are necessary . however , through this easy and safe surgical method , hearing improved in a short period of time . malleostapedotomy has the potential to replace previous procedures and is safe and effective in patients with congenital oval window anomalies .

congenital anomaly of the oval window with an abnormal facial nerve course is an uncommon embryological defect , which is related to the underdevelopment of second branchial arch derivatives . some treatments for improving hearing levels are available ; these include hearing aids , vestibulotomy , neo - oval window formation , and stapes surgeries , including incudostapedotomy and malleostapedotomy . however , surgery for congenital anomalies of the oval window has rarely been described , usually in very small series of patients . we describe two cases of congenital anomalies of the oval window with aberrant facial nerve courses . one was a 40-year - old male diagnosed with unilateral congenital oval window atresia ; the other was a 10-year - old male diagnosed with bilateral congenital oval window atresia . we also describe the clinical manifestations and treatment outcomes of malleostapedotomy for congenital anomalies of the oval window with aberrant facial nerve courses .

ischemic heart disease is one of the major leading causes of death for both men and women . depriving the organ from its blood supply has long been documented as a critical factor in the clinical outcome of stroke , hemorrhagic shock , myocardial infarction , and organ transplantation . although the restoration of blood flow to an ischemic organ is essential to prevent permanent tissue damage , reperfusion may increase tissue injury in excess of that produced by ischemia alone . restoration of blood flow to ischemic myocardium results in the ischemia reperfusion ( i / r ) injury . cellular damage after reperfusion of previously viable ischemic tissue is defined as ischemia reperfusion ( i / r ) injury . i / r injury may occur in a variety of clinical situations , including reperfusion after thrombolytic therapy , coronary angioplasty , organ transplantation , and cardiopulmonary bypass . reperfusion of ischemic tissue results in both a local and systemic inflammatory responses that , in turn , may give rise to wide spread microvascular dysfunction and changed tissue barrier and function . if sever enough , the inflammatory response after i / r may even lead to systemic inflammatory response or multiple organ dysfunction syndrome , which account for up to 3040% of intensive care unit mortality . gender differences have been distinguished in i / r injury [ 410 ] , with several studies connecting the sex hormone estrogen in the cardioprotection found in females [ 1115 ] . in contrast , testosterone has received little attention . presently the majority of evidence points toward the detrimental effects of testosterone on myocardium , possibly by adverse effects on lipoproteins , thrombosis , and cardiac hypertrophy [ 1619 ] . indeed , some studies established that chronic endogenous testosterone has a deleterious effect in the isolated rat heart subjected to i / r . recent advances in our understanding of cell death during ischemia reperfusion implicate two forms of cell death in the pathology of myocardial infarction that is to say necrosis and apoptosis . apoptosis cell death in rat heart has been established to be induced by prolonged episode of ischemia alone in absence of reperfusion [ 22 , 23 ] . some studies have suggested that reperfusion accelerates the apoptotic cell death process initiated during ischemia [ 22 , 2426 ] . in contrast , several studies suggest that the apoptotic component of cell death is triggered at time of reperfusion and does not manifest during the ischemic period . therefore , evidence suggests that the apoptotic component of cell death is either generated or accelerated during the reperfusion phase . the fact that the apoptosis is an energy dependent process and atp levels are depleted during ischemia and replenished on reperfusion may explain why the apoptotic component of cell death is associated with reperfusion . a total number of 24 adult male albino rats weighting ( 200250 g ) were purchased from animal resource center , national center for drug control and research . they were housed in the animal house of kufa university / college of medicine in a temperature - controlled ( 25 1 c ) room ( humidity was kept at 6065% ) with alternating 12-hr light/12-hr dark cycles and were allowed free access to water and chow diet until the start of experiment . after the 1st week of acclimatization , the rats were randomized into 4 groups ( 6 rats in each group ) as follow.in sham group , rats underwent the same anesthetic and surgical procedures ( for an identical period of time for regional myocardial ischemia and reperfusion ) but without lad ligation.in control group ( induced untreated ) , rats underwent surgical operation for lad ligation and were subjected to 25 min of ischemia and 40 min of reperfusion.in castrated group , surgically castrated rats were left 4wks for recovery and then underwent surgical lad ligation and were subjected to 25 min of ischemia and 40 min of reperfusion.in treated group ( goserelin treated ) , rats of this group take a s.c injection of goserelin acetate ( lhrh analogue ) 3 wks before the surgery and then were subjected to surgical lad ligation with 25 min ischemia and 40 min of reperfusion . in sham group , rats underwent the same anesthetic and surgical procedures ( for an identical period of time for regional myocardial ischemia and reperfusion ) but without lad ligation . in control group ( induced untreated ) , rats underwent surgical operation for lad ligation and were subjected to 25 min of ischemia and 40 min of reperfusion . in castrated group , surgically castrated rats were left 4wks for recovery and then underwent surgical lad ligation and were subjected to 25 min of ischemia and 40 min of reperfusion . in treated group ( goserelin treated ) , rats of this group take a s.c injection of goserelin acetate ( lhrh analogue ) 3 wks before the surgery and then were subjected to surgical lad ligation with 25 min ischemia and 40 min of reperfusion . the procedure of lad ligation in rats is modified from that mentioned in previous study with modification . the rats were anesthetized by intraperitoneal ( ip ) injection of 100 mg / kg ketamine and 5 mg / kg xylazine . when the rat anesthetized ( within 510 min ) , we placed it in supine position , then , fix the four limbs , tail and extended the head . the trachea is intubated with a cannula sized either 22 fg or 20 fg according to the weight of animal as the small catheter is reserved for the smaller animal . and the tube is connected tightly to the ventilation machine . with scissors and fine pickup , ( 2 - 3 ) cm long skin incision was made over the left thorax area starting from midline , just 30 mm above the xiphoid process to the left anterior axillary fold . zoom in the microscope on the heart and then the pericardium is opened using two pairs of small micropickup . the left ventricle ( lv ) with its partly overlying left auricle ( atrium ) is now visible . the left anterior descending coronary artery ( lad ) is ligated just distal to the left auricle , the distance from the ligation site to the left auricle being the length of both tips of a pair of rounded forceps as this is equal to ( 2 - 3 ) mm . the ligation continues for 25 min ; then the ligation is terminated by cutting the ligature by using microscissor . at this time the reperfusion time is started to be calculated , then closing the chest wall by enclosing the ribs with figure eight of 4 zero silk suture . the pectoral muscles should be moisturized and returned back into the original position ( first the minor and then the major partly overlying it ) ; after that , the skin is closed with 4 zero silk suture , watching for the spontaneous breathing , and when it is sufficient , then the decision is made for gentle and careful extubation after freeing the mouse from tapes . finally , the mouse should be transferred into clean cage oxygenated with 100% oxygen and placed near fair heating lamp . the reperfusion time is calculated from the moment of removing the ligature and the reperfusion is continued for 40 min . at the end of reperfusion period , the animal is reanesthetized and placed in the supine position with its limbs immobilized , the chest reopened , and the heart exposed , and then a needle of the syringe is introduced into right ventricle to aspirate around ( 58 ) ml of blood for later blood analysis . the blood sample was placed in a tube containing disodium edta ( 22 mg / ml ) as anticoagulant and mixed thoroughly and then centrifuged at 3000 rpm for 15 min . then it was used for determination of plasma ctn i by elisa with a commercially available elisa kit ( literature of kit by life diagnostic , usa ) according to the manufacturer 's instructions . the excised heart tissues were rinsed with ice cold saline to remove any red blood cells or clots and then homogenized with a high intensity ultrasonic liquid processor in 1 : 10 ( w / v ) phosphate buffered saline that contained 1% triton x-100 and a protease inhibitor cocktail . the supernatant was collected for determination of tnf- , il-1 , and icam-1 by elisa with a commercially available elisa kit ( literature of kit by life diagnostic , usa ) according to the manufacturer 's instructions . the cardiac sections for histopathological study were fixed in 10% formalin and embedded in paraffin . evaluate scores were performed by an investigator who was blinded to the experimental treatment groups . the following morphological criteria were used to assess the histopathological damage : score 0 , no damage ; score 1 ( mild ) , interstitial edema and focal necrosis ; score 2 ( moderate ) , diffuse myocardial cell swelling and necrosis ; score 3 ( severe ) , necrosis with the presence of contraction bands , neutrophil infiltration , and the capillaries were compressed ; and score 4 ( highly severe ) , widespread necrosis with the presence of contraction bands , neutrophil infiltration , capillaries compressing , and hemorrhage . the part of ventricular samples that were used for measurement of apoptosis level underwent lyses by trypsin . trypsin is a serine protease commonly used for detachment of adherent cell lines and dissociation of tissues . incubating cells with too high trypsin concentration for too long time period will damage cell membranes and kill the cells . for the dissociation of tissues , trypsin has been used alone or as a supplement to other enzymes.transfer 1,000 to 10,000 nonfixed cells to each well.centrifuge plate at 200 g for 5 minutes . remove medium , add 200 l of fixative ( 80% methanol in pbs ) , and incubate at room temperature for 30 minutes . then the measurement is done by elisa with a commercially available elisa kit ( ssdna apoptosis elisa kit , chemicon international , inc . the part of ventricular samples that were used for measurement of apoptosis level underwent lyses by trypsin . trypsin is a serine protease commonly used for detachment of adherent cell lines and dissociation of tissues . the concentration of trypsin can range from 0.025% to 0.5% . incubating cells with too high trypsin concentration for too long time period will damage cell membranes and kill the cells . for the dissociation of tissues , trypsin has been used alone or as a supplement to other enzymes . transfer 1,000 to 10,000 nonfixed cells to each well . remove medium , add 200 l of fixative ( 80% methanol in pbs ) , and incubate at room temperature for 30 minutes . then the measurement is done by elisa with a commercially available elisa kit ( ssdna apoptosis elisa kit , chemicon international , inc . quantitative variables were tested for statistical significance of difference between more than 2 groups by one - way anova test followed by post hoc . the statistical significance of difference between more than 2 groups was assessed by kruskal - wallis test , while mann - whitney u test was used for the difference between 2 groups . in all tests , compared with the sham group , levels of myocardial tnf- , il-1 , and icam-1 were increased ( p < 0.05 ) in control group . both castration and goserelin acetate injection significantly counteract the increase in myocardial levels of tnf- , il-1 , and icam-1 ( p < 0.05 ) , but there was no significant difference between castrated group and goserelin treated group as shown in figures 1 , 2 , and 3 . compared with the sham group , levels of plasma ctn both surgical castration and goserelin injection significantly counteract the increase in level of plasma ctn i ( p < 0.05 ) , but there was no significant difference between castrated group and goserelin treated group as shown in figure 4 . compared with the sham group , myocardial apoptosis levels were increased ( p < 0.05 ) in control group . both surgical castration and goserelin injection significantly counteract the increase in myocardial apoptosis level ( p < 0.05 ) , but there was no significant difference between castrated group and goserelin treated group as shown in figure 5 . histologically , all control group rats showed a significant myocardial injury ( p < 0.05 ) compared with sham group as shown in figures 6 , 7 , and 8 . both castration and goserelin injection markedly reduced ( p < 0.05 ) the severity of heart injury in the rats which underwent the regional ischemia - reperfusion procedure , but there was no significant difference between castrated group and goserelin treated group as shown in figures 6 , 8 , 9 , and 10 . the main findings of the present study were that after myocardial i / r , compared with control group , both castrated group and goserelin treated group ( 1 ) exhibited a lower histopathological damage , ( 2 ) had decreased proinflammatory cytokine production ( tnf- , il-1 , and icam-1 ) , ( 3 ) exhibited a lower apoptotic injury , and ( 4 ) there were no significant differences between castrated group and goserelin treated group . the role of testosterone in cardiac injury may be very important because the heart can accumulate testosterone at higher concentrations than other androgen target organs and functional androgen receptors are found in isolated cardiac myocytes . role of testosterone in cardiac injury is controversial ; some studies indicated that testosterone was reported to confirm cardioprotection against ischemia reperfusion by upregulating the cardiac alpha(1)-adrenoceptor and enhancing the effects of stimulation of this adrenoceptor . on the contrary , other studies hypothesized that testosterone may exert deleterious effects on myocardial proinflammatory cytokine production through proinflammatory and/or the proapoptotic properties of endogenous testosterone in ischemia reperfusion . furthermore , exogenous testosterone supplementation increased apoptosis in adult rat ventricular myocytes during i / r injury . the relationship between apoptotic and necrotic cell death during ischemia reperfusion injury is unresolved with some authors showing that there may be significant overlap in terms of early signaling steps between these two pathways , this observation may be useful in development of future therapeutic targets for clinical use . zhao et al . have used a canine model of ischemia reperfusion injury to demonstrate the contribution of necrotic and apoptotic cell death . they established that both forms of cell death occur together during the reperfusion phase with necrotic cell death peaking after 24 hr . of reperfusion and apoptotic cell death increasing up to 72 hr . other studies have showed that the pharmacological inhibition of the apoptotic signaling cascade during the reperfusion phase is able to attenuate both the apoptotic and the necrotic cell death [ 4043 ] . they suggested that the apoptotic death can evolve into necrotic cell death . to the best of our knowledge , there is no previous study that used goserelin acetate to produce a chemical castration for male rats but there are many studies that used the testosterone receptor blockers as flutamide to block the testosterone receptors . wang et al . demonstrated that male rats of both ( 1 ) treated group with testosterone receptor blocker ( flutamide ) and other groups ( 2 ) with surgical castration when were subjected to i / r show a decrease in production of proinflammatory cytokines ( tnf- , il1 , and icam-1 ) compared with untreated control group , explaining the possible role of testosterone in promoting the myocardial inflammatory response . other studies report protected cardiac performance in animals with testosterone depletion or testosterone receptor blockade after trauma and hemorrhage and suggest that endogenous testosterone may have a negative effect on the heart subjected to i / r . wang et al . demonstrated that both male rats treated with testosterone receptor blocker ( flutamide ) and male rats underwent surgical castration when subjected to i / r show a decrease in the activation of proapoptotic signaling cascade ( caspase-3 , caspase-11 ) and increase antiapoptotic bcl2 compared with control untreated group so the net result is decrease in apoptosis . showed that female rat hearts had better functional recovery after acute ischemia than male rat and expressed less myocardial tnf- , il1- ( mrna and protein ) than male hearts subjected to the same i / r insult . the present study showed that there was a significant lowering ( p < 0.05 ) in plasma level of ctni in both castrated group and goserelin group compared to control group . crisostomo et al . also demonstrated that in rat hearts devoid from chronic exposure to testosterone , a single dose of exogenous testosterone increases apoptosis level . findings in the present study according to apoptosis level are in agreement with the above 2 studies . the present study showed a marked decrease in ischemic injury in both castrated and goserelin treated groups ( p < 0.05 ) compared with the control group but there was no significant difference between castrated group and goserelin treated group . 50% of castrated group show mild cardiac damage ( interstitial edema and focal necrosis ) , 33.33% of castrated group show moderate cardiac damage ( diffuse myocardial cell swelling and necrosis ) , and 16.67% of castrated group show normal tissue appearance . showed that castrated male rats when subjected to the ischemia have significantly decreased in the severity of histological finding of ischemia so that there are less ischemic expansion and less neutrophil infiltration at the infarction border than the noncastrated male control group . histopathological finding in goserelin treated group explains that 33.33% of treated group show mild myocardial damage ( interstitial edema with focal necrosis ) , 50% of treated group show moderate myocardial damage ( diffuse myocardial cell swelling and necrosis ) , and 16.67% of treated group show normal myocardial appearance . regarding goserelin treated group , to the best of our knowledge there is no study yet available to compare our data . this study is further supporting the role of inflammatory cytokine ( il-1 , tnf- , and icam-1 ) in the pathology of regional myocardial i / r and myocardial apoptosis during regional i / r injury . both surgical castration and goserelin administration reduce the level of inflammatory mediators in myocardial tissues , which may provide mechanistic answer for their protective effect . both surgical castration and goserelin administration ameliorate myocardial injury and apoptosis in regional i / r induced by lad ligation in rats as evidenced by reduction in the release of cardiac specific enzyme troponin i. the findings of the present study support the idea that endogenous testosterone may have deleterious effect on myocardial injury and apoptosis during regional i / r .

although reperfusion of an ischemic organ is essential to prevent irreversible tissue damage , it may amplify tissue injury . this study investigates the role of endogenous testosterone in myocardial ischemia reperfusion and apoptosis in male rats . material and method . twenty four male rats were randomized into 4 equal groups : group ( 1 ) , sham group , rats underwent the same anesthetic and surgical procedure as the control group except for lad ligation ; group ( 2 ) , active control group , rats underwent lad ligation ; group ( 3 ) , castrated , rats underwent surgical castration , left 3wks for recovery , and then underwent lad ligation ; and group ( 4 ) , goserelin acetate treated , rats received 3.6 mg of goserelin 3 wks before surgery and then underwent lad ligation . at the end of experiment , plasma ctn i , cardiac tnf- , il1- , icam-1 , and apoptosis level were measured and histological examination was made . results . compared to sham group , the levels of myocardial tnf- , il-1 , icam-1 , apoptosis , and plasma ctn i were significantly increased ( p < 0.05 ) in control group and all rats showed significant myocardial injury ( p < 0.05 ) . castration and goserelin acetates significantly counteract the increase in myocardial levels of tnf- , il-1 , icam-1 , plasma ctn i , and apoptosis ( p < 0.05 ) and significantly reduce ( p < 0.05 ) the severity of myocardial injury . we conclude that castration and goserelin acetates ameliorate myocardial i / r injury and apoptosis in rats via interfering with inflammatory reactions .

diabetic retinopathy is the most common complication in diabetes.1,2 it is a chronic , progressive , potentially sight - threatening disease of the retinal microvasculature that is associated with prolonged hyperglycemia and other conditions linked to diabetes mellitus such as hypertension.3 the threat to sight is due to either growth of new vessels leading to intraocular hemorrhage and possible retinal detachment with profound sight loss or localized damage to the macula of the eye with loss of central visual acuity.3 grading of diabetic retinopathy is based on visible signs of increasing severity on ophthalmoscopy and on imaging . diabetic retinopathy is classified as proliferative or nonproliferative ( background / preproliferative ) retinopathy based on the presence or absence of abnormal new vessels , respectively . subgroups of nonproliferative diabetic retinopathy ( mild , moderate , preproliferative ) reflect increasing severity of the disease , which consequently results in shortening of screening intervals.4 nonproliferative diabetic retinopathy is typically managed by optimizing the patient s general health . it is hypothesized that this technique reduces the amount of ischemic retina , and thus the production of angiogenic molecules . diabetic maculopathy is divided into three types , based on whether it causes focal , ischemic or diffuse edema , and may include tractional ( vitreoretinal ) or nontractional ( intraretinal ) components.3 the management of diabetic macular edema has advanced significantly with the introduction of anti - vegf ( vascular endothelial growth factor ) treatments.3 however , macular laser treatment still plays a major role in treating noncenter - involving macular edema.5 vision loss due to diabetic retinopathy is one of the leading causes of visual loss worldwide and is an important cause of impaired vision and disability in the working - age population.6,7,8 advanced diabetic eye disease has a negative influence on quality of life.6 therefore , eye screening for the diabetes population aims to identify patients with early signs of sight - threatening disease to facilitate efficient treatment and prevent loss of sight . the danish registry of diabetic retinopathy ( diabase ) was established to monitor the development of diabetic eye disease in denmark and to evaluate the accessibility and effectiveness of diabetic eye screening programs with focus on interregional variations.9 the main aim of the registry is to enable evaluation of quality of care for patients with diabetic eye disease . the target population includes all patients diagnosed with diabetes in denmark . at present , denmark ( 5.5 million inhabitants ) has ~320,000 diabetes patients with an annual increase of ~27,000 newly diagnosed patients.10 the prevalence of diabetes in denmark has more than doubled since 1996 and was 5737 per 100,000 people in 2012.10 diabase contains data on all diabetes patients aged 18 years who attend screening for diabetic eye disease in the five regions of denmark . eye examination of children with diabetes is recorded in the children diabetes registry ( dandiabkids [ children and teenagers with diabetes < 18 years old ] ) . in 2011 , the adult diabetes registry ( adult patients with diabetes from 18 years old ) , the diabase , and the dandiabkids joined to form the danish diabetes database.9 diabase receives data collected from hospital eye departments and private ophthalmological practices where diabetes patients aged 18 years attend diabetic eye screening . in denmark , diabetes care is managed by both primary care physicians in private practice and hospital - based endocrinologists . diabetic eye screening for most patients attending their primary care physician is delivered by an ophthalmologist in private practice . patients being followed in endocrinology departments receive diabetic eye screening in the eye department of the respective hospital . an annual report analyzing diabetes screening data from the previous year is issued every spring by the steering committee . the systematic collection of outpatient data from hospitals in denmark started in 2007 and was extended nationwide in 2010 . data collection on patients screened by ophthalmologists in private practice started in 2013 . in 20142015 , the registry included data from 77,968 diabetes patients;11 of these patients , 57,985 had been screened by ophthalmologists in private practice , whereas 20,291 patients had been screened in hospitals.11 key quality indicators for diabase were selected according to international standards for good clinical practice : two process indicators to examine efficiency and three performance indicators to examine outcome9 ( table 1 ) . indicator measurements are based on the collection of data with regard to the following main variables:9 registering screening unitpatient name and unique danish identification numberdate of screening visitindication for screeningprevious eye surgerybest corrected visual acuityscreening method ( slit lamp examination or retinal photography)diabetic retinopathy and maculopathy grading according to wilkinson et al12quality of screening photographdefinition of next examination ( screening , treatment)interval to next screening visit . registering screening unit patient name and unique danish identification number date of screening visit indication for screening best corrected visual acuity screening method ( slit lamp examination or retinal photography ) diabetic retinopathy and maculopathy grading according to wilkinson et al12 quality of screening photograph definition of next examination ( screening , treatment ) interval to next screening visit . the data on diabetes type and duration of disease are recorded in the adult diabetes registry . a diabase report containing calculations of the key indicators is published every year . at annual meetings , data issues , interregional variations , and definition of indicators diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy , newly diagnosed . in case of treatment for diabetic eye disease after completion of treatment , patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category treated maculopathy , stable . diabase classifies treated patients as laser - treated proliferative diabetic retinopathy , stable . in case of relapse requiring additional laser treatment , patients are labeled laser - treated proliferative diabetic retinopathy , recurrence . until 2013 , this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . however , the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals , the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval ( table 2 ) . neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable ( at least 90% of patients should obtain eye screening within the defined interval ) . as this is the first year , this indicator is calculated in its altered state , the amount of data collected is still insufficient to provide a proper analysis . the nationwide prevalence of nonproliferative diabetic retinopathy is 18% , with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice ( table 3 ) . mild nonproliferative diabetic retinopathy alone contributes to 13% , while 78% of diabetes patients do not have diabetic retinopathy . however , there are differences between patients screened in hospitals and by ophthalmologists in private practice . eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy , with minor interregional variations . only 53% of patients screened in hospitals have no diabetic retinopathy , with a wide interregional disparity . these numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . in the central denmark region , 11% of patients screened in hospitals have proliferative diabetic retinopathy , newly diagnosed , a significantly higher number than in other regions of denmark . even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy , regional traditions may play a role in differing interpretations . sight - threatening subtypes ( newly diagnosed and previously treated recurrent proliferative diabetic retinopathy ) comprise 3% of patients . the overall prevalence of patients without diabetic maculopathy is 97% in the registry ( 91% screened in hospitals vs 98% screened by ophthalmologists in private practice ) . only 2% of all patients have newly diagnosed diabetic maculopathy , and an equally small number of patients have stable maculopathy after treatment ( table 4 ) . diabetic retinal changes may progress as well as regress , essentially depending on medical treatment and diabetic control . the proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase ( table 5 ) . this requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . furthermore , the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed ( table 6 ) . this also requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the mildest stage of disease ( none ) at the first of the screening visits are excluded from the assessment . in 20142015 , however , this figure is lower than that reported during 20132014 ( 14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . the proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . eighteen percent of patients screened in hospitals regress to a milder stage of disease ( interregional variation between 12% and 23% ) . twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . nonetheless , the percentage of these patients is significantly higher in the north denmark region ( 58% ) than in the other regions , where percentages vary between 19% and 28% . this difference may be based on variations in grading due to region - specific circumstances . diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy , newly diagnosed . in case of treatment for diabetic eye disease , screening is temporarily discontinued . after completion of treatment , patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category diabase classifies treated patients as laser - treated proliferative diabetic retinopathy , stable . in case of relapse requiring additional laser treatment , patients are labeled laser - treated proliferative diabetic retinopathy , recurrence . until 2013 , this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . however , the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals , the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval ( table 2 ) . neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable ( at least 90% of patients should obtain eye screening within the defined interval ) . as this is the first year , this indicator is calculated in its altered state , the amount of data collected is still insufficient to provide a proper analysis . the nationwide prevalence of nonproliferative diabetic retinopathy is 18% , with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice ( table 3 ) . mild nonproliferative diabetic retinopathy alone contributes to 13% , while 78% of diabetes patients do not have diabetic retinopathy . however , there are differences between patients screened in hospitals and by ophthalmologists in private practice . eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy , with minor interregional variations . only 53% of patients screened in hospitals have no diabetic retinopathy , with a wide interregional disparity . these numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . in the central denmark region , 11% of patients screened in hospitals have proliferative diabetic retinopathy , newly diagnosed , a significantly higher number than in other regions of denmark . even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy , regional traditions may play a role in differing interpretations . sight - threatening subtypes ( newly diagnosed and previously treated recurrent proliferative diabetic retinopathy ) comprise 3% of patients . the number of patients with recurrence after treatment is very small . one percent of patients are recorded as laser treated and stable . the overall prevalence of patients without diabetic maculopathy is 97% in the registry ( 91% screened in hospitals vs 98% screened by ophthalmologists in private practice ) . only 2% of all patients have newly diagnosed diabetic maculopathy , and an equally small number of patients have stable maculopathy after treatment ( table 4 ) . diabetic retinal changes may progress as well as regress , essentially depending on medical treatment and diabetic control . the proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase ( table 5 ) . this requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . furthermore , the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed ( table 6 ) . this also requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the mildest stage of disease ( none ) at the first of the screening visits are excluded from the assessment . in 20142015 , however , this figure is lower than that reported during 20132014 ( 14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . the proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . eighteen percent of patients screened in hospitals regress to a milder stage of disease ( interregional variation between 12% and 23% ) . twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . nonetheless , the percentage of these patients is significantly higher in the north denmark region ( 58% ) than in the other regions , where percentages vary between 19% and 28% . this difference may be based on variations in grading due to region - specific circumstances . diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy , newly diagnosed . in case of treatment for diabetic eye disease , screening is temporarily discontinued . after completion of treatment , patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category diabase classifies treated patients as laser - treated proliferative diabetic retinopathy , stable . in case of relapse requiring additional laser treatment , until 2013 , this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . however , the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals , the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval ( table 2 ) . neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable ( at least 90% of patients should obtain eye screening within the defined interval ) . as this is the first year , this indicator is calculated in its altered state , the amount of data collected is still insufficient to provide a proper analysis . the nationwide prevalence of nonproliferative diabetic retinopathy is 18% , with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice ( table 3 ) . mild nonproliferative diabetic retinopathy alone contributes to 13% , while 78% of diabetes patients do not have diabetic retinopathy . however , there are differences between patients screened in hospitals and by ophthalmologists in private practice . eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy , with minor interregional variations . only 53% of patients screened in hospitals have no diabetic retinopathy , with a wide interregional disparity . these numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . in the central denmark region , 11% of patients screened in hospitals have proliferative diabetic retinopathy , newly diagnosed , a significantly higher number than in other regions of denmark . even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy , regional traditions may play a role in differing interpretations . sight - threatening subtypes ( newly diagnosed and previously treated recurrent proliferative diabetic retinopathy ) comprise 3% of patients . the overall prevalence of patients without diabetic maculopathy is 97% in the registry ( 91% screened in hospitals vs 98% screened by ophthalmologists in private practice ) . only 2% of all patients have newly diagnosed diabetic maculopathy , and an equally small number of patients have stable maculopathy after treatment ( table 4 ) . diabetic retinal changes may progress as well as regress , essentially depending on medical treatment and diabetic control . the proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase ( table 5 ) . this requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . furthermore , the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed ( table 6 ) . this also requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the mildest stage of disease ( none ) at the first of the screening visits are excluded from the assessment . in 20142015 , however , this figure is lower than that reported during 20132014 ( 14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . the proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . eighteen percent of patients screened in hospitals regress to a milder stage of disease ( interregional variation between 12% and 23% ) . twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . nonetheless , the percentage of these patients is significantly higher in the north denmark region ( 58% ) than in the other regions , where percentages vary between 19% and 28% . this difference may be based on variations in grading due to region - specific circumstances . diabase was established by n andersen in collaboration with the danish ophthalmological society and the organization of danish ophthalmologists in private practice,13 based on the status screening for diabetic retinopathy in denmark.14 the registry is led by a steering committee of medical retina specialists representing the five regions of denmark , the chairman of the danish ophthalmological society , and the chairman of the organization of danish ophthalmologists in private practice . initially , the register was partly funded by hovedstadens sygehusfllesskab ( association of hospitals in the capital region of denmark ) . diabase is funded and operated by the danish clinical registries ( rkkp ) , which is financed and owned by the five danish regions . the systematic collection of data from diabetic eye screening in denmark is still in the development process . data analysis from diabase s latest annual report ( 20142015)11 reveals a decrease in the prevalence of diabetic retinopathy from 26% to 22% compared to the previous report ( 20132014 ) , whereas the number of patients diagnosed with diabetes has increased between 1996 and 2012.10 additionally , the proportion of patients with regression ( 20% ) is greater than the proportion of patients with progression ( 10% ) of diabetic retinopathy . the diabase is a useful tool to observe the quality of screening , prevalence , and progression / regression of diabetic eye disease . thus , it contributes to ensure a high quality of care for diabetes patients in denmark . reducing the overall morbidity and mortality associated with diabetes by preventing complications may help to relieve the large economic burden of the disease .

aim of databaseto monitor the development of diabetic eye disease in denmark and to evaluate the accessibility and effectiveness of diabetic eye screening programs with focus on interregional variations.target populationthe target population includes all patients diagnosed with diabetes . denmark ( 5.5 million inhabitants ) has ~320,000 diabetes patients with an annual increase of 27,000 newly diagnosed patients . the danish registry of diabetic retinopathy ( diabase ) collects data on all diabetes patients aged 18 years who attend screening for diabetic eye disease in hospital eye departments and in private ophthalmological practice . in 20142015 , diabase included data collected from 77,968 diabetes patients.main variablesthe main variables provide data for calculation of performance indicators to monitor the quality of diabetic eye screening and development of diabetic retinopathy . data with respect to age , sex , best corrected visual acuity , screening frequency , grading of diabetic retinopathy and maculopathy at each visit , progression / regression of diabetic eye disease , and prevalence of blindness were obtained . data analysis from diabase s latest annual report ( 20142015 ) indicates that the prevalence of no diabetic retinopathy , nonproliferative diabetic retinopathy , and proliferative diabetic retinopathy is 78% , 18% , and 4% , respectively . the percentage of patients without diabetic maculopathy is 97% . the proportion of patients with regression of diabetic retinopathy ( 20% ) is greater than the proportion of patients with progression of diabetic retinopathy ( 10%).conclusionthe collection of data from diabetic eye screening is still expanding in denmark . analysis of the data collected during the period 20142015 reveals an overall decrease of diabetic retinopathy compared to the previous year , although the number of patients newly diagnosed with diabetes has been increasing in denmark . diabase is a useful tool to observe the quality of screening , prevalence , and progression / regression of diabetic eye disease .

a case showing sustained structural and functional responses 2 years after a single treatment with iluvien ( 0.2 g / day fluocinolone acetonide , fac ) despite suboptimal responses to ranibizumab . a 68-year - old female patient with diabetic macular oedema ( dme ) from type 2 diabetes mellitus was first diagnosed in october 2010 and had a baseline visual acuity ( va ) of 46 early treatment diabetic retinopathy study ( etdrs ) letters in the left eye . the patient was treated with 11 intravitreal injections of ranibizumab ( 5 in combination with a small - interfering rna agent ) , and by march 2014 , va and cft were largely unchanged ( 55 etdrs letters and 774 microns ) . the patient was treated with iluvien as she had a pseudophakic lens and a clearly suboptimal response to the prior therapy with ranibizumab . an implant releasing fac at a dosage of 0.2 g / day was administered in march 2014 , and the optical coherence tomography indicated that the macula was dry after 7 days ( cft was below 300 microns ) . va improved by 5 letters within 7 days and by 15 letters within 14 days , and this was maintained after 24 months . throughout the duration of this study , the intraocular pressure was 22 mm hg , and no glaucoma medication was administered . in real - life uk practice , this dme patient showed a suboptimal response to multiple intravitreal injections of ranibizumab . when subsequently treated with a single injection of iluvien , there were large and rapid improvements in va and cft that were maintained for the following 2 years . worldwide diabetic macular edema ( dme ) is reported to have a prevalence of 6.8% and results in vision loss . dme management can be difficult , with only around 15% of the patients achieving significant vision recovery with laser , the current standard of care . a number of pharmacotherapies are now licensed for the treatment of dme in europe , including anti - vascular endothelial growth factor agents and corticosteroid therapies , which are used to target vascular endothelial growth pathways and inflammatory pathways , respectively . in diabetes , leukocytes release free radicals and enzymes that cause direct damage to endothelial cells , increasing blood retinal barrier leakage . they also release cytokines , including vascular endothelial growth factor , tumor necrosis factor- , and interleukin-6 , which act through various signaling pathways to increase vascular permeability . the release of cytokines with a corticosteroid such as dexamethasone , triamcinolone or fluocinolone has been shown to reduce dme and rehabilitate vision in several pivotal clinical studies . iluvien contains the corticosteroid fluocinolone acetonide ( fac ) and uses microdosingtm technology to release fac at a daily rate of 0.2 g for up to 3 years . this differs significantly from both the dexamethasone delivery system and that of triamcinolone , which are reported to have a duration of action of only up to 3 and 4 months , respectively . the effectiveness of iluvien was demonstrated in the fame trials ( nct00344968 ) in which patients with dme who had previously shown an insufficient response to laser were treated with either a 0.2 g / day ( iluvien ) or 0.5 g / day fac implant and were compared against a sham - control treated population . both fame trials independently met their primary endpoint and showed that significantly more patients with chronic dme treated with the 0.2 g / day fac implant experienced a 15-letter improvement in visual acuity ( va ) at month 24 than sham - control patients ( pooled data ; 34.4 vs. 13.4% ; p < 0.001 ) and that this benefit was sustained to month 36 . functional improvements were accompanied by rapid and sustained improvements in central foveal thickness ( cft ) . in europe , iluvien is indicated for the treatment of vision impairment associated with chronic diabetic macular oedema considered insufficiently responsive to available therapies . since then miss clare bailey presented the real world outcomes from a uk audit of patients treated with iluvien at the annual meeting of the royal college of ophthalmologists in birmingham , uk , between june 24 and 26 , 2016 . this unpublished interim analysis showed that the majority of treated eyes ( 69.4% of 290 eyes ) maintained or improved va . to date , however , relatively limited data with a longer - term follow - up of the functional and structural responses following treatment with iluvien have been reported . the case described herein provides data for both va and cft over a 24-month follow - up period . a 68-year - old caucasian female with type 2 diabetes mellitus had diffuse dme diagnosed in her left eye in october 2010 . the treatment history is summarised in table 1 and was previously reported when only 6 months of follow - up were available . at diagnosis , va was 46 early treatment diabetic retinopathy study ( etdrs ) letters , converted from snellen va using the equation 85 + 50 x log ( snellen fraction ) , cft was 712 microns , and intraocular pressure ( iop ) was 22 mm hg . the patient had phacoemulsification plus intraocular lens insertion in the left eye in february 2012 . intravitreal triamcinolone acetonide was also administered to treat the persistent dme postoperatively . at the first postoperative visit , va was 70 etdrs letters , cft was 278 microns , and iop was 20 mm hg . over the next 5 months , va ( 50 etdrs letters ) and cft ( 805 microns ) progressively worsened , and the patient was admitted into the matisse trial in september 2012 to test the effects of ranibizumab plus a small - interfering rna agent . between october 2012 and march 2014 , the patient received 5 injections of ranibizumab plus the small - interfering rna agent and then subsequently listed for 2 further courses of 3 intravitreal injections of ranibizumab . by the end of this stage of treatment , by 1 month after the final injection of ranibizumab , the dme had recurred , va was 55 etdrs letters , cft was 774 microns , and iop was 17 mm hg . the patient 's dme was now chronic ( over 18 months of duration ) , relapsing , and her crt had fluctuated wildly through the different treatment phases , which is believed to have a deleterious effect on the function of the retina and , more specifically , on the visual function due to the presence of submacular fluid . it was at this stage that the patient was treated with iluvien according to nice ta301 ( please see http://www.nice.org.uk/guidance/ta301/chapter/1-guidance ) . figure 1 shows the response of va and cft after a single iluvien implant without any further treatment to this eye over the next 2 years . within 7 days , va had increased to 61 etdrs letters and cft had decreased to 267 microns . within 2 weeks , va had improved further to 70 etdrs letters , which is the legal requirement to hold a driving license in the uk . these early improvements were then largely maintained throughout the next 24 months without further intervention , as shown in figure 1 . figure 2 shows optical coherence tomography scans before and after iluvien implantation , illustrating the structural improvement that occurred alongside the functional improvement in vision . over the course of the 2-year period , iop remained below 21 mm hg , and no iop - lowering medication was required . this is the first case that the authors are aware of , which shows that a single injection of the 0.2 g / day fac implant leads to rapid improvements ( within 7 days ) in va and cft that are maintained over 2 years of follow - up . this was despite 11 previous injections of ranibizumab , which failed to control the dme prior to treatment with iluvien . the functional and structural responses presented herein are consistent with those reported in the fame trials , with rapid and marked responses observed early and being sustained in the long term . this patient will continue to be monitored to see if the responses reported in controlled clinical trials are replicated with a single injection in real - life uk practice over a 36-month period . this article does not contain any new studies with human or animal subjects performed by any of the authors . f. quhill has attended advisory boards and speaker engagements and has been remunerated for these by alimera sciences .

importancea case showing sustained structural and functional responses 2 years after a single treatment with iluvien ( 0.2 g / day fluocinolone acetonide , fac ) despite suboptimal responses to ranibizumab.observationsa 68-year - old female patient with diabetic macular oedema ( dme ) from type 2 diabetes mellitus was first diagnosed in october 2010 and had a baseline visual acuity ( va ) of 46 early treatment diabetic retinopathy study ( etdrs ) letters in the left eye . central foveal thickness ( cft ) was 712 microns . the patient was treated with 11 intravitreal injections of ranibizumab ( 5 in combination with a small - interfering rna agent ) , and by march 2014 , va and cft were largely unchanged ( 55 etdrs letters and 774 microns ) . the patient was treated with iluvien as she had a pseudophakic lens and a clearly suboptimal response to the prior therapy with ranibizumab . an implant releasing fac at a dosage of 0.2 g / day was administered in march 2014 , and the optical coherence tomography indicated that the macula was dry after 7 days ( cft was below 300 microns ) . this was sustained at 6 , 12 , and 24 months after the treatment . va improved by 5 letters within 7 days and by 15 letters within 14 days , and this was maintained after 24 months . throughout the duration of this study , the intraocular pressure was 22 mm hg , and no glaucoma medication was administered.conclusions and relevancein real - life uk practice , this dme patient showed a suboptimal response to multiple intravitreal injections of ranibizumab . when subsequently treated with a single injection of iluvien , there were large and rapid improvements in va and cft that were maintained for the following 2 years .

melanocyte - stimulating hormone release inhibiting factor-1 ( mif-1 ) , also known as plg based on its amino acid structure ( pro - leu - gly - nh2 ) , is an endogenous brain peptide that exerts a variety of pharmacological effects on the central nervous system . clinical studies have shown that mif-1 can alleviate symptoms in parkinson 's disease ( pd ) and mental depression . these have been summarized elsewhere , although the review overlooked a report in the chinese literature of favorable results of mif-1 in pd . mif-1 was the first hypothalamic peptide shown to act up on the brain , not just down on the pituitary . in human plasma , a duration of 5 days is required for 50% degradation of mif-1 at 37c . this remarkable stability of mif-1 in human blood , coupled with its persisting biological activity , makes mif-1 a worthwhile candidate as a human therapeutic agent . the therapeutic potential of mif-1 indicates the importance of further determining how it acts on the brain . there already is evidence that mif-1 activates cns pathways related to opiate and dopaminergic systems based on the following evidence : ( 1 ) mif-1 antagonizes opiate actions , and the first report of such activity correctly predicted the discovery of other endogenous antiopiate peptides blocking the analgesic effect of morphine and enkephalin in a radiant heat tail - flick assay . mif-1 also significantly antagonized the effects of morphine in a double - blind study in humans . ( 2 ) mif-1 is effective in the dopa - potentiation , oxotremorine antagonism , and deserpidine antagonism tests . in a small number of patients with pd , barbeau found its potentiation of the effects of levodopa to be remarkable ; ( 3 ) mif-1 can modulate dopaminergic transmission in - vitro as well as in - vivo , increasing the binding affinity of agonists to the high - affinity state of the dopamine receptor and shifting the ratio of high- and low - affinity states of the dopamine receptor in favor of the g - protein - coupled high - affinity state . ( 4 ) the actions of mif-1 appear rather selective toward dopamine receptors since it does not interact with other aminergic receptors such as adrenergic , gabaergic , or serotonergic receptors . ( 5 ) mif-1 also facilitates passive acquisition of brightness discrimination , passive avoidance retention , appetitive maze performance , and inhibits shock - suppressed water intake , findings interpreted as contributing to the processes of memory consolidation [ 1 , 12 ] . however , mif-1 does not change camp in the brain in contrast to the increase induced by -msh , and its induction of cgmp is not robust in rat brain . this led us to study alternative cellular signaling pathways . a number of exogenous stimuli , including an increase in neuronal activity , trigger the transcription of c - fos , which is an immediate early gene that in combination with the specific jun proteins forms the heterodimeric transcription regulator , ap-1 . the extracellular signal - regulated kinase ( erk)-1/2 pathways are involved in the induction and regulation of c - fos . in this study , we performed a brain mapping of the neuronal expression of c - fos after intravenous ( iv ) or intracerebroventricular ( icv ) injection of mif-1 . all studies were conducted following a protocol approved by the institutional animal care and use committee . adult male c57bl/6j mice were purchased from jackson laboratories ( bar harbor , me ) and housed in the animal care facility for at least 2 weeks before study . the mice were housed 4/cage and provided with regular rodent chow and water ad libitum . the light span was 07:0019:00 hours in a light - dark ( ld ) 12:12 lighting regimen . mif-1 was purchased from phoenix pharmaceuticals ( burlingame , ca ) and reconstituted in phosphate - buffered saline ( pbs ) before use . rabbit polyclonal anti - c - fos antibody , goat anti - pstat3-tyr antibody , and mouse anti - perk e-4 monoclonal antibody were purchased from santa cruz biotechnology ( santa cruz , ca ) . louis , mo ) . in accordance with a protocol approved by the institutional animal care and use committee , c57bl/6j male mice ( 57 weeks old ) mif-1 was delivered either into the isolated left jugular vein ( iv ) at 10 g / mouse in a volume of 50 l ( n = 3 ) , or into the right lateral cerebral ventricle ( icv ) at 1 g / mouse in a volume of 1 l ( n = 3 ) . the icv coordinates were 2 mm lateral and 0.2 mm posterior to the bregma , and 2.5 mm below the skull . the mice were perfused intracardially with 30 ml of normal saline ( ns ) followed by 60 ml of 4% paraformaldehyde . the brain was postfixed overnight in 4% paraformaldehyde and cryoprotected in 15% and then 30% sucrose . coronal sections of 20 m thickness were obtained by the use of a cryostat . the tissue sections were permeabilized with 0.3% triton x-100 and blocked with 10% normal donkey serum , and incubated with a primary antibody overnight at 4c . the antibodies include rabbit polyclonal anti - c - fos antibody ( 1 : 200 , santa cruz biotechnology sc-52 ) and anti - rat neun antibody ( 1 : 100 , chemicon ) . after thorough washing , they were incubated with respective alexa488-conjugated secondary antibodies at room temperature for 1 hour , washed , and mounted . sh - sy5y human neuroblastoma cells ( american type culture collection , atcc , manassas , va ) were grown in dulbecco 's modified eagle 's medium ( dmem ) with 10% fetal bovine serum ( fbs ) . the cells were differentiated by treatment with 10 m of all - trans retinoic acid ( sigma , st . sixteen hours after serum starvation , the cells were treated with mif-1 ( 110 ng / ml for different time intervals ( 03 hours ) . all cells were plated at the same time and treated according to the time intervals designed for individual experiments . the cells were lysed in ice - cold ripa buffer ( 100 mm nacl , 10 mm tris , ph 7.2 , 0.1% sds , 1% triton x-100 , 1% deoxycholate , 5 mm edta ) in the presence of protease inhibitor cocktail ( pierce , rockford , il ) . thirty to 50 g of protein was electrophoresed on 12% sds - polyacrylamide gel and transferred to a nitrocellulose membrane ( bio - rad , hercules , ca ) . the membrane was blocked with 5% non - fat dry milk in tris - buffered saline ( ph 7.6 ) containing 0.1% tween-20 , and probed with rabbit anti - c - fos ( polyclonal , 1 : 200 , santa cruz biotechnology , sc-52 ) , goat anti - pstat3 tyr 705 ( polyclonal , 1 : 1,000 sc-7993 ) , mouse anti - perk e-4 ( monoclonal , 1 : 500 , sc-7383 and mouse anti--actin ( monoclonal , 1 : 10,000 , sigma , a2228 ) overnight at 4c . after thorough washing , the membranes were incubated with horseradish peroxidase - conjugated secondary antibody for 1 hour at room temperature . the signals were developed with enhanced chemiluminescence - plus western blotting detection reagents ( amersham biosciences , piscataway , nj ) . we previously observed that mif-1 is saturably transported from blood to brain . in this study , we demonstrate that iv injection of mif-1 increased c - fos immunoreactivity in different brain regions . the regions that showed the highest c - fos activation include cingulate cortex ( figures 1(c3 ) and 2(a ) ) , infralimbic cortex ( figures 1(c1 ) and 2(e ) ) , nucleus accumbens ( figures 1(c1 ) and 2(i ) ) , paraventricular nucleus ( pvn ) in the hypothalamus ( figures 1(c5 ) and 2(f ) ) , medial basal amygdaloid nucleus ( figures 1(c6 ) and 2(h ) ) , fiber tract in piriform cortex ( figures 1(c6 ) and 2(g ) ) , paraventricular thalamic nucleus ( figures 1(c6 ) , 2(c ) , and 2(d ) ) , and other thalamic nuclei ( figures 1(c7 ) and 2(b ) ) . double labeling with neun showed that many of the cells expressing c - fos were neurons . the increase in c - fos expression was greater after iv injection than after icv injection in many brain regions . this is consistent with the ability of stable substances in the cerebral circulation to reach all parts of the brain rapidly . after icv , the increase of c - fos was mainly seen in the paraventricular nucleus of the hypothalamus ( figures 1(b5 ) and 2(f ) ) . table 1 summarizes the number of c - fos immunopositive cells in different brain regions . western blotting showed that the c - fos signal was increased 60 minutes after mif-1 treatment ( 10 ng / ml ) . there was also a dose - dependent increase , highest at the maximal dose of 10 g / ml , but even the lowest concentration of mif-1 tested ( 6.25 ng / ml ) showed a robust induction of c - fos 1 hour later ( figure 3(b ) ) . western blotting analysis showed that perk expression was increased in sh - sy5y cells 10 minutes after mif-1 treatment ( 10 ng / ml ) ( figure 4 ) . by contrast , the cells responded to mif-1 with an initial reduction of pstat3 at 10 and 60 minutes , followed by increased pstat3 expression at 2 and 3 hours ( figure 5 ) . in this study , we showed that mif-1 induces c - fos activation in different regions of the brain and in cultured neurons . this is the first report stating that mif-1 increases the phosphorylation of erk , indicative of activation of a mitogen - activated protein kinase ( mapk ) pathway . our results show that mif-1 decreased pstat3 initially ( 10 and 60 minutes ) , but then increased pstat3 at later times ( 2 and 3 hours ) in neuronal culture , probably reflecting a secondary mechanism . this also is the first report showing that mif-1 modulates pstat3 activation , although the functional consequences are not clear . these are not classical elements of the gpcr signaling pathway , and suggest a broader action of this orphan ligand . while a peptide like mif-1 may either show direct cns effects or activate secondary mediators , c - fos immunoreactivity reflects a final common pathway of brain activation as a result of mif-1 application . the immediate early gene product c - fos is an easily identifiable and rather sensitive marker for cns activation . the increase of c - fos has been demonstrated after various stimuli , including growth factors , ion channel activation , neurotransmitter release , and behavioral modifications . the increase of its expression can be mediated by many intracellular signaling pathways , such as increases in camp , calcium influx , and activation of mapk . our results show that the increase in c - fos expression is greater after iv injection than after icv injection in many brain regions . after icv administration , the increase of c - fos immunoreactivity was mainly seen in the pvn of the hypothalamus . considering that less than 1% of mif-1 from blood permeates the blood - brain barrier to reach the brain , like most centrally active peptides and even l - dopa and morphine , this indicates that blood - borne mif-1 is more effective than when administered into the slower moving ventricular system of the brain . this is not surprising considering that no neuron is more than about 8 m from a capillary . it is also possible that peripherally injected mif-1 activates additional mediators , thus triggering a cascade of signalling events . the implications of mif-1-induced c - fos activation in different brain regions are discussed below . ( 1 ) cingulate cortex : the cingulate cortex is an anatomically and functionally heterogeneous region and it modulates emotion and mood . attention deficit in pd has been explained by dopamine depletion of the cingulate cortex . fornix - induced lesions can reduce c - fos immunoreactivity in the cingulate cortex of rats . earlier studies showed that lesions of the cingulate cortex affect behavior in the open - field and interspecies aggression behavior in rats . melatonin ( 5-methoxy - n - acetyltryptamine ) was reported to be critically involved in the regulation of both mood and pain . melatonin receptor type 1 ( mt1)-knockout mice display depression - like behavior with altered sensory responses and attention deficits . these previous studies show that the central melatoninergic system might play an important role in the mechanism of interactions between pain and depression , and the anterior cingulate cortex could be a forebrain region of interest in this process . mif-1 can potentiate the melanocyte - lightening effect of melatonin in rats , and its effects in patients with pd are associated with marked mood elevation . therefore , the mif-1-induced c - fos activation in the cingulate cortex supports the speculation that the effectiveness of mif-1 in treating movement disorders may be associated with increased melatonin secretion . ( 2 ) thalamus : the lateral geniculate nucleus of the thalamus is involved in fluctuations in both visual attention and visual awareness . mif-1 can facilitate acquisition of brightness discrimination , probably by affecting processes of attention when rats are tested with a spatial extradimensional shift problem after acquisition of a visual task . c - fos expression has been found in the medial geniculate body ( mgb ) of the thalamus after mice acquired a visually cued conditioned fear . the activation of c - fos by mif-1 in the thalamus supports the direct effects of mif-1 there . ( 3 ) infralimbic cortex : the infralimbic cortex ( il ) is a cortical region in the medial prefrontal cortex that is important in tonic inhibition of subcortical structures and emotional responses such as fear this illustrates cortical control over extinction processes , which is one of the simplest forms of emotional regulation . less c - fos immunoreactivity is present in the il of the extinction - resistant mouse compared with the control . in a 12-choice warden maze for a palatable food reward , rats receiving mif-1 have shorter latencies and make fewer errors than controls during learning , but not extinction , of the task . ( 4 ) nucleus accumbens : both typical and atypical antipsychotic drugs increase c - fos protein expression in the nucleus accumbens shell . the ability of mif-1 to increase c - fos in the forebrain may have considerable predictive validity for antipsychotic drug actions . administration of mif-1 to patients with depression showed substantial improvement within a few days after initiation of treatment [ 3335 ] . previous studies showed that antipsychotic drugs like clozapine and amperozide preferentially increase dopamine release in the rat nucleus accumbens and prefrontal cortex . hippocampal dopamine receptors modulate c - fos expression in the rat nucleus accumbens that is evoked by chemical stimulation of the ventral hippocampus . thus , mif-1 may activate cells in the nucleus accumbens and modulate dopaminergic activity there to alleviate mood and schizoaffective disorder . ( 5 ) pvn : the pvn plays important roles in neuroendocrine and autonomic nervous system controls . for example , many experimental challenges ( such as restraint stress , dehydration , and immune challenge ) induce c - fos expression in the pvn [ 38 , 39 ] . although mif-1 has no effects on a naloxone - sensitive peptide yy ( pyy ) model of hyperphagia after pyy injection into the pvn , the induction of c - fos by mif-1 through both iv and icv injection indicates that pvn is a major site of action for mif-1 . ( 6 ) medial amygdaloid nucleus : an avoidance task in the elevated t maze can increase fos protein expression in the medial amygdaloid nucleus . the amygdala is a point of convergence for conditioned and unconditioned stimuli and seems to impart emotional value to sensory stimulation . increased expression of immediate early genes in the amygdala has been reported in several paradigms of aversive conditioning . these findings may provide a physiological basis for mif-1 induced c - fos activation in the amygdala . ( 7 ) piriform cortex : the presence of the c - fos protein has been shown in the piriform cortex at different stages during the acquisition of trace conditioning in rabbits . mif-1 also facilitates passive avoidance retention and inhibits shock - suppressed water intake , findings interpreted as contributing to the processes of memory consolidation . in elevated - plus - maze tests , mice treated with tyr - mif-1 tend to spend more time in the open arms compared with the control group , suggesting the anxiolytic properties of this peptide that shows structural homology with mif-1 . training induces c - fos mrna expression in the piriform cortex and the neocortex of n-3-fatty acid depleted rats , who showed learning improvement in an olfactory discrimination task . mif-1 also improves the capacity of rats to store information received through olfactory cues in social investigatory behavior . in summary , the results show that mif-1 increased c - fos expression in brain regions involved in the regulation of mood , anxiety , depression , and memory . blood - borne mif-1 induced a greater extent of activation than that after icv , suggesting a prominent role of blood - brain barrier permeation . the activation status of perk and pstat3 may contribute to the overall expression level of c - fos . thus , the results indicate the cellular mechanisms of actions of mif-1 that may underlie the therapeutic effects of mif-1 in the treatment of parkinson 's disease and depression .

mif-1 ( pro - leu - gly - nh2 ) is a tripeptide for which the therapeutic potential in parkinson 's disease and depression has been indicated by many studies . however , the cellular mechanisms of action of mif-1 are not yet clear . here , we show the specific brain regions responsive to mif-1 treatment by c - fos mapping , and determine the kinetics of cellular signaling by western blotting of perk , pstat3 , and c - fos in cultured neurons . the immunoreactivity of c - fos was increased 4 hours after mif-1 treatment in brain regions critically involved in the regulation of mood , anxiety , depression , and memory . the number of cells activated was greater after peripheral treatment ( intravenous delivery ) than after intracerebroventricular injection . in cultured sh - sy5y neuronal cells , c - fos was induced time- and dose - dependently . the activation of cellular c - fos was preceded by a transient increase of mitogen - activated protein kinase perk but a reduction of phosphorylated signal transducer and activator of transcription ( pstat3 ) initially . we conclude that mif-1 can modulate multiple cellular signals including perk , and pstat3 to activate c - fos . the cellular activation in specific brain regions illustrates the biochemical and neuroanatomical basis underlying the therapeutic effect of mif-1 in parkinson 's disease and depression .

antibodies and reagents anti - human gpvi monoclonal antibody ( mab ) 204 - 11 has been described previously ( 25 ) . anti - syk polyclonal ab ( pab ) ( 26 ) was kindly provided by j. b. bolen ( dnax , ca ) . anti - phospho - syk ( tyr ) pab and anti - myc mab were purchased from cell signaling technology ( new england biolabs uk ltd . , anti - phosphotyrosine mab 4g10 , anti - fcr -chain pab , and normal rabbit igg were purchased from upstate biotechnology ( milton keynes , uk ) . anti - pecam-1 mab ab468 was from autogen - bioclear ( wiltshire , uk ) . horseradish peroxidase - conjugated donkey anti - rabbit secondary ab and enhanced chemiluminescence reagents ( ecl ) were purchased from amersham biosciences . fluorescein isothiocyanate - conjugated anti - mouse igg secondary antibody was purchased from sigma . the src kinase inhibitors used were , pp1 , purchased from biosource europe ( nivelles , belgium ) ; pp2 , purchased from calbiochem ( nottingham , uk ) ; and pd0173952 , a gift from pfizer global research and development ( ann arbor , mi ) . fcr -chain knock - out mice were bred as heterozygotes as described ( 28 ) . 10 mm pervanadate was freshly prepared on the day for use by mixing sodium orthovanadate and hydrogen peroxide in phosphate - buffered saline to final concentrations 10 mm , then left for 5 min at room temperature and kept on ice . other reagents were from previously described sources ( 6 , 8 , 24 ) . constructs the human prc / gpvi , pef6/fcr -chain , pef6/clec-2 , and mutant clec-2 ( y7f ) expression plasmids have been previously described ( 8) . the human pcdna3/-g6b - b ( kindly given by prof r. d. campbell , oxford , uk ) has been described ( 9 ) and the human pcdna3/pecam-1 ( kindly given by c. d. buckley , birmingham , uk ) has also been described ( 29 ) . the nfat luciferase reporter containing three copies of the distal nfat site from the interleukin-2 promoter has been described ( 30 ) . making myc - tagged fcr -chain the c - myc epitope tag ( eqkliseedl ) was fused at the amino terminus of fcr -chain by using pef6/fcr -chain as a template and the primers : forward ( 5-gaa caa aaa ctc atc tca gaa gag gat ctg ctg gga gag cct cag ctc-3 ) and reverse ( 5-cag atc ctc ttc tga gat gag ttt ttg ttc ggc cgc tgc ttg ttc aac-3 ) , and subcloned into pef6 . site - directed mutagenesis of g6b - b site - directed mutagenesis of g6b - b was performed by a quikchange site - directed mutagenesis kit ( stratagene , cambridge , uk ) . the primers g6b - b - y211f - forward ( 5-ccg agc ctg ctc ttt gcg gat ctg gac-3 ) and g6b - b - y211f - reverse ( 5-gtc cag atc cgc aaa gag cag gct cgg-3 ) were used for tyrosine to phenylalanine mutation in g6b - b ( y211f ) using wild - type human pcdna / g6b - b as a template . the primers g6b - b - y237f - forward ( 5-gat gcc tcc acc atc ttt gca gtt gta gtt tg-3 ) and g6b - b - y237f - reverse ( 5-caa act aca act gca aag atg gtg gag gca tc-3 ) were used for tyrosine to phenylalanine mutation in g6b - b ( y237f ) using wild - type human pcdna / g6b - b as a template and they were also used for tyrosine to phenylalanine mutation in g6b - b ( y211f / y237f ) using mutant pcdna / g6b - b ( y211f ) as a template . cell culture wild - type ( wt ) , syk - deficient ( 31 ) , shp1 and shp2 double - deficient ( 32 ) ( kindly donated by l. meyaard , utrecht , the netherlands ) , ship - deficient ( 33 ) ( kindly donated by d. k. newman , milwaukee , wi ) dt40 chicken b cells were grown in rpmi supplemented with 10% fetal bovine serum , 1% chicken serum , 100 units / ml penicillin , 100 g / ml streptomycin , 50 m -mercaptoethanol , and 20 mm glutamine . luciferase assay the nfat reporter assay was performed as described ( 8 , 24 ) . the indicated amount of dna of each construct and 15 g of nfat - luciferase reporter construct were transfected by electroporation at 350 v and 500 microfarads into 2 10 cells of wt , syk - deficient , and shp1/shp2-deficient dt40 cells . twenty hours after transfection , live cells were counted by trypan blue exclusion , and samples divided for luciferase assay ( 2 10 cells / ml ) , flow cytometry ( 5 10 cells / sample ) , and western blotting ( 1 10 cells / sample ) . collagen was used at 10 g / ml and rhodocytin was used at 50 nm . luciferase activity was measured with a centro lb960 microplate luminometer ( berthold technologies , germany ) . cell surface expression of transfected cells was analyzed by flow cytometry using 1 g / ml , gpvi mab , pecam-1 mab , and myc mab to detect clec-2 and fcr -chain , t7-tag mab to detect g6b - b , or mouse igg followed by staining with 4 g / ml fluorescein isothiocyanate - conjugated anti - mouse igg secondary antibody , and assessed on a facscalibur ( becton dickinson , san jose , ca ) . human and mouse platelets washed preparations of human and mouse platelets were prepared as previously described ( 5 , 8) . platelets were resuspended in a modified tyrodes - hepes buffer at concentrations of 4 10/ml ( human ) or 2 10/ml ( mouse ) . platelets were prewarmed to 37 c for 5 min and incubated with inhibitors or solvent controls for up to 10 min . immunoprecipitation and western blotting transfected cells ( 1 10/ml ) were incubated for 30 min in rpmi at 37 c before stimulating . after stimulation , transfected cells or platelets were lysed with ice - cold 2 lysis buffer ( 2% triton x-100 , 2% dodecyl maltoside , 4 mm 4-(2-aminoethyl)benzenesulfonyl fluoride , 20 g / ml aprotinin , 20 g / ml leupeptin , 2 g / ml pepstatin , 10 mm sodium orthovanadate , ph 7.5 ) and insoluble material was removed by centrifugation . for immunoprecipitation , lysates were precleared with protein a ( g)-sepharose beads for 30 min at 4 c and mixed with 2 g of the indicated antibodies and protein a - sepharose beads ( protein g - sepharose ) . whole cell lysates or immunoprecipitated lysates were added to 2 laemmli sample buffer . samples were separated by sds - page on 10 or 412% bistris gels ( invitrogen ) and transferred to polyvinylidene difluoride membrane . statistical analysis experiments were performed on at least three occasions and results are shown as mean s.e . with the exception of the representative western blots and flow cytometry histograms . constitutive signaling of gpvi - fcr -chain in dt40 cells we set out to extend our previous characterization of the gpvi - fcr -chain signaling pathway in the dt40 b cell line ( 24 ) by testing whether activation of gpvi by collagen is dependent on its associated fcr -chain . activation was monitored in the absence and presence of collagen and compared with mock - transfected cells that had been allowed to settle on fibronectin using a nfat - luciferase reporter assay . adhesion to fibronectin alone did not induce nfat activation ( not shown ) . as anticipated , collagen stimulated nfat activation in dt40 cells expressing both gpvi and an nh2-terminal myc - tagged version of fcr -chain , whereas it had no effect when either subunit was transfected on its own ( fig . the myc - tagged version of fcr -chain supports a similar level of activation to that of the wild - type protein ( not shown ) and has the advantage that it can be used to monitor surface expression by flow cytometry , which is not altered by expression of gpvi ( fig . , gpvi was not expressed on the surface of dt40 cells in the absence of the fcr -chain ( not shown ) , as is the case for platelets ( 34 ) . these results are consistent with a model in which cross - linking of gpvi by collagen leads to tyrosine phosphorylation of the fcr -chain and activation of the tyrosine kinase syk . these studies further revealed the unexpected observation that expression of the myc - tagged or wild - type fcr -chain caused a significant increase in luciferase activity that approached almost 10% of the response to collagen ( fig . furthermore , the constitutive signal from the fcr -chain was not altered by co - expression with gpvi ( fig . thus the increase in luciferase activity that was observed in the absence of a stimulatory agonist reflects signaling by the itam - containing protein . to investigate constitutive signaling in further detail , dt40 cells were transfected with varying concentrations of the fcr -chain plasmid and the level of nfat activation monitored . increasing levels of transfection of fcr -chain led to a corresponding increase in both nfat activation ( fig . 1b , panel i ) and fcr -chain expression as shown by western blotting ( fig . furthermore , western blotting of gpvi - fcr -chain - transfected cells demonstrated an increase in tyrosine phosphorylation of a band of 72 kda that comigrates with syk , along with constitutive tyrosine phosphorylation of fcr -chain ( fig . confirmation that the 72-kda protein corresponds to syk was confirmed using a phosphospecific antibody ( phospho - syk tyr ) that binds to the activated tyrosine kinase ( not shown ) . tyrosine phosphorylation of syk and fcr -chain were inhibited in the presence of the src family kinase inhibitor pd0173952 ( fig . these results demonstrate that the fcr -chain generates constitutive signals in dt40 cells that lead to tyrosine phosphorylation of syk and nfat activation . stimulation of gpvi - fcr -chain - transfected cells with collagen leads to a further increase in tyrosine phosphorylation of syk ( fig . 1c , panel ii ) , consistent with the activation of syk by the collagen receptor complex , as described in earlier studies . the above studies were extended to clec-2 , which is a recently identified platelet glycoprotein receptor that mediates activation through a single yxxl motif in its cytosolic tail . clec-2 is a receptor for the snake venom toxin , rhodocytin , and the lymphatic marker podoplanin . both agonists induce activation of clec-2-transfected dt40 cells , with the response being dependent on the conserved tyrosine in the cytoplasmic yxxl motif ( 7 , 8) . in the present study , we have confirmed that rhodocytin stimulates nfat activation in clec-2-transfected dt40 cells , with the level of response increasing with the level of surface expression of clec-2 ( fig . moreover , as is the case with the fcr -chain , expression of clec-2 was sufficient to increase nfat activity in the absence of agonist stimulation , with the level of response increasing in parallel with that of clec-2 ( fig . the level of constitutive activity approached between 10 and 20% the response to rhodocytin . constitutive signaling by clec-2 is abolished following mutation of the tyrosine in the clec-2 yxxl sequence to a phenylalanine ( y7f ) ( fig . 2b , panel i ) , as is the case for stimulation by rhodocytin ( 8) . flow cytometry confirmed a similar level of expression of wild - type and the y7f mutant of clec-2 in these studies ( fig . these results demonstrate that constitutive and agonist - induced signaling by clec-2 is dependent on the yxxl motif . a , panel i , constitutive and collagen - induced signaling in dt40 cells transfected with plasmids ( 10 g ) encoding gpvi and/or myc - fcr -chain ( fcr ) was analyzed using an nfat - luciferase reporter assay . cell lysates were analyzed for luciferase activity following incubation with media or collagen ( 10 g / ml ) for 6 h. data are expressed as -fold increase over the basal of mock - transfected cells . panel ii , gpvi and fcr surface expression was measured by flow cytometry following transfection with 10 g of plasmid of gpvi / myc - fcr or myc - fcr only ( corresponding to a , panel i ) relative to a control igg . data are representative of three experiments.b , constitutive signaling by the fcr alone . panel ii , western blotting ( wb ) for fcr -chain in dt40 cells transfected with increasing amounts of fcr -chain plasmid . c , panel i , constitutive tyrosine phosphorylation of syk and fcr. mock and gpvi - fcr-transfected dt40 cells were pre - treated with pd0173952 ( 20 m ) for 5 min . whole cell lysates were western blotted for tyrosine phosphorylation using mab 4g10 and then reprobed for syk and fcr. tyrosine phosphorylated bands that comigrate with syk and fcr are shown . panel ii , tyrosine phosphorylation of syk in gpvi - fcr-transfected dt40 cells lysates by collagen ( 30 g / ml ) is partially inhibited by cotransfection with g6b - b . cells were stimulated by collagen for 90 s. experimental conditions were as for panel i. data are representative of three experiments . a , panel i , constitutive and collagen - induced signaling in dt40 cells transfected with plasmids ( 10 g ) encoding gpvi and/or myc - fcr -chain ( fcr ) was analyzed using an nfat - luciferase reporter assay . cell lysates were analyzed for luciferase activity following incubation with media or collagen ( 10 g / ml ) for 6 h. data are expressed as -fold increase over the basal of mock - transfected cells . panel ii , gpvi and fcr surface expression was measured by flow cytometry following transfection with 10 g of plasmid of gpvi / myc - fcr or myc - fcr only ( corresponding to a , panel i ) relative to a control igg . data are representative of three experiments.b , constitutive signaling by the fcr alone . panel ii , western blotting ( wb ) for fcr -chain in dt40 cells transfected with increasing amounts of fcr -chain plasmid . c , panel i , constitutive tyrosine phosphorylation of syk and fcr. mock and gpvi - fcr-transfected dt40 cells were pre - treated with pd0173952 ( 20 m ) for 5 min . whole cell lysates were western blotted for tyrosine phosphorylation using mab 4g10 and then reprobed for syk and fcr. tyrosine phosphorylated bands that comigrate with syk and fcr are shown . panel ii , tyrosine phosphorylation of syk in gpvi - fcr-transfected dt40 cells lysates by collagen ( 30 g / ml ) is partially inhibited by cotransfection with g6b - b . cells were stimulated by collagen for 90 s. experimental conditions were as for panel i. data are representative of three experiments . constitutive signaling by gpvi - fcr -chain and clec-2 is mediated by src and syk tyrosine kinases we and others have previously reported that collagen stimulates phosphorylation of the fcr -chain itam in platelets through the src kinases , fyn and lyn , leading to recruitment and tyrosine phosphorylation of syk ( 3537 ) . similarly , phosphorylation of clec-2 and syk by rhodocytin in platelets is mediated through a src kinase pathway , although the identity of the src kinase is not known ( 5 ) . consistent with this , we observed constitutive and collagen - stimulated tyrosine phosphorylation of syk in gpvi - fcr -chain - transfected dt40 cells ( fig . , we have not been able to detect constitutive phosphorylation of clec-2 in our studies , possibly because of a lower level of expression relative to that of fcr -chain , as shown using a myc - tagged version of both proteins ( supplemental fig . s1 ) , and because the c - type lectin receptor has a single yxxl motif . however , we have observed a small increase in constitutive phosphorylation of syk in dt40 cells expressing clec-2 , which was further increased in the presence of rhodocytin ( not shown ) . experiments were designed to investigate whether nfat signaling by the gpvi - fcr -chain complex and clec-2 in transfected dt40 cells is mediated through src and syk kinases . as shown in fig . 3a , constitutive and agonist - induced nfat activation by both receptors is blocked in the presence of the src family kinase inhibitor pd0173952 . furthermore , constitutive and agonist - induced signaling by the two receptors was also markedly inhibited in the absence of syk ( fig . thus , these results demonstrate that constitutive and agonist - induced signaling by gpvi - fcr -chain and clec-2 are both dependent on src family and syk tyrosine kinases . g6b - b inhibits constitutive and agonist - induced signaling by gpvi - fcr -chain and clec-2 through its two itims a series of experiments were undertaken to investigate the possible regulation of constitutive and agonist - induced signaling through the gpvi - fcr -chain complex and clec-2 by the platelet immunoglobulin receptor g6b - b , which contains two itims in its cytosolic tail ( 9 , 10 ) . xpression of g6b - b significantly inhibited constitutive signaling by both receptors by more than 60% ( fig . 4 , panel i ) , as well as inhibiting the response to collagen and rhodocytin by 35 and 60% , respectively ( fig . 4 , . the greater degree of inhibition of the response to rhodocytin may reflect the lower level of expression of clec-2 relative to gpvi - fcr -chain ( supplemental fig . s1 ) . expression of g6b - b had no effect on the level of expression of either clec-2 or gpvi ( supplemental fig . expression of g6b - b also partially inhibited collagen - induced tyrosine phosphorylation of syk ( fig . 1c , panel ii ) , demonstrating a molecular basis for its inhibitory action . these results demonstrate that g6b - b inhibits constitutive and agonist - induced signaling induced by gpvi - fcr -chain and clec-2 . figure 2.constitutive signaling by clec-2 in dt40 cells is dependent on its yxxl motif . a , panel i , constitutive and rhodocytin - induced signaling in dt40 cells transfected with varying amounts of the clec-2 plasmid was analyzed by nfat - luciferase reporter assay . cells were stimulated with 50 nm rhodocytin for 6 h. values are mean s.e . panel ii , clec-2 surface expression following transfection with varying amounts of clec-2 plasmid was assessed by flow cytometry using anti - myc tag mab relative to a control igg . b , panel i , constitutive and rhodocytin - induced signaling in cells transfected with wild - type ( wt ) and mutant ( y7f ) clec-2 . panel ii , clec-2 surface expression ( corresponding to panel i ) was assessed by flow cytometry using anti - myc tag mab relative to a control igg . a , panel i , constitutive and rhodocytin - induced signaling in dt40 cells transfected with varying amounts of the clec-2 plasmid was analyzed by nfat - luciferase reporter assay . cells were stimulated with 50 nm rhodocytin for 6 h. values are mean s.e . panel ii , clec-2 surface expression following transfection with varying amounts of clec-2 plasmid was assessed by flow cytometry using anti - myc tag mab relative to a control igg . b , panel i , constitutive and rhodocytin - induced signaling in cells transfected with wild - type ( wt ) and mutant ( y7f ) clec-2 . panel ii , clec-2 surface expression ( corresponding to panel i ) was assessed by flow cytometry using anti - myc tag mab relative to a control igg . g6b - b contains two itims in its cytosolic tail , which independently mediate binding to shp1 and shp2 following incubation with the protein - tyrosine phosphatase inhibitor , pervanadate ( 9 ) . mutation of the two conserved tyrosines at positions 211 and 237 to phenylalanine inhibits association with the two sh2 domain - containing protein - tyrosine phosphatases ( 9 ) . to investigate whether either or both of the itims mediate the inhibitory effect of g6b - b , the y211f / y237f double mutant was expressed in dt40 cells together with the gpvi - fcr -chain complex and clec-2 . flow cytometry was used to confirm similar levels of expression of the g6b - b mutant , gpvi and clec-2 in the transfected cell lines to that in cells transfected with wild - type g6b - b and the two yxxl - containing receptors ( supplemental fig . mutation of the two conserved tyrosines in the g6b - b itims abolished the inhibitory effect of g6b - b against constitutive and agonist - induced activation of nfat induced by gpvi - fcr -chain and clec-2 ( fig . 4 ) , whereas mutation of either of the two tyrosines alone had a partial or neglible effect ( not shown ) . in line with this , we were able to detect weak tyrosine phosphorylation of g6b - b in the dt40-transfected cells ( not shown ) . these results demonstrate that g6b - b inhibits constitutive and agonist - induced signaling through the conserved tyrosines at positions 211 and 237 . the ability of g6b - b to inhibit constitutive and agonist - induced responses mediated through gpvi - fcr -chain and clec-2 was further investigated in the combined absence of the two sh2 domain - containing tyrosine phosphatases , shp1 and shp2 , or in the absence of the 5-inositol phosphatase , ship . unexpectedly , the absence of the two protein - tyrosine phosphatases led to an increase in the level of constitutive and agonist - induced nfat activation through gpvi - fcr -chain and clec-2 , suggesting that both receptors are under dynamic inhibitory feedback through the two tyrosine phosphatases ( fig . nevertheless , g6b - b was still able to inhibit constitutive and agonist - induced signaling through gpvi - fcr -chain and clec-2 in the absence of shp-1 and shp-2 ( fig . 5a ) . indeed , the inhibitory action against rhodocytin was enhanced in the combined absence of shp1 and shp2 ( fig . 5a ) , although this may reflect the increased response to rhodocytin that is observed in the absence of the two protein - tyrosine phosphatases . g6b - b also inhibits constitutive and agonist - induced nfat activation by gpvi - fcr -chain and clec-2 in dt40 cells deficient in the sh2-domain - containing inositol 5-phosphatase ( ship ) ( fig . indeed the inhibitory action of g6b - b against clec-2 was also enhanced by the absence of the 5-inositol phosphatase ( fig . 5b ) , as was the case in the absence of shp1 and shp2 . these results demonstrate that g6b - b inhibits gpvi and clec-2 signaling in dt40 cells by a shp1/shp2-independent and ship - independent mechanism . figure 3.constitutive and agonist - induced signaling by gpvi - fcr -chain and clec-2 is dependent on src and syk tyrosine kinases . constitutive and agonist - induced signaling in wild - type ( wt ) and syk - deficient dt40 cells transfected with gpvi - fcr-chain or clec-2 was analyzed using an nfat - luciferase reporter assay . cell lysates were analyzed for luciferase activity following agonist stimulation for 6 h. a , wt dt40 cells were either mock - transfected or transfected with ( panel i ) gpvi - fcr -chain ( 10 g of each plasmid ) or ( panel ii ) clec-2 ( 10 g ) and stimulated with 10 g / ml collagen or 50 nm rhodocytin in the presence and absence of the src kinase inhibitor , pd0173952 ( 20 m ) . b , basal signaling in wt or syk - deficient dt40 cells transfected with mock or transfected with ( panel i ) gpvi - fcr -chain ( 10 g of each plasmid ) or ( panel ii ) clec-2 ( 10 g ) and incubated for 6 h to monitor the degree of constitutive signaling . values are mean s.e . constitutive and agonist - induced signaling by gpvi - fcr -chain and clec-2 is dependent on src and syk tyrosine kinases . constitutive and agonist - induced signaling in wild - type ( wt ) and syk - deficient dt40 cells transfected with gpvi - fcr-chain or clec-2 was analyzed using an nfat - luciferase reporter assay . cell lysates were analyzed for luciferase activity following agonist stimulation for 6 h. a , wt dt40 cells were either mock - transfected or transfected with ( panel i ) gpvi - fcr -chain ( 10 g of each plasmid ) or ( panel ii ) clec-2 ( 10 g ) and stimulated with 10 g / ml collagen or 50 nm rhodocytin in the presence and absence of the src kinase inhibitor , pd0173952 ( 20 m ) . b , basal signaling in wt or syk - deficient dt40 cells transfected with mock or transfected with ( panel i ) gpvi - fcr -chain ( 10 g of each plasmid ) or ( panel ii ) clec-2 ( 10 g ) and incubated for 6 h to monitor the degree of constitutive signaling . figure 4.the novel platelet itim transmembrane protein g6b - b inhibits constitutive and agonist - induced signaling through gpvi and clec-2 . the effect of the wild - type ( wt ) and double itim - mutant transmembrane protein g6b - b ( y211f / y237f ) on ( panel i ) constitutive and ( panel ii ) agonist - induced signaling by gpvi - fcr -chain and clec-2 in transfected ( 10 g of each plasmid ) dt40 cells , measured using an nfat - luciferase reporter assay . cells were stimulated with 10 g / ml collagen or 50 nm rhodocytin as appropriate . the double itim mutant contained inactivating point mutations ( y / f ) at tyrosines 211 and 237 . the results are mean s.e . of between 4 and 7 independent experiments . * , p < 0.05 ; and * * , p < 0.01 compared with the gpvi - fcr -chain or clec-2-transfected samples . the novel platelet itim transmembrane protein g6b - b inhibits constitutive and agonist - induced signaling through gpvi and clec-2 . the effect of the wild - type ( wt ) and double itim - mutant transmembrane protein g6b - b ( y211f / y237f ) on ( panel i ) constitutive and ( panel ii ) agonist - induced signaling by gpvi - fcr -chain and clec-2 in transfected ( 10 g of each plasmid ) dt40 cells , measured using an nfat - luciferase reporter assay . cells were stimulated with 10 g / ml collagen or 50 nm rhodocytin as appropriate . the double itim mutant contained inactivating point mutations ( y / f ) at tyrosines 211 and 237 . the results are mean s.e . of between 4 and 7 independent experiments . * , p < 0.05 ; and * * , p < 0.01 compared with the gpvi - fcr -chain or clec-2-transfected samples . figure 5.the inhibitory effect of g6b - b is independent of shp1 , shp2 , and ship . constitutive and agonist - induced signaling in shp1/shp2 double - deficient ( a ) and ship - deficient dt40 cells ( b ) transfected with gpvi - fcr -chain , clec-2 , and g6b - b was analyzed using a nfat - luciferase reporter assay . cells were stimulated with 10 g / ml collagen or 50 nm rhodocytin for 6 h. * , p < 0.05 relative to response in the absence of g6b - b . the inhibitory effect of g6b - b is independent of shp1 , shp2 , and ship . constitutive and agonist - induced signaling in shp1/shp2 double - deficient ( a ) and ship - deficient dt40 cells ( b ) transfected with gpvi - fcr -chain , clec-2 , and g6b - b was analyzed using a nfat - luciferase reporter assay . cells were stimulated with 10 g / ml collagen or 50 nm rhodocytin for 6 h. * , p < 0.05 relative to response in the absence of g6b - b . pecam-1 does not inhibit constitutive signaling in dt40 cells a similar set of studies were undertaken to investigate whether the major platelet itim receptor , pecam-1 , also inhibits constitutive and agonist - induced activation of nfat downstream of gpvi - fcr -chain and clec-2 . s3a , pecam-1 had no effect on constitutive or agonist - induced activation of either receptor in dt40 cells , possibly because of a low level of expression ( supplemental fig . a , human washed platelets were incubated at 37 c with the syk kinase inhibitor , r406 ( 1 m ) , and src inhibitor pp2 ( 20 m ) for 1 min . b , wild - type ( wt ) or fcr -chain deficient mouse ( ko ) platelets ( pretreated with egta to block aggregation ) were stimulated with 100 m pervanadate ( pv ) for 90 s in the presence or absence of src inhibitor pp2 ( 20 m ) . c , human washed platelets were incubated at 37 c with the src kinase inhibitors pp1 ( 10 m ) or pd0173952 ( 10 m ) for 5 min . cell lysates were immunoprecipitated with anti - syk ab or an igg and probed for tyr(p ) . d , human washed platelets were stimulated with 30 nm rhodocytin for 5 min in the presence and absence of the src kinase inhibitor , pp2 ( 10 m ) . cell lysates were immunoprecipitated ( ip ) with anti - clec-2 ab and probed for tyr(p ) . a , human washed platelets were incubated at 37 c with the syk kinase inhibitor , r406 ( 1 m ) , and src inhibitor pp2 ( 20 m ) for 1 min . b , wild - type ( wt ) or fcr -chain deficient mouse ( ko ) platelets ( pretreated with egta to block aggregation ) were stimulated with 100 m pervanadate ( pv ) for 90 s in the presence or absence of src inhibitor pp2 ( 20 m ) . c , human washed platelets were incubated at 37 c with the src kinase inhibitors pp1 ( 10 m ) or pd0173952 ( 10 m ) for 5 min . cell lysates were immunoprecipitated with anti - syk ab or an igg and probed for tyr(p ) . d , human washed platelets were stimulated with 30 nm rhodocytin for 5 min in the presence and absence of the src kinase inhibitor , pp2 ( 10 m ) . cell lysates were immunoprecipitated ( ip ) with anti - clec-2 ab and probed for tyr(p ) . src and syk kinase - dependent constitutive signaling in platelets experiments were designed to investigate whether there is evidence for constitutive signaling through src and syk kinases in platelets . in this context , it is important to emphasize that platelets express several classes of receptor that signal through src and syk tyrosine kinases , including the major platelet integrin , iib3 , and the gpib - ix - v complex , the levels of which are over 1 order of magnitude greater than that of gpvi - fcr -chain and clec-2 . we first asked the question as to whether the tyrosine phosphorylation that is seen in the absence of agonist stimulation in platelets is regulated by src or syk tyrosine kinases . western blotting for phosphotyrosine using the monoclonal antibody 4g10 reveals the presence of a broad band of proteins in non - stimulated platelets of between 50 and 60 kda ( fig . this region includes src kinases , which are constitutively phosphorylated in resting platelets by the src kinase - regulatory protein , csk , at an inhibitory site that promotes intramolecular binding to the sh2 domain . in addition , several other proteins , which have been shown to be constitutively phosphorylated in nonstimulated platelets , migrate in this region , including dok-2 ( 38 ) . additional phosphorylation bands that lie outside of this region can also be seen in non - stimulated platelets in longer exposures , as illustrated in fig . tyrosine phosphorylation of the majority of these bands is markedly inhibited in the presence of the src family kinase inhibitors , pp1 and pp2 , and the syk family kinase inhibitor , r406 ( 39 ) , with the exception of the broad band of proteins that runs at 5060 kda , which is only partially reduced ( fig . the residual phosphorylation that is seen in this region is likely to reflect phosphorylation of src kinases on their inhibitory site by csk . significantly , csk is not known to be regulated downstream of src and syk kinases . the reduction in phosphorylation in this region is presumably due to loss of phosphorylation of proteins such as dok-2 , as discussed above . the similar pattern of reduction in tyrosine phosphorylation that is induced by r406 to that of pp2 can not be due to direct inhibition of src kinases , as r406 does not inhibit collagen - stimulated tyrosine phosphorylation of the fcr -chain,5 which is mediated through src kinase activation . these results demonstrate that constitutive signaling by src and syk family kinases underlies tyrosine phosphorylation of the majority of proteins in non - stimulated platelets , thereby providing evidence of constitutive signaling by src and syk kinases . we used the protein - tyrosine phosphatase inhibitor , pervanadate , to further investigate the contribution of src and syk family kinases to constitutive tyrosine phosphorylation in human and mouse platelets , on the grounds that this would potentiate protein tyrosine phosphorylation by constitutively active tyrosine kinases . 6b ) , with similar observations made for human platelets ( not shown ) . as previously reported ( 4042 ) , pervanadate induces a marked increase in tyrosine phosphorylation of a large number of proteins in platelets ( fig . strikingly , protein tyrosine phosphorylation induced by pervanadate was dramatically inhibited in the presence of the src kinase inhibitor , pp2 , confirming that src family kinases are the major family of kinases that contribute to constitutive tyrosine phosphorylation in platelets . a small number of tyrosine - phosphorylated proteins are seen in longer exposures of pervanadate - treated platelets in the presence of pp2 , including a band of 72 kda ( fig . 6b ) that was identified as syk by immunoprecipitation of the kinase and western blotting for phosphotyrosine ( fig . confirm that src kinases are constitutively active in nonstimulated platelets and demonstrate that they underlie the major increase in tyrosine phosphorylation that is induced in the presence of protein - tyrosine phosphatase inhibition . further experiments were designed to investigate the possible dependence of constitutive signaling through src and syk family kinases on the gpvi - fcr -chain complex . for these experiments , syk was immunoprecipitated from resting human platelets and western blotted for phosphotyrosine in the absence and presence of the src family kinase inhibitor , pd0173952 . 6c demonstrate association of constitutively tyrosine - phosphorylated syk and constitutively tyrosine - phosphorylated fcr -chain , which is dramatically reduced in the presence of the src kinase inhibitor pd0173952 . on the other hand , treatment of fcr -chain - deficient mouse platelets with pervanadate revealed that constitutive tyrosine phosphorylation in mouse platelets is minimally altered in platelets deficient in the itam - containing protein ( fig . 6b ) , demonstrating that the gpvi - fcr -chain complex makes a relatively minor contribution to the overall level of tyrosine phosphorylation . constitutive phosphorylation of clec-2 is observed in human platelets and is reduced in the presence of the src kinase inhibitor , pp2 ( fig . the contribution of clec-2 to constitutive tyrosine phosphorylation in mouse platelets can not be assessed , as mice lacking the c - type lectin receptor have not been made . the present study demonstrates that the gpvi - fcr -chain complex and clec-2 generate constitutive signals in transfected dt40 cells leading to nfat activation with the degree of signaling corresponding to the level of expression . furthermore , the dependence on src and syk family kinases provides strong evidence that constitutive signaling by both receptors is mediated through the same pathway as used by agonists to mediate activation . in line with this , constitutive signaling by clec-2 is inhibited by mutation of the conserved tyrosine in the yxxl sequence in its cytosolic tail . furthermore , the response to the gpvi - fcr -chain complex is mediated by fcr -chain , and is independent of gpvi , consistent with it being generated through the tandem yxxl sequence of the fcr -chain . constitutive and agonist - induced signaling through gpvi - fcr -chain and clec-2 is reduced by co - expression of the itim - containing platelet protein , g6b - b ( 9 ) . the inhibitory effect of g6b - b is dependent on the conserved tyrosines in its two itims , as shown by abolition of the inhibitory response upon mutation of the itim tyrosines to phenylalanine . however , unexpectedly , this inhibitory effect is retained in dt40 cells in the combined absence of the sh2 domain - containing tyrosine phosphatases , shp1 and shp2 , which have been shown to bind to g6b - b ( 9 , 10 ) . the inhibitory effect of g6b - b is also retained in the absence of the sh2 domain - containing inositol phosphatase , ship , which has been shown to inhibit b cell receptor signaling through association with the fcriib itim ( 43 , 44 ) . an alternative pathway of inhibition could be through recruitment of the sh2 domain - containing inhibitor of src kinases , csk , to the two itims in g6b - b . such a mechanism has been proposed to underlie the inhibition of fcri signaling by the itim - containing transmembrane protein , lair-1 , in rat rbl mast cells ( 45 ) . however , we were unable to demonstrate association of csk with g6b - b in transfected dt40 cells ( not shown ) , possibly because of the low level of constitutive phosphorylation of the itim - containing protein . access to csk - deficient dt40 cells is required to directly test the role of the src kinase regulatory protein in mediating the inhibitory effect of g6b - b . it is also possible that the inhibitory effect of g6b - b is mediated by association with several proteins , including a combination of shp1 , shp2 , ship , and csk , such that loss of any one is compensated by expression of the others . such a mechanism would explain why g6b - b is still able to mediate inhibition in dt40 cells deficient in shp1 and shp2 , which have both been shown to bind to its cytosolic itims . interestingly , we observed a small reduction in tyrosine phosphorylation of syk by g6b - b in dt40 cells stimulated by collagen , suggesting that this underlies the inhibitory effect of the itim - containing protein . the observation that the fcr -chain and clec-2 generate constitutive signals is in line with reports that itam receptors generate weak , constitutive signals in other hematopoietic cells . for example , in mouse thymocytes and peripheral t cells , there is limited constitutive phosphorylation of tcr chains leading to association with the syk - related tyrosine kinase zap-70 ( 46 , 47 ) . this gives rise to constitutive signaling in resting mouse thymocyte and jurkat t cell lines , as shown by suppression of rag gene expression via extracellular signal - regulated kinase ( erk ) and abl kinases , and prevention of further recombination of t cell receptor genes ( 48 ) . the b cell antigen receptor also signals independently of ligand engagement and this provides functionally relevant signals in immature b lymphocytes ( 49 ) and in diffuse large b - cell lymphoma ( 50 ) . significantly , this constitutive signaling is mediated through the b cell receptor itams ( 51 , 52 ) . thus , constitutive signaling appears to be a common feature of yxxl - containing receptors . evidence of constitutive signaling through src and syk tyrosine kinases in platelets has been demonstrated in the present study in association with a low level of tyrosine phosphorylation of the fcr -chain and clec-2 . studies in mice deficient in the fcr -chain demonstrate that the gpvi receptor complex makes only a minimal contribution to this phosphorylation , most likely because of the association of src kinases with other surface receptors , including the iib3 complex that is expressed at over 20 times the level of gpvi . the demonstration of constitutive signaling via src and syk kinases in platelets emphasizes the need for inhibitory signals to oppose activation occurring in healthy vessels . we speculate that this function may be mediated , at least in part , by the itim receptor , g6b - b , which is markedly phosphorylated in resting platelets ( 10 ) . the ligand for g6b - b is not known , but if this is expressed on platelets , it is possible that this may account for the high level of constitutive phosphorylation of g6b - b through a cis - interaction . a similar function to that of g6b - b may be mediated in platelets by the itim - containing receptor , pecam-1 . this is in line with studies that have reported inhibition of agonist - induced platelet activation by the immunoglobulin receptor ( 2123 ) . however , unexpectedly , we were unable to observe inhibition of constitutive and agonist - induced signaling by pecam-1 in the dt40 cell line , possibly because of too low a level of expression . in summary , the present study reports that both fcr -chain and clec-2 generate weak , sustained constitutive signals that are inhibited by co - expression with g6b - b . we speculate that this could represent an important physiological role of g6b - b and other platelet itim proteins in helping to prevent platelet activation in vivo .

platelets play an essential role in wound healing by forming thrombi that plug holes in the walls of damaged blood vessels . to achieve this , platelets express a diverse array of cell surface receptors and signaling proteins that induce rapid platelet activation . in this study we show that two platelet glycoprotein receptors that signal via an immunoreceptor tyrosine - based activation motif ( itam ) or an itam - like domain , namely the collagen receptor complex glycoprotein vi ( gpvi)-fcr -chain and the c - type lectin - like receptor 2 ( clec-2 ) , respectively , support constitutive ( i.e. agonist - independent ) signaling in a cell line model using a nuclear factor of activated t - cells ( nfat ) transcriptional reporter assay that can detect low level activation of phospholipase c ( plc ) . constitutive and agonist signaling by both receptors is dependent on src and syk family kinases , and is inhibited by g6b - b , a platelet immunoglobulin receptor that has two immunoreceptor tyrosine - based inhibitory motifs in its cytosolic tail . mutation of the conserved tyrosines in the two immunoreceptor tyrosine - based inhibitory motifs prevents the inhibitory action of g6b - b . interestingly , the inhibitory activity of g6b - b is independent of the src homology 2 ( sh2)-domain containing tyrosine phosphatases , shp1 and shp2 , and the inositol 5-phosphatase , ship . constitutive signaling via src and syk tyrosine kinases is observed in platelets and is associated with tyrosine phosphorylation of gpvi - fcr -chain and clec-2 . we speculate that inhibition of constitutive signaling through src and syk tyrosine kinases by g6b - b may help to prevent unwanted platelet activation .

in many inflammatory responses , polymorphonuclear leukocytes ( pmnls ) are among the first cells to exit the blood stream and migrate to an inflammatory site , where they become fully activated . this activation is a two - stage process : pmnls first encounter a stimulus that does not activate the cells directly but leaves them in a primed then , upon encountering a second stimulus in the inflamed site , the transition into a fully activated state will occur [ 1 , 2 ] . this process involves the production of free radicals and release of granule enzymes into the surrounding milieu . therefore , tight regulation of pmnl activation is needed throughout the steps of infiltration from the blood stream to the inflamed site in order to prevent damage to the vascular wall and the extracellular matrix ( ecm ) . one of the ecm components is heparin ( in the form of heparan sulfate ) , a soluble molecule that plays a major role in defining the physical and chemical properties of the ecm . heparin , which is commonly used as a blood anticoagulant , is also known to have anti - inflammatory effects ; however , the mechanism of these biological activities remains largely unknown [ 4 , 5 ] . some of heparin 's anti - inflammatory effects are mediated through the modulation of cellular activation , particularly of pmnls [ 69 ] . heparin decreases phorbol myristate acetate ( pma ) , n - formyl - methionyl - leucyl - phenylalanine ( fmlp ) , and opsonized zymosan - induced superoxide production , a decrease which is even greater when the pmnls are primed by platelet activating factor ( paf ) . heparin reduces fmlp - stimulated pmnl adhesion to endothelial cells and decreases the release of beta - glucuronidase and lysozyme from stimulated pmnls . in addition , heparin has been shown to inhibit leukocyte recruitment and chemotaxis in response to zymosan - activated serum . recently , it was shown that immobilized heparin can mediate cell adhesion via interaction with the pmnl integrin mac-1 ( cd11b / cd18 , m2 ) . mac-1 is one of the most versatile adhesion molecules , with ligands of various biological functions . one of these functions is the induction of a signal transduction cascade that substantially augments apoptosis of activated pmnls . the above data , especially the known apoptotic effect of heparin on pmnls [ 13 , 14 ] , led us to hypothesize that priming of pmnls renders them more susceptible to the apoptotic effects of heparin and that apoptosis induced by heparin is mediated in part by heparin interactions with cd11b , which is highly expressed on the surface of primed pmnls . in order to test our hypothesis , we used pmnls isolated from hemodialysis ( hd ) patients as a model of in vivo primed cells and pmnls isolated from healthy controls ( nc ) primed ex vivo with paf . our results indicate that primed pmnls , regardless of their priming origin ( ex vivo or in vivo ) , are more susceptible to the apoptotic effect of heparin compared to nonprimed pmnls . we also show that heparin binds to cd11b , leading to apoptosis that can be blocked with neutralizing antibodies against cd11b . blood was drawn from 17 patients on chronic hemodialysis and 24 age- and gender - matched healthy control subjects ( nc ) . blood for the determination of biochemical and hematological parameters and for the isolation of pmnls was drawn after an overnight fast . blood was collected into citrate tubes from the arterial line of all the hd patients immediately before a dialysis session . all patients underwent hemodialysis three times a week ; each dialysis treatment lasted 4 hours and was carried out with low flux polysulfone membranes ( f8 , fresenius medical care , bad homburg , germany ) . the water for dialysis met the standards of the association for the advancement of medical instrumentation ( aami ) . patients with evidence of acute or chronic infection or malignancy or who had received blood transfusion within 3 months prior to blood sampling were excluded . all participants signed an informed consent for blood sampling , and the study was approved by the institutional committee in accordance with the helsinki declaration . isolated pmnls ( > 98% pure , approximately 10 cells per isolation ) were resuspended and counted in phosphate buffered saline ( pbs , beit haemek , israel ) containing 0.1% glucose . pmnl priming was assessed by the rate of superoxide release and by the surface levels of cd11b , as described previously . the rate of superoxide release was determined after cell stimulation with 0.32 10 m phorbol 12-myristate 13-acetate ( pma ; sigma , st . the assay is based on superoxide dismutase ( sod ) inhibitable reduction of 80 m cytochrome c ( sigma , st . the change in optical density was monitored at 549 nm , as described previously . expression of cd11b on pmnls in whole blood was determined using the fc500 flow cytometer ( beckman - coulter ) . 50 l of blood was incubated for 10 min with anti - cd11b - pe conjugated monoclonal antibody ( immunotech , marseille , france ) , followed by red blood cell lysis ( q - prep method ; coulter corporation , hialeah , fl , usa ) . to enable gating on the pmnl population , anti - cd16 , conjugated to pc5 monoclonal antibody ( iq products ) , was used . surface levels of cd11b on pmnls are expressed as mean fluorescence intensity ( mfi ) , after subtracting the nonspecific background . paf ( sigma , usa ) , a known dose - dependent priming agent of pmnls , was used for the in vitro priming of nc pmnls in three concentrations : 1 pm , 1 nm , and 1 m . cells were incubated with paf for 15 minutes at room temperature and then washed with pbs . in paf - stimulated pmnls where cd11b intensity was measured and in experiments where cd11b was blocked , 5 minutes after the initiation of incubation with paf , mouse anti - human - cd11b - pe was added . cd11b expression was measured as described above for whole blood , but without the lysis step . the effect of heparin was studied on three types of isolated pmnls : normal control ( nc ) pmnls , paf - stimulated nc pmnls , and hd pmnls . all cells were incubated for 30 min at room temperature with 25 , 50 , and 100 u / ml sodium heparin ( kamada , beit kama , israel ) diluted in pbs . in order to measure time - dependent effects of heparin , nc and hd pmnls were incubated with 100 u / ml sodium heparin for 300 min at room temperature . the percentage of apoptotic pmnls was based on annexin - v - fitc binding according to the manufacturer 's recommendations ( annexin - v / fitc kit , bender medsystems diagnostics gmbh , vienna , austria ) . annexin - v - fitc and propidium iodide ( pi ) were added to the cell suspension and incubated for 10 min in the dark at room temperature . pi staining is a dye - exclusion assay that discriminates between cells with intact membranes ( pi negative ) and permeabilized membranes ( pi positive ) . the cell population showing annexin - v/pi was considered viable ; annexin - v+/pi was considered as an early apoptotic population . separated pmnls ( 5 10 ) were incubated with anti - cd11b - pe or its isotype control- ( ic- ) pe for 10 minutes , washed , and incubated for 30 minutes with 25 u / ml heparin . this dose of heparin was chosen since it is the minimal dose that caused a statistically significant difference in apoptosis between primed and nonprimed pmnls . apoptosis in pmnls was detected using the following : ( a ) annexin - v - fitc binding was measured as mentioned above without the addition of pi . the percentage of apoptotic cells was compared with apoptosis detected using fitc - labeled annexin - v , added after preincubation with ic - pe ( immunotech , marseille , france ) . the positive cutoff point was determined by fitc - isotype controls ( iq products , netherlands ) , added after preincubation with ic - pe . ( b ) pmnls ( 5 10 ) were cytospinned and apoptosis was detected with an axioscop 2 upright fluorescence microscope , using the in situ cell death detection kit ( tunel staining , roche molecular biochemicals ) . cells ( 2 10 ) were incubated at room temperature for 0 , 30 , and 90 minutes in pbs with and without heparin ( 100 u / ml ) , stained with trypan blue solution ( 0.4% in hbss ) , and counted . separated pmnls ( 5 10 ) were incubated with anti - cd11b - pe or its isotype control for 10 minutes , washed , and assayed for heparin binding by two different methods : ( a ) the pmnls were further incubated with 25 u / ml sodium heparin . the percentage of pmnls that bound heparin and the intensity of heparin binding to pmnls were determined by flow cytometry using mouse anti - human heparan sulfate - fitc ( united states biological , massachusetts ) . the ab was generated by immunization with liposome - intercalated membrane hs proteoglycans and recognizes an epitope present in many types of human heparan sulfate including heparin . the epitope includes n - sulfated glucosamine residues that are critical for the reactivity of the antibody . the ab does not react with hyaluronan , chondroitin sulfate , dermatan sulfate , keratan sulfate , or dna [ 20 , 21 ] . the positive cutoff point was determined by fitc - isotype control ( iq products , netherlands ) , added after preincubation with anti - cd11b - pe . the percentage of heparin bound cells and the intensity of heparin binding to pmnls detected in this experiment were compared with cells detected using fitc - labeled anti - heparan sulfate , added after preincubation with ic - pe ( immunotech , marseille , france ) . the positive cutoff point was determined by fitc - isotype controls ( iq products , netherlands ) , added after preincubation with ic - pe . ( b ) the pmnls were further incubated with 25 u / ml fitc - labeled heparin ( molecular probes , eugene , or ) in pbs for 30 minutes at room temperature . the intensity of heparin binding to pmnls was determined by fc500 flow cytometer ( beckman - coulter ) . data are expressed as mean sd . in the box and whiskers presentations , the horizontal line in the middle shows the median ( 50th percentile ) , the top and bottom of the box indicate the 75th and 25th percentiles , respectively , and the whiskers show the maximum and the minimum values . the two - paired wilcoxon signed ranks test was used for comparing two dependent groups . pmnl priming was manifested by increased rates of superoxide release and amplified levels of membrane cd11b [ 1618 ] . preincubation of isolated normal control ( nc ) pmnls with increasing concentrations of paf caused a dose - dependent increase in the rate of superoxide release from pma - stimulated pmnls ( p < 0.05 , figure 1(a ) ) . in addition , the expression of cd11b was higher in paf - treated nc pmnls compared to nontreated nc pmnls ( p < 0.05 , figure 1(b ) ) . we reported previously that pmnls from hemodialysis ( hd ) patients are primed . to confirm these results the rate of superoxide release following pma stimulation was higher in pmnls isolated from hd patients compared to paf untreated nc cells ( 33.5 4 versus 24.7 5 nmoles/10 cells/10 min , resp . , p < 0.05 , figure 1(a ) ) and was similar to the rate achieved by stimulation with the highest concentration of paf . the expression of cd11b was also higher in hd pmnls than in nc pmnls ( 61 25 versus 29 11 mfi , resp . , p < 0.05 , figure 1(b ) ) and comparable to the levels measured in nc cells stimulated with the highest concentration of paf . we have previously reported that heparin exerts an apoptotic effect on pmnls . to determine whether primed pmnls are differently affected by heparin compared to nonprimed cells , we exposed 3 groups of pmnls : nc , 1 m paf - stimulated nc , and hd pmnls , to increasing concentrations of heparin for 30 min ( figure 2 ) . we used 1 m paf - stimulated nc since the rate of superoxide release and the expression of cd11b on these ex vivo primed cells were similar to in vivo primed cells , isolated from hd patients ( figure 1 ) . incubation of pmnls with increasing concentrations of heparin resulted in an increase in early apoptosis in all three groups , however to a much greater extent in hd pmnls ( figure 2(b ) ) . the increase in hd pmnl apoptosis was significant at all heparin concentrations versus without heparin ( p < 0.05 ) , while in nc pmnls and paf - stimulated nc pmnls significance was achieved only at 100 u / ml of heparin ( p < 0.05 ) . moreover , the maximal percentage of early apoptotic pmnls was 8% in nc and 10% in paf - stimulated nc whereas 17% apoptotic cells were detected in hd pmnls . incubation of pmnls with increasing concentrations of heparin caused a significant increase in apoptosis ( early + late ) in all three groups of pmnls , however to a much greater extent in paf - stimulated nc and hd pmnls with both groups showing similar dose - dependent responses ( figure 2(c ) ) . the increased degree of apoptosis in paf - stimulated nc and hd pmnls was significant at all heparin concentrations versus without heparin ( p < 0.05 ) , while in nc pmnls significance was detected only at 100 u / ml of heparin ( p < 0.05 ) . the effect of heparin on paf - stimulated nc and hd pmnls was much greater than its effect on nc pmnls ( p < 0.05 nc versus hd and paf - stimulated nc at all heparin concentrations ) . the maximal percentage of apoptotic pmnls in nc was only 14% , whereas 22% apoptotic cells were detected in paf - stimulated nc and hd pmnls . priming is also reflected by the rate of superoxide release from pma - activated pmnls . to determine whether apoptosis induced by heparin modulates activation of primed pmnls , we investigated the dose - dependent effect of heparin on the rate of superoxide release . a significant reduction in the rate of superoxide release was observed in all groups of pmnls ( p < 0.05 for all heparin concentrations versus no heparin ; figure 2(d ) ) . moreover , paf - stimulated nc and hd pmnls showed lower rates of superoxide release versus nc pmnls . the decreased rate of superoxide release was maximized at heparin concentrations of 25 u / ml for nc pmnls and 50 u / ml for 1 m paf - stimulated nc and hd pmnls . this result suggests that the effect of heparin is greater with increased priming ; the maximal inhibition in the rate of superoxide release from primed pmnls was approximately three times higher than in unprimed cells . to determine whether heparin exerts a similar time - dependent apoptotic effect on primed versus quiescent cells , we incubated nc and hd pmnls with 100 u / ml of heparin up to 300 min ( figure 3 ) . we used 100 u / ml of heparin as it was the only heparin concentration that induced apoptosis in nc pmnls ( figures 2(b ) and 2(c ) ) . heparin induced early apoptosis in both hd and nc pmnls at all time points during the incubation , while without heparin , these cells did not exhibit enhanced early apoptosis at any time point ( figure 3(a ) ) . moreover , heparin caused an oscillatory apoptotic pattern of hd and nc pmnls reaching apoptotic peaks at 30 and 210 min for hd pmnls and 90 and 210 min for nc pmnls . when detecting total apoptosis ( early + late ) , the oscillatory apoptotic patterns of hd and nc pmnls were similar regarding the apoptotic peaks , but with an augmented percentage of apoptotic cells at all points ( figure 3(b ) ) . to test whether the oscillatory pattern could be explained by the loss of apoptotic cells in the ex vivo incubation , we counted the nc and hd pmnls with and without heparin up to 90 min . this assay revealed that during the 30 min of incubation most of the cells ( nc , hd ) were still alive , while after 90 min a significant decrease in hd pmnl count was found ( figure 3(c ) ) . based on these results , all incubation experiments were for 30 minutes to avoid significant cell disintegration in vitro . paf stimulation resulted in a dose - dependent increase in heparin binding to pmnls ( figures 4(a)4(c ) ) . pretreatment of paf - stimulated pmnls with anti - cd11b antibodies completely prevented heparin binding to pmnls , indicating that heparin binds to pmnls , at least partially , via cd11b ( figure 4(c ) ) . these results heparin binding intensity to unstimulated nc pmnls was 6.22 0.19 mfi and increased to 13.15 1.76 mfi after stimulation with 1 m paf , demonstrating increased heparin binding with increased priming . pretreatment of paf - stimulated pmnls with anti - cd11b antibodies completely prevented heparin binding to pmnls with heparin - fitc intensity reduced to 6.48 0.57 mfi . in a second set of experiments depicted in figure 4(d ) , fitc - conjugated anti - heparin antibodies were used to detect the percentage of paf - stimulated pmnls which bound heparin . the more primed the pmnls , the higher the percentage of cells that bound heparin . this binding was also prevented by preincubation with anti - cd11b antibodies applied before the addition of heparin ( figure 4(d ) ) . these results indicate that heparin binding is mediated by cd11b and that the higher the priming state is , the more the heparin binds to pmnls . paf - stimulated nc pmnls showed increased apoptosis dependent on the cell priming state when incubated with heparin ( figures 5(a ) and 5(b ) ) and apoptosis was increased concomitantly with increases in cell priming . anti - cd11b which prevents the binding of heparin to pmnls abolished the apoptotic effect of heparin at all paf concentrations ( figure 5(b ) ) . in addition , anti - cd11b also prevented the binding of heparin to primed pmnls isolated from hd patients and almost completely abolished the apoptosis induced by heparin ( figure 5(b ) ) . the effect of 25 u / ml heparin on apoptosis of nc pmnls was also examined before and following the stimulation with 1 m paf , using the tunel assay . very few apoptotic cells ( with green nuclei , ~2% ) were observed in nc pmnls ( figure 5(c)(1 ) ) and nc pmnls stimulated by paf ( figure 5(c)(2 ) ) without exposure to heparin . when nc pmnls were exposed to 25 u / ml heparin , the percentage of apoptotic cells increased to 6 2% , together with 25% cell loss ( figure 5(c)(3 ) ) . when paf - stimulated nc pmnls were exposed to 25 u / ml heparin , the percentage of apoptotic cells increased to approximately 22 5% ( figure 5(c)(4 ) ) , concomitantly with 65% cell disappearance . exposure of the cells to anti - cd11b - pe antibodies prior to the addition of heparin completely abolished the apoptotic effects of heparin and cell disappearance ( figures 5(c)(5 ) and 5(c)(6 ) ) on both nc pmnls and nc pmnls stimulated by paf . under the same conditions , exposure to isotype - controls- ( ic- ) pe ( instead of to anti - cd11b - pe ) did not prevent the apoptotic effects of heparin and cell disappearance ( figures 5(c)(7 ) and 5(c)(8 ) ) . these results clearly demonstrate that heparin - mediated apoptosis depends on pmnl priming . in order to detect whether exposure of the cells to heparin causes loss of primed pmnls , we further stained the paf - primed pmnls with anti - cd11b - pe ( figure 6 ) . thirty percent of the paf - treated cells that were not exposed to heparin showed elevated levels of cd11b , supporting their primed state . when these cells were exposed to heparin , no primed pmnls or decreases in cell count could be seen . since heparin causes a decrease in superoxide release ( figure 2(d ) ) and at the same time it induces apoptosis via cd11b , it was interesting to find out whether blocking cd11b would have an effect on superoxide release . paf - stimulated nc pmnls incubated with ic showed increased rates of superoxide release which were dependent on the extent of the cell priming : the greater the priming state , the greater the rate of superoxide release ( pmnls ; figure 7 ) . heparin ( 25 u / ml ) prevented this increase in superoxide release ( pmnls + heparin ; figure 7 ) . paf - stimulated nc pmnls , incubated with anti - cd11b but not with heparin , showed a similar increased rate of superoxide release as with ic , which was also dependent on the extent of the cell priming ( pmnls + anti - cd11b ; figure 7 ) . when anti - cd11b was added to pmnls prior to the incubation of the cells with heparin ( pmnls + anti - cd11b + heparin ) , the effect of heparin in terms of inhibition of superoxide release was abolished ( figure 7 ) . our novel finding is that heparin exerts its apoptotic effect on primed pmnls by binding to their cd11b . moreover , heparin causes a significant dose - dependent decrease in the rate of superoxide release from pmnls , blocking primed cells from further activation , partially explaining the anti - inflammatory effects of heparin . it has been previously reported that heparin induces apoptosis in a dose - dependent manner in nc pmnls . in the present study , 30 min incubation with heparin enhanced apoptosis in separated human pmnls in a dose - dependent fashion , however to a much greater extent in primed paf - stimulated nc and hd pmnls . in nc pmnls , the increase in apoptosis was mild and became significant only at 100 u / ml of heparin . interestingly , apoptosis time courses for nc or hd pmnls incubated with heparin displayed an oscillatory pattern , with nc apoptosis lagging that of the hd pmnls . this oscillatory behavior can be explained by the fact that 100 u / ml of heparin caused a time - dependent increase in apoptosis both in nc and in hd pmnls ( however faster and to a much greater extent in hd ) . the decline in apoptosis , for example , after 90 min for hd pmnls and only after 150 min for nc pmnls , can be explained by disappearance of the apoptotic cells as shown in our ex vivo survival studies : almost 4050% of the hd pmnls disappeared after 90 min , probably by disintegration . why do we see another increase after the nadirs ? we suggest that the next apoptotic peak is the result of an increase in cd11b expression in vitro during incubation in pbs ( data not shown ) , which in the presence of heparin will result in apoptosis . nevertheless , in the absence of heparin , such an increase in cd11b is not accompanied by enhanced apoptosis . another possible explanation for increased apoptosis after 30 minutes can arise from a toxic effect . while we specifically measured priming and apoptosis , we do recognize that cell counts were decreasing over time ( an effect we referred to as cell disintegration ) , which may suggest toxicity . yet , when measuring cell activation , we made sure to count the same number of cells for each time point . thus , even if cell toxicity is possible due to prolonged activation , the rate of superoxide release and levels of cd11b were measured on viable cells and support our conclusion that heparin can increase apoptosis through its actions mediated by cd11b . increases in pmnl priming as expressed by increased levels of cd11b and superoxide release resulted in dose - dependent increases of heparin binding to pmnls . this increased binding is demonstrated both by the augmented intensity of heparin bound to the pmnls and by the percentage of cells binding anti - heparin antibodies following incubation with heparin . in all experiments anti - cd11b antibodies competed with heparin for binding to cd11b , supporting the proposed mechanism of heparin - cd11b interactions as previously reported [ 11 , 12 ] . moreover , the percentage of pmnls that bind heparin depends on the initial priming state of the cells ; that is , a higher priming state results in a higher percentage of cells binding heparin . finally , increases in cell priming resulted in augmented apoptosis by heparin in pmnls , which was abolished by anti - cd11b antibodies added prior to the addition of heparin . heparin inhibited superoxide release from pmnls and to a greater extent when cells were primed , such as hd and paf - stimulated nc pmnls . this indicates that heparin exerts its effect mainly on the subpopulation of cells that are primed and are more abundant in hd and paf - stimulated pmnls . since the population of primed pmnls is the major contributor to superoxide release , rendering them apoptotic by heparin results in a decreased rate of superoxide release . these important findings indicate that the rates of superoxide release are increased due to a primed subpopulation of cells . in addition , the inhibitory effect of heparin on superoxide release from pmnls was also abolished by anti - cd11b antibodies added prior to the addition of heparin . altogether , this study suggests a novel role for the interaction of heparin and pmnl cd11b , resulting in cell apoptosis . apoptosis induced by heparin occurs when cd11b levels are increased or , in other words , when a subpopulation of primed pmnls exists . as a result , heparin plays an anti - inflammatory role by making the primed cells apoptotic and preventing leakage of pmnl contents into the surrounding milieu . heparan sulfate , a less sulfated form of heparin , is also known to bind to the pmnl cd11b , and recently we found it can promote apoptosis in separated pmnls ( data not shown ) , a characteristic that is dose - dependently affecting superoxide release from stimulated pmnls . more interesting , however , is the in vivo presence of heparan sulfate in the ecm and on the endothelial cell surface of vascular walls . our studies on heparin raise the intriguing possibility that heparan sulfate may limit and/or regulate , to a certain degree , tissue injury and vascular damage by uncontrolled degranulation and release of reactive oxygen species and toxic contents into the surrounding milieu by activated transmigrating pmnls .

heparin is known to have anti - inflammatory effects , yet the mechanisms are not completely understood . in this study , we tested the hypothesis that heparin has a direct effect on activated polymorphonuclear leukocytes ( pmnls ) , changing their activation state , and can explain its anti - inflammatory effect . to test our hypothesis , we designed both in vitro and ex vivo studies to elucidate the mechanism by which heparin modulates pmnl functions and therefore the inflammatory response . we specifically tested the hypothesis that priming of pmnls renders them more susceptible to heparin . amplified levels of cd11b and increased rate of superoxide release manifested pmnl priming . increase in cell priming resulted in a dose - dependent increase in heparin binding to pmnls followed by augmented apoptosis . blocking antibodies to cd11b inhibited heparin binding and abolished the apoptotic response . moreover , heparin caused a significant dose - dependent decrease in the rate of superoxide release from pmnls , which was blunted by blocking antibodies to cd11b . altogether , this study shows that the interaction of heparin with the pmnl cd11b results in cell apoptosis and explains heparin 's anti - inflammatory effects .

the importance of parasites in shaping community structure and influencing ecosystem functioning in the marine environment has gained considerable recognition over the past few decades ( dobson and hudson , 1986 , poulin , 1999 , poulin et al . , 2016 ) . parasites have complex roles in community ecology by influencing population sizes and shifting patterns in both biodiversity and community structure . parasites can also alter the outcome of competitive interactions , either by enabling rare species to coexist with dominant ones or by helping to eliminate competitors . additionally , parasites have become increasingly recognized as important components of trophic pathways ( see demopoulos and sikkel , 2015 ) . the inclusion of parasites in food webs has revealed higher connections among species ( amundsen et al . , 2009 ) and higher trophic efficiency ( arias - gonzlez and morand , 2006 ) . although the importance of parasites in marine ecosystems is clear , there is still much to be learned regarding the multiple effects that parasites have in different ecosystems throughout the marine realm . a recent review regarding the synergy of marine ecology and parasitology highlighted seven key areas to further increase our understanding of the importance of parasites in marine ecosystem functioning ( poulin et al . , 2016 ) . ( 2016 ) emphasized the need to discover and identify key parasite species that play pivotal roles in ecosystems , while adding new model systems to broaden perspectives on marine parasitism . because the majority of marine parasitology studies have been conducted in coastal and coral reef ecosystems , it was also suggested that research should be expanded to additional marine habitats . focusing on a narrow range of habitats can constrain generalizations regarding parasitism in the marine environment ( poulin et al . , the deep sea is one such understudied ecosystem in which data on parasitism remains limited . for fishes inhabiting the deep sea , knowledge of parasitism is limited to < 10% ( klimpel et al . , 2006 ) . the few studies on parasitism in deep - sea fishes have focused mainly on the prevalence of endoparasitism ( noble , 1973 , campbell et al . , 1980 , , 2006 , palm and klimpel , 2008 ) , revealing the importance of temperature , depth , and habitat ( such as submarine canyons ) in influencing the prevalence of endoparasite infections in the deep sea ( manter , 1934 , campbell et al . , 1980 , gartner and zwerner , 1989 , marcogliese , 2002 , klimpel et al . , however , deep - sea fishes are also hosts to ectoparasites , which can adversely affect fishes by causing anemia ( adlard and lester , 1995 , lester et al . , 1995 ) , tissue damage ( adlard and lester , 1995 , lester et al . , 1995 ) , scarring ( ross et al . , 2001 ) , and behavioral changes ( e.g. welicky and sikkel , 2014 , artim et al . , 2015 ) , while transmitting other diseases [ e.g. , blood parasites , ( davies and smit , 2001 ) , viruses ( lawler et al . , 1974 ) ] . ectoparasitism may thus influence population dynamics of deep - sea fishes and may be important in trophic ecology through direct consumption by other organisms ( johnson et al . yet , ectoparasitism remains understudied , partly because prior data have been obtained opportunistically from trawling and dredging efforts . these types of gear can dislodge ectoparasites from their hosts during collection ( ross et al . , 2001 ) . to investigate ectoparasitism in the deep sea , direct observations using remotely operated vehicles ( rovs ) provide an alternative method to trawling . visual based surveys have provided a considerable amount of information on ectoparasite - host interactions in shallow waters , while revealing effects of parasitism on fish behavior ( e.g. , swimming behavior , site fidelity , barber et al . , 2000 , trophic connections have also been determined from in situ observations ( i.e. , cleaner stations on coral reefs , sikkel et al . , 2004 ) . thus , the value of visual analysis in parasite studies , from shallow waters to the deep - sea , is clear . recent expeditions to survey various seafloor features along the continental margin of the northeastern united states ( neus ) provided an opportunity to increase knowledge of ectoparasites infecting demersal fishes in the deep sea . visual observations from rov surveys were used in the present study to identify ectoparasites and their hosts and examine whether ectoparasite diversity declines with increasing depth . we also examined whether ectoparasite - host interactions and intensity of infections differ among depths and habitats in each of three common fish species [ antimora rostrata ( family moridae ) , nezumia bairdii ( family macrouridae ) , and synaphobranchus ( family synaphobranchidae ) ] . the high - definition video obtained from these expeditions enabled in situ observations of host - parasite interactions while providing unparalleled , high - resolution images of ectoparasites infecting fishes in the deep sea . forty - three remotely operated vehicle ( rov ) dives were conducted with the rov deep discoverer ( d2 ) along the neus continental margin and new england seamount chain during two expeditions ( 9 july to 16 aug 2013 and 19 sep to 6 oct 2014 ) aboard the noaa ship okeanos explorer ( fig . 1 ) . these expeditions were telepresence - enabled , with live video feeds transmitted back to shore in real time ( http://oceanexplorer.noaa.gov/okeanos/media/exstream/exstream.html ) , allowing scientists on shore and on the ship to interact during the dives via an internet chat room and satellite teleconference line . the rov d2 was equipped with two high - definition cameras and 16,600 lumens of hydraulically positioned led lights . a sea - bird 911 + conductivity - temperature - depth ( ctd ) logger with a dissolved oxygen ( do ) sensor paired lasers ( 10 cm apart ) were positioned on the rov to approximate field of view and sizes of fishes and ectoparasites . the okeanos explorer followed the vehicles using dynamic positioning and tracked vehicle position with an ultra - short baseline tracking system . each rov dive traversed one broad - scale habitat feature at depths ranging from 494 to 4689 m ( fig . 1 ) . these habitat features included : submarine canyons ( 25 dives ) , cold seeps ( three dives ) , open slope / intercanyon areas ( seven dives ) , and seamounts ( eight dives ) . no fishes were observed during one dive at the deepest seamount surveyed ( un - named seamount , 45524689 m ) . as the rov traversed a habitat feature ( 0.10.2 knots , 1 knot = 0.514 m s ) , the cameras were generally set on wide - angle view , but zooms were frequently conducted to obtain detailed imagery of each previously undocumented species encountered during a given dive survey . the over - ground distance covered by the rov [ measured in arcgis v9 ( esri ) ] varied across dives ( 3002200 m ) , but the observation time on bottom was approximately the same ( 57 h per dive ) . during each dive , video clips ( 103191clips ) from the high - definition camera mounted on the rov d2 were contiguously acquired as part of the mission of the expeditions . these video clips ranged in length from approximately 30 s to 5 min . sixty - nine demersal fish taxa and three mesopelagic taxa were identified using both frame grab and video observations ( see quattrini et al . , 2015 ) . ectoparasites were identified to the lowest taxonomic level on fishes from all available frame grabs . ectoparasite type , placement , number and size also ensured that individuals were counted only once . because we restricted this analysis to using frame grabs only , we calculated frequency of ectoparasite - host interactions to examine general patterns across the region . three species of fishes ( antimora rostrata , n. bairdii and synaphobranchus spp . ) that were dominant in the region and had ectoparasites were further enumerated using all video clips . the average intensity of infection ( number per one side ) was estimated for these species using individuals imaged during times when the camera was positioned to permit accurate counts . although gnathiid parasites were common , these could not be consistently identified on all individuals due to the wide camera view . thus , estimates provided herein for this taxonomic group are conservative and many parasites labeled as unknown may in fact be gnathiids . for each dominant fish species , abundances of ectoparasite - host interactions were estimated by taking the total number of hosts observed with at least one ectoparasite during a dive and dividing by the product of the total over the ground distance covered by the rov and the estimated field of view ( 4.3 m ) . depth zones were binned into 300 m depth intervals from 500 to 3200 m , except the last depth zone ranged from 2900 to 3262 m. a single dive may have traversed across two depth zones , but only across one broad - scale habitat feature . a kruskal - wallis ( k - w ) test was used to determine if hosts or ectoparasite - host interactions were significantly more abundant within a particular depth range or habitat . following other deep - sea studies ( e.g. , davies et al . , 2008 , doughty et al . , 2014 ) , only dives in which each of the dominant species was present were included in these tests . all statistical tests were conducted in r v 3.1 ( r core team . , 2015 ; http://www.r-project.org ) . a total of 125 adult fishes [ out of 1429 individuals confirmed with or without ectoparasites ] representing at least 25 species [ out of 69 demersal species ( quattrini et al . , 2015 ) and three mesopelagic species ] from 18 families were observed hosting at least five families of ectoparasites ( table 1 ) . the isopoda ( aegidae , cymothoidae , gnathiidae ) was the most common group of ectoparasites observed , infecting 74 individual hosts . an additional 29 individual hosts were infected with ectoparasites that could not be identified ; however , many were possible gnathiids . gnathiids were the most common ectoparasite observed across species , infecting at least 19 species ( table 1 ) . hoplostethus mediterraneus hosted a cymothoid isopod ( table 1 , table 2 ) . siphonostomatoid copepod parasites were observed on at least four host species : a. rostrata , diaphus sp . two families of siphonostomatoid copepods were identified on three species of fishes ( fig . copepods from the family lernaeopodidae , sized at approximately 13 cm total length ( tl ) , were observed on a. rostrata ( fig . copepods were attached to anal fins , below second dorsal fins , and behind the eyes . at least two species ( likely lophoura spp . ) from the family sphyriidae infected synaphobranchus spp . the copepods ( 23 cm tl ) infecting n. bairdii were attached directly behind the dorsal fin , whereas larger copepods ( 45 cm tl ) infecting synaphobranchus spp . unidentified siphonostomatoid copepods were observed ( 2 cm tl ) on mesopelagic fishes , including two diaphus sp . hyperparasitism was observed on n. bairdii , with each sphyriid copepod infected by at least three to eight leeches ( fig . of the three families of isopods that infected demersal fishes , gnathiids were the most common , with 1 to 45 individuals infecting at least one side of each individual fish . gnathiids were translucent , attached to all fins , heads , and sides of bodies ( fig . 2h ) , and ranged in size from 1 to 3 mm tl . one large ( 2.5 cm tl ) aegid was attached mid - way on the body of a. radiata , at the juncture of the left pectoral wing and the central disk ( fig . the other fish individual had at least 15 smaller ( 12 mm tl ) aegids attached to both the wings and the central disk . each aegid ( 23 cm tl ) was attached behind the dorsal fin ( fig . one cymothoid isopod ( 4 cm tl ) was observed attached on the side of the body below the dorsal fin of h. mediterraneus ( fig . ectoparasite - host interactions were documented during 36 dives across the entire study region at depths ranging from 494 to 3262 m ( temperature 5.6 to 2.6 c , dissolved oxygen 3.65.6 ml observations of host - ectoparasite interactions were more frequent in canyons ( 66% , n = 23 dives ) than in open slope ( 23% n = 7 dives ) , cold seep ( 7% , n = 3 dives ) , and seamount ( 4% , n = 3 dives ) habitats ( fig . 1 ) . of the six seamounts where fishes were observed ( < 20 individuals per dive ) , ectoparasites ( gnathiids ) were observed on five individuals , one individual each on kelvin and retriever seamounts and three individuals from mytilus seamount , at depths ranging from 2035 to 3260 m ( fig . 1 , table 2 ) . the number of species infected with parasites was similar among open slope ( 6 spp ) , seamount ( 4 spp . ) , and cold seep ( 4 spp . ) frequencies of ectoparasite - host interactions ranged from 2 to 34% , with the most frequent observations in 8001100 m and 11001400 m ( table 2 ) . few ( n = 8) ectoparasite - host interactions were observed in the deeper areas ( > 1700 m ) ( table 2 ) . the number of host species infected with parasites was highest at depths of 8001100 m ( n = 12 species ) , followed by 11001400 m ( n = 11 species ) , and then declined with increasing depth ( table 2 ) . species richness of ectoparasites was similar among habitats , but declined with deeper depths ( table 2 ) . siphonostomatoid copepods were observed in canyon , cold seep , and open slope habitats at depths down to 1400 m. aegids were observed in open slope and canyon habitats at depths down to 1100 m. one cymothoid isopod was observed in a canyon habitat at a depth of 739 m. gnathiids were observed in all habitats and at the deepest depths surveyed ( down to 3300 m ) . out of the three common species enumerated on video , antimora rostrata ( n = 97 adults , n = 29 dives ) was observed with parasites most frequently . we positively identified ectoparasites on 33% of all observed a. rostrata ( 2540 cm tl ) . of the individuals confirmed with parasites , 88% were infected with gnathiids and 12% were infected with lernaeopodid copepods ( fig . 3 , table 1 ) . 3 ) . for the remaining 55% ( n = 53 ) of individuals , it could not be determined whether or not individuals had ectoparasites because individuals in the video were too far from the camera to confirm whether or not ectoparasites were present . the average number of parasites infecting a single side of an individual was 7.72 1.89 se parasites ( n = 26 individuals , 1 to 45 ectoparasites per individual ) . the most intense infections ( 9.05 2.39 se ectoparasites per side ) were observed on individuals in canyon habitats , particularly at depths ranging from 1100 to 2000 m ( table 3 ) . although prevalence of infections did not differ ( k - w , x = 0.14 , p = 0.93 ) among the three dominant species , the infection intensity was significantly higher ( k - w , x = 14.78 , p = 0.0006 ) in a. rostrata than in the other species . antimora rostrata was observed at depths ranging from 810 to 2718 m. this species was most abundant at depths of 1100 to 1400 m ( 0.029 0.010 se individuals 10 m ) followed by 1400 to 1700 m ( 0.027 0.009 se individuals 10 m ) ( fig . although ectoparasite - host interactions ( 0.010 0.006 se interactions 10 m ) were slightly higher at 800 to 1100 m , there were no significant differences in ectoparasite - host interactions among depth zones ( k - w , x = 4.28 , p = 0.63 , fig . only two individuals were infected with gnathiid parasites depths > 2000 m. among all habitats , a. rostrata was most abundant in cold seeps ( 0.020 0.009 se individuals 10 m , fig . 5 , fig . a. rostrata was most abundant during a single dive at a cold seep site ( 0.37 individuals 10 m , 14121474 m depth ) . here , only 0.004 ectoparasite - host interactions 10 m was estimated . the greatest number ( 0.005 0.001 se interactions 10 m ) of ectoparasite - host interactions was in submarine canyons , but interactions were not significantly different among habitats ( k - w , x = 5.56 , p = 0.13 , fig . 5a ) . the highest abundance ( 0.13 interactions 10 m ) of ectoparasite - host interactions during a single dive was from heezen canyon ( 16941722 m ) , where the abundance of a. rostrata was 0.018 individuals 10 m. for n. bairdii ( n = 153 individuals , n = 24 dives ) , we positively identified ectoparasites on 12% of all individuals ( 1525 cm tl ) , while 25% of n. bairdii individuals had no ectoparasites . of the individuals confirmed with parasites , 42% were infected with gnathiids , 26% were infected with aegid isopods , 21% were infected with sphyriid copepods , and 11% had unidentified parasites ( table 1 , fig . 3 ) . for the remaining 63% of individuals , it could not be determined whether or not individuals hosted parasites . the average number of parasites infecting a single side of an individual was 2.15 0.52 se parasites per side ( n = 13 individuals , 1 to 7 ectoparasites per individual ) . the highest intensity of infections ( 2.67 0.92 se ectoparasites per side ) on n. bairdii occurred in open slope / intercanyon habitats ( table 3 ) . while n. bairdii was observed at depths of 500 to 1860 m , this species was most abundant ( 0.035 0.007 se individuals 10 m ) between 1100 and 1400 m. however , ectoparasite - host interactions were not significantly different among depth zones ( k - w , x = 7.57 , p - value = 0.11 ) ( fig . ectoparasite - host interactions also did not differ among habitats ( k - w , x = 1.92 , p = 0.38 , fig . 5 , fig . ( n = 6 dives , open slope ) to 0.038 individuals 10 m ( n = 1 dive , cold seep ) . during a single dive , n. bairdii was most abundant ( 0.054 individuals 10 m ) in okeanos canyon at depths ranging from 1360 to 1500 m ; yet no individuals had ectoparasites at this site . the greatest number of individuals with ectoparasites ( 0.009 interactions 10 m ) was during a single dive in phoenix canyon at depths ranging from 1035 to 1172 m. here , abundance of n. bairdii was 0.041 individuals 10 m. the cutthroat eel , synaphobranchus spp . was the most abundant species observed ( n = 1785 individuals , 33 dives ) across the study area , but had the fewest ectoparasites . ( 2550 cm tl ) , whereas 68.2% of synaphobranchus individuals had no ectoparasites . of the individuals confirmed with parasites , 32% were infected with sphyriid copepods , 2% were infected with gnathiids , and 48% had unidentified parasites ( fig . 3 ) . for the remaining 30.4% of individuals the average number of parasites infecting a single side of an individual was 1.45 0.21 se parasites per side ( 13 ectoparasites per individual ) . the most intense infections ( 2.00 0.25 se ectoparasites per side ) were in canyon habitats ( table 3 ) . was observed at depths ranging from 500 to 2025 m and was most abundant ( 0.256 0.074 se individuals 10 m ) at depths of 1100 to 1400 m. ectoparasitism , however , was slightly more abundant at 800 to 1100 m , but not significantly higher ( k - w , x = 4.20 , p = 0.52 ) than other depth ranges ( fig . although synaphobranchus spp . were abundant in open slope habitats ( 0.165 0.083 se individuals 10 m ) , ectoparasite - host interactions did not differ among habitats ( k - w , x = 0.79 , p = 0.67 , fig . 5 , fig . ectoparasite - host interactions ranged from 0.002 0.001 to 0.003 0.003 se individuals 10 m in open slope , canyon , and cold - seep habitats . during a single dive , both the highest abundances of synaphobranchus spp . ( 0.68 individuals 10 m ) and ectoparasite - host interactions ( 0.014 individuals 10 m ) were observed in phoenix canyon at depths ranging from 1000 to 1170 m. no notable differences in behavior were observed for the majority of fishes infected with ectoparasites , particularly those infected with gnathiids . most of the individuals appeared to be either resting on the bottom [ e.g. , a. radiata , bathysaurus ferox , cottunculus thomsonii ] or swimming normally ( e.g. , sharks , chimaeras , ophidiids , morids , macrourids , synaphobranchids ) either close to or just a few meters above the seafloor . only a few of the fishes that had large ectoparasites appeared to be behaving abnormally . one n. bairdii individual with a sphyriid copepod hyperparasitized by eight leeches ( fig . 2c ) appeared to be underweight than other individuals of similar total lengths ( 15 cm tl ) . this individual was observed swimming in circles and appeared to be leaning towards one side ( suppl . one hoplostethus mediterraneus with a large cymothoid isopod on its left side was observed making short , erratic movements using its pectoral fins . finally , one synaphobranchus individual with a large ( 5 cm tl ) sphyriid copepod was swimming so close to the seafloor that both host and copepod were in contact with the sediment , perhaps increasing the chance for parasite removal . although rov lights and noise can alter individual fish behavior ( stoner et al . , 2008 ) , abnormal swimming behaviors were likely not an effect of the rov because these behaviors were not observed in numerous uninfected individuals . the following is the supplementary data related to this article : video s1nezumia bairdii with a sphyriid copepod hyperparasitized by eight leeches ( phoenix canyon , 8001100 m depth ) . video recorded by rov d2 during the noaa okeanos explorer program , 2014 atlantic canyons and seamounts expedition . nezumia bairdii with a sphyriid copepod hyperparasitized by eight leeches ( phoenix canyon , 8001100 m depth ) . video recorded by rov d2 during the noaa okeanos explorer program , 2014 atlantic canyons and seamounts expedition . rov video provided remarkable observations of ectoparasite infections on deep - sea fishes . these observations enabled us to determine that ectoparasitism occurs across a variety of depths ( 5003300 m ) , habitats ( seamounts , canyons , cold seeps , open slope ) , and host species ( 25 species ) along the northeastern u.s . we found that the abundance of ectoparasite - host interactions and intensity of infections peaked within particular depths and habitats depending upon the host species examined , but that submarine canyons may enhance ectoparasitism . we also found that species richness of ectoparasites declined with depth ; only gnathiids were observed at the deepest depths surveyed . thus , our results strengthen the notion that as temperature decreases ( poulin and rohde , 1997 ) and the number of host species decline ( campbell et al . , 1980 ) with increasing depth , the diversity of host - ectoparasite interactions decreases as well . we also note that , at least at the family level , ectoparasites infecting demersal fishes appear to be both generalist ( gnathiids , infecting 19 host species ) and specialist ( copepods , aegids , and cymothoids , each infecting 12 host species ) species , likely due to differences in parasite life cycles . although our estimates of ectoparasite diversity are conservative , as species can not be identified without collections , our study demonstrates the utility of using an rov to observe and count ectoparasite - host interactions across a variety of depths , habitats , and host species , while providing the opportunity to examine in situ the impact of ectoparasite infections on fish behavior . ectoparasitism was widespread across fish species , with 18 families of teleosts and chondrichthyans observed with ectoparasite infections . many ectoparasites have benthic life stages ( e.g. , smit and davies , 2004 ) and thus would more likely encounter a demersal fish host than a mesopelagic host . the majority of fish species harboring ectoparasites were both relatively abundant in the region and/or were habitat generalists ( auster et al . thus , the number of ectoparasite - host interactions could be a consequence of the host population size or the host adopting a generalist strategy by utilizing a wide range of niches , including food resources and habitats . other host behaviors , such as spawning ( e.g. , scyliorhinids ) or feeding on the benthos ( e.g. , n. bairdii , campbell et al . , 1980 ) or aggregating ( a. rostrata , iwamoto , 1975 ) , may also increase ectoparasite infections ( boxshall , 1998 ) . our study also revealed that demersal lifestyle alone , of hosts , was not sufficient to explain ectoparasite infections . the number of demersal host species ( 24 species ) with ectoparasites constituted approximately one third of all demersal species ( 69 species ) observed across the same depth range in the region ( table s1 , quattrini et al . , 2015 ) . although ectoparasite - host interactions may be underestimated , our results are comparable to those documented from deep - sea fishes ( to 1000 m ) collected off australia using surface - deployed gear ( e.g. , traps , trawls ) ( rohde et al . , 1995 ) . the absence of ectoparasites on several species might provide evidence of unoccupied niches for the ectoparasites ( rohde et al . , 1995 ) . alternatively , the absence of ectoparasites could be a result of a fish 's resistance to infection ( e.g. mucous production , skin / scale resiliency , coile and sikkel , 2013 ) , rarity of the fish host ( boxshall , 1998 ) or fish behavior ( boxshall , 1998 ) . the intensity of infections and the abundance of ectoparasite - host interactions was not a function of host abundance . ectoparasitism was not most abundant where both n. bairdii and a. rostrata were locally most abundant . furthermore , synaphobranchus spp . was the most abundant species observed ; yet ectoparasitism was relatively low in this species compared to the others . additionally , among the three dominant species , the infection intensity was highest in a. rostrata , yet all three species were common across depths and habitats and all are generalist feeders . scavenge ( collins et al . , 1999 , jamieson et al . , 2011 ) or feed on benthopelagic species and n. bairdii feeds mainly on benthic invertebrates ( campbell et al . , 1980 , perhaps the higher intensity of infections on a. rostrata relate to movement and/or aggregation of individuals ( boxshall , 1998 ) for reproduction ( iwamoto , 1975 , wenner and musick , 1977 ) . aggregating at a single , dominant spawning site or undergoing periodic re - distribution during reproduction ( white et al . higher infection intensity in a. rostrata may also be due to reduced resistance to infection . gnathiids could perhaps more easily penetrate a. rostrata , as this species has relatively large , overlapping cycloid scales . in addition to the ecology and biology of the host species , the ecology and life history traits of the ectoparasites also influence prevalence , specificity , and intensity of infections . compared to the other ectoparasite families , gnathiids infected a variety of host species ( 19 spp . ) across the entire depth range . a single species of gnathiid is known to infect numerous host species in shallow waters ( e.g. , coile and sikkel , 2013 ) . life history characteristics of gnathiids likely increase their ability to infect a variety of species and more than one host species in their lifetime ( lafferty and kuris , 2002 , jones et al . although the three larval stages of gnathiids are obligate fish parasites , between each stage , larval gnathiids return to the benthos ( e.g. , sponges , corals , serpulid tubeworms , tunicates , sediments , among rocks , wood ) to molt until infecting another species or until the final , non - feeding adult stage ( mouchet , 1928 , stoll , 1962 , upton , 1987 , jacoby and greenwood , 1988 , klitgaard , 1991 , smit et al . , 1999 , thus , gnathiids may have been so successful at colonizing , with high intensity , a diversity of host fishes from shallow waters to the deep sea because of attributes of their life cycle . in contrast to gnathiids , siphonostomatoids , aegids , and cymothoids isopods are known to be highly host specific ( wilson , 1919 , ho , 1985 , boxshall , 1998 , bunkley - williams and williams , 1998 , ross et al . , 2001 ) . in our study , siphonostomatoid copepods and aegid and cymothoid isopods infected four , two , and one species , respectively . for cymothoids and copepods , free - living juvenile stages attach to hosts and remain on the host for life until reproduction ( boxshall , 1998 , bunkley - williams and williams , 1998 ) . although these ectoparasites have reproductive strategies that would help them complete their life cycle in the deep sea [ e.g. , males parasitizing females ( copepods , boxshall , 1998 ) and hermaphroditism ( cymothoids , bunkley - williams and williams , 1998 ) ] , specializing on only a few host species may help increase encounter rates of male and females during periods of sexual reproduction . in contrast , aegids are temporary parasites , changing hosts during their lifetimes by settling on the benthos until infecting another species ( bunkley - williams and williams , 1998 ) . this behavior may result in higher infection rates of demersal fishes that feed on the benthos , such as n. bairdii and a. radiata ( e.g. , campbell et al . , 1980 ) . based on previous research , ectoparasites from the host - specific families observed in this study were most likely different species . leptodactylus gracilis has been reported from s. kaupii ( wilson , 1919 ) whereas leptodactylus pentaloba and leptodactylus bouvieri have been reported from n. bairdii ( wilson , 1919 , ho , 1985 ) . parabrachiella pinguis is the only lernaeopodid that has been reported from a. rostrata in the neus region ( wilson , 1915 , ho , 1985 ) . sarcotretes scopeli ( family pennellidae ) is the only copepod recorded from myctophids in the atlantic ( gartner and zwerner , 1989 , boxshall , 1998 ) . as for the isopods , the aegid syscenus infelix has been reported from n. bairdii along the neus slope ( ross et al . , 2001 ) . aega psora is the only aegid recorded from antimora radiata , documented only once in the bay of fundy ( wallace and huntsman , 1919 ) . one cymothoid was observed in this study , and to our knowledge constitutes the first record of ectoparasitism on h. mediterraneus . few cymothoids are known to inhabit deep waters ( brusca , 1981 ) , particularly below 800 m ( poore and bruce , 2012 ) . ectoparasite - host interactions were observed in all habitats , but our data suggest that submarine canyons may increase abundance of ectoparasite - host interactions , the number of host species infected , and the intensity of infections , at least for some species . canyons ( alvin , nygren , hydrographer , phoenix ) with the highest ectoparasite - host interactions observed contained relatively high numbers of fish species observed ( 1420 species per dive ) than other sites in the region ( see quattrini et al . , 2015 ) . additionally , for each dominant species , ectoparasite - host interactions were most abundant during a single dive in a canyon habitat . for a. rostrata , the mean abundance of ectoparasite - host interactions and the intensity of ectoparasite infections were also higher in submarine canyons than other habitats . ( 1980 ) found a higher endoparasite load in both a. rostrata and n. bairdii occupying canyon habitats in the same region . higher intensities of infections in canyon environments may in part be related to increased habitat heterogeneity , including higher abundances of both corals and sponges ( huvenne et al . , 2011 , quattrini et al . , 2015 ) . corals and sponges have been noted to house resting stages of gnathiid larvae ( klitgaard , 1991 ) . in fact , all resting larval and adult stages have been previously collected from a single sponge in deep waters ( 150487 m , klitgaard , 1991 ) , suggesting some site fidelity for parasites . , 2006 , oliveira et al . , 2007 ) , and have been documented with higher abundances of fauna compared to the surrounding slopes ( vetter and dayton , 1999 ) . it is possible that deep - sea fishes , including a. rostrata , are more actively feeding in submarine canyons , and thus these behaviors may increase infection rates of ectoparasites . peaks in both ectoparasite diversity and ectoparasite - host interactions were observed at mid - slope depths . ectoparasite - host interactions were most abundant at depths of 800 to 1100 m for a. rostrata and synaphobranchus spp . and at 500 to 800 m for n. bairdii . ectoparasitism diversity was highest at depths of 500 to 1400 m , and then declined with increasing depth . siphonostomatoid copepods , aegids , and cymothoids were absent at depths > 1400 m ; only gnathiids were observed at the deepest depths surveyed ( up to 3260 m ) . peaks at mid - slope depths appear to correspond to higher species richness of fishes . rov dives from the 20132014 expeditions documented fewer numbers of species ( 512 species per dive ) at deeper depths ( > 1400 m ) than in shallower ( 5001400 m ) depths ( 920 species per dive , see quattrini et al . , 2015 ) . the absence of the host - specific ectoparasites at deeper depths is due to decreased diversity and depth range limits of host species , similar to the endoparasite fauna sampled from fishes in the same region ( campbell et al . , 1980 ) . but in contrast to patterns in the endoparasite fauna , the number of ectoparasite - host interactions did not decrease linearly with depth in this region ; similar abundances of ectoparasite - host interactions were observed at depths > 1100 m ( campbell et al . , 1980 ) . in addition to host distribution , environmental conditions , such as temperature , could also limit the distribution of ectoparasites . temperature has a significant effect on the species richness of ectoparasite communities ( rohde et al . , 1995 ) . in the neus region , temperature changes from 4 - 5 c to 34 c at a depth boundary of approximately 1300 m , corresponding to a change in deep water masses ( pickart , 1992 ) . this study was part of a larger expedition that was not focused solely on documenting ectoparasites on deep - sea fishes . thus , we note a few methodological limitations and suggest modifications for future use of rovs to fully document ectoparasitism in the deep sea . due to inadequate camera angles , we were unable to determine whether ectoparasites were present on a portion of the dominant species . targeted rov surveys that incorporate frequent zooms and discrete collections , perhaps in combination with museum collections , would be best to elucidate fine - scale patterns of ectoparasitism in the deep sea . we acknowledge that further sampling across similar depths and habitats is necessary to resolve confounding effects of habitat and depth on the distribution of ectoparasites and ectoparasite - host interactions ; most effort was conducted at depths of 500 to 1100 m in canyon habitats . further quantification is necessary to determine whether submarine canyons significantly influence the prevalence , abundance , and infection intensity of ectoparasitism in deep - sea fishes . metazoan parasites are an important , yet overlooked , component of deep - sea communities . similar to shallow - water communities , an estimated 1.5 metazoan parasite species occur per fish species ; thus parasites likely have significant impacts on ecosystem functioning in the deep sea ( klimpel et al . , 2001 ) . in the present study , the widespread occurrence of ectoparasitism across a variety of host species , depths , habitats , and locations indicate that ectoparasites are a significant component of deep - sea biodiversity . because ectoparasitism is widespread and many fishes also have wide - ranging distributions ( e.g. , moore et al . , 2003 ) , ectoparasites could alter behavior and population dynamics of hosts , while increasing trophic connections ( amundsen et al . , 2009 , demopoulos and sikkel , 2015 ) in communities throughout the deep sea . understanding parasite ecology may thus serve as a proxy for determining healthy ecosystems ( hudson et al . , 2006 ) . for example , recent studies in shallow water ecosystems have demonstrated the important connections between fishes , ectoparasites , and cleaner species ( johnson et al . , 2010 ) ; disruptions to these connections can cause community changes ( e.g. , lafferty et al . , 2008 , sun et al . , 2015 ) . focused parasitology studies are sorely needed to further our understanding of the roles of parasites in both community and trophic ecology in the deep sea ( poulin et al . , 2016 ) . by demonstrating the widespread occurrence of ectoparasitism in the deep sea using visual based surveys , we hope that this study can serve as a basis for testing further hypotheses regarding the role of parasitism throughout the deep sea . amq analyzed the video , conducted analyses , and wrote the text with significant contributions from awjd .

a complete understanding of how parasites influence marine ecosystem functioning requires characterizing a broad range of parasite - host interactions while determining the effects of parasitism in a variety of habitats . in deep - sea fishes , the prevalence of parasitism remains poorly understood . knowledge of ectoparasitism , in particular , is limited because collection methods often cause dislodgment of ectoparasites from their hosts . high - definition video collected during 43 remotely operated vehicle surveys ( 20132014 ) provided the opportunity to examine ectoparasitism on fishes across habitats ( open slope , canyon , seamount , cold seep ) and depths ( 4944689 m ) off the northeastern u.s . , while providing high - resolution images and valuable observations of fish behavior . only 9% ( n = 125 individuals ) of all observed fishes ( 25 species ) were confirmed with ectoparasites , but higher percentages ( 33% ) were observed for some of the most abundant fish species ( e.g. , antimora rostrata ) . ectoparasites included two copepod families ( lernaeopodidae , sphyriidae ) that infected four host species , two isopod families ( cymothoidae , aegidae ) that infected three host species , and one isopod family ( gnathiidae ) that infected 19 host species . hyperparasitism was also observed . as host diversity declined with depth , ectoparasite diversity declined ; only gnathiids were observed at depths down to 3260 m. thus , gnathiids appear to be the most successful group to infect a diversity of fishes across a broad depth range in the deep sea . for three dominant fishes ( a. rostrata , nezumia bairdii , synaphobranchus spp . ) , the abundance and intensity of ectoparasitism peaked in different depths and habitats depending on the host species examined . notably , gnathiid infections were most intense on a. rostrata , particularly in submarine canyons , suggesting that these habitats may increase ectoparasite infections . although ectoparasitism is often overlooked in deep - sea benthic communities , our results demonstrate that it occurs widely across a variety of habitats , depths , and locations and is a significant component of deep - sea biodiversity .

the following terms were used to describe the different kinds of genetic maps used in this study , as suggested by hudson et al . ( 2012 ) : 1 ) sex - averaged map : a consensus map for both parents of a pedigree ; 2 ) consensus map : an integrated map based on segregation data from individual component maps ; 3 ) composite map : an integrated map of different individual component maps built by a marker - merging method ; and 4 ) component map : each of the maps used in the construction of a composite map . the graphics and the representations of genetic maps were produced with r 3.1.0 ( r core team 2014 ) . we used 14 base maps generated from seven different crosses to generate a composite genetic linkage map for p. pinaster . the first six maps were obtained from three controlled crosses ( pedigrees # 1 , # 2 , and # 3 in supplementary fig . s1 , supplementary material online ) between three different genotypes : corsica landes ( cl ) , morocco landes ( ml ) , and corsica morocco ( cm ) . in total , 106 , 117 , and 94 full - sibs the regression mapping algorithm of joinmap 4.1 ( van ooijen 2011 ) was used to produce two maps for each parental genotype ( one per cross ) , according to a two - way pseudotestcross mapping strategy ( grattapaglia and sederoff 1994 ) , using testcross markers ( i.e. , segregating in a 1:1 mendelian ratio ) only . the genetic maps were then combined into sex - averaged maps ( corsica , landes and morocco , see supplementary fig . s1 , supplementary material online ) with the function combine groups for map integration of joinmap 4.1 . more details on the construction of the maps can be found in lagraulet ( 2015 ) . the first population was a three - generation inbred pedigree consisting of an f2 population ( # 4 in supplementary fig . s1 , supplementary material online ) resulting from the selfing of an interprovenance tree ( landes corsica ) . the second population was a three - generation outbred pedigree ( g2 , # 5 ) resulting from a controlled cross of two intraprovenance hybrid trees ( landes landes ) . for the f2 population , two different sets of individuals were used to generate two maps ( f2_o and f2_n ) with the record algorithm ( van os et al . for the g2 population , one map for each parent ( g2 m and g2f ) was produced with the regression mapping algorithm of joinmap 4.1 ( van ooijen , 2011 ) . the f2_o , g2 m , and g2f maps included different marker types : aflp , single sequence repeat ( ssr ) , expressed sequence tag ( est ) , and snps from different arrays ( chancerel et al . 2011 , 2013 ) , whereas the f2_n map contained only snps from the 9k snp - array ( plomion et al . we made use of the large number of common markers and the high level of collinearity between the two f2 maps to construct a composite map ( referred to as f2c by plomion et al . the last four maps were generated from two different f1 crosses : c14c15 ( # 6 in supplementary fig . s1 , supplementary material online ) and gal1056oria6 ( # 7 ) . from the initial parental maps of the c14c15 mapping population described by de miguel ( 2012 ) , we mapped an additional set of 980 snps from the 12k snp - array described by chancerel et al . ( 2011 ) and 273 snps from a 1,536 snp - array ( sez - laguna et al . for both pedigrees , we used the maximum - likelihood mapping algorithm of joinmap 4.1 to generate individual genetic maps and sex - averaged maps . the four maps from the c14c15 and gal1056oria6 crosses contained different types of molecular markers ( ssrs , ests , sampls , and snps ) . for all maps , genetic distances in centimorgans ( cm ) were calculated with the kosambi mapping function ( kosambi 1943 ) . we carried out a literature review to identify previously published high - density gene - based linkage maps for members of the pinaceae family , for which sequence information was publicly available . eckert et al . ( 2010 ) provided a sex - averaged linkage map for a two - generation outbred pedigree based on snps for p. taeda ( accession number : the white spruce pedigree was an f1 full - sib family , whereas the black spruce pedigree was a backcross representing the hybridization species complex pic . lind et al . ( 2014 ) provided the most saturated and gene - rich map to date for pic . this map was a sex - averaged map of the two parents of an f1 controlled cross and was also constructed with the regression algorithm of joinmap 3.0 . a detailed list of mapping features for each component map included in this study is available in table 1 . a high - density linkage map for c. japonica was incorporated into this study , as a representative species from the cupressaceae family ( moriguchi et al . this map was constructed from an f1 full - sib family ( table 1 ) , with the regression mapping algorithm implemented in joinmap v 3.0 . the 17 maps described above were mostly constructed with snp markers ( 100% of the markers for picea sp . , 98% for p. pinaster , and 90% for p. taeda ) . the flanking sequences of each snp marker were compared with the most recent unigene sets available for each species to obtain the sequence of unigenes containing the mapped snps : canales et al . this comparison was carried out with the blastn tool ( the blast 1 step in fig . unigenes with a percentage identity exceeding 95% with mapped snp flanking sequences were retained for the next step . ( 2014 ) , pine v3 , was then used as the reference for the identification of homologous unigenes within pinaceae species . a second sequence comparison ( r - blast 2 in fig . 1a ) was performed , between the mapped unigenes of each species and the unigene sequences of pine v3 . for this interspecific comparison , only sequences with a reciprocal best hit with a percentage identity exceeding 85% , an e value below e , and an alignment of more than 200 bp were retained as homologous unigenes . homologous unigenes between different species were considered as orthologs if they were positioned in the same lg ( i.e. , syntenic unigenes ) . identified orthologous unigenes were used as anchor markers to construct a composite linkage map for each genus ( pinus and picea ) , as a preliminary step in the construction of a composite map for the pinaceae family including both genera . we used the r package lpmerge ( endelman and plomion 2014 ) to integrate component linkage maps into a composite map without the use of segregation data . lpmerge assessed the goodness of fit of the composite map by calculating a root mean squared error ( rmse ) per lg , by comparing the position ( in cm ) of all markers on the composite map with that on the component maps . we calculated this metric for different maximum interval sizes ( parameter k in the algorithm ) , ranging from 1 to 10 . the value of k minimizing the mean rmse per lg was selected for construction of the composite map . this method was used for the construction of all the composite species maps reported here . further details about the production of each composite map are described below . before integrating the 14 base genetic linkage maps into a single composite map , we established consensus maps ( supplementary fig . s1 , supplementary material online ) based on markers common to different accessions across pedigrees ( corsica , landes , morocco genotypes for pedigrees # 1 , # 2 , and # 3 , respectively ) , or accessions within pedigrees ( coca and gxo for pedigrees # 6 and # 7 , respectively ) , or based on the merging of different data sets of the same pedigree ( f2 for pedigree # 4 ) . this process , designed to increase the number of markers common to component maps , was facilitated by the use of the same 12k ( chancerel et al . 2013 ) and 9k ( plomion et al . 2015 ) snp - arrays for some pedigrees . the snp marker i d of each component map was replaced by the corresponding maritime pine unigene i d from canales et al . this step , which was essential for the use of lpmerge ( i.e. , same marker name for orthologous markers ) , also made it possible to check the collinearity between maps . thus , nonsyntenic unigenes between different p. pinaster linkage maps were removed from the analysis with the exception of those validated for at least two other component maps ( supplementary table s2 , supplementary material online ) . finally , lpmerge was used to create the composite map for p. pinaster . given that similar numbers of genotypes were used to obtain the base maps and the high degree of synteny between base maps , each component map was assigned the same weight in lpmerge . the snp marker i d of each species component map was replaced by the corresponding homologous unigene i d of p. pinaster ( canales et al . we established composite maps at genus level before integrating the four genetic maps for each species into a single composite map for pinaceae . this process was designed to increase the number of markers common to the component maps for each genus ( pinus and picea ) . lpmerge was used to build these two composite maps , following the same procedure as described for p. pinaster . we discarded nonsyntenic unigenes , except for nonsyntenic unigenes validated by at least two component maps in the p. pinaster composite map , from the construction of composite linkage maps . noncollinear unigenes with inversions of more than 15 cm were also excluded from the construction of the composite linkage map . abies ( lind et al . 2014 ) , when the map for this species was compared with that for pic . abies lg7 ( renamed lg2 after comparison with the p. pinaster reference map ) was reconstructed from genotyping data provided as supplementary material by lind et al . ( 2014 ) , using the same parameters described in lind s article and the same mapping software ( joinmap v4.1 ) . two markers with a log10 ( p ) > 1 that produced a large number of double recombinants were excluded from this lg map . we were thus able to map 16 additional markers , and a much higher degree of synteny and collinearity was found between the homologous lgs of pic . the available map for c. japonica consisted of 77% of snp markers ( moriguchi et al . sequences of unigenes containing the mapped snps were retrieved from the unigene set developed by ueno et al . 2014 ) mapped in the pinaceae composite map using tblastx ( blast 3 , fig . different e - value cutoff for homologous unigenes identification between pinaceae and c. japonica was tested : lower than 1e and 1e . selected homologs from the pinaceae and c. japonica linkage maps were used for comparative mapping . we established orthologous blocks within lgs where several homologous unigenes were shared between both families . different thresholds were also tested to consider an orthologous block within an lg : blocks with at least four and six shared unigenes . the most parsimonious evolutionary model between pinaceae and cupressaceae considering the existence of the identified cars was proposed . circular genetic maps used in interfamily comparative mapping were drawn with circos software ( krzywinski et al . the following terms were used to describe the different kinds of genetic maps used in this study , as suggested by hudson et al . ( 2012 ) : 1 ) sex - averaged map : a consensus map for both parents of a pedigree ; 2 ) consensus map : an integrated map based on segregation data from individual component maps ; 3 ) composite map : an integrated map of different individual component maps built by a marker - merging method ; and 4 ) component map : each of the maps used in the construction of a composite map . the graphics and the representations of genetic maps were produced with r 3.1.0 ( r core team 2014 ) . we used 14 base maps generated from seven different crosses to generate a composite genetic linkage map for p. pinaster . the first six maps were obtained from three controlled crosses ( pedigrees # 1 , # 2 , and # 3 in supplementary fig . s1 , supplementary material online ) between three different genotypes : corsica landes ( cl ) , morocco landes ( ml ) , and corsica morocco ( cm ) . in total , 106 , 117 , and 94 full - sibs the regression mapping algorithm of joinmap 4.1 ( van ooijen 2011 ) was used to produce two maps for each parental genotype ( one per cross ) , according to a two - way pseudotestcross mapping strategy ( grattapaglia and sederoff 1994 ) , using testcross markers ( i.e. , segregating in a 1:1 mendelian ratio ) only . the genetic maps were then combined into sex - averaged maps ( corsica , landes and morocco , see supplementary fig . s1 , supplementary material online ) with the function combine groups for map integration of joinmap 4.1 . more details on the construction of the maps can be found in lagraulet ( 2015 ) . the first population was a three - generation inbred pedigree consisting of an f2 population ( # 4 in supplementary fig . s1 , supplementary material online ) resulting from the selfing of an interprovenance tree ( landes corsica ) . the second population was a three - generation outbred pedigree ( g2 , # 5 ) resulting from a controlled cross of two intraprovenance hybrid trees ( landes landes ) . for the f2 population , two different sets of individuals were used to generate two maps ( f2_o and f2_n ) with the record algorithm ( van os et al . for the g2 population , one map for each parent ( g2 m and g2f ) was produced with the regression mapping algorithm of joinmap 4.1 ( van ooijen , 2011 ) . the f2_o , g2 m , and g2f maps included different marker types : aflp , single sequence repeat ( ssr ) , expressed sequence tag ( est ) , and snps from different arrays ( chancerel et al . 2011 , 2013 ) , whereas the f2_n map contained only snps from the 9k snp - array ( plomion et al . we made use of the large number of common markers and the high level of collinearity between the two f2 maps to construct a composite map ( referred to as f2c by plomion et al . the last four maps were generated from two different f1 crosses : c14c15 ( # 6 in supplementary fig . s1 , supplementary material online ) and gal1056oria6 ( # 7 ) . from the initial parental maps of the c14c15 mapping population described by de miguel ( 2012 ) , we mapped an additional set of 980 snps from the 12k snp - array described by chancerel et al . ( 2011 ) and 273 snps from a 1,536 snp - array ( sez - laguna et al . for both pedigrees , we used the maximum - likelihood mapping algorithm of joinmap 4.1 to generate individual genetic maps and sex - averaged maps . the four maps from the c14c15 and gal1056oria6 crosses contained different types of molecular markers ( ssrs , ests , sampls , and snps ) . for all maps , genetic distances in centimorgans ( cm ) were calculated with the kosambi mapping function ( kosambi 1943 ) . we carried out a literature review to identify previously published high - density gene - based linkage maps for members of the pinaceae family , for which sequence information was publicly available . eckert et al . ( 2010 ) provided a sex - averaged linkage map for a two - generation outbred pedigree based on snps for p. taeda ( accession number : the white spruce pedigree was an f1 full - sib family , whereas the black spruce pedigree was a backcross representing the hybridization species complex pic . lind et al . ( 2014 ) provided the most saturated and gene - rich map to date for pic . this map was a sex - averaged map of the two parents of an f1 controlled cross and was also constructed with the regression algorithm of joinmap 3.0 . a detailed list of mapping features for each component map included in this study is available in table 1 . a high - density linkage map for c. japonica was incorporated into this study , as a representative species from the cupressaceae family ( moriguchi et al . this map was constructed from an f1 full - sib family ( table 1 ) , with the regression mapping algorithm implemented in joinmap v 3.0 . we used 14 base maps generated from seven different crosses to generate a composite genetic linkage map for p. pinaster . the first six maps were obtained from three controlled crosses ( pedigrees # 1 , # 2 , and # 3 in supplementary fig . s1 , supplementary material online ) between three different genotypes : corsica landes ( cl ) , morocco landes ( ml ) , and corsica morocco ( cm ) . in total , 106 , 117 , and 94 full - sibs the regression mapping algorithm of joinmap 4.1 ( van ooijen 2011 ) was used to produce two maps for each parental genotype ( one per cross ) , according to a two - way pseudotestcross mapping strategy ( grattapaglia and sederoff 1994 ) , using testcross markers ( i.e. , segregating in a 1:1 mendelian ratio ) only . the genetic maps were then combined into sex - averaged maps ( corsica , landes and morocco , see supplementary fig . s1 , supplementary material online ) with the function combine groups for map integration of joinmap 4.1 . more details on the construction of the maps can be found in lagraulet ( 2015 ) . the first population was a three - generation inbred pedigree consisting of an f2 population ( # 4 in supplementary fig . s1 , supplementary material online ) resulting from the selfing of an interprovenance tree ( landes corsica ) . the second population was a three - generation outbred pedigree ( g2 , # 5 ) resulting from a controlled cross of two intraprovenance hybrid trees ( landes landes ) . for the f2 population , two different sets of individuals were used to generate two maps ( f2_o and f2_n ) with the record algorithm ( van os et al . for the g2 population , one map for each parent ( g2 m and g2f ) was produced with the regression mapping algorithm of joinmap 4.1 ( van ooijen , 2011 ) . the f2_o , g2 m , and g2f maps included different marker types : aflp , single sequence repeat ( ssr ) , expressed sequence tag ( est ) , and snps from different arrays ( chancerel et al . 2011 , 2013 ) , whereas the f2_n map contained only snps from the 9k snp - array ( plomion et al . we made use of the large number of common markers and the high level of collinearity between the two f2 maps to construct a composite map ( referred to as f2c by plomion et al . the last four maps were generated from two different f1 crosses : c14c15 ( # 6 in supplementary fig . s1 , supplementary material online ) and gal1056oria6 ( # 7 ) . from the initial parental maps of the c14c15 mapping population described by de miguel ( 2012 ) , we mapped an additional set of 980 snps from the 12k snp - array described by chancerel et al . ( 2011 ) and 273 snps from a 1,536 snp - array ( sez - laguna et al . for both pedigrees , we used the maximum - likelihood mapping algorithm of joinmap 4.1 to generate individual genetic maps and sex - averaged maps . the four maps from the c14c15 and gal1056oria6 crosses contained different types of molecular markers ( ssrs , ests , sampls , and snps ) . for all maps , genetic distances in centimorgans ( cm ) were calculated with the kosambi mapping function ( kosambi 1943 ) . we carried out a literature review to identify previously published high - density gene - based linkage maps for members of the pinaceae family , for which sequence information was publicly available . eckert et al . ( 2010 ) provided a sex - averaged linkage map for a two - generation outbred pedigree based on snps for p. taeda ( accession number : tg091 , http://dendrome.ucdavis.edu/cmap/ , last accessed may 21 , 2015 ) . the map provided by pavy et al . the white spruce pedigree was an f1 full - sib family , whereas the black spruce pedigree was a backcross representing the hybridization species complex pic . lind et al . ( 2014 ) provided the most saturated and gene - rich map to date for pic . this map was a sex - averaged map of the two parents of an f1 controlled cross and was also constructed with the regression algorithm of joinmap 3.0 . a detailed list of mapping features for each component map included in this study is available in table 1 . a high - density linkage map for c. japonica was incorporated into this study , as a representative species from the cupressaceae family ( moriguchi et al . this map was constructed from an f1 full - sib family ( table 1 ) , with the regression mapping algorithm implemented in joinmap v 3.0 . the 17 maps described above were mostly constructed with snp markers ( 100% of the markers for picea the flanking sequences of each snp marker were compared with the most recent unigene sets available for each species to obtain the sequence of unigenes containing the mapped snps : canales et al . this comparison was carried out with the blastn tool ( the blast 1 step in fig . unigenes with a percentage identity exceeding 95% with mapped snp flanking sequences were retained for the next step . ( 2014 ) , pine v3 , was then used as the reference for the identification of homologous unigenes within pinaceae species . a second sequence comparison ( r - blast 2 in fig . 1a ) was performed , between the mapped unigenes of each species and the unigene sequences of pine v3 . for this interspecific comparison , only sequences with a reciprocal best hit with a percentage identity exceeding 85% , an e value below e , and an alignment of more than 200 bp were retained as homologous unigenes . homologous unigenes between different species were considered as orthologs if they were positioned in the same lg ( i.e. , syntenic unigenes ) . identified orthologous unigenes were used as anchor markers to construct a composite linkage map for each genus ( pinus and picea ) , as a preliminary step in the construction of a composite map for the pinaceae family including both genera . we used the r package lpmerge ( endelman and plomion 2014 ) to integrate component linkage maps into a composite map without the use of segregation data . lpmerge assessed the goodness of fit of the composite map by calculating a root mean squared error ( rmse ) per lg , by comparing the position ( in cm ) of all markers on the composite map with that on the component maps . we calculated this metric for different maximum interval sizes ( parameter k in the algorithm ) , ranging from 1 to 10 . the value of k minimizing the mean rmse per lg was selected for construction of the composite map . this method was used for the construction of all the composite species maps reported here . further details about the production of each composite map are described below . before integrating the 14 base genetic linkage maps into a single composite map , we established consensus maps ( supplementary fig . s1 , supplementary material online ) based on markers common to different accessions across pedigrees ( corsica , landes , morocco genotypes for pedigrees # 1 , # 2 , and # 3 , respectively ) , or accessions within pedigrees ( coca and gxo for pedigrees # 6 and # 7 , respectively ) , or based on the merging of different data sets of the same pedigree ( f2 for pedigree # 4 ) . this process , designed to increase the number of markers common to component maps , was facilitated by the use of the same 12k ( chancerel et al . 2013 ) and 9k ( plomion et al . 2015 ) snp - arrays for some pedigrees . the snp marker i d of each component map was replaced by the corresponding maritime pine unigene i d from canales et al . this step , which was essential for the use of lpmerge ( i.e. , same marker name for orthologous markers ) , also made it possible to check the collinearity between maps . thus , nonsyntenic unigenes between different p. pinaster linkage maps were removed from the analysis with the exception of those validated for at least two other component maps ( supplementary table s2 , supplementary material online ) . given that similar numbers of genotypes were used to obtain the base maps and the high degree of synteny between base maps , each component map was assigned the same weight in lpmerge . the snp marker i d of each species component map was replaced by the corresponding homologous unigene i d of p. pinaster ( canales et al . we established composite maps at genus level before integrating the four genetic maps for each species into a single composite map for pinaceae . this process was designed to increase the number of markers common to the component maps for each genus ( pinus and picea ) . lpmerge was used to build these two composite maps , following the same procedure as described for p. pinaster . we discarded nonsyntenic unigenes , except for nonsyntenic unigenes validated by at least two component maps in the p. pinaster composite map , from the construction of composite linkage maps . noncollinear unigenes with inversions of more than 15 cm were also excluded from the construction of the composite linkage map . abies ( lind et al . 2014 ) , when the map for this species was compared with that for pic . abies lg7 ( renamed lg2 after comparison with the p. pinaster reference map ) was reconstructed from genotyping data provided as supplementary material by lind et al . ( 2014 ) , using the same parameters described in lind s article and the same mapping software ( joinmap v4.1 ) . two markers with a log10 ( p ) > 1 that produced a large number of double recombinants were excluded from this lg map . we were thus able to map 16 additional markers , and a much higher degree of synteny and collinearity was found between the homologous lgs of pic . before integrating the 14 base genetic linkage maps into a single composite map , we established consensus maps ( supplementary fig . s1 , supplementary material online ) based on markers common to different accessions across pedigrees ( corsica , landes , morocco genotypes for pedigrees # 1 , # 2 , and # 3 , respectively ) , or accessions within pedigrees ( coca and gxo for pedigrees # 6 and # 7 , respectively ) , or based on the merging of different data sets of the same pedigree ( f2 for pedigree # 4 ) . this process , designed to increase the number of markers common to component maps , was facilitated by the use of the same 12k ( chancerel et al . 2013 ) and 9k ( plomion et al . 2015 ) snp - arrays for some pedigrees . the snp marker i d of each component map was replaced by the corresponding maritime pine unigene i d from canales et al . this step , which was essential for the use of lpmerge ( i.e. , same marker name for orthologous markers ) , also made it possible to check the collinearity between maps . thus , nonsyntenic unigenes between different p. pinaster linkage maps were removed from the analysis with the exception of those validated for at least two other component maps ( supplementary table s2 , supplementary material online ) . given that similar numbers of genotypes were used to obtain the base maps and the high degree of synteny between base maps , each component map was assigned the same weight in lpmerge . the snp marker i d of each species component map was replaced by the corresponding homologous unigene i d of p. pinaster ( canales et al . we established composite maps at genus level before integrating the four genetic maps for each species into a single composite map for pinaceae . this process was designed to increase the number of markers common to the component maps for each genus ( pinus and picea ) . lpmerge was used to build these two composite maps , following the same procedure as described for p. pinaster . we discarded nonsyntenic unigenes , except for nonsyntenic unigenes validated by at least two component maps in the p. pinaster composite map , from the construction of composite linkage maps . noncollinear unigenes with inversions of more than 15 cm were also excluded from the construction of the composite linkage map . abies ( lind et al . 2014 ) , when the map for this species was compared with that for pic . abies lg7 ( renamed lg2 after comparison with the p. pinaster reference map ) was reconstructed from genotyping data provided as supplementary material by lind et al . ( 2014 ) , using the same parameters described in lind s article and the same mapping software ( joinmap v4.1 ) . two markers with a log10 ( p ) > 1 that produced a large number of double recombinants were excluded from this lg map . we were thus able to map 16 additional markers , and a much higher degree of synteny and collinearity was found between the homologous lgs of pic . the available map for c. japonica consisted of 77% of snp markers ( moriguchi et al . 2012 ) . sequences of unigenes containing the mapped snps were retrieved from the unigene set developed by ueno et al . 2014 ) mapped in the pinaceae composite map using tblastx ( blast 3 , fig . different e - value cutoff for homologous unigenes identification between pinaceae and c. japonica was tested : lower than 1e and 1e . selected homologs from the pinaceae and c. japonica linkage maps were used for comparative mapping . we established orthologous blocks within lgs where several homologous unigenes were shared between both families . different thresholds were also tested to consider an orthologous block within an lg : blocks with at least four and six shared unigenes . the most parsimonious evolutionary model between pinaceae and cupressaceae considering the existence of the identified cars was proposed . circular genetic maps used in interfamily comparative mapping were drawn with circos software ( krzywinski et al . all the linkage maps described here are available from the pinus portal ( a european genetic and genomic resource for pinus ) through the pinusmap application ( https://w3.pierroton.inra.fr/pinusportal/index.php ) . accession numbers for marker sequences used in this study are available in supplementary table s3 , supplementary material online . supplementary figures s1s5 and tables s1s3 are available at genome biology and evolution online ( http://www.gbe.oxfordjournals.org/ ) .

although recent advances have been gained on genome evolution in angiosperm lineages , virtually nothing is known about karyotype evolution in the other group of seed plants , the gymnosperms . here , we used high - density gene - based linkage mapping to compare the karyotype structure of two families of conifers ( the most abundant group of gymnosperms ) separated around 290 ma : pinaceae and cupressaceae . we propose for the first time a model based on the fusion of 20 ancestral chromosomal blocks that may have shaped the modern karyotpes of pinaceae ( with n = 12 ) and cupressaceae ( with n = 11 ) . the considerable difference in modern genome organization between these two lineages contrasts strongly with the remarkable level of synteny already reported within the pinaceae . it also suggests a convergent evolutionary mechanism of chromosomal block shuffling that has shaped the genomes of the spermatophytes .

kearns sayre syndrome ( kss ) is a rare mitochondrial cytopathy , first described at mayo clinic in 1958.1 kss belongs to a group of mitochondrial dna ( mtdna ) deletion syndromes that also includes pearson syndrome and progressive external ophthalmoplegia ( peo).2 classically , kss has a triad of features , including presence of peo , pigmentary retinopathy , and an age of onset younger than 20 years.1,3,4 additionally , one or more of the following features must be present to make the diagnosis of kss : 1 ) heart block , 2 ) cerebellar ataxia , or 3 ) increased cerebrospinal fluid ( csf ) protein level ( > 100 mg / dl).1,3,4 patients with peo who meet some , but not all , of the criteria for kss have been termed as having kss minus or peo plus.2 although the diagnosis of kss is based on clinical criteria , confirmation with muscle biopsy and genetic testing is now routine.3 muscle biopsy reveals characteristic ragged red fibers on trichrome stain and hyperactive fibers with succinate dehydrogenase stain.3 in terms of genetic testing , most patients with kss have large ( 1.310 kb ) mtdna deletions.2,3 treatment of kss includes monitoring for the development of ophthalmologic manifestations and , if present , consideration of their surgical management . many patients are given supplements , such as coenzyme q10.5 current guidelines recommend permanent pacemaker implantation for patients with neuromuscular diseases with atrioventricular block , and this includes kss.6 clinically , kss is a heterogeneous neurodegenerative syndrome involving the musculoskeletal , central nervous , cardiovascular , and endocrine systems . the current literature on kss primarily consists of case reports or small case series that use clinical diagnostic criteria . in the case series , ptosis , ophthalmoplegia , and cricopharyngeal dysphagia are commonly recognized symptoms.7 onset of disease usually occurs in childhood , with death commonly reported in early adulthood.2 published case series of patients with mitochondrial diseases8,9 have included patients with kss . the largest case series to date incorporated 136 patients with large - scale mtdna deletions and included 33 japanese adults and children with kss.10 this study found an inverse association between the length of the deletion and the age at which kss was diagnosed . despite these existing studies , kss remains a difficult syndrome to recognize because of the variety of clinical manifestations and the lack of any large case series to date . because kss is rare , an accurate description of its phenotype is needed for clinicians to recognize the syndrome . our objective was to characterize these patients with kss in terms of their demographic characteristics , presenting signs and symptoms , diagnostic features , clinical evolution , and associations between disease features and the development of disability . the study cohort was identified by using the previously validated medical index database at mayo clinic , rochester , minnesota.11 the database classified patients with kss using an internal coding system based on the hospital adaptation of the international classification of diseases , eighth revision.11 additional searches , using alternative coding systems such as systematized nomenclature , were completed and revealed no additional cases . this computerized medical record search of patients seen from 1976 through 2009 identified 37 patient cases . one of the identified patients had a family history of kss but no personal diagnosis of the syndrome and was therefore excluded . a second patient did not provide consent to use his medical records for research and was also excluded . therefore , 35 cases were used for data collection in this study . all diagnoses of kss were confirmed by examining patients medical records for the triad of peo , pigmentary retinopathy , and an age of onset younger than 20 years.1,3,4 additionally , one or more of the following were required for the diagnosis of kss : 1 ) heart block , 2 ) cerebellar ataxia , or 3 ) increased csf protein level ( > 100 mg / dl).1,3,4 additional abstracted data included patient demographic characteristics ( sex , age at diagnosis , family history of kss , and family history of any mitochondrial disorder ) ; diagnostic features ( presence of an mtdna mutation , muscle biopsy results , and protein concentrations in the csf ) ; major presenting symptom leading to the diagnosis of kss ; laboratory studies at diagnosis ( hematocrit , leukocyte count , platelet count , and levels of hemoglobin , creatinine , calcium , aspartate aminotransferase , creatinine kinase , serum lactate , and pyruvate ) ; relevant clinical features that developed during follow up ( ophthalmologic , neurologic , or endocrine ) ; mortality ; cardiovascular symptoms ( syncope , dilated cardiomyopathy , cardiac arrest , pacemaker implantation , pacemaker indication , and sudden cardiac death ) ; and electrocardiographic ( ecg ) abnormalities ( heart block , conduction delay , axis deviation , and preexcitation ) . additionally , the severity of kss was rated by whether the patient was independently ambulatory or used a gait aid or wheelchair . this method was modified from the kurtzke expanded disability status scale.12 continuous data were reported as mean ( standard deviation [ sd ] ) , and discrete data were reported as number of patients ( % ) . associations between severity of kss ( ambulatory versus [ vs ] use of gait aid or wheelchair ) and patient characteristics ( sex and confirmation of kss diagnosis ) , presence of a genetic mutation , presence of a muscle defect on biopsy , presence of deafness , presence of cognitive decline , and death were determined using a two - tailed fisher s exact text . statistical analyses were conducted using sas ( sas institute inc . , cary , nc , usa ) . the study cohort was identified by using the previously validated medical index database at mayo clinic , rochester , minnesota.11 the database classified patients with kss using an internal coding system based on the hospital adaptation of the international classification of diseases , eighth revision.11 additional searches , using alternative coding systems such as systematized nomenclature , were completed and revealed no additional cases . this computerized medical record search of patients seen from 1976 through 2009 identified 37 patient cases . one of the identified patients had a family history of kss but no personal diagnosis of the syndrome and was therefore excluded . a second patient did not provide consent to use his medical records for research and was also excluded . therefore , 35 cases were used for data collection in this study . all diagnoses of kss were confirmed by examining patients medical records for the triad of peo , pigmentary retinopathy , and an age of onset younger than 20 years.1,3,4 additionally , one or more of the following were required for the diagnosis of kss : 1 ) heart block , 2 ) cerebellar ataxia , or 3 ) increased csf protein level ( > 100 mg / dl).1,3,4 additional abstracted data included patient demographic characteristics ( sex , age at diagnosis , family history of kss , and family history of any mitochondrial disorder ) ; diagnostic features ( presence of an mtdna mutation , muscle biopsy results , and protein concentrations in the csf ) ; major presenting symptom leading to the diagnosis of kss ; laboratory studies at diagnosis ( hematocrit , leukocyte count , platelet count , and levels of hemoglobin , creatinine , calcium , aspartate aminotransferase , creatinine kinase , serum lactate , and pyruvate ) ; relevant clinical features that developed during follow up ( ophthalmologic , neurologic , or endocrine ) ; mortality ; cardiovascular symptoms ( syncope , dilated cardiomyopathy , cardiac arrest , pacemaker implantation , pacemaker indication , and sudden cardiac death ) ; and electrocardiographic ( ecg ) abnormalities ( heart block , conduction delay , axis deviation , and preexcitation ) . additionally , the severity of kss was rated by whether the patient was independently ambulatory or used a gait aid or wheelchair . continuous data were reported as mean ( standard deviation [ sd ] ) , and discrete data were reported as number of patients ( % ) . associations between severity of kss ( ambulatory versus [ vs ] use of gait aid or wheelchair ) and patient characteristics ( sex and confirmation of kss diagnosis ) , presence of a genetic mutation , presence of a muscle defect on biopsy , presence of deafness , presence of cognitive decline , and death were determined using a two - tailed fisher s exact text . statistical analyses were conducted using sas ( sas institute inc . , cary , nc , usa ) . most patients ( 28 [ 80% ] ) had available information in the chart to confirm the treating physicians diagnosis of kss , based on accepted criteria.1,3,4 most patients were male ( 24 [ 69% ] ) , and all patients were white except for one , who was african american . the mean ( sd ) age at kss presentation was 17 ( 10 ) years , but the mean age at diagnosis was 26 ( 15 ) years . none of the patients had a documented family history of kss , although one patient had a family member with mitochondrial encephalomyopathy , lactic acidosis , and strokelike episodes ( melas syndrome ) . additionally , one patient had a sister with ataxia without a formal diagnosis of a mitochondrial disorder . fifteen patients ( 43% ) underwent genetic testing for an mtdna mutation consistent with kss , and abnormalities were found in 12 of these ( 80% ) . muscle biopsy was performed in 17 patients ( 49% ) , 15 ( 88% ) of whom had results consistent with a mitochondrial myopathy . csf was tested in only five patients ( 14% ) , which showed an increased protein value in only two . in the 16 patients who had no genetic or muscle testing , the diagnosis of kss was made on a clinical basis only ; in general , these patients were older . analysis of the major presenting signs and symptoms leading to the diagnosis of kss ( table 2 ) showed that most patients ( 22 [ 63% ] ) initially had an abnormality of the ophthalmologic system . of these ophthalmologic presenting symptoms , ptosis was the most common ( 16 [ 46% ] ) ; the other six patients had retinal pigment in the characteristic salt and pepper13 distribution ( three patients ) , diplopia ( two patients ) , and decreased vision ( one patient ) . neurologic symptoms were the next most common ( six [ 17% ] ) , which included nonspecific weakness ( four ) , ataxia ( one ) , and hearing loss ( one ) . in one patient ( 3% ) , delayed puberty was the initial symptom of kss . at the time of kss diagnosis , no significant abnormalities were found in the hemoglobin , hematocrit , leukocyte count , platelet count , or creatinine , calcium , or aspartate aminotransferase levels in any of the patients tested . however , four of the 20 patients with data available had small increases in creatinine kinase value . < 2.3 mmol / l ) in six of 18 patients ( 33% ) at diagnosis , with only one patient having a level higher than 5 only four patients ( 11% ) died during the study period ( average duration of follow - up of 10.8 years ) . the mean ( sd ) age at death was 46 ( 23 ) years , and all patients died of sudden cardiac death . an ophthalmologic abnormality developed in all patients as a part of their kss . peo was present in 31 patients ( 89% ) , and ptosis developed in 30 ( 86% ) , 17 of whom underwent surgery for ptosis at least once . pigmentary retinopathy ( 25 [ 71% ] ) and visual loss ( ten [ 29% ] ) were also noted . weakness was found in 27 patients ( 77% ) , which varied from mild weakness to extreme debility . other symptoms included ataxia , deafness , cognitive decline , dysphagia , dysarthria , and seizure disorder . additional clinical features in patients with kss were short stature ( ten [ 9% ] ) , developmental delay ( four [ 11% ] ) , and encephalopathy ( two [ 6% ] ) . cardiovascular features that developed during follow up ( table 3 ) included syncope and dilated cardiomyopathy as the most frequently described symptoms ( six patients each [ 17% ] ) . one patient died of heart failure , and five ( 14% ) had survived a previous cardiac arrest . permanent pacemaker / implantable cardioverter - defibrillator ( ppm / icd ) devices were implanted in eleven patients ( 31% ) . the indications for ppm / icd placement included high - grade heart block , bradycardia , a combination of heart block and bradycardia , and widening of the qrs complex . importantly , the four patients who died all died of sudden cardiac death , and only one of these patients had a ppm / icd in place . the other three patients had no prior ecg changes to indicate ppm / icd placement . nonetheless , one patient had prior syncope , and one patient had a previous cardiac arrest and ventricular arrhythmias . heart blocks ( eleven [ 31% ] ) included first degree , second degree type i , second degree type ii , and third degree . conduction delays occurred in 23 patients ( 66% ) , and ten patients ( 29% ) had an axis deviation . preexcitation in the form of wolff parkinson white syndrome was seen in two patients ( 6% ) , and two patients ( 6% ) had a history of ventricular arrhythmias . at their last visit to mayo clinic , six patients ( 17% ) used a wheelchair , and four ( 11% ) noted some gait instability requiring the use of a gait assist device . two young adults noted that they were unable to work because of disease - related issues , including heart failure and fatigue . however , 25 of the patients in this study ( 71% ) had no disability from the mitochondrial myopathy . statistical analysis indicated that the presence of disability , defined as the use of a gait aid or wheelchair , was associated only with cognitive decline ( p=0.004 ) . there were no statistically significant associations between disability and patient sex , diagnosis , genetic defect , muscle defect , deafness , or sudden cardiac death ( table 4 ) most patients ( 28 [ 80% ] ) had available information in the chart to confirm the treating physicians diagnosis of kss , based on accepted criteria.1,3,4 most patients were male ( 24 [ 69% ] ) , and all patients were white except for one , who was african american . the mean ( sd ) age at kss presentation was 17 ( 10 ) years , but the mean age at diagnosis was 26 ( 15 ) years . none of the patients had a documented family history of kss , although one patient had a family member with mitochondrial encephalomyopathy , lactic acidosis , and strokelike episodes ( melas syndrome ) . additionally , one patient had a sister with ataxia without a formal diagnosis of a mitochondrial disorder . fifteen patients ( 43% ) underwent genetic testing for an mtdna mutation consistent with kss , and abnormalities were found in 12 of these ( 80% ) . muscle biopsy was performed in 17 patients ( 49% ) , 15 ( 88% ) of whom had results consistent with a mitochondrial myopathy . csf was tested in only five patients ( 14% ) , which showed an increased protein value in only two . in the 16 patients who had no genetic or muscle testing , the diagnosis of kss was made on a clinical basis only ; in general , these patients were older . analysis of the major presenting signs and symptoms leading to the diagnosis of kss ( table 2 ) showed that most patients ( 22 [ 63% ] ) initially had an abnormality of the ophthalmologic system . of these ophthalmologic presenting symptoms , ptosis was the most common ( 16 [ 46% ] ) ; the other six patients had retinal pigment in the characteristic salt and pepper13 distribution ( three patients ) , diplopia ( two patients ) , and decreased vision ( one patient ) . neurologic symptoms were the next most common ( six [ 17% ] ) , which included nonspecific weakness ( four ) , ataxia ( one ) , and hearing loss ( one ) . in one patient ( 3% ) , delayed puberty was the initial symptom of kss . at the time of kss diagnosis , no significant abnormalities were found in the hemoglobin , hematocrit , leukocyte count , platelet count , or creatinine , calcium , or aspartate aminotransferase levels in any of the patients tested . however , four of the 20 patients with data available had small increases in creatinine kinase value . < 2.3 mmol / l ) in six of 18 patients ( 33% ) at diagnosis , with only one patient having a level higher than 5 mmol / l . only four patients ( 11% ) died during the study period ( average duration of follow - up of 10.8 years ) . the mean ( sd ) age at death was 46 ( 23 ) years , and all patients died of sudden cardiac death . an ophthalmologic abnormality developed in all patients as a part of their kss . peo was present in 31 patients ( 89% ) , and ptosis developed in 30 ( 86% ) , 17 of whom underwent surgery for ptosis at least once . pigmentary retinopathy ( 25 [ 71% ] ) and visual loss ( ten [ 29% ] ) were also noted . weakness was found in 27 patients ( 77% ) , which varied from mild weakness to extreme debility . other symptoms included ataxia , deafness , cognitive decline , dysphagia , dysarthria , and seizure disorder . additional clinical features in patients with kss were short stature ( ten [ 9% ] ) , developmental delay ( four [ 11% ] ) , and encephalopathy ( two [ 6% ] ) . cardiovascular features that developed during follow up ( table 3 ) included syncope and dilated cardiomyopathy as the most frequently described symptoms ( six patients each [ 17% ] ) . one patient died of heart failure , and five ( 14% ) had survived a previous cardiac arrest . permanent pacemaker / implantable cardioverter - defibrillator ( ppm / icd ) devices were implanted in eleven patients ( 31% ) . the indications for ppm / icd placement included high - grade heart block , bradycardia , a combination of heart block and bradycardia , and widening of the qrs complex . importantly , the four patients who died all died of sudden cardiac death , and only one of these patients had a ppm / icd in place . the other three patients had no prior ecg changes to indicate ppm / icd placement . nonetheless , one patient had prior syncope , and one patient had a previous cardiac arrest and ventricular arrhythmias . heart blocks ( eleven [ 31% ] ) included first degree , second degree type i , second degree type ii , and third degree . conduction delays occurred in 23 patients ( 66% ) , and ten patients ( 29% ) had an axis deviation . preexcitation in the form of wolff parkinson white syndrome was seen in two patients ( 6% ) , and two patients ( 6% ) had a history of ventricular arrhythmias . at their last visit to mayo clinic , six patients ( 17% ) used a wheelchair , and four ( 11% ) noted some gait instability requiring the use of a gait assist device . two young adults noted that they were unable to work because of disease - related issues , including heart failure and fatigue . however , 25 of the patients in this study ( 71% ) had no disability from the mitochondrial myopathy . statistical analysis indicated that the presence of disability , defined as the use of a gait aid or wheelchair , was associated only with cognitive decline ( p=0.004 ) . there were no statistically significant associations between disability and patient sex , diagnosis , genetic defect , muscle defect , deafness , or sudden cardiac death ( table 4 ) . we found that patients with kss all had ophthalmologic symptoms and commonly had neurologic and cardiac involvement . this finding is consistent with current diagnostic criteria for kss.1,3,4 however , the findings of this study , may dispute some commonly held beliefs regarding kss , including lack of certain diseases or laboratory associations , and longevity beyond middle adulthood . only four of 35 patients in our series died ( 11% ) , but all deaths were from sudden cardiac events . although most of these patients had no ecg changes to indicate the need for ppm / icd placement , our findings support previous recommendations to carefully consider the placement of such devices in patients with kss . finally , we found that the development of physical disability ( need for a gait aid or wheelchair ) was significantly associated with cognitive decline but not with other clinical features , such as sex or sudden cardiac death . extraocular muscles have a high energy requirement , and mitochondria make up approximately 60% of the cell volume in eye muscles.8 not surprisingly , the most common visual abnormality identified in our study was ophthalmoplegia , followed by ptosis and pigmentary retinopathy . additionally , the characteristic salt and pepper retinopathy was detected in a majority of patients . on the basis of these findings , we believe that the diagnosis of kss should be considered in all young patients with these ocular and visual symptoms . the extent of cardiac abnormalities varied from ecg changes to high - grade heart block , cardiomyopathy , and cardiac arrest . previous studies have noted the presence of cardiac conduction system abnormalities in patients with kss.14,15 moreover , exercise intolerance has been described in patients with mitochondrial myopathies , including kss.16 less than half the patients ( eleven [ 31% ] ) received a ppm / icd as prophylactic treatment for the indications of bradycardia or heart block . all of the patients who died in this series succumbed to sudden cardiac death , and only one of these four patients had received a prophylactic ppm / icd . nonetheless , the other three patients had no ecg changes or symptoms indicating a need for ppm / icd . in the general adult population , the overall incidence of sudden cardiac death has been estimated at 0.1% to 0.2% per year.17 findings from the current study confirm the results from previous studies regarding progressive heart block in patients with kss,9,14,15 support previous calls to consider routine prophylactic ppm / icd placement in patients with kss , and possibly suggest a low threshold for formal electrophysiologic testing in these patients . yamashita et al10 described 136 patients with mtdna deletions . using the diagnostic definition of rowland et al,4 they found that 33 ( 24% ) of these patients met the criteria for kss . deafness , short stature , and insulin - dependent diabetes mellitus were all frequently observed . they also noted that patients with kss had significantly longer dna deletions and more deleted mitochondrial transfer ( t ) rna than other patients in the series . in contrast to that case series , our study used the treating physician s diagnosis rather than a retrospective application of criteria in patients with a positive genetic test . therefore , the patients we describe with the clinical diagnosis of kss were more heterogeneous , including some with disease presentation after age 20 years and without peo or pigmentary retinopathy . first , the existing diagnostic criteria require that patients have symptom onset before age 20 years , and it is commonly believed that patients with kss die in early adulthood . however , seven patients ( 20% ) were older than 20 years at disease presentation , and only four ( 11% ) died , at a mean age of 46 years , during the study time frame ( mean follow up of 10.8 years ) . potential explanations for the finding of diagnosis after age 20 years include recall bias , insidious onset of symptoms , or that milder disease may present at an older age . second , anemia has previously been noted as a feature of kss but was not a predominant feature of patients in our study.18 third , kss has been associated with several endocrine disorders.19 in this series , we identified patients with short stature , delayed puberty , diabetes mellitus , and hypothyroidism . however , hyperaldosteronism and hypoparathyroidism , which have been reported in previous studies,19 were not observed in our cohort of patients . we found that the development of disability in patients with kss is statistically associated with cognitive decline but not with other clinical features , such as sex or sudden cardiac death . nevertheless , the lack of association between disability and other clinical features may be reassuring to patients with kss . a single mtdna mutation can result in the expression of multiple phenotypes.20 indeed , we found that multiple phenotypes ( ranging from mild to severe disease ) were present with the same mtdna mutation . additionally , mtdna deletions generally occur de novo and thus , usually cause disease in only one family member.20,21 this observation was supported by our study no patient in this series had a family history of kss . ophthalmoplegia caused by mitochondrial abnormalities represents a heterogeneous group of illnesses , which has given rise to the concept of ophthalmoplegia plus.22 moreover , the original diagnostic criteria for kss were based on a limited number of cases.1,3,4 phenotypic designations such as kss remain useful tools for clinicians to recognize disease . categorization of patients by signs and symptoms may allow treating clinicians to better predict prognosis and response to treatment on the basis of similar cases in the literature . keeping the designation of kss may help to alert the physician that cardiac conduction defects may occur and lead to earlier intervention . for example , it is now known that ragged - red fibers seen on muscle biopsy indicate a combined defect of respiratory complexes i and iv.23 moreover , mitochondrial disorders of other complexes or of only i or iv do not generally produce ragged - red fibers . in addition , the brain development engrailed genes are important in protecting neurons against mitochondrial dysfunction.24 novel mtdna deletions are being discovered and suggest that these deletions play a role in the pathogenesis of kss.25,26 constant advances in biochemical markers and expanding genotypes of mitochondrial disorders make diagnosis a challenge.27 this study had limitations . first , it was conducted at a single institution , which may limit external validity ; further , only 35 patients were identified ; with a larger sample size , potentially more associations between patient disability and clinical features may have been discovered . second , in retrospective review , not all patients in the cohort had documented evidence in the chart to fulfill all diagnostic criteria for kss . however , this may have been due to incomplete information in the chart or the patient having kss minus or peo plus.2 we were able to confirm a clinical diagnosis of kss in 27 of the 35 patients based on information in the chart . this may explain why only ten patients had short stature and why some patients were older than 40 years . we included all cases ( 35 ) in which the treating physician documented their clinical diagnosis of kss in the medical record . finally , since some of the cases included in the series are decades old , some may not have had the genetic testing , metabolic studies , or muscle biopsy that are now standard because the tests were not available at the time . we report , to our knowledge , the largest case series of patients with kss from a single institution . we found that consistent with the major criteria for diagnosis , ophthalmic involvement presents in most patients at a young age . however , many patients in this series ( 20% ) were older than the suggested cutoff of 20 years at diagnosis and , contrary to common belief , most lived beyond middle adulthood . additionally , we failed to confirm the prevalence of anemia , hypoadrenalism , and hypoparathyroidism in patients with kss , as had been suggested by previous research . in addition to the conduction system abnormalities that were identified in previous series , our cohort included patients with syncope and sudden cardiac death , which underscores the need to consider formal electrophysiologic studies and prophylactic defibrillators in these patients .

backgroundkearns sayre syndrome ( kss ) is a rare mitochondrial cytopathy , first described at mayo clinic in 1958.aimswe aimed to define patient and disease characteristics in a large group of adult and pediatric patients with kss.methodswe retrospectively searched the mayo clinic medical index patient database for the records of patients with kss between 1976 and 2009 . the 35 patients identified with kss were analyzed in terms of demographic characteristics , presenting signs and symptoms , diagnostic features , clinical evolution , and associations between disease features and the development of disability.resultsthe mean ( standard [ sd ] ) age at kss presentation was 17 ( 10 ) years , but the mean age at diagnosis was 26 ( 15 ) years . ophthalmologic symptoms developed in all patients , and neurologic and cardiac involvement was common . only four patients ( 11% ) in the series died , but all deaths were from sudden cardiac events . the development of physical disability was significantly associated with cognitive decline ( p=0.004 ) but not with other clinical features , such as sex or sudden cardiac death.conclusionwe report the largest case series to date of patients with kss from a single institution . in addition to the conduction system abnormalities identified in previous series , our cohort included patients with syncope and sudden cardiac death . this underscores the need to consider formal electrophysiologic studies and prophylactic defibrillators in patients with kss .

. failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications , even death . management of an unexpectedly difficult airway consists of laryngeal mask ventilation , gum - elastic bougie and video laryngoscopy - assisted intubation . gum - elastic bougie is the easiest and cheapest tool used in case of an unexpected difficult intubation occurring in the operating room . a 53-year - old male patient with hypogonadotropic hypogonadism presented as an unexpected difficult intubation after the induction of anesthesia . a difficult airway has been described in patients with a variety of endocrine disorders , including pituitary diseases , but not with hypogonadism . there may be an unrevealed relationship between hypogonadism and difficult airway . gum - elastic bougie is still the most attainable and effective tool in the operation room in this situation . anesthesiologists are responsible for maintaining a patent airway in the anesthetized patient . failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications , as even a few minutes of deoxygenation can result in catastrophic outcome like brain damage or even death.1 anesthesiologists are occasionally faced and challenged with this significant problem in practice . a difficult airway has been described in patients with pituitary endocrine disorders such as acromegaly and dwarfism ; however , airway problems with hypogonadism have not been well identified in the literature.2 a 53-year - old married man ( weight : 85 kg , height : 187 cm , body mass index : 24 kg / m ) presented with a history of nasal obstruction for two years . he had not had any prior operation under general anesthesia , so he did not have any history of difficult intubation , and he did not have any chronic systemic disease . the patient was evaluated for obstructive sleep apnea syndrome ( osas ) with a comprehensive questionnaire on his sleeping habits and medical history ; no complaints or predictors pertaining to osas were identified . the patient s preoperative airway assessment was normal , mallampati class was ii , thyromental distance was 7 cm , inter - incisor gap was 5 cm , and head extension was > 35. his physical examination was characterized by lack of secondary sexual characteristics and presence of fine facial wrinkles . although , as previously indicated , the patient was married , he had had no children . his hormone profile was : testosterone 0.3 ng / ml ( reference range 1.757.81 ) , free testosterone 0.91 ( reference range 4.542.0 ) , prolactin 1.31 ng / ml ( reference range 2.6426.72 ) , luteinizing hormone ( lh ) 0.33 miu / ml ( reference range 1.24103.03 ) . no other pathological finding was obtained as the result of magnetic resonance imaging of the pituitary gland . he was admitted to the operating theater , and following the induction of anesthesia with a dose of 5 mg / kg intravenous thiopental , bag - mask ventilation was barely sustained . fentanyl ( 12 gr / kg ) and , as a muscle relaxant , rocuronium ( 0.6 mg / kg ) were administered . while the patient s head was in the sniffing position , direct laryngoscopy and intubation of the trachea were attempted three times with different sizes of macintosh and miller blades by an assistant professor of anesthesiology with 5 years experience . however , unfortunately , the intubation failed . the lungs were then ventilated with 100% oxygen via a face mask in order to avoid desaturation . glottic visualization was assessed with cook s modification of the cormack lehane classification ; a grade of 3a ( with direct laryngoscopy , only the epiglottis can be visualized ; the epiglottis can be lifted using an introducer or bougie ) was assigned.3 the patient was subsequently successfully intubated with a gum - elastic bougie . after the operation , the patient was extubated successfully without any complication and then examined by otorhinolaryngologists via fexible laryngoscopy . the epiglottis was found to be in a slightly lower than normal position ( figure 1 ) . the overall incidence of unexpected difficult intubation is estimated to be 1%3% , while failed intubation incidence is 0.05%0.35% in europe.1 difficult endotracheal intubation has been described in patients with pituitary diseases like acromegaly , cushing s disease , lh / follicle - stimulating hormone - secreting adenoma , thyroid - stimulating hormone - secreting adenoma , nonfunctional adenoma and prolactinoma.4 difficult airway with dwarfism has also been described . however , difficult airway with a hypogonadotropic patient has not yet been clearly defined . in our case , further , magnetic resonance imaging of the pituitary gland did not reveal any adenoma or mass lesion.2 pulsatile release of follicle stimulating hormone and lh in puberty instigates the development of the male larynx and secondary sexual characteristics . the growth of laryngeal cartilages and maturation of the male larynx is also facilitated by androgen . high - affinity androgen receptors have been found in the human larynx.5,6 in this case , the patient s laryngeal development was compatible with his age and sex . only the epiglottis was located in a slightly lower position than normal , partially leaning toward the laryngeal passage . the patient was infertile and lacked secondary sexual characteristics due to insufficient exposure to androgens . the rate of difficult intubation has been found to be higher in osas patients than the normal , healthy population.7 body mass index , mallampati grading , cormack lehane classification , sternomental distance , and thyromental distance evaluation might be predictive factors for difficult airway in osas patients . as such , anesthesiologists must be aware of this fact and be prepared for difficult intubation in osas patients.7 however , the rate of difficult intubation has not been found to be related to the severity of osas.8 no significant relationship between the apnea hypopnea index and difficult intubation has been found.8 in our patient , no apnea and daytime sleepiness were present in his history . only snoring was present , which might well have been associated with nasal septal deviation . his body mass index was 24 kg / m , mallampati class was ii , thyromental distance was 7 cm , inter - incisor gap was 5 cm , and head extension was above 35. these findings did not suggest any evidence of osas or difficult airway . this multiparameter test reveals the presence and severity of osas.9 in this case , as there was no clinical index of suspicion for osas and to keep costs down , polysomnography was not required by the otorhinolaryngologists . thus , anesthesiologists must take into account difficult airway in endocrinological disorders like hypogonadotropic hypogonadism and be prepared for difficult intubation .

backgrounda critical aspect of safe general anesthesia is providing adequate ventilation and oxygenation . failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications , even death . anesthesiologists rarely encounter unexpected difficult airway problems in daily routine . management of an unexpectedly difficult airway consists of laryngeal mask ventilation , gum - elastic bougie and video laryngoscopy - assisted intubation . gum - elastic bougie is the easiest and cheapest tool used in case of an unexpected difficult intubation occurring in the operating room.casea 53-year - old male patient with hypogonadotropic hypogonadism presented as an unexpected difficult intubation after the induction of anesthesia . no pathological finding or predictor of difficult intubation was present . in addition , bag - mask ventilation was poor and inadequate . the patient was finally successfully intubated with a gum - elastic bougie.conclusiona difficult airway has been described in patients with a variety of endocrine disorders , including pituitary diseases , but not with hypogonadism . there may be an unrevealed relationship between hypogonadism and difficult airway . gum - elastic bougie is still the most attainable and effective tool in the operation room in this situation .

the gamma - aminobutyric acid ( gaba ) , the major inhibitory neurotransmitter in the mammalian central nervous system , causes changes in a polarization of cell membrane acting through the activation of gaba receptors . the most prevalent , gaba type a ( gaba a ) , receptors tend to exist as pentameric structures consisting of various combinations of six major subunits : , , , , , and . recent data indicate that gabaergic activity is not restricted to the central nervous system , but also involves cells of different origin that , like hepatocytes , possess the peripheral type of gaba a receptors . as was shown in several studies , an activation of gaba a receptors ( especially the 3 subunit ) leads to the hyperpolarization of cell membrane , which , in turn , causes a rapid decrease in cell proliferation [ 3 , 4 ] . this feature seems to be interesting with regard to the study that demonstrated the impact of cell polarization on the efficiency of hepatitis c virus ( hcv ) entry . an elevated gabaergic activity was found to be responsible for the impaired hepatocyte proliferation in regenerating livers after partial hepatectomy [ 6 , 7 ] . on the other hand , it has been known since the early 1980s that the serum level of gaba may be elevated in case of acute or chronic hepatocellular failure , and the gaba neurotransmitter system is involved in the pathogenesis of hepatic encephalopathy ( he ) in humans . recently , it has been suggested that he - dependent ammonia may be developed due to the modification of the gaba a receptor affinity . other findings suggest that increased inhibition through gaba a receptors may represent an important pathophysiological mechanism of fatigue in chronic hcv infection . this multifunctionality of gabaergic action in numerous liver failures has drawn our attention to the possible role of the modulation of gaba a receptors expression in the course of hcv infection and in the response to the antiviral treatment . although the liver is the main place of hcv replication , gathered data , including our own [ 12 , 13 ] , indicate that hcv can persist and replicate efficiently in extrahepatic tissue , including peripheral blood mononuclear cells ( pbmcs ) . hcv rna can persist in pbmcs long after spontaneous or treatment - induced viral elimination from sera , but the relevance of this phenomenon is still unknown . it has been documented recently that pbmcs originated from the healthy human population express functional 1 and 3 subunits of the gaba a receptor . the aim of the current study was to investigate whether the comparable expression of gaba a subunits can be observed in pbmcs from chronic hepatitis c ( chc ) patients that have undergone anti - hcv treatment . consequently , not only did we succeed to show 1 and 3 expression in pbmcs from hcv - infected patients , but our results also demonstrated the substantial differences in 3 and , less manifested , in 1 subunits expression in pbmcs between healthy donors and post - treatment hcv patients . we then speculate on how the alterations in the expression of gaba a subunits may be of special importance for hcv rna persistence . blood samples were collected , after the informed consent had been obtained , from ten healthy donors ( 6 males , 4 females : age 1826 years ) and from 22 chronically infected with hcv patients ( 12 males , 10 females : age 1622 years ) within 2 weeks after the cessation of antiviral treatment ( ifn alfa2b + ribavirin ) . neither patients nor healthy controls were taking medication known to alter gaba a receptor expression or activity . pbmcs and sera were isolated by blood centrifugation in density gradient ( histopaque 1077 , sigma ) . total rna was extracted from pbmcs by a modified guanidinium thiocyanate / phenol / chloroform technique . hcv rna presence in sera was determined by reverse transcription polymerase chain reaction ( rt - pcr ) ( cobas , amplicor hcv 2.0 monitor , roche ) . briefly , 6 g of total rna were reverse - transcribed and amplified by masteramp tth dna polymerases ( epicentre biotechnologies ) with external hcv - specific primers ( table 1 ) in a reaction as follows : 20 min of rt at 70c and 3 min at 94c , followed by 35 cycles of 94c for 20s , 50c for 20s , 72c for 20s , and 72c for 7 min . the resultant amplicon was used in the second - round pcr ( 2 min at 94c , 30 cycles of 94c for 40s , 55c for 40s , 72c for 40s , and 72c for 10 min ) . after pa gel electrophoresis , an hcv - specific product of 278 bp was visualized with ethidium bromide staining.table 1list and sequences of primers used in the reverse transcription polymerase chain reaction ( rt - pcr ) analysis and size of pcr productsspecificity of primerspcr product ( bp)sequence of forward and reverse primershcv rna ( external)321f : ccaccatgaatcactcccctgtr : gctcatggtgcacggtctacgagaccthcv rna ( internal)278f : gtcttcacgcagaaagcgtctagccr : cactcgcaagcaccctatcaggcaggaba a 1(external)241f : cggtcaattttgctgacactr : ggttatgcatgggatggcgaba a 1(internal)95f : gacctctttaaggttctatggr : gctccaacagcaaccagcgaba a 3 ( external)319f : cacatcggttagatcaggr : caaggcaaagaatgaccggaba a 3 ( internal)110f : cgctggaagttcacaatgr : cgaggcatgctctgtttc-actin434f : caaagacctgtacgccaacacar : aaccgactgctgtcaccttcac list and sequences of primers used in the reverse transcription polymerase chain reaction ( rt - pcr ) analysis and size of pcr products for the detection of mrnas specific for gaba a receptor subunits 1 and 3 , random cdna was synthesized according to the manufacturer s instructions by using the transcription high fidelity cdna synthesis kit ( roche diagnostics , mannheim , germany ) and then amplified in nested pcr assays ( each of 35 cycles ) were performed as follows : 5 min of preliminary heating at 94c , 94c for 40s , 50c ( for gaba a 1/3)/55c ( for actin ) for 40s , 72c for 40s , and 72c for 10 min . pcr 1- and 3-specific products of 95 bp and 110 bp , respectively , were analyzed as described above . protein lysates ( 20 g / lane ) were separated on 10% sds - pa gel . resolved proteins were electroblotted into nitrocellulose and incubated with gaba a 1 , 52 kda ( gtx 30204 , dilution 1:12,000 ) and 3 , 55 kda ( gtx 261302 , dilution 1:2,000 ) specific antibodies purchased from gene tex , inc . the reactions with the goat antibodies against -actin , 43 kda ( sc-1615 , santa cruz biotechnology ) were carried out at the dilution of 1 to 300 . the bound antibodies were visualized using the enhanced chemiluminescence ( ecl ) western blotting reagent ( sc-2048 , santa cruz biotechnology ) with signals captured on film . in order to quantify the density of signals , the bio - rad quantity one system was used . to estimate the comparative levels of gaba a 1 and 3 subunits expression , all immunoreactivities were normalized to -actin expression before statistical analysis . cells were collected from healthy donors and chc patients who had undergone antiviral treatment . according to the hcv rna status in sera and in pbmcs , three subgroups of patients were distinguished : 0/0 with sera and pbmcs free from hcv rna ( n = 10 ) ; 0/1 with sera negative for hcv rna , but with hcv rna - positive pbmcs ( n = 6 ) ; and the 1/1 group , where sera and pbmc samples contained hcv rna ( n = 6 ) . to analyze the gene expression of gaba a receptor subunits 1 and 3 , pcr amplification produced single 1- and 3-specific pcr products , of 95 and 110 bp , respectively . our results showed that all pbmc samples contained mrna specific for the 1 and 3 subunits of gaba a receptor . the expression of -actin was used as the endogenous control of gene expression . as shown in fig . 1 , the gene expression of gaba a receptor subunits differs among pbmc samples , even among the same group . no significant differences were found in gene expression level for either 1 or 3 between groups . we could only observe that 3 gene expression showed a margin tendency to be elevated in pbmcs from healthy donors in comparison to the hcv - infected patients . in contrast , the gene expression of 1 subunit in pbmcs tends to be slightly higher in the group of chc patients compared to the healthy controls.fig . 1gamma - aminobutyric acid type a ( gaba a ) receptor , 1 and 3 genes expression in peripheral blood mononuclear cells ( pbmcs ) . the figure shows several examples of the results obtained by reverse transcription polymerase chain reaction ( rt - pcr ) analysis performed in the groups as follows : a healthy donors ( hd ) and ( b d ) anti - hepatitis c virus ( hcv)-treated chronic hepatitis c ( chc ) patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . as a control of gene expression , the analysis of -actin was performed gamma - aminobutyric acid type a ( gaba a ) receptor , 1 and 3 genes expression in peripheral blood mononuclear cells ( pbmcs ) . the figure shows several examples of the results obtained by reverse transcription polymerase chain reaction ( rt - pcr ) analysis performed in the groups as follows : a healthy donors ( hd ) and ( b d ) anti - hepatitis c virus ( hcv)-treated chronic hepatitis c ( chc ) patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . as a control of gene expression , the analysis of -actin was performed the presence of the protein expression of gaba a 1 and 3 subunits was confirmed using western blot in all of the tested pbmc samples . figure 2 shows several examples of western blot analysis performed on lysates obtained from the pbmcs of healthy donors and chc patients . the quantitative immunoblotting based on a density analysis , described in the materials and methods section , was utilized in order to determine the possible differences in the gaba a 1 and 3 subunits expression between pbmc samples . as indicated in fig . 3a , the gaba a 1 protein expression was somewhat higher ( p = 0.047 ) in the group of anti - hcv - treated chc patients than in the group of healthy controls . however , no statistical differences were found between individual subgroups of patients.fig . 2expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . representative images of western blot analysis come from groups as follows : a healthy donors ( hd ) and ( b d ) anti - hcv - treated chc patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . 3differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . the results are shown after normalization to the -actin expression . a relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . b relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients ( 0/0 , 0/1 , 1/1 ) expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . representative images of western blot analysis come from groups as follows : a healthy donors ( hd ) and ( b d ) anti - hcv - treated chc patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . the analysis of -actin was performed as a control of gene expression differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . the results are shown after normalization to the -actin expression . a relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . b relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients ( 0/0 , 0/1 , 1/1 ) an opposite relation was found for the expression of 3 subunit . in pbmcs from anti - hcv - treated chc patients , the 3 protein showed decreased levels in comparison to the group of healthy donors . as presented in fig.3b , significant differences ( p = 0.0038 ) in the 3 expression among healthy donors and the three subgroups of chc patients were observed as a result of the 3 expression analysis . the lowest expression level of 3 protein , compared to the healthy donors , was observed in pbmcs from patients , who , despite the antiviral treatment , have retained hcv rna in both sera and pbmcs ( p = 0.00047 ) . cells were collected from healthy donors and chc patients who had undergone antiviral treatment . according to the hcv rna status in sera and in pbmcs , three subgroups of patients were distinguished : 0/0 with sera and pbmcs free from hcv rna ( n = 10 ) ; 0/1 with sera negative for hcv rna , but with hcv rna - positive pbmcs ( n = 6 ) ; and the 1/1 group , where sera and pbmc samples contained hcv rna ( n = 6 ) . to analyze the gene expression of gaba a receptor subunits 1 and 3 , pcr amplification produced single 1- and 3-specific pcr products , of 95 and 110 bp , respectively . our results showed that all pbmc samples contained mrna specific for the 1 and 3 subunits of gaba a receptor . the expression of -actin was used as the endogenous control of gene expression . as shown in fig . 1 , the gene expression of gaba a receptor subunits differs among pbmc samples , even among the same group . no significant differences were found in gene expression level for either 1 or 3 between groups . we could only observe that 3 gene expression showed a margin tendency to be elevated in pbmcs from healthy donors in comparison to the hcv - infected patients . in contrast , the gene expression of 1 subunit in pbmcs tends to be slightly higher in the group of chc patients compared to the healthy controls.fig . 1gamma - aminobutyric acid type a ( gaba a ) receptor , 1 and 3 genes expression in peripheral blood mononuclear cells ( pbmcs ) . the figure shows several examples of the results obtained by reverse transcription polymerase chain reaction ( rt - pcr ) analysis performed in the groups as follows : a healthy donors ( hd ) and ( b d ) anti - hepatitis c virus ( hcv)-treated chronic hepatitis c ( chc ) patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . as a control of gene expression , the analysis of -actin was performed gamma - aminobutyric acid type a ( gaba a ) receptor , 1 and 3 genes expression in peripheral blood mononuclear cells ( pbmcs ) . the figure shows several examples of the results obtained by reverse transcription polymerase chain reaction ( rt - pcr ) analysis performed in the groups as follows : a healthy donors ( hd ) and ( b d ) anti - hepatitis c virus ( hcv)-treated chronic hepatitis c ( chc ) patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . as a control of gene expression , the presence of the protein expression of gaba a 1 and 3 subunits was confirmed using western blot in all of the tested pbmc samples . figure 2 shows several examples of western blot analysis performed on lysates obtained from the pbmcs of healthy donors and chc patients . the quantitative immunoblotting based on a density analysis , described in the materials and methods section , was utilized in order to determine the possible differences in the gaba a 1 and 3 subunits expression between pbmc samples . as indicated in fig . 3a , the gaba a 1 protein expression was somewhat higher ( p = 0.047 ) in the group of anti - hcv - treated chc patients than in the group of healthy controls . 2expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . representative images of western blot analysis come from groups as follows : a healthy donors ( hd ) and ( b d ) anti - hcv - treated chc patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . 3differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . the results are shown after normalization to the -actin expression . a relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . b relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients ( 0/0 , 0/1 , 1/1 ) expression of 1 and 3 subunits of the gaba a receptor in pbmcs as revealed by western blot analysis . representative images of western blot analysis come from groups as follows : a healthy donors ( hd ) and ( b d ) anti - hcv - treated chc patients , who : b eliminated hcv rna from both sera and pbmcs ( 0/0 ) , c only from sera ( 0/1 ) , or d neither from sera nor from pbmcs ( 1/1 ) . the analysis of -actin was performed as a control of gene expression differences in gaba a 1 and 3 subunits expression in pbmcs evaluated by western blot analysis . the results are shown after normalization to the -actin expression . a relative expression level of gaba a 1 protein in pbmcs from healthy donors and from post - treatment chc patients . b relative expression level of gaba a 3 protein expression in pbmcs from healthy donors and three groups of anti - hcv - treated chc patients ( 0/0 , 0/1 , 1/1 ) an opposite relation was found for the expression of 3 subunit . in pbmcs from anti - hcv - treated chc patients , the 3 protein showed decreased levels in comparison to the group of healthy donors . as presented in fig.3b , significant differences ( p = 0.0038 ) in the 3 expression among healthy donors and the three subgroups of chc patients were observed as a result of the 3 expression analysis . the lowest expression level of 3 protein , compared to the healthy donors , was observed in pbmcs from patients , who , despite the antiviral treatment , have retained hcv rna in both sera and pbmcs ( p = 0.00047 ) . several studies have revealed the contribution of a variety of host factors to the development of hcv rna persistence in chronically infected patients , despite having used antiviral treatment [ 13 , 16 , 17 ] . our study was designed to evaluate whether the expression of chosen subunits of gaba a receptors in pbmcs bears any relation to hcv infection and/or the path of hcv rna elimination after anti - viral treatment . studies that were carried out on other viruses like herpes simplex virus ( hsv ) and human immunodeficiency virus ( hiv ) indicated that the expression of gaba a receptor on the target cells could be modulated upon the viral infection [ 18 , 19 ] . although gaba a receptors tend to exist as a pentameric structure consisting of six major gaba a receptor subunits , we decided to screen the expression of two of them : 1 and 3 . this choice was grounded on alam et al.s study that confirmed the significant content of the 1 subunit in pbmcs and fractionated t - cell populations . the evaluation of 3 expression , despite the lower abundance of this subunit in pbmcs , seemed interesting due to the confirmed impact on a proliferative activity of other cells [ 20 , 21 ] . if governing the hcv infection indeed plays any role in the gaba a receptor activity , the modulation of their expression would be an expected phenomenon . to address this issue , we analyzed the 1 and 3 gaba a expression in pbmcs using nested pcr and quantitative immunoblotting . our results showed , for the first time , that the expression of the 1 and 3 subunits of the gaba a receptor is common not only for healthy donors ( 15 ) , but also for anti - hcv - treated patients . moreover , the expression of these subunits at the protein level displayed differences between healthy donors and chc patients . a marginally significant elevation of 1 gaba a in pbmcs was demonstrated for anti - hcv - treated patients when compared with healthy donors . it seems interesting that the expression of 1 gaba a receptor subunit is detectable in the majority of pbmcs subtypes , such as : t - cells , b - cells , and monocytes , in other words , in cells that are also able to maintain hcv during chronic infection . taking into account that the increased expression of these receptors in t - cells downregulates the effector t - cell response [ 23 , 24 ] and that the defective function of hcv - specific t - cells contribute to the chronicity of infection [ 2527 ] , we can hypothesize that gaba a activation may contribute to the impaired response to the hcv infection . in contrast , the majority of pbmcs from the anti - hcv - treated patients represented significantly lower expression of the 3 subunit of the gaba a receptor than the healthy donors pbmcs . thus , also in case of the 3 subunit , expression measured at the protein level does not reflect precisely the gene expression level . this type of discrepancy , probably connected with the post - transcriptional regulation , was observed for gaba a receptor expression previously . the lowest level of gaba a 3 receptor expression was observed in these pbmcs , where hcv rna presence in cells was accompanied by the hcv rna positivity of sera . as was demonstrated , the transfection of hepatoma cells with 3-specific cdna resulted in a significant decrease of cell proliferation . similarly , an increased gaba a 3 receptor expression was found to act as an inhibitory signal for hepatic cell proliferation , whereas the downregulation of the gaba a 3 receptor expression was observed in malignant hepatocyte cell lines . although less is known about the role of 3 subunit expression of the gaba a receptor in pbmcs , we can hypothesize that , like in the case of hepatic cells , the decreased expression of gaba a 3 receptor in pbmcs may alter the proliferative activity of these cells . since hcv - infected cells present enhanced proliferation in comparison to non - infected cells [ 30 , 31 ] , this process appears to play an important role in hcv rna replication . on the other hand , it was previously demonstrated that the drug - dependent inhibition of gaba a receptors expression does not alter hcv load , which may suggest that , rather , hcv infection is responsible for inducing such changes in gaba a expression that favor hcv propagation in target cells . in conclusion , the current study provides evidence for the 1 and 3 expression in pbmcs from hcv - infected patients . decreased gaba a 3 expression , which is observed in hcv rna - positive pbmcs , future studies should elucidate whether the alteration of gaba a expression , which is observed during chc infection , has an impact on the development of hepatocellular carcinoma .

the modulation of the gamma - aminobutyric acid type a ( gaba a ) receptors activity was observed in several chronic hepatitis failures , including hepatitis c. the expression of gaba a receptor subunits 1 and 3 was detected in peripheral blood mononuclear cells ( pbmcs ) originated from healthy donors . the aim of the study was to evaluate if gaba a 1 and 3 expression can also be observed in pbmcs from chronic hepatitis c ( chc ) patients and to evaluate a possible association between their expression and the course of hepatitis c virus ( hcv ) infection . gaba a 1- and 3-specific mrnas presence and a protein expression in pbmcs from healthy donors and chc patients were screened by reverse transcription polymerase chain reaction ( rt - pcr ) and western blot , respectively . in patients , hcv rna was determined in sera and pbmcs . it was shown that gaba a 1 and 3 expression was significantly different in pbmcs from chc patients and healthy donors . in comparison to healthy donors , chc patients were found to present an increase in the expression of gaba a 1 subunit and a decrease in the expression of 3 subunit in their pbmcs . the modulation of 1 and 3 gaba a receptors subunits expression in pbmcs may be associated with ongoing or past hcv infection .

dronedarone is a relatively new antiarrhythmic drug and is held to be less proarrhythmic than comparable compounds , although its proarrhythmia potential in humans has not been sufficiently evaluated . we describe a so far unreported dronedarone effect , namely a significant alteration of both the morphology and the duration of the qrs complex on electrocardiogram ( ecg ) in a 41-year old patient with symptomatic paroxysmal atrial fibrillation . dronedarone is a derivate of the potent antiarrhythmic drug amiodarone that was designed to have less toxic side effects ( 1 ) . although dronedarone was approved following reports of an improved safety profile , more recent studies have cast doubt on its safety ( 1 - 2 - 3 ) . however , dronedarone is still held to be less proarrhythmic than comparable compounds , although its proarrhythmia potential in humans has not been sufficiently evaluated ( 1 ) . we describe a hitherto unreported dronedarone effect , namely a significant alteration of both the morphology and the duration of the qrs complex on ecg . a 41-year old patient was admitted to our emergency unit because of a highly symptomatic attack of paroxysmal atrial fibrillation ( af ) that a few hours later spontaneously converted into sinus rhythm . atrial fibrillation had been first diagnosed in this patent in 2008 and the af episodes had been becoming more frequent in the months immediately preceding hospital admission . on admission , it should be noted that , during sinus rhythm , the ecg was normal showing an unremarkable qrs morphology and a qrs duration of 85 msec ( fig . clinically , the patient was in a good state of health . his risk profile consisted of grade 1 obesity ( body mass index 30.9 kg / m ) and arterial hypertension that was well controlled by a combination therapy of an ace - inhibitor and a beta - blocker . routine blood tests , including kidney , liver and thyroid function analysis , were all within normal values . coronary artery disease had been previously excluded by coronary angiography in 2011 , and a recently performed transthoracic echocardiography revealed a structurally normal heart exhibiting normal systolic and diastolic function . after giving informed consent , the patient was reluctant to undergo an invasive approach and preferred pharmacological rhythm management with dronedarone . according to our standard approach for af patients admitted to our institution , the initiation of antiarrhythmic therapy , regardless of the antiarrhythmic drug , is always performed in the hospital setting . during the hospital stay , the patients are not restricted to bed rest but are allowed to be ambulant while being continuously monitored using ecg telemetry . in addition , 12-lead standard ecg is registered in each patient on a daily basis . in the index patient , after two doses of dronedarone ( 400 mg each ) , a marked prolongation of qrs duration with a left bundle branch block pattern was documented on the 12-lead ecg ( fig . , the qrs complexes again showed a normal morphology and a normal duration of 90 msec ( fig . subsequently , the patient refused further attempts at pharmacological rhythm control , but requested a catheter ablation of atrial fibrillation that had recurred . therefore , circumferential pulmonary vein isolation was successfully performed . return to normal qrs - width after dronedarone withdrawal and self - limiting episode of atrial fibrillation . three months later , at the first follow - up visit in our rhythmology outpatient clinic , the patient was free of af and continued to show a narrow qrs - complex . dronedarone is a multichannel blocker exhibiting all of the 4 vaughan williams classes of action ( 4 ) . in fact , qt - interval prolongation , increased frequency of ventricular premature beats , and episodes of atrial flutter have all been reported as potentially proarrhythmic side effects of dronedarone ( 2 , 3 ) . mechanistically , this phenomenon may be explained by a reduction in the maximum slope of the action potential upstroke due to an increased inhibition of the fast na(+ ) inward current by dronedarone ( 4 , 5 ) . thus , a widened qrs complex may be indicative of slowed impulse conduction in the ventricles and may herald potential proarrhythmia . therefore , careful telemetry monitoring appears to be mandatory , particularly during the period following the first administration of dronedarone .

dronedarone is a relatively new antiarrhythmic drug and is held to be less proarrhythmic than comparable compounds , although its proarrhythmia potential in humans has not been sufficiently evaluated . we describe a so far unreported dronedarone effect , namely a significant alteration of both the morphology and the duration of the qrs complex on the electro cardiogram in a 41-year old patient with symptomatic paroxysmal atrial fibrillation .

pari passu with the progress of science in medical education , simulation in medical education is also progressing in leaps and bounds . something which was hardly ever talked about even a couple of years ago has now become the new buzz word in medical education circles , and now india is also getting on the bandwagon . simulation has been variably defined as the imitation of the operation of a real - world process or system over time ; an imitation of some real thing , state of affairs , or process for the practice of skills , problem solving , and judgment . the aim of medical simulation training is to imitate reality , or rather , to mimic reality to the closest extent possible so that the learner is in a state of suspended disbelief and he believes himself to be undergoing a real experience . simulation has been used at its greatest effect in pilot training - indeed , it is mandatory for all pilots of commercial aircraft to undergo refresher courses on flight simulators , regardless of their real flying experience . medical simulation has unfortunately not kept up with the development of simulation in engineering systems , flight training , etc . however , this situation is now rapidly changing . this change has been brought about by three main reasons : firstly , a big increase in student population in medical education , both at the undergraduate and post - graduate level . this unprecedented growth has occurred in the past two decades ( mci vision 2015 ) . approximately 33,528 graduates pass out every year from these colleges ( mci annual report 20092010 ) . . there has also been legislation which limits the number of hours residents can now work , reducing further the opportunity for bedside learning . the american medical association 's accreditation council for graduate medical education has limited the time that residents can be required to work to 80 h a week . although this action was intended to improve patient safety , it also reduced the number of patient - contact hours needed to train residents . secondly , there is a growing awareness of patients of their rights and reluctance to be practiced upon and the growing incidence of medical litigation leading to a reduction in the number of available patients . finally , there has been a huge technological improvement in the quality and variety of simulators . now , high fidelity computerised human patient simulators have been developed by various companies ( e.g. simman by laerdal , the meti family of human patient simulators by cae health care ) , which mimic very realistically the response of human beings to physiological insults , whether it be an acute cardiac event , or a trauma event ; indeed , any disease process that affects the cardiovascular or respiratory system can be accurately modelled . surgical simulators have been developed to practice laparoscopic surgery using a virtual reality environment ( e.g. the lapvr laparoscopic simulator by cae health care ) , which even provide haptic feedback ( a sense of tissue resistance ) . , many countries are now making certification on simulators mandatory before performing procedures on actual patients . even in india , the mci 2015 vision document says that a mandatory and desirable comprehensive list of skills has been planned and would be recommended for bachelor of medicine and bachelor of surgery ( mbbs ) graduate . the educational technology section of the 2004 aem consensus conference for informatics and technology in emergency department health care concluded that there should be increasing use of web - based , virtual reality and human patient simulation in educating emergency medicine trainees . the authors postulate the philosophy of see one , simulate many , do one competently , and teach everyone . there are now many articles on how simulation can be used in medical training . a key challenge for surgical training is to provide conditions for effective learning without putting patients health at risk . simulation presents an attractive solution , offering a safe , simulated clinical environment where the training agenda can be determined by the needs of the learner , not the patient . evidence is now available to suggest that simulation training actually improves clinical performance . in a review of simulation articles , it was found that four ( 3% ) journal articles provided evidence for the direct correlation of simulation validity with effective learning . another study showed that the use of virtual reality surgical simulation to reach specific target criteria significantly improved the operating room ( or ) performance of residents during laparoscopic cholecystectomy . simulation in wound management is still relatively in its infancy when compared to the use of simulation in other areas of medical education . it is however reasonable to believe that the use of simulation in wound management will result in improvement in wound care . simulation in relation to wounds can be divided into use of simulation to study the effect of projectiles on tissue ( wound modelling ) and the use of simulation in the management of wounds . the purpose of this article is to outline the present status of simulation related to wounds , in terms of their creation and management . moulage is the art of creating mock injuries to simulate wounds . theatrical makeup and common everyday materials moulage is commonly used in mass casualty and disaster drills to add realism to the simulation . it is reasonable to believe , though not proven , that the use of moulage would create a more realistic environment to enhance learning in mass casualty and other trauma situations . as far back as in 1964 , omissions and deficiencies in disaster ability were dramatically and conclusively revealed by use of what appeared to be a live disaster setting with smoke , fire , explosions ; adverse weather and light conditions ; realistically simulated casualties especially prepared not only to look but also to act the part . moulage by author ( drp ) showing bleeding thigh wound and evisceration on metiman ( cae health care ) mannequin another area where simulation is used in wounds is to simulate the effect of injuring agents on the body so as to understand the various forces that are at work on the tissues during the causation of an injury . this would help in accurate wound assessment and anticipation of likely tissue damage if the causative agent is known . work has mainly been done on cavitating injuries produced by high - velocity projectiles . because gelatin and glycerin soap have approximately the same density as human tissue , the gunshot effects in them are comparable with those in human tissue . the experiments with these substitutes make it possible to understand what happens to the human body as the result of , for example , a penetrating gunshot . some other authors have used transparent gel candles [ 15% kraton ( polymers ) in 85% white paraffin oil ] for the same purpose . a synthetic skin skull brain model has been developed to simulate gunshot wounds to the head in such a realistic manner as to reconstruct the specific physical characteristics of a given trauma , including its progressive formation . this model uses a silicon cap containing synthetic fibres for artificial skin , a layered polyurethane sphere for the skull ( containing the outer and inner tables as well as the diploe ) , a periosteum of latex and the brain itself is simulated with ordnance gelatin . high fidelity simulators are now available which can mimic the physiological effects of wounds on the body . the aim of management of a wounded individual in the emergency department is mainly to correct and prevent the life - threatening physiological derangements associated with the wound like airway obstruction , hypovolemia , respiratory distress , etc . as such these physiological derangements can be mimicked extremely realistically by these high fidelity systems , examples of which are the meti family of mannequins from cae health care or the simman family from laerdal . these simulators are used the world over to train emergency medical care providers , medical students , post - graduates and practicing physicians and surgeons in emergency trauma management [ figure 2 ] . military specific simulators ( e.g. caesar from cae healthcare ) are now in advanced stages of development to train soldiers with non - medical backgrounds at the point of injury . john 's ambulance team ( malaysia ) demonstration of trauma scenario on ecs ( meti ) simulator there are a few articles on the emergence of simulation in wound management , which deal essentially with teaching learners local wound management . this includes wound dressing techniques , performance of local surgery like escharotomy or wound debridement . wound management simulators can be divided into basic part task trainers which use low - technology solutions that are cheap and high - technology virtual reality simulators which , of course , will be much more expensive . the low - technology solutions are discussed first , followed by the high - technology virtual reality solutions . simulated wounds have been created on animal models like pig trotters to teach the technique of wound debridement . a simulated wound covered with thick slough can be created on a pig trotter by excising an area of skin and then applying a layer of hydrocolloid paste ( e.g. adapttm , hollister ) on the denuded area . a layer of toothpaste may then be applied and covered with a piece of glad wrap to simulate the application of emla cream . a small curette is then used to debride the wound as in a human patient , after washing away the layer of toothpaste ( = topical anaesthetic ) . another study has created a simulated abscess in chicken breast by injecting mock purulent material under the chicken breast skin . the author felt that this new simulation model may be an effective tool to teach skin abscess management . physicians who evaluated the simulated abscess found that it replicates the classic palpable fluctuance and ultrasound findings of an actual abscess , and it can be surgically incised and drained in a similar fashion . yet another researcher has used an orange to simulate debridement - the student is required to remove the peel and the white fibres ( representing slough ) off the orange without puncturing the inner orange itself . burn wounds offer a challenge to learners in terms of local wound care , and as a result this helps train burn care trainees in the management of such wounds , specifically to perform escharotomy . a major technological development has been that of a thigh wound virtual reality model by delp et al . they have used the data from the visible human project as the basis of reconstruction of the thigh anatomy , on which they superimposed wound models of bullet wounds gleaned from data available in the literature . functional consequences of the injuries were also modelled , which provided both short - term consequences as well as long - term disability of the simulated patient . the user could interact with the virtual thigh model using virtual surgical instruments from a virtual tray to stop the bleeding , assess muscle bleeding and contractility , perform debridement , align bone , etc . the overall effect on the patient 's physiology was also calculated and displayed in terms of vital signs readouts , which changed depending upon appropriate treatment , e.g. control of bleeding , etc . the virtual reality medical center ( vrmc ) conceptualised and developed a unique injury simulator as an adjunct to current combat medic training . this initial technology , called injury creation science ( ics ) , very realistically simulated a number of battlefield injuries such as amputations , eviscerations , blast injuries , punctures and burns . since the initial prototypes , vrmc has developed this technology into wearable part - task trainers that simulate injuries as well as allow combat medics to practice actual medical procedures common to the battlefield . the procedures currently available or under development include treatment of pneumothorax , hemoperitonium and gunshot wounds to an artery . by integrating medical science with cutting - edge simulation and training technologies , realistic prosthetic tissue , wounds and part - task trainers one of the major issues with wounds is the risk of hospital - acquired wound infections , which are usually preventable by simple personal hygiene techniques . unfortunately , many hospital workers are either unaware of them or unwilling to follow these steps . training of all hospital staff to prevent cross infection is therefore high on the agenda for most hospital administrators , impinging as it does on patient safety . if the movement of bacteria that cause wound infection , and their removal from hands and other inanimate hospital objects could be seen , then it would be a very useful training tool and could markedly increase staff compliance with hygiene measures . this is exactly what was done in one study wherein ultraviolet polyethylene microspheres were able to simulate the spread of bacteria through direct and indirect contact on different surfaces and had the ability to be washed off under specific hand washing guidelines . the authors felt that due to the positive results , the use of microspheres as a simulator of bacterial presence and spread should be explored further in order to improve hand washing techniques and compliance . a simulation - based training system for surgical wound debridement has been developed and comprises a multimedia introduction , a surgical simulator ( tutorial component ) and an assessment component . the multimedia training component describes varieties of wound categories ( e.g. burns , lacerations , etc . ) , methods of debridement ( e.g. sharp , mechanical , etc . ) and equipment / materials used in the procedure . this module provides the pedagogical context for skills training and assessment , linking together all of the required elements for mastering the procedure . a software virtual agent is included and performs the role of an instructor by providing verbal guidance and assessment feedback . designed to be comprehensive in order to reduce the need for a more senior instructor , the software addresses the patient 's condition , initial description of the injury , and provides instruction on operation of the simulator . specific instructions cover the removal of foreign objects with forceps , scrubbing with a brush , rinsing with saline solution and the maintenance of sterility . trainees are instructed to remove debris with forceps , scrub with a brush and rinse with saline solution to maintain sterility . in conclusion , increasing sophistication in simulation technology has been also used in simulation of wounds , both in wound modelling and wound management . the available simulators include low - technology solutions and high - technology virtual reality simulators , all of which train learners in the art of wound management . however , this technology is yet to be validated in wound management to see if simulator training can result in better management of wounds in actual patients . future developments would include research on application of simulator training to real patient care , and the development of better technology to make virtual reality simulators even more realistic by the improvement of design , graphics and haptic feedback .

simulation in medical education is progressing in leaps and bounds . the need for simulation in medical education and training is increasing because of a ) overall increase in the number of medical students vis - - vis the availability of patients ; b ) increasing awareness among patients of their rights and consequent increase in litigations and c ) tremendous improvement in simulation technology which makes simulation more and more realistic . simulation in wound care can be divided into use of simulation in wound modelling ( to test the effect of projectiles on the body ) and simulation for training in wound management . though this science is still in its infancy , more and more researchers are now devising both low - technology and high - technology ( virtual reality ) simulators in this field . it is believed that simulator training will eventually translate into better wound care in real patients , though this will be the subject of further research .

a 62-year - old woman presented to the emergency department of central hospital bad berka with nausea and an episode of acute chest pain . she had been previously diagnosed with a myxofibrosarcoma of the left forearm ( april 2013 ) , which had been treated surgically . at that time , the maximal diameter of her ascending aorta was 47 mm , and anti - hypertensive therapy with a calcium - channel blocker was initiated . a contrast - enhanced computed tomography ( ct ) scan upon admission to the emergency unit showed an eccentric hypodense thickening of the ascending aorta and aortic arch . the maximal thickness of the intramural hematoma ( imh ) was 25 mm in the convexity of the ascending aorta and 10 mm in the aortic arch . moreover , no pleural effusion and only a small pericardial effusion were detected ( fig . despite the presence of an intramural hematoma , the patient s clinical symptoms did not recur , and she remained stable without progression of the pericardial effusion on echocardiographic follow - up . the imh was interpreted as a stable and non - emergency finding , and the patient was treated medically . due to an episode of recurrent chest pain , the patient was referred to our cardiac surgical unit the next morning . as a part of a preoperative work - up in preparation for urgent surgery , another follow - up ct scan was conducted . the rationale behind this decision was to determine whether the status of the imh had changed and to determine whether an intimal tear could be detected . to our surprise , significant regression of the aortic imh was found , with only minor residual thickening in the aortic arch and virtually no detectable hematoma in the ascending aorta ( fig . transesophageal echocardiography was then performed , demonstrating a complete disappearance of the imh ( fig . moderate aortic valve regurgitation was detected , showing no obvious changes in comparison with previous echocardiographic findings . although the patient remained asymptomatic , the recurrence of aortic imh was diagnosed 72 hours after the second ct scan . we were surprised to find a recurrence of aortic imh , especially since it predominantly involved the ascending aorta , with a maximal imh thickness of 12 mm ( fig . due to the recurrence of type a imh , in combination with the presence of aortic valve regurgitation and the increasing degree of pericardial effusion , the decision was made to undertake urgent surgery . intraoperatively , an unanticipated intimal tear was identified in the noncoronary sinus at the level of the sinotubular junction ( fig . regurgitation and moderate root dilatation ( an aortic root diameter of 45 mm ) , root replacement ( bentall technique ) using a bioprosthesis was conducted , as well as a partial aortic arch replacement . the patient s postoperative course was uneventful and she patient the unusual dynamics of this aortic imh are demonstrated in the frontal reconstructions of consecutive ct scans ( fig . aortic imh has often been diagnosed as a variant of aortic dissection using modern imaging techniques . it may present with the clinical symptoms of aortic dissection , and may occasionally precede overt aortic dissection or rupture . the clinical course of imh has been reported to vary , ranging from progression to an overt aortic dissection to complete disappearance over the course of follow - up . the serial changes of imh during follow - up have yet to be established , whereas its disappearance has been linked to a good long - term prognosis . we report herein a patient in whom two episodes of aortic imh ( stanford a , debakey i ) occurred within four days , influencing the surgical treatment strategy . aortic imh is a variant of overt dissection and may account for up to one of three to four cases of acute aortic syndrome . imh may completely resolve during follow - up , or it may progress to a classic aortic dissection . in the largest case series , reported by song et al . , the vast majority of the type a imh patients ( 84% ) were classified as being hemodynamically stable and hence were treated medically , resulting in a mortality rate of only 7.1% , whereas the international registry of aortic dissection reported a mortality rate of medically treated type a imh of as high as 33% . similarly to our patient , ohmi et al . reported a case in which an imh exhibited rapid regression , affecting the descending aorta during the initial presentation and involving the ascending aorta one year later . on both occasions , the imh regressed rapidly just hours after it was diagnosed . no aortic surgery was conducted due to the rapid and complete resolution of the imh . the phenomenon of the regression and/or disappearance of an imh is intriguing , and may explain to some extent the ongoing controversy with regard to its optimal treatment . nishigami et al . claimed that the disappearance of an imh suggests a good long - term prognosis . although no significant changes were observed during the course of follow - up among their patients with an imh that disappeared , they did not present guidelines regarding whether such cases of regressed imhs should be frequently checked for malign changes . therefore , the results from this single study should be interpreted with caution and can not be generalized to the entire spectrum of regressed imhs . progressive groups might be suboptimal , as it may only represent different stages of ongoing aortic disease . the clinical course of imh is very similar to that of a possible overt aortic dissection , mainly because an imh diagnosed using imaging techniques may precede an overt aortic dissection . although the resorption of an imh may occur without specific treatment , a substantial number of medically treated patients may suffer sudden cardiac death during the course of follow - up . therefore , no consensus has emerged regarding the most appropriate surveillance strategy in asymptomatic patients with a known history of the regression of an aortic type a imh . nevertheless , as previously reported , new - onset pericardial and pleural effusion have been reported to be more common in imh patients than in patients with an overt aortic dissection . due to the fact that our patient presented with these two indirect signs of imh - related complications and an initial imh thickness of 25 mm , a rather aggressive treatment strategy was chosen in order to prevent the possibility of impending sudden death . the definite decision to perform surgical treatment in the present patient was made due to the recurrence of an imh on the third ct scan , which demonstrated the malignant character of this case of acute aortic syndrome . despite aortic imaging by means of serial ct scans and transesophageal echocardiography , the intimal tear and overt aortic dissection furthermore , it remains uncertain whether the intimal tear remained undetected or developed secondarily during the course of the imh . nevertheless , the majority of patients undergoing surgical treatment for acute type a imh may present intraoperatively with an intimal tear . the lack of a visible tear on the ct scan may contribute to the delay of surgical treatment . this possibility means that the appropriateness of aortic imaging as currently implemented should be questioned , and further raises the issue of whether other markers would lead to more accurate decision - making in the treatment of acute aortic syndrome .

we report an interesting case in which overt aortic dissection mimicked two episodes of aortic intramural hematoma ( imh ) ( stanford a , debakey i ) . this took place over the course of four days and had a major influence on the surgical treatment strategy . the first episode of imh regressed completely within 15 hours after it was clinically diagnosed and verified using imaging techniques . the recurrence of imh was detected three days thereafter , resulting in an urgent surgical intervention . overt aortic dissection with evidence of an intimal tear was diagnosed intraoperatively .

the perioperative period of major oncological surgery is marked by several potential causes for renal injury such as hypotension , volume depletion , self - regulation disorders of the kidney , surgical trauma and drug - induced nephrotoxicity . on the other hand , patients with oncological malignancies are susceptible to various kidney insults that are associated to complications from the disease itself or from its treatment , such as chemotherapy and radiotherapy . thus , surgical stress would potentiate various risk factors to kidney injury previously present in the carriers of malignancies , resulting in increased length of hospitalization , infectious complications , and mortality rates . in the last few years , several researchers have been trying to find serum and urinary biomarkers that could detect earlier or even predict the evolution to acute kidney injury ( aki)/failure in patients at risk . neutrophil gelatinase - associated lipocalin ( n - gal ) is a widely studied early biomarker of ischemia and kidney injury , which allows the identification of patients at a higher risk of kidney injury 48 h before traditional detection methods , thereby allowing the implementation of preventive / protective strategies before renal damage becomes irreversible . considering the negative impact of aki among oncology patients , this study intended to assess the efficacy of urinary n - gal as an early biomarker of aki immediately after major oncological surgeries in patients admitted to the intensive care unit ( icu ) . this was a prospective cohort study on consecutive patients diagnosed with solid neoplasia , submitted to elective or emergency surgeries , and admitted in the icu of a cancer hospital . all adult patients ( aged > 18 years ) submitted to major oncological surgeries ( abdominal , pelvic , thoracic , or head / neck ) were included , since they previously had a normal renal function . the exclusion criteria were : patients with a previous diagnosis of kidney injury or failure ( with or without renal replacement therapy ) , pregnant women , and terminal patients under exclusive palliative support . acute kidney injury diagnosis was defined in accordance with the aki network definition of injury criteria . selected variable data ( age , acute physiology and chronic health evaluation ii [ apache ii ] , n - gal , c - reactive protein - immediate postoperative [ crp - ipo ] , serum creatinine - ipo , serum creatinine 1 po , serum urea - immediate po and 1 po , length of hospitalization , operation time , and serum lactate - ipo ) were standardized using z function and later analyzed by principal component analysis ( pca ) , after verification of the data quality using kaiser - meyer - olkin ( kmo ) test . it was possible to determine the explanatory variables for each of the patients , with a priori - defined outcome ( 0-normal ; aki ) . urinary n - gal was measured at the time of admission in the icu using quantitative architect abbott ( chemiluminescent microparticle immunoassay ) method . most of the patients ( 77% ) were males , with a mean age of 52.8 years . patients with elevated urinary n - gal had higher apache ii score at admission , with a trend toward higher mean age compared with those with reduced n - gal . there were no differences in gender , site of cancer , or related diseases [ table 1 ] . demographic characteristics and clinical outcome of the patients according to urinary n - gal levels overall incidence of po aki was 13.6% . patients with lower levels of urinary n - gal had lower incidence of aki ( lower levels of serum urea and creatinine ) and shorter length of hospitalization in the icu . when patients with or without the development of aki were compared , the urinary n - gal levels were found to be a strong outcome predictor of aki incidence [ table 2 ] . the occurrence of aki increased the length of hospitalization in the icu , although it did not increase the mortality rate . univariate analysis of the risk factors and outcomes among patients with or without the development of aki when the kmo test value was > 0.5 ( kmo = 0.695 ) , it was possible to verify that the variables post oncological surgeries were in accordance with the pca application assumptions , after removing the variables creatinine 1 po , urea 1 po , length of hospitalization , duration of surgery , and lactate - ipo . correlation between matrix of variables was assessed using bartlett spherical test ( c = 53.097 , p < 0.0001 ) . using canonical analysis ( axes f1 and f2 ) , it was confirmed that age , n - gal , and apache ii score were the primary variables associated with aki outcome [ figure 1 ] . when the kmo test value was > 0.5 ( kmo = 0.695 ) , it was possible to verify that the variables post oncological surgeries were in accordance with the pca application assumptions , after removing the variables creatinine 1 po , urea 1 po , length of hospitalization , duration of surgery , and lactate - ipo . correlation between matrix of variables was assessed using bartlett spherical test ( c = 53.097 , p < 0.0001 ) . using canonical analysis ( axes f1 and f2 ) , it was confirmed that age , n - gal , and apache ii score were the primary variables associated with aki outcome [ figure 1 ] . when the kmo test value was > 0.5 ( kmo = 0.695 ) , it was possible to verify that the variables post oncological surgeries were in accordance with the pca application assumptions , after removing the variables creatinine 1 po , urea 1 po , length of hospitalization , duration of surgery , and lactate - ipo . correlation between matrix of variables was assessed using bartlett spherical test ( c = 53.097 , p < 0.0001 ) . using canonical analysis ( axes f1 and f2 ) , it was confirmed that age , n - gal , and apache ii score were the primary variables associated with aki outcome [ figure 1 ] . this study showed that in the context of oncological surgery , the urinary n - gal level assessed at admission to the icu was a strong predictor of aki , and patients with higher values of n - gal showed a trend toward higher hospital mortality . neutrophil gelatinase - associated lipocalin , as well as other lipocalins , is expressed biologically in various tissues , such as lungs , spleen , kidney , liver , brain , heart , and testicles , under healthy conditions in humans . but under stress conditions , it is produced by neutrophils and performs complementary functions , by transporting inflammatory substances ( such as prostaglandins and arachidonic acid ) and mediating the action of iron during inflammatory process . therefore , n - gal has possible immunological action during severe acute situations , such as sepsis and trauma . on the other hand , specifically in the kidney tissue , n - gal is upregulated in injuries ( particularly ischemic and by the use of contrast ) . therefore , it is possible to say that plasma n - gal acts like a neutrophil activation biomarker and urinary n - gal acts like a tubular injury marker . however , because of its small size and resistance to degradation , n - gal is easily detected in the blood and urine . therefore , increased urinary n - gal detection could be affected by a kidney process ( aki ) or it might reflect a severe acute systemic inflammatory process ( e.g. , sepsis or trauma ) . during differentiation of various human tissues , n - gal may play a role in the genesis and , probably , the growth , proliferation , and diffusion of human neoplasms . major surgeries can themselves result in severe systemic inflammatory process , which intrinsically would lead to higher mortality . n - gal has been shown to be increased during the po period of major cardiac and noncardiac surgeries , correlating with the severity of inflammatory process and mortality , and even in other chronic and acute inflammatory conditions , such as extracorporeal circulation and inflammatory bowel disease . acute kidney injury is common in the po period of major surgeries , with a strong impact on morbi - mortality , particularly in patients with cancer . despite its multifactorial nature , a characteristic feature of aki related to po period is its association with systemic inflammation processes . in the present study , urinary n - gal showed a strong correlation to kidney dysfunction and a tendency toward increase in mortality ( possibly not significant due to an insufficient number of patients ) . in this study , urinary n - gal , besides being clearly an aki predictor , was increased ( although without statistical significance ) in patients who died . n - gal has been associated with unfavorable outcome in critical patients , particularly ( but not exclusively ) in sepsis and systemic inflammatory reaction syndrome ( sirs ) patients . inflammation has an important role in cellular biology and cancer pathophysiology , either in the development and emergence of oncogenic mutations and metastasis formation or host reaction and eventual secondary immunosuppression . moreover , secondary to major surgeries , particularly in patients with cancer , a systemic inflammatory process is triggered , including an immunosuppressive anti - inflammatory response - an activity that could be mediated by n - gal . in the current study , all patients were submitted to moderate to high - risk surgery , with severe po inflammation , as shown by the elevated crp levels . in the current study , age > this could only be associated with the intrinsic higher severity of disease in these patients , with higher number of comorbidities and higher aki risk . however , although the literature is not clear regarding the correlation between age and n - gal levels , elderly patients with sirs / sepsis present greater inflammatory activity ( determined by biomarkers ) than younger patients . hence , n - gal could hypothetically be a biomarker of age - related inflammatory activity in these patients . the incidence rate of aki ( 13.6% ) and need for renal replacement therapy ( 4.5% ) in this study were compatible with literature . aki incidence varying from 6.8% ( lung cancer ) and 17.3% ( pancreatectomy ) to 38.3% ( esophageal cancer ) has been described in hospitalized oncology patients , with a strong correlation to hospital mortality . in this study , there was a small increase of aki incidence in gastrointestinal surgeries , although without statistical difference . the main predictors of aki were older age , apache ii score , urinary n - gal , and crp , and the first three parameters maintained their predictability when subjected to multivariate analysis . in po patients , it has been shown that aki is correlated with disease severity , previous diseases ( such as chronic heart failure [ chf ] and diabetes ) , and abdominal surgery . the crp level in critically ill sepsis cancer patients shows a strong correlation with the course of acute disease , thereby being a good marker of inflammatory process . this study has some limitations , primarily because of a single center design and limited number of subjects . in addition , n - gal serum level was not measured , which could better differentiate between systemic inflammatory process and kidney injury . it has also been shown that urinary n - gal has a strong correlation with mortality and inflammatory process , independent of the presence of aki . the serial measurement of n - gal was not performed , which could increase the predictability of the diagnostic test . in addition , because two variables were studied ( oncological and at po status ) it would be difficult to arrive at conclusions on the relative impact of each one of the parameters involved in the development of aki . in a small cohort of cancer patients submitted to major surgery and admitted to the icu , initial urinary n - gal was a predictor of po aki . patients with elevated urinary n - gal also showed a trend toward higher hospital mortality .

background and aims : neutrophil gelatinase - associated lipocalin ( n - gal ) is an early biomarker of acute kidney injury ( aki ) due to various etiologies . on the other hand , n - gal is also elevated in patients with acute inflammatory conditions and in several solid neoplasms . the goal of this study was to assess the efficacy of n - gal as a predictor of aki and mortality in oncological surgical patients postoperatively in the intensive care unit ( icu).methods : this was a prospective cohort observation study on adult cancer patients submitted to elective or emergency surgeries and admitted in the icu . urinary n - gal was measured at the first 2 h after admission . aki incidence and other complications were assessed , including hospital mortality.results:a total of 22 patients were assessed ( 77% male , age 52.8 years , acute physiology and chronic health evaluation ii [ apache ii ] 17.3 ) in whom the most frequent site of cancer was the gastrointestinal tract . aki incidence was 13.6% . urinary n - gal was a predictor of aki ( 22.0 ng / ml in patients without aki vs. 239.1 ng / ml in patients with aki , p < 0.001 ) . multivariate analysis showed that the main predictors of aki were age , apache ii , and n - gal . n - gal was also higher , although not statistically significant in patients who died in the hospital.conclusions:in oncological postoperative patients admitted to the icu , urinary n - gal was an independent predictor of aki ; moreover , its level was higher in the deceased patients .

patients with coronary artery disease ( cad ) and diabetes have higher mortality and morbidity than patients without diabetes . data from studies such as the uk prospective diabetes study suggest that very good glycemic control is associated with fewer cardiovascular events . hypoglycemia is a very common side effect of insulin therapy and , to a lesser extent , of treatment with sulfonylureas . risk factors for severe hypoglycemia include age , duration of diabetes , strict glycemic control , sleep , impaired awareness of hypoglycemia , renal impairment , c - peptide negativity and previous history of severe hypoglycemia . acute hypoglycemia provokes pronounced physiological responses , the important consequences of which are to maintain the supply of glucose to brain and promote hepatic production of glucose . hypoglycemia and the rapid changes in blood glucose have been shown to increase counter - regulatory hormones such as epinephrine and nor - epinephrine , which may induce vasoconstriction and platelet aggregation , thereby precipitating myocardial ischemia . autonomic activation , principally of the sympatho - adrenal system , results in end - organ stimulation and the profuse release of epinephrine which precipitates hemodynamic changes like tachycardia , increased peripheral systolic blood pressure , decreased central blood pressure and increased myocardial contractility with an increased ejection fraction . the increased activity of sympathetic nervous system and secretion of other hormones and peptides such as the potent vasoconstrictor endothelin have pronounced effects on intravascular coagulability and viscosity . increased plasma viscosity occurs during hypoglycemia because of an increase in erythrocyte concentration , while coagulation is promoted by platelet activation and an increment in factor viii and von - willebrand factor . endothelial functions may be compromised during hypoglycemia because of an increase in c - reactive protein , mobilization and activation of neutrophils and platelet activation . the catecholamine - induced increased myocardial contractility may induce ischemia in the myocardium in patients with cad . the greater oxygen demand is not met because of not only the rigid vessels , but also endothelial dysfunction with failure to vasodilate . several studies have shown that the hypoglycemia is associated with a significant lengthening of the corrected qt interval ( qtc ) in subjects with and without diabetes . these changes are likely seen because of increased catecholamine release during hypoglycemia , and qtc prolongation , in particular , could lead to a high risk of ventricular tachycardia and sudden death . hyperinsulinemia and increased secretion of catecholamines may lead to hypokalemia during hypoglycemia , thus potentiating cardiac repolarizing abnormalities . effects of antecedent hypoglycemia on cardiac autonomic regulation may contribute to the occurrence of adverse cardiac events . abnormalities in high - frequency and low - frequency heart rate variability have been associated with hypoglycemia and increased catecholamine release . however , other studies did not find any associations between heart rate variability , hypoglycemia and increased catecholamine release . episodes of hypoglycemia have been found to be associated with rise in inflammatory cytokines including interleukin ( il)-6 , il-8 , tumor necrosis factor ( tnf)- , c - reactive protein and endothelin-1 . these inflammatory cytokines result in endothelial injury and abnormalities in coagulation , resulting in rise of cardiovascular events . inflammatory cytokines like il-1 have also been shown to increase the severity of hypoglycemia , thus perpetuating a positive feedback cycle . vessel wall stiffness was found to be increased during hypoglycemia in patients with type-1 diabetes of longer duration than those with shorter duration of diabetes . thus , hypoglycemia may increase the risk of cardiovascular events , especially in subsets of patients with longer duration of diabetes . inflammation and endothelial dysfunction could potentially be the aggravating factors that contribute to increased cardiovascular risk with severe hypoglycemia , especially in the subset of patients with pre - existing cardiovascular disease , diabetes , and severe autonomic neuropathy . a direct relationship between hypoglycemia and fatal cardiovascular event is difficult to demonstrate as blood glucose and cardiac monitoring are seldom performed simultaneously . in the accord study , excess of deaths was noted in the intensive treatment arm , which led to discontinuation of study . in the smaller study of veterans with type-2 diabetes , veterans affairs diabetes trial ( vadt ) , ecg changes , including ectopic activity , flattening of t - wave , st depression , ventricular tachycardia , and atrial fibrillation , have been reported in cases of low plasma glucose . sudden death during sleep has been described in patients with type-1 diabetes , the mechanism being a significant cardiac arrhythmia induced by nocturnal hypoglycemia . many of these patients have no evidence of severe hypoglycemia - induced neuronal damage at autopsy , implying that a cardiac arrhythmia had been triggered by hypoglycemia , resulting in sudden death . despite the high frequency of nocturnal hypoglycemia in young patients with type-1 diabetes , sudden nocturnal death ( dead in bed syndrome ) is rare . evidence is accumulating that severe hypoglycemia can provoke adverse cardiovascular outcomes such as myocardial ischemia or cardiac arrhythmia . episodes of severe hypoglycemia are common during intensive therapy in type-1 and type-2 diabetes in the out - patient as well as in - patient setting . larger clinical trials are required to look specifically at the association between hypoglycemia and cardiovascular events and to determine the mechanism further . the challenge to the physicians is to lower blood glucose to normal values to decrease the risk for long - term complications and at the same time minimize hypoglycemia and hypoglycemia - associated morbidity and mortality .

hypoglycemia is a very common side effect of insulin therapy and , to a lesser extent , of treatment with oral hypoglycemic agents . severe hypoglycemia can precipitate adverse cardiovascular outcomes such as myocardial ischemia and cardiac arrhythmia . these are mainly secondary to autonomic activation which results in hemodynamic changes , vasoconstriction and rise in intravascular coagulability and viscosity .

protection of human health and the environment is one of the major challenges facing developing as well as developed countries of the world [ 15 ] . the original aim of regulating waste disposal is to reduce the introduction of polluting substances into the atmosphere since protection of the environment is a major challenge facing developing countries such as zimbabwe . the activities in solid waste management in the informal enterprises of gweru involve risk either to the worker directly involved or to the informal enterprise operators . risks occur at every stage in the process , from the point where enterprise operators handle waste in their enterprises for collection or recycling to the point of ultimate disposal [ 611 ] . the informal sector enterprise activities generate large quantities of waste which could be detrimental not only to the environment but to the waste workers as well . many concerns have been raised about the potential harm from waste to the environment and general public , but the risks and consequent costs of occupational hazards in waste management have received little attention in the rush to adopt or adapt technologies such as composting . environmental policies and legislation are , in the main , aimed at regulating the disposal of waste rather than addressing and preventing its generation . in some countries of the developed world attention seems to have shifted towards policies and legislation designed to minimise the generation of waste and to secure its beneficial reutilisation . it is therefore vital in this study to examine the occupational safety and health hazards associated with solid waste generated and disposed of in the informal enterprises of the city of gweru the third largest urban settlement in zimbabwe . the city of gweru covers an area of about 16 700 square kilometres and lies in agro - ecological region three . the main types of soils that characterise the landscape of gweru include black basalt soils , red loams , sands , and gravel . it lies in a watershed which stretches from rusape to bulawayo and is at an altitude of 1422 meters . the municipal area is dissected by numerous streams most of which drain into the gweru river , a tributary of gwayi river . the normal rainy season starts in october right through to april . in the past few years , however , the rainfall patterns have been increasingly becoming poor , with seasons , in some cases , ending in march . temperatures are high in summer ( september to april ) when they may average 30c and low in winter ( may to july ) averaging 14c . mkoba high density suburb located in the western section of the city of gweru is the largest low income residential area and is divided into 20 sections which are referred to as villages . other low income high density suburbs include ascot , monomotapa , senga - nehosho , and mambo and the middle density suburbs include ivene , woodlands , nashville , and shamrock park . high income low density areas are located mainly in the northern and eastern sectors of the city and include lundi park , southdowns , kopje , gweru east , windsor park , daylesford , harben park , brackenhurst , ridgemond , athlone , and riverside . the settlements in gweru are divided into 18 wards and these are located in different directions from the cbd . according to the 2012 national census of zimbabwe undertaken by zimstat , the total population of gweru was 158 233 comprising 73 768 males and 84 465 females and the households make a total of 41 149 out of the city 's 18 wards . the suburbs or residential areas are divided into wards for ease of administration and service provision by the local council . the city of gweru has always had great potential for growth due to its endowment with a wide variety of industries and as a result it has the highest per capita income in zimbabwe . this has resulted in it being the city with the highest employment rate per capita in the country . it is centrally located and hence it is a very accessible place and the hub of traffic traversing the country . the major industries include zimbabwe alloys , a chrome smelting plant , and bata shoe company ( established in 1939 ) , and both are leading employers in gweru . the city is situated in one of zimbabwe 's finest cattle rearing areas : the surrounding agricultural activity revolves around the cattle industry ( both beef and dairy ) . flowers are also grown in the area for the export market , and zimbabwe 's largest distiller , afdis , has extensive vineyards in gweru for the production of wine . mining is also prevalent , mainly chromite ore from rich deposits along the great dyke to the east of gweru . the objective of any informal enterprise should be to minimise the amounts of unwanted products or by - products so as to reduce impact on human health and the environment [ 1319 ] . it is vital to examine the potential environmental and health impacts of waste generated in the informal enterprises since this gives an indication of the effectiveness of the waste management practices such as waste collection and disposal . according to tchobanoglous et al . hazardous wastes are wastes or combinations of waste that pose a substantial present or potential hazard to humans or other living organisms because such wastes are nonbiodegradable or persistent in nature ; they can be biologically magnified , can be lethal , or may otherwise cause or tend to cause detrimental cumulative effects . the environmental management act of zimbabwe defines a hazardous substance as any substance whether solid , liquid , or gas or any organism which is injurious to human health or the environment . it further defines hazardous waste as any waste which is poisonous , corrosive , noxious , explosive , inflammable , radioactive , toxic , or harmful to the environment . the properties of solid waste that have been used to assess whether the waste is hazardous or not are related to questions of safety ( corrosivity , explosivity , flammability , ignitability , and reactivity ) and health ( carcinogenicity , infectivity , irritability , mutagenicity , toxicity , radioactivity , and teratogenicity ) . there has been growing concern over the disposal of solid waste , which may contain small amounts of hazardous waste . hazardous products generated in the informal enterprises , just like those generated in the domestic and industrial sectors , pose a threat to human health and the environment in their use and disposal . in this study , the amounts of hazardous waste in the informal sector solid waste stream were determined by measuring components separated mechanically ( by hand ) from the commingled waste . wastes become a problem when they are harmful to the environment or human health and in this regard the wastes become hazardous . the shrinking of the formal sector industries in zimbabwe has resulted in the growth of home industries in the city of gweru . these home industries generate solid waste and sound management of the waste is the greatest challenge currently facing these industries . these activities produce high quantities of waste which could be detrimental to the health of the waste worker and environment by contributing to air , water , and land pollution as well as pollution of the visual environment and hence a number of safety and health risks if the waste is not properly managed through an efficient waste management system . the informal enterprises are recognised as part of a waste management system in an urban environment in terms of waste recycling . studies in zimbabwe have made preliminary assessments on the impact of domestic and formal waste on the environment [ 2024 ] , but no comprehensive study has been made to determine the characteristics of waste generated in the informal enterprises as well as the occupational safety and health hazards associated with the collection and disposal of the waste . studies have not clearly articulated the issue of the occupational safety and health risks of waste generation , collection , and disposal in the informal enterprises of zimbabwe as deserving investigation because some say it is difficult to study and probably the government does not directly generate any revenue from this sector . this is an area in which our ignorance exceeds our knowledge and hence deserves special attention in this study . the research design employed in the study was closely related to the ontological and epistemological assumptions held about reality by the various stakeholders associated with the informal enterprises of gweru . a multimethods approach triangulating quantitative ( for generating hard data ) and qualitative ( for generating soft data ) approaches was thus employed in the study area comprising a sample of 601 informal enterprises . in this study working procedures , conditions , and occupational safety and health risks were assessed in the informal enterprises of gweru . the study population for questionnaire surveys comprised all the 589 organised informal enterprises in monomotapa high density suburb , shamrock park medium density suburb , mkoba high density suburb , ascot high density suburb , kudzanai market , and kombayi market . focus was on these areas because of the large concentrations of informal enterprises characterised by a diverse range of enterprises that include retail , service , repair , manufacturing , and construction activities . in monomotapa 47 out of 51 enterprises agreed to participate in the survey . at shamrock park there was a combination of informal enterprises and small - scale and medium - scale enterprises . all the 57 informal sector enterprises were selected to participate in the survey and they were those with less than 10 employees and the small - scale and medium - scale enterprises were left out since they did not meet the criteria for defining informal enterprises . all the 182 enterprises at kudzanai that were allocated with stalls from which they operated were involved in this study and participated with keen interest and the majority are retailers of food and clothing . the other market area near the city centre is at kombayi and all the 29 informal enterprises that were allocated stalls participated in the study and at kudzanai these are mainly food and clothing retailers . in mkoba and ascot high density suburbs the majority of enterprise operators participated in the survey and the very few that declined to participate were either suspicious or simply uncooperative . out of a total of 229 enterprises in mkoba , 224 participated from the sections of mkoba 6 , mkoba 14 , and mkoba 16 and in ascot a total of 50 out of 53 enterprises participated in the study . questionnaire surveys were used to realise the immediate objectives of the research as well as to gather data on the informal enterprises of gweru . to gather data on critical areas of solid waste management in the informal sector , the design as recommended by oppenheim , de vaus , and baker was used so as to reduce ambiguity or bias . the questionnaire was developed to cover aspects of the objectives to investigate issues concerning informal enterprise waste generation and disposal practices , availability and type of waste disposal services , and perceptions on the waste management situation in the informal enterprises and how the system can be improved . the questionnaire administered to the home industry operators aimed at collecting information on the quantity and type of waste produced , waste collection and disposal practices , and the occupational safety and health hazards associated with these activities . the instrument was divided into appropriate sections to allow for the systematic collection of data from the enterprises in the different spatial locations of monomotapa , shamrock park , mkoba , kudzanai , kombayi market , and ascot . the survey questionnaire was semistructured , containing both open - ended and closed - ended questions . interviews were for the purpose of gathering information on waste management system in gweru 's home industries , occupational safety and health problems associated with solid waste management , planning for waste management in informal enterprises and environmental impact of waste produced in the home industries . personal observations were undertaken to assess the typical tasks performed during waste collection and disposal and the associated hazards . in addition to the field assessments a focus group discussion was held in each of the spatial areas was held . this was meant to assess the perceptions of the workers as well as enterprise operators on risk perception , injuries and diseases linked to waste occupation and their own ideas for improvement options . data collection for the waste compositional study followed the traditional material based classification adopted by burnley . the samples from the informal enterprises were collected in plastic bags and labelled with unique identity marks . the segregated components were weighed to determine weights as percentages of total weight of a sample . it is generally assumed that solid waste generated in the informal enterprises contributes an insignificant proportion to the total waste stream generated in any urban environment and hence it does not deserve special attention . however , the study reveals that significant quantities of solid waste are generated in the informal sector of gweru especially in market areas that focus on retailing of vegetable and food products and the industrial sectors involved in manufacturing and construction . the major components of the waste stream include food and vegetable wastes at monomotapa , ascot , and mkoba ( 51% , 29% , and 18% of total weight , resp . ) , metals at shamrock park , monomotapa , and mkoba ( 36% , 31% , and 19% of total weight , resp . ) , and paper at mkoba , ascot , and kudzanai ( 11% , 11% , and 9% of total weight , resp . ) . solid waste generated in the retail sector is dominated by biodegradable waste in the form of food and vegetable waste as well as long - term biodegradable ( incinerable ) wastes such as paper , textiles , rubber , and leather products . the biodegradable waste stream dominates in the market areas of kudzanai and kombayi where it constitutes an average of 57.1% of waste generated in these areas . in the market areas located in ascot and mkoba , the biodegradable fraction comprises 31.6% and 20% , respectively , of the waste generated in those areas . it is important to note that biodegradability is a vital biological characteristic of the organic component of solid waste . therefore , wastes with low lignin content such as food wastes and vegetable wastes are more biodegradable than those with high lignin content such as paper and plastic that are dominant in some enterprises . establishing biodegradability of solid waste is essential because the majority of environmental and health problems associated with waste generated in the enterprises are caused by the biodegradable components . this assertion confirms findings in the literature regarding the impacts of biodegradability of solid waste on human health and the environment ( see [ 2935 ] and tchobanoglous , 2003 ) . the nonbiodegradable waste fraction includes metals , plastics , and inerts arising out of builder 's rubble . metals dominate in the manufacturing and construction enterprises at monomotapa and shamrock park and constitute on average 30.6% and 39.6% , respectively , of the total waste generated in those areas . this can be attributed to the nature of activities associated with these enterprises that include welding , steel fabrication , panel beating , mechanical and electrical engineering , and tinsmithing . the dry recyclables such as paper , plastics , and glass are lower in most cases due to the informal practices of waste reduction , reuse , and recycling with the involvement of rag pickers , itinerant buyers , and dealers of recyclables . the composition of hazardous waste generated in the informal enterprises of gweru is shown in table 1 . hazardous waste contributes on average 2.6% of total waste by weight in the informal enterprises . although occurring in small quantities , the hazardous solid waste can have significant negative impacts on human health and environment when improperly disposed of . the hazardous wastes pose substantial present or potential hazards to humans or other living organisms because they are nondegradable , are persistent in nature , or are lethal . the typical problems associated with hazardous enterprise wastes identified above are summarised in table 2 . in the informal enterprises of gweru , the hazardous waste stream comprises mainly cleaning products , personal care products , automotive products , pesticides , insecticides , and herbicides , and miscellany which incorporates batteries and sharps such as broken glassware . there is risk caused by the myriad of toxic chemicals present in some the hazardous waste shown in table 2 , especially the e - waste because of its association with heavy metals such as arsenic , cadmium , chromium , lead , and mercury . these heavy metals have no beneficial effects in humans and there is no known homeostasis mechanism for them . these elements are regarded as most toxic to humans and animals and the adverse human health effects associated with exposure to them , even at low concentrations , are adverse and include , but are not limited to , neurotoxic and carcinogenic actions [ 3638 ] . arsenic is a metalloid that would be associated with insecticide containers discarded in the informal enterprises . in organic arsenic is considered carcinogenic and is related mainly to lung , kidney , bladder , and skin disorders . the toxicity of arsenic in its organic form has been known for decades under the following forms : acute toxicity , subchronic toxicity , genetic toxicity , developmental and reproductive toxicity , immunotoxicity , and biochemical and cellular toxicity [ 18 , 32 ] . the solid wastes generated in the enterprises such as lead and zinc batteries , detergent containers , and pvc contain cadmium which derives its toxicological properties from its chemical similarity to zinc . cadmium accumulates in the human body affecting several organs that include the liver , kidneys , lungs , bones ( osteomalacia ; osteoporosis ) , the placenta , brain , and the central nervous system . other types of damage that have been observed include reproductive and development toxicity and hepatic , haematological , and immunological effects . discarded batteries , alloys , and petroleum additives associated with the informal enterprises are linked with the heavy metal lead which has no essential function in the human body.toxic waste is capable of causing injury or death through injection , inhalation , or skin absorption ; some can cause cancer , genetic mutation , and foetal harm.flammable/combustible wastes can be easily set on fire.corrosive waste can burn and destroy living tissue or other materials when brought into contact with them.once in the bloodstream , lead is primarily distributed among blood , soft tissue , and mineralising tissue and children are particularly sensitive to this metal because of their more rapid growth rate and metabolism , with critical effects in the developing nervous system . mercury would be associated with containers of seed preservatives , fungicides , pharmaceuticals , and batteries discarded in the informal enterprises and it is one of the most toxic heavy metals in the environment . thus far the disposal of e - waste with the rest of the municipal solid waste may result in negative impacts on the environment such as groundwater contamination by lead leaching and high concentrations of lead in lead leachate . when e - waste is burnt in incinerators , heavy metals become concentrated in the ash , limiting its disposal and reuse options . since most of the plastic materials in e - waste contain flame retardants that are mainly halogenated organic chemicals , toxic organic contaminants such as dioxins and furans may be formed during incineration and exit through the stack to the surrounding areas in the form of gaseous pollutants . toxic waste is capable of causing injury or death through injection , inhalation , or skin absorption ; some can cause cancer , genetic mutation , and foetal harm . flammable / combustible wastes can be easily set on fire . corrosive waste can burn and destroy living tissue or other materials when brought into contact with them . the actual fate of the small quantities of hazardous waste generated in municipal solid waste is generally unknown and hence the environmental persistence of these hazardous compounds is one of the critical issues in their long - term management and this is true with regard to the hazardous waste generated in the informal sector of gweru identified in table 2 . in the informal enterprises the hazards associated with nonpersistent organic waste emanating from containers of oil , some solvents , biodegradable pesticides , waste oils , and most detergents cause toxicity problems to the environment and biota . persistent organic wastes such as some pesticides are associated with immediate toxic effects ( acute and subacute ) resulting in long - term chronic toxicity and the transportation of organic waste from the source can result in widespread contamination and bioconcentration in the food chain . occupational health concerns emanating from solid waste in the informal enterprises relate to the infestation of areas used for storage and disposal of solid wastes with vermin and insects that serve as potential disease vectors ( figure 2 ) . during focus group discussions and questionnaire interviews with enterprise operators a number of waste related problems the problems identified included disease transmitting insects such as flies and cockroaches and increasing populations of rodents and odours . the provincial environmental health technician in the ministry of health and child welfare and the senior environmental health officer in the gweru city health department confirmed that the problems of disease transmitting insects were attributable to the indiscriminate dumping of refuse . enterprise operators reported that the waste related problems were attributed to noncollection or erratic collection of waste and the lack of adequate temporary storage facilities . open space dumping in the backyards of enterprises as well as improvised pit dumping has provided fertile grounds for breeding of disease transmitting insects such as the two - winged fly ( diptera ) and cockroaches ( dictyoptera ) . the most important fly species from the point of view of pathogen transmission observed in the enterprise dumping areas were the housefly ( musca domestica ) and a species of the tropical green blowfly ( chrysomya ) . musca domestica breed on solid , moist , and fermenting organic matter and can develop in less than two weeks after the eggs are laid over a temperature range of 20c30c . cockroaches are usually attracted by the moisture in waste streams and are potential carriers of faecal pathogens . in confirming these problems the senior environmental health officer in the city of gweru revealed thatflies and cockroaches breeding and feeding on the indiscriminately dumped solid waste carry particles of waste from place to place . flies spread enteric infections such as diarrhoea , typhoid , dysentery , eye infections and skin infections such as cutaneous ephthera [ sic ] and yaws and incidents of such diseases as diarrhoea have occurred in the informal enterprises . these incidents are common during rainy seasons when fly populations increase and when collections are erratic due to logistic problems . the conditions at kudzanai market as well as at kombayi market are particularly worrying during the rainy season when uncontrolled dumping can result in unsightly heaps of waste and this is detrimental to human health . flies and cockroaches breeding and feeding on the indiscriminately dumped solid waste carry particles of waste from place to place . flies spread enteric infections such as diarrhoea , typhoid , dysentery , eye infections and skin infections such as cutaneous ephthera [ sic ] and yaws and incidents of such diseases as diarrhoea have occurred in the informal enterprises . these incidents are common during rainy seasons when fly populations increase and when collections are erratic due to logistic problems . the conditions at kudzanai market as well as at kombayi market are particularly worrying during the rainy season when uncontrolled dumping can result in unsightly heaps of waste and this is detrimental to human health . increasing rat populations were reported by 69% of the enterprise operators especially in those enterprises where waste is disposed of in open pits . the rats are such a menace and have the potential of spreading flea - borne disease and plague . though such diseases have not yet occurred in the enterprises , they need to be guarded against as the rat populations continue to increase . in those enterprises with an unreliable collection system , burning of combustible solid waste such as paper , plastic rubber , and textiles waste hot ashes which are added to combustible refuse pose a great danger to the inhabitants adjacent to the enterprises since this results in uncontrolled fires . in most cases the fires start with the objectionable practice of open burning of waste and the smoke from the burning refuse is an environmental nuisance to surrounding residents . it has also been observed that waste management procedures in developing countries are characterised by a dominance of manual handling tasks . the waste generated in the informal enterprises exposes those involved in the collection and recycling to a diversity of occupational health hazards that might not be easily treated due to limited access to healthcare facilities . exposure to occupational hazards in terms of waste management is defined by the properties of the waste , the management task ( collection , transport , and recycling ) , and the applied procedures and technologies . waste collection from the informal sector also involves carrying heavy loads and rotting organic waste or waste contaminated with pathogens and/or hazardous substances is handled . the waste handlers in the enterprises have shown a high risk of muscular - skeletal disorders such as low back pain and elbow / wrist pain twice as often as the control group due to handling heavy loads . furthermore , the repetition of similar movements of hands and arms when grabbing and disposing waste containers causes joint problems as also observed by yang et al . , 2001 ; the risks associated with solid waste management in the informal enterprises can thus be divided into the following categories : occupational accidents , physical risks , chemical risks , ergonomic risks , psychological risks , and biological risks . the health risks either to the worker directly involved or to the enterprise operators and nearby residents are caused by many factors that include the following : the nature of raw waste , its composition ( e.g. , toxic , allergic , and infectious substances ) , and its components ( e.g. , gases , dusts , leachates , and sharps).the nature of waste as it decomposes ( e.g. , gases , dusts , leachates , and particle sizes ) and their change in ability to cause a toxic , allergic , or infectious health response.the handling of waste ( e.g. , shovelling , lifting , equipment vibrations , and accidents).the processing of wastes ( e.g. , odour , noise , vibration , accidents , air and water emissions , residuals , explosions , and fires).the disposal of wastes ( e.g. , odour , noise , vibration , stability of waste piles , air and water emissions , explosions , and fires).the health hazards associated with waste management in gweru according to records from the gweru city council 's health department are summarised in table 4 . the nature of raw waste , its composition ( e.g. , toxic , allergic , and infectious substances ) , and its components ( e.g. , gases , dusts , leachates , and sharps ) . the nature of waste as it decomposes ( e.g. , gases , dusts , leachates , and particle sizes ) and their change in ability to cause a toxic , allergic , or infectious health response . the handling of waste ( e.g. , shovelling , lifting , equipment vibrations , and accidents ) . the processing of wastes ( e.g. , odour , noise , vibration , accidents , air and water emissions , residuals , explosions , and fires ) . the disposal of wastes ( e.g. , odour , noise , vibration , stability of waste piles , air and water emissions , explosions , and fires ) . an interview with a health authority in the gweru city council confirmed the statistics shown in table 7 which revealed that 40% of waste collectors who were referred to gweru provincial hospital suffered cuts and punchers while 16% suffered from sprains . eye injuries were mainly due to dust and smoke from the fires at the dumpsite . the official also indicated that there were no active vaccination programs for workers due to low financial allocation to the health sector by the national fiscus , although she quickly pointed out that injections were administered at the time of occurrence . she indicated that a single rabies injection / vile can cost up to us$100 . back and truck injuries have the lowest incidences at 2% but when they occur they are highly life - threatening . table 5 shows the number and percentage of occupational injuries among workers in the cleansing section of the gweru city council health services department , by injury type and cause from 2011 to 2012 according to statistics from the human resources department . the common mechanical hazards affecting waste workers in the informal enterprises include cuts from sharp items ( razor blades , glass cutlets , and metal pieces ) and needle pricks from dressmaking enterprises . observations revealed that workers are also at risk of being electrocuted from naked wires , wrong wiring connections , traumatic injuries from sharp objects , burns from electric sparks during electrical fixing , dust from carpenters and grind mills , noise from welders and milers , and exposure to heat and ultraviolet radiation from welding . health hazards also emanate from infections caused by biological agents , especially virus infections such as hepatitis b / c . tetanus infection is also a serious concern since some of the workers are not vaccinated and the wounds are not treated adequately due to a lack of hygiene and the necessity to resume work immediately in order not to lose income . other mechanical risks include bruises from hitting equipment , fractures , and contusions evoked by falling from unsecured platforms of trucks . however , closely connected with waste collection are cuts from sharp items from waste generated in the informal enterprises as well as falling accidents from small platforms of waste collection trucks . the mechanical safety and health problems associated with solid waste management in the informal enterprises were succinctly explained by a municipal waste worker who was busy collecting waste at monomotapa:mechanical hazards associated with solid waste generated and disposed in the informal sector include piercing , scraping and bruising by scrap metals , old wires and vehicle shells resulting in wounds from contact with sharp waste . hazards like broken bottles , liquid fires at fuelling depots , residual fires at landfills , bins with jagged edges and compactors pose safety hazards to us employees . broken bottles , glasses and other sharp objects impale our already worn out gloves thus exposing us to cuts and bruises which may lead to diseases like tetanus , dermatitis and may eventually fester into septic wounds . we also do not have adequate protective clothing to protect ourselves especially face masks , gloves and overalls . mechanical hazards associated with solid waste generated and disposed in the informal sector include piercing , scraping and bruising by scrap metals , old wires and vehicle shells resulting in wounds from contact with sharp waste . hazards like broken bottles , liquid fires at fuelling depots , residual fires at landfills , bins with jagged edges and compactors pose safety hazards to us employees . broken bottles , glasses and other sharp objects impale our already worn out gloves thus exposing us to cuts and bruises which may lead to diseases like tetanus , dermatitis and may eventually fester into septic wounds . we also do not have adequate protective clothing to protect ourselves especially face masks , gloves and overalls . there are various methods used by the gweru city council to prevent injuries and these include the use of personal protective equipment ( ppe ) , personal protective clothing ( ppc ) , and safety warnings ppc such as dust masks and respirators are used to deal with problems of high levels of dust and smoke . however , landfill workers and bin loaders complained that the material used to make the masks is not very effective since they are facing respiratory difficulties during the time of waste burning . some of the masks do not fit to faces since they do not have room for adjustment ; hence some workers would rather operate without masks , a move that may be detrimental to their health and most of the time most workers do not have the masks since they are usually in short supply ( figure 3 ) . work - suits and safety shoes are also used as a way of protecting the body from harmful objects . furthermore , ear plugs are used in areas with high levels of noise . working in areas with high levels of noise ergonomic hazards in the informal enterprises result from carrying or lifting heavy loads , repetitive movement and work , that is , shovelling , muscular - skeletal disorders resulting from handling heavy containers , heat stress resulting from exposure to excessive temperatures , and hearing loss due to too much exposure to excessive noise . collection and sorting operations require repeated lifting and twisting motions which are common sources of musculoskeletal injuries including repetitive strain injuries . collection workers must lift , twist , and dump heavy bins and bags and during curbside sorting the lifting can exceed guidelines recommended and hence is likely to cause harm ( figure 4 ) . manual sorting tasks often require reaching , lifting , and twisting and this can cause workers pain , soreness , general fatigue , tendonitis , and musculoskeletal injuries of the feet , arms , shoulders , hands , wrists , and lower and upper back . observations showed that garbage workers experienced a high incidence of repetitive strain injuries because of repeated flexing and twisting motions , further noting that waste collection workers are usually inadequately trained and prepared for the fine motor activities required for curb side sorting hence exposure to ergonomic hazards ( table 6 ) . it is the awkward postures , forceful exertions , static loading , extended reaches , deviated wrist hand and arm postures , and contact stress which present major ergonomic hazards . a total of 32 waste collectors were interviewed on healthy ergonomics behaviour ; 29 of them are male and aged between 18 and 50 years . it became clear that most men had some insight into the occupational hazards of their workplaces but generally lacked thorough factual occupational health and safety knowledge . the respondents were able to mention certain safety related occupational health risks but did not consider these hazards to be dangerous to their health or capable of causing disease . for example , the waste collection crews in mkoba and ascot considered their trade to be dangerous but could not explain the health effects that were related to the job . the level of awareness regarding the major areas of ergonomics was found to be low among the collection crew members who operated in the informal enterprises when compared to the office workers as shown in table 7 . in identifying the health impacts of chemical and biological agents in the informal sector , the possible obstructing factors include the following : the long period before the effect becomes manifested , the multiplicity of causes of diseases ( which makes it difficult to distinguish occupational diseases from diseases caused by , e.g. , unhygienic living conditions ) ; the lack of knowledge mechanisms involved in the pathogenesis of human chronic diseases ; and a wrong classification of diseases . there is high danger of skin and blood infections resulting from direct contact with these liquids and from infected wounds intoxication and skin irritation resulting from contact with small amounts of hazardous chemical waste . residues of hazardous chemicals in recyclable containers and their gaseous emissions pose hazards to workers involved in the collection , sorting , and washing processes . chemicals that pose risks include chlorine , fluorine , paper beaching , deinking , pulping agents , plastic additives and equipment cleaning solvents , and insecticides and herbicides . contact with skin or inhalation or even ingestion of these chemicals can cause dermatitis , disorder to the central nervous system , and possible liver and kidney damage . exposure to fumes from heated metals can produce metal fume fever which is a flu - like condition . exposure to chemicals can also cause irritation to the skin and respiratory tract and potential damage to the liver and central nervous system . inhalation of metal , glass , paper , or plastic dust from shredding , demagging , and detinning can cause or aggravate chest discomfort , bronchitis , or asthma . acute exposure to metal dust may cause irritation of the upper respiratory system and eventually severe pulmonary irritation . chronic exposure to some heavy metals may cause cancer and adverse effects to the central nervous gastrointestinal system . disposal of old batteries and electronic and electrical appliances such as cell phones , radios , computers , televisions , digital satellite decoders , and fluorescent tubes may pose danger as these contain toxic substances such as mercury , lead , and cadmium . motor mechanics and welders at shamrock park , monomotapa , ascot , and mkoba use paraffin , paint , and solvents such as benzene and methylated spirit and there is high danger of skin and blood infections resulting from direct contact with these liquids . scrap batteries removed from vehicles have the potential of corroding clothes , causing blisters , and fire outbreaks due to the acid containers . scrap metal from welding shops and garages is hazardous since people experience cuts when collecting and disposing waste materials . empty bottles of toxic chemicals are dangerous to children who play with these and poisoning may occur through ingestion , absorption , and inhalation of gases in empty containers . biological hazards associated with waste generated and disposed of in the informal sector enterprises include water borne diseases resulting from flies and mosquitoes breeding in dumping sites around the enterprises . rabid dogs scrambling in bins may result in bites that cause rabies and rodents may also spread disease . dermal and blood infections may result from direct contact with waste and from infected wounds , zoonosis due to bites by wild or stray animals feeding on waste , and enteric infections transmitted by insects . leaching of toxic matter in areas close to the dumps leads to contamination of water sources resulting in diarrheal diseases . workers may be infected by biological agents such as bacteria and viruses that contaminate waste , which are usually formed from the decomposition of matter and result in infections . cuts or puncture wounds from broken glass , metal edges , or needles become the site of infection following exposure to bacteria and viruses and the infections include hepatitis b , fungi , or parasites . common health problems associated with exposure to certain bacteria , fungi , and viruses include contact dermatitis infections , diarrhoea , and skin diseases . long - term occupational exposure to contaminated air in composting operations can include allergic responses such as asthma , chronic bronchitis , and hay fever . other symptoms in waste workers include chills , irritation of eyes , nose , and upper respiratory tract , nausea , headache , chest tightness , and feeling of influenza . workers in paper sorting operations have the highest incidence or chances of lung infections compared to all other waste workers and this is a result of high levels of organic dust and endotoxins ( poisonous substances produced by bacteria in the air ) . water - borne diseases are also biological hazards emanating from flies and mosquitoes breeding in dumpsites and causing malaria . dermal and blood infections from direct contact with waste and from infected wounds , zoonosis resulting from bites by stray animals feeding on waste , and enteric infections transmitted by insects are the other biological hazards . it has been documented that waste workers experience higher incidents of diarrhoea , viral hepatitis , and higher incidents of obstructive and restrictive respiratory disorders than control groups and suffer from dog and rat bites , skin diseases , and jaundice [ 34 , 43 ] . some of the problems that were reported by the authorities in the city of gweru as emanating from waste generated in the enterprises are like common cold , cough , bronchitis , bronchial asthma , tuberculosis , and other respiratory problems . however , other authors such as van eerd and porta et al . have noted that it is difficult to prove a direct link between these diseases and the waste occupation . occupational exposure in the case of solid waste management activities in the informal enterprises of gweru is influenced especially by the properties of the waste and secondly by the management task which involves collection and disposal as well as the applied procedures and technologies . solid waste management procedures in the informal sector of gweru are characterised by a dominance of manual handling tasks . collection involves carrying heavy loads and rotting organic waste or waste contaminated with pathogens and/or hazardous substances . the working conditions and properties of the waste expose workers involved in collection and disposal of waste to a diversity of occupational safety and health hazards that might not be treated adequately due to limited resources . a holistic view of waste management implies integrating the waste management system into the informal enterprises activities and the gweru municipality as an organisation since this incorporates occupational safety and health aspects ( see figure 5 ) . for the manufacturing and construction enterprises in monomotapa , shamrock park , mkoba , and ascot there would be need to take into account the waste management issues as an integral part of the design activity . t would represent the process such as construction and manufacturing , while e would represent an aggregate of the base level process design activity b1 and another base level activity e2 which both refine t by specifying cycle by cycle its attributes with an aim to end up with an acceptable performance of t assessed against a predefined set of performance criteria . e2 refers to the she system taking into account safety , health , and environmental issues of the activities . waste workers in the informal enterprises of gweru experience a number of adverse health and safety effects and these include higher incidents of diarrhoea , viral hepatitis , higher incidents of obstructive and restrictive respiratory disorders , and dog and rat bites , skin diseases , and jaundice . there are also higher incidents of muscular - skeletal disorders affecting the waste collectors such as low back pain and elbow / wrist pain and joint problems which arise from the repetitive movements of hands and arms when grabbing and disposing waste containers . the common mechanical hazards in the informal enterprises of gweru include cuts from sharp items such as razor blades , glass cutlets , and metal pieces . workers are thus exposed to the risk of infections caused by biological agents , especially virus infections . infections such as hepatitis b / c and tetanus are a major concern since workers are rarely vaccinated and wounds are not treated adequately due to a lack of hygiene and the desire to resume work immediately so as not to lose income . mechanical risks experienced by waste workers in gweru include bruises from hitting equipment , fractures , and contusions evoked by falling from unsecured platforms of trucks . since safety , health , and environmental management systems are a vital component of the waste management model shown in figure 5 , risk assessment therefore becomes imperative in determining and evaluating the risks posed by the working conditions of the waste workers . risk assessment is a systematic examination of all aspects of work and it considers what could cause injury or harm , whether the hazards could be eliminated , and what preventive or protective measures should be put in place to control the risks . undertaking risk assessment would enable the municipality of gweru and the enterprise operators to understand the action necessary to improve workplace occupational health and safety . the ultimate objective is to decide on an action plan designed to establish the control of risk and to ensure that risk control remains effective . risk assessment directly relates to the actual techniques and procedures in detecting what hazards could cause injury or long - term health impacts . the focus group discussions with waste workers and interviews with waste authorities in gweru showed indeed that transfer mechanisms of waste from temporary waste disposal receptacles into municipal receptacles needed urgent attention . the risk assessment survey also showed that the waste management conditions in the informal sector enterprises were hazardous . waste collection involved manual handling of plastic and metal bins and this was associated with a number of ergonomic hazards as discussed in the previous sections . some of the roads , especially in mkoba , ascot , and monomotapa high density suburbs , were rough and unpaved and hence posed risks in the form of road accidents . waste was also sometimes strewn down the streets from the collection vehicles . in all the enterprises including those in monomotapa and shamrock park , sharp items such as razor blades , glass cutlets , and syringes as well as hazardous substances such as broken where plastic bags were used for collecting solid waste , the thin permeable material posed dermal exposure because hazardous substances , microorganisms , and sharp items also injure workers when handling the waste bags with bare hands . there is inadequate and improper personal protective clothing ( ppe ) as evidenced by the torn or makeshift protective clothing such as the gloves worn as protection by the workers . it was also revealed through risk assessment that most of the waste workers as well as enterprise operators had been affected by cuts and skin rashes that were caused by substances and insects associated with the disposed - of solid waste . the open wounds were also at risk of being infected by tuberculosis in such unhygienic working conditions . it has been observed by bleck and wettberg that hepatitis b infections can occur when the cuts are caused by razor blades or syringes which are disposed of in the ordinary waste stream . dust is generated in quite visible amounts in informal sector enterprises especially at monomotapa , kombayi market , ascot , and mkoba . this was during the pouring of waste into collection bags and also during the transfer of waste into containers . dust constitutes a major hazard because of its contribution to inhalation ; exposure to biological agents and bronchial asthma , cough , and other respiratory problems may result . the ergonomic hazards are exacerbated by the carrying and emptying of heavy unstable waste bags and this is a major health hazard among the female workers . the safety interventions in gweru are complicated by the fact that solid waste collection is undertaken through labour intensive systems and hence workers experience high physical loads and inadequately stored waste . in the low - tech waste management sector of the city of gweru , occupational safety and health intervention is often equalled with the supply of personal protective clothing . this has been proven to be one of the least effective measures due to the demand for correct application , infrequency of supply , and inadequate materials as also in studies undertaken elsewhere by kenao . officials from the health department of the city of gweru indicated that their safety interventions included mainly the provision of ppe . the environmental health officer in the city of gweru indicated that we provide our waste collection crew with ppe to protect themselves against occupational hazards associated with the collection and disposal of solid waste and this has proven to be effective through the years . van eerd , however , notes that health officials may not be aware that protective devises are among the least effective safety interventions and that the long distribution intervals , especially for masks , rendered the supply itself absurdum . usually even when workers are supplied with the protective equipment , they normally do not use it as a result of lack of awareness as well as their low social status . a sustainable solution to increase occupation safety and health among the workers would be the adaptation of workplace and process design . improving the occupational safety of waste workers is thus a crucial step to increase their social welfare . this can only be done in an efficient manner by firstly identifying the actual occupational risks associated with solid waste management activities . this is vital in the quest to apply a hierarchy for exposure control measures as initiated by the council directive 89/391/eec of june 1989 . this entails eliminating the hazard at its source , for example , substituting hazardous chemicals or omitting burdensome work steps and hence rendering additional work steps unnecessary and it is the most efficient precaution . technical measures are also vital and these involve safer equipment and are more preferable to individual measures such as personal protective equipment and training in proper behaviour . these do not eliminate the hazard per se but only provide a barrier between the hazard and the worker at the ultimate point . this is the stopp principle : s : substitution of hazardous process or material.t : technical measures.o : organisational measures.p : personal protective equipment.p : personal behaviour.the lack of a comprehensive waste policy that is packaged to deal with safety , health , and environmental management issues in zimbabwe has compromised effective solid waste management in the informal sector . there is lack of consensus on what constitutes solid waste , its characteristics , and how the waste should be managed and this has resulted in the municipalities having no proper guidelines over the organisation of sustainable solid waste management in the informal enterprises .

this study identifies and analyses the occupational risks associated with solid waste management practices in the informal enterprises of gweru . many concerns have been raised about the potential harm from waste to the environment and the general public , but the risks and consequent costs of occupational hazards in waste management have received little attention in the rush to adopt or adapt technologies such as composting . a multimethods research design that triangulates qualitative and quantitative research paradigms is employed in this study . the quantitative design involves physical characterisation of solid waste through material component separation and measurements as well as a questionnaire survey that investigates the risks associated with waste management . the qualitative component includes interviews , open - ended questionnaires , and field observations . occupational risks occur at every stage in the waste management process , from the point where workers handle waste in the enterprises for collection or recycling to the point of ultimate disposal . key findings from the study revealed that solid waste management practices are dominated by manual handling tasks hence the higher incidents of muscular - skeletal disorders . other safety and health hazards associated with waste management in the informal enterprises of gweru include incidents of diarrhoea , viral hepatitis , and higher incidents of obstructive and restrictive disorders .

shivering associated with neuraxial anesthesia is a frequent complication ; occurring in up to 55% of patients . shivering is uncomfortable for the patient and may interfere with monitoring of electrocardiogram , blood pressure ( bp ) , and oxygen saturation . the metabolic and hemodynamic consequences of shivering include increased disbursement of cardiac and systemic energy , increased oxygen consumption and carbon dioxide production , and increased cardiac work . the mechanisms chiefly responsible for shivering in patients undergoing surgery are intraoperative temperature loss , increased sympathetic tone , pain and systemic release of pyrogens . spinal anesthesia for cesarean section still continues to be a popular technique because it provides many advantages such as rapid onset , high success rate , minimal maternal and fetal drug exposure and minimal maternal aspiration . in spite of several investigations used to treat shivering after spinal anesthesia little is known about the exact etiology of shivering and the best way of prevention . meperidine has been used for a long time to treat and prevent shivering , with somecontroversy of its optimal dose without producing undesired side - effects . recommended use of intrathecal meperidine to decrease the incidence of shivering without considerable side - effects in the obstetrical population but in another study khan et al . found that intrathecal meperidine can not be recommended in caesarean section to prevent shivering as its use however , these controversy and lack of meta - analysis study to clear the risk and benefit of injecting meperidine into intratechal spaceforced us to do this study . the purpose of this study was to compare the effect of adding different doses of intrathecal meperdine on the incidence , intensity and other side - effects during delivery under spinal anesthesia . this randomized double - blinded clinical trial was conducted between august 2009 and august 2010 in the educational hospitals of busheher university of medical sciences , bushehr , iran . this study was approved by the ethics committee of busheher university of medical sciences and is registered at the clinicaltrials.gov database ( reference no . this study was performed according to the requirements of the declaration of helsinki . after attaining informed consent 156 parturient women ( asa physical status i or ii ) scheduled for elective cesarean delivery under spinal anesthesia parturient women with contraindications to regional anesthesia , hypersensitivity to amide local anesthetics or meperidine , history of headache , smoking , previous postoperative nausea and vomiting , opioid use or severe preeclampsia were excluded . patients were randomly assigned to four equal groups for spinal anesthesia according to numbers inserted in sealed envelopes . the temperature of the operating room was kept instantly using a calibrated temperature in cases and control groups . before the spinal anesthesia was administered , patients were placed under standard monitoring ( blood pressure , electrocardiogram , heart rate and oxygen saturation ) and received iv lactated ringer 's solution 10ml / kg . during anesthesia , oxygen was given , and patients were covered with drapes but not activelywarmed . standard group received only 2 cc heavy bupivacaine 0.5% ( 10 mg ) ( group i ) and we added free preservative meperidine in three experimental groups . heavy bupivacaine 0.5% ( 10 mg ) plus 0/2 mg / kg free preservative meperidine ( group ii ) , heavy bupivacaine 0.5% ( 10 mg ) plus 0/3 mg / kg free preservative meperidine ( group iii ) , heavy bupivacaine 0.5% ( 10 mg ) plus 0/4 mg/ kg free preservative meperidine ( group iv ) . spinal anesthesia was administered in sitting position at the l4 - 5 interspace with a midline approach by using a 25-gauge quincke needle . solutions were prepared by another anesthesiologist so that the anesthesiologist performing the spinal block was blind to which drug was injected . active support of ventilation was provided if there was any sign of respiratory depression ( spo2 less than 95% ) in the case and control groups . sensory anesthesia was evaluated by pinprick at one - minute intervals for 10 min , five - minute intervals for 35 min , and then at ten - minute intervals until regression to l4 . once patients were in the post - anesthesia care unit , motor blockade was assessed with the bromage scale:1 , unable to move feet ; 2 , able to move feet only ; 3 , just able to move knees ; and 4 , full flexion of knees and feet . hypotension was defined as a decrease in systolic blood pressure to < 90 mm hg or 30% less than baseline value . it was treated with 5 - 10 mg of ephedrine iv and bradycardia ( heart rate<50 ) was treated with intravenous atropine 0.5 mg . vomiting was scored yes or no ; nausea was scored none , mild , moderate or severe on a verbal patient / examiner / scale and metoclopramide 10 mg iv was administered for moderate to severe nausea and vomiting . supplemental intraoperative analgesia was limited to iv fentanyl ( 1 - 2 g / kg ) , which was standardized and used as a rescue dose if necessary . the tympanic temperature was monitored every 20 min from one side ( right ear ) . the operating room temperature was maintained at 21c23c for all patients using a calibrated temperature . shivering was graded with a scale described by crossley and mahajan : 0 , no shivering ; 1 , piloerection or peripheral vasoconstriction but no visible shivering ; 2 , muscular activity in only one muscle group ; 3 , muscular activity in more than one muscle group but not generalized shivering ; and 4 , shivering involving the whole body . all patients were asked on the first and second postoperative day about occurrence of headache , backache , paraesthesia , pain in thighs , buttocks or leg etc . demographic data was collected by an observer unaware of the study groups ; and demographic data except vomiting and maximal intensity of shivering were compared using kruskal wallis h. the maximal intensity of shivering and vomiting were compared using chi - square . to obtain at least 50% reduction in expected incidence , with error of 0.05 and a error of 0.2 , a sample size of 39 patients per group was needed . there was no significant difference between groups in terms of demographic and surgical data [ table 1 ] . time to highest sensory level and maximum number of segments blocked also regression of sensory and motor blocks showed no difference between the groups . demographic and surgical data vomiting was increased with higher dose of meperidine and was most common in group iv . finally , the usage of methoclopramide as antiemetic drug was more frequently in experimental groups . the systolic bp was similar between groups for each time interval , as was patient temperature . we lost one patient in the control group and two patients in the experimental groups because of failure of spinal block . there was no need for rescue dose of fentanyl in the case and experimental groups . first need forpostoperative analgesia in groups ii , iii , iv compared to standard group was ( median time to need analgesic drug):130,140,140 versus 80 min,(p<0.05 ) . need for analgesic drugs was more in the standard group ( 17.6%)(p = 0.000 ) but was not significantly different between experimental groups ( 4.6% , 4.8% and 4.3% , respectively ( p = 0.641 ) . the incidence and intensity of shivering between the groups of study decreased as the dose of meperidine increased ( incidence : 47.5% , 37.5% , 27.5% and 15.0% , respectively ) ( p=0.002 ) [ figure 1 ] . the incidence of pruritis also increased to 25.64 , 28.21 , 38.46 , and 48.72 respectively ) ( p=0.000 ) . according to the obtained results , adding meperidine , in increasing small dosages , to the intrathecal mixture anesthesia for cesarean delivery reduces the incidence and intensity of shivering but increases undesirable side - effects that bother the patients . although a lot of iv drugs were used for the treatment of postoperative shivering iv meperidine is the gold standard . the main consequences of postoperative shivering are an increase of oxygen consumption and of co2 production . otherwise , it also produces an increase in intracranial pressure , interferes with electrocardiographic monitoring , and causes general discomfort , including a sensation of feeling cold . postoperative shivering produces physiological changes and constitutes a significant risk during the early postoperative period in high - risk patients . the prevention of shivering is more important than its treatment and has not been well - investigated . when we compare treatment of shivering with intrathecal route and iv route we might find two advantages in the former : first , it is a preventive treatment , therefore , patients are spared the negative experience associated with shivering . second , the administration of iv drug is associated with unwanted side - effects which can be harmful , especially in obstetrics women . although the etiology of post - spinal shivering is inadequately understood , various risk factors have been evaluated . among these , hypothermia , stress , uncontrolled pain , uninhibited spinal reflexes , and decreased sympathetic activity are frequently mentioned . meperidine , which binds to both mu and k - opioid receptors , is frequently recommended for the treatment of postoperative shivering and the anti - shivering action of meperidine has previously been attributed to its action on -opioid receptors.[1115 ] patel et al . compared intrathecal meperidine and lidocaine in 42 asa physical status ii or iii patients who were candidates for endoscopic urological procedures and found that mean arterial blood pressure decreased significantly in the lidocaine group but not in the meperidine group . motor block was absent in ten patients in the meperidine group but was present in all the patients in the lidocaine group . complications such as nausea , vomiting , itching , drowsiness and respiratory depression were similar in the two groups . it is concluded that low - dose meperidine , 0.5 mg kg1 is effective as a spinal anesthetic agent and has few complications . some of the findings of this study are against those of our study . in ours there is no bp change between groups and the incidence of side - effects is related to the dose of meperidine and is least in the control group . studied the effect of a low dose of intrathecal meperidine on shivering in 40 parturient women scheduled for no emergent cesarean delivery . spinal anesthesia consisted of hyperbaric bupivacaine ( 0.75% ; 10.5 mg ) , morphine 0.15 mg , and , in the experimental group , meperidine ( 0.2 mg/ kg ) or , in the control group , normal saline . time to highest sensory level , maximum number of blocked segments , sensory and motor blockade regression , and systolic blood pressure showed no difference between groups . the incidence of shivering was less in the meperidine group , as was its intensity . they found no difference between doses of diphenhydramine , and metoclopramide administered to the patient . finally , they recommended use of intrathecal meperidine to decrease the incidence of shivering without considerable side - effects in the obstetrical population . intrathecal meperidine ( 0.2 mg / kg ) was effective in reducing the incidence and intensity of shivering associated with spinal anesthesia for cesarean delivery . some findings of this study confirm our findings but we found a higher incidence of post operative nausea and vomiting and pruritis in the meperdine group that was dose - dependent . although , meperidine readily cross the placenta and block performed just a few minutes before delivery of fetus but none of newborns was depressed at the time of delivery because a highly lipid - soluble drug like meperidine is readily absorbed by lipid tissues and reabsorption into capillaries of the spinal cord is very slow . in one study the effect of intrathecal meperidine on the incidence of shivering after spinal anesthesia was studied . sixty patients with asa class i - ii were divided into intrathecal meperidine group ( case group ) and control group ( group ii ) . case group received spinal tetracaine with meperidine 0.2 mg / kg and control group received spinal tetracaine without meperidine . there was a significant reduction in the incidence of shivering in the case group ( 16.7% ) when compared with the control group ( 56.7% ) . in one prospective randomized double - blinded study 72 parturient women , scheduled for elective caesarean section under spinal anesthesia , were enrolled in three different groups . spinal anesthesia consisted of bupivacaine 0.5% ( 10 mg ) for the control group , and the same dose of bupivacaine with meperidine 12.5 or 25 mg for the experimental groups . they found the highest incidence of shivering in the control group ( 16.7% ) in comparison with the experimental groups ( 0/24 ) . they concluded that intrathecal meperidine can not be recommended for the prevention of shivering during spinal anesthesia for caesarean section as its use is associated with increased incidence of nausea and vomiting .. some result of this study confirm our findings . in our study and we found a higher incidence of pruritis that was also dose - dependent in another study the effect of adding meperidine 0.5% hyperbaric bupivacaine was investigated in 50 patient candidates for elective transurethral resection operations under spinal anesthesia . expect vomiting the single serious adverse effect of intrathecal opioid is respiratory - depressant but reported with much larger doses ( 50 mg ) of intrathecal meperidine . there has been no report of delayed respiratory depression with intrathecal meperidine , also some investigations confirm early respiratory depression in higher dosages than we used . we found no respiratory depression and need for mechanical ventilation in any of the groups . first : in our hospital it was impossible to determine meperidine level of cerebrospinal fluid . second : it was impossible to monitor the temperature of csf and compare it with the tympanic temperature obtained from the right ear and intensity of shivering . it could help us to know more about the relation between the temperature of the spinal cord , core temperature , intensity , incidence of shivering and add to our knowledge about the etiology of shivering . according to this study , shivering continues to be a common problem after spinal anesthesia for cesarean delivery , with unknown etiology and no definite treatment . although increasing the dose of intrathecal meperidine can decrease the incidence and intensity of shivering it can also increase the incidence of nausea and vomiting that can be a major problem in these patients . finally , the use of intrathecal meperidine can not be recommended for the prevention of shivering during spinal anesthesia for caesarean section as its use is associated with increased incidence of nausea and vomiting and we need to treat shivering with safer drugs .

background : this study was performed to compare the effect of different doses of intrathecal meperidine on the incidence and intensity of shivering and other side - effects after spinal anesthesia for cesarean delivery.methods:one hundred and fifty - six parturient women scheduled for elective cesarean delivery were enrolled in four groups . spinal anesthesia consisted of heavy bupivacaine 0.5% ( 10 mg ) in the standard group ( group i ) , heavy bupivacaine 0.5% ( 10 mg ) plus meperidine ( 0.2 mg per kg ) in group ii , heavy bupivacaine 0.5% ( 10 mg ) plus meperidine ( 0.3 mg per kg ) in group iii , heavy bupivacaine 0.5% ( 10 mg ) plus meperidine ( 0.4 mg per kg ) in group iv . the signs and symptoms were recorded by an observer unaware of the study groups . data were analyzed using analysis of variance , kruskal wallis h - test and chi - square . a p value less than 0.05 was considered to be significant.results:the systolic blood pressure , amount of bleeding , pulse rate , o2 saturation , neonatal apgar scores , core temperatures and sensory level revealed no difference between groups ( p>0.05 ) . the incidence ( 47.5% , 37.5% , 27.5% and 15.0% , respectively ) and intensity of shivering decreased as the dose of meperidine increased ( p=0.002 ) but the incidence of nausea and vomiting ( 8.0% , 15.4% , 25.9% and 35.8% , respectively ) ( p=0.000 ) and pruritis ( 25.64 , 28.21 , 38.46 , and 48.72 respectively ) increased as the dose of meperidine increased ( p=0.000).conclusion : the high dose of intrathecal meperidine is effective in reducing the incidence and intensity of shivering associated with spinal anesthesia for cesarean delivery but the high incidence of nausea and vomiting is unpleasant for the patient and can be a major problem with a high dose of meperdine .

the most recent national hospital discharge survey reported over 400,000 patients underwent cardiac surgery in the united states in 2010 . in cardiac patients , respiratory problems following extubation are the most significant cause of postoperative comorbidity , despite considerable improvement in postoperative care and monitoring . in a recent study of 7,105 cardiac patients , 216 were readmitted to the intensive care unit ( icu ) due to respiratory complications . this represented 39% of all icu readmissions in that study . in recent study of the 7.8% of patients readmitted to the icu following cardiac surgery , respiratory failure was reported to be the cause for 39% of them [ 2 , 4 ] . current trends in cardiac anesthesia recommend early extubation , but that is not always feasible and prolonged endotracheal intubation and mechanical ventilation place cardiac patients at an increased risk of respiratory complications . previous data show that the airway can constrict immediately after extubation as a result of mechanical irritation to the upper airway and prolonged supine position . cardiopulmonary bypass patients are at an even greater risk since they can develop temporary pulmonary ischemia that decreases the production of surfactant and stiffens respiratory tissue . timely detection and prevention of respiratory compromise in this population has become a priority . despite the inherent dangers caused by respiratory complications , current in - hospital monitoring is still lacking . a non - invasive technology that could reliably measure respiratory function after extubation and give early warning signs of respiratory compromise before harmful events occurred could markedly improve patient care and safety . subjective clinical assessment and respiratory rate ( rr ) monitoring are both inconsistent and unreliable indicators of respiratory sufficiency , and current clinical practice relies heavily on continuous pulse oximetry or capnography . though used in almost every clinical setting , pulse oximetry can be unreliable and studies have shown nearly two - thirds of alarms triggered by the oximeter to be false [ 6 , 7 ] . furthermore , oxygen saturation is a lagging indicator , as it decreases only after a significant drop in ventilatory adequacy and readings are often confounded by the use of supplemental oxygen leading to possible delay in interventions and risk to patient safety . one of the difficulties with capnography in the non - intubated patients is patient compliance and maintaining proper placement of the sampling cannula . both oximetry and capnography are indirect measurements of respiratory performance , as they do not directly monitor the adequacy of respiration , but are rather surrogate measures of respiratory status . while a skilled clinician may measure a patient s rr by counting chest wall movements , an obstructed airway or chest muscle contraction could result in this same movement rather than true respiratory effort . in the obese population , observing a chest rise and fall is increasingly challenging and even if one can accurately count the rr , one would not be able to easily distinguish between adequate and inadequate breathing . the currently available measures are limited and often do not provide enough clinically relevant information to trigger healthcare provider response and early intervention to prevent respiratory compromise . recent development of a non - invasive respiratory volume monitor ( rvm ) that provides quantitative , continuous , real - time measurements of mv , tv and rr in non - intubated patients has addressed a number of these challenges . with the recommended electrode placement and calibration algorithms , strong correlations ( 0.96 0.16 , mean 95% ci for regular and erratic breathing ) between rvm and spirometric measurements the rvm can quantify ventilation in non - intubated patients and help identify patients at risk for respiratory complications following cardiac surgery and in other clinical settings [ 11 - 15 ] . the goal of this study was to demonstrate that an alternate electrode placement , to accommodate the sternal dressing , would not affect the rvm correlations to the ventilator and to show the utility of using rvm to monitor mv , tv , and rr in cardiac surgery patients after median sternotomy . it was hypothesized rvm would provide accurate , continuous measurements of mv , tv , and rr in this cohort before and after extubation . fourteen cardiothoracic patients ( four females and 10 males , average age 69 11.8 years , average bmi 29 6.0 kg / m , eight coronary artery bypasses , four valve replacements , and two myomectomies , table 1 ) were enrolled in an irb approved protocol for monitoring respiratory status in the tufts cardiothoracic unit ( ctu ) . respiratory traces were recorded from thoracic electrodes using an impedance - based rvm system ( exspiron , respiratory motion , inc . , all cardiothoracic procedures were performed under general anesthesia and all patients arrived in the ctu intubated and sedated . upon arrival in the ctu , the exspiron electrode padset was positioned to the right of the sternal dressing , approximately at the right mid - clavicular line , instead of the standard midsternal placement . the device was calibrated while the patient was on the ventilator ( puritan - bennett 840 , covidien , mansfield , ma ) during synchronous intermittent mandatory ventilation mode ( simv ) with setting at 6 - 8 ml / kg ibw as determined by the anesthesiologist . respiratory data ( mv , tv and rr ) were acquired only every 15 s from the ventilator , as the ventilator did not support continuous respiratory trace streaming . rvm - based mv , tv , and rr were calculated from continuous 30-s segments . rvm data were recorded continuously from ctu arrival until 24 h after extubation or ctu discharge , whichever occurred first . arterial blood gases were collected before extubation and again approximately 1 - 2 h after extubation in a subset of patients ( n = 12 ) as deemed necessary by the surgical care team . rvm traces were continuously recorded in the ctu for 27 3.7 h ( 6 - 49 h ) . after extubation , patients remained in the ctu and were monitored by the rvm for another 18 2.5 h ( 2 - 29 h ) . twelve of 14 of the patients had ventilator reading for analysis . during mechanical ventilation , tvs measured by the rvm strongly correlated with tvs reported by the ventilator ( r = 0.97 ) . this correlation was maintained during both mandatory ventilation ( simv ) and during spontaneous breathing with pressure support ( ps ) modes . patient average error in tv measurements between rvm and the ventilator was -2.6% , the average precision was 23.9% and average accuracy was 26.2% . an example of simultaneous rvm and ventilator recordings for 30 min is shown in figure 1 . during this time , the ventilator measured an average mv of 6.3 l / min , a tv of 520 ml , and a rate of 12 breaths / min , while rvm measured an average mv of 5.9 l / min ( 7% error ) , an average tv of 490 ml ( 6% error ) , and an average rr of 12.2 breaths / min ( 3% error ) . measured mv , tv , and rr over a 30-min period using rvm ( red ) and the puritan bennett ventilator in simv mode ( black ) for one example patient . average errors between rvm and the ventilator for mv , tv , and rr are less than 10% . before and after extubation , the rvm recorded respiratory traces continuously , in real - time , and captured a distinct pattern of post - extubation respiratory variation . based on body surface area , the average predicted mv was calculated to be 7.6 0.6 l / min for the 14 patients . during 2 min of breathing on simv mode on the ventilator , the average baseline ventilation was slightly above the predicted at 8.2 0.4 l / min ( 1095% of predicted ) . analysis of the exspiron data from the 14 studied patients showed mv was significantly reduced 30 min after extubation to 779% of baseline ( 8.2 0.4 to 6.4 0.9 l / min , p < 0.05 ) and tv was significantly reduced to 719% of baseline ( 520 40 to 370 40 ml , p < 0.01 ) relative to the pre - extubation baseline mv ( table 2 , fig . mv began to increase and by 60 min after extubation , average mv and tv had returned to baseline levels ( mv : 11816% of baseline ( 9.6 1.2 l / min ) ; tv : 10516% of baseline ( 490 50 ml ) ; p > 0.4 ) . thirty minutes after extubation , rr was 1138% of baseline ( 17.1 1.5 to 17.5 1.0 breaths / min , p = 0.4 ) . it is important to note that rr is the only direct and continuous respiratory parameter currently monitored after extubation . sao2 monitoring was recorded every hour by the nursing staff and revealed no significant drops in blood oxygen saturation after extubation ( fig . ( a ) mv , tv , and rr as percent of baseline before and after extubation . a nadir in ventilation occurs 30 min after extubation with mv significantly reduced to 779% of baseline ( * p < 0.05 ) and tv significantly reduced to 719% of baseline ( * p < 0.01 ) , while rr is not significantly different at 1138% of baseline . sixty minutes after extubation , mv has returned to 11816% of baseline and tv has returned to 10516% of baseline . ( b ) absolute values of mv , tv , and rr measured before and after extubation . mv falls significantly from 8.2 0.4 l / min at baseline to 6.4 0.9 l / min 30 min after extubation and tv was significantly reduced from 520 40 ml at baseline to 370 40 ml after extubation . the minimum spo2 value recorded at each time point among all subjects is shown as a blood gas measurements were taken on average 56 25 min before extubation and 106 27 min after extubation . spo2 remained unchanged from before to after extubation ( 98 0.4 vs. 98 0.8 , p = 0.21 , table 3 ) . there was a slight significant increase in bicarbonate from before to after extubation , but was of no clinical importance ( 21.3 0.5 vs. 22.3 0.4 , p = 0.04 ) . example respiratory traces from a representative patient ( 60-year - old male , bmi 29 ) . as the patient awakes from anesthesia and progresses toward extubation , faster and shallower spontaneous breaths predominate with an occasional ventilator breath ( b ) . just after extubation , the patient s breathing pattern is more irregular ( c , d ) and tvs and mvs decrease ( d , e ) . tv and mv measurements increase over time after successful extubation ( f , g , h ) . while intubated , rvm - based mv , tv and rr correlated well with ctu ventilator measurements in patients after median sternotomy . after extubation , rvm continuously reported mv , tv and rr , providing a continuous , non - invasive , quantitative assessment of respiratory competence . a pattern of mv and tv decrease during the first 30 min after extubation was noted in all patients . subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . rvm showed distinct changes in mv and tv after extubation , while rr showed no significant variations . although no patients in this study required reintubation , based on data from other studies collected after extubation in premature infants , we propose that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . further studies to evaluate the use of rvm in postoperative cardiac surgical patients for early detection of respiratory failure for development of reintubation protocols are ongoing . this study demonstrated that , while intubated , rvm - based mv , tv and rr correlated well with ventilator measurements ( r = 0.97 ) . in addition , the change in the padset placement to accommodate the sternal wound and dressing did not affect the device measurements . this confirms that the rvm can provide accurate measurements of mv , tv and rr in patient s post - median sternotomy using the modified positioning of the electrode padset . after extubation , rvm continuously reported mv , tv and rr , providing a real - time , non - invasive , quantitative assessment of respiratory competence . a pattern of mv and tv decrease during the first 30 min after extubation subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . this shows that rvm is capable of providing patterns and trends in ventilation status not available to healthcare providers with other technology . respiratory complications are one of the leading causes of readmission to the icu for cardiac surgery patients . this study shows the benefits of this new technology and its application in the ctu and possibly other locations . pulse oximetry is the leading technology used to assess respiratory status in non - intubated patients ; however , spo2 levels do not begin to decline until well after respiratory decompensation has begun and is known for being prone to inaccuracies [ 13 , 17 ] . intermittent blood gas measurements were taken intermittently and on average over 1 h after extubation , well after rvm confirmed a recovery in mv . rvm showed distinct changes in mv and tv after extubation , while rr , generally measured with cardiac monitoring , showed no significant variations . the time it takes a patient to return to baseline mv is inversely proportional to successful extubation , therefore demonstrating the importance of obtaining mv measurements . additionally , determination of mv after extubation using rvm could potentially aid in quicker assessment of the necessity and timing of reintubation , or provide an early indication of when institute non - invasive ventilation ( niv ) , in the form of continuous positive airway pressure or biphasic positive airway pressure . although no patients in this study required reintubation , based on data from other studies collected after extubation in premature infants , it is hypothesized that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . recently , the american society of anesthesiology has voiced the opinion that quantitative monitoring of respiratory status is superior over qualitative methods . qualitative clinical signs such as chest excursion and auscultation of breath sounds are useful , but they can only be obtained periodically and are often inaccurate . carbon dioxide monitoring is also a qualitative sign of respiration in non - intubated patients and its accuracy is dependent on many factors . however , non - invasive mv and tv have been previously unavailable in non - intubated patients . the rvm permits a more comprehensive , quantitative assessment of respiratory status . with this functionality , rvm - derived respiratory data can bring forth reproducible and comparable data across patients over a wide range of breathing patterns . this can promote better evaluation of respiratory status in the ctu and other healthcare settings . while intubated , rvm - based mv , tv and rr correlated well with ctu ventilator measurements in patients after median sternotomy . after extubation , rvm continuously reported mv , tv and rr , providing a continuous , non - invasive , quantitative assessment of respiratory competence . a pattern of mv and tv decrease during the first 30 min after extubation was noted in all patients . subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . rvm showed distinct changes in mv and tv after extubation , while rr showed no significant variations . although no patients in this study required reintubation , based on data from other studies collected after extubation in premature infants , we propose that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . further studies to evaluate the use of rvm in postoperative cardiac surgical patients for early detection of respiratory failure for development of reintubation protocols are ongoing . this study demonstrated that , while intubated , rvm - based mv , tv and rr correlated well with ventilator measurements ( r = 0.97 ) . in addition , the change in the padset placement to accommodate the sternal wound and dressing did not affect the device measurements . this confirms that the rvm can provide accurate measurements of mv , tv and rr in patient s post - median sternotomy using the modified positioning of the electrode padset . after extubation , rvm continuously reported mv , tv and rr , providing a real - time , non - invasive , quantitative assessment of respiratory competence . a pattern of mv and tv decrease during the first 30 min after extubation was noted . subsequent recovery to pre - extubation levels within 1 h as confirmed by paco2 from arterial blood gas was noted in all patients . this shows that rvm is capable of providing patterns and trends in ventilation status not available to healthcare providers with other technology . respiratory complications are one of the leading causes of readmission to the icu for cardiac surgery patients . this study shows the benefits of this new technology and its application in the ctu and possibly other locations . pulse oximetry is the leading technology used to assess respiratory status in non - intubated patients ; however , spo2 levels do not begin to decline until well after respiratory decompensation has begun and is known for being prone to inaccuracies [ 13 , 17 ] . intermittent blood gas measurements were taken intermittently and on average over 1 h after extubation , well after rvm confirmed a recovery in mv . rvm showed distinct changes in mv and tv after extubation , while rr , generally measured with cardiac monitoring , showed no significant variations . the time it takes a patient to return to baseline mv is inversely proportional to successful extubation , therefore demonstrating the importance of obtaining mv measurements . additionally , determination of mv after extubation using rvm could potentially aid in quicker assessment of the necessity and timing of reintubation , or provide an early indication of when institute non - invasive ventilation ( niv ) , in the form of continuous positive airway pressure or biphasic positive airway pressure . although no patients in this study required reintubation , based on data from other studies collected after extubation in premature infants , it is hypothesized that patients who continue to have a decrease in mv with no rise to baseline within 1 h after extubation will require intervention such as non - invasive ventilation or reintubation . recently , the american society of anesthesiology has voiced the opinion that quantitative monitoring of respiratory status is superior over qualitative methods . qualitative clinical signs such as chest excursion and auscultation of breath sounds are useful , but they can only be obtained periodically and are often inaccurate . carbon dioxide monitoring is also a qualitative sign of respiration in non - intubated patients and its accuracy is dependent on many factors . however , non - invasive mv and tv have been previously unavailable in non - intubated patients . , the rvm permits a more comprehensive , quantitative assessment of respiratory status . with this functionality , rvm - derived respiratory data can bring forth reproducible and comparable data across patients over a wide range of breathing patterns . this can promote better evaluation of respiratory status in the ctu and other healthcare settings .

backgroundpatients who have undergone cardiac surgery are generally mechanically ventilated postoperatively . early postoperative extubation is currently recommended in anesthesia guidelines . no current technology can accurately , non - invasively , measure respiratory competence after extubation . pulse oximetry has been helpful , but this is a late indicator of respiratory compromise . a novel , non - invasive , respiratory volume monitor ( rvm ) has been shown to deliver accurate continuous , real - time minute ventilation ( mv ) , tidal volume ( tv ) and respiratory rate ( rr ) measurements and provide an objective measure of respiratory competence . the rvm will accurately reflect mv , tv and rr in cardiac surgery patients before and after extubation.methodsrvm traces were recorded from patients before and after cardiac surgery . continuous monitoring began on admission to the unit and was ended at 24 h after extubation . rvm - based mv , tv and rr were calculated from 30-s segments . mv , tv and rr were also continuously recorded from the ventilator prior to extubation . the rvm was calibrated to each patient using the readings from the ventilator.resultsduring mechanical ventilation , the rvm measured tvs strongly correlated with the ventilator tvs ( r = 0.97 ) . following extubation , the patient s breathing became more erratic and tvs and mvs decreased . within 1 h , all patients studied showed a marked recovery of mv and tv.conclusionsrvm-based mv , tv and rr correlated well with similar data collected from ventilators . after extubation , rvm shows promise as a means to monitor respiratory competence of non - intubated patients , and has implications for use in other settings and improving patient safety .

acute cytomegalovirus ( cmv ) infection is common in both immunocompromised and immunocompetent patients worldwide.12 the infection is often asymptomatic . symptoms , when they occur , include fever , cervical lymphadenitis , and arthralgia.3 rarely , acute cmv infection may be complicated by pneumonia , colitis , myocarditis , pericarditis , or hemolytic anemia.4 vascular events caused by acute cmv infection , including thrombosis of the venous or arterial vascular system , are rarely reported in the english literature . we report a case of acute cmv colitis in an immunocompetent adult that was complicated by vascular thrombosis and pulmonary embolism . further , we present a review of the literature regarding the association between vascular events and cmv infection in immunocompetent patients . a 78-year - old man was referred to our emergency department with a 3-day history of diarrhea and fever . he had no recent travel history , did not use steroids , and had not experienced recent trauma . he used medication for hypertension and diabetes mellitus , both of which were well controlled . on admission , his vital signs were : body temperature , 38.8 ; blood pressure , 145/85 mmhg ; respiratory rate , 18/min ; and pulse rate , 90/min . on physical examination , his pulse was regular and he had no cardiac murmurs , his chest was clear without signs of respiratory distress , and his abdomen was soft with hyperactive bowel sounds . laboratory tests showed a white blood cell count of 8,270/mm ( normal : 3,99010,500/mm ) , a platelet count of 199,000/mm ( normal : 140,000450,000/mm ) , a prothrombin time of 14.10 seconds ( control : 11.16 seconds ) , an inr of 1.21 , an activated partial thromboplastin time of 26.0 seconds ( control : 27.4 seconds ) , and crp level of 16.7 mg / dl ( normal : < 0.8 mg / dl ) . a coagulation profile , including protein c ( 80% , normal : 70%140% ) , protein s ( 75% , normal : 60%130% ) and anti - thrombin iii ( 95% , normal : 75%125% ) , was normal . . colonoscopy demonstrated multiple giant ulcers with skip lesions in the distal colon , sparing the rectum ( fig . multiple forceps - biopsy tissue samples , taken from the coloniculcers , were sent for pathological examination . however , 5 days post - colonoscopy , the patient experienced dyspnea and severe hypoxemia , necessitating emergent endotracheal intubation and ventilation . a chest radiograph obtained post - intubation revealed an engorged main pulmonary trunk with an abrupt cutoff of pulmonary vascularity in the distal portions bilaterally , indicative of the " westermark sign " ( fig . subsequently , a ct scan of the chest was performed that showed several filling defects within the pulmonary trunk and main pulmonary arteries ( fig . histological evaluation of the colonic biopsy specimens revealed cytomegalic cells with densely staining nuclei and intranuclear inclusion bodies in the epithelium ( fig . these epithelial cells were positive for monoclonal anti - cmv antibody on immunohistochemical analysis , indicative of cmv infection ( fig . the patient had no obvious risk factors for thrombosis , and had no family history of coagulopathy . follow - up ct scan of the patient 's chest showed complete resolution of the pulmonary emboli . acute cmv infection in immunocompetent patients is common worldwide , with seroprevalence rates ranging from 40% to 100% , depending on country , socio - economic conditions , and age.1 colitis is the most common manifestation of severe cmv infection.2 patients with cmv colitis are generally asymptomatic ; if symptomatic , they may present with diarrhea , fever , bleeding , abdominal pain , and perforation . 4 vascular events are a very rare manifestation of severe cmv infection in immunocompetent individuals.2 these vascular events include thrombosis of the portal , superior mesenteric , or splenic vein ; cerebral venous thrombosis ; deep vein thrombosis ; and life - threatening pulmonary embolism . 567 vascular complications may be discovered only several weeks after the initial diagnosis of cmv infection . however , abgueguen et al . proposed that venous thrombosis in immunocompetent patients with cmv infection may not be as rare as previously reported.8 although the pathogenesis of cmv - induced vascular events is unknown , several mechanisms have been postulated , including direct damage to endothelial cells , increased levels of hemostatic indicators , induction of smooth muscle proliferation , enhanced platelet - derived growth factor production , and the presence of antiphospholipid antibodies.91011 vascular thrombosis in immunocompetent patients is usually associated with predisposing factors such as heterozygous factor v leiden mutation , presence of antiphospholipid antibodies , heterozygous prothrombin gene mutation , protein c and/or protein s deficiency , or oral contraceptive use.12 in contrast , this patient had no family history of coagulopathy , was not bed - ridden , and had no other risk - factors for thrombosis . it is , therefore , likely that cmv infection was the precipitating factor for pulmonary embolism . in the diagnosis of vascular events caused by cmv infection , doppler ultrasound and ct scanning are the most useful diagnostic modalities.6 treatment of cmv - associated pulmonary embolism includes immediate administration of antiviral agents and anticoagulants . advanced age , male gender , presence of immune - modulating comorbidities , and need for surgical intervention all negatively influence survival.13 although the cost - effectiveness of investigating for acute cmv infection in patients presenting with thrombosis has not yet been established , we believe that serum samples for cmv infection should be obtained and endoscopic examination should be considered in patients with idiopathic thrombosis . in conclusion , although pulmonary embolism caused by acute cmv colitis in immunocompetent patients is extremely rare , it should be considered in patients who present with severe respiratory symptoms . to the best of our knowledge , this is the first report of an immunocompetent patient with acute cmv colitis complicated by vascular thrombosis with pulmonary embolism in which no other obvious underlying predisposing factor for thrombosis was identified .

acute cytomegalovirus ( cmv ) infection occurs commonly in immunocompromised and immunocompetent patients , but is usually asymptomatic in the latter . vascular events associated with acute cmv infection have been described , but are rare . hence , such events are rarely reported in the literature . we report a case of pulmonary embolism secondary to acute cmv colitis in an immunocompetent 78-year - old man . the patient presented with fever and diarrhea . colonic ulcers were diagnosed based on colonoscopy findings , and cmv was the proven etiology on pathological examination . the patient subsequently experienced acute respiratory failure . pulmonary embolism was diagnosed based on the chest radiography and computed tomography findings . a diagnosis of acute cmv colitis complicated by pulmonary embolism was made . the patient was successfully treated with intravenous administration of unfractionated heparin and intravenous ganciclovir .

the endothelium represents a monolayer of cells that coat the interior surface of the cardiovascular and lymphatic systems . it is the largest secreting organ in the body weighing up to 1.8 kg and extending to a total surface area greater than 4,000 m in the vessel wall of adult humans . in the cardiovascular system , the vessel wall is typically composed of extracellular matrix , connective tissue fibers , and smooth muscle and endothelial cells . the number of endothelial cells ( ecs ) lining the endothelium is believed to be more than one trillion [ 2 , 3 ] . physiologically , the ecs are involved in the maintenance of vascular structure and function including formation of physical barrier between blood elements and vessel wall , as well as biological regulation of smooth muscle cell proliferation , adhesion of inflammatory cells to vessel wall , vascular tone , inflammation , thrombosis , and vascular remodeling . these biological effects of the endothelium are mediated by one or more of the molecules that it secretes such as prostacyclin ( pgi2 ) , thromboxane a2 ( txa2 ) , thrombomodulin ( tm ) , tissue - type plasminogen activator ( tpa ) , von willebrand factor ( vwf ) , plasminogen activator inhibitor type 1 ( pai-1 ) , cd39 , angiotensin type 2 ( at2 ) , adenosine , endothelin ( et ) , and nitric oxide ( no ) . among these bioactive molecules , no is likely the most studied molecule in the pathophysiology of the cardiovascular system including its role in vascular tone regulation , angiogenesis and cell proliferation , inflammatory and immune response , blood clotting , and carbohydrate and lipid metabolism . in the chemical industry , nitric oxide or nitrogen monoxide is known as a byproduct released from heat engines upon refinery of raw materials such as coal , oil , natural gas , and metals . however , mammals are squarely dependent on the biological function of no ranging from maintenance of blood pressure to immune defense and neurotransmission . biochemically , no is synthesized from oxidation of the natural amino acid l - arginine upon catalysis by its three enzymes in the presence of several cosubstrates and cofactors . the first enzyme ( nos i ; nnos ) is actively expressed by resident cells of the central nervous system including neurons and nonneuronal cells such as astrocytes , microglial cells , and oligodendrocytes . the main function of no in the nervous system is its involvement in neurogenesis , neurotransmission , cerebral blood flow , and memory and learning . by contrast , the second nos isoform ( nos ii ; inos ) is mainly expressed by inflammatory cells as an immune defense mechanism including involvement in bacterial killing , cardiovascular inflammation , and neuroinflammation . the endothelial nos- ( nos iii ; enos- ) derived no is the most active vasodilator and is involved in the regulation of blood pressure , vascular smooth muscle cell proliferation , aggregation of platelets , and adhesion of inflammatory cells to vessel wall . although it can directly activate downstream targets such as soluble guanylate cyclase ( sgc ) and calcium - dependent potassium channels to influence vascular function , its half - life is incredibly short measuring only in seconds before its oxidation into nitrites ( no2 ) and nitrates ( no3 ) . endogenously , the concentration of cellular no is regulated by several factors including oligomeric structure of the nos enzymes , concentrations of substrate ( l - arginine ) , cofactors ( heme , bh4 , fmn , and fad ) , cosubstrates ( oxygen molecule , nadph ) , and intracellular calcium ( ca ) . the concentrations of each of these factors are in turn regulated by other factors including enzymes ( e.g. , arginase regulates arginine ) , vasoactive molecules ( e.g. , histamine , bradykinin , and acetylcholine ) , lipid particles ( e.g. , oxidized low - density lipoprotein ; oxldl ) , and reactive oxygen species . in addition , several studies have demonstrated that the endothelium - derived nos ( enos ) is endogenously regulated by protein - protein interaction with structural , regulatory , and transport proteins ( e.g. , with calmodulin , caveolin , actin , tubulin , lipoproteins , soluble guanylate cyclase , and cationic amino acid transporters ) , posttranslational modification ( e.g. , phosphorylation , s - nitrosylation ) triggered by shear stress , hypoxia , inflammatory cytokines ( e.g. , tnf , il1 ) , growth factors ( e.g. , vegf ) , and hormones ( e.g. , estrogen , erythropoietin , and insulin ) . moreover , enos activity is regulated by its competitive inhibitor asymmetric dimethylarginine ( adma ) . physiologically , adma is synthesized as a result of posttranslational methylation of arginine residues in cellular proteins by a family of enzymes called protein arginine methyltransferases ( prmts ) in the presence of a methyl - group donor s - adenosyl methionine ( sam ) . once generated and released into the cytosol , adma competes with l - arginine for the substrate binding site on the enos protein . as a result , the enos - bound adma inhibits the production of no and favors the uncoupling of enos where highly reactive oxygen ( superoxide anion ; o2 ) and nitrogen ( e.g. , peroxynitrite ; oono ) radicals are generated instead of vasoactive no molecules . the concentration of circulating adma is normally regulated by urinary excretion and enzymatic metabolism through dimethylarginine dimethylaminohydrolase ( ddah ) . in humans generally , the biodistribution of ddah1 appears to be colocalized with the neuronal nos ( nos i ) while that of ddah2 appears to coexpress with enos in endothelial and cardiac tissues . studies have , however , shown that both isoforms can express in various cells and tissue types despite the distribution of the noss . for example , in addition to the brain , ddah1 is known to express in the pancreas , skeletal muscle , heart , liver , and kidneys . recent genetic and biochemical studies report that ddah1 is mainly responsible for the enzymatic breakdown of adma into citrulline and methylamine . the clearance of adma by ddah is however compromised by several cardiovascular risk factors that impair the expression and/or activity of ddah . preclinical and clinical studies have demonstrated that hypercholesterolemia , hypertension , coronary artery disease , renal failure , insulin resistance , and diabetes mellitus are associated with increased production of reactive oxygen species ( ros ) , decreased expression and/or activity of ddah , and accumulation of adma in cells and tissues . the oxidative stress perpetrated by the cardiovascular risk factors is believed to be the principal cause of impaired ddah activity due to the sensitivity of the ddah enzyme to oxidation at a catalytically active site and subsequent loss of enzymatic activity to metabolize adma . higher level of circulating adma is a known independent risk factor for major adverse cardiovascular events ( mace ) including myocardial infarction ( mi ) and stroke [ 1315 ] . elevated plasma adma could trigger reduction of endothelium - derived no through uncoupling of enos as described above . in addition , the oxidative stress induced by the cardiovascular risk factors in the vascular wall persistently decreases ddah activity and reduces no levels further leading to disturbed hemodynamic compliance . chronically low level of no is associated with several morbid vascular disorders and increases the risk of mace including cardiovascular - related disability and death . by contrast , increased expression of ddah reduces plasma adma and stimulates no production . preclinical studies have shown that genetic overexpression of human ddah1 in mice reduces plasma levels of adma by 50% and increases no by about 2-fold . as a result , the ddah transgenic animals show optimal vascular compliance including significantly reduced systemic vascular resistance ( svr ) and systolic blood pressure ( sbp ) . in addition , cross - breeding of the ddah1 transgenic animals with the hyperlipidemic apoe - deficient mice reduces plasma adma and decreases the development of atherosclerotic plaque . physiologically , endothelium - derived no ( eno ) is known to regulate the transport of insulin and uptake of glucose by several tissues including the endothelium , liver , pancreas , and skeletal muscle [ 19 , 20 ] . no enhances flow - mediated vasodilation and likely improves the delivery of nutrients and other chemicals to these target tissues . conversely , both high glucose and insulin stimulate the transport of l - arginine and increase no production in vascular endothelial cells . in addition , insulin has been shown to stimulate skeletal muscle blood flow and enhance vasodilation by increasing no release . the transport of glucose to skeletal muscle is also reported to be regulated by no . taken together thus , understanding the interaction among no , glucose , and insulin as well as defining the role of the nos / adma / ddah pathway in this process is essential towards complete characterization and development of effective preventative strategies and novel therapeutic agents for diabetes and its cardiovascular complications , including insulin resistance . in line with the well - characterized contribution of the nos / adma / ddah pathway in cardiovascular diseases , the volume of the literature deciphering the precise role of this pathway in the development and progression of insulin resistance , type 2 diabetes , and its complications is growing . pharmacological and genetic studies indicate that the nos pathway is necessary in the transport of insulin and glucose to various tissues . genetic deletion of the enos or nnos genes in mice triggers vascular impairment and insulin resistance [ 23 , 24 ] likely due to impairment of insulin - stimulated glucose uptake by skeletal muscle and other insulin sensitive tissues . furthermore , the enos knockout mice develop diabetic microvascular complication of advanced diabetic nephropathy in multiple preclinical models of diabetes [ 2528 ] . similarly , accumulation of adma reduces nos activity and is associated with insulin resistance . as described above , excessive adma is often a result of ddah impairment . the role of dysfunctional ddah in cardiovascular complications including diabetes and insulin resistance has been studied in several preclinical models [ 8 , 29 ] . for example , in high - fat - diet - fed type 2 diabetic rats , adipose - tissue - derived ddah / adma is involved in the regulation of insulin sensitivity through modulation of key insulin signaling genes such as insulin receptor substrate 1 ( irs-1 ) and glucose transporter 4 ( glut-4 ) . homozygous ddah1 knockout mice are , for example , hypertensive , showing significantly higher adma level and decreased no production . moreover , targeted deletion of endothelial ddah1 significantly elevates plasma and tissue adma and increases systemic blood pressure . several studies have documented that both essential and salt - sensitive hypertension are associated with insulin resistance [ 33 , 34 ] . by contrast , in ddah1 overexpression mice , blood glucose and plasma insulin levels after glucose challenge were lower and the insulin resistance index was reduced by 50% indicating enhanced insulin sensitivity in the transgenic animals compared to wild type controls . likewise , the ddah2 overexpression mice show enhanced insulin secretion from pancreas despite high - fat diet . clinically , a number of prospective studies also show that elevated adma level is correlated with type 1 or type 2 diabetes [ 3742 ] . considering all the data from preclinical models and clinical studies , it is evident that the nos / ddah pathway is involved in the regulation of insulin and glucose metabolism . in addition , many of these studies indicate that plasma adma has a reciprocal relationship with insulin sensitivity . for example , sthlinger et al . conducted a cross - sectional study evaluating the relationship between plasma adma and insulin resistance . interestingly , treatment of these subjects with the insulin sensitizing drug rosiglitazone enhanced insulin sensitivity and reduced plasma concentration of adma , a correlation that remained significant even after adjusting for risk factors associated with insulin resistance . although effective pharmacological approaches and lifestyle - oriented intervention strategies for the prevention and treatment of diabetes have been implemented , the prevalence and incidence of diabetes are still rising at an alarming rate and are particularly worrisome in the developing world . according to the world health organization ( who ) , the global prevalence of type 2 diabetes , the most common type accounting for 90 to 95% of all cases , in 2014 was about 9% of the adult population . one of the major characteristics of type 2 diabetes is relative insulin deficiency ( hypoinsulinemia ) or decreased response to insulin stimulation ( insulin resistance ) . in insulin resistant subjects , the body fails to properly respond to endogenous insulin and as a result glucose accumulates within the body instead of being absorbed . this phenomenon overwhelms the insulin - secreting pancreatic beta - cells resulting in gradual loss of the ability to produce sufficient insulin that can dispose the accumulated glucose in the bloodstream . although insulin resistance alone may not lead to type 2 diabetes , it significantly increases the risk of developing type 2 diabetes . when left uncontrolled , patients with type 2 diabetes are frequently burdened with life - threatening comorbidities including atherosclerosis , hypertension , nephropathy , retinopathy , and neuropathy . results from several clinical trials including the diabetes control and complications ( ddct ) , epidemiology of diabetes interventions and complications ( edic ) , and the uk prospective diabetes study ( ukpds ) revealed that conventional glycemic control treatment can reduce the risk of cardiovascular events . besides hyperglycemia , insulin resistance is directly associated with dyslipidemia and hypertension ( figure 1 ) . insulin resistance plays an important role in the development of dyslipidemia by contributing to an increase in the free fatty acid flux released from insulin resistant fat cells . in addition , hypertensive patients in general and salt - sensitive hypertensive patients in particular are often insulin resistant . given that the vascular system is a direct target for the action of insulin as described above , all the comorbid complications outlined above heavily contribute to increased cardiovascular risk often seen in diabetic , hypertensive , and/or dyslipidemic patients . endothelial dysfunction is an early event in the development of insulin resistance and contributes to many pathological changes in the vasculature including impairment in the contraction and relaxation of blood vessels and inflammatory and coagulation responses , all of which are closely associated with adverse cardiovascular events . however , sustained hyperinsulinemia or insulin resistance can lead to progressive decline in endothelium - dependent vasodilation [ 46 , 47 ] , as well as impairment of transcapillary insulin transport to skeletal muscle cells in vivo . the interdependence of insulin signaling , glucose metabolism , and endothelial function including the release of endothelium - derived bioactive molecules calls for the development of novel therapeutic strategies to modulate the nos / adma / ddah pathway to treat insulin resistance syndrome and prevent mace . metformin ( glucophage ) is the recommended first - line medication for type 2 diabetes . the mechanism by which this drug suppresses hepatic glucose production and stimulates its tissue uptake is through suppression of mitochondrial respiratory chain complex 1 and activation of adenosine monophosphate- ( amp- ) activated protein kinase ( ampk ) [ 49 , 50 ] . both targeted pathways and the l - arginine - no pathway are mutually restrained in vascular function and homeostasis [ 51 , 52 ] . for example , in l - arginine treated ecs , coincubation with an ampk inhibitor increased glucose accumulation and blunted the increase in no . interestingly , the chemical structure of metformin is strikingly similar to that of adma and metformin itself is known to reduce adma and restore no levels in vivo . in addition , metformin has been shown to protect the liver from inflammatory damage through modulation of the ddah / adma pathway ( table 1 ) . thiazolidinediones ( tzds or glitazones ) are ligands of the nuclear receptor transcription factor peroxisome proliferator - activated receptor gamma ( ppar gamma ) that have recently been developed as insulin sensitizers to treat patients with type 2 diabetes [ 55 , 56 ] . ppar gamma is a member of the ppar family that is mainly expressed in the adipose tissue and is known to masterfully regulate glucose metabolism . intriguingly , studies have reported that the vasoprotective effect of ppar gamma ligands is directly correlated with no regulation . for example , pioglitazone ( actos ) has been shown to upregulate ddah gene expression , reduce circulating levels of adma , and enhance no production ( figure 2 ) . although this effect could not be reproduced with other tzds , rosiglitazone ( avandia ) has been shown to improve endothelial function ( table 1 ) in patients with type 2 diabetes [ 58 , 59 ] . the effect of no in insulin signaling is demonstrated in multiple animal models that are genetically modified to manipulate the no signaling . for example , loss - of - function studies demonstrated that knockdown of enos gene reduces no and causes vascular dysfunction including insulin resistance . by contrast , the no donor sin-1 has been shown to rescue the insulin resistance phenotype induced by the nos inhibitor n(g)-nitro - l - arginine methyl ester ( l - name ) [ 6062 ] . in addition , exogenous supplementation of the nos substrate l - arginine or the cofactor tetrahydrobiopterin ( bh4 ) is shown to increase insulin sensitivity [ 63 , 64 ] . these proof - of - principle genetic and pharmacological studies suggest that stimulation of no production by activating enos is an attractive approach to discover and develop novel insulin sensitizers that would also be vasoprotective . similarly , increased expression or activity of ddah reduces circulating levels of adma and increases nos signaling . recently , we have demonstrated that upregulation of ddah expression by the bile acid derivative farnesoid x receptor ( fxr ) agonist int-747 ( figure 2 ) improves insulin sensitivity in an animal model of salt - sensitive hypertension and insulin resistance . a clinical trial on the efficacy of int-747 demonstrated that this compound is able to enhance insulin sensitivity in type 2 diabetics . meanwhile , we have recently developed a robust high throughput assay to screen for small molecules that modulate ddah enzymatic activity . unlike transcriptional ddah regulators such as the fxr agonists int-747 and gw4064 that upregulate the gene expression of ddah ( table 1 ) , our screening strategy is aimed at identifying compounds that modulate ddah posttranslationally . using this biochemical assay , we have identified and reported several new chemical entities ( nces ) and existing drugs that directly modulate ddah activity [ 6668 ] . the effect of these agents on insulin signaling and glucose metabolism remains to be seen . for example , we discovered that the antacid drug , proton pump inhibitors ( ppis ) , directly inhibit ddah enzymatic activity and impair endothelium - derived no . given that ppis are among the most widely sold drug worldwide , it might be important , from drug surveillance perspective , to evaluate their effect on glucose metabolism and insulin sensitivity . meanwhile , when allosteric ddah activators are developed , it is important to establish their efficacy in glucose metabolism and insulin signaling . in addition to these pharmacological approaches , dietary supplementation with fruits and green vegetables and other life style choices such as cessation of smoking , body weight management , and regular exercise to reduce oxidative stress and maintain or enhance the nos / ddah pathway are possible strategies to prevent and manage cardiovascular disease including diabetes and insulin resistance . despite the promising efficacy of the glitazones ( tzds ) in improving insulin sensitivity and management of type 2 diabetes , the serious concern over their cardiovascular safety has urged many countries to remove all approved tzds from the market . in addition , prescription of other antidiabetic drugs such as the sulfonylurea class is increasingly limited due to incidences of associated cardiovascular risk . these unfortunate adversities have intensified the urgency to develop safe and effective insulin sensitizers for diabetic patients . the endothelial nos / ddah pathway is presumed to be a viable target to discover and develop novel insulin sensitizers . preclinical and clinical studies indicate that downregulation of this pathway is associated with insulin resistance and its upregulation is linked to enhanced insulin sensitivity . in addition , upregulation of nos / ddah is known to increase the vasoprotective molecule nitric oxide and reduce the cardiovascular risk factor adma . therefore , increased expression and/or activity of endothelial nos or ddah using selective nces is a novel strategy to develop effective insulin sensitizers that are also expected to protect the vascular wall and reduce major adverse cardiovascular events including stroke and heart attack .

insulin resistance syndrome ( irs ) is a configuration of cardiovascular risk factors involved in the development of metabolic disorders including type 2 diabetes mellitus . in addition to diet , age , socioeconomic , and environmental factors , genetic factors that impair insulin signaling are centrally involved in the development and exacerbation of irs . genetic and pharmacological studies have demonstrated that the nitric oxide ( no ) synthase ( nos ) genes are critically involved in the regulation of insulin - mediated glucose disposal . the generation of no by the nos enzymes is known to contribute to vascular homeostasis including insulin - mediated skeletal muscle vasodilation and insulin sensitivity . by contrast , excessive inhibition of nos enzymes by exogenous or endogenous factors is associated with insulin resistance ( ir ) . asymmetric dimethylarginine ( adma ) is an endogenous molecule that competitively inhibits all the nos enzymes and contributes to metabolic perturbations including ir . the concentration of adma in plasma and tissue is enzymatically regulated by dimethylarginine dimethylaminohydrolase ( ddah ) , a widely expressed enzyme in the cardiovascular system . in preclinical studies , overexpression of ddah has been shown to reduce adma levels , improve vascular compliance , and increase insulin sensitivity . this review discusses the feasibility of the nos / ddah pathway as a novel target to develop vasoprotective insulin sensitizers .

marine sponges ( porifera ) have been prolific sources of many interesting bioactive substances and are still an important resource for marine natural product chemistry . in the course of our studies on biologically active natural products of marine organisms , we have recently isolated four new melophlins p ( 1 ) , q ( 2 ) , r ( 3 ) , and s ( 4 ) together with seven known melophlins a ( 5 ) , d ( 6 ) , e ( 7 ) , g ( 8) , h ( 9 ) , i ( 10 ) , and o ( 11 ) from two marine sponges of the genus melophlus collected in palau . melophlins are tetramic acid derivatives possessing a long alkyl chain and have been isolated from melophlus sarasinorum [ 13 ] . compounds 111 , except 8 , showed weak to modest growth inhibitory activity against a murine leukemia cell line l1210 . melophlins a ( 5 ) and b ( possessing the c11 alkyl chain and two methyl groups at c-5 and c-9 ) were reported to have moderate cytotoxicity against hl-60 and arrest nih3t3 fibroblasts in the g1 phase of the cell cycle . furthermore , melophlins a and b were found to reverse the morphology of h - ras - transformed hih3t3 cells to normal and might act on the components of the ras - mediated signal transduction pathway . therefore , we intended to investigate the influence of 11 compounds ( 111 ) on the colony formation of chinese hamster v79 cells . we also observed the effect of 11 compounds ( 111 ) on the production of an inflammatory cytokine , il-8 , in pma - stimulated hl-60 cells since the inhibition of cell proliferation sometimes correlates with il-8 production . in this paper , we would like to describe some structure - activity relationships of these compounds against v79 and l1210 cells . melophlins were isolated from two marine sponges of the genus melophlus collected in palau as described previously . dimethylsulfoxide ( dmso ) was purchased from pierce chemical co. ( rockfield , il ) , and fetal bovine serum ( fbs ) was obtained from gibco after checking the lot . chinese hamster v79 cells were grown as a monolayer culture in eagle s mem ( nissui seiyaku co. , ltd . , the hl-60 cell line was obtained from the japanese cancer research resources bank ( jcrb , kamiyoga , tokyo , japan ) and maintained in tissue culture dishes in rpmi 1640 medium ( nissui seiyaku , tokyo , japan ) supplemented with 10% heat - inactivated fbs , 2 mm glutamine , 100 u / ml of penicillin g , and 100 g / ml of streptomycin . the relative plating efficiencies against v79 cells were determined as the ratio of the number of colonies in various concentrations of samples to that in the sample - free control , as described in previous papers . two hundred cells were seeded onto a 60/15-mm plastic plate with 4 ml culture medium and incubated overnight at 37c . after each sample in dmso ( 4 l ) was added to the culture medium , cells were further cultured for four days . the numbers of colonies in the sample plates were counted and compared with those in the control cultures . the il-8 concentrations of the culture supernatants under control and various test conditions were measured by elisa using a combination of monoclonal and polyclonal antibodies . melophlins were isolated from two marine sponges of the genus melophlus collected in palau as described previously . dimethylsulfoxide ( dmso ) was purchased from pierce chemical co. ( rockfield , il ) , and fetal bovine serum ( fbs ) was obtained from gibco after checking the lot . chinese hamster v79 cells were grown as a monolayer culture in eagle s mem ( nissui seiyaku co. , ltd . , the hl-60 cell line was obtained from the japanese cancer research resources bank ( jcrb , kamiyoga , tokyo , japan ) and maintained in tissue culture dishes in rpmi 1640 medium ( nissui seiyaku , tokyo , japan ) supplemented with 10% heat - inactivated fbs , 2 mm glutamine , 100 u / ml of penicillin g , and 100 g / ml of streptomycin . the relative plating efficiencies against v79 cells were determined as the ratio of the number of colonies in various concentrations of samples to that in the sample - free control , as described in previous papers . two hundred cells were seeded onto a 60/15-mm plastic plate with 4 ml culture medium and incubated overnight at 37c . after each sample in dmso ( 4 l ) was added to the culture medium , cells were further cultured for four days . the numbers of colonies in the sample plates were counted and compared with those in the control cultures . the il-8 concentrations of the culture supernatants under control and various test conditions were measured by elisa using a combination of monoclonal and polyclonal antibodies . melophlin a ( 5 ) has been reported to inhibit the cell proliferation of hl-60 at the ic50 value of 0.2 g / ml ( 0.57 m ) . this compound arrested nih3t3 fibroblast cells in the g1 phase of the cell cycle at 1 g / ml ( 2.85 m ) and reversed the morphology of h - ras transformed nih3t3 cells to normal at 5g / ml ( 14.2 m ) . on the other hand , melophlins c , e ( 7 ) , g ( 8) , h ( 9 ) , i ( 10 ) , m , n , and o ( 11 ) were not cytotoxic to hl-60 , hela , or tf-1 cells . in our experiment , compounds 17 and 911 showed weak to modest inhibitory activity against l1210 cells ( table 1 ) ; therefore , we examined the effect of compounds 111 on the rate of colony formation using v79 cells . since the production of an inflammatory cytokine , il-8 , is , in some cases , correlated with the inhibition of cell proliferation , we also observed the influence of 11 compounds on the il-8 production system mediated by pma - stimulated hl-60 cells . although the inhibitory activities of the 11 compounds on the colony formation of v79 were not remarkable , melophlins h ( 9 ) and o ( 11 ) showed activity at ec50 values of 8.5 and 9.6 m , respectively ( table 1 ) ; however , compounds 111 did not affect the production of il-8 . linear - chain - type compounds ( 1 , 5 , 6 , and 8) were least active among the four chain types ( table 1 ) . the methyl group at c-5 reduced the activity of linear - chain - type and iso - type compounds ( 2 , 7 , and 9 ) , while the activity of anteiso - type compounds ( 3 , 10 , and 11 ) were increased by c-5 methylation . activity was decreased as the chain length increased for linear - chain - type compounds . on the other hand , activity was increased as the chain length decreased for iso - type and anteiso - type compounds . these structure - activity relationships were detected against both v79 and l1210 cells except for the iso - type compound with the c-5 methyl group ( compound 2 ) , which showed stronger activity against l1210 cells than compound 9 . the activity of the 10-methyl compound ( 4 ) against v79 and l1210 cells was stronger than that of the iso - type compound ( 2 ) and weaker than that of the anteiso - type compound ( 3 ) . therefore , it will be interesting to examine the in vitro growth inhibitory activity of compounds possessing iso - type or anteiso - type chains with a chain - length of less than c12 against human solid tumor cell lines .

we have recently isolated four new melophlins p ( 1 ) , q ( 2 ) , r ( 3 ) , and s ( 4 ) together with seven known melophlins a ( 5 ) , d ( 6 ) , e ( 7 ) , g ( 8) , h ( 9 ) , i ( 10 ) , and o ( 11 ) from two marine sponges of the genus melophlus collected in palau . in this study , the influence of these compounds on the colony formation of chinese hamster v79 cells and the production of il-8 in pma - stimulated hl-60 cells were examined . these 11 compounds did not show any effect on il-8 production . the ec50 values of compounds 2 , 3 , 4 , 5 , 7 , 9 , 10 , and 11 against v79 cells were 44.0 , 13.3 , 16.7 , 27.2 , 19.8 , 8.5 , 23.1 , and 9.6 m , respectively . the linear - chain - type compounds ( 1 , 6 , and 8) were not active against v79 cells at 50 m . although the growth inhibitory activity of these melophlins was not remarkable , some structure - activity relationships of these compounds against v79 and murine leukemia l1210 cells were observed .

mood disorders are one of the most common psychiatric disorders that are expressed as diminished mood during periods of depression and elevated mood during periods of mania . bipolar disorder is a complex chronic condition characterized by interactive periods of depression and mania or hypomania . the incidence of recurrent periods of depression and mania may have a deep impact on different aspects of life quality , including social , occupational , functional , and emotional well - being . the main features of these disorders are inability to cope with desire and power , interest and willingness to perform singular acts that are harmful to oneself or others , and feeling pleasure or relief during extreme behavioral tendencies such as excess in gambling , shopping , internet usage , romantic relationships , work , physical activities , and even eating . recent studies have suggested that a large percentage of bipolar patients show a grave prognosis , high recurrence rate , residual symptoms , functional - cognitive deficits , psychosocial disabilities , and chronic addictive behaviors ( overeating , extreme libido , watching television , gambling , impulsiveness , impulsive shopping , and work alcoholism , etc . ) . the relationships between smoking and alcohol consumption , being exposed to violence and alcohol consumption , or early sexual contact and substance abuse have been repeatedly studied . among these high - risk behaviors , sexual behaviors because of their irreversible consequences such as pregnancy , infectious diseases , and human immunodeficiency virus infection has been overemphasized in recent years . other risky behaviors such as smoking , alcohol consumption , and drug abuse are proposed predictors of sexual risk - taking . have shown that addictive behaviors in patients with mental disorders , such as schizophrenia and bipolar patients , are observed in a high level . various researches have declared that the rate of drug - abuse , smoking , and addictive behavior in bipolar patients is higher than the other patients . cerebrobehavioral systems are among the variables that probably play a role in the appearance of addictive behaviors . with the introduction of gray 's theory , many psychiatric disorders are described in terms of two activation systems . in response to environmental stimuli , the theory viewing personality through a psychophysiological approach basically considers two activation systems namely behavioral activation system ( bas ) and behavioral inhibition system ( bis ) , which has a neurological basis . bas is responsible for the activation behaviors in response to reward ( positive affection ) and bis is responsible for the inhibitory behaviors in response to the threat and punishment ( negative affection ) . in other words , bas makes individual potentially sensitive to the rewards , and creates incentives to explore them , whereas bis impacts individual 's sensitivity toward punishment and makes them potentially sensitive to the punishments and avoiding them . various findings have shown that an increase , decrease , or loss of balance in the operation of these systems is associated with a reduced life quality and several psychiatric and psychosomatic disorders . for example , an increase in bas activity influences substance abuse and antisocial behaviors , reduction of bas activity impacts depression , and its imbalance effects bipolar disorders . studies have also shown that high bas sensitivity is associated with admission to addictive behaviors . in a comparative study between students with internet addiction and alcoholism , it was shown that students with internet addiction had higher scores in bis , whereas students with alcoholism had higher scores in response to stimulation and happiness and their scores were lower in bis . meerkerk showed that drug abuse is more associated with bis rather than bas , however , yen et al . reported contradictory results , that is , high bas and looking for entertainment characteristic are concluded to be among the risk factors leading to addiction . kim and lee showed that morbid gambling behaviors are related to low scores in bis and high scores in bas . it has also been suggested that sometimes bas alongside low bis plays an important role in other addictive behaviors such as morbid gambling , which has similar features with internet addiction . in addictive behaviors , the person becomes obsessed ( constantly thinks of ) the object , activity , or substance . they will seek it out or engage in a behavior even though it causes harm ( physical problems , poor work or study performance , problems with friends , family , and fellow workers ) . in addition , the person does not appear to have control regarding when , how long , or how much he or she will continue the behavior ( loss of control ) . another problems that are possible as a result of addictive behaviors include denying the problems , low self - esteem , and depression . in general , the present research is necessary considering the high prevalence of this disorder in our society , the role of bas and bis as key factors in generating success , promoting health , reducing psychological problems , and addictive behaviors , along with the lack of research in this field and the application of the results of the present study in the field of bipolar disorder patient 's pathology . therefore , the present study aimed to examine the role of bas and bis in predicting bipolar patients addictive behaviors . the population of this study consisted of all male patients with bipolar disorder who consulted psychiatrists or referred to the roozbeh psychiatric hospital , iran in 2014 . the sample comprises 80 male patients with bipolar disorder selected by a convenience sampling method . considering that the sample should consist of at least 3050 participants in descriptive ( correlative ) studies , to increase the external validity of the study , 80 participants were selected . in addition , using the inclusion and exclusion criteria , the benchmark of participant 's homogeneity was taken into consideration . inclusion criteria for study participants were having at least junior high school education ; having no cerebral palsy , mental retardation , or active hallucinations and delusions ; being in partial remission period ; being 2245 years old ; and taking medicine during diagnosis and study project periods . exclusion criteria included having severe comorbid disorders and confusion , severe depression , drug intoxication , or being in withdrawal period . this study recruited the persian translated version of comprehensive international diagnostic interview ( cidi2.1 ) which provides the possibility of diagnosis of lifetime psychiatric disorders according to the diagnostic and statistical manual of mental disorders ( dsm - iv - tr ) and international classification of diseases ( icd-10 ) . cidi consists of 14 sections , each marked with a letter ( from a to x ) and covers 17 major diagnostic fields : psychosis / mania module consists of f , g , and p , which is distinctively applied for the assessment of psychotic and bipolar disorders . in cases where psychosis / mania module was used alone , some schizophrenia diagnostic criteria for ruling out other mental disorders are not assessable . according to the cidi guideline , cidi 's complete version or a special module can be applied . this self - report questionnaire developed by carver and white ( 1994 ) , includes 24 items . the subscale of bis consists of seven items that measure the sensitivity of the bis . the subscale of bas includes 13 items measuring the sensitivity of bas which includes the following three subscales : response to drive containing four items , response to reward containing five items , and looking for entertainment containing four items . four additional items are included in the scale having no effect on the assessment of bas / bis . each item is rated on a four - point likert - type rating scale ranging from strongly agree to strongly disagree . as reported by carver and white , the internal stability of bis is 0.74 and the internal consistency of bas is 0.71 . cronbach 's alpha coefficients of bas subscales have been reported to be 0.73 , 0.76 , and 0.66 , respectively . retest reliability for bas scale to be 0.78 and for bis scale to be 0.81 . to determine the frequency of addictive behaviors ( e.g. , eating addiction , drug and alcohol addiction , and addiction to television and cell phone ) , lesieur and blume questionnaire can be used . this questionnaire had 28 items , each of which can be responded based on a likert scale ( it does not describe me very well to it describes me very well ) . thus , for each hypothesis , the questions were distributed among experts to consider their comments . after gathering their views and comments , the final questionnaire was prepared . to measure the internal consistency of the questionnaire , have reported the cronbach 's alpha coefficient of the questionnaire to be 0.68 . in the present study , cronbach 's alpha for eating addiction was 0.72 , alcoholism , 0.84 , television addiction 0.72 , smoking addiction 0.76 , and phone addiction was 0.82 . after coordinating with the roozbeh psychiatric hospital and gaining the satisfaction of the participants , as well as identifying men with bipolar disorder , the first aim of this study was explained to them . the participants were asked to read the questions carefully and choose the desired responses according to their own characteristics and answer as many questions as possible . data were collected on an individual basis at related centers . finally , the collected data were analyzed using pearson correlation and multiple regression statistical techniques . moreover , the ethical issues including ensuring the participants about the confidentiality of their information and freedom of choice for participation in the study project observed in this research were explained to the participants . ethical issues including ensuring the participants about the confidentiality of their information and freedom of choice for participation in the study project observed in this research were explained to the participants . this study recruited the persian translated version of comprehensive international diagnostic interview ( cidi2.1 ) which provides the possibility of diagnosis of lifetime psychiatric disorders according to the diagnostic and statistical manual of mental disorders ( dsm - iv - tr ) and international classification of diseases ( icd-10 ) . cidi consists of 14 sections , each marked with a letter ( from a to x ) and covers 17 major diagnostic fields : psychosis / mania module consists of f , g , and p , which is distinctively applied for the assessment of psychotic and bipolar disorders . in cases where psychosis / mania module was used alone , some schizophrenia diagnostic criteria for ruling out other mental disorders are not assessable . according to the cidi guideline , cidi 's complete version or a special module can be applied . this self - report questionnaire developed by carver and white ( 1994 ) , includes 24 items . the subscale of bis consists of seven items that measure the sensitivity of the bis . the subscale of bas includes 13 items measuring the sensitivity of bas which includes the following three subscales : response to drive containing four items , response to reward containing five items , and looking for entertainment containing four items . four additional items are included in the scale having no effect on the assessment of bas / bis . each item is rated on a four - point likert - type rating scale ranging from strongly agree to strongly disagree . as reported by carver and white , the internal stability of bis is 0.74 and the internal consistency of bas is 0.71 . cronbach 's alpha coefficients of bas subscales have been reported to be 0.73 , 0.76 , and 0.66 , respectively . retest reliability for bas scale to be 0.78 and for bis scale to be 0.81 . to determine the frequency of addictive behaviors ( e.g. , eating addiction , drug and alcohol addiction , and addiction to television and cell phone ) , lesieur and blume questionnaire can be used . this questionnaire had 28 items , each of which can be responded based on a likert scale ( it does not describe me very well to it describes me very well ) . maximum and minimum score of this scale is 112 and 28 , respectively . thus , for each hypothesis , the questions were distributed among experts to consider their comments . after gathering their views and comments , abolghasemi et al . have reported the cronbach 's alpha coefficient of the questionnaire to be 0.68 . in the present study , cronbach 's alpha for eating addiction was 0.72 , alcoholism , 0.84 , television addiction 0.72 , smoking addiction 0.76 , and phone addiction was 0.82 . after coordinating with the roozbeh psychiatric hospital and gaining the satisfaction of the participants , as well as identifying men with bipolar disorder , the first aim of this study was explained to them . the participants were asked to read the questions carefully and choose the desired responses according to their own characteristics and answer as many questions as possible . finally , the collected data were analyzed using pearson correlation and multiple regression statistical techniques . moreover , the ethical issues including ensuring the participants about the confidentiality of their information and freedom of choice for participation in the study project observed in this research were explained to the participants . ethical issues including ensuring the participants about the confidentiality of their information and freedom of choice for participation in the study project observed in this research were explained to the participants . the results showed that , among patients with bipolar disorder , 43% had high school education , 19% had diploma education , and 38% had upper diploma education . in addition , 50% of patients were hospitalized for 1 to 15 days , 25% for 15 to 30 days , 17% for 1 month , and 8% were hospitalized for more than 1 month . as it can be seen in table 1 , the mean [ standard deviation ( sd ) ] of the total score of behavioral activation was 41.83 ( 4.14 ) , and the mean ( sd ) of the total score of addictive behavior was 14.55 ( 3.15 ) . descriptive statistics of variables the results of table 2 show that there is a significant relationship between behavioral activation and addictive eating ( r = 0.21 ) , addiction to alcohol ( r = 0.32 ) , television addiction ( r = 0.31 ) , cigarette addiction ( r = 0.34 ) , mobile addiction ( r = 0.34 ) , and the score of all additive behaviors ( r = 0.32 ) . in fact , the greater level of behavioral activation in patients with bipolar disorder is associated with more addictive behaviors . in addition , there is a significant relationship between behavioral inhibition with addictive eating ( r = 0.28 ) , addiction to alcohol ( r = 0.29 ) , television addiction ( r = 0.90 ) , cigarette addiction ( r = 0.38 ) , mobile addiction ( r = 0.25 ) , and the score of all additive behaviors ( r = 0.31 ) . in fact , the greater level of behavioral inhibition in patients with bipolar disorder are associated with less addictive behaviors . the correlation coefficient between behavioral activation and inhibition systems with addictive behaviors as it can be seen in table 3 , the observed f was significant and the results show that 47% of the variance of addictive behaviors in bipolar patients can be explained by reply to reward , derive , fun , bas , and bis . given the amount of , reply to reward ( = 0.38 ) , derive ( = 0.24 ) , fun ( = 0.24 ) , bas ( = 0.27 ) , bis ( = 0.21 ) are the most powerful variables to predict addictive behaviors in bipolar patients . in addition , the summary results of the multivariate regression model showed that behavioral activation and inhibition systems could predict 47% of the variance of addictive behaviors in patients with bipolar disorder . according to the results of the durbin watson test , that is equal to 1.88 , the assumptions of normality of data , has also been considered . summary results of standard and non - standard coefficients for the prediction of addictive behaviors based on behavioral activation and inhibition system this study aimed to assess the role of gray 's activation / inhibition system in predicting addictive behaviors of bipolar patients . according to the results , there is a negative relationship between the bis and bas in bipolar patients , i.e. the higher level of behavioral inhibition is , the lower are the addictive behaviors . these findings are consistent with the studies of meerkerk et al . , kim and lee , and park et al . , whereas it is inconsistent with the studies of taylor et al . and staiger et al . , which showed that bis activity in addicted smokers is more than that in the non - addicted ones ; that is , in the absence of reward , avoidance of negative outcomes , and unpleasant and severe conditions , individuals grow a tendency toward drug and alcohol consumption . furthermore , bis is a neurological system which with its weakness , pleasure - feeling symptoms , becomes activated and creates a sense of euphoria and liberty . low sensitivity of bis may create an increasing euphoria feeling and a tendency toward lack of inhibition , and therefore readiness to experience drugs and other deviations . one of them is related to the sensitivity of the bas and the uncontrollable desire for alcohol 's rewarding . and the other is the uncontrollable desire for alcohol after leaving drug abuse , which is related to the sensitivity of the bis . bipolar disorder and its features such as hopelessness , impulsivity , emotional instability , and interpersonal disturbances are significantly correlated with addictive and self - injuring behaviors . considering that bipolar disorder is associated with negative emotions , the individual with the disorder when coping with adverse and stressful events is always looking for a way to escape from painful feelings . such individuals may use different methods to minimize their pain including addictive behaviors and self - injury . a weak bis and a tendency toward lack of inhibition , that prevents the inhibition of inappropriate behaviors in different situations , causes the individual to have intense attachment to an object , behavior , or addictive behavior as a defense against depression and low mood , when experiencing negative emotions and stressful events . there is a positive relationship between bas and addictive behaviors in bipolar patients . in other words , the higher the level of behavioral activation is , the more addictive behaviors will be experienced . mitchell and nelson - gray , and hundt et al . in explaining the results , it can be said that the lack of behavioral inhibition , experience seeking , risk - taking , and sensibility to monotony are effective factors on addictive behaviors . the desire to experience increased levels of risk for joy , especially in manic phases , is of higher risk - taking levels so that individuals in order to seek more pleasure or to escape monotony take the risks of consuming drugs and alcohol or perform other risky behaviors . on the other hand , they estimate the activation of risks and negative consequences of such behaviors as low and insignificant and much lower than the actual rate for themselves ; for example , despite their occasional use of alcohol or drugs or engaging in risky sexual behaviors , they consider the consequences and risks as negligible for themselves , and with irrational beliefs , such as the recreational drug use is not harmful or addictive , or i use it only a few times and consider themselves strong in the face of these risks . moreover , with the examination of the bas components , the results showed that there is a relationship between bas drive , response to reward , entertainment seeking , and addictive behaviors of bipolar patients . these results are consistent with the studies of park et al . and kim and lee . bipolar patients , because of a lack of emotional awareness and cognitive capability of processing their emotions , have a limited ability to cope with stressful situations . as a result , the psychological component of emotional expression and psychological distress systems , namely depression , mania , and anxiety increases , which can be expressed as bas excitation . based on the outcome of bas activity , the pleasure - seeking personality , which plays an important role in the development of addictive behavior , it can be concluded that those bipolar patients have high levels of sensitivity toward bas reward who have high enjoyable activities , looking for new experiences , are unable to control themselves , and make impulsive decisions as a result of the tendency toward high - risk and addictive behaviors . finally , the small sample size and lack of a comparative study of women with bipolar disorder it is recommended that the authorities with their emotional support provide proper conditions for these patients to express their feelings and emotions in a suitable manner , and facilitate the emotional , cognitive , and psychiatric compatibility of these patients .

background : nowadays , prevalence of addictive behaviors among bipolar patients is considered to be a serious health threat by the world health organization . the aim of this study is to investigate the role of behavioral activation and inhibition systems in predicting addictive behaviors of male patients with bipolar disorder at the roozbeh psychiatric hospital.materials and methods : the research method used in this study is correlation . the study population consisted of 80 male patients with bipolar disorder referring to the psychiatrics clinics of tehran city in 2014 who were referred to the roozbeh psychiatric hospital . to collect data , the international and comprehensive inventory diagnostic interview , behavioral activation and inhibition systems scale , and addictive behaviors scale were used.results:the results showed that there is a positive and significant relationship between behavioral activation systems and addictive behaviors ( addictive eating , alcohol addiction , television addiction , cigarette addiction , mobile addiction , etc . ) . in addition , correlation between behavioral inhibition systems and addictive behaviors ( addictive eating , alcohol addiction , tv addiction , cigarette addiction , mobile addiction ) is significantly negative . finally , regression analysis showed that behavioral activation and inhibition systems could significantly predict 47% of addictive behaviors in patients with bipolar disorder.conclusions:it can be said that the patients with bipolar disorder use substance and addictive behaviors for enjoyment and as pleasure stimulants ; they also use substances to suppress unpleasant stimulants and negative emotions . these results indicate that behavioral activation and inhibition systems have an important role in the incidence and exacerbation of addictive behaviors . therefore , preventive interventions in this direction seem to be necessary .

the generation of neurons in the developing central nervous system requires a number of precisely orchestrated steps , whereby proliferating neural progenitors become committed to the neuronal fate , exit cell cycle , and undergo a long and complex program of migration and differentiation ( kriegstein and alvarez - buylla , 2009 ) . proneural transcription factors ( tfs ) of the bhlh family , such as ascl1/mash1 , are the main regulators of neurogenesis in the mammalian brain , and gain and loss - of - function analyses have shown that they are both required and sufficient to promote neurogenesis ( bertrand et al . , 2002 , wilkinson et al . , 2013 ) . accordingly , while genetic ablation of proneural genes in mice results in neural developmental defects associated with reduced neurogenesis , overexpression of proneural factors in neural progenitors induces a full neuronal differentiation program ( berninger et al . , 2007b , casarosa et al . , 1999 , geoffroy et al . , 2009 ) . in addition to its pivotal role in development , ascl1 has been extensively used in protocols to reprogram somatic cells , including fibroblasts , astrocytes , and pericytes , into induced neurons ( berninger et al . , 2007a , karow et al . , 2012 , vierbuchen et al . , 2010 ) , renewing interest in understanding the neurogenic activity of this proneural factor . previously , we characterized the transcriptional program of ascl1 in the ventral telencephalic region of the embryonic mouse brain by combining gene expression profiling with chromatin immunoprecipitation ( chip ) , followed by hybridization to promoter oligonucleotide arrays ( chip - chip ) . this work resulted in the identification of a set of ascl1 target genes with various biological roles at distinct stages of the differentiation program , raising intriguing questions concerning the molecular basis for such temporal pattern ( castro et al . in addition , it led to the identification of a novel function for ascl1 in maintaining cell proliferation , mediated by the direct activation of genes that promote cell cycle progression . this resulted in a model whereby this proneural factor sequentially promotes the proliferation and differentiation of progenitor cells along the neuronal lineage , reconciling the classical view of this proneural protein as a differentiation factor with the fact that it is mostly expressed in cycling progenitors . moreover , a recent study has shown that these two opposing activities are associated with distinct modes of ascl1 expression , with oscillating or sustained ascl1 promoting proliferation or differentiation , respectively ( imayoshi et al . , 2013 ) . in spite of the significant progress made on the characterization of its transcriptional targets , little is still known about how ascl1 regulates gene expression . in particular , the relationship between ascl1 binding , regulation of the chromatin landscape , and gene transcription is poorly understood . it was recently shown that during neuronal reprogramming , ascl1 can access its cognate sites in nucleosomal - dna when ectopically expressed in fibroblasts , defining it as a pioneer tf ( wapinski et al . , 2013 ) . however , it remains to be seen whether ascl1 works as a pioneer factor in a neurogenic context and whether binding of ascl1 results in alterations to the chromatin landscape at its target regions , as it has been shown for some , but not all , other pioneer tfs ( zaret and carroll , 2011 ) . mammalian neurogenesis is not a synchronized process at a cell population level and studies to investigate the mechanistic basis of ascl1 function at a genome - wide scale are difficult to perform in the developing embryo or in the adult brain . an alternative is the use of adherent cultures of neural stem ( ns ) cell lines derived from embryonic stem cells or embryonic neural precursors ( conti et al . these cultures provide us with reliable models to study neurogenesis in culture , without the confounding effects of cellular heterogeneity , characteristic of other cellular models such as neurospheres . in proliferating culture conditions , endogenous ascl1 regulates a progenitor program that functions to maintain cell proliferation ( castro et al . , 2011 ) , whereas overexpression of ascl1 leads to efficient cell cycle exit and neuronal differentiation . here we investigate how ascl1 activity is restricted by and impacts the chromatin landscape , when driving neuronal differentiation . we combined expression profiling with genome - wide mapping of ascl1 binding sites ( chip - seq ) ( park , 2009 ) , and dnase i hypersensitivity sites ( dnase - seq ) ( song and crawford , 2010 ) , in a cellular model of neurogenesis driven by overexpressed ascl1 . we identify a large number of genes directly regulated by ascl1 and characterize widespread changes in chromatin accessibility during differentiation . ascl1 binding correlates with activation of gene transcription , targeting not only regions of accessible but also of closed chromatin . in addition , binding of ascl1 to dna precedes a local increase in chromatin accessibility at the regulatory regions of its target genes , providing the first direct link between ascl1 regulation of gene expression and local changes in chromatin landscape . overexpression of ascl1 promotes cell cycle exit and neuronal differentiation of neural progenitor cells ( castro et al . , 2006 ) . to study this process in controlled conditions , we established a cellular model of ascl1-driven neurogenesis by expressing an inducible version of ascl1 in ns cells in culture ( ns5 cell line ) ( pollard et al . , 2006 ) . fusion of full - length ascl1 to the modified ligand binding domain of the estrogen receptor ( ert2 ) renders ascl1 activity dependent on the presence of 4-hydroxytamoxifen ( herein referred to as tamoxifen ) ( bergstrom et al . , 2002 , , ascl1-ert2 induces the transcriptional activation of an enhancer of the ascl1 target gene dll1 ( castro et al . , 2006 ) in an inducible manner to levels that are similar to its wt counterpart ( figure s1a ) . in order to test for the ability of the inducible ascl1 protein to promote neuronal differentiation , we transduced ns cells in culture with a retrovirus vector co - expressing ascl1-ert2 and green fluorescent protein ( gfp ) . in the vast majority of transduced cells , drastic morphological changes characterized by the extension of long processes and associated with the expression of the neuronal marker tuj1 were observed only upon the addition of tamoxifen , confirming the ability of ascl1-ert2 to activate the neurogenic differentiation program in an inducible manner ( figure s1b ) . although activation is associated with the nuclear translocation of a small fraction of ascl1-ert2 , most of the protein is already nuclear prior to addition of tamoxifen ( as previously reported with other cases of tfs fused to ert2 ) ( burk and klempnauer , 1991 , roemer and friedmann , 1993 ) , and additional mechanisms must therefore contribute to the inducibility of ascl1-ert2 ( figure 1a ) . to obtain large numbers of synchronized differentiating neural progenitors , we used antibiotic selection following the retroviral delivery of the ascl1-ert2 transgene . quantification of immunofluorescence levels upon immunohistochemistry estimated the total ascl1 protein level in transduced cells to be 8- to 9-fold higher when compared with endogenous ascl1 expressed in embryonic ventral telencephalic progenitors ( figure 1b ) . ns cells expressing ascl1-ert2 plated at low density differentiate with great efficiency upon addition of tamoxifen ( figure 1c ) . four days after induction , immunocytochemical analysis shows expression of the rate limiting enzyme for gaba synthesis glutamic acid decarboxylase gad65/67 ( 15.1% 0.3% ) ( figure 1d ) . whole - cell patch - clamp recordings of retrovirus - transduced cells 14 days after onset of tamoxifen treatment show that these cells consistently exhibit electrophysiological properties of neurons ( figure 1e ) . moreover , their action potential discharges pattern in response to step current injections is highly reminiscent of low - threshold burst spiking interneurons and very similar to those generated from medial ganglionic eminence progenitors of the ventral telencephalon ( figure 1d ) ( martnez - cerdeo et al . , 2010 ) . to characterize the transcriptome changes in our model , we performed expression profiling at various time points 4 , 12 , 24 , and 50 hr after the onset of differentiation . a large number of genes ( 1,508 ) are differentially regulated at least at one time point ( fold change > 1.5 , p < 10 ; see figure 1f for a breakdown of numbers ) , as expected upon induction of a cellular differentiation program ( table s1 ) . functional annotation of differentially expressed genes by gene ontology shows considerable enrichment in terms associated with distinct phases of neurogenesis , describing both early events ( e.g. , notch signaling , cell division ) and later steps of the differentiation program ( e.g. , cell migration , axon guidance ) ( figure 1 g ) . overall , these results show ascl1 drives an extended program of neuronal differentiation in our model . to understand how the observed changes in gene expression relate to ascl1 function , we mapped ascl1 binding sites genome - wide by chip followed by massive parallel sequencing ( chip - seq ) ( wapinski et al . , 2013 ) , using an antibody against the ha tag of ascl1-ert2 . this was performed 18 hr after the onset of differentiation , at a time point when ns cells have already undergone large transcriptional changes . using input chromatin as control , we defined an extended list comprising 21,582 ascl1 binding sites , with fdr < 0.5% and p < 10 ( table s2 ) . in order to validate binding events ( bes ) mediated by the ascl1-ert2 protein , we used chip - pcr against wt ascl1 , with chromatin extracted from embryonic e14.5 ventral telencephalic progenitors , or wt ns5 cells ( figure s2a ) . we reasoned that most bes in differentiating ns cells should be identified in at least one of the chromatin samples . indeed , this is the case for all chip - seq peaks associated with p < 10 ( with the majority of bes validated in both chromatins ) , indicating a good match between ascl1-ert2 and wt ascl1 . most of the 11,782 ascl1 bes defined by this high - confidence list ( p < 10 ) are located within intergenic regions ( 63% ) and at long distances from the nearest identified transcription start site ( tss ) . less than one third of ascl1 binding occurs inside genes ( 30% ) or their promoter regions ( 7% ) ( figures 2a and 2b ) , suggesting that ascl1 binds predominantly to distal enhancer regions . we next used a hidden - markov model to characterize the chromatin states at ascl1-bound regions , using genome - wide profiles of histone modifications generated from proliferating and differentiating ns cells ( before or 24 hr after addition of tamoxifen , respectively ) ( ernst and kellis , 2012 ) . ascl1 bes fall mostly within regions of chromatin highly co - enriched for h3k4me1 and h3k27ac , characteristic of active enhancers ( same result for p < 10 ; data not shown ) . moreover , the same association with this chromatin state is found in proliferating ns cells , indicating that during differentiation ascl1 binds predominantly to regions that are already marked as active enhancers in proliferating ns cells ( figures 2c , 2d , and s2b ) . to determine the dna sequence mediating ascl1 binding , we searched for motifs enriched within the 20 nucleotides region centered under the ascl1 peak summits . a strong preference is found for the hexamer sequence cagctg , corresponding to the e - box type sequence previously associated with ascl1 binding ( castro et al . , 2011 ) and in agreement with its role in mediating direct dna binding ( figure 2e ) . although it is generally believed that proneural factors function by activating gene transcription , some reports have challenged this view ( alvarez - rodrguez and pons , 2009 , rheinbay et al . , 2013 ) . in order to investigate this issue , we started by performing an in depth cross - comparison between the location analysis and expression profiling results , annotating each ascl1 be to its nearest tss . direct comparison with the set of deregulated genes previously described shows that only a small fraction of bes are considered to be regulatory using nearest gene annotation ( figure 3a ) . nonetheless , we find a positive correlation between peak height ( which is proportional to significance of binding , or p value ) and its potential to upregulate gene expression ( top peaks 20% ) . in contrast , the fraction of regulatory peaks that can be associated to repressed genes is invariant with changes in peak size , suggesting no direct relation between ascl1 binding significance and downregulation of gene expression . therefore , mere binding of ascl1 to chromatin does not predict a regulatory event ; however , the size of an ascl1 peak may be correlated with its potential to activate gene transcription . to have a global view of the association between the data sets of genes bound by ascl1 and regulated during differentiation , we determined the frequency at which deregulated genes ( grouped in bins of increasing thresholds of fold change of expression ) are associated with ascl1 bes ( grouped in bins of increasing p value cutoff ) and therefore considered to be directly regulated by ascl1 ( figure 3b , left ) . the statistical significance of the overlaps was assessed by a similar comparison against 100 randomly generated control chip - seq data sets of identical size ( figure 3b , right ) . the resulting heat maps indicate a strong association between ascl1-bound genes and those upregulated during differentiation and a much less pronounced association with downregulated genes ( figure 3b , top left versus bottom left ) . moreover , the fraction of downregulated genes that are considered ascl1 targets is very similar to that expected by chance ( figure 3b , left versus right ) . in addition , this function is independent of the progress of differentiation during the first 50 hr , as shown with similar analyses for the different time points considered in the transcription profiling ( figures 3c and s3 ) . importantly , restricting the analysis to the ascl1 bes located within 5 kb of a tss , producing a more stringent gene annotation , results in a similar conclusion ( figure s4 ) . to integrate the transcriptional profiling data sets collected at distinct time points , we applied a fuzzy c - means clustering algorithm , resulting in the identification of seven distinct temporal clusters ( clusters 14 comprised of upregulated genes , clusters 57 of downregulated genes ) ( figure s5 ; table s3 ) . clusters of genes that are upregulated during differentiation are all strongly associated with ascl1 bes ( p 1.3 10 , 8.0 10 , 1.1 10 , and 7.9 10 for clusters 1 , 2 , 3 , and 4 , respectively ) , whereas clusters of downregulated genes show no such association ( figure 3d ) , further indicating that ascl1 binding correlates with transcriptional activation . the relative size of each cluster ( figure s5b ) and their enrichment for bes indicate that most ascl1 target genes fall within a cluster characterized by an early activation profile ( cluster 2 ) , while a smaller but significant number is upregulated at mid or late time points ( clusters 3 and 4 , respectively ) . we then compiled a high - confidence list of 272 ascl1 direct targets comprising genes from clusters 2 , 3 , and 4 that are associated with at least one ascl1 be with high regulatory potential ( p < 10 ) ( table s4 ) . a search for terms describing biological process , molecular function , and pathways ( panther classification system ) revealed the segregation in each temporal cluster of ascl1 target genes encoding proteins of distinct classes and functions , suggesting the control of various subprograms at distinct developmental stages ( figure s5c ) . genes with the earliest onset of activation ( belonging to cluster 2 ) are associated with signal transduction and cell communication , while targets with a mid - onset of activation ( cluster 3 ) encode mostly proteins with a function related to transcription or notch signaling . genes with latest onset ( cluster 4 ) are enriched for generic terms associated with neural development and relate to late events in the differentiation program , from cell migration to axonal growth and guidance ( figure s5c ) . in summary and in agreement with our previous study performed on a smaller scale , the identification of ascl1 target genes in our neurogenesis model demonstrates the direct control of distinct components of the neurogenic differentiation program by ascl1 . it was previously shown that ascl1 target genes display different onsets of expression at distinct stages of the neuronal lineage ( borromeo et al . , 2014 , castro et al . , 2011 ) . such temporal patterning could be associated with distinct accessibilities of ascl1 to its binding sites ( e.g. , due to differences in the chromatin landscape ) . to investigate this , we compared the binding profile of overexpressed ascl1 at two distinct stages by extending the previous chip - seq analysis to a time point at the onset of differentiation ( 30 min upon addition of tamoxifen ) ( table s9 ) . surprisingly , visual inspection of the genomic distribution of ascl1 peaks finds a remarkable similarity between ascl1 bes at t = 30 min and t = 18 hr ( figure 4a ) . comparison of the two ascl1 binding profiles in a bin - by - bin approach within the confidence limits defined by the previous chip - pcr validation ( figure 4b , dashed line ) shows an overlap of 86% between the two stages ( figure 4b ) . furthermore , the presence of normalized sequencing signal across both samples in genomic regions centered at putative sample - specific bes suggests that the overlap of occupancies may have been underestimated by peak calling conditions ( figure 4c ) . overall , our results indicate that the accessibility of ascl1 to the full complement of its binding sites remains largely identical throughout differentiation . we next asked what impact ascl1 may have on the chromatin landscape when it promotes neuronal differentiation of ns cells . we started by characterizing the chromatin landscape of proliferating ns cells and of ns cells undergoing differentiation by ascl1 , using a dnase i hypersensitivity assay coupled to massive parallel sequencing ( dnase - seq ) . open chromatin ) on a genome - wide scale , which correspond mostly to active regulatory elements such as promoters , enhancers , insulators , and silencers ( boyle et al . , 2008 , the density of mapped reads for each genome position was computed to generate a comprehensive list of dnase i hypersensitivity sites ( dhss ) . using a constant threshold of p < 10 , we identified 87,000 and 94,000 dhss in proliferating and differentiating ns cells , respectively ( tables s5 and s6 ) , numbers with a magnitude consistent with those obtained in other cell types ( song et al . , 2011 ) . although the majority of these sites is shared by both experimental conditions , each cell state exhibits a specific set of 20,000 dhss ( figure 5a ) . since ascl1 functions as a transcriptional activator , we focused on the dhss induced during differentiation ( table s7 ) , as these are more likely to provide new insights into ascl1 function . to validate these dhss , we used formaldehyde - assisted isolation of regulatory elements ( faire ) , an alternative method to identify regions of open chromatin . although distinct preferences have been described for each technique in the identification of distal or proximal regulatory regions , the two techniques have been shown to yield largely overlapping results on a genome - wide basis ( song et al . , , 9 of 13 tested regions presented more than 2-fold enrichment by faire - pcr across samples collected before and 24 hr after addition of tamoxifen , as opposed to control regions ( figure 5b ) . next , we investigated how regions of chromatin newly opened during differentiation may be associated with the observed changes in gene expression . we find a statistically significant enrichment of differentiation - induced dhss in the vicinity of upregulated genes ( the sum of clusters 14 ; p < 1.3 10 ) , in sharp contrast with downregulated genes ( clusters 57 ) ( figure 5c ) . moreover , a large fraction of all upregulated genes ( 413 of 760 ) is associated with at least one differentiation - induced dhs , suggesting the importance of these putative regulatory regions in activating gene expression during neurogenesis . notably , upregulated genes associated with differentiation - induced dhss are either not expressed in proliferating ns cells or expressed at a low level when compared with upregulated genes near constant dhss ( figure 5d ) . this is well exemplified by the induction of neurod4 , a pro - differentiation tf only expressed in post - mitotic precursors ( ohsawa et al . , 2005 ) , and which is associated with newly open dhss ( figure 6b ) . overall , our results indicate that activation of differentiation genes is strongly associated with the appearance of new dhss . in order to investigate which dna - binding tfs may be associated with the appearance of newly open chromatin regions , we took advantage of the high resolution potential of digital genomic footprinting ( dgf ) applied to dnase - seq data to determine the position of sites occupied by tfs within differentiation - induced dhss ( figure 5e ) ( piper et al . , 2013 ) . dgf identified almost 17,000 genomic sites ( table s8 ) with significant occupancy levels ( p < 10 ) , and the corresponding sequences were then subject to a search for frequency of motif occurrence . the most abundant motif found corresponds to the consensus sequence of ctcf and is likely to reflect its frequent binding to insulator regions identified by dnase - seq ( figure 5e ) ( thurman et al . , 2012 ) . three additional motifs reveal binding by tfs of the bhlh or nfi families , with the most frequent one corresponding to the e - box consensus sequence , which mediates ascl1 binding . this observation establishes ascl1 as a prime candidate to promote the opening of chromatin structure and induce new dhss during differentiation . to understand how ascl1 binding may relate to the observed changes in chromatin compaction , we compared the genomic distribution of ascl1 bes with that of dhss before and after neuronal differentiation ( figure 5f ) . ascl1 chip - seq and dnase - seq data sets show a high degree of overlap ( e.g. , 80.3% of ascl1 bes with p < 10 at t = 30 min fall within dhss in proliferating cells ) , indicating that a large fraction of bes , but not all , occur in regions of open chromatin in proliferating ns cells ( figure 5f ) . strikingly , this overlap increases significantly under differentiation conditions ( to 91.05% after differentiation , in the aforementioned case ; figure 5f ) . altogether , a comparison between the ascl1 chip - seq and dnase - seq suggests that ( 1 ) the ascl1 binding profile remains constant at the two stages analyzed , ( 2 ) a large fraction of ascl1 bes occurs in regions of open chromatin in proliferating cells , with a subset falling within closed chromatin , and ( 3 ) binding of ascl1 to closed chromatin precedes the appearance of new dhss during differentiation . visualization of aligned ascl1 chip - seq and dnase - seq data suggests that many differentiation - induced dhss overlap with ascl1 bes ( figure 6a ) , as exemplified by those in the vicinity of genes activated during differentiation such as neurod4 , ap3b2 , mcf2l , and nrxn3 ( figure 6b ) . validation of changes in chromatin compaction at the selected ascl1 binding sites was performed by faire - pcr using chromatin extracted from ns5 cells expressing full - length ascl1 under the regulation of a doxycycline inducible promoter , before and after ascl1 induction ( figure 6c ) . although not all dhss that arise de novo during differentiation are associated with an ascl1 be , as not all ascl1 bes overlap with changes detected by dnase - seq , the vast majority of ascl1 bes fall within dhss in differentiating cells ( 91.05% or 91.27% with p < 10 , at t = 30 min or t = 18 hr , respectively ; figure 5f ) . to investigate the correlation between ascl1 binding and changes in chromatin compaction on a large scale , we quantified the dnase - seq signal from both time points centered on ascl1 peak summits . confirming previous observations , the overall dnase - seq profile at ascl1 peak summits is consistent with many bes occurring in regions of already open chromatin at t = 30 min ( figure 6d ) . nevertheless , a significant increase is observed when comparing profiles before and after differentiation ( 2.33 increase of median read count ) at ascl1 peak summits genome - wide ( figure 6d ) . this increase is amplified when focusing our analysis on ascl1 peaks that fall within differentiation - induced dhss ( 4.37 increase of median read count ; figure 6d ) . ascl1 bes co - localizing with differentiation - induced dhss are strongly associated with gene activation and not with gene repression ( p < 6.8 10 ; figure 6e ) , targeting a total number of 98 genes during differentiation . overall , the integration of ascl1 location analysis , dnase - seq results , and expression profiling demonstrate ascl1 promotes genome - wide changes in chromatin compaction at its target sites during neuronal differentiation and the appearance of new dhss associated with activation of gene expression . our results are in agreement with the observation that ascl1 can bind to nucleosomal dna when overexpressed in fibroblasts ( wapinski et al . , 2013 ) . to verify that ascl1 can bind to closed chromatin in a physiological context , we focused on the ascl1-bound regulatory region identified immediately downstream the neurod4 promoter ( bs2 in figure 6a ) , a target gene of ascl1 in our cellular system that is not expressed in ventral telencephalon . we reasoned that binding to closed chromatin to neurod4 may still occur in this embryonic brain region at the neurogenic period , even in the absence of gene expression . indeed , we detected strong binding of ascl1 , as compared with a negative control region within the neurod4 locus by chip - pcr in chromatin extracted from mouse ventral telencephalon ( figure 6f ) . however , in contrast to our previous findings with differentiating ns cells in culture , a lack of enrichment for non - nucleosomal dna assessed by faire - pcr shows this ascl1 target site is found within closed chromatin in ventral telencephalon ( figure 6 g , compare with ascl1 site in dll1 ) . thus , our results with the neurod4 regulatory region demonstrate that endogenous ascl1 can bind to closed chromatin in an in vivo context . finally , we wished to analyze the accessibility of chromatin at ascl1 target sites in the absence of ascl1 expression . for this , we used chromatin extracted from ventral telencephalon of ascl1-null embryos and probed ascl1-bound regions associated with previously validated ascl1 target genes ( dll1 , fbxw7 , and stk33 ) in this embryonic structure ( castro et al . , 2006 ) . ascl1 null embryos show a very significant reduction of faire - pcr signal relative to wt chromatin at all tested ascl1 binding sites , as compared with pairwise control regions , which is consistent with the results above and in support of a role for ascl1 in regulating chromatin compaction in vivo ( figure s6 ) . in spite of its pivotal role during neurogenesis , little is known on how ascl1 functions to regulate gene expression . here we investigated the reciprocal interactions between ascl1 and the chromatin landscape when promoting the neuronal differentiation of ns cells in culture . we found that ascl1 can bind to and promote the opening of closed chromatin regions in its native context . below we discuss our findings and their implications to the mechanisms that govern the temporal progression of the ascl1 transcriptional program . our work resulted in a fine - grained characterization of a differentiation program driven by ascl1 . in spite of displaying a wide range of biological roles , the first consists of genes encoding transcriptional regulators , an observation consistent with the master regulator function of ascl1 in this developmental process . importantly , the activation of some tfs may define feedback loops that modulate ascl1 activity . this is the case of id1 , an inhibitor of bhlh activity that functions by sequestering e - proteins ( ruzinova and benezra , 2003 ) , and cbfa2t2/mtgr1 , a zinc - finger protein that has been shown to function as a co - repressor of proneural proteins , including ascl1 ( aaker et al . , 2010 ) . other examples , suggesting positive feedback mechanisms , are tfs previously linked to a relief of notch inhibition by counteracting the activity of hes1 ( hes6 ) , repressing notch1 ( prox1 ) , or by as yet unknown mechanisms ( myt1 ) ( bellefroid et al . , 1996 , gratton et al . these regulatory events define a less well - understood role of ascl1 in modulating notch signaling cell autonomously , of putative importance to the progression of differentiation . the abundance of this group of genes is likely to result from its recognized role in many cellular functions , from signal transduction ( where it may serve as a scaffold for components of signaling pathways ) to cell shape change and locomotion , activities that are essential to the neurogenic differentiation program ( forgacs et al . , 2004 ) . it was recently shown that ascl1 promotes sequentially the proliferation and differentiation along the neuronal lineage , with the concomitant activation of distinct target genes ( castro et al . , 2011 ) . our study focused on the transcriptional program activated by ascl1 when promoting neuronal differentiation . comparing the identity and molecular determinants for target gene specificity associated with both cellular functions will likely require the characterization of ascl1 binding profile in an oscillatory versus sustained mode of expression . nevertheless , the observation that overexpressed ascl1 can readily access the full complement of its differentiation sites at the onset of differentiation suggests these may already be accessible to this tf in proliferating cells , an important observation in the context of the dynamics of ascl1 function along the neuronal lineage . it was previously shown that overexpressed ascl1 can bind to closed chromatin in fibroblasts ( as assessed by faire - pcr ) , defining it as a pioneer tf ( wapinski et al . , 2013 ) , results that the present study validates for the first time in a neural context . moreover , our analysis of binding of ascl1 to the neurod4 locus in ventral telencephalic progenitors that do not express this gene allowed for the dissociation between binding and opening of chromatin , revealing binding of endogenous ascl1 to closed chromatin in vivo . altogether , our study supports the idea that ascl1 displays its pioneer activity when regulating gene expression in its native context . our analysis of chromatin states suggests that most ascl1 binding in our differentiation model occurs within enhancer regions that are already active in proliferating ns cells as shown by their enrichment for both h3k4me1 and h3k27ac . this may be due to the fact that many genes upregulated by ascl1 during differentiation are already expressed in proliferating ns cells . alternatively , it may reflect the trivalent mark ( h3k4me1 , h3k27ac , and h3k9m3 ) identified at ascl1 binding sites in various cell types permissive to ascl1-mediated reprogramming ( wapinski et al . , 2013 ) . most importantly , ascl1 promotes dnase i accessibility to regions of closed chromatin at a smaller but significant number of its target sites associated with the activation of a differentiation - specific component of its transcriptional program . our results cast light into a previously unknown function of ascl1 and establish the first link between the chromatin landscape at ascl1-bound regulatory regions and the temporal pattern of the ascl1 program along the neuronal lineage . moreover , they suggest that the hierarchical model recently proposed for the reprograming paradigm ( wapinski et al . , 2013 ) may also be representative of the neurogenesis process and that opening of chromatin regions at ascl1 target sites may be important to allow subsequent binding of other tfs in differentiating cells . finally , it is tempting to speculate that the broad effect of ascl1 in promoting chromatin accessibility described in this study will be important for the reprogramming capacity of this tf upon its ectopic expression in various cell types . ascl1-ert2 encodes full - length mouse ascl1 in frame with the modified ligand binding domain of the human estrogen receptor ( ert2 ) and an n - terminal flag / ha tag sequence . for virus production , ascl1-ert2 was subcloned into pmx - ires - gfp or pbabe - ires - gfp - puro . replication - incompetent retroviruses were produced from hek293 t cells transiently transfected with retroviral , viral envelope- , and vsvg - pseudotyping plasmids . retroviral particles were concentrated from supernatant by ultracentrifugation at 90,000 g for 90 min . viral titers were typically 1010 infectious particles / ml . ns5 cells were cultured as previously described ( conti et al . , 2005 ) using laminin as media supplement ( 20 g / ml ) . ns5 ascl1-ert2 cells were generated upon infection with pbabe - ascl1-ert2-ires - gfp - puro , followed by selection in complete medium containing 1-g / ml puromycin ( calbiochem ) . ns5 ascl1-ert2 cells were plated at 28,000 per cm of density and induced with 50-nm 4-hydroxytamoxifen , while reducing egf concentration to 5 ng / ml . all experiments were carried out upon approval and following the guidelines of the ethics committee of instituto gulbenkian de cincia . quantification of ascl1 ( endogenous + ascl1-ert2 ) done by parallel immunostaining with anti - ascl1 antibody in acutely cultured primary ventral telencephalon progenitors from e14.5 mouse embryos and ns5 ascl1-ert2 cells ( three replicates each ) . a total of 939 and 751 cells for embryonic and ns5 progenitors , respectively , was imaged with identical exposure and images thresholded and normalized mean fluorescence per cell x ( mean fluorescence of all cells in picture / mean fluorescence of all cells per sample)to define positive cells . extraction of mrna and cdna synthesis performed as previously described ( castro et al . , 2011 ) . quantitative real - time pcr ( qrt - pcr ) was performed according to the manufacturer using sybr green super - mix ( quanta biosciences ) on an abi7500 machine ( applied biosystems ) . for microarray analysis , quality of total rna from biological triplicates was assessed using agilent bioanalyser , and samples were processed according to the illumina whole - genome gene expression direct hybridization assay guide , using illumina totalprep-96 rna amplification kit ( life technologies ) . quality control was performed on labeled crna , and 750 ng of labeled crna was hybridized to mouse ref-8v2 arrays and scanned by beedstudio v.3.1.3 ( quantile normalization with background correction ) . further details of data processing , including gene clustering , are described in supplemental information . for ascl1 chip - seq , ns5 ascl1-ert2 cells were fixed sequentially with 2 mm di(n - succimidyl ) glutarate and 1% formaldehyde in pbs and then lysed , sonicated , and immunoprecipitated with anti - ha antibody , as previously described ( castro et al . , 2011 ) . dna libraries were prepared from 10 ng of immunoprecipitated dna according to the standard illumina chip - seq protocol and sequenced with illumina gaiix . raw reads were mapped to the mouse genome ( ncbi37/mm9 ) with bowtie 0.12.7 ( langmead et al . , 2009 ) . uniquely mapped reads data ( 11.5 million for both ascl1 chip and input chromatin samples ) were then subsampled before peak calling with macs 1.4.1 ( zhang et al . , 2008 ) . for histone marks chip - seq , ascl1-ert2 cells were fixed in 1% formaldehyde in pbs , prepared as described above and immunoprecipitated with anti - h3k27ac and anti - h3k4me1 antibodies . raw reads were mapped as above ( 25 million uniquely mapped reads for all samples ) and data processed with macs 2.1.0 . for chromatin state characterization , we used a hidden markov modeling of chromatin enrichment software chromhmm ( ernst and kellis , 2012 ) . chromatin preparation was done with a single fixation with 1% formaldehyde , from ns5 ascl1-ert2 cells , or when indicated with ns5 cells infected with a doxycycline inducible lentivirus expressing wt ascl1 ( wapinski et al . , three rounds of phenol / chloroform extraction were followed by isopropanol precipitation of the dna . quantification of genomic regions was done using a standard curve generated with decross - linked input chromatin by qrt - pcr as above . dnase - seq samples from differentiating ns5 ascl1-ert2 cells or proliferating ns5 cells were prepared as previously described ( song et al . , 2008 , song and crawford , 2010 ) with a slight modification to the linkers to increase ligation efficiency ( song et al . , 2011 ) and then sequenced with illumina gaiix . mapping was done as for chip - seq , resulting in 165.9 and 168.7 millions of unique reads for proliferating and differentiating conditions , respectively . genomic location of dhss was identified with macs version 1.4.1 , following a protocol described in supplemental information . for oligonucleotides used in this study , designed research and performed experimental work , except electrophysiology tests performed by b.b . d.s.c . and a.a.s.f.r .

summarythe proneural transcription factor ascl1 coordinates gene expression in both proliferating and differentiating progenitors along the neuronal lineage . here , we used a cellular model of neurogenesis to investigate how ascl1 interacts with the chromatin landscape to regulate gene expression when promoting neuronal differentiation . we find that ascl1 binding occurs mostly at distal enhancers and is associated with activation of gene transcription . surprisingly , the accessibility of ascl1 to its binding sites in neural stem / progenitor cells remains largely unchanged throughout their differentiation , as ascl1 targets regions of both readily accessible and closed chromatin in proliferating cells . moreover , binding of ascl1 often precedes an increase in chromatin accessibility and the appearance of new regions of open chromatin , associated with de novo gene expression during differentiation . our results reveal a function of ascl1 in promoting chromatin accessibility during neurogenesis , linking the chromatin landscape at ascl1 target regions with the temporal progression of its transcriptional program .

a genome - wide approach opens up the possibility of obtaining new information in the field of genome instability . nevertheless , every method has its own restrictions . in our comments , we compare cytological , genetic and genome - wide molecular analyses of mobile element transposition rates in hybrid genomes . the mobility of transposable elements ( tes ) is one of the factors that induce spontaneous genetic instability . the transposition rate of tes is difficult to study due to the rarity of events and polymorphic tes locations , even in inbred strains . aflp and fish were used by vela et al . to estimate the tes transposition rate in interspecies hybrids between d. koepferae females and d. buzzatii male after subsequent 3 backcrosses between a fertile hybrid female and a d. buzzatii male . it was found a big difference in number of tes insertions by using different techniques . tes osvaldo , helena and galileo were detected by fish as several hybridization sites on the salivary gland polytene chromosomes ( 12 hybridization site for helena , no one for osvaldo and one for galileo in the case of d. koepferae ; one hybridization site for galileo , 5 for helena and 4 for osvaldo in the case of d. buzzatii ) , whereas the molecular method aflp detected 25 dozen insertions per genome . the authors supposed that the difference in the tes copy number studied by different methods appeared because fish detects only euchromatic sites while aflp can also detect heterochromatic sites . it means that we should find another explanation of discrepancy in data obtained by fish and aflp . the difference in the tes copy number found in hybrid genomes by fish and aflp approach can be explained by different sensitivities of these methods . the fish analysis of the hobo , mdg1 , dm412 and i - element transposition rates in the reference d. melanogaster genome can only realize usually sequences that have a base pair length of more than 1,000 , although in this genome , there are several dozen smaller te derivatives that were annotated . te localized in chromocenter usually represented by short defective copies and can be recognized by fish only if they are highly repeated . as usually hybridization of te in chromocenter region aflp - based technique allows the simultaneous amplification of the te insertions from a particular element which are identified by a ligation - mediated nested pcr that starts within the transposon and amplifies part of the flanking sequence . the polymorphic length of pcr products in aflp analysis is a reflection of the polymorphism of adjacent tes sequences . aflp allows for the registration of short defective tes variant , but most of short defective tes variants can not be recognized and moved by transposase , because most of them do not have both terminal repeats . an example of the instability of gene singed in intraspecies hybrids is presented in vela et al . 's article as a reflection of the rate of p - element transposition because of the excision of the p - element introduced in this gene . meanwhile , it was found that mutations in the unstable sn were caused by the introduction of 2 p - elements oriented end - to - end or head - to - head . another explanation of sn instability is as follows : homologous recombination or slippage of a replication fork between these repeats , perhaps during attempted transposition , would also produce the observed structures . thus , singed instability may not be a reliable indicator of p - element transposition . it was shown also that the instability in notch and yellow-2 was caused by recombination between 2 tes . hypermutability in yellow2 coincided with the multiplication of inversion appeared in the regulatory region between 2 hobo transposable elements and recombination between repeats . recombination frequency increases also in heterozygote in pericentromeric regions where defective tes and other repeats are concentrated . as was mentioned by authors of commented article new aflp hybrid markers detected in amaranthus hybrids have homology with tes associated to the mobilization of repetitive dna . we found an example of distribution of 3 kb degenerative repeat between tes in annotated y ; cn bw sp d. melanogaster genome ( fig . 1 ) . the members of this degenerative family are divided into 2 groups according to there 's similarity and are distributed between different couples of short defective tes ( jockey and rt1 ; stalker and invader ) . members of one group are situated mainly between jockey and rt1 couples , but members of other group are localized mainly between stalker and invader couples . appearance of such structure and multiplication of tes could be result of recombination between these 3 kb repeats . figure 1.distribution of 3 kb repeats between couples of tes ( jockey and rt1 in oval ; stalker and invader in poligon ) on the x - chromosome of y ; cn bw sp d. melanogaster genome ( in silico data was obtained from flybase ) . distribution of 3 kb repeats between couples of tes ( jockey and rt1 in oval ; stalker and invader in poligon ) on the x - chromosome of y ; cn bw sp d. melanogaster genome ( in silico data was obtained from flybase ) . changes in the number of bands in the aflp analysis in interspecies hybrids can be caused not only by te transpositions , but also by conversion , multiplication or recombination between defective tes repeats or between their repeated neighbors . if this is the case , then recombination between repeats adjacent to te or recombination between different tes can simulate tes movement recognized by aflp . by the way , osvaldo is the most movable te according to aflp technique and the only te that strongly hybridizes with chromocenter . a difference in the number of aflp markers between the different flies of parental lines in spite of the fact that both stocks correspond to inbred lines maintained by brother the number of total galileo insertions in 2 different families was 41 , 43 and 42 , 45 in the case of d. buzzatii and d. koepferae respectively ( table 5 ) . according to figure 1 from vela et al . article paternal insertion sites are nearly summarized in hybrids because aflp markers are not coincide in analyzed species . the biggest number ( 52 ) of total galileo insertions was found in family 40 . it is not clear , what is the impact of polymorphic pattern of parental tes in aflp result if backcross1 was carried out by mass crossing . a similar divergence between the genome - wide and cytological data in the analysis of the rate of te transposition was found in drosophila melanogaster intraspecies crosses . authors directly mapped new transposon insertions by paired - end deep sequencing of ovarian dna . by contrast , genome sequence analysis of dysgenic ovaries devoted viable eggs , revealed approximately 15 new insertions in a single generation . the length of p - elements was not determined as in the vela et al . the rate of p - element transposition was about 10 and 10 according to hybridization in situ and genome - wide analysis respectively . the frequency of tes transpositions in interspecies hybrids varies from 10 to 10 per genome per generation according to aflp - based technique . genome - wide methods identify increases in genome instability in inter - and intra - species hybrids , but overestimate tes transposition rates by at least one order of magnitude in comparison with fish . this is because genome - wide methods can recognize not only movable te , but also short defective derivatives , which have lost the potential to change positions . instability which is recognized by aflp technique can reflect changes of tes position that happens mainly without transposase participation . the genome instability in intraspecies crosses is at least one order of magnitude higher than in interspecies hybrids if take into account genome - wide approaches . this work is supported partially by grant rfbr 14 - 04 - 00929 and base project vi.53.1.2 .

there is wide - spread interest in understanding the rate of transposable element movement within populations and between species . a recent study using interprecific crosses between d. buzzatii and d. koepferae indicated that transposition rates in hybrids may be quite high . however , we suggest caution should be taken in this interpretation since aflp methods to detect transposition events may lead to overestimated rate estimates . comparative analyses of genome instability received by different methods suggest that transposition rates can be higher in intraspecific crosses compared to interspecific crosses .

confident peptide identification through tandem mass spectrometry ( ms ) is one of the most important components in ms - based proteomics . for this reason , a great amount of effort has been invested to develop automated data analysis tools to identify peptides through tandem ms ( ms ) spectra . among available because each search method uses a different algorithm and proceeds from a different view of what spectrum components contain the most critical information for identification , the search results for one spectrum from various search engines may differ significantly . however , it is also well - recognized that such difference may be turned into positive use : it would be useful to find complementary engines and combine the results in an effective way to enhance peptide identification.(1 ) combining search results from different methods , if feasible , definitely bears the possibility to improve the peptide identification confidence via reducing noise and utilizing complementary strengths . the difficulty in combining results from different search methods largely comes from the lack of a common statistical standard.(2 ) the importance of having a community standard has been stressed , and efforts in reaching such community standard have been invested . using iterative expectation - maximization ( em ) , keller et al . ( 3 ) proposed a statistical model to estimate the probability , determined through a global analysis of ms spectra from an experiment , for a given spectrum to have correct peptide identification . in principle , results from different search methods may go through the same analysis and thus compared . however , if after the statistical analysis two different methods report different confident identifications for the same spectrum , one ends up needing to invent an ad hoc rule to decide which identification should be kept . furthermore , to use the em approach , one needs to assume or guess , without theoretical / statistical foundation , the forms of the score distributions for true positives and false positives . this , unfortunately , must weaken the validity of any statistical significance assignment obtained from such type of analyses . in our recent work,(4 ) it was shown possible to calibrate the statistics ( e - value ) of various search methods to reach a universal standard that is in agreement with the fundamental definition of e - value . for a given query spectrum and quality score cutoff s , e - value is defined as the expected number of hits , in a random database , with quality score being the same as or larger than the cutoff . a realistic e - value assignment thus provides the user with the number of false positives to anticipate when setting a quality score threshold . most importantly , this peptide - centric statistical calibration allows one to combine search results even if the top hits from various methods disagree . another possible approach to establish common statistical standard is through equating the false discovery rate ( fdr ) ( 5 ) of various methods considered . this approach , however , does not provide statistical significance for each peptide hit and thus is not directly applicable to peptide - centric combination of different search results . to be explicit , one may refer from fdr the e - value of a peptide hit with score identical to the first false positive , but any peptide hits with score better than the first false positive can not have their e - value assigned . furthermore , for peptides with scores falling in the range [ sk+1 , sk ] , where sk represents the kth best score of false positives , one can not distinguish them statistically well except by using some ad hoc interpolations . there also exist other issues concerning misleading inference using fdr , but this is not the focus of the current paper and we refer the readers to a few relevant literatures . in this paper , in addition to providing a universal protocol to combine search results , we also carry out the performance assessment for all possible combinations , among seven database search methods , of two and three search methods using the receiver operating characteristic ( roc ) curves . the database search methods employed in our analysis are sequest(8 ) ( v27 rev12 ) , probid(9 ) ( v1.0 ) , inspect(10 ) ( v20060505 ) , mascot(11 ) ( v2.1 ) , x ! tandem(12 ) ( v2007.07.01.2 ) , omssa(13 ) ( v2.0 ) and raid_dbs.(14 ) to better illustrate the main points of this paper , we have relegated to the supporting information a large number of roc curves that convey similar information of that exhibited in the plots of the main text . since the centroid mode seems to be the dominant mode in ms database searches today , we present in the main text only results from centroid mode data and results from profile mode data are shown in the . throughout the paper , we use dalton ( da ) as the unit for molecular weight . in the following , we will then describe briefly in the implementation , followed by our main results : best combinations within search methods tested . in this section , we will start with the definitions of p - value and e - value , which will be frequently used for the rest of this paper . we then describe the mathematical underpinnings of how to combine the p - values of different database search methods to result in a final e - value . we should note that the mathematical formulation employed here was first introduced by fisher,(15 ) and its extensions and applications to other research areas also exist . to the proteomics community let us define the p - value and e - value in the context of peptide identification in database searches . for a given spectrum and a score cutoff sc , one may ask what is the probability for a qualified ( with molecular weight in the allowed range ) random peptide to reach a score larger than or equal to sc . this probability p(sc ) , a function of sc , is called the p - value . for spectrum , if a database contains n qualified , unrelated random peptides , one will expect to have e(sc ) = np(sc ) number of random peptides to have quality score larger than or equal to sc . this expectation value e(sc ) is by definition the e - value associated with score cutoff sc . if one further assumes that the occurrence of a high - scoring random hit is a rare event and thus can be modeled by a poisson process with expected number of occurrence e(sc ) , one may then define another p - value , which is called the database p - value , via the database p - value pdb(sc ) represents the probability of seeing at least one hit in a given random database with quality score larger than or equal to sc . note that , at the level of pdb , one may compare the statistics from different search methods using different sizes of random databases . because of the differences in the choices of optimal search parameters , it is likely that different search methods , for the same query spectrum , may search over different number of qualified peptides , that is , having different effective database sizes . therefore , combining the database p - values is the natural choice if one were to merge results from different search methods . suppose that one wishes to combine the search results from l different search methods , each peptide candidate will have in principle l different p - values reported by the l search methods . the formula in eq 6 of the next subsection provides us the final combined p - value pcomb from the list . once pcomb is obtained , we may invert the formula in eq 1 to get a combined e - value ecomb via having outlined how to obtain the final quantity of interest , ecomb , we now turn to the mathematical underpinnings of how to combine a list of , ideally independent , p - values reported by different database search methods . consider an event labeled by a list of l independent quantities s1 , s2 , ... , sl . each quantity si may have an associated p - value pi depending on the statistics of the variable si . an important issue to address is how one should combine all the pi values to obtain an overall p - value . in the context of combining search results of different methods to assign statistical significance to a certain candidate peptide pl ) uniformly distributed in the interval ( 0 , 1 ) ] , what is the probability of finding their product to be smaller than a certain threshold . to put it in a more concrete framework , one may consider a unit hypercube whose interior points having coordinates ( x1 , x2 , ... , xl ) with 0 xi 1 for all 1 i l. one then asks what is the volume bounded by the hypersurfaces xi 0 and ( i=1lxi ) with = i=1lpi . we may express this volume f( ) mathematically as an integral : where (x ) is a step function with (x > 0 ) = 1 and (x < 0 ) = 0 . let f( ) f()/ , we have with (x ) being the dirac delta function that takes zero value everywhere except when x = 0 where its value approaches infinity . for the ease of computation , we make the following changes of variables : e and xi e. after this change , all the new variables t and ui are in the range ( 0, ) . equation 4 now becomes ( with = e understood ) where the identity (e e ) = e(t c ) is used . using the integral expression of the delta function , we may rewrite eq 4 as ( with = e understood ) where the last equality results from choosing the integration path to enclose the lower half of the complex k plane . we may now go back to f( ) by integrating f( ) . with = i=1lpi while combining the lp - values p1 , p2 , ... , pl . as specific examples , when l = 2 , we have f(p1p2 ) = p1p2[1 ln ( p1p2 ) ] , and when l = 3 , we have f(p1p2p3 ) = p1p2p3[1 ln(p1p2p3 ) + ln(p1p2p3 ) ] . we will provide in the more examples to elucidate the consequence of the formula provided in eq 6 .

confident peptide identification is one of the most important components in mass - spectrometry - based proteomics . we propose a method to properly combine the results from different database search methods to enhance the accuracy of peptide identifications . the database search methods included in our analysis are sequest ( v27 rev12 ) , probid ( v1.0 ) , inspect ( v20060505 ) , mascot ( v2.1 ) , x ! tandem ( v2007.07.01.2 ) , omssa ( v2.0 ) and raid_dbs . using two data sets , one collected in profile mode and one collected in centroid mode , we tested the search performance of all 21 combinations of two search methods as well as all 35 possible combinations of three search methods . the results obtained from our study suggest that properly combining search methods does improve retrieval accuracy . in addition to performance results , we also describe the theoretical framework which in principle allows one to combine many independent scoring methods including de novo sequencing and spectral library searches . the correlations among different methods are also investigated in terms of common true positives , common false positives , and a global analysis . we find that the average correlation strength , between any pairwise combination of the seven methods studied , is usually smaller than the associated standard error . this indicates only weak correlation may be present among different methods and validates our approach in combining the search results . the usefulness of our approach is further confirmed by showing that the average cumulative number of false positive peptides agrees reasonably well with the combined e - value . the data related to this study are freely available upon request .

stroke is still a major cause of death and long - term disability worldwide and it is associated with significant clinical and socioeconomical problems . despite the continuous efforts to develop the new pharmacological strategies , there is no effective neuroprotective therapy so far for ischemic stroke . novel approaches are needed to improve the recovery and quality of life of stroke patients . development of tissue damage after ischemic insult is dependent not only on duration and intensity of the blood flow reduction , but also on flow independent mechanisms , especially in the peri - infarct brain area . the blood flow dependent mechanisms of tissue damage develop in brain ischemic focus in the short time after onset of blood flow reduction . at that time cell death is a consequence of the acute energy failure and permanent anoxic cells depolarization is induced by loss of ionic gradients . a few hours later , the infarct expands into the adjacent penumbra , and cellular damage is mainly triggered by excitotoxicity , mitochondrial disturbances , reactive oxygen species production , and programmed cell death [ 1 , 2 ] . excitotoxicity is a pathologic process based on massive activation of ampa and nmda receptors in the brain . inappropriate activation of ampa and nmda receptors is a trigger for subsequent dysregulation of calcium ions homeostasis in the neurons and finally results in neuronal loss . massive activation of those receptors is observed in many cns disorders including stroke , epilepsy , multiple sclerosis , amyotrophic lateral sclerosis , parkinson , alzheimer , and huntington diseases . the most important factor leading to ampa and nmda upregulation is glutamate . glutamate is an important neurotransmitter in physiological concentration , but in pathologically high concentration it is neurotoxic [ 35 ] . lately , it is suggested that stroke triggers immune responses leading to inflammatory cell activation and infiltration of cerebral parenchyma . in the stroke brain upregulation of a variety of cytotoxic agents like cytokines , matrix metalloproteinases ( mmps ) , nitric oxide ( no ) , and more ros can be detected [ 68 ] . there is also upregulation of expression of some chemokines like ccl2 in the csf [ 9 , 10 ] and serum of patients with stroke . studies in experimental stroke ( middle cerebral artery occlusion model ( mcao ) ) confirmed involvement of chemokine ccl2 and its receptors ccr2 in stroke development . reported no difference in the level of ccl5 but montecucco and colleagues detected increased expression of plasma ccl5 in symptomatic as compared with asymptomatic patients . moreover , canou - poitrine confirmed that , higher systemic levels of ccl5 and cxcl10 in asymptomatic men are independent predictors of ischemic stroke . there is also a recent report from tokami et al . supporting the concept that ccl5 may be neuroprotective during stroke development . they showed upregulation of ccl5 but not ccl2 , ccl3 , and ccl4 on day 0 in stroke patients . this upregulation correlated with plasma concentrations of neuroprotective factors bdnf , egf , and vegf . other data from mcao model also showed upregulation of several chemokines and their receptors including ccl7 , cxcl10 , ccl20 , and chemokine receptors cxcr4 and ccr6 . et-1 induced model of stroke has been previously described by anthony et al . who induced the acute rat cerebral blood volume changes after intravenous and intracranial injections of this vasoconstrictor [ 21 , 22 ] . after microinjection of et-1 into selected brain regions they observed using magnetic resonance imaging ( mri ) an acute reduction of local perfusion in the injected hemisphere , loss of neurons in the grey matter and a macrophage / microglia and astrocyte response . after injection of et-1 into the cortical white matter , those authors observed amyloid precursor protein - positive immunostaining ( indicative of axonal disruption ) and an increase in tau-1 immunostaining in oligodendrocytes . similar to the grey matter lesions , no neutrophils were present and macrophage / microglia response did not occur . additionally , no breakdown in the blood - brain barrier was detected in the white and grey matter . in this study expression of several chemokines including : ccl2 , ccl3 , ccl5 , and cxcl2 as well as expression of markers of neuroinflammation like cd3 , f4/80 , and il-1 beta was studied . correlation of this expression with intensity of early neurodegeneration detected in the brain during the et-1 induced model of stroke was also analyzed . in all experiments , 8- to 12-week - old female sjl / j mice ( n = five for each time point ) were used . all animals were housed at the animal facility of the medical university of lodz , lodz , poland , under standard conditions . all experiments in this study have been approved by the local ethics committee for affairs experiments on animals . animal stroke model was induced by stereotactic , intracerebral injection of endothelin-1 ( et-1 , sigma - aldrich , poznan , poland , ) ( 20 pmol in 1 l of pbs per mouse ) into the left hemisphere of the brain . prior injection mice were anaesthetized with mixture of ketamine ( 1,15 mg , biowet , pulawy , poland ) and ksylazine ( 0,1 mg , biowet , pulawy , poland ) per mouse . after complete anaesthetization mice were placed in stereotactic frame ( david kopf instruments , ca , usa ) , skin on the head was cut , and a small hole in the skull was made using surgical drill . et-1 was administered with a hamilton syringe ( 32 g needle ) ( hamilton company , bonaduz , gr , switzerland ) . site of injection ( a-2 mm , l-1 , 2 mm , d-2 , 5 mm ) was selected using the stereotactic atlas tissue samples were collected 24 and 72 hours after the model induction . as a controls , brains from uninjected mice and from mice injected in the same way with pbs were used . to obtain rna animals , were perfused with a saline solution . tissues were weighed and then homogenized using a mechanical homogenizer ultra turrax ( ika , staufen , germany ) . tissues were homogenized in a volume of 1ml of trizol ls reagent ( gibco brl , invitrogen , carlsbad , ca , usa ) . rna was isolated from the homogenates with trizol ls reagent using phenol - chloroform method described by chomczynski and sacchi ( chomczynski and sacchi , 1987 ) . after rna isolation , its concentration was estimated using the photometric method ( biophotometr plus , eppendorf company , wien , austria ) . to obtain the proteins for the elisa assay harvested organs were weighed using a laboratory balance ( radwag radom , poland ) and homogenized using a mechanical homogenizer ultra turrax ( ika ) . homogenisation was performed in a volume of 1 ml hepes buffer ph 7.4 containing : hepes 20 mm ; edta 1.5 mm ; benzamidyn 0.5 mm ; chicken egg owoinhibitor 10 ug / ml pmsf ( phenylmetylsulfonyl fluoride ) 0.1 mm ( sigma - aldrich , poznan , poland ) . supernatants were obtained after centrifugation ( 20 000 g , time 30 minutes at 4c mpw , warsaw , poland ) . analysis of the rna expression was performed using the corbett real - time pcr machine rotor gene 3000 apparatus ( corbett research , sydney , australia ) . the key enzyme used in this reaction was taq polymerase with activity of 5 u / ml . additional reaction components were buffer for polymerase , 25 mm mgcl2 , 10 mm dntps , fluorescent dye evagreen ( biomibo , warsaw , poland ) , 10 m primers specific to the duplicated sequences , and rnase / dnase free water . for each reaction 2 l of cdna derived from the reverse transcription reaction was used and the total volume was 20 l . as a control histone h3 gene and reference rna ( qpcr mouse reference total cellular rna , stratagene , la jolla , ca , usa ) were used . quantitative analysis of gene expression at the protein level was performed using elisa method with commercially available immunoenzymatic quantikine kits ( r & d systems , mn , usa ) . each set consisted of 96 well plates coated by manufacturer , standard proteins used to prepare the calibration , secondary and tertiary antibodies combined with the horseradish peroxidase enzyme , and washing buffer and color substrate for peroxidase . the assay procedure was performed according to the protocol provided by the manufacturer . after stopping the color reaction protein concentration was evaluated using a photometric reader victor2 wallac 1420 ( perkinelmer , waltham , ma , usa ) with for 450 nm filters , corrected at 595 nm . all samples were analyzed in duplicates . quantitative assessment of the intensity of neurodegeneration was performed using elisa method with primary antibodies directed against phosphorylated neurofilaments . the first step was the coating of 96 well maxisorb microtitre plate ( nunc , roskilde , denmark ) with monoclonal anti - nfh antibodies ( smi35r , sternberger monoclonals , convance princeton , nj , usa ) and overnight incubation at 4c . the next day tested samples and standard curve samples ( neurofilament 200 kd , progen , heidelberg , germany ) were added . as a secondary antibody rabbit polyclonal antineurofilament 200 antibody ( sigma - aldrich , poznan , poland ) was used . as a tertiary antibody swine antibodies against rabbit immunoglobulin conjugated with horseradish peroxidase ( dako , glostrup , denmark ) were used . the final step was the addition of color substrate for horseradish peroxidase , which was 3,35,5-tetramethylbenzidine ( sigma - aldrich , poznan , poland ) . inhibition of the reaction was performed with 1 m hcl and finally color photometric assessment was done using victor2 reader wallac 1420 ( perkinelmer , waltham , ma , usa ) . the analysis was performed using 450 nm filter with correction at 595 nm . all samples were analyzed in duplicates and the concentration of nfh was determined by referring to the standard curve . assessment of the localization and severity of neurodegeneration at the level of protein was performed using the fluorescent fluoro - jade c dye ( chemicon , millipore , warsaw , poland ) . animals were perfused with 4% buffered formalin solution and tissues samples were embedded in paraffin blocks . 10 m thick sections were applied to a polished super frost slides ( menzel - glaser braunschweig , germany ) . before final staining paraffin fluoro - jade c staining was performed according to the protocol provided by the manufacturer ( chemicon ) . for staining of nuclei sections were counterstained using the blue fluorescent dye dapi ( sigma - aldrich , poznan , poland ) . then the tissue was mounted and coverslipped using dpx ( sigma - aldrich , poznan , poland ) . for the analysis and acquisition of images an inverted microscope axioobserver a1 ( carl zeiss inc . , the following lenses made by carl zeiss inc . were used : plan - achromat : 4x/0.10 , a- plan 10x/0.25 ph1 ; ld a - plan 20x/0.3 ; ld plan - neofluar 40x/0.6 , ph2 korr . the images were obtained with a digital camera , axiocam mrc5 ( carl zeiss group , goettingen , germany ) attached to the microscope . for image acquisition we used axio - vision rel . nonparametric kruskal - wallis and mann - whitney tests were used . for correlation analyses kendal significant upregulation of expression of t cell line marker - cd3 was observed in the et-1-injected hemisphere at 72 h after injection ( p = 0.03 , mann - whitney test ) ( figure 1(a ) ) . at that time a significant difference in expression of cd3 was detected between ipsilateral and contralateral hemispheres ( p = 0.019 , mann - whitney test ) ( figure 1(a ) ) . expression of cd3 in ipsilateral hemisphere was also increased when compared to pbs injected hemisphere ( p = 0.28 , mann - whitney test ) . the expression of monocyte / macrophage lineage marker f4/80 was significantly elevated only in et-1 injected hemisphere at 72 hours after injection . at that time significant difference was observed in expression of f4/80 between et-1 injected hemisphere and untreated control group ( p = 0.022 ; mann - whitney test ) ( figure 1(b ) ) . we detected also a significant difference in expression of f4/80 between ipsilateral and contralateral hemispheres of et-1 injected mice at 72 hours after injection ( p = 0.035 , mann - whitney test ) ( figure 1(b ) ) . upregulation of cytokine il-1 expression was observed in et-1 injected hemispheres only at 24 h after injection . significant difference in expression of il-1 was observed between contralateral hemispheres and normal control group at 72 hours after injection ( p = 0.03 and 0.019 , resp . ; we detected also a significant difference in expression of il-1 between ipsilateral and contralateral hemispheres of et-1 injected mice 72 hours after injection ( p = 0.019 , p = 0.019 , resp . ; upregulation of chemokine ccl2 expression was observed in ipsilateral hemispheres at 24 and 72 h after injection of et-1 ( p = 0.005 , p = 0.005 , resp . ; mann - whitney test ) ( figure 2(a ) ) . at 24 h ccl2 expression in ipsilateral hemisphere was significantly higher than at 72 h ( p = 0.019 ; mann - whitney test ) . significant difference in ccl2 expression after et-1 injection was also observed between ipsilateral and contralateral hemispheres at 24 h and 72 h ( p = 0.012 and 0.036 , resp . ; we also showed that during early stage of et-1-injection stroke model expression of ccl3 is significantly upregulated at 24 and 72 h after model induction ( figure 2(b ) ) . there was significant upregulation of ccl3 expression in ipsilateral hemispheres of et-1 injected mice in comparison to normal controls and contralateral hemispheres at 24 h after injection ( p = 0.008 and 0.012 , resp . ; mann - whitney test ) . at 72 h after model induction we observed significant upregulation of ccl3 expression in et-1-injected hemispheres in comparison to normal brains and contralateral hemispheres ( p = 0.014 and 0.019 , resp . ; mann - whitney test ) ( figure 2(b ) ) . ccl5 was observed in et-1-injected hemispheres in comparison to uninjected animals at 24 and 72 h ( p = 0.008 , and 0.008 resp . ; significant difference was also observed in ccl5 expression between ipsilateral and contralateral hemispheres at 24 h and 72 h after injection of et-1 ( p = 0.008 and 0.012 , resp . ; mann - whitney test ) ( figure 2(c ) ) . initially increasing expression of cxcl2 in et-1 injected hemispheres was detected with the peak at 24 h and subsequent decrease at 72 h but still significantly higher than in normal controls ( p = 0.036 , and 0.036 , resp . ; mann - whitney test ) ( figure 2(d ) ) . at 24 h cxcl2 expression in ipsilateral hemisphere was significantly higher than at 72 h ( p = 0.012 ; mann - whitney test ) and then at 24 h after et-1 injection in contralateral hemispheres ( p = 0.012 ; mann - whitney test ) ( figure 2(d ) ) . the expression of cxcl12 in the et-1 and pbs - injected brains and normal controls did not show a significant difference between analysed groups ( data not shown ) . the most severe neurodegeneration was observed in et-1-injected hemispheres at 24 and 72 h after model induction ( p = 0.019 and 0.029 , resp . ; there was also increased neurodegeneration in contralateral hemispheres of et-1 injected mice at 24 and 72 h , but it was significantly lower than in ipsilateral hemispheres ( p = 0.03 , and 0.03 , resp . ; the localization of ischemic lesion was detected in et-1 injected ipsilateral hemispheres using cresyl violet staining ( figure 3(b ) , large box ) . inside the ischemic focus injured neurons were abundant ( detected by fluoro - jade and marked by arrows ) cells nuclei counterstained with dapi are marked on the picture by arrowheads ( figure 3(c ) ) . we observed the positive correlation between expression of lymphocyte lineage marker cd3 ( kendall tau = 0,62 ; p = 0.0004 ) ( figure 4(a ) ) as well as monocyte / macrophage lineage marker f4/80 ( kendall tau = 0,56 ; p = 0.0007 ) ( figure 4(b ) ) and the severity of neurodegeneration in et-1 injected brain hemispheres . although the expression of several studied chemotactic inflammatory mediators ( chemokines ccl2 , ccl3 , ccl5 , and cxcl2 ) was significantly increased in the early stage of this stroke model , there was no clear correlation between this expression and intensity of neurodegeneration ( data not shown ) . in this study we analyzed potential relationship between neuroinflammation and neurodegeneration in experimental model of ischemic stroke induced by intracerebral et-1 injection . we focused on a group of proinflammatory chemokines , especially the classical representatives of ccl subfamily . the reason for selecting these chemokines was their confirmed participation in pathogenesis of many central nervous system diseases . during the first few days of the experimental brain ischemia we observed increasing neurodegeneration in et-1 injected hemisphere . there are several studies showing that neurodegeneration occurs early during brain ischaemia [ 23 , 24 ] . at that time also the relationship between those two processes is complex and still requires further studies . to measure the intensity of neuroinflammation the expression of inflammatory cells markers ( cd3 for t cells and f4/80 for monocytes / macrophages ) has been measured at the same time . this analysis showed increased lymphocyte migration to ischemic brain hemisphere at 72 h after model induction . similarly , infiltration of ipsilateral hemisphere by monocytes / macrophages was significantly increased at 72 h after initiation of brain ischemia . comparable observation was reported by others who showed the presence of macrophages / activated microglia at 72 h after intracerebral injection of et-1 to rat brain . in another study using mcao stroke model , the influx of mononuclear cells to the site of brain ischemia was recorded between 2 and 15 days after model induction . the presence of neuroinflammation during early brain ischemia was also confirmed in our study by elevated expression of inflammatory mediator - cytokine il-1. its presence was observed as early as 24 h after model induction . in several cell types including astrocytes , microglia , neurons , and endothelium . in another study increased production of il-1 was reported even at 36 hours after induction of brain ischemia . the peak of this expression was observed at 12 h , and it returned to baseline level after 5 days . other studies confirmed also that inflammatory mediators , such as il-1 and tnf , are important contributors to cns neural tissue damage induced by ischemia [ 28 , 29 ] . in our stroke model analysis of the relationship between the infiltration of ischemic hemisphere by mononuclear inflammatory cells and this may suggest that there is close connection between neuroinflammation and neurodegeneration in ischemic stroke . migration of inflammatory cells from the blood to the ischemic brain may be at least partially induced by chemotactic cytokines - chemokines . to study this concept the highest expression of ccl2 was observed in our model at 24 h after initiation of brain ischemia . increased expression of ccl2 was still observed at 72 h but was at that time significantly lower . increased expression of ccl2 in mcao model in the ipsilateral hemisphere was observed on neurons at 12 h and on astrocytes at 24 h after cardiac arrest , suggesting that these cells are the potential source of ccl2 during ischemic stroke . minami and satoh using double in situ hybridization method pointed to microglia as the cellular source of ccl2 during mcao . it was shown in another mcao study that ccl2 leads to infiltration of the cns by monocytes and thus enhances brain damage induced by ischemia . also in human stroke patients elevated level of ccl2 was detected in cerebrospinal fluid and serum [ 9 , 11 ] . the highest ccl3 expression was detected at 24 h after et-1 injection . at 72 h this expression was still increased but it was much lower than at 24 h. also at the protein level we observed significant increase in ccl3 production in the ischemic hemisphere . our results are in line with the report by gourmala et al . who observed an increase in ccl3 expression at mrna level already at 1 h after mcao in rats , with peak expression at 816 h . in addition , they observed higher expression of ccl3 during temporary mcao than in permanent mcao , suggesting the impact of reperfusion on the neuroinflammation in the damaged tissue . gourmala et al . using in situ hybridization localized the expression of ccl3 on microglial cells / macrophages during brain ischemia . in addition , another studies have concluded that ccl3 application to the brain ventricles after complete mcao enhances mcao harmful effects . we observed almost 46-fold and 30-fold increase in ccl5 expression at 24 h and 72 h , respectively , after induction of et-1 induced stroke model . there are only a few reports concerning the role of ccl5 in the development of ischemic stroke . it was suggested that ccl5 mediates blood - brain - barrier ( bbb ) disruption and cns tissue damage as well as inflammation after reperfusion during mcao model . these data were not confirmed by tokami and colleagues who observed neuroprotective effect of ccl5 in ischemic stroke suggesting that ccl5 is expressed during stroke mostly in neurons . in et-1 induced experimental stroke a significant increase in cxcl2 expression at 24 h after brain ischemia induction was also observed . observed increased expression of cxcl2 in the brain of rats with the permanent mcao as well as in the brain and spleen during temporary mcao in mice . in other study increased cxcl2 expression was observed at 6 h of reperfusion and decreased by almost half at 22 h after reperfusion . vikman et al . showed increased cxcl2 expression in the brain vessels in the model of subarachnoid haemorrhage and in organotypic cultures . cxcl2 involvement in the inflammatory process in the cns during mcao was also confirmed in a scid mice . mcao induced in scid mice led to development of significantly reduced area of brain damage and lower inflammatory infiltration in ipsilateral hemispheres . reduced expression of many inflammatory mediators including cxcl2 was also observed in t- and b - cell - deficient mice mcao study . unfortunately , therapy of ischemic stroke with cxcl2 receptor - cxcr2 antagonists sb225002 was not successful . in report presented by copin et al . the cxcl1/cxcl2 chemokine - binding protein evasin-3 treatment was associated with reduction in neutrophilic inflammation in mice mcao model . although in our study the expression of several studied chemokines was significantly increased at the early phase of et-1 induced stroke model , no clear correlation of this expression with neurodegeneration was observed . that they suggest that inhibition of inflammatory cell accumulation in the brain at the early stage of stroke may lead to amelioration of ischemic neurodegeneration . upregulated in the ischemic brain chemokines may be a potential target for future therapies reducing inflammatory cell migration to the brain in early stroke .

neurodegeneration is a hallmark of most of the central nervous system ( cns ) disorders including stroke . recently inflammation has been implicated in pathogenesis of neurodegeneration and neurodegenerative diseases . the aim of this study was analysis of expression of several inflammatory markers and its correlation with development of neurodegeneration during the early stage of experimental stroke . ischemic stroke model was induced by stereotaxic intracerebral injection of vasoconstricting agent endothelin-1 ( et-1 ) . it was observed that neurodegeneration appears very early in that model and correlates well with migration of inflammatory lymphocytes and macrophages to the brain . although the expression of several studied chemotactic cytokines ( chemokines ) was significantly increased at the early phase of et-1 induced stroke model , no clear correlation of this expression with neurodegeneration was observed . these data may indicate that chemokines do not induce neurodegeneration directly . upregulated in the ischemic brain chemokines may be a potential target for future therapies reducing inflammatory cell migration to the brain in early stroke . inhibition of inflammatory cell accumulation in the brain at the early stage of stroke may lead to amelioration of ischemic neurodegeneration .

aniridia is a rare bilateral congenital malformation of iris due to neuro - ectodermal developmental defect secondary to a mutation in pax6 gene located on chromosome 11p13 . the incidence of aniridia is estimated to be 1 in 60,000 - 100,000 live births.1 it exists in both sporadic and familial form . it may occur in isolation or associated with number of syndromes such as wagr ( wilm 's tumor , bilateral aniridia , genitourinary abnormalities and mental retardation ) . the pax6 mutations cause a spectrum of ocular malformations , of which aniridia is the major sign . other ocular defect that may be associated includes microcornea , corneal opacity , glaucoma , cataract , subluxated lens , foveal and optic nerve hypoplasia . we report two cases of familial total aniridia associated with microcornea , high myopia and aphakia . a 40-year - old male patient presented with marked dimness of vision for last 1 year . his elder brother ( only sibling ) had visual acuity of 6/6 with -1.5 dioptre sphere ( dsph ) without any other ocular abnormalities . ocular examination revealed best corrected visual acuity in right eye ( re ) counting finger at 3 feet and 3/60 in left eye ( le ) with + 7.0 dsph . slit lamp examination showed bilateral total aniridia with superiorly subluxated cataractous lens in the re [ figure 1 ] and aphakia in the le . the radius of corneal curvature was 8.8 mm in the re and 8.6 mm in the le . the refractive power of cornea of the re in dioptre ( d ) was 39.0 in both vertical and horizontal meridian . the anterior chamber depth in the re was 1.54 mm and in the le was 1.48 . the axial length was 25.57 mm and 25.34 mm in the re and le respectively . gonioscopy of be revealed rudimentary frill of iris tissue in all quadrants and the angle was open . aniridia with superiorly subluxated lens dislocated lens in vitreous a 7-year - old girl , the only child of case i , had poor vision since early childhood . her best corrected visual acuity was 6/36 be with -7.0 dsph and -1.0 dioptre cylinder ( dcyl ) at 90. she had bilateral total aniridia , microcornea , microspherophekic lens [ figure 3 ] and horizontal nystagmus . average corneal diameter of be was 9.5 mm . radius of corneal curvature was 8.6 mm in the re and 8.3 mm in the le . the refractive power of cornea of the re was 38.5d in vertical and 37.5d in horizontal meridian . the diameter of lens was 7.9 mm in be and iop in be with goldmann applanation tonometry was 14 mm hg . gonioscopy of be revealed rudimentary frill of iris tissue in all quadrants and the angle was open . fundus examination of be revealed normal optic disc with foveal hypoplasia [ figure 4 ] . a 40-year - old male patient presented with marked dimness of vision for last 1 year . his elder brother ( only sibling ) had visual acuity of 6/6 with -1.5 dioptre sphere ( dsph ) without any other ocular abnormalities . ocular examination revealed best corrected visual acuity in right eye ( re ) counting finger at 3 feet and 3/60 in left eye ( le ) with + 7.0 dsph . slit lamp examination showed bilateral total aniridia with superiorly subluxated cataractous lens in the re [ figure 1 ] and aphakia in the le . the radius of corneal curvature was 8.8 mm in the re and 8.6 mm in the le . the refractive power of cornea of the re in dioptre ( d ) was 39.0 in both vertical and horizontal meridian . the anterior chamber depth in the re was 1.54 mm and in the le was 1.48 . the axial length was 25.57 mm and 25.34 mm in the re and le respectively . gonioscopy of be revealed rudimentary frill of iris tissue in all quadrants and the angle was open . a 7-year - old girl , the only child of case i , had poor vision since early childhood . her best corrected visual acuity was 6/36 be with -7.0 dsph and -1.0 dioptre cylinder ( dcyl ) at 90. she had bilateral total aniridia , microcornea , microspherophekic lens [ figure 3 ] and horizontal nystagmus . average corneal diameter of be was 9.5 mm . radius of corneal curvature was 8.6 mm in the re and 8.3 mm in the le . the refractive power of cornea of the re was 38.5d in vertical and 37.5d in horizontal meridian . the diameter of lens was 7.9 mm in be and iop in be with goldmann applanation tonometry was 14 mm hg . gonioscopy of be revealed rudimentary frill of iris tissue in all quadrants and the angle was open . fundus examination of be revealed normal optic disc with foveal hypoplasia [ figure 4 ] . aniridia is a rare congenital abnormality transmitted as an autosomal dominant trait with 85 - 90% penetrance.2 microcornea may rarely be associated with aniridia.34 high myopia is again a very rare association with aniridia and microcornea.5 both these abnormalities were present in our case . aniridia and lenticular abnormalities like cataract and subluxated lens may co - exist.134 ] case i had subluxated cataractous lens in the re and aphakia in the le due to spontaneously dislocated lens in vitreous cavity in the le . to the best of our knowledge , in the literature of aniridia association of aphakia aniridia may be associated with defects in angle of anterior chamber and glaucoma , but the findings were not present in our cases . foveal hypoplasia that may be associated with aniridia was present in our case.2 none of the patients was mentally retarded and thorough systemic examination was normal . our cases highlight the rare association of congenital aniridia with microcornea , aphakia and high myopia .

aniridia is a rare congenital malformation that may be associated with various ocular and systemic manifestations . we describe two cases of familial total aniridia associated with microcornea , high myopia and dislocated lens . no systemic abnormality was noted in any of the cases .

polycyclic aromatic hydrocarbons ( pahs ) are a large group of organic compounds that are included in the european union ( eu ) and us environmental protection agency ( us epa ) priority pollutant list due to their mutagenic and carcinogenic properties . the most important sources of pahs have been identified as coke ovens in the production of aluminum , iron , and steel ; heating in power plants and residences ; cooking ; motor vehicle traffic ; environmental tobacco smoke ; and the incineration of waste material . cooking and food processing at high temperatures have been shown to generate various kinds of genotoxic substances or cooking toxicants including pahs . a number of pahs are known for their carcinogenic , mutagenic , and teratogenic properties like benzo(a)anthracene , benzo(b)fluoranthene , benzo(k)fluoranthene , benzo(g , h , i)perylene , benzo(a)pyrene , chrysene , dibenzo(a , h)anthracene , and indeno(1,2,3-cd)pyrene . pahs containing up to four fused benzene rings are known as light pahs and those containing more than four benzene rings are called heavy pahs . light pahs are more volatile , water soluble , and less lipophilic than the heavy pahs , so pahs migrate through the food chain into hydrophobic compartments and thus accumulate in lipid components due to their lipophilic nature [ 68 ] . seven of the pahs have been classified by the us epa as compounds of probable human carcinogens . these are benzo(a)anthracene , benzo(b)fluoranthene , benzo(k)fluoranthene , chrysene , benzo(a)pyrene , dibenzo(a , h)anthracene , and indeno(1,2,3-cd)pyrene . with the aim of minimizing harmful effects on human health , recently , the european union established a maximum level of 2 ng / g wet weight for benzo(a)pyrene ( the marker used for carcinogenic risk of pahs ) in muscle meat of fish . in 2008 , a scientific opinion adopted by the european food safety authority ( efsa , 2008 ) concluded that benzo(a)pyrene alone is not a suitable indicator for the occurrence and toxicity of pahs in food and that eight specified pahs ( pah8 ) , for which oral carcinogenicity data are available , and/or a subgroup of these , pah4 , are more suitable markers . it was further concluded that pah8 would not provide much added value compared to pah4 ( the sum of benzo(a)pyrene , chrysene , benz(a)anthracene , and benzo(b)fluoranthene ) . in september 2012 , benz(a)anthracene , benzo(b)fluoranthene , and chrysene were included in the assessment and recorded together with benzo(a)pyrene as a sum parameter ( group of pah4 ) , as per regulation ( eu ) number 835/2011 . developed analytical methods include soxhlet extraction , dispersed solid phase extraction , and accelerated solvent extraction coupled to sample cleanup using gel permeation chromatography which had been used to assess most of pahs in different matrices by changing the technique of cleanup from coextracted interferences that may cause false positive results , but most of these techniques are expensive , use chlorinated solvent for extraction , and are time and chemicals consuming . in 2013 a simple solid phase extraction ( spe ) method followed by comprehensive two - dimensional gas chromatography coupled to time - of - flight mass spectrometry has been developed for analysis of ( 15 + 1 ) carcinogenic polycyclic aromatic hydrocarbons ( pahs ) . this method includes three critically assessed sample preparation approaches : ( i ) gel permeation chromatography ( gpc ) , ( ii ) gpc followed by silica based spe , and ( iii ) spe employing pahs - dedicated molecularly imprinted polymers ( mips ) . also in 2013 , two of the most relevant analytical methods including different extraction procedures such as ultrasound - assisted solvent extraction ( usae ) and ultrasound - assisted emulsification microextraction ( usaeme ) for determination of 11 mutagenic and carcinogenic pahs were optimized by the selected extraction techniques . the recoveries ranging from 70% to 100% by usae and from 70% to 108% by usaeme with estimated quantification limits between 0.020 and 2.6 g / kg were achieved . a few researches on the development of quechers analytical method for determination of pahs levels in fish the streamline of quechers ( quick , easy , cheap , effective , rugged , and safe ) method for extraction of pesticides in tissues of high fat ( > 3.5% ) encourages scientists to apply modifications and develop this method in order to extract veterinary drugs and pahs from seafood such as shrimp and in fish by using quechers for extraction followed by dispersive spe analysis by gcms in sim mode for quantification . the aim of this study is to adapt and validate quechers method for extraction followed by solid phase extraction for sample purification and gas chromatography mass spectrometer gcms for determination of 16 pahs in fish at low loq level . the edible parts ( head , bones , and removable skin were removed ) of nonsmoked blank herring fish were obtained and completely homogenized in a food mixer as a blank sample and then stored in a freezer at 20c . acetone ( riedel - de hen , purity 99.8% ) , acetonitrile ( sigma - aldrich , purity > 99.9% ) , toluene ( merck ) , dichloromethane chromatography grade , and n - hexane ( purity > 99.0% ) were the solvents used . agilent quechers salts and buffers were prepackaged in anhydrous packages for en 15662 containing 4 g magnesium sulfate ( mgso4 ) , 1 g sodium chloride ( nacl ) , 1 g sodium citrate , and 0.5 g disodium citrate sesquihydrate . silica gel ( 60120 mesh , fluka ) was activated at 150c for 12 hours prior to use . a 1000 g / ml stock solution of 14 pahs includes naphthalene , fluorene , fluoranthene , benz(a)anthracene , chrysene , pyrene , benzo(b)fluoranthene , benzo(k)fluoranthene , benzo(a)pyrene , acenaphthene , phenanthrene , anthracene , acenaphthylene , and pyrene - d10 ( surrogate standard ) and reference standards obtained from sigma - aldrich with purity > 95% were prepared , while benzo(g , h , i)perylene and dibenz(a , h)anthracene were obtained as readymade of 100 g / ml in methylene chloride and indeno[1,2,3-cd]pyrene 200 g / ml in methanol . a 1 g / ml working solution of all 16 pahs was prepared in toluene . calibration mixtures with concentration 2 , 10 , 50 , 100 , and 500 ng / ml were prepared from serial dilution of the working solution in toluene where pyrene - d10 maintained at level 50 ng / ml in all calibration levels and all stored in refrigerator at 4c . pfte or polyethylene 50 ml tubes with screw cap and 15 ml tubes contain 1 g magnesium sulfate were obtained for sample extraction . centrifuge up to 4000 rpm ( heraeus labofuge 400 ) , vortex , automatic pipettes ( hirschmann laborgerate ) suitable for handling volumes of 10 l to 100 l and 100 l to 1000 l , 10 ml solvent - dispenser ( hirschmann laborgerate ) for acetonitrile . the glassware were washed with detergent and water then rinsed with acetone and dried at 90c before use . the validation procedure needs to be considered , the context of fitness for purpose and cost benefit criteria . about 10 g of fish sample was weighted in 50 ml teflon centrifuge tube , 50 l of 10 g / ml pyrene - d10 was added which acts as surrogate standard of 50 g / kg , and each set of 6 replicates was spiked with 20 , 100 , and 500 l of 1 g / ml spiking mixture to get 2 , 10 , and 50 g / kg , respectively . 10 ml of acetonitrile was used for extraction , shaken for 2 minutes , mixed with agilent quechers , shaken for 1 minute , and centrifuged at 4000 rpm for 5 minutes . aliquots of the resulting supernatant were transferred to teflon tube containing mgso4 , vortexed for 30 seconds , and centrifuged at 4000 rpm for 2 minutes ; 4 ml of the acetonitrile layer was transferred into 50 ml flask and then evaporated near to dryness . all fish extracts were subjected to packed solid phase cleanup cartridge which was prepared in - house as follows . plug a glass wool on 10 ml length syringe ; 1 g 20% deactivated silica gel and 0.2 mgso4 were weighted and conditioned with 5 ml of n - hexane / dichloromethane ( 3 : 2 ) , the sample extract loaded to the cartridge using 10 ml of elute ( n - hexane / dichloromethane ) . collect fractions in a 50 ml flask , evaporate on rotary evaporator at 40cnear to dryness and dissolve in 2 ml toluene and then apply to gcms for analysis . agilent 6890n series gas chromatography instrument equipped with 5975 series mass selective detector and agilent gc column of model j&w hp-5ms ultra inert with the specifications ( 30 m length , 0.25 mm internal diameter , 0.25 m film thickness ) were used for both qualitative and quantitative determination of pahs . helium gas was used as the carrier gas ; the column was maintained at a constant flow rate of 1.3 ml / min . the column temperature was initially held at 90c for 2 min , ramping to 180c at a rate of 15c / min , held at 180c for 15 min , ramping to 250c at a rate of 10c / min , held for 2 min , ramping to 290c at a rate of 10c / min , and held for 10 min . the mass spectrometer was operated in the ionization mode and spectra were acquired using a mass range of 45450 m / z . sim acquisition was carried out by comparison of the base peak of each targeted pah as shown in table 1 . quality control and assurance of each patch were passed by monitoring the performance of the gcms and the mass selective detector daily by tuning the mass detector and monitoring the sensitivity and linearity of the calibration curve , respectively , and also analyzing blank sample to confirm that there in contamination effect on the results during analysis . figure 1 represents overlay between blank and spike fish at level 50 g / kg samples to show the separation of 16 pahs by gcms in 35 minutes using agilent j&w hp-5ms ultra inert gc column ( 30 m length , 0.25 mm internal diameter , and 0.25 m film thicknesses ) . this representative chromatogram of pahs in fish matrix indicates good cleanup separation techniques with minimum interference of coextract that may influence the accuracy of the result . the linearity was obtained by plotting the peak area of each analyte versus its concentration . the linearity of all pahs indicates that both dibenz(a , h)anthracene and indeno(1,2,3-cd)pyrene compounds had r values of 0.996 ; all others were 0.998 or higher within measurement range of 250 g / l indicating excellent linearity . it is the minimum concentration of analyte in the test sample that can be measured with a stated probability that the analyte is present at a concentration above that in the blank sample . limits of detection expressed as three multiplied by sd of the recovery replicates at the lowest expected concentrations ranging between 0.09 and 1.94 g / kg are shown in table 2 . it is the lowest concentration of analyte that can be determined with an acceptable level of uncertainty according to eurachem guideline and it is usually the lowest point on the calibration curve which is 2 g / kg . the analytes were considered to be quantitative when their abundance confirmation ion signal to noise is s / n 3 with an accurate quantitation of 20% of their true value in the calibration standard . sample residues that met all criteria but had s / n < 3 were reported as less than the limit of quantification ( < loq ) while those which had not fit any criteria were reported as not detected ( n.d . ) . the recovery of ( n = 6 ) replicates at each level was calculated and summarized in table 3 which shows very good recovery and excellent rsd . from table 3 , the recovery of each set of 6 replicates was in the range of 56115% where the lower spiking level was selected in order to include the lower concentration of pahs fish muscle fixed at 2 g / kg . the extraction efficiency was consistent over the entire range with indeno(1,2,3-cd)pyrene and benzo(g , h , i)perylene being the most affected compounds where their recovery at lower level was 65 and 69% , respectively , and at the second level was 61 and 56% . no significant dispersion of results was observed for the other remaining pahs and recovery did not differ substantially at the lowest and the highest concentrations . according to commission regulation ( ec ) number 1881/2006 and ( ec ) number 333/2007 [ 22 , 23 ] , the maximum level for the determination of pahs in fish was 2 g / kg wet weight and the recovery range of the methods used should be 50120% , indicating that the validated method complies with these criteria . where rsdpooled can be calculated as(1)rsdpooled = rsd12n11+rsd22n21+n11+n21+.rsd is the relative standard deviation , n is the number of samples , and the equation used to calculate the recovery is ( 2)recovery%=cfce100,where c f is the found concentration and c e is the expected concentration . figures 2 , 3 , and 4 represent mean recovery and rsd% ranges ; most of the pahs recovery was between 70 and 120% with most of rsd less than 10% . the reported results provide evidence that the adapted quechers method achieved for most of the pahs gives good recoveries , repeatability , and reproducibility . using these equations the following relative standard uncertainty u rec = 3.6% and(3)u(rec)=sn . combined uncertainty u c is(4)uc = up2+urec2+uref=6.2% . u p is the uncertainty due to precision experiments . the uncertainty due to reference standard preparation u ref = 0.7 . u p which is the relative standard uncertainty due to precision experiments expressed as relative standard deviation was found to be less than 5% ( the highest pooled rsd% for pyrene ) . expanded uncertainty is obtained by multiplying the combined uncertainty by a coverage factor k. for confidence level of 95% k is 2 . the expanded uncertainty ( at 95% confidence level ) the higher sample weight used in the proposed method ( 10 g ) with accepted solid phase extraction cleanup techniques compared with e1 and e2 quechers acetonitrile based extraction method ( 1 g ) facilitates the ability of lowering the limits of quantification for pahs where the recoveries obtained at 500 g / kg for traditional acetonitrile based quechers extraction using extraction scheme e1 ( 1% acetic acid in acetonitrile and aoac salts ) yield average recoveries less than 67% , with individual pahs recoveries typically ranging from 35 to 87% , also for extraction scheme e2 ( acetonitrile and en salts ) performed equally poorly , with average pahs recoveries being less than 68% and individual pahs recoveries ranging from 24 to 88% , while for the proposed method the individual pahs recoveries range from 65 to 107% at the loq limits ( 2 g / kg ) with method uncertainty equal to 12 ( at 95% confidence level ) indicating that the method is quite fit for purpose with acceptable loq , precision , and accuracy according to commission regulation ( ec ) number 1881/2006 and ( ec ) number 333/2007 . the results found were very promising ; it may be concluded that modified quechers method of extraction followed by cleanup silica gel packed solid phase extraction combined with gcms for quantitation is an efficient method for determination of low concentration of selected group of pahs in homogenized fish samples . this method is suitable for laboratories engaged daily in routine analysis of a large number of samples , and the loq of the method is sufficiently attained low in order to be used in the national monitoring program of egypt for determination of pahs in fish as well as in imported and exported fish following codex regulations .

a gas chromatography equipped with mass spectrometer ( gcms ) method was developed and validated for determination of 16 polycyclic aromatic hydrocarbons ( pahs ) in fish using modified quick , easy , cheap , effective , rugged , and safe ( quechers ) method for extraction and solid phase extraction for sample cleanup to remove most of the coextract combined with gcms for determination of low concentration of selected group of pahs in homogenized fish samples . pahs were separated on a gcms with hp-5ms ultra inert gc column ( 30 m , 0.25 mm , and 0.25 m ) . mean recovery ranged from 56 to 115% . the extraction efficiency was consistent over the entire range where indeno(1,2,3-cd)pyrene and benzo(g , h , i)perylene showed recovery ( 65 , 69% ) , respectively , at 2 g / kg . no significant dispersion of results was observed for the other remaining pahs and recovery did not differ substantially , and at the lowest and the highest concentrations mean recovery and rsd% showed that most of pahs were between 70% and 120% with rsd less than 10% . the measurement uncertainty is expressed as expanded uncertainty and in terms of relative standard deviation ( at 95% confidence level ) is 12% . this method is suitable for laboratories engaged daily in routine analysis of a large number of samples .

female genital tuberculosis ( fgtb ) is common in developing countries and associated with significant morbidity in the form of menstrual dysfunction , infertility , tubal block , peritubal adhesions , intrauterine adhesions , and perihepatic adhesions . fallopian tubes are involved in about 90% of the cases with findings such as congested tubes , tubercles , or caseous nodules on them , peritubal adhesions , and tubal blockage at various levels such as cornual block , mid - tubal block , multiple tubal blocks , or fimbrial block , hydrosalpinx , pyosalpinx , and tubo - ovarian masses . a 25-year - old woman with family history of pulmonary tb was presented to the gynecology outpatient department with primary infertility and oligomenorrhea of 3 years . on examination , vaginal examination demonstrated anteverted uterus with fullness and induration in both fornices . on investigations , hysterosalpingogram which was already performed by the referring doctor for infertility before diagnosis of fgtb was made showed bilateral tubal block . endometrial aspirate performed in premenstrual phase showed positive polymerase chain reaction based on the amplification of the 240 bp region of the mpt 64 gene using primers mpt 1 ( 59-tccgctgccagtcgtcttcc-39 ; nt 460479 ) and mpt 2 ( 59-gtcctcgcgag tctaggcca-39 ; nt 700681 ) with equipment using amplitron thermocycler ( barnstead / thermolyne ) , it also tested positive for culture for mycobacterium tuberculosis using mycobacterium growth indicator tube-960 . , there were findings of tb in the pelvis in the form of multiple tubercles on tubes and uterus , bilateral hydrosalpinx with beading of tubes , and few caseous nodules . when methylene blue dye was injected in the uterus , the fallopian tubes became distended and blue colored with beading looking with alternate constrictions and dilatation looking - like blue pythons diagnosis of genital tb was made , and she was started on anti - tb therapy . her postoperative period and follow - up were uneventful . left fallopian tube with distension , multiple ballooning , and blue coloration with fimbrial block showing blue python sign although gold standard in diagnosis of fgtb is demonstration of mycobacterium tuberculosis either on microscopy or culture of endometrial biopsy or presence of epithelioid granuloma on histopathology , they are positive in only few cases leading on to missing of diagnosis in many cases . polymerase chain reaction on endometrial biopsy is a sensitive and rapid method for detecting mycobacterium dna ( mpt 64 gene ) but can be false positive and may not be able to differentiate between infection and disease . gene xpert has recently been introduced in both pulmonary and extra - pulmonary tb as a sensitive and specific method , but its data in fgtb are very sparse . imaging modalities such as ultrasound , computed tomography scan , magnetic resonance imaging , and positron emission tomography scan have main role in tubo - ovarian masses . hysterosalpingography is generally avoided in a suspected case of fgtb due to risk of flare up of the disease but may demonstrate tubal block and other tubal patterns , especially in advanced case . hysteroscopy is useful in endometrial disease and may show pale looking endometrium with endometrial cavity being partially or completely obliterated by adhesions of varying grade ( asherman 's syndrome ) which may involve ostia . however , laparoscopy is the most reliable tool to diagnose fgtb , especially for tubal , ovarian , and peritoneal disease . there can be tubercles on peritoneum or tubes , tubo - ovarian masses , caseous nodules , encysted ascites , various grades of pelvic adhesions , hydrosalpinx , pyosalpinx , beaded tubes , tobacco pouch appearance , and inability to see tubes due to adhesions . other authors have also found laparoscopy very useful in diagnosis and management of genital and peritoneal tb with the advantage of avoidance of laparoscopy which is more traumatic and hazardous especially in a case of abdominopelvic tb . in a case of fgtb , if there is no cornual block , there is a partial or complete fimbrial block with multiple blocks at various parts of tube as is typical of fgtb , dye enters the tube but remains in various parts of tubes with alternate dilatation and constriction making the tube look like a blue python as happened in the present case . the new sign case is easily diagnosed by gynecologists during routine laparotomy performed for infertility patients with suspected fgtb and can aid in its diagnosis

female genital tuberculosis ( fgtb ) is an important cause of infertility in developing countries . various type of tb salpingitis can be endosalpingitis , exosalpingitis , interstitial tb salpingitis , and salpingitis isthmica nodosa . the fallopian tubes are thickened enlarged and tortuous . unilateral or bilateral hydrosalpinx or pyosalpinx may be formed . a new sign python sign is presented in which fallopian tube looks like a blue python on dye testing in fgtb .

the success of endodontic treatment is based on the effective decontamination of the root canal system , whereas microbial agents are essential for the development and maintenance of pathological processes that damage the pulp and periapical region . despite technological and scientific advances in endodontics , the persistence of endodontic infections depends on the ability of microorganisms to adapt to environmental changes . many different mechanisms are used by bacteria , such as : biofilm formation , physiological modifications , exchange of genetic material , and creation of cell subpopulations . one challenge that has motivated many researchers in recent years is to develop new technologies to eliminate these persistent microorganisms . among the new technologies , photodynamic therapy ( pdt ) , also known as photoactivated disinfection or photochemotherapy , has demonstrated to be a great ally to conventional endodontic treatment in eliminating microorganisms that remain viable in root canal system . this treatment is based on the use of a nontoxic dye sensitive to light , followed by irradiation with a visible light source with a suitable wavelength in the presence of oxygen . given the above , the purpose of this paper is to review the dental literature that describes the main factors involving antimicrobial effects of pdt combined with conventional endodontic treatment in the total disinfection of the root canal system . the databases pubmed , isi web of knowledge and medline were used with specific indexing of the following terms : pdt , photoactivated disinfection , photochemotherapy , endodontics and root canal , and a subsequent search with specific limits and criteria were performed . the first reports that the association between dye and light could generate antimicrobial effect date back over 100 years . in 1900 oscar raab and hermann von tappeiner realized that red acridine could absorb ambient light and cause toxic effect on cultures of protozoa . years later , von tappeiner and dermatologist jesionek realized that it was possible to treat skin cancer lesions using a combination of topical eosin and white light . in 1904 , von tappeiner and jodlbauer demonstrated that the presence of oxygen was required for the photosensitizing reaction to occur . however , in the decades of 80 and 90 , due to the rapid increase in the appearance of antibiotic - resistant bacteria , a number of researchers regained interest in the first study of raab and von tappeiner , studying elimination of microorganisms by pdt . currently , it is known that various microorganisms can be eliminated by activating a nontoxic photosensitizing using a resonant light source . the mechanism of action of pdt occurs when dye , acting as a photosensitizing agent , absorbs photons from the light source , and their electrons enter an excited state , also known as triplet state . in the presence of a substrate , such as oxygen , the photosensitizer , when return to its basic state , transfers the energy to substrate , forming free radicals of high cytotoxicity , such as superoxides and singlet oxygen . these highly reactive species can cause serious damage to microorganisms through irreversible oxidation of cellular components , causing damage to the cell membrane , to mitochondria , to nucleus , and to other microbial cell components . there are two mechanisms that explain how photosensitizer in the triplet state can react with biomolecules . the type i reaction involves the transfer of electrons from excited photosensitizer molecules of the substrate , leading to production of free radicals that react rapidly with oxygen , resulting in the production of superoxide , hydroxyl radicals and hydrogen peroxide . in the type ii reaction , the excited photosensitizer transfers energy to oxygen , leading to the production of electronically animated molecules known as singlet oxygen . in pdt the reaction of type ii ; however , is accepted as the main means of microbial cells destruction . due to its selective antimicrobial action , pdt appears as a promising therapy to eradicate pathogenic bacteria , since , in low concentrations , it kills microorganisms without causing injury to human normal cells . several studies have shown that the dose required to cause bacterial death is lower the dose needed to cause damage to keratinocytes and fibroblasts . xu et al . suggested that pdt can be used as an adjunct to endodontic disinfection without damaging the cells of periapical region in their evaluation of the in vitro effects of methylene blue at 50 g / ml and irradiation with diode light amplification by stimulated emission of radiation ( laser ) at 665 nm for 5 min on human gingival fibroblasts and osteoblasts . one of the advantages of photosensitization compared to traditional antimicrobials is that as the interaction of highly reactive oxygen with organic molecules is not specific , any macromolecule within microbial cell may become a potential target , thus hindering the development of mechanisms of microbial resistance . furthermore , the procedure can be repeated several times , as it there are no reports of cumulative effects . photodynamic therapy has other attributes that make it an excellent tool in intracanal bacterial reduction , such as : it is safe for human tissues , it has the ability to eradicate pathogens in biofilms , it is easy to apply , painless , and cheap when compared to high - intensity laser . bonsor et al . evaluated the antimicrobial efficacy of pdt as an adjunct to disinfect root canals of patients with symptoms of irreversible pulpitis or periradicular periodontitis . the authors concluded that the use of toluidine blue o dye at 12.7 mg / l irradiated for 120 s using a diode laser at 100 mw connected to a delivery fiber was effective to remove completely the remaining microorganisms of the chemomechanical preparation . garcez et al . evaluated the antimicrobial action of pdt combined with endodontic retreatment and intracanal medication in anterior teeth with periapical lesions in patients who had undergone antibiotic therapy . the total elimination of intracanal microbial load was observed when pdt was used with a conjugate between polyethylenimine and chlorin ( e6 ) , and diode laser irradiation at a wavelength of 660 nm and 40 mw of power associated with a fiber optics . ok et al . evaluated the in vitro effect of pdt on the bond strength of ah plus sealer to dentin in root canals obturated with lateral condensation technique . the authors concluded that the final disinfection using pdt ( 0.01% toluidine blue o and light - emitting diode ( led ) irradiation with 625 - 635 nm wavelength ) did not affect negatively the bond strength of the cement to root dentin . in order for pdt be successful , it is essential that the selected photosensitizer possesses particular characteristics such as it must be biologically stable , minimally toxic to healthy tissues , photochemically efficient , and resonant with the wavelength emitted by the light source . , the applicability of each dye is conditioned to its characteristics , such as maximum absorption of wavelength and intensity of light absorption . the photosensitizing agents used in pdt belong to different groups of compounds and most of them are activated by light between 630 nm and 700 nm . in the literature , photosensitizers derived from group of phenothiazines , such as toluidine blue and methylene blue dyes have been the most used in research involving antimicrobial action in root canals . according to fimple et al . increasing the concentration of methylene blue and the light energy fluence ( j / cm ) , causes an increase in the antibacterial capacity of pdt . used freshly extracted teeth with pulp necrosis to compare the intracanal microbial reduction obtained by conventional chemomechanical debridement using sodium hypochlorite 6% only or added to pdt . methylene blue was used at a concentration of 50 g / ml and irradiation with diode laser with a power of 100 mw / cm and wavelength of 665 nm connected to an optical fiber . the results indicated that chemomechanical debridement followed by pdt was able to eliminate microorganisms totally in 86.5% of the canals , compared to 49% when pdt was not used . verified that the combination of sodium hypochlorite at 2.5% and pdt using toluidine blue at a concentration of 15 g / ml and diode laser with 200 mw / cm of power and a wavelength of 625 nm was able to eliminate totally enterococcus faecalis in single - rooted canals of freshly extracted teeth . komine and tsujimoto evaluated the relation between the amount of singlet oxygen generated by different concentrations of activated methylene blue and the bactericidal effect of pdt in suspensions of e. faecalis . they concluded that methylene blue at a concentration of 0.01% , when activated by diode laser with a wavelength of 660 nm and 200 mw of power , was able to generate the greatest amount of singlet oxygen and consequently result in a large reduction in the number of colony - forming units of the micro - organism . the use of encapsulated nanoparticles with photoactive drugs has also been tested to improve the ability of antimicrobial pdt . pagonis et al . verified that irradiation of poly ( lactic - co - glycolic acid ) nanopaticles loaded with methylene blue ( 50 g / ml ) showed elimination of approximately 1log10 colony - forming units of e. faecalis in experimentally infected root canals . dentin staining caused by photosensitizing agents has been indicated as one of the main inconveniences of the use of pdt in root canals . the effectiveness of some chemical compounds have been evaluated in an attempt to overcome this disadvantage . concluded that the use of 2.5% of sodium hypochlorite , associated or not to endo - ptc cream , was effective in preventing tooth stains caused by the use of methylene blue during pdt . in pdt , light must be of a specific wavelength to ensure maximum effectiveness of the treatment . low - power lasers , such as helium - neon ( he - ne ) and diodes are the most used sources of radiation in pdt for microbial reduction of various cultures of bacteria and fungi in the oral cavity . helium - neon lasers show positive results in the microbial reduction of various cultures of microorganisms using toluidine blue and methylene blue dyes . currently , diode lasers have been the most used because are more compact and easier to handle , less costly , more versatile and well absorbed by biological tissues . this latter is an advantage , because in pdt the effects obtained are not due to increase in temperature , but by photochemical reactions between photosensitizer , light source , and substrate . evaluated the antimicrobial action of pdt in deciduous teeth with pulp necrosis after chemomechanical instrumentation of root canals . pdt was performed using toluidine blue in a concentration of 0.005% mg / l and diode laser irradiation at 100 mw of power and a wavelength of 660 nm . the results demonstrated that chemo - mechanical instrumentation has led to a reduction of 82.59% of viable cells , and after pdt , the significant microbial reduction observed was 98.37% . recently , sources of nonlaser light , such as leds , have been successfully applied as alternative energy sources in pdt because of their low cost , flexibility , and light weight . rios et al . observed that the association between sodium hypochlorite at 6% and pdt ( using toluidine blue o and led lamp at 628 nm ) resulted in low survival rate of e. faecalis ( 0.1% ) in root canals of extracted teeth . when sodium hypochlorite or pdt was employed separately , light amplification by stimulated emission of radiation light used in pdt can be directed through an optical fiber . when employed in the elimination of microorganisms from root canal , this is due to the capacity of optical fiber to distribute light evenly 360 around the root canal system with minimal losses , and compatible with the dimensions of the root canal . with the aid of the fiber , the effect of laser can be extended to areas of difficult access , and can easily reach the apical third , even in curvatures of molars , as well as to external biofilm of the root apex . is important that during use of optical fiber , helical movements be performed from apical third toward cervical , allowing the irradiation beam to reach the full extent of the canal during activation of the photosensitizer dye . after comparing the antimicrobial effects of pdt against e. faecalis in root canals , garcez et al . , suggested that the use of an optical fiber / diffusor , when used for endodontic treatment , had better results than when laser light was used directed to access of the pulp cavity . another important factor for the success of pdt is the elapsed time between application of the photosensitizer and its activation by light . at the moment of activation , photosensitizer must be next to its target so that the formation of toxic species occurs at the desired local . in antimicrobial pdt applications , it is important that at the moment of activation by the light source , the dye be attached to microorganism or has overtaken the barrier of its cell membrane . it is imperative that in this period the photosensitizer does not undergo degradation before it can be activated by the light source . evaluated in vitro the efficacy of pdt to eliminate suspensions of candida species using methylene blue ( 300 g / ml ) and irradiation with diode laser ( 660 nm , 40 mw ) employing three energy dosages ( 60 j / cm , 120 j / cm , 180 j / cm ) . , and the dose of 180 j / cm was the most effective , reducing about 78% of the number of colony - forming units . the microbial reduction by photodynamic effect faces different challenges when used against gram - positive bacteria , gram - negative bacteria and fungi . in general , the literature shows that gram - positive bacteria are more susceptible to pdt action compared to gram - negative . this is due to differences in the physiology of these microorganisms , because gram - positive bacteria have a relatively porous outer membrane , formed by a thick layer of peptidoglycan and lipoteichoic acid . this characteristic allows a greater diffusion of the photosensitizer into the bacterium , so that various types of dyes and lower doses of irradiation can remove it . on the other hand , the outer membrane of gram - negative bacteria is thinner and more complex , formed by a heterogeneous composition that includes proteins with a porin function , lipopolysaccharides and lipoproteins , which act as an effective barrier limiting the penetration of some substances . the photosensitization of bacteria is related to the photosensitizer charge . because it has characteristics such as a positive charge , low molecular weight and hydrophilicity , methylene blue is capable of interacting with anionic lipopolysaccharide macromolecules and penetrate the outer membrane of gram - negative bacteria . as regards the fungi , these have a cell wall constituted by a thick layer of beta glucan and chitin , which promotes an intermediate permeability barrier between gram - positive and gram - negative bacteria . investigated the effects of pdt in root canals of extracted teeth experimentally infected with endodontic pathogens . methylene blue was used at a concentration of 25 g / ml and exposure to diode laser with a wavelength of 665 nm and energy fluence of 30 j / cm coupled to an optical fiber . following this protocol , all bacterial species were completely eliminated , except for e. faecalis ( 53% of death ) . however , by increasing the energy fluence to 222 j / cm , they eliminated 97% of e. faecalis is also possible to observe differences in susceptibility of pdt when microorganisms are organized in the form of biofilm and when they are arranged as isolated cells . the challenge is greater when microorganisms are organized in biofilms , because they are then protected within a matrix , showing , thus , less susceptibility to antimicrobial therapy . tested the bactericidal effect of pdt on strains of streptococcus anginosus , e. faecalis and mixed cultures containing e. faecalis and fusobacterium nucleatum inoculated in root canals of extracted teeth . the authors verified that when microorganisms were organized in individual cells or monolayers , pdt easily eliminated them . whereas when microorganisms were arranged in biofilm , the bacterial eradication was substantially reduced in the deeper layers . upadya and kishen compared the efficacy of pdt in planktonic suspensions and mono - species biofilms containing pseudomonas aeruginosa and e. faecalis . the authors concluded that modifications in the formulation of the photosensitizer increased the antibacterial efficacy of pdt in biofilms . the reduced susceptibility of biofilms to pdt is attributed to the low penetration of the photosensitizer . accordingly , various methods have been studied aiming to increase the potential penetration of the photosensitizer in biofilms . according to george and kishen the inclusion of an oxidant and an oxygen carrier in the formulation of methylene blue enables an increase in the potential of photo - oxidation and generation of singlet oxygen of pdt , facilitating the disruption of the biofilm matrix of e. faecalis in root canals in vitro . kishen et al . concluded that the use of a specific microbial efflux pump inhibitor added to methylene blue was able to increase the efficacy of pdt in eliminating biofilms formed by e. faecalis in polystyrene plates . compared the in vitro efficacy of conventional pdt ( methylene blue at 15 mol / l and irradiation with diode laser with 40 mw and 660 nm ) and modified pdt ( methylene blue at 100 mol / l , hydrogen peroxide at 0.5% , ethylenediaminetetraacetic acid at 0.05% , chlorhexidine at 0.05% and laser irradiation ) in the elimination of e. faecalis and mixed bacterial plaque in suspensions and biofilms . the authors concluded that modified pdt was able to remove up to twenty times more bacterial biofilms than conventional pdt . thus , research protocols on laser light intensity , photosensitizers concentrations and activation methods are still being developed , showing different results and susceptibilities of microorganisms to treatment . it could be concluded that pdt is presented as an important auxiliary tool to antimicrobial substances commonly used in endodontic treatment . however , this therapy presents different challenges regarding its susceptibility to different microorganisms , according to their physiology . thus , for pdt to be employed with maximum effectiveness is important that further studies be performed in order to determine appropriate parameters for energy dosage used , photosensitizer concentration , time of preirradiation , and exposure . the mechanism of action of pdt occurs when dye , acting as a photosensitizing agent , absorbs photons from the light source , and their electrons enter an excited state , also known as triplet state . in the presence of a substrate , such as oxygen , the photosensitizer , when return to its basic state , transfers the energy to substrate , forming free radicals of high cytotoxicity , such as superoxides and singlet oxygen . these highly reactive species can cause serious damage to microorganisms through irreversible oxidation of cellular components , causing damage to the cell membrane , to mitochondria , to nucleus , and to other microbial cell components . there are two mechanisms that explain how photosensitizer in the triplet state can react with biomolecules . the type i reaction involves the transfer of electrons from excited photosensitizer molecules of the substrate , leading to production of free radicals that react rapidly with oxygen , resulting in the production of superoxide , hydroxyl radicals and hydrogen peroxide . in the type ii reaction , the excited photosensitizer transfers energy to oxygen , leading to the production of electronically animated molecules known as singlet oxygen . in pdt the reaction of type ii ; however , is accepted as the main means of microbial cells destruction . due to its selective antimicrobial action , pdt appears as a promising therapy to eradicate pathogenic bacteria , since , in low concentrations , it kills microorganisms without causing injury to human normal cells . several studies have shown that the dose required to cause bacterial death is lower the dose needed to cause damage to keratinocytes and fibroblasts . xu et al . suggested that pdt can be used as an adjunct to endodontic disinfection without damaging the cells of periapical region in their evaluation of the in vitro effects of methylene blue at 50 g / ml and irradiation with diode light amplification by stimulated emission of radiation ( laser ) at 665 nm for 5 min on human gingival fibroblasts and osteoblasts . one of the advantages of photosensitization compared to traditional antimicrobials is that as the interaction of highly reactive oxygen with organic molecules is not specific , any macromolecule within microbial cell may become a potential target , thus hindering the development of mechanisms of microbial resistance . furthermore , the procedure can be repeated several times , as it there are no reports of cumulative effects . photodynamic therapy has other attributes that make it an excellent tool in intracanal bacterial reduction , such as : it is safe for human tissues , it has the ability to eradicate pathogens in biofilms , it is easy to apply , painless , and cheap when compared to high - intensity laser . bonsor et al . evaluated the antimicrobial efficacy of pdt as an adjunct to disinfect root canals of patients with symptoms of irreversible pulpitis or periradicular periodontitis . the authors concluded that the use of toluidine blue o dye at 12.7 mg / l irradiated for 120 s using a diode laser at 100 mw connected to a delivery fiber was effective to remove completely the remaining microorganisms of the chemomechanical preparation . evaluated the antimicrobial action of pdt combined with endodontic retreatment and intracanal medication in anterior teeth with periapical lesions in patients who had undergone antibiotic therapy . the total elimination of intracanal microbial load was observed when pdt was used with a conjugate between polyethylenimine and chlorin ( e6 ) , and diode laser irradiation at a wavelength of 660 nm and 40 mw of power associated with a fiber optics . ok et al . evaluated the in vitro effect of pdt on the bond strength of ah plus sealer to dentin in root canals obturated with lateral condensation technique . the authors concluded that the final disinfection using pdt ( 0.01% toluidine blue o and light - emitting diode ( led ) irradiation with 625 - 635 nm wavelength ) did not affect negatively the bond strength of the cement to root dentin . in order for pdt be successful , it is essential that the selected photosensitizer possesses particular characteristics such as it must be biologically stable , minimally toxic to healthy tissues , photochemically efficient , and resonant with the wavelength emitted by the light source . various types of photosensitizers may be associated to the laser . according to wainwright , the applicability of each dye is conditioned to its characteristics , such as maximum absorption of wavelength and intensity of light absorption . the photosensitizing agents used in pdt belong to different groups of compounds and most of them are activated by light between 630 nm and 700 nm . in the literature , photosensitizers derived from group of phenothiazines , such as toluidine blue and methylene blue dyes have been the most used in research involving antimicrobial action in root canals . according to fimple et al . increasing the concentration of methylene blue and the light energy fluence ( j / cm ) , causes an increase in the antibacterial capacity of pdt . used freshly extracted teeth with pulp necrosis to compare the intracanal microbial reduction obtained by conventional chemomechanical debridement using sodium hypochlorite 6% only or added to pdt . methylene blue was used at a concentration of 50 g / ml and irradiation with diode laser with a power of 100 mw / cm and wavelength of 665 nm connected to an optical fiber . the results indicated that chemomechanical debridement followed by pdt was able to eliminate microorganisms totally in 86.5% of the canals , compared to 49% when pdt was not used . verified that the combination of sodium hypochlorite at 2.5% and pdt using toluidine blue at a concentration of 15 g / ml and diode laser with 200 mw / cm of power and a wavelength of 625 nm was able to eliminate totally enterococcus faecalis in single - rooted canals of freshly extracted teeth . komine and tsujimoto evaluated the relation between the amount of singlet oxygen generated by different concentrations of activated methylene blue and the bactericidal effect of pdt in suspensions of e. faecalis . they concluded that methylene blue at a concentration of 0.01% , when activated by diode laser with a wavelength of 660 nm and 200 mw of power , was able to generate the greatest amount of singlet oxygen and consequently result in a large reduction in the number of colony - forming units of the micro - organism . the use of encapsulated nanoparticles with photoactive drugs has also been tested to improve the ability of antimicrobial pdt . pagonis et al . verified that irradiation of poly ( lactic - co - glycolic acid ) nanopaticles loaded with methylene blue ( 50 g / ml ) showed elimination of approximately 1log10 colony - forming units of e. faecalis in experimentally infected root canals . dentin staining caused by photosensitizing agents has been indicated as one of the main inconveniences of the use of pdt in root canals . the effectiveness of some chemical compounds have been evaluated in an attempt to overcome this disadvantage . concluded that the use of 2.5% of sodium hypochlorite , associated or not to endo - ptc cream , was effective in preventing tooth stains caused by the use of methylene blue during pdt . in pdt , light must be of a specific wavelength to ensure maximum effectiveness of the treatment . low - power lasers , such as helium - neon ( he - ne ) and diodes are the most used sources of radiation in pdt for microbial reduction of various cultures of bacteria and fungi in the oral cavity . helium - neon lasers show positive results in the microbial reduction of various cultures of microorganisms using toluidine blue and methylene blue dyes . currently , diode lasers have been the most used because are more compact and easier to handle , less costly , more versatile and well absorbed by biological tissues . this latter is an advantage , because in pdt the effects obtained are not due to increase in temperature , but by photochemical reactions between photosensitizer , light source , and substrate . evaluated the antimicrobial action of pdt in deciduous teeth with pulp necrosis after chemomechanical instrumentation of root canals . mg / l and diode laser irradiation at 100 mw of power and a wavelength of 660 nm . the results demonstrated that chemo - mechanical instrumentation has led to a reduction of 82.59% of viable cells , and after pdt , the significant microbial reduction observed was 98.37% . recently , sources of nonlaser light , such as leds , have been successfully applied as alternative energy sources in pdt because of their low cost , flexibility , and light weight . rios et al . observed that the association between sodium hypochlorite at 6% and pdt ( using toluidine blue o and led lamp at 628 nm ) resulted in low survival rate of e. faecalis ( 0.1% ) in root canals of extracted teeth . when sodium hypochlorite or pdt was employed separately , light amplification by stimulated emission of radiation light used in pdt can be directed through an optical fiber . when employed in the elimination of microorganisms from root canal , this is due to the capacity of optical fiber to distribute light evenly 360 around the root canal system with minimal losses , and compatible with the dimensions of the root canal . with the aid of the fiber , the effect of laser can be extended to areas of difficult access , and can easily reach the apical third , even in curvatures of molars , as well as to external biofilm of the root apex . is important that during use of optical fiber , helical movements be performed from apical third toward cervical , allowing the irradiation beam to reach the full extent of the canal during activation of the photosensitizer dye . after comparing the antimicrobial effects of pdt against e. faecalis in root canals , garcez et al . , suggested that the use of an optical fiber / diffusor , when used for endodontic treatment , had better results than when laser light was used directed to access of the pulp cavity . another important factor for the success of pdt is the elapsed time between application of the photosensitizer and its activation by light . at the moment of activation , photosensitizer must be next to its target so that the formation of toxic species occurs at the desired local . in antimicrobial pdt applications , it is important that at the moment of activation by the light source , the dye be attached to microorganism or has overtaken the barrier of its cell membrane . it is imperative that in this period the photosensitizer does not undergo degradation before it can be activated by the light source . evaluated in vitro the efficacy of pdt to eliminate suspensions of candida species using methylene blue ( 300 g / ml ) and irradiation with diode laser ( 660 nm , 40 mw ) employing three energy dosages ( 60 j / cm , 120 j / cm , 180 j / cm ) . the dose of 180 j / cm was the most effective , reducing about 78% of the number of colony - forming units . the microbial reduction by photodynamic effect faces different challenges when used against gram - positive bacteria , gram - negative bacteria and fungi . in general , the literature shows that gram - positive bacteria are more susceptible to pdt action compared to gram - negative . this is due to differences in the physiology of these microorganisms , because gram - positive bacteria have a relatively porous outer membrane , formed by a thick layer of peptidoglycan and lipoteichoic acid . this characteristic allows a greater diffusion of the photosensitizer into the bacterium , so that various types of dyes and lower doses of irradiation can remove it . on the other hand , the outer membrane of gram - negative bacteria is thinner and more complex , formed by a heterogeneous composition that includes proteins with a porin function , lipopolysaccharides and lipoproteins , which act as an effective barrier limiting the penetration of some substances . because it has characteristics such as a positive charge , low molecular weight and hydrophilicity , methylene blue is capable of interacting with anionic lipopolysaccharide macromolecules and penetrate the outer membrane of gram - negative bacteria . as regards the fungi , these have a cell wall constituted by a thick layer of beta glucan and chitin , which promotes an intermediate permeability barrier between gram - positive and gram - negative bacteria . investigated the effects of pdt in root canals of extracted teeth experimentally infected with endodontic pathogens . methylene blue was used at a concentration of 25 g / ml and exposure to diode laser with a wavelength of 665 nm and energy fluence of 30 j / cm coupled to an optical fiber . following this protocol , all bacterial species were completely eliminated , except for e. faecalis ( 53% of death ) . however , by increasing the energy fluence to 222 j / cm , they eliminated 97% of e. faecalis is also possible to observe differences in susceptibility of pdt when microorganisms are organized in the form of biofilm and when they are arranged as isolated cells . the challenge is greater when microorganisms are organized in biofilms , because they are then protected within a matrix , showing , thus , less susceptibility to antimicrobial therapy . bergmans et al . tested the bactericidal effect of pdt on strains of streptococcus anginosus , e. faecalis and mixed cultures containing e. faecalis and fusobacterium nucleatum inoculated in root canals of extracted teeth . the authors verified that when microorganisms were organized in individual cells or monolayers , pdt easily eliminated them . whereas when microorganisms were arranged in biofilm , the bacterial eradication was substantially reduced in the deeper layers . upadya and kishen compared the efficacy of pdt in planktonic suspensions and mono - species biofilms containing pseudomonas aeruginosa and e. faecalis . the authors concluded that modifications in the formulation of the photosensitizer increased the antibacterial efficacy of pdt in biofilms . the reduced susceptibility of biofilms to pdt is attributed to the low penetration of the photosensitizer . accordingly , various methods have been studied aiming to increase the potential penetration of the photosensitizer in biofilms . according to george and kishen the inclusion of an oxidant and an oxygen carrier in the formulation of methylene blue enables an increase in the potential of photo - oxidation and generation of singlet oxygen of pdt , facilitating the disruption of the biofilm matrix of e. faecalis in root canals in vitro . concluded that the use of a specific microbial efflux pump inhibitor added to methylene blue was able to increase the efficacy of pdt in eliminating biofilms formed by e. faecalis in polystyrene plates . mol / l and irradiation with diode laser with 40 mw and 660 nm ) and modified pdt ( methylene blue at 100 mol / l , hydrogen peroxide at 0.5% , ethylenediaminetetraacetic acid at 0.05% , chlorhexidine at 0.05% and laser irradiation ) in the elimination of e. faecalis and mixed bacterial plaque in suspensions and biofilms . the authors concluded that modified pdt was able to remove up to twenty times more bacterial biofilms than conventional pdt . thus , research protocols on laser light intensity , photosensitizers concentrations and activation methods are still being developed , showing different results and susceptibilities of microorganisms to treatment . it could be concluded that pdt is presented as an important auxiliary tool to antimicrobial substances commonly used in endodontic treatment . however , this therapy presents different challenges regarding its susceptibility to different microorganisms , according to their physiology . thus , for pdt to be employed with maximum effectiveness is important that further studies be performed in order to determine appropriate parameters for energy dosage used , photosensitizer concentration , time of preirradiation , and exposure .

photodynamic therapy ( pdt ) is presented as a promising antimicrobial therapy that can eliminate microorganisms present in endodontic infections . this treatment is based on the use of a nontoxic photosensitizing agent followed by irradiation of a resonant light source being capable of generating highly reactive species that are harmful to microorganisms . the purpose of this paper is to review the dental literature about the main factors that encompass the use of pdt combined with endodontic treatment for decontamination of the root canal system . a literature search was performed using the following index databases : pubmed , isi web of knowledge and medline , between 2000 and 2014 , looking for studies regarding antimicrobial action of pdt and its application to endodontic therapy . it was observed that despite numerous promising results , it is still necessary to establish different parameters so that pdt can be used with maximum effectiveness in eliminating microorganisms that cause endodontic infections .

twenty - eight male new zealand white rabbits weighing 2.5 - 3 kg were anesthetized by intramuscular injection of 50 mg / kg ketamine hydrochloride ( ketamine ; yuhan , seoul , korea ) and 5 mg / kg xylazine ( rumpun ; bayer korea , ansan , korea ) prior to rfa and other procedures . booster injections of up to one - half of the initial dose were administered as needed . the upper back and lower abdominal areas were shaved and sterilized , and each animal was placed in the prone position on the ct table . to assess the feasibility and safety of saline - enhanced rfa of normal lung parenchyma compared to conventional rfa , rabbits were allocated to either the rfa group ( n=10 ) or the saline - enhanced rfa ( srfa ) group ( n=18 ) . in addition , to compare the histopathologic change in lung parenchyma following srfa and the occurrence of delayed complications , the rabbits in the srfa group were allocated to either an acute ( n=10 ) or subacute subgroup ( n=8 ) , and sacrificed at different time intervals after the procedure . in the rfa group ( n=10 ) and the acute subgroup of the srfa group ( n=10 ) , unilateral lung rfa was performed in 20 rabbits and all were sacrificed on the day of the procedure . during the subacute phase , eight rabbits were sacrificed on day 7 ( n=2 ) , or day 10 ( n=2 ) , and at two ( n=2 ) or three weeks ( n=2 ) after rfa . a somatom plus-4 ct scanner ( siemens , erlangen , germany ) was used to obtain axial scans ( 2-mm slice thickness and 1.0 - 1.5 pitch ) of the entire lung field , and the target portion and appropriate approach route for saline infusion and rfa were thus determined . in the saline infusion group , a polyteflon - coated 21-gauge chiba needle ( m.i.tech , seoul , korea ) was used for 0.9% saline infusion before and during the application of rf energy . an internally cooled , 17-gauge electrode ( radionics ; burlington , mass . , u.s.a . ) with a 1- or 2-cm active tip was placed in the target area of the lung under ct guidance , and the chiba needle was inserted using the tandem technique ( 20 ) . to maximize the effects of saline instillation , the tip of the needle was placed 3 mm posterior to the tip of the rf electrode . to confirm the position of the needle and the electrode in the target area , ct scanning was performed . saline ( 0.5 ml ) was then infused at a rate of 0.1 ml / sec prior to the application of rf energy , and to avoid bronchial aspiration , 1 ml saline at a rate of 0.05 ml / sec was also infused during rfa after frequent pulsing began . an electrode with a 1-cm active tip was used in rabbits in the rfa and srfa groups to evaluate the immediate effects of rfa , while the electrode used in the subacute subgroup to evaluate histopathologic change and delayed complications had a 2-cm active tip . lesions were created using a 500-khz rf generator ( cc-3 ; radionics ) capable of producing 200 w of power . for analyzing the adverse effects of rf energy on lung parenchyma , ablated lesions were induced in the central portion of the lung in 14 rabbits and in its peripheral portion in the other 14 . during the procedure , a thermocouple embedded within the electrode tip continuously measured the local tissue temperature , and tissue impedance was monitored by circuitry incorporated within the generator . a peristaltic pump ( watson - marlow ; medford , mass . , u.s.a . ) was used to infuse normal saline solution at 0 into the lumen of the electrode at a rate of 10 - 25 ml / min , and this was sufficient to maintain a tip temperature of 20 - 25. when the desired current could not be applied due to a rapid elevation of impedance suggestive of tissue boiling , the generator automatically switched to the pulsed - rf technique ( 21 ) . power output was set at 30 w , and rf energy was applied for approximately five minutes on the basis of our earlier study findings ( 22 ) . using the same scanner and starting two hours after rfa ( day 0 ) , spiral ct scans were obtained to monitor the effects of ablation and to observe morphological change in the lesions at weeks 1 , 2 , and 3 after rfa . axial scans ( 2-mm slice thickness and 1.0 - 1.5 pitch ) of both the lung and upper abdomen , including the kidneys , were obtained before and after the injection of contrast medium ( 6 - 9 ml , ultravist 370 ; schering , berlin , germany ) at a rate of 1 ml / sec through the ear vein . the diameters of the ablated lesions were measured on pacs images by one radiologist using an electric caliper . imaging analysis : two radiologists experienced in body imaging reviewed pre- and post - ablation ct images of all animals . each rfa lesion was evaluated in terms of its location , size and shape , attenuation change , and the presence of hemorrhage or air in the pleural cavity , and then classified as either central ( inner 2/3 ) or peripheral ( outer 1/3 ) , depending on its location . to ensure that the changes noted were not present before rfa histopathologic examination : after spiral ct examination , rabbits were sacrificed at various points in time by injection of an overdose of ketamine and xylazine , and their lungs were harvested . the gross specimens obtained were dissected in planes similar to those of the spiral ct scans , and were examined . for macroscopic examination , two observers , who reached a consensus , used calipers to measure the central discolored region of coagulation necrosis in each pathologic specimen . tissues were then fixed in 10% formalin for routine histologic examination , and final processing for light microscopic study involved paraffin sectioning and hematoxylin - eosin ( he ) staining . tissues obtained from all treatment areas were analyzed for nonviability , their histologic appearance , and demarcation from surrounding viable tissue . a surgical pathologist and a radiologist evaluated the gross and microscopic findings at each rfa site , and reached a consensus . the technical aspects of rfa ( namely , total time needed for the procedure and current or impedance changes occurring ) and complications arising were compared for both techniques . for all statistical analysis , spss 9.0 computer software ( spss inc . , the size of the acute rf lesions in the two groups was compared using an unpaired student 's t test . all contingency data were analyzed using the chi - square test , or fisher 's exact test for fewer than five observed events . for all statistical analysis , a p value of less than 0.05 was considered statistically significant . twenty - eight male new zealand white rabbits weighing 2.5 - 3 kg were anesthetized by intramuscular injection of 50 mg / kg ketamine hydrochloride ( ketamine ; yuhan , seoul , korea ) and 5 mg / kg xylazine ( rumpun ; bayer korea , ansan , korea ) prior to rfa and other procedures . booster injections of up to one - half of the initial dose were administered as needed . the upper back and lower abdominal areas were shaved and sterilized , and each animal was placed in the prone position on the ct table . to assess the feasibility and safety of saline - enhanced rfa of normal lung parenchyma compared to conventional rfa , rabbits were allocated to either the rfa group ( n=10 ) or the saline - enhanced rfa ( srfa ) group ( n=18 ) . in addition , to compare the histopathologic change in lung parenchyma following srfa and the occurrence of delayed complications , the rabbits in the srfa group were allocated to either an acute ( n=10 ) or subacute subgroup ( n=8 ) , and sacrificed at different time intervals after the procedure . in the rfa group ( n=10 ) and the acute subgroup of the srfa group ( n=10 ) , unilateral lung rfa was performed in 20 rabbits and all were sacrificed on the day of the procedure . during the subacute phase , eight rabbits were sacrificed on day 7 ( n=2 ) , or day 10 ( n=2 ) , and at two ( n=2 ) or three weeks ( n=2 ) after rfa . a somatom plus-4 ct scanner ( siemens , erlangen , germany ) was used to obtain axial scans ( 2-mm slice thickness and 1.0 - 1.5 pitch ) of the entire lung field , and the target portion and appropriate approach route for saline infusion and rfa were thus determined . in the saline infusion group , a polyteflon - coated 21-gauge chiba needle ( m.i.tech , seoul , korea ) was used for 0.9% saline infusion before and during the application of rf energy . an internally cooled , 17-gauge electrode ( radionics ; burlington , mass . , u.s.a . ) with a 1- or 2-cm active tip was placed in the target area of the lung under ct guidance , and the chiba needle was inserted using the tandem technique ( 20 ) . to maximize the effects of saline instillation , the tip of the needle was placed 3 mm posterior to the tip of the rf electrode . to confirm the position of the needle and the electrode in the target area , ct scanning was performed . saline ( 0.5 ml ) was then infused at a rate of 0.1 ml / sec prior to the application of rf energy , and to avoid bronchial aspiration , 1 ml saline at a rate of 0.05 ml / sec was also infused during rfa after frequent pulsing began . an electrode with a 1-cm active tip was used in rabbits in the rfa and srfa groups to evaluate the immediate effects of rfa , while the electrode used in the subacute subgroup to evaluate histopathologic change and delayed complications had a 2-cm active tip . lesions were created using a 500-khz rf generator ( cc-3 ; radionics ) capable of producing 200 w of power . for analyzing the adverse effects of rf energy on lung parenchyma , ablated lesions were induced in the central portion of the lung in 14 rabbits and in its peripheral portion in the other 14 . during the procedure , a thermocouple embedded within the electrode tip continuously measured the local tissue temperature , and tissue impedance was monitored by circuitry incorporated within the generator . a peristaltic pump ( watson - marlow ; medford , mass . , u.s.a . ) was used to infuse normal saline solution at 0 into the lumen of the electrode at a rate of 10 - 25 ml / min , and this was sufficient to maintain a tip temperature of 20 - 25. when the desired current could not be applied due to a rapid elevation of impedance suggestive of tissue boiling , the generator automatically switched to the pulsed - rf technique ( 21 ) . power output was set at 30 w , and rf energy was applied for approximately five minutes on the basis of our earlier study findings ( 22 ) . using the same scanner and starting two hours after rfa ( day 0 ) , spiral ct scans were obtained to monitor the effects of ablation and to observe morphological change in the lesions at weeks 1 , 2 , and 3 after rfa . axial scans ( 2-mm slice thickness and 1.0 - 1.5 pitch ) of both the lung and upper abdomen , including the kidneys , were obtained before and after the injection of contrast medium ( 6 - 9 ml , ultravist 370 ; schering , berlin , germany ) at a rate of 1 ml / sec through the ear vein . the diameters of the ablated lesions were measured on pacs images by one radiologist using an electric caliper . imaging analysis : two radiologists experienced in body imaging reviewed pre- and post - ablation ct images of all animals . each rfa lesion was evaluated in terms of its location , size and shape , attenuation change , and the presence of hemorrhage or air in the pleural cavity , and then classified as either central ( inner 2/3 ) or peripheral ( outer 1/3 ) , depending on its location . to ensure that the changes noted were not present before rfa , the post- and preprocedural ct findings were compared . histopathologic examination : after spiral ct examination , rabbits were sacrificed at various points in time by injection of an overdose of ketamine and xylazine , and their lungs were harvested . the gross specimens obtained were dissected in planes similar to those of the spiral ct scans , and were examined . for macroscopic examination , two observers , who reached a consensus , used calipers to measure the central discolored region of coagulation necrosis in each pathologic specimen . tissues were then fixed in 10% formalin for routine histologic examination , and final processing for light microscopic study involved paraffin sectioning and hematoxylin - eosin ( he ) staining . tissues obtained from all treatment areas were analyzed for nonviability , their histologic appearance , and demarcation from surrounding viable tissue . a surgical pathologist and a radiologist evaluated the gross and microscopic findings at each rfa site , and reached a consensus . the technical aspects of rfa ( namely , total time needed for the procedure and current or impedance changes occurring ) and complications arising were compared for both techniques . for all statistical analysis , the size of the acute rf lesions in the two groups was compared using an unpaired student 's t test . all contingency data were analyzed using the chi - square test , or fisher 's exact test for fewer than five observed events . for all statistical analysis , a p value of less than 0.05 was considered statistically significant . rfa was technically successful in all instances , and 28 lesions were created with or without saline infusion . since the tip of the rf electrode or chiba needle was easily localized at ct , its positioning was not difficult . the time required for correct needle placement ranged from 1.5 to 3.5 ( mean , 2.3 0.6 ) minutes for rfa and from 2.7 to 4.5 ( mean , 3.4 1.5 ) minutes for srfa ( p = .04 ) . in the rfa group , mean initial tissue impedance was 187 24,and in the srfa group , after instillation of 0.5 ml of normal saline , the reading decreased to 134 24 ( p < .05 ) . in the rfa group , tissue impedance changed markedly ( from 200 to 1000 ) during the procedure and frequently induced activation of the pulsing technique , whereas in the srfa group , impedance showed no notable change ( range , 100 - 500 ) . without saline infusion , as in the rfa group , impedance rose abruptly within a mean period of 20 4.5 seconds . this automatically initiated rf pulsing , which was followed by alternating 5 - 10-second periods of high - energy deposition and approximately 15-second periods of low energy deposition . with saline infusion prior to and during rfa ( srfa group ) , impedance remained constantly low ( at approximately 100 ) during the first 1 - 2 minutes of rf energy instillation , but an abrupt rise which induced rf pulsing occurred during the second half of the procedure ( at mean 107 54 seconds ) . additional infusion of saline after the initiation of rf pulsing led to a lower rise in impedance and extended the time of continuous rf energy application . differences between the two groups in the duration of rf energy instillation before pulsing were statistically significant : 20 4.5 vs. 107 54 seconds ( p < .05 ) . in the srfa and rfa groups , the mean maximum diameters of acute lesions induced by a 1-cm active tip , as measured in gross specimens , were 12.5 1.6 and 8.5 1.4 mm , respectively ; this difference between the two groups was statistically significant ( p < .05 ) ( table 1 ) . in the srfa group , the mean maximum diameter of subacute lesions induced by a 2-cm active tip was 21.3 5.8 cm ( p < .05 ) . the complications occurring after rfa are summarized in table 2 , and were as follows : pneumothorax ( n=8 ) ; thermal injury to the chest wall ( n=2 ) ; hemothorax ( n=1 ) ; and lung abscess ( n=1 ) . three pneumothoraces were large ( with lung volume decrease due to pleural air collection and clinically visible respiratory distress ) and five were small ( perilesional small air collection , with no evidence of respiratory distress ) . complications tended to occur more frequently in the srfa group ( 55.6% , 10/18 ) than in the rfa group ( 20% , 2/10 ) , though the difference was not statistically significant ( p = .11 ) . however , complication rates varied between the two groups , depending on the location of the lesions . among central lesions , large pneumothorax occurred in two rabbits in the rfa group ( 20% , 2/10 ) and in one in the srfa group ( 5.6% , 1/18 ) ( p = .28 ) . among peripheral lesions , on the other hand , the complication rate was much higher in the srfa group ( 77.8% ) than in the rfa group ( p = .02 ) . the complications involved included thermal injury to the chest wall , and one lung abscess . the incidence rates of complications , namely 35.7% ( 5/14 ) for centrally located lesions and 50% ( 7/14 ) for peripherally located lesions , did not differ significantly ( p = .72 ) , though the type of complication involved depended on the location of the ablated lesion . although the incidence rate of pneumothorax ( 28.6% , 4/14 ) was not different between centrally and peripherally located lesions , large pneumothoraces ( n=3 ) or hemothorax ( n=1 ) occurred only in four central lesions ( 28.6% ) adjacent to hilar vessels or bronchi . major hemorrhage due to electrode penetration of vessels did not occur even where the lesion was located directly on a vessel . after rfa , unenhanced ct scanning revealed circumscribed hyperattenuated regions extending 5 - 8 mm from the portion of the inserted electrode ( fig . 1 ) , while contrast - enhanced ct showed no enhancement in the region of altered pulmonary attenuation . greater conspicuity of coagulated tissues was observed at wide window settings ( level=500 hu , width = 2000 hu ) . at ct imaging , thermal lesions appeared as hazy opacity in the soft tissue window ( level=50 hu , width=350 hu ) and ranged in diameter from 8 to 19 ( mean , 12.6 4.3 ) mm ( figs . 1 , 2 ) . at ct imaging at a soft - tissue window setting , acute lesions were round or oval - shaped except in regions abutting pulmonary vessels , and there was no significant difference in the shape of acute lesions between the rfa and the srfa group . however , because of the opacity related to saline infusion in rabbits in the srfa group , the appearance of lesions in the lung window was not well matched with that of gross specimens . gross examination showed that the diameter of an acute lesion , measured as a central discolored region , was 7 - 14 ( mean , 10.9 1.8)mm , and the thickness of the peripheral rim was 1 - 2 mm . the mean difference in lesion size , as determined by ct scanning and pathologic examination , was 3 mm , which was not statistically significant ( p > .05 ) . histological examination of an acute lesion revealed a central charred zone with complete destruction of the parenchyma , including a small central cavity where tissue had been lost . surrounding this were two zones of eosinophilic coagulative necrosis and a peripheral hemorrhagic rim ( figs . 1 , 2 ) one to two weeks following rfa , surrounding tissue was becoming organized into granulation tissue , with an increase of fibroblasts and macrophages and dilatation of blood vessels at the perimeter of the lesion ( fig . 3 ) . in a lesion 's central zone , typical findings of coagulation necrosis were observed . in centrally located lesions , , granulation tissue had achieved progressive ingrowth into the original area of necrosis , and was replacing it , and there was sharp cut - off between the lesion and normal tissue . the final appearance was of a nodule comprised of central coagulation necrosis surrounded by a fibrous capsule . since the tip of the rf electrode or chiba needle was easily localized at ct , its positioning was not difficult . the time required for correct needle placement ranged from 1.5 to 3.5 ( mean , 2.3 0.6 ) minutes for rfa and from 2.7 to 4.5 ( mean , 3.4 1.5 ) minutes for srfa ( p = .04 ) . in the rfa group , mean initial tissue impedance was 187 24,and in the srfa group , after instillation of 0.5 ml of normal saline , the reading decreased to 134 24 ( p < .05 ) . in the rfa group , tissue impedance changed markedly ( from 200 to 1000 ) during the procedure and frequently induced activation of the pulsing technique , whereas in the srfa group , impedance showed no notable change ( range , 100 - 500 ) . without saline infusion , as in the rfa group , impedance rose abruptly within a mean period of 20 4.5 seconds . this automatically initiated rf pulsing , which was followed by alternating 5 - 10-second periods of high - energy deposition and approximately 15-second periods of low energy deposition . with saline infusion prior to and during rfa ( srfa group ) , impedance remained constantly low ( at approximately 100 ) during the first 1 - 2 minutes of rf energy instillation , but an abrupt rise which induced rf pulsing occurred during the second half of the procedure ( at mean 107 54 seconds ) . additional infusion of saline after the initiation of rf pulsing led to a lower rise in impedance and extended the time of continuous rf energy application . differences between the two groups in the duration of rf energy instillation before pulsing were statistically significant : 20 4.5 vs. 107 54 seconds ( p < .05 ) . in the srfa and rfa groups , the mean maximum diameters of acute lesions induced by a 1-cm active tip , as measured in gross specimens , were 12.5 1.6 and 8.5 1.4 mm , respectively ; this difference between the two groups was statistically significant ( p < .05 ) ( table 1 ) . in the srfa group , the mean maximum diameter of subacute lesions induced by a 2-cm active tip was 21.3 5.8 cm ( p < .05 ) . the complications occurring after rfa are summarized in table 2 , and were as follows : pneumothorax ( n=8 ) ; thermal injury to the chest wall ( n=2 ) ; hemothorax ( n=1 ) ; and lung abscess ( n=1 ) . three pneumothoraces were large ( with lung volume decrease due to pleural air collection and clinically visible respiratory distress ) and five were small ( perilesional small air collection , with no evidence of respiratory distress ) . complications tended to occur more frequently in the srfa group ( 55.6% , 10/18 ) than in the rfa group ( 20% , 2/10 ) , though the difference was not statistically significant ( p = .11 ) . however , complication rates varied between the two groups , depending on the location of the lesions . among central lesions , large pneumothorax occurred in two rabbits in the rfa group ( 20% , 2/10 ) and in one in the srfa group ( 5.6% , 1/18 ) ( p = .28 ) . among peripheral lesions , on the other hand , the complication rate was much higher in the srfa group ( 77.8% ) than in the rfa group ( p = .02 ) . the complications involved included thermal injury to the chest wall , and one lung abscess . the incidence rates of complications , namely 35.7% ( 5/14 ) for centrally located lesions and 50% ( 7/14 ) for peripherally located lesions , did not differ significantly ( p = .72 ) , though the type of complication involved depended on the location of the ablated lesion . although the incidence rate of pneumothorax ( 28.6% , 4/14 ) was not different between centrally and peripherally located lesions , large pneumothoraces ( n=3 ) or hemothorax ( n=1 ) occurred only in four central lesions ( 28.6% ) adjacent to hilar vessels or bronchi . major hemorrhage due to electrode penetration of vessels did not occur even where the lesion was located directly on a vessel . after rfa , unenhanced ct scanning revealed circumscribed hyperattenuated regions extending 5 - 8 mm from the portion of the inserted electrode ( fig . 1 ) , while contrast - enhanced ct showed no enhancement in the region of altered pulmonary attenuation . greater conspicuity of coagulated tissues was observed at wide window settings ( level=500 hu , width = 2000 hu ) . at ct imaging , thermal lesions appeared as hazy opacity in the soft tissue window ( level=50 hu , width=350 hu ) and ranged in diameter from 8 to 19 ( mean , 12.6 4.3 ) mm ( figs . 1 , 2 ) . at ct imaging at a soft - tissue window setting , acute lesions were round or oval - shaped except in regions abutting pulmonary vessels , and there was no significant difference in the shape of acute lesions between the rfa and the srfa group . however , because of the opacity related to saline infusion in rabbits in the srfa group , the appearance of lesions in the lung window was not well matched with that of gross specimens . gross examination showed that the diameter of an acute lesion , measured as a central discolored region , was 7 - 14 ( mean , 10.9 1.8)mm , and the thickness of the peripheral rim was 1 - 2 mm . the mean difference in lesion size , as determined by ct scanning and pathologic examination , was 3 mm , which was not statistically significant ( p > .05 ) . histological examination of an acute lesion revealed a central charred zone with complete destruction of the parenchyma , including a small central cavity where tissue had been lost . surrounding this were two zones of eosinophilic coagulative necrosis and a peripheral hemorrhagic rim ( figs . 1 , 2 ) . there was sharp cut - off between ablated lesions and normal lung . outside this area , one to two weeks following rfa , surrounding tissue was becoming organized into granulation tissue , with an increase of fibroblasts and macrophages and dilatation of blood vessels at the perimeter of the lesion ( fig . 3 ) . in a lesion 's central zone , typical findings of coagulation necrosis were observed . in centrally located lesions , , granulation tissue had achieved progressive ingrowth into the original area of necrosis , and was replacing it , and there was sharp cut - off between the lesion and normal tissue . the final appearance was of a nodule comprised of central coagulation necrosis surrounded by a fibrous capsule . lung cancer is among the most commonly occurring malignancies in the world and is one of the few that continues to show an increasing incidence ( 23 , 24 ) . although surgical resection is acknowledged to be the treatment of choice and the only therapy with any prospect of cure or long - term survival , in practice a considerable percentage of patients with lung cancer are not eligible for surgical intervention due to the advanced stage of the disease , their limited pulmonary functional reserve , co - morbidities or advanced age ( 25 ) . those who are not candidates for surgery can undergo radiation treatment and/or chemotherapy , but survival prospects increase only modestly and gains are often accompanied by substantial toxicity , especially in patients suffering from other co - morbidities ( 26 ) . nevertheless , the development of nonsurgical and minimally invasive percutaneous techniques for the treatment of lung cancer would be advantageous . effective options might prove useful for patients with multiple medical problems , co - morbid disease , or concomitant tumor , or for whom surgery carries high risks . after encouraging results of rfa in the liver , some researchers have suggested that the procedure could be used for the treatment of lung malignancies ( 13 - 17 ) . the main advantage of rfa is that it is simple , easy to perform and offers the option of an indefinite number of repeated applications . a drawback , however , is that it is often necessary to overlap ablations by multiple repositioning of the electrode in order to decrease marginal recurrence after rfa ( 6 ) . furthermore , if lung tumors are to be treated by rfa , the naturally high impedance of air - containing lung tissue and the risk of pneumothorax related to multiple passes through the pleura during rfa might be an obstacle to induction of complete tumor necrosis . if these inherent problems of rfa of lung tumors are to be solved , ablation must produce a larger coagulation area that could include focal lung malignancies and some safety margin . several investigators have demonstrated the possibility of increasing rf tissue heating and coagulation during rf ablation by altering electrical and/or thermal conduction through the injection of saline into the tissues during rf application ( 18 , 19 ) . the present study was conducted to assess the actual effect of simultaneous infusion of saline during rfa , and possible resultant complications . in our study , the mean diameter of rfa lesions in the saline infusion group was significantly greater than in the control group : 12.5 mm vs. 8.5 mm ( p < .05 ) . in addition , initial impedance in the srfa group was significantly lower than in the rfa group ( p < .05 ) , and tissue impedance did not change markedly . thus , in the srfa group , high - rf energy instillation over a long period was possible , but in the rfa group , impedance changed rapidly during the procedure , frequently inducing activation of the pulsing technique . furthermore , impedance was decreased by additional infusion of saline during the application of rf energy . this increases tissue ionicity and decreases tissue impedance , thereby permitting greater current flow , and the heated liquid spreads thermal energy further and faster through the tissue than does heat conduction ( 28 , 29 ) . in this study , an internally cooled electrode was used for rfa , together with the pulsing technique , and the resultant lesion was larges than that made by the conventional electrode used in previous studies ( 21 , 27 , 30 ) . nonetheless , even with an internal cooling mechanism and pulsing technique , impedance rose rapidly and uncontrollably during rf energy instillation , inducing frequent pulsing and leading to restrictions in the size of lesions . after saline infusion , however , the period of rf energy instillation increased , and with it , lesion size . our results agreed with those of previous studies of saline - enhanced rfa of the liver and retroperitoneum ( 31 - 33 ) . as demonstrated in this investigation , an extended volume of coagulation necrosis due to saline infusion may increase the clinical utility of rfa therapy by permitting successful treatment of larger lung tumors or reducing the number of sessions needed for the treatment of a given tumor . this finding is of particular importance in the application of rfa to the treatment of lung cancer , since in order to decrease the occurrence of pneumothoraces , electrodes should pass through the pleura as infrequently as possible . if the incidence of pneumothorax can be reduced , more patients may benefit from this potentially curative therapy , with its reduced medical and social costs . procedure - related complications arose in 12 cases , comprising eight pneumothoraces , two thermal injuries to the chest wall , one hemothorax , and one lung abscess ( table 2 ) . their incidence tended to be higher in the srfa group ( 55.6% ) than the rfa group ( 20% ) , though the difference was not statistically significant ( p = .11 ) . for the peripheral lesions , however , the complication rates among rabbits in the srfa group ( 77.8% , 7/9 ) was higher than among those in the rfa group ( 0% ) ( p < .05 ) . the relatively high incidence rates ( 28.6% , 8/28 ) of pneumothorax in this study were related to the small size of rabbit lung , the relatively large size of the electrodes , and the additional use of a chiba needle with an electrode in the srfa group . we believe that if the electrode used during rfa is adequate , permitting simultaneous instillation of saline during rfa in large animals or in clinical trials , the incidence rates of pneumothorax could decrease markedly . according to earlier reports of saline - enhanced rfa ( 18 , 19 , 31 , 32 ) , direct and uncontrollable thermal damage to both adjacent and remote structures was observed more frequently in the saline infusion group than in the conventional rfa group . to decrease this damage , we used a very small amount of saline ( 1.5 ml ) at a slow infusion rate ( approximately 0.05 ml / sec ) , and it is possible that the two cases of unexpected thermal injury to the chest wall and diaphragm resulted from drainage of steam or saline through low - resistance tissue . a further possible drawback of saline - enhanced rfa , also involving this steam or saline drainage , is that the lesions produced may be somewhat irregular in shape , rather than spherical . however , most ablated lesions in the present study were spherical , and we believe that instillation of a larger amount of saline than we used could be related to the formation of irregularly shaped lesions . the clinical role of rfa in the treatment of lung tumors is still not clear but will undoubtedly evolve . for example , in patients with hemoptysis or cough in whom radiotherapy has not controlled the symptoms or can not be undertaken due to poor lung function or co - morbidity , this technique might play a primarily palliative role . we believe that in lung cancer patients , rf ablation possesses several potential benefits compared with systemic chemotherapy or radiotherapy . first , because the therapy is local in nature , it is likely to minimize damage to lung parenchyma and reduce adverse systemic affects on a patient 's general health , and for this same reason , rf ablation therapy can be utilized in patients with limited pulmonary reserve . it is less likely to have a curative role for stage - i tumors because many patients with peripheral tumors who have poor lung function can be offered limited resection , such as wedge resection or segmentectomy by video - assisted thoracoscopic surgery ( 34 - 36 ) . however , a randomized trial of lobectomy versus limited resection for stage - i lung cancer showed that the latter did not confer improved perioperative morbidity or mortality . furthermore , even if less invasive than open surgery , limited resection also requires general anesthesia ( 35 ) . there could , therefore , be a role for rfa as a less invasive alternative to metastasectomy , but for the present , the greatest clinical utility of rfa may be in patients with small peripheral lung cancers who are poor candidates for surgery . first , the results obtained in healthy rabbit lung may differ from those obtained with non - small - cell human lung carcinoma . however , aspects of the process of cell degeneration caused by the effect of heat on tissue lead us to believe that the results might well be the same with either normal lung tissue in rabbits or human lung cancer cells . second , rabbit lungs are smaller than the size of the rf ablation zone that can be produced with the currently available rf electrode system , and the effectiveness of saline infusion during rfa may thus not be entirely comparable between the two groups . in addition , since the 17-gauge electrode used in this study is too large for rabbits , with their relatively smaller lungs , the complication rates of rfa might be overestimated . in conclusion , ct - guided percutaneous transthoracic rfa with simultaneous hypertonic saline infusion is feasible , and more effectively produces coagulation necrosis than rfa without saline infusion . saline - enhanced rfa might be a promising technique for the management of inoperable lung malignancies and has the potential for use as a minimally invasive approach . to determine whether the technique can be feasibly and safely used to produce a sufficiently large volume of necrosis to be of value in the treatment of small peripheral lung tumors in patients for whom surgery or palliative radiotherapy is unsuitable , further study using a larger animal model is warranted

objectiveto assess the feasibility and safety of ct - guided percutaneous transthoracic radiofrequency ablation ( rfa ) with saline infusion of pulmonary tissue in rabbits.materials and methodstwenty - eight new zealand white rabbits were divided into two groups : an rfa group ( n=10 ) and a saline - enhanced rfa ( srfa ) group ( n=18 ) . in the rfa group , percutaneous rfa of the lung was performed under ct guidance and using a 17-gauge internally cooled electrode . in the srfa group , 1.5 ml of 0.9% saline was infused slowly through a 21-gauge , polyteflon - coated chiba needle prior to and during rfa . lesion size and the healing process were studied in rabbits sacrificed at times from the day following treatment to three weeks after , and any complications were noted.resultsin the srfa group , the mean diameter ( 12.5 1.6 mm ) of acute rf lesions was greater than that of rfa lesions ( 8.5 1.4 mm ) ( p < .05 ) . the complications arising in 12 cases were pneumothorax ( n=8 ) , thermal injury to the chest wall ( n=2 ) , hemothorax ( n=1 ) , and lung abscess ( n=1 ) . although procedure - related complications tended to occur more frequently in the srfa group ( 55.6% ) than in the rfa group ( 20% ) , the difference was not statistically significant ( p = .11).conclusionsaline - enhanced rfa of pulmonary tissue in rabbits produces more extensive coagulation necrosis than conventional rfa procedures , without adding substantial risk of serious complications .

higher carriage rates are seen in diabetics , intravenous drug users ( ivdu ) , hiv and dialysis patients . all patients with s. aureus bacteremia should undergo transthoracic echocardiography ( tte ) , since s. aureus bacteremia is associated with heart valve involvement in 25% of the cases . nevertheless , tee has been shown to be superior to tte for the diagnosis of infective endocarditis ( ie ) , identifying small vegetations and abscesses . all infective foci must be identified and removed as soon as possible ; however , foci are not always obvious and long - term antimicrobial therapy might be necessary . nafcillin is a well - established agent for serious systemic non methicillin - resistant s. aureus ( mrsa ) infections and has been reported as superior over vancomycin . we present a very interesting case of a rapidly progressive methicillin - sensitive staphylococcus aureus infection , for which empirical treatment with vancomycin and initial treatment with nafcillin did not stop further dissemination despite adequate mic , taking longer than usual to respond to adequate treatment . a 64-year - old male patient with a past medical history of hypertension , hiatal hernia and osteoarthritis presented to the emergency department with a chief complaint of acute worsening of his chronic lower back pain for two weeks and progressive weakness in lower extremities . he used to ambulate with a cane and later used a walker for several days , but recently he felt non - ambulant . cardiac examination showed a regular rate and rhythm with normal s1 and s2 and no murmurs . on further review of systems he reported having chronic bilateral knee pain related with osteoarthritis and a congenital deformation of his right knee . he was a smoker of 40 pack - years , occasional user of alcohol and marijuana , but denied ever using intravenous drugs and toxicology was positive only for oxycodone , which he used for chronic lumbar pain for several years . laboratory exams displayed a leukocytosis of 25,500 with 89% neutrophils , no bands , sedimentation rate of 44 , lactic acid 1.6 , anion gap 18 . thoracic and lumbar spine computed tomography ( ct ) scan showed multilevel central canal and bilateral neural foraminal compromise , but did not show evidence of abscess . partially visualized lungs showed a cavitary lesion in the superior segment of the left lower lobe , measuring 1.4 cm with circumferential thick wall , suggestive of septic emboli versus tuberculosis , and left inferior renal pole abnormalities suggestive of multiple infarctions . the patient was started empirically on vancomycin 15 mg / kg iv q 12h , while waiting for sensitivities . the tte performed after bacteremia diagnosis showed an ejection fraction of 65% with normal valves and no vegetations . on day two of hospitalization the clinical picture worsened as the patient suddenly developed an altered mental status and nuchal rigidity . lumbar puncture confirmed meningitis with a cerebrospinal fluid leukocytosis of 1157 ( neutrophil 95% ) and culture positive for s. aureus . testing for hiv , herpes simplex virus ( hsv ) and tuberculin skin test ( ppd ) were all negative . spine magnetic resonance imaging ( mri ) showed osteomyelitis at t12-l1 and previously seen ( in ct scan ) renal infarcts . the patient continued to be febrile despite pathogen susceptible to vancomycin with mic < 2 mg / ml , trough previous to 4 dose 11 , repeated trough 18.4 , repeat blood cultures at 48 and 96 hours remained negative . six days later he had clinical deterioration with tachypnea , hypoxia , new systolic 2/6 murmur , louder over cardiac apex area , and bilateral respiratory crackles . at this point , the patient was switched to nafcillin 2 g iv q 4h when blood culture results confirmed methicillin susceptibility on day 3 of admission . head mri showed multiple infarcts in a non - vascular pattern secondary to septic embolisms ( figure 1 ) . the tee showed severe mitral and tricuspid regurgitations , with 1.5 cm mobile vegetation on the posterior leaflet of the mitral valve . the patient was transferred to the intensive care unit due to the complicated picture of mssa bacteremia , ie , osteomyelitis , meningitis , ischemic stroke , renal and pulmonary infarcts secondary to septic emboli . there were indications for emergent mitral valve replacement , however given his recent finding of embolic stroke ; this was not feasible due to high mortality risk . follow up tte showed worsening mitral and tricuspid valve involvement , therefore mitral and tricuspid valve replacements were performed , four weeks from ie diagnosis . he completed 8 weeks of nafcillin ( given his vertebral involvement and unknown source ) . after 2 months of hospitalization , patient was discharged home with a dual - chamber pacemaker due to persistent 3rd degree atrio - ventricular block , post surgery . staphylococcus aureus is one of the leading agents of infection among adult patients . when s. aureus invades deep structures it often metastasize hematogenously to other areas and organs with significant morbidity . infection caused by community acquired mssa strains are characterized by severe clinical course with increased incidence of endocarditis and organ failure . two important questions should be asked to the patient with the intention to identify focal source and consider additional necessary diagnostic test . ivdu related infection can manifest as an initially insidious presentation that later complicates to be an aggressive metastatic disease . we presented a unique case since our patient was not an ivdu nor an initial focus of infection was identified . additionally , the progression from negative to positive echocardiogram findings of valvular vegetations highlights the high virulence of this community - acquired pathogen , since severe valvular regurgitation or insufficiency should be equally observed on both types of echocardiograms . altered mental status in such patients a mri is crucial to confirm the diagnosis with the visualization of a non - vascular pattern . mssa meningitis is a serious infection , which can occurs in patients without risk factors or immunosuppression . like meningitis , stroke secondary ca - mssa is rarely seen , regardless of the severity of infection . high level of clinical suspicion is needed in such patients , as back pain could be the only reliable predictor of an added spine infection . when treating for gram - positive cocci bacteremia , empirical antibiotic therapy should provide coverage against staphylococci , usually with vancomycin to cover mrsa . nafcillin / oxacillin remains the antibiotic of choice for treating infections caused by mssa once culture and sensitivity results confirm it , because nafcillin is superior to vancomycin in preventing persistent or relapsing mssa bacteremia . in the case of endocarditis , studies have demonstrated that vancomycin ( versus nafcillin ) is significantly associated with relapse given its slow bactericidal activity . for our case , the reasons why empirical treatment with vancomycin and initial treatment with nafcillin , did not stop further dissemination remained unknown . nevertheless , continued treatment with nafcillin eventually did resolve the infection . we have to consider that , even though the mic remains the only satisfactory in vitro measurement of the intrinsic activity of antimicrobials , the test has always been open for criticism since it is performed with the use of artificial media and fixed concentrations , under conditions that may be very different from those in the actual site of infection . there is evidence that support the concept of the principal determinant of efficacy of beta lactams to be the time for which the drug levels exceed the mic at the site of infection , not just and mic < 2 mg / ml by itself . also , bacterial strains have been detected to have a mbc ( minimum bactericidal concentration ) many times higher than the mic , ( known as phenotypic tolerance ) , isolated in vitro gram - positive bacteria causing slower clinical response . the inoculum effect may be clinically relevant since the number of bacteria at the site of infection may much higher that the traditionally used for susceptibility testing . although the benefit of such concentration is questionable since our patient s infection was multifocal . our laboratory was not able to analyze serum nafcillin concentrations ; hence , samples would have to send to a referral laboratory . a community acquired pathogen , even when part of the normal flora could be virulent enough to cause end organ damage from head to toe . the use of head mri as a pre evaluation tool for ie - related urgent valve surgery is imperative , to investigate whether such preoperative findings affect postoperative outcomes . the presence of characteristic cranial mri lesions may prompt early diagnosis of infective source and lead to the adequate management . beyond the mic , the time the drug level exceeds the mic , the phenotypic tolerance and the inoculum effects may be reasons why empirical treatment with vancomycin and initial treatment with nafcillin did not stop further dissemination , but , eventually , clearing the infection .

methicillin - sensitive staphylococcus aureus ( mssa ) meningitis is a rare disease when not related to neurosurgery : there are only few reported cases in the literature to date . we describe a case that highlights not only meningeal but also diffuse and rapidly progressive systemic involvement with multi - organ failure . a 64-year - old male presented to our hospital with a chief complaint of acute worsening of his usual chronic lower back pain , progressive weakness in lower extremities and subjective fevers at home . hospital course demonstrated mssa bacteremia , of questionable source , that resulted in endocarditis affecting right and left heart in a patient with no history of intravenous drug use . the case was complicated by septic emboli to systemic circulation involving the kidneys , vertebral spine , lungs and brain with consequent meningitis and stroke , even when treated empirically with vancomycin and then switched to nafcillin as indicated . even though mssa infections are well known , there are very few case reports describing such an acute - simultaneous - manifestation of multi - end - organ failure , including meningitis and stroke . our case , also presented with an uncommon manifestation of persistent infection dissemination despite adequate antibiotic treatment .

fibro - osseous lesions of the jaws represent a diverse group of entities which include developmental ( hamartomatous ) lesions , reactive or dysplastic processes and neoplasms . benign fibro - osseous lesions of the head and neck region are uncommon and represent a wide range of tumors sharing some histopathological features ; which comprise fibrous dysplasia , ossifying fibroma ( of ) , and cement - osseous dysplasia . of can be further divided into conventional and juvenile forms ( juvenile ossifying fibroma ( jof ) ) . jof has to be distinguished from a larger group of ofs on the basis of the age of the patient , site of involvement and clinical behaviour . according to the world health organization ( who ) classification of odontogenic tumors 2005 , jof is further subdivided into psammomatoid jof ( psjof ) and trabecular jof ( trjof ) . benjamins in 1938 first reported psjof as an osteoid fibroma with atypical ossification of the frontal sinus , golgi in 1949 called it as psammomatoid ossifying fibroma , and johnson in 1952 coined the term juvenile active ossifying fibroma . according to who classification of odontogenic tumors 2005 , it was named as the term juvenile psammomatoid ossifying fibroma is now used to designate the neoplasm of the craniofacial skeleton of young age with well - defined clinicopathological features . the pathogenesis of these jaw lesions are related to the abnormal development of basal generative mechanism that is essential for root formation . this paper highlights a rare entity of psjof involving the maxillary sinus and nasal cavity on the left side . a 20-year - old female patient reported with a painless progressive swelling in the left cheek region and difficulty in breathing since 1 year . past medical history revealed that the patient underwent surgery in a private dental clinic 5 years back for the impacted tooth 23 which was associated with pathology . the swelling was 6 4 cm in size approximately extending anteroposteriorly from ala of the nose to 5 cm from tragus of the ear on the left side . nasal polyp was seen in the left nostril with obliteration of left ala of the nose [ figure 1 ] . nasal polyp seen in left nostril with obliteration of left ala of nose intraoral examination presented a swelling extending anteroposteriorly from the distal aspect of 21 to mesial aspect of 26 ; medially till the mid palatine raphe and laterally the buccal vestibule was obliterated and the swelling extended from 21 to 26 . paranasal sinus ( pns ) x - ray revealed haziness in the left maxillary sinus . computed tomography ( ct ) scan confirmed well - defined mixed radiolucent and radiopaque areas with calcifications extending superoinferiorly from infraorbital rim to alveolus and anteroposteriorly from the nasal septum to post zygomatic buttress on left side [ figure 2 ] . axial computed tomography revealing well - defined radiolucent and radiopaque areas with calcifications histopathological examination of incisional biopsy revealed connective tissue stroma with numerous spherical / irregular ossifications interspersed with cellular fibrous tissue [ figure 3 ] . the ossifications showed peripheral brush border surrounded by an eosinophilic rimming [ figure 4 ] . haemorrhagic areas were also seen . the constellation of clinical , radiological , and histopathological features of this lesion supported an interpretation of psammomatoid variant of jof . photomicrograph of hematoxylin and eosin ( h&e ) stained section ( 100 ) showing numerous spherical and irregular calcifications interspersed with fibrous tissue photomicrograph of h&e stained section ( 400 ) showing peripheral brush border surrounded by eosinophilic rimming under general anesthesia , a weber - ferguson incision was given to expose the complete lesion . subtotal maxillectomy was performed and the tumor mass along with nasal and ethmoidal polyps were removed with the help of a chisel and mallet . after complete removal of the mass , borders were carefully osteotomized to avoid the chances of recurrence [ figure 5 ] . the excised specimen was sent for histopathological examination [ figure 6 ] and the diagnosis of psjof was confirmed . jof are benign , potentially aggressive fibro - osseous lesions of the craniofacial bones . the word psjof is a unique variant of jof that has a predilection for orbit and pnss accounting for about 72% followed by calvarium 11% , maxilla 10% , and mandible 7% . the ethmoidal sinuses are most commonly involved , followed by the frontal sinuses , the maxillary sinuses , and the sphenoid sinus . both the variants of jof show a predilection for males . the swelling in this case is associated with maxilla involving maxillary sinus and nasal cavity in a 20-year - old female patient . table 1 summarizes the clinical presentation of case series of psjof reviewed in the literature . the patients may develop exopthalmoses , bulbar displacement , and nasal obstruction . in the present case because of the extension of the tumor into the nasal cavity , nasal obstruction was present on the left side . radiographically , psjof can be radiolucent , radiopaque , or mixed depending upon cystic changes and the degree of calcification . sclerotic changes are evident in the lesion which may show a ground - glass appearance . histologically , psjof shows highly cellular fibrous stroma often with whorled pattern containing closely packed spherical ossicles resembling psammoma bodies . these ossicles are round to oval in shape which have a basophilic center and peripheral pink rim showing some radiating fibers which corroborates with the microscopic features provided in the present case . psjof should be differentiated from extracranial meningioma with psammoma bodies , which demonstrates epithelial membrane antigen ( ema ) positivity and even the psammomatoid ossicles in psjof are clearly different from spherical true psammoma bodies . other differential diagnosis include fibrous dysplasia , osteoma , cementoblastoma , well - differentiated osteosarcoma , psammomatous extracranial meningioma [ table 2 ] . differential diagnosis the clinical management of smaller lesions is simple excision with surrounding marginal bone , whereas larger lesions warrant more aggressive surgical management . prognosis is good with a recurrence rate of about 30 - 58% . no malignant transformation has been documented . even though these lesions tend to locally invade , there were no cases of metastasis being reported . therefore , it is very important to correlate the clinical , radiographical , and histopathological findings for proper treatment . early detection and complete surgical excision of the lesion followed by long - term follow - up is necessary for proper clinical management .

juvenile ossifying fibroma ( jof ) is an uncommon , benign , bone - forming neoplasm with an aggressive local growth that is distinguished from other fibro - osseous lesions primarily by its age of onset , clinical presentation and aggressive behaviour . jof is considered as a variant of the ossifying fibroma ( of ) and the former includes psammomatoid jof ( psjof ) and trabecular jof ( trjof ) . both variants involve the craniofacial bones with the trabecular variant being more common in the jaws and the psammomatoid variant being more common in the craniofacial skeleton . psjof is an unique variant of jof that has a predilection for the sinonasal tract and the orbit particularly centered on the periorbital , frontal , and ethmoid bones . we report a rare case of massive psjof involving the maxillary sinus in a 20-year - old female .

ts is a key enzyme in the de novo synthesis of dtmp , an essential precursor of dna , which catalyses the methylation of dump to dtmp . the critical role of ts in the nucleotide metabolism has made it an important target of a variety of chemotherapeutic agents including 5-fu , 5-fu prodrugs as capecitabine , and novel folate - based ts inhibitor such as raltitrexed and pemetrexed , used in the treatment of colorectal and other solid tumours . resistance to fluoropyrimidines and other ts inhibitors may occur through a variety of mechanisms including elevated intracellular ts levels resulting from increases in ts transcription and translation . in crc patients the ts intratumoural expression may predict for the sensitivity to 5-fu and other ts inhibitor - based chemotherapies [ 5 , 6 ] and may also be an important prognostic marker . high ts expression in early stage crc patients seems to predict for poorer overall survival in both chemotherapy - treated and untreated patients following surgery . also , metastatic crc patients with high ts levels are unlikely to respond to infusional treatment with 5-fu , whereas patients with low ts levels have higher than average response rate [ 8 , 9 ] . in a previous study , however , we demonstrated that higher ts levels are favourable prognostic factors for disease free and overall survival . to date the real value of the ts level as prognostic factor is doubtful and some authors are in disagreement about it . the ts gene , containing 7 coding exons , is located in chromosome 18q , for which a high percentage of monosomic loss has been reported to be cell - cycle dependent , although some recent evidence points are more oriented towards proliferation - dependence . it can be predicted that mutations in the ts gene might result in a modification of its structure and then in its ability to interact with the fluoropyrimidines . this prediction has been born out in a variety of studies [ 1215 ] . s. h. berger and f. g. berger reported that the human colon tumour cell line hct116 produces a variant structural form of ts , in addition to the common form found in all colon cell lines tested . among the ts overproduction derivatives of hct116 , cells overexposing the novel forms are more resistant to fdurd , compared with cells overexpressing the normal form so , an association between drug response and altered ts structure could suggest that the novel ts form , which is encoded by a variant structural ts gene , confers relative resistance to fdurd ; this was supported by preliminary kinetic data indicating that this novel form has a reduced affinity for fdump . this variant form presents a replacement of an evolutionary conserved tyrosine by a histidine at residue 33 of the ts polypeptide [ 17 , 18 ] ; this mutation represents the only difference between the two ts forms and must account for the structural and functional differences between them . in an our previous paper we performed the analysis of the ts structure in patients bearing crc to try to demonstrate the presence of that specific mutation , but we did not find it in any patient . here , we intend to proceed on the use of sequencing techniques to see if any ts variant form could be present in human cancer samples from patients who underwent surgery for primary colorectal cancer and previously untreated and try to find relationship between any hypothetical ts variant form with the 5-fu treatment . we performed the ts - dna gene sequence in 68 cancer samples from patients of different dukes ' stages ( a , b , and c ) and histological grade but we did not find any change in the ts - dna structure . ts structure was assessed in a series of 68 patients who underwent surgery for primary colorectal carcinoma confirmed histologically and previously untreated . the following exclusion criteria were applied : history of other neoplasias apart of crc and death occurring within 30 days following surgery and due to postoperative complications . the tumours were staged and graded according dukes ' system and their clinicopathological features were summarised in tables 1 , 2 , and 3 . the samples at surgery were divided in two parts : one was frozen at 80 until analysis , and the other portion was embedded in paraffin to confirm histologically the absence of contamination by normal and necrotic tissue and lymphocytes . genomic dna was extracted from tumour and mucosa samples with a commercial kit purchased from qiagen ( kjvenlo , the netherlands ) and stored at 20. the ts gene of tumour and mucosa samples was amplified in seven different pcr reactions using dna primers of 1620 bases in length placed in the adjacent intronic regions of exons 1 , 2 , 3 , 4 , 5 , 6 , and 7 and listed in table 4 . amplification was performed using a perkin elmer model 2400 thermal cycler ( boston usa ) . reaction mixture included 5 l of 10% dimethylsulfoxide , 5 l of 10 buffer , 1.5 l of 1.5 mm mgcl2 , 1 l of 10 mm dntps , 200500 ng of genomic dna , 200 pmol of both upstream and downstream primers , and 1 units of taq dna polymerase , in a final volume of 50 l . amplification was run for 35 cycles with each cycle consisting in a denaturation step at 95c for 1 minutes , a primer annealing step at 51c for 1 minute , and an extention step at 72c for 2 minutes . pcr was terminated by incubation at 72c for 10 minutes . the length of the amplification products ranged from 180 to 310 bases . dna samples , generated with independently repeated pcr products , were sequenced with the sequitherm excel ii dna sequencing kit ( epicenter , madison , wi ) on a li - cor 4000 ( mwg - biotech , ebersberg , germany ) sequencer . the enzyme structure obtained by sequencing the ts genomic dna of each sample was performed in 68 patients with operable crc , untreated with previous chemotherapy . primary tumours and corresponding colonic mucosa were obtained from each patient and the ts genomic structure was performed on each of them , after histological control . 7 patients had g1 histological grade , 36 had g2 , and 25 had g3 histological grade ; 10 patients had dukes ' a tumours , 27 patients had dukes ' b , and 31 patients had dukes c cancers . the median age of patients was 67 years ; 30 patients were male and 38 female . in all the tumour samples evaluated we did not find any ts - dna variant structure in tumour : all a , b , and c dukes ' patients showed stable ts - dna , and also in the germline genome no ts - dna variants have been observed . the structure of the macromolecular target of a cytotoxic drug is a critical determinant of cellular sensitivity to that drug . recently , ts has become the subject of several studies aimed to elucidate a possible clinical role of ts detection either as determinant of drug resistance or as prognostic marker of the disease and predictive factor of the treatment . many studies are currently examining the real value of ts expression levels as a prognostic factor , but in the mean time significant uncertainty prevails ; whatever its prognostic influence , to date no studies have been able to establish a cut - off all of these in vitro studies have promising implications in the study of the role of ts in clinical practice . moreover , the unclear meaning of levels not only as a prognostic indicator but also as marker predictive of resistance could be due to mechanisms different from over expression , as mutation . in fact some authors focused their attention on the ts structure with a double aim : development of a new classes of ts - inhibitors with a different mechanism of action and generation of ts mutants to develop gene - therapy strategies . berger and coworkers showed that a single naturally occurring change , a tyr to his replacement , in the primary structure of the ts molecule confers relative resistance to the ts - directed antimetabolite fdurd in hct 116 cells . the tyr to his mutation is the only difference between the altered form of ts and the normal form and , therefore , must be responsible for the diminished effectiveness of the enzyme as a drug target . the data in those studies , together with previously published experiments , strongly favour the notion that the tyr to his ' mutation is responsible for the relative fdurd resistance of cell line hct 116 [ 15 , 16 ] . however , as noted earlier , it is quite possible that factors in addition to this mutation contribute to the phenotype of hct116 and other colon cell lines . the frequency of the tyr33 to his33 mutation in the normal and in the pathological human populations is unknown . the altered ts may exist as a polymorphism in humans ; alternatively , it may have spontaneously arisen during tumorigenesis or during establishment of the cell lines in culture . distinguishing among these possibilities will be of great utility in assessing whether variant forms of ts identified in cultured cell lines are segregating in the human population and have an impact upon clinical response to 5-fluorouracil therapy in cancer patients . on the basis of this knowledge we hoped to see if in human crc samples it could be possible to find the same tyr33 to his33 substitution in the ts structure and eventually to correlate this finding with some clinicopathological parameters such as age and sex , tumour size and location , histological grade , dukes ' stage , 5-fu and raltitrexed treatment , and disease free and overall survivals , to see if that point mutation could be considered a reliable marker of drug resistance and of prognosis . in those samples we did not find that point mutation at the codon 33 . in this study we intend to proceed on the use of sequencing techniques to see if any ts variant form could be present in human cancer samples from patients who underwent surgery for primary colorectal cancer ( crc ) and previously untreated and try to find a relationship between any hypothetical ts variant form with the 5-fu treatment and prognosis . we performed the ts - dna gene sequence in 68 cancer samples from patients of different dukes ' stages ( a , b , and c ) and histological grade , but we did not find any mutation in the ts - dna structure . the conclusions that could be drown are that in dukes ' a , b , and c crcs there are no changes in the ts - dna gene structure and that the evaluation of the ts expression is the main crc prognostic and drug response marker . what remains is to evaluate the ts gene structure of the d metastatic dukes ' crcs : in these tumours it might be possible to find ts - dna structural changes related with their higher genomic instability and this fact could give an explanation of the 5-fu drug resistance and worse prognosis .

thymidylate synthase ( ts ) catalyzes methylation of dump to dtmp and it is the target for the 5-fluorouracil ( 5-fu ) activity . barbour et al . showed that variant structural forms of ts in tumour cell lines confer resistance to fluoropyrimidines . we planned to perform the whole ts gene structure by means of sequencing techniques in human colorectal cancer ( crc ) samples to try to identify the presence of any possible ts variant form that could be responsible of fluoropyrimidines drug resistance and of the worse prognosis . we performed the ts - dna gene sequence in 68 crc from patients of a , b , and c dukes ' stages and different histological grade , but we did not find any mutation in the ts - dna structure . in the future we intend to widen the ts structure analysis to the metastatic crcs , because due to their higher genomic instability , they could present a ts variant form responsible of the fluoropyrimidines drug resistance and the worse prognosis .

palatal rugae are irregular , asymmetric ridges of mucous membrane extending laterally from the incisive papilla and the anterior part of the median palatal raphe . these structures have been used as internal cast reference points for quantification of tooth migration . a few investigators have shown the medial rugae region to be stable or show predictable changes post orthodontic therapy . the rugae patterns are completely formed by the 12 to 14 week of prenatal life and remain stable thereafter . these are unique to each person and show distinctiveness based on ethnic groups and hence are useful in forensic identification . because they are stable landmarks the palatine rugae play a significant role in clinical dentistry as well . the objective of this study was to analyze and characterize the rugae patterns , compare the rugae dimensions in various age groups and to ascertain any relationship between dimensional analysis and palatal depth . cross - sectional casts of 52 females and 48 males were selected from the archival section of the department of orthodontics , m. m. college of dental sciences and research , mullana ( ambala ) and studied employing following parameters : assessment of age ( according to erupted teeth).gender differentiation ( based upon records).division of medial palatal region into : a : distance between incisive papilla length and anterior limit of the anteriormost rugae.b : distance between incisive papilla and posteriormost rugae limits.lateral rugae dimensions . palatal depth ( measured from healthy gingival margin underneath the mesiolingual cusp to the deepest concavity of the palatal arch using a brass wire between two opposing points and measuring the vertical distance at the center).rugae patterns . division of medial palatal region into : a : distance between incisive papilla length and anterior limit of the anteriormost rugae.b : distance between incisive papilla and posteriormost rugae limits.lateral rugae dimensions . a : distance between incisive papilla length and anterior limit of the anteriormost rugae . palatal depth ( measured from healthy gingival margin underneath the mesiolingual cusp to the deepest concavity of the palatal arch using a brass wire between two opposing points and measuring the vertical distance at the center ) . no patient details were disclosed and ethical guidelines as per the declaration of helsinki were followed . correlations among a , b , lateral rugae patterns and palatal depth were calculated by mean s.d . correlations among a , b , lateral rugae patterns and palatal depth were calculated by mean s.d . followed by evaluation of p values . the rugae patterns identified were : common origin ; separate origin ; lateral branching ; secondary rugae and fragmentary patterns . females were found to have slightly higher predilection towards having the common , fragmentary and lateral branching rugae patterns . there was a stronger female predisposition for rugae with separate origin , whereas , the secondary rugae were equally existent in either gender . significant correlation was found between the a ( p=0.03 ) and b values ( p=0.02 ) on comparing the mean s.d . values of age groups between 12 - 13 years and > 14 years , respectively . hence , there is a corresponding anteroposterior increase in palatal dimensions in these age groups [ table 1 ] . this study showed no changes in the lateral rugae dimension and palatal depth with increasing age . the majority of the study cohort ( 57% ) had a palatal depth in the range of 1.6 - 2.0 cm [ table 2 ] . palatal rugae have been used as reference points for many purposes such as evaluating tooth movement pre- and post - orthodontic treatment , population studies and forensic identification . stability of medial palatal region has been a subject due to differences among various investigators . christou and kiliardis evaluated the vertical changes in the medial aspects of the rugae and concluded that these changes over time are due to the alterations in the vertical positioning of maxillary incisors and increase in lower face height . growth periods ( 12 - 13 years and > 14 years ) studied in this paper , showed a downward and forward movement of the maxilla in relation to the cranial base and also , changes in the size and shape of maxilla by structural remodeling . these phenomena can be explained by the deposition of new bone on the oral surface of the palate and at the alveolar crest . therefore , the changes in rugae dimensions can be the result of this differential growth in the palate and alveolar crest.[24 ] rugae patterns showed a strong female predilection for rugae with separate origins [ figure 1 ] whereas slightly higher incidences were noted for rugae with common origin , fragmentary and lateral branching patterns . there was an equal percentage of gender with secondary rugae pattern in the ethnic segment of north indian population studied [ table 1 ] . photograph depicting rugae patterns with secondary origin and fragmentary nature the purpose of this paper was to evaluate a cross - sectional patient database to analyze the anteroposterior stability of the medial rugae region . analysis of 100 study casts showed a significant difference in the medial rugae region ( p= 0.03 , 0.02 ) in a and b values . no significant changes were noted in the lateral rugae dimensions . the palate growth in this period was found to be non - significant . hence , it can be surmised from the analysis of the results that there is a differential growth spurt in the anterior and posterior palate during adolescence as is marked by the significant differences in the measurement values obtained through this study . palatal rugae can be studied as a strong indicator of ethnicity , gender differentiation and study of growth changes in the anterior maxilla . thus , rugae are important tools in clinical investigations involving forensic anthropology and developmental biology .

introduction : rugae patterns are significant markers for analyzing anteroposterior changes in adolescence , and forensic investigations.aim:the purpose of this study was to ascertain the gender - wise predisposition of rugae patterns and to analyze anteroposterior alterations along with any developmental changes in palatal depth.materials and methods : one hundred pre - treatment study cast models were obtained from the archives of the department of orthodontics , m.m . cdsr , mullana . parameters employed were : division of medial palatal region into a : distance between incisive papilla length and anterior limit of the anteriormost rugae ; b : distance between incisive papilla and most posterior rugae limits ; measurement of lateral rugae dimensions and palatal depth . statistical analysis : mean s.d . values were obtained and p values calculated.results:comparison of a and b showed a significant difference in the p values between the age - groups 12 - 13 years and > 14 years . rugae patterns with separate origins showed a predisposition for female gender.conclusion:a significant change in the anteroposterior medial rugae dimensions was seen in adolescent age groups alongside no variation in palate depth . hence , it can be concluded that differential growth potential is present in the premaxilla and can cause shift in medial palatal dimensions without altering the rugae patterns and palatal depth .

hypothermia defined as a core body temperature < 35 can be a life - threatening emergency , especially in cold winter climates , but can be used therapeutically . therapeutic hypothermia ( th ) has been used to improve neurological outcome in comatose patients after cardiac arrest.1)2 ) the exact mechanism for neuroprotection is unclear ; potential mechanisms include attenuation of deleterious processes occurring after initial hypoxic tissue injury.3)4)5 ) generally , mild hypothermia is defined as a core body temperature between 32 and 34.2 ) this is thought to be appropriate temperature between neuroprotective effects and possible toxicities . the osborn wave ( also known as the j wave ) it is not pathognomonic of hypothermia , but usually occurs in patients with a core temperature < 32 and the magnitude of the j point elevation correlates inversely with the body temperature.6 ) several studies have suggested an arrhythmogenic potential of the osborn wave,7)8)9)10 ) but there is no solid evidence that th - induced osborn wave itself is associated with increased mortality.11)12 ) here we report a case of recurrent ventricular fibrillation ( vf ) after appearance of osborn wave during mild th . a 56-year - old man with no underlying disease was admitted to the emergency department with sudden cardiac arrest . while having breakfast , he suddenly pounded his chest . he received cardiopulmonary resuscitation ( cpr ) from his son for about 20 minutes until paramedics arrived with a defibrillator . 1 ) . defibrillation with 200 j was delivered once followed by 5 cycles of cpr . following restoration of cardiac rhythm , he was transferred to our hospital for further management . at our hospital , initial ecg ( fig . 2a ) showed sinus tachycardia with a heart rate of 114 beats per minute . on the first day of admission , echocardiography was done , which showed no regional wall motion abnormality of the left ventricle . the initial ph was 7.375 and the levels of electrolytes including sodium , potassium , calcium and magnesium were within the normal ranges . the target temperature was 33. soon after th was begun , osborn waves appeared in lead ii and v 4 , v 5 , and v 6 ( fig . two hours after th , vf occurred when the esophageal temperature was 34.9. defibrillation of 150 j was applied ( fig . 2c ) . not much later atrial fibrillation developed and the osborn waves were prominent in diffuse leads . three more defibrillations were delivered to terminate vf and the height of osborn waves increased over time ( fig . two hours after a warmer was applied to the patient , ecg revealed less prominent osborn wave and vf did not recur . he was diagnosed with idiopathic vf and discharged from our hospital after implantable cardioverter defibrillator insertion ( fig . it is generally accepted that th has the potential to improve the neurological outcome in comatose patients after cardiac arrest.1)2 ) following initial resuscitation , various mechanisms including ischemia , reperfusion injury , inflammatory response , and free radical production are involved in cerebral damage.1)3)5 ) th lowers the cerebral metabolic rate , blocks the apoptotic pathways , suppresses inflammatory responses , and attenuates production of free radicals.3)4)5 ) however , possible side effects , such as electrolyte imbalance , hemodynamic instability , infection , seizures , and arrhythmias , can rarely occur in patients undergoing th.1)2)5 ) electrocardiogram findings of hypothermia include osborn waves , atrial and ventricular dysrhythmias , and interval ( pr , qrs , qt ) prolongations.11)13)14 ) among these , the osborn wave is a positive deflection occurring at the qrs - st junction and may originate from a transmural voltage gradient during early repolarization due to a transient outward potassium current in the epicardium , but not in the endocardium.15 ) as the osborn wave can be seen in various conditions like acidosis , subarachnoid hemorrhage , and hypercalcemia , it is not pathognomonic of hypothermia . but , it has been reported that the height of j point elevation is related with the severity of hypothermia.6 ) several mechanisms have been suggested to explain the arrythmogenic potential of the osborn wave . the prominent action potential notch can lead to loss of the dome of action potential , which can heterogeneously cause a marked dispersion of repolarization . this eventually can cause extrasystolic activity by a mechanism called phase 2 reentry and vf.15)16 ) another proposed mechanism is triggered automaticity . intracellular ca overload during hypothermia is a precursor for early or delayed after depolarization , which is associated with triggered activity.17 ) however , other reports have not associated the osborn wave with vf in hypothermic patients.18 ) therefore , the arrythmogenic potential of the osborn wave requires further study . although various adverse events have been reported during th , th - induced arrhythmia seems not to be related with increased mortality.1)2 ) in one study of ecg changes in th , the osborn wave incidence during th was 30% and no association with unfavorable short - term outcome was evident.11 ) after rewarming , the osborn wave disappears in almost cases . so , on the basis of many studies , th is well tolerated and relatively safe . hypothermia is also proarrhythmic and can cause lethal arrhythmias , especially at low temperature and in the presence of low serum ph.19 ) however , in our case , vf developed in normal serum ph , electrolyte levels , and not markedly low body temperature . therefore , vf and osborn wave seem not always to be related to body temperature , and individual variations in response to hypothermia can be more important to determine the vulnerability to arrhythmias . physicians need to monitor patient 's vital signs including core temperature , ecg , and laboratory tests carefully during th .

therapeutic hypothermia ( th ) has been used to protect neurological functions in cardiac arrest patient . although osborn wave is not pathognomonic of hypothermia , it is a well - known electrocardiogram finding of hypothermic patients . the cellular and ionic mechanisms of the osborn wave have been suggested , and its relationship to tachyarrhythmias , such as ventricular tachycardia and ventricular fibrillation , is being explored . this case highlights the arrhythmogenic potential of osborn wave and individual difference in response of th .

a 56-year - old man suffering from diabetes and hypertension was admitted to the neurology department in a hospital elsewhere with signs of epileptic seizure . after a brief period , a diagnostic laparotomy with gastrotomy was performed , at which over 3 liters of blood were found , but no active bleeding . the site of origin of hemorrhage was suspected at the gastroesophageal junction , although no peptic ulcer could be discovered . gastroscopy was performed 1 day later , demonstrating a large , ulcerating tumor at the cardia , of which biopsies were taken . because the patient was now diagnosed with a bleeding tumor at the gastroesophageal junction , he was transferred to the icu of the canisius - wilhelmina hospital in nijmegen ( in formation with the radboud university hospital comprising the esophagus centre eastern netherlands , scon ) . a computed tomography ( ct ) scan was performed , showing a large tumor at the gastroesophageal junction , extending towards the pancreatic tail ( fig . a second gastroscopy with new biopsies , 8 days later , proved the same results . at the time of the third gastroscopy , a second ct scan revealed a remarkable decline of the entire process , emanating from the pancreatic tail as a pseudocyst ( fig . our patient experienced hypovolemic shock following massive gastrointestinal hemorrhage caused by a burst - through of a pancreatic pseudocyst to the stomach . the incidence of upper gastrointestinal hemorrhage in the netherlands is 45 - 70 per 100,000 per year , most of which are caused by peptic ulcers of the stomach and duodenum . a pseudocyst of the pancreas consists of one or several collections of pancreatic fluid , surrounded by inflamed pancreatic tissues . the wall is formed by the enclosing structures , i.e. stomach , transverse colon or omentum . the pseudocyst is usually connected to the pancreatic duct . the distinctive feature between a genuine cyst and a pseudocyst is the lack of an epithelial layer . pseudocysts of the pancreas arise as a result of episodes of acute pancreatitis or blunt force abdominal trauma . the cause is often disruption or obstruction of the pancreatic duct , with subsequent accumulation of pancreatic fluids , containing high concentrations of pancreatic enzymes . in acute pancreatitis , ( pseudo)cyst and necrosis can be difficult to distinguish by contrast - enhanced ct scan , whereas magnetic resonance imaging ( mri ) is distinctive . pseudocysts can damage adjacent arteries by means of mechanical pressure and digestion by pancreatic enzymes , hereby causing the formation of pseudoaneurysm with possible subsequent hemorrhage into the pancreatic duct . usually , this involves the splenic artery , but also the gastroepiploic arteries and gastroduodenal branches can be affected . the old motto is to drain pseudocysts larger than 6 cm or existing longer than 6 weeks , although literature on the subject scarcely supports this . the possibilities for drainage are to marsupialize the pseudocyst through laparotomy or laparoscopy to the stomach or jejunum , or to perform resection of the pancreatic tail pseudoaneurysms or hemorrhages are eligible for endovascular embolization , and transgastric drainage of cysts is contraindicated during hemorrhages , unless embolization is performed first . case series and case reports in the available literature on hemorrhaging pseudocysts all advocate endovascular embolization , followed by resection of the pancreatic tail [ 5 , 8 , 9 , 10 , 11 , 12 , 13 ] . our patient was diagnosed with hemorrhaging pseudocyst 16 days after admission and initial laparotomy . because of the improving clinical condition and decline of the pseudocyst on ct scan , it was decided to pursue a the initial plan was to perform pancreatic tail resection after clinical recovery ; however , ultrasonography and ct scan revealed a rapid decline and full disappearance of the pseudocyst . our patient made a full recovery and has adjusted his life style . in all case reports , operative intervention is advocated , precipitated by endovascular embolization in case of serious hemodynamic instability . one case series of 16 patients reports a 62% mortality rate , in which endovascular embolization is combined with pancreatic tail resection . there is evidence to support the role of angiography in case of acute upper gastrointestinal hemorrhage , simultaneously offering the possibility for endovascular treatment [ 2 , 5 , 8 , 9 , 10 , 11 , 12 , 13 ] . embolizing the splenic artery does not inevitably necessitate splenectomy , for the remaining blood supply to the spleen is routed through the vasa brevia , which should be sufficient . furthermore , the course of our patient proves that surgical intervention such as pancreatic tail resection is not always an absolute necessity . however , surgery is nowadays not the only option for treatment , as possibilities in radiological endovascular diagnostics and techniques are increasing and will eventually be the first step in treating acute upper gastrointestinal hemorrhage .

acute upper gastrointestinal tract hemorrhage represents a frequent morbidity which can be localized and treated endoscopically . when endoscopic treatment alone is failing , radiological or surgical treatment may be warranted . a case history will be presented regarding a rare cause of intestinal hemorrhage with an extraordinary course of illness .

adenomatoid odontogenic tumor ( aot ) is a benign , slow - growing , and noninvasive odontogenic lesion associated with an impacted tooth . the presence of so - called unique duct - like structures under microscope imparts the tumor a glandular , i.e. , adenomatoid appearance . the tumor is also known as two third 's tumor because about 2/3 cases occur in maxilla , about 2/3 cases are diagnosed in young females during the second decade , 2/3 cases are associated with an impacted tooth and in 2/3 cases , impacted tooth is canine . we present a case of unusually large aggressive aot in the maxilla associated with impacted third molar . a 19-year - old male reported with a chief complaint of painless mass over the left side of face and upper left back tooth region since 6 months . initially , pea - sized and asymptomatic swelling appeared in upper left back tooth region . three months later , swelling also appeared below left eye , initially pea - sized . he gave h / o exfoliation of multiple teeth from the same region within these 6 months . on examination , solitary , smooth , roughly spherical - shaped swelling was present on the left side of face below eye . swelling extends from infraorbital region until malar prominence and from medial to lateral corner of left eye measuring approximately 5.0 cm 5.0 cm in maximum dimensions . there was marked obliteration of palpebral fissure of the left eye [ figure 1a ] . intraorally , there was a solitary roughly oval - shaped growth in the left maxillary region , obliterating the buccal vestibule . growth was extending from canine region till retromolar area along alveolar ridge measuring approximately 7 cm 4 cm . overlying mucosa was erythematous , edematous , and inflamed . both extraorally and intraorally , swelling was firm , noncompressible , nonfluctuant , nontender , nonreducible , and nonpulsatile . ( b ) intraoral photograph showing lesion involving palate , alveolar ridge , and buccal vestibule orthopantomogram revealed a huge , diffuse radiolucent lesion extending throughout left maxilla from canine till retromolar region . the lesion was associated with an impacted permanent upper left third molar , which was found to be present below floor of the orbit . computed tomography scan [ figure 3a c ] demonstrated a large cystic expansile radiolucent lesion with flecks of calcification of varying sizes . the buccal and palatal bony expansion was remarkable , and resorption of bone with perforation was evident . maxillary sinus was completely opaque . on the basis of these radiological findings , aot and pindborg tumor orthopantomogram showing a large radiolucent lesion involving left maxilla , and impacted upper left third molar teeth displaced below floor of orbit by the lesion ( red circle ) ( a - c ) computed tomography scan revealing the expansile radiolucent lesion with few radio - opaque flakes . there is remarkable bony expansion and thinning and discontinuity of the palatal and buccal cortices . having accessed the tumor extraorally as well as intraorally , subtotal maxillectomy was performed , and the involved teeth were also removed [ figure 4b ] . the surgical defect was simultaneously reconstructed using temporalis myofascial flap [ figure 4d ] healing was uneventful . six months after surgery , computed tomogram was done which revealed complete eradication of the lesion [ figure 5a c ] . there was no evidence of any recurrence 1 year after the surgery [ figure 6a and b ] . ( a - d ) operative photographs ( a - c ) six months postoperative computed tomogram shows normal healing and no signs of recurrence ( a ) one year follow - up photograph . ( b ) one year follow - up intraoral photograph with normal healing histological examination revealed a partially cyst - like cavity lined with the fibrous capsule . rounded and rosette - like aggregates of odontogenic epithelial cells with sparse areas of eosinophilic material could be visualized . the characteristic rounded and rosette form lined with a single layer of polarised cuboidal or columnar epithelium cells giving it the adenomatoid appearance ( h and e , 400 ) aot has three clincopathological variants , namely intraosseous follicular ( 73% ) , intraosseous extrafollicular ( 24% ) , and peripheral ( 3% ) . the intraosseous follicular type is associated with an impacted tooth as in our case , whereas the intraosseous extrafollicular type has no association with an impacted tooth and the peripheral variant is soft tissue component , attached to the gingival structures . the lesion often leads to the expansion of the involved bone and the displacement of the adjacent teeth . owing to the slow growing and painless nature of the tumor , the patients tolerate the swelling for a long duration , sometimes years until it produces an obvious esthetic deformity . it may rarely show aggressive nature such as gaining unusually large size or extending into the intracranial space . radiographically , the lesion often demonstrates as a unilocular radiolucency associated with an impacted tooth . in certain cases , small radiopaque spots ( calcifications ) differential diagnosis of aot includes dentigerous cyst , calcifying odontogenic cyst ( coc ) , calcifying odontogenic tumor ( cot ) ( pindborg tumor ) , and odontogenic keratocyst . radiolucency with multiple radiopaque foci ( particularly when the radiolucency surrounds a portion of the root or entire tooth ) is suggestive of an aot rather than a coc / cot . histologically , aot is mostly surrounded by a well - developed fibrous connective tissue capsule . the tumor is usually composed of spindle - shaped or polygonal cells forming sheets , rosettes or whorled masses in a sparse connective tissue stroma . the amorphous eosinophilic material is present between the epithelial cells as well as in the center of these rosette - like structures . the large size of this lesion has been attributed to a higher growth rate in younger patients and a delay in seeking treatment . however , in our case , the lesion was extremely large in size and expansile . therefore , subtotal maxillectomy with simultaneous reconstruction of surgical defect with temporalis myofascial flap was planned and carried out . the case presented is rare in occurrence because of certain atypical features such as unusual large size , aggressive behavior , the involvement of maxillary third molar , third molar present below floor of orbit , significant bony expansion , and cortical perforation . under general anesthesia , the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .

adenomatoid odontogenic tumor ( aot ) is a rare tumor comprising only 3% of all odontogenic tumors . it is a benign , encapsulated , noninvasive , nonaggressive , slowly growing odontogenic lesion associated with an impacted tooth . these lesions may go unnoticed for years . the usual treatment is enucleation and curettage , and the lesion does not recur . here , we present a rare case of an unusually large aggressive aot of maxilla associated with impacted third molar . the authors also discuss clinical , radiographic , histopathologic , and therapeutic features of the case . subtotal maxillectomy with simultaneous reconstruction of the surgical defect with temporalis myofascial flap was planned and carried out .

marks ( 2015 ) review and analysis significantly advances the understanding of the obesity epidemic by ( a ) identifying the factors that could be at the origin of weight gain and clarifying how they contribute to the obesity epidemic ; ( b ) highlighting the distinction between factors that contribute to initial weight gain , as well as to the processes involved in the circle of discontent ( cod ) ; ( c ) describing the psychological and health problems that result from weight gain and obesity and ( d ) proposing prevention strategies . although we applaud the article s advancement in the field , we nevertheless see some issues that may benefit from a different perspective . our differences with marks largely revolve around his conceptualization of the motivational processes underlying eating regulation and the factors that could lead to successful , versus unsuccessful self - regulation . in general , we believe that marks model focuses almost entirely on environmental factors that may derail the internal process of homeostatic regulation , resulting in the development of obesity . consequently , the strategies proposed to circumvent the obesity epidemic are aimed at legislations , public policies and facilitating conditions ( see also gearhardt et al . , 2012 ; pomeranz and brownell , 2012 ) . the notion that behaviour should be regulated by homeostasis is nearly a truism ; people should be motivated to eat when they are hungry and stop when they are satiated . unfortunately , many people find it challenging to regulate their eating behaviours and , more so , to sustain this over a long period of time . why is this ? marks ( 2015 ) proposes that over - consumption of high - caloric , low - nutrient foods with low satiating power explains why people initially gain weight , and that the resulting body dissatisfaction and negative affect lead people to consume even more high - density foods and beverages . once people reach that stage , they gain more weight , become more dissatisfied with their bodies and feel even worse about themselves . consequently , they attempt to control their weight through different means , which aggravates the problem and leads to more weight gain and , eventually , obesity . although we agree with marks that a considerable amount of research supports these processes and the association between the variables included in the cod , this view could be problematic for several reasons : ( a ) it does not explain why some people exposed to the same conditions ( e.g. abundance of unhealthy foods , negative life events ) do not gain weight and become obese ; ( b ) it suggests that the individual has a limited capacity to self - regulate ; ( c ) it devotes very little attention to the psychological resources needed for long - term maintenance and ( d ) it emphasizes strategies to prevent obesity that do not consider individuals as active agents of their own behaviours . we propose that an important aspect of fighting obesity is determining the psychological factors that explain why some individuals may be less susceptible to the processes described in marks theory and how this relates to their motivation to regulate their eating behaviours ( patrick and williams , 2012 ; pelletier et al . we believe that people have the potential to play an active role in the regulation of their eating behaviours , above and beyond what was proposed in marks model . for instance , individuals can plan their eating behaviours on a daily basis by preparing grocery lists and planning daily or weekly meals ( otis and pelletier , 2008 ) . they can also engage in activities that are conducive to the achievement of their goals ( e.g. to be healthy ) ( pelletier and dion , 2007 ) , that are integrated with other goals and values ( e.g. improving nutrition for family members ) or that are intrinsically enjoyable ( e.g. making meals special family time ) ( pelletier et al . , 2004 ) . in agreement with self - determination theory ( sdt ; deci and ryan , 2000 ) , people differ in their reasons for engaging in their nutritional choices and these reasons correspond to the level of autonomy they experience in that life domain . when someone has a more autonomous motivation orientation for a behaviour , they engage in that behaviour for the pleasure , interest and satisfaction derived from the behaviour itself ; because it is consistent with other values in their self - system ; and it is congruent with their values and goals ( e.g. eating a plant - based diet because you view yourself as a healthy individual that is environmentally conscious ) . when someone has a more controlling motivation orientation for a behaviour , they perform that behaviour because of self - imposed pressures such as guilt or anxiety ( ryan and connell , 1989 ) or they want to achieve a reward or avoid a punishment ( e.g. eating behaviours engaged in to avoid feeling ashamed for not eating healthy ) . people who have an autonomous orientation , versus a controlled orientation , assume greater responsibility for their actions because they have personally endorsed their course . autonomously motivated behaviours are better maintained because they are either inherently enjoyable or are well internalized into the person s sense of self ( ryan and deci , 2006 ) . in relation to eating , autonomously motivated eating behaviours lead to better regulation of eating and weight management ( pelletier et al . , 2004 ) and more sustained regulation over time ( guertin et al . , 2015 ) . in sum , we believe that the form of regulation portrayed by marks ( 2015 ) corresponds to controlled regulations and although the model could explain why some people fail to regulate their eating behaviours , it falls short when trying to explain why some people succeed and , most importantly , how this pattern could be prevented and even reversed . like several other researchers before him ( dittmar , 2005 ; levine and harrison , 2004 ; polivy and herman , 2004 ) , marks ( 2015 ) suggests that body image , sociocultural pressures about body image and the internalization of the thin - ideal represent risk factors for body dissatisfaction and lead to several eating - related problems ( levine and piran , 2004 ; stice , 2002 ) . pelletier and dion ( 2007 ) have examined how sdt could contribute to our understanding of the associations between these risks factors by examining how motivation at two different levels ( life in general and in the context of eating ) could explain why some people differ in their responses to sociocultural pressures and messages related to body image . their results suggest that an autonomous motivation orientation at the general level can help people protect against pressures related to body image and endorsement of society s beliefs about thinness and obesity and has a direct influence on their motivation towards eating behaviour . specifically , autonomous motivation at the general level is positively associated with autonomous motivation for healthy eating behaviour , which leads to increased healthy eating , and negatively associated with controlled motivation of eating behaviours , which is associated with dysfunctional and unhealthy eating . overall , these results suggest that a general autonomous motivation orientation may serve as a buffer against sociocultural pressures and messages of thinness and promote autonomous motivation towards healthy eating , which is in accordance with one s own integrated values , instead of a response to external controlling forces . as a contrast , it appears that body dissatisfaction resulting from pressures about body image and endorsement of society s beliefs about thinness and obesity may be more closely associated with controlled motivation towards eating behaviours , which may explain its relation with eating pathology . thus , the more people are autonomous in their life in general and , as well as towards their eating , the less likely they are to perceive sociocultural messages about body image as a source of pressure , but instead , as information that they are free to use or dismiss . although we agree with the four prevention strategies proposed by marks ( 2015 ) , we fail to see how they could lead to behaviour change and , more importantly , to sustained self - motivation for health behaviours . environmental changes such as those proposed by marks may be slow to implement , can be very expensive and could be stalled by industries with competing interests ( pomeranz and brownell , 2012 ) . therefore , it might be important to develop strategies that emphasize self - regulatory processes that help individuals become active agents in their own behaviours in the pursuit of healthy and sustained eating behaviour changes . a critical point is that both individual - based and population - based initiatives to fight obesity should be guided by information campaigns to promote healthy eating which apply sound theory - based motivational principles . for instance , providing people with strategic messages is often perceived as an important step to motivate people to change a specific behaviour . one systematic approach that could be used to facilitate behaviour change consists in tailoring persuasive messages in function of the processes that underlie behaviour change ( i.e. detecting a problem , deciding on a course of action and implementing a behaviour ) and framing persuasive messages in terms of whether they serve autonomous ( health , well - being , personal growth ) or controlling ( physical appearance and appealing to others ) goals . regarding message framing , research suggests that when a goal is framed as a function of autonomous motives , relative to controlling motives , it should lead to more engagement in an activity , more persistence over time and its effects should generalize to health - related behaviours ( pelletier and sharp , 2008 ) . in summary , although we commend marks for the contributions to the obesity literature , we highlight three points that should be considered when attempting to explain and propose solutions for the obesity epidemic . greater emphasis should be placed on the role the individual plays in regulating their own eating behaviours , with less responsibility attributed to external sources , in order to facilitate feelings of self - control and accountability . a substantial base of research has indicated that there are multiple forms of motivation that differ in their degree of internalization and result in very different outcomes , with autonomous motives leading to desirable outcomes , and controlled or amotivated motives resulting in less desirable consequences . instead of simply de - valorizing the thin - ideal , messages about eating should be designed to highlight autonomous goals and motives ( e.g. pleasure , health , personal development or family time ) in order to facilitate sustained changes in eating behaviours .

in his article , homeostatic theory of obesity , marks suggested that imbalances in homeostatic processes could explain weight gain and obesity . he proposes that over - consumption of high - caloric , low - nutrient and low satiating foods , combined with a stressful environment , is the origin of weight gain . once weight gain occurs , individuals may develop body dissatisfaction and negative affect , leading to continued over - consumption , which sets in motion a system of feedback loops that leads to a circle of discontent and further weight gain . in this article , we attempt to clarify certain problematic aspects of marks framework and identify specific directions that researchers should pursue to address these shortcomings .

mr images of the liver were retrospectively reviewed alongside clinical findings in 50 children and young adults with wilson 's disease ( m : f = 33:17 ; age range , 5 - 26 years ; median age , 14 years ) . the database of the computed hospital information system was cross - referenced with the mr imaging database to identify all patients with wilson 's disease who had undergone mr imaging of the liver at the institution over the course of a 10-year period from january 1997 to january 2007 . the institutional review board approved the review of the radiological and clinical data for this study and waived the requirement for patient informed consent . wilson 's disease was diagnosed based on a combination of low serum ceruloplasmin levels accompanied with elevated 24-hour urinary copper excretion ( n = 50 ) , as well as the presence of a kayser - fleischer ( k - f ) ring ( n = 28 ) , and a liver biopsy ( n = 12 ) . patients were classified at the time of diagnosis as having neurological ( either current clinical or historical evidence of neurological dysfunction which was not associated with symptomatic liver disease ) and non - neurological presentation , including hepatic ( an increase in serum transaminase levels , acute / chronic hepatitis or cirrhosis ) and asymptomatic presentation ( siblings of index cases with no disease - related symptoms ) ( 6 ) . the hepatic function of the each patient was categorized into three groups ( class a , b and c ) according to the child - turcotte - pugh score ( 5 to 15-point scale ) ( 15 ) . twenty - two patients had been treated with copper chelators , d - penicillamine ( n = 16 ) , or trientine ( n = 6 ) ( median duration of treatment : 6 years , range : 0.5 - 12 years ) at the time of mr imaging . another 28 patients were diagnosed with wilson 's disease at the time of mr imaging and was administered any copper chelating agents . all patients were followed at the pediatric outpatient clinic , and follow - up mr images were available for 17 patients . all examinations were obtained using 1.0 or 1.5 tesla mr scanners ( siemens medical systems , erlangen , germany ) . this retrospective data collection was preceded by the various mr imaging protocols for the liver . however , the studies included the following mr sequences : an axial t2-weighted fast spin - echo sequence ( repetition time msec / echo time msec , 3500 - 5000/96 - 144 ) and an axial t1-weighted spin echo sequence ( repetition time msec / echo time msec , 410 - 530/1.5 - 2.2 ) with a 7 mm thickness , 1 - 2-mm gap , 256 256 matrix size and field - of - view , 240 320 . two radiologists , each with more than seven years of experience in mr body imaging , retrospectively evaluated the mr images . the two readers evaluated the mr images for ( a ) the presence and pattern of intrahepatic nodules , ( b ) the contour abnormalities of the liver and ( c ) additional findings such as a gallbladder abnormality , splenomegaly , venous collateral formation , or ascites . a three - point scoring system was used to evaluate the pattern of intrahepatic nodules as follows : 0 for none , 1 for granular ( 3 mm in diameter ) , and 2 for macronodular ( > 3 mm in diameter ) ( fig . 1 ) . we evaluated the signal intensity of the nodules on t1-weighted images in comparison to the underlying liver parenchyma . the various contour abnormalities of the liver identified included surface nodularity , gallbladder fossa widening , and caudate hypertrophy . surface nodularity of the liver and the gallbladder fossa widening were assessed subjectively by the evaluation of irregularities along the liver surface and enlargement of the pericholecystic space ( i.e. , the gallbladder fossa ) , respectively . caudate hypertrophy was evaluated using a modified caudate - right lobe ratio ( 16 ) . twenty follow - up mr examinations obtained from 17 patients over a 10-year period ( mean interval 28 months , range , 8 - 130 months ) were also evaluated with the same mr interpretation protocols . nine patients underwent mr imaging , before and after treatment , using copper chelating agents . in the eight remaining patients , both initial and follow - up mr examinations were obtained during treatment with copper chelating agents . the prevalence of the mr imaging findings was estimated as a percentage of the patients displaying each abnormality . the overall association between the mr findings and clinical presentations ( neurological or non - neurological ) , or severity of hepatic dysfunction ( child - pugh classification a , b , c ) , was assessed with a contingency table , employing the chi - squared and fisher 's exact tests . the association of clinical features for both clinical presentations was also evaluated by chi - squared and fisher 's exact probability tests . differences in age and duration of treatment were compared for both groups of clinical presentation , three groups of hepatic dysfunction , and type of mr finding using non - parametric probability tests ( mann - whitney or kruskal - wallis ) . all p - values were based on two tailed comparisons and a 5% confidence - level was considered to indicate a statistically significant difference . statistical analyses were performed with spss 7.5 for windows ( spss , chicago , il ) . mr images of the liver were retrospectively reviewed alongside clinical findings in 50 children and young adults with wilson 's disease ( m : f = 33:17 ; age range , 5 - 26 years ; median age , 14 years ) . the database of the computed hospital information system was cross - referenced with the mr imaging database to identify all patients with wilson 's disease who had undergone mr imaging of the liver at the institution over the course of a 10-year period from january 1997 to january 2007 . the institutional review board approved the review of the radiological and clinical data for this study and waived the requirement for patient informed consent . wilson 's disease was diagnosed based on a combination of low serum ceruloplasmin levels accompanied with elevated 24-hour urinary copper excretion ( n = 50 ) , as well as the presence of a kayser - fleischer ( k - f ) ring ( n = 28 ) , and a liver biopsy ( n = 12 ) . patients were classified at the time of diagnosis as having neurological ( either current clinical or historical evidence of neurological dysfunction which was not associated with symptomatic liver disease ) and non - neurological presentation , including hepatic ( an increase in serum transaminase levels , acute / chronic hepatitis or cirrhosis ) and asymptomatic presentation ( siblings of index cases with no disease - related symptoms ) ( 6 ) . the hepatic function of the each patient was categorized into three groups ( class a , b and c ) according to the child - turcotte - pugh score ( 5 to 15-point scale ) ( 15 ) . twenty - two patients had been treated with copper chelators , d - penicillamine ( n = 16 ) , or trientine ( n = 6 ) ( median duration of treatment : 6 years , range : 0.5 - 12 years ) at the time of mr imaging . another 28 patients were diagnosed with wilson 's disease at the time of mr imaging and was administered any copper chelating agents . all patients were followed at the pediatric outpatient clinic , and follow - up mr images were available for 17 patients . all examinations were obtained using 1.0 or 1.5 tesla mr scanners ( siemens medical systems , erlangen , germany ) . this retrospective data collection was preceded by the various mr imaging protocols for the liver . however , the studies included the following mr sequences : an axial t2-weighted fast spin - echo sequence ( repetition time msec / echo time msec , 3500 - 5000/96 - 144 ) and an axial t1-weighted spin echo sequence ( repetition time msec / echo time msec , 410 - 530/1.5 - 2.2 ) with a 7 mm thickness , 1 - 2-mm gap , 256 256 matrix size and field - of - view , 240 320 . two radiologists , each with more than seven years of experience in mr body imaging , retrospectively evaluated the mr images . the two readers evaluated the mr images for ( a ) the presence and pattern of intrahepatic nodules , ( b ) the contour abnormalities of the liver and ( c ) additional findings such as a gallbladder abnormality , splenomegaly , venous collateral formation , or ascites . a three - point scoring system was used to evaluate the pattern of intrahepatic nodules as follows : 0 for none , 1 for granular ( 3 mm in diameter ) , and 2 for macronodular ( > 3 mm in diameter ) ( fig . 1 ) . we evaluated the signal intensity of the nodules on t1-weighted images in comparison to the underlying liver parenchyma . the various contour abnormalities of the liver identified included surface nodularity , gallbladder fossa widening , and caudate hypertrophy . surface nodularity of the liver and the gallbladder fossa widening were assessed subjectively by the evaluation of irregularities along the liver surface and enlargement of the pericholecystic space ( i.e. , the gallbladder fossa ) , respectively . caudate hypertrophy was evaluated using a modified caudate - right lobe ratio ( 16 ) . twenty follow - up mr examinations obtained from 17 patients over a 10-year period ( mean interval 28 months , range , 8 - 130 months ) were also evaluated with the same mr interpretation protocols . nine patients underwent mr imaging , before and after treatment , using copper chelating agents . in the eight remaining patients , both initial and follow - up mr examinations were obtained during treatment with copper chelating agents . the prevalence of the mr imaging findings was estimated as a percentage of the patients displaying each abnormality . the overall association between the mr findings and clinical presentations ( neurological or non - neurological ) , or severity of hepatic dysfunction ( child - pugh classification a , b , c ) , was assessed with a contingency table , employing the chi - squared and fisher 's exact tests . the association of clinical features for both clinical presentations was also evaluated by chi - squared and fisher 's exact probability tests . differences in age and duration of treatment were compared for both groups of clinical presentation , three groups of hepatic dysfunction , and type of mr finding using non - parametric probability tests ( mann - whitney or kruskal - wallis ) . all p - values were based on two tailed comparisons and a 5% confidence - level was considered to indicate a statistically significant difference . statistical analyses were performed with spss 7.5 for windows ( spss , chicago , il ) . at the time of diagnosis , 12 patients presented with neurological dysfunction , compared to 38 patients who presented with non - neurological manifestations ( 33 patients with hepatic dysfunction and five asymptomatic siblings of index cases ) . the k - f ring was most common in the neurological presentation ( 92% , 11 of 12 ) relative to non - neurological presentation ( 45% ; 17 of 38 ; p = 0.006 ) . there were no statistically significant differences between sex , age , presence of medical treatment , and duration of treatment among both clinical presentations ( table 1 ) . patient hepatic function was categorized as child - pugh class a in 36 patients , child - pugh class b in five patients , and child - pugh class c in nine patients . mean age at diagnosis was 11.1 years in class a , 13.4 years in class b , and 17.0 years in class c. a statistically significant difference was noted for age at mr imaging among the three groups of child - pugh classification ( p = 0.036 ) . all of the patients with a neurological presentation were categorized as class a. another 38 patients with non - neurological presentation were categorized as class a ( n = 24 , 63% ) , class b ( n = 5 , 13% ) , and class c ( n = 9 , 24% ) . there was a statistically significant difference for child - pugh classification between neurological and non - neurological presentations ( p = 0.048 ) . the nodules were granular ( grade 1 , 3 mm in diameter ) in 13 patients ( figs . these nodules were hyperintense ( n = 14 ) or isointense , or slightly hypointense ( n = 11 ) as seen on t1-weighted images ( figs . thirty - one patients ( 62% ) showed contour abnormalities such as surface nodularity ( n = 25 ) , caudate hypertrophy ( n = 10 ) , or gallbladder fossa widening ( n = 29 ) ( figs . 3 , 4 ) . ascites , venous collaterals , and splenomegaly were observed in seven patients , 10 patients , and 40 patients , respectively . edematous wall thickening of the gallbladder was observed in 12 patients , and a gallbladder stone or sludge in three patients ( fig . a , hypointense nodules as seen on t2-weighted images , were detected in 12 patients ( 33% ) ( grade 1 [ n = 9 , 25% ] and grade 2 [ n = 3 , 8% ] ) . contour abnormalities of the liver were noted in 17 patients ( 47% ) . in the five patients categorized as child - pugh class b , hypointense nodules as seen on t2-weighted images , and contour abnormalities of the liver macronodular lesions ( grade 2 , > 3 mm in diameter ) were observed in three patients ( 60% ) ( fig . 3 ) . in the nine patients categorized as child - pugh class c , hypointense nodules as seen on t2-weighted images and contour abnormalities of the liver 4 ) . each mr imaging finding demonstrated a statistically significant difference among the three groups of child - pugh classification except for splenomegaly ( p = 0.243 ) . a summary of the mr findings and association of mr findings with the severity of hepatic dysfunction are listed in table 2 . for each mr imaging finding , mean age at mr examination was greater in patients with a positive finding than those with negative findings , and were statistically significant except in hyperintense nodules on t1-weighted images ( p = 0.113 ) ( table 3 ) . in the patients belonging to child - pugh class a ( n = 36 ) , mr findings such as intrahepatic nodules ( p = 0.007 ) , surface nodularity ( p = 0.011 ) , and gallbladder fossa widening ( p < 0.001 ) demonstrated a statistically significant difference between patients with neurological presentation and non - neurological presentation . other mr findings did not present a statistically significant difference between neurological presentation and non - neurological presentation ( table 4 ) . twenty follow - up mr examinations obtained from 17 patients demonstrated improved hepatic nodular infiltrations for eight patients , aggravated intrahepatic nodules and/or cirrhosis for four patients , and a stationary state of imaging features for five patients ( fig . in the eight patients with improved nodular lesions , all of them showed improved hepatic dysfunction ( normalized serum transaminase level , n = 5 ; improved hyperbilirubinemia , n = 1 ; improved coagulation abnormality , n = 2 ) . in four patients with aggravated nodular lesions and/or cirrhosis , newly appeared intrahepatic nodules were detected in two patients , whereas aggravated intrahepatic nodules and cirrhosis were observed in two patients . among these four patients , two patients underwent liver transplantation ( fig . at the time of diagnosis , 12 patients presented with neurological dysfunction , compared to 38 patients who presented with non - neurological manifestations ( 33 patients with hepatic dysfunction and five asymptomatic siblings of index cases ) . the k - f ring was most common in the neurological presentation ( 92% , 11 of 12 ) relative to non - neurological presentation ( 45% ; 17 of 38 ; p = 0.006 ) . there were no statistically significant differences between sex , age , presence of medical treatment , and duration of treatment among both clinical presentations ( table 1 ) . patient hepatic function was categorized as child - pugh class a in 36 patients , child - pugh class b in five patients , and child - pugh class c in nine patients . mean age at diagnosis was 11.1 years in class a , 13.4 years in class b , and 17.0 years in class c. a statistically significant difference was noted for age at mr imaging among the three groups of child - pugh classification ( p = 0.036 ) . all of the patients with a neurological presentation were categorized as class a. another 38 patients with non - neurological presentation were categorized as class a ( n = 24 , 63% ) , class b ( n = 5 , 13% ) , and class c ( n = 9 , 24% ) . there was a statistically significant difference for child - pugh classification between neurological and non - neurological presentations ( p = 0.048 ) . the nodules were granular ( grade 1 , 3 mm in diameter ) in 13 patients ( figs . 1a , 2a ) , or macronodular ( grade 2 , > 3 mm in diameter ) in 12 patients ( figs . these nodules were hyperintense ( n = 14 ) or isointense , or slightly hypointense ( n = 11 ) as seen on t1-weighted images ( figs . thirty - one patients ( 62% ) showed contour abnormalities such as surface nodularity ( n = 25 ) , caudate hypertrophy ( n = 10 ) , or gallbladder fossa widening ( n = 29 ) ( figs . 3 , 4 ) . ascites , venous collaterals , and splenomegaly were observed in seven patients , 10 patients , and 40 patients , respectively . edematous wall thickening of the gallbladder was observed in 12 patients , and a gallbladder stone or sludge in three patients ( fig . in the 36 patients belonging to child - pugh class a , hypointense nodules as seen on t2-weighted images , were detected in 12 patients ( 33% ) ( grade 1 [ n = 9 , 25% ] and grade 2 [ n = 3 , 8% ] ) . contour abnormalities of the liver were noted in 17 patients ( 47% ) . in the five patients categorized as child - pugh class b , hypointense nodules as seen on t2-weighted images , and contour abnormalities of the liver macronodular lesions ( grade 2 , > 3 mm in diameter ) were observed in three patients ( 60% ) ( fig . 3 ) . in the nine patients categorized as child - pugh class c , hypointense nodules as seen on t2-weighted images and contour abnormalities of the liver 4 ) . each mr imaging finding demonstrated a statistically significant difference among the three groups of child - pugh classification except for splenomegaly ( p = 0.243 ) . a summary of the mr findings and association of mr findings with the severity of hepatic dysfunction are listed in table 2 . for each mr imaging finding , mean age at mr examination was greater in patients with a positive finding than those with negative findings , and were statistically significant except in hyperintense nodules on t1-weighted images ( p = 0.113 ) ( table 3 ) . in the patients belonging to child - pugh class a ( n = 36 ) , mr findings such as intrahepatic nodules ( p = 0.007 ) , surface nodularity ( p = 0.011 ) , and gallbladder fossa widening ( p < 0.001 ) demonstrated a statistically significant difference between patients with neurological presentation and non - neurological presentation . other mr findings did not present a statistically significant difference between neurological presentation and non - neurological presentation ( table 4 ) . twenty follow - up mr examinations obtained from 17 patients demonstrated improved hepatic nodular infiltrations for eight patients , aggravated intrahepatic nodules and/or cirrhosis for four patients , and a stationary state of imaging features for five patients ( fig . in the eight patients with improved nodular lesions , all of them showed improved hepatic dysfunction ( normalized serum transaminase level , n = 5 ; improved hyperbilirubinemia , n = 1 ; improved coagulation abnormality , n = 2 ) . in four patients with aggravated nodular lesions and/or cirrhosis , newly appeared intrahepatic nodules were detected in two patients , whereas aggravated intrahepatic nodules and cirrhosis were observed in two patients . among these four patients , in wilson 's disease , asymptomatic hepatic copper deposition in liver cells occurs early in the disease 's progression , predominantly in the periportal regions and along the hepatic sinusoids ( 17 , 18 ) . after episodes of acute hepatitis , which may be reflected by elevated plasma levels of liver enzymes , a fatty change and periportal inflammation can develop . finally , after several years , insidious development of irreversible cirrhosis occurs ( 19 ) . in a large cohort study of patients with wilson 's disease , liver biopsies revealed variable hepatic involvement in 37% of patients presenting cirrhosis , 36% at an unspecified stage of fibrosis , and 54% with steatosis ( 20 ) . considering the variable hepatic involvement , various imaging findings of the liver in wilson 's disease are demonstrated ( 8 - 13 ) . recently , akhan et al . ( 14 ) reported that wilson 's disease should be considered as one of the leading diagnoses of young patients with a perihepatic fat layer , parenchymal heterogeneity with multiple nodules , and the absence of caudate lobe hypertrophy . it also suggested that us seemed to be the best imaging modality for the demonstration of early parenchymal alteration . in this study , hypointense nodules on t2-weighted images , surface nodularity of the liver , and gallbladder fossa widening were common mr imaging findings in patients with wilson 's disease , and these correlated with severity of hepatic dysfunction . among the patients with normal or mild hepatic dysfunction ( child - pugh class a ) , the mr findings were more common in patients with the neurological manifestations than the non - neurological manifestations of wilson 's disease . therefore , it is postulated that neurological dysfunction , which was not associated with symptomatic liver disease , might be related with hepatic copper accumulation and subsequent hepatic parenchymal changes . hepatic nodules in wilson 's disease are considered as a result of copper deposition . on mr imaging , these lesions typically appear as hypointense on t2-weighted images and hyperintense on t1-weigthed images ( 9 , 14 ) . in this study , the paramagnetic effect of ionic copper has been implicated as a cause of hypointensity , as was observed on t2-weighted images and hyperintensity as observed on t1-weighted images . however , the t1-shortening and t2-shortening effect of copper deposition may be nullified by elevated t1 and t2 values in advanced cirrhosis ( 17 ) . multiple hypoinstense nodules of the liver were noted in 33% of patients with early stage of hepatic dysfunction ( child - pugh class a ) before advanced cirrhosis . in patients with advanced hepatic dysfunction ( child - pugh classes b and c ) , hypointense nodules of the liver were noted in 93% ( 13 of 14 ) of the patients and 50% of the nodules were macronodular ( > 3 mm in diameter ) and were observed as hyperintense on t1-weighted images . contour abnormalities of the liver due to parenchymal necrosis , regeneration , and scarring that suggest cirrhosis were correlated with hepatic dysfunction in this study . the expanded gallbladder fossa sign has been reported to be a highly specific mr sign for the diagnosis of cirrhosis , and consists of the enlargement of the pericholecystic space ( i.e. , the gallbladder fossa ) ( 21 ) . this is comparable to the finding of a thickened perihepatic fat layer as described by akhan et al . right lobe ratio has been reported as a unique feature of cirrhosis in wilson 's disease ( 14 ) . in this study , caudate hypertrophy was less common ( 20% of patients ) relative to other imaging features that were suggestive of cirrhosis . however , an explanation is not postulated for the mechanism of lobar dysmorphism of the liver in these patients . ( 22 ) reported that mr imaging of the brain depicts the reversible changes of the involved brain parenchyma after copper chelating therapy . reversible changes of copper deposition in the liver have been rarely reported ( 12 , 14 , 23 ) . in this study , follow - up mr images of the liver demonstrated improved intrahepatic nodules in 47% ( 8 of 17 ) of patients after copper chelating therapy with clinical improvement of liver function . follow - up mr examinations also demonstrated aggravated nodular infiltrations and progressed contour abnormalities of cirrhosis in four patients with rapidly progressive hepatic dysfunction . from this point of view , mr imaging may be used as an indicator of therapeutic response in wilson 's disease . the child - pugh classification was used in the evaluation of clinical status of wilson 's disease , which only reflects hepatic dysfunction . serum ceruloplasmin and copper levels , as well as the 24-hour urinary copper level were not considered . although 50 patients with wilson 's disease were included in the study , most of the patients were child - pugh class a , and only 25% of the patients were child - pugh class b or c. therefore , an error in the statistical analysis was inevitable . second , the mr protocol could not be uniformly assumed , as the study included retrospective data collection for a 10-year span . third , interobserver or intraobserver variance analyses were not performed for the mr imaging interpretation . in conclusion , mr imaging of the liver in wilson 's disease demonstrated multiple , hypointense nodules on t2-weighted images , as well as contour abnormalities of the liver suggestive of cirrhosis .

objectiveto determine whether there is a correlation between liver mr findings and the clinical manifestations and severity of liver dysfunction in patients with wilson 's disease.materials and methodstwo radiologists retrospectively evaluated mr images of the liver in 50 patients with wilson 's disease . the institutional review board approved this retrospective study and informed consent was waived . mr images were evaluated with a focus on hepatic contour abnormalities and the presence of intrahepatic nodules . by using fisher 's exact test , mr findings were compared with clinical presentations ( neurological and non - neurological ) and hepatic dysfunction , which was categorized by the child - pugh classification system ( a , b and c ) . follow - up mr images were available for 17 patients.resultscontour abnormalities of the liver and intrahepatic nodules were observed in 31 patients ( 62% ) and 25 patients ( 50% ) , respectively . each mr finding showed a statistically significant difference ( p < 0.05 ) among the three groups of child - pugh classifications ( a , n = 36 ; b , n = 5 ; c , n = 9 ) , except for splenomegaly ( p = 0.243 ) . the mean age of the patients with positive mr findings was higher than that of patients with negative mr findings . for patients with child - pugh class a ( n = 36 ) with neurological presentation , intrahepatic nodules , surface nodularity , and gallbladder fossa widening were more common . intrahepatic nodules were improved ( n = 8 , 47% ) , stationary ( n = 5 , 29% ) , or aggravated ( n = 4 , 24% ) on follow - up mr images.conclusionmr imaging demonstrates the contour abnormalities and parenchymal nodules of the liver in more than half of the patients with wilson 's disease , which correlates with the severity of hepatic dysfunction and clinical manifestations .

extralobar pulmonary sequestration is defined as a mass of pulmonary parenchyma anatomically separate from the normal lung . in extralobar pulmonary sequestration , the tissue has a distinct pleural covering and may be supplied by an aberrant artery from the aorta or its branch , in rare instances , extralobar pulmonary sequestration communicates with the esophagus or stomach . the pulmonary sequestration is found lying mostly at the left lung base but can be found in the right lung and in the mediastinum at any level from the neck to below the diaphragm . extralobar pulmonary sequestration is often discovered at the time of routine roentgenogram of the chest or at the time of repair of associated congenital anomalies such as diaphragmatic hernia and fistulous communication with the gastrointestinal tract because extralobar sequestration rarely presents like the intralobar form with recurrent pulmonary infection . a 27-year - old man was admitted to yong dong severance hospital , yonsei university medical center , for evaluation and management of mediastinal mass . three years prior to admission , he found mediastinal mass on computerized tomographic ( ct ) scan performed in another institution . at admission , he was noted to be with generalized weakness and right chest pain , but he denied cough , sputum and dyspnea . the temperature was 38.6c , the pulse rate 72/min and the blood pressure 110/70 mmhg . on examination , he appeared chronically ill , the skin was warm and dry , the head and neck were normal and cervical lymphadenopathy was not found , the lungs were clear and the heart was normal . the urine was normal and the hemoglobin was 13.5gm / dl ; hematocrit 41.9% ; white cell count 5,500/mm with 64 percent neutrophils , 35 percent lymphocytes and 1 percent eosinophils , the serum electrolytes and liver function tests were normal . t3 : 150 ng / dl , t4 : 7.1 ug / dl , ft4 : 1.6ng / dl and tsh was 1.5 uu / ml . the electrocardiogram showed right axis deviation and tall r wave in right precordial leads , and the sputum exanination did not suggest malignancy or tuberculosis . chest ct scan revealed large multi - cystic mass lesion on the right paratracheal area which was attached to the lower pole of right thyroid gland , displaced the superior vena cava anteriorly and extended to the level of the azygous arch vein ( fig . the lung perfusion scan and whole body bone scan were normal and the thyroid scan revealed cold area in the lower pole of right thyroid gland . the pulmonary function studies showed mild restriction with fev1:2.85 l / sec and fvc : 3.49 l / sec . 88 cm sized mass composed of multi - cystic and solid part was located in the pericardium and excised easily from the surrounding structures and the feeding vessel maybe originated from the subclavian artery . grossly , the mass was composed of several cystic lesions and yellow solid lesion , resembling unexpanded lung tissues ( fig . mlicroscopically , the cyst wall showed a bronchial tissue which was composed of ciliated columanar epithelium , submucosal gland and cartilage ( fig . 5 ) and solid portion of the mass showed alveolar space filled with inflammatory cells such as macrophages or lymphocytes ( fig . pulmonary sequestration is an uncommon congenital malformation characterized by the presence of nonfunctioning lung tissue which usually has no communication with the normal bronchial tree and which receives its blood supply from an anomalous systemic artery instead of a pulmonary arterial branch . in intralobar sequestration , the abnormal pulmonary tissue is incorporated within the normal lung and shares a common covering of visceral pleura , and in extralobar sequestration , the abnormal pulmonary tissue is separate from the normal lung and has its own pleural covering . is generally accepted and their spectrum of bronchopulmonary foregut malformation includes intralobar and extralobar sequestration , esophageal diverticuli , foregut duplication cysts ( esophageal cysts ) and maybe expanded to include bronchogenic cysts . the incidence rate was 1.1 to 1.8 percent of all lobectomied patients by carter and 0.15 to 6.4 percent of all congenital pulmonary malformation by savic . savic found 133 cases of extralobar sequestration in a review of 547 cases of pulmonary sequestration . the male predominance of patients with extralobar pulmonary sequestration ( 3:1 ) was described by carter and savic described that extralobar sequstration was located between the diaphragm and lower lobe in 77.4% and on left lung in 78.9% of the cases . most of the published cases of extralobar pulmonary sequestration were located outside the pericardium , only four reported cases were intrapericardial . since an extralobar sequestered segment is enveloped in its own pleural sac , the chance of becoming infected are very small , unless there is communication with the gastrointestinal tract . the extralobar sequestration ( 42% ) is more often associated with other anomalies than intralobar type ( 14% ) such as diaphragmatic hernia and fistulous communication with the gastrointestinal tract . consequently , extralobar sequestration is usually an incidental finding on routine roentgenograms of the chest or during management of some other congenital anomaly and infrequently , extralobar sequestration presents with symptoms similar to those seen with the intralobar form and with a picture of congestive heart failure or pulmonary overcirculation . in all cases of intrapericardial extralobar pulmonary sequestration , a large quantity of pericardial fluid was found , but no sign of congestive heart failure or cardiac tamponade was noticed . a correct preoperative diagnosis is made in 39 percent of intralobar lung sequestration and only in 9 percent of extralobar lung sequstration by savic and correct preoperative diagnosis is more difficult in the cases of unusual location . preoperative angiography is important to confirm the diagnosis and to afford a safe operative approach . the sequestratered segment is typically made up of multiple cysts or noncystic mass containing branching bronchi which run in the direction of the aberrant artery . histologically , the sequestration consists of normal lung elements in an abnormal and disorderly arrangement with a variable presence of cartilage , bronchial glands and alveolar parenchyma . extralobar pulmonary sequestration with symptoms or discovered at operation for another problem should be excised and it is feasible to observe asymptomatic and definite extralobar pulmonary sequestration without operation .

extralobar pulmonary sequestration , known as accessory lung , is a rare congenital anomaly and intrapericardial lung sequestration is extremely rare.to the best of our knowledge , only four reported cases were intrapericardial . we report a case with intrapericardial extralobar pulmonary sequestration confirmed by operation and morphologic basis .

the hippocampus is a major component of the brain of humans and other mammals located bilaterally in the medial temporal lobe , underneath the cortical surface . it belongs to the limbic system and plays important roles in long - term memory and spatial navigation particularly the ca3 subregion of the hippocampus . our earlier studies have shown that glycyrrhiza glabra ( gg ) aqueous root extract treatment ( 2 , 4 and 6 weeks duration of the treatment ) in different age grouped ( 1 and 3 months old ) wistar albino rats enhances both spatial learning ability and retention of learned tasks accordingly , the present study was designed to study the effects of gg root extract on rat hippocampal neurons particularly the ca3 subregion of the hippocampus . the roots of gg were purchased from a local ayuredic store in udupi , karnataka , india during 2/4/2012 . the crude aqueous extract of gg was prepared by macerating dried powdered root with respective solvent for 24 h. the macerated powdered roots were then extracted by using soxhlet extractor for 36 h , 1 - 2 cycles / h . the extract was dried and weighed . a brownish black waxy residue with 16% yield was obtained . this aqueous extract of gg was administrated orally to separate groups of 1-month old male wistar albino rats in four different doses 75 , 150 , 225 and 300 mg / kg respectively . the experimental protocol was approved during september 2011 by the institutional animals ethics committee , yenepoya university and care of laboratory animals was taken as per committee for the purpose of control and supervision of experiments on animals ( cpcsea ) guidelines . rats were housed individually ( animal house , yenepoya university , reg.no 347/cpcsea ) in polypropylene cages of standard dimensions ( 22.5 cm 35.5 cm 15 cm ) and maintained at temperature ( 25 c 2 c ) and light ( light period , 08.00 - 20.00 ) in a controlled room with relative humidity of 50 - 55% . food and water were provided ad libitum . experiments were carried out between 09:00h and 14:00 h. rats were randomly divided into eight groups . group i- : control ( n = 6 ) : a known volume of distilled water was administrated orally each day for 4 weeksgroup ii- : diazepam control ( n = 6 ) : diazepam 7 mg / kg was injected i.p . 20 min before the test sessiongroup iii ( n = 6 ) : received 75 mg / kg aqueous extract of gg orally every day for 4 weeksgroup iv ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeksgroup v ( n = 6 ) : received 225 mg / kg aqueous extract of gg orally every day for 4 weeksgroup vi ( n = 6 ) : received 300 mg / kg aqueous extract of gg orally every day for 4 weeksgroup vii- : gg 150 mg + diazepam ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeks . n = number of animals.group viii- : gg 225 mg + diazepam ( n = 6):received 225 mg / kg aqueous extract of gg orally every day for 4 weeks . group i- : control ( n = 6 ) : a known volume of distilled water was administrated orally each day for 4 weeks group ii- : diazepam control ( n = 6 ) : diazepam 7 mg / kg was injected i.p . 20 min before the test session group iii ( n = 6 ) : received 75 mg / kg aqueous extract of gg orally every day for 4 weeks group iv ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeks group v ( n = 6 ) : received 225 mg / kg aqueous extract of gg orally every day for 4 weeks group vi ( n = 6 ) : received 300 mg / kg aqueous extract of gg orally every day for 4 weeks group vii- : gg 150 mg + diazepam ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeks . group viii- : gg 225 mg + diazepam ( n = 6):received 225 mg / kg aqueous extract of gg orally every day for 4 weeks . after the treatment period , all experimental animals were subjected to spatial learning ( morris water maze , and elevated plus maze ) tests . at the end of the spatial memory tests , the rats were deeply anesthetized with pentobarbitone and killed ; their brains were removed rapidly and fixed in rapid golgi fixative . briefly , tissues were fixed for 5 days in golgi fixative and impregnated with a 1.5% aqueous silver nitrate solution for 48 h. sledge microtome sections of 120-m thickness were excised , dehydrated , cleared and mounted with distrin plasticizer xylene mounting media . from each rat , hippocampal ca3 pyramidal neurons were traced using camera lucida and their dendritic branching points ( a measure of dendritic arborization ) and dendritic intersections ( a measure dendritic length ) were quantified . concentric circles with a distance of 20 m between 2 adjacent concentric circles were drawn on a transparent sheet for quantification of dendritic branching points and dendritic intersections . the number of branching points between the two concentric circles that is each successive 20 m concentric zone ( circle ) was counted . the dendritic intersections point ( a dendrite intersected a given concentric circle ) at each concentric circle were counted . both branching points and intersections were counted up to a radial distance of 140 m from the center of the cell body of the ca3 neuron . mean number of apical and basal dendritic quantification ( dendritic branching points and dendritic intersections ) in each concentric zone were calculated . the roots of gg were purchased from a local ayuredic store in udupi , karnataka , india during 2/4/2012 . the crude aqueous extract of gg was prepared by macerating dried powdered root with respective solvent for 24 h. the macerated powdered roots were then extracted by using soxhlet extractor for 36 h , 1 - 2 cycles / h . the extract was dried and weighed . a brownish black waxy residue with 16% yield was obtained . this aqueous extract of gg was administrated orally to separate groups of 1-month old male wistar albino rats in four different doses 75 , 150 , 225 and 300 mg / kg respectively . the experimental protocol was approved during september 2011 by the institutional animals ethics committee , yenepoya university and care of laboratory animals was taken as per committee for the purpose of control and supervision of experiments on animals ( cpcsea ) guidelines . rats were housed individually ( animal house , yenepoya university , reg.no 347/cpcsea ) in polypropylene cages of standard dimensions ( 22.5 cm 35.5 cm 15 cm ) and maintained at temperature ( 25 c 2 c ) and light ( light period , 08.00 - 20.00 ) in a controlled room with relative humidity of 50 - 55% . food and water were provided ad libitum . group i- : control ( n = 6 ) : a known volume of distilled water was administrated orally each day for 4 weeksgroup ii- : diazepam control ( n = 6 ) : diazepam 7 mg / kg was injected i.p . 20 min before the test sessiongroup iii ( n = 6 ) : received 75 mg / kg aqueous extract of gg orally every day for 4 weeksgroup iv ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeksgroup v ( n = 6 ) : received 225 mg / kg aqueous extract of gg orally every day for 4 weeksgroup vi ( n = 6 ) : received 300 mg / kg aqueous extract of gg orally every day for 4 weeksgroup vii- : gg 150 mg + diazepam ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeks . n = number of animals.group viii- : gg 225 mg + diazepam ( n = 6):received 225 mg / kg aqueous extract of gg orally every day for 4 weeks . group i- : control ( n = 6 ) : a known volume of distilled water was administrated orally each day for 4 weeks group ii- : diazepam control ( n = 6 ) : diazepam 7 mg / kg was injected i.p . 20 min before the test session group iii ( n = 6 ) : received 75 mg / kg aqueous extract of gg orally every day for 4 weeks group iv ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeks group v ( n = 6 ) : received 225 mg / kg aqueous extract of gg orally every day for 4 weeks group vi ( n = 6 ) : received 300 mg / kg aqueous extract of gg orally every day for 4 weeks group vii- : gg 150 mg + diazepam ( n = 6 ) : received 150 mg / kg aqueous extract of gg orally every day for 4 weeks . group viii- : gg 225 mg + diazepam ( n = 6):received 225 mg / kg aqueous extract of gg orally every day for 4 weeks . after the treatment period , all experimental animals were subjected to spatial learning ( morris water maze , and elevated plus maze ) tests . at the end of the spatial memory tests , the rats were deeply anesthetized with pentobarbitone and killed ; their brains were removed rapidly and fixed in rapid golgi fixative . briefly , tissues were fixed for 5 days in golgi fixative and impregnated with a 1.5% aqueous silver nitrate solution for 48 h. sledge microtome sections of 120-m thickness were excised , dehydrated , cleared and mounted with distrin plasticizer xylene mounting media . from each rat , hippocampal ca3 pyramidal neurons were traced using camera lucida and their dendritic branching points ( a measure of dendritic arborization ) and dendritic intersections ( a measure dendritic length ) were quantified . concentric circles with a distance of 20 m between 2 adjacent concentric circles were drawn on a transparent sheet for quantification of dendritic branching points and dendritic intersections . the number of branching points between the two concentric circles that is each successive 20 m concentric zone ( circle ) was counted . the dendritic intersections point ( a dendrite intersected a given concentric circle ) at each concentric circle were counted . both branching points and intersections were counted up to a radial distance of 140 m from the center of the cell body of the ca3 neuron . mean number of apical and basal dendritic quantification ( dendritic branching points and dendritic intersections ) in each concentric zone were calculated . figures 14 illustrates camera lucida tracings ( a1 , b1 , c1 , d1 , e1 , f1 , g1 and h1 ) of golgi - stained ( silver nitrate impregnated ) hippocampal ca3 pyramidal neurons ( a , b , c , d , e , f , g and h ) of control and different doses of the aqueous root extract of gg treated rats for 4-weeks . representative photomicrographs ( a - b ) and camera lucida tracings ( a1-b1 ) of golgi - stained hippocampal ca3 neurons . a and a1-control ( group i ) ; b and b1- diazepam control ( group ii ) ; black arrow- basal dendrites of hippocampal ca3 neurons ; red arrow- apical dendrites of hippocampal ca3 neurons representative photomicrographs ( c - d ) and camera lucida tracings ( c1-d1 ) of golgi - stained hippocampal ca3 neurons . c and c1- hippocampal ca3 neurons of rats treated with 75 mg / kg aqueous extract of gg orally every day for 4 weeks ( group iii ) ; d and d1- hippocampal ca3 neurons of rats treated with 150 mg / kg aqueous extract of gg orally every day for 4 weeks ( group iv ) representative photomicrographs ( e - f ) and camera lucida tracings ( e1- f1 ) of golgi - stained hippocampal ca3 neurons . e and e1- hippocampal ca3 neurons of rats treated with 225 mg / kg aqueous extract of gg orally every day for 4 weeks ( group v ) ; f and f1- hippocampal ca3 neurons of rats treated with 300 mg / kg aqueous extract of gg orally every day for 4 weeks ( group vi ) representative photomicrographs ( g - h ) and camera lucida tracings ( g1-h1 ) of golgi - stained hippocampal ca3 neurons of rats treated with aqueous extract of glycyrrhiza glabra ( gg ) for 4 weeks . g and g1- hippocampal ca3 neurons of rats treated with gg150 mg / kg / p.o + diazepam 7 mg / kg / i.p ( group vii ) ; h and h1- hippocampal ca3 neurons of rats treated with gg225 mg / kg / p.o + diazepam 7 mg / kg / i.p ( group viii ) the aqueous root extract of gg in the dose of 150 and 225 mg / kg / p.o showed significantly ( p < 0.01 ) increased numbers of dendritic branching points and dendritic length along the length of both apical and basal dendrites in all the ( 0 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 100 - 120 , 120 - 140 m ) concentric zones is comparable to control rats [ tables 14 ] . basal dendritic branching points of hippocampal ca3 neurons at different concentric zones in 1-month old male wistar albino rats ( four weeks duration ) basal dendritic intersections of hippocampal ca3 neurons at different concentric zones in 1- month old male wistar albino rats ( four weeks duration ) apical dendritic branching points of hippocampal ca3 neurons at different concentric zones in 1-month old male wistar albino rats ( four weeks duration ) apical dendritic intersections of hippocampal ca3 neurons at different concentric zones in1- month old male wistar albino rats ( four weeks duration ) furthermore diazepam induced amnesia reversed by the aqueous root extract of gg ( 150 and 225 mg / kg , p.o ) has shown a significant ( p < 0.01 ) increased numbers of both apical and basal dendritic branching points and dendritic intersections in all the ( 0 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 100 - 120 , 120 - 140 m ) concentric zones . in addition , the aqueous root extract of gg in the dose of 300 mg / kg / p.o has shown a significant ( p < 0.05 ) increased basal dendritic arborization in the 0 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 100 - 120 m concentric zones and increased basal dendritic intersections ( p < 0.01 ) in the 60 - 80 , 80 - 100 , 100 - 120 , 120 - 140 m concentric zones . this dose also shown a significant ( p < 0.01 ) increased apical dendritic arborization in the 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 m concentric zones and increased ( p < 0.01 ) apical dendritic intersections in the 80 - 100 and 100 - 120 m concentric zones . the aqueous root extract of gg in the dose of 150 and 225 mg / kg / p.o showed significantly ( p < 0.01 ) increased numbers of dendritic branching points and dendritic length along the length of both apical and basal dendrites in all the ( 0 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 100 - 120 , 120 - 140 m ) concentric zones is comparable to control rats [ tables 14 ] . basal dendritic branching points of hippocampal ca3 neurons at different concentric zones in 1-month old male wistar albino rats ( four weeks duration ) basal dendritic intersections of hippocampal ca3 neurons at different concentric zones in 1- month old male wistar albino rats ( four weeks duration ) apical dendritic branching points of hippocampal ca3 neurons at different concentric zones in 1-month old male wistar albino rats ( four weeks duration ) apical dendritic intersections of hippocampal ca3 neurons at different concentric zones in1- month old male wistar albino rats ( four weeks duration ) furthermore diazepam induced amnesia reversed by the aqueous root extract of gg ( 150 and 225 mg / kg , p.o ) has shown a significant ( p < 0.01 ) increased numbers of both apical and basal dendritic branching points and dendritic intersections in all the ( 0 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 100 - 120 , 120 - 140 m ) concentric zones . in addition , the aqueous root extract of gg in the dose of 300 mg / kg / p.o has shown a significant ( p < 0.05 ) increased basal dendritic arborization in the 0 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 100 - 120 m concentric zones and increased basal dendritic intersections ( p < 0.01 ) in the 60 - 80 , 80 - 100 , 100 - 120 , 120 - 140 m concentric zones . this dose also shown a significant ( p < 0.01 ) increased apical dendritic arborization in the 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 m concentric zones and increased ( p < 0.01 ) apical dendritic intersections in the 80 - 100 and 100 - 120 m concentric zones . the dendrites of hippocampal ca3 pyramidal neurons receive inputs from entorhinal cortex , septal area , mamillary body , dentate granule cells and the contralateral ca3 regions and play an important role in the encoding of new spatial information within short - term memory with duration of seconds and minutes . it is believed that some areas of the brain particularly the hippocampus vulnerable to glutamate , ischemia , inflammatory processes , repeated psychosocial or oxidative stress , may leads to dendritic atrophy in ca3 pyramidal neurons of the hippocampus , accompanied by specific cognitive deficits in spatial learning and memory . alzheimer 's disease and schizophrenia are progressive neurodegenerative disorders associated with loss of neurons in distinct brain areas particularly the hippocampus . such areas of brain structures has been shown to significantly increase the density of spines and dendritic complexity due to repeated exposure to enriched environments . increase in the dendritic arborization and dendritic intersections in hippocampal ca3 pyramidal neurons may result in alterations in synaptic connectivity . it may result in alteration in learning and memory the present study showed that the aqueous root extract of gg in the dose of 150 and 225 mg / kg / p.o significant ( p < 0.01 ) enhancement of dendritic arborization and dendritic intersections in hippocampal ca3 pyramidal neurons . increase in the dendritic arborization and dendritic intersections in hippocampal ca3 pyramidal neurons may result in alterations in synaptic connectivity , which probably is one reason for the enhanced learning and memory in same rats has been reported previously . thus the aqueous root extract of gg may stimulate the release of neuromodulators or neuronal dendritic growth stimulating factors that alter the activity of neurotransmitters that are involved in learning and memory , which thereby contributes to enhanced learning and memory . in conclusion , the aqueous root extract of gg in the dose of 150 and 225 mg / kg / p.o showed a significant ( p < 0.01 ) enhancement of dendritic arborization and dendritic intersections in hippocampal ca3 pyramidal neurons is comparable to the control . based on our results obtained , we conclude that constituents present in aqueous extract of root of gg have neuronal dendritic growth stimulating properties .

background : in the traditional system of medicine , the roots and rhizomes of glycyrrhiza glabra ( gg ) ( family : leguminosae ) have been in clinical use for centuries.aim:in the present study , we investigated the role of aqueous extract of root of gg treatment on the dendritic morphology of hippocampal cornu ammonis area three ( ca3 ) neurons , one of the regions concerned with learning and memory , in 1- month- old male wistar albino rats.materials and methods : the aqueous extract of root of gg was administered orally in four doses ( 75 , 150 , 225 and 300 mg / kg ) for 4 weeks . after the treatment period , all experimental animals were subjected to spatial learning ( morris water maze , hebb - william 's maze and elevated plus maze ) tests . at the end of the spatial memory tests , the rats were deeply anesthetized with pentobarbitone and killed their brains were removed rapidly and fixed in rapid golgi fixative . hippocampal ca3 neurons were traced using camera lucida , and dendritic arborization and intersections were quantified . these data were compared to those of age - matched control rats.results:the aqueous root extract of gg in the dose of 150 and 225 mg / kg / p.o showed a significant ( p < 0.01 ) enhancement of dendritic arborization ( dendritic branching points ) and dendritic intersections along the length of both apical and basal dendrites in hippocampal ( ca3 ) pyramidal neurons is comparable to control.conclusion:based on our results obtained , we conclude that constituents present in aqueous root extract of gg have neuronal dendritic growth stimulating properties .

in most classifications of tibial plateau fractures , including one used most widely - schatzker classification , fractures are described as a combination of medial and lateral condyle , primarily in the sagittal plane . coronal component of these fractures , affecting the posterior tibial condyle is now well recognized . what is not described is anterior coronal component of the fracture , what we are calling anterior tibial condyle fracture . these fractures are often missed on routine antero - posterior and lateral knee x - rays due to an overlap between the fracture and the normal bone . eight cases of anterior tibial condyle fractures with posterior subluxation of the tibia , six of which were missed by the initial surgeon and two referred to us early , are described . primary outcome measures such as union of the fracture , residual flexion deformity , range of motion and stability were studied at the end of 6 months . all operated fractures united . there was no posterior sag in any . in those presenting late and were operated , the flexion deformity got corrected in all ( average from 15 to 0 ) and mean flexion achieved was 100 ( range : 80 - 120 ) . in those presenting early and were operated , there was no flexion deformity at 6 months and a mean flexion achieved was 115 ( range : 100 - 130 ) . they should be suspected , diagnosed early and treated by reconstruction of anterior condyle , posterior cruciate ligament reconstruction . tibial plateau fractures are commonly described as a combination of fractures affecting medial , lateral or both condyles in the sagittal plane.1 fractures of the posterior condyle of the tibia have been described in the literature,23 but we did not come across a description of anterior tibial condyle fracture on an extensive search of english literature . we define anterior tibial condyle fractures as those affecting anterior one - third of the medial condyle , extending to a variable degree to the lateral side [ figure 1 ] . the importance of reporting this injury lies in the fact that it is likely to be missed by the initial treating doctor , as has happened in six out of eight cases in this series . delay in treatment results in fixed posterior subluxation of the knee , making it technically difficult to treat at a later date . we have described our technique of treating this injury . a line diagram showing anterior tibial condyle fracture we are reporting a total of eight cases , six presenting late ( between 3 and 7 months ) and two referred to us early ( within 1 week , range : 2 - 6 days ) . they were in the age group of 21 - 45 years ( mean 35 years ) . all patients had sustained the injury in road traffic accidents , the exact mechanism of injury could not be ascertained . in all the cases presenting late , the fracture was missed by the initial treating doctor and they were treated as soft - tissue injury . all patients were treated for 3 - 6 weeks with immobilization in a plaster of paris cast , followed by physiotherapy . a detailed clinical evaluation was done to record range of motion ( rom ) , deformity and stability . posterior subluxation was passively completely correctable in one and to a variable extent in others . they all had a flexion deformity in the range of 10 - 30 , with terminal loss of flexion of 30 - 40. two of the patients had common peroneal nerve palsy . the x - ray showed fracture of the anterior condyle of tibia with subtle posterior subluxation . x - rays and clinical picture of a representative case is as shown in figure 2 . only 2 of the 6 patients in this late group accepted surgery . in one , the posterior subluxation was correctable whereas in the other , initial surgical mobilization of the tibial plateau was done from posteromedial approach to correct fixed posterior subluxation . once the posterior subluxation was corrected , it was held in place with pcl reconstruction using hamstring graft . it was observed that with pcl reconstruction alone , the femoral condyle had a tendency to slide into the depressed malunited anterior tibial condyle . hence , anterior tibial condyle was lifted by an open wedge osteotomy from front , stabilized by an osteochondral graft and a radius t - buttress plate anteriorly [ figure 3 ] . the patients were kept nonweight bearing for 4 weeks , with rom exercises commencing on day 1 . after 4 weeks , the patients were allowed to partially weight bear and full weight bear at the end of 12 weeks . clinical photographs ( a and b ) showing posterior subluxation of tibia and x - rays knee joint anteroposterior and lateral views ( c ) showing anterior tibial plateau fracture of a typical case , presenting late intraoperative photographs showing ( a ) depression of anterior condyle ( b ) osteotomy to elevate the depressed condyle ( c ) insertion of cortico cancellous graft ( d ) buttressing the graft with plate two other cases who presented early ( within the 1 week of injury ) had hemarthrosis and the tibia was subluxated posteriorly . on opening the joint , we noticed that the femoral condyle was dipping into the depression caused by the depressed anterior tibial condyle . we did reconstruction of the anterior tibial condyle from front using the technique described above and pcl reconstruction . the primary outcome measures of union of the fracture , deformity , rom and stability were studied at the end of 6 months . secondarily the complications were studied as well as the presence or absence of posterior step off . we also made note of any operative / nonoperative procedures such as manipulation under anesthesia , that were done on the patients . the four patients who did not get operated ( late un - operated group ) continued to have flexion deformity of 20 ( range 15 - 25 ) and range of flexion of average 69 ( range 60 - 80 ) . the common peroneal nerve injury in one of these four cases had not improved at the end of 6 months . all the fractures united with a posterior step off . in the group that presented late and were operated upon ( late operated group ) , the flexion deformity got corrected in all of the cases ( from an average of 15 - 0 ) . mean flexion achieved was 100 ( range 80 - 120 ) and there was no posterior sag . the common peroneal nerve palsy in one of the case in this group recovered partially in 6 months . both cases showed union at the fracture site at the end of 6 months [ figure 4 ] . ( a ) clinical photographs of a patient presented late showing posterior sagging of tibia ( b ) x - rays of knee joint anteroposterior and lateral views showing tibial plateau injury ( c ) sagittal mri of same patient showing anterior tibial plateau injury ( d ) immediate postoperative x - ray of knee joint anteroposterior and lateral views showing implant in situ with reduction achieved in the group that presented early , there was no flexion deformity at the end of 6 months , the mean flexion achieved was of 115 ( range : 100 - 130 ) . the knee was stable with no posterior sag and there was union at the fracture site at the end of 6 months . the purpose of this paper is to report a hitherto not described injury - anterior tibial condyle fracture with posterior subluxation of tibia . we did not come across any reference to such an injury on extensive search of english literature . it seems that this fracture is missed often as is clear from our series where six out of eight cases were missed by the treating doctors . this also raises a question on relevance of commonly used schatzker 's classification , which is based on considering the tibial plateau fracture a combination of medial and lateral pillars.1 not much attention has been paid to the coronal component of these injuries . moore identified that the medial condyle fracture is often posteromedial and not purely medial , for which they recommended posteromedial plating.4 there have been reports where the fracture is in the coronal plane alone , involving only the posterior part of the medial condyle.3 in such cases , the fractured condyle is displaced posteriorly , carrying with it the medial femoral condyle . such fractures can be missed on ap x - ray , but can be diagnosed in lateral x - rays . coronal bicondylar tibial plateau fracture involving the posterior condyles have also been reported.3 the relevance of recognizing the coronal component of these fractures lies in the fact that the buttress plate has to be put from behind.5 lately , luo et al . proposed , based on computed tomography ( ct ) evaluation , the concept of three - column in the treatment of tibial condyle fractures , where three columns were medial , lateral and posterior.6 it seems that inspite of such extensive work on tibial plateau fractures , the anterior condyle fractures have escaped attention . an anterior rim fracture detected on magnetic resonance imaging has been reported in radiology literature.78 this was only thought to be a useful indicator of associated pcl and posterolateral corner injuries . the anterior tibial plateau fractures reported by us are not merely that of the rim , but involve the anterior third of the tibial condyle . whereas reconstruction of pcl would be required to keep the knee aligned in the sagittal plane , reconstruction of the anterior depressed tibial plateau fracture is mandatory not to let the femoral condyle slide into it . in our opinion , unless anterior bony stability is restored , an attempt at standalone pcl reconstruction may fail . we suspect that this fracture may be responsible for failure of pcl reconstruction in some cases where this fracture is co - existent and is not addressed too . we highlight the importance of early diagnosis of these fractures as they were missed in six out of eight cases in this series . this happened apparently as these are difficult to see on ap and lateral x - rays due to overlap . in the absence of routine use of ct scan in treatment of these fractures , the only clue in plain x - rays is subtle posterior subluxation of the tibia . early diagnosis and early surgery is critical in these cases as delay in treatment results in the tibia remaining in a posteriorly subluxated position . there are long term implications of leaving the knee subluxated as it will cause abnormal loading on the tibiofemoral and patella - femoral joint resulting in early degeneration . attempt at late surgery is technically more demanding as one has to dissect behind the tibial condyles to mobilize the tibia . it is required to stabilize the anterior coronal fracture with an anterior plate , similar to posterior fixation of coronal fractures in the posterior plane . we conclude that recognition of coronal component of the tibial condyle fracture , commonly posterior , but sometimes anterior , is important . awareness that such an injury exists and suspecting it in a case with posterior subluxation of tibia , is the key to early diagnosis . once diagnosed , an evaluation by ct scan and reconstruction of the depressed anterior condyle from front , in addition to pcl reconstruction is required .

background : in most classifications of tibial plateau fractures , including one used most widely - schatzker classification , fractures are described as a combination of medial and lateral condyle , primarily in the sagittal plane . coronal component of these fractures , affecting the posterior tibial condyle is now well recognized . what is not described is anterior coronal component of the fracture , what we are calling anterior tibial condyle fracture . these fractures are often missed on routine antero - posterior and lateral knee x - rays due to an overlap between the fracture and the normal bone.materials and methods : eight cases of anterior tibial condyle fractures with posterior subluxation of the tibia , six of which were missed by the initial surgeon and two referred to us early , are described . two of the six late cases and both the early ones were operated . reconstruction of the anterior condyle and posterior cruciate ligament reconstruction was done . primary outcome measures such as union of the fracture , residual flexion deformity , range of motion and stability were studied at the end of 6 months.results:all operated fractures united . there was no posterior sag in any . in those presenting late and were operated , the flexion deformity got corrected in all ( average from 15 to 0 ) and mean flexion achieved was 100 ( range : 80 - 120 ) . in those presenting early and were operated , there was no flexion deformity at 6 months and a mean flexion achieved was 115 ( range : 100 - 130 ) . none of the operated patients had instability.conclusion:this article attempts to highlight that this injury is often missed . they should be suspected , diagnosed early and treated by reconstruction of anterior condyle , posterior cruciate ligament reconstruction .

gels have been described as materials that are easier to recognize than define . most of the times this problem comes from industry , which develops products with a gel name , just to be attractive to consumers . however , gels have been accepted as semisolid materials comprising low concentrations ( < 15% ) of gelator molecules to form a network self - assembly that entraps the solvent ( in organogels both nonpolar components ) , preventing flow due to surface tension . gels can be defined both from a rheological behavior and from a structural feature . in a rheological point of view , a gel is a system that does not flow and has the presence of a plateau region of storage modulus and a low tan ( < 0.1 ) at an angular frequency from 10 to 10 rad / s . the structural definition is based on the connectivity of the system . gel is a system consisting of molecules , particles , and chains , which are partially connected to each other in a fluid medium by crosslinks to the macroscopic dimensions . organogels have been attracting much attention in biomedical and pharmaceutical fields , where the erosion of gels in stomach and intestines is important for drug delivery [ 4 , 5 ] ; therefore gels erosion has been applied for this purpose . as oils are safe materials and are suitable for lipophilic components , they are considered a good option for organogels elaboration . that is why food industry is very interested in this type of systems as a replacement of hydrogenated fats . thus , understanding organogels , definition is closely related to their characteristics and their crucial potential to develop new applications . the case of fat oils is very important due to their applications in food industry . the study of crystal nucleation , dissolution , and agglomeration in the overall precipitation scheme implies practical difficulties . nucleation and crystal growth are spontaneous processes , which diminish the energy of the growing particle and nucleation process in order to overcome activation energy ; that is , the critical cluster ( critical size ) is the cluster with maximum gibbs free energy . the activation barrier may be represented by three parameters : supersaturation ratio , reaction temperature , and interfacial energy . following crystal formation in organogels can give detailed information on how their preparation is affecting their final structure . the crystallization behavior is related to concentration of gelator , cooling rate [ 11 , 12 ] , and shear rate on fat crystals [ 13 , 14 ] . depending on the system , gels are formed by different forces and interactions and there are some parameters that affect , such as ph , ionic force , and mechanical forces . the plastic fat gels are formed due to the aggregation of fat crystals by several forces as van der waals , dipole - dipole , hydrophobic , and hydrogen bond interactions between crystals . fractal is a geometric pattern that is repeated at every smaller scale to produce irregular shapes and surfaces . hence , since the study of organogels is very complex , it must include structural analysis and rheological and thermal behaviors in order to have a clear understanding on how preparation parameters are affecting the final product . thus , our objective was to evaluate the influence of gelator ( type and concentration ) , type of vegetable oil , stirring speed , and temperature preparation on the physical properties of obtained organogels . three different vegetable oils ( soybean , canola , and corn oil ) were used . they have important differences in composition of saturated fatty acids ( sfa ) , monounsaturated fatty acids ( mufa ) , and polyunsaturated fatty acids ( pufa ) . the approximate compositions of soybean ( sfa 15.65% , mufa 22.78% , and pufa 57.74% , wesson brand ) , canola ( sfa 7.36% , mufa 63.27% , and pufa 28.14% , wesson brand ) , and corn ( sfa 12.94% , mufa 27.57% , and pufa 54.67% , mazola brand ) were considered . these oils were bought at a local supermarket in new brunswick ( new jersey , usa ) . myverol ( mainly monoglycerides glyceryl monostearate 49% , glyceryl monopalmitate 48% , and calcium silicate 3% ) and myvatex ( mixture of monoglycerides and diglycerides , soy monoglycerides 3545% , stearic acid monoester with propane-1 - 2-diol 4050% , sodium 2-stearoyl lactate 1015% , and calcium silicate 3% ) were provided by kerry , mexico / usa , and used as gelator agents . gelators myverol ( mv ) and myvatex ( mx ) at three different concentrations ( 8 , 9 , and 10% ) were heated ( 70 , 80 , and 90c ) on glass containers until complete melting , and then either vegetable oil ( soy ( sy ) , canola ( ca ) , or corn ( cn ) ) was added . samples were stirred ( t 25 digital ultra - turrax , ika , north carolina , usa ) for five minutes at three independent speeds ( 3600 , 7200 , and 12000 rpm ) to homogenize them ; then , samples were cooled to room temperature and stored in refrigerator for 24 hours . dynamic frequency sweep tests were performed in a rheometer ( ares rheometer 902 - 30004 , ta instruments , new castle , de , usa ) using parallel plates geometry ( 25 mm diameter ) under the following experimental settings : strain 0.1% , temperature 20c , frequency sweep 0.1100 rad s , and a gap of 1 mm . the g and g modules , complex viscosity , and delta tangent for each experimental sample were obtained . polarized light microphotographs of organogels were obtained using a polarized light microscope linkam brand ( t95 system controller ; t95 linksys 32 soft , 2009 , tadworth , uk ) . it was equipped with a q imaging camera ( color rtv 10 bit ) using an olympus th4 - 100 halogen lamp power supply unit ( lts120 temp . controlled stage ) . images were taken at 20c , and video was taken using the camtasia studio v 7.0 ( build 1426 , 2010 , techsmith corporation , okemos , mn , usa ) . thermal behavior of samples was studied using a differential scanning calorimeter ( dsc q2000 ta instruments , schaumburg , ill , usa ) equipped with refrigerated cooling system ( rcs 40 ta instruments , schaumburg , ill , usa ) . samples were heated at 120c ( 30 min ) for deleting fat thermal memory . x - ray diffraction experiment was developed by the use of a pxrd conduced with a d / m-2200 t automated system ( ultima rigaku , tokyo , japan ) with cu k radiation = 1.5406 a. patterns were collected at 2 angles of 3 to 50 at a scan rate of 2/min . a graphite monochromator was used and the generator power settings were fixed at 40 kv and 40 ma . 2010.01.30 , woburn , massachusetts , usa ) for clarifying peaks , applying a single functional filter smoothing and five cycles of fourier deconvolution . the fractal dimension of the samples was calculated using ( 1 ) according to a described method , which is based on the avrami relationship . consider ( 1)ln(1xcr)=ktd , where xcr is the crystallinity of the system ; t is time ; k is a constant ; and d denotes the dimension of growing . d and k were calculated by nonlinear estimation using levenberg - marquardt algorithm ( statistica v 7.0 , tulsa , ok , usa ) . crystalline fraction of samples was calculated adjusting values from complex viscosity of the system removing complex viscosity of the solvent : ( 2)xcr=(t)(). a universal relation has been developed , but in the present work a previous relationship was used , supported by earlier theoretical work in order to evaluate structural parameters . in this experimental work , a three - dimensional colloidal network was considered as being composed of interconnected flocs and the fractal dimension was used to quantify the relationship between the average floc size and the particle concentration of the colloidal network . the fractal nature of fat crystal networks has been already presented and explained the power - law relationship followed by g and the solid fat content ( sfc ) data for fat samples with low solid fat content ( < 10% ) . rheological data from experimental work can lead us to obtain a parameter related to elastic modulus ( the solid fraction previously obtained by xcr ) , , and m , obtained by nonlinear estimations ( statistica v 7.0 , levenberg - marquardt algorithm , tulsa , ok , usa ) . the hamaker constant was determined following reported methodology [ 18 , 22 ] where a is the hamaker constant , a is the diameter of the particles within a floc , and d is the average distance between clusters . 14.0.0.567 , menlo park , ca , usa ) applying channel separation ( cmyk ) in order to obtain floc and distance parameters as clearly as possible . consider ( 4)~a3ad2 . comparisons and calculations of parameters were obtained by nonlinear estimation with statistica software ( ver . 7.0 , 2007 , tulsa , ok , usa ) using levenberg - marquardt algorithm . mean effects on interactions between processing parameters and fractal dimensions and microstructural parameters were determined by screening design ( jmp ver . higher values of g were observed for mv gels at higher frequencies used at 10% gelator concentration , 70c , and 12000 rpm . the elastic module ( g ) thus , this value may indicate that , at higher shear rates , structural order produced by lipid chains ( i.e. , acylglycerides ) is organized in a more stable configuration , as a function of more contact between molecules that lower the necessary energy for self - organization and structure building . theoretical analysis of gels indicated that small particles could be aggregated to form large clusters with tenuous , chain - like , and self - similar structures that eventually span the entire enclosing space . this behavior not only was influenced by shear rate , but also seems to be influenced by the type of gelator used as can be seen in figures 1 , 2 , and 3 . from these figures it can be observed that at the same conditions mv organogels always give higher elastic modules in comparison with the mx . the mechanisms of aggregation of gelators in organogels occur primarily through van der waals forces , specific intermolecular hydrogen bonding , electrostatic forces , - stacking , or london dispersion forces . thus , in function of the solvent and the gelator molecule , which type of intermolecular force predominates to stabilize the self - assembly primary structure , the growth mode , and finally the organogel microstructure and its thermomechanical properties is determined . however , the relationship between gelator chemical structure and its gelling capability is not evident a priori in most cases . however , it is desirable for gel modules to maintain a stable behavior during the complete frequency range . solid behavior is predominant in all samples at the experimental shear range used , so it can be considered suitable for an excipient . similar behavior was observed in the organogels prepared with different oils ( figure 3 ) , except for soy oil ( sy ) , which seems to have a different effect , producing more elastic gels at the same conditions . sy seems to be favored by its higher solid fatty acids content , which gives more elastic modules to myvatex gelator samples . an explanation of this behavior has been already reported . in there , candelilla wax and amides derived from ( r)-12-hydroxystearic acid were tested as gelators of safflower oil , observing that the increase in the hydrocarbon chain length raises both the organogel resistance to deformation and its instant recovery capacity . however , the extended recovery capacity of the gel decreased . as can be seen in figure 3 , the behavior of each sample made with different oil at the same conditions changes significantly . this may be related to the different composition of vegetable oil and how each component is reacting at different preparation conditions . although the higher elastic modules are obtained with canola ( ca ) and corn ( cn ) oil samples , in general ca gave the higher elasticity samples in comparison with those made with cn and sy . this behavior could be related to the monounsaturated fatty acids ( msfa ) and polyunsaturated fatty acids ( pufa ) contents . obtained micrographs ( figure 4 ) showed that myvatex tends to crystallize as spherulitic forms , some of them with larges spaces between these spherulites , while samples prepared with myverol crystallized as fibrillar networks . it was reported that the higher number of hydroxyl groups related to the diacylglycerides was correlated with a lack of gelation into the organogels . this gives further evidence to the fact that hydrogen bonding is critical to the organogelation . statistical analysis of enthalpy data showed that gelator type and its concentration ( p < 0.05 ) were the most important factors that influence enthalpy ( table 1 ) . the statistical analysis showed a very complex phenomenon influenced by the following interactions : oil oil , concentration gelator , and gelator temperature . organogels obtained with myvatex gelator showed two different nucleation stages related to the presence of two main types of molecules ( mono- and diacylglycerides ) ; so probably distributed free energy makes gels tend to crystallize as spherulites rather than as a needle shaped network . however , not only the gelator is important , but also its concentration and several interactions including vegetable oil type and temperature are important . at this point , it is interesting to highlight that the temperature factor does not have influence on the enthalpy of organogels . thus during cooling , both components might develop a mixed molecular packing with vegetable oils . on the other hand , myvatex gelator ( mx ) does not seem to be affected significantly by any preparation conditions . finally , it is clear that the use of myverol at higher concentrations produces organogels with higher values of gelation enthalpies , indicating more stable structures . a comparison of d spacing data was done in order to elucidate not only possible arrangements in packing , but also the most probable polymorphic forms in batches . since they were complex mixtures of components ( nonpure components ) , at least two different packings and polymorphs were selected . it can be noticed that most of the structures obtained are mainly polymorphs , because most of them are amorphous materials and b crystals are present only in part . although mx also gave a good structure , it was only possible under the highest energy conditions . in order to compare different samples behaviors with a representative value , samples fractal dimensions ( table 3 ) were obtained from rheological behavior according to others , on which we should obtain crystalline fraction of each sample based on complex viscosity behavior and then get fractal parameter from nonlinear estimation . once fractal data was obtained , anova test was developed looking for some important influence . the model obtained was too complex and t - student was not sensitive enough to detect means without a significant error . even in general no means were detected ; some interesting effects were found when gelators and oils were blocked . also , several works on formation of organogels studied and correlated by avrami exponent ( n ) with fractal dimensionality have been reported [ 17 , 28 ] . however , it was indicated that it may be inappropriate to compare avrami derived fractal dimensionalities from several systems in which different nucleation mechanisms for gelators are involved . thus , there are reports on homogeneous nucleation with a fractal dimensionality near 2 , while others found a fractal dimensionality near 1 in a heterogeneous nucleation system . thus in the present experimental work , fractal dimensionality was in that range ( lower than 2 ) , particularly when using mono- and diacylglyceride blends , indicating a possible heterogeneous nucleation process . as an example , when the variable gelator ( myvatex ) was blocked on canola oil ( p = 0.047 ) , the fractal dimension ( d ) was affected by the gelator concentration . also , when corn oil temperature was blocked , the results indicated that higher temperatures render higher fractal dimensions . the fractal dimensions ( d ) determined by the particle counting method are sensitive to the spatial distribution of particles in the crystal network . higher fractal dimensions occur in networks that are more ordered , whereas networks that arise from a more disordered nucleation and growth process result in lower fractal dimensions . the fractal dimension value found in the present work was lower , similar , and higher than other reports . even though we did not find any significant mean on rpm versus d parameters , independently of the gelator , d fractal dimension tends to decrease as rpm increases . this could mean that as the shear rises there is an increase in disorder of the structure , which is contrary to reports from others [ 13 , 14 ] . this could also indicate that different conditions are affecting gels structure and there is not necessarily a codependence on shear rate and order of the structure . the highest value of was found for myverol ( mainly monounsaturated fatty acids ) in comparison with myvatex . the gelator molecules are related to the nature of the short - range weak forces and the strong solvent dependence on the molecular self - assembling capabilities , so that molecules with higher molecular weight could affect crystal growth and its consequence on fiber interpenetration among vicinal spherulites . however , not only gelator molecule is important , but solvent nature and interaction solvent - gelator are important too . in this way , experimental data was blocked for the two gelators in separated assessments . results showed that myverol is affected by the type of oil used for the sample ( p = 0.0085 ) , by the oil - concentration interaction ( p = 0.04 ) , and the concentration quadratic effect as well ( p = 0.0072 ) . meanwhile for myvatex , the oil effect was also important ( p = 0.0766 ) , but contrary to myverol , it was affected by the oil quadratic ( p = 0.43 ) and the temperature quadratic effects ( p = 0.032 ) . thermal parameters could be helpful to explain this behavior , because they are associated with the molecules polarity and the energy of the molecular interactions that are established with the crystal structure of gelators in their neat and organogel states . thus , the energy related to the organogel depends on the energy of the noncovalent interactions involved during the molecular self - assembly . as can be seen , higher enthalpies were observed for myverol in comparison to myvatex , like a structural parameter . monoglycerides are known to be good initiators of fat crystallization and the matching in saturation and carbon chain length of both the gelator fatty acids and the oil phase are important in the particular lipid - lipid interactions . for the hamaker constant ( table 3 ) , gelator appears as a main effect ( p 0.0001 ) , followed by the stirring speed ( p = 0.052 ) , as well as the interaction gelator - stirring speed ( p = 0.088 ) . also the bilayer packing seems to be favored by the particularities on ca oil composition of mainly the high mufa and low pufa contents . also the first gelator tends to form needle shaped network structures with better intermolecular forces according to their hamaker constant and xrd analysis . the stirring speed should be an important parameter to take into account , as well as the gelator and its concentration . it was found that temperature does not seem to be an important parameter in gels preparation . finally , it is important to point out that most of the influence of the stirring speed conditions is apparently related to the oils higher mufa and low pufa contents .

the objective of this study was to evaluate the influence of gelator , vegetable oil , stirring speed , and temperature on the physical properties of obtained organogels . they were prepared under varying independent conditions and applying a fractional experimental design . from there a rheological characterization was developed . the physical characterization also included polarized light microscopy and calorimetric analysis . once these data were obtained , x - ray diffraction was applied to selected samples and a microstructure lattice was confirmed . commonly , the only conditions that affect crystallization have been analyzed ( temperature , solvent , gelator , and cooling rate ) . we found that stirring speed is the most important parameter in the organogel preparation .

the head and neck posture of an individual can influence soft - tissue relationships in the cervical and shoulder region1 , 2 . a common concern in the modern workplace is upper extremity disorders arising from overhead work , which is associated with neck and shoulder disorders and pain3 . long - term overhead working postures result in strain and fatigue of the shoulder muscles because arm elevation is associated with shoulder muscle fatigue4 , 5 . previous studies have focused on risk factor analysis and the development of therapeutic exercises for overhead work - related disorders rather than prevention6 , 7 . some studies have been performed on postural ergonomic interventions including working techniques for overhead work6 , 7 . however , we found that few studies have focused on protective ergonomic devices for overhead workers . therefore , this study investigated a new neck support tying ( nst ) method that used a thera - band for the prevention of neck and shoulder pain in workers performing overhead work . the new nst method supports the neck during hyperextension and prevents excessive upward rotation of the scapula during overhead work . the purpose of the present study was to investigate the effect of this nst method on cervical rom and shoulder pain after overhead work . the subjects were divided into two groups as follows : a control group consisting of 7 males without nst , and a nst group consisting of 7 males with nst . the initial cervical rom and initial ppts of the ut and mt were not significantly different between the two groups . the initial values of cervical flexion , extension , and right and left lateral flexion in the control group were 63.44.2 , 72.86.0 , 53.92.9 , and 51.35.6 degrees , respectively . the initial values for cervical flexion , extension , and right and left lateral flexion in the nst group were 62.35.1 , 72.53.9 , 53.33.0 , and 52.22.4 degrees , respectively . all participants gave their informed , written consent according to the protocol approved by the human ethics committee of the yonsei university faculty of health science . this study examined a new nst method that uses a thera - band for the prevention of neck and shoulder pain in workers performing overhead work . for the nst method , we used the grey thera - band ( 60 cm length ) which was applied as follows . the midpoint of the thera - band supported the posterior aspect of the neck , and both ends of the thera - band were passed under both axillae , and tied behind the back . the nst provided support for neck hyperextension and prevented excessive upward scapular rotation during overhead work . cervical flexion , extension , and right and left lateral flexion were measured with a cervical range of motion ( crom ) instrument ( performance attainment associates , st . a dolorimeter pressure algometer ( fabrication enterprises , white plains , ny , usa ) was used to measure the pressure pain threshold ( ppt ) of the right side upper trapezius ( ut ) and the lower trapezius ( lt ) muscles . a 1-cm rubber plate delivers pressure from the probe to the body , and the pressure is read from a needle gauge . all subjects performed one trial of overhead work with their arms over their heads for 15 min . the overhead work was performed at a height of 25 cm above each subject 's head . differences in cervical rom and ppt between the nst and control groups after the overhead work were tested with the independent t - test using the spss statistical package ( version 18.0 ; spss , chicago , il , usa ) . the cervical flexion , extension , and lateral flexion angles of the nst group were significantly larger than those of the control group ( p < 0.05 ) . the cervical flexion , extension , and right and left lateral flexion of control group were 50.48.2 , 64.711.3 , 41.77.9 , 43.29.2 degrees , respectively . the cervical flexion , extension , and right and left lateral flexion of nst group were 61.511.2 , 69.46.9 , 48.75.6 , 49.86.7 degrees , respectively . the ppt of ut of the nst group ( 7.21.8 lb ) was significantly higher than those of the control group ( 6.32.0 lb ) ( p < 0.05 ) . the ppt of mt of the nst group ( 5.81.4 lb ) was significantly higher than those of the control group ( 5.01.2 lb ) ( p < 0.05 ) . repeated and sustained working with elevated arms is known to lead to neck and shoulder pain8 . this study proposed a new neck support tying method using thera - band and investigated its effect on cervical rom and shoulder pain after overhead work . reductions in rom have implications for the safety and efficiency of functional activities , and lead to a loss of corrective or protective reactions1 , 9 . rom losses can occur from inactivity and structural changes of the tissues in the cervical spine , and result in an increase in connective - tissue density , shortening of collagen tissue , and muscle fibrosis1 , 9 . in this study , the cervical flexion , extension , and lateral flexion angles of the nst group shoulder forward flexion with scapular upward rotation requires the activation of the upper trapezius , and overstretches the middle trapezius through scapular protraction3 , 5 , 7 . the ppts of the ut and mt were significantly lower in the nst group than those of the control group . these results indicate that the nst supported the neck and prevented excessive scapular elevation and upward rotation during overhead work . the thera - band , which provides varied resistance through the range of movement , has been used for rehabilitation in combination with therapeutic exercise10 . it is light and portable , has low resistance , and can be adjusted to accommodate various situations11 . the nst method prevented rom reduction and pain in the cervical and shoulder regions . the nst method can be easily and simply applied using a thera - band and is also inexpensive . we suggest that industrial workers could use the nst method when performing overhead work .

[ purpose ] this study proposed a new neck support tying ( nst ) method using thera - band for the prevention of neck and shoulder pain in workers doing overhead work . the purpose of this study was to investigate the effect of the new nst method using thera - band on cervical rom and shoulder pain after overhead work . [ subjects ] fourteen male subjects were recruited . [ methods ] this study measured the cervical rom and pressure pain threshold ( ppt ) of the upper and middle trapezius ( ut and mt ) muscles after the control and nst groups had performed overhead work . [ results ] the cervical flexion , extension , and lateral flexion angles of the nst group were significantly larger than those of the control group . the ppts of ut and mt of the nst group were significantly higher than those of the control group [ conclusion ] the nst prevented rom reduction and pain in the cervical and shoulder regions .

transmission electron microscopy ( tem ) is one of the main tools to investigate the morphology of materials , from subnanometer to micrometer length scales . however , the interaction of electrons with materials , and especially beam sensitive structures such as polymers , biological materials , or zeolites , causes different types of radiation damage , e.g. , atomic displacement , electrostatic charging , sputtering , radiolysis , and knock - on damage . these mechanisms operate at different length scales : at subnanometer length scales , knock - on damage and atomic displacement can result in distorted crystal lattices , while morphology changes due to heating , electrostatic charging and sputtering are visible at nanometer and micrometer length scales . hence , for beam sensitive materials , beam damage constitutes a physical limit and determines the resolution that can be achieved in imaging , diffraction , and electron tomography . therefore , it is important to analyze and understand beam damage to facilitate the study of these ( beam sensitive ) materials with a minimum amount of artifacts . the degradation of crystal lattices , at subnanometer length scales , can be studied by electron diffraction . it is well established that electron beam damage causes the fading of diffraction spots and rings in protein crystallography , and it has been shown that it is affected by the temperature of the material , the electron flux through the material , and the accumulated amount of electrons transmitting the material . furthermore , this effect is easily quantified by following the intensity of diffraction rings or spots as a function of accumulated dose . the effects of beam damage at nanometer and micrometer length scales are dependent on and specific to the utilized imaging mode but mainly relate to materials loss by sputtering , and shrinkage . the degradation of materials causes artifacts in the form of changes in contrast or local intensity , while mass loss will result in an increase in overall intensity . in the literature , this phenomenon is mostly studied by using the difference image of two images with different accumulated electron doses . these techniques , however , is not commonly used to follow beam damage over a multitude of images , which is essential for e.g. electron tomography . the analysis of organic photovoltaics ( opvs ) is a good example where beam sensitivity plays an important part . since the morphology of this photoactive layer , i.e. , the distribution of molecules , including their nanoscale phase separation , has a large impact on the overall efficiency of opvs , tem has become a standard characterization tool . common opv materials are e.g. poly(3-hexylthiophene ) ( p3ht ) and phenyl - c61-butyric acid methyl ester ( pcbm ) . these materials show diffraction rings instead of diffraction spots , resulting from the random orientation of crystallites or the presence of amorphous phases . therefore , radial averaging of diffraction patterns is a suitable way to record and analyze the intensity change of p3ht and pcbm diffraction signals upon electron beam damage . in the analysis of opvs , tem samples are usually created by floating the photoactive layer on water from a water - soluble polymer film . the resulting water that is present in the sample might play a role in beam damage mechanisms as well , for example , by creating oxygen radicals . an oxygen- and water - free sample preparation method is therefore introduced to specifically study the influence of sample preparation . in this paper , beam damage is studied in both diffraction and bright field imaging , investigating the effect of electron dose rate , temperature , and sample preparation . more specifically , ( 1 ) beam damage of the crystallinity is quantified via radially averaged diffraction patterns , ( 2 ) mass loss is assessed via changes in intensity and standard deviation of the mean intensity , and ( 3 ) shrinkage is determined by monitoring the movement of markers , while a method is introduced to determine shrinkage or expansion via the use of the normalized cross - correlation . poly(3-hexylthiophene ) ( p3ht , plexcore os2100 ) was supplied by plextronics , while pcbm ( ( 6,6)-phenyl - c61-butyric acid methyl ester , purity 99% ) was purchased from solenne b.v . and the solvent o - dichlorobenzene ( odcb ) from sigma - aldrich . pedot : pss ( clevios p vpal 4083 ) was purchased from heraues gmbh . tem grids ( quantifoil , r2\2 200-mesh cu ) was purchased form quantifoil micro tools gmbh . p3ht and pcbm were dissolved in odcb , resulting in a solution with 1 wt % p3ht and 1 wt % pcbm . the solution was stirred at 70 c for 24 h to ensure complete dissolving of the materials . a custom - made specimen holder was used to facilitate direct spin - coating on tem grids . four recesses were laser ablated ( 20 m deep with a diameter of 3 mm ) on 5 , 10 , 15 , and 20 mm from the center of a 50 50 mm glass plate . a custom spring was designed to lock the tem grids in the recesses , with minimal altering of flow behavior of the solution during spin - coating . glass plates were cleaned by ( 1 ) ultrasonication in acetone for 30 min , ( 2 ) rubbing with soap and rinsing with demineralized water , ( 3 ) ultrasonication in isopropanol for 30 min , and ( 4 ) uv - ozone for 30 min . first , pedot : pss was spin - coated on 25 25 mm glass plates , at 3000 rpm for 60 s , resulting in a 50 nm thick water - soluble layer . the p3ht : pcbm solution was subsequently spin - coated at 2000 rpm for 120 s , which results in a 25 nm thick layer . the opv thin films prepared on the pedot : pss spin - coated glass plates were submerged in water to dissolve the pedot : pss layer , resulting in an opv thin film floating on a water surface . this film was picked up on a glow - discharged tem grid , dried at room temperature , and subsequently annealed in air at 120 c for 10 min . after floating of the opv layer on water and pickup by the tem grid , there is a small chance that some pedot : pss will remain on the sample surface . however , due to the small surface - to - volume ratio , the diffraction and imaging experiments are dominated by the bulk information , including oxygen and water which can penetrate into the bulk . furthermore , this adds a significant advantage to the new direct spin - coating method , since there certainly will be no pedot : pss present during this method . in one of the conventional prepared samples , silver particles ( 10 nm diameter , dissolved in toluene with oleylamine as capping agent ) were added to the p3ht : pcbm solution before spin - coating . to exclude water and oxygen being present in the opv thin film , another approach was followed . here , the opv thin film was directly spin - coated on a tem grid inside a glovebox ( m - braun labmaster glove box system ) at 500 rpm for 10 min . the directly spin - coated samples were annealed at 120 c for 10 min inside a glovebox . note that the direct spin - coating method is not used as an alternative to opv device fabrication but as an alternative tem sample preparation method . it is not possible to achieve water- and oxygen - free tem analysis by preparing a sample using the common floating method , hence the need for a direct spin - coating method . for clarity , the sample code used in the results section the samples were loaded into the tu / e cryo titan ( fei company ; now thermo fisher scientific ) , which was operated at 300 kv and is equipped with a field emission gun . diffraction patterns were acquired at dose rates of 0.1 , 1 , 10 e/( s ) , with exposure times of 5 , 0.5 , and 0.05 s ( keeping the total dose per pattern constant ) , at a camera length of 1.15 m. for the bright field imaging experiments , the dose rates were set at 1 , 10 , and 100 e/( s ) , with exposure times of 5 , 0.5 , and 0.05 s ( again , keeping the total dose per image constant ) , respectively , at a magnification of 18k . for high accumulated dose experiments , the screen was flipped down to realize constant irradiation and flipped up to acquire intermediate images . diffraction patterns were radially averaged using an in - house matlab script ( details in the supporting information , section 1 ) and fitted by a nonlinear least - squares method using the lsqnonlin command in matlab ( details in results section and figure 1b ) . the signal intensities of p3ht ( at 0.256 ) and pcbm ( at 0.217 ) were normalized to their initial intensity and followed as a function of accumulated electron dose . ( a ) fading of diffraction rings of a p3ht : pcbm bulk heterojunction at room temperature , before and after exposure to 50 e / . ( b ) radial average of diffraction pattern as shown in ( a ) decomposed in its different components by least - squares fitting . prior to further analysis , bright field images were aligned via cross - correlation to avoid processing artifacts from sample drift . the aligned data stack was cropped to the overlap area present in all images for analysis . from the resulting aligned stack of images , the average intensity , standard deviation , and the normalized cross - correlation coefficient with the first image of the series were measured as a function of accumulated electron dose . finally , to assess local deformations , the aligned stack was cut into 16 subareas of equal size . these subarea stacks were individually aligned via cross - correlation . from this alignment , the shift of each individual subarea with respect to the first image in the x and y direction was used to calculate the displacement of each subarea . furthermore , the relative displacement from the center of the total image was calculated by measuring the distance between the center of the subarea and the center of the total image . more details can be found in the results section and supporting information section 2 . figure 1a shows a diffraction pattern obtained from a typical p3ht : pcbm bulk heterojunction prepared via the conventional sample preparation ( cf / rt/10 ) , before and after exposure to 50 e / at room temperature . it is evident that the sharp outer ring , depicting the ( 020 ) lattice spacing in p3ht , is decreasing in intensity faster than the broad inner ring , characterizing pcbm nanocrystals , which is in agreement with previous studies . since the pcbm is inherently broader than the p3ht ring , indicating a large part of pcbm being amorphous , a slower decrease in diffraction intensity for pcbm the radially averaged diffraction pattern of the p3ht : pcbm bulk heterojunction is presented . to quantitatively analyze the decrease in intensity as a function of accumulated electron dose , it is necessary to separate neighboring peaks . therefore , to independently address the intensity of the pcbm peak at 0.217 and the p3ht peak at 0.256 , the spectrum was fitted to a model function by least - squares fitting . this function contains ( in the same order as in eq 1 ) a gaussian describing the pcbm peak , a gaussian describing the p3ht peak , a gaussian located between 0.285 and 0.323 describing ( inseparable ) secondary components of both p3ht and pcbm , a power law to estimate the inelastic background , and a constant representing residual dark current in the diffraction patterns . the variables a1 and a2 describe the intensity of the pcbm and p3ht signal , respectively.1 to study the effect of electron dose rate on the decrease of intensity of p3ht and pcbm diffraction rings , dose series were acquired at various dose rates , i.e. , 0.1 , 1 , and 10 e/( s ) . the dose per image was kept constant at 0.5 e / by adjusting the exposure time accordingly . because of differences in absolute peak height for pcbm and p3ht , and changes in pcbm / p3ht ratio in different regions of the sample , all peaks were normalized to the peak intensity of pcbm ( a10 ) and p3ht ( a20 ) of the initial diffraction pattern ( a1,20 ) . figure 2 shows the decrease in relative intensity ( a1,2i / a1,20 ) for p3ht ( a ) and pcbm ( b ) acquired at three different dose rates ( cf / rt / x ) , in the presence of water and oxygen . the results confirm that the relative intensity of the p3ht diffraction ring decreases faster than the relative intensity of the pcbm diffraction ring , as seen in figure 1a . in all three cases the critical dose for p3ht , which we define by the accumulated electron dose at which the relative intensity decreases to 1/e ( 37% ) , is about 1619 e / ( table 2 ) , as calculated from an exponential decay fit . most notably , changing the electron dose rate from 0.1 to 10 e/( s ) has no significant effect on the fading of the diffraction rings , i.e. , the critical dose . fading of relative diffraction intensity ( a / a ) as a function of accumulated dose for p3ht ( a ) and pcbm ( b ) at different dose rates . for visibility reasons the critical dose of pcbm was obtained by an exponential decay extrapolation of the curves in figure 2b ( details are presented in the supporting information , section 3 ) . therefore , the critical dose for pcbm is less well - defined than the critical dose for p3ht . table 2 shows that this critical dose is between 265 and 412 e / . despite the large error due to extrapolations , it is clearly shown that the critical dose of pcbm is more than 10 times larger than the critical dose of p3ht . therefore , in this system , the stability of p3ht is the limiting factor . the results show that , using a dose of 0.1 e / per image , at least 160 diffraction patterns can be acquired , opening up the possibility of using high electron dose techniques such as electron diffraction tomography for organic crystals . to complement the presented results , studies on beam damage effects for each component individually and nanocomposites of different ratios should be considered . , dose rates between 0.1 and 10 e/( s ) do not have an effect on the rate of relative intensity loss of both p3ht and pcbm . this is in agreement with previous studies on the decrease of features in the eels spectrum of other organic materials , but in contrast with observations of karuppasamy et al . in single - particle cryo - electron microscopy . note that karuppasamy et al . used an electron microscope operating at 120 kv , significantly decreasing the inelastic mean free path . at 300 kv , as in our experiments , changing the sample thickness or increasing the electron dose rate to values above 10 e/( s ) might therefore cause an electron dose rate effect on sample damage . nonetheless , this falls beyond the scope of this paper and is therefore not investigated . as the decrease in diffraction intensity is related to the breaking of chemical bonds , beam damage will change the homo and lumo levels of opv materials , which can be measured with electron energy loss spectroscopy ( eels ) . based on the low - loss eels results presented in ref ( 17 ) , a critical dose can be estimated which is similar to our diffraction results . this clearly illustrates the close relationship between diffraction intensities and energy levels in opv materials with low - dose diffraction being somewhat simpler to carry out and more broadly available for critical dose measurements . the above results were obtained with a standard opv bulk heterojunction sample imaged at room temperature . additional dose series were acquired in cryogenic conditions , as this has been shown to reduce beam damage in beam sensitive materials . we furthermore studied the effect of sample preparation using either the conventional sample preparation ( cf ) or by direct spin - coating ( ds ) on a tem grid in a water and oxygen - free environment ( glovebox ) , facilitated by a custom - made tem specimen holder as described in the methods section . figure 3 shows the influence of temperature and sample preparation on the decrease of relative intensity of the p3ht ( a ) and the pcbm ( b ) signal , with a dose per image of 0.5 e / acquired with a dose rate of 10 e/( s ) . it is clearly visible that the sample cf / cryo/10 shows a slower fading of the diffraction signal for both the pcbm and the p3ht signal . the critical dose increases from 16 e / at room temperature to 108 e / at 80 k ( table 3 ) . hence , cryo - preservation is shown again to be essential in the analysis of beam sensitive materials . more importantly , having a quantitative criterion or threshold for determining exposure limits as presented here will provide a framework to maximize useful information before beam damage influences the validity of acquired data . fading of relative diffraction intensity ( a / a ) for p3ht ( a ) and pcbm ( b ) as a function of accumulated dose , showing the effect of sample preparation at room temperature ( rt ) and at 80 k ( cryo ) . sample preparation effects , i.e. , the presence or absence of oxygen and water , are only minor at room temperature . however , at cryogenic conditions , the rate of relative intensity loss for p3ht ( figure 3a , purple triangles ) is significantly decreased by a water- and oxygen - free sample preparation method ( ds / cryo/10 ) , increasing the critical dose from 108 to 188 e / ( table 3 ) . a detailed analysis of the significance of these results is presented in the supporting information , section 4 . the observed difference in critical dose for p3ht and pcbm with or without oxygen and water being present at low temperatures these molecules will form radicals upon electron beam irradiation , thus decreasing the crystalline order at lower accumulated electron doses . because of the fact that the samples have been in high vacuum for at least 30 min before imaging , it is expected that water and oxygen will diffuse out of the material at rt conditions and thus only be present in small amounts in the imaged thin film . this explains why sample preparation seems to have little influence when measuring at room temperature . for cryogenic conditions the exclusion of water and oxygen significantly improves the stability of p3ht exposed to an electron beam . furthermore , for the room temperature experiments , annealing in air might cause minor damage . this also could explain the observed critical dose , causing the critical dose for the cf / rt/10 to be lower than the critical dose for ds / rt/10 . the values in table 3 also suggest that a water- and oxygen - free method increases the critical dose of pcbm in cryogenic conditions . in this case , a linear extrapolation was used , since the adjusted r value for the exponential decay fits were too low ( 0.85 ( exponential fit ) compared to 0.95 ( linear fit ) ) . since the pcbm intensity decay will probably not behave in a linear fashion , one could suggest that the difference between the pcbm critical doses at cryogenic conditions is therefore not significant . since pcbm is more hydrophobic than p3ht , and it is known that p3ht forms a charge - transfer complex with oxygen , it can indeed be expected that the presence of water and oxygen has less influence on the decay of the pcbm diffraction ring . in imaging mode , beam damage can present itself as among others ( 1 ) shrinkage or expansion of an organic thin film and ( 2 ) sample thinning due to mass loss . both effects were measured by acquiring dose series of samples prepared by cf and ds methods . these series of images were acquired at different dose rates and at either room temperature or cryogenic conditions . to study sample deformations , the normalized cross - correlation coefficient ( nccc ) of an image with respect to the first image within the series was calculated . sample thinning due to mass loss was assessed by the relative decrease in average pixel intensity and the accompanying standard deviation . figure 4a shows the decrease of the nccc with respect to the original image as a function of accumulated dose at dose rates of 1 , 10 , and 100 e/( s ) ( cf / rt / x ) . local differences in thickness , small deviations in intensity due to microscope instabilities , and high contrast contaminations cause the nccc to start at different values for each series . therefore , the trend of the curves is studies instead of the absolute nccc values . it is clearly visible that the nccc drops quickly before a more stable regime is reached after approximately 150180 e / , as calculated from the intersect of two linear fits : one fitted to the first 50 e / and one fitted between 750 and 1000 e / ( for details , see supporting information , section 5 ) . identical fit regimes were chosen in every experiment to ensure a fair comparison between data sets , at room temperature and at cryogenic conditions . ( a ) cross - correlation coefficient with respect to the first image of three dose series ( 1 , 10 , and 100 e/( s ) ) as a function of accumulated dose . for visibility reasons , ( b ) cross - correlation coefficient with the first image of a dose series acquired at 10 e / at room temperature , starting at 750 e / . an exponential fit is added to calculate the critical dose . for cf / rt/100 , the quick initial drop is less evident ( a slope of ( 6.73 0.04 ) 10 as compared to ( 1.32 0.04 ) 10 and ( 1.67 0.05 ) 10 for cf / rt/1 and cf / rt/10 , respectively ) , which is likely caused by pre - exposure with a higher dose before starting the dose series . an exposure of 0.25 s to check that there was no carbon film in the entire field of view caused a pre - exposure of 0.25 and 2.5 e / for the cf / rt/1 and cf / rt/10 samples , respectively , which is small compared to the dose limit . however , for the cf / rt/100 , this pre - exposure will be 25 e / . this will cause significant damage , and therefore the nccc for the last image will be higher , as the first image is already more damaged . after the cutoff dose is reached , a more stable second regime starts , as indicated by a much smaller slope ( 1 10 ) . since the cutoff dose and the slope of the second regime are fairly similar between dose rates of 1 to 100 e/( s ) , it is concluded that the dose rate effect is negligible , similar to the diffraction data . although the slope of the second damage regime is much smaller , beam damage still occurs . in a similar way as introduced for the diffraction data , a quantitative criterion can be set to calculate the critical dose , at which the initial nccc decreases with a factor of e. to estimate this critical dose for imaging , a dose series is acquired at 10 e/( s ) , reaching an accumulated dose of 30 000 e / . an exponential decay curve is fitted to the nccc decay of this data set , starting at 750 e / to exclude effects from the first damage regime . calculating the critical dose imaging results in a value of ( 2.6 0.2 ) 10 e / ( for details , since the nccc is a measure of similarity , it will entail among others sample deformation and contrast loss or intermixing . to show that the initial drop in cross - correlation is caused by sample deformations , the stack of aligned images acquired at 10 e/( s ) was cut into 16 equal subimages ( figure 5a ) , and these different subimages were aligned by the normalized cross - correlation to the next image of the dose series . this approach facilitates the measurement of displacement of each subimage , i.e. , expansion or contraction of the thin film as a function of accumulated dose . it is clearly visible that the displacement of the subimages at the corners and edges of the stack is larger than the displacement of the subimages at the center of the stack ( figure 5b ) , indicating movement to or from the center of the stack . calculating the relative increase in distance between the center of each subimage and the center of the total image results in a shrinkage of 0.70 0.14% at an accumulated dose of 1000 e / . ( a ) schematic representation of cutting a stack of images in 16 parts ( left to middle ) and using the cross - correlation to find the shift in 1 part of the image compared to the original image ( right ) , as a representation of shrinkage or expansion . ( b ) the average shift of the 4 corner subareas , the 8 edge subareas , and the 4 center subareas , acquired at 10 e/( s ) . ( c ) relative decrease in standard deviation of the mean intensity as a function of accumulated dose for samples prepared by the common floating approach at room temperature , at three different dose rates . for visibility reasons , the validity and accuracy of the method above has been proven against an approach that uses the movement of high contrast silver makers to determine shift , as presented in the supporting information , section 2 . as a different measure to assess beam damage , we quantify the change in average intensity that can be interpreted as a change in mass thickness due to either mass loss or deformations of the thin film . to minimize the effects of microscope instabilities , two low - magnification overview images were taken , before and after the dose series . from these two images the intensity ratio of the nonilluminated and illuminated region before and after the series was calculated ( table 4 ) . because of the occurrence of lateral shrinkage , one would expect the sample to become thicker ( assuming volume preservation ) , since material is moving toward the center . however , table 4 shows an insignificant change in intensity , which can be explained by the fact that the relative shrinkage is small . furthermore , thinning caused by mass loss will increase the average intensity , compensating for the thickening effect of shrinkage . before and after images are shown in the supporting information , section 7 . last , figure 5c shows the relative decrease in standard deviation of the mean intensity of the aligned images . shrinkage would result in a higher standard deviation , since more data will move into the field of view . it is , however , clear that the standard deviation decreases , again pointing out that mass loss plays a significant role in beam damage processes . the fast drop in relative standard deviation at the onset of beam damage might be caused by quick mass loss of material at the surface of the sample removing sample roughness . after this initial drop , a more stable regime is reached where mass loss plays a less significant role since the sample has reached a more equilibrated state . from this , we can again conclude that in imaging mode a dose rate between 1 and 100 e/( s ) has a negligible effect on beam damage . furthermore , we can conclude that the minimal pre - exposure of polymer thin films or microtome sections , often applied prior to acquiring electron tomography data sets , can now be quantified to limit artifacts in imaging . during this regime , mass loss and shrinkage occur , while after this regime , a second regime will set in , significantly reducing the rate of electron beam damage at higher doses . furthermore , a critical dose in imaging is calculated , which results in a critical dose of more than 2500 e / . even when the cutoff dose of the first damage regime is subtracted , this leaves more than enough dose available for acquiring tomography data sets ( e.g. , tilting from 70 to + 70 in 1 steps , with 10 e / per image results in a total dose of 1410 e / ) . figure 6a shows the decline of the nccc with respect to the first image as a function of accumulated dose , for series acquired at room temperature and cryogenic conditions , and prepared by either the cf or ds methods . comparing the room temperature measurements , one can see that the decrease in nccc in the first regime does not significantly change for ds method , as the calculated slope is ( 1.57 0.12 ) 10 compared to ( 1.67 0.05 ) 10 for the cf method . however , the cutoff between the two damage regimes decreases from 156 9 to 96 12 e / . this indicates that the rate of damage is similar for both the cf and the ds method but that the total damage in the first regime will be smaller for the ds method ( the relative decay of nccc at the cutoff dose decreases from 24% for the cf method to 15% for the ds method ) , indicating a more stable system . ( a ) decrease in nccc with respect to the first image for dose series acquired at 10 e/( s ) , at room temperature and at cryogenic conditions , from samples prepared by either the conventional floating method or the oxygen- and water - free method . ( b ) cross - correlation with the first image of a dose series acquired at 10 e / at room temperature of a sample prepared by the oxygen- and water - free method . ( c ) mean - squared displacement of the 12 edge subareas and the 4 center subareas calculated by alignment via cross - correlation . the images were acquired at 10 e / at room temperature from a sample prepared by either the common floating approach or the oxygen- and water - free method . ( d ) see part c , but for images acquired at cryogenic conditions . for visibility reasons , every fifth data point is shown . the second , more stable regime shows a relatively constant nccc for the ds method , since the slope of this regime decreases from ( 12.7 0.3 ) 10 for the cf method to ( 6.9 0.2 ) 10 without water and oxygen present . the critical dose therefore increases from ( 2.6 0.2 ) 10 e / for the cf method to ( 5.0 0.4 ) 10 e / for the ds method ( for details , see supporting information , sections 5 and 6 ) . this again indicates that the ds method will create a more stable system during electron beam radiation . figure 6c shows the displacement of parts of the images acquired at room temperature by using the alignment method as described before . it is clearly visible that by using the ds method , the shrinkage of the thin film decreases significantly , from 0.70 0.18% to 0.40 0.14% . the sample prepared by the ds method is more stable , since it is clear that the absolute decrease in relative standard deviation is smaller for this method . just as the nccc behavior , a second more stable regime sets in . the smaller slope in this regime for the ds method ( figure 6b , black squares vs red circles ) indicates a larger stability . all in all , this leads to the conclusion that at room temperature an oxygen- and water - free sample preparation method significantly enhances sample stability . after subtracting the initial pre - exposure regime , an electron dose of 5 10 e / is still available before reaching the critical dose imaging , which is about twice as much as for a sample prepared by the cf method . furthermore , since the relative decay of nccc at the cutoff dose is smaller for the ds method , the acquired data set in the second regime will show the most resemblance to the sample in the initial , nondamaged state . figure 6a also shows the evolution of the nccc as a function of accumulated dose in cryogenic conditions . clearly , the two damage regimes remain visible . the slope of the first regime decreases from ( 1.57 0.12 ) 10 for ds / rt/10 to ( 9.25 0.76 ) 10 for ds / cryo/10 and to a minimum of ( 9.53 0.57 ) 10 for cf / cryo/10 . this indicates that cryo - preservation could be useful when acquiring small data sets with a low total dose , since the nccc changes more slowly , and one can therefore acquire images as close as possible to the original , nondamaged state . the cutoff between the two damage regimes increases from 156 9 e / for cf / rt/10 to 219 19 and 271 28 e / for cf / cryo/10 and ds / cryo/10 , respectively . with a relative decay of 19% at the cutoff dose for cf / cryo/10 , in comparison to 37% for ds / cryo/10 , it can be concluded that for small data sets with relatively low doses a conventional floating method at cryogenic conditions is best applicable , since the nccc decreases slowly over a larger amount of dose . in cryogenic conditions , the second regime behaves differently in comparison to room temperature conditions , since the nccc is increasing again . therefore , it was impossible to determine a useful critical dose imaging , based on an nccc decay by a factor of e. the increase in nccc can be explained by an inversion of the displacement , i.e. , initial shrinkage followed by expansion or vice versa . this is confirmed by the displacement of subareas , shown in figure 6d . at an accumulated dose of 400 e / , the relative shrinkage is calculated to be 0.39 0.16% and 0.79 0.42% for cf / cryo/10 and ds / cryo/10 , respectively . this means that the sample will expand first , before it starts to shrink , in contrast to room temperature conditions where shrinkage occurs directly from the onset of beam damage . whether a stable regime will appear after shrinkage in cryogenic conditions , just as in room temperature conditions , is not investigated . because of the initial expansion , one would expect an initial decrease in standard deviation , since the information on less material will be spread over the same amount of pixels . this effect is seen in figure 6b . however , for the cf / cryo/10 sample , this effect is minimal . local mass loss , which is expected since oxygen and water can be removed easily , will increase the standard deviation , explaining the smaller decrease in relative standard deviation . in cryogenic conditions , in contrast with room temperature conditions , the sample seems to be destabilized by an oxygen- and water - free sample preparation method . furthermore , even without oxygen and water being present , the stability at high doses is less in cryogenic conditions than at room temperature . further details on intensity changes of areas before and after exposure can be found in supporting information section 7 . by combining diffraction and imaging data , we have investigated electron beam damage effects in p3ht - pcbm thin films over multiple length scales . analysis of the fading of electron diffraction rings allows us to quantify the beam sensitivity of each component of the nanocomposite individually . this shows that pcbm is 15 times more stable based on the criterion of the critical dose diffraction , i.e. , the accumulated electron dose at which the intensity of the corresponding diffraction ring decreases with a factor of e. for electron dose rates between 0.1 and 10 e/( s ) , no dose rate effects are observed . cryo - preservation increases beam stability of both materials with the critical dose for p3ht significantly increasing from 16 to 108 e / , while the critical dose for pcbm increases from 392 to 596 e / . most importantly , it is shown that excluding water and oxygen during sample preparation further improves the beam stability of these materials , reaching a critical dose of 188 e / for p3ht , which corresponds to a 10-fold increase over conventional sample preparation and room temperature diffraction . beam damage in imaging mode was analyzed in terms of mass loss and thin film deformations . the normalized cross - correlation coefficient ( nccc ) between images contains contributions from among others contrast loss and intermixing of phases . here , the nccc is used to assess sample deformation , as the nccc is followed as a function of accumulated dose . first , it is shown that the dose rate effect is negligible for dose rates between 1 and 100 e/( s ) . second , experiments at room temperature show a quick initial decrease in nccc before a stable second regime is reached . in this first regime , shrinkage and mass loss occurs , as shown via the movement of subimages and changes in relative standard deviation . the second , more stable regime is used to calculate a critical dose imaging , defined by the dose at which the initial nccc is decreased with a factor of e. an oxygen- and water - free sample preparation method increases this critical dose imaging from 2600 to 5000 e / . furthermore , since the relative decay of the nccc at the cutoff dose is lowest in oxygen and water free conditions , data acquired in this second regime will be closest to the sample in a nondamaged state . in cryogenic conditions , the first regime shows a slower decrease of the nccc , indicating that the first regime is more stable than in room temperature conditions . in the second regime , however , the nccc increases again . this is due to the fact that after an initial expansion of the thin film the sample starts to shrink . in summary , we suggest to use an oxygen- and water - free sample preparation method combined with cryogenic conditions in diffraction mode , while for imaging an oxygen- and water - free sample preparation method is best suited combined with data acquisition at room temperature ( high total doses , large data sets ) and a conventional floating method is best suited for cryogenic condition ( small total doses , small data sets ) . we believe that the quantitative analysis of tem beam damage as illustrated here will become a standard tool to optimize tem imaging conditions and sample preparation protocols in the future .

in transmission electron microscopy ( tem ) the interaction of an electron beam with polymers such as p3ht : pcbm photovoltaic nanocomposites results in electron beam damage , which is the most important factor limiting acquisition of structural or chemical data at high spatial resolution . beam effects can vary depending on parameters such as electron dose rate , temperature during imaging , and the presence of water and oxygen in the sample . furthermore , beam damage will occur at different length scales . to assess beam damage at the angstrom scale , we followed the intensity of p3ht and pcbm diffraction rings as a function of accumulated electron dose by acquiring dose series and varying the electron dose rate , sample preparation , and the temperature during acquisition . from this , we calculated a critical dose for diffraction experiments . in imaging mode , thin film deformation was assessed using the normalized cross - correlation coefficient , while mass loss was determined via changes in average intensity and standard deviation , also varying electron dose rate , sample preparation , and temperature during acquisition . the understanding of beam damage and the determination of critical electron doses provides a framework for future experiments to maximize the information content during the acquisition of images and diffraction patterns with ( cryogenic ) transmission electron microscopy .

the increasing prevalence of obesity represents a major public health concern in many countries , and healthy eating can play a predominant role in prevention strategies . in this context , it is important to identify effective nutritional strategies to help individuals achieve or maintain a healthy weight by making better food choices . one of these strategies consists in the regulation of food labeling , which includes the use of nutrition claims intended to provide a quick and easy way to identify foods with nutritional features of interest [ 24 ] . in this regard , satiating properties of foods induced by specific nutrients such as fibres or proteins are of particular interest [ 5 , 6 ] . indeed , there is convincing evidence that appetite sensations are important determinants of long - term energy intake [ 7 , 8 ] and that satiety - enhancing foods may provide benefit to consumers by facilitating appetite control and compliance with weight - management efforts . furthermore , the regulation of nutrition claims related to satiety is currently evaluated and developed by health organizations , which clearly recommend that such claims are supported by strong scientific evidence [ 10 , 11 ] . while nutritional information related to the satiating effects of foods might be relevant for weight control , less is known about consumers ' perception and understanding of such nutrition claims and how these claims can affect perceived appetite sensations . indeed , nutritional information conveyed by food labeling can be difficult to understand for many consumers , particularly for older adults , adolescents , or those with less education [ 12 , 13 ] . nutrition claims can also be misunderstood , which may lead to misleading inferences or unexpected eating behaviors . for example , a recent study showed that a low - fat - labeled candy was perceived healthier than a regular - labeled candy , independent of caloric information . healthy was considered less fattening and that the amount eaten was 35% higher than when the snack was described as unhealthy . with regard to appetite sensations , it has been demonstrated that a food considered as unhealthy is perceived to contribute more to weight gain and satiation , while imposed healthy eating can increase the sensation of hunger . beliefs and expectations about the satiating power of a food can also affect perceived fullness , and this effect can persist as long as three hours after the meal . another study showed that a meal presented as highly satiating , without having physiological satiating properties , can increase satiety potential more than a meal having physiological satiating properties , but presented as regular . this suggests that the psychological effect of a satiety - related claim can be as effective as a physiological effect related to intrinsic satiety properties and highlights the need to better understand this possible psychological effect . individual factors such as sex , weight , or restrained eating could also influence the perception of foods and modulate behavioral change . as the perception of food can influence appetite sensations , it could be hypothesized that individual factors can also modulate the perception of appetite sensations . since women generally consider themselves as being more knowledgeable about nutrition and having better eating habits and tend to pay more attention to nutritional information , it could be suggested that women would be more readily influenced by nutrition claims . overweight / obese individuals and restrained eaters might also be more sensitive to nutrition claims related to healthy eating or weight loss since they can use it as a tool for weight management . interestingly , one study showed that food products carrying satiety - related claims were generally not seen as a magic bullet to weight loss , but that restrained eaters were more prone to overinterpretation of these claims , that is to interpret it as directly delivering weight loss . individual factors can thus affect perception of foods and perceived appetite sensations , but they can also act in a physiological way . indeed , some studies have associated higher levels of restraint with an orexigenic hormonal profile [ 24 , 25 ] , suggesting that restrained individuals could more easily feel hunger . it has also been proposed that overweight / obese individuals are less connected to their internal signals than normal - weight individuals , making the detection of hunger and satiation more complex . sex , weight , and restrained eating are thus variables of interest when studying appetite sensations , alone or in combination with nutrition claims . in summary , current literature suggests that nutrition claims may influence perception of foods and appetite sensations and that this influence could be modulated by individual factors such as sex , weight , or restrained eating . in that context , there is an urgent need to better understand the way nutrition claims should be used , taking into account possible side effects , and evaluate the relevance of some claims in a public health nutrition context . this study addresses this issue by evaluating combined and separated effects of nutrition claims and individual factors on appetite sensations . the main purpose of this study was to evaluate the impact of nutrition claims and individual factors on perceived appetite sensations . the specific objectives were ( 1 ) to evaluate the effects of healthy , diet , or claims on appetite sensations , ( 2 ) to evaluate if sex , weight , or restrained eating influence appetite sensations , and ( 3 ) to investigate if sex , weight , and restrained eating can modulate the effects of nutrition claims on appetite sensations . note that the hedonic condition refers to ingredients generally considered as highly palatable and that the diet condition refers to satiating properties ( see section 2.1 for a complete description ) . our corresponding hypotheses are that ( 1 ) the snack in the healthy condition will be less satiating than in the diet or hedonic conditions , ( 2 ) individual factors such as sex , weight , and restrained eating will significantly influence appetite sensations , and ( 3 ) the satiating effects of the diet and hedonic conditions will be more important in overweight / obese restrained women . the study was conducted among 164 men and 188 women ( aged 1865 ) from quebec city , canada , who were invited to taste and rate an oatmeal - raisin snack in a blinded and ad libitum context . exclusion criteria were personal condition or history of diseases that could affect food intake ( unstable weight in the last two months , pregnancy , breastfeeding , eating disorders , type 1 or 2 diabetes , and uncontrolled hypo- or hyperthyroidism ) , use of medication that might interfere with appetite or food taste ( antidepressants , antipsychotic , or corticosteroids ) , and food allergies for safety reasons . participants were randomly assigned to an experimental condition in a three ( healthy versus diet versus hedonic ) by two ( restrained or not restrained ) by two ( normal - weight or overweight / obese ) by two ( men versus women ) factorial design , which means that the recruitment was based on these characteristics in order to obtain a balanced number of participants in each subgroup . this design results in eight subgroups based on individual characteristics combined with the three experimental conditions tested , which leads to a total of 24 combinations for the analysis . the factorial distribution of participants is presented in table 1 . initial randomization was performed according to self - reported weight and height and restraint score , but participants were reassigned according to their measured data if needed . condition emphasized the favorable nutritional characteristics of the snack : the snack product that you have to taste today is a new high - fiber oatmeal snack made with healthy ingredients . you have certainly heard that whole oatmeal is good for your health because it contains soluble fibers . so , this new oatmeal snack is high in soluble fibers , as well as low in saturated fat and free from trans - fat . the diet condition focused more on beneficial satiating properties for weight management : the food product that you have to taste today is a new healthy high - fiber snack . you must have probably heard that whole - grain foods , like those that contain oat soluble fibers , are composed of complex carbohydrates which are digested slowly and which can delay the appearance of hunger . this new healthy snack has been especially designed to satiate , because it is a source of fibers , which make it an interesting choice for any persons concerned to reach and to maintain a healthy weight . finally , condition underlined the sweet and pleasant taste of the snack using hedonic food words : ( these are ) new gourmet cookies made with fresh butter and old - fashioned brown sugar . so , these new cookies are a great treat with a pleasant , sweet taste . cookie was never mentioned in the two first conditions , and that we specifically chose to use an oatmeal - raisin rather than a chocolate snack in order to facilitate the blinded context of the experiment , as oatmeal and raisins can be considered as healthy ingredients or not depending on the food containing it . indeed , this psychological manipulation was previously shown to be effective in changing the healthiness perception of food [ 16 , 28 ] . in spite of the description , the study was approved by the institutional review board of universit laval ( # 2009 - 117/26 - 05 - 2009 ) and was registered in the clinical-trials.gov registry ( nct01141140 ) . participants came to the institute of nutrition and functional foods ( universit laval ) between 8:30 a.m. and 7 p.m. at a single occasion . they had to be in a fasting state for at least two hours prior to their visit . they were given a food description according to the experimental condition they were assigned and then had 10 minutes to taste the snack ad libitum in a private room . participants stayed for approximately two hours after the taste - rating task to complete appetite sensations scales , questionnaires , and anthropometric measurements . they were told the real goal of the study only at the end of the visit and were free to withdraw their participation at that moment . appetite sensations are defined as follows : hunger refers to the physiological recognition of a need to eat , while desire to eat reflects the motivation to eat , fullness is a physical feeling that could be related to the degree of stomach filling , and satiety refers to the processes that inhibit further intake after an eating occasion has ended . appetite sensations were evaluated with unipolar 150 mm visual analog scales ( vas ) ( adapted from hill and blundell ) . these scales are anchored at the two ends with the extremes of the subjective feeling evaluated . vas have been widely used in the past to evaluate appetite sensations and are considered reliable for single meal protocols [ 31 , 33 ] . participants rated their appetite sensations before the test meal ( time = 10 ) as well as immediately after ( time = 0 ) and 20 , 40 , and 60 minutes later . the first measure ( time = 10 ) was taken immediately before the description of the snack . four appetite sensations were measured : desire to eat ( how strong is your desire to eat ? ; very low desire to very high desire ) , hunger ( how hungry do you feel ? ; not at all hungry to extremely hungry ) , fullness ( how full do you feel ? ; not at all full to extremely full ) , and prospective food consumption ( pfc ) ( how much food do you think you could eat ? ; none at all to a large amount ) . the vas values were calculated by measuring the distance in mm with a ruler from the left end of the scale to the mark drawn by the participant with a precision of 0.5 mm . one - hour area under the curve ( auc ) was calculated from time zero to time 60 with the trapezoid method . as recommended by blundell et al . the auc allows an overall view of the appetite sensation response , while the raw vas data allows comparisons at each time . appreciation of the snack ( in general , how much do you appreciate the food you just tasted ? ) was evaluated with a unipolar 150 mm vas labeled from bottom to top with not at all , moderately , and enormously . a validated food frequency questionnaire ( ffq ) the restraint scale allowed the distinction between restrained eaters ( score 12 for men and 15 for women ) and unrestrained eaters ( score < 12 for men and < 15 for women ) . the validity of the restraint scale for the measurement of restrained eating has been previously reported [ 3739 ] . the food pleasure scale ( fps ) was also used to evaluate the pleasure associated with eating . body mass index ( bmi ) was calculated from weight and height measured after the completion of all questionnaires . participants were classified as normal - weight if they had a bmi under or equal to 25 kg / m and as overweight / obese if they had a bmi higher than 25 kg / m . energy needs were estimated from the mean of ffq data and the harris - benedict formula , as previously performed in our research institute . with a mean cohen 's d estimate of 0.35 , power analyses for anovas testing main effects and interactions indicated that a sample size of 180 males and 180 females would allow the detection of significant differences with an alpha level of 0.02 and a power ( 1 error probability ) of 0.90 . one - way analyses of variance ( anovas ) were used to assess differences in initial characteristics between experimental conditions . in line with the factorial design of the study , factorial repeated measures anovas were performed with mixed procedures for the analysis of the appetite vas ( desire to eat , hunger , fullness , and pfc ) , with time , experimental condition , sex , bmi , and restrained eating used as independent variables and tested in interactions . age and initial appetite sensations ( time = 10 ) were included in the models as potential confounding factors , as they may affect appetite sensations [ 29 , 44 ] . adjustments for energy needs and total amount eaten were also made to palliate to the fact that the amount eaten was ad libitum and therefore not adjusted for energy requirements ( as the study also aimed to measure the effect of claims on food intake ) . time of the day was also added as a covariate in case the two hours fasting period was not long enough to standardize initial appetite sensations . finally , appreciation of the snack and pleasure associated with eating were added as covariates as hedonic eating indicators . similar procedures without repeated measures were used for the analysis of auc for all appetite sensations . the slice option was used to investigate significant experimental conditions effects in each of the eight predetermined subgroups ( based on sex , weight , and restrained eating ) . the structure of covariance matrix was taken into consideration for all statistical models to ensure an optimal fit to the data . a p value < 0.05 was considered statistically significant for all tests , with bonferroni corrections made for all multiple comparisons . all analyses were performed with statistical analysis software version 9.3 ( sas institute , cary , nc , usa ) . a total of 352 participants were recruited and completed the study . from these participants , 11 ( 4 men and 7 women ) were excluded from the analysis because of missing values in covariates . the remaining total of 341 participants ( 160 men and 181 women ) were thus included in the present study . one missing value was also observed for the initial pfc sensation ( time = 10 ) , which led to the exclusion of one participant from the pfc analysis because of the necessity of this covariate in the statistical model . no significant differences were found between conditions for any initial characteristic . as explained previously in section 2.6 , all the following results are adjusted for age , time of the day , energy needs , amount eaten , and initial appetite sensations . note that only initial appetite sensations and total amount eaten contributed significantly to the models . no main experimental condition effect was observed for any of the four appetite sensations evaluated , when expressed in both vas means ( f(2,306 ) = 1.14 for desire to eat , f(2,306 ) = 1.54 for hunger , f(2,306 ) = 0.66 for fullness , and f(2,305 ) = 0.68 for pfc ; p = 1.00 ) and auc ( f(2,306 ) = 2.99 for desire to eat , f(2,306 ) = 3.20 for hunger , f(2,306 ) = 1.06 for fullness , and f(2,301 ) = 0.4440 for pfc ; p = 1.00 ) . mean values for all vas at each time point ( 10 , 0 , 20 , 40 , and 60 minutes ) as well as their related auc are presented in table 3 for each experimental condition . appetite sensations were affected neither by bmi ( p = 1.00 for all vas values and auc ) , nor by restrained eating ( p > 0.96 and p > 0.33 for all vas values and auc , resp . ) . however , a main effect of sex was noted for all appetite sensations , with men reporting higher vas values than women for desire to eat , hunger , and pfc ( p < 0.004 ) and lower vas values than women for fullness ( p = 0.008 ) . as presented in table 4 , cohen 's d effect sizes ( ess ) ranged from 0.08 to 0.52 , which represents small to moderate effects . an effect size comprised between 0.2 and 0.49 represents a small effect size , between 0.5 and 0.79 , a moderate effect size , and 0.8 a large effect size . no sex differences were observed for desire to eat and hunger at baseline , but fullness was higher and pfc lower in women in comparison to men . note that men had significantly higher energy needs and ate significantly more than women ( data not shown ) . as previously explained in section 2.6 , adjustments were made for these covariates for all results presented . significant effects of nutrition claims on appetite sensations were observed in specific subgroups ( based on combinations of individual factors ) . among normal - weight unrestrained women , lower auc values for desire to eat ( es = 0.76 ) , hunger ( es = 1.03 ) , and pfc ( es = 0.72 ) were observed in the diet condition compared with the healthy condition ( table 5 ) . however , significant differences between these two conditions were not observed at each time point . some differences between diet and hedonic conditions and also between healthy and hedonic conditions were also noted among normal - weight unrestrained women . in fact , hunger was lower in the diet condition than in the hedonic condition at time 0 and was higher in the healthy condition than in the hedonic condition at time 20 ( table 5 ) . among overweight / obese unrestrained men , a higher auc value for fullness was observed in the diet condition than in the healthy and hedonic conditions ( ess of 1.19 and 0.99 , resp . ) ( table 6 ) . no significant differences were found between other subgroups for any of the four appetite sensations . the aim of this study was to evaluate the impact of food labeling and individual factors on perceived appetite sensations and more precisely to ( 1 ) evaluate the effects of healthy , diet , or claims on appetite sensations , ( 2 ) evaluate if sex , weight , or restrained eating influence appetite sensations , and ( 3 ) investigate if sex , weight , and restrained eating can modulate the effects of nutrition claims on appetite sensations . associated results are that ( 1 ) claims did not affect appetite sensations , ( 2 ) sex had a significant influence on appetite sensations , but not weight and restrained eating , and ( 3 ) a significant interaction between claims and individual factors has been observed in normal - weight unrestrained women and overweight / obese unrestrained men . as previously reported , the psychological manipulation was effective in changing the healthy perception of the snack , as the healthy condition was considered to be healthier than the diet condition , itself considered healthier than the contrary to our first hypothesis , the three experimental conditions resulted in similar perceived appetite sensations , suggesting that a snack labeled with healthy characteristics is not necessarily perceived as less satiating than a snack labeled with satiating or hedonic properties . this finding is in contradiction with finkelstein and fishbach who demonstrated that participants felt hungrier after eating a healthy chocolate - raspberry bar than after eating the same bar described as yummy . however , few details are given in this study about the composition of experimental groups , and initial hunger sensation was not measured and then not used as a covariate , as performed in the present study . as our statistical models showed that initial sensations are important covariates to consider in the evaluation of appetite sensations , differences in statistical adjustments between studies may explain the different results obtained . our finding is also in contradiction with arguin et al . who demonstrated that highlighting the satiating properties of a meal increases satiety potential against a control condition . the different types of food ( i.e. , snack versus meal ) used and the absence of a control condition ( i.e. , without any description ) in our study may explain why we did not observe such a difference . it could also be explained by the fact that our diet condition was not only targeting satiating properties , but also weight control . as we did not measure the expected satiating power ( as performed previously for perceived healthiness ) in any case , the absence of an effect of nutrition claims on appetite sensations in our study implies neither a contraindication nor incentive to their use in a public health context . as hypothesized , sex had a significant influence on the perception of appetite sensations , regardless of nutrition claims , energy needs , and amount eaten ( men had significantly higher energy needs and ate significantly more than women ) . indeed , men reported higher levels of desire to eat , hunger , and pfc and lower levels of fullness . these results suggest that women could feel more easily satiated than men and could be less tempted to prospectively eat more food . some studies have already reported similar findings [ 7 , 44 ] , while other studies found no sex differences or mixed results depending on the appetite sensation observed and experimental conditions ( ad libitum versus controlled ) . the fact that baseline fullness and pfc were , respectively , higher and lower in women than in men is also of interest . it suggests that these two sensations could differ between men and women even before food consumption . sex differences in the perception of appetite sensations could be explained by differences in hormonal profiles . these observations involve that public health nutrition interventions may not have the same effects in men and women and that individual or group interventions should be adapted in consequence . according to our findings , women could be more responsive to an intuitive or mindful eating approach than men , that is , to eat in response to physical sensations such as hunger and satiety signals [ 4951 ] . health at every size ( haes ) programs , endorsed by the association for size diversity and health , are an example of interventions addressing the recognition of appetite sensations . other programs are also sex - specific , focusing more on body image for women and energy and body functions for men . current literature shows that obese individuals have lower fasting ghrelin levels and that their ghrelin response to food intake is less pronounced than in normal - weight individuals . this is in line with the proposition that overweight or obese individuals could be less sensitive to their internal appetite sensations . however , we found no difference between normal - weight and overweight / obese individuals , which has been found in past literature . another study proposes that hormonal response to food intake could be dependent of a bmi by sex interaction , suggesting that the study of bmi alone is not sufficient . appetite - regulating hormones are not necessarily related to subjective appetite sensations , which could explain why we obtained different results as we only measured perceived appetite sensations and not appetite - regulating hormones . also , we did not differentiate between overweight and obese individuals , our sample including more overweight ( n = 124 ) than obese ( n = 51 ) individuals . no main effect of restraint status on appetite sensations was observed . this was unexpected as restrained eating has been previously associated with higher levels of perceived hunger . it has also been already associated with higher levels of ghrelin [ 24 , 57 ] . hooper et al . also demonstrated that a high degree of weight cycling was associated with an appetite - stimulating hormonal profile . as mentioned previously , however , appetite - regulating hormones are not necessarily well related to subjective appetite sensations . on the other hand , other studies found no effect of restrained eating on hunger [ 44 , 55 ] . restrained eating can be measured either by the restraint scale ( as performed in the present study ) or by the restraint scales included in the three - factor eating questionnaire ( tfeq ) or the dutch eating behavior questionnaire ( debq ) . the restraint scale combines the measure of concern with dieting and weight fluctuation , whereas both tfeq and debq measure attempt to restrict eating , independent of weight fluctuation . the choice of the questionnaire used to classify participants as restrained or not could then explain differences in results obtained between studies . as proposed earlier , it is also possible that restrained eating needs to be considered in interaction with sex or bmi to reveal significant effects . for example , martins et al . showed that restrained eating in women could be associated with lower levels of hunger and higher levels of fullness . even if weight status and restrained eating are important factors to consider in individual consultation , our results suggest that they do not necessarily need to be taken into account for the evaluation of appetite sensations . to our knowledge , this is the first study to explore the influence of nutrition claims on appetite sensations according to a combination of individual factors , namely , sex , weight , and restrained eating . our hypothesis that overweight / obese restrained women would be more easily satiated in the diet and hedonic conditions in comparison with the healthy condition was not confirmed as a satiating effect of the diet condition was rather observed in normal - weight unrestrained women and overweight / obese unrestrained men , while no satiating effect of the hedonic condition was noted . being more easily influenced by satiety - related claims could either indicate a greater susceptibility to external factors , or in contrary a better predisposition for the recognition of internal satiety signals . an effect of nutrition claims was only noticed in individuals presenting a low level of cognitive restraint , which has already been associated with a lower susceptibility to external influences [ 20 , 56 ] . it is then more likely that the diet this observation highlights the relevance of considering individual factors in interaction when studying appetite sensations . our results also suggest that nutrition claims emphasizing satiating properties could be more effective in reducing perceived hunger than claims focusing on hedonic properties . more precisely , it suggests a potential benefit of satiety - related claims , at least in certain subgroups of individuals . first , it might be argued that the healthy and diet labels were not congruent with the food tasted , which could explain the absence of a main effect on appetite sensations . however , this argument is not supported as the manipulation effectively changed the perception of food . on the other hand , no control condition ( i.e. , without any description ) was used , and the diet condition was not only targeting satiating properties but also weight management . also , the amount eaten was not standardized , which however allowed participants to eat according to their physiological and psychological needs . the use of many multiple comparisons and bonferroni corrections could have led to a lack of power , but it can also be argued that the probability of committing type 1 errors is really small . this study also has strengths , such as a high number of participants recruited on the basis of a factorial design . this is also the first study to evaluate the role played by specific combinations of individual factors in the study of the effect of nutrition claims on appetite sensations . we investigated the impact of nutrition claims and individual factors on the perception of appetite sensations . women felt more satiated then men regardless of nutrition claims , while bmi and restrained eating alone did not influence appetite sensations . no adverse effect of nutrition claims on appetite sensations was observed , which suggests no contraindication to their use . positive effects of satiety - related claims have been observed only in specific subgroups of individual . in a real - world setting , foods labeled with satiety - related claims would possess demonstrated physiological satiating properties and therefore would probably induce a physiological effect ( as opposed to a psychological effect in this study ) . as enhanced satiety may benefit dietary control or weight - management , it may thus be useful to inform consumers about these specific properties . to conclude , nutrition claims do not generally affect appetite sensations and the evaluation of their relevance sex is an important individual factor to consider when studying appetite sensations , while weight and restrained eating should be considered in interaction for a better understanding of their effects . more studies are needed to assess a significant and beneficial effect of nutrition claims on appetite sensations and eating behavior , and to better understand the contribution of individual factors .

nutrition claims may help people to adopt healthier eating habits , but little is known about the potential cognitive effects of such claims on appetite sensations . the main purpose of this study was to evaluate the impact of nutrition claims and individual factors on perceived appetite sensations . according to a three ( healthy versus diet ( i.e. , satiating ) versus hedonic ) by two ( restrained or not restrained ) by two ( normal - weight or overweight / obese ) by two ( men versus women ) factorial design , 164 males and 188 females aged 1865 were invited to taste an oatmeal - raisin snack in a blinded and ad libitum context . visual analog scales ( 150 mm ) were used to evaluate appetite sensations before and over 1 h after consumption period . bmi and restraint scale were used to categorize participants according to their weight and restraint status . no main condition effect was observed for any of the four appetite sensations . however , subgroups analysis revealed significant differences among specific subgroups . a main effect of sex was also observed for all appetite sensations with men reporting higher levels of desire to eat , hunger and prospective food consumption , and lower levels of fullness than women . these findings highlight the importance of considering individual characteristics in interaction when studying appetite sensations .

sarcomas are mesenchymal neoplasms with various lines of differentiation , i.e. , fibrocytic , myogenic , neurogenic , vascular , chondro - osseus , or undefined . it is a spindle - cell tumor composed of collagen - rich and myxoid parts . lgfs prefers subfascial soft tissue layers on the trunk and proximal extremities in younger adults but can also develop in internal organs . pediatric cases have also been reported.[13 ] herein , we present a 48-year - old female patient who developed a lgfs on the lower leg . the clinical presentation , histopathology , surgical treatment , and follow - up are discussed . a 48-year - old woman was referred to our department because she had developed a slow - growing plaque below the left knee for 2 years . on examination we found an otherwise healthy , slim , woman with a symptomless firm subcutaneous plaque of about 2 cm size on the anterior aspect of the left lower leg figure 1.there was some bluish discoloration and circumscribed ulceration but no erythema or warmth . ( a ) overview and ( b ) the ulcerated honeycomb - like plaque routine laboratory tests were unremarkable . thoracic dual - energy x - ray and abdominal and lymph node ultrasound excluded a metastatic spread . histology revealed a spindle - cell tumor , with mild atypia and fibroblast - like morphology [ figure 2 ] . cells were arranged in a whorled or plexifiorm pattern , with alternating collagenous stroma and myxoid zones . the tumor was surgically removed with a wide safety margin ( > 3 cm ) . the defect was covered by a mesh graft transplant covered by vacuum - assisted closure ( vac ; kci international ) [ figure 3 ] . compression stockings were prescribed to protect the transplant and prevent leg edema . a regular follow - up for at least 5 years ( a ) overview ( h&e , 4 ) and ( b ) detail ( h&e , 40 ) surgical procedure . ( a ) wide excision of suprafascial soft tissue ; ( b ) mesh graft transplantation ; and ( c ) placement of microporous white sponge for vacuum - assisted closure above the transplant lgfs is a very rare and distinctive type of fibrosarcoma that was first described by evans in 1987 . there is a discrepancy between the bland histologic features with sparse mitotic figures and absent or mild nuclear and cellular pleomorphism and the anaplasia . the hyalinizing spindle - cell tumor with giant rosettes is considered a subtype of lgfs.[13 ] the tumor is further characterized by t(7;16)(q34;p11 ) translocation and fusion of fus and creb3l1 genes . tumor cell phenotype is positive for vimentin , ema , cd99 , and bcl-2 , but negative for cd34 , sma , s-100 , desmin , keratins , neuron - specific enolase , and cd177 . the differential diagnosis includes other types of sarcomas , myxoma , neurofibroma , peripheral sheath tumor , histocytoma , desmoid tumor , and others . the diagnosis often is delayed - mainly because the patients do not seek treatment early . ( 2000 ) reported that in 15% of patients a histologic diagnosis was delayed by > 5 years . in our case although the histopathologic features suggest a low - grade malignancy , local recurrence is seen in more than 50% of patients and metastasis occurs in 6% of patients . tumor cell dormancy is responsible for very late metastasis in some patients , with 45 years being the longest period observed between primary surgery and metastasis . complete surgery with wide margins ( > 3 cm ) is the most important procedure . we used a combination of mesh graft transplantation and vacuum - assisted closure to cover the large defect . it has been demonstrated recently that such a combination , with microporous sponge for vacuum - assisted closure , results in a significantly improved take rate .

a 48-year - old female with an atypical plaque - like lesion of the lower leg is presented in this article . histologic investigation revealed a rare low - grade fibromyxoid sarcoma ( pt1a cn0 cm0 ; stage ia ) of suprafascial localization . staging of the patient did not reveal metastatic spread . the tumor was surgically removed with wide safety margins . the defect was closed using a mesh graft transplant and vacuum - assisted closure . healing was complete . regular follow - up for at least 5 years is recommended . besides the rareness of this tumor , this case is also remarkable because of the localization on the lower leg and the suprafascial soft tissue .

malaria ranks among the major health and developmental challenges facing some of the poorest countries in the tropical and sub - tropical region across the globe.1 an estimated 3.3 billion people were at risk of malaria in 2010 , although of all geographical regions , population living in sub - saharan africa have the highest risk of acquiring malaria ; in 2010 , 81% of the cases and 91% of the deaths are estimated to have occurred in the world health organization ( who ) african region with children under 5 years of age and pregnant women being most severely affected.2 in ghana , malaria is one of the leading causes of mortality in children under 5 years.3 similarly , studies have indicated that about 3.5 million people suffer from malaria every year , and approximately 20,000 children die from malaria annually with 25% of the deaths occurring in children under the age of 5 years.4 urine analysis remains the most valuable and highly important means of diagnosis in clinical medicine , as it helps to detect many diseases even before symptoms appear.1 liver dysfunction and renal impairment have been reported in severe malaria infections,56 and these observations led to the suggestion that malaria infection may have a significant effect on urine composition.1 studies conducted in nigeria and sudan examined urinary abnormalities among the general population with malaria infection and reported parasite density using the semi - quantitative ( plus ) system instead of the standard quantitative system.17 however , studies on urinary abnormalities in plasmodium falciparum infection , and the extent to which the degree of malaria parasitemia affects urinary composition in ghanaian children remains scarce . considering the endemicity of malaria in ghana , and the associated mortality and morbidity , particularly in children and pregnant women , accurate diagnosis and proper management are very necessary . it is imperative , therefore , to determine urine abnormalities and its relationship with parasite density in children with p. falciparum infection in a resource - limited malaria - endemic setting . this randomized study was conducted at comboni mission and sogakope district hospitals , in the south tongu district of the volta region from december 2013 to march 2014 . a total of 116 participants ( age- and sex - matched ) comprising 58 children aged 12 years with confirmed falciparum malaria ( cases ) and 58 healthy children ( controls ) were recruited . children with other variants of malaria and those with ailments such as renal disease , liver disease , or urinary tract infection were excluded . the institutional review board of university of cape coast and the ethical committee of the hospitals concerned approved the study . written informed consent venous blood ( 3 ml ) was obtained for the determination of hemoglobin ( hgb ) , white blood cell count ( wbc ) , and malaria parasite density . smears for malaria parasite were stained with giemsa and examined using standard protocols.12 hgb concentration and total wbc count were estimated using the mindray auto - hematology analyzer bc-3000 plus ( shenzhen , china ) . malaria infection was grouped into mild / moderate ( parasite density < 7000/l ) and severe ( parasite density > 7000/l).5 dipstick urinalysis strips ( accu - tell ref abt - um - a33 ) was used to detect the following parameters in urine provided by the participants ; protein , glucose , bilirubin , urobilinogen , ketones , blood , and leukocytes . the outcomes were measured with the mindray urine analyzer ua-66 ( shenzhen , china ) . ibm spss statistics for windows , version 21.0 ( ibm corporation , armonk , ny , usa ) was used for statistical analysis . continuous variable estimates were expressed as mean standard error mean ( sem ) , and student 's t - test used to determine the variation amongst healthy individuals and malaria patients while mann - whitney u - test was used for the analysis of categorical variables . spearman 's rho correlation coefficient was used to show correlation of the parameters measured . statistical significance level was set at p < 0.05 . table 1 summarizes the mean age , hgb concentration , and parasite density of the study participants . the participants included 58 malarial patients ( 29 males and 29 females ) and 58 controls ( 29 males and 29 females ) , indicating that comparable numbers of malaria cases and controls were selected for this study . the independent sample t - test showed no significant difference between mean ages of cases and controls . although the malaria cases and controls were of comparable age , the former had significantly ( p < 0.001 ) lower hgb concentration than the latter . there was a high mean parasite density in the cases , signifying severe infection of the participants with malaria . demographic , hemoglobin concentration , and parasite density study participants table 2 categorizes malaria infection among the cases into two , those with mild infection and those with severe infection . parasite density of participants with malaria table 3 shows the percentage distribution of the urinary parameters of the study participants . although the concentration of all the urine parameters were elevated in the cases in comparison to the controls , only protein , blood , bilirubin , urobilinogen , and ketones were statistically significant . percentage distribution of dipstick urinary findings among study participants figure 1 is a graphical ( visual ) presentation of the comparison of the significant dipstick urinalysis findings between cases and controls . differences between the significant urinary abnormalities of the cases and controls the dipstick urinalysis findings in relation to parasite density of the participants is summarized in table 4 . the spearman 's rho correlation test showed positive correlation between proteinuria , hematuria , bilirubinuria , urobilinogenuria , and ketonuria with malaria parasite density . however , only bilirubinuria was significantly ( p = 0.001 ) higher at higher parasite density . accurate diagnosis of malaria is integral to the appropriate and effective treatment of affected individuals and in the reduction of malaria - related morbidity and mortality.131415 this study related dipstick urinalysis findings to malaria parasite density , with the aim of using dipstick urinalysis in conjunction with other diagnostic tests to accurately diagnose malaria in resource - limited malaria - endemic settings . our findings indicated a significantly higher urine protein , blood , bilirubin , urobilinogen , and ketones in individuals with p. falciparum infection in comparison to healthy controls . although proteinuria , hematuria , bilirubinuria , urobilinogenuria , and ketonuria were positively correlated with malaria parasitemia , only bilirubinuria was significantly ( p = 0.001 ) higher at higher parasitemia . the presence of significant bilirubinuria and urobilinogenuria in malaria patients is similar to observations made in other west african countries1 and is suggestive of either hepatic involvement or hemolysis . however , this is attributable to malaria since bilirubinuria and urobilinogenuria were positively correlated with malaria parasite density , with bilirubinuria increasing with increasing parasite density . consequently , a study has shown that in patients presenting with fever and mainly conjugated hyperbilirubinemia , there should be a high index of suspicion for falciparum malaria even in the face of negative blood films.16 malaria is known to have an effect on the liver with cases of altered liver function tests being reported.17 although the determination of plasma bilirubin was not part of this study , the appearance of significantly higher bilirubinuria in the cases in comparison to the controls suggests the presence of conjugated bilirubin and by extrapolation , there was conjugated hyperbilirubinemia . jaundice is one of the common manifestation of severe falciparum malaria that may be caused by many factors including intravascular hemolysis of parasitized and nonparasitized red blood cells and hepatic dysfunction.181920 the co - existence of malaria with viral hepatitis could be another cause of jaundice.1921 however , the selection procedure excluded people with viral hepatitis and thus the increased bilirubinuria and urobilinogenuria observed in the present study can not be attributed to co - infection with viral hepatitis . the significantly lower hgb concentration observed in cases in comparison to the controls reaffirms anemia as a complication of severe malaria infection.22 similar results was obtained from a study conducted in nigeria.1 the anemia may partly be attributed to increased destruction of red blood cells in high parasitemia hence reducing hgb levels leading to anemia . this buttresses the fact that the observed urobilinogenuria may be a consequence of intravascular hemolysis . as indicated in this study , there was significant proteinuria and hematuria in cases compared to controls . these findings are in agreement with earlier studies.72324 proteinuria is an early manifestation of renal disease.525 in healthy kidneys , proteins are completely filtered from the bloodstream and subsequently reabsorbed , allowing no protein or only untraceable amounts of protein into the urine . persistent presence of considerable amounts of protein in the urine is a useful indicator of a form of kidney disease.5 studies have shown that positive urine tests for hematuria and/or proteinuria in mass screening settings were significant predictors of end - stage renal disease.26 therefore , the presence of significant levels of proteinuria and hematuria in cases in comparison to controls is suggestive of renal impairment . however , these findings are not conclusive of renal impairment due to the lack of data on renal function tests in this study . nevertheless , renal impairments such as glomerulonephritis and nephrotic syndrome have been reported in malaria patients.17 this study also observed significant ketonuria in the cases which cases might have resulted from some form of caloric deprivation ( starvation ) or an overnight fast due to loss of appetite.25 in contrast to the findings of this study , research conducted in nigeria observed significantly higher urobilinogenuria at higher parasitemia in p. falciparum infection.1 the difference between these studies might be as a result of the methods used in conducting the urinalysis . this study assessed the dipstick urinalysis using the automated urine analyzer as compared to the previous study where dipstick color changes were assessed visually . the small sample size used and the short duration of the study , however , remain the limitations of this study . in view of these , it is recommended that further studies should be conducted using a large sample size with enough time duration where dipstick urinalysis findings could be correlated with renal function and liver function markers in children with falciparum malaria infection . this would help in knowing the diagnostic value of dipstick urinalysis in detecting renal impairment and liver dysfunction in falciparum malaria in resource - limited malaria - endemic areas . it is evident that severe malaria infection has significant effects on urine , which may lead to urine abnormalities , such as proteinuria , hematuria , bilirubinuria , and urobilinogenuria . urinalysis could be used in conjunction with microscopy in health facilities , especially in resource - limited malaria - endemic settings for accurate diagnosis and prognosis of severe malaria infection , particularly falciparum malaria .

background : malaria ranks among the major health and developmental challenges facing some of the poorest countries in tropical and sub - tropical regions across the globe . we determined urinary abnormalities and its relationship with parasite density in children 12 years with plasmodium falciparum infection.materials and methods : from december 2013 to march 2014 , we randomly recruited 116 participants comprising 58 malaria patients ( cases ) and 58 healthy controls from the comboni mission and the sogakope district hospitals both in the south tongu district . blood was collected for the estimation of hemoglobin and total white blood cells ; thick and thin blood films were used for the determination of malaria parasite density . urine was collected for the measurement of the various biochemical components using the automated urine analyzer . a pretested questionnaire was used to obtain demographic and clinical data.results:urine protein ( p < 0.001 ) , blood ( p < 0.001 ) , bilirubin ( p < 0.001 ) , urobilinogen ( p < 0.001 ) , and ketones ( p = 0.001 ) were significantly higher in individuals with p. falciparum infection than in healthy controls . proteinuria ( p = 0.247 ; r = 0.155 ) , hematuria ( p = 0.142 ; r = 0.195 ) , bilirubinuria ( p = 0.001 ; r = 0.438 ) , urobilinogenuria ( p = 0.876 ; r = 0.021 ) , and ketonuria ( p = 0.136 ; r = 0.198 ) were positively correlated with malaria parasite density ; however , only bilirubinuria was significantly higher at higher parasitemia.conclusion:malaria has a significant effect on the chemical composition of urine with bilirubin positively correlated with parasite density . dipstick urinalysis can be used together with light microscopy in resource - limited malaria - endemic areas to accurately diagnose falciparum malaria infection .

a 9-month - old female patient was brought to a health institute with complaints of coughing persisting for 2 weeks . her hematologic tests revealed the presence of hyperleucocytosis ( 107.000/mm ) , and consequently she was referred to us with the initial diagnosis of leukemia . her history revealed the presence of vomiting , and diarrhea in addition to her complaints of coughing within the first week . she had nt been vaccinated . her oropharynx was hyperemic , and crepitant rales were heard bilaterally over basal lobes of her lungs . some of her laboratory values were as follows : hemoglobin : 10.6 gr / dl , wbc : 102.900/mm , platelets : 797.000/mm , normal hepatic , and renal function test results ; uric acid : 2.5 mg / dl , and ldh : 386 u / l . results of peripheral smear analysis were as follows : neutrophils : 26% , lymphocyte : 72% , monocyte : 2% , absence of atypical cells , and blast cells . dimensions of mediastinum were within normal limits , and infiltration in the right paracardiac region was seen . polymerase chain reaction ( pcr ) performed with throat swab , and respiratory tract panel realized for adenovirus infection yielded positive results . pcr test could not detect any evidence of pertussis infection . respiratory tract infection caused by an adenovirus , and hyperleucocytosis day of her hospitalization wbc was 66.680/mm . during follow - up of the patient , her respiratory symptoms , and complaints of coughing regressed at the end of the first week of her hospitalization . on 7 . whole blood cell counts , and results of her peripheral smear are shown in table 1 . complaints of the patient regressed , and her clinical problems resolved during her follow - up , and consequently she was discharged with prescription of a vacination plan . whole blood cell count , and peripheral smear results of the patient x wbc : whole blood cell . classical whooping cough infection courses with paroxysmal fits of coughing , vomiting after coughing , deep inspirium , and intermittent symptoms of coughing lasting longer than 28 days up to 3 months . adenovirus infections most frequently present with manifestations of respiratory tract infections , and gastroenteritis . in our patient coughing episodes lasted for 3 weeks , and in the first week diarrhea , and vomiting accompanied complaints of coughing . in the pediatric age group acute leukemias are the most frequent causes of hyperleukocytosis . apart from leukemias , infections , drugs , bleeding , hypersensitivity reactions , splenectomy , and solid tumors induce leukemoid reaction leading to development of hyperleukocytosis . however hyperleukocytosis secondary to absolute lymphocytosis is seen in pertussis , tuberculosis , and viral infections . among viral infections , whole blood cell count of our patient demonstrated hyperleukocytos , anemia , and reactive thrombocytosis . apart from bordetella pertussis infection the manifestations of pertussis - like coughing can be encountered during the course of infections caused by chlamydophila pneumoniae , chlamydiae trochomatis , mycoplasma pneumoniae , adenoviruses , and bordetella bronchiseptica . in a study on 149 patients who presented with clinical manifestations of pertussis , the most frequently detected infectious agents , apart from bordetella pertussis were adenoviruses , parainfluenza , mycoplasma pneumoniae , and rsv . in this study , adenoviruses , and mycoplasma pneumoniae were detected in 3 , and 1.3% of the cases , respectively . in patients presenting with clinical manifestations of pertussis where bordetella pertussis can not be isolated or can not be confirmed serologically , investigation for infectious agents as mycoplasmae , chlamydiae , and adenoviruses has been recommended . gold standard for the diagnosis of pertussis is detection of bacterial growth on culture which has a 100% specificity . its sensitivity changes depending on many factors as stage of the disease , initiation of antimicrobial treatment , sampling method , quality of the material used for sampling , conditions of delivery of the sample to the laboratory , and experience of the laboratory , and ranges between 12 , and 60 percent . the world health organization recommends combined use of antibiograms , and pcr technique for the diagnosis of pertussis . sensitivity , and specificity of pcr method have been indicated as 7099% , and 86100% , respectively . in our patient bacterial growth pcr respiratory tract panel revealed presence of adenovirus , and absence of mycoplasma pneumoniae , and rsv . although the patient presented to our clinic with pertussis - like coughing , complaints of vomiting , and diarrhea at the beginning of the disease , shorter duration of the coughing when compared with whoopig cough , and in consideration of laboratory test results , presumptive diagnosis of pertussis - like syndrome secondary to adenovirus infection , and hyperleucocytosis were made . since all her necessary vaccinations were not performed , and diagnostic laboratory methods were not 100% sensitive , bordatella infection could not be ruled out conclusively . in conclusion , in patients presenting with clinical manifestations of pertussis , and hyperleucocytosis , if especially etiologic agent can not be cultivated , then adenovirus infections should be considered in the differential diagnosis , and relevant investigations should be carried out .

adenovirus is an infectious viral agent that causes variety of clinical presentations such as respiratory disease , conjunctivitis , and gastroenteritis . hepatitis , pancreatitis , myocarditis , encephalitis , and disseminated infection are primarily seen in immunocompromised patients . rarely , adenovirus infection can present with pertussis - like syndrome . described here is case of pertussis - like syndrome associated with adenovirus presenting with hyperleukocytosis .

catheter ablation has become a standard therapy in the treatment of many arrhythmias . while different ablation strategies have been proposed and are currently applied , all ablation procedures share one commonality in their necessity for the use of fluoroscopy to visualize catheters . heavy reliance on the use of live x - ray for ablation procedures was alleviated in the 1990s with the advent of 3d electroanatomical mapping systems ( eams ) that helped to significantly reduce radiation time and dosage . integration of cardiac imaging using magnetic resonance imaging ( mri ) and computed tomography ( ct ) was shown to even further reduce fluoroscopy exposure during ablation procedures . more recently , a new technology for catheter visualization , called the mediguide-(mg ) technology , has been introduced that can further facilitate reduction in radiation exposure . briefly , single - coil sensors embedded in the catheter tip can be accurately localized by an electromagnetic field . information about the 3d position and orientation of the tools is then transferred to the fluoroscopy system and is used to visualize the catheter tip in a virtual bi - planar view projected on 2 pre - recorded cine loops . it has been previously shown that the application of the mg technology can lead to a significant reduction in fluoroscopy burden by using diagnostic catheters in atrial flutter and by using both diagnostic and ablation catheters in several supraventricular tachycardias ( svt ) and atrial fibrillation ( af ) cases . there may be concerns that the application of the non - fluoroscopic catheter visualization ( nfcv ) technology may increase procedural risks in the absence of the catheter shaft visualization and catheter localization that is solely based on the location of the catheter tip . it was demonstrated that the complication rate is equal or even lower to procedures performed with conventional tools . this could be explained by a limitation of conventional procedures : only in a certain percentage of the procedure catheters will be visible . this changed by application of nfcv technology since catheters will be visible during the entire procedure on this virtual biplanar view . in this protocol , we perform an ablation of atrial fibrillation in a patient with paroxysmal , drug - refractory and highly symptomatic atrial fibrillation . the goal of this protocol is to achieve the same endpoints as in a conventional procedure , i.e. , isolation of all pulmonary veins with proven bi - directional block , and to reduce fluoroscopy exposure for the patient by > 90% as compared to conventional settings via the additional use of the nfcv technology . all patients signed an informed consent form after all typical complications of an ablation procedure such as pericardial effusion , vascular complications at the access site , stroke / tia , and esophago - atrial fistula , were explained . no patient subgroup had to be excluded ( e.g. , patients with pacemakers or icd ) ; only general contraindications for af ablation procedures ( e.g. , contraindication for anticoagulation , hyperthyreosis , valvular af , etc . ) had to be addressed . on the day of hospital admission , perform a routine physical exam including resting ecg , blood analysis , transesophageal echo and a contrast - enhanced ct scan of the heart on the patient . if novel anticoagulants are used , skip either 1 dose ( rivaroxaban ) or 2 doses ( dabigatran and apixaban ) before the procedure . place the 3d eams patches on the patient per manufacturer s instructions on the thorax ( front and back ; left and right ) , neck , and belly . monitor oxygen saturation using a finger clip , as well as the non - invasive blood pressure . administer midazolam ( 2 - 3 mg , i.v . ) and fentanyl ( 0.025 mg , i.v . ) as premedication to slightly sedate the patient and to provide some analgesics during the puncture of the femoral vessels . start the procedure with the injection of 40 ml of 1% mepivacain to the left and right groin areas . start the puncture for venous access 1 cm medial to the femoral artery , 1 cm below the connection between symphysis and crista iliaca anterior superior . perform two 7f punctures in the left femoral vein for placing two diagnostic catheters : 1 steerable decapolar catheter for the coronary sinus ( cs ) and 1 steerable decapolar catheter for the right ventricular apex . after a successful puncture of the vessels , advance a guidewire , remove the puncture needle and place the sheath over the wire per the seldinger technique.next , perform 2 punctures on the right side : a 4f puncture in the right femoral artery for invasive blood pressure measurements , and an 11f one in the right femoral vein for the transseptal sheath . before inserting the 11f sheath , control the intravasal position of the wire using fluoroscopy and then place the sheath . perform two 7f punctures in the left femoral vein for placing two diagnostic catheters : 1 steerable decapolar catheter for the coronary sinus ( cs ) and 1 steerable decapolar catheter for the right ventricular apex . after a successful puncture of the vessels , advance a guidewire , remove the puncture needle and place the sheath over the wire per the seldinger technique . next , perform 2 punctures on the right side : a 4f puncture in the right femoral artery for invasive blood pressure measurements , and an 11f one in the right femoral vein for the transseptal sheath . before inserting the 11f sheath , check the activated clotting time ( act ) every 20 min ; the target for the anticoagulation is an act between 250 and 350 sec . if necessary , administer boluses of heparin according to act measurements . during the procedure , maintain the patient in a deep analgosedation using midazolam ( 2 - 5 mg ) , fentanyl ( 0.05 - 0.1 mg ) and propofol ( bolus 0.5 mg / kg and constant basal rate of 0.5 mg / kg / h ) . acquire 2 live fluoroscopy or cine loops using the x - ray fluoroscopy system in a right anterior oblique projection ( rao 15 ) and a left anterior oblique projection ( lao 50 ) , each approximately 3 sec long ( figure 3 and video 1 ) . note : the nfcv projects the catheter tips on these pre - recorded cine loops allowing a non - fluoroscopic placement of the diagnostic catheters . place one of the diagnostic catheters in the cs by first advancing the catheter tip to the superior vena cava ( svc ) , then pulling it back slowly and deflecting it to bring it close to the bundle of his . deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . advance the catheter as deep as possible in the cs to achieve a stable position . then , place a landmark on the catheter tip using the nfcv system to mark the location.use the other diagnostic catheter to place landmarks for superior vena cava ( svc ) , inferior vena cava ( ivc ) and fossa ovalis ( see figure 1 ) . deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . advance the catheter as deep as possible in the cs to achieve a stable position . then , place a landmark on the catheter tip using the nfcv system to mark the location . use the other diagnostic catheter to place landmarks for superior vena cava ( svc ) , inferior vena cava ( ivc ) and fossa ovalis ( see figure 1 ) . perform a trans - atrial septal puncture using a long steerable sheath . insert a long guidewire to the svc and verify the position with fluoroscopy . advance the steerable sheath over the wire to the junction between the svc and the right atrium ( ra ) . insert a long needle into the dilator , pull back the sheath until it jumps into the fossa ovalis.perform the puncture by advancing the needle and injecting contrast dye ( 15 ml of ultravist 300 ) to verify the correct position of the sheath in the left atrium ( la).once the needle tip is in the la , advance the dilator to la , disconnect it from the sheath and advance the sheath over the dilator into the la . deflect the sheath and slowly remove the needle and dilator from the sheath.aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . note : the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . advance the steerable sheath over the wire to the junction between the svc and the right atrium ( ra ) . insert a long needle into the dilator , pull back the sheath until it jumps into the fossa ovalis . perform the puncture by advancing the needle and injecting contrast dye ( 15 ml of ultravist 300 ) to verify the correct position of the sheath in the left atrium ( la ) . once the needle tip is in the la , advance the dilator to la , disconnect it from the sheath and advance the sheath over the dilator into the la . deflect the sheath and aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . note : the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . insert the long sheath in the superior pulmonary veins and perform 2 new fluoroscopy or cine loops in rao 15 ( right pv ) and lao 50 ( left pv ) during injection of 15 ml of contrast dye ( ultravist 300 ) . map anatomical landmarks in the la carefully and use for this co - registration process . for example , use the junction of the left inferior pulmonary vein ( lipv ) to the la body . take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . upon completion , the segmented ct model is positioned at an anatomically correct position in 3d space . for example , use the junction of the left inferior pulmonary vein ( lipv ) to the la body . take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . upon completion , the segmented ct model is positioned at an anatomically correct position in 3d space . place a temperature probe with 3 thermocouples trans - orally to measure the intra - luminal intra - esophageal temperature at the level of the la . perform ablation around the ipsilateral pulmonary veins by using power settings of 35 w ( anterior ) and 25 w ( posterior ) at an irrigation rate of 17 ml / min . if the intra - luminal temperature exceeds 39 c , immediately stop the ablation and adjust the power settings , lowering the minimum power to be 20 w. in case of temperature rise despite reduction of energy settings , consider modifying the lesion setting to go more antral if it is too close to the esophagus . if the temperature still exceeds 41 c , perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . if the temperature still exceeds 41 c , perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . check the completeness of the pulmonary vein isolation using a decapolar circular catheter by pacing maneuvers at maximum power ( usually 10 ma / msec ) from all bipoles of the spiral catheter . make sure that the stimulus does not capture the la by checking signals on the cs catheter . gaps in the lesion set : move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . if the atrium is captured , start ablation until the local capture disappears . use this pace - and - ablate-technique around all pulmonary veins . if necessary , detect and close gaps in the lesion set : move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . once the isolation line around the pulmonary veins is completed , perform a voltage map of the left atrium to determine a healthy atrium ( shown in purple ) or a fibrotic atrium ( shown in blue , yellow , and grey ) [ see figure 1 and 2 ] . use the cut - off values 0.5 mv for normal tissue and 0.2 mv for scar tissue . use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . for a normal sized la , take points covering the entire la body and pv antrum ( 100 - 150 points ) . use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . for a normal sized la , take points covering the entire la body and pv antrum ( 100 - 150 points ) . perform a test for inducibility with 20 sec burst - pacing from the coronary sinus with cycle lengths of 300 msec , 250 msec and 200 msec or to atrial refractory time . if a stable atrial tachycardia or atrial flutter is induced , map and ablate accordingly . if atrial fibrillation is induced , perform an electrical cardioversion ( with 200 j biphasic shock ) and terminate the procedure . antagonize heparin by injecting protaminsulfat ( 10,000 iu , i.v . ) and remove the sheaths from the groin . after removal of the sheaths manually , compress the puncture sites on both sides . check if there is still active bleeding after 5 min . if not , continue compression for at least an additional 5 min and place the pressure bandage for 6 hr . after removal of the pressure bandage and checking the femoral vessels clinically ( palpation and auscultation ) , deliver the next dose of anticoagulant drugs ( warfarin or novel anticoagulants ) . on the day of hospital admission , perform a routine physical exam including resting ecg , blood analysis , transesophageal echo and a contrast - enhanced ct scan of the heart on the patient . if novel anticoagulants are used , skip either 1 dose ( rivaroxaban ) or 2 doses ( dabigatran and apixaban ) before the procedure . place the 3d eams patches on the patient per manufacturer s instructions on the thorax ( front and back ; left and right ) , neck , and belly . monitor oxygen saturation using a finger clip , as well as the non - invasive blood pressure . perform disinfection of the groin region . administer midazolam ( 2 - 3 mg , i.v . ) and fentanyl ( 0.025 mg , i.v . ) as premedication to slightly sedate the patient and to provide some analgesics during the puncture of the femoral vessels . start the procedure with the injection of 40 ml of 1% mepivacain to the left and right groin areas . start the puncture for venous access 1 cm medial to the femoral artery , 1 cm below the connection between symphysis and crista iliaca anterior superior . perform two 7f punctures in the left femoral vein for placing two diagnostic catheters : 1 steerable decapolar catheter for the coronary sinus ( cs ) and 1 steerable decapolar catheter for the right ventricular apex . after a successful puncture of the vessels , advance a guidewire , remove the puncture needle and place the sheath over the wire per the seldinger technique.next , perform 2 punctures on the right side : a 4f puncture in the right femoral artery for invasive blood pressure measurements , and an 11f one in the right femoral vein for the transseptal sheath . before inserting the 11f sheath , control the intravasal position of the wire using fluoroscopy and then place the sheath . perform two 7f punctures in the left femoral vein for placing two diagnostic catheters : 1 steerable decapolar catheter for the coronary sinus ( cs ) and 1 steerable decapolar catheter for the right ventricular apex . after a successful puncture of the vessels , advance a guidewire , remove the puncture needle and place the sheath over the wire per the seldinger technique . next , perform 2 punctures on the right side : a 4f puncture in the right femoral artery for invasive blood pressure measurements , and an 11f one in the right femoral vein for the transseptal sheath . before inserting the 11f sheath , check the activated clotting time ( act ) every 20 min ; the target for the anticoagulation is an act between 250 and 350 sec . if necessary , administer boluses of heparin according to act measurements . during the procedure , maintain the patient in a deep analgosedation using midazolam ( 2 - 5 mg ) , fentanyl ( 0.05 - 0.1 mg ) and propofol ( bolus 0.5 mg / kg and constant basal rate of 0.5 mg / kg / h ) . acquire 2 live fluoroscopy or cine loops using the x - ray fluoroscopy system in a right anterior oblique projection ( rao 15 ) and a left anterior oblique projection ( lao 50 ) , each approximately 3 sec long ( figure 3 and video 1 ) . note : the nfcv projects the catheter tips on these pre - recorded cine loops allowing a non - fluoroscopic placement of the diagnostic catheters . place one of the diagnostic catheters in the cs by first advancing the catheter tip to the superior vena cava ( svc ) , then pulling it back slowly and deflecting it to bring it close to the bundle of his . deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . advance the catheter as deep as possible in the cs to achieve a stable position . then , place a landmark on the catheter tip using the nfcv system to mark the location.use the other diagnostic catheter to place landmarks for superior vena cava ( svc ) , inferior vena cava ( ivc ) and fossa ovalis ( see figure 1 ) . deflect the catheter to its maximum allowable curve and perform a clockwise rotation to bring the tip to the cs ostium . advance the catheter as deep as possible in the cs to achieve a stable position . then , place a landmark on the catheter tip using the nfcv system to mark the location . use the other diagnostic catheter to place landmarks for superior vena cava ( svc ) , inferior vena cava ( ivc ) and fossa ovalis ( see figure 1 ) . perform a trans - atrial septal puncture using a long steerable sheath . advance the steerable sheath over the wire to the junction between the svc and the right atrium ( ra ) . insert a long needle into the dilator , pull back the sheath until it jumps into the fossa ovalis.perform the puncture by advancing the needle and injecting contrast dye ( 15 ml of ultravist 300 ) to verify the correct position of the sheath in the left atrium ( la).once the needle tip is in the la , advance the dilator to la , disconnect it from the sheath and advance the sheath over the dilator into the la . deflect the sheath and slowly remove the needle and dilator from the sheath.aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . note : the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . advance the steerable sheath over the wire to the junction between the svc and the right atrium ( ra ) . insert a long needle into the dilator , pull back the sheath until it jumps into the fossa ovalis . perform the puncture by advancing the needle and injecting contrast dye ( 15 ml of ultravist 300 ) to verify the correct position of the sheath in the left atrium ( la ) . once the needle tip is in the la , advance the dilator to la , disconnect it from the sheath and advance the sheath over the dilator into the la . aspire 10 ml of blood from the sheath and carefully flush the sheath with heparinized saline . flush the sheath with heparinized saline constantly at a flow rate of 2 ml / hr . note : the diagnostic catheter is used for electroanatomical reconstruction of the la and pulmonary venous anatomy . coronary sinus catheter remains in place and serves as the reference catheter for the 3d mapping system . insert the long sheath in the superior pulmonary veins and perform 2 new fluoroscopy or cine loops in rao 15 ( right pv ) and lao 50 ( left pv ) during injection of 15 ml of contrast dye ( ultravist 300 ) . perform fusion of the electroanatomical map with 3d reconstructed ct anatomy . map anatomical landmarks in the la carefully and use for this co - registration process . for example , use the junction of the left inferior pulmonary vein ( lipv ) to the la body . take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . upon completion , the segmented ct model is positioned at an anatomically correct position in 3d space . for example , use the junction of the left inferior pulmonary vein ( lipv ) to the la body . take at least 10 - 15 points for the fusion process and then double - check and optimize the co - registration process with the roving catheter . upon completion , the segmented ct model is positioned at an anatomically correct position in 3d space . place a temperature probe with 3 thermocouples trans - orally to measure the intra - luminal intra - esophageal temperature at the level of the la . perform ablation around the ipsilateral pulmonary veins by using power settings of 35 w ( anterior ) and 25 w ( posterior ) at an irrigation rate of 17 ml / min . if the intra - luminal temperature exceeds 39 c , immediately stop the ablation and adjust the power settings , lowering the minimum power to be 20 w. in case of temperature rise despite reduction of energy settings , consider modifying the lesion setting to go more antral if it is too close to the esophagus . if the temperature still exceeds 41 c , perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . if the temperature still exceeds 41 c , perform an esophagoscopy the day after the ablation to exclude mucosal thermal damage which could develop to an esophago - atrial fistula . check the completeness of the pulmonary vein isolation using a decapolar circular catheter by pacing maneuvers at maximum power ( usually 10 ma / msec ) from all bipoles of the spiral catheter . make sure that the stimulus does not capture the la by checking signals on the cs catheter . if necessary , detect and close gaps in the lesion set : move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . use this pace - and - ablate-technique around all pulmonary veins . if necessary , detect and close gaps in the lesion set : move the ablation catheter around the circumferential lesions and stimulate with maximum output from the tip of the ablation catheter . once the isolation line around the pulmonary veins is completed , perform a voltage map of the left atrium to determine a healthy atrium ( shown in purple ) or a fibrotic atrium ( shown in blue , yellow , and grey ) [ see figure 1 and 2 ] . use the cut - off values 0.5 mv for normal tissue and 0.2 mv for scar tissue . use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . for a normal sized la , take points covering the entire la body and pv antrum ( 100 - 150 points ) . use the ablation catheter or the diagnostic catheter and start in the pulmonary vein antrum . make sure that there is sufficient contact with the catheter tip and register the local signal amplitude to the 3d mapping system . for a normal sized la , take points covering the entire la body and pv antrum ( 100 - 150 points ) . perform a test for inducibility with 20 sec burst - pacing from the coronary sinus with cycle lengths of 300 msec , 250 msec and 200 msec or to atrial refractory time . if a stable atrial tachycardia or atrial flutter is induced , map and ablate accordingly . if atrial fibrillation is induced , perform an electrical cardioversion ( with 200 j biphasic shock ) and terminate the procedure . remove the transseptal sheath and catheters . antagonize heparin by injecting protaminsulfat ( 10,000 iu , i.v . ) and remove the sheaths from the groin . after removal of the sheaths manually , compress the puncture sites on both sides . check if there is still active bleeding after 5 min . if not , continue compression for at least an additional 5 min and place the pressure bandage for 6 hr . after removal of the pressure bandage and checking the femoral vessels clinically ( palpation and auscultation ) , deliver the next dose of anticoagulant drugs ( warfarin or novel anticoagulants ) . the patients are under deep analog - sedation , meaning that they are sleeping , receiving analgesics but breathe spontaneously . if all endpoints including bi - directional block in all pulmonary veins , healthy left atrial tissue , and non - inducibility of atrial fibrillation or atrial flutter are achieved , patients have about a 75% probability of freedom from atrial fibrillation recurrence after 12 months . if the left atrium has fibrotic tissue with low voltage areas ( see figure 2 ) , the chances of permanent freedom from arrhythmias decrease compared to patients with healthy left atrial tissue ( see figure 3 ) . typically , patients can be discharged 24 hr after the procedure . in the first 4 - 6 weeks after the ablation procedure after 6 weeks , the likely outcomes of the ablation procedure are evident . in most cases , all medical anti - arrhythmic treatments are discontinued on the day of the ablation procedure . oral anticoagulation is mandatory and needs to be continued after the ablation procedure irrespective of the individual s stroke risk for at least 3 months . figure 1 : ablation of atrial fibrillation using nfcv technology . left and middle : catheter visualization using the nfcv technology : ablation catheter ( red tip ) in the left superior pulmonary vein ( lspv , blue marker ) . ablation catheter ( green halo ) placed in the left superior pulmonary vein close to the ridge to the left atrial appendage . 3d reconstructed ct with low - voltage areas at the posterior wall of the left atrium and in the mitral isthmus region indicating areas of previous ablation . a color - coded voltage map is shown with purple for healthy tissue ( electrograms > 0.5 mv ) and grey for scar tissue ( electrograms < 0.2 mv ) . electrogram amplitudes > 0.2 mv and < 0.5 mv are displayed in yellow , red , and blue . 2 short cine loops ( 3 sec each ) are recorded and are used as the dynamic background for catheter visualization . specially - designed catheters with miniaturized sensors at the tip are inserted in the patient and visualized by the nfcv system . radiation exposure for interventional cardiologists and electrophysiologists is an underestimated risk because of its unpredictable side - effects . current literature reveals a higher incidence of left - sided brain - tumors among this subgroup of clinicians , suggesting that the proximity of the left hemisphere to the x - ray source may be a culprit . the latency between radiation exposure and diagnosis of neoplasia has been reported to be 20 years or more . therefore , today s interventionalists should use all technological options to reduce radiation exposure to a minimum . the nfcv system can help reduce fluoroscopy exposure without affecting procedure time with a workflow that was adapted several times over the past 3 years in order to minimize radiation exposure according to the alara principle . 3d mapping systems can help to improve the understanding of complex 3-dimensional structures , but the basic orientation for the operator is generated using conventional fluoroscopy . the transseptal puncture remains the largest contributing step ( 75 - 80% ) of the radiation dose during these procedures since no sensor - equipped material for use with nfcv technology is currently available . especially in unexperienced hands this represents the most critical step in that procedure- other imaging modalities ( such as intracardiac or transesophageal echo ) can contribute to safe punctures and low complication rates . the nfcv is not only used in ablation procedures but also in complex implantations such as cardiac resynchronization therapy ( crt ) . in these procedures , the system allows the reduction of fluoroscopy burden by 75 - 80% compared to conventional implantations . a recent publication could show that after a learning curve of 30 - 40 procedures a median fluoroscopy time of 1.1 min for 50 consecutive patients is feasible and safe this was confirmed when extending the data acquisition to > 500 patients ( see figure 4 ) . figure 4 : please click here to view a larger version of this figure . the limitation of the current available system is that only the tips of the catheters are visualized . unexperienced operators will probably not be able to interpolate from the orientation of the tip to know what the position of the catheter shaft will be . only a limited choice of catheters are currently available- therefore only a limited number of different procedures is suitable using nfcv technology . in near future more devices and tools will be available that are equipped with a sensor to be visualized non - fluoroscopically . the system here basically works as a cardiovascular platform for different procedures ; electrophysiology is just the first application that has been introduced .

a technological platform ( mediguide ) has been recently introduced for non - fluoroscopic catheter tracking . in several studies , we have demonstrated that the application of this non - fluoroscopic catheter visualization system ( nfcv ) reduces fluoroscopy time and dose by 90 - 95% in a variety of electrophysiology ( ep ) procedures . this can be of relevance not only to the patients , but also to the nurses and physicians working in the ep lab . furthermore , in a subset of indications such as supraventricular tachycardias , nfcv enables a fully non - fluoroscopic procedure and allows the lab staff to work without wearing lead aprons . with this protocol , we demonstrate that even complex procedures such as ablations of atrial fibrillation , that are typically associated with fluoroscopy times of > 30 min in conventional settings , can safely be performed with a reduction of > 90% in fluoroscopy exposure by the additional use of nfcv .

drugs were not new to asylums in the 1950s . while opium and morphine have long been used in psychiatry , the second half of the nineteenth century witnessed the emergence of a large number of other substances considered more effective and less dangerous , such as chloral and bromides . after the success of these sedatives in the second half of the nineteenth century , the early 1890s saw the rise of barbiturates . these were considered more active and were seen as having fewer side effects than their predecessors , although concerns were regularly voiced about their addictive properties . the use of therapeutic drugs was widespread within the institut ever since its foundation in the early 1930s . in 1931 , at least 55 per cent of patients received some drugs during their stay , the most prominent being luminal , a barbiturate distributed by bayer . in 1935 , this percentage dropped to around 40 per cent ; in 1940 , it rose to around 80 per cent ; in 1945 , approximately 50 per cent of patients were medicated ; and by 1950 , two thirds of them were on some form of medication . despite the significant variations due to its rather small size , this sample shows that , before the introduction of neuroleptics , more than half of the patients at the institut consumed therapeutic drugs . well before the 1950s , drugs thus rhythmically structured the daily lives of patients at this institution ; and , indeed , the users were well aware of the material nature of these medications . their distribution whether in the form of pills or injections took place two or three times a day and represented a moment of negotiation between patients and caregivers . the doctor prescribed the framework within which the drugs were administered ( frequency and maximum amount ) , but every day it was the nurses who decided on these parameters and negotiated the actual taking of the drugs with the residents . by the time psychotropics entered psychiatric wards , the first neuroleptic was introduced into french psychiatry in 1952 under its generic name chlorpromazine ; it was sold under the name largactil . but only in 1954 did the psychiatric field begin to consider the drug as a breakthrough , and its use in most western - european countries began to transcend the experimental framework . that same year , largactil was administered to the first patients at the institut . at this point , it had been marketed for about a year in belgian medical journals by specia , the pharmaceutical branch of rhne - poulenc and the belgian distributor of largactil . the first accounts of its use appeared in belgian scientific journals published in 1954 . at first , largactil was not sold exclusively as a psychiatric drug , but also as a treatment for surgery and obstetrics . pathogenic specificity , that is , on the drug s effect on symptoms rather than actual healing . over the years , largactil was more specifically defined as a psychiatric drug , although the indications for use still remained very broad : psychomotor agitation , confusion , anxiety , depression , obsessions , cenestopathy , intractable insomnia , sleep therapy , neuralgia , various pains , dysautonomia. in the second half of 1954 , largactil was classified as category a by the belgian national health and disability insurance fund ( fonds national dassurance maladie - invalidit ) . this classification offered patients in belgium a refund of 70 per cent of the drug s cost , providing an important argument for its use given the high cost . it should be mentioned that the introduction of neuroleptics happened in a context of collective enthusiasm for medical drugs . since the triumphant march of penicillin in the mid-1940s , the medical community seemed to find a new miracle cure every year : for example , the first anti - tb medicine ( late 1940 ) and extended spectrum antibiotics . as a symbol of postmodern medicine , the doctor no longer merely affixed a diagnosis , but also healed organic diseases . in parallel with these discussions at national and international levels and across different arenas medicine , pharmaceutics and welfare state neuroleptics also made their way into asylums at a local level . at the institut , largactil was used very broadly to treat schizophrenia as well as anxiety and delirium tremens . within ten years , treatment patterns went through some major changes , as indicated in the table below . table 1:psychotropic drugs and electroconvulsive therapy at the institut de psychiatrie de brugmann ( percentage of patients receiving treatment ) . 195054 ( ) 195559 ( ) 196064 ( ) 196569 ( ) ect20%13% 6% 3%psychotropic drugs24%68%82%86% psychotropic drugs and electroconvulsive therapy at the institut de psychiatrie de brugmann ( percentage of patients receiving treatment ) . while electroconvulsive therapy ( ect ) was still the cure used most frequently in the late 1940s , it saw a significant and sustained decrease from the second half of the next decade . at the same time , the growing and widening diffusion of psychotropic medication allows for two conclusions . first , never in the history of psychiatry had any treatment experienced such a widespread use ; in the late 1960s , nearly nine out of ten patients received psychotropic drugs . second , their use led to the virtual disappearance of all other biological therapies such as cardiazol and insulin shock therapy . these developments had an impact on patient experience as well as on the dynamics among members of the institut . the detailed nursing notes , taken three times a day , as well as the letters kept in patient records , can be used to gain insight into how patients perceived the change in medication practice during the 1950s . , a nurse or psychiatrist has noted down the patient s reaction to the medication . patient response is extremely heterogeneous and a far cry from clichd images ( depictions of inmates being force - fed drugs by doctors on the pay list of pharmaceutical companies or , in stark opposition , the introduction of neuroleptics as a universally hailed innovation ) . to be sure , many patients were opposed to taking drugs during their stay . the administration of medication usually at 8 am , 2 pm and 8 pm was a daily ritual . since the patients were left to themselves most of the time , this was also one of the few moments when they interacted with the staff . indeed , administering drugs not only structured the day as an obligatory meeting with the caregivers , but it also represented a moment when an opposition to hospitalisation could be expressed especially at a time when this still happened mostly without the patient s consent . a 65-year - old retired officer of the belgian army , he was not given a very precise diagnosis and the reasons for his admittance can not be found in his medical records . at no point did the staff take any detailed notes on his consuming any drugs . the word medicine appears in one single instance within a more general comment : the patient refused all food and medicine . [ ? ] active bites his fingers refuses to urinate in toilets . [ ? ] on the hands after the injection at noon , rests on the bed , in a theatrical position , feigns total inertia . the patient refused all food and medicine . [ ? ] active bites his fingers refuses to urinate in toilets . [ ? ] on the hands after the injection at noon , rests on the bed , in a theatrical position , feigns total inertia . in this note , not taking one s medication was a way to show a general opposition to one s stay in the hospital , in the same way as a refusal to eat or urinate properly . for many patients , disease , medication and healing formed a closely interlaced triangle . it would be interesting to study whether administering drugs helped psychiatrists convince patients of their illness . at the same time , receiving medication offered patients some hope for their approaching remission . refusing drugs was thus a way to tell the physician that one did not ( any longer ) consider oneself sick . joseph r. , for example , was a german worker in his forties . in february 1958 , twenty years after leaving germany , he was interned at the institut for the first time . paranoid , he received his first dose of largactil after two weeks . over the following two weeks his daily dose was quadrupled from three administrations of 50 mg to three administrations of 200 mg . although joseph r. had no access to his file , he realised that the dose was increasing . it thus became progressively more difficult to convince him to take his pills : wants to leave but wonders how on earth he can , considering his medication was increased. a few days later : unhappy wants to go home if his medication is not reduced. for this patient who was convinced that he was not ill , the administration of drugs reminded him daily that he would not soon be leaving the institut . the dosage increase was interpreted as a sign of his deteriorating condition , and implied that his stay would be prolonged . another frequent complaint for joseph r. and others concerned the unwanted physical reactions of the drugs . indeed , the first neuroleptics produced quite serious side effects , affecting both patients ( who developed tremors similar to parkinson s disease ) and nurses ( who developed skin rashes ) . the medical records regularly mention secondary symptoms commonly attributed to psychotropic drugs from the 1950s and 1960s . these include stomach aches , headaches and sleep problems . since physicians were not in regular contact with the drugs , at first they paid little attention to these side effects . before the thalidomide scandal , which broke out in west germany and austria in the early 1960s and then spread throughout europe , this issue was hardly debated in the public space , and its ethical implications were not discussed among medical doctors . at the institut a first sign of concern about side effects appears in a patient record of 1962 . after complaining repeatedly about tremors caused by haloperidol , a neuroleptic that had been produced in belgium since 1958 , dirk m. caused the head physician to reduce the prescribed dose used by the attending psychiatrist this earned the physician letters of thanks : dear madam , thank you for your lovely visit and for your fortunate intervention as well as for the cogentin , crucial in stopping internal and external tremors the side effects of r1625 [ which produced in me a purely artificial anxiety ] . dear madam , thank you for your lovely visit and for your fortunate intervention as well as for the cogentin , crucial in stopping internal and external tremors the side effects of r1625 [ which produced in me a purely artificial anxiety ] . dirk m. is not the only patient who linked his medication to physical problems . in february 1955 , depression. she had repeatedly received psychotropics before : there is just one thing that is unpleasant about my health ; i sleep very well , but every morning i wake up with a crazy headache . and there is no way to get rid of it even though i dine at 6 pm and i go to bed at 10 or 11 pm the latest . lately dr dewale prescribed me quatane but with these tablets i only managed to wake up completely at 10 oclock . while i was working , i always became tired with these drugs and the headaches did not go away . there is just one thing that is unpleasant about my health ; i sleep very well , but every morning i wake up with a crazy headache . and there is no way to get rid of it even though i dine at 6 pm and i go to bed at 10 or 11 pm the latest . lately dr dewale prescribed me quatane but with these tablets i only managed to wake up completely at 10 oclock . while i was working , i always became tired with these drugs and the headaches did not go away . it is perhaps not surprising , therefore , that patients should make up various strategies to escape what some of them saw as poison : [ patient ] is to be monitored for taking pills , tries to throw them or hide them between his fingers , under his tongue ; basically tries every possible trick , even spitting them into a cup so as to throw them out at the slightest inattention . thirty - one - year - old christian d. was admitted to the institut in june 1958 . the scion of a bourgeois family from brussels , he had attended university and worked as an artist . very quickly he challenged the authority of the psychiatrist and opposed his forced hospitalisation by writing letters to family members and friends who held influential positions in brussels society . in a call to a relative ( who also happened to be a physician ) , he wrote : i apologise [ for this unstructured letter ] - they gave me , i should say fed me , largasil [ largactil ] , a revolting pill that makes it difficult to follow up on two ideas . since you re a doctor , i hope you can intervene and demand explanations from the doctors of the hospital . i apologise [ for this unstructured letter ] - they gave me , i should say fed me , largasil [ largactil ] , a revolting pill that makes it difficult to follow up on two ideas . since you re a doctor , i hope you can intervene and demand explanations from the doctors of the hospital . nursing notes are filled with the questions he raised about his drugs : the reasons for their use , their dosage , their frequency , the point of the treatment , and so on . often enough requests explanations about medications treatment , etc . ; would prefer not having to take medication and leave from here. christian d. remained one of the few patients who voiced specific questions about the use of drugs and the reasons for their use . mental illness ; rather , they are evidence of a social milieu that saw its relationship with the medical world not only paradigmatically as patients , but also as customers . the nurses he had to face throughout the day were not part of his social class in the outside world , and christian d. seems to have had particular difficulty recognising their authority . as seen above , patient opposition to the medication also gave rise to a whole range of ruses to escape treatment . but these tactics of resistance , in turn , encouraged the nurses to develop tactics of their own : a form of knowledge that was obviously not included in their textbooks . to be sure , nursing notes such as the one below ( about an s. , who was admitted to the psychiatric ward after an acute psychotic state ) are common : [ patient ] has just complained to the nurse because must take agarol [ largactil ] at night , said it makes her ill , afterwards came complaining that she passes no stool and that it has been lasting all day . just bored everyone with her supposed constipation . [ patient ] has just complained to the nurse because must take agarol [ largactil ] at night , said it makes her ill , afterwards came complaining that she passes no stool and that it has been lasting all day . just bored everyone with her it is therefore not surprising that , for some patients , taking drugs became a symbol of the physicians negative power. yet refusing medication did not mean escaping medication . even within the voluntary service , interestingly , however , a first refusal was not automatically penalised by forced administration ( a measure that is nowhere mentioned in this sample ) . convinced of suffering from joubert syndrome , he was admitted to the institut for the first time in november 1954 at the age of forty - three . after a week , he began to be opposed to taking drugs : very suspicious , constantly asking why he has to take medication , at first does not want to take them , took them finally , does not sleep yet , calm. these notes are found in several reports . sometimes nurses were even willing to accept that patients reject their drugs if they remained calm , as shown in the example of nordin f. , diagnosed as senile demented : evening refuses his medication [ 25 mg of largactil ] falls asleep nonetheless. but these instances remain exceptional , even for nordin f. indeed , the following day he refused his neuroleptic once again : did not want to take his larg [ largactil ] phen [ phenergan ] . larg[actil ] at 21 oclock. the nurses notes remain silent on the means of persuasion used at the institut . the records say close to nothing on the strategies and persuasive techniques of nursing and medical staff . they do , however , suggest that , sometimes , the administration of neuroleptics in 1950s psychiatric clinics was due to administrative or practical reasons . in a later file , dating from 1960 , a letter from a patient to the league of human rights makes explicit the possible strategies for constraint used by medical officers . these included the ( more painful ) threat of administering the drug intravenously in case a patient refused to swallow the pill : they wanted me to take a drug called haloperidol ( 1625 ) , which they had wanted me to take before and to which i am opposed if you do not take your drug or drugs they make you take them as an injection however , in recent days , they make me take largactif [ largactil ] in large doses . upon my refusal to take the drug again comes the threat of injections . they wanted me to take a drug called haloperidol ( 1625 ) , which they had wanted me to take before and to which i am opposed if you do not take your drug or drugs they make you take them as an injection however , in recent days , they make me take largactif [ largactil ] in large doses . upon my refusal to take the drug again comes the threat of injections . despite these tensions , records show that not all patients perceived the introduction of these drugs in solely negative terms . karine o. ( discussed above ) was admitted to the institut for the fourth time in september 1954 . until then , the only treatment she had received was electroconvulsive therapy ; but this time , the psychiatrist decided to have her try a new drug that had just been released : chlorpromazine . a letter to a friend shows her delight : since saturday , as i ve said , i have a new treatment with lacartine [ largactil ] 6 per day and from tomorrow wednesday i get an additional injection in the morning to calm me because i can only sleep from 9 pm until 2 or 3 am ; thus i stay awake in my bed , it s long ( ) i ll tell you about the treatment that they give me . the morning some beladomme at about 9 am 1 cup protecum 2 promenal 2 lacartine [ largactil]3am : 2 promenal , 2 lacartine [ largactil ] , 1 cup protenum6am : 2 promenal , 2 lacartine [ largactil]8pm : 1 fnergant [ phenergan]9am 1 injection 1 in the morningso you see that i am cared for and that i am treated very well . that way i ll leave the hospital completely healed . since saturday , as i ve said , i have a new treatment with lacartine [ largactil ] 6 per day and from tomorrow wednesday i get an additional injection in the morning to calm me because i can only sleep from 9 pm until 2 or 3 am ; thus i stay awake in my bed , it s long ( ) i ll tell you about the treatment that they give me . the morning some beladomme at about 9 am 1 cup protecum 2 promenal 2 lacartine [ largactil ] 3 am : 2 promenal , 2 lacartine [ largactil ] , 1 cup protenum 6 am : 2 promenal , 2 lacartine [ largactil ] 8 pm : 1 fnergant [ phenergan ] 9 am 1 injection 1 in the morning so you see that i am cared for and that i am treated very well . that way i ll leave the hospital completely healed . in this case , receiving drugs was taken as a sign that the disease was being dealt with . for karine o. it acted as a synonym for good treatment and it was closely linked to the hope of healing . the introduction of new medication therapies and their widespread use in psychiatric hospitals , therefore , not only led to new hopes within the medical field , but also among patients . we still lack studies on their consumption in private during the 1950s and 1960s , but several patients of the institut did regularly take medication at home . thus anne - marie c. expressed from the first day her desire to receive drugs : sick , came in at noon , clean . insists on taking something to sleep , received one pill of [ vitamin ] b complex at 8 pm . insists on taking something to sleep , received one pill of [ vitamin ] b complex at 8 pm . in this example , the patient no longer appears as a passive subject who merely waits for the psychiatrist s instructions . instead , she turns into what we might now consider a psychiatric user. one can even wonder if these attitudes have not become more widespread since the 1980s , when patients came to be represented not simply as objects without agency , but , indeed , as active customers . anne - marie c. was not the only person who had very specific ideas about the therapies that suited her best . in the admission report of gilles s. , suffering from oligophrenia [ joubert syndrome ] , we find similar comments : pat[ient ] well oriented in time and space , extremely agitated and anxious , constantly gets up from his bed , despite all the injunctions , asks plaintively for sedatives , or inquires about his release date you re surely not restraining me with the belt , i was wrapped like rotten fish give me a tranquilliser and let me out tell doctors several times to consultations at the hospital of etterbeek where one would have given him 1 bottle and tablets . pat[ient ] well oriented in time and space , extremely agitated and anxious , constantly gets up from his bed , despite all the injunctions , asks plaintively for sedatives , or inquires about his release date the examination is constantly interrupted by anxious questions , always the same : you re surely not restraining me with the belt , i was wrapped like rotten fish give me a tranquilliser and let me out tell doctors several times to consultations at the hospital of etterbeek where one would have given him 1 bottle and tablets . gilles s. had already been interned in psychiatric hospitals by the time he arrived in the institut . during short stays in other asylums , as soon as he was admitted , he required a sedative ; and to give more weight to his demand , he mentioned his experience at another hospital . for him , taking medication was a way to escape internment : give me a tranquilliser and let me leave. he was aware of being agitated , but knew that his agitation could be stopped with medication . the administration of the drug was thus perceived , instead , as a possibility for escaping the hold of the psychiatric hospital . compared to other psychiatric treatments of the time , such as ect , taking drugs was an act that paradoxically served to weaken the medical grip ; this was a therapy that could be administered outside the hospital walls . for medical staff , there also remained the issue of finding out how much access patients had to drugs prior to their hospitalisation at the institut . a few days after his first appointment in december 1953 , he was admitted to the institut in january 1954 with a diagnosis of depression . since he was particularly agitated , francis was administered hyoscine , a sedative , almost every night . in fact , for two consecutive nights he destroyed the sheet in which he was wrapped . the attending psychiatrist then prescribed bromide and chloral , two other sedatives , but francis c. remained very disturbed until his release on 8 february 1954 . the two drugs were administered to calm him down and he received five electroshocks . during that first stay , his record remains silent as to how he perceived the medication . during a conversation with his wife , however , it emerged that he had taken largactil even before coming to brugmann . the case of francis c. therefore not only poses the question of how many patients had been on medication before entering the institut , but also whether ( and how widely ) largactil was distributed outside asylums before being used in those institutions . in fact , the records lack enough detail to provide a precise answer , but they do reveal practices that have hardly been addressed by historians until now : namely , the use of medications outside hospital . six months later , francis c. went back to the institut , this time without a precise diagnosis . his admission was justified on the basis of some very general symptoms : anxious states of melancholia . mental disorders , dangerous to himself. the man now seemed used to taking medication . upon admission , he asked for an injection to help him sleep , a request that was denied by the nurse on duty . the following night , he received two tablespoons of largactil . in late august , after thirteen days , he left the hospital . the physician made the following diagnosis : old agitation , tendency to depression and suicide . insomnia. this was the first time he received neuroleptics on a regular basis and after ten days he started to complain . the nurses noted that he spends much time resting on his bed. the next day the psychiatrist wrote : remembers having had ect in 54 and it was better than the pills. the same day , the nurse recorded in the morning : seems a little depressed today , never agrees with what he is given as a medicine thinks it s too much , also complains of headache. and at night : around 6 pm received 1 cibalgine did not want to take ( suspicious ) , said he will be dead tomorrow . very depressed cries said the doctor had promised him another treatment . during his third stay and a few days after he had asked several questions about drugs , francis c. received his first electroshock . from that moment remains a little confused in the afternoon . constantly asks for his injection in evening . remains a little confused in the afternoon . constantly asks for his injection in evening . the above indicates that , at a time when therapies were not explained to patients , they could actually appropriate a part of medical knowledge . it is particularly striking , in this respect , that patients often referred to drugs by their names sometimes even their industrial names , for example , r1625 for haloperidol . these regularly appear in the files , generally with a more or less correct pronunciation and spelling . ( it is to be noted , however , that patients did not describe drugs through their effects : the terms antipsychotics, neuroleptics and some even declared themselves psychiatric specialists inside their family circles by virtue of their stay at the institut . depressed who stayed thrice at brugmann while several of her family members also suffered from mental illnesses , once wrote to her grandmother : what i was especially happy about is that c[. ] and you granny both take a seresta ; which seems to do you well because i found you all 4 very well. more generally , these records highlight the varied and complex tactics employed by the various protagonists in this story . the nurses were interested in keeping their wards calm or had other practical interests . as for patients , they had some power of compliance or non - compliance , and integrated these drugs into their daily lives and into different understandings of healing . naturally , elements such as social class often played a role on the degree to which their demands were met by medical staff . in any event , the vast majority of patients who asked for some medication received it . in 200 cases studied in detail , this article has aimed to follow the proposition made in 2007 by flurin condrau in his rather pessimistic assessment of the historiography of patients . if historians want to have a voice , he noted , they must engage with debates that have raged elsewhere and to claim intellectual , empirical and theoretical importance in the field. the few pages of this contribution raise questions linked to four broader debates : the bias due to observing the sufferer solely through the institutional archive , the multiplicity of players in the hospital setting , the critical and often anti - psychiatric genealogy of scholars interested in psychiatric history and the question of whether a historical investigation can only reveal what is heard , not what is said. i would like to return to roy porter s seminal article , the patient s view . doing medical history from below. in this piece the author did not really lay his cards on the table . indeed , his was far from a plea to consider the patient only within the hospital . porter aimed further , by also addressing aspects beyond the patient that is , the sufferer outside the hospital . herein lie also the limits of this article . the wealth of information in the institut s archives allows one to appreciate patient narratives , not only because of the medical reports , nursing notes , and so on that were recorded , but also because of the institut s tendency to archive documents produced directly by patients . these files contain the direct voices of these key players through therapy - related material ( for example , drawings and results of writing workshops ) , but there are also traces that were illegally preserved such as letters that the hospital management decided never to send . yet our knowledge remains extremely limited on the use of antipsychotics and antidepressants in non - hospital settings , since these practices do not necessarily give rise to archival material . as such , the patient records provide a few small glimpses into what appears to be a high consumption of these new drugs outside the institution . on a purely empirical level , the integration of the patient s voice into a history of psychiatric medication expands the characters that ought to appear in this narrative . that these now include patients seems obvious , as evidenced by the theme of this special issue dedicated to porter s seminal article . but the same applies to caregivers , whose central role in patients accounts should now be clear . in the past three decades , historians of psychiatry have sought to integrate the patient into the classic narrative but still often present it as a dance for two . it is time to recognise the multiplicity of roles within psychiatric institutions and to include , in particular , the heterogeneous figure of the nurse ( for example , guardians , servants , caregivers and nurses ) . after world war ii , when these new drugs spread through the asylum , there was a proliferation of new professions in psychiatry ( for example , social workers , psychologists and occupational therapists ) who changed the patients experiences of their stay in psychiatric institutions . if , for the nineteenth century , roy porter could still claim that it takes two for a medical encounter , this is definitely not the case for the twentieth century especially since this period witnessed the move of medical encounters and healthcare from patients private houses to hospitals . the change in scale that often goes along with an interest in patients attempts to make sense also takes this story to the ground level. this change of perspective moves away from a medical history that is embedded ( as is so often the case ) in a sterile and moralising opposition between , on the one hand , a narrative that focuses on the remarkable progress of medicine , and , on the other hand , one that only sees a history of rulers and ruled. this particular historiographical understanding of the past is particularly strong in psychiatry . the humanities remain strongly marked by this anti - psychiatric genealogy , even more than sixty years after the publication of the two great classical critical studies : erving goffman s asylums and michel foucault s madness and civilisation . integrating the patient as a key player and not just as an object of the medical gaze renders narratives less linear and more complex . the psychiatric ward of the 1950s was certainly marked by an asymmetry of structuring power . by choosing to focus on daily life , however , we perceive the margins of interpretation and manoeuvring for all those involved : patients , nurses , doctors and families . this article also questions a particularly strong current among sociologists who emphasise two phenomena : first , that the patient supposedly exists only through medicine , or , in the words of michel foucault , through the medical gaze. from this perspective , the patient s experience is only transmitted by a technique demanded by medicine. second , they argue that , over the last hundred years , the voice of the patient has largely disappeared from the medical field , whose representatives no longer rely exclusively on the patient to establish a diagnosis but use other techniques to psychiatrists still depend largely on the patient s word to determine the efficacy of psychiatric therapies , particularly with regard to psychoactive drugs , because their effect can not be fully measured by bodily reactions . despite the development of tools supposed to decipher mental illness first electroencephalograms ( eeg ) , then computerised axial tomography ( cat ) and magnetic resonance imaging ( mri ) scans this voice from below remains essential for gaining insight into various forms of disease experience and its management and representation .

the so - called chemical revolution has produced a vast historiographical corpus . yet the patient s voice remains surprisingly absent from these stories . based on the archives of the institut de psychiatrie ( brussels ) , this paper traces the introduction of largactil as recounted in patient letters , physician records and nurse notes . the paper thus contributes to the history of therapies from below , but also participates in the historiographical debate about whether the introduction of neuroleptics can indeed be considered a revolution .

antenatal care ( anc ) services are considered to be the key element in the primary health care delivery system of a country , which aims for a healthy society . over the past 60 years , the maternal health situation in the country has been staggering despite several changes in a rapidly evolving socioeconomic environment . the roles and responsibilities of primary care physicians have also been revised continuously in this context . under their leadership , different cadres of health workers have been appointed to address the problem . as deadline for millennium development goals is approaching , the need for improving the standard of maternal care is more than ever . in the last decade , as per the national data , health indicators keeping in view the gap between the target and reality , national rural health mission ( nrhm ) was launched in april 2005 , to improve the rural health care delivery system and health status of the people . accredited social health activists ( ashas ) were introduced at the village level for motivating the beneficiaries to utilize the antenatal care services provided by the government health facilities . under supervision of auxillary nurse midwives ( anm ) and physicians at primary health care level , ashas were planned to play the role of a connecting bridge between community and first level government health sector . these groups of health care providers , along with anganwadi workers ( aww ) , build the base line of rural health services in the country . they , under the mission , seek to provide universal access to equitable , affordable and quality maternal health care , as well as to bring about an improvement in the health status of the pregnant women belonging to underprivileged sections of the society . in this perspective , the present study aimed to find out the determinants of utilization of antenatal care services by the beneficiaries in rural lucknow . the present study , cross - sectional in nature , was conducted among rural beneficiaries in lucknow district from august 2009 to july 2010 . lucknow , a district in uttar pradesh ( up ) , north india , is having 33.3% of the population living in rural area . the rural part of the district has a literacy rate of 61.8% overall and 52.3% among the females . a rdw was defined as a post natal woman who had delivered a baby during the period from january 2009 till june 2010 . the percentage of women attending antenatal care was 64.2% in rural up , based on the findings of nfhs-3 . sample size was calculated with a relative precision of 10% and a design effect of 1.5 . sample size calculation was done using formula to estimate a proportion requirement for 95% confidence . considering non - response , an additional list of rdw ( comprising of 10% of the sample size ) was kept ready for every village . in case of absence or unwillingness of the rdw , the list was utilized . multistage random sampling was used for selecting villages . in the first stage , out of nine community health centers ( chcs ) in lucknow , two were chosen randomly . in the second stage , two primary health centers ( phcs ) were selected randomly from each chc , thus four phcs were included in the study . under each phc , two sub centers were taken within five km and two sub centers were taken more than five km away from the respective phc . in each of the sub centers thus selected , two villages were selected , one in which sub centre is located and any other village , selected via random sampling . thus , the study covered 32 villages , which includes equal ( 16 each ) number of sub centre villages ( scv ) and non - sub centre villages ( nscv ) . list of rdws was collected from ashas and awws and then systematic random sampling was followed to pick up the requisite number of beneficiaries . the study was conducted after clearance from the institutional ethical committee and permission from the superintendents of the concerned chc . a pretested structured interview schedule was used to collect required information . among independent variables , age , religion , caste , type of family , education , socio economic status ( ses ) , parity , and timing of registration were considered . for calculating ses , modified pareek 's classification for rural area data entry and analysis were done using pasw statistics version 19.0 ( spss inc . , fisher 's exact test were used to compare the rdws who took at least three antenatal care visits and who did not . results were expressed in terms of odd 's ratio ( or ) and confidence interval ( ci ) . independent variables that were significant at univariate level were included in multivariate model for avoiding confounding . backward logistic model , based on likelihood ratio , was used to find predictors for institutional deliveries at government hospitals . the fit of final model was assessed using hosmer - lemeshow goodness - of - fit test . multistage random sampling was used for selecting villages . in the first stage , out of nine community health centers ( chcs ) in lucknow , two were chosen randomly . in the second stage , two primary health centers ( phcs ) were selected randomly from each chc , thus four phcs were included in the study . under each phc , two sub centers were taken within five km and two sub centers were taken more than five km away from the respective phc . in each of the sub centers thus selected , two villages were selected , one in which sub centre is located and any other village , selected via random sampling . thus , the study covered 32 villages , which includes equal ( 16 each ) number of sub centre villages ( scv ) and non - sub centre villages ( nscv ) . list of rdws was collected from ashas and awws and then systematic random sampling was followed to pick up the requisite number of beneficiaries . the study was conducted after clearance from the institutional ethical committee and permission from the superintendents of the concerned chc . a pretested structured interview schedule was used to collect required information . among independent variables , age , religion , caste , type of family , education , socio economic status ( ses ) , parity , and timing of registration were considered . for calculating ses , modified pareek 's classification for rural area data entry and analysis were done using pasw statistics version 19.0 ( spss inc . , fisher 's exact test were used to compare the rdws who took at least three antenatal care visits and who did not . results were expressed in terms of odd 's ratio ( or ) and confidence interval ( ci ) . independent variables that were significant at univariate level were included in multivariate model for avoiding confounding . backward logistic model , based on likelihood ratio , was used to find predictors for institutional deliveries at government hospitals . the fit of final model was assessed using hosmer - lemeshow goodness - of - fit test . about half ( 54.5% ) of the rdws were above the age of 25 years . overall , 85.5% of the rdws took at least three anc services during their pregnancy ( 95% ci : 81.8% - 88.9% ) and 53.7% of them got registered during the first trimester of pregnancy ( 95% ci : 49.1% - 59.1% ) . chcs and anganwadi centers ( awc ) were the most common ( 50.9% and 48.6% , respectively ) sources of antenatal care services for them . for scv , sub centre was the most common ( 52.3% ) source followed by chc ( 45.5% ) for antenatal care services . for nscv , awc was the most common ( 63.1% ) source followed by chc ( 56.3% ) , for the same services [ table 1 ] . distribution of rdws according to the source of antenatal care during their last pregnancy * at the comparison between the profiles of the women who went for three anc visits and who did not , significant difference was found in terms of age , ses , and timing of registration . about 89.1% rdw above the age of 25 years took three or more such visits . majority ( 91% ) of the pregnant women who got them registered early went for more number of antenatal visits . the influence of religion , caste , education , family type or parity was not prominent though higher utilization was seen with increasing education [ table 2 ] . comparison of the profile of the rdws based on three antenatal care visits on simple logistic regression , no significant relation was found between three anc visits and religion , caste , education , family type or parity of the rdws . however , significant relation was found between three ante natal care visits and age ( or = 1.189 , 95% ci = 1.029 3.433 ) , ses ( or = 1.888 , 95% ci = 1.009 3.533 ) , and timing of antenatal registration ( or = 2.667 , 95% ci = 1.427 4.984 ) . women with age more than 25 years , higher ses , and early registration were found to be more likely to get three or more number of antenatal visits [ table 3 ] . factors associated with three antenatal care visits by the rdws on simple logistic regression at multivariate level , significant variables in the model were age of woman ( or = 2.107 , 95% ci = 1.132 3.923 ) and timing of registration ( or = 2.817 , 95% ci= 1.487 5.338 ) [ table 4 ] . the result of hosmer - lemeshow goodness - of - fit test was not significant ( p = 0.683 , df = 6 ) . overall correct classification result indicated that 85.5% of the rdws are predicted rightly about their number of antenatal visits . the study found that all the studied beneficiaries got themselves registered for antenatal care services . however , the findings are different from the observation of murthy , which showed that for phc / sc villages , the coverage was more than other villages . no such difference was found in the present study with regard to presence of sub centre in the village and this could be attributed to presence of asha in every village . majority of the beneficiaries attended three or more anc check - up and they got themselves registered most commonly in the first trimester of pregnancy . it was observed in the present study that chc and awc were the most common sources of antenatal care services for the beneficiaries . this is not consistent with a previous study , which found that most of the pregnant females went to sub centre or phc . preference for chc in the present study might be due to provision of lab facilities , while awcs were chosen due to their presence in every village . among different factors , less age has earlier been established as the determinant for three or more anc visits . in contrary to these studies , the present study suggests that increased age is associated with at least three antenatal visits . this might be due to increased awareness and more familiarity with the health workers with increasing age . the doctors at the phc and chc level should be more elaborate to the young pregnant ladies , as the latter , many a times , lack sufficient information . as per our study , ses was associated with adequate number of anc visits although after controlling for other variables , it could not come out as significant . previous studies also pointed towards economic factor as a predictor . in an area where three fourth of the population survive in a low standard of living , economic factors providing free care or conditional cash transfer will continue to be weighed against loss of daily wages in financially staggering part of the society . without an overall improvement in the standard of living , nothing more it is thought to pave way for longer period of contact between rdw and health workers . that explains higher tendency of early registered women to go for three or more number of anc visits . this finding is important , since it implies that encouraging early registration will ensure better maternal health in a long run . although it was not statistically significant , it is worth noting as several other studies in the past recorded the role of education in deciding health seeking attitude of pregnant women . education , on the other hand , by imparting awareness and autonomy to the women , encourages utilization of maternal services and leads to demand for maternal health care services . to sum up more importantly , the introduction of ashas at the rural level seemed to have influenced the health care seeking attitude of the rdws . it 's too early to say that ashas have changed the face of primary health care over past few years . setbacks are still there but it has been proved that ashas could play a pivotal role in improvising the health seeking attitudes of rural population . primary care physicians should also motivate the rdws for regular ante natal visits . at this stage of pregnancy , women are usually more receptive to their advices . this opportunity should be utilized today for the sake of a better maternal health tomorrow . evaluation of nrhm at the grass root level through a community - based approach , meticulously collected data and finding out the predictors for three anc visits are few strengths of this study . on the other hand , dependence of the sampling procedure on the completeness of the lists of rdws , retrieved from asha and aww , second , recall bias was not an impossible factor as the clients were asked regarding their pregnancies in this cross sectional study . third , we did not ask for the reasons for getting less number of antenatal care visits . elicitation of such causes would have revealed the views of the rdws in this regard . in addition , a longitudinal study will help in better understanding of the role of socio demographic as well as behavioral factors for sufficient antenatal care . evaluation of nrhm at the grass root level through a community - based approach , meticulously collected data and finding out the predictors for three anc visits are few strengths of this study . on the other hand , dependence of the sampling procedure on the completeness of the lists of rdws , retrieved from asha and aww , is one of the limitations . second , recall bias was not an impossible factor as the clients were asked regarding their pregnancies in this cross sectional study . third , we did not ask for the reasons for getting less number of antenatal care visits . elicitation of such causes would have revealed the views of the rdws in this regard . in addition , a longitudinal study will help in better understanding of the role of socio demographic as well as behavioral factors for sufficient antenatal care . elder rdws and those with early registration were found to be more likely to have at least three antenatal care visits . encouraging early registration and more focus on young mothers should be the thrust areas in maternal health program . younger mothers are easily convincible , personal interaction with them on part of asha could bring in successful changes in behavior . counseling for early registration should also get priorities , as it would be the first step for sufficient antenatal care visits to the health facility . under nrhm , there is improvement in anc coverage but health sector is yet to get 15% of the clients convinced , who are availing less care during their pregnancy . besides , conditional cash transfer has certain limitations in indian perspective , corruption being on of them . until there are improvements in terms of quality of care and community participation , it will remain challenging to achieve higher coverage of anc in rural areas . it is , therefore , recommended to focus on the predictors at individual as well as community level to bring about development in maternal health care utilization .

background : antenatal care services are the first steps towards ensuring the health of mothers and the newborn . this is the key component for achieving millennium development goals by 2015 . but india 's performance continues to be poor in providing antenatal care services to its huge population , particularly in the rural areas.objective:to assess the determinants of utilization of antenatal services by rural beneficiaries in lucknow , a district of north india.materials and methods : the study , cross - sectional in design , was conducted from august 2009 to july 2010 . multistage random sampling was used for selecting villages . a total of 352 recently delivered women were selected following systematic random sampling . logistic regression was used to find out the determinants of three antenatal care services.results:overall , 85.5% of the beneficiaries surveyed were found to receive at least three antenatal care services from any health facility . community health centre was the most common source for such care . significant difference was found between beneficiaries who took three antenatal care visits and who did not in terms of age , socio economic status , and timing of registration . on multiple regression , only age ( or = 2.107 , 95% ci = 1.132 3.923 ) and timing of registration ( or = 2.817 , 95% ci = 1.487 5.338 ) were found to be the predictors for three antenatal care visits.conclusion:intervention should be focused on young and late registered women for ensuring sufficient care during pregnancy .

periodontitis is a chronic immunoinflammatory infectious disease leading to the destruction of periodontal ligament and adjacent supportive alveolar bone induced by pathogenic biofilms containing numerous periodontal pathogens . among the periodontal pathogens , porphyromonas gingivalis , treponema denticola and tannerella forsythia are commonly co - isolated in subgingival biofilm samples from adult periodontitis lesions [ 15 ] . this consistent coexistence suggests that a strong ecological relationship may exist among these microbial species . furthermore , several studies report the co - existence of p. gingivalis and t. denticola in close association with chronic periodontitis lesions [ 1 , 68 ] , detection in carotid and aortic atheromatous plaques , exhibit nutritional interactions , demonstrate bimodal co - aggregation [ 1113 ] , binding of p. gingivalis fimbriae to t. denticola dentilisin , as well as synergistic biofilm formation [ 15 , 16 ] . moreover , both species express high trypsin - like proteolytic enzyme activities [ 1720 ] in addition to synergistic virulence as mixed infections in mouse abscess [ 21 , 22 ] and pneumonia animal models . we have shown previously that p. gingivalis and fusobacterium nucleatum exhibit synergistic soft tissue destruction . the mechanisms of interaction between p. gingivalis and t. denticola as a consortium in the subgingival sulcus and whether they express a synergistic pathogenic potential in progressing periodontitis remain enigmatic at present . recently , we have demonstrated that p. gingivalis , t. denticola , and t. forsythia with and without f. nucleatum not only exist as a consortium that is associated with chronic periodontitis in humans but also exhibit virulence resulting in the colonization of the rat oral cavity , induction of enhanced igg immune responses , and significant alveolar bone resorption characteristic of polymicrobial ( three pathogens or more ) periodontitis . monomicrobial ( single pathogen ) periodontal infections using p. gingivalis , t. denticola , t. forsythia , or f. nucleatum have been studied in rats and mice [ 2530 ] . increasing evidence supports the concept that bacterial interactions among members of the subgingival pathogens at any time during periodontal disease progression are important . however , there are no published reports establishing a mixed microbial ( two species ) periodontal infection for examining the virulence between p. gingivalis and t. denticola . this study examined mixed microbial periodontal disease using p. gingivalis and t. denticola as a consortium and examined their colonization / infection characteristics , periodontal inflammation parameters , immune response patterns , induction of alveolar bone resorption , and virulence interactions . the bacteria used in this study were p. gingivalis 381 and t. denticola atcc 35404 and these strains were grown under anaerobic conditions ( 85% n2 , 10% h2 , and 5% co2 ) at 37c in a coy anaerobic chamber as described previously [ 25 , 31 ] . the p. gingivalis strain 381 was chosen due to its known role in alveolar bone resorption in adult periodontitis and its proven ability to colonize the oral cavity of rodents [ 25 , 27 , 28 , 32 ] . for oral monobacterial infection , p. gingivalis ( 2 10 cells per ml : grown for 3 days on cdc anaerobic 5% sheep blood agar plates ) or t. denticola ( 2 10 cells per ml : grown in gm-1 broth for 4872 hours as a log phase culture ) was mixed with equal volumes of sterile 2% ( w / v ) low viscosity carboxymethylcellulose with pbs ( cmc : sigma ) , [ 25 , 26 , 28 , 33 ] and one ml was used for infection ( 10 cells per ml ) by oral gavage [ 25 , 26 , 28 , 33 ] . for oral mixed microbial infection , p. gingivalis ( 2 10 cells per ml ) was gently mixed with an equal volume of t. denticola ( 2 10 cells per ml ) , mixed gently for 1 - 2 min , and allowed to interact for additional 5 minutes for any interactions among these species . an equal volume of sterile 2% ( w / v ) cmc was added , mixed thoroughly , and one ml ( 5 10 cells of p. gingivalis ml , 5 10 cells of t. denticola ) was administered by oral gavage and anal topical application . rats are coprophagic in nature , and the rationale behind the anal application is that bacteria will be in the feces and will then return to the oral cavity , thereby establishing a cycle of oral reinfection [ 28 , 34 ] . female sprague - dawley rats ( 8 weeks old , charles river laboratories , ma , usa ) were maintained in groups and housed in microisolator cages in an aalac facility at the university of florida . the protocol ( # e900 ) and all rat infection procedures used in this study were approved by the institutional animal care and use committee of the university of florida . animals were fed standard powdered chow ( teklad global 18% protein rodent diet 2918 , harlan ) and water ad libitum . all rats were administered kanamycin ( 20 mg ) and ampicillin ( 20 mg ) daily for 4 days in the drinking water [ 25 , 35 ] and the oral cavity was swabbed with 0.12% ( v / v ) chlorhexidine gluconate ( proctor and gamble , oh , usa ) mouth rinse [ 25 , 31 ] to inhibit the endogenous organisms and to promote subsequent colonization of p. gingivalis and t. denticola . rats were randomized into groups ( n = 18 ) and monobacterial and mixed microbial inocula were administered by oral gavage and anal topical application [ 28 , 34 ] for 4 consecutive days per week on 46 alternate weeks ( 1624 inoculations ) . sham - infected control rats received vehicle and sterile 2% low viscosity cmc only . oral microbial samples from rats were collected using sterile cotton swabs at pre- and post - infections . a total of 46 postinfection microbial samples were collected the following week from all the infected rats . to determine the kinetics of virulence of mono- and mixed infection - induced periodontal disease and immune responses , rats were euthanized at the beginning of the 8th ( 7 weeks of 16 inoculations ) and 13th weeks ( 12 weeks of 24 inoculations ) . the rats were killed , skulls were removed , autoclaved , and mechanically defleshed with a periodontal scaler . the randomly selected rat jaws ( n = 3 ) were also suspended in 10% ( v / v ) buffered formalin , decalcified , tissues trimmed , and used for histomorphometry and histology . dna was isolated from rat oral microbial samples using a wizard genomic dna purification kit ( promega , wi , usa ) . the standard genomic dna for p. gingivalis , and t. denticola were also extracted following the same procedure from their respective 2472 hours pure cultures as described previously in . subsequently , pcr was performed using 16s rrna gene species - specific pcr oligonucleotide primers with a bio - rad thermal cycler as described previously in [ 25 , 31 , 35 ] . after amplification ; pcr products were separated by 1.5% agarose gel electrophoresis and the bands were visualized using the uvp biodoc - it imaging system . the genomic dna extracted from p. gingivalis and t. denticola served as positive control and pcr performed with no template dna making up the negative control . each pcr assay with the standard dna was sensitive enough to detect 0.05 pg of dna ( p. gingivalis 30 cells ; t. denticola 18 cells ) . different pcr cycles from 35 to 40 were standardized to produce detectable amplicons with the least amount ( 0.05 pg ) of template dna . serum from monobacterial ( n = 9 ) or mixed microbial infected rats ( n = 9 ) at 7 weeks ( 4 infections ) and 12 weeks ( 6 infections ) was used to determine igg , igm , iga , and igg subclass ( igg1 , igg2a , igg2b , igg2c ) antibody concentrations , using a standard elisa protocol [ 25 , 3436 ] . briefly , diluted infected rat serum ( 1 : 100 for igg and 1 : 20 for igm , iga and igg subclass ) was incubated in wells of either p. gingivalis or t. denticola coated microtiter polystyrene plates ( costar , corning , ny , usa ) for 2 hours at room temperature . after washing , alkaline phosphatase - conjugated goat anti - rat igg ( 1 : 2000 ) , igm and iga ( bethyl laboratories , tx , usa ) were added ( 1 : 500 ) and incubated for additional 2 h at room temperature on a rotator . the substrate ( p - nitrophenylphosphate ; sigma , 1 mg / ml ) was added to the washed plates , and the reaction was terminated by using 3 m naoh . for igg subclass elisa analysis , alkaline phosphatase - conjugated goat anti - rat igg1 , igg2a , igg2b , and igg2c ( bethyl laboratories , tx , usa ) were used ( 1 : 500 ) . the optical density ( od ) louis , usa ) , which were coated onto wells of the microtiter polystyrene plates , detected , and developed as described above . the pattern of alveolar bone resorption ( horizontal or vertical ) induced by p. gingivalis and t. denticola were measured by both morphometric and radiograph methods , respectively . the 7 and 12 weeks mono- and mixed microbial infected jaws ( n = 6 ) were immersed in 3% ( vol / vol ) hydrogen peroxide overnight , and stained with 0.1% ( wt / vol ) methylene blue to delineate the cemento - enamel junction ( cej ) using the modified morphometric method [ 33 , 34 ] . the digital images of both buccal and lingual root surfaces of all molar teeth were captured under a 10 stereo dissecting microscope ( stereo discovery v8 ; carl zeiss ) , after superimposition of buccal and lingual cusps to ensure reproducibility and consistency . the line tool was used to make horizontal bone resorption measurements on all molars in each quadrant from the cej to the alveolar bone crest ( abc ) . the surface perimeters of cej and abc were traced using the calibrated line tool . as the axiovision software program was calibrated using a precise ruler , the area of the horizontal bone loss reading in mm two blinded investigators were used and all measurements were done two times by the same examiner at separate times and the means of the measurements were obtained for each of the four quadrants . the maxillae and mandibles were placed and stabilized with dental wax on a digital kodak 6000 sensor ( carestream health , usa ) oriented with the axis of the teeth parallel to the sensor surface . digital radiographs of distal and mesial surfaces of the molars were acquired with orthogonal projection geometry using an exposure time of 0.08 s at 60 kvp and 15 ma . all radiographic images were exported into the tuned aperture computed tomography workbench , calibrated for magnification using known anatomic measurements , and histograms equalized . the line tool was used to make vertical bone resorption measurements on the distal and mesial sides of each interproximal surface ( 2 sites per tooth ) for each of the molars in each quadrant from the cej to the abc ( i.e. , resorption ) as the primary outcome parameter of the study . the summation of alveolar bone resorption in mm was tabulated and analyzed for intra and intergroup comparison [ 25 , 31 , 35 ] . monomicrobial and mixed microbial infected rat jaws ( n = 3 ) were removed randomly and fixed in 10% buffered formalin . the decalcified tissue was embedded in paraffin blocks , 4 sections prepared , stained with hematoxylin and eosin and the wholeslides were digitally scanned with a scanscope cs system ( aperio technologies , vista , ca ) . the scanned slides were viewed with imagescope viewing software ( aperio technologies , vista , ca ) . the inflammation at the supracrestal gingival connective tissue between the molars in each specimen at consecutive sections or levels 10 and 20 was examined based on multiple parameters including polymorphonuclear leukocytes ( pmn ) , lymphocytes , blood vessel density , apical migration of junctional epithelium ( je ) , rete ridge elongation ( r ) and alveolar bone resorption ( abr ) . the number of inflammatory cells ( pmns and lymphocytes ) per unit area ( 0.05 mm 0.05 mm ) was counted in the area of the junctional epithelium and adjacent connective tissue . the migration of je , elongation of rete ridges and resorption of alveolar bone was measured using the imagescope software with a microgrid at a magnification of 200 . the distances from the cej to the coronal portion of the connective tissue attachment ( apical migration ) , from the cej to the apical portion of the rete ridge ; and from the cej to the level of the alveolar bone crest were measured . the alveolar bone resorption and igg antibody data were presented as means standard deviations ( prism 4 , graphpad software ) . p values were calculated using the kruskal walis anova with dunn 's correction for multiple comparisons and mann - whitney student t - test . prior to mono- or mixed infection ; we examined all rats for p. gingivalis and t. denticola using appropriate bacterium - specific primers by pcr , and observed all rats were consistently negative for these oral pathogens . the pcr results demonstrate an appropriately sized amplicon for p. gingivalis ( 600 bp ) present in dna isolated from rat oral microbial samples following infection with the single - microbe inocula ( data not shown ) . among two monobacterial infections , p. gingivalis was found positive by pcr in all individual rats ( n = 18 ) and was positive 14 times during the four to six sampling times . in addition , 5083.3% of infected rats were positive for p. gingivalis during four ( 2 , 3 , 4 , and 6 ) out of six sampling times . in contrast , t. denticola ( 860 bp ) amplicons were negative for dna isolated from rat oral microbial samples following infection with the single - microbe inocula . the rats that had been given p. gingivalis + t. denticola mixed infection showed 72% ( 13/18 ) positive amplicons for p. gingivalis and only 2 out of 18 rats were positive for amplicons of t. denticola . to provide additional documentation of oral infection and to demonstrate an immunological response to p. gingivalis and t. denticola infection , we evaluated the levels of pathogen specific igg , igm , iga , and igg subclass ( igg1 , igg2a , igg2b , iggc ) antibodies in rat sera 7 weeks and 12 weeks post - initial infection ( figure 1 ) . the induction of igg antibody response patterns was identical in both 7 and 12 weeks infected rats using either mono- or mixed infection protocols . all rats in the p. gingivalis infected group at both 7 ( figure 1(a ) ) and 12 weeks ( figure 1(c ) ) demonstrated significantly elevated igg antibody ( p < .05 ) compared to the levels in shaminfected control rats . similarly , all rats infected with t. denticola produced igg antibody that was significantly higher ( p < .05 ) than levels of sham - infected control rats at both 7 ( figure 1(b ) ) and 12 weeks ( figure 1(e ) ) postinfection . however , p. gingivalis infection induced significantly higher igg levels ( > 100-fold ) than t. denticola infection in the monoinfected rats . the levels of igg antibody in the rat serum paralleled the frequency of detection of p. gingivalis in the oral microbial samples . interestingly , all rats in the t. denticola monobacterial infection group at 12 weeks ( figure 1(e ) ) induced significantly strong igg immune response in spite of our inability to detect t. denticola dna in the oral microbial samples . all rats in the mixed infection groups showed elevated serum igg antibodies to p. gingivalis and t. denticola compared to the levels in shaminfected control rats ( figure 1 ) . interestingly , p. gingivalis + t. denticola infection at 7 ( figures 1(a ) and 1(b ) ) and 12 week ( figures 1(d ) and 1(f ) ) post - initial infection induced > 100-fold stronger p. gingivalis specific igg immune response as compared to t. denticola igg responses . approximately , 90% of the rats infected with mixed bacteria ( 16/18 ) presented elevated serum igg to p. gingivalis when compared to sham - infected control rats ( figure 1(a ) ) . similarly , 100% of the mixed microbial infected rats ( 18/18 ) demonstrated significantly elevated serum igg to t. denticola compared to that in sham - infected control rats ( figure 1(b ) ) . none of the p. gingivalis and t. denticola infected rats induced iga and igm antibodies during 7 and 12 weeks of infection ( data not shown ) . thus , we had observed that p. gingivalis and t. denticola are antigenic in the rats , which resulted in significant levels of serum igg antibodies . in order to more fully assess the characteristics of the antibody , we determined the igg subclass distribution of the humoral immune response following oral infection . following 12 weeks of p. gingivalis mono- and mixed microbial infection , the igg2b subclass levels ( p < .05 ) were higher than the igg1 and igg2a antibody levels and significantly ( p < .05 ) greater than in sham - infected control rats ( figures 1(c ) and 1(d ) ) . similarly , in t. denticola mono- and mixed microbial infection , the igg2b subclass levels ( p < .05 ) were higher than the igg1 and igg2c antibody levels and significantly greater than in sham - infected control rats ( p < .05 ) ( figures 1(e ) and 1(f ) ) . additionally , p. gingivalis induced higher levels of igg subclass antibody than that induced by t. denticola . in order to address the potential virulence between the p. gingivalis and t. denticola in periodontal disease progression in the rats , we examined the effect of infection on the maxilla and mandible alveolar bone resorption . both mono- and mixed infection induced buccal and palatal areas of alveolar bone resorption ( table 1 ; figure 2 ) . here , the maxillary and mandibular bone loss in the rats infected with p. gingivalis , t. denticola , and p. gingivalis + t. denticola were significantly greater ( p < .05 ) than that of the sham - infected control group at 7 and 12 weeks ( table 1 ) . the maxillary and mandibular bone loss in all infected groups during 12 weeks of periodontal disease was generally greater than 7 weeks of periodontal disease . in addition , mandibular bone loss was generally higher than maxillary bone loss in both buccal and palatal surfaces ( table 1 ) . gingivalis monoinfection induced more palatal mandibular horizontal bone loss area than maxilla at 7 and 12 weeks post - initial infection . in contrast , t. denticola monoinfection generally induced greater palatal and buccal area bone loss than p. gingivalis as well as more mandibular bone loss than maxilla at 7 and 12 weeks post - initial infection . similarly , mixed infection induced more significant bone loss in both maxilla and mandibles , palatal and buccal surfaces than monoinfection at 7 and 12 weeks post initial infection ( table 1 ) . furthermore , mixed infection induced more mandibular palatal surface horizontal area bone loss than maxillae . in order to confirm our observations of alveolar bone resorption , radiographic analysis of the maxilla and mandible mono- and mixed infection resulted in significantly increased maxillary , mandibular , and total interproximal alveolar bone resorption at 7 weeks ( data not shown ) and 12 weeks of periodontal disease compared with sham - infected control rats ( p < .05 ) ( figure 3 ) . in addition , there was an overall loss in vertical bone height , with associated circumferential angular defects . furthermore , mixed infection demonstrated a significant increase in maxillary , mandibular , and total vertical bone loss compared to any of the monobacterial and sham - infected control infections ( p < .05 ) ( figure 3 ) . in order to determine if the infection protocols induced differing levels of inflammation which could be responsible for the increased alveolar bone resorption observed , sections of the maxilla and mandible of rats infected with p. gingivalis and/or t. denticola during 7 and 12 weeks of periodontal disease were examined at consecutive levels 1 , 10 , and 20 for inflammation . mixed microbial infection rats showed more significant histological changes , particularly apical migration of je , rete ridge elongation , pmn density , lymphocytes infiltration , blood vessel density and alveolar bone loss than sham - infected control animals ( table 2 ; figure 4 ) . the sham - infected control rats showed mild inflammation with fewer pmn and lymphocytes , no apical migration , and small rete ridge elongation . similarly , mixed microbial infection induced significant apical migration of je ( p < .01 ) and dense inflammation in the periodontium compared to p. gingivalis monoinfected rats . in addition , mixed microbial infection rats showed no significant differences in rete ridge elongation , pmn density , lymphocytes infiltration , and blood vessel density compared to p. gingivalis and t. denticola mono - infected rats . p. gingivalis and t. denticola infected rats showed significant histological changes , specifically apical migration of je , alveolar bone loss , pmn density , lymphocytes infiltration , and blood vessel density more than sham - infected control animals ( table 2 ; figure 4 ) . moreover , p. gingivalis infected rats showed significant infiltration of lymphocytes ( p < .05 ) and blood vessel density in the periodontium ( p < .001 ) compared to mixed microbial infected rats ( table 2 ) . this paper explicitly demonstrates an experimental model for mixed microbial infections in periodontal disease , documenting colonization / infection with the p. gingivalis / t . denticola consortium of oral microorganisms , with ( kinetics ) induction of periodontal inflammation at 7 and 12 weeks , generation of specific systemic igg immune responses to the infecting pathogens , and stimulation of enhanced alveolar bone resorption in rats . these results also documented , for the first time , the virulence of mixed infections with p. gingivalis + t. denticola in a periodontal disease model . bacterial synergism in progression from periodontal health to disease has been proposed but few studies have documented bacterial synergism due to the inherent complexity of the subgingival microflora [ 8 , 38 ] . in the previous study , we had not examined the early induction of periodontal inflammation and assessment of both palatal and buccal horizontal bone loss . here we demonstrate this early kinetics in a model of periodontal disease at 7 and 12 weeks of disease . the monobacterial infection in rats indicated that p. gingivalis exhibited the ability to colonize / infect the oral cavity with 46 alternate weekly infection schedules ( 1624 inoculations ) during the 712 weeks study establishing a chronic infection . we have shown previously that infecting rats 15 - 16 times with p. gingivalis , over a similar interval of the experiment , resulted in consistent detection of genomic dna in oral microbial samples [ 25 , 31 , 35 ] . moreover , induction of significant igg immune responses and enhanced alveolar bone loss observed in all rats clearly documents that these rats were infected , even though the rats showed negative pcr reactions for t. denticola . we recognize the limitations in sample collection procedures , as existing with all the current techniques of microbial sampling from the oral cavity . the serum igg antibody levels to monoinfection during 7 and 12 weeks of periodontal disease clearly indicated that p. gingivalis is highly effective in colonization and/or is highly antigenic in the rats when compared to t. denticola . however , we observed an increase in serum igg antibody to t. denticola in p. gingivalis mono - infected rats . while this igg antibody was more than sham - infected controls , it was approximately 1000-fold lower than the homologous igg antibody response to p. gingivalis infection . this could indicate that these bacteria share some common epitopes . the mixed oral infection with p. gingivalis / t . these altered responses could be due to a lowered colonization capacity of the t. denticola within the mixed consortium challenge and/or a decreased ability to multiply in the oral cavity during the infection , thus resulting in a lower magnitude of antigenic challenge , reduced periodontal inflammation , and no robust alveolar bone loss nor virulence synergism . the predominant response following p. gingivalis infection was the igg2b ( t helper type 1 ) and igg1 subclass ( t helper type 2 ) , followed by igg2a ( th1 ) and undetectable level of igg2c antibody indicating a stimulation of both th1 and th2 activities in development of the humoral immune response to bacterial infection . similarly , the predominant response following t. denticola monoinfection was the igg2b subclass , followed by igg1 , igg2c and undetectable level of igg2a antibody in rats suggesting a mixed th1- and th2-responses to oral infection . in contrast , igg1 antibody titer was much higher in mice to t. denticola infection . despite the high bacterial specific igg antibody levels during 7 and 12 weeks of infection , there was no significant immune protection from alveolar bone loss in rats as well as in several previous studies [ 39 , 40 ] suggesting complex mechanisms of antibody protection . furthermore , p. gingivalis recombinant hemagglutinin b immunization or immunized and infected rats induced igg subclass responses ( igg1 = igg2a > igg2b > igg2c ) suggesting a mixed th1 and th2 responses and immunized rats had less alveolar bone loss indicating a protective immune response [ 41 , 42 ] . similarly , immunization with p. gingivalis whole cells induced high - titer serum igg2a ( th2 ) , moderate - titer igg2b ( th1 ) and low - titer igg1 ( th2 ) responses and immunization with rgpa - kgp cysteine proteases of p. gingivalis induced high - titer serum igg2a ( th2 ) responses which restricted colonization and decreased periodontal bone loss indicating a protective immune response in the rat . while differences in horizontal ( palatal and buccal surface ) and interproximal alveolar bone resorption levels were observed following monoinfection with p. gingivalis and t. denticola dependent upon both the differences in the sites of the samples as well as the techniques for measurements , we could not easily compare the magnitude of alveolar bone resorption between these individual bacteria . denticola significantly increased interproximal as well as horizontal alveolar bone loss compared to mono - infections . this increased bone loss may be related to enhancement of expression of the virulence of individual bacteria by cooperative abilities of their extracellular potent proteinases ( p. gingivalis rgpa , rgpb , kgp gingipains cysteine proteinase ) ( t. denticola chymotrypsin - like protease , phospholipase c , oligopeptidase , endopeptidase and cystalysin ) to affect host systems through specific cleavage of cell surface receptors and the inactivation of host - defense proteins [ 18 , 20 ] . in addition , mixed infection with p. gingivalis + t. denticola exhibits significant virulence synergism in abscess formation and mortality in mouse pneumonia model and mouse abscess model [ 21 , 22 ] . the analysis of the data have clearly shown the following : ( i ) mono- and mixed microbial colonization / infection of human oral pathogens in rat oral cavity during 7 weeks of periodontal disease ( gained access to the oral epithelium ) , ( ii ) generation of a specific serum igg antibody responses ( as early as 7 weeks ) reflecting the oral infection ( engagement of systemic host response mechanisms ) , ( iii ) induction of enhanced horizontal and interproximal alveolar bone resorption in rats with mixed infection as expected ( direct result of local infection ) , ( iv ) induction of inflammatory response ( apical migration of je , rete ridge elongation , crestal alveolar bone loss , pmns ) consistent with established characteristics of periodontal disease , and ( v ) no synergistic virulence observed with p. gingivalis / t . this mixed infection model will provide an opportunity for further studies to clarify the characteristics and alterations of the host response profiles such as proinflammatory cytokines and matrix metalloproteinases in periodontal tissues that relate to osteoclastic alveolar bone loss in response to mixed infections .

porphyromonas gingivalis and treponema denticola are periodontal pathogens that express virulence factors associated with the pathogenesis of periodontitis . in this paper we tested the hypothesis that p. gingivalis and t. denticola are synergistic in terms of virulence ; using a model of mixed microbial infection in rats . groups of rats were orally infected with either p. gingivalis or t. denticola or mixed microbial infections for 7 and 12 weeks . p. gingivalis genomic dna was detected more frequently by pcr than t. denticola . both bacteria induced significantly high igg , igg2b , igg1 , igg2a antibody levels indicating a stimulation of th1 and th2 immune response . radiographic and morphometric measurements demonstrated that rats infected with the mixed infection exhibited significantly more alveolar bone loss than shaminfected control rats . histology revealed apical migration of junctional epithelium , rete ridge elongation , and crestal alveolar bone resorption ; resembling periodontal disease lesion . these results showed that p. gingivalis and t. denticola exhibit no synergistic virulence in a rat model of periodontal disease .

the goal to achieve ideal pediatric drug therapy is a worldwide challenge for regulatory bodies and clinicians . children are treated with medicines not tested for safety and efficacy and are frequently supported by the low quality of evidence . in the absence of standard prescribing information , clinicians prescribe drugs in an off - label manner . off - label use means use of medicine which is outside the terms of product license with respect to dose , route of administration , indication , or age . off - label medicine use among children represents an important health issue as the effects and health risks may be unexpected . various national and international studies have been published about the amount of and problems associated with off - label medicines in children . the magnitude of off - label prescribing is accounted to be between 18% and 60% in infants but it may be up to 90% in neonates [ 39 ] . most of these studies have been conducted outside india and may not be applicable as hospitalization and prescribing patterns differ based on culture , healthcare infrastructure , and health policies . only one previous study has been conducted in india which reported 50.62% of off - label prescribing based on british national formulary . currently there is no study conducted in india based on national formulary of india ( nfi ) . hence , the objective of the research study was to quantify off - label use based on nfi , various predictors and discusses some strategies to monitor it . the prospective observational study was carried out at a tertiary care hospital in ahmedabad ( india ) for the period of six months . all the pediatric patients in ages between 0 and 12 years receiving at least one medication and admitted in pediatric ward were included in the study . the pediatric ward was of 60 bed size and attended by 10 academic pediatricians and 28 postgraduate students . patients were not considered if they were in age of more than 12 years , not taking any prescription medication and undergoing surgery . demographics , clinical characteristics , and medication usage were obtained from the medical records using predefined paper case record forms . the data collection was carried out by one of the researchers ( mms ) who discussed each of the medicines with attending pediatrician and clinical pharmacologist ( dr ) . drugs were entered into the database using the world health organization anatomical therapeutic chemical ( who - atc ) classification system . we utilized national formulary of india ( nfi , 4th edition , 2011 ) which is an official publication of indian pharmacopoeia commission , ministry of health and family welfare , government of india . categories for off - label use were allocated for each medicine according to the reason(s ) why their use was deemed off - label when compared to the terms of the product labeling for that medicine in nfi . we followed a published algorithm and used these dimensions to determine whether there is strong scientific evidence for frequently prescribed off - label medicines ( table 4 ) . variables such as age , number of medications , number of diagnoses , and length of hospital stay were regarded as continuous and expressed as mean with standard deviation ( sd ) . the odds ratio ( or ) with 95% confidence interval ( ci ) was used to determine the predictors for off - label prescribing . the data were analyzed using statistical package for the social sciences ( spss inc . , this study was reported according to the strengthening the reporting of observational studies in epidemiology ( strobe ) guidelines . the study included a total of 320 patients admitted in pediatric general ward of the public teaching hospital over a period of six months . the mean age was 2.73 years ( range = 0.1 to 12 years and standard deviation : 3.09 ) . the most common age group was 0 to 1 years representing 43% of total sample size . on average each patient had 1.2 number of diagnosis and 48 patients ( mean = 2.5 ) had more than one diagnosis during hospitalization . the majority of patients suffered from respiratory diseases ( 33% ) , central nervous system diseases ( 16.5% ) , and gastrointestinal disease ( 11% ) . a total of 1645 medications were prescribed to the study cohort during hospitalization , with a total hospital stay of 1743 days . this constituted the mean number of five ( sd = 2 ) medications prescribed per patient and 5.48 ( sd = 3.62 ) days of hospital stay . the number of medications and hospital stay ranged from one to 13 and one to 33 days , respectively . the majority of patients received antibiotics , cough , and cold preparations , antipyretics , inhaled corticosteroids , bronchodilators , and antiepileptic drugs . medications were mostly administered by oral route ( 40% ) and intravenous route ( 35% ) followed by inhalation route ( 25% ) . of the 320 patients included in the study , 310 ( 97% ) patients received at least one off - label medication . a total of 1645 medications were administered during the hospitalization ; 1152 ( 70% ) medicines were prescribed in off - label manner when its usage was validated with national formulary of india , 2011 , for five different off - label categories . patients received on average ( sd ) 3.66 ( 2.13 ) off - label medicines within a range of one to 10 . the most common cause of off - label prescribing 893 ( 63% ) was due to higher dose use ( category 1 ) than stated for particular pediatric patients . off - label medicines use for age ( category 2 ) and indication ( category 3 ) was found to be 282 ( 19.8% ) and 145 ( 10.2% ) , respectively . those medicines which had no pediatric information ( category 5 ) were 76 ( 5.3% ) . use of ipratropium , salbutamol , and dextromethorphan was common for different dose and age limits . lorazepam ( seizures ) and ondansetron ( nausea and vomiting ) were frequently used for off - label indication . the study also attempted to distribute the receipt of off - label medicines in different age groups as shown in table 2 . the extent off - label prescribing was highest ( 76% ) in age group of more than 1 to 2 years , followed by age group of more than 1 to 12 months which accounted for 69% of off - label use . off - label use in dose ( category 1 ) was consistent among the patients in age of 0 to 6 years . the use of medicines in patients for restricted age limits ( category 2 ) was highest in 112-month age group . indication ( category 3 ) and absence of pediatric information ( category 5 ) were most prominent in 612-year patients . highest proportion of off - label medicines were prescribed in anti - infectives for systemic use 389 ( 73% ) and respiratory system 378 ( 82% ) as shown in table 3 . the amount of off - label prescribing in nervous system and alimentary tract and metabolism system was 220 ( 53% ) and 85 ( 86% ) , respectively . majority of off - label medicines prescribed were ceftriaxone , amikacin , amoxicillin , and vancomycin in antibiotics class and inhaled corticosteroids , ipratropium , salbutamol , chlorpheniramine , phenylephrine corresponding to respiratory system . blood and blood forming agents 16 ( 89% ) , hormonal preparation 32 ( 80% ) , and cardiovascular medicines 24 ( 71% ) had substantial high amount of off - label use . adrenaline , nifedipine , prednisolone , and dexamethasone were also used in off - label manner . antiparasitic products 8 ( 16% ) had minimum off - label use . antibiotics ( 75% ) and inhaled corticosteroids ( 79% ) were mostly prescribed in higher doses ( category 1 ) than recommended . in respiratory system , many medicines ( 39.5% ) were prescribed below age limits ( category 2 ) as indicated in the formulary . medicines used for unapproved indication ( category 3 ) largely confined to alimentary tract and metabolism system and blood and blood forming agents . medicines which had no pediatric information were predominantly in antihypertensive drug class . on multivariate regression analysis as shown in table 5 , we found that pediatric patients in age of 0 to 2 years ( or 1.68 , 95% ci , 1.262.24 , ) were more likely to receive off - label medicines than any other age group . female patients ( or 1.41 , 95% ci , 1.131.77 ) received substantially high amount of off - label medicines compared to male . hospital stay of six to 10 days ( or 1.91 , 95% ci , 1.332.75 ) also carried higher risk of off - label prescription . using the data of the pediatric ward of a tertiary care hospital , we found that 70% of medicines were prescribed in off - label manner . the magnitude off - label prescribing is substantial higher than reported in the recent studies [ 1416 ] . cuzzolin et al . performed a literature review of published studies on off - label and unlicensed drug use in children . seven studies involved neonatal intensive care units ( nicus ) , fifteen studies included pediatric wards , and twelve studies were conducted in community setting . cuzzolin et al . found off - label prescribing in pediatric ward ranging between 18 and 60% . various reasons for different rates of off - label use are off - label classification methods , sample sizes , pediatrician 's prescribing habits , in - house treatment protocols , and diseases characteristics most importantly pediatric drug regulation . patients in ages between 0 and 2 years are most likely to receive off - label medicines and had highest representation in study sample . previous studies also established that age group of 0 to 2 years is the highest recipient of off - label prescriptions [ 16 , 17 ] . this is mainly due to absence of specific dosing guidelines and route administration in 0-to-2-year age group in nfi . of the medicines prescribed during the period , it was observed that antibiotics , respiratory medicines , and nervous system medicines were frequently prescribed in off - label manner . several studies had shown high rate of off - label prescribing in respiratory , antibiotics , analgesics , and antiepileptics . about 82% of medicines in respiratory system were off - label which is more than what is reported in studies in us ( n = 312 million , 70% ) and portugal ( n = 500 , 77% ) . if asthma therapies are considered , inhaled corticosteroids are frequently prescribed ( 30.7% of all prescriptions ) . the mainstay therapy for asthma is inhaled corticosteroids ( ics ) , but guidelines often do not give specific recommendations for upper doses limits specially in children . various combinations of antihistaminics , decongestants , and/or analgesics were prescribed to patients in off - label doses for common cold . still , the off - label use of paracetamol is substantial , mainly due to off - label classification for dose or age . although paracetamol is normally considered safe in pediatrics care , a previous cochrane review pointed out that there is limited evidence regarding the efficacy and safety for paracetamol in the treatment of fever in children . lorazepam and ondansetron were widely prescribed for off - label indication but are supported by well conducted clinical studies [ 27 , 28 ] . better medicines for children to improve monitoring medicine safety in the pediatrics and highlighted its concern on off - label medicines . the strict drug approval procedure is the way to ensure quality data on quality , safety , and efficacy for different pediatric age groups . despite many regulatory amendments and policies , we still have apathetic outlook to pediatric clinical trials . the pharmaceutical companies should be convinced to have appropriate pediatric information in the label and they are not being permitted to market drugs likely to be used in children without suitable pediatric labeling . indian drug regulatory authorities should also develop pediatric specific drug development regulation so that the tendency to market medicines without pediatric specific data is discouraged . this might ensure pediatric labeling for new medicines yet to be introduced in the market ; but it is unlikely that drug companies will carry out trials to confirm pediatric use for drugs already marketed and used in children , although in an off - label manner . alternatively , the situation can be improved when prescribers report their pediatric experiences with different off - label medicines in form research articles or discussion at scientific platforms . when medicines are used as off - label , each patient is unique and risk - benefit pertaining to him should be assessed by high quality evidence . the doctor needs to be updated with latest evidence which could be accomplished by using several useful drug compendia like drugdex , clinical pharmacology , and so forth . only such focused and coordinated actions would make sure that children 's right to safe , cost - effective , and quality medicines would be realized . based on national formulary of india , our data suggest that magnitude of off - label prescribing in pediatric inpatients is considerable higher than reported in some of the countries . dose discrepancy and use in restricted age limits were identified as main contributor to off - label prescribing . there is need for strict drug regulation for pediatric population to ensure safety and effectiveness of pharmacotherapy . further studies are needed to examine why there are inadequate dosing guidelines and generation of more clinical data especially in respiratory medicines . understanding various risk factors and spectrum of off - label medicine use can assist developing prevention strategies .

background . in the absence of standard pediatric prescribing information , clinicians often use medicines in an off - label way . many studies have been published across the globe reporting different rates of off - label use . there is currently no study based on indian drug formulary . methods . the prospective observational study included pediatric patients in ages between 0 and 12 years admitted in a tertiary care hospital . off - label use was assessed using the national formulary of india ( nfi ) . predictors of off - label use were determined by logistic regression . results . of the 1645 medications prescribed , 1152 ( 70% ) were off - label based on 14 possible off - label categories . off - label medicines were mainly due to dose difference and use in restricted age limits as indicated in nfi . respiratory medicines ( 82% ) , anti - infectives ( 73% ) , and nervous system medicines ( 53% ) had higher off - label use . important predictors of off - label prescribing were pediatric patients in age of 0 to 2 years ( or 1.68 , 95% ci ; p < 0.001 ) and hospital stay of six to 10 days ( or 1.91 , 95% ci ; p < 0.001 ) . conclusion . off - label prescribing is common among pediatric patients . there is need to generate more quality data on the safety and efficacy of off - label medicines to rationalize pediatric pharmacotherapy .

the synthetic modification of proteins enables the construction of biomolecular hybrids that can be used to study protein function , deliver potent therapeutics to cellular targets , and build new materials . the synthesis of these constructs requires a suite of chemoselective bioconjugation reactions that proceed under mild , aqueous conditions in the presence of the native functional groups that are present on protein surfaces . the most common methods for protein modification target the nucleophilic side - chains of lysine and cysteine . however , these strategies can result in complex product mixtures , as lysine is typically found in high abundance on the protein surface and uniquely reactive cysteine labeling sites can be difficult to install in many instances ( such as thiol proteases and proteins produced via the eukaryotic secretory pathway , for example ) . many newer approaches for the site - selective modification of proteins involve the introduction of artificial amino acids with reactivities that are orthogonal to those of the native amino acids . along these lines , a number of powerful methods have been developed for the selective modification of azide , alkyne , alkene , carbonyl , and aniline moieties . however , the difficulty of introducing a non - canonical amino acid can limit the application of these methods . complementary approaches rely on the site - selective modification of native amino acids by enzymes . in addition , a reliable method for the modification of c - terminal thioesters with n - terminal cysteines , termed native chemical ligation , has been developed by kent and co - workers . this method has been used for the semi- and total synthesis of complex protein substrates , including the chemical synthesis of a single glycoform of human erythropoietin . as an alternative strategy , we and others have developed methods for the selective modification of the n - terminal amino group . methods that target the n - terminus can offer significant advantages for bioconjugate preparation , as they can be used for a wide range of protein targets produced by virtually any expression system . conceptually powerful as they are , however , these methods can be hampered by long reaction times , often require large excesses of reagent , and/or involve at least two - steps for the attachment of synthetic molecules . we have therefore sought to develop new techniques that can achieve n - terminal modification with similarly high positional selectivity , but with significantly improved efficiency . herein , we report an oxidative coupling pathway that can preferentially modify the n - terminus of proteins with fast kinetics . peptide substrates were first used to screen reaction conditions and identify the site of modification . a peptide panel with varying n - terminal residues was then evaluated to determine the sequence specificity of the reaction , leading to the identification of proline as the optimal n - terminal amino acid . the reaction was next applied to protein substrates , showing similarly high levels of conversion when an n - terminal proline residue was present . this mild bioconjugation reaction enables the facile , rapid modification of proteins to create a well - defined and stable linkage in a single position , and thus should be useful for many different applications in chemical biology and the construction of biomolecular materials . we have previously reported the chemoselective coupling of aniline moieties on proteins to electron - rich aromatic rings , such as o - aminophenols , at slightly acidic ph ( 6.06.5 ) . these reactions require the addition of naio4 or k3fe(cn)6 as a terminal oxidant , with the latter reagent exhibiting improved compatibility with glycoproteins and substrates with free sulfhydryl groups . the use of ferricyanide as the oxidant also yields a single reaction product ( 1 ) , whereas periodate leads to the formation of a ring contracted species as a competing pathway . the ferricyanide - based reactions are presumed to involve an o - iminoquinone as the reactive intermediate , as suggested in scheme 1 , or could involve the corresponding o - quinone after imine hydrolysis . taken together , the oxidative coupling strategies have demonstrated excellent functional group compatibility and the ability to join large unprotected biomolecules at low concentrations , as demonstrated for the coupling of peptides , polymers , and nucleic acids to specific locations on viral capsids and antibody fc domains . while these coupling reactions were found to be highly aniline - selective under the conditions used , several studies have reported the reaction of o - aminophenols and o - catechols with native amino acids , dating back to 1949 . in addition , recent work by messersmith has shown the ability of proteins to be coupled to o - quinone moieties present on polydopamine - coated surfaces . these reports suggested that secondary coupling pathways could be developed to achieve the modification of native amino acids with o - aminophenols ( scheme 1 ) , and thus initial experiments were designed to identify the optimal reaction conditions for achieving this with complex molecules . in our previous work , we noted that low amounts of background reactivity could be observed in aniline - based oxidative coupling reactions when higher ph conditions ( > ph 6.5 ) were used . in an initial effort to characterize this alternative reaction pathway , conditions and reaction times were first screened to increase the reaction yields for peptides that did not contain aniline groups . angiotensin i and melittin were used as substrates , as they contain many reactive amino acids , including lys , arg , his , trp , and tyr . the peptides were exposed to 2-amino - p - cresol using k3fe(cn)6 as the oxidant . the reaction ph was varied from 5.5 to 8.5 , and the reaction mixtures were analyzed using maldi - tof ms ( supporting information figure s1 ) . the level of modification increased with the basicity of the reaction , with near quantitative modification of angiotensin i after 20 min at ph 7.5 and higher . throughout these initial investigations , it was noted that angiotensin and melittin showed significant differences in reactivity , with angiotensin consistently demonstrating better conversion . ms / ms analysis of the angiotensin product was used to identify the participating residue , and revealed that the n - terminal amino group was responsible for the observed reactivity ( supporting information figure s2 ) . as further confirmation of the site - selectivity , several peptide substrates were screened for reactivity ( figure 1a and supporting information figure s3 ) . consistent with the n - terminal reaction selectivity , the only peptide that did not react had a pyroglutamate in this position , and therefore no free amino group . ( a ) modification of commercially available peptides was monitored by maldi - tof ms . ( b ) a positional scan of the n - terminal amino acid was evaluated . peptides with the sequence xadswag were tested for reactivity with 2-amino - p - cresol . the reactions were run with 100 m peptide , 200 m aminophenol , and 5 mm ferricyanide at ph 7.5 and analyzed by lc ms . shown is the average percent modification with error bars representing the standard deviation of three reactions . the same peptides were used for a screen of coupling partner equivalents ( c ) and a time screen ( d ) . most buffers did not alter the reactivity , but imidazole and buffers containing a morpholine or piperazine ring ( pipes , hepes , hepps , and mops ) significantly impeded the reaction ( supporting information figure s4 ) . this is possibly due to small amounts of buffer impurities that react competitively with the oxidized intermediate . the time course of the reaction was also investigated ( supporting information figure s5 ) . in addition , it was found that the peptides could be modified using naio4 as the oxidant , or 4-methylcatechol as the coupling partner ( supporting information figures s67 ) . both of these reactions showed the same dependence on ph ; however , moderate levels of modification were still observed at acidic ph ( 5.56.5 ) when using these alternative coupling conditions . these observations suggested that the peptides were reacting with the o - quinone intermediate formed in situ from either the catechol or the iminoquinone precursor ( after imine hydrolysis ) . given the differential reactivity observed on peptide substrates , we synthesized peptides with varied n - terminal residues ( xadswag ) to determine the specificity of the reaction . the base sequence was selected to increase the mass of the peptide , impart water solubility , and include a tryptophan residue for quantitation using uv monitoring . the peptides were synthesized on the solid phase using standard fmoc synthesis , cleaved from the resin , and purified by hplc . after purification , the peptides were resuspended in phosphate buffer , ph 7.5 , adjusted to a concentration of 1 mm , and stored at 20 c until use . to assess the effect of the n - terminal residue on reactivity , the peptides ( 100 m ) were reacted with 2 equiv of 2-amino - p - cresol ( 200 m ) in the presence of k3fe(cn)6 ( 5 mm ) in phosphate buffer , ph 7.5 ( figure 1b ) . ms ( see supporting information figure s8 for representative ms data for the modified peptides ) . most n - terminal amino acids showed good - to - high levels of conversion ( 6090% ) , but proline stood out as the only residue that showed nearly complete modification ( 90100% ) . a second observation of this screen was the fact that tryptophan , tyrosine , and methionine residues were not oxidized by the ferricyanide reagent , consistent with our previous report of oxidative coupling with this oxidant ( see supporting information figure s8 ) . however , free cysteine residues can be oxidized to various species , potentially including disulfides and sulfenic acids , and thus it is recommended that they be protected as disulfides before oxidative coupling is attempted ( vide infra ) . to optimize the reagent ratios ( specifically the equivalents of o - aminophenol ) , the peptides ( 100 m ) were reacted with 110 equiv of the o - aminophenol ( 1001000 m ) in the presence of ferricyanide ( 10 mm ) . after 30 min , the reactions were quenched with excess tris(2-carboxyethyl)phosphine ( tcep ) . it was demonstrated that conversion was highest using 25 equiv of the coupling partner ( figure 1c ) . using more than 5 equiv of this was most likely due to the ability of the aminophenol to react with itself at higher concentrations ( 1 mm ) . consistent with this , when using 10 equiv of the o - aminophenol , a byproduct was observed with a mass that corresponded to the condensation of 3 aminophenols ( 344 da ) . we also investigated the differences in coupling rates for representative n - termini . the reaction of 2-amino - p - cresol with three different peptides was monitored over the course of 1 h ( figure 1d ) . the peptides ( 100 m ) were reacted with 2 equiv of the o - aminophenol ( 200 m ) in the presence of ferricyanide ( 5 mm ) , and aliquots were quenched with excess tcep at the indicated time points . the proline terminal peptide not only reached the highest level of conversion , but also did so in a significantly shorter time than the other termini . despite efforts to optimize conditions for all n - termini the reaction of n - terminal amines with o - aminophenols was characterized using small molecule mimics . the methyl esters of phenylalanine ( h - phe - ome ) and proline ( h - pro - ome ) were coupled to 2-amino - p - cresol using ferricyanide at ph 7.5 . the crude products were characterized using two - dimensional nmr and high - resolution mass spectrometry . the primary amine of h - phe - ome formed p - iminoquinone product 2 , which was analogous to the one formed with aniline coupling partners ( scheme 1 , supporting information figure s9 ) . however , the secondary amine of proline prevented the formation of the p - iminoquinone tautomer , and thus favored o - quinone product 3 ( scheme 1 , supporting information figure s10 ) . given the different linkage obtained with proline , we verified the stability of the product to a variety of conditions . the proline terminal peptide , padswag , was first modified with 2-amino - p - cresol . after purification , the modified peptide ( 100 m ) was exposed to reductants , nucleophiles and acidic and basic ph ( 10 mm additives or buffer ) . no loss of product was observed under any of the conditions tested , demonstrating the hydrolytic stability of the product ( supporting information figure s11 ) . the ability of the linkage to withstand these conditions renders this method quite useful for the construction of biomolecular materials for a variety of applications . with a view toward in vivo applications , current efforts are examining the stability of the linkage in blood plasma , as well as evaluating the intrinsic immunogenicity of the o - quinone group . in the process of characterizing the reaction products , it was observed that the colored products absorbed light at wavelengths greater than 500 nm ( with max between 505 and 525 nm depending on the amine coupling partner ) . as the starting coupling partners and ferricyanide did not absorb at these wavelengths , this unique absorbance provided a means to monitor the reaction progress . the different amine coupling partners ( p - toluidine , h - pro - ome , and h - phe - ome ) were reacted with 4-methylcatechol in the presence of 10 mm ferricyanide , and the absorbance of the resulting solution was monitored at 520 nm to determine the relative rates of reactivity ( figure 2a ; for unnormalized data see supporting information figure s12 ) . the catechol substrate was used for these studies to simplify the reaction pathway by eliminating the imine hydrolysis step . the reactions were run under pseudo - first order conditions with 0.1 mm catechol and 1 mm amine coupling partner . when the reaction was carried out at ph 6.0 , the reaction with the proline analogue reached completion nearly as rapidly ( 2 min ) , but the reaction with the primary aliphatic amine of phenylalanine required longer reaction times ( 10 min ) . ( a ) amine coupling partners were reacted with 4-methylcatechol as a model substrate . reactions were run under pseudo - first order conditions with 100 m catechol , 1 mm amine , 10 mm ferricyanide in 50 mm phosphate buffer . ( b ) a peptide containing both an n - terminal proline and a p - aminophenylalanine residue ( pad(paf)swag ) was tested for reactivity with 2 equiv of 2-amino - p - cresol at ph 6 . the remainder of the reaction was purified and then reacted with 2 equiv of the aminophenol at ph 7.5 and analyzed by lc ms . by quantifying product formation by absorbance , we were also able to measure the second - order rate constant for the proline - based coupling ( supporting information figure s13 ) . the reaction of 1 equiv of h - pro - ome ( 100 m ) with 1 equiv of 4-methylcatechol ( 100 m ) and 100 equiv of k3fe(cn)6 ( 10 mm ) was performed in triplicate at 25 c . the second - order rate constant for the coupling was determined to be 44 4 m s. while proline reacted rapidly with the electron - rich coupling partner , the small molecule studies indicated that aniline should react faster . the rate for the aniline reaction was too fast under these conditions to determine the second - order rate constant accurately . given the differences in reactivity observed at ph 6.0 and 7.5 , we hypothesized that it would be possible to modify the aniline side chain of p - aminophenylalanine ( paf ) and the n - terminal proline amine sequentially . to test this hypothesis , we synthesized a peptide containing both reactive moieties ( pad(paf)swag ) . only one modification was observed when the peptide was reacted with 2-amino - p - cresol at ph 6.0 ( figure 2b ) . ms / ms analysis of the modified peptide confirmed that the single modification occurred on the aniline side chain ( supporting information figure s14 ) . after this step , the peptide was purified and subsequently reacted with 2-amino - p - cresol at ph 7.5 . reaction at the higher ph enabled a second modification of the peptide substrate , at the n - terminal proline residue . the differential reactivity was investigated by comparing the reactivity of a protein containing a paf residue to proteins without the artificial amino acid . the paf residue was introduced into the coat protein of bacteriophage ms2 , which self - assembles into a spherical , hollow protein shell . myoglobin and a mutant of the tobacco mosaic virus ( tmv ) coat protein were used as native protein substrates . reactions with 2-amino - p - cresol were either performed on the isolated , individual proteins or with the aniline containing protein mixed with the native protein substrate ( supporting information figure s15 ) . addition of the aniline containing protein to the native protein decreased the n - terminal reactivity , indicating that the aniline residues react more rapidly than n - terminal residues with the o - aminophenols . in addition , ms2 showed significantly higher reactivity at all of the phs tested , confirming preference for aniline residues . the oxidative coupling reaction with n - terminal amino groups was first tested on proteins with native n - termini . several proteins were reacted with o - aminophenol - functionalized 5 kda peg under the optimized reaction conditions ( figure 3 ) . the native proteins showed moderate levels of reactivity , which could be attributed to inaccessible n - termini or simply to the less reactive n - terminal residues . to test if proline terminal proteins were more reactive , a proline residue was introduced to the n - terminus of gfp and the tobacco mosaic virus ( tmv ) coat protein . the n - terminus of tmv was also slightly extended from the native sequence ( addition of pag ) . the proline - gfp was treated with a variety of conditions to determine the specificity of the reaction ( figure 4a ) . only at basic ph in the presence of both the o - aminophenol substrate and the oxidant was modification observed . additionally , the proline - terminal variant showed significantly improved reactivity compared to that of the wild - type n - terminus . these high levels of modification were maintained even when only 12 equiv of the o - aminophenol peg was used . the site of modification was confirmed to be the n - terminal proline by lc ms / ms analysis of a tryptic digest of proline - gfp modified with 2-amino - p - cresol ( supporting information figure s16 ) . ( a ) the n - terminus of several proteins was pegylated using o - aminophenol - functionalized 5 kda peg and ferricyanide . ( b ) modification of wild type proteins with 5 kda o - aminophenol - peg was monitored by sds - page . ( a ) a proline was introduced to the n - terminus of gfp . the proline terminal variant showed much higher levels of modification than the wild - type protein . the band doubling is due to a gel artifact , and appears in all lanes . ( b ) mutants of tmv were reacted with 5 equiv of 2-amino - p - cresol and 1 mm k3fe(cn)6 for 30 min and analyzed by lc ms . reaction conditions for both native and proline terminal proteins were optimized by evaluating reactivity with myoglobin and proline - gfp . the reaction time , buffer , and ph were screened ( supporting information figures s17 and s18 ) . similar to the results obtained with peptide substrates , the reaction reached its highest level of conversion after about 1530 min . in addition , most buffer salts tested were compatible with the reaction with the exception of buffers containing morpholine ( mops ) or piperazine moieties ( hepes ) , as was observed with peptide substrates . these buffers decreased the level of modification slightly , but did not completely inhibit reactivity . the effect of reaction ph was tested using both k3fe(cn)6 and naio4 as the oxidants . little reactivity was observed at acidic ph , and the level of conversion increased between ph 7.0 and 8.0 . at higher reaction ph ( 8.0 ) a second modification was observed , indicating that lysines may also participate in the reaction . however , it is also possible that under more forcing conditions , such as higher reaction ph or increased concentration of aminophenol substrate , the aminophenol reacts with both itself and the n - terminal amino group resulting in double modification of the n - terminus . n - terminal mutants of tmv were also evaluated for their reactivity with o - aminophenols . the tmv monomers assemble into well - known double disk structures , displaying 34 copies of the n - terminal groups on their peripheries . two n - terminal mutants ( pag and ag ) were reacted with 5 equiv of 2-amino - p - cresol ( 100 m ) and 1 mm k3fe(cn)6 for 30 min . ms demonstrated that the proline terminal mutant reached nearly complete conversion , while the alanine terminal mutant showed low levels of modification under these coupling conditions ( figure 4b , see supporting information figure s19 for wider mass range and ion series ) . the compatibility of the reaction with cysteine residues was also tested using tmv . a single cysteine residue ( s123c ) was introduced into the tmv coat protein with a proline n - terminus ( pag s123c tmv ) . this mutant was reacted with 2-amino - p - cresol and analyzed by lc the cysteine residue also reacted with the o - aminophenol , resulting in two modifications . however , it was found that the n - terminal proline could be modified selectively if the cysteine was first capped ( figure 5a , b , see supporting information figures s2122 for wider mass range and ion series ) . to do this , the cysteine residue was protected as a disulfide bond by reaction with 5,5-dithiobis(2-nitrobenzoic acid ) ( dtnb , ellman s reagent ) . after the oxidative coupling step the disulfide bond was readily reduced by tcep , leaving the free cysteine and the modified n - terminus . alternatively , the cysteine residue was modified with a maleimide , followed by modification at the n - terminus with an o - aminophenol reagent . a ) pag s123c tmv was reacted with small molecule substrates and analyzed by lc cysteine residues were protected as a disulfide using ellman s reagent ( dtnb ) before oxidative coupling . subsequent reduction of the disulfide resulted in selective modification of the n - terminus . the n - terminal proline was then modified with a rhodamine - functionalized o - aminophenol . this strategy allowed for the direct , dual modification of the protein at both the cysteine residue and the n - terminus . two fluorophores paired for frster resonance energy transfer ( fret , alexa fluor 488 c5-maleimide and o - aminophenol functionalized rhodamine b ) were thus conjugated to tmv using this strategy to create a templated array of chromophores for light harvesting applications . the free cysteine was first quantitatively labeled with an alexa fluor maleimide ( supporting information figure s22 ) . the n - terminal proline was then coupled to a fluorescent o - aminophenol resulting in 50% modification of the tmv monomers with both fluorphores ( figure 5b ) . complete modification of the n - terminus was not observed as tmv precipitated from solution with increasing levels of modification with the rhodamine dye . in current experiments , we are using this dual - labeling strategy to introduce more soluble chromophores . the oxidative coupling reaction was also compared to the reaction of protein amines with activated esters . this acylation methodology is commonly employed , and can be targeted to the n - terminus by controlling the reaction ph in some cases . the reactions were compared on creatine kinase , a protein with a native proline n - terminus . reaction with 15 equiv of o - aminophenol peg resulted in good levels of modification of creatine kinase ( 5060% ) , while reaction with 15 equiv of n - hydroxysuccinimide ( nhs ) peg resulted in low levels of modification ( 525% , figure 6 ) . only when a vast excess of the nhs peg was used were moderate levels of modification achieved . as was the case with proline - gfp , some over modification was observed under the oxidative coupling conditions when using five or more equivalents of aminophenol . this could result from dimerization of the oxidized species before protein coupling , but has yet to be characterized due to the low abundance of this product . in any case , lowering the reaction ph slightly or using fewer equivalents of the o - aminophenol substrate prevented the over modification from occurring . the modification of the n - terminus of creatine kinase with aminophenol peg was compared to the reaction of creatine kinase with nhs peg . in this study , we have identified conditions for the oxidative coupling of o - aminophenols to n - terminal amino acids . proline residues work particularly well with this strategy , and are therefore strongly recommended when using it . these groups can be introduced readily in n - terminal positions using site - directed mutagenesis and escherichia coli expression , especially since the methionine residue resulting from the start codon is cleaved when proline is in the second position . the fast kinetics of the reaction allow it to be successful even at low reagent and substrate concentrations , and suggest that it can be used for sterically demanding bioconjugations . the oxidative coupling strategy reported here offers two distinct advantages over other n - terminal labeling methods . first , the modification occurs in a single step and does not require initial oxidation of the n - terminus . second , the fast second - order kinetics allow for low concentrations of the coupling partners to be used . however , to achieve high levels of modification on protein substrates , proline was required as the n - terminal residue . this new protein modification strategy is currently being explored in our lab for the generation of protein - based materials . in the larger context , new techniques for the introduction of a single functional group in a specific position on a protein surface are always in demand . the ability of the n - terminal oxidative coupling method to achieve this in a single , brief reaction step is highly advantageous , and the fact that it can be combined with cysteine modification chemistry provides new opportunities for complex bioconjugate synthesis .

the synthetic modification of proteins plays an important role in chemical biology and biomaterials science . these fields provide a constant need for chemical tools that can introduce new functionality in specific locations on protein surfaces . in this work , an oxidative strategy is demonstrated for the efficient modification of n - terminal residues on peptides and n - terminal proline residues on proteins . the strategy uses o - aminophenols or o - catechols that are oxidized to active coupling species in situ using potassium ferricyanide . peptide screening results have revealed that many n - terminal amino acids can participate in this reaction , and that proline residues are particularly reactive . when applied to protein substrates , the reaction shows a stronger requirement for the proline group . key advantages of the reaction include its fast second - order kinetics and ability to achieve site - selective modification in a single step using low concentrations of reagent . although free cysteines are also modified by the coupling reaction , they can be protected through disulfide formation and then liberated after n - terminal coupling is complete . this allows access to doubly functionalized bioconjugates that can be difficult to access using other methods .

a challenge to increasing early childhood immunizations on a state or local level is the limited ability of standard summary measures of up - to - date ( utd ) rates to identify barriers to improvement . typically , early childhood utd rates are based on the number of doses of recommended vaccines , by individual antigen or in total , that a cohort of children receive by either a fixed age or a fixed date of assessment . for the national immunization survey ( nis ) , this represents the proportion of 19- to 35-month - old children having all recommended doses for up to 7 vaccine types . similarly , health plans utilize a healthcare effectiveness data and information set ( hedis ) immunization measure , which counts the number of doses received by 24 months of age [ 2 , 3 ] . however , a low utd rate among a population , derived using these measures , does not aid in determining why the rate is low . the growing complexity of the early childhood immunization schedule , with up to 19 vaccine doses recommended across at least 6 visits by age 2 , means that there are many points of time and many reasons by which children can fall behind on immunizations . while immunization summary utd rates for 2-year - olds can identify general problems , there is also a need for more detailed assessment tools to describe local immunization coverage and more specific vaccine usage . one alternative method of evaluation is to consider age - appropriate vaccinations . a substantial body of prior work exists comparing summary utd measures against more specific assessments either for complete antigen series or combinations when actually due without considering late catch - up [ 79 ] , or in comparison of individual antigens and shots to when they are expected or late . to the extent that early childhood immunizations are often used as a proxy for the quality of early childhood routine care , the timeliness of immunizations is a relevant measure delayed or lagging immunizations may reflect other issues with early childhood care . one perspective on age - appropriate immunizations is to track children 's progress through immunization milestones between birth and age 2 . immunization milestones are the ages at which recommended immunizations first become late according to the schedule developed by the advisory committee on immunization practices ( acip ) . these milestones occur at 3 , 5 , 7 , 16 , 19 , and 24 months of age . when immunizations are tracked using this approach , children 's progression through milestones unfolds as a story of falling behind and catching up with recommended doses . this is a beneficial method as it facilitates identifying provider failure to give all or some of the immunizations that are due at healthcare encounters ( missed opportunities ) or parental failure to bring children to providers for vaccination - eligible encounters ( missed visits ) . the prevalence of missed opportunities and missed visits at each milestone age can guide immunization interventions . however , basing milestone analysis exclusively on immunization record data may misclassify missed opportunities as missed visits , and shift the apparent burden of children who are not appropriately immunized for their age from providers to parents . this can occur because healthcare encounters during which no vaccinations are administered will not be captured into immunization record datasets . this study provides an example of using a milestone approach to assess a specific population and their progression through early childhood immunizations , where both payor - administrative and state - level immunization information system ( iis ) data are available . combining children 's healthcare encounter information from payer records with their immunization records gives a more accurate assessment at each milestone age of the effect of missed opportunities and missed visits on age - appropriate immunizations and overall immunization rates . the study population consisted of a birth cohort of oregon children enrolled in the oregon health plan ( ohp ) and whose immunization records were in the oregon alert immunization information system ( alert iis ) . alert iis immunization records were merged with provider encounter records from the ohp for this population . the alert iis is a statewide immunization registry which receives immunization records from 97% of oregon private healthcare providers and 100% of the immunization records from public providers . the ohp is oregon 's public healthcare plan that provides healthcare coverage for children in families living below 185% of the federal poverty level and covers both those with traditional medicaid eligibility as well as an expanded state children 's health insurance program ( schip ) population . the majority of ohp - enrolled children are placed in commercially available managed care plans . immunization records for ohp children are available both from ohp collected records for billing and encounters as well as from direct provider record submissions to alert . for this study , alert iis records and ohp encounter records immunization records and encounter data were restricted to those received through the child 's 24th month of age . children 's records were merged across the two data systems based on the child 's name , date of birth , and county of residence . the matching process was based on the observation that within the 2005 oregon birth cohort , a combination of name and date of birth was over 99.9% unique , with almost all exceptions resolving with the inclusion of residence . this high - probability matching process was selected over the usual process alert uses to incorporate ohp and other administrative data , wherein a hard - match is required also on additional information such as address or phone number . immunization records were selected for the six vaccines ( including combination vaccines ) included in the recommended the 4:3:1:3:3:1 series consists of 4 diphtheria , tetanus toxoid , and acellular pertussis ( dtap ) ; 3 poliovirus ( ipv ) ; 1 measles , mumps , and rubella ( mmr ) , 3 haemophilus influenzae type b ( hib ) ; 3 hepatitis b ( hepb ) , and 1 varicella . records for these vaccines were reviewed for appropriate age and interval between doses , according to the 2007 acip immunization schedule . doses given too early or with insufficient spacing between doses to be considered valid were removed from the analysis . to ensure that records of encounters would be available to compare with immunizations at all of the milestone ages , children with limited enrollment or nonenrollment at key ages were excluded from the final analysis dataset . the study population was restricted to children enrolled in ohp within 30 days of birth , with a cumulative total of at least 365 days of enrollment by age 2 , and continuous enrollment across the key period of 15 to 18 months , when the 4th dose of dtap is due . because ohp enrollment generally occurs in 12-month blocks , the majority of children meeting the above requirements were also continuously enrolled through their second birthday . children born outside oregon were excluded since possibly both early encounters and immunizations would not be reported to alert or ohp . children with only a birth dose of hepatitis b and no other vaccines in alert also were excluded . the ohp requires health plans and providers to submit detailed encounter records on enrolled children for all services received . for ohp - enrolled children , a subset of vaccination - eligible encounters was created from all encounters , based on a review of icd-9 and cpt coding in ohp encounter records . a vaccination - eligible encounter was defined as an encounter occurring in a nonemergent or noninpatient setting with a medical provider , and with either a cpt procedure code indicating that routine care or evaluation was performed , or an icd-9 diagnostic code indicating that the purpose of the encounter was consistent with routine care and immunization evaluation . these criteria were used to identify not only visits that providers would define as well - child visits , but also other visits during which immunizations could have been given , and include nonemergent sick visits . in a few cases , alert had a record of an immunization visit for which there was no matching ohp encounter record . this was usually found to reflect free vaccinations without administration fees at sites outside of those normally reporting to ohp , such as school clinics , and some public health departments . these visits were also counted as vaccination - eligible encounters . also if cpt codes for vaccine administration were found in ohp data without other evidence of a shot - eligible encounter , the definitions of milestone periods were taken from luman and chu , and reflect the dates at which recommended immunizations are first late according to the 2007 acip schedule . the milestone periods occur at the start of 3 months , 5 months , 7 months , 16 months , 19 months , and 24 months of age . immunization ( utd ) status at each milestone was evaluated for the timely receipt of all doses due in the 4:3:1:3:3:1 series by age 2 . additionally children were categorized according to whether they had vaccination - eligible encounters in the period prior to each milestone . in cases in which a non - utd child at a milestone had multiple encounters in the prior period , and received vaccinations at some encounters and not at others , they were counted as having a vaccination visit . schematically , this classification is presented in table 1 . at each milestone age , immunization status was compared with the immunization status at the previous milestone age to determine whether children had remained utd , remained non - utd , fallen behind due to a missed visit , fallen behind due to a missed opportunity , or caught up with the immunization schedule . children remained utd if they were utd at the prior milestone age and utd at the current milestone age . children remained non - utd if they were non - utd at the prior milestone age and non - utd at the current milestone age . children fell behind due to a missed visit if they were utd at the prior milestone age , non - utd at the current milestone age , and had no record of a valid healthcare visit or immunization record during the period in between . children fell behind due to a missed opportunity if they were utd at the prior milestone age , non - utd at the current milestone age , and had a vaccination - eligible healthcare visit during the period in between . children caught up if they were non - utd at the prior milestone age and utd at the current milestone age . an exception to the missed opportunity calculation is for the 16-month milestone , which includes the first mmr vaccine . the mmr is not valid before 12 months of age , so encounters between 7 months and 12 months were not counted as potential missed opportunities . as a check on the completeness of immunization visits represented by this merged dataset , a lincoln - peterson capture - recapture method was used to estimate the percentage of immunization visits for the study population not captured by the alert iis either by provider records or by ohp administrative records . the total number of immunization visits , both captured and uncaptured , was estimated by ( 1)n=[(a+1)(b+1)](ab1 ) , where n is the total estimated number of visits , a is the number of visits captured by provider reports in alert , b is the number of visits captured by ohp billing and administrative reports , and ab is the number of visits captured in both by date . the principal assessment tool of this study is a time - based progression of young children across milestones and age - appropriate immunizations , presented in a novel form for easier depiction of change between milestones . the data by milestone are presented for whether children were complete on age - appropriate immunizations along with categories for catching up and falling behind by milestone , and by missed opportunities versus missed visits for non - utd children . finally , a comparison of age - appropriate milestone results is made to a summary utd measure for the 4:3:1:3:3:1 immunization series assessed at 24 to 35 months of age . of 20,411 children born in 2005 who were enrolled in the oregon health plan for some period of time , 13,199 met the requirements to be counted among the study population . the numbers of those excluded are listed in the order they were excluded and do not reflect the total prevalence of each criterion in the population ; for example , of the 1,004 children excluded for being born out of oregon , the majority would also have been excluded for length of enrollment . the primary reason for exclusions from the study population is nonenrollment after 1 year of age , so that no encounter data would be reported to ohp . also 2% of the study population met all enrollment criteria except that they did not have any reported immunizations . the capture - recapture estimate of total immunization visits for the study population was 76,087 . thus the dataset appears relatively complete for all immunization visits of the study population , with the combination of alert iis provider reports and ohp administrative data capturing 98.4% of estimated immunization visits among the study population . as shown in figure 1 , only 32% of children had all acip recommended immunizations on time at all milestones , while 14% were not complete at only one milestone , 15% were not complete at 2 milestones , and 9% were not complete at any milestone . also 41% of children had vaccination - eligible encounters in all of the periods before each milestone , and 35% of children were missing encounters in only one of the periods before milestones . another 14% were missing encounters in 2 periods , and 10% were missing encounters in 3 or more periods . rates of completeness of age - appropriate immunizations per the acip schedule varied among the milestone ages , from a high of 82.4% at 3 months of age to a low of 52.5% at 19 months of age . for the final milestone at 24-months , no further vaccinations were due , and the final 24 month completion rate for the study population was 68.6% , with 16.1% catching up from the prior 19-month milestone . the pattern of completion , falling behind , and catching up by milestone period is presented in figure 2 . while 17.6% of the study population had fallen behind by the 3-month milestone , representing a late start on immunizations , the most salient episode of falling behind occurred at the 5-month milestone , where 21.0% of children fell behind . in this analysis the 19-month milestone adds 4 antigens beyond the 16-month milestone , including the fourth dtap and varicella ; and the risk of falling behind between these milestones is calculated from table 2 as ( 16.7/61.3 ) = 27.2% . this is interpreted as , for those who are on schedule at 16 months , 27.2% will fall behind by 19 months . the largest total percentage of children without age - appropriate immunizations , 47.5% , also occurred at the 19-month milestone . overall , the percentages of children who were not complete by milestone from table 2 with missed opportunities was 68.5% at 3 months , 72.2% at 5 months , 71.7% at 7 months , 72.5% at 16 months , 58.4% at 19 months , and 60.0% at 24 months . another approach to interpreting the reasons for children falling behind is to further examine missed visits , missed opportunities , and vaccination visits at each milestone for those who were not complete . figure 3 describes how children who are not complete for age - appropriate immunizations at any milestone have either missed visits or missed opportunities , where missed opportunities are divided between provider encounters with no shots received versus encounters where some shots are received . the percentage of noncomplete children per milestone with provider encounters on which some shots were received ( vaccination visits ) ranged from a high of 50.8% prior to the 3-month milestone to a low of 15.2% before the 24-month milestone . the percentage of children with provider encounters and no shots , and without vaccination visits , in each period is a measure of the amount by which immunization - record - only data would misclassify missed opportunities as missed visits . this potential misclassified percentage of noncomplete children having vaccination - eligible encounters with no reported vaccinations ranged from a high of 44.8% at the 24-month milestone , to a low of 21.4% at the 5-month milestone . at the 3-month milestone , noncomplete children were evenly divided between those with no encounters on record during the period ( 31.4% ) , those with encounters but no vaccinations ( 34.1% ) , and those with encounters during which some vaccinations were given ( 34.5% ) . as a final analysis , the results by milestone for encounters and completeness were stratified by children 's status on a summary utd measure for having all shots in a 4:3:1:3:3:1 series by age 24 to 35 months , and using a fixed date of assessment . overall 77.8% of the study population were utd by 24 to 35 months for the 4:3:1:3:3:1 series . the comparison across milestones for children who were utd of the children who were utd by the date of assessment , only 68% were complete for age - appropriate immunizations by the 19-month milestone , 72% were complete by the 16-month milestone , 67% were complete at the 7-month milestone , and 71% were complete at the 5-month milestone . the majority of those who were not complete at any milestone , with the exception of the 24-month milestone , also had encounters with providers on which some shots were given . figure 5 presents the same analysis across milestones for the 22.2% of the study population who were not utd for the 4:3:1:3:3:1 series at 24 to 35 months . children not utd at 2435 months were also not complete for age - appropriate immunizations at 19 and 24 months by definition of which shots were required at these milestones . overall in figure 5 the majority of non - utd children at 24 to 35 months who also were not complete at milestones had substantial volumes of encounters with providers . an analysis using only shot - record data , however , would reach , falsely , the conclusion that the majority of non - utd children were missing provider encounters at each milestone . the reality of children 's immunizations in the present study population is a story of falling behind and catching up with recommended immunizations . what this study adds to the understanding of milestones and immunizations is a more accurate representation of how missed opportunities and missed visits contribute to children not being up - to - date for recommended vaccines . the present finding that for many children , periods of missed visits in immunization record data are actually periods of missed opportunities is a first in the analysis of larger , population - based data systems such as immunization registries . this finding should lead at least to caution in assigning reasons regarding why children are not up - to - date according to either state - level immunization registries or other immunization record data , including the national immunization survey . the importance of this is that the prevalence of either true missed visits or true missed opportunities should lead to different interventions to improve immunization rates . focusing on methods to improve rates of missed visits , such as reminder - recalls to parents of children who appear to have missing vaccinations and visits , may be of limited utility if the greater issue is that the parents have brought their children in to providers across milestones without receiving needed vaccinations . as a recommendation to correct this problem , immunization record data for at least a sample of covered children should be compared with encounter records from billing and administrative sources before considering appropriate immunization interventions . also , data collected from samples of provider records for immunization assessment should include basic information on all encounters , whether vaccinations were given or not . in this study , the majority of children who were not catching up at each milestone were having encounters with providers . these encounters were potentially ones in which missing vaccinations could be administered ; however , converting these missed opportunities to vaccination visits may be difficult . provider reluctance to administer vaccinations during sick or other nonroutine visits is a known barrier to improving immunization rates , and may be difficult to change [ 1214 ] . the type of encounter may also be a barrier to receiving vaccinations in many clinics and healthcare providers ; for example , in urgent care encounters , when limited time and a press of higher priority needs make it difficult to include review of records and delivery of vaccinations [ 1517 ] . while parental reluctance in such circumstances is likely a factor , at least one study has found that the barrier in such visits is more likely to be provider - based than parental . also , reimbursement levels may not be sufficient to encourage providers to expand immunizations outside of well - child visits . finally parents who bring their children in for sick visits or other encounters without immunizations may easily believe that their child has received all needed care , including immunizations . most parents of children who are not utd believe their child has received all needed immunizations and may not understand the difference between well - child and other types of encounters . solutions to this problem may lie in the redesign of early childhood care encounters within clinics and healthcare providers that are concerned about their immunization rates , to deemphasize urgent care or access to short , single - purpose visits in favor of longer appointments during which aspects of routine care such as immunizations are also reviewed . a strength of the present study is the combination of administrative data on all encounters with immunization records reported separately to the alert iis . this approach could potentially serve as a standard for the evaluation of immunizations given to health plan participants and public populations in areas that have strong immunization information systems such as alert . a similar approach by dombkowski et al . has previously demonstrated the utility of combining registry and medicaid data in michigan for assessing missed opportunities to vaccinate asthmatics against influenza . the potential for missed opportunities to be misclassified as missed visits when conducting milestone analysis solely from immunization record data without all encounters should lead to caution in interpreting the balance of responsibility between parents and providers for children not being up - to - date . also the present study does not address the extent to which parental reluctance to accept all age - appropriate immunizations may limit the ability of provider - based interventions to improve milestone immunization completeness . from the perspective of a state immunization program with concerns for improving immunization rates , the development of a roadmap showing where and how children are falling behind is invaluable for setting policy . while national measurements such as the nis can identify variations in rates between states , state - level programs have been left on their own to identify what in - state factors are affecting their rates . also because immunization levels are often taken as a measure for overall quality of care in early childhood , counting doses by age two is not as strong a proxy as is the checking of timely receipt of age - appropriate immunizations across the entire period from birth to age two . a risk of solely depending on immunization results at age two is that utd and non - utd status may be taken as discrete categories , irrespective of age - appropriate history . searching for explanatory factors for these two categories may be misleading for developing an understanding of where barriers exist and where interventions are needed . this is illustrated in the present study by the observation that only a minority of children were consistently on schedule at all milestone ages , and that the majority fell behind at one or more point in receiving immunizations . falling behind by milestone period is a more useful concept for intervention than final utd status . a useful model then is that most children are at great risk of falling behind at many points , and that their final status reflects the work that providers do to catch them up to standard . the concept of milestone ages and the charting of children 's progress through the milestones , as advanced by luman and chu , provides such a roadmap for use by local programs . local variations in patterns of falling behind and catching up , however , argue for analyzing milestones with available local or state - level data to determine where problems are most salient . yet , while specific findings may differ , the present study confirms the utility of the milestone approach for a local population . the present study is representative only of a single state population , and of children enrolled through the oregon health plan . because children in the ohp are generally enrolled in the same health plans , with the same networks of providers and benefits , as privately insured children , their encounters are potentially similar to the wider state population . overall in 2007 , the oip estimated that among all ohp - enrolled 2-year - olds , the utd rate for a 4:3:1:3:3:1 series was 75.2% , as compared to 72.9% among non - ohp - enrolled children . however , the present study population also reflects a group with stable , long - term enrollment in ohp . children with short - term enrollment or who disenrolled after age 1 are not represented and may have substantially different patterns of falling behind and catching up to recommended immunizations . also it is expected that individual health plans under the ohp are a significant factor in the receipt of age - appropriate immunizations ; however , this information was not included in the present analysis dataset . another limitation on the present results is that the definition of encounters was deliberately set broadly , to reflect any encounters in which vaccinations could have been delivered as opposed to well - child visits , during which immunization screening should be routine . as such , the possibility of raising immunization rates by converting all missed opportunities here should be taken as an upper figure to what is possible . institutional , scheduling , reimbursement and parental acceptance are all potential factors on what proportion of encounters without vaccinations could incorporate immunization screening . also , encounters were not stratified by type of provider or principal reason for each encounter . while some research suggests that provider type is not a key factor for immunization performance when the volume of well - child visits is taken account , no provider information was included in the present study dataset to confirm or identify other relevant provider features . whether encounters without immunizations are due to children using a spectrum of different provider types , to parental reluctance , or are due to use of settings such as urgent care in place of scheduled well - child visits can not be determined from the data of this study . the milestone approach to evaluating early childhood immunizations provides a useful perspective for understanding the time - based progression of children through immunization periods . however , the results of this study warrant some caution in the use of immunization record data only in assessing failure to have age - appropriate immunizations because of the chance of misclassification of missed opportunities by providers as missed visits by parents . nevertheless , for local assessment by public agencies or health plans , and for the design of interventions to improve immunization rates , looking at the patterns by which children fall behind or catch up on immunizations at milestone periods is a valuable next step beyond the count of vaccine doses received by age two .

a challenge facing immunization registries is developing measures of childhood immunization coverage that contain more information for setting policy than present vaccine series up - to - date ( utd ) rates . this study combined milestone analysis with provider encounter data to determine when children either do not receive indicated immunizations during medical encounters or fail to visit providers . milestone analysis measures immunization status at key times between birth and age 2 , when recommended immunizations first become late . the immunization status of a large population of children in the oregon alert immunization registry and in the oregon health plan was tracked across milestone ages . findings indicate that the majority of children went back and forth with regard to having complete age - appropriate immunizations over time . we also found that immunization utd rates when used alone are biased towards relating non - utd status to a lack of visits to providers , instead of to provider visits on which recommended immunizations are not given .